WorldWideScience

Sample records for bacteriophage-coded gene products

  1. Synthesis of bacteriophage-coded gene products during infection of Escherichia coli with amber mutants of T3 and T7 defective in gene 1

    DEFF Research Database (Denmark)

    Issinger, O G; Hausmann, R

    1973-01-01

    During nonpermissive infection by a T7 amber mutant in gene 1 (phage RNA polymerase-deficient), synthesis of the products of the phage genes 3 (endonuclease), 3, 5 (lysozyme), 5 (DNA polymerase), and 17 (serum blocking power) was shown to occur at about half the rate as during wild-type infection...

  2. Cattle Candidate Genes for Meat Production Traits

    OpenAIRE

    Bláhová, Alice

    2013-01-01

    The objective of this study was to compile a summary of the most important candidate genes for meat production. The studied genes were: GH, GHR, MSTN, MyoD family, leptin, IGF, TG5, SCD, DGAT and STAT5A. Growth hormone (GH) is involved in physiological processes of growth and metabolism. Growth hormone receptor (GHR) has been proposed as a candidate gene for meat production in cattle. Myostatin is a significant marker. It affects the amount of muscle, reduces marbling and elevate meat tendern...

  3. On the bursting of gene products

    CERN Document Server

    Yvinec, Romain

    2011-01-01

    In this article we demonstrate that the so-called bursting production of molecular species during gene expression may be an artifact caused by low time resolution in experimental data collection and not an actual burst in production. We reach this conclusion through an analysis of a two-stage and binary model for gene expression, and demonstrate that in the limit when mRNA degradation is much faster than protein degradation they are equivalent. The negative binomial distribution is shown to be a limiting case of the binary model for fast "on to off" state transitions and high values of the ratio between protein synthesis and degradation rates. The gene products population increases by unity but multiple times in a time interval orders of magnitude smaller than protein half-life or the precision of the experimental apparatus employed in its detection. This rare-and-fast one-by-one protein synthesis has been interpreted as bursting.

  4. Cattle Candidate Genes for Milk Production Traits

    OpenAIRE

    Kadlec,Tomáš

    2012-01-01

    The aim of this thesis is to make an overview of important candidate genes affecting milk yield and milk quality parameters, with an emphasis on genes associated with the quantity and quality of milk proteins and milk fat.

  5. Bacteriophage P22 gene 23 product acts preferentially in cis.

    OpenAIRE

    Riggs, P D; Botstein, D

    1987-01-01

    The expression of the P22 late operon was measured while the activator of the late operon, the product of gene 23, was provided in cis or in trans. It was found that expression of the late operon, assayed from a late-gene-lacZ gene fusion, was reduced by more than twofold when the only functional copy of gene 23 was present in trans.

  6. Integrating Ontological Knowledge and Textual Evidence in Estimating Gene and Gene Product Similarity

    Energy Technology Data Exchange (ETDEWEB)

    Sanfilippo, Antonio P.; Posse, Christian; Gopalan, Banu; Tratz, Stephen C.; Gregory, Michelle L.

    2006-06-08

    With the rising influence of the Gene On-tology, new approaches have emerged where the similarity between genes or gene products is obtained by comparing Gene Ontology code annotations associ-ated with them. So far, these approaches have solely relied on the knowledge en-coded in the Gene Ontology and the gene annotations associated with the Gene On-tology database. The goal of this paper is to demonstrate that improvements to these approaches can be obtained by integrating textual evidence extracted from relevant biomedical literature.

  7. Correlating Information Contents of Gene Ontology Terms to Infer Semantic Similarity of Gene Products

    Directory of Open Access Journals (Sweden)

    Mingxin Gan

    2014-01-01

    Full Text Available Successful applications of the gene ontology to the inference of functional relationships between gene products in recent years have raised the need for computational methods to automatically calculate semantic similarity between gene products based on semantic similarity of gene ontology terms. Nevertheless, existing methods, though having been widely used in a variety of applications, may significantly overestimate semantic similarity between genes that are actually not functionally related, thereby yielding misleading results in applications. To overcome this limitation, we propose to represent a gene product as a vector that is composed of information contents of gene ontology terms annotated for the gene product, and we suggest calculating similarity between two gene products as the relatedness of their corresponding vectors using three measures: Pearson’s correlation coefficient, cosine similarity, and the Jaccard index. We focus on the biological process domain of the gene ontology and annotations of yeast proteins to study the effectiveness of the proposed measures. Results show that semantic similarity scores calculated using the proposed measures are more consistent with known biological knowledge than those derived using a list of existing methods, suggesting the effectiveness of our method in characterizing functional relationships between gene products.

  8. Radiochemical identification of the kil gene product of bacteriophage lambda

    International Nuclear Information System (INIS)

    The coliphage lambda kil gene product has been identified using a differential labeling technique . The kil gene polypeptide has a molecular weight of about 16,000, as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Gel filtration of the kil protein indicates that it may exist as a tetramer in native form

  9. Enhanced citrate production through gene insertion in Aspergillus niger

    DEFF Research Database (Denmark)

    Jongh, Wian de; Nielsen, Jens

    2007-01-01

    The effect of inserting genes involved in the reductive branch of the tricarboxylic acid (TCA) cycle on citrate production by Aspergillus niger was evaluated. Several different genes were inserted individually and in combination, i.e. malate dehydrogenase (mdh2) from Saccharomyces cerevisiae, two...

  10. Identification and amplification of the E. coli phr gene product.

    OpenAIRE

    Sancar, G B; Smith, F W; Sancar, A

    1983-01-01

    We have constructed a series of multicopy plasmids that complement mutations in the phr gene of Escherichia coli. By subcloning into a tac plasmid vector we obtained a phr plasmid that upon induction overproduces two proteins of Mr's 49,000 and 20,000. Tn1000 insertions into the phr gene caused the disappearance of the 49,000 dalton protein, thus demonstrating this protein to be the phr gene product, DNA photolyase. The photolyase encoded by the phr gene makes up about 15% of total cellular p...

  11. PRODUCT GENE REPRESENTATION AND ACQUISITION METHOD BASED ON POPULATION OF PRODUCT CASES

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    The representation and acquisition of a product gene is a crucial problem in product evolutionary design. A new methodology of product gene representation and acquisition from a population of product cases is proposed, and the methodology for product evolutionary design based on a population of product cases is realized. By properly classifying product cases according to its product species, the populations of product cases are divided and a model is established. Knowledge of the scheme design is extracted and formulated as the function base, principle base, and structure base, which are then combined to form a product gene. Subsequently, the product gene tree is created and represented by object-oriented method. Then combining this method with the evolutionary reasoning technology, an intelligent and automatic evolutionary scheme design of product based on the population of product cases is realized. This design method will be helpful in the processing of knowledge formulation, accumulation, and reuse, and in addressing the difficulty of acquiring design knowledge in traditional design. In addition, the disadvantages of manual case adaptation and update in case-based reasoning can be eliminated. Moreover, by optimizing the design scheme in multiple levels and aspects of product function, principle, and structure etc., the level of creativity in the scheme design can be improved.

  12. A two-cassette reporter system for assessing target gene translation and target gene product inclusion body formation

    DEFF Research Database (Denmark)

    2016-01-01

    The present invention relates to a dual cassette reporter system capable of assessing target gene translation and target gene product folding. The present invention further relates to vectors and host cells comprising the dual cassette reporter system. In addition the invention relates to the use...... of the dual cassette reporter system for assessing target gene translation and target gene product folding....

  13. The classification of gene products in the molecular biology domain: Realism, objectivity, and the limitations of the Gene Ontology

    OpenAIRE

    Mayor, Charlie

    2012-01-01

    Background: Controlled vocabularies in the molecular biology domain exist to facilitate data integration across database resources. One such tool is the Gene Ontology (GO), a classification designed to act as a universal index for gene products from any species. The Gene Ontology is used extensively in annotating gene products and analysing gene expression data, yet very little research exists from a library and information science perspective exploring the design principles, philosophy and s...

  14. Id-1 gene and gene products as therapeutic targets for treatment of breast cancer and other types of carcinoma

    Science.gov (United States)

    Desprez, Pierre-Yves; Campisi, Judith

    2014-08-19

    A method for treatment of breast cancer and other types of cancer. The method comprises targeting and modulating Id-1 gene expression, if any, for the Id-1 gene, or gene products in breast or other epithelial cancers in a patient by delivering products that modulate Id-1 gene expression. When expressed, Id-1 gene is a prognostic indicator that cancer cells are invasive and metastatic.

  15. Identification of Drosophila Gene Products Required for Phagocytosis of Candidaalbicans.

    Directory of Open Access Journals (Sweden)

    2005-12-01

    Full Text Available Phagocytosis is a highly conserved aspect of innate immunity. We used Drosophila melanogaster S2 cells as a model system to study the phagocytosis of Candida albicans, the major fungal pathogen of humans, by screening an RNAi library representing 7,216 fly genes conserved among metazoans. After rescreening the initial genes identified and eliminating certain classes of housekeeping genes, we identified 184 genes required for efficient phagocytosis of C. albicans. Diverse biological processes are represented, with actin cytoskeleton regulation, vesicle transport, signaling, and transcriptional regulation being prominent. Secondary screens using Escherichia coli and latex beads revealed several genes specific for C. albicans phagocytosis. Characterization of one of those gene products, Macroglobulin complement related (Mcr, shows that it is secreted, that it binds specifically to the surface of C. albicans, and that it promotes its subsequent phagocytosis. Mcr is closely related to the four Drosophila thioester proteins (Teps, and we show that TepII is required for efficient phagocytosis of E. coli (but not C. albicans or Staphylococcus aureus and that TepIII is required for the efficient phagocytosis of S. aureus (but not C. albicans or E. coli. Thus, this family of fly proteins distinguishes different pathogens for subsequent phagocytosis.

  16. Identification of the ftsA gene product

    International Nuclear Information System (INIS)

    A nonsense mutation was identified in the essential cell division gene ftsA of Escherichia coli. A lambda-transducing phage was isolated which complemented this mutation. This phage programmed the synthesis of four bacterial proteins in uv-irradiated cells. By substituting the nonsense mutation for the ftsA+ allele in this transducing phage and comparing the proteins programmed by it in uv-treated Su+ and Su- cells, the product of the ftsA gene was identified as a protein with a molecular weight of 50,000

  17. Use of Galerina marginata genes and proteins for peptide production

    Energy Technology Data Exchange (ETDEWEB)

    Hallen-Adams, Heather E.; Scott-Craig, John S.; Walton, Jonathan D.; Luo, Hong

    2016-03-01

    The present invention relates to compositions and methods comprising genes and peptides associated with cyclic peptides and cyclic peptide production in mushrooms. In particular, the present invention relates to using genes and proteins from Galerina species encoding peptides specifically relating to amatoxins in addition to proteins involved with processing cyclic peptide toxins. In a preferred embodiment, the present invention also relates to methods for making small peptides and small cyclic peptides including peptides similar to amanitin. Further, the present inventions relate to providing kits for making small peptides.

  18. Redefining body composition: nutrients hormones, and genes in meat production.

    Science.gov (United States)

    Wray-Cahen, C D; Kerr, D E; Evock-Clover, C M; Steele, N C

    1998-01-01

    Growth rate and body composition of livestock can be optimized to meet consumer needs for a leaner product and to improve the efficiency of meat-animal production. Optimization strategies have traditionally focused on genetic selection and cost-effective ration formulation to achieve the genetic potential. Advances in understanding the mechanisms of growth and its control have led to additional opportunities for its manipulation. These include nutritional manipulation,the use of growth promotants, and, more recently, the ability to change the genetic potential through genetic engineering. Selection of appropriate candidate genes for manipulation depends on understanding the mechanisms underlying differentiation and growth of embryonic muscle cells. Recent advances in genetic engineering techniques, including gene therapy and germline transgenesis, will likely hasten the genetic progress toward a leaner carcass in domestic livestock. Such strategies may prove to be more beneficial then the controlled enhancement of somatotropin expression. PMID:9706219

  19. Modular optimization of multi-gene pathways for fumarate production.

    Science.gov (United States)

    Chen, Xiulai; Zhu, Pan; Liu, Liming

    2016-01-01

    Microbial fumarate production from renewable feedstock is a promising and sustainable alternative to petroleum-based chemical synthesis. Here, we report a modular engineering approach that systematically removed metabolic pathway bottlenecks and led to significant titer improvements in a multi-gene fumarate metabolic pathway. On the basis of central pathway architecture, yeast fumarate biosynthesis was re-cast into three modules: reduction module, oxidation module, and byproduct module. We targeted reduction module and oxidation module to the cytoplasm and the mitochondria, respectively. Combinatorially tuning pathway efficiency by constructing protein fusions RoMDH-P160A and KGD2-SUCLG2 and optimizing metabolic balance by controlling genes RoPYC, RoMDH-P160A, KGD2-SUCLG2 and SDH1 expression strengths led to significantly improved fumarate production (20.46 g/L). In byproduct module, synthetizing DNA-guided scaffolds and designing sRNA switchs enabled further production improvement up to 33.13 g/L. These results suggest that modular pathway engineering can systematically optimize biosynthesis pathways to enable an efficient production of fumarate. PMID:26241189

  20. Identification of the neurofibromatosis type 1 gene product

    International Nuclear Information System (INIS)

    The gene for neurofibromatosis type 1 (NF1) was recently identified by positional cloning. The complete cDNA encodes a polypeptide of 2818 amino acids. To study the NF1 gene product, antibodies were raised against both fusion proteins and synthetic peptides. Initial characterization of two anti-peptide antibodies and one fusion-protein antibody demonstrated a specific protein of ∼250 kDa by both immunoprecipitation and immunoblotting. This protein was found in all tissues and cell lines examined and is detected in human, rat, and mouse tissues. To demonstrate that these antibodies specifically recognize the NF1 protein, additional fusion proteins containing the sequence specific to the synthetic peptide were generated. Both peptide antisera recognize the proper specific fusion proteins so generated. Immunoprecipitates using the peptide antisera were shown to recognize the same protein detected by immunoblotting with either the other peptide antiserum or the fusion-protein antiserum. Immunoblotting using antiserum specific to spatially distinct epitopes conducted on tissue homogenates demonstrated the NF1 protein in all adult tissues. Based on the homology between the NF1 gene product and members of the GTPase-activating protein (GAP) superfamily, the name NF1-GAP-related protein (NF1GRP) is suggested

  1. dcp gene of Escherichia coli: cloning, sequencing, transcript mapping, and characterization of the gene product.

    Science.gov (United States)

    Henrich, B; Becker, S; Schroeder, U; Plapp, R

    1993-01-01

    Dipeptidyl carboxypeptidase is a C-terminal exopeptidase of Escherichia coli. We have isolated the respective gene, dcp, from a low-copy-number plasmid library by its ability to complement a dcp mutation preventing the utilization of the unique substrate N-benzoyl-L-glycyl-L-histidyl-L-leucine. Sequence analysis of a 2.9-kb DNA fragment revealed an open reading frame of 2,043 nucleotides which was assigned to the dcp gene by N-terminal amino acid sequencing and electrophoretic molecular mass determination of the purified dcp product. Transcript mapping by primer extension and S1 protection experiments verified the physiological significance of potential initiation and termination signals for dcp transcription and allowed the identification of a single species of monocistronic dcp mRNA. The codon usage pattern and the effects of elevated gene copy number indicated a relatively low level of dcp expression. The predicted amino acid sequence of dipeptidyl carboxypeptidase, containing a potential zinc-binding site, is highly homologous (78.8%) to the corresponding enzyme from Salmonella typhimurium. It also displays significant homology to the products of the S. typhimurium opdA and the E. coli prlC genes and to some metalloproteases from rats and Saccharomyces cerevisiae. No potential export signals could be inferred from the amino acid sequence. Dipeptidyl carboxypeptidase was enriched 80-fold from crude extracts of E. coli and used to investigate some of its biochemical and biophysical properties. Images PMID:8226676

  2. 76 FR 9028 - Guidance for Industry: Potency Tests for Cellular and Gene Therapy Products; Availability

    Science.gov (United States)

    2011-02-16

    ... Industry: Potency Tests for Cellular and Gene Therapy Products'' dated January 2011. The guidance document provides manufacturers of cellular and gene therapy (CGT) products with recommendations for developing... document entitled ``Guidance for Industry: Potency Tests for Cellular and Gene Therapy Products''...

  3. Single gene insertion drives bioalcohol production by a thermophilic archaeon

    Energy Technology Data Exchange (ETDEWEB)

    Basen, M; Schut, GJ; Nguyen, DM; Lipscomb, GL; Benn, RA; Prybol, CJ; Vaccaro, BJ; Poole, FL; Kelly, RM; Adams, MWW

    2014-12-09

    Bioethanol production is achieved by only two metabolic pathways and only at moderate temperatures. Herein a fundamentally different synthetic pathway for bioalcohol production at 70 degrees C was constructed by insertion of the gene for bacterial alcohol dehydrogenase (AdhA) into the archaeon Pyrococcus furiosus. The engineered strain converted glucose to ethanol via acetate and acetaldehyde, catalyzed by the host-encoded aldehyde ferredoxin oxidoreductase (AOR) and heterologously expressed AdhA, in an energy-conserving, redox-balanced pathway. Furthermore, the AOR/AdhA pathway also converted exogenously added aliphatic and aromatic carboxylic acids to the corresponding alcohol using glucose, pyruvate, and/or hydrogen as the source of reductant. By heterologous coexpression of a membrane-bound carbon monoxide dehydrogenase, CO was used as a reductant for converting carboxylic acids to alcohols. Redirecting the fermentative metabolism of P. furiosus through strategic insertion of foreign genes creates unprecedented opportunities for thermophilic bioalcohol production. Moreover, the AOR/AdhA pathway is a potentially game-changing strategy for syngas fermentation, especially in combination with carbon chain elongation pathways.

  4. Multiple joined genes prevent product degradation in Escherichia coli.

    OpenAIRE

    Shen, S H

    1984-01-01

    A method is described that allows the expression of a stable human proinsulin product in Escherichia coli as encoded by either a fused or an unfused gene construction. In the fused system, the human proinsulin coding sequence is joined to the 3' side of a fragment containing the lac promoter and the coding sequence for a small part of the NH2 terminus of beta-galactosidase. In the unfused system, the proinsulin coding sequence is linked directly to a fragment containing the Tac promoter follo...

  5. Functional annotation of human cytomegalovirus gene products: an update

    Directory of Open Access Journals (Sweden)

    Ellen eVan Damme

    2014-05-01

    Full Text Available Human Cytomegalovirus is an opportunistic double-stranded DNA virus with one of the largest viral genomes known. The 235kB genome is divided in a unique long (UL and a unique short (US region which are flanked by terminal and internal repeats. The expression of HCMV genes is highly complex and involves the production of protein coding transcripts, polyadenylated long non-coding RNAs, polyadenylated anti-sense transcripts and a variety of non-polyadenylated RNAs such as microRNAs. Although the function of many of these transcripts is unknown, they are suggested play a direct or regulatory role in the delicately orchestrated processes that ensure HCMV replication and life-long persistence. This review focuses on annotating the complete viral genome based on three sources of information. First, previous reviews were used as a template for the functional keywords to ensure continuity; second, the Uniprot database was used to further enrich the functional database; and finally, the literature was manually curated for novel functions of HCMV gene products. Novel discoveries were discussed in light of the viral life cycle. This functional annotation highlights still poorly understood regions of the genome but most importantly it can give insight in functional clusters and/or may be helpful in the analysis of transcriptomics and proteomics studies.

  6. Genes related to xylose fermentation and methods of using same for enhanced biofuel production

    Science.gov (United States)

    Wohlbach, Dana J.; Gasch, Audrey P.

    2014-08-05

    The present invention provides isolated gene sequences involved in xylose fermentation and related recombinant yeast which are useful in methods of enhanced biofuel production, particularly ethanol production. Methods of bioengineering recombinant yeast useful for biofuel production are also provided.

  7. Genes related to xylose fermentation and methods of using same for enhanced biofuel production

    Energy Technology Data Exchange (ETDEWEB)

    Wohlbach, Dana J.; Gasch, Audrey P.

    2015-09-29

    The present invention provides isolated gene sequences involved in xylose fermentation and related recombinant yeast which are useful in methods of enhanced biofuel production, particularly ethanol production. Methods of bioengineering recombinant yeast useful for biofuel production are also provided.

  8. FSim: A Novel Functional Similarity Search Algorithm and Tool for Discovering Functionally Related Gene Products

    OpenAIRE

    2014-01-01

    Background. During the analysis of genomics data, it is often required to quantify the functional similarity of genes and their products based on the annotation information from gene ontology (GO) with hierarchical structure. A flexible and user-friendly way to estimate the functional similarity of genes utilizing GO annotation is therefore highly desired. Results. We proposed a novel algorithm using a level coefficient-weighted model to measure the functional similarity of gene products base...

  9. Transcription of interferon-stimulated genes is induced by adenovirus particles but is suppressed by E1A gene products

    Energy Technology Data Exchange (ETDEWEB)

    Reich, N.; Pine, R.; Levy, D.; Darnell, J.E. Jr.

    1988-01-01

    Interferon treatment of cell cultures results in the rapid transcriptional induction of a specific set of genes. In this paper the authors explore the effect of cellular infection by several adenoviruses, both wild type and mutant, on the expression of these genes. Infection with adenovirus induces the transcription of the interferon-stimulated genes in the absence of any protein synthesis. In fact, the inhibition of protein synthesis during a wild-type infection produces enhanced stimulation of transcription of these genes. Experiments with viral mutants indicate the ability to specifically suppress this transcription maps to the E1A gene. In addition, the E1A gene products are capable of suppressing the specific transcriptional induction of interferon-stimulated promoters during cotransfection experiments and therefore presumably during viral infection. The dual effect of adenovirus on the expression of interferon-stimulated genes may represent an example of action and evolutionary reaction between virus and host.

  10. Expression regulation of design process gene in product design

    DEFF Research Database (Denmark)

    Fang, Lusheng; Li, Bo; Tong, Shurong;

    2011-01-01

    To improve the design process efficiency, this paper proposes the principle and methodology that design process gene controls the characteristics of design process under the framework of design process reuse and optimization based on design process gene. First, the concept of design process gene ...

  11. The Salmonella typhimurium LT2 uvrD gene is regulated by the lexA gene product.

    OpenAIRE

    Pang, P P; Walker, G C

    1983-01-01

    The uvrD gene product apparently plays a role in the repair of UV damage, in mismatch repair, and in genetic recombination. A lower level of expression of the Salmonella typhimurium LT2 uvrD gene was observed in maxicells prepared from an Escherichia coli strain that contained a lexA+ plasmid than in maxicells prepared from an E. coli strain that lacked functional LexA protein. These results suggest that the uvrD+ gene is repressed by the LexA protein and is thus a member of the set of genes ...

  12. Gene deletion of cytosolic ATP: citrate lyase leads to altered organic acid production in Aspergillus niger

    DEFF Research Database (Denmark)

    Meijer, Susan Lisette; Nielsen, Michael Lynge; Olsson, Lisbeth;

    2009-01-01

    factory platform for production of chemicals. Using molecular biology techniques, this study focused on metabolic engineering of A. niger to manipulate its organic acid production in the direction of succinic acid. The gene target for complete gene deletion was cytosolic ATP: citrate lyase (acl), which...

  13. Metabolites production improvement by identifying minimal genomes and essential genes using flux balance analysis.

    Science.gov (United States)

    Salleh, Abdul Hakim Mohamed; Mohamad, Mohd Saberi; Deris, Safaai; Illias, Rosli Md

    2015-01-01

    With the advancement in metabolic engineering technologies, reconstruction of the genome of host organisms to achieve desired phenotypes can be made. However, due to the complexity and size of the genome scale metabolic network, significant components tend to be invisible. We proposed an approach to improve metabolite production that consists of two steps. First, we find the essential genes and identify the minimal genome by a single gene deletion process using Flux Balance Analysis (FBA) and second by identifying the significant pathway for the metabolite production using gene expression data. A genome scale model of Saccharomyces cerevisiae for production of vanillin and acetate is used to test this approach. The result has shown the reliability of this approach to find essential genes, reduce genome size and identify production pathway that can further optimise the production yield. The identified genes and pathways can be extendable to other applications especially in strain optimisation. PMID:26489144

  14. Cloning and characterization of the gene product of the form II ribulose-1,5-bisphosphate carboxylase gene of Rhodopseudomonas sphaeroides.

    OpenAIRE

    Muller, E D; Chory, J; Kaplan, S

    1985-01-01

    We report the cloning and characterization of the gene product of the gene for the form II ribulose bisphosphate carboxylase from Rhodopseudomonas sphaeroides. We present evidence that the form II enzyme is encoded by a single gene in R. sphaeroides; however, this gene does hybridize to a second chromosomal locus.

  15. Cloned yeast and mammalian transcription factor TFIID gene products support basal but not activated metallothionein gene transcription

    International Nuclear Information System (INIS)

    Transcription factor IID (TFIID), the TATA binding factor, is thought to play a key role in the regulation of eukaryotic transcriptional initiation. The authors studied the role of TFIID in the transcription of the yeast metallothionein gene, which is regulated by the copper-dependent activator protein ACE1. Both basal and induced transcription of the metallothionein gene require TFIID and a functional TATA binding site. Crude human and mouse TFIID fractions, prepared from mammalian cells, respond to stimulation by ACE1, In contrast, human and yeast TFIID proteins expressed from the cloned genes do not respond to ACE1, except in the presence of what germ or yeast total cell extracts. These results indicate that the cloned TFIID gene products lack a component(s) or modifications(s) that is required for regulated as compared to basal transription

  16. Cloning and characterization of a pair of novel genes that regulate production of extracellular enzymes in Bacillus subtilis.

    OpenAIRE

    Pang, A S; Nathoo, S; Wong, S L

    1991-01-01

    Two novel Bacillus subtilis genes that regulate the production of several extracellular enzymes were clones and characterized. These two genes are organized as part of an operon. When cloned in a multicopy plasmid, the first gene (tenA, transcription enhancement) stimulates alkaline protease production at the transcriptional level. The second gene (tenI) exerts an opposite effect to reduce alkaline protease production. The production of neutral protease, levansucrase, and alkaline protease ca...

  17. Modulation of Chaperone Gene Expression in Mutagenized Saccharomyces cerevisiae Strains Developed for Recombinant Human Albumin Production Results in Increased Production of Multiple Heterologous Proteins▿

    OpenAIRE

    Payne, T.; Finnis, C.; Evans, L R; Mead, D. J.; Avery, S V; Archer, D. B.; Sleep, D.

    2008-01-01

    The yeast Saccharomyces cerevisiae has been successfully established as a commercially viable system for the production of recombinant proteins. Manipulation of chaperone gene expression has been utilized extensively to increase recombinant protein production from S. cerevisiae, focusing predominantly on the products of the protein disulfide isomerase gene PDI1 and the hsp70 gene KAR2. Here we show that the expression of the genes SIL1, LHS1, JEM1, and SCJ1, all of which are involved in regul...

  18. Genetic resources for advanced biofuel production described with the Gene Ontology

    OpenAIRE

    Torto-Alalibo, Trudy; Purwantini, Endang; Lomax, Jane; Setubal, João C.; Mukhopadhyay, Biswarup; Tyler, Brett M.

    2014-01-01

    Dramatic increases in research in the area of microbial biofuel production coupled with high-throughput data generation on bioenergy-related microbes has led to a deluge of information in the scientific literature and in databases. Consolidating this information and making it easily accessible requires a unified vocabulary. The Gene Ontology (GO) fulfills that requirement, as it is a well-developed structured vocabulary that describes the activities and locations of gene products in a consist...

  19. Products of vasopressin gene expression in small-cell carcinoma of the lung.

    OpenAIRE

    Friedmann, A. S.; Malott, K. A.; Memoli, V. A.; PAI, S.I.; Yu, X M; North, W. G.

    1994-01-01

    Small-cell neuroendocrine carcinoma of the lung is known to express products related to the vasopressin gene, although these products have been reported to sometimes differ from those generated by neurones of the hypothalamo-neurohypophyseal system. To further investigate vasopressin gene expression in neuroendocrine carcinomas, we performed immunohistochemistry on 24 histologically classified small-cell carcinomas using antibodies directed against different regions of the vasopressin precurs...

  20. Effect of Different Carbon Source on Expression of Carotenogenic Genes and Astaxanthin Production in Xanthophyllomyces dendrorhous

    OpenAIRE

    Wei Wu; Xin Yu

    2013-01-01

    The present research gives an insight into astaxanthin production, as well as transcription differences of four key carotenogenic genes, in Xanthophyllomyces dendrorhous when cultured with various carbon sources and soybean oil as co-substrates. Glucose was found to be the carbon source with best culture growth and astaxanthin production and the addition of 2% (v/v) soybean oil resulted in even higher astaxanthin producing. In addition, four carotenogenic genes encoding geranylgeranyl diphosp...

  1. Coregulation of terpenoid pathway genes and prediction of isoprene production in Bacillus subtilis using transcriptomics

    Energy Technology Data Exchange (ETDEWEB)

    Hess, Becky M.; Xue, Junfeng; Markillie, Lye Meng; Taylor, Ronald C.; Wiley, H. S.; Ahring, Birgitte K.; Linggi, Bryan E.

    2013-06-19

    The isoprenoid pathway converts pyruvate to isoprene and related isoprenoid compounds in plants and some bacteria. Currently, this pathway is of great interest because of the critical role that isoprenoids play in basic cellular processes as well as the industrial value of metabolites such as isoprene. Although the regulation of several pathway genes has been described, there is a paucity of information regarding the system level regulation and control of the pathway. To address this limitation, we examined Bacillus subtilis grown under multiple conditions and then determined the relationship between altered isoprene production and the pattern of gene expression. We found that terpenoid genes appeared to fall into two distinct subsets with opposing correlations with respect to the amount of isoprene produced. The group whose expression levels positively correlated with isoprene production included dxs, the gene responsible for the commitment step in the pathway, as well as ispD, and two genes that participate in the mevalonate pathway, yhfS and pksG. The subset of terpenoid genes that inversely correlated with isoprene production included ispH, ispF, hepS, uppS, ispE, and dxr. A genome wide partial least squares regression model was created to identify other genes or pathways that contribute to isoprene production. This analysis showed that a subset of 213 regulated genes was sufficient to create a predictive model of isoprene production under different conditions and showed correlations at the transcriptional level. We conclude that gene expression levels alone are sufficiently informative about the metabolic state of a cell that produces increased isoprene and can be used to build a model which accurately predicts production of this secondary metabolite across many simulated environmental conditions.

  2. Regulation of the human stress response gene GADD153 expression: role of ETS1 and FLI-1 gene products.

    Science.gov (United States)

    Seth, A; Giunta, S; Franceschil, C; Kola, I; Venanzoni, M C

    1999-09-01

    We have previously shown that ETS transcription factors, regulate cell growth and differentiation, and ETS1 and ETS2 are able to transcriptionally regulate wt p53 gene expression. In the present study we show that the ETS transcription factors also play a role in regulating expression of GADD153, a wt p53 inducible gene, which induces growth arrest and apoptosis in response to stress signals or DNA damage. We report the presence of a single EBS in the human GADD153 promoter, and that the GADD45 gene promoter lacks EBSs. The GADD153 promoter EBS shows a very high affinity for ETS1 and FLI-1 gene products. In addition, our data show that both ETS1 and FLI-1 strongly activate transcription of the GADD153 EBS linked to the CAT reporter gene. Our results also demonstrate how ETS1 and FLI-1 specifically regulate GADD153 expression. In addition, ectopic ETS2 protein expression resulted in only a weak induction of the same CAT reporter construct. The ETS1 and FLI-1 proteins provide a novel mechanism of activation for GADD153, allowing these two ETS genes to control its expression during cell growth and differentiation, rather than in response to oxidative stress. PMID:10510472

  3. Major genes and QTL influencing wool production and quality: a review

    Directory of Open Access Journals (Sweden)

    Purvis Ian

    2005-12-01

    Full Text Available Abstract The opportunity exists to utilise our knowledge of major genes that influence the economically important traits in wool sheep. Genes with Mendelian inheritance have been identified for many important traits in wool sheep. Of particular importance are genes influencing pigmentation, wool quality and the keratin proteins, the latter of which are important for the morphology of the wool fibre. Gene mapping studies have identified some chromosomal regions associated with variation in wool quality and production traits. The challenge now is to build on this knowledge base in a cost-effective way to deliver molecular tools that facilitate enhanced genetic improvement programs for wool sheep.

  4. Id-1 and Id-2 genes and products as markers of epithelial cancer

    Science.gov (United States)

    Desprez, Pierre-Yves; Campisi, Judith

    2008-09-30

    A method for detection and prognosis of breast cancer and other types of cancer. The method comprises detecting expression, if any, for both an Id-1 and an Id-2 genes, or the ratio thereof, of gene products in samples of breast tissue obtained from a patient. When expressed, Id-1 gene is a prognostic indicator that breast cancer cells are invasive and metastatic, whereas Id-2 gene is a prognostic indicator that breast cancer cells are localized and noninvasive in the breast tissue.

  5. Split-gene system for hybrid wheat seed production

    OpenAIRE

    Kempe, Katja; Rubtsova, Myroslava; Gils, Mario

    2014-01-01

    Global food security demands the development of new technologies to increase and secure cereal production on finite arable land without increasing water and fertilizer use. Although the use of heterosis through hybrid breeding has produced tremendous economic benefits in worldwide crop production, less than 1% of the global wheat area is planted with hybrids. One of the greatest bottlenecks in breeding hybrid wheat is the lack of an efficient sterility system to block self-pollination. This r...

  6. Identification and localization of a gene that specifies production of Escherichia coli DNA topoisomerase I

    Energy Technology Data Exchange (ETDEWEB)

    Trucksis, M.; Depew, R.E.

    1981-04-01

    A gene that specifies production of Escherichia coli DNA topoisomerase I (..omega.. protein) was identified with the aid of a radioimmunoassay for this protein. E. coli DNA topoisomerase I was produced by Salmonella typhimurium merodiploids that harbored E. coli plasmid F' 123, but not by strains that lost this plasmid. Analysis of strains with spontaneous deletions of F' 123 showed that the gene, topA, required for production of the E. coli ..omega.. protein was between the trp operon and the cysB gene. Deletions that eliminated topA also eliminated the supX gene. We suggest that topA is the structural gene of E. coli DNA topoisomerase I and that topA is identical to supX.

  7. Identification and manipulation of the pleuromutilin gene cluster from Clitopilus passeckerianus for increased rapid antibiotic production

    Science.gov (United States)

    Bailey, Andy M.; Alberti, Fabrizio; Kilaru, Sreedhar; Collins, Catherine M.; de Mattos-Shipley, Kate; Hartley, Amanda J.; Hayes, Patrick; Griffin, Alison; Lazarus, Colin M.; Cox, Russell J.; Willis, Christine L.; O’Dwyer, Karen; Spence, David W.; Foster, Gary D.

    2016-05-01

    Semi-synthetic derivatives of the tricyclic diterpene antibiotic pleuromutilin from the basidiomycete Clitopilus passeckerianus are important in combatting bacterial infections in human and veterinary medicine. These compounds belong to the only new class of antibiotics for human applications, with novel mode of action and lack of cross-resistance, representing a class with great potential. Basidiomycete fungi, being dikaryotic, are not generally amenable to strain improvement. We report identification of the seven-gene pleuromutilin gene cluster and verify that using various targeted approaches aimed at increasing antibiotic production in C. passeckerianus, no improvement in yield was achieved. The seven-gene pleuromutilin cluster was reconstructed within Aspergillus oryzae giving production of pleuromutilin in an ascomycete, with a significant increase (2106%) in production. This is the first gene cluster from a basidiomycete to be successfully expressed in an ascomycete, and paves the way for the exploitation of a metabolically rich but traditionally overlooked group of fungi.

  8. Regulation of gene expression by tobacco product preparations in cultured human dermal fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Malpass, Gloria E., E-mail: gloria.malpass@gmail.com [Department of Physiology and Pharmacology, Wake Forest University Health Sciences, Winston-Salem, NC 27157 (United States); Arimilli, Subhashini, E-mail: sarimill@wakehealth.edu [Department of Microbiology and Immunology, Wake Forest University Health Sciences, Winston-Salem, NC 27157 (United States); Prasad, G.L., E-mail: prasadg@rjrt.com [R and D Department, R.J. Reynolds Tobacco Company, Winston-Salem, NC 27102 (United States); Howlett, Allyn C., E-mail: ahowlett@wakehealth.edu [Department of Physiology and Pharmacology, Wake Forest University Health Sciences, Winston-Salem, NC 27157 (United States)

    2014-09-01

    Skin fibroblasts comprise the first barrier of defense against wounds, and tobacco products directly contact the oral cavity. Cultured human dermal fibroblasts were exposed to smokeless tobacco extract (STE), total particulate matter (TPM) from tobacco smoke, or nicotine at concentrations comparable to those found in these extracts for 1 h or 5 h. Differences were identified in pathway-specific genes between treatments and vehicle using qRT-PCR. At 1 h, IL1α was suppressed significantly by TPM and less significantly by STE. Neither FOS nor JUN was suppressed at 1 h by tobacco products. IL8, TNFα, VCAM1, and NFκB1 were suppressed after 5 h with STE, whereas only TNFα and NFκB1 were suppressed by TPM. At 1 h with TPM, secreted levels of IL10 and TNFα were increased. Potentially confounding effects of nicotine were exemplified by genes such as ATF3 (5 h), which was increased by nicotine but suppressed by other components of STE. Within 2 h, TPM stimulated nitric oxide production, and both STE and TPM increased reactive oxygen species. The biological significance of these findings and utilization of the gene expression changes reported herein regarding effects of the tobacco product preparations on dermal fibroblasts will require additional research. - Highlights: • Tobacco product preparations (TPPs) alter gene expression in dermal fibroblasts. • Some immediate early genes critical to the inflammatory process are affected. • Different TPPs produce differential responses in certain pro-inflammatory genes.

  9. Regulation of gene expression by tobacco product preparations in cultured human dermal fibroblasts

    International Nuclear Information System (INIS)

    Skin fibroblasts comprise the first barrier of defense against wounds, and tobacco products directly contact the oral cavity. Cultured human dermal fibroblasts were exposed to smokeless tobacco extract (STE), total particulate matter (TPM) from tobacco smoke, or nicotine at concentrations comparable to those found in these extracts for 1 h or 5 h. Differences were identified in pathway-specific genes between treatments and vehicle using qRT-PCR. At 1 h, IL1α was suppressed significantly by TPM and less significantly by STE. Neither FOS nor JUN was suppressed at 1 h by tobacco products. IL8, TNFα, VCAM1, and NFκB1 were suppressed after 5 h with STE, whereas only TNFα and NFκB1 were suppressed by TPM. At 1 h with TPM, secreted levels of IL10 and TNFα were increased. Potentially confounding effects of nicotine were exemplified by genes such as ATF3 (5 h), which was increased by nicotine but suppressed by other components of STE. Within 2 h, TPM stimulated nitric oxide production, and both STE and TPM increased reactive oxygen species. The biological significance of these findings and utilization of the gene expression changes reported herein regarding effects of the tobacco product preparations on dermal fibroblasts will require additional research. - Highlights: • Tobacco product preparations (TPPs) alter gene expression in dermal fibroblasts. • Some immediate early genes critical to the inflammatory process are affected. • Different TPPs produce differential responses in certain pro-inflammatory genes

  10. dcp gene of Escherichia coli: cloning, sequencing, transcript mapping, and characterization of the gene product.

    OpenAIRE

    Henrich, B; S. Becker; Schroeder, U; Plapp, R.

    1993-01-01

    Dipeptidyl carboxypeptidase is a C-terminal exopeptidase of Escherichia coli. We have isolated the respective gene, dcp, from a low-copy-number plasmid library by its ability to complement a dcp mutation preventing the utilization of the unique substrate N-benzoyl-L-glycyl-L-histidyl-L-leucine. Sequence analysis of a 2.9-kb DNA fragment revealed an open reading frame of 2,043 nucleotides which was assigned to the dcp gene by N-terminal amino acid sequencing and electrophoretic molecular mass ...

  11. Lack of feedback inhibition of V kappa gene rearrangement by productively rearranged alleles.

    Science.gov (United States)

    Harada, K; Yamagishi, H

    1991-02-01

    Circular DNAs excised by immunoglobulin kappa chain gene rearrangements were cloned and characterized. 16 of 17 clones examined were double recombination products containing a V kappa-J kappa rearrangement (coding joint) as well as the reciprocal element (signal joint) of another V kappa-J kappa rearrangement. These products suggested multiple recombination, primary inversion, and secondary excision. In primary events, 5 of 16 translational reading frames were in-phase. Thus, V kappa gene rearrangement may not be inhibited by the presence of a productively rearranged allele. An unusually large trinucleotide (P) insertion forming a palindrome of 12 nucleotides was also observed in one of the coding joints. PMID:1988542

  12. The paf gene product modulates asexual development in Penicillium chrysogenum.

    Science.gov (United States)

    Hegedüs, Nikoletta; Sigl, Claudia; Zadra, Ivo; Pócsi, Istvan; Marx, Florentine

    2011-06-01

    Penicillium chrysogenum secretes a low molecular weight, cationic and cysteine-rich protein (PAF). It has growth inhibitory activity against the model organism Aspergillus nidulans and numerous zoo- and phytopathogenic fungi but shows only minimal conditional antifungal activity against the producing organism itself. In this study we provide evidence for an additional function of PAF which is distinct from the antifungal activity against putative ecologically concurrent microorganisms. Our data indicate that PAF enhances conidiation in P. chrysogenum by modulating the expression of brlA, the central regulatory gene for mitospore development. A paf deletion strain showed a significant impairment of mitospore formation which sustains our hypothesis that PAF plays an important role in balancing asexual differentiation in P. chrysogenum. PMID:21298690

  13. Phylogenomic study of lipid genes involved in microalgal biofuel production-candidate gene mining and metabolic pathway analyses.

    Science.gov (United States)

    Misra, Namrata; Panda, Prasanna Kumar; Parida, Bikram Kumar; Mishra, Barada Kanta

    2012-01-01

    Optimizing microalgal biofuel production using metabolic engineering tools requires an in-depth understanding of the structure-function relationship of genes involved in lipid biosynthetic pathway. In the present study, genome-wide identification and characterization of 398 putative genes involved in lipid biosynthesis in Arabidopsis thaliana Chlamydomonas reinhardtii, Volvox carteri, Ostreococcus lucimarinus, Ostreococcus tauri and Cyanidioschyzon merolae was undertaken on the basis of their conserved motif/domain organization and phylogenetic profile. The results indicated that the core lipid metabolic pathways in all the species are carried out by a comparable number of orthologous proteins. Although the fundamental gene organizations were observed to be invariantly conserved between microalgae and Arabidopsis genome, with increased order of genome complexity there seems to be an association with more number of genes involved in triacylglycerol (TAG) biosynthesis and catabolism. Further, phylogenomic analysis of the genes provided insights into the molecular evolution of lipid biosynthetic pathway in microalgae and confirm the close evolutionary proximity between the Streptophyte and Chlorophyte lineages. Together, these studies will improve our understanding of the global lipid metabolic pathway and contribute to the engineering of regulatory networks of algal strains for higher accumulation of oil. PMID:23032611

  14. Physiological evaluation of the filamentous fungus Trichoderma reesei in production processes by marker gene expression analysis

    Directory of Open Access Journals (Sweden)

    Penttilä Merja

    2007-05-01

    Full Text Available Abstract Background Biologically relevant molecular markers can be used in evaluation of the physiological state of an organism in biotechnical processes. We monitored at high frequency the expression of 34 marker genes in batch, fed-batch and continuous cultures of the filamentous fungus Trichoderma reesei by the transcriptional analysis method TRAC (TRanscript analysis with the aid of Affinity Capture. Expression of specific genes was normalised either with respect to biomass or to overall polyA RNA concentration. Expressional variation of the genes involved in various process relevant cellular functions, such as protein production, growth and stress responses, was related to process parameters such as specific growth and production rates and substrate and dissolved oxygen concentrations. Results Gene expression of secreted cellulases and recombinant Melanocarpus albomyces laccase predicted the trends in the corresponding extracellular enzyme production rates and was highest in a narrow "physiological window" in the specific growth rate (μ range of 0.03 – 0.05 h-1. Expression of ribosomal protein mRNAs was consistent with the changes in μ. Nine starvation-related genes were found as potential markers for detection of insufficient substrate feed for maintaining optimal protein production. For two genes induced in anaerobic conditions, increasing transcript levels were measured as dissolved oxygen decreased. Conclusion The data obtained by TRAC supported the usefulness of focused and intensive transcriptional analysis in monitoring of biotechnical processes providing thus tools for process optimisation purposes.

  15. Duplication of partial spinosyn biosynthetic gene cluster in Saccharopolyspora spinosa enhances spinosyn production.

    Science.gov (United States)

    Tang, Ying; Xia, Liqiu; Ding, Xuezhi; Luo, Yushuang; Huang, Fan; Jiang, Yuanwei

    2011-12-01

    Spinosyns, the secondary metabolites produced by Saccharopolyspora spinosa, are the active ingredients in a family of insect control agents. Most of the S. spinosa genes involved in spinosyn biosynthesis are found in a contiguous c. 74-kb cluster. To increase the spinosyn production through overexpression of their biosynthetic genes, part of its gene cluster (c. 18 kb) participating in the conversion of the cyclized polyketide to spinosyn was obtained by direct cloning via Red/ET recombination rather than by constructing and screening the genomic library. The resultant plasmid pUCAmT-spn was introduced into S. spinosa CCTCC M206084 from Escherichia coli S17-1 by conjugal transfer. The subsequent single-crossover homologous recombination caused a duplication of the partial gene cluster. Integration of this plasmid enhanced production of spinosyns with a total of 388 (± 25.0) mg L(-1) for spinosyns A and D in the exconjugant S. spinosa trans1 compared with 100 (± 7.7) mg L(-1) in the parental strain. Quantitative real time polymerase chain reaction analysis of three selected genes (spnH, spnI, and spnK) confirmed the positive effect of the overexpression of these genes on the spinosyn production. This study provides a simple avenue for enhancing spinosyn production. The strategies could also be used to improve the yield of other secondary metabolites. PMID:22092858

  16. The FRIABLE1 gene product affects cell adhesion in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Lutz Neumetzler

    Full Text Available Cell adhesion in plants is mediated predominantly by pectins, a group of complex cell wall associated polysaccharides. An Arabidopsis mutant, friable1 (frb1, was identified through a screen of T-DNA insertion lines that exhibited defective cell adhesion. Interestingly, the frb1 plants displayed both cell and organ dissociations and also ectopic defects in organ separation. The FRB1 gene encodes a Golgi-localized, plant specific protein with only weak sequence similarities to known proteins (DUF246. Unlike other cell adhesion deficient mutants, frb1 mutants do not have reduced levels of adhesion related cell wall polymers, such as pectins. Instead, FRB1 affects the abundance of galactose- and arabinose-containing oligosaccharides in the Golgi. Furthermore, frb1 mutants displayed alteration in pectin methylesterification, cell wall associated extensins and xyloglucan microstructure. We propose that abnormal FRB1 action has pleiotropic consequences on wall architecture, affecting both the extensin and pectin matrices, with consequent changes to the biomechanical properties of the wall and middle lamella, thereby influencing cell-cell adhesion.

  17. Candidate genes for drought tolerance and improved productivity in rice (Oryza sativa L.)

    Indian Academy of Sciences (India)

    M S Vinod; Naveen Sharma; K Manjunatha; Adnan Kanbar; N B Prakash; H E Shashidhar

    2006-03-01

    Candidate genes are sequenced genes of known biological action involved in the development or physiology of a trait. Twenty-one putative candidate genes were designed after an exhaustive search in the public databases along with an elaborate literature survey for candidate gene products and/or regulatory sequences associated with enhanced drought resistance. The downloaded sequences were then used to design primers considering the flanking sequences as well. Polymerase chain reaction (PCR) performed on 10 diverse cultivars that involved Japonica, Indica and local accessions, revealed 12 polymorphic candidate genes. Seven polymorphic candidate genes were then utilized to genotype 148 individuals of CT9993 × IR62266 doubled haploid (DH) mapping population. The segregation data were tested for deviation from the expected Mendelian ratio (1:1) using a Chi-square test (<1%). Based on this, four candidate genes were assessed to be significant and the remaining three, as non-significant. All the significant candidate genes were biased towards CT9993, the female parent in the DH mapping population. Single-marker analysis strongly associated ( < 1%) them to different traits under both well-watered and low-moisture stress conditions. Two candidate genes, EXP15 and EXP13, were found to be associated with root number and silicon content in the stem respectively, under both well-watered and low-moisture stress conditions.

  18. O-linked glycosylation of retroviral envelope gene products

    International Nuclear Information System (INIS)

    Treatment of [3H]glucosamine-labeled Friend mink cell focus-forming virus (FrMCF) gp70 with excess peptide:N-glycanase F (PNGase F) resulted in removal of the expected seven N-linked oligosaccharide chains; however, approximately 10% of the glucosamine label was retained in the resulting 49,000-Mr (49K) product. For [3H]mannose-labeled gp70, similar treatment led to removal of all the carbohydrate label from the protein. Prior digestion of the PNGase F-treated gp70 with neuraminidase resulted in an addition size shift, and treatment with O-glycanase led to the removal of almost all of the PNGase F-resistant sugars. These results indicate that gp70 possesses sialic acid-containing O-linked oligosaccharides. Analysis of intracellular env precursors demonstrated that O-linked sugars were present in gPr90env, the polyprotein intermediate which contains complex sugars, but not in the primary translation product, gPr80env, and proteolytic digestion studies allowed localization of the O-linked carbohydrates to a 10K region near the center of the gp70 molecule. similar substituents were detected on the gp70s of ecotropic and xenotropic murine leukemia viruses and two subgroups of feline leukemia virus, indicting that O-linked glycosylation is a conserved feature of retroviral env proteins

  19. Database of cattle candidate genes and genetic markers for milk production and mastitis

    OpenAIRE

    Ogorevc, J; Kunej, T; Razpet, A; Dovc, P

    2009-01-01

    A cattle database of candidate genes and genetic markers for milk production and mastitis has been developed to provide an integrated research tool incorporating different types of information supporting a genomic approach to study lactation, udder development and health. The database contains 943 genes and genetic markers involved in mammary gland development and function, representing candidates for further functional studies. The candidate loci were drawn on a genetic map to reveal positio...

  20. The human cytomegalovirus gene product US6 inhibits ATP binding by TAP

    OpenAIRE

    Hewitt, Eric W.; Gupta, Soma Sen; Lehner, Paul J.

    2001-01-01

    Human cytomegalovirus (HCMV) encodes several genes that disrupt the major histocompatibility complex (MHC) class I antigen presentation pathway. We recently described the HCMV-encoded US6 gene product, a 23 kDa endoplasmic reticulum (ER)-resident type I integral membrane protein that binds to the transporter associated with antigen processing (TAP), inhibits peptide translocation and prevents MHC class I assembly. The functional consequence of this inhibition is to prevent the cell surface ex...

  1. Functional analysis of the Erwinia herbicola tutB gene and its product.

    Science.gov (United States)

    Katayama, Takane; Suzuki, Hideyuki; Koyanagi, Takashi; Kumagai, Hidehiko

    2002-06-01

    The tutB gene, which lies just downstream of tpl, has been cloned from Erwinia herbicola, and its product was analyzed. Despite its high sequence similarity to tryptophan transporters, TutB was found to be a tyrosine-specific transporter. Tryptophan acted as a competitive inhibitor of tyrosine transport. Unlike the tryptophanase operon, the tpl and tutB genes do not constitute an operon. PMID:12003958

  2. Functional Analysis of the Erwinia herbicola tutB Gene and Its Product

    OpenAIRE

    Katayama, Takane; Suzuki, Hideyuki; Koyanagi, Takashi; Kumagai, Hidehiko

    2002-01-01

    The tutB gene, which lies just downstream of tpl, has been cloned from Erwinia herbicola, and its product was analyzed. Despite its high sequence similarity to tryptophan transporters, TutB was found to be a tyrosine-specific transporter. Tryptophan acted as a competitive inhibitor of tyrosine transport. Unlike the tryptophanase operon, the tpl and tutB genes do not constitute an operon.

  3. A mutant gene that increases gibberellin production in Brassica

    International Nuclear Information System (INIS)

    A single gene mutant (elongated internode [ein/ein]) with accelerated shoot elongation was identified from a rapid cycling line of Brassica rapa. Relative to normal plants, mutant plants had slightly accelerated floral development, greater stem dry weights, and particularly, increased internode and inflorescence elongation. The application of the triazole plant growth retardant, paclobutrazol, inhibited shoot elongation, returning ein to a more normal phenotype. Conversely, exogenous gibberellin A3 (GA3) can convert normal genotypes to a phenotype resembling ein. The content of endogenous GA1 and GA3 were estimated by gas chromatography-selected ion monitoring using [2H]GA1 as a quantitative internal standard and at day 14 were 1.5- and 12.1-fold higher per stem, respectively, in ein than in normal plants, although GA concentrations were more similar. The endogenous levels of GA20 and GA1, and the rate of GA19 metabolism were simultaneously analyzed. Levels of GA1 and GA20 were 4.6- and 12.9-fold higher, respectively, and conversions to GA20 and GA1 were 8.3 and 1.3 times faster in ein than normal plants. Confirming the enhanced rate of GA1 biosynthesis in ein, the conversion of [3H]GA20 to [3H] GA1 was also faster in ein than in the normal genotype. Thus, the ein allele results in accelerated GA1 biosynthesis and an elevated content of endogenous GAs, including the dihydroxylated GAs A1 and A3

  4. A mutant gene that increases gibberellin production in Brassica

    Energy Technology Data Exchange (ETDEWEB)

    Rood, S.B. (Univ. of Lethbridge, Alberta (Canada)); Williams, P.H. (Univ. of Wisconsin, Madison (USA)); Pearce, D.; Pharis, R.P. (Univ. of Calgary, Alberta (Canada)); Murofushi, Noboru (Univ. of Tokyo (Japan)); Mander, L.N. (Australian National Univ., Canberra (Australia))

    1990-07-01

    A single gene mutant (elongated internode (ein/ein)) with accelerated shoot elongation was identified from a rapid cycling line of Brassica rapa. Relative to normal plants, mutant plants had slightly accelerated floral development, greater stem dry weights, and particularly, increased internode and inflorescence elongation. The application of the triazole plant growth retardant, paclobutrazol, inhibited shoot elongation, returning ein to a more normal phenotype. Conversely, exogenous gibberellin A{sub 3} (GA{sub 3}) can convert normal genotypes to a phenotype resembling ein. The content of endogenous GA{sub 1} and GA{sub 3} were estimated by gas chromatography-selected ion monitoring using ({sup 2}H)GA{sub 1} as a quantitative internal standard and at day 14 were 1.5- and 12.1-fold higher per stem, respectively, in ein than in normal plants, although GA concentrations were more similar. The endogenous levels of GA{sub 20} and GA{sub 1}, and the rate of GA{sub 19} metabolism were simultaneously analyzed. Levels of GA{sub 1} and GA{sub 20} were 4.6- and 12.9-fold higher, respectively, and conversions to GA{sub 20} and GA{sub 1} were 8.3 and 1.3 times faster in ein than normal plants. Confirming the enhanced rate of GA{sub 1} biosynthesis in ein, the conversion of ({sup 3}H)GA{sub 20} to ({sup 3}H) GA{sub 1} was also faster in ein than in the normal genotype. Thus, the ein allele results in accelerated GA{sub 1} biosynthesis and an elevated content of endogenous GAs, including the dihydroxylated GAs A{sub 1} and A{sub 3}.

  5. The 32-kilobase exp gene cluster of Rhizobium meliloti directing the biosynthesis of galactoglucan: genetic organization and properties of the encoded gene products.

    OpenAIRE

    Becker, A.; Rüberg, S; Küster, H.; Roxlau, A A; Keller, M; Ivashina, T; H.P. Cheng; Walker, G C; Pühler, A

    1997-01-01

    Proteins directing the biosynthesis of galactoglucan (exopolysaccharide II) in Rhizobium meliloti Rm2011 are encoded by the exp genes. Sequence analysis of a 32-kb DNA fragment of megaplasmid 2 containing the exp gene cluster identified previously (J. Glazebrook and G. C. Walker, Cell 56:661-672, 1989) revealed the presence of 25 open reading frames. Homologies of the deduced exp gene products to proteins of known function suggested that the exp genes encoded four proteins involved in the bio...

  6. Transcriptome and Gene Ontology (GO) Enrichment Analysis Reveals Genes Involved in Biotin Metabolism That Affect l-Lysine Production in Corynebacterium glutamicum

    OpenAIRE

    Hong-Il Kim; Jong-Hyeon Kim; Young-Jin Park

    2016-01-01

    Corynebacterium glutamicum is widely used for amino acid production. In the present study, 543 genes showed a significant change in their mRNA expression levels in l-lysine-producing C. glutamicum ATCC21300 than that in the wild-type C. glutamicum ATCC13032. Among these 543 differentially expressed genes (DEGs), 28 genes were up- or downregulated. In addition, 454 DEGs were functionally enriched and categorized based on BLAST sequence homologies and gene ontology (GO) annotations using the Bl...

  7. GeneViTo: Visualizing gene-product functional and structural features in genomic datasets

    Directory of Open Access Journals (Sweden)

    Promponas Vasilis J

    2003-10-01

    Full Text Available Abstract Background The availability of increasing amounts of sequence data from completely sequenced genomes boosts the development of new computational methods for automated genome annotation and comparative genomics. Therefore, there is a need for tools that facilitate the visualization of raw data and results produced by bioinformatics analysis, providing new means for interactive genome exploration. Visual inspection can be used as a basis to assess the quality of various analysis algorithms and to aid in-depth genomic studies. Results GeneViTo is a JAVA-based computer application that serves as a workbench for genome-wide analysis through visual interaction. The application deals with various experimental information concerning both DNA and protein sequences (derived from public sequence databases or proprietary data sources and meta-data obtained by various prediction algorithms, classification schemes or user-defined features. Interaction with a Graphical User Interface (GUI allows easy extraction of genomic and proteomic data referring to the sequence itself, sequence features, or general structural and functional features. Emphasis is laid on the potential comparison between annotation and prediction data in order to offer a supplement to the provided information, especially in cases of "poor" annotation, or an evaluation of available predictions. Moreover, desired information can be output in high quality JPEG image files for further elaboration and scientific use. A compilation of properly formatted GeneViTo input data for demonstration is available to interested readers for two completely sequenced prokaryotes, Chlamydia trachomatis and Methanococcus jannaschii. Conclusions GeneViTo offers an inspectional view of genomic functional elements, concerning data stemming both from database annotation and analysis tools for an overall analysis of existing genomes. The application is compatible with Linux or Windows ME-2000-XP operating

  8. Genetic resources for advanced biofuel production described with the Gene Ontology.

    Science.gov (United States)

    Torto-Alalibo, Trudy; Purwantini, Endang; Lomax, Jane; Setubal, João C; Mukhopadhyay, Biswarup; Tyler, Brett M

    2014-01-01

    Dramatic increases in research in the area of microbial biofuel production coupled with high-throughput data generation on bioenergy-related microbes has led to a deluge of information in the scientific literature and in databases. Consolidating this information and making it easily accessible requires a unified vocabulary. The Gene Ontology (GO) fulfills that requirement, as it is a well-developed structured vocabulary that describes the activities and locations of gene products in a consistent manner across all kingdoms of life. The Microbial ENergy processes Gene Ontology () project is extending the GO to include new terms to describe microbial processes of interest to bioenergy production. Our effort has added over 600 bioenergy related terms to the Gene Ontology. These terms will aid in the comprehensive annotation of gene products from diverse energy-related microbial genomes. An area of microbial energy research that has received a lot of attention is microbial production of advanced biofuels. These include alcohols such as butanol, isopropanol, isobutanol, and fuels derived from fatty acids, isoprenoids, and polyhydroxyalkanoates. These fuels are superior to first generation biofuels (ethanol and biodiesel esterified from vegetable oil or animal fat), can be generated from non-food feedstock sources, can be used as supplements or substitutes for gasoline, diesel and jet fuels, and can be stored and distributed using existing infrastructure. Here we review the roles of genes associated with synthesis of advanced biofuels, and at the same time introduce the use of the GO to describe the functions of these genes in a standardized way. PMID:25346727

  9. Genetic Resources for Advanced Biofuel Production Described with the Gene Ontology

    Directory of Open Access Journals (Sweden)

    Trudy eTorto-Alalibo

    2014-10-01

    Full Text Available Dramatic increases in research in the area of microbial biofuel production coupled with high-throughput data generation on bioenergy-related microbes has led to a deluge of information in the scientific literature and in databases. Consolidating this information and making it easily accessible requires a unified vocabulary. The Gene Ontology (GO fulfills that requirement, as it is a well-developed structured vocabulary that describes the activities and locations of gene products in a consistent manner across all kingdoms of life. The Microbial Energy Gene Ontology (MENGO: http://www.mengo.biochem.vt.edu project is extending the GO to include new terms to describe microbial processes of interest to bioenergy production. Our effort has added over 600 bioenergy related terms to the Gene Ontology. These terms will aid in the comprehensive annotation of gene products from diverse energy-related microbial genomes. An area of microbial energy research that has received a lot of attention is microbial production of advanced biofuels. These include alcohols such as butanol, isopropanol, isobutanol, and fuels derived from fatty acids, isoprenoids, and polyhydroxyalkanoates. These fuels are superior to first generation biofuels (ethanol and biodiesel esterified from vegetable oil or animal fat, can be generated from non-food feedstock sources, can be used as supplements or substitutes for gasoline, diesel and jet fuels, and can be stored and distributed using existing infrastructure. Here we review the roles of genes associated with synthesis of advanced biofuels, and at the same time introduce the use of the GO to describe the functions of these genes in a standardized way.

  10. Identification of the uvrD gene product of Salmonella typhimurium LT2.

    OpenAIRE

    Pang, P P; Walker, G C

    1983-01-01

    The product of the uvrD gene of Salmonella typhimurium LT2 and Escherichia coli K-12 is thought to play a role in both the correction of mismatched bases and the repair of DNA damage, since insertion mutations in the uvrD gene increase the spontaneous mutation frequency and make the cells more sensitive to killing by UV irradiation. To clone the uvrD gene of S. typhimurium, we first generated a uvrD-specific probe by using DNA from an S. typhimurium uvrD421::Tn5 mutant. This probe was used to...

  11. Investigation of genes involved in nisin production in Enterococcus spp. strains isolated from raw goat milk.

    Science.gov (United States)

    Perin, Luana Martins; Todorov, Svetoslav Dimitrov; Nero, Luís Augusto

    2016-09-01

    Different strains of Lactococcus lactis are capable of producing the bacteriocin nisin. However, genetic transfer mechanisms allow the natural occurrence of genes involved in nisin production in members of other bacterial genera, such as Enterococcus spp. In a previous study, nisA was identified in eight enterococci capable of producing antimicrobial substances. The aim of this study was to verify the presence of genes involved in nisin production in Enterococcus spp. strains, as well as nisin expression. The nisA genes from eight Enterococcus spp. strains were sequenced and the translated amino acid sequences were compared to nisin amino-acid sequences previously described in databases. Although containing nisin structural and maturation related genes, the enterococci strains tested in the present study did not present the immunity related genes (nisFEG and nisI). The translated sequences of nisA showed some point mutations, identical to those presented by Lactococcus strains isolated from goat milk. All enterococci were inhibited by nisin, indicating the absence of immunity and thus that nisin cannot be expressed. This study demonstrated for the first time the natural occurrence of nisin structural genes in Enterococcus strains and highlights the importance of providing evidence of a link between the presence of bacteriocin genes and their expression. PMID:27255139

  12. Overexpression of bacterial ethylene-forming enzyme gene in Trichoderma reesei enhanced the production of ethylene

    Directory of Open Access Journals (Sweden)

    Xi Chen, Yong Liang, Jing Hua, Li Tao, Wensheng Qin, Sanfeng Chen

    2010-01-01

    Full Text Available In order to efficiently utilize natural cellulose materials to produce ethylene, three expression vectors containing the ethylene-forming enzyme (efe gene from Pseudomonas syringae pv. glycinea were constructed. The target gene was respectively controlled by different promoters: cbh I promoter from Trichoderma reesei cellobiohydrolases I gene, gpd promoter from Aspergillus nidulans glyceraldehyde-3-phosphate dehydrogenase gene and pgk I promoter from T. reesei 3-phosphoglycerate kinase I gene. After transforming into T. reesei QM9414, 43 stable transformants were obtained by PCR amplification and ethylene determination. Southern blot analysis of 14 transformants demonstrated that the efe gene was integrated into chromosomal DNA with copy numbers from 1 to 4. Reverse transcription polymerase chain reaction (RT-PCR analysis of 6 transformants showed that the heterologous gene was transcribed. By using wheat straw as a carbon source, the ethylene production rates of aforementioned 14 transformants were measured. Transformant C30-3 with pgk I promoter had the highest ethylene production (4,012 nl h-1 l-1. This indicates that agricultural wastes could be used to produce ethylene in recombinant filamentous fungus T. reesei.

  13. Associations between polymorphisms of the gene and milk production traits in water buffaloes.

    Science.gov (United States)

    Deng, T X; Pang, C Y; Lu, X R; Zhu, P; Duan, A Q; Liang, X W

    2016-03-01

    Signal transducer and activator of transcription 1 () is an important regulator of mammary gland differentiation and cell survival that has been regarded as a candidate gene affecting milk production traits in mammals. Therefore, this study was conducted to evaluate significant associations between SNP of the gene and milk production traits in buffaloes. Here, 18 SNP were identified in the buffalo gene, including 15 intronic mutations and 3 exon mutations. All the identified SNP were then genotyped using matrix-assisted laser desorption/ionization time of flight mass spectrometry methods from 192 buffaloes. All the SNP were in Hardy-Weinberg equilibrium, and 2 haplotype blocks were successfully constructed based on these SNP data, which formed 5 and 3 major haplotypes in the population (>5%), respectively. The results of association analysis showed that only SNP13 located in exon 10 was significantly associated with the milk production traits in the population ( buffalo gene are associated with milk production traits and can be used as a candidate gene for marker-assisted selection in buffalo breeding. PMID:27065255

  14. Isolated fungal promoters and gene transcription terminators and methods of protein and chemical production in a fungus

    Energy Technology Data Exchange (ETDEWEB)

    Dai, Ziyu; Lasure, Linda L; Magnuson, Jon K

    2014-05-27

    The present invention encompasses isolated gene regulatory elements and gene transcription terminators that are differentially expressed in a native fungus exhibiting a first morphology relative to the native fungus exhibiting a second morphology. The invention also encompasses a method of utilizing a fungus for protein or chemical production. A transformed fungus is produced by transforming a fungus with a recombinant polynucleotide molecule. The recombinant polynucleotide molecule contains an isolated polynucleotide sequence linked operably to another molecule comprising a coding region of a gene of interest. The gene regulatory element and gene transcription terminator may temporally and spatially regulate expression of particular genes for optimum production of compounds of interest in a transgenic fungus.

  15. Isolated fungal promoters and gene transcription terminators and methods of protein and chemical production in a fungus

    Science.gov (United States)

    Dai, Ziyu; Lasure, Linda L.; Magnuson, Jon K.

    2008-11-11

    The present invention encompasses isolated gene regulatory elements and gene transcription terminators that are differentially expressed in a native fungus exhibiting a first morphology relative to the native fungus exhibiting a second morphology. The invention also encompasses a method of utilizing a fungus for protein or chemical production. A transformed fungus is produced by transforming a fungus with a recombinant polynucleotide molecule. The recombinant polynucleotide molecule contains an isolated polynucleotide sequence linked operably to another molecule comprising a coding region of a gene of interest. The gene regulatory element and gene transcription terminator may temporally and spatially regulate expression of particular genes for optimum production of compounds of interest in a transgenic fungus.

  16. A Gene Optimization Strategy that Enhances Production of Fully Functional P-Glycoprotein in Pichia pastoris

    OpenAIRE

    Bai, Jiangping; Swartz, Douglas J.; Protasevich, Irina I.; Brouillette, Christie G; Harrell, Patina M.; Hildebrandt, Ellen; Gasser, Brigitte; Mattanovich, Diethard; Ward, Andrew; Chang, Geoffrey; Urbatsch, Ina L.

    2011-01-01

    Background Structural and biochemical studies of mammalian membrane proteins remain hampered by inefficient production of pure protein. We explored codon optimization based on highly expressed Pichia pastoris genes to enhance co-translational folding and production of P-glycoprotein (Pgp), an ATP-dependent drug efflux pump involved in multidrug resistance of cancers. Methodology/Principal Findings Codon-optimized “Opti-Pgp” and wild-type Pgp, identical in primary protein sequence, were rigoro...

  17. Early Determination of Animals with Favorable Genes in Milk Production for Profitable Private Farms

    OpenAIRE

    DANIELA E. ILIE; Aurelia Sălăjeanu; Anuţa Magdin; Radu Neamţ; I. Vintila

    2010-01-01

    The primary goal of dairy industry has been to identify an efficient and economical way of increasing milk production and its constituents without increasing the size of the dairy herd. The use of milk protein polymorphisms as detectable molecular markers has been studied intensively because of their effect on the yield and processing properties of milk and its products. Thus, molecular markers are promising alternative to the current methods of trait selection once these genes are proven to ...

  18. Efficient production of multi-modified pigs for xenotransplantation by 'combineering', gene stacking and gene editing.

    Science.gov (United States)

    Fischer, Konrad; Kraner-Scheiber, Simone; Petersen, Björn; Rieblinger, Beate; Buermann, Anna; Flisikowska, Tatiana; Flisikowski, Krzysztof; Christan, Susanne; Edlinger, Marlene; Baars, Wiebke; Kurome, Mayuko; Zakhartchenko, Valeri; Kessler, Barbara; Plotzki, Elena; Szczerbal, Izabela; Switonski, Marek; Denner, Joachim; Wolf, Eckhard; Schwinzer, Reinhard; Niemann, Heiner; Kind, Alexander; Schnieke, Angelika

    2016-01-01

    Xenotransplantation from pigs could alleviate the shortage of human tissues and organs for transplantation. Means have been identified to overcome hyperacute rejection and acute vascular rejection mechanisms mounted by the recipient. The challenge is to combine multiple genetic modifications to enable normal animal breeding and meet the demand for transplants. We used two methods to colocate xenoprotective transgenes at one locus, sequential targeted transgene placement - 'gene stacking', and cointegration of multiple engineered large vectors - 'combineering', to generate pigs carrying modifications considered necessary to inhibit short to mid-term xenograft rejection. Pigs were generated by serial nuclear transfer and analysed at intermediate stages. Human complement inhibitors CD46, CD55 and CD59 were abundantly expressed in all tissues examined, human HO1 and human A20 were widely expressed. ZFN or CRISPR/Cas9 mediated homozygous GGTA1 and CMAH knockout abolished α-Gal and Neu5Gc epitopes. Cells from multi-transgenic piglets showed complete protection against human complement-mediated lysis, even before GGTA1 knockout. Blockade of endothelial activation reduced TNFα-induced E-selectin expression, IFNγ-induced MHC class-II upregulation and TNFα/cycloheximide caspase induction. Microbial analysis found no PERV-C, PCMV or 13 other infectious agents. These animals are a major advance towards clinical porcine xenotransplantation and demonstrate that livestock engineering has come of age. PMID:27353424

  19. Effects of medium composition on the production of plasmid DNA vector potentially for human gene therapy

    Institute of Scientific and Technical Information of China (English)

    XU Zhi-nan; SHEN Wen-he; CHEN Hao; CEN Pei-lin

    2005-01-01

    Plasmid vector is increasingly applied to gene therapy or gene vaccine. The production of plasmid pCMV-AP3 for cancer gene therapy was conducted in a modified MBL medium using a recombinant E. coli BL21 system. The effects of different MMBL components on plasmid yield, cell mass and specific plasmid DNA productivity were evaluated on shake-flask scale. The results showed that glucose was the optimal carbon source. High plasmid yield (58.3 mg/L) was obtained when 5.0 g/L glucose was added to MMBL. Glycerol could be chosen as a complementary carbon source because of the highest specific plasmid productivity (37.9 mg DNA/g DCW). After tests of different levels of nitrogen source and inorganic phosphate, a modified MMBL medium was formulated for optimal plasmid production. Further study showed that the initial acetate addition (less than 4.0 g/L) in MMBL improved plasmid production significantly, although it inhibited cell growth. The results will be useful for large-scale plasmid production using recombinant E. coli system.

  20. Nonlinear Biosynthetic Gene Cluster Dose Effect on Penicillin Production by Penicillium chrysogenum

    NARCIS (Netherlands)

    Nijland, Jeroen G.; Ebbendorf, Bjorg; Woszczynska, Marta; Boer, Remon; Bovenberg, Roel A. L.; Driessen, Arnold J. M.

    2010-01-01

    Industrial penicillin production levels by the filamentous fungus Penicillium chrysogenum increased dramatically by classical strain improvement. High-yielding strains contain multiple copies of the penicillin biosynthetic gene cluster that encodes three key enzymes of the beta-lactam biosynthetic p

  1. Overproduction and purification of the luxR gene product: transcriptional activator of the Vibrio fischeri luminescence system

    International Nuclear Information System (INIS)

    Expression of Vibrio fischeri luminescence genes requires an inducer, termed autoinducer, and a positive regulatory element, the luxR gene product. A plasmid containing luxR under control of a tac promoter was engineered to overproduce this gene product. The overproduced luxR gene product was active in vivo, and its apparent monomeric molecular weight was indistinguishable from that of the protein encoded by luxR under control of its own promoter (M/sub r/ 27,000). The new tac-luxR construct directed the synthesis of large quantities of the luxR gene product in induced Escherichia coli cells lacking other lux genes. In the presence of other lux genes, overexpression of the tac-luxR construct was not detected. The overproduced luxR gene product, which formed cytoplasmic inclusion bodies, was purified and used in subsequent studies. Nonequilibrium pH gradient electrophoresis indicated that the protein was basic, and the amino-terminal 15 amino acids were sequenced. DNA-binding activity was detected by membrane filter binding assays; under the conditions used, the binding was not lux DNA-specific. Binding of tritium-labeled autoinducer to the luxR gene product was not detected, and autoinducer enhancement of the binding of the luxR gene product to DNA could not be detected reproducibly

  2. Comprehensive identification of LMW-GS genes and their protein products in a common wheat variety.

    Science.gov (United States)

    Lee, Jong-Yeol; Beom, Hye-Rang; Altenbach, Susan B; Lim, Sun-Hyung; Kim, Yeong-Tae; Kang, Chon-Sik; Yoon, Ung-Han; Gupta, Ravi; Kim, Sun-Tae; Ahn, Sang-Nag; Kim, Young-Mi

    2016-05-01

    Although it is well known that low-molecular-weight glutenin subunits (LMW-GS) from wheat affect bread and noodle processing quality, the function of specific LMW-GS proteins remains unclear. It is important to find the genes that correspond to individual LMW-GS proteins in order to understand the functions of specific proteins. The objective of this study was to link LMW-GS genes and haplotypes characterized using well known Glu-A3, Glu-B3, and Glu-D3 gene-specific primers to their protein products in a single wheat variety. A total of 36 LMW-GS genes and pseudogenes were amplified from the Korean cultivar Keumkang. These include 11 Glu-3 gene haplotypes, two from the Glu-A3 locus, two from the Glu-B3 locus, and seven from the Glu-D3 locus. To establish relationships between gene haplotypes and their protein products, a glutenin protein fraction was separated by two-dimensional gel electrophoresis (2-DGE) and 17 protein spots were analyzed by N-terminal amino acid sequencing and tandem mass spectrometry (MS/MS). LMW-GS proteins were identified that corresponded to all Glu-3 gene haplotypes except the pseudogenes. This is the first report of the comprehensive characterization of LMW-GS genes and their corresponding proteins in a single wheat cultivar. Our approach will be useful to understand the contributions of individual LMW-GS to the end-use quality of flour. PMID:26882917

  3. Purification of a murine protein-tyrosine/threonine kinase that phosphorylates and activates the Erk-1 gene product: relationship to the fission yeast byr1 gene product.

    OpenAIRE

    Crews, C M; Erikson, R L

    1992-01-01

    We report the purification to near homogeneity of a 45-kDa phorbol ester-stimulated protein kinase that phosphorylates and activates the Erk-1 gene product. This kinase, which we provisionally denote MEK for MAPK/Erk kinase, phosphorylated kinase-inactive Erk-1 protein primarily on a tyrosine residue and, to a lesser extent, on a threonine. We extend our previous results and show that two forms of purified MEK activated the myelin basic protein kinase encoded by Erk-1. MEK was inactivated by ...

  4. Production of retrovirus vector for gene therapy; Idenshi chiryo no tameno retoro uirusu bekuta no seisan

    Energy Technology Data Exchange (ETDEWEB)

    Yamaji, H. [Kobe Univ., Kobe (Japan)

    2000-12-05

    At present, retrovirus vector is used widely in clinical field in gene transducing methods. While vector cell secretes retrovirus vector being impossible self-replication into culture solution, production of vector in long term is possible by reason of not dying by gemmation of virus. At present, production of retrovirus vector is executed by monostratal culture of vector producing cell in lab-scale. In another hand, the development of efficient mass-production technology is expected for needs of mass volume for one patient and enlargement for adaptation disease. (translated by NEDO)

  5. Phenazine Production in The Presence of Heavy Metals in Recombinant Erwinia herbicola Bearing the Hemoglobin Gene

    OpenAIRE

    KAHRAMAN, Hüseyin; Emel AYTAN; GİRAY KURT, Aslı; Duygu ÖZCAN

    2014-01-01

    In this study, from Vitreoscilla sp. recombinant strains were obtained from cloned bacterial hemoglobin (VHb) gene (vgb) Eh [pUC8:15] and its wild-type strain Erwinia herbicola phenazine production in the presence of heavy metals were investigated. Time-dependent production of phenazine in the wild bacteria not shows a significant change. In generally, at the end of 96 hours in the presence of Pb in terms of production of wild-type bacteria phenazine 2.91 μg/ml of recombinant bacteria is to ...

  6. Rhamnolipids in perspective: gene regulatory pathways, metabolic engineering, production and technological forecasting.

    Science.gov (United States)

    Dobler, Leticia; Vilela, Leonardo F; Almeida, Rodrigo V; Neves, Bianca C

    2016-01-25

    Rhamnolipids have emerged as a very promising class of biosurfactants in the last decades, exhibiting properties of great interest in several industrial applications, and have represented a suitable alternative to chemically-synthesized surfactants. This class of biosurfactants has been extensively studied in recent years, aiming at their large-scale production based on renewable resources, which still require high financial costs. Development of non-pathogenic, high-producing strains has been the focus of a number of studies involving heterologous microbial hosts as platforms. However, the intricate gene regulation network controlling rhamnolipid biosynthesis represents a challenge to metabolic engineering and remains to be further understood and explored. This article provides an overview of the biosynthetic pathways and the main gene regulatory factors involved in rhamnolipid production within Pseudomonas aeruginosa, the prototypal producing species. In addition, we provide a perspective view into the main strategies applied to metabolic engineering and biotechnological production. PMID:26409933

  7. Epstein-Barr virus immediate-early gene product trans-activates gene expression from the human immunodeficiency virus long terminal repeat

    International Nuclear Information System (INIS)

    Acquired immunodeficiency syndrome patients are frequently coinfected with Epstein-Barr virus (EBV). In this report, the authors demonstrate that an EBV immediate-early gene product, BamHI MLF1, stimulates expression of the bacterial chloramphenicol acetyltransferase (CAT) gene linked to the human immunodeficiency virus (HIV) promoter. The HIV promoter sequences necessary for trans-activation by EBV do not include the tat-responsive sequences. In addition, in contrast to the other herpesvirus trans-activators previously studied, the EBV BamHI MLF1 gene product appears to function in part by a posttranscriptional mechanism, since it increases pHIV-CAT protein activity more than it increases HIV-CAT mRNA. This ability of an EBV gene product to activate HIV gene expression may have biologic consequences in persons coinfected with both viruses

  8. Prevalence of Campylobacter species in milk and milk products, their virulence gene profile and antibiogram

    Directory of Open Access Journals (Sweden)

    Shivani Modi

    2015-01-01

    Full Text Available Aim: During the last decades, number of food poisoning cases due to Campylobacter occurred, immensely. After poultry, raw milk acts as a second main source of Campylobacter. Therefore, the present study was undertaken to detect the prevalence of Campylobacters in milk and milk products and to know the antibiotic sensitivity and virulence gene profile of Campylobacter spp. in Anand city, Gujarat, India. Materials and Methods: A total of 240 samples (85 buffalo milk, 65 cow milk, 30 cheese, 30 ice-cream and 30 paneer were collected from the different collection points in Anand city. The samples were processed by microbiological culture method, and presumptive isolates were further confirmed by genus and species-specific polymerase chain reaction using previously reported primer. The isolates were further subjected to antibiotic susceptibility assay and virulence gene detection. Result: Campylobacter species were detected in 7 (2.91% raw milk samples whereas none of the milk product was positive. All the isolate identified were Campylobacter jejuni. Most of the isolates showed resistance against nalidixic acid, ciprofloxacin, and tetracyclin. All the isolates have three virulence genes cadF, cdtB and flgR whereas only one isolate was positive for iamA gene and 6 isolates were positive for fla gene. Conclusion: The presence of Campylobacter in raw milk indicates that raw milk consumption is hazardous for human being and proper pasteurization of milk and adaptation of hygienic condition will be necessary to protect the consumer from this zoonotic pathogen.

  9. Production of 2-ketoisocaproate with Corynebacterium glutamicum strains devoid of plasmids and heterologous genes.

    Science.gov (United States)

    Vogt, Michael; Haas, Sabine; Polen, Tino; van Ooyen, Jan; Bott, Michael

    2015-03-01

    2-Ketoisocaproate (KIC), the last intermediate in l-leucine biosynthesis, has various medical and industrial applications. After deletion of the ilvE gene for transaminase B in l-leucine production strains of Corynebacterium glutamicum, KIC became the major product, however, the strains were auxotrophic for l-isoleucine. To avoid auxotrophy, reduction of IlvE activity by exchanging the ATG start codon of ilvE by GTG was tested instead of an ilvE deletion. The resulting strains were indeed able to grow in glucose minimal medium without amino acid supplementation, but at the cost of lowered growth rates and KIC production parameters. The best production performance was obtained with strain MV-KICF1, which carried besides the ilvE start codon exchange three copies of a gene for a feedback-resistant 2-isopropylmalate synthase, one copy of a gene for a feedback-resistant acetohydroxyacid synthase and deletions of ltbR and iolR encoding transcriptional regulators. In the presence of 1 mM l-isoleucine, MV-KICF1 accumulated 47 mM KIC (6.1 g l(-1)) with a yield of 0.20 mol/mol glucose and a volumetric productivity of 1.41 mmol KIC l(-1)  h(-1). Since MV-KICF1 is plasmid free and lacks heterologous genes, it is an interesting strain for industrial application and as platform for the production of KIC-derived compounds, such as 3-methyl-1-butanol. PMID:25488800

  10. Correlation of gene expression and protein production rate - a system wide study

    Directory of Open Access Journals (Sweden)

    Arvas Mikko

    2011-12-01

    Full Text Available Abstract Background Growth rate is a major determinant of intracellular function. However its effects can only be properly dissected with technically demanding chemostat cultivations in which it can be controlled. Recent work on Saccharomyces cerevisiae chemostat cultivations provided the first analysis on genome wide effects of growth rate. In this work we study the filamentous fungus Trichoderma reesei (Hypocrea jecorina that is an industrial protein production host known for its exceptional protein secretion capability. Interestingly, it exhibits a low growth rate protein production phenotype. Results We have used transcriptomics and proteomics to study the effect of growth rate and cell density on protein production in chemostat cultivations of T. reesei. Use of chemostat allowed control of growth rate and exact estimation of the extracellular specific protein production rate (SPPR. We find that major biosynthetic activities are all negatively correlated with SPPR. We also find that expression of many genes of secreted proteins and secondary metabolism, as well as various lineage specific, mostly unknown genes are positively correlated with SPPR. Finally, we enumerate possible regulators and regulatory mechanisms, arising from the data, for this response. Conclusions Based on these results it appears that in low growth rate protein production energy is very efficiently used primarly for protein production. Also, we propose that flux through early glycolysis or the TCA cycle is a more fundamental determining factor than growth rate for low growth rate protein production and we propose a novel eukaryotic response to this i.e. the lineage specific response (LSR.

  11. Comprehensive curation and analysis of fungal biosynthetic gene clusters of published natural products.

    Science.gov (United States)

    Li, Yong Fuga; Tsai, Kathleen J S; Harvey, Colin J B; Li, James Jian; Ary, Beatrice E; Berlew, Erin E; Boehman, Brenna L; Findley, David M; Friant, Alexandra G; Gardner, Christopher A; Gould, Michael P; Ha, Jae H; Lilley, Brenna K; McKinstry, Emily L; Nawal, Saadia; Parry, Robert C; Rothchild, Kristina W; Silbert, Samantha D; Tentilucci, Michael D; Thurston, Alana M; Wai, Rebecca B; Yoon, Yongjin; Aiyar, Raeka S; Medema, Marnix H; Hillenmeyer, Maureen E; Charkoudian, Louise K

    2016-04-01

    Microorganisms produce a wide range of natural products (NPs) with clinically and agriculturally relevant biological activities. In bacteria and fungi, genes encoding successive steps in a biosynthetic pathway tend to be clustered on the chromosome as biosynthetic gene clusters (BGCs). Historically, "activity-guided" approaches to NP discovery have focused on bioactivity screening of NPs produced by culturable microbes. In contrast, recent "genome mining" approaches first identify candidate BGCs, express these biosynthetic genes using synthetic biology methods, and finally test for the production of NPs. Fungal genome mining efforts and the exploration of novel sequence and NP space are limited, however, by the lack of a comprehensive catalog of BGCs encoding experimentally-validated products. In this study, we generated a comprehensive reference set of fungal NPs whose biosynthetic gene clusters are described in the published literature. To generate this dataset, we first identified NCBI records that included both a peer-reviewed article and an associated nucleotide record. We filtered these records by text and homology criteria to identify putative NP-related articles and BGCs. Next, we manually curated the resulting articles, chemical structures, and protein sequences. The resulting catalog contains 197 unique NP compounds covering several major classes of fungal NPs, including polyketides, non-ribosomal peptides, terpenoids, and alkaloids. The distribution of articles published per compound shows a bias toward the study of certain popular compounds, such as the aflatoxins. Phylogenetic analysis of biosynthetic genes suggests that much chemical and enzymatic diversity remains to be discovered in fungi. Our catalog was incorporated into the recently launched Minimum Information about Biosynthetic Gene cluster (MIBiG) repository to create the largest known set of fungal BGCs and associated NPs, a resource that we anticipate will guide future genome mining and

  12. Enhanced hydrogen production by insertional inactivation of adhE gene in Klebsiella oxytoca HP1

    Institute of Scientific and Technical Information of China (English)

    ZHU JunBo; LONG MinNan; XU FangCheng; WU XiaoBing; XU HuiJuan

    2007-01-01

    Ethanol is the main byproduct of anaerobic H2-producing fermentation in Klebsiella oxytoca HP1. Two moles of NAD(P)H are consumed to yield one mole of ethanol that may decrease bacterial hydrogen production. In this article the adhE gene that codes for acetaldehyde dehydrogenase was disrupted for the first time. A homologous recombination vector pTA-Str was constructed in which the adhE gene was disrupted by inserting an aminoglycoside-3'-adenyltransferase (aadA) gene. As expected, the vector includes the insertion 5'-adhE-aadA-adhE-3'. The amplified DNA fragment 5'-adhE-aadA-adhE-3' from pTA-Str was transformed into K. Oxytoca HP1 and one recombinant was obtained. PCR analysis of the resulting genomic DNA indicated the appropriate deletion and insertion. Compared with the H2-production of wild type K. Oxytoca HP1, the hydrogen yield of the mutant increased by 16.07% and ethanol concentration decreased by 77.47%, suggesting that inactivation of the adhE gene in K. Oxytoca HP1 is a potential method for enhancing bacterial H2-production.

  13. The SKP1-like gene family of Arabidopsis exhibits a high degree of differential gene expression and gene product interaction during development.

    Directory of Open Access Journals (Sweden)

    Mohammad H Dezfulian

    Full Text Available The Arabidopsis thaliana genome encodes several families of polypeptides that are known or predicted to participate in the formation of the SCF-class of E3-ubiquitin ligase complexes. One such gene family encodes the Skp1-like class of polypeptide subunits, where 21 genes have been identified and are known to be expressed in Arabidopsis. Phylogenetic analysis based on deduced polypeptide sequence organizes the family of ASK proteins into 7 clades. The complexity of the ASK gene family, together with the close structural similarity among its members raises the prospect of significant functional redundancy among select paralogs. We have assessed the potential for functional redundancy within the ASK gene family by analyzing an expanded set of criteria that define redundancy with higher resolution. The criteria used include quantitative expression of locus-specific transcripts using qRT-PCR, assessment of the sub-cellular localization of individual ASK:YFP auto-fluorescent fusion proteins expressed in vivo as well as the in planta assessment of individual ASK-F-Box protein interactions using bimolecular fluorescent complementation techniques in combination with confocal imagery in live cells. The results indicate significant functional divergence of steady state transcript abundance and protein-protein interaction specificity involving ASK proteins in a pattern that is poorly predicted by sequence-based phylogeny. The information emerging from this and related studies will prove important for defining the functional intersection of expression, localization and gene product interaction that better predicts the formation of discrete SCF complexes, as a prelude to investigating their molecular mode of action.

  14. PepPSy: a web server to prioritize gene products in experimental and biocuration workflows

    OpenAIRE

    Sallou, Olivier; Duek, Paula D.; Darde, Thomas A.; Collin, Olivier; Lane, Lydie; Chalmel, Frédéric

    2016-01-01

    Among the 20 000 human gene products predicted from genome annotation, about 3000 still lack validation at protein level. We developed PepPSy, a user-friendly gene expression-based prioritization system, to help investigators to determine in which human tissues they should look for an unseen protein. PepPSy can also be used by biocurators to revisit the annotation of specific categories of proteins based on the ‘omics’ data housed by the system. In this study, it was used to prioritize 21 dub...

  15. Identification of a splicing coactivator gene that affects the production of ochratoxin a in Aspergillus carbonarius

    Directory of Open Access Journals (Sweden)

    Lígia Uno Lunardi

    2009-11-01

    Full Text Available Ochratoxin A is a mycotoxin produced by some fungi species. Among them, Aspergillus carbonarius is considered a powerful producer. Genes involved in the ochratoxin A biosynthesis pathway have been identified in some producer species. However, there are few studies that purpose to identify these genes in A. carbonarius. The use of insertion mutants to identify genes associated with certain properties has been increased in the literature. In this work, the region of T-DNA integration was investigated in one A. carbonarius ochratoxin-defective mutant previously obtained by Agrobacterium tumefaciens-mediated transformation, in order to find an association between interrupted gene and the biosynthesis of ochratoxin A. The integration occurred in a gene that possibly encodes a splicing coactivator protein. The analysis of the relative expression of the splicing coativator gene from A. carbonarius wild type strain in four different media showed high correlation between the transcript levels and the ochratoxin A production.A ocratoxina A é uma micotoxina frequentemente encontrada em uma grande variedade de produtos alimentares e apresenta efeitos nefrotóxicos e potencial carcinogênico para animais e humanos. É naturalmente produzida por algumas espécies fúngicas, como Aspergillus carbonarius, que é considerado um potente produtor. Apesar disso, o número de estudos que visam identificar genes que são essenciais para a biossíntese de ocratoxina em A. carbonarius é ainda reduzido. Um mutante de A. carbonarius com baixa produção de ocratoxina A previamente obtido por transformação mediada por Agrobacterium tumefaciens foi investigado com o objetivo de encontrar uma associação entre o gene interrompido e a biossíntese desta micotoxina. Os resultados mostraram a ocorrência de uma junção não exata entre o T-DNA e o DNA genômico do fungo durante o evento de integração. A integração do T-DNA no genoma do mutante T188 provocou dele

  16. Yeast homologous recombination-based promoter engineering for the activation of silent natural product biosynthetic gene clusters.

    Science.gov (United States)

    Montiel, Daniel; Kang, Hahk-Soo; Chang, Fang-Yuan; Charlop-Powers, Zachary; Brady, Sean F

    2015-07-21

    Large-scale sequencing of prokaryotic (meta)genomic DNA suggests that most bacterial natural product gene clusters are not expressed under common laboratory culture conditions. Silent gene clusters represent a promising resource for natural product discovery and the development of a new generation of therapeutics. Unfortunately, the characterization of molecules encoded by these clusters is hampered owing to our inability to express these gene clusters in the laboratory. To address this bottleneck, we have developed a promoter-engineering platform to transcriptionally activate silent gene clusters in a model heterologous host. Our approach uses yeast homologous recombination, an auxotrophy complementation-based yeast selection system and sequence orthogonal promoter cassettes to exchange all native promoters in silent gene clusters with constitutively active promoters. As part of this platform, we constructed and validated a set of bidirectional promoter cassettes consisting of orthogonal promoter sequences, Streptomyces ribosome binding sites, and yeast selectable marker genes. Using these tools we demonstrate the ability to simultaneously insert multiple promoter cassettes into a gene cluster, thereby expediting the reengineering process. We apply this method to model active and silent gene clusters (rebeccamycin and tetarimycin) and to the silent, cryptic pseudogene-containing, environmental DNA-derived Lzr gene cluster. Complete promoter refactoring and targeted gene exchange in this "dead" cluster led to the discovery of potent indolotryptoline antiproliferative agents, lazarimides A and B. This potentially scalable and cost-effective promoter reengineering platform should streamline the discovery of natural products from silent natural product biosynthetic gene clusters. PMID:26150486

  17. Improvement of heterologous protein production in Aspergillus oryzae by RNA interference with alpha-amylase genes.

    Science.gov (United States)

    Nemoto, Takashi; Maruyama, Jun-ichi; Kitamoto, Katsuhiko

    2009-11-01

    Aspergillus oryzae RIB40 has three alpha-amylase genes (amyA, amyB, and amyC), and secretes alpha-amylase abundantly. However, large amounts of endogenous secretory proteins such as alpha-amylase can compete with heterologous protein in the secretory pathway and decrease its production yields. In this study, we examined the effects of suppression of alpha-amylase on heterologous protein production in A. oryzae, using the bovine chymosin (CHY) as a reporter heterologous protein. The three alpha-amylase genes in A. oryzae have nearly identical DNA sequences from those promoters to the coding regions. Hence we performed silencing of alpha-amylase genes by RNA interference (RNAi) in the A. oryzae CHY producing strain. The silenced strains exhibited a reduction in alpha-amylase activity and an increase in CHY production in the culture medium. This result suggests that suppression of alpha-amylase is effective in heterologous protein production in A. oryzae. PMID:19897917

  18. Improving heterologous polyketide production in Escherichia coli by overexpression of an S-adenosylmethionine synthetase gene.

    Science.gov (United States)

    Wang, Yong; Boghigian, Brett A; Pfeifer, Blaine A

    2007-11-01

    An S-adenosylmethionine synthetase gene (metK) from Streptomyces spectabilis was cloned into an expression plasmid under the control of an inducible T7 promoter and introduced into a strain of Escherichia coli (BAP1(pBP130/pBP144)) capable of producing the polyketide product 6-deoxyerythronolide B (6-dEB). The metK coexpression in BAP1(pBP130/pBP144) improved the specific production of 6-dEB from 10.86 to 20.08 mg l(-1) OD(600)(-1). In an effort to probe the reason for this improvement, a series of gene deletion and expression experiments were conducted based on a metK metabolic pathway that branches between propionyl-CoA (a 6-dEB precursor) and autoinducer compounds. The deletion and expression studies suggested that the autoinducer pathway had a larger impact on improved 6-dEB biosynthesis. Supporting these results were experiments demonstrating the positive effect conditioned media (the suspected location of the autoinducer compounds) had on 6-dEB production. Taken together, the results of this study show an increase in heterologous 6-dEB production concomitant with heterologous metK gene expression and suggest that the mechanism for this improvement is linked to native autoinducer compounds. PMID:17876579

  19. PepPSy: a web server to prioritize gene products in experimental and biocuration workflows.

    Science.gov (United States)

    Sallou, Olivier; Duek, Paula D; Darde, Thomas A; Collin, Olivier; Lane, Lydie; Chalmel, Frédéric

    2016-01-01

    Among the 20 000 human gene products predicted from genome annotation, about 3000 still lack validation at protein level. We developed PepPSy, a user-friendly gene expression-based prioritization system, to help investigators to determine in which human tissues they should look for an unseen protein. PepPSy can also be used by biocurators to revisit the annotation of specific categories of proteins based on the 'omics' data housed by the system. In this study, it was used to prioritize 21 dubious protein-coding genes among the 616 annotated in neXtProt for reannotation. PepPSy is freely available at http://peppsy.genouest.orgDatabase URL: http://peppsy.genouest.org. PMID:27173522

  20. Genome Wide Association Analysis Reveals New Production Trait Genes in a Male Duroc Population.

    Directory of Open Access Journals (Sweden)

    Kejun Wang

    Full Text Available In this study, 796 male Duroc pigs were used to identify genomic regions controlling growth traits. Three production traits were studied: food conversion ratio, days to 100 KG, and average daily gain, using a panel of 39,436 single nucleotide polymorphisms. In total, we detected 11 genome-wide and 162 chromosome-wide single nucleotide polymorphism trait associations. The Gene ontology analysis identified 14 candidate genes close to significant single nucleotide polymorphisms, with growth-related functions: six for days to 100 KG (WT1, FBXO3, DOCK7, PPP3CA, AGPAT9, and NKX6-1, seven for food conversion ratio (MAP2, TBX15, IVL, ARL15, CPS1, VWC2L, and VAV3, and one for average daily gain (COL27A1. Gene ontology analysis indicated that most of the candidate genes are involved in muscle, fat, bone or nervous system development, nutrient absorption, and metabolism, which are all either directly or indirectly related to growth traits in pigs. Additionally, we found four haplotype blocks composed of suggestive single nucleotide polymorphisms located in the growth trait-related quantitative trait loci and further narrowed down the ranges, the largest of which decreased by ~60 Mb. Hence, our results could be used to improve pig production traits by increasing the frequency of favorable alleles via artificial selection.

  1. Expression and Localization of TRK-Fused Gene Products in the Rat Brain and Retina

    International Nuclear Information System (INIS)

    The TRK-fused gene (TFG in human, Tfg in rat) was originally identified in human papillary thyroid cancer as a chimeric form of the NTRK1 gene. It has been reported that the gene product (TFG) plays a role in regulating phosphotyrosine-specific phosphatase-1 activity. However, no information regarding the localization of Tfg in rat tissues is available. In this study, we investigated the expression of Tfg mRNA in normal rat tissues using reverse transcription-polymerase chain reaction (RT-PCR). We also produced an antibody against Tfg gene products and examined the localization of TFG in the rat brain and retina. The RT-PCR experiments demonstrated that two types of Tfg mRNA were expressed in rat tissues: the conventional form of Tfg (cTfg) and a novel variant form, retinal Tfg (rTfg). RT-PCR analyses demonstrated that cTfg was ubiquitously expressed in rat tissues, while rTfg was predominantly expressed in the brain and retina. Western blot analysis demonstrated two bands with molecular weights of about 30 kDa and 50 kDa in the rat brain. Immunohistochemistry indicated that TFG proteins were predominantly expressed by neurons in the brain. In the rat retina, intense TFG-immunoreactivity was detected in the layer of rods and cones and the outer plexiform layer

  2. Adhesion plaques of Rous sarcoma virus-transformed cells contain the src gene product.

    OpenAIRE

    Rohrschneider, L R

    1980-01-01

    Another intracellular location of the Rous sarcoma virus (RSU) src gene product (pp60src) has been detected within RSV-transformed cells by indirect immunofluorescence. By using rabbit anti-tumor serum specific for pp60src, a speckled pattern of fluorescence was found on the ventral surface of RSV (Schmidt-Ruppin strain)-transformed normal rat kidney cells. Several tests indicated that this pattern was specific for pp60src. In addition, interference-reflection microscopy was used to visualize...

  3. Prevalence of Campylobacter species in milk and milk products, their virulence gene profile and antibiogram

    OpenAIRE

    Shivani Modi; M. N. Brahmbhatt; Y. A. Chatur; J. B. Nayak

    2015-01-01

    Aim: During the last decades, number of food poisoning cases due to Campylobacter occurred, immensely. After poultry, raw milk acts as a second main source of Campylobacter. Therefore, the present study was undertaken to detect the prevalence of Campylobacters in milk and milk products and to know the antibiotic sensitivity and virulence gene profile of Campylobacter spp. in Anand city, Gujarat, India. Materials and Methods: A total of 240 samples (85 buffalo milk, 65 cow milk, 30 cheese, ...

  4. Transient gene expression for rapid protein production: studies & optimizations under serum-free conditions

    OpenAIRE

    Muller, Natalie; Wurm, Florian

    2007-01-01

    Recombinant proteins are important for biomedical research and for the treatment of human disease. Therefore it is necessary to develop reproducible bioprocesses to rapidly produce proteins of adequate quality and quantity. Expression in mammalian cells is preferred if the proteins are to be properly folded and post-translationally modified. For the rapid production of milligram to gram quantities of a protein in mammalian cells, large-scale transient gene expression is an attractive option. ...

  5. Production of human glucocerebrosidase in mice after retroviral gene transfer into multipotential hematopoietic progenitor cells.

    OpenAIRE

    Correll, P H; Fink, J K; Brady, R O; Perry, L K; S. Karlsson

    1989-01-01

    The human glucocerebrosidase (GC) gene has been transferred efficiently into spleen colony-forming unit (CFU-S) multipotential hematopoietic progenitor cells, and production of human GC RNA and protein has been achieved in transduced CFU-S colonies. High-titer retroviral vectors containing the human GC cDNA were constructed. Mouse bone marrow cells were stimulated with hematopoietic growth factors, infected by coculture with producer cells, and injected into lethally irradiated animals. Four ...

  6. Genetic resources for methane production from biomass described with gene ontology

    Directory of Open Access Journals (Sweden)

    Endang ePurwantini

    2014-12-01

    Full Text Available Methane (CH4 is a valuable fuel, constituting 70-95% of natural gas, and a potent greenhouse gas. Release of CH4 into the atmosphere contributes to climate change. Biological CH4 production or methanogenesis is mostly performed by methanogens, a group of strictly anaerobic archaea. The direct substrates for methanogenesis are H2 plus CO2, acetate, formate, methylamines, methanol, methyl sulfides, and ethanol or a secondary alcohol plus CO2. In numerous anaerobic niches in nature, methanogenesis facilitates mineralization of complex biopolymers such as carbohydrates, lipids and proteins generated by primary producers. Thus, methanogens are critical players in the global carbon cycle. The same process is used in anaerobic treatment of municipal, industrial and agricultural wastes, reducing the biological pollutants in the wastes and generating methane. It also holds potential for commercial production of natural gas from renewable resources. This process operates in digestive systems of many animals, including cattle, and humans. In contrast, in deep-sea hydrothermal vents methanogenesis is a primary production process, allowing chemosynthesis of biomaterials from H2 plus CO2. In this report we present Gene Ontology (GO terms that can be used to describe processes, functions and cellular components involved in methanogenic biodegradation and biosynthesis of specialized coenzymes that methanogens use. Some of these GO terms were previously available and the rest were generated in our Microbial Energy Gene Ontology (MENGO project. A recently discovered non-canonical CH4 production process is also described. We have performed manual GO annotation of selected methanogenesis genes, based on experimental evidence, providing gold standards for machine annotation and automated discovery of methanogenesis genes or systems in diverse genomes. Most of the GO-related information presented in this report is available at the MENGO website (http://www.mengo.biochem.vt.edu/.

  7. Automated type specific ELISA probe detection of amplified NS3 gene products of dengue viruses.

    OpenAIRE

    Chow, V T; Yong, R Y; Ngoh, B L; Chan, Y. C.

    1997-01-01

    AIM: To apply an automated system of nucleic acid hybridisation coupled with the enzyme linked immunosorbent assay (ELISA) for the type specific detection of amplification products of dengue viruses. METHODS: Non-structural 3 (NS3) gene targets of reference strains of all four dengue and other flaviviruses, as well as dengue patient viraemic sera, were subjected to reverse transcription and polymerase chain reaction using consensus and dengue type specific primers and digoxigenin-11-dUTP labe...

  8. Genetic resources for methane production from biomass described with the Gene Ontology.

    Science.gov (United States)

    Purwantini, Endang; Torto-Alalibo, Trudy; Lomax, Jane; Setubal, João C; Tyler, Brett M; Mukhopadhyay, Biswarup

    2014-01-01

    Methane (CH4) is a valuable fuel, constituting 70-95% of natural gas, and a potent greenhouse gas. Release of CH4 into the atmosphere contributes to climate change. Biological CH4 production or methanogenesis is mostly performed by methanogens, a group of strictly anaerobic archaea. The direct substrates for methanogenesis are H2 plus CO2, acetate, formate, methylamines, methanol, methyl sulfides, and ethanol or a secondary alcohol plus CO2. In numerous anaerobic niches in nature, methanogenesis facilitates mineralization of complex biopolymers such as carbohydrates, lipids and proteins generated by primary producers. Thus, methanogens are critical players in the global carbon cycle. The same process is used in anaerobic treatment of municipal, industrial and agricultural wastes, reducing the biological pollutants in the wastes and generating methane. It also holds potential for commercial production of natural gas from renewable resources. This process operates in digestive systems of many animals, including cattle, and humans. In contrast, in deep-sea hydrothermal vents methanogenesis is a primary production process, allowing chemosynthesis of biomaterials from H2 plus CO2. In this report we present Gene Ontology (GO) terms that can be used to describe processes, functions and cellular components involved in methanogenic biodegradation and biosynthesis of specialized coenzymes that methanogens use. Some of these GO terms were previously available and the rest were generated in our Microbial Energy Gene Ontology (MENGO) project. A recently discovered non-canonical CH4 production process is also described. We have performed manual GO annotation of selected methanogenesis genes, based on experimental evidence, providing "gold standards" for machine annotation and automated discovery of methanogenesis genes or systems in diverse genomes. Most of the GO-related information presented in this report is available at the MENGO website (http

  9. Recombinant Streptomyces clavuligerus strain including cas2 gene production and analysis its antibiotic overproduction by bioassay

    Directory of Open Access Journals (Sweden)

    Zohreh Hojati

    2014-03-01

    Full Text Available Background: Streptomyces clavuligerus is one of the most important strain that produce clavulanic acid that wildly used in combination of strong but sensitive to β-lactamase antibiotics in clinics. The cas2 is one of the important genes in the biosynthesis pathway of clavulanic acid. Materials and Methods: The recombinant construct pMTcas2 which contain cas2 gene is obtained from Isfahan University. Recombinant plasmid extracts from streptomyces lividans and confirm by enzyme digestion. The streptomyces clavuligerus protoplast was prepared and transformation was done by using polyethylene glycol. Transformation was confirmed by plasmid extraction and PCR using cas2 specific primers. Finally, bioassay method was used to survey the effect of extra copy of cas2 on clavulanic acid production. Result: Plasmid extraction was initially carried out and the structure of plasmid was confirmed by digestion. The typical white colony was seen on protoplast recovery culture containing thiostrepton antibiotic and gray spores were detected after one week. Plasmid extraction was done from transformed strain and transformation was confirmed by PCR. The results of the bioassay show that amplification of the cas2 gene in multicopy plasmids resulted in a 4.1 fold increase in clavulanic acid production. Conclusion: The bioassay was done and the diameters of zone of inhibition in control and sample were compared. The results of the bioassay show that amplification of the cas2 gene in multicopy plasmids resulted in a 4.1 fold increase in clavulanic acid production. Overproduction of clavulanic acid decreases the cost of its dependent drug production.

  10. Steroid receptor RNA activator (SRA1): unusual bifaceted gene products with suspected relevance to breast cancer

    OpenAIRE

    Leygue, Etienne

    2007-01-01

    The steroid receptor RNA activator (SRA) is a unique modulator of steroid receptor transcriptional activity, as it is able to mediate its coregulatory effects as a RNA molecule. Recent findings, however, have painted a more complex picture of the SRA gene (SRA1) products. Indeed, even though SRA was initially thought to be noncoding, several RNA isoforms have now been found to encode an endogenous protein (SRAP), which is well conserved among Chordata. Although the function of SRAP remains la...

  11. Production of transgenic mice by random recombination of targeted genes in female germline stem cells

    Institute of Scientific and Technical Information of China (English)

    Yong Zhang; Ji Xiong; Jie Xiang; Ji Wu; Zhaojuan Yang; Yunze Yang; Shuzeng Wang; Lingjun Shi; Wenhai Xie; Kejing Sun; Kang Zou; Lei Wang

    2011-01-01

    Oocyte production in most mammalian species is believed to cease before birth. However, this idea has been challenged with the finding that postnatal mouse ovaries possess mitotically active germ cells. A recent study showed that female germline stem cells (FGSCs) from adult mice were isolated, cultured long term and produced oocytes and progeny after transplantation into infertile mice. Here, we demonstrate the successful generation of transgenic or gene knock-down mice using FGSCs. The FGSCs from ovaries of 5-day-old and adult mice were isolated and either infected with recombinant viruses carrying green fluorescent protein, Oocyte-G1 or the mouse dynein axonemal intermediate chain 2 gene, or transfected with the Oocyte-G1 specific shRNA expression vector (pRS shOocyte-G1 vector), and then transplanted into infertile mice. Transplanted cells in the ovaries underwent oogenesis and produced heterozygous offspring after mating with wild-type male mice. The offspring were genetically characterized and the biological functions of the transferred or knock-down genes were investigated. Efficiency of genetransfer or gene knock-down was 29%-37% and it took 2 months to produce transgenic offspring. Gene manipulation of FGSCs is a rapid and efficient method of animal transgenesis and may serve as a powerful tool for biomedical science and biotechnology.

  12. Products of the iron-molybdenum cofactor-specific biosynthetic genes, nifE and nifN, are structurally homologous to the products of the nitrogenase molybdenum-iron protein genes, nifD and nifK.

    OpenAIRE

    Brigle, K E; Weiss, M C; Newton, W E; Dean, D R

    1987-01-01

    The genes from Azotobacter vinelandii, which are homologous to the iron-molybdenum cofactor biosynthetic genes, nifE and nifN, from Klebsiella pneumoniae, have been cloned and sequenced. These genes comprise a single transcription unit and are located immediately downstream from the nitrogenase structural gene cluster (nifHDK). DNA sequence analysis has revealed that the products of the nifE and nifN genes contain considerable homology when compared with the nifD (MoFe protein alpha subunit) ...

  13. Excision of foreign gene product with cathepsin D in chicken hepatoma cell line

    International Nuclear Information System (INIS)

    To easily and rapidly recover exogenous gene products from chicken egg yolk, we constructed pVTG-catD (VTG, vitellogenin; catD, cathepsin D), a vector cassette carrying two catD-recognition signal peptides (catD-RSPs) in addition to the cloning site. An enhanced green fluorescence protein (EGFP)-encoding DNA fragment was ligated into the pVTG-catD. When the resultant construct pVTG-EGFP-catD containing histidine- and myc-tags was transfected into the chicken hepatoma cell line LMH, EGFP-expression at 24 h post-cultivation was confirmed by fluorescence microscopy. Because a signal peptide (NTVLAEF) encoded in pVTG-EGFP-catD is recognized by catD, the VTG-EGFP fusion protein digested with catD was detectable by Western blotting. Digested exogenous gene product was recovered with nickel resin. These results indicate that catD-recognition sites bearing pVTG-catD and His-tags are functional in chicken LMH cells. Therefore, the system described here may be of use in making excision exogenous gene products in the chicken and in creating homozygous knock-in chickens

  14. Tetracycline residues and tetracycline resistance genes in groundwater impacted by swine production facilities

    Science.gov (United States)

    Mackie, R.I.; Koike, S.; Krapac, I.; Chee-Sanford, J.; Maxwell, Susan; Aminov, R.I.

    2006-01-01

    Antibiotics are used at therapeutic levels to treat disease; at slightly lower levels as prophylactics; and at low, subtherapeutic levels for growth promotion and improvement of feed efficiency. Over 88% of swine producers in the United States gave antimicrobials to grower/finisher pigs in feed as a growth promoter in 2000. It is estimated that ca. 75% of antibiotics are not absorbed by animals and are excreted in urine and feces. The extensive use of antibiotics in swine production has resulted in antibiotic resistance in many intestinal bacteria, which are also excreted in swine feces, resulting in dissemination of resistance genes into the environment.To assess the impact of manure management on groundwater quality, groundwater samples have been collected near two swine confinement facilities that use lagoons for manure storage and treatment. Several key contaminant indicators-including inorganic ions, antibiotics, and antibiotic resistance genes-were analyzed in groundwater collected from the monitoring wells. Chloride, ammonium, potassium, and sodium were predominant inorganic constituents in the manure samples and served as indicators of groundwater contamination. Based on these analyses, shallow groundwater has been impacted by lagoon seepage at both sites. Liquid chromatography-mass spectroscopy (LC-MS) was used to measure the dissolved concentrations of tetracycline, chlortetracycline, and oxytetracycline in groundwater and manure. Although tetracyclines were regularly used at both facilities, they were infrequently detected in manure samples and then at relatively trace concentrations. Concentrations of all tetracyclines and their breakdown products in the groundwater sampled were generally less than 0.5 ??g/L.Bacterial tetracycline resistance genes served as distinct genotypic markers to indicate the dissemination and mobility of antibiotic resistance genes that originated from the lagoons. Applying PCR to genomic DNA extracted from the lagoon and

  15. nusB: a protein factor necessary for transcription antitermination in vitro by phage lambda N gene product.

    OpenAIRE

    Ghosh, B.; Das, A.

    1984-01-01

    We demonstrate that the protein product of the Escherichia coli nusB gene is essential for transcription antitermination in vitro by phage lambda N gene product. We recently have described a convenient biochemical assay for N protein activity in the S30-coupled transcription translation system and demonstrated that N action requires the 69-kDa L factor (nusA), the product of E. coli nusA gene. Using a complementation assay for the restoration of N activity specifically in the nusB mutant extr...

  16. A gene from Renibacterium salmoninarum encoding a product which shows homology to bacterial zinc-metalloproteases.

    Science.gov (United States)

    Grayson, T H; Evenden, A J; Gilpin, M L; Martin, K L; Munn, C B

    1995-06-01

    A genomic library constructed from Renibacterium salmoninarum isolate MT444 DNA in the plasmid vector pBR328 was screened using Escherichia coli host strain DH1 for the expression of genes encoding putative virulence factors. A single haemolytic clone was isolated at 22 degrees C and found to contain a 3.1 kb HindIII fragment of inserted DNA. This fragment was present in seven isolates of R. salmoninarum which were examined. Western blots of extracts from clones exhibiting haemolytic activity were performed with antisera raised against either cellular or extracellular components of R. salmoninarum and failed to identify any additional proteins compared to control E. coli containing pBR328. However, minicell analysis revealed that a polypeptide with an apparent molecular mass of 65 kDa was associated with a haemolytic activity distinct from that previously described for R. salmoninarum. The nucleotide sequence of the gene encoding this product was determined and the amino acid sequence deduced. The product was 548 amino acids with a predicted molecular mass of 66757 Da and a pl of 5.57. The deduced amino acid sequence of the gene possessed strong similarities to those of a range of secreted bacterial zinc-metalloproteases and was tentatively designed hly. Neither protease nor lecithinase activities were detectable in E. coli recombinants expressing gene hly. Haemolytic activity was observed from 6 degrees C to 37 degrees C for erythrocytes from a number of mammalian species and also from fish. Gene hly was expressed in E. coli as a fusion protein consisting of maltose-binding protein at the N-terminus linked to all but the first 24 amino acids, largely constituting the putative signal peptide, of the N-terminus of Hly. The soluble fusion protein was produced and purified by affinity chromatography. Antiserum raised against the purified fusion protein was used to probe Western blots of cell lysates and extracellular products from seven isolates of R. salmoninarum

  17. Modulation of gene transcription by natural products--a viable anticancer strategy.

    Science.gov (United States)

    D'Incalci, M; Brunelli, D; Marangon, E; Simone, M; Tavecchio, M; Gescher, A; Mantovani, R

    2007-01-01

    Drug design based on the structure of specific enzymes playing a role in carcinogenesis, e.g. tyrosine kinases, has been successful at identifying novel effective anticancer drugs. In contrast, no success has been achieved in drug design attempts, in which transcription factors or DNA-transcription factor complexes involved in the pathogenesis of human neoplasms were targeted. This failure is likely to be due to the fact that the mechanism of transcription regulation is probably too complex and still too inadequately understood to be a suitable target for drug design. It seems plausible that the high selectivity of some human tumors to some DNA-interactive anticancer drugs, e.g. cisplatin, is related to an effect on the transcription of genes that are crucial for those tumors. In this article we propose that some natural products have evolutionarily evolved to exert highly specialized functions, including modulation of the transcriptional regulation of specific genes. We discuss in detail the marine natural product Yondelis (Trabectedin, ET-743) that is effective against some soft tissue sarcoma, possibly because it interferes with the aberrant transcription mechanism in these tumors. In addition we highlight the existing evidence that many different natural products are effective inhibitors of NF-kB, a transcription factor that plays a crucial role in inflammation and cancer, indicating that some of these compounds might possess antitumor properties. We propose that large-scale characterization of natural products acting as potential modulators of gene transcription is a realistic and attractive approach to discover compounds therapeutically effective against neoplastic diseases characterized by specific aberrations of transcriptional regulation. PMID:17897020

  18. Lessons in Détente or know thy host: The immunomodulatory gene products of myxoma virus

    Indian Academy of Sciences (India)

    Martha C Zúñiga

    2003-04-01

    The poxvirus, myxoma virus, encodes within its genome at least eleven different proteins that compromise, skew, or disable the innate and adaptive responses of its hosts. In the laboratory rabbit, Oryctolagus cuniculus, these effects result in myxomatosis, a fatal condition characterized by skin lesions and systemic immunosuppression. Interestingly, while myxoma infection also causes skin lesions in its natural host and in natural populations of O. cuniculus in Australia where this novel host and the virus have co-evolved, the condition of myxomatosis does not ensue and infection is not fatal. In this review I discuss the biochemical properties of the characterized immunomodulatory proteins of myxoma virus, and their pathogenic effects in laboratory rabbits. Disruption of any one myxoma immunomodulatory gene diminishes the severity of the infection without compromising infectivity. Thus, the characterized immunomodulatory genes appear not to be required for a productive infection in vivo. The differences in the severity of their effects in laboratory-bred versus wild O. cuniculus suggest that the outcome of myxoma infection is a consequence of the interplay between the viral immunomodulatory gene products and the cells and molecules of the host immune system.

  19. Phytoalexin detoxification genes and gene products: Implication for the evolution of host specific traits for pathogenicity. Final report

    Energy Technology Data Exchange (ETDEWEB)

    VanEtten, H.

    1997-06-01

    The overall objectives of this research were to determine which differences among PDA genes were associated with different levels of virulence on pea and to clone and characterize a MAK gene. The authors also proposed to characterize the pisatin detoxifying system in pea pathogens in addition to N. haematococca to assess whether pathogens of a common host had evolved similar pathogenicity genes.

  20. Phytoalexin detoxification genes and gene products: Implication for the evolution of host specific traits for pathogenicity. Final report

    International Nuclear Information System (INIS)

    The overall objectives of this research were to determine which differences among PDA genes were associated with different levels of virulence on pea and to clone and characterize a MAK gene. The authors also proposed to characterize the pisatin detoxifying system in pea pathogens in addition to N. haematococca to assess whether pathogens of a common host had evolved similar pathogenicity genes

  1. Relationship between fumonisin production and FUM gene expression in Fusarium verticillioides under different environmental conditions.

    Science.gov (United States)

    Fanelli, Francesca; Iversen, Anita; Logrieco, Antonio F; Mulè, Giuseppina

    2013-01-01

    Fusarium verticillioides is the main source of fumonisins, a group of mycotoxins that can contaminate maize-based food and feed and cause diseases in humans and animals. The study of the effect of different environmental conditions on toxin production should provide information that can be used to develop strategies to minimize the risk. This study analysed the effect of temperature (15°C-35°C), water activity (a(w): 0.999-0.93), salinity (0-125 g l(-1) NaCl) and pH (5-8) on the growth and production of fumonisins B(1) (FB1), B(2) (FB2) and B(3) (FB3) and the expression of FUM1 and FUM21 in F. verticillioides. The highest growth rate was measured at 25°C, a(w) of 0.998-0.99 and 0-25 g l(-1) of NaCl. Optimal conditions for fumonisin production were 30°C, a(w) of 0.99, 25 g l(-1) of NaCl and pH 5; nevertheless, the strain showed a good adaptability and was able to produce moderate levels of fumonisins under a wide range of conditions. Gene expression mirrored fumonisin production profile under all conditions with the exception of temperature: FUM1 and FUM21 expression was highest at 15°C, while maximum fumonisin production was at 30°C. These data indicate that a post-transcriptional regulation mechanism could account for the different optimal temperatures for FUM gene expression and fumonisin production. PMID:23167929

  2. Combining mouse mammary gland gene expression and comparative mapping for the identification of candidate genes for QTL of milk production traits in cattle

    Directory of Open Access Journals (Sweden)

    Shani Moshe

    2007-06-01

    Full Text Available Abstract Background Many studies have found segregating quantitative trait loci (QTL for milk production traits in different dairy cattle populations. However, even for relatively large effects with a saturated marker map the confidence interval for QTL location by linkage analysis spans tens of map units, or hundreds of genes. Combining mapping and arraying has been suggested as an approach to identify candidate genes. Thus, gene expression analysis in the mammary gland of genes positioned in the confidence interval of the QTL can bridge the gap between fine mapping and quantitative trait nucleotide (QTN determination. Results We hybridized Affymetrix microarray (MG-U74v2, containing 12,488 murine probes, with RNA derived from mammary gland of virgin, pregnant, lactating and involuting C57BL/6J mice in a total of nine biological replicates. We combined microarray data from two additional studies that used the same design in mice with a total of 75 biological replicates. The same filtering and normalization was applied to each microarray data using GeneSpring software. Analysis of variance identified 249 differentially expressed probe sets common to the three experiments along the four developmental stages of puberty, pregnancy, lactation and involution. 212 genes were assigned to their bovine map positions through comparative mapping, and thus form a list of candidate genes for previously identified QTLs for milk production traits. A total of 82 of the genes showed mammary gland-specific expression with at least 3-fold expression over the median representing all tissues tested in GeneAtlas. Conclusion This work presents a web tool for candidate genes for QTL (cgQTL that allows navigation between the map of bovine milk production QTL, potential candidate genes and their level of expression in mammary gland arrays and in GeneAtlas. Three out of four confirmed genes that affect QTL in livestock (ABCG2, DGAT1, GDF8, IGF2 were over expressed in the

  3. Expressing the sweet potato orange gene in transgenic potato improves drought tolerance and marketable tuber production.

    Science.gov (United States)

    Cho, Kwang-Soo; Han, Eun-Heui; Kwak, Sang-Soo; Cho, Ji-Hong; Im, Ju-Seong; Hong, Su-Young; Sohn, Hwang-Bae; Kim, Yun-Hee; Lee, Shin-Woo

    2016-01-01

    Potato (Solanum tuberosum L.) is generally considered to be sensitive to drought stress. Even short periods of water shortage can result in reduced tuber production and quality. We previously reported that transgenic potato plants expressing the sweet potato orange gene (IbOr) under the control of the stress-inducible SWPA2 promoter (referred to as SOR plants) showed increased tolerance to methyl viologen-mediated oxidative stress and high salinity, along with increased carotenoid contents. In this study, in an effort to improve the productivity and environmental stress tolerance of potato, we subjected transgenic potato plants expressing IbOr to water-deficient conditions in the greenhouse. The SOR plants exhibited increased tolerance to drought stress under greenhouse conditions. IbOr expression was associated with slightly negative phenotypes, including reduced tuber production. Controlling IbOr expression imparted the same degree of drought tolerance while ameliorating these negative phenotypic effects, leading to levels of tuber production similar to or better than those of wild-type plants under drought stress conditions. In particular, under drought stress, drought tolerance and the production of marketable tubers (over 80g) were improved in transgenic plants compared with non-transgenic plants. These results suggest that expressing the IbOr transgene can lead to significant gains in drought tolerance and tuber production in potato, thereby improving these agronomically important traits. PMID:27212605

  4. Metabolic engineering of Escherichia coli for ethanol production without foreign genes

    Science.gov (United States)

    Kim, Youngnyun

    Worldwide dependence on finite petroleum-based energy necessitates alternative energy sources that can be produced from renewable resources. A successful example of an alternative transportation fuel is bioethanol, produced by microorganisms, from corn starch that is blended with gasoline. However, corn, currently the main feedstock for bioethanol production, also occupies a significant role in human food and animal feed chains. As more corn is diverted to bioethanol, the cost of corn is expected to increase with an increase in the price of food, feed and ethanol. Using lignocellulosic biomass for ethanol production is considered to resolve this problem. However, this requires a microbial biocatalyst that can ferment hexoses and pentoses to ethanol. Escherichia coli is an efficient biocatalyst that can use all the monomeric sugars in lignocellulose, and recombinant derivatives of E. coli have been engineered to produce ethanol as the major fermentation product. In my study, ethanologenic E. coli strains were isolated from a ldhA-, pflB- derivative without introduction of foreign genes. These isolates grew anaerobically and produced ethanol as the main fermentation product. The mutation responsible for anaerobic growth and ethanol production was mapped in the lpdA gene and the mutation was identified as E354K in three of the isolates tested. Another three isolates carried an lpdA mutation, H352Y. Enzyme kinetic studies revealed that the mutated form of the dihydrolipoamide dehydrogenase (LPD) encoded by the lpdA was significantly less sensitive to NADH inhibition than the native LPD. This reduced NADH sensitivity of the mutated LPD was translated into lower sensitivity to NADH of the pyruvate dehydrogenase complex in strain SE2378. The net yield of 4 moles of NADH and 2 moles of acetyl-CoA per mole of glucose produced by a combination of glycolysis and PDH provided a logical basis to explain the production of 2 moles of ethanol per glucose. The development of E

  5. Regulated expression of the obese gene product (leptin) in white adipose tissue and 3T3-L1 adipocytes.

    OpenAIRE

    MacDougald, O A; Hwang, C. S.; Fan, H; Lane, M D

    1995-01-01

    A mutation within the obese gene was recently identified as the genetic basis for obesity in the ob/ob mouse. The obese gene product, leptin, is a 16-kDa protein expressed predominantly in adipose tissue. Consistent with leptin's postulated role as an extracellular signaling protein, human embryonic kidney 293 cells transfected with the obese gene secreted leptin with minimal intracellular accumulation. Upon differentiation of 3T3-L1 preadipocytes into adipocytes, the leptin mRNA was expresse...

  6. The PKS4 gene in Fusarium graminearum is essential for zearalenone production

    DEFF Research Database (Denmark)

    Lysøe, E.; Klemsdal, S. S.; Bone, K.R.; Frandsen, Rasmus John Normand; Johansen, Thomas; Thrane, Ulf; Giese, H.

    2006-01-01

    Zearalenones are produced by several Fusarium species and can cause reproductive problems in animals. Some aurofusarin mutants of Fusarium pseudograminearum produce elevated levels of zearalenone (ZON), one of the estrogenic mycotoxins comprising the zearalenones. An analysis of transcripts from......4. High-performance liquid chromatography analysis showed that the PKS4 replacement mutant did not produce ZON. Thus, PKS4 encodes an enzyme required for the production of ZON in F. graminearum. Barley root infection studies revealed no alteration in the pathogenicity of the PKS4 mutant compared to...... protocol was used to replace the central part of the PKS4 gene with a hygB resistance gene through double homologous recombination in an F. graminearum strain producing a high level of ZON. PCR and Southern analysis of transformants were used to identify isolates with single insertional replacements of PKS...

  7. Analysis of the ruv locus of Escherichia coli K-12 and identification of the gene product

    International Nuclear Information System (INIS)

    The ruv gene of Escherichia coli, which is associated with inducible mechanisms of DNA repair and recombination, has been cloned into the low-copy plasmid vector pHSG415. The recombinant plasmid pPVA101 fully complements the DNA repair-deficient phenotype of ruv mutants. Restriction endonuclease analysis of this plasmid revealed a 10.6-kilobase (kb) HindIII DNA insert which contained a 7.7-kb PstI fragment identified as being from the chromosomal ruv region. Deletion analysis and Tn1000 insertional inactivation of ruv function located the ruv coding region to a 2.2-kb section of the cloned DNA fragment. A comparison of the proteins encoded by ruv wild-type and mutant plasmids identified the gene product as a protein of molecular weight 41,000

  8. Suppression of Tla1 gene expression for improved solar conversion efficiency and photosynthetic productivity in plants and algae

    Science.gov (United States)

    Melis, Anastasios; Mitra, Mautusi

    2010-06-29

    The invention provides method and compositions to minimize the chlorophyll antenna size of photosynthesis by decreasing TLA1 gene expression, thereby improving solar conversion efficiencies and photosynthetic productivity in plants, e.g., green microalgae, under bright sunlight conditions.

  9. Characterization of foot-and-mouth disease virus gene products with antisera against bacterially synthesized fusion proteins

    International Nuclear Information System (INIS)

    Defined segments of the cloned foot-and-mouth disease virus genome corresponding to all parts of the coding region were expressed in Escherichia coli as fusions to the N-terminal part of the MS2-polymerase gene under the control of the inducible λPL promoter. All constructs yielded large amounts of proteins, which were purified and used to raise sequence-specific antisera in rabbits. These antisera were used to identify the corresponding viral gene products in 35S-labeled extracts from foot-and-mouth disease virus-infected BHK cells. This allowed us to locate unequivocally all mature foot-and-mouth disease virus gene products in the nucleotide sequence, to identify precursor-product relationships, and to detect several foot-and mouth disease virus gene products not previously identified in vivo or in vitro

  10. Directed natural product biosynthesis gene cluster capture and expression in the model bacterium Bacillus subtilis

    KAUST Repository

    Li, Yongxin

    2015-03-24

    Bacilli are ubiquitous low G+C environmental Gram-positive bacteria that produce a wide assortment of specialized small molecules. Although their natural product biosynthetic potential is high, robust molecular tools to support the heterologous expression of large biosynthetic gene clusters in Bacillus hosts are rare. Herein we adapt transformation-associated recombination (TAR) in yeast to design a single genomic capture and expression vector for antibiotic production in Bacillus subtilis. After validating this direct cloning plug-and-playa approach with surfactin, we genetically interrogated amicoumacin biosynthetic gene cluster from the marine isolate Bacillus subtilis 1779. Its heterologous expression allowed us to explore an unusual maturation process involving the N-acyl-asparagine pro-drug intermediates preamicoumacins, which are hydrolyzed by the asparagine-specific peptidase into the active component amicoumacin A. This work represents the first direct cloning based heterologous expression of natural products in the model organism B. subtilis and paves the way to the development of future genome mining efforts in this genus.

  11. Directed natural product biosynthesis gene cluster capture and expression in the model bacterium Bacillus subtilis

    Science.gov (United States)

    Li, Yongxin; Li, Zhongrui; Yamanaka, Kazuya; Xu, Ying; Zhang, Weipeng; Vlamakis, Hera; Kolter, Roberto; Moore, Bradley S.; Qian, Pei-Yuan

    2015-03-01

    Bacilli are ubiquitous low G+C environmental Gram-positive bacteria that produce a wide assortment of specialized small molecules. Although their natural product biosynthetic potential is high, robust molecular tools to support the heterologous expression of large biosynthetic gene clusters in Bacillus hosts are rare. Herein we adapt transformation-associated recombination (TAR) in yeast to design a single genomic capture and expression vector for antibiotic production in Bacillus subtilis. After validating this direct cloning ``plug-and-play'' approach with surfactin, we genetically interrogated amicoumacin biosynthetic gene cluster from the marine isolate Bacillus subtilis 1779. Its heterologous expression allowed us to explore an unusual maturation process involving the N-acyl-asparagine pro-drug intermediates preamicoumacins, which are hydrolyzed by the asparagine-specific peptidase into the active component amicoumacin A. This work represents the first direct cloning based heterologous expression of natural products in the model organism B. subtilis and paves the way to the development of future genome mining efforts in this genus.

  12. Improvement of hydrogen production with expression of lba gene in chloroplast of Chlamydomonas reinhardtii

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Shuangxiu; Yan, Guangyu; Xu, Lili; Wang, Quanxi; Liu, Xiaolei [Department of Biology, college of life and environmental science, Shanghai Normal University, Guilin road 100, 200234, Shanghai City (China)

    2010-12-15

    An ORF cDNA fragment of one of leghemoglobin genes, lba was cloned from Glycine max and transferred into chloroplasts of Chlamydomonas reinhardtii. More rapidly O{sub 2} consumption, lower O{sub 2} content and higher H{sub 2} output were monitored in the transgenic algal cultures than those in WT cultures either in S-free or S-containing medium. Maximum expression of lba in the transgenic algae consisted with the time when minimal O{sub 2} contents and maximal H{sub 2} evolution occurred. The highest H{sub 2} production achieved in sulfur-free medium for both algal cultures. When restoring sulfate in the medium, H{sub 2} production in the transgenic algal cultures kept steadily around 130-145 {mu}l per bottle while that in WT cultures decreased gradually from 98 {mu}l per bottle at 12.5 {mu}M sulfate to 40 {mu}l per bottle at 100 {mu}M sulfate. The results indicated that heteroexpression of lehemoglaobin genes in chloroplasts of green algae improved H{sub 2} yield by decreasing O{sub 2} content in the medium. This protein had potential to be used in improvement of H{sub 2} production in green algae. (author)

  13. Overexpression of D-Xylose Reductase (xyl1) Gene and Antisense Inhibition of D-Xylulokinase (xyiH) Gene Increase Xylitol Production in Trichoderma reesei

    OpenAIRE

    Yuanyuan Hong; Mehdi Dashtban; Greg Kepka; Sanfeng Chen; Wensheng Qin

    2014-01-01

    T. reesei is an efficient cellulase producer and biomass degrader. To improve xylitol production in Trichoderma reesei strains by genetic engineering, two approaches were used in this study. First, the presumptive D-xylulokinase gene in T. reesei (xyiH), which has high homology to known fungi D-xylulokinase genes, was silenced by transformation of T. reesei QM9414 strain with an antisense construct to create strain S6-2-2. The expression of the xyiH gene in the transformed strain S6-2-2 decre...

  14. Multiplexed, targeted gene editing in Nicotiana benthamiana for glyco-engineering and monoclonal antibody production.

    Science.gov (United States)

    Li, Jin; Stoddard, Thomas J; Demorest, Zachary L; Lavoie, Pierre-Olivier; Luo, Song; Clasen, Benjamin M; Cedrone, Frederic; Ray, Erin E; Coffman, Andrew P; Daulhac, Aurelie; Yabandith, Ann; Retterath, Adam J; Mathis, Luc; Voytas, Daniel F; D'Aoust, Marc-André; Zhang, Feng

    2016-02-01

    Biopharmaceutical glycoproteins produced in plants carry N-glycans with plant-specific residues core α(1,3)-fucose and β(1,2)-xylose, which can significantly impact the activity, stability and immunogenicity of biopharmaceuticals. In this study, we have employed sequence-specific transcription activator-like effector nucleases (TALENs) to knock out two α(1,3)-fucosyltransferase (FucT) and the two β(1,2)-xylosyltransferase (XylT) genes within Nicotiana benthamiana to generate plants with improved capacity to produce glycoproteins devoid of plant-specific residues. Among plants regenerated from N. benthamiana protoplasts transformed with TALENs targeting either the FucT or XylT genes, 50% (80 of 160) and 73% (94 of 129) had mutations in at least one FucT or XylT allele, respectively. Among plants regenerated from protoplasts transformed with both TALEN pairs, 17% (18 of 105) had mutations in all four gene targets, and 3% (3 of 105) plants had mutations in all eight alleles comprising both gene families; these mutations were transmitted to the next generation. Endogenous proteins expressed in the complete knockout line had N-glycans that lacked β(1,2)-xylose and had a significant reduction in core α(1,3)-fucose levels (40% of wild type). A similar phenotype was observed in the N-glycans of a recombinant rituximab antibody transiently expressed in the homozygous mutant plants. More importantly, the most desirable glycoform, one lacking both core α(1,3)-fucose and β(1,2)-xylose residues, increased in the antibody from 2% when produced in the wild-type line to 55% in the mutant line. These results demonstrate the power of TALENs for multiplexed gene editing. Furthermore, the mutant N. benthamiana lines provide a valuable platform for producing highly potent biopharmaceutical products. PMID:26011187

  15. Identification of Genetic Variants Within Androgen Receptor Gene of Sika Deer and its Association with Antler Production

    OpenAIRE

    Liguo Yang; Shujun Zhang; Lijun Huo; Pu Zhang; Bin Fan; Lei Shen; Guohua Hua; Feifei Yang; Jiajun Xiong

    2012-01-01

    Antler production is one of the most important economical traits of Sika deer. However, the genetic mechanism of antler growth and genetic markers associated with antler yield remain unclear. In the present study Androgen Receptor (AR) gene has been considered as a candidate gene to identify the polymorphisms. Besides, its effect on antler production was investigated in Chinese Sika deer. Genomic sequences of exons1-7 of Sika deer have been successfully obtained and showed high homogeneity wi...

  16. Diversity, Distribution and Quantification of Antibiotic Resistance Genes in Goat and Lamb Slaughterhouse Surfaces and Meat Products

    OpenAIRE

    Lavilla Lerma, Leyre; Benomar, Nabil; Knapp, Charles W.; Correa Galeote, David; Gálvez, Antonio; Abriouel, Hikmate

    2014-01-01

    The distribution and quantification of tetracycline, sulfonamide and beta-lactam resistance genes were assessed in slaughterhouse zones throughout meat chain production and the meat products; this study represents the first to report quantitatively monitor antibiotic resistance genes (ARG) in goat and lamb slaughterhouse using a culture independent approach, since most studies focused on individual bacterial species and their specific resistance types. Quantitative PCR (qPCR) revealed a high ...

  17. The immunolocalization of protein gene product 9.5 using rabbit polyclonal and mouse monoclonal antibodies.

    OpenAIRE

    Wilson, P. O.; Barber, P. C.; Hamid, Q. A.; Power, B. F.; Dhillon, A. P.; Rode, J.; Day, I N; Thompson, R. J.; Polak, J.M. (Julia M.)

    1988-01-01

    In order to assess the potential of protein gene product (PGP) 9.5 as a marker of the nervous and neuroendocrine systems, we examined its immunolocation in human, rat and guinea-pig tissues, using a rabbit polyclonal antiserum and two new mouse monoclonal antisera, I3C4 and 3IA3. Our results demonstrate immunoreactive PGP 9.5 in neurons and nerve fibres at all levels of the central and peripheral nervous system, in many neuroendocrine cells, in part of the renal tubule, in spermatogonia and L...

  18. Genetic assignment of multiple E2 gene products in bovine papillomavirus-transformed cells.

    OpenAIRE

    Lambert, P F; Hubbert, N L; Howley, P M; Schiller, J T

    1989-01-01

    The E2 open reading frame of bovine papillomavirus type 1 has been shown genetically to encode at least three transcriptional regulatory factors, and three E2 specific proteins have been recently identified in virally transformed rodent cells. In this study, the genes encoding these E2 specific proteins have been determined. The 48-kilodalton (kDa) protein was identified as the product of a full-length E2 open reading frame cDNA, which confirmed that this polypeptide is the E2 transactivator....

  19. An in vitro complementation assay for the Escherichia coli uvrD gene product.

    OpenAIRE

    Kuemmerle, N B; Masker, W E

    1983-01-01

    An in vitro assay specific for the product of the uvrD gene of Escherichia coli has been developed. This assay, derived from properties of uvrD mutants revealed by in vivo experiments, is based on the necessity for a functional UvrD protein for complete rejoining of covalently closed circular DNA during the excision repair of UV-induced damage. Extracts prepared from gently lysed uvrD101 mutant cells are capable of restoring UV-damaged DNA to its covalently closed circular form when provided ...

  20. Synergistic Effect of Elicitors in Enhancement of Ganoderic Acid Production: Optimization and Gene Expression Studies

    Directory of Open Access Journals (Sweden)

    Motaharehsadat Heydarian

    2015-06-01

    Full Text Available AbstractGanoderma lucidum is one of the most well-known fungi, and has many applications in medicine. Ganoderic acid is among the valuable secondary metabolites of Ganoderma lucidum, and responsible for the inhibition of the tumor cell growth and cancer treatment. Application of ganoderic acid has been limited because of low yields of its production from Ganoderma lucidum. The present study aims to investigate the synergistic effect of elicitors including methyl jasmonate and aspirin on the production of ganoderic acid derived from Ganoderma lucidum mushroom in a shaken flasks using response surface methodology. The results showed that the optimal dose of methyl jasmonate and asprin significantly impacts on the amount of ganoderic acid production as a response (p<0.05. The proposed model predicted the maximum ganoderic acid production as 0.085 mg/ml in which the optimal concentrations obtained for methyl jasmonate and asprin were 250mM and 4.4mM, respectively. Also the influence of ganoderic acid production on the expression of 3-hydroxy-3-methyl-glutaryl coenzyme A reductase and squalene synthase (two important metabolic pathway genes in ganoderic acid was investigated, and the results showed that these genes’ expression has increased by 10 and 11 folds, respectively.  

  1. Enhancement of ganoderic acid production by constitutively expressing Vitreoscilla hemoglobin gene in Ganoderma lucidum.

    Science.gov (United States)

    Li, Huan-Jun; He, Yi-Long; Zhang, De-Huai; Yue, Tong-Hui; Jiang, Lu-Xi; Li, Na; Xu, Jun-Wei

    2016-06-10

    The Vitreoscilla hemoglobin (VHb) gene was expressed in Ganoderma lucidum to enhance antitumor ganoderic acid (GA) production. The effects of VHb expression on the accumulation of GAs and lanosterol (intermediate) and the transcription of GA biosynthesis genes were also investigated. In VHb-expressing G. lucidum, the maximum concentrations of four individual GAs (GA-S, GA-T, GA-Mk and GA-Me) were 19.1±1.8, 34.6±2.1, 191.5±13.1 and 45.2±2.8μg/100mg dry weight, respectively, which were 1.4-, 2.2, 1.9- and 2.0-fold higher than those obtained in the wild-type strain. Moreover, the maximum lanosterol concentration in the strain expressing VHb was 1.28-fold lower than that in the wild-type strain. The transcription levels of 3-hydroxy-3-methylglutaryl coenzyme A reductase, squalene synthase, and lanosterol synthase genes were up-regulated by 1.6-, 1.5-, and 1.6-fold, respectively, in the strain expressing VHb. This work is beneficial in developing an efficient fermentation process for the hyperproduction of GAs. PMID:27080449

  2. Production of human glucocerebrosidase in mice after retroviral gene transfer into multipotential hematopoietic progenitor cells

    International Nuclear Information System (INIS)

    The human glucocerebrosidase (GC) gene has been transferred efficiently into spleen colony-forming unit (CFU-S) multipotential hematopoietic progenitor cells, and production of human GC RNA and protein has been achieved in transduced CFU-S colonies. High-titer retroviral vectors containing the human GC cDNA were constructed. Four vectors were compared with respect to gene-transfer efficiency into CFU-S progenitors. One vector (G vector) required high concentrations of interleukins 3 and 6 during stimulation and coculture for efficient transduction of CFU-S progenitors. The remaining three vectors (NTG, GTN, and GI vectors) transduced these progenitors at infection frequencies approaching 100% using low concentrations of hematopoietic growth factors to simulate cell division prior to and during the infection. Vectors using the viral long terminal repeat enhancer/promoter to drive the human GC cDNA produced high levels of human GC RNA in the progeny of CFU-S progenitors after gene transfer. All three vectors producing human GC RNA in CFU-S colonies can generate human GC as detected by immunochemical analysis of CFU-S colonies. The capacity of the viral long terminal repeat and the internal thymidine kinase promoter to direct synthesis of RNA in transduced bone marrow and spleen cells 5 months after bone marrow transplantation reflected the performance of these promoters in NTG-transduced CFU-S colonies

  3. Production of human glucocerebrosidase in mice after retroviral gene transfer into multipotential hematopoietic progenitor cells

    Energy Technology Data Exchange (ETDEWEB)

    Correll, P.H.; Fink, J.K.; Brady, R.O.; Perry, L.K.; Karlsson, S. (National Institutes of Health, Bethesda, MD (USA))

    1989-11-01

    The human glucocerebrosidase (GC) gene has been transferred efficiently into spleen colony-forming unit (CFU-S) multipotential hematopoietic progenitor cells, and production of human GC RNA and protein has been achieved in transduced CFU-S colonies. High-titer retroviral vectors containing the human GC cDNA were constructed. Four vectors were compared with respect to gene-transfer efficiency into CFU-S progenitors. One vector (G vector) required high concentrations of interleukins 3 and 6 during stimulation and coculture for efficient transduction of CFU-S progenitors. The remaining three vectors (NTG, GTN, and GI vectors) transduced these progenitors at infection frequencies approaching 100% using low concentrations of hematopoietic growth factors to simulate cell division prior to and during the infection. Vectors using the viral long terminal repeat enhancer/promoter to drive the human GC cDNA produced high levels of human GC RNA in the progeny of CFU-S progenitors after gene transfer. All three vectors producing human GC RNA in CFU-S colonies can generate human GC as detected by immunochemical analysis of CFU-S colonies. The capacity of the viral long terminal repeat and the internal thymidine kinase promoter to direct synthesis of RNA in transduced bone marrow and spleen cells 5 months after bone marrow transplantation reflected the performance of these promoters in NTG-transduced CFU-S colonies.

  4. Increased isobutanol production in Saccharomyces cerevisiae by overexpression of genes in valine metabolism

    Directory of Open Access Journals (Sweden)

    Karhumaa Kaisa

    2011-07-01

    Full Text Available Abstract Background Isobutanol can be a better biofuel than ethanol due to its higher energy density and lower hygroscopicity. Furthermore, the branched-chain structure of isobutanol gives a higher octane number than the isomeric n-butanol. Saccharomyces cerevisiae was chosen as the production host because of its relative tolerance to alcohols, robustness in industrial fermentations, and the possibility for future combination of isobutanol production with fermentation of lignocellulosic materials. Results The yield of isobutanol was improved from 0.16 to 0.97 mg per g glucose by simultaneous overexpression of biosynthetic genes ILV2, ILV3, and ILV5 in valine metabolism in anaerobic fermentation of glucose in mineral medium in S. cerevisiae. Isobutanol yield was further improved by twofold by the additional overexpression of BAT2, encoding the cytoplasmic branched-chain amino-acid aminotransferase. Overexpression of ILV6, encoding the regulatory subunit of Ilv2, in the ILV2 ILV3 ILV5 overexpression strain decreased isobutanol production yield by threefold. In aerobic cultivations in shake flasks in mineral medium, the isobutanol yield of the ILV2 ILV3 ILV5 overexpression strain and the reference strain were 3.86 and 0.28 mg per g glucose, respectively. They increased to 4.12 and 2.4 mg per g glucose in yeast extract/peptone/dextrose (YPD complex medium under aerobic conditions, respectively. Conclusions Overexpression of genes ILV2, ILV3, ILV5, and BAT2 in valine metabolism led to an increase in isobutanol production in S. cerevisiae. Additional overexpression of ILV6 in the ILV2 ILV3 ILV5 overexpression strain had a negative effect, presumably by increasing the sensitivity of Ilv2 to valine inhibition, thus weakening the positive impact of overexpression of ILV2, ILV3, and ILV5 on isobutanol production. Aerobic cultivations of the ILV2 ILV3 ILV5 overexpression strain and the reference strain showed that supplying amino acids in cultivation media

  5. Nucleotide and protein sequences for dog masticatory tropomyosin identify a novel Tpm4 gene product.

    Science.gov (United States)

    Brundage, Elizabeth A; Biesiadecki, Brandon J; Reiser, Peter J

    2015-10-01

    Jaw-closing muscles of several vertebrate species, including members of Carnivora, express a unique, "masticatory", isoform of myosin heavy chain, along with isoforms of other myofibrillar proteins that are not expressed in most other muscles. It is generally believed that the complement of myofibrillar isoforms in these muscles serves high force generation for capturing live prey, breaking down tough plant material and defensive biting. A unique isoform of tropomyosin (Tpm) was reported to be expressed in cat jaw-closing muscle, based upon two-dimensional gel mobility, peptide mapping, and immunohistochemistry. The objective of this study was to obtain protein and gene sequence information for this unique Tpm isoform. Samples of masseter (a jaw-closing muscle), tibialis (predominantly fast-twitch fibers), and the deep lateral gastrocnemius (predominantly slow-twitch fibers) were obtained from adult dogs. Expressed Tpm isoforms were cloned and sequencing yielded cDNAs that were identical to genomic predicted striated muscle Tpm1.1St(a,b,b,a) (historically referred to as αTpm), Tpm2.2St(a,b,b,a) (βTpm) and Tpm3.12St(a,b,b,a) (γTpm) isoforms (nomenclature reflects predominant tissue expression ("St"-striated muscle) and exon splicing pattern), as well as a novel 284 amino acid isoform observed in jaw-closing muscle that is identical to a genomic predicted product of the Tpm4 gene (δTpm) family. The novel isoform is designated as Tpm4.3St(a,b,b,a). The myofibrillar Tpm isoform expressed in dog masseter exhibits a unique electrophoretic mobility on gels containing 6 M urea, compared to other skeletal Tpm isoforms. To validate that the cloned Tpm4.3 isoform is the Tpm expressed in dog masseter, E. coli-expressed Tpm4.3 was electrophoresed in the presence of urea. Results demonstrate that Tpm4.3 has identical electrophoretic mobility to the unique dog masseter Tpm isoform and is of different mobility from that of muscle Tpm1.1, Tpm2.2 and Tpm3.12 isoforms. We

  6. Essential Oils Modulate Gene Expression and Ochratoxin A Production in Aspergillus carbonarius

    Science.gov (United States)

    El Khoury, Rachelle; Atoui, Ali; Verheecke, Carol; Maroun, Richard; El Khoury, Andre; Mathieu, Florence

    2016-01-01

    Ochratoxin A (OTA) is a mycotoxin, mainly produced on grapes by Aspergillus carbonarius, that causes massive health problems for humans. This study aims to reduce the occurrence of OTA by using the ten following essential oils (E.Os): fennel, cardamom, anise, chamomile, celery, cinnamon, thyme, taramira, oregano and rosemary at 1 µL/mL and 5 µL/mL for each E.O.As a matter of fact, their effects on the OTA production and the growth of A. carbonarius S402 cultures were evaluated, after four days at 28 °C on a Synthetic Grape Medium (SGM). Results showed that A. carbonarius growth was reduced up to 100%, when cultured with the E.Os of cinnamon, taramira, and oregano at both concentrations and the thyme at 5 µL/mL. As for the other six E.Os, their effect on A. carbonarius growth was insignificant, but highly important on the OTA production. Interestingly, the fennel E.O at 5 µL/mL reduced the OTA production up to 88.9% compared to the control, with only 13.8% of fungal growth reduction. We further investigated the effect of these E.Os on the expression levels of the genes responsible for the OTA biosynthesis (acOTApks and acOTAnrps along with the acpks gene) as well as the two regulatory genes laeA and vea, using the quantitative Reverse Transcription-Polymerase Chain Reaction (qRT-PCR) method. The results revealed that these six E.Os reduced the expression of the five studied genes, where the ackps was downregulated by 99.2% (the highest downregulation in this study) with 5 µL/mL of fennel E.O.As for the acOTApks, acOTAnrps, veA and laeA, their reduction levels ranged between 10% and 96% depending on the nature of the E.O and its concentration in the medium. PMID:27548221

  7. Quantitative trait loci linked to PRNP gene controlling health and production traits in INRA 401 sheep

    Directory of Open Access Journals (Sweden)

    Brunel Jean-Claude

    2007-07-01

    Full Text Available Abstract In this study, the potential association of PrP genotypes with health and productive traits was investigated. Data were recorded on animals of the INRA 401 breed from the Bourges-La Sapinière INRA experimental farm. The population consisted of 30 rams and 852 ewes, which produced 1310 lambs. The animals were categorized into three PrP genotype classes: ARR homozygous, ARR heterozygous, and animals without any ARR allele. Two analyses differing in the approach considered were carried out. Firstly, the potential association of the PrP genotype with disease (Salmonella resistance and production (wool and carcass traits was studied. The data used included 1042, 1043 and 1013 genotyped animals for the Salmonella resistance, wool and carcass traits, respectively. The different traits were analyzed using an animal model, where the PrP genotype effect was included as a fixed effect. Association analyses do not indicate any evidence of an effect of PrP genotypes on traits studied in this breed. Secondly, a quantitative trait loci (QTL detection approach using the PRNP gene as a marker was applied on ovine chromosome 13. Interval mapping was used. Evidence for one QTL affecting mean fiber diameter was found at 25 cM from the PRNP gene. However, a linkage between PRNP and this QTL does not imply unfavorable linkage disequilibrium for PRNP selection purposes.

  8. Effect of retS gene on antibiotics production in Pseudomonas fluorescens FD6.

    Science.gov (United States)

    Zhang, Qingxia; Xiao, Qi; Xu, Jingyou; Tong, Yunhui; Wen, Jia; Chen, Xijun; Wei, Lihui

    2015-11-01

    A hybrid sensor kinase termed RetS (regulator of exopolysaccharide and Type III secretion) controls expression of numerous genes in Pseudomonas aeruginosa. To investigate the function of RetS in P. fluorescens FD6, the retS gene was disrupted. Genetic inactivation of retS resulted in enhanced production of 2, 4-diacetylphloroglucinol, pyrrolnitrin, and pyoluteorin. The retS mutant also exhibited significant increase in phlA-lacZ, prnA-lacZ, and pltA-lacZ transcription levels, influencing expression levels of the small regulatory RNAs RsmX and RsmZ. In the gacSretS double mutant, all the phenotypic changes caused by the retS deletion were reversed to the level of gacS single mutant. Furthermore, the retS mutation drastically elevated biofilm formation and improved the colonization ability of strain FD6 on wheat rhizospheres. Based on these results, we proposed that RetS negatively controlled the production of antibiotics through the Gac/Rsm pathway in P. fluorescens FD6. PMID:26505308

  9. Gene-based vaccine development for improving animal production in developing countries

    International Nuclear Information System (INIS)

    Full text: The cloning and expression of microbial genes in alternate hosts to enhance production of antigens for animal vaccines against all disease is theoretically achievable. It is essential, however, that antigens expressed in this way are known to be protective. Many years of costly research usually precedes the identification of such antigens or combinations of antigens. Thus, while conventional vaccines based on living, attenuated or inactivated microorganisms may be effective, the protective components contained in them i.e. the candidates for cloning, have yet to be found. The principal protective antigen in vaccines against foot rot of sheep and goats is fimbrial protein of Dichelobacter nodosus. Recombinant vaccines against this infection are ineffective if the protein subunits are not assembled and presented to the host in a manner morphologically indistinguishable from those of the natural fimbriae. Availability of recombinant antigen does not necessarily avoid the need for the use of adjuvants to potentiate response. Oil emulsion vaccines, while enhancing immune response, almost inevitably cause a marked reaction at the site of injection. Livestock owners in developing countries are as likely as those elsewhere to object to these reactions. The need to find an acceptable and effective formulation adds to the cost of recombinant vaccines and their application in countries with limited resources for disease control. Another costly feature of recombinant vaccines has been the patenting of processes involving gene technology and licencing agreements for production under the protection of these patents. In some systems antigenic competition between similar and disparate antigens limits the usefulness of even recombinant antigens that, administered individually, are highly potent. In the case of programs for the control and eventual eradication of footrot in sheep and goats in Nepal this problem was overcome by the prior identification of causal serotypes

  10. Gene identification in black cohosh (Actaea racemosa L.): expressed sequence tag profiling and genetic screening yields candidate genes for production of bioactive secondary metabolites.

    Science.gov (United States)

    Spiering, Martin J; Urban, Lori A; Nuss, Donald L; Gopalan, Vivek; Stoltzfus, Arlin; Eisenstein, Edward

    2011-04-01

    Black cohosh (Actaea racemosa L., syn. Cimicifuga racemosa, Nutt., Ranunculaceae) is a popular herb used for relieving menopausal discomforts. A variety of secondary metabolites, including triterpenoids, phenolic dimers, and serotonin derivatives have been associated with its biological activity, but the genes and metabolic pathways as well as the tissue distribution of their production in this plant are unknown. A gene discovery effort was initiated in A. racemosa by partial sequencing of cDNA libraries constructed from young leaf, rhizome, and root tissues. In total, 2,066 expressed sequence tags (ESTs) were assembled into 1,590 unique genes (unigenes). Most of the unigenes were predicted to encode primary metabolism genes, but about 70 were identified as putative secondary metabolism genes. Several of these candidates were analyzed further and full-length cDNA and genomic sequences for a putative 2,3 oxidosqualene cyclase (CAS1) and two BAHD-type acyltransferases (ACT1 and HCT1) were obtained. Homology-based PCR screening for the central gene in plant serotonin biosynthesis, tryptophan decarboxylase (TDC), identified two TDC-related sequences in A. racemosa. CAS1, ACT1, and HCT1 were expressed in most plant tissues, whereas expression of TDC genes was detected only sporadically in immature flower heads and some very young leaf tissues. The cDNA libraries described and assorted genes identified provide initial insight into gene content and diversity in black cohosh, and provide tools and resources for detailed investigations of secondary metabolite genes and enzymes in this important medicinal plant. PMID:21188383

  11. Gene

    Data.gov (United States)

    U.S. Department of Health & Human Services — Gene integrates information from a wide range of species. A record may include nomenclature, Reference Sequences (RefSeqs), maps, pathways, variations, phenotypes,...

  12. Diversity, distribution and quantification of antibiotic resistance genes in goat and lamb slaughterhouse surfaces and meat products.

    Science.gov (United States)

    Lavilla Lerma, Leyre; Benomar, Nabil; Knapp, Charles W; Correa Galeote, David; Gálvez, Antonio; Abriouel, Hikmate

    2014-01-01

    The distribution and quantification of tetracycline, sulfonamide and beta-lactam resistance genes were assessed in slaughterhouse zones throughout meat chain production and the meat products; this study represents the first to report quantitatively monitor antibiotic resistance genes (ARG) in goat and lamb slaughterhouse using a culture independent approach, since most studies focused on individual bacterial species and their specific resistance types. Quantitative PCR (qPCR) revealed a high prevalence of tetracycline resistance genes tetA and tetB in almost all slaughterhouse zones. Sulfonamide resistance genes were largely distributed, while beta-lactam resistance genes were less predominant. Statistical analysis revealed that resistant bacteria, in most cases, were spread by the same route in almost all slaughterhouse zones, except for tetB, blaCTX and blaTEM genes, which occurred in few zones as isolated 'hot spots.' The sum of all analyzed ARG indicated that slaughterhouse surfaces and end products act as reservoirs of ARG, mainly tet genes, which were more prevalent in slaughtering room (SR), cutting room (CR) and commercial meat products (MP). Resistance gene patterns suggest they were disseminated throughout slaughterhouse zones being also detected in commercial meat products, with significant correlations between different sampling zones/end products and total resistance in SR, CR and white room (WR) zones, and also refrigerator 4 (F4) and MP were observed. Strategically controlling key zones in slaughterhouse (SR, CR and WR) by adequate disinfection methods could strategically reduce the risks of ARG transmission and minimize the issues of food safety and environment contamination. PMID:25479100

  13. Transcriptome and Gene Ontology (GO) Enrichment Analysis Reveals Genes Involved in Biotin Metabolism That Affect l-Lysine Production in Corynebacterium glutamicum.

    Science.gov (United States)

    Kim, Hong-Il; Kim, Jong-Hyeon; Park, Young-Jin

    2016-01-01

    Corynebacterium glutamicum is widely used for amino acid production. In the present study, 543 genes showed a significant change in their mRNA expression levels in l-lysine-producing C. glutamicum ATCC21300 than that in the wild-type C. glutamicum ATCC13032. Among these 543 differentially expressed genes (DEGs), 28 genes were up- or downregulated. In addition, 454 DEGs were functionally enriched and categorized based on BLAST sequence homologies and gene ontology (GO) annotations using the Blast2GO software. Interestingly, NCgl0071 (bioB, encoding biotin synthase) was expressed at levels ~20-fold higher in the l-lysine-producing ATCC21300 strain than that in the wild-type ATCC13032 strain. Five other genes involved in biotin metabolism or transport-NCgl2515 (bioA, encoding adenosylmethionine-8-amino-7-oxononanoate aminotransferase), NCgl2516 (bioD, encoding dithiobiotin synthetase), NCgl1883, NCgl1884, and NCgl1885-were also expressed at significantly higher levels in the l-lysine-producing ATCC21300 strain than that in the wild-type ATCC13032 strain, which we determined using both next-generation RNA sequencing and quantitative real-time PCR analysis. When we disrupted the bioB gene in C. glutamicum ATCC21300, l-lysine production decreased by approximately 76%, and the three genes involved in biotin transport (NCgl1883, NCgl1884, and NCgl1885) were significantly downregulated. These results will be helpful to improve our understanding of C. glutamicum for industrial amino acid production. PMID:27005618

  14. Transcriptome and Gene Ontology (GO Enrichment Analysis Reveals Genes Involved in Biotin Metabolism That Affect l-Lysine Production in Corynebacterium glutamicum

    Directory of Open Access Journals (Sweden)

    Hong-Il Kim

    2016-03-01

    Full Text Available Corynebacterium glutamicum is widely used for amino acid production. In the present study, 543 genes showed a significant change in their mRNA expression levels in l-lysine-producing C. glutamicum ATCC21300 than that in the wild-type C. glutamicum ATCC13032. Among these 543 differentially expressed genes (DEGs, 28 genes were up- or downregulated. In addition, 454 DEGs were functionally enriched and categorized based on BLAST sequence homologies and gene ontology (GO annotations using the Blast2GO software. Interestingly, NCgl0071 (bioB, encoding biotin synthase was expressed at levels ~20-fold higher in the l-lysine-producing ATCC21300 strain than that in the wild-type ATCC13032 strain. Five other genes involved in biotin metabolism or transport—NCgl2515 (bioA, encoding adenosylmethionine-8-amino-7-oxononanoate aminotransferase, NCgl2516 (bioD, encoding dithiobiotin synthetase, NCgl1883, NCgl1884, and NCgl1885—were also expressed at significantly higher levels in the l-lysine-producing ATCC21300 strain than that in the wild-type ATCC13032 strain, which we determined using both next-generation RNA sequencing and quantitative real-time PCR analysis. When we disrupted the bioB gene in C. glutamicum ATCC21300, l-lysine production decreased by approximately 76%, and the three genes involved in biotin transport (NCgl1883, NCgl1884, and NCgl1885 were significantly downregulated. These results will be helpful to improve our understanding of C. glutamicum for industrial amino acid production.

  15. A Gene Optimization Strategy that Enhances Production of Fully Functional P-Glycoprotein in Pichia pastoris

    Science.gov (United States)

    Protasevich, Irina I.; Brouillette, Christie G.; Harrell, Patina M.; Hildebrandt, Ellen; Gasser, Brigitte; Mattanovich, Diethard; Ward, Andrew; Chang, Geoffrey; Urbatsch, Ina L.

    2011-01-01

    Background Structural and biochemical studies of mammalian membrane proteins remain hampered by inefficient production of pure protein. We explored codon optimization based on highly expressed Pichia pastoris genes to enhance co-translational folding and production of P-glycoprotein (Pgp), an ATP-dependent drug efflux pump involved in multidrug resistance of cancers. Methodology/Principal Findings Codon-optimized “Opti-Pgp” and wild-type Pgp, identical in primary protein sequence, were rigorously analyzed for differences in function or solution structure. Yeast expression levels and yield of purified protein from P. pastoris (∼130 mg per kg cells) were about three-fold higher for Opti-Pgp than for wild-type protein. Opti-Pgp conveyed full in vivo drug resistance against multiple anticancer and fungicidal drugs. ATP hydrolysis by purified Opti-Pgp was strongly stimulated ∼15-fold by verapamil and inhibited by cyclosporine A with binding constants of 4.2±2.2 µM and 1.1±0.26 µM, indistinguishable from wild-type Pgp. Maximum turnover number was 2.1±0.28 µmol/min/mg and was enhanced by 1.2-fold over wild-type Pgp, likely due to higher purity of Opti-Pgp preparations. Analysis of purified wild-type and Opti-Pgp by CD, DSC and limited proteolysis suggested similar secondary and ternary structure. Addition of lipid increased the thermal stability from Tm ∼40°C to 49°C, and the total unfolding enthalpy. The increase in folded state may account for the increase in drug-stimulated ATPase activity seen in presence of lipids. Conclusion The significantly higher yields of protein in the native folded state, higher purity and improved function establish the value of our gene optimization approach, and provide a basis to improve production of other membrane proteins. PMID:21826197

  16. Enhanced biosurfactant production through cloning of three genes and role of esterase in biosurfactant release

    Directory of Open Access Journals (Sweden)

    Khanna Sunil

    2011-06-01

    Full Text Available Abstract Background Biosurfactants have been reported to utilize a number of immiscible substrates and thereby facilitate the biodegradation of panoply of polyaromatic hydrocarbons. Olive oil is one such carbon source which has been explored by many researchers. However, studying the concomitant production of biosurfactant and esterase enzyme in the presence of olive oil in the Bacillus species and its recombinants is a relatively novel approach. Results Bacillus species isolated from endosulfan sprayed cashew plantation soil was cultivated on a number of hydrophobic substrates. Olive oil was found to be the best inducer of biosurfactant activity. The protein associated with the release of the biosurfactant was found to be an esterase. There was a twofold increase in the biosurfactant and esterase activities after the successful cloning of the biosurfactant genes from Bacillus subtilis SK320 into E.coli. Multiple sequence alignment showed regions of similarity and conserved sequences between biosurfactant and esterase genes, further confirming the symbiotic correlation between the two. Biosurfactants produced by Bacillus subtilis SK320 and recombinant strains BioS a, BioS b, BioS c were found to be effective emulsifiers, reducing the surface tension of water from 72 dynes/cm to as low as 30.7 dynes/cm. Conclusion The attributes of enhanced biosurfactant and esterase production by hyper-producing recombinant strains have many utilities from industrial viewpoint. This study for the first time has shown a possible association between biosurfactant production and esterase activity in any Bacillus species. Biosurfactant-esterase complex has been found to have powerful emulsification properties, which shows promising bioremediation, hydrocarbon biodegradation and pharmaceutical applications.

  17. MitoRes: a resource of nuclear-encoded mitochondrial genes and their products in Metazoa

    Directory of Open Access Journals (Sweden)

    Grillo Giorgio

    2006-01-01

    Full Text Available Abstract Background Mitochondria are sub-cellular organelles that have a central role in energy production and in other metabolic pathways of all eukaryotic respiring cells. In the last few years, with more and more genomes being sequenced, a huge amount of data has been generated providing an unprecedented opportunity to use the comparative analysis approach in studies of evolution and functional genomics with the aim of shedding light on molecular mechanisms regulating mitochondrial biogenesis and metabolism. In this context, the problem of the optimal extraction of representative datasets of genomic and proteomic data assumes a crucial importance. Specialised resources for nuclear-encoded mitochondria-related proteins already exist; however, no mitochondrial database is currently available with the same features of MitoRes, which is an update of the MitoNuc database extensively modified in its structure, data sources and graphical interface. It contains data on nuclear-encoded mitochondria-related products for any metazoan species for which this type of data is available and also provides comprehensive sequence datasets (gene, transcript and protein as well as useful tools for their extraction and export. Description MitoRes http://www2.ba.itb.cnr.it/MitoRes/ consolidates information from publicly external sources and automatically annotates them into a relational database. Additionally, it also clusters proteins on the basis of their sequence similarity and interconnects them with genomic data. The search engine and sequence management tools allow the query/retrieval of the database content and the extraction and export of sequences (gene, transcript, protein and related sub-sequences (intron, exon, UTR, CDS, signal peptide and gene flanking regions ready to be used for in silico analysis. Conclusion The tool we describe here has been developed to support lab scientists and bioinformaticians alike in the characterization of molecular

  18. Trade-off between constitutive and inducible resistance against herbivores is only partially explained by gene expression and glucosinolate production.

    Science.gov (United States)

    Rasmann, Sergio; Chassin, Estelle; Bilat, Julia; Glauser, Gaétan; Reymond, Philippe

    2015-05-01

    The hypothesis that constitutive and inducible plant resistance against herbivores should trade-off because they use the same resources and impose costs to plant fitness has been postulated for a long time. Negative correlations between modes of deployment of resistance and defences have been observed across and within species in common garden experiments. It was therefore tested whether that pattern of resistance across genotypes follows a similar variation in patterns of gene expression and chemical defence production. Using the genetically tractable model Arabidopsis thaliana and different modes of induction, including the generalist herbivore Spodoptera littoralis, the specialist herbivore Pieris brassicae, and jasmonate application, constitutive and inducibility of resistance was measured across seven A. thaliana accessions that were previously selected based on constitutive levels of defence gene expression. According to theory, it was found that modes of resistance traded-off among accessions, particularly against S. littoralis, in which accessions investing in high constitutive resistance did not increase it substantially after attack and vice-versa. Accordingly, the average expression of eight genes involved in glucosinolate production negatively predicted larval growth across the seven accessions. Glucosinolate production and genes related to defence induction on healthy and herbivore-damaged plants were measured next. Surprisingly, only a partial correlation between glucosinolate production, gene expression, and the herbivore resistance results was found. These results suggest that the defence outcome of plants against herbivores goes beyond individual molecules or genes but stands on a complex network of interactions. PMID:25716695

  19. Lactobacillus reuteri-specific immunoregulatory gene rsiR modulates histamine production and immunomodulation by Lactobacillus reuteri.

    Science.gov (United States)

    Hemarajata, P; Gao, C; Pflughoeft, K J; Thomas, C M; Saulnier, D M; Spinler, J K; Versalovic, J

    2013-12-01

    Human microbiome-derived strains of Lactobacillus reuteri potently suppress proinflammatory cytokines like human tumor necrosis factor (TNF) by converting the amino acid l-histidine to the biogenic amine histamine. Histamine suppresses mitogen-activated protein (MAP) kinase activation and cytokine production by signaling via histamine receptor type 2 (H2) on myeloid cells. Investigations of the gene expression profiles of immunomodulatory L. reuteri ATCC PTA 6475 highlighted numerous genes that were highly expressed during the stationary phase of growth, when TNF suppression is most potent. One such gene was found to be a regulator of genes involved in histidine-histamine metabolism by this probiotic species. During the course of these studies, this gene was renamed the Lactobacillus reuteri-specific immunoregulatory (rsiR) gene. The rsiR gene is essential for human TNF suppression by L. reuteri and expression of the histidine decarboxylase (hdc) gene cluster on the L. reuteri chromosome. Inactivation of rsiR resulted in diminished TNF suppression in vitro and reduced anti-inflammatory effects in vivo in a trinitrobenzene sulfonic acid (TNBS)-induced mouse model of acute colitis. A L. reuteri strain lacking an intact rsiR gene was unable to suppress colitis and resulted in greater concentrations of serum amyloid A (SAA) in the bloodstream of affected animals. The PhdcAB promoter region targeted by rsiR was defined by reporter gene experiments. These studies support the presence of a regulatory gene, rsiR, which modulates the expression of a gene cluster known to mediate immunoregulation by probiotics at the transcriptional level. These findings may point the way toward new strategies for controlling gene expression in probiotics by dietary interventions or microbiome manipulation. PMID:24123819

  20. Increased isobutanol production in Saccharomyces cerevisiae by overexpression of genes in valine metabolism

    DEFF Research Database (Denmark)

    Chen, Xiao; Nielsen, Kristian Fog; Borodina, Irina;

    2011-01-01

    production. Aerobic cultivations of the ILV2 ILV3 ILV5 overexpression strain and the reference strain showed that supplying amino acids in cultivation media gave a substantial improvement in isobutanol production for the reference strain, but not for the ILV2 ILV3 ILV5 overexpression strain. This result....... Overexpression of ILV6, encoding the regulatory subunit of Ilv2, in the ILV2 ILV3 ILV5 overexpression strain decreased isobutanol production yield by threefold. In aerobic cultivations in shake flasks in mineral medium, the isobutanol yield of the ILV2 ILV3 ILV5 overexpression strain and the reference strain...... were 3.86 and 0.28 mg per g glucose, respectively. They increased to 4.12 and 2.4 mg per g glucose in yeast extract/peptone/dextrose (YPD) complex medium under aerobic conditions, respectively. CONCLUSIONS: Overexpression of genes ILV2, ILV3, ILV5, and BAT2 in valine metabolism led to an increase in...

  1. Methyl jasmonate and miconazole differently affect arteminisin production and gene expression in Artemisia annua suspension cultures.

    Science.gov (United States)

    Caretto, S; Quarta, A; Durante, M; Nisi, R; De Paolis, A; Blando, F; Mita, G

    2011-01-01

    Artemisia annua L. is a herb traditionally used for treatment of fevers. The glandular trichomes of this plant accumulate, although at low levels, artemisinin, which is highly effective against malaria. Due to the great importance of this compound, many efforts have been made to improve knowledge on artemisinin production both in plants and in cell cultures. In this study, A. annua suspension cultures were established in order to investigate the effects of methyl jasmonate (MeJA) and miconazole on artemisinin biosynthesis. Twenty-two micro molar MeJA induced a three-fold increase of artemisinin production in around 30 min; while 200 μm miconazole induced a 2.5-fold increase of artemisinin production after 24 h, but had severe effects on cell viability. The influence of these treatments on expression of biosynthetic genes was also investigated. MeJA induced up-regulation of CYP71AV1, while miconazole induced up-regulation of CPR and DBR2. PMID:21143725

  2. Cellulosic Ethanol Production by Recombinant Cellulolytic Bacteria Harbouring pdc and adh II Genes of Zymomonas mobilis

    Directory of Open Access Journals (Sweden)

    P. Sobana Piriya

    2012-01-01

    Full Text Available The ethanol fermenting genes such as pyruvate decarboxylase (pdc and alcohol dehydrogenase II (adh II were cloned from Zymomonas mobilis and transformed into three different cellulolytic bacteria, namely Enterobacter cloacae JV, Proteus mirabilis JV and Erwinia chrysanthemi and their cellulosic ethanol production capability was studied. Recombinant E. cloacae JV was found to produce 4.5% and 3.5% (v/v ethanol, respectively, when CMC and 4% NaOH pretreated bagasse were used as substrates, whereas recombinant P. mirabilis and E. chrysanthemi with the same substrates could only produce 4%, 3.5%, 1%, and 1.5 % of ethanol, respectively. The recombinant E. cloacae strain produced twofold higher percentage of ethanol than the wild type. The recombinant E. cloacae strain could be improved further by increasing its ethanol tolerance capability through media optimization and also by combining multigene cellulase expression for enhancing ethanol production from various types of lignocellulosic biomass so that it can be used for industrial level ethanol production.

  3. SYBR® Green qPCR Screening Methods for Detection of Anti-herbicide Genes in Genetically Modiifed Processed Products

    Institute of Scientific and Technical Information of China (English)

    Zhen Zhen; Lv Wei; Tang Zhi-fen; Liu Ying; Ao Jin-xia; Yuan Xiao-han; Zhang Ming-hui; Qiu You-wen; Gao Xue-jun

    2016-01-01

    The use of genetically modified organisms (GMOs) as food products becomes more and more widespread. The European Union has implemented a set of very strict procedures for the approval to grow, import and/or utilize GMOs as food or food ingredients. Thus, analytical methods for detection of GMOs are necessary in order to verify compliance with labelling requirements. There are few effective screening methods for processed GM (genetically modified) products. Three anti-herbicide genes (CP4-EPSPS,BAR andPAT) are common exogenous genes used in commercialized transgenic soybean, maize and rice. In the present study, a new SYBR® Green qPCR screening method was developed to simultaneously detect the three exogenous anti-herbicide genes and one endogenous gene in a run. We tested seven samples of representative processed products (soya lecithin, soya protein powder, chocolate beverage, infant rice cereal, maize protein powder, maize starch, and maize jam) using the developed method, and amplicons of endogenous gene and transgenic fragments were obtained from all the processed products, and the sensitivity was 0.1%. These results indicated that SYBR® Green qPCR screening method was appropriate for qualitative detection of transgenic soybean, maize and rice in processed products.

  4. Advanced Glycation End-Products affect transcription factors regulating insulin gene expression

    International Nuclear Information System (INIS)

    Advanced Glycation End-Products (AGEs) are generated by the covalent interaction of reducing sugars with proteins, lipids or nucleic acids. AGEs are implicated in diabetic complications and pancreatic β-cell dysfunction. We previously demonstrated that exposure of the pancreatic islet cell line HIT-T15 to high concentrations of AGEs leads to a significant decrease of insulin secretion and content. Insulin gene transcription is positively regulated by the beta cell specific transcription factor PDX-1 (Pancreatic and Duodenal Homeobox-1). On the contrary, the forkhead transcription factor FoxO1 inhibits PDX-1 gene transcription. Activity of FoxO1 is regulated by post-translational modifications: phosphorylation deactivates FoxO1, and acetylation prevents FoxO1 ubiquitination. In this work we investigated whether AGEs affect expression and subcellular localization of PDX-1 and FoxO1. HIT-T15 cells were cultured for 5 days in presence of AGEs. Cells were then lysed and processed for subcellular fractionation. We determined intracellular insulin content, then we assessed the expression and subcellular localization of PDX-1, FoxO1, phosphoFoxO1 and acetylFoxO1. As expected intracellular insulin content was lower in HIT-T15 cells cultured with AGEs. The results showed that AGEs decreased expression and nuclear localization of PDX-1, reduced phosphorylation of FoxO1, and increased expression and acetylation of FoxO1. These results suggest that AGEs decrease insulin content unbalancing transcription factors regulating insulin gene expression.

  5. Gene-based vaccine development for improving animal production in developing countries. Possibilities and constraints

    International Nuclear Information System (INIS)

    For vaccine production, recombinant antigens must be protective. Identifying protective antigens or candidate antigens is an essential precursor to vaccine development. Even when a protective antigen has been identified, cloning of its gene does not lead directly to vaccine development. The fimbrial protein of Dichelobacter nodosus, the agent of foot-rot in ruminants, was known to be protective. Recombinant vaccines against this infection are ineffective if expressed protein subunits are not assembled as mature fimbriae. Antigenic competition between different, but closely related, recombinant antigens limited the use of multivalent vaccines based on this technology. Recombinant antigens may need adjuvants to enhance response. DNA vaccines, potentiated with genes for different cytokines, may replace the need for aggressive adjuvants, and especially where cellular immunity is essential for protection. The expression of antigens from animal pathogens in plants and the demonstration of some immunity to a disease like rinderpest after ingestion of these, suggests an alternative approach to vaccination by injection. Research on disease pathogenesis and the identification of candidate antigens is specific to the disease agent. The definition of expression systems and the formulation of a vaccine for each disease must be followed by research to establish safety and efficacy. Where vaccines are based on unique gene sequences, the intellectual property is likely to be protected by patent. Organizations, licensed to produce recombinant vaccines, expect to recover their costs and to make a profit. The consequence is that genetically-derived vaccines are expensive. The capacity of vaccines to help animal owners of poorer countries depends not only on quality and cost but also on the veterinary infrastructure where they are used. Ensuring the existence of an effective animal health infrastructure in developing countries is as great a challenge for the developed world as

  6. Evaluation of Retinoblastoma Gene Product (RB) as A Prognostic Indicator in Bladder Carcinoma

    International Nuclear Information System (INIS)

    Despite precise pathologic staging and grading, we are unable to predict clinical outcome in patients with bladder cancer. The retinoblastoma susceptibility gene (RB) a prototype of tumour suppressor genes, thought to function as a cell cycle regulator, has recently been associated with development and/or progression of bladder cancer, as well as sarcoma and small cell lung cancer. Purpose: The aim of this study was to investigate the hypothesis that altered patterns of RB expression correlate with prognosis and with tumour cell growth fraction in bladder cancer. Methods: Tumours from 40 patients with primary transitional cell carcinoma were studied. Expression of RB gene product was assessed immuno histochemically. The proportion of cells expressing the ki 67 antigen was also detected. Results: Three patterns of RB protein staining were observed, absent n = 12, heterogenous n = 23 and strongly homogenous n = 5. Cases with loss of RB protein and those with apparent over expression were considered to have an altered RB protein expression. Altered expression of RB was significantly associated with muscle invasive growth and high tumour grade (ρ< 0.0001, ρ< 001) respectively. The 5 years survival rate was significantly decreased in patients with altered RB protein expression compared with patients with normal expression of RB (ρ< 0.05). There were significant differences in the ki 67 index between poorly (G3) and better (G I/G2) differentiated tumours and between invasive and non muscle invasive tumours. Conclusion: This study suggests that altered patterns of RB protein expression may be an important prognostic variable in patients presenting with invasive bladder cancer

  7. Gene expression profiling defined pathways correlated with fibroblast cell proliferation induced by Opisthorchis viverrini excretory/secretory product

    Institute of Scientific and Technical Information of China (English)

    Chanitra Thuwajit; Peti Thuwajit; Kazuhiko Uchida; Daoyot Daorueang; Sasithorn Kaewkes; Sopit Wongkham; Masanao Miwa

    2006-01-01

    AIM: To investigate the mechanism of fibroblast cell proliferation stimulated by the Opisthorchis viverrini excretory/secretory (ES) product.METHODS: NIH-3T3, mouse fibroblast cells were treated with O. viverrini ES product by non-contact co-cultured with the adult parasites. Total RNA from NIH-3T3 treated and untreated with O. viverrini was extracted, reverse transcribed and hybridized with the mouse 15K complementary DNA (cDNA) array. The result was analyzed by ArrayVision version 5 and GeneSpring version 5 softwares. After normalization, the ratios of gene expression of parasite treated to untreated NIH3T3 cells of 2-and more-fold upregulated was defined as the differentially expressed genes. The expression levels of the signal transduction genes were validated by semiquantitative SYBR-based real-time RT-PCR.RESULTS: Among a total of 15 000 genes/ESTs, 239genes with established cell proliferation-related function were 2 fold-and more-up-regulated by O. viverrini ES product compared to those in cells without exposure to the parasitic product. These genes were classified into groups including energy and metabolism, signal transduction, protein synthesis and translation, matrix and structural protein, transcription control, cell cycle and DNA replication. Moreover, the expressions of serinethreonine kinase receptor, receptor tyrosine kinase and collagen production-related genes were up-regulated by O. viverrini ES product. The expression level of signal transduction genes; pkC, pdgfrα, jak 1, eps 8, tgfβ 1/4,strap and h ras measured by real-time RT-PCR confirmed their expression levels to those obtained from cDNA array. However, only the up-regulated expression of pkC, eps 8 and tgfβ 1/4 which are the downstream signaling molecules of either epidermal growth factor (EGF) or transforming growth factor-β (TGF-β) showed statistical significance (P < 0.05). CONCLUSION: O. viverrini ES product stimulates the significant changes of gene expression in several

  8. Functional analysis of the Borrelia burgdorferi bba64 gene product in murine infection via tick infestation.

    Directory of Open Access Journals (Sweden)

    Toni G Patton

    Full Text Available Borrelia burgdorferi, the causative agent of Lyme borreliosis, is transmitted to humans from the bite of Ixodes spp. ticks. During the borrelial tick-to-mammal life cycle, B. burgdorferi must adapt to many environmental changes by regulating several genes, including bba64. Our laboratory recently demonstrated that the bba64 gene product is necessary for mouse infectivity when B. burgdorferi is transmitted by an infected tick bite, but not via needle inoculation. In this study we investigated the phenotypic properties of a bba64 mutant strain, including 1 replication during tick engorgement, 2 migration into the nymphal salivary glands, 3 host transmission, and 4 susceptibility to the MyD88-dependent innate immune response. Results revealed that the bba64 mutant's attenuated infectivity by tick bite was not due to a growth defect inside an actively feeding nymphal tick, or failure to invade the salivary glands. These findings suggested there was either a lack of spirochete transmission to the host dermis or increased susceptibility to the host's innate immune response. Further experiments showed the bba64 mutant was not culturable from mouse skin taken at the nymphal bite site and was unable to establish infection in MyD88-deficient mice via tick infestation. Collectively, the results of this study indicate that BBA64 functions at the salivary gland-to-host delivery interface of vector transmission and is not involved in resistance to MyD88-mediated innate immunity.

  9. Invertase production by Aspergillus and Penicillium and sequencing of an inv gene fragment

    Directory of Open Access Journals (Sweden)

    A. C. Flores-Gallegos

    2012-01-01

    Full Text Available Invertase (B-fructofuranosidase is an enzyme used in the food industry, where sugar mixtures are preferred to glucose because they are sweeter and do not crystallize easily. In this study, a biochemical characterization of five fungal strains isolated from a Mexican semi-desert (Aspergillus niger GH1, A. fumigatus GS, Penicillium purpurogenum GH2, P. citrinum ESS, P. pinophilum EH2 was carried out. Evaluation of maximal growth of the strains on potato dextrose agar at several temperatures and pH values, as well as the assessment of invertase production using polyurethane foam as a non-biodegradable support, were performed. The highest growth rates corresponded to A. niger GH1 (0.2831 mm/h, and P. citrinum ESS (0.1931 mm/h. The maximum invertase yield was 81,270 U/L per min, determined for A. niger GH1 at 72 h. Oligonucleotide primers were designed for amplification of sequences from the invertase gene, InvF 5 ACGTCTGGCTGTCCGGTGAC and InvR 5 ACCGAACCCAAGTACTCAACGCA 3, showing an optimum annealing temperature of 61.6 C. DNA fragments of about 560 bp were obtained and sequenced, corresponding to the putative invertase gene of Aspergillus.

  10. Relationship between gene polymorphism and milk production traits in Teleorman Black Head sheep breed

    Directory of Open Access Journals (Sweden)

    Gras MA

    2015-12-01

    Full Text Available Objective. This study is a preliminary step of a larger national program aimed to develop a strategy for “in situ” preservation of Teleorman Black Head sheep population. In this paper we estimated the effect of β-lactoglobulin, casein and prolactin on some quantitative and qualitative milk traits in this local sheep population. Material and methods. Genotyping methodology included PCR for CSN3 (A and B alleles and PCR-RFLP for LGB (A and B alleles and PRL (T and C alleles, respectively. Repeated milking and milk composition analysis were used for the polymorphism effect estimation. Results. No association between CSN3 polymorphism and milk traits was found. Effect of LGB on production traits was quite constant. Genotype AA performed better than BB. PRL marker effect showed small differences than LGB. Concerning milk, fat and protein yield, AA genotype for PRL had a smaller positive impact than AA genotype for LGB. Regarding fat and protein content, PRL showed a negative effect for AA and positive for BB genotype, respectively. Conclusions. Positive association between LGB and milk yield and composition recommend this candidate gene like marker for a future MAS program. Although PRL gene is also associated with an increased milk quantity, inverse response over milk composition must be considered in MAS strategy. Our study demonstrated that both LGB and PRL markers could became an advent of MAS utilization in Romanian dairy sheep breeding industry.

  11. Carotenoid production and gene expression in an astaxanthin-overproducing Xanthophyllomyces dendrorhous mutant strain.

    Science.gov (United States)

    Castelblanco-Matiz, Lina M; Barbachano-Torres, Alejandra; Ponce-Noyola, Teresa; Ramos-Valdivia, Ana C; Cerda García-Rojas, Carlos M; Flores-Ortiz, César M; Barahona-Crisóstomo, Salvador K; Baeza-Cancino, Marcelo E; Alcaíno-Gorman, Jennifer; Cifuentes-Guzmán, Víctor H

    2015-12-01

    The primary carotenoid synthesized by Xanthophyllomyces dendrorhous is astaxanthin, which is used as a feed additive in aquaculture. Cell growth kinetics and carotenoid production were correlated with the mRNA levels of the idi, crtE, crtYB, crtI, crtS and crtR genes, and the changes in gene sequence between the wild-type and a carotenoid overproducer XR4 mutant strain were identified. At the late stationary phase, the total carotenoid content in XR4 was fivefold higher than that of the wild-type strain. Additionally, the mRNA levels of crtE and crtS increased during the XR4 growth and were three times higher than the wild-type strain in the late stationary phase. Moreover, the nucleotide sequences of crtYB, crtI and crtR exhibited differences between the strains. Both the higher crtE and crtS transcript levels and the crtYB, crtI and crtR mutations can, at least in part, act to up-regulate the carotenoid biosynthesis pathway in the XR4 strain. PMID:26377586

  12. Effects of CSN3 and LGB gene polymorphisms on production traits in beef cattle

    Directory of Open Access Journals (Sweden)

    Rogério A. Curi

    2005-01-01

    Full Text Available The objective of the present study was to estimate the allele and genotype frequencies of the CSN3/HinfI and LGB/HaeIII gene polymorphisms in beef cattle belonging to different genetic groups, and to determine the effects of these polymorphisms on growth and carcass traits in these animals, which are submitted to an intensive production model. Genotyping was performed on 79 Nelore, 30 Canchim (5/8 Charolais + 3/8 Zebu and 275 crossbred cattle originating from the crosses of Simmental (n = 30 and Angus (n = 245 sires with Nelore females. Body weight, weight gain, dressing percentage, longissimus dorsi area and backfat thickness were fitted using the GLM procedure, and least square means of the genotypes were compared by the F test. The results showed that the CSN3/HinfI and LGB/HaeIII polymorphisms did not have any effect on growth or carcass traits (p > 0.05.

  13. In vitro complementation assay for the Escherichia coli uvrD gene product

    Energy Technology Data Exchange (ETDEWEB)

    Kuemmerle, N.B.; Masker, W.E.

    1983-01-01

    An in vitro assay for the product of the uvrD gene of Escherichia coli has been developed. This assay, derived from properties of uvrD mutants revealed by in vivo experiments, is based on the necessity for a functional uvrD protein for complete rejoining of covalently closed circular DNA during the excision repair of UV-induced damage. Extracts prepared from gently lysed uvrD101 mutant cells are capable of restoring UV-damaged DNA to its covalently closed circular form when provided with a functional uvrD protein from other repair-deficient cell extracts or from partially purified protein fractions. This assay was employed to monitor the activity of the uvrD protein after several steps of fractionation.

  14. Heterologous expression of leader-less pga gene in Pichia pastoris: intracellular production of prokaryotic enzyme

    Directory of Open Access Journals (Sweden)

    Kyslík Pavel

    2010-02-01

    Full Text Available Abstract Background Penicillin G acylase of Escherichia coli (PGAEc is a commercially valuable enzyme for which efficient bacterial expression systems have been developed. The enzyme is used as a catalyst for the hydrolytic production of β-lactam nuclei or for the synthesis of semi-synthetic penicillins such as ampicillin, amoxicillin and cephalexin. To become a mature, periplasmic enzyme, the inactive prepropeptide of PGA has to undergo complex processing that begins in the cytoplasm (autocatalytic cleavage, continues at crossing the cytoplasmic membrane (signal sequence removing, and it is completed in the periplasm. Since there are reports on impressive cytosolic expression of bacterial proteins in Pichia, we have cloned the leader-less gene encoding PGAEc in this host and studied yeast production capacity and enzyme authenticity. Results Leader-less pga gene encoding PGAEcunder the control of AOX1 promoter was cloned in Pichia pastoris X-33. The intracellular overproduction of heterologous PGAEc(hPGAEc was evaluated in a stirred 10 litre bioreactor in high-cell density, fed batch cultures using different profiles of transient phases. Under optimal conditions, the average volumetric activity of 25900 U l-1 was reached. The hPGAEc was purified, characterized and compared with the wild-type PGAEc. The α-subunit of the hPGAEc formed in the cytosol was processed aberrantly resulting in two forms with C- terminuses extended to the spacer peptide. The enzyme exhibited modified traits: the activity of the purified enzyme was reduced to 49%, the ratios of hydrolytic activities with cephalexin, phenylacetamide or 6-nitro-3-phenylacetylamidobenzoic acid (NIPAB to penicillin G increased and the enzyme showed a better synthesis/hydrolysis ratio for the synthesis of cephalexin. Conclusions Presented results provide useful data regarding fermentation strategy, intracellular biosynthetic potential, and consequences of the heterologous expression of PGAEc

  15. Ghrelin gene products and the regulation of food intake and gut motility.

    Science.gov (United States)

    Chen, Chih-Yen; Asakawa, Akihiro; Fujimiya, Mineko; Lee, Shou-Dong; Inui, Akio

    2009-12-01

    A breakthrough using "reverse pharmacology" identified and characterized acyl ghrelin from the stomach as the endogenous cognate ligand for the growth hormone (GH) secretagogue receptor (GHS-R) 1a. The unique post-translational modification of O-n-octanoylation at serine 3 is the first in peptide discovery history and is essential for GH-releasing ability. Des-acyl ghrelin, lacking O-n-octanoylation at serine 3, is also produced in the stomach and remains the major molecular form secreted into the circulation. The third ghrelin gene product, obestatin, a novel 23-amino acid peptide identified from rat stomach, was found by comparative genomic analysis. Three ghrelin gene products actively participate in modulating appetite, adipogenesis, gut motility, glucose metabolism, cell proliferation, immune, sleep, memory, anxiety, cognition, and stress. Knockdown or knockout of acyl ghrelin and/or GHS-R1a, and overexpression of des-acyl ghrelin show benefits in the therapy of obesity and metabolic syndrome. By contrast, agonism of acyl ghrelin and/or GHS-R1a could combat human anorexia-cachexia, including anorexia nervosa, chronic heart failure, chronic obstructive pulmonary disease, liver cirrhosis, chronic kidney disease, burn, and postsurgery recovery, as well as restore gut dysmotility, such as diabetic or neurogenic gastroparesis, and postoperative ileus. The ghrelin acyl-modifying enzyme, ghrelin O-Acyltransferase (GOAT), which attaches octanoate to serine-3 of ghrelin, has been identified and characterized also from the stomach. To date, ghrelin is the only protein to be octanylated, and inhibition of GOAT may have effects only on the stomach and is unlikely to affect the synthesis of other proteins. GOAT may provide a critical molecular target in developing novel therapeutics for obesity and type 2 diabetes. PMID:20038570

  16. Lactobacillus reuteri-Specific Immunoregulatory Gene rsiR Modulates Histamine Production and Immunomodulation by Lactobacillus reuteri

    OpenAIRE

    Hemarajata, P; Gao, C; Pflughoeft, K. J.; Thomas, C M; Saulnier, D. M.; Spinler, J. K.; Versalovic, J

    2013-01-01

    Human microbiome-derived strains of Lactobacillus reuteri potently suppress proinflammatory cytokines like human tumor necrosis factor (TNF) by converting the amino acid l-histidine to the biogenic amine histamine. Histamine suppresses mitogen-activated protein (MAP) kinase activation and cytokine production by signaling via histamine receptor type 2 (H2) on myeloid cells. Investigations of the gene expression profiles of immunomodulatory L. reuteri ATCC PTA 6475 highlighted numerous genes th...

  17. The role of nucleotide binding and hydrolysis in the function of the fission yeast cdc18(+) gene product.

    OpenAIRE

    DeRyckere, D; Smith, C.L.; Martin, G S

    1999-01-01

    The fission yeast cdc18(+) gene is required for both initiation of DNA replication and the mitotic checkpoint that normally inhibits mitosis in the absence of DNA replication. The cdc18(+) gene product contains conserved Walker A and B box motifs. Studies of other ATPases have shown that these motifs are required for nucleotide binding and hydrolysis, respectively. We have observed that mutant strains in which either of these motifs is disrupted are inviable. The effects of these mutations we...

  18. Overexpression of D-Xylose Reductase (xyl1) Gene and Antisense Inhibition of D-Xylulokinase (xyiH) Gene Increase Xylitol Production in Trichoderma reesei

    Science.gov (United States)

    Hong, Yuanyuan; Dashtban, Mehdi; Kepka, Greg; Chen, Sanfeng; Qin, Wensheng

    2014-01-01

    T. reesei is an efficient cellulase producer and biomass degrader. To improve xylitol production in Trichoderma reesei strains by genetic engineering, two approaches were used in this study. First, the presumptive D-xylulokinase gene in T. reesei (xyiH), which has high homology to known fungi D-xylulokinase genes, was silenced by transformation of T. reesei QM9414 strain with an antisense construct to create strain S6-2-2. The expression of the xyiH gene in the transformed strain S6-2-2 decreased at the mRNA level, and D-xylulokinase activity decreased after 48 h of incubation. This led to an increase in xylitol production from undetectable levels in wild-type T. reesei QM9414 to 8.6 mM in S6-2-2. The T. reesei Δxdh is a xylose dehydrogenase knockout strain with increased xylitol production compared to the wild-type T. reesei QM9414 (22.8 mM versus undetectable). The copy number of the xylose reductase gene (xyl1) in T. reesei Δxdh strain was increased by genetic engineering to create a new strain Δ9-5-1. The Δ9-5-1 strain showed a higher xyl1 expression and a higher yield of xylose reductase, and xylitol production was increased from 22.8 mM to 24.8 mM. Two novel strains S6-2-2 and Δ9-5-1 are capable of producing higher yields of xylitol. T. reesei has great potential in the industrial production of xylitol. PMID:25013760

  19. Overexpression of D-Xylose Reductase (xyl1 Gene and Antisense Inhibition of D-Xylulokinase (xyiH Gene Increase Xylitol Production in Trichoderma reesei

    Directory of Open Access Journals (Sweden)

    Yuanyuan Hong

    2014-01-01

    Full Text Available T. reesei is an efficient cellulase producer and biomass degrader. To improve xylitol production in Trichoderma reesei strains by genetic engineering, two approaches were used in this study. First, the presumptive D-xylulokinase gene in T. reesei (xyiH, which has high homology to known fungi D-xylulokinase genes, was silenced by transformation of T. reesei QM9414 strain with an antisense construct to create strain S6-2-2. The expression of the xyiH gene in the transformed strain S6-2-2 decreased at the mRNA level, and D-xylulokinase activity decreased after 48 h of incubation. This led to an increase in xylitol production from undetectable levels in wild-type T. reesei QM9414 to 8.6 mM in S6-2-2. The T. reesei Δxdh is a xylose dehydrogenase knockout strain with increased xylitol production compared to the wild-type T. reesei QM9414 (22.8 mM versus undetectable. The copy number of the xylose reductase gene (xyl1 in T. reesei Δxdh strain was increased by genetic engineering to create a new strain Δ9-5-1. The Δ9-5-1 strain showed a higher xyl1 expression and a higher yield of xylose reductase, and xylitol production was increased from 22.8 mM to 24.8 mM. Two novel strains S6-2-2 and Δ9-5-1 are capable of producing higher yields of xylitol. T. reesei has great potential in the industrial production of xylitol.

  20. Enhanced production of shikimic acid using a multi-gene co-expression system in Escherichia coli.

    Science.gov (United States)

    Liu, Xiang-Lei; Lin, Jun; Hu, Hai-Feng; Zhou, Bin; Zhu, Bao-Quan

    2016-04-01

    Shikimic acid (SA) is the key synthetic material for the chemical synthesis of Oseltamivir, which is prescribed as the front-line treatment for serious cases of influenza. Multi-gene expression vector can be used for expressing the plurality of the genes in one plasmid, so it is widely applied to increase the yield of metabolites. In the present study, on the basis of a shikimate kinase genetic defect strain Escherichia coli BL21 (ΔaroL/aroK, DE3), the key enzyme genes aroG, aroB, tktA and aroE of SA pathway were co-expressed and compared systematically by constructing a series of multi-gene expression vectors. The results showed that different gene co-expression combinations (two, three or four genes) or gene orders had different effects on the production of SA. SA production of the recombinant BL21-GBAE reached to 886.38 mg·L(-1), which was 17-fold (P < 0.05) of the parent strain BL21 (ΔaroL/aroK, DE3). PMID:27114316

  1. Production of p53 gene knockout rats by homologous recombination in embryonic stem cells

    OpenAIRE

    Tong, Chang; Li, Ping; Wu, Nancy L; Yan, Youzhen; Ying, Qi-Long

    2010-01-01

    The use of homologous recombination to modify genes in embryonic stem (ES) cells provides a powerful means to elucidate gene function and create disease models1. Application of this technology to engineer genes in rats has previously been impossible in the absence of germline competent ES cells in this species. We have recently established authentic rat ES cells2, 3. Here we report the generation of the first gene knockout rats using the ES cell-based gene targeting technology. We designed a ...

  2. A lentiviral gene therapy strategy for the in vitro production of feline erythropoietin.

    Directory of Open Access Journals (Sweden)

    Natalia Vapniarsky

    Full Text Available Nonregenerative anemia due to chronic renal failure is a common problem in domestic cats. Unfortunately, administration of recombinant human erythropoietin often only improves anemia temporarily due to antibody development. In this in vitro study, feline erythropoietin cDNA was cloned from feline renal tissue and utilized in the construction of a replication-defective lentiviral vector. The native recombinant feline erythropoietin (rfEPO sequence was confirmed by sequencing. Upon viral vector infection of human 293H cells, Crandall Renal Feline Kidney cell line and primary feline peripheral blood mononuclear cells, bioactive rfEPO protein was produced. The presence of cellular rfEPO cDNA was confirmed by standard PCR, production of abundant rfEPO mRNA was confirmed by real-time PCR, and secretion of rfEPO protein was demonstrated by Western blot analyses, while rfEPO protein bioactivity was confirmed via an MTT proliferation bioassay. This in vitro study demonstrates the feasibility of a replication-defective lentiviral vector delivery system for the in vitro production of biologically active feline erythropoietin. Anemic cats with chronic renal failure represent a potential in vivo application of a lentiviral gene therapy system.

  3. Effect of inhibin gene immunization on antibody production and reproductive performance in Partridge Shank hens.

    Science.gov (United States)

    Mao, Dagan; Bai, Wujiao; Hui, Fengming; Yang, Liguo; Cao, Shaoxian; Xu, Yinxue

    2016-04-01

    To investigate the effect of inhibin gene immunization on antibody production and reproductive performance in broiler breeder females, Partridge Shank hens aged 380 days were immunized with inhibin recombinant plasmid pcISI. One hundred and twenty hens were randomly assigned to four groups and treated intramuscularly with 25, 75, or 125 μg/300-μL inhibin recombinant plasmid pcISI (T1∼T3) or 300-μL saline as control (C), respectively. Booster immunization was given with the same dosage 20 days later. Blood and egg samples were collected to detect the antibody against inhibin by enzyme-linked immunosorbent assay and to evaluate egg performance. The ovaries were collected to classify the follicles and detect the FSH receptor (FSHR) messenger RNA (mRNA) expression by reverse transcription-PCR. The results showed that immunization against pcISI could elicit antibody against inhibin in both plasma and egg yolk compared with the control (P lay during the first 30 days after primary vaccination (P laying performance in Partridge Shank hens, which provides a good foundation for the application of inhibin DNA vaccine in avian production. PMID:26739531

  4. Early Determination of Animals with Favorable Genes in Milk Production for Profitable Private Farms

    Directory of Open Access Journals (Sweden)

    Daniela E. Ilie

    2010-05-01

    Full Text Available The primary goal of dairy industry has been to identify an efficient and economical way of increasing milk production and its constituents without increasing the size of the dairy herd. The use of milk protein polymorphisms as detectable molecular markers has been studied intensively because of their effect on the yield and processing properties of milk and its products. Thus, molecular markers are promising alternative to the current methods of trait selection once these genes are proven to be associated with traits of interest in animals. Kappa-casein (CSN3 and beta-lactoglobulin (BLG are two of the most important proteins in the milk of mammals that play a crucial role in the milk quality and coagulation, an essential process for cheese and butter. The A and B variant of k-casein and β-lactoglobulin were distinguished by Polymerase Chain Reaction and Restriction Fragment Length Polymorphism (PCR-RFLP analysis in 108 Romanian Simmental and 60 Holstein Friesian cattle.

  5. Purification and characterization of the nifN and nifE gene products from Azotobacter vinelandii mutant UW45.

    OpenAIRE

    Paustian, T D; Shah, V K; Roberts, G P

    1989-01-01

    The nifN and -E gene products are involved in the synthesis of the iron-molybdenum cofactor of dinitrogenase, the enzyme responsible for the reduction of dinitrogen to ammonia. By using the in vitro iron-molybdenum cofactor biosynthesis assay, we have followed the purification of these gene products 450-fold to greater than 95% purity. An overall recovery of 20% was obtained with the purified protein having a specific activity of 6900 units/mg of protein. The protein (hereafter referred to as...

  6. Cloning and verification of the Lactococcus lactis pyrG gene and characterization of the gene product, CTP synthase

    DEFF Research Database (Denmark)

    Wadskov-Hansen, Steen Lyders Lerche; Willemoës, M.; Martinussen, Jan;

    2001-01-01

    The pyrG gene of Lactococcus lactis subsp. cremoris, encoding CTP synthase, has been cloned and sequenced. It is flanked upstream by an open reading frame showing homology to several aminotransferases and downstream by an open reading frame of unknown function. L. lactis strains harboring disrupted...

  7. Identification of candidate genes for yeast engineering to improve bioethanol production in very high gravity and lignocellulosic biomass industrial fermentations

    Directory of Open Access Journals (Sweden)

    Pereira Francisco B

    2011-12-01

    Full Text Available Abstract Background The optimization of industrial bioethanol production will depend on the rational design and manipulation of industrial strains to improve their robustness against the many stress factors affecting their performance during very high gravity (VHG or lignocellulosic fermentations. In this study, a set of Saccharomyces cerevisiae genes found, through genome-wide screenings, to confer resistance to the simultaneous presence of different relevant stresses were identified as required for maximal fermentation performance under industrial conditions. Results Chemogenomics data were used to identify eight genes whose expression confers simultaneous resistance to high concentrations of glucose, acetic acid and ethanol, chemical stresses relevant for VHG fermentations; and eleven genes conferring simultaneous resistance to stresses relevant during lignocellulosic fermentations. These eleven genes were identified based on two different sets: one with five genes granting simultaneous resistance to ethanol, acetic acid and furfural, and the other with six genes providing simultaneous resistance to ethanol, acetic acid and vanillin. The expression of Bud31 and Hpr1 was found to lead to the increase of both ethanol yield and fermentation rate, while Pho85, Vrp1 and Ygl024w expression is required for maximal ethanol production in VHG fermentations. Five genes, Erg2, Prs3, Rav1, Rpb4 and Vma8, were found to contribute to the maintenance of cell viability in wheat straw hydrolysate and/or the maximal fermentation rate of this substrate. Conclusions The identified genes stand as preferential targets for genetic engineering manipulation in order to generate more robust industrial strains, able to cope with the most significant fermentation stresses and, thus, to increase ethanol production rate and final ethanol titers.

  8. Quorum sensing in Escherichia coli, Salmonella typhimurium, and Vibrio harveyi: A new family of genes responsible for autoinducer production

    Science.gov (United States)

    Surette, Michael G.; Miller, Melissa B.; Bassler, Bonnie L.

    1999-01-01

    In bacteria, the regulation of gene expression in response to changes in cell density is called quorum sensing. Quorum-sensing bacteria produce, release, and respond to hormone-like molecules (autoinducers) that accumulate in the external environment as the cell population grows. In the marine bacterium Vibrio harveyi two parallel quorum-sensing systems exist, and each is composed of a sensor–autoinducer pair. V. harveyi reporter strains capable of detecting only autoinducer 1 (AI-1) or autoinducer 2 (AI-2) have been constructed and used to show that many species of bacteria, including Escherichia coli MG1655, E. coli O157:H7, Salmonella typhimurium 14028, and S. typhimurium LT2 produce autoinducers similar or identical to the V. harveyi system 2 autoinducer AI-2. However, the domesticated laboratory strain E. coli DH5α does not produce this signal molecule. Here we report the identification and analysis of the gene responsible for AI-2 production in V. harveyi, S. typhimurium, and E. coli. The genes, which we have named luxSV.h., luxSS.t., and luxSE.c. respectively, are highly homologous to one another but not to any other identified gene. E. coli DH5α can be complemented to AI-2 production by the introduction of the luxS gene from V. harveyi or E. coli O157:H7. Analysis of the E. coli DH5α luxSE.c. gene shows that it contains a frameshift mutation resulting in premature truncation of the LuxSE.c. protein. Our results indicate that the luxS genes define a new family of autoinducer-production genes. PMID:9990077

  9. Heterologous expression and product identification of Colletotrichum lagenarium polyketide synthase encoded by the PKS1 gene involved in melanin biosynthesis.

    Science.gov (United States)

    Fujii, I; Mori, Y; Watanabe, A; Kubo, Y; Tsuji, G; Ebizuka, Y

    1999-08-01

    The Colletotrichum lagenarium PKS1 gene was expressed in the heterologous fungal host, Aspergillus oryzae, under the starch-inducible alpha-amylase promoter to identify the direct product of polyketide synthase (PKS) encoded by the PKS1 gene. The main compound produced by an A. oryzae transformant was isolated and characterized to be 1,3,6,8-tetrahydroxynaphthalene (T4HN) as its tetraacetate. Since the PKS1 gene was cloned from C. lagenarium to complement the nonmelanizing albino mutant, T4HN was assumed to be an initial biosynthetic intermediate, and thus the product of the PKS reaction, but had not been isolated from the fungus. The production of T4HN by the PKS1 transformant unambiguously identified the gene to encode a PKS of pentaketide T4HN. In addition, tetraketide orsellinic acid and pentaketide isocoumarin were isolated, the latter being derived from a pentaketide monocyclic carboxylic acid, as by-products of the PKS1 PKS reaction. Production of the pentaketide carboxylic acid provided insights into the mechanism for the PKS1 polyketide synthase reaction to form T4HN. PMID:10501004

  10. Cloning of a catabolite repression control (crc) gene from Pseudomonas aeruginosa, expression of the gene in Escherichia coli, and identification of the gene product in Pseudomonas aeruginosa.

    OpenAIRE

    MacGregor, C H; Wolff, J A; Arora, S K; Phibbs, P V

    1991-01-01

    Mutants which are defective in catabolite repression control (CRC) of multiple independently regulated catabolic pathways have been previously described. The mutations were mapped at 11 min on the Pseudomonas aeruginosa chromosome and designated crc. This report describes the cloning of a gene which restores normal CRC to these Crc- mutants in trans. The gene expressing this CRC activity was subcloned on a 2-kb piece of DNA. When this 2-kb fragment was placed in a plasmid behind a phage T7 pr...

  11. Genistein production in rice seed via transformation with soybean IFS genes.

    Science.gov (United States)

    Sohn, Soo-In; Kim, Yul-Ho; Kim, Sun-Lim; Lee, Jang-Yong; Oh, Young-Ju; Chung, Joo-Hee; Lee, Kyeong-Ryeol

    2014-03-01

    To produce genistein in rice, the isoflavone synthase (IFS) genes, SpdIFS1 and SpdIFS2 were cloned from the Korean soybean cultivar, Sinpaldalkong II as it has a higher genistein content than other soybean varieties. SpdIFS1 and SpdIFS2 show a 99.6% and 98.2% identity at the nucleotide level and 99.4% and 97.9% identity at the amino acid level, respectively, with IFS1 and IFS2 from soybean (GenBank accession Nos. AF195798 and AF195819). Plant expression vectors were constructed harboring SpdIFS1 or SpdIFS2 under the control of a rice globulin promoter that directs seed specific expression, and used to transform two rice varieties, Heugnam, a black rice, and Nakdong, a normal rice cultivar without anthocyanin pigment. Because naringenin, the substrate of SpdIFS1 and SpdIFS2, is on the anthocyanin biosynthesis pathway, the relative production rate of genistein was compared between SpdIFS-expressing transgenic Heugnam and Nakdong. Southern blot analysis of eight of the resulting transgenic rice plants revealed that the T0 plants had one to three copies of the SpdIFS1 or SpdIFS2 gene. The highest level of genistein content found in rice seeds was 103 μg/g. These levels were about 30-fold higher in our transgenic rice lines than the genistein aglycon content of a non-leguminous IFS-expressing transgenic tobacco petal, equaling about 12% of total genistein content of Sinpaldalkong II. There were no significant differences found between the genistein content in Heugnam and Nakdong transgenic rice plants. PMID:24467893

  12. The CYP2A3 gene product catalyzes coumarin 7-hydroxylation in human liver microsomes

    International Nuclear Information System (INIS)

    Three cDNAs, designated IIA3, IIA3v, and IIA4, coding for P450s in the CYP2A gene subfamily were isolated from a λgt11 library prepared from human hepatic mRNA. Only three nucleotide differences and a single amino acid difference, Leu160→His, were found between IIA3 and IIA3v, indicating that they are probably allelic variants. IIA4 displayed 94% amino acid similarity with IIA3 and IIA3v. The three cDNAs were inserted into vaccinia virus, and recombinant viruses were used to infect human hepatoma Hep G2 cells. Only IIA3 was able to produce an enzyme that had a reduced CO-bound spectrum with a λmax at 450 nm. This expressed enzyme was able to carry out coumarin 7-hydroxylation and ethoxycoumarin O-deethylation. cDNA-expressed IIA3v and IIA4 failed to incorporate heme and were enzymatically inactive. Analysis of IIA proteins in human liver microsomes, using antibody against rat IIA2, revealed two proteins of 49 and 50 kDa, the former of which appeared to correlate with human microsomal coumarin 7-hydroxylase activity. A more striking correlation was found between IIa mRNA and enzyme activity. The rat antibody was able to completely abolish coumarin 7-hydroxylase activity in 12 liver samples. These data establish that the CYP2A3 gene product is primarily responsible for coumarin 7-hydroxylase activity in human liver. The level of expression of this activity varied up to 40-fold between livers. Levels of IIA mRNA also varied significantly between liver specimens, and three specimens had no detectable mRNA

  13. Dynamic Linkages between Denitrification Functional Genes/Enzymes and Biogeochemical Reaction Rates of Nitrate and Its Reduction Products

    Science.gov (United States)

    Li, M.; Shi, L.; Qian, W.; Gao, Y.; Liu, Y.; Liu, C.

    2015-12-01

    Denitrification is a respiratory process in which oxidized nitrogen compounds are used as alternative electron acceptors for energy production when oxygen is limited. Denitrification is an important process that not only accounts for the significant loss of nitrogen fertilizers from soils but also leads to NO, N2O and CO2 emissions, which are important greenhouse gas species. In this study, denitrification was investigated in Columbia River sediments, focusing on the dynamic linkages between functional genes/enzymes and biogeochemical reaction rates of nitrate and its reduction products. NO3-, NO2- and N2O were assayed in different incubation time. DNA was extracted from the sediments and functional genes were quantified as a function of time during the denitrification. Functional enzymes were extracted from the sediments and measured using a newly developed, targeted protein method. The biogeochemical, functional gene, and enzyme data were collectively used to establish the dynamic correlation of functional genes/enzymes and biogeochemical reaction rates. The results provide fundamental insights regarding the dynamic regulation of functional genes and enzymes in the processes of denitrification and greenhouse gas production, and also provide experimental data critical for the development of biogeochemical reaction models that incorporate genome-scale insights and describe macroscopic biogeochemical reaction rates in ecosystems.

  14. Increased Production of Fatty Acids and Triglycerides in Aspergillus oryzae by Enhancing Expressions of Fatty Acid Synthesis-Related Genes

    Energy Technology Data Exchange (ETDEWEB)

    Tamano, Koichi; Bruno, Kenneth S.; Karagiosis, Sue A.; Culley, David E.; Deng, Shuang; Collett, James R.; Umemura, Myco; Koike, Hideaki; Baker, Scott E.; Machida, Masa

    2013-01-01

    Microbial production of fats and oils is being developedas a means of converting biomass to biofuels. Here we investigate enhancing expression of enzymes involved in the production of fatty acids and triglycerides as a means to increase production of these compounds in Aspergillusoryzae. Examination of the A.oryzaegenome demonstrates that it contains twofatty acid synthases and several other genes that are predicted to be part of this biosynthetic pathway. We enhancedthe expressionof fatty acid synthesis-related genes by replacing their promoters with thepromoter fromthe constitutively highly expressedgene tef1. We demonstrate that by simply increasing the expression of the fatty acid synthasegenes we successfullyincreasedtheproduction of fatty acids and triglyceridesby more than two fold. Enhancement of expression of the fatty acid pathway genes ATP-citrate lyase and palmitoyl-ACP thioesteraseincreasedproductivity to a lesser extent.Increasing expression ofacetyl-CoA carboxylase caused no detectable change in fatty acid levels. Increases in message level for each gene were monitored usingquantitative real-time RT-PCR. Our data demonstrates that a simple increase in the abundance of fatty acid synthase genes can increase the detectable amount of fatty acids.

  15. Study of gene expression and OTA production by Penicillium nordicum during a small-scale seasoning process of salami.

    Science.gov (United States)

    Ferrara, Massimo; Magistà, Donato; Epifani, Filomena; Cervellieri, Salvatore; Lippolis, Vincenzo; Gallo, Antonia; Perrone, Giancarlo; Susca, Antonia

    2016-06-16

    Penicillium nordicum, an important and consistent producer of ochratoxin A (OTA), is a widely distributed contaminant of protein rich food with elevated NaCl. It is usually found on dry-cured meat products and is considered the main species responsible for their contamination by OTA. The aim of this work was to study the gene expression of a polyketide synthase (otapksPN) involved in P. nordicum OTA biosynthesis, and OTA production during a small-scale seasoning process. Fresh pork sausages were surface inoculated with P. nordicum and seasoned for 30days. Gene expression and OTA production were monitored throughout the seasoning process after 4, 5, 6, 7, 10, 14, and 30days. The expression of otapksPN gene was already detected after 4days and increased significantly after 7days of seasoning, reaching the maximum expression level after 10days (1.69×10(4)copies/100mg). Consistently with gene expression monitoring, OTA was detected from the 4th day and its content increased significantly from the 7th day, reaching the maximum level after 10days. In the late stages of the seasoning process, OTA did not increase further and the number of gene copies was progressively reduced after 14 and 30days. PMID:27060649

  16. A Transposable Partitioning Locus Used To Stabilize Plasmid-Borne Hydrogen Oxidation and Trifolitoxin Production Genes in a Sinorhizobium Strain

    OpenAIRE

    Kent, Angela D.; Wojtasiak, Michelle L.; Robleto, Eduardo A.; Eric W Triplett

    1998-01-01

    Improved nitrogen-fixing inoculum strains for leguminous crops must be able to effectively compete with indigenous strains for nodulation, enhance legume productivity compared to the productivity obtained with indigenous strains, and maintain stable expression of any added genes in the absence of selection pressure. We constructed a transposable element containing the tfx region for expression of increased nodulation competitiveness and the par locus for plasmid stability. The transposon was ...

  17. Overexpression of bacterial ethylene-forming enzyme gene in Trichoderma reesei enhanced the production of ethylene

    OpenAIRE

    Chen, Xi; Liang, Yong; Hua, Jing; Tao, Li; Qin, Wensheng; Chen, Sanfeng

    2010-01-01

    In order to efficiently utilize natural cellulose materials to produce ethylene, three expression vectors containing the ethylene-forming enzyme (efe) gene from Pseudomonas syringae pv. glycinea were constructed. The target gene was respectively controlled by different promoters: cbh I promoter from Trichoderma reesei cellobiohydrolases I gene, gpd promoter from Aspergillus nidulans glyceraldehyde-3-phosphate dehydrogenase gene and pgk I promoter from T. reesei 3-phosphoglycerate kinase I gen...

  18. Identification of genes implicated in toxin production in the cyanobacterium Cylindrospermopsis raciborskii

    DEFF Research Database (Denmark)

    Schembri, Mark; Neilan, B.A.; Saint, C.P.

    2001-01-01

    strain-specific distribution of the PKS and PS genes in C. raciborskii isolates demonstrated a direct link between the presence of these two genes and the ability to produce cylindrospermopsin. Interestingly, the possession of these two genes was also linked. They were also identified in an Anabaena...

  19. Mapping of a gene that regulates hemolysin production in Vibrio cholerae.

    OpenAIRE

    von Mechow, S; Vaidya, A B; Bramucci, M G

    1985-01-01

    A gene that regulates the hemolysin structural gene (hly) was found to be tightly linked to the tox-1000 locus of Vibrio cholerae RJ1 and separated from hly by a large section of the V. cholerae genetic map. This hemolysin regulatory gene was designated hlyR.

  20. Overexpression and rapid purification of the orfE/rph gene product, RNase PH of Escherichia coli

    DEFF Research Database (Denmark)

    Jensen, Kaj Frank; Andersen, J T; Poulsen, Peter

    1992-01-01

    The pyrE gene, encoding the pyrimidine biosynthetic enzyme orotate phosphoribosyltransferase, is the promoter distal gene of the dicistronic orfE-pyrE operon. The promoter proximal orfE gene, whose transcription and translation is important for regulation of the pyrE attenuator, encodes a 238-amino...... acid residue protein which was recently identified as the phosphorolytic ribonuclease, RNase PH, that removes nucleotides from the 3' ends of tRNA precursors. In this paper we report the construction of a plasmid, which overexpresses the orfE and pyrE gene products substantially, as well as the....../min/mg, as characteristic for RNase PH. OrfE/RNase PH contains helix-turn-helix motifs resembling those in DNA-binding proteins, and it binds nonspecifically to DNA. On SDS gels, OrfE/RNase PH migrates as two distinct protein bands. This heterogeneity might be caused by post-translational modification other...

  1. Ethanol production by recombinant Escherichia coli carrying genes from Zymomonas mobilis.

    Science.gov (United States)

    Lawford, H G; Rousseau, J D

    1991-01-01

    Efficient utilization of lignocellulosic feedstocks offers an opportunity to reduce the cost of producing fuel ethanol. The fermentation performance characteristics of recombinant Escherichia coli ATCC 11303 carrying the "PET plasmid" (pLOI297) with the lac operon controlling the expression of pyruvate decarboxylase (pdc) and alcohol dehydrogenase II (adhB) genes cloned from Zymomonas mobilis CP4 (Alterthum & Ingram, 1989) were assessed in batch and continuous processes with sugar mixtures designed to mimic process streams from lignocellulosic hydrolysis systems. Growth was pseudoexponential at a rate (generation time) of 1.28 h at pH 6.8 and 1.61 h at pH 6.0. The molar growth yields for glucose and xylose were 17.28 and 7.65 g DW cell/mol, respectively (at pH 6.3 and 30 degrees C), suggesting that the net yield of ATP from xylose metabolism is only 50% compared to glucose. In pH-stat batch fermentations (Luria broth with 6% sugar, pH 6.3), glucose was converted to ethanol 4-6 times faster than xylose, but the glucose conversion rate was much less than can be achieved with comparable cell densities of Zymomonas. Sugar-to-ethanol conversion efficiencies in nutrient-rich, complex LB medium were near theoretical at 98 and 88% for glucose and xylose, respectively. The yield was 10-20% less in a defined-mineral-salts medium. Acetate at a concentration of 0.1M (present in lignocellulosic hydrolysates from thermochemical processing) inhibited glucose utilization (about 50%) much more than xylose, and caused a decrease in product yield of about 30% for both sugars. With phosphate-buffered media (pH 7), glucose was a preferred substrate in mixtures with a ratio of hexose to pentose of 2.3 to 1. Xylose was consumed after glucose, and the product yield was less (0.37 g/g). Under steady-state conditions of continuous culture, the specific productivity ranged from 0.76-1.24 g EtOH/g cell/h, and the maximum volumetric productivity, 2.5 g EtOH/L/h, was achieved with a rich

  2. Exploring the Transcriptome Landscape of Pomegranate Fruit Peel for Natural Product Biosynthetic Gene and SSR Marker Discovery

    Institute of Scientific and Technical Information of China (English)

    Nadia Nicole Ono; Monica Therese Britton; Joseph Nathaniel Fass; Charles Meyer Nicolet; Dawei Lin; Li Tian

    2011-01-01

    Pomegranate fruit peel is rich in bioactive plant natural products,such as hydrolyzable tannins and anthocyanins.Despite their documented roles in human nutrition and fruit quality,genes involved in natural product biosynthesis have not been cloned from pomegranate and very little sequence information is available on pomegranate in the public domain.Shotgun transcriptome sequencing of pomegranate fruit peel cDNA was performed using RNA-Seq on the Illumina Genome Analyzer platform.Over 100 million raw sequence reads were obtained and assembled into 9,839 transcriptome assemblies (TAs) (>200 bp).Candidate genes for hydrolyzable tannin,anthocyanin,flavonoid,terpenoid and fatty acid biosynthesis and/or regulation were identified.Three lipid transfer proteins were obtained that may contribute to the previously reported IgE reactivity of pomegranate fruit extracts.In addition,115 SSR markers were identified from the pomegranate fruit peel transcriptome and primers were designed for 77 SSR markers.The pomegranate fruit peel transcriptome set provides a valuable platform for natural product biosynthetic gene and SSR marker discovery in pomegranate.This work also demonstrates that next-generation transcriptome sequencing is an economical and effective approach for investigating natural product biosynthesis,identifying genes controlling important agronomic traits,and discovering molecular markers in non-model specialty crop species.

  3. Improved polysaccharide production in a submerged culture of Ganoderma lucidum by the heterologous expression of Vitreoscilla hemoglobin gene.

    Science.gov (United States)

    Li, Huan-Jun; Zhang, De-Huai; Yue, Tong-Hui; Jiang, Lu-Xi; Yu, Xuya; Zhao, Peng; Li, Tao; Xu, Jun-Wei

    2016-01-10

    Expression of Vitreoscilla hemoglobin (VHb) gene was used to improve polysaccharide production in Ganoderma lucidum. The VHb gene, vgb, under the control of the constitutive glyceraldehyde-3-phosphate dehydrogenase gene promoter was introduced into G. lucidum. The activity of expressed VHb was confirmed by the observation of VHb specific CO-difference spectrum with a maximal absorption at 419 nm for the transformant. The effects of VHb expression on intracellular polysaccharide (IPS) content, extracellular polysaccharide (EPS) production and transcription levels of three genes encoding the enzymes involved in polysaccharide biosynthesis, including phosphoglucomutase (PGM), uridine diphosphate glucose pyrophosphorylase (UGP), and β-1,3-glucan synthase (GLS), were investigated. The maximum IPS content and EPS production in the vgb-bearing G. lucidum were 26.4 mg/100mg dry weight and 0.83 g/L, respectively, which were higher by 30.5% and 88.2% than those of the wild-type strain. The transcription levels of PGM, UGP and GLS were up-regulated by 1.51-, 1.55- and 3.83-fold, respectively, in the vgb-bearing G. lucidum. This work highlights the potential of VHb to enhance G. lucidum polysaccharide production by large scale fermentation. PMID:26603122

  4. High-level production of beta-carotene in Saccharomyces cerevisiae by successive transformation with carotenogenic genes from Xanthophyllomyces dendrorhous

    NARCIS (Netherlands)

    Verwaal, R.; Wang, J.; Meijnen, J.P.; Visser, H.; Sandmann, G.; Berg, van den J.A.; Ooyen, van A.J.J.

    2007-01-01

    To determine whether Saccharomyces cerevisiae can serve as a host for efficient carotenoid and especially ß-carotene production, carotenogenic genes from the carotenoid-producing yeast Xanthophyllomyces dendrorhous were introduced and overexpressed in S. cerevisiae. Because overexpression of these g

  5. Model-driven in Silico glpC Gene Knockout Predicts Increased Succinate Production from Glycerol in Escherichia Coli

    Directory of Open Access Journals (Sweden)

    Bashir Sajo Mienda

    2015-04-01

    Full Text Available Metabolic engineered targeting for increased succinate production in Escherichia coli using glycerol as a low cost carbon source has attracted global attention in recent years. Succinate production in engineered E. coli has progressed significantly using an experimental trial and error approach. The use of a model-guided, targeted metabolic gene knockout prediction for increased succinate production from glycerol under anaerobic conditions in E. coli still remains largely underexplored. In this study, we applied a model-driven, targeted glpC/b2243 in silico metabolic gene knockout using E. coli genome scale model iJO1366 under the OptFlux software platform with the aim of predicting high succinate flux. The results indicated that the mutant model lacking the glpC/b2243 gene will demonstrate increased succinate flux that is 30% higher than its wild-type control model. We can hypothesize that an additional NADH molecule was generated following the deletion of the gene and/or the alternatively preferred GldA-DhaKLM fermentative route for glycerol metabolism in E. coli may have been activated. Although the exact metabolic mechanism involved in increasing the succinate flux still remains obscure; the current study informs other studies that a model-driven, metabolic glpC/b2243 gene knockout could be applicable in filling our knowledge gap using a comprehensive experimental inquiry in the future; leading to a better understanding of the underlying metabolic function of this gene in relation to succinate production in E. coli from glycerol.

  6. Evaluation of three herbicide resistance genes for use in genetic transformations and for potential crop protection in algae production.

    Science.gov (United States)

    Brueggeman, Andrew J; Bruggeman, Andrew J; Kuehler, Daniel; Weeks, Donald P

    2014-09-01

    Genes conferring resistance to the herbicides glyphosate, oxyfluorfen and norflurazon were developed and tested for use as dominant selectable markers in genetic transformation of Chlamydomonas reinhardtii and as potential tools for the protection of commercial-scale algal production facilities against contamination by organisms sensitive to these broad-spectrum herbicides. A synthetic glyphosate acetyltransferase (GAT) gene, when fitted with a strong Chlamydomonas promoter, conferred a 2.7×-fold increase in tolerance to the EPSPS inhibitor, glyphosate, in transgenic cells compared with progenitor WT cells. A mutant Chlamydomonas protoporphyrinogen oxidase (protox, PPO) gene previously shown to produce an enzyme insensitive to PPO-inhibiting herbicides, when genetically engineered, generated transgenic cells able to tolerate up to 136× higher levels of the PPO inhibitor, oxyfluorfen, than nontransformed cells. Genetic modification of the Chlamydomonas phytoene desaturase (PDS) gene-based gene sequences found in various norflurazon-resistant organisms allowed production of transgenic cells tolerant to 40× higher levels of norflurazon than nontransgenic cells. The high efficiency of all three herbicide resistance genes in producing transgenic cells demonstrated their suitability as dominant selectable markers for genetic transformation of Chlamydomonas and, potentially, other eukaryotic algae. However, the requirement for high concentrations of glyphosate and its associated negative effects on cell growth rates preclude its consideration for use in large-scale production facilities. In contrast, only low doses of norflurazon and oxyfluorfen (~1.5 μm and ~0.1 μm, respectively) are required for inhibition of cell growth, suggesting that these two herbicides may prove effective in large-scale algal production facilities in suppressing growth of organisms sensitive to these herbicides. PMID:24796724

  7. Variation in siderophore biosynthetic gene distribution and production across environmental and faecal populations of Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Laura J Searle

    Full Text Available Iron is essential for Escherichia coli growth and survival in the host and the external environment, but its availability is generally low due to the poor solubility of its ferric form in aqueous environments and the presence of iron-withholding proteins in the host. Most E. coli can increase access to iron by excreting siderophores such as enterobactin, which have a very strong affinity for Fe3+. A smaller proportion of isolates can generate up to 3 additional siderophores linked with pathogenesis; aerobactin, salmochelin, and yersiniabactin. However, non-pathogenic E. coli are also able to synthesise these virulence-associated siderophores. This raises questions about their role in the ecology of E. coli, beyond virulence, and whether specific siderophores might be linked with persistence in the external environment. Under the assumption that selection favours phenotypes that confer a fitness advantage, we compared siderophore production and gene distribution in E. coli isolated either from agricultural plants or the faeces of healthy mammals. This population-level comparison has revealed that under iron limiting growth conditions plant-associated isolates produced lower amounts of siderophores than faecal isolates. Additionally, multiplex PCR showed that environmental isolates were less likely to contain loci associated with aerobactin and yersiniabactin synthesis. Although aerobactin was linked with strong siderophore excretion, a significant difference in production was still observed between plant and faecal isolates when the analysis was restricted to strains only able to synthesise enterobactin. This finding suggests that the regulatory response to iron limitation may be an important trait associated with adaptation to the non-host environment. Our findings are consistent with the hypothesis that the ability to produce multiple siderophores facilitates E. coli gut colonisation and plays an important role in E. coli commensalism.

  8. Linking gene regulation and the exo-metabolome: A comparative transcriptomics approach to identify genes that impact on the production of volatile aroma compounds in yeast

    Directory of Open Access Journals (Sweden)

    Bauer Florian F

    2008-11-01

    Full Text Available Abstract Background 'Omics' tools provide novel opportunities for system-wide analysis of complex cellular functions. Secondary metabolism is an example of a complex network of biochemical pathways, which, although well mapped from a biochemical point of view, is not well understood with regards to its physiological roles and genetic and biochemical regulation. Many of the metabolites produced by this network such as higher alcohols and esters are significant aroma impact compounds in fermentation products, and different yeast strains are known to produce highly divergent aroma profiles. Here, we investigated whether we can predict the impact of specific genes of known or unknown function on this metabolic network by combining whole transcriptome and partial exo-metabolome analysis. Results For this purpose, the gene expression levels of five different industrial wine yeast strains that produce divergent aroma profiles were established at three different time points of alcoholic fermentation in synthetic wine must. A matrix of gene expression data was generated and integrated with the concentrations of volatile aroma compounds measured at the same time points. This relatively unbiased approach to the study of volatile aroma compounds enabled us to identify candidate genes for aroma profile modification. Five of these genes, namely YMR210W, BAT1, AAD10, AAD14 and ACS1 were selected for overexpression in commercial wine yeast, VIN13. Analysis of the data show a statistically significant correlation between the changes in the exo-metabome of the overexpressing strains and the changes that were predicted based on the unbiased alignment of transcriptomic and exo-metabolomic data. Conclusion The data suggest that a comparative transcriptomics and metabolomics approach can be used to identify the metabolic impacts of the expression of individual genes in complex systems, and the amenability of transcriptomic data to direct applications of

  9. Protein gene product 9.5-immunoreactive nerve fibres and cells in human skin.

    Science.gov (United States)

    Wang, L; Hilliges, M; Jernberg, T; Wiegleb-Edström, D; Johansson, O

    1990-07-01

    Sections of human skin were processed according to the indirect immunofluorescence technique with a rabbit antiserum against human protein gene product 9.5 (PGP 9.5). Immunoreactivity was detected in intraepidermal and dermal nerve fibres and cells. The intraepidermal nerves were varicose or smooth with different diameters, running as single processes or branched, straight or bent, projecting in various directions and terminating in the stratum basale, spinosum or granulosum. The density of the intraepidermal nerves varied between the different skin areas investigated. PGP 9.5-containing axons of the lower dermis were found in large bundles. They separated into smaller axon bundles within the upper dermis, entering this portion of the skin perpendicular to the surface. Then they branched into fibres mainly arranged parallel to the epidermal-dermal junctional zone. However, the fibres en route to the epidermis traversed the upper dermis more or less perpendicularly. Furthermore, immunoreactive dermal nerve fibres were found in the Meissner corpuscles, the arrector pili muscles, hair follicles, around the eccrine and apocrine sweat glands and around certain blood vessels. Such fibres were also observed around most subcutaneous blood vessels, sometimes heavily innervating these structures. Numerous weakly-to-strongly PGP 9.5-immunoreactive cells were found both in the epidermis and in the dermis. PMID:2143435

  10. Deletion of alcohol dehydrogenase 2 gene in Pachysolen tannophilus improves ethanol production from corn stover hydrolysates

    Directory of Open Access Journals (Sweden)

    Sen Yang

    2015-12-01

    Full Text Available Although ethanol derived from lignocellulosic biomass is a promising alternative biofuel, the conversion rate of xylose to ethanol by fermentation is not ideal due to the low efficiency of many common yeasts in utilizing xylose. Pachysolen tannophilus can convert hexose and pentose such as L-arabinose, xylose and glucose in lignocellulosic hydrolysates to ethanol simultaneously. To increase the conversion of corn stover hydrolysates to bioethanol, the effect of alcohol dehydrogenase 2 gene (adh2 deletion in P. tannophilus on bioethanol production from corn stover hydrolysates was investigated. Two adh2 deletants (heterozygote ND and homozygote MC were constructed by using the short flanking homology PCR (SFH-PCR. The ND and MC strains showed lower alcohol dehydrogenase 2 (ADH2 activity than the initial strain P-01. In the fermented pentose and hexose sugars of MC and ND, the ethanol concentrations (g/L reached 15.8 and 18.9 versus14.6 of the initial P-01, while in the corn stover hydrolysate medium, the ethanol concentrations (g/L were 9.1 for MC and 9.8 for ND versus 7.5 for the initial strain P-01. This research provides useful information for improving the conversion efficiency of hexose and pentose to bioethanol by Pachysolen tannophilus.

  11. Association of genetic polymorphism in GH gene with milk production traits in Beijing Holstein cows

    Indian Academy of Sciences (India)

    Guo Li Zhou; Hai Guo Jin; Chen Liu; Shan Li; Qi Zhu; Yu Hou Wu

    2005-12-01

    Associations were analysed between polymorphisms of the growth hormone gene (GH-MspI) (localized in intron 3) and milk production traits of Beijing Holstein cows (a total of 543 cows). Polymerase chain reaction (PCR)-restriction fragment length polymorphism (RFLP) method was used for identification of various genotypes. Frequencies of genotypes were 0.77, 0.21 and 0.02 for A/A, A/B and B/B, respectively. The frequency of the allele is 0.875. The results of the least squares means show that in all three lactations, the GH A/A cows yielded more milk ( < 0.01 for lactation I and < 0.05 for lactations II and III), whereas A/B cows showed higher milk fat content than A/A individuals ( < 0.05 for lactations I and II, and < 0.01 for lactation III). The A/A cows yielded more fat than A/B individuals ( < 0.01 only in lactation I). The A/A cows yielded more milk protein than A/B individuals ( < 0.01 for lactations I, II, and III). The A/A cows produced milk of higher protein content than of A/B individuals ( < 0.05 only in lactation II).

  12. Production of L-DOPA and dopamine in recombinant bacteria bearing the Vitreoscilla hemoglobin gene.

    Science.gov (United States)

    Kurt, Asli Giray; Aytan, Emel; Ozer, Ufuk; Ates, Burhan; Geckil, Hikmet

    2009-07-01

    Given the well-established beneficial effects of Vitreoscilla hemoglobin (VHb) on heterologous organisms, the potential of this protein for the production of L-DOPA and dopamine in two bacteria, Citrobacter freundii and Erwinia herbicola, was investigated. The constructed recombinants bearing the VHb gene (vgb(+)) had substantially higher levels of cytoplasmic L-DOPA (112 mg/L for C. freundii and 97 mg/L for E. herbicola) than their respective hosts (30.4 and 33.8 mg/L) and the vgb(-) control strains (35.6 and 35.8 mg/L). Further, the vgb(+) recombinants of C. freundii and E. herbicola had 20-fold and about two orders of magnitude higher dopamine levels than their hosts, repectively. The activity of tyrosine phenol-lyase, the enzyme converting L-tyrosine to L-DOPA, was well-correlated to cytoplasmic L-DOPA levels. As cultures aged, higher tyrosine phenol-lyase activity of the vgb(+) strains was more apparent. PMID:19585534

  13. Cardiovascular actions of DOPA mediated by the gene product of ocular albinism 1.

    Science.gov (United States)

    Goshima, Yoshio; Nakamura, Fumio; Masukawa, Daiki; Chen, Sandy; Koga, Motokazu

    2014-01-01

    l-3,4-Dihydroxyphenylalanine (DOPA) is the metabolic precursor of dopamine, and the single most effective agent in the treatment of Parkinson's disease. One problem with DOPA therapy for Parkinson's disease is its cardiovascular side effects including hypotension and syncope, the underlying mechanisms of which are largely unknown. We proposed that DOPA is a neurotransmitter in the central nervous system, but specific receptors for DOPA had not been identified. Recently, the gene product of ocular albinism 1 (OA1) was shown to possess DOPA-binding activity. It was unknown, however, whether or not OA1 is responsible for the actions of DOPA itself. Immunohistochemical examination revealed that OA1 was expressed in the nucleus tractus solitarii (NTS). OA1-positive cells adjacent to tyrosine hydroxylase-positive cell bodies and nerve fibers were detected in the depressor sites of the NTS. OA1 knockdown using oa1-specific shRNA-adenovirus vectors in the NTS reduced the expression levels of OA1 in the NTS. The prior injection of the shRNA against OA1 suppressed the depressor and bradycardic responses to DOPA but not to glutamate in the NTS of anesthetized rats. Thus OA-1 is a functional receptor of DOPA in the NTS, which warrants reexamination of the mechanisms for the therapeutic and untoward actions of DOPA. PMID:25185585

  14. Association of polymorphism κ-casein gene with longevity and lifetime production of Holstein-Friesian cows in Vojvodina

    Directory of Open Access Journals (Sweden)

    Dragomir Lukač

    2015-11-01

    Full Text Available The aim of this study was to identify frequencies of alleles and genotypes, to evaluate their frequency in population of Holstein-Friesian cows, and to investigate association of κ-casein genotypes with longevity and lifetime production of cows. Blood samples were collected from 192 Holstein cows which have finished their production. Cows were reared at one farm in Vojvodina in Serbia. In the current study the following ratios of κ-casein genotypes were found: 0.50 were AA, 0.40 were AB and 0.10 were BB. Frequencies of alleles A and B were 0.70 and 0.30, respectively. Based on these results, it can be concluded that cows with heterozygous genotype AB had the longest life (2809 days with the highest number of productive days (2062, while the cows which were homozygous recessive of genotype BB had the shortest life expectancy (2627 days and the lowest number productive days (1878. The same trend was observed with regard to the production results of cows of these genotypes, where statistically significant differences have been observed (P0.05. The effect of dominant genes in observed traits was greater than the additive effect of genes. From the ratio of the additive and dominant gene effects, it can be seen that the average degree of dominance in observed traits was positive.

  15. Increased glycopeptide production after overexpression of shikimate pathway genes being part of the balhimycin biosynthetic gene cluster

    DEFF Research Database (Denmark)

    Thykær, Jette; Nielsen, Jens; Wohlleben, W.;

    2010-01-01

    Amycolatopsis balhimycina produces the vancomycin-analogue balhimycin. The strain therefore serves as a model strain for glycopeptide antibiotic production. Previous characterisation of the balhimycin biosynthetic cluster had shown that the border sequences contained both, a putative 3-deoxy-d-ar...

  16. SxtA and sxtG Gene Expression and Toxin Production in the Mediterranean Alexandrium minutum (Dinophyceae

    Directory of Open Access Journals (Sweden)

    Federico Perini

    2014-10-01

    Full Text Available The dinoflagellate Alexandrium minutum is known for the production of potent neurotoxins affecting the health of human seafood consumers via paralytic shellfish poisoning (PSP. The aim of this study was to investigate the relationship between the toxin content and the expression level of the genes involved in paralytic shellfish toxin (PST production. The algal cultures were grown both in standard f/2 medium and in phosphorus/nitrogen limitation. In our study, LC-HRMS analyses of PST profile and content in different Mediterranean A. minutum strains confirmed that this species was able to synthesize mainly the saxitoxin analogues Gonyautoxin-1 (GTX1 and Gonyautoxin-4 (GTX4. The average cellular toxin content varied among different strains, and between growth phases, highlighting a decreasing trend from exponential to stationary phase in all culture conditions tested. The absolute quantities of intracellular sxtA1 and sxtG mRNA were not correlated with the amount of intracellular toxins in the analysed A. minutum suggesting that the production of toxins may be regulated by post-transcriptional mechanisms and/or by the concerted actions of alternative genes belonging to the PST biosynthesis gene cluster. Therefore, it is likely that the sxtA1 and sxtG gene expression could not reflect the PST accumulation in the Mediterranean A. minutum populations under the examined standard and nutrient limiting conditions.

  17. Distribution of Salmonella paratyphi A outer membrane protein X gene and immune-protective effect related to its recombinant expressed products

    Institute of Scientific and Technical Information of China (English)

    李明雷

    2014-01-01

    Objective To determine the distribution and sequence conservation of outer membrane protein X(ompX)gene in Salmonella paratyphi A isolates as well as the immunogenicity and immono-protection of ompX gene products.Methods OmpX gene in Salmonella paratyphi A isolates was detected by PCR and the amplification products were sequenced after the T-A cloning process.OmpX gene product was expressed with E.coli expression system and the expressed rOmpX was extracted by Ni-NTA affinity

  18. TranscriptomeBrowser: a powerful and flexible toolbox to explore productively the transcriptional landscape of the Gene Expression Omnibus database.

    Directory of Open Access Journals (Sweden)

    Fabrice Lopez

    Full Text Available BACKGROUND: As public microarray repositories are constantly growing, we are facing the challenge of designing strategies to provide productive access to the available data. METHODOLOGY: We used a modified version of the Markov clustering algorithm to systematically extract clusters of co-regulated genes from hundreds of microarray datasets stored in the Gene Expression Omnibus database (n = 1,484. This approach led to the definition of 18,250 transcriptional signatures (TS that were tested for functional enrichment using the DAVID knowledgebase. Over-representation of functional terms was found in a large proportion of these TS (84%. We developed a JAVA application, TBrowser that comes with an open plug-in architecture and whose interface implements a highly sophisticated search engine supporting several Boolean operators (http://tagc.univ-mrs.fr/tbrowser/. User can search and analyze TS containing a list of identifiers (gene symbols or AffyIDs or associated with a set of functional terms. CONCLUSIONS/SIGNIFICANCE: As proof of principle, TBrowser was used to define breast cancer cell specific genes and to detect chromosomal abnormalities in tumors. Finally, taking advantage of our large collection of transcriptional signatures, we constructed a comprehensive map that summarizes gene-gene co-regulations observed through all the experiments performed on HGU133A Affymetrix platform. We provide evidences that this map can extend our knowledge of cellular signaling pathways.

  19. Myostatin gene (MSTN) polymorphism with a negative effect on meat productivity in Dzhalginsky Merino sheep breed

    OpenAIRE

    VLADIMIR TRUKHACHEV; VALERY BELYAEV; ANDREY KVOCHKO; ALEXANDER KULICHENKO; DMITRY KOVALEV; SERGEY PISARENKO; ANNA VOLYNKINA; MARINA SELIONOVA; MAGOMET AYBAZOV; SVETLANA SHUMAENKO; ARSLAN OMAROV; TATYANA MAMONTOVA; NATALIA GOLOVANOVA; OLESYA YATSYK; ALEXANDER KRIVORUCHKO

    2015-01-01

    One of the most important negative regulator of muscle grow in mammalians is myostatin. Some mutations in myostatin gene (MSTN) can decrease the effect of protein and play role in meat quality of sheep. Therefore, in genome selection, knowledge of MSTN gene structure is very important. We investigated the polymorphism of the MSTN gene and its influence on body parameters in Russian sheep breed Dzhalginsky Merino. To detect alleles, we use NimbleGen sequencing technolog). In this breed, we fou...

  20. Characterization of foot-and-mouth disease virus gene products with antisera against bacterially synthesized fusion proteins.

    OpenAIRE

    Strebel, K; De Beck, E.; K Strohmaier; Schaller, H

    1986-01-01

    Defined segments of the cloned foot-and-mouth disease virus genome corresponding to all parts of the coding region were expressed in Escherichia coli as fusions to the N-terminal part of the MS2-polymerase gene under the control of the inducible lambda PL promoter. All constructs yielded large amounts of proteins, which were purified and used to raise sequence-specific antisera in rabbits. These antisera were used to identify the corresponding viral gene products in 35S-labeled extracts from ...

  1. Effects of exogenous methyl jasmonate and 2-isopentenyladenine on artemisinin production and gene expression in Artemisia annua

    OpenAIRE

    MEHRJERDI, Mahboobeh ZARE; BIHAMTA, Mohammad-Reza; OMIDI, Mansoor

    2013-01-01

    Artemisinin, produced in very low amounts in Artemisia annua L. plants, is one of the most effective drugs in treating malaria. In this study, the effect of exogenous applications of methyl jasmonate (MeJA) and 2-isopentenyladenine (2-iP) in artemisinin production and the main genes of its biosynthesis pathway within a 1-week time period were investigated. Both MeJA and 2-iP increased artemisinin content, but no correlation was found between gene expression and its content. In plants treated ...

  2. Cyclic Lipopeptide Biosynthetic Genes and Products, and Inhibitory Activity of Plant-Associated Bacillus against Phytopathogenic Bacteria

    OpenAIRE

    Mora, Isabel; Cabrefiga, Jordi; Montesinos, Emilio

    2015-01-01

    The antibacterial activity against bacterial plant pathogens and its relationships with the presence of the cyclic lipopeptide (cLP) biosynthetic genes ituC (iturin), bmyB (bacillomycin), fenD (fengycin) and srfAA (surfactin), and their corresponding antimicrobial peptide products have been studied in a collection of 64 strains of Bacillus spp. isolated from plant environments. The most frequent antimicrobial peptide (AMP) genes were bmyB, srfAA and fenD (34-50% of isolates). Most isolates (9...

  3. Cloning of the Thermomonospora fusca Endoglucanase E2 gene in Streptomyces lividans: Affinity purification and functional domains of the cloned gene product

    Energy Technology Data Exchange (ETDEWEB)

    Ghangas, G.S.; Wilson, D.B. (Cornell Univ., Ithaca, NY (USA))

    1988-10-01

    Thermomonospora fusca YX grown in the presence of cellulose produces a number of {beta}-1-4-endoglucanases, some of which bind to microcrystalline cellulose. By using a multicopy plasmid, pIJ702, a gene coding for one of these enzymes (E2) was cloned into Streptomyces lividans and then mobilized into both Escherichia coli and Streptomyces albus. The gene was localized to a 1.6-kilobase PvuII-ClaI segment of the originally cloned 3.0-kilobase SstI fragment of Thermomonospora DNA. The culture supernatants of Streptomyces transformants contain a major endoglucanase that cross-reacts with antibody against Thermomonospora cellulase E2 and has the same molecular weight (43,000) as T. fusca E2. This protein binds quickly and tightly to Avicel. It also binds to filter paper but at a slower rate than to Avicel. Several large proteolytic degradation products of this enzyme generated in vivo lose the ability to bind to Avicel and have higher activity on carboxymethyl cellulose than the native enzyme. Other smaller products bind to Avicel but lack activity. A weak cellobiose-binding site not observed in the native enzyme was present in one of the degradation products. In E. coli, the cloned gene produced a cellulase that also binds tightly to Avicel but appeared to be slightly larger than T. fusca E2. The activity of intact E2 from all organisms can be inactivated by Hg{sup 2+} ions. Dithiothreitol protected against Hg{sup 2+} inactivation and reactivated both unbound and Avicel-bound Hg{sub 2+}-inhibited E2, but at different rates.

  4. Modulation of steroidogenic gene expression and hormone production of H295R cells by pharmaceuticals and other environmentally active compounds

    International Nuclear Information System (INIS)

    The H295R cell bioassay was used to evaluate the potential endocrine disrupting effects of 18 of the most commonly used pharmaceuticals in the United States. Exposures for 48 h with single pharmaceuticals and binary mixtures were conducted; the expression of five steroidogenic genes, 3βHSD2, CYP11β1, CYP11β2, CYP17 and CYP19, was quantified by Q-RT-PCR. Production of the steroid hormones estradiol (E2), testosterone (T) and progesterone (P) was also evaluated. Antibiotics were shown to modulate gene expression and hormone production. Amoxicillin up-regulated the expression of CYP11β2 and CYP19 by more than 2-fold and induced estradiol production up to almost 3-fold. Erythromycin significantly increased CYP11β2 expression and the production of P and E2 by 3.5- and 2.4-fold, respectively, while production of T was significantly decreased. The β-blocker salbutamol caused the greatest induction of CYP17, more than 13-fold, and significantly decreased E2 production. The binary mixture of cyproterone and salbutamol significantly down-regulated expression of CYP19, while a mixture of ethynylestradiol and trenbolone, increased E2 production 3.7-fold. Estradiol production was significantly affected by changes in concentrations of trenbolone, cyproterone, and ethynylestradiol. Exposures with individual pharmaceuticals showed the possible secondary effects that drugs may exert on steroid production. Results from binary mixture exposures suggested the possible type of interactions that may occur between drugs and the joint effects product of such interactions. Dose-response results indicated that although two chemicals may share a common mechanism of action the concentration effects observed may be significantly different

  5. Early aldosterone-induced gene product regulates the epithelial sodium channel by deubiquitylation.

    Science.gov (United States)

    Fakitsas, Panagiotis; Adam, Gabriele; Daidié, Dorothée; van Bemmelen, Miguel X; Fouladkou, Fatemeh; Patrignani, Andrea; Wagner, Ulrich; Warth, Richard; Camargo, Simone M R; Staub, Olivier; Verrey, François

    2007-04-01

    The mineralocorticoid hormone aldosterone controls sodium reabsorption and BP largely by regulating the cell-surface expression and function of the epithelial sodium channel (ENaC) in target kidney tubules. Part of the stimulatory effect of aldosterone on ENaC is mediated by the induction of serum- and glucocorticoid-regulated kinase 1 (Sgk1), a kinase that interferes with the ubiquitylation of ENaC by ubiquitin-protein ligase Nedd4-2. In vivo early aldosterone-regulated mRNA now has been identified in microselected mouse distal nephron by microarray. From 22 mRNA that displayed a two-fold or more change, 13 were downregulated and nine were upregulated. Besides Sgk1, the induced mRNA include Grem2 (protein related to DAN and cerebrus [PRDC]), activating transcription factor 3, cAMP responsive element modulator, and the ubiquitin-specific protease Usp2-45. The induction of this last enzyme isoform was verified in mouse distal nephron tubule at the protein level. With the use of Hek293 cells, Xenopus oocytes, and mpkCCD(c14) cells as expression systems, it was shown that Usp2-45 deubiquitylates ENaC and stimulates ENaC-mediated sodium transport, an effect that is not additive to that of Sgk1. A deubiquitylating enzyme that targets ENaC in vitro and thus may play a role in sodium transport regulation was identified within a series of new in vivo early aldosterone-regulated gene products. PMID:17344426

  6. Thermophile-specific proteins: the gene product of aq_1292 from Aquifex aeolicus is an NTPase

    Directory of Open Access Journals (Sweden)

    Howe Rebecca

    2003-09-01

    Full Text Available Abstract Background To identify thermophile-specific proteins, we performed phylogenetic patterns searches of 66 completely sequenced microbial genomes. This analysis revealed a cluster of orthologous groups (COG1618 which contains a protein from every thermophile and no sequence from 52 out of 53 mesophilic genomes. Thus, COG1618 proteins belong to the group of thermophile-specific proteins (THEPs and therefore we here designate COG1618 proteins as THEP1s. Since no THEP1 had been analyzed biochemically thus far, we characterized the gene product of aq_1292 which is THEP1 from the hyperthermophilic bacterium Aquifex aeolicus (aaTHEP1. Results aaTHEP1 was cloned in E. coli, expressed and purified to homogeneity. At a temperature optimum between 70 and 80°C, aaTHEP1 shows enzymatic activity in hydrolyzing ATP to ADP + Pi with kcat = 5 × 10-3 s-1 and Km = 5.5 × 10-6 M. In addition, the enzyme exhibits GTPase activity (kcat = 9 × 10-3 s-1 and Km= 45 × 10-6 M. aaTHEP1 is inhibited competitively by CTP, UTP, dATP, dGTP, dCTP, and dTTP. As shown by gel filtration, aaTHEP1 in its purified state appears as a monomer. The enzyme is resistant to limited proteolysis suggesting that it consists of a single domain. Although THEP1s are annotated as "predicted nucleotide kinases" we could not confirm such an activity experimentally. Conclusion Since aaTHEP1 is the first member of COG1618 that is characterized biochemically and functional information about one member of a COG may be transferred to the entire COG, we conclude that COG1618 proteins are a family of thermophilic NTPases.

  7. Evolution and Origin of HRS, a Protein Interacting with Merlin, the Neurofibromatosis 2 Gene Product

    Directory of Open Access Journals (Sweden)

    Leonid V. Omelyanchuk

    2009-10-01

    Full Text Available Hepatocyte growth factor receptor tyrosine kinase substrate (HRS is an endosomal protein required for trafficking receptor tyrosine kinases from the early endosome to the lysosome. HRS interacts with Merlin, the Neurofibromatosis 2 (NF2 gene product, and this interaction may be important for Merlin’s tumor suppressor activity. Understanding the evolution, origin, and structure of HRS may provide new insight into Merlin function. We show that HRS homologs are present across a wide range of Metazoa with the yeast Vps27 protein as their most distant ancestor. The phylogenetic tree of the HRS family coincides with species evolution and divergence, suggesting a unique function for HRS. Sequence alignment shows that various protein domains of HRS, including the VHS domain, the FYVE domain, the UIM domain, and the clathrin-binding domain, are conserved from yeast to multicellular organisms. The evolutionary transition from unicellular to multicellular organisms was accompanied by the appearance of a binding site for Merlin, which emerges in the early Metazoa after its separation from flatworms. In addition to the region responsible for growth suppression, the Merlin-binding and STAM-binding domains of HRS are conserved among multicellular organisms. The residue equivalent to tyrosine-377, which is phosphorylated in the human HRS protein, is highly conserved throughout the HRS family. Three additional conserved boxes lacking assigned functions are found in the HRS proteins of Metazoa. While boxes 1 and 3 may constitute the Eps-15- and Snx1-binding sites, respectively, box 2, containing the residue equivalent to tyrosine-377, is likely to be important for HRS phosphorylation. While several functional domains are conserved throughout the HRS family, the STAM-binding, Merlin-binding, and growth suppression domains evolved in the early Metazoa around the time the Merlin protein emerged. As these domains appear during the transition to multicellularity

  8. Producer immunity towards the lantibiotic Pep5: identification of the immunity gene pepI and localization and functional analysis of its gene product.

    OpenAIRE

    M. Reis; Eschbach-Bludau, M.; Iglesias-Wind, M I; Kupke, T.; Sahl, H.G.

    1994-01-01

    The lantibiotic Pep5 is produced by Staphylococcus epidermidis 5. Pep5 production and producer immunity are associated with the 20-kb plasmid pED503. A 1.3-kb KpnI fragment of pED503, containing the Pep5 structural gene pepA, was subcloned into the Escherichia coli-Staphylococcus shuttle vector pCU1, and the recombinant plasmid pMR2 was transferred to the Pep5- and immunity-negative mutant S. epidermidis 5 Pep5- (devoid of pED503). This clone did not produce active Pep5 but showed the same de...

  9. Production of Truncated Candida antarctica Lipase B Gene Using Automated PCR Gene Assembly Protocol and Expression in Yeast for use in Ethanol and Biodiesel Production.

    Science.gov (United States)

    An improved column-based process for production of biodiesel was developed using a column containing a strongly basic anion-exchange resin in sequence with a column containing a resin to which a lipase biocatalyst is bound. Currently most biodiesel is produced by transesterification of triglyceride...

  10. Environmental effects on resistance gene expression in milk stage popcorn kernels and associations with mycotoxin production.

    Science.gov (United States)

    Dowd, Patrick F; Johnson, Eric T

    2015-05-01

    Like other forms of maize, popcorn is subject to increased levels of contamination by a variety of different mycotoxins under stress conditions, although levels generally are less than dent maize under comparable stress. Gene array analysis was used to determine expression differences of disease resistance-associated genes in milk stage kernels from commercial popcorn fields over 3 years. Relatively lower expression of resistance gene types was noted in years with higher temperatures and lower rainfall, which was consistent with prior results for many previously identified resistance response-associated genes. The lower rates of expression occurred for genes such as chitinases, protease inhibitors, and peroxidases; enzymes involved in the synthesis of cell wall barriers and secondary metabolites; and regulatory proteins. However, expression of several specific resistance genes previously associated with mycotoxins, such as aflatoxin in dent maize, was not affected. Insect damage altered the spectrum of resistance gene expression differences compared to undamaged ears. Correlation analyses showed expression differences of some previously reported resistance genes that were highly associated with mycotoxin levels and included glucanases, protease inhibitors, peroxidases, and thionins. PMID:25512225

  11. Efficient production of multi-modified pigs for xenotransplantation by ‘combineering’, gene stacking and gene editing

    Science.gov (United States)

    Fischer, Konrad; Kraner-Scheiber, Simone; Petersen, Björn; Rieblinger, Beate; Buermann, Anna; Flisikowska, Tatiana; Flisikowski, Krzysztof; Christan, Susanne; Edlinger, Marlene; Baars, Wiebke; Kurome, Mayuko; Zakhartchenko, Valeri; Kessler, Barbara; Plotzki, Elena; Szczerbal, Izabela; Switonski, Marek; Denner, Joachim; Wolf, Eckhard; Schwinzer, Reinhard; Niemann, Heiner; Kind, Alexander; Schnieke, Angelika

    2016-01-01

    Xenotransplantation from pigs could alleviate the shortage of human tissues and organs for transplantation. Means have been identified to overcome hyperacute rejection and acute vascular rejection mechanisms mounted by the recipient. The challenge is to combine multiple genetic modifications to enable normal animal breeding and meet the demand for transplants. We used two methods to colocate xenoprotective transgenes at one locus, sequential targeted transgene placement - ‘gene stacking’, and cointegration of multiple engineered large vectors - ‘combineering’, to generate pigs carrying modifications considered necessary to inhibit short to mid-term xenograft rejection. Pigs were generated by serial nuclear transfer and analysed at intermediate stages. Human complement inhibitors CD46, CD55 and CD59 were abundantly expressed in all tissues examined, human HO1 and human A20 were widely expressed. ZFN or CRISPR/Cas9 mediated homozygous GGTA1 and CMAH knockout abolished α-Gal and Neu5Gc epitopes. Cells from multi-transgenic piglets showed complete protection against human complement-mediated lysis, even before GGTA1 knockout. Blockade of endothelial activation reduced TNFα-induced E-selectin expression, IFNγ-induced MHC class-II upregulation and TNFα/cycloheximide caspase induction. Microbial analysis found no PERV-C, PCMV or 13 other infectious agents. These animals are a major advance towards clinical porcine xenotransplantation and demonstrate that livestock engineering has come of age. PMID:27353424

  12. Production of DNA microarray and expression analysis of genes from Xylella fastidiosa in different culture media

    Directory of Open Access Journals (Sweden)

    Regiane de Fátima Travensolo

    2009-06-01

    Full Text Available DNA Microarray was developed to monitor the expression of many genes from Xylella fastidiosa, allowing the side by-side comparison of two situations in a single experiment. The experiments were performed using X. fastidiosa cells grown in two culture media: BCYE and XDM2. The primers were synthesized, spotted onto glass slides and the array was hybridized against fluorescently labeled cDNAs. The emitted signals were quantified, normalized and the data were statistically analyzed to verify the differentially expressed genes. According to the data, 104 genes were differentially expressed in XDM2 and 30 genes in BCYE media. The present study showed that DNA microarray technique efficiently differentiate the expressed genes under different conditions.DNA Microarray foi desenvolvida para monitorar a expressão de muitos genes de Xylella fastidiosa, permitindo a comparação de duas situações distintas em um único experimento. Os experimentos foram feitos utilizando células de X. fastidiosa cultivada em dois meios de cultura: BCYE e XDM2. Pares de oligonucleotídeos iniciadores foram sintetizados, depositados em lâminas de vidro e o arranjo foi hibridizado contra cDNAs marcados fluorescentemente. Os sinais emitidos foram quantificados, normalizados e os dados foram estatisticamente analisados para verificar os genes diferencialmente expressos. De acordo com nossos dados, 104 genes foram diferencialmente expressos para o meio de cultura XDM2 e 30 genes para o BCYE. No presente estudo, nós demonstramos que a técnica de DNA microarrays eficientemente diferencia genes expressos sob diferentes condições de cultivo.

  13. Unraveling antimicrobial resistance genes and phenotype patterns among Enterococcus faecalis isolated from retail chicken products in Japan.

    Science.gov (United States)

    Hidano, Arata; Yamamoto, Takehisa; Hayama, Yoko; Muroga, Norihiko; Kobayashi, Sota; Nishida, Takeshi; Tsutsui, Toshiyuki

    2015-01-01

    Multidrug-resistant enterococci are considered crucial drivers for the dissemination of antimicrobial resistance determinants within and beyond a genus. These organisms may pass numerous resistance determinants to other harmful pathogens, whose multiple resistances would cause adverse consequences. Therefore, an understanding of the coexistence epidemiology of resistance genes is critical, but such information remains limited. In this study, our first objective was to determine the prevalence of principal resistance phenotypes and genes among Enterococcus faecalis isolated from retail chicken domestic products collected throughout Japan. Subsequent analysis of these data by using an additive Bayesian network (ABN) model revealed the co-appearance patterns of resistance genes and identified the associations between resistance genes and phenotypes. The common phenotypes observed among E. faecalis isolated from the domestic products were the resistances to oxytetracycline (58.4%), dihydrostreptomycin (50.4%), and erythromycin (37.2%), and the gene tet(L) was detected in 46.0% of the isolates. The ABN model identified statistically significant associations between tet(L) and erm(B), tet(L) and ant(6)-Ia, ant(6)-Ia and aph(3')-IIIa, and aph(3')-IIIa and erm(B), which indicated that a multiple-resistance profile of tetracycline, erythromycin, streptomycin, and kanamycin is systematic rather than random. Conversely, the presence of tet(O) was only negatively associated with that of erm(B) and tet(M), which suggested that in the presence of tet(O), the aforementioned multiple resistance is unlikely to be observed. Such heterogeneity in linkages among genes that confer the same phenotypic resistance highlights the importance of incorporating genetic information when investigating the risk factors for the spread of resistance. The epidemiological factors that underlie the persistence of systematic multiple-resistance patterns warrant further investigations with appropriate

  14. Unraveling antimicrobial resistance genes and phenotype patterns among Enterococcus faecalis isolated from retail chicken products in Japan.

    Directory of Open Access Journals (Sweden)

    Arata Hidano

    Full Text Available Multidrug-resistant enterococci are considered crucial drivers for the dissemination of antimicrobial resistance determinants within and beyond a genus. These organisms may pass numerous resistance determinants to other harmful pathogens, whose multiple resistances would cause adverse consequences. Therefore, an understanding of the coexistence epidemiology of resistance genes is critical, but such information remains limited. In this study, our first objective was to determine the prevalence of principal resistance phenotypes and genes among Enterococcus faecalis isolated from retail chicken domestic products collected throughout Japan. Subsequent analysis of these data by using an additive Bayesian network (ABN model revealed the co-appearance patterns of resistance genes and identified the associations between resistance genes and phenotypes. The common phenotypes observed among E. faecalis isolated from the domestic products were the resistances to oxytetracycline (58.4%, dihydrostreptomycin (50.4%, and erythromycin (37.2%, and the gene tet(L was detected in 46.0% of the isolates. The ABN model identified statistically significant associations between tet(L and erm(B, tet(L and ant(6-Ia, ant(6-Ia and aph(3'-IIIa, and aph(3'-IIIa and erm(B, which indicated that a multiple-resistance profile of tetracycline, erythromycin, streptomycin, and kanamycin is systematic rather than random. Conversely, the presence of tet(O was only negatively associated with that of erm(B and tet(M, which suggested that in the presence of tet(O, the aforementioned multiple resistance is unlikely to be observed. Such heterogeneity in linkages among genes that confer the same phenotypic resistance highlights the importance of incorporating genetic information when investigating the risk factors for the spread of resistance. The epidemiological factors that underlie the persistence of systematic multiple-resistance patterns warrant further investigations with

  15. Functional genomics reveals that a compact terpene synthase gene family can account for terpene volatile production in apple.

    Science.gov (United States)

    Nieuwenhuizen, Niels J; Green, Sol A; Chen, Xiuyin; Bailleul, Estelle J D; Matich, Adam J; Wang, Mindy Y; Atkinson, Ross G

    2013-02-01

    Terpenes are specialized plant metabolites that act as attractants to pollinators and as defensive compounds against pathogens and herbivores, but they also play an important role in determining the quality of horticultural food products. We show that the genome of cultivated apple (Malus domestica) contains 55 putative terpene synthase (TPS) genes, of which only 10 are predicted to be functional. This low number of predicted functional TPS genes compared with other plant species was supported by the identification of only eight potentially functional TPS enzymes in apple 'Royal Gala' expressed sequence tag databases, including the previously characterized apple (E,E)-α-farnesene synthase. In planta functional characterization of these TPS enzymes showed that they could account for the majority of terpene volatiles produced in cv Royal Gala, including the sesquiterpenes germacrene-D and (E)-β-caryophyllene, the monoterpenes linalool and α-pinene, and the homoterpene (E)-4,8-dimethyl-1,3,7-nonatriene. Relative expression analysis of the TPS genes indicated that floral and vegetative tissues were the primary sites of terpene production in cv Royal Gala. However, production of cv Royal Gala floral-specific terpenes and TPS genes was observed in the fruit of some heritage apple cultivars. Our results suggest that the apple TPS gene family has been shaped by a combination of ancestral and more recent genome-wide duplication events. The relatively small number of functional enzymes suggests that the remaining terpenes produced in floral and vegetative and fruit tissues are maintained under a positive selective pressure, while the small number of terpenes found in the fruit of modern cultivars may be related to commercial breeding strategies. PMID:23256150

  16. Functional Genomics Reveals That a Compact Terpene Synthase Gene Family Can Account for Terpene Volatile Production in Apple1[W

    Science.gov (United States)

    Nieuwenhuizen, Niels J.; Green, Sol A.; Chen, Xiuyin; Bailleul, Estelle J.D.; Matich, Adam J.; Wang, Mindy Y.; Atkinson, Ross G.

    2013-01-01

    Terpenes are specialized plant metabolites that act as attractants to pollinators and as defensive compounds against pathogens and herbivores, but they also play an important role in determining the quality of horticultural food products. We show that the genome of cultivated apple (Malus domestica) contains 55 putative terpene synthase (TPS) genes, of which only 10 are predicted to be functional. This low number of predicted functional TPS genes compared with other plant species was supported by the identification of only eight potentially functional TPS enzymes in apple ‘Royal Gala’ expressed sequence tag databases, including the previously characterized apple (E,E)-α-farnesene synthase. In planta functional characterization of these TPS enzymes showed that they could account for the majority of terpene volatiles produced in cv Royal Gala, including the sesquiterpenes germacrene-D and (E)-β-caryophyllene, the monoterpenes linalool and α-pinene, and the homoterpene (E)-4,8-dimethyl-1,3,7-nonatriene. Relative expression analysis of the TPS genes indicated that floral and vegetative tissues were the primary sites of terpene production in cv Royal Gala. However, production of cv Royal Gala floral-specific terpenes and TPS genes was observed in the fruit of some heritage apple cultivars. Our results suggest that the apple TPS gene family has been shaped by a combination of ancestral and more recent genome-wide duplication events. The relatively small number of functional enzymes suggests that the remaining terpenes produced in floral and vegetative and fruit tissues are maintained under a positive selective pressure, while the small number of terpenes found in the fruit of modern cultivars may be related to commercial breeding strategies. PMID:23256150

  17. Isoepoxydon dehydrogenase (idh) gene expression in relation to patulin production by Penicillium expansum under different temperature and atmosphere.

    Science.gov (United States)

    De Clercq, N; Vlaemynck, G; Van Pamel, E; Van Weyenberg, S; Herman, L; Devlieghere, F; De Meulenaer, B; Van Coillie, E

    2016-03-01

    Penicillium expansum growth and patulin production occur mainly at post-harvest stage during the long-term storage of apples. Low temperature in combination with reduced oxygen concentrations is commonly applied as a control strategy to extend apple shelf life and supply the market throughout the year. Our in vitro study investigated the effect of temperature and atmosphere on expression of the idh gene in relation to the patulin production by P. expansum. The idh gene encodes the isoepoxydon dehydrogenase enzyme, a key enzyme in the patulin biosynthesis pathway. First, a reverse transcription real-time PCR (RT-qPCR) method was optimized to measure accurately the P. expansum idh mRNA levels relative to the mRNA levels of three reference genes (18S, β-tubulin, calmodulin), taking into account important parameters such as PCR inhibition and multiple reference gene stability. Subsequently, two P. expansum field isolates and one reference strain were grown on apple puree agar medium (APAM) under three conditions of temperature and atmosphere: 20 °C - air, 4 °C - air and 4 °C - controlled atmosphere (CA; 3% O2). When P. expansum strains reached a 0.5 and 2.0 cm colony diameter, idh expression and patulin concentrations were determined by means of the developed RT-qPCR and an HPLC-UV method, respectively. The in vitro study showed a clear reduction in patulin production and down-regulation of the idh gene expression when P. expansum was grown under 4 °C - CA. The results suggest that stress (low temperature and oxygen level) caused a delay of the fungal metabolism rather than a complete inhibition of toxin biosynthesis. A good correlation was found between the idh expression and patulin production, corroborating that temperature and atmosphere affected patulin production by acting at the transcriptional level of the idh gene. Finally, a reliable RT-qPCR can be considered as an alternative tool to investigate the effect of control strategies on the toxin formation in

  18. Functional analysis of three type-2 DGAT homologue genes for triacylglycerol production in the green microalga Chlamydomonas reinhardtii.

    Science.gov (United States)

    La Russa, M; Bogen, C; Uhmeyer, A; Doebbe, A; Filippone, E; Kruse, O; Mussgnug, J H

    2012-11-30

    Photosynthetic organisms like plants and algae can use sunlight to produce lipids as important metabolic compounds. Plant-derived triacylglycerols (TAGs) are valuable for human and animal nutrition because of their high energy content and are becoming increasingly important for the production of renewable biofuels. Acyl-CoA:diacylglycerol acyltransferases (DGATs) have been demonstrated to play an important role in the accumulation of TAG compounds in higher plants. DGAT homologue genes have been identified in the genome of the green alga Chlamydomonas reinhardtii, however their function in vivo is still unknown. In this work, the three most promising type-2 DGAT candidate genes potentially involved in TAG lipid accumulation (CrDGAT2a, b and c) were investigated by constructing overexpression strains. For each of the genes, three strains were identified which showed enhanced mRNA levels of between 1.7 and 29.1 times that of the wild type (wt). Total lipid contents, neutral lipids and fatty acid profiles were determined and showed that an enhanced mRNA expression level of the investigated DGAT genes did not boost the intracellular TAG accumulation or resulted in alterations of the fatty acid profiles compared to wild type during standard growth condition or during nitrogen or sulfur stress conditions. We conclude that biotechnological efforts to enhance cellular TAG amount in microalgae need further insights into the complex network of lipid biosynthesis to identify potential bottlenecks of neutral lipid production. PMID:22542934

  19. Extended region of nodulation genes in Rhizobium meliloti 1021. II. Nucleotide sequence, transcription start sites and protein products

    International Nuclear Information System (INIS)

    The authors have established the DNA sequence and analyzed the transcription and translation products of a series of putative nodulation (nod) genes in Rhizobium meliloti strain 1021. Four loci have been designated nodF, nodE, nodG and nodH. The correlation of transposon insertion positions with phenotypes and open reading frames was confirmed by sequencing the insertion junctions of the transposons. The protein products of these nod genes were visualized by in vitro expression of cloned DNA segments in a R. meliloti transcription-translation system. In addition, the sequence for nodG was substantiated by creating translational fusions in all three reading frames at several points in the sequence; the resulting fusions were expressed in vitro in both E. coli and R. meliloti transcription-translation systems. A DNA segment bearing several open reading frames downstream of nodG corresponds to the putative nod gene mutated in strain nod-216. The transcription start sites of nodF and nodH were mapped by primer extension of RNA from cells induced with the plant flavone, luteolin. Initiation of transcription occurs approximately 25 bp downstream from the conserved sequence designated the nod box, suggesting that this conserved sequence acts as an upstream regulator of inducible nod gene expression. Its distance from the transcription start site is more suggestive of an activator binding site rather than an RNA polymerase binding site

  20. Heterologous expression of an orphan NRPS gene cluster from Paenibacillus larvae in Escherichia coli revealed production of sevadicin.

    Science.gov (United States)

    Tang, Ying; Frewert, Simon; Harmrolfs, Kirsten; Herrmann, Jennifer; Karmann, Lisa; Kazmaier, Uli; Xia, Liqiu; Zhang, Youming; Müller, Rolf

    2015-01-20

    The Gram-positive bacterium Paenibacillus larvae is the causative agent of the fateful honey bee disease American Foulbrood (AFB). Sequence analysis of P. larvae genomic DNA showed the presence of numerous nonribosomal peptide synthetase (NRPS) and polyketide synthase (PKS) encoding gene clusters, not correlating with secondary metabolite production. As NRPS and PKS derived metabolites are known to exhibit diverse biological activities, their identification is of particular interest for infection and drug research. Here an 11.6kb orphan NRPS gene cluster was directly cloned from the genomic DNA of P. larvae and expressed in Escherichia coli resulting in the production of sevadicin. Isolation of the metabolite was followed by structural characterization, synthesis and bioactivity studies. PMID:25529345

  1. Occurrence and Diversity of Tetracycline Resistance Genes in Lagoons and Groundwater Underlying Two Swine Production Facilities

    Science.gov (United States)

    Chee-Sanford, J. C.; Aminov, R.I.; Krapac, I.J.; Garrigues-Jeanjean, N.; Mackie, R.I.

    2001-01-01

    In this study, we used PCR typing methods to assess the presence of tetracycline resistance determinants conferring ribosomal protection in waste lagoons and in groundwater underlying two swine farms. All eight classes of genes encoding this mechanism of resistance [tet(O), tet(Q), tet(W), tet(M), tetB(P), tet(S), tet(T), and otrA] were found in total DNA extracted from water of two lagoons. These determinants were found to be seeping into the underlying groundwater and could be detected as far as 250 m downstream from the lagoons. The identities and origin of these genes in groundwater were confirmed by PCR-denaturing gradient gel electrophoresis and sequence analyses. Tetracycline-resistant bacterial isolates from groundwater harbored the tet(M) gene, which was not predominant in the environmental samples and was identical to tet(M) from the lagoons. The presence of this gene in some typical soil inhabitants suggests that the vector of antibiotic resistance gene dissemination is not limited to strains of gastrointestinal origin carrying the gene but can be mobilized into the indigenous soil microbiota. This study demonstrated that tet genes occur in the environment as a direct result of agriculture and suggested that groundwater may be a potential source of antibiotic resistance in the food chain.

  2. Efficient Production of Gene-Modified Mice using Staphylococcus aureus Cas9

    Science.gov (United States)

    Zhang, Xiya; Liang, Puping; Ding, Chenhui; Zhang, Zhen; Zhou, Jianwen; Xie, Xiaowei; Huang, Rui; Sun, Ying; Sun, Hongwei; Zhang, Jinran; Xu, Yanwen; Songyang, Zhou; Huang, Junjiu

    2016-01-01

    The CRISPR/Cas system is an efficient genome-editing tool to modify genes in mouse zygotes. However, only the Streptococcus pyogenes Cas9 (SpCas9) has been systematically tested for generating gene-modified mice. The protospacer adjacent motif (PAM, 5′-NGG-3′) recognized by SpCas9 limits the number of potential target sites for this system. Staphylococcus aureus Cas9 (SaCas9), with its smaller size and unique PAM (5′-NNGRRT-3′) preferences, presents an alternative for genome editing in zygotes. Here, we showed that SaCas9 could efficiently and specifically edit the X-linked gene Slx2 and the autosomal gene Zp1 in mouse zygotes. SaCas9-mediated disruption of the tyrosinase (Tyr) gene led to C57BL/6J mice with mosaic coat color. Furthermore, multiplex targeting proved efficient multiple genes disruption when we co-injected gRNAs targeting Slx2, Zp1, and Tyr together with SaCas9 mRNA. We were also able to insert a Flag tag at the C-terminus of histone H1c, when a Flag-encoding single-stranded DNA oligo was co-introduced into mouse zygotes with SaCas9 mRNA and the gRNA. These results indicate that SaCas9 can specifically cleave the target gene locus, leading to successful gene knock-out and precise knock-in in mouse zygotes, and highlight the potential of using SaCas9 for genome editing in preimplantation embryos and producing gene-modified animal models. PMID:27586692

  3. Purification of the inlB Gene Product of Listeria monocytogenes and Demonstration of Its Biological Activity

    OpenAIRE

    Müller, Simone; Hain, Torsten; Pashalidis, Philippos; Lingnau, Andreas; Domann, Eugen; Chakraborty, Trinad; Wehland, Jürgen

    1998-01-01

    Entry of Listeria monocytogenes into nonphagocytic cells requires the inlAB gene products. InlA and InlB are bacterial cell wall-associated polypeptides that can be released by sodium dodecyl sulfate treatment. By applying more gentle extraction methods, we have purified InlB in its native form. Treatment of bacteria with various nondenaturating agents including mutanolysin, thiol reagents, sodium chloride, and detergents like Triton X-100 or 3-[(3-cholamidopropyl)-dimethylammonio]-1-propanes...

  4. Identification of candidate genes for yeast engineering to improve bioethanol production in very high gravity and lignocellulosic biomass industrial fermentations

    OpenAIRE

    Pereira Francisco B; Guimarães Pedro; Gomes Daniel G; Mira Nuno P; Teixeira Miguel C; Sá-Correia Isabel; Domingues Lucília

    2011-01-01

    Abstract Background The optimization of industrial bioethanol production will depend on the rational design and manipulation of industrial strains to improve their robustness against the many stress factors affecting their performance during very high gravity (VHG) or lignocellulosic fermentations. In this study, a set of Saccharomyces cerevisiae genes found, through genome-wide screenings, to confer resistance to the simultaneous presence of different relevant stresses were identified as req...

  5. Identification of candidate genes for yeast engineering to improve bioethanol production in very high gravity and lignocellulosic biomass industrial fermentations

    OpenAIRE

    Pereira, Francisco B; Guimarães, Pedro M. R.; Gomes, Daniel Gonçalves; Mira, Nuno P.; Teixeira, Miguel C

    2011-01-01

    Background: The optimization of industrial bioethanol production will depend on the rational design and manipulation of industrial strains to improve their robustness against the many stress factors affecting their performance during very high gravity (VHG) or lignocellulosic fermentations. In this study, a set of Saccharomyces cerevisiae genes found, through genome-wide screenings, to confer resistance to the simultaneous presence of different relevant stresses were identified as...

  6. Expression and state of phosphorylation of the retinoblastoma susceptibility gene product in cycling and noncycling human hematopoietic cells.

    OpenAIRE

    Furukawa, Y.; DeCaprio, J A; Freedman, A.; Kanakura, Y.; Nakamura, M.; Ernst, T J; Livingston, D M; Griffin, J D

    1990-01-01

    The product of the retinoblastoma susceptibility gene RB1 (Rb) is likely to function as an inhibitor of cell growth. Previous studies have suggested that certain growth-suppressing effects of Rb are exerted in G0/G1 phase and that phosphorylation can inactivate these functions. We tested this hypothesis by examining the expression and state of phosphorylation of Rb in several lineages of primary hematopoietic cells that spontaneously arrest in G0 phase. Resting lymphocytes were found to expre...

  7. The retinoblastoma-susceptibility gene product becomes phosphorylated in multiple stages during cell cycle entry and progression.

    OpenAIRE

    DeCaprio, J A; Furukawa, Y.; Ajchenbaum, F; Griffin, J D; Livingston, D M

    1992-01-01

    The retinoblastoma-susceptibility gene product (RB) undergoes cell cycle-dependent phosphorylation and dephosphorylation. We characterized RB phosphorylation after mitogenic stimulation of primary human T lymphocytes, initially arrested in the G0 state. RB is phosphorylated in at least three steps when T cells are driven into the cell cycle. The first event occurs during mid G1 phase, the second during S phase, and the third in G2/M. Tryptic phosphopeptide mapping indicates that the different...

  8. FUM Gene Expression Profile and Fumonisin Production by Fusarium verticillioides Inoculated in Bt and Non-Bt Maize.

    Science.gov (United States)

    Rocha, Liliana O; Barroso, Vinícius M; Andrade, Ludmila J; Pereira, Gustavo H A; Ferreira-Castro, Fabiane L; Duarte, Aildson P; Michelotto, Marcos D; Correa, Benedito

    2015-01-01

    This study aimed to determine the levels of fumonisins produced by Fusarium verticillioides and FUM gene expression on Bt (Bacillus thuringiensis) and non-Bt maize, post harvest, during different periods of incubation. Transgenic hybrids 30F35 YG, 2B710 Hx and their isogenic (30F35 and 2B710) were collected from the field and a subset of 30 samples selected for the experiments. Maize samples were sterilized by gamma radiation at a dose of 20 kGy. Samples were then inoculated with F. verticillioides and analyzed under controlled conditions of temperature and relative humidity for fumonisin B1 and B2 (FB1 and FB2) production and FUM1, FUM3, FUM6, FUM7, FUM8, FUM13, FUM14, FUM15, and FUM19 expression. 2B710 Hx and 30F35 YG kernel samples were virtually intact when compared to the non-Bt hybrids that came from the field. Statistical analysis showed that FB1 production was significantly lower in 30F35 YG and 2B710 Hx than in the 30F35 and 2B710 hybrids (P 0.05). The kernel injuries observed in the non-Bt samples have possibly facilitated F. verticillioides penetration and promoted FB1 production under controlled conditions. FUM genes were expressed by F. verticillioides in all of the samples. However, there was indication of lower expression of a few FUM genes in the Bt hybrids; and a weak association between FB1 production and the relative expression of some of the FUM genes were observed in the 30F35 YG hybrid. PMID:26779158

  9. L-lactic acid production from D-xylose with Candida sonorensis expressing a heterologous lactate dehydrogenase encoding gene

    OpenAIRE

    Koivuranta, Kari T; Ilmén, Marja; Wiebe, Marilyn G.; Ruohonen, Laura; Suominen, Pirkko; Penttilä, Merja

    2014-01-01

    Background Bioplastics, like polylactic acid (PLA), are renewable alternatives for petroleum-based plastics. Lactic acid, the monomer of PLA, has traditionally been produced biotechnologically with bacteria. With genetic engineering, yeast have the potential to replace bacteria in biotechnological lactic acid production, with the benefits of being acid tolerant and having simple nutritional requirements. Lactate dehydrogenase genes have been introduced to various yeast to demonstrate this pot...

  10. Genomic Characterisation and Polymorphism Analysis of Candidate Genes for Milk Production Traits and Association Studies in Three Cattle Breeds

    OpenAIRE

    Seefried, Franz Reinhold

    2008-01-01

    In the past decades, various mapping experiments resulted in the detection of several markers affecting milk production traits on bovine chromosome 6. The aim of this study was to identify causative polymorphisms of milk traits using a multiple breed approach. Six selected candidate genes on chromosome 6 in cattle were characterised and screened for polymorphisms. Following this, 50 polymorphisms were genotyped in sires of German Brown, Fleckvieh and German Holstein for investigation in assoc...

  11. FUM gene expression profile and fumonisin production by Fusarium verticillioides inoculated in Bt and non-Bt maize

    Directory of Open Access Journals (Sweden)

    Liliana Oliveira Rocha

    2016-01-01

    Full Text Available This study aimed to determine the levels of fumonisins produced by F. verticillioides and FUM gene expression on Bt (Bacillus thuringiensis and non-Bt maize, post harvest, during different periods of incubation. Transgenic hybrids 30F35 YG, 2B710 Hx and their isogenic (30F35 and 2B710 were collected from the field and a subset of 30 samples selected for the experiments. Maize samples were sterilized by gamma radiation at a dose of 20 kGy. Samples were then inoculated with Fusarium verticillioides and analysed under controlled conditions of temperature and relative humidity for fumonisin B1 and B2 (FB¬1 and FB2 production and FUM1, FUM3, FUM6, FUM7, FUM8, FUM13, FUM14, FUM15 and FUM19 expression. 2B710 Hx and 30F35 YG kernel samples were virtually intact when compared to the non-Bt hybrids that came from the field. Statistical analysis showed that FB¬1 production was significantly lower in 30F35 YG and 2B710 Hx than in the 30F35 and 2B710 hybrids (P 0.05. The kernel injuries observed in the non-Bt samples have possibly facilitated F. verticillioides penetration and promoted FB1 production under controlled conditions. FUM genes were expressed by F. verticillioides in all of the samples. However, there was indication of lower expression of a few FUM genes in the Bt hybrids; and a weak association between FB1 production and the relative expression of some of the FUM genes were observed in the 30F35 YG hybrid.

  12. FUM Gene Expression Profile and Fumonisin Production by Fusarium verticillioides Inoculated in Bt and Non-Bt Maize

    Science.gov (United States)

    Rocha, Liliana O.; Barroso, Vinícius M.; Andrade, Ludmila J.; Pereira, Gustavo H. A.; Ferreira-Castro, Fabiane L.; Duarte, Aildson P.; Michelotto, Marcos D.; Correa, Benedito

    2016-01-01

    This study aimed to determine the levels of fumonisins produced by Fusarium verticillioides and FUM gene expression on Bt (Bacillus thuringiensis) and non-Bt maize, post harvest, during different periods of incubation. Transgenic hybrids 30F35 YG, 2B710 Hx and their isogenic (30F35 and 2B710) were collected from the field and a subset of 30 samples selected for the experiments. Maize samples were sterilized by gamma radiation at a dose of 20 kGy. Samples were then inoculated with F. verticillioides and analyzed under controlled conditions of temperature and relative humidity for fumonisin B1 and B2 (FB1 and FB2) production and FUM1, FUM3, FUM6, FUM7, FUM8, FUM13, FUM14, FUM15, and FUM19 expression. 2B710 Hx and 30F35 YG kernel samples were virtually intact when compared to the non-Bt hybrids that came from the field. Statistical analysis showed that FB1 production was significantly lower in 30F35 YG and 2B710 Hx than in the 30F35 and 2B710 hybrids (P 0.05). The kernel injuries observed in the non-Bt samples have possibly facilitated F. verticillioides penetration and promoted FB1 production under controlled conditions. FUM genes were expressed by F. verticillioides in all of the samples. However, there was indication of lower expression of a few FUM genes in the Bt hybrids; and a weak association between FB1 production and the relative expression of some of the FUM genes were observed in the 30F35 YG hybrid. PMID:26779158

  13. Evaluation of gene expression and alginate production in response to oxygen transfer in continuous culture of Azotobacter vinelandii.

    Directory of Open Access Journals (Sweden)

    Alvaro Díaz-Barrera

    Full Text Available Alginates are polysaccharides used as food additives and encapsulation agents in biotechnology, and their functional properties depend on its molecular weight. In this study, different steady-states in continuous cultures of A. vinelandii were established to determine the effect of the dilution rate (D and the agitation rate on alginate production and expression of genes involved in alginate polymerization and depolymerization. Both, the agitation and dilution rates, determined the partitioning of the carbon utilization from sucrose into alginate and CO2 under oxygen-limiting conditions. A low D (0.07 h(-1 and 500 rpm resulted in the highest carbon utilization into alginate (25%. Quantitative real-time polymerase chain reaction was used to determine the transcription level of six genes involved in alginate polymerization and depolymerization. In chemostat cultures at 0.07 h(-1, the gene expression was affected by changes in the agitation rate. By increasing the agitation rate from 400 to 600 rpm, the algE7 gene expression decreased tenfold, whereas alyA1, algL and alyA2 gene expression increased between 1.5 and 2.8 times under similar conditions evaluated. Chemostat at 0.07 h(-1 showed a highest alginate molecular weight (580 kDa at 500 rpm whereas similar molecular weights (480 kDa were obtained at 400 and 600 rpm. The highest molecular weight was not explained by changes in the expression of alg8 and alg44 (genes involved in alginate polymerization. Nonetheless, a different expression pattern observed for lyases could explain the highest alginate molecular weight obtained. Overall, the results suggest that the control of alginate molecular weight in A. vinelandii cells growing in continuous mode is determined by a balance between the gene expression of intracellular and extracellular lyases in response to oxygen availability. These findings better our understanding of the biosynthesis of bacterial alginate and help us progress toward obtain

  14. Heterologous expression of Mus musculus immunoresponsive gene 1 (irg1 in Escherichia coli results in itaconate production

    Directory of Open Access Journals (Sweden)

    Kiira S Vuoristo

    2015-08-01

    Full Text Available Itaconic acid, a C5-dicarboxylic acid, is a potential biobased building block for the polymer industry. It is obtained from the citric acid cycle by decarboxylation of cis-aconitic acid. This reaction is catalysed by CadA in the native itaconic acid producer Aspergillus terreus. Recently, another enzyme encoded by the mammalian immunoresponsive gene 1 (irg1, was found to decarboxylate cis-aconitate to itaconate in vitro. We show that heterologous expression of irg1 enabled itaconate production in E. coli with production titres up to 560 mg/L.

  15. Gene detection and toxin production evaluation of hemolysin BL of Bacillus cereus isolated from milk and dairy products marketed in Brazil

    Directory of Open Access Journals (Sweden)

    Andre L.S. Reis

    2013-12-01

    Full Text Available Bacillus cereusis an ubiquitous, spore-forming bacteria that can survive pasteurization and the majority of the heating processes used in the dairy industry. Besides, it is a pathogen responsible for different types of food poisoning. One type of foodborne disease caused by B.cereusis the diarrheal syndrome, which is caused by the ingestion of vegetative cells producing toxins in the small intestine. One virulence factor for the diarrheal syndrome is the toxin hemolysin BL (HBL, a three-component protein formed by the L1, L2 and B components. In order to evaluate the presence of diarrheal strains isolated from milk and dairy products, 63 B. cereus isolates were obtained from 260 samples of UHT milk, pasteurized milk and powdered milk, sold in commercial establishments and from different brands. The isolates were subjected to the Polymerase Chain Reaction (PCR for the detection of the encoding genes for the L1, L2 and B components and the toxin production capacity were evaluated with an immunoassay. A total of 23 [36.5%] isolates were identified carrying simultaneously the three tested genes, from which, 20 [86.9%] showed toxigenic capacity. 26 [41.3%] isolates did not carry any of genes tested and the other 14 [22.2%] were positive for one or two of them. The results showed a high toxigenic capacity among the B. cereus isolates able to produce the HBL, indicating a potential risk for consumers.

  16. Gene detection and toxin production evaluation of hemolysin BL of Bacillus cereus isolated from milk and dairy products marketed in Brazil.

    Science.gov (United States)

    Reis, Andre L S; Montanhini, Maike T M; Bittencourt, Juliana V M; Destro, Maria T; Bersot, Luciano S

    2013-12-01

    Bacillus cereusis an ubiquitous, spore-forming bacteria that can survive pasteurization and the majority of the heating processes used in the dairy industry. Besides, it is a pathogen responsible for different types of food poisoning. One type of foodborne disease caused by B.cereusis the diarrheal syndrome, which is caused by the ingestion of vegetative cells producing toxins in the small intestine. One virulence factor for the diarrheal syndrome is the toxin hemolysin BL (HBL), a three-component protein formed by the L1, L2 and B components. In order to evaluate the presence of diarrheal strains isolated from milk and dairy products, 63 B. cereus isolates were obtained from 260 samples of UHT milk, pasteurized milk and powdered milk, sold in commercial establishments and from different brands. The isolates were subjected to the Polymerase Chain Reaction (PCR) for the detection of the encoding genes for the L1, L2 and B components and the toxin production capacity were evaluated with an immunoassay. A total of 23 [36.5%] isolates were identified carrying simultaneously the three tested genes, from which, 20 [86.9%] showed toxigenic capacity. 26 [41.3%] isolates did not carry any of genes tested and the other 14 [22.2%] were positive for one or two of them. The results showed a high toxigenic capacity among the B. cereus isolates able to produce the HBL, indicating a potential risk for consumers. PMID:24688511

  17. Production Data - Captive Broodstock Gene Rescue Program for Odd Year Class Elwha River Pink Salmon

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Conduct captive brood stock gene rescue program for Elwha River odd-year class pink salmon. Information on the number of smolts received into the program is...

  18. Retroviral-mediated transfer of genomic globin genes leads to regulated production of RNA and protein

    International Nuclear Information System (INIS)

    A high-titer amphotropic retroviral vector containing the neomycin resistance gene and a hybrid γ-β genomic human globin gene has been constructed. Mouse erythroleukemia cells infected with this virus were found to contain the full transcriptional unit of the transferred human globin gene by Southern blot analysis. These cells contain normally initiated, spliced, and terminated human globin mRNA. The human globin mRNA level increased 5- to 10-fold upon induction of the mouse erythroleukemia cells. Human globin chains were produced but only in a fraction of the cells as detected by immunofluorescent staining. A similar retrovirus containing a human β-globin gene was used to transduce mouse erythroleukemia cells resulting in much higher levels of human globin synthesis than detected in mouse erythroleukemia cells transduced with the γ-β globin virus

  19. Characterization of the human GYS2 gene and its product using bioinformatic tools

    OpenAIRE

    DİLMEÇ, Fuat

    2009-01-01

    Aim: The GYS2 gene, which encodes for glycogen synthase 2 (liver) (GS), is an enzyme responsible for the synthesis of 1,4-linked glucose chains in glycogen. The present study aimed to investigate the homology, conserved domain, and promoter and expression profiles of the human GYS2 gene among various vertebrate species using bioinformatic tools. Materials and Methods: We analyzed the homology with NCBI blast, the conserved domain with EBI ClustalW and Mega4, the promoter with Genomatix, and...

  20. Analysis of transfer genes and gene products within the traB-traC region of the Escherichia coli fertility factor, F

    International Nuclear Information System (INIS)

    A series of plasmids that carry overlapping segments of F DNA encoding the genes in the traB-traC interval was constructed, and a restriction enzyme map of the region was derived. Plasmids carrying deletions that had been introduced at an HpaI sites within this interval were also isolated. The ability of these plasmids to complement transfer of F lac plasmids carrying mutations in traB, traV, traW, and traC was analyzed. The protein products of the plasmids were labeled in UV-irradiated cells and analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and autoradiography. These analyses showed that the product of traV is a polypeptide that migrates with an apparent molecular weight of 21,000. It was not detected when [35S]methionine was used to label plasmid products, but was readily detected in 14C-amino acid labeling experiments. A 21,500-dalton product appeared to stem from the region assigned to traP. A 9000-dalton product was found to stem from a locus, named traR, that is located between traV and traC. No traW activity could be detected from the region of tra DNA examined. The authors data also indicated that traC is located in a more promoter-proximal position than suggested on earlier maps. The plasmids constructed are expected to be useful in studies designed to identify the specific functions of the traB, -P, -V, -R, and -C products

  1. Drosophila eggshell production: identification of new genes and coordination by Pxt.

    Directory of Open Access Journals (Sweden)

    Tina L Tootle

    Full Text Available Drosophila ovarian follicles complete development using a spatially and temporally controlled maturation process in which they resume meiosis and secrete a multi-layered, protective eggshell before undergoing arrest and/or ovulation. Microarray analysis revealed more than 150 genes that are expressed in a stage-specific manner during the last 24 hours of follicle development. These include all 30 previously known eggshell genes, as well as 19 new candidate chorion genes and 100 other genes likely to participate in maturation. Mutations in pxt, encoding a putative Drosophila cyclooxygenase, cause many transcripts to begin expression prematurely, and are associated with eggshell defects. Somatic activity of Pxt is required, as RNAi knockdown of pxt in the follicle cells recapitulates both the temporal expression and eggshell defects. One of the temporally regulated genes, cyp18a1, which encodes a cytochromome P450 protein mediating ecdysone turnover, is downregulated in pxt mutant follicles, and cyp18a1 mutation itself alters eggshell gene expression. These studies further define the molecular program of Drosophila follicle maturation and support the idea that it is coordinated by lipid and steroid hormonal signals.

  2. Staphylococcus aureus Biofilm and Planktonic cultures differentially impact gene expression, mapk phosphorylation, and cytokine production in human keratinocytes

    Directory of Open Access Journals (Sweden)

    Olerud John E

    2011-06-01

    Full Text Available Abstract Background Many chronic diseases, such as non-healing wounds are characterized by prolonged inflammation and respond poorly to conventional treatment. Bacterial biofilms are a major impediment to wound healing. Persistent infection of the skin allows the formation of complex bacterial communities termed biofilm. Bacteria living in biofilms are phenotypically distinct from their planktonic counterparts and are orders of magnitude more resistant to antibiotics, host immune response, and environmental stress. Staphylococcus aureus is prevalent in cutaneous infections such as chronic wounds and is an important human pathogen. Results The impact of S. aureus soluble products in biofilm-conditioned medium (BCM or in planktonic-conditioned medium (PCM on human keratinocytes was investigated. Proteomic analysis of BCM and PCM revealed differential protein compositions with PCM containing several enzymes involved in glycolysis. Global gene expression of keratinocytes exposed to biofilm and planktonic S. aureus was analyzed after four hours of exposure. Gene ontology terms associated with responses to bacteria, inflammation, apoptosis, chemotaxis, and signal transduction were enriched in BCM treated keratinocytes. Several transcripts encoding cytokines were also upregulated by BCM after four hours. ELISA analysis of cytokines confirmed microarray results at four hours and revealed that after 24 hours of exposure, S. aureus biofilm induced sustained low level cytokine production compared to near exponential increases of cytokines in planktonic treated keratinocytes. The reduction in cytokines produced by keratinocytes exposed to biofilm was accompanied by suppressed phosphorylation of MAPKs. Chemical inhibition of MAPKs did not drastically reduce cytokine production in BCM-treated keratinocytes suggesting that the majority of cytokine production is mediated through MAPK-independent mechanisms. Conclusions Collectively the results indicate that S

  3. Detection and Diversity evaluation of tetracycline resistance genes in grassland-based production systems in Colombia, South America

    Directory of Open Access Journals (Sweden)

    Johanna eSantamaría

    2011-12-01

    Full Text Available Grassland-based production systems use approximately 26 percent of land surface on earth. However, there are no evaluations of these systems as a source of antibiotic pollution. This study was conducted to evaluate the presence, diversity, and distribution of tetracycline resistance genes in the grasslands of the Colombian Andes, where administration of antibiotics to animals is limited to treat disease and growth promoters are not included in animals’ diet. Animal (ruminal fluid and feces and environmental (soil and water samples were collected from six different dairy cattle farms and evaluated by PCR for the genes encoding ribosomal protection proteins (RPPs tet(M, tet(O, tetB(P, tet(Q tet(W, tet(S, tet(T, tet(A, and tetracycline efflux pumps tet(A, tet(B, tet(D, tet(H, tet(J, tet(Z, and tet(D. A wide distribution and high frequency for genes tet(W and tet(Q were found in both sample types. Other genes encoding RPPs ( tetB(P, tet(O, tet(M, tet(S and tet(T were detected at lower frequencies and more restricted distributions. Genes encoding efflux pumps were not common in this region, and only two of them, tet(B and tet(Z, were detected. DGGE-PCR followed by comparative sequence analysis of tet(W and tet(Q showed that the sequences detected in animals did not differ from those coming from soil and water, suggesting the transmission of tet genes from animal reservoirs to the environment. Additionally, there seems to be a differential flow of tet genes from one reservoir to the other because gene tet(O and tetB(P, detected in high frequencies in feces, were detected in low frequencies or not detected at all in the environment. Finally, the farms sampled in this study showed more than 50% similarity in relation to the tet genes detected and their frequencies. However, farms closer in space and under the influence of the same hydrographic network were significantly more similar to each other.

  4. Enhancing hydrogen production of Enterobacter aerogenes by heterologous expression of hydrogenase genes originated from Synechocystis sp.

    Science.gov (United States)

    Song, Wenlu; Cheng, Jun; Zhao, Jinfang; Zhang, Chuanxi; Zhou, Junhu; Cen, Kefa

    2016-09-01

    The hydrogenase genes (hoxEFUYH) of Synechocystis sp. PCC 6803 were cloned and heterologously expressed in Enterobacter aerogenes ATCC13408 for the first time in this study, and the hydrogen yield was significantly enhanced using the recombinant strain. A recombinant plasmid containing the gene in-frame with Glutathione-S-Transferase (GST) gene was transformed into E. aerogenes ATCC13408 to produce a GST-fusion protein. SDS-PAGE and western blot analysis confirm the successful expression of the hox genes. The hydrogenase activity of the recombinant strain is 237.6±9.3ml/(g-DW·h), which is 152% higher than the wild strain. The hydrogen yield of the recombinant strain is 298.3ml/g-glucose, which is 88% higher than the wild strain. During hydrogen fermentation, the recombinant strain produces more acetate and butyrate, but less ethanol. This is corresponding to the NADH metabolism in the cell due to the higher hydrogenase activity with the heterologous expression of hox genes. PMID:27343449

  5. Characterization of representative rpoB gene mutations leading to a significant change in toyocamycin production of Streptomyces diastatochromogenes 1628.

    Science.gov (United States)

    Ma, Zheng; Luo, Shuai; Xu, Xianhao; Bechthold, Andreas; Yu, Xiaoping

    2016-04-01

    Modification of enzymes involved in transcription- or translation-processes is an interesting way to increase secondary metabolite production in Streptomycetes. However, application of such methods has not been widely described for strains which produce nucleoside antibiotics. The nucleoside antibiotic toyocamycin (TM) is produced by Streptomyces diastatochromogenes 1628. For improving TM production in S. diastatochromogenes 1628, the strain was spread on rifamycin-resistant (Rif(r)) medium. Several spontaneous mutants were obtained with mutations in the rpoB gene which encodes a RNA polymerase β-subunit. The mutants which showed increased TM production were detected at a frequency of 7.5 % among the total Rif(r) mutants. Mutant 1628-T15 harboring amino acid substitution His437Arg was the best TM producer with a 4.5-fold increase in comparison to that of the wild-type strain. The worst producer was mutant 1628-T62 which also showed a poor sporulation behavior. RT-PCR was performed to study the transcription levels of the TM biosynthetic gene toyG in the parental strain as well as in mutants 1628-T15 and 1628-T62. The transcriptional level of toyG was higher in mutant 1628-T15 than that in parental strain 1628, while much lower in mutant 1628-T62. In mutant strain 1628-T62 the expression of adpA sd gene, which is required for morphological differentiation, was also much lower. Our studies also indicate that the introduction of mutations into rpoB is an effective strategy to improve the production of TM which is an important nucleoside antibiotic. PMID:26790416

  6. Cloning, reassembling and integration of the entire nikkomycin biosynthetic gene cluster into Streptomyces ansochromogenes lead to an improved nikkomycin production

    Directory of Open Access Journals (Sweden)

    Yang Haihua

    2010-01-01

    Full Text Available Abstract Background Nikkomycins are a group of peptidyl nucleoside antibiotics produced by Streptomyces ansochromogenes. They are competitive inhibitors of chitin synthase and show potent fungicidal, insecticidal, and acaricidal activities. Nikkomycin X and Z are the main components produced by S. ansochromogenes. Generation of a high-producing strain is crucial to scale up nikkomycins production for further clinical trials. Results To increase the yields of nikkomycins, an additional copy of nikkomycin biosynthetic gene cluster (35 kb was introduced into nikkomycin producing strain, S. ansochromogenes 7100. The gene cluster was first reassembled into an integrative plasmid by Red/ET technology combining with classic cloning methods and then the resulting plasmid(pNIKwas introduced into S. ansochromogenes by conjugal transfer. Introduction of pNIK led to enhanced production of nikkomycins (880 mg L-1, 4 -fold nikkomycin X and 210 mg L-1, 1.8-fold nikkomycin Z in the resulting exconjugants comparing with the parent strain (220 mg L-1 nikkomycin X and 120 mg L-1 nikkomycin Z. The exconjugants are genetically stable in the absence of antibiotic resistance selection pressure. Conclusion A high nikkomycins producing strain (1100 mg L-1 nikkomycins was obtained by introduction of an extra nikkomycin biosynthetic gene cluster into the genome of S. ansochromogenes. The strategies presented here could be applicable to other bacteria to improve the yields of secondary metabolites.

  7. The Impact of Kappa Casein Gene Polymorphism on Milk Components and Other Productive Performance Traits of Chinese Holstein Cattle

    Directory of Open Access Journals (Sweden)

    A. E. Hamza1, 2, Z. P.Yang1*, X. L. Wang1, R. J. Chen1, H. T. Wu1 and A. I. Ibrahim3

    2011-04-01

    Full Text Available Polymorphism of kappa casein gene (κ-Cn at exon 5 in 259 Chinese Holstein cattle was investigated using polymerase chain reaction-single strand conformation (PCR-SSCP technique, to verify its effect on milk composition (fat, protein, lactose, total solids (TS and solids not fat (SNF content and influence of other factors such as parity and season of calving; aiming at utilizing it as a genetic aid in selection to improve the quality of production of this herd. A 218 bp fragment containing exon 1V of kappa casein gene was amplified by PCR and SSCP was applied to identify the structural gene polymorphism of κ-Cn. General linear model (GLM was used to analyze differences between genotypes. The results indicated that κ-Cn genotypes significantly (P0.05 on TS and SNF. However, cows with genotype TT showed higher fat and protein contents (3.89 and 3.50%, respectively than those of genotypes CC and TC (3.62 and 3.66% for fat; 3.35 and 3.36 % for protein, respectively. Except for lactose content; parity had no effect on milk components. Also, the results disclosed that season of calving did not affect (P>0.05 milk composition. This study indicated that the κ-Cn genetic variants may be used as a genetic aid through increasing the frequency of desired genotypes to improve the quality of production of this herd.

  8. Lessons in détente or know thy host: the immunomodulatory gene products of myxoma virus.

    Science.gov (United States)

    Zúñiga, Martha C

    2003-04-01

    The poxvirus, myxoma virus, encodes within its genome at least eleven different proteins that compromise, skew, or disable the innate and adaptive responses of its hosts. In the laboratory rabbit, Oryctolagus cuniculus, these effects result in myxomatosis, a fatal condition characterized by skin lesions and systemic immunosuppression. Interestingly, while myxoma infection also causes skin lesions in its natural host and in natural populations of O. cuniculus in Australia where this novel host and the virus have co-evolved, the condition of myxomatosis does not ensue and infection is not fatal. In this review I discuss the biochemical properties of the characterized immunomodulatory proteins of myxoma virus, and their pathogenic effects in laboratory rabbits. Disruption of any one myxoma immunomodulatory gene diminishes the severity of the infection without compromising infectivity. Thus, the characterized immunomodulatory genes appear not to be required for a productive infection in vivo. The differences in the severity of their effects in laboratory-bred versus wild O. cuniculus suggest that the outcome of myxoma infection is a consequence of the interplay between the viral immunomodulatory gene products and the cells and molecules of the host immune system. PMID:12734406

  9. Volatile Gas Production by Methyl Halide Transferase: An In Situ Reporter Of Microbial Gene Expression In Soil.

    Science.gov (United States)

    Cheng, Hsiao-Ying; Masiello, Caroline A; Bennett, George N; Silberg, Jonathan J

    2016-08-16

    Traditional visual reporters of gene expression have only very limited use in soils because their outputs are challenging to detect through the soil matrix. This severely restricts our ability to study time-dependent microbial gene expression in one of the Earth's largest, most complex habitats. Here we describe an approach to report on dynamic gene expression within a microbial population in a soil under natural water levels (at and below water holding capacity) via production of methyl halides using a methyl halide transferase. As a proof-of-concept application, we couple the expression of this gas reporter to the conjugative transfer of a bacterial plasmid in a soil matrix and show that gas released from the matrix displays a strong correlation with the number of transconjugant bacteria that formed. Gas reporting of gene expression will make possible dynamic studies of natural and engineered microbes within many hard-to-image environmental matrices (soils, sediments, sludge, and biomass) at sample scales exceeding those used for traditional visual reporting. PMID:27415416

  10. Prenatal exposure to dexamethasone disturbs sex-determining gene expression and fetal testosterone production in male embryos.

    Science.gov (United States)

    Yun, Hyo Jung; Lee, Ji-Yeon; Kim, Myoung Hee

    2016-02-26

    Prenatal stress is known to cause intrauterine fetal growth retardation, and is also associated with various long-term effects in the form of metabolic and neurodevelopmental diseases in adults. Many of the diseases associated with prenatal stress exhibit a sex bias. Perturbations and vulnerability to prenatal stress are often more profound in males, but the mechanisms responsible for this relationship are not clear. We have previously shown that administration of the synthetic glucocorticoid, dexamethasone (Dex), at embryonic days 7.5, 8.5, and 9.5, induces embryonic growth restriction in a sex-dependent manner in a mouse model. Here we examined the effect of prenatal exposure to Dex on gonadal development. During male gonadal development, sex-determining genes, such as Sry, Sox9, and other downstream genes, were found to be dysregulated in response to prenatal Dex, whereas the genes for the ovarian pathway were affected to a lesser degree in females. In addition, fetal testosterone concentrations were decreased by prenatal exposure to Dex, in parallel with reduced numbers of 3β-hydroxysteroid dehydrogenase (3β-HSD)-positive cells in the embryonic testis. These results show that prenatal exposure to Dex differentially influences male versus female on the gene expression and hormone production during sex determination. We believe these studies provide valuable insights into possible mechanisms responsible for sex-specific responses to prenatal stress. PMID:26827828

  11. Targeted disruption of the mouse adenine phosphoribosyltransferase (aprt) gene and the production of APRT-deficient mice

    Energy Technology Data Exchange (ETDEWEB)

    Engle, S.J.; Chen, J.; Tischfield, J.A. [Indiana Univ., School of Medicine, Indianapolis, IN (United States)] [and others

    1994-09-01

    Adenine phosphoribosyltransferase (APRT: EC 2.4.2.7), a ubiquitously expressed purine salvage enzyme, catalyzes the synthesis of AMP and inorganic pyrophosphate from existing adenine and 5-phosphoribosyl-1-pyrophosphate. Deficiency of this enzyme in humans results in the accumulation of 2,8-dihydroxyadenine leading to crystalluria and nephrolithiasis. In order to facilitate our study of this rare, autosomal recessive disorder, we applied the advances in gene targeting technology and mouse embryonic stem (ES) cell culture to the production of APRT-deficient mice. A positive-negative targeting strategy was used. The tageting vector contain 5.6 kb of the mouse APRT gene, a neomycin resistance gene in exon 3 as a positive selection marker, and a HSV thymidine kinase gene at the 3{prime} end of the homology as a negative selection marker. The vector was introduced into D3 ES cells by electroporation and the cells were selected for G418 and ganciclovir (GANC) resistance. G418-GANC resistant clones were screened by Southern blot. One of several correctly targeted clones was expanded and used for blastocyst microinjection to produce chimeric mice. Chimeric animals were bred and agouti progeny heterozygous for the targeted allele were obtained. Heterozygous animals have been bred to produce APRT-deficient animals. Matings are currently underway to determine the phenotype of APRT/HPRT-deficient animals.

  12. A Sulfonylurea Herbicide Resistance Gene from Arabidopsis thaliana as a New Selectable Marker for Production of Fertile Transgenic Rice Plants.

    Science.gov (United States)

    Li, Z; Hayashimoto, A; Murai, N

    1992-10-01

    A mutant acetolactate synthase (ALS) gene, csr1-1, isolated from sulfonylurea herbicide-resistant Arabidopsis thaliana, was placed under control of a cauliflower mosaic virus 35S promoter (35S). Rice protoplasts were transformed with the 35S/ALS chimeric gene and regenerated into fertile transgenic rice (Oryza sativa) plants. The 35S/ALS gene was expressed effectively as demonstrated by northern blot hybridization analysis, and conferred to transformed calli at least 200-fold greater chlorsulfuron resistance than nontransformed control calli. Effective selection of 35S/ALS-transformed protoplasts was achieved at extremely low chlorsulfuron concentrations of 10 nm. The results demonstrated that the 35S/ALS gene is an alternative selectable marker for rice protoplast transformation and fertile transgenic rice production. The results also suggest that the mutant form of Arabidopsis ALS enzyme operates normally in rice cells. Thus, the mechanism of protein transport to chloroplast and ALS inhibition by chlorsulfuron is apparently conserved among plant species as diverse as Arabidopsis (dicotyledon) and rice (monocotyledon). PMID:16653044

  13. Significant enhancement of methionol production by co-expression of the aminotransferase gene ARO8 and the decarboxylase gene ARO10 in Saccharomyces cerevisiae.

    Science.gov (United States)

    Yin, Sheng; Lang, Tiandan; Xiao, Xiao; Liu, Li; Sun, Baoguo; Wang, Chengtao

    2015-03-01

    Methionol is an important volatile sulfur flavor compound, which can be produced via the Ehrlich pathway in Saccharomyces cerevisiae. Aminotransferase and decarboxylase are essential enzymes catalyzing methionol biosynthesis. In this work, two aminotransferase genes ARO8 and ARO9 and one decarboxylase gene ARO10 were introduced into S. cerevisiae S288c, respectively, via an expression vector. Over-expression of ARO8 resulted in higher aminotransferase activity than that of ARO9. And the cellular decarboxylase activity was remarkably increased by over-expression of ARO10. A co-expression vector carrying both ARO8 and ARO10 was further constructed to generate the recombinant strain S810. Shaking flask experiments showed that the methionol yield from S810 reached 1.27 g L(-1), which was increased by 51.8 and 68.8% compared to that from the wild-type strain and the control strain harboring the empty vector. The fed-batch fermentation by strain S810 produced 3.24 g L(-1) of methionol after 72 h of cultivation in a bioreactor. These results demonstrated that co-expression of ARO8 and ARO10 significantly boosted the methionol production. It is the first time that more than 3.0 g L(-1) of methionol produced by genetically engineered yeast strain was reported by co-expression of the aminotransferase and decarboxylase via the Ehrlich pathway. PMID:25743068

  14. Pollen and seed mediated gene flow in commercial alfalfa seed production fields

    Science.gov (United States)

    The potential for gene flow has been widely recognized since alfalfa is pollinated by bees. The Western US is a major exporter of alfalfa seed and hay and the organic dairy industry is one of the fastest growing agricultural sectors. Because of this, many alfalfa producers are impacted by market sen...

  15. BIOFILTRATION INCORPORATING GENE SILENCING TECHNOLOGY FOR THE PRODUCTION OF METHANOL FROM METHANE CONTAINING WASTE GASES

    Science.gov (United States)

    I expect the proposed and revised approach will work, as there are multiple examples of plasmid-based gene silencing systems in nature (HOK/SOK is a perfect example). The challenge will be in developing a strong plasmid for use in methanotrophs. Potential to ...

  16. Myostatin gene (MSTN polymorphism with a negative effect on meat productivity in Dzhalginsky Merino sheep breed

    Directory of Open Access Journals (Sweden)

    VLADIMIR TRUKHACHEV

    2015-08-01

    Full Text Available One of the most important negative regulator of muscle grow in mammalians is myostatin. Some mutations in myostatin gene (MSTN can decrease the effect of protein and play role in meat quality of sheep. Therefore, in genome selection, knowledge of MSTN gene structure is very important. We investigated the polymorphism of the MSTN gene and its influence on body parameters in Russian sheep breed Dzhalginsky Merino. To detect alleles, we use NimbleGen sequencing technolog. In this breed, we found 20 single nucleotide polymorphism (SNP. That is SNP in promoter: с.-1866, с.-1404, с.-1401, с.-1213, с.-1128, с.-958, с.-783; 5'UTR: с.-40; exon I: с.101; intron 1-2: c.373+18, c.373+241, c.373+243, c.373+259, c.373+563; intron 2-3: с.747+164, с.747+309, с.748-810, с.748-229G>A, с.748-475; 3'UTR: с.*1232. Three of detected SNP (c.-1128, c.-958, c.-40 have a negative effect on the body parameters – decrease weight, height and other. Other three SNP (c.101, c.373+18, с.*1232 have not significant influence on this parameters. Our investigation is a base of next research of affection of different MSTN gene alleles on meat quality and can be used to prepare a PCR test-system for genomic selection.

  17. Environmental effects on resistance gene expression in milk stage popcorn kernels and associations with mycotoxin production

    Science.gov (United States)

    Like other forms of maize, popcorn is subject to increased levels of contamination by a variety of different mycotoxins under stress conditions, although levels generally are less than dent maize under comparable stress. Gene array analysis was used to determine expression differences of disease res...

  18. recA gene product is responsible for inhibition of deoxyribonucleic acid synthesis after ultraviolet irradiation.

    OpenAIRE

    Trgovcević, Z; Petranović, D; Petranović, M; Salaj-Smic, E

    1980-01-01

    Deoxyribonucleic acid synthesis after ultraviolet irradiation was studied in wild-type, uvrA, recB, recA recB, and recA Escherichia coli strains. Inhibition of deoxyribonucleic acid synthesis, which occurs almost immediately after exposing the cells to ultraviolet radiation, depends on the functional gene recA.

  19. recA gene product is responsible for inhibition of deoxyribonucleic acid synthesis after ultraviolet irradiation

    International Nuclear Information System (INIS)

    Deoxyribonucleic acid synthesis after ultraviolet irradiation was studied in wild-type, uvrA, recB, recA, recB, and recA Escherichia coli strains. Inhibition of deoxyribonucleic acid synthesis, which occurs almost immediately after exposing the cells to ultraviolet radiation, depends on the functional gene recA

  20. Effects of Cytokine IL-18 Gene on Antibody Production Induced by Ag85A DNA Vaccine

    Institute of Scientific and Technical Information of China (English)

    CHENHai-wen; WANGZi-ming; FANXiong-lin; GANWei-min; SHITao; XUZhi-kai; LIYuan

    2004-01-01

    Objective: To investigate the effects of plasmid containing human IL-18 gene on the humoral immune response of mice immunized by Ag85A DNA vaccines of Mycobacterium tuberculosis H37 Rv strain. Methods: Human IL-18 cDNA was amplified from RNA of peripheral blood mononuclear cells(PBMCs)by RT-PCR and cloned into the pGEM-TEasy vector.After sequencing IL-18 gene was subcloned into the the sites of BamH I and EooR I digestion of pcDNA3.1. BALB/c mice were injected intramuscularly with eukaryotic expression plasmid pclL18, together with MTB pcAg85A DNA vaccines. The same immunization was repeated three times at intervals of two weeks. Mouse serawere collected at two weeks after the each injection. The titers of anti-Ag85A antibody were detected by ELISA. Results:IL-18 cDNA was amplified successfully from RNA of human PBMCs by RT-PCR and the result of sequencing was correct. The IL-18 gene was correctly inserted into the vector pcDNA3.1, which was confirmed with BamH I and EooR I digestion analysis. The positive plasmid was called pcIL18.After being immtmized with DNA vaccines,the titers of antibody obtained from mice being immtmized by pcAg85A combining with pclL18 were superior to mice inmunized by pcAg85A independently. Conc/us/on: Combination of IL-18 gene with MTB pcAg85A DNA vaccine could observably enhance the humoral immune responses to pcAg85A. It remains further investigated whether IL-18 gene plus MTB pcAg85A DNA vaccine could markedly induce the cellular mediated immune response to Ag85A or not.

  1. Structural analysis of the RH-like blood group gene products in nonhuman primates

    Energy Technology Data Exchange (ETDEWEB)

    Salvignol, I. [Centre Regional de Transfusion Sanguine, Toulouse (France); Calvas, P.; Blancher, A. [Universitaire d`Immunogenetique moleculaire, Toulouse (France); Socha, W.W. [University Medical Center, New York, NY (United States); Colin, Y.; Le Van Kim, C.; Bailly, P.; Cartron, J.P. [Institut National de la Transfusion Sanguine, Paris (France); Ruffie, J.; Blancher, A. [College de France, Paris (France)

    1995-03-01

    Rh-related transcripts present in bone marrow samples from several species of nonhuman primates (chimpanzee, gorilla, gibbon, crab-eating macaque) have been amplified by RT-polymerase chain reaction using primers deduced from the sequence of human RH genes. Nucleotide sequence analysis of the nonhuman transcripts revealed a high degree of similarity to human blood group Rh sequences, suggesting a great conservation of the RH genes throughout evolution. Full-length transcripts, potentially encoding 417 amino acid long proteins homologous to Rh polypeptides, were characterized, as well as mRNA isoforms which harbored nucleotide deletions or insertions and potentially encode truncated proteins. Proteins of 30-40,000 M{sub r}, immunologically related to human Rh proteins, were detected by western blot analysis with antipeptide antibodies, indicating that Rh-like transcripts are translated into membrane proteins. Comparison of human and nonhuman protein sequences was pivotal in clarifying the molecular basis of the blood group C/c polymorphism, showing that only the Pro103Ser substitution was correlated with C/c polymorphism. In addition, it was shown that a proline residue at position 102 was critical in the expression of C and c epitopes, most likely by providing an appropriate conformation of Rh polypeptides. From these data a phylogenetic reconstruction of the RH locus evolution has been calculated from which an unrooted phylogenetic tree could be proposed, indicating that African ape Rh-like genes would be closer to the human RhD gene than to the human RhCE gene. 55 refs., 4 figs., 1 tab.

  2. Identification of a novel gene product that promotes survival of Mycobacterium smegmatis in macrophages.

    Directory of Open Access Journals (Sweden)

    Assunta Pelosi

    Full Text Available BACKGROUND: Bacteria of the suborder Corynebacterineae include significant human pathogens such as Mycobacterium tuberculosis and M. leprae. Drug resistance in mycobacteria is increasingly common making identification of new antimicrobials a priority. Mycobacteria replicate intracellularly, most commonly within the phagosomes of macrophages, and bacterial proteins essential for intracellular survival and persistence are particularly attractive targets for intervention with new generations of anti-mycobacterial drugs. METHODOLOGY/PRINCIPAL FINDINGS: We have identified a novel gene that, when inactivated, leads to accelerated death of M. smegmatis within a macrophage cell line in the first eight hours following infection. Complementation of the mutant with an intact copy of the gene restored survival to near wild type levels. Gene disruption did not affect growth compared to wild type M. smegmatis in axenic culture or in the presence of low pH or reactive oxygen intermediates, suggesting the growth defect is not related to increased susceptibility to these stresses. The disrupted gene, MSMEG_5817, is conserved in all mycobacteria for which genome sequence information is available, and designated Rv0807 in M. tuberculosis. Although homology searches suggest that MSMEG_5817 is similar to the serine:pyruvate aminotransferase of Brevibacterium linens suggesting a possible role in glyoxylate metabolism, enzymatic assays comparing activity in wild type and mutant strains demonstrated no differences in the capacity to metabolize glyoxylate. CONCLUSIONS/SIGNIFICANCE: MSMEG_5817 is a previously uncharacterized gene that facilitates intracellular survival of mycobacteria. Interference with the function of MSMEG_5817 may provide a novel therapeutic approach for control of mycobacterial pathogens by assisting the host immune system in clearance of persistent intracellular bacteria.

  3. Evaluation of bovine chemerin (RARRES2 gene variation on beef cattle production traits

    Directory of Open Access Journals (Sweden)

    Amanda K Lindholm-Perry

    2012-03-01

    Full Text Available A previous study in cattle based on >48,000 markers identified markers on chromosome 4 near the chemerin gene associated with average daily feed intake (ADFI in steers (P<0.008. Chemerin is an adipokine associated with obesity and metabolic syndrome in humans, representing a strong candidate gene potentially underlying the observed association. To evaluate whether the bovine chemerin gene is involved in feed intake, 16 markers within and around the gene were tested for association in the same resource population. Eleven were nominally significant for ADFI (P<0.05 and two were significant after Bonferroni correction. Two and five SNP in this region were nominally significant for the related traits of average daily gain (ADG and residual feed intake (RFI, respectively. All markers were evaluated for effects on meat quality and carcass phenotypes. Many of the markers associated with ADFI were associated with hot carcass weight (HCW, adjusted fat thickness (AFT, and marbling (P<0.05. Marker alleles that were associated with lower ADFI were also associated with lower HCW, AFT, and marbling. Markers associated with ADFI were genotyped in a validation population of steers representing 14 breeds to determine predictive merit across populations. No consistent relationships for ADFI were detected. To determine whether cattle feed intake or growth phenotypes might be related to chemerin transcript abundance, the expression of chemerin was evaluated in adipose of 114 heifers that were siblings of the steers in the discovery population. Relative chemerin transcript abundance was not correlated with ADFI, ADG, or RFI, but associations with body condition score and yearling weight were observed. We conclude that variation in the chemerin gene may underlie observed association in the resource population, but that additional research is required to determine if this variation is widespread among breeds and to develop robust markers with predictive merit across

  4. The piggyBac-Based Gene Delivery System Can Confer Successful Production of Cloned Porcine Blastocysts with Multigene Constructs.

    Science.gov (United States)

    Sato, Masahiro; Maeda, Kosuke; Koriyama, Miyu; Inada, Emi; Saitoh, Issei; Miura, Hiromi; Ohtsuka, Masato; Nakamura, Shingo; Sakurai, Takayuki; Watanabe, Satoshi; Miyoshi, Kazuchika

    2016-01-01

    The introduction of multigene constructs into single cells is important for improving the performance of domestic animals, as well as understanding basic biological processes. In particular, multigene constructs allow the engineering and integration of multiple genes related to xenotransplantation into the porcine genome. The piggyBac (PB) transposon system allows multiple genes to be stably integrated into target genomes through a single transfection event. However, to our knowledge, no attempt to introduce multiple genes into a porcine genome has been made using this system. In this study, we simultaneously introduced seven transposons into a single porcine embryonic fibroblast (PEF). PEFs were transfected with seven transposons containing genes for five drug resistance proteins and two (red and green) fluorescent proteins, together with a PB transposase expression vector, pTrans (experimental group). The above seven transposons (without pTrans) were transfected concomitantly (control group). Selection of these transfected cells in the presence of multiple selection drugs resulted in the survival of several clones derived from the experimental group, but not from the control. PCR analysis demonstrated that approximately 90% (12/13 tested) of the surviving clones possessed all of the introduced transposons. Splinkerette PCR demonstrated that the transposons were inserted through the TTAA target sites of PB. Somatic cell nuclear transfer (SCNT) using a PEF clone with multigene constructs demonstrated successful production of cloned blastocysts expressing both red and green fluorescence. These results indicate the feasibility of this PB-mediated method for simultaneous transfer of multigene constructs into the porcine cell genome, which is useful for production of cloned transgenic pigs expressing multiple transgenes. PMID:27589724

  5. PCR detection of seven virulence and toxin genes of Campylobacter jejuni and Campylobacter coli isolates from Danish pigs and cattle and cytolethal distending toxin production of the isolates

    DEFF Research Database (Denmark)

    Bang, Dang Duong; Nielsen, E.M.; Scheutz, F.;

    2003-01-01

    Aims: To study the prevalence of seven virulence and toxin genes, and cytolethal distending toxin (CDT) production of Campylobacter jejuni and C. coli isolates from Danish pigs and cattle. Methods and Results: The presence of the cadF, ceuE, virB11, flaA, cdtA, cdtB, cdtC and the cdt gene cluster...

  6. Design and construction of a first-generation high-throughput integrated molecular biology platform for production of optimized synthetic genes and improved industrial strains

    Science.gov (United States)

    The molecular biological techniques for plasmid-based assembly and cloning of synthetic assembled gene open reading frames are essential for elucidating the function of the proteins encoded by the genes. These techniques involve the production of full-length cDNA libraries as a source of plasmid-bas...

  7. Large-scale production and evaluation of marker-free indica rice IR64 expressing phytoferritin genes.

    Science.gov (United States)

    Oliva, Norman; Chadha-Mohanty, Prabhjit; Poletti, Susanna; Abrigo, Editha; Atienza, Genelou; Torrizo, Lina; Garcia, Ruby; Dueñas, Conrado; Poncio, Mar Aristeo; Balindong, Jeanette; Manzanilla, Marina; Montecillo, Florencia; Zaidem, Maricris; Barry, Gerard; Hervé, Philippe; Shou, Huxia; Slamet-Loedin, Inez H

    2014-01-01

    Biofortification of rice (Oryza sativa L.) using a transgenic approach to increase the amount of iron in the grain is proposed as a low-cost, reliable, and sustainable solution to help developing countries combat anemia. In this study, we generated and evaluated a large number of rice or soybean ferritin over-accumulators in rice mega-variety IR64, including marker-free events, by introducing soybean or rice ferritin genes into the endosperm for product development. Accumulation of the protein was confirmed by ELISA, in situ immunological detection, and Western blotting. As much as a 37- and 19-fold increase in the expression of ferritin gene in single and co-transformed plants, respectively, and a 3.4-fold increase in Fe content in the grain over the IR64 wild type was achieved using this approach. Agronomic characteristics of a total of 1,860 progenies from 58 IR64 single independent transgenic events and 768 progenies from 27 marker-free transgenic events were evaluated and most trait characteristics did not show a penalty. Grain quality evaluation of high-Fe IR64 transgenic events showed quality similar to that of the wild-type IR64. To understand the effect of transgenes on iron homeostasis, transcript analysis was conducted on a subset of genes involved in iron uptake and loading. Gene expression of the exogenous ferritin gene in grain correlates with protein accumulation and iron concentration. The expression of NAS2 and NAS3 metal transporters increased during the grain milky stage. PMID:24482599

  8. Cyclic Lipopeptide Biosynthetic Genes and Products, and Inhibitory Activity of Plant-Associated Bacillus against Phytopathogenic Bacteria.

    Directory of Open Access Journals (Sweden)

    Isabel Mora

    Full Text Available The antibacterial activity against bacterial plant pathogens and its relationships with the presence of the cyclic lipopeptide (cLP biosynthetic genes ituC (iturin, bmyB (bacillomycin, fenD (fengycin and srfAA (surfactin, and their corresponding antimicrobial peptide products have been studied in a collection of 64 strains of Bacillus spp. isolated from plant environments. The most frequent antimicrobial peptide (AMP genes were bmyB, srfAA and fenD (34-50% of isolates. Most isolates (98.4% produced surfactin isoforms, 90.6% iturins and 79.7% fengycins. The antibacterial activity was very frequent and generally intense among the collection of strains because 75% of the isolates were active against at least 6 of the 8 bacterial plant pathogens tested. Hierarchical and correspondence analysis confirmed the presence of two clearly differentiated groups. One group consisted of Bacillus strains that showed a strong antibacterial activity, presented several cLPs genes and produced several isoforms of cLPs simultaneously, mainly composed of B. subtilis and B. amyloliquefaciens, although the last one was exclusive to this group. Another group was characterized by strains with very low or none antibacterial activity, that showed one or none of the cLP genes and produced a few or none of the corresponding cLPs, and was the most heterogenous group including B. subtilis, B. licheniformis, B. megaterium, B. pumilus, B. cereus and B. thuringiensis, although the last two were exclusive to this group. This work demonstrated that the antagonistic capacity of plant-associated Bacillus against plant pathogenic bacteria is related to the presence of cLP genes and to the production of the corresponding cLPs, and it is mainly associated to the species B. subtilis and B. amyloliquefaciens. Our findings would help to increase the yield and efficiency of screening methods to obtain candidate strains to biocontrol agents with a mechanism of action relaying on the

  9. Cyclic Lipopeptide Biosynthetic Genes and Products, and Inhibitory Activity of Plant-Associated Bacillus against Phytopathogenic Bacteria.

    Science.gov (United States)

    Mora, Isabel; Cabrefiga, Jordi; Montesinos, Emilio

    2015-01-01

    The antibacterial activity against bacterial plant pathogens and its relationships with the presence of the cyclic lipopeptide (cLP) biosynthetic genes ituC (iturin), bmyB (bacillomycin), fenD (fengycin) and srfAA (surfactin), and their corresponding antimicrobial peptide products have been studied in a collection of 64 strains of Bacillus spp. isolated from plant environments. The most frequent antimicrobial peptide (AMP) genes were bmyB, srfAA and fenD (34-50% of isolates). Most isolates (98.4%) produced surfactin isoforms, 90.6% iturins and 79.7% fengycins. The antibacterial activity was very frequent and generally intense among the collection of strains because 75% of the isolates were active against at least 6 of the 8 bacterial plant pathogens tested. Hierarchical and correspondence analysis confirmed the presence of two clearly differentiated groups. One group consisted of Bacillus strains that showed a strong antibacterial activity, presented several cLPs genes and produced several isoforms of cLPs simultaneously, mainly composed of B. subtilis and B. amyloliquefaciens, although the last one was exclusive to this group. Another group was characterized by strains with very low or none antibacterial activity, that showed one or none of the cLP genes and produced a few or none of the corresponding cLPs, and was the most heterogenous group including B. subtilis, B. licheniformis, B. megaterium, B. pumilus, B. cereus and B. thuringiensis, although the last two were exclusive to this group. This work demonstrated that the antagonistic capacity of plant-associated Bacillus against plant pathogenic bacteria is related to the presence of cLP genes and to the production of the corresponding cLPs, and it is mainly associated to the species B. subtilis and B. amyloliquefaciens. Our findings would help to increase the yield and efficiency of screening methods to obtain candidate strains to biocontrol agents with a mechanism of action relaying on the production of

  10. Identification of gene clusters associated with fusaric acid, fusarin, and perithecial pigment production in Fusarium verticillioides

    Science.gov (United States)

    The genus Fusarium is of concern to agricultural production and food/feed safety because of its ability to cause crop disease and to produce mycotoxins, secondary metabolites (SMs) that are toxic to humans and other animals. Understanding the genetic basis for production of mycotoxins and other SMs ...

  11. The presence of c-erbB-2 gene product-related protein in culture medium conditioned by breast cancer cell line SK-BR-3

    International Nuclear Information System (INIS)

    The Mr 185,000 glycoprotein encoded by human c-erbB-2/neu/HER2 gene, termed c-erbB-2 gene product, shows a close structural similarity with epidermal growth factor receptor and is now regarded to be a growth factor receptor for an as yet unidentified ligand. Abundant c-erbB-2 mRNA was demonstrated by Northern blot studies in the human breast cancer cell line SK-BR-3. Cellular radiolabeling experiments followed by immunoprecipitation with three different anti-c-erbB-2 gene product antibodies, recognizing extracellular domain, kinase domain, and carboxyl-terminal portion, respectively, demonstrated the production of a large amount of c-erbB-2 gene product which had the capacity to be phosphorylated. Immunization of mice with concentrated culture medium conditioned by SK-BR-3 cells always generated antibodies against c-erbB-2 gene product, demonstrating that this culture medium contained substance(s) immunologically indistinguishable from c-erbB-2 gene product. This observation was supported by the successful development of a monoclonal antibody against c-erbB-2 gene product, GFD-OA-p185-1, by immunizing mice with this culture medium. The biochemical nature of the substance(s) present in the culture medium was further characterized. When the culture medium conditioned by [35S]cysteine-labeled SK-BR-3 cells was immunoprecipitated by three different anti-c-erbB-2 gene product antibodies, only the antibody recognizing extracellular domain precipitated the [35S]-labeled protein with a molecular weight of 110,000, namely p110. The newly developed monoclonal antibody also immunoprecipitated this protein

  12. The genes involved in production of and immunity to sakacin A, a bacteriocin from Lactobacillus sake Lb706.

    OpenAIRE

    Axelsson, L.; Holck, A

    1995-01-01

    Sakacin A is a small, heat-stable, antilisterial bacteriocin produced by Lactobacillus sake Lb706. The nucleotide sequence of a 8,668-bp fragment, shown to contain all information necessary for sakacin A production and immunity, was determined. The sequence revealed the presence of two divergently transcribed operons. The first encompassed the structural gene sapA (previously designated sakA) and saiA, which encoded a putative peptide of 90 amino acid residues. The second encompassed sapK (pr...

  13. Production of polyhydroxybutyrate in oil palm (Elaeis guineensis Jacq.) mediated by microprojectile bombardment of PHB biosynthesis genes into embryogenic calli

    OpenAIRE

    Parveez, Ghulam Kadir Ahmad; Bahariah, Bohari; Ayub, Nor Hanin; Masani, Mat Yunus Abdul; Rasid, Omar Abdul; Tarmizi, Ahmad Hashim; Ishak, Zamzuri

    2015-01-01

    Biodegradable plastics, mainly polyhydroxybutyrate (PHB), which are traditionally produced by bacterial cells, have been produced in the cells of more than 15 plant species. Since the production of biodegradable plastics and the synthesis of oil in plants share the same substrate, acetyl-coenzyme A (acetyl-CoA), producing PHB in oil bearing crops, such as oil palm, will be advantageous. In this study, three bacterial genes, bktB, phaB, and phaC, which are required for the synthesis of PHB and...

  14. Association between the Advanced Glycosylation End Product-Specific Receptor Gene and Cardiovascular Death in Older Men

    OpenAIRE

    Biros, Erik; Moran, Corey S.; Norman, Paul E; Hankey, Graeme J; Yeap, Bu B; OSVALDO P. ALMEIDA; Flicker, Leon; White, Richard; Jones, Rhondda; Golledge, Jonathan

    2015-01-01

    Advanced glycosylation end product-specific receptor (AGER) signaling has been implicated in atherosclerosis. The aim of this study was to evaluate whether a common genetic variation in the AGER gene is associated with cardiovascular (CV) death. We included 1304 older men who were genotyped for rs1035798:C>T, which is a single nucleotide polymorphism (SNP) mapped to the third intron of AGER. Cox proportional hazard analysis was used to estimate the association of rs1035798:C>T with CV death. ...

  15. Production of Xylitol from d-Xylose by a Xylitol Dehydrogenase Gene-Disrupted Mutant of Candida tropicalis

    OpenAIRE

    Ko, Byoung Sam; Kim, Jinmi; Kim, Jung Hoe

    2006-01-01

    Xylitol dehydrogenase (XDH) is one of the key enzymes in d-xylose metabolism, catalyzing the oxidation of xylitol to d-xylulose. Two copies of the XYL2 gene encoding XDH in the diploid yeast Candida tropicalis were sequentially disrupted using the Ura-blasting method. The XYL2-disrupted mutant, BSXDH-3, did not grow on a minimal medium containing d-xylose as a sole carbon source. An enzyme assay experiment indicated that BSXDH-3 lost apparently all XDH activity. Xylitol production by BSXDH-3 ...

  16. Flagellar structure and hyperthermophily: analysis of a single flagellin gene and its product in Aquifex pyrophilus.

    OpenAIRE

    Behammer, W; Shao, Z; Mages, W; Rachel, R; Stetter, K O; Schmitt, R.

    1995-01-01

    The polytrichously inserted flagella of Aquifex pyrophilus, a marine hyperthermophilic bacterium growing at 85 degrees C, were isolated and purified. Electron micrographs of the 19-nm-diameter flagellar filaments show prominent helical arrays of subunits. The primary structure of these 54-kDa flagellin monomers determining the helical shape and heat stability of filaments was of particular interest. The genomic region encoding the flagellin subunit (flaA gene) and an upstream open reading fra...

  17. The Tangier disease gene product ABC1 controls the cellular apolipoprotein-mediated lipid removal pathway

    OpenAIRE

    Lawn, Richard M.; Wade, David P.; Garvin, Michael R.; Wang, Xingbo; Schwartz, Karen; Porter, J. Gordon; Seilhamer, Jeffrey J.; Ashley M Vaughan; Oram, John F.

    1999-01-01

    The ABC1 transporter was identified as the defect in Tangier disease by a combined strategy of gene expression microarray analysis, genetic mapping, and biochemical studies. Patients with Tangier disease have a defect in cellular cholesterol removal, which results in near zero plasma levels of HDL and in massive tissue deposition of cholesteryl esters. Blocking the expression or activity of ABC1 reduces apolipoprotein-mediated lipid efflux from cultured cells, and increasing expression of ABC...

  18. Posttranslational Modifications, Localization, and Protein Interactions of Optineurin, the Product of a Glaucoma Gene

    OpenAIRE

    Hongyu Ying; Xiang Shen; BumChan Park; Beatrice Y J T Yue

    2010-01-01

    BACKGROUND: Glaucoma is a major blinding disease. The most common form of this disease, primary open angle glaucoma (POAG), is genetically heterogeneous. One of the candidate genes, optineurin, is linked principally to normal tension glaucoma, a subtype of POAG. The present study was undertaken to illustrate the basic characteristics of optineurin. METHODOLOGY/PRINCIPAL FINDINGS: Lysates from rat retinal ganglion RGC5 cells were subjected to N- or O-deglycosylation or membrane protein extract...

  19. A cell engineering strategy to enhance supercoiled plasmid DNA production for gene therapy

    OpenAIRE

    Hassan, S.; Keshavarz-Moore, E.; J. Ward

    2016-01-01

    With the recent revival of the promise of plasmid DNA vectors in gene therapy, a novel synthetic biology approach was used to enhance the quantity, (yield), and quality of the plasmid DNA. Quality was measured by percentage supercoiling and supercoiling density, as well as improving segregational stability in fermentation. We examined the hypothesis that adding a Strong Gyrase binding Site (SGS) would increase DNA gyrase-mediated plasmid supercoiling. SGS from 3 different replicons, (the Mu b...

  20. A Genetic Strategy to Measure Circulating Drosophila Insulin Reveals Genes Regulating Insulin Production and Secretion

    OpenAIRE

    Sangbin Park; Alfa, Ronald W.; Topper, Sydni M.; Grace E S Kim; Lutz Kockel; Kim, Seung K.

    2014-01-01

    Insulin is a major regulator of metabolism in metazoans, including the fruit fly Drosophila melanogaster. Genome-wide association studies (GWAS) suggest a genetic basis for reductions of both insulin sensitivity and insulin secretion, phenotypes commonly observed in humans with type 2 diabetes mellitus (T2DM). To identify molecular functions of genes linked to T2DM risk, we developed a genetic tool to measure insulin-like peptide 2 (Ilp2) levels in Drosophila, a model organism with superb exp...

  1. The HP0256 gene product is involved in motility and cell envelope architecture of Helicobacter pylori

    LENUS (Irish Health Repository)

    Douillard, Francois P

    2010-04-08

    Abstract Background Helicobacter pylori is the causative agent for gastritis, and peptic and duodenal ulcers. The bacterium displays 5-6 polar sheathed flagella that are essential for colonisation and persistence in the gastric mucosa. The biochemistry and genetics of flagellar biogenesis in H. pylori has not been fully elucidated. Bioinformatics analysis suggested that the gene HP0256, annotated as hypothetical, was a FliJ homologue. In Salmonella, FliJ is a chaperone escort protein for FlgN and FliT, two proteins that themselves display chaperone activity for components of the hook, the rod and the filament. Results Ablation of the HP0256 gene in H. pylori significantly reduced motility. However, flagellin and hook protein synthesis was not affected in the HP0256 mutant. Transmission electron transmission microscopy revealed that the HP0256 mutant cells displayed a normal flagellum configuration, suggesting that HP0256 was not essential for assembly and polar localisation of the flagella in the cell. Interestingly, whole genome microarrays of an HP0256 mutant revealed transcriptional changes in a number of genes associated with the flagellar regulon and the cell envelope, such as outer membrane proteins and adhesins. Consistent with the array data, lack of the HP0256 gene significantly reduced adhesion and the inflammatory response in host cells. Conclusions We conclude that HP0256 is not a functional counterpart of FliJ in H. pylori. However, it is required for full motility and it is involved, possibly indirectly, in expression of outer membrane proteins and adhesins involved in pathogenesis and adhesion.

  2. Polyketide synthesis genes associated with toxin production in two species of Gambierdiscus (Dinophyceae)

    OpenAIRE

    Kohli, Gurjeet S.; John, Uwe; Figueroa, Rosa I.; Rhodes, Lesley L.; Harwood, D. Tim; Groth, Marco; Bolch, Christopher J. S.; Murray, Shauna A.

    2015-01-01

    Background Marine microbial protists, in particular, dinoflagellates, produce polyketide toxins with ecosystem-wide and human health impacts. Species of Gambierdiscus produce the polyether ladder compounds ciguatoxins and maitotoxins, which can lead to ciguatera fish poisoning, a serious human illness associated with reef fish consumption. Genes associated with the biosynthesis of polyether ladder compounds are yet to be elucidated, however, stable isotope feeding studies of such compounds co...

  3. Whole-Genome Microarray and Gene Deletion Studies Reveal Regulation of the Polyhydroxyalkanoate Production Cycle by the Stringent Response in Ralstonia eutropha H16

    Energy Technology Data Exchange (ETDEWEB)

    Brigham, CJ; Speth, DR; Rha, C; Sinskey, AJ

    2012-10-22

    Poly(3-hydroxybutyrate) (PHB) production and mobilization in Ralstonia eutropha are well studied, but in only a few instances has PHB production been explored in relation to other cellular processes. We examined the global gene expression of wild-type R. eutropha throughout the PHB cycle: growth on fructose, PHB production using fructose following ammonium depletion, and PHB utilization in the absence of exogenous carbon after ammonium was resupplied. Our results confirm or lend support to previously reported results regarding the expression of PHB-related genes and enzymes. Additionally, genes for many different cellular processes, such as DNA replication, cell division, and translation, are selectively repressed during PHB production. In contrast, the expression levels of genes under the control of the alternative sigma factor sigma(54) increase sharply during PHB production and are repressed again during PHB utilization. Global gene regulation during PHB production is strongly reminiscent of the gene expression pattern observed during the stringent response in other species. Furthermore, a ppGpp synthase deletion mutant did not show an accumulation of PHB, and the chemical induction of the stringent response with DL-norvaline caused an increased accumulation of PHB in the presence of ammonium. These results indicate that the stringent response is required for PHB accumulation in R. eutropha, helping to elucidate a thus-far-unknown physiological basis for this process.

  4. A single ataxia telangiectasia gene with a product similar to PI-3 kinase

    Energy Technology Data Exchange (ETDEWEB)

    Savitsky, K.; Bar-Shira, A.; Gilad, S.; Rotman, G.; Ziv, Y.; Vanagaite, L.; Smith, S.; Uziel, T.; Sfez, S.; Ashkenazi, M. [Tel Aviv Univ. (Israel)] [and others

    1995-06-23

    A gene, ATM, that is mutated in the autosomal recessive disorder ataxia telangiectasia (AT) was identified by positional cloning on chromosome 11q22-23. AT is characterized by cerebellar degeneration, immunodeficiency, chromosomal instability, cancer predisposition, radiation sensitivity, and cell cycle abnormalities. The disease is genetically heterogeneous, with four complementation groups that have been suspected to represent different genes. ATM, which has a transcript of 12 kilobases, was found to be mutated in AT patients from all complementation groups, indicating that it is probably the sole gene responsible for this disorder. A partial ATM complementary DNA clone of 5.9 kilobases encoded a putative protein that is similar to several yeast and mammalian phosphatidylinositol-3{prime} kinases that are involved in mitogenic signal transduction, meiotic recombination, and cell cycle control. The discovery of ATM should enhance understanding of AT and related syndromes and may allow the identification of AT heterozygotes, who are at increased risk of cancer. 54 refs., 5 figs., 1 tab.

  5. The promoter polymorphism of the interleukin-6 gene regulates interleukin-6 production in neonates but not in adults.

    Science.gov (United States)

    Kilpinen, S; Hulkkonen, J; Wang, X Y; Hurme, M

    2001-03-01

    In the promoter region of the IL-6 gene there is a single base exchange (G --> C) polymorphism at position -174. Recent findings suggest that this polymorphism may affect the transcription rate of the IL-6 gene and IL-6 plasma levels. To analyse its biological significance, we examined IL-6 plasma levels in cord blood and IL-6 production by neonatal cells after LPS-stimulation in relation to the presence of the IL-6G and IL-6C alleles. We hypothesized that since healthy neonates lack a previous exposure to exogenous antigens, their cytokine production could be genetically regulated. We also assumed that the normal labour-related stress could provide a physiological stimulus for IL-6 production. Cord blood was collected from 50 healthy, full-term neonates after normal vaginal delivery (VD) and from 42 healthy, full-term neonates after elective caesarean section (ECS). Adult samples were obtained from 450 healthy adult controls. The -174 polymorphism was analysed using PCR. IL-6 plasma levels and in vitro IL-6 production were measured using an ELISA method. Generally, IL-6 plasma levels in neonates were significantly higher than those in adults (neonates born by VD versus adults p < 0.001 and neonates born by ECS versus adults p < 0.001); the median value for neonates born by VD was 11.4 pg/ml (4.5-45.9), for neonates born by ECS 2.9 pg/ml (1.9-6.4) and for adults, 1.2 pg/ml (0.7-2.0). Surprisingly, cord blood IL-6 levels after VD differed significantly from those after ECS (p < 0.001). An analysis was carried out to ascertain if there was a genetic association between different IL-6 genotypes and IL-6 plasma levels in neonates. In the group of VD neonates with the CC genotype, non-carriers of the G allele, secreted significantly more IL-6 than carriers of the G allele (p < 0.03); 21.4 pg/ml (9.5-81.3) and 9.6 pg/ml (3.5-36.2) respectively. In line with this, ECS newborns with the CC genotype had higher IL-6 plasma levels than carriers of the G allele (p < 0

  6. Silencing of vacuolar invertase and asparagine synthetase genes and its impact on acrylamide formation of fried potato products.

    Science.gov (United States)

    Zhu, Xiaobiao; Gong, Huiling; He, Qunyan; Zeng, Zixian; Busse, James S; Jin, Weiwei; Bethke, Paul C; Jiang, Jiming

    2016-02-01

    Acrylamide is produced in a wide variety of carbohydrate-rich foods during high-temperature cooking. Dietary acrylamide is a suspected human carcinogen, and health concerns related to dietary acrylamide have been raised worldwide. French fries and potato chips contribute a significant proportion to the average daily intake of acrylamide, especially in developed countries. One way to mitigate health concerns related to acrylamide is to develop potato cultivars that have reduced contents of the acrylamide precursors asparagine, glucose and fructose in tubers. We generated a large number of silencing lines of potato cultivar Russet Burbank by targeting the vacuolar invertase gene VInv and the asparagine synthetase genes StAS1 and StAS2 with a single RNA interference construct. The transcription levels of these three genes were correlated with reducing sugar (glucose and fructose) and asparagine content in tubers. Fried potato products from the best VInv/StAS1/StAS2-triple silencing lines contained only one-fifteenth of the acrylamide content of the controls. Interestingly, the extent of acrylamide reduction of the best triple silencing lines was similar to that of the best VInv-single silencing lines developed previously from the same potato cultivar Russet Burbank. These results show that an acrylamide mitigation strategy focused on developing potato cultivars with low reducing sugars is likely to be an effective and sufficient approach for minimizing the acrylamide-forming potential of French fry processing potatoes. PMID:26079224

  7. Evaluation of the utility of the FecB gene to improve the productivity of Deccani sheep in Maharashtra, India

    International Nuclear Information System (INIS)

    The Booroola fecundity gene (FecB) is an autosomal gene in sheep with a large effect on ovulation rate and consequently, litter size. The Nimbkar Agricultural Research Institute (NARI) at Phaltan, Maharashtra, India (latitude 18 deg. N and longitude 74 deg. E) has embarked upon a breeding program to introgress the FecB gene from the Garole breed of Sunderban, West Bengal, into the local Deccani breed. Garole sheep, the probable original source of the FecB gene, are small-sized (average adult live weight 15 kg) and adapted to hot humid conditions. The Deccani are the native sheep of the semi-arid Deccan plateau and adult ewes weigh about 27 kg. The reproductive performance of 188 ewes with 1/4 Garole genotype (progeny of Deccani ewes mated to Garole x Deccani F1 rams), 97 of which were heterozygote carriers of the FecB gene (FecB''B''+) and 91 were non-carriers (FecB''+''+), was analyzed to quantify the advantage in lamb production conferred by the gene. The percentage of abortions/stillbirths among maiden ewes was compared between ewes of the two FecB genotypes using a Z test. Other traits analysed were litter size (lambs born alive) and lambs weaned per lambing (weaning age being 120 days) as traits of the ewe. Fixed effects fitted for both traits were FecB genotype of ewe, birth year of ewe, year and season of lambing with age of ewe at lambing as a covariable. The interaction of ewe genotype and litter size was also fitted for lambs weaned. In addition, another model was fitted for the trait lambs weaned per lambing, with litter size instead of ewe genotype as a fixed effect. A random sire effect was fitted for both traits. A repeated measures analysis was done for both traits, using data from 1-3 lambings per ewe. Sire variance was found to be very low for both traits. The proportion of abortions/stillbirths among heterozygote maiden ewes (0.21) was significantly higher (P<0.05) than that among non-carrier ewes (0.11). At the second and third parities, the

  8. Phylogenomic Analysis of Natural Products Biosynthetic Gene Clusters Allows Discovery of Arseno-Organic Metabolites in Model Streptomycetes

    Science.gov (United States)

    Cruz-Morales, Pablo; Kopp, Johannes Florian; Martínez-Guerrero, Christian; Yáñez-Guerra, Luis Alfonso; Selem-Mojica, Nelly; Ramos-Aboites, Hilda; Feldmann, Jörg; Barona-Gómez, Francisco

    2016-01-01

    Natural products from microbes have provided humans with beneficial antibiotics for millennia. However, a decline in the pace of antibiotic discovery exerts pressure on human health as antibiotic resistance spreads, a challenge that may better faced by unveiling chemical diversity produced by microbes. Current microbial genome mining approaches have revitalized research into antibiotics, but the empirical nature of these methods limits the chemical space that is explored. Here, we address the problem of finding novel pathways by incorporating evolutionary principles into genome mining. We recapitulated the evolutionary history of twenty-three enzyme families previously uninvestigated in the context of natural product biosynthesis in Actinobacteria, the most proficient producers of natural products. Our genome evolutionary analyses where based on the assumption that expanded—repurposed enzyme families—from central metabolism, occur frequently and thus have the potential to catalyze new conversions in the context of natural products biosynthesis. Our analyses led to the discovery of biosynthetic gene clusters coding for hidden chemical diversity, as validated by comparing our predictions with those from state-of-the-art genome mining tools; as well as experimentally demonstrating the existence of a biosynthetic pathway for arseno-organic metabolites in Streptomyces coelicolor and Streptomyces lividans, Using a gene knockout and metabolite profile combined strategy. As our approach does not rely solely on sequence similarity searches of previously identified biosynthetic enzymes, these results establish the basis for the development of an evolutionary-driven genome mining tool termed EvoMining that complements current platforms. We anticipate that by doing so real ‘chemical dark matter’ will be unveiled. PMID:27289100

  9. Phylogenomic Analysis of Natural Products Biosynthetic Gene Clusters Allows Discovery of Arseno-Organic Metabolites in Model Streptomycetes.

    Science.gov (United States)

    Cruz-Morales, Pablo; Kopp, Johannes Florian; Martínez-Guerrero, Christian; Yáñez-Guerra, Luis Alfonso; Selem-Mojica, Nelly; Ramos-Aboites, Hilda; Feldmann, Jörg; Barona-Gómez, Francisco

    2016-01-01

    Natural products from microbes have provided humans with beneficial antibiotics for millennia. However, a decline in the pace of antibiotic discovery exerts pressure on human health as antibiotic resistance spreads, a challenge that may better faced by unveiling chemical diversity produced by microbes. Current microbial genome mining approaches have revitalized research into antibiotics, but the empirical nature of these methods limits the chemical space that is explored.Here, we address the problem of finding novel pathways by incorporating evolutionary principles into genome mining. We recapitulated the evolutionary history of twenty-three enzyme families previously uninvestigated in the context of natural product biosynthesis in Actinobacteria, the most proficient producers of natural products. Our genome evolutionary analyses where based on the assumption that expanded-repurposed enzyme families-from central metabolism, occur frequently and thus have the potential to catalyze new conversions in the context of natural products biosynthesis. Our analyses led to the discovery of biosynthetic gene clusters coding for hidden chemical diversity, as validated by comparing our predictions with those from state-of-the-art genome mining tools; as well as experimentally demonstrating the existence of a biosynthetic pathway for arseno-organic metabolites in Streptomyces coelicolor and Streptomyces lividans, Using a gene knockout and metabolite profile combined strategy.As our approach does not rely solely on sequence similarity searches of previously identified biosynthetic enzymes, these results establish the basis for the development of an evolutionary-driven genome mining tool termed EvoMining that complements current platforms. We anticipate that by doing so real 'chemical dark matter' will be unveiled. PMID:27289100

  10. Analysis of Tox5 gene expression in Gibberella pulicaris strains with different trichothecene production phenotypes.

    OpenAIRE

    Hohn, T M; Desjardins, A. E.; McCormick, S P

    1993-01-01

    The Tox5 gene encodes trichodiene synthase, the first unique enzyme in the trichothecene biosynthetic pathway. In Gibberella pulicaris R-6380, the level of Tox5 mRNA was found to increase 47-fold in early stationary phase. Sequence analysis of the Tox5 promoter regions from geographically distinct strains of G. pulicaris revealed the existence of two Tox5 alleles (Tox5-1 and Tox5-2). All G. pulicaris strains that produce high levels of trichothecenes in liquid culture carry a 42-nucleotide (n...

  11. Sequence and structural requirements for high-affinity DNA binding by the WT1 gene product.

    OpenAIRE

    Nakagama, H; Heinrich, G.; Pelletier, J; Housman, D E

    1995-01-01

    The Wilms' tumor suppressor gene, WT1, encodes a zinc finger polypeptide which plays a key role regulating cell growth and differentiation in the urogenital system. Using the whole-genome PCR approach, we searched murine genomic DNA for high-affinity WT1 binding sites and identified a 10-bp motif 5'GCGTGGGAGT3' which we term WTE). The WTE motif is similar to the consensus binding sequence 5'GCG(G/T)GGGCG3' recognized by EGR-1 and is also suggested to function as a binding site for WT1, settin...

  12. DNA repair in Escherichia coli: identification of the uvrD gene product.

    OpenAIRE

    Maples, V F; Kushner, S R

    1982-01-01

    A 2.9-kilobase (kb) Pvu II DNA fragment that contains the uvrD gene of Escherichia coli K-12 has been cloned in both low-copy and multiple-copy plasmid vehicles. The low-copy uvrD plasmid (pVMK49) complements a variety of uvrD, uvrE, and recL mutations. In contrast, the same strains carrying the 2.9-kb fragment in a multiple-copy plasmid (pVMK45) remain sensitive to ultraviolet light (UV). Additionally, pVMK45 transformants of wild-type E. coli are sensitive to UV and methyl methanesulfonate ...

  13. Gene products specifying adhesion of uropathogenic Escherichia coli are minor components of pili.

    OpenAIRE

    Lindberg, F; Lund, B; Normark, S

    1986-01-01

    The papE, papF, and papG genes of uropathogenic Escherichia coli are dispensable for the synthesis and assembly of pili associated with pyelonephritis, called Pap pili. Phenotypically, papF and papG mediate digalactoside [alpha-D-Galp-(1----4)-beta-D-Galp)-specific adhesion. Although whole bacterial cells of a papE mutant bind to this receptor, purified pili from such a mutant do not. This is in contrast to pili purified from the wild type, which bind specifically. The DNA sequences of the pa...

  14. Recombinant polycistronic structure of hydantoinase process genes in Escherichia coli for the production of optically pure D-amino acids.

    Science.gov (United States)

    Martínez-Gómez, Ana Isabel; Martínez-Rodríguez, Sergio; Clemente-Jiménez, Josefa María; Pozo-Dengra, Joaquín; Rodríguez-Vico, Felipe; Las Heras-Vázquez, Francisco Javier

    2007-03-01

    Two recombinant reaction systems for the production of optically pure D-amino acids from different D,L-5-monosubstituted hydantoins were constructed. Each system contained three enzymes, two of which were D-hydantoinase and D-carbamoylase from Agrobacterium tumefaciens BQL9. The third enzyme was hydantoin racemase 1 for the first system and hydantoin racemase 2 for the second system, both from A. tumefaciens C58. Each system was formed by using a recombinant Escherichia coli strain with one plasmid harboring three genes coexpressed with one promoter in a polycistronic structure. The D-carbamoylase gene was cloned closest to the promoter in order to obtain the highest level of synthesis of the enzyme, thus avoiding intermediate accumulation, which decreases the reaction rate. Both systems were able to produce 100% conversion and 100% optically pure D-methionine, D-leucine, D-norleucine, D-norvaline, D-aminobutyric acid, D-valine, D-phenylalanine, D-tyrosine, and D-tryptophan from the corresponding hydantoin racemic mixture. For the production of almost all D-amino acids studied in this work, system 1 hydrolyzed the 5-monosubstituted hydantoins faster than system 2. PMID:17220246

  15. Enhanced production of steviol glycosides in mycorrhizal plants: a concerted effect of arbuscular mycorrhizal symbiosis on transcription of biosynthetic genes.

    Science.gov (United States)

    Mandal, Shantanu; Upadhyay, Shivangi; Singh, Ved Pal; Kapoor, Rupam

    2015-04-01

    Stevia rebaudiana (Bertoni) produces steviol glycosides (SGs)--stevioside (stev) and rebaudioside-A (reb-A) that are valued as low calorie sweeteners. Inoculation with arbuscular mycorrhizal fungi (AMF) augments SGs production, though the effect of this interaction on SGs biosynthesis has not been studied at molecular level. In this study transcription profiles of eleven key genes grouped under three stages of the SGs biosynthesis pathway were compared. The transcript analysis showed upregulation of genes encoding 2-C-methyl-D-erythritol-4-phosphate (MEP) pathway enzymes viz.,1-deoxy-D-xylulose 5-phospate synthase (DXS), 1-deoxy-D-xylulose 5-phospate reductoisomerase (DXR) and 2-C-methyl-D-erytrithol 2,4-cyclodiphosphate synthase (MDS) in mycorrhizal (M) plants. Zn and Mn are imperative for the expression of MDS and their enhanced uptake in M plants could be responsible for the increased transcription of MDS. Furthermore, in the second stage of SGs biosynthesis pathway, mycorrhization enhanced the transcription of copalyl diphosphate synthase (CPPS) and kaurenoic acid hydroxylase (KAH). Their expression is decisive for SGs biosynthesis as CPPS regulates flow of metabolites towards synthesis of kaurenoid precursors and KAH directs these towards steviol synthesis instead of gibberellins. In the third stage glucosylation of steviol to reb-A by four specific uridine diphosphate (UDP)-dependent glycosyltransferases (UGTs) occurs. While higher transcription of all the three characterized UGTs in M plants explains augmented production of SGs; higher transcript levels of UGT76G1, specifically improved reb-A to stev ratio implying increased sweetness. The work signifies that AM symbiosis upregulates the transcription of all eleven SGs biosynthesis genes as a result of improved nutrition and enhanced sugar concentration due to increased photosynthesis in M plants. PMID:25734328

  16. Overexpression of the Wheat Expansin Gene TaEXPA2 Improved Seed Production and Drought Tolerance in Transgenic Tobacco Plants.

    Science.gov (United States)

    Chen, Yanhui; Han, Yangyang; Zhang, Meng; Zhou, Shan; Kong, Xiangzhu; Wang, Wei

    2016-01-01

    Expansins are cell wall proteins that are grouped into two main families, α-expansins and β-expansins, and they are implicated in the control of cell extension via the disruption of hydrogen bonds between cellulose and matrix glucans. TaEXPA2 is an α-expansin gene identified in wheat. Based on putative cis-regulatory elements in the TaEXPA2 promoter sequence and the expression pattern induced when polyethylene glycol (PEG) is used to mimic water stress, we hypothesized that TaEXPA2 is involved in plant drought tolerance and plant development. Through transient expression of 35S::TaEXPA2-GFP in onion epidermal cells, TaEXPA2 was localized to the cell wall. Constitutive expression of TaEXPA2 in tobacco improved seed production by increasing capsule number, not seed size, without having any effect on plant growth patterns. The transgenic tobacco exhibited a significantly greater tolerance to water-deficiency stress than did wild-type (WT) plants. We found that under drought stress, the transgenic plants maintained a better water status. The accumulated content of osmotic adjustment substances, such as proline, in TaEXPA2 transgenic plants was greater than that in WT plants. Transgenic plants also displayed greater antioxidative competence as indicated by their lower malondialdehyde (MDA) content, relative electrical conductivity, and reactive oxygen species (ROS) accumulation than did WT plants. This result suggests that the transgenic plants suffer less damage from ROS under drought conditions. The activities of some antioxidant enzymes as well as expression levels of several genes encoding key antioxidant enzymes were higher in the transgenic plants than in the WT plants under drought stress. Collectively, our results suggest that ectopic expression of the wheat expansin gene TaEXPA2 improves seed production and drought tolerance in transgenic tobacco plants. PMID:27073898

  17. Double disruption of the proteinase genes, tppA and pepE, increases the production level of human lysozyme by Aspergillus oryzae.

    Science.gov (United States)

    Jin, Feng Jie; Watanabe, Taisuke; Juvvadi, Praveen Rao; Maruyama, Jun-ichi; Arioka, Manabu; Kitamoto, Katsuhiko

    2007-10-01

    In this study, we investigated the effects of proteinase gene disruption on heterologous protein production by Aspergillus oryzae. The human lysozyme (HLY) was selected for recombinant production as a model for the heterologous protein. A tandem HLY construct fused with alpha-amylase (AmyB) was expressed by A. oryzae in which the Kex2 cleavage site was inserted at the upstream of HLY. HLY was successfully processed from AmyB and produced in the medium. We performed a systematic disruption analysis of five proteinase genes (pepA, pepE, alpA, tppA, and palB) in the HLY-producing strain with the adeA selectable marker. Comparative analysis indicated that disruption of the tppA gene encoding a tripeptidyl peptidase resulted in the highest increase (36%) in the HLY production. We further deleted the tppA gene in the pepE or palB disruptant with another selectable marker, argB. Consequently, a double disruption of the tppA and pepE genes led to a 63% increase in the HLY production compared to the control strain. This is the first study to report that the double disruption of the tppA and pepE genes improved the production level of a heterologous protein by filamentous fungi. PMID:17622525

  18. Targeted Sequencing Reveals Large-Scale Sequence Polymorphism in Maize Candidate Genes for Biomass Production and Composition.

    Directory of Open Access Journals (Sweden)

    Moses M Muraya

    Full Text Available A major goal of maize genomic research is to identify sequence polymorphisms responsible for phenotypic variation in traits of economic importance. Large-scale detection of sequence variation is critical for linking genes, or genomic regions, to phenotypes. However, due to its size and complexity, it remains expensive to generate whole genome sequences of sufficient coverage for divergent maize lines, even with access to next generation sequencing (NGS technology. Because methods involving reduction of genome complexity, such as genotyping-by-sequencing (GBS, assess only a limited fraction of sequence variation, targeted sequencing of selected genomic loci offers an attractive alternative. We therefore designed a sequence capture assay to target 29 Mb genomic regions and surveyed a total of 4,648 genes possibly affecting biomass production in 21 diverse inbred maize lines (7 flints, 14 dents. Captured and enriched genomic DNA was sequenced using the 454 NGS platform to 19.6-fold average depth coverage, and a broad evaluation of read alignment and variant calling methods was performed to select optimal procedures for variant discovery. Sequence alignment with the B73 reference and de novo assembly identified 383,145 putative single nucleotide polymorphisms (SNPs, of which 42,685 were non-synonymous alterations and 7,139 caused frameshifts. Presence/absence variation (PAV of genes was also detected. We found that substantial sequence variation exists among genomic regions targeted in this study, which was particularly evident within coding regions. This diversification has the potential to broaden functional diversity and generate phenotypic variation that may lead to new adaptations and the modification of important agronomic traits. Further, annotated SNPs identified here will serve as useful genetic tools and as candidates in searches for phenotype-altering DNA variation. In summary, we demonstrated that sequencing of captured DNA is a powerful

  19. Validation of PDE9A Gene Identified in GWAS Showing Strong Association with Milk Production Traits in Chinese Holstein

    Directory of Open Access Journals (Sweden)

    Shao-Hua Yang

    2015-11-01

    Full Text Available Phosphodiesterase9A (PDE9A is a cyclic guanosine monophosphate (cGMP-specific enzyme widely expressed among the tissues, which is important in activating cGMP-dependent signaling pathways. In our previous genome-wide association study, a single nucleotide polymorphism (SNP (BTA-55340-no-rsb located in the intron 14 of PDE9A, was found to be significantly associated with protein yield. In addition, we found that PDE9A was highly expressed in mammary gland by analyzing its mRNA expression in different tissues. The objectives of this study were to identify genetic polymorphisms of PDE9A and to determine the effects of these variants on milk production traits in dairy cattle. DNA sequencing identified 11 single nucleotide polymorphisms (SNPs and six SNPs in 5′ regulatory region were genotyped to test for the subsequent association analyses. After Bonferroni correction for multiple testing, all these identified SNPs were statistically significant for one or more milk production traits (p < 0.0001~0.0077. Interestingly, haplotype-based association analysis revealed similar effects on milk production traits (p < 0.01. In follow-up RNA expression analyses, two SNPs (c.-1376 G>A, c.-724 A>G were involved in the regulation of gene expression. Consequently, our findings provide confirmatory evidences for associations of PDE9A variants with milk production traits and these identified SNPs may serve as genetic markers to accelerate Chinese Holstein breeding program.

  20. The Saccharomyces Genome Database: Gene Product Annotation of Function, Process, and Component.

    Science.gov (United States)

    Cherry, J Michael

    2015-12-01

    An ontology is a highly structured form of controlled vocabulary. Each entry in the ontology is commonly called a term. These terms are used when talking about an annotation. However, each term has a definition that, like the definition of a word found within a dictionary, provides the complete usage and detailed explanation of the term. It is critical to consult a term's definition because the distinction between terms can be subtle. The use of ontologies in biology started as a way of unifying communication between scientific communities and to provide a standard dictionary for different topics, including molecular functions, biological processes, mutant phenotypes, chemical properties and structures. The creation of ontology terms and their definitions often requires debate to reach agreement but the result has been a unified descriptive language used to communicate knowledge. In addition to terms and definitions, ontologies require a relationship used to define the type of connection between terms. In an ontology, a term can have more than one parent term, the term above it in an ontology, as well as more than one child, the term below it in the ontology. Many ontologies are used to construct annotations in the Saccharomyces Genome Database (SGD), as in all modern biological databases; however, Gene Ontology (GO), a descriptive system used to categorize gene function, is the most extensively used ontology in SGD annotations. Examples included in this protocol illustrate the structure and features of this ontology. PMID:26631125

  1. A lepidopteran pacifastin member: cloning, gene structure, recombinant production, transcript profiling and in vitro activity.

    Science.gov (United States)

    Breugelmans, Bert; Simonet, Gert; van Hoef, Vincent; Van Soest, Sofie; Smagghe, Guy; Vanden Broeck, Jozef

    2009-07-01

    Members of the pacifastin family have been characterized as serine peptidase inhibitors (PI), but their target enzyme(s) are unknown in insects. So far, the structural and biochemical characteristics of pacifastin-like PI have only been studied in locusts. Here we report the molecular identification and functional characterization of a pacifastin-like precursor in a lepidopteran insect, i.e. the silkworm Bombyx mori. The bmpp-1 gene contains 17 exons and codes for two pacifastin-related precursors of different length. The longest splice variant encodes 13 inhibitor domains, more than any other pacifastin-like precursor in arthropods. The second transcript lacks two exons and codes for 11 inhibitor domains. By studying the expression profile of the Bombyx pacifastin-like gene a different expression pattern for the two variants was observed suggesting functional diversification. Next, several PI domains of BMPP-1 were produced and, contrary to locust pacifastin peptides, they were found to be potent inhibitors of both bovine trypsin and chymotrypsin. Surprisingly, the same Bombyx PI are only weak inhibitors of endogenous digestive peptidases, indicating that other peptidases are the in vivo targets. Interestingly, the Bombyx PI inhibit a fungal trypsin-like cuticle degrading enzyme, suggesting a protective function for BMPP-1 against entomopathogenic fungi. PMID:19364530

  2. The schizophrenia risk gene product miR-137 alters presynaptic plasticity.

    Science.gov (United States)

    Siegert, Sandra; Seo, Jinsoo; Kwon, Ester J; Rudenko, Andrii; Cho, Sukhee; Wang, Wenyuan; Flood, Zachary; Martorell, Anthony J; Ericsson, Maria; Mungenast, Alison E; Tsai, Li-Huei

    2015-07-01

    Noncoding variants in the human MIR137 gene locus increase schizophrenia risk with genome-wide significance. However, the functional consequence of these risk alleles is unknown. Here we examined induced human neurons harboring the minor alleles of four disease-associated single nucleotide polymorphisms in MIR137. We observed increased MIR137 levels compared to those in major allele-carrying cells. microRNA-137 gain of function caused downregulation of the presynaptic target genes complexin-1 (Cplx1), Nsf and synaptotagmin-1 (Syt1), leading to impaired vesicle release. In vivo, miR-137 gain of function resulted in changes in synaptic vesicle pool distribution, impaired induction of mossy fiber long-term potentiation and deficits in hippocampus-dependent learning and memory. By sequestering endogenous miR-137, we were able to ameliorate the synaptic phenotypes. Moreover, reinstatement of Syt1 expression partially restored synaptic plasticity, demonstrating the importance of Syt1 as a miR-137 target. Our data provide new insight into the mechanism by which miR-137 dysregulation can impair synaptic plasticity in the hippocampus. PMID:26005852

  3. L-lactic acid production by Aspergillus brasiliensis overexpressing the heterologous ldha gene from Rhizopus oryzae

    OpenAIRE

    Liaud, Nadège; Rosso, Marie-Noëlle; Fabre, Nicolas; Crapart, Sylvaine; Herpoël-Gimbert, Isabelle; Sigoillot, Jean-Claude; Raouche, Sana; Levasseur, Anthony

    2015-01-01

    International audience Background: Lactic acid is the building block of poly-lactic acid (PLA), a biopolymer that could be set to replace petroleum-based plastics. To make lactic acid production cost-effective, the production process should be carried out at low pH, in low-nutrient media, and with a low-cost carbon source. Yeasts have been engineered to produce high levels of lactic acid at low pH from glucose but not from carbohydrate polymers (e.g. cellulose, hemicellulose, starch). Aspe...

  4. Uricase production by a recombinant Hansenula polymorpha strain harboring Candida utilis uricase gene.

    Science.gov (United States)

    Chen, Zhiyu; Wang, Zhaoyue; He, Xiuping; Guo, Xuena; Li, Weiwei; Zhang, Borun

    2008-06-01

    Uricase is an important medical enzyme which can be used to determine urate in clinical analysis, to therapy gout, hyperuricemia, and tumor lysis syndrome. Uricase of Candida utilis was successfully expressed in Hansenula polymorpha under the control of methanol oxidase promoter using Saccharomyces cerevisiae alpha-factor signal peptide as the secretory sequence. Recombinant H. polymorpha MU200 with the highest extracellular uricase production was characterized with three copies of expression cassette and selected for process optimization for the production of recombinant enzyme. Among the parameters investigated in shaking flask cultures, the pH value of medium and inoculum size had great influence on the recombinant uricase production. The maximum extracellular uricase yield of 2.6 U/ml was obtained in shaking flask culture. The yield of recombinant uricase was significantly improved by the combined use of a high cell-density cultivation technique and a pH control strategy of switching culture pH from 5.5 to 6.5 in the induction phase. After induction for 58 h, the production of recombinant uricase reached 52.3 U/ml (about 2.1 g/l of protein) extracellularly and 60.3 U/ml (about 2.4 g/l) intracellularly in fed-batch fermentation, which are much higher than those expressed in other expression systems. To our knowledge, this is the first report about the heterologous expression of uricase in H. polymorpha. PMID:18437374

  5. Influence of Gene Expression on Variable Aflatoxin Production by Different Strains of Aspergillus flavus

    Science.gov (United States)

    Aspergillus flavus is a globally distributed fungus. It causes disease in human and crop plants due to the production of numerous conidia dispersed by air movement and possibly by insects. The fungus is an economically important food contaminant because it produces the most potent natural carcinogen...

  6. Physical and functional analyses of the syrA and syrB genes involved in syringomycin production by Pseudomonas syringae pv. syringae.

    OpenAIRE

    Xu, G W; Gross, D. C.

    1988-01-01

    The syrA and syrB genes involved in syringomycin production in Pseudomonas syringae pv. syringae B301D were identified from an EcoRI-pLAFR3 cosmid library and then physically and functionally analyzed in relation to plant pathogenicity. Homologous recombination of the genes required for syringomycin production from cosmids pGX183 (syrA) and pGX56 (syrB), respectively, introduced into nontoxigenic (Tox-) Tn5 mutants W4S2545 and W4S770 resulted in the concomitant restoration of toxin production...

  7. End-to-end gene fusions and their impact on the production of multifunctional biomass degrading enzymes

    Energy Technology Data Exchange (ETDEWEB)

    Rizk, Mazen, E-mail: mazen.rizk@tuhh.de [Institute of Technical Microbiology, Hamburg University of Technology (TUHH), Kasernenstr. 12, D-21073 Hamburg (Germany); Antranikian, Garabed, E-mail: antranikian@tuhh.de [Institute of Technical Microbiology, Hamburg University of Technology (TUHH), Kasernenstr. 12, D-21073 Hamburg (Germany); Elleuche, Skander, E-mail: skander.elleuche@tuhh.de [Institute of Technical Microbiology, Hamburg University of Technology (TUHH), Kasernenstr. 12, D-21073 Hamburg (Germany)

    2012-11-09

    Highlights: Black-Right-Pointing-Pointer Multifunctional enzymes offer an interesting approach for biomass degradation. Black-Right-Pointing-Pointer Size and conformation of separate constructs play a role in the effectiveness of chimeras. Black-Right-Pointing-Pointer A connecting linker allows for maximal flexibility and increased thermostability. Black-Right-Pointing-Pointer Genes with functional similarities are the best choice for fusion candidates. -- Abstract: The reduction of fossil fuels, coupled with its increase in price, has made the search for alternative energy resources more plausible. One of the topics gaining fast interest is the utilization of lignocellulose, the main component of plants. Its primary constituents, cellulose and hemicellulose, can be degraded by a series of enzymes present in microorganisms, into simple sugars, later used for bioethanol production. Thermophilic bacteria have proven to be an interesting source of enzymes required for hydrolysis since they can withstand high and denaturing temperatures, which are usually required for processes involving biomass degradation. However, the cost associated with the whole enzymatic process is staggering. A solution for cost effective and highly active production is through the construction of multifunctional enzyme complexes harboring the function of more than one enzyme needed for the hydrolysis process. There are various strategies for the degradation of complex biomass ranging from the regulation of the enzymes involved, to cellulosomes, and proteins harboring more than one enzymatic activity. In this review, the construction of multifunctional biomass degrading enzymes through end-to-end gene fusions, and its impact on production and activity by choosing the enzymes and linkers is assessed.

  8. Phenotypes and gene expression profiles of Saccharopolyspora erythraea rifampicin-resistant (rif mutants affected in erythromycin production

    Directory of Open Access Journals (Sweden)

    Bicciato Silvio

    2009-03-01

    Full Text Available Abstract Background There is evidence from previous works that bacterial secondary metabolism may be stimulated by genetic manipulation of RNA polymerase (RNAP. In this study we have used rifampicin selection as a strategy to genetically improve the erythromycin producer Saccharopolyspora erythraea. Results Spontaneous rifampicin-resistant (rif mutants were isolated from the parental strain NRRL2338 and two rif mutations mapping within rpoB, S444F and Q426R, were characterized. With respect to the parental strain, S444F mutants exhibited higher respiratory performance and up to four-fold higher final erythromycin yields; in contrast, Q426R mutants were slow-growing, developmental-defective and severely impaired in erythromycin production. DNA microarray analysis demonstrated that these rif mutations deeply changed the transcriptional profile of S. erythraea. The expression of genes coding for key enzymes of carbon (and energy and nitrogen central metabolism was dramatically altered in turn affecting the flux of metabolites through erythromycin feeder pathways. In particular, the valine catabolic pathway that supplies propionyl-CoA for biosynthesis of the erythromycin precursor 6-deoxyerythronolide B was strongly up-regulated in the S444F mutants, while the expression of the biosynthetic gene cluster of erythromycin (ery was not significantly affected. In contrast, the ery cluster was down-regulated ( Conclusion Rifampicin selection is a simple and reliable tool to investigate novel links between primary and secondary metabolism and morphological differentiation in S. erythraea and to improve erythromycin production. At the same time genome-wide analysis of expression profiles using DNA microarrays allowed information to be gained about the mechanisms underlying the stimulatory/inhibitory effects of the rif mutations on erythromycin production.

  9. Multiple chromosomal gene integration for production of pharmaceutical proteins in S. cerevisiae

    DEFF Research Database (Denmark)

    Jensen, Malene; Mortensen, Uffe Hasbro; Gunnarsson, Nina;

    2014-01-01

    When studying protein folding and secretion the general conception is that all cells in a population express an equal amount of protein. Recent work has shown that expression levels vary greatly in cell populations which express proteins on plasmids. Hence a yeast expression platform has been...... developed at the Department of Systems Biology, DTU. The platform offers the opportunity to express genes on the chromosome in 1 to 10 copies. A comparison between the expression of CFP and RFP by the platform and by plasmids reveals the problems of plasmid expression. FACS analyses of two cell populations......, expressing CFP and RFP on the separate plasmids or expressing CFP and RFP using the yeast expression platform shows expression varies greatly in a cell population based on plasmid expression compared to the yeast expression platform. When expressed on plasmids a few cells are high performers on both proteins...

  10. Enhancement of lipase r27RCL production in Pichia pastoris by regulating gene dosage and co-expression with chaperone protein disulfide isomerase.

    Science.gov (United States)

    Sha, Chong; Yu, Xiao-Wei; Lin, Nai-Xin; Zhang, Meng; Xu, Yan

    2013-12-10

    Pichia pastoris has been successfully used in the production of many secreted and intracellular recombinant proteins, but there is still a large room of improvement for this expression system. Two factors drastically influence the lipase r27RCL production from Rhizopus chinensis CCTCC M201021, which are gene dosage and protein folding in the endoplasmic reticulum (ER). Regarding the effect of gene dosage, the enzyme activity for recombinant strain with three copies lipase gene was 1.95-fold higher than that for recombinant strain with only one copy lipase gene. In addition, the lipase production was further improved by co-expression with chaperone PDI involved in the disulfide bond formation in the ER. Overall, the maximum enzyme activity reached 355U/mL by the recombinant strain with one copy chaperone gene PDI plus five copies lipase gene proRCL in shaking flasks, which was 2.74-fold higher than that for the control strain with only one copy lipase gene. Overall, co-expression with PDI vastly increased the capacity for processing proteins of ER in P. pastoris. PMID:24315648

  11. Construction of an in vivo system for functional analysis of the genes involved in sex pheromone production in the silkmoth, Bombyx mori.

    Directory of Open Access Journals (Sweden)

    Ken-IchiMoto

    2012-02-01

    Full Text Available Moths produce species-specific sex pheromones to attract conspecific mates. The biochemical processes that comprise sex pheromone biosynthesis are precisely regulated and a number of gene products are involved in this biosynthesis and regulation. In recent years, at least 300 EST clones have been isolated from Bombyx mori pheromone gland (PG specific cDNA libraries with some of those clones (i.e., B. mori PG-specific desaturase1 (Bmpgdesat1, PG-specific fatty-acyl reductase (pgFAR, PG-specific acyl-CoA-binding protein (pgACBP, B. mori fatty acid transport protein (BmFATP, B. mori lipid storage droplet protein-1 (BmLsd1 characterized and demonstrated to play a role in sex pheromone production. However, most of the EST clones have yet to be fully characterized and identified. To develop an efficient system for analyzing sex pheromone production-related genes, we investigated the feasibility of a novel gene analysis system using the upstream region of Bmpgdesat1 that should contain a PG-specific gene promoter in conjunction with piggyBac vector-mediated germ-line transformation. As a result, we have been able to obtain expression of our reporter gene (enhanced green fluorescent protein in the PG but not in other tissues of transgenic B. mori. Current results indicate that we have successfully constructed a novel in vivo gene analysis system for sex pheromone production in B. mori.

  12. Construction of an in vivo system for functional analysis of the genes involved in sex pheromone production in the silkmoth, Bombyx mori.

    Science.gov (United States)

    Moto, Ken-Ichi; Matsumoto, Shogo

    2012-01-01

    Moths produce species-specific sex pheromones to attract conspecific mates. The biochemical processes that comprise sex pheromone biosynthesis are precisely regulated and a number of gene products are involved in this biosynthesis and regulation. In recent years, at least 300 EST clones have been isolated from Bombyx mori pheromone gland (PG) specific cDNA libraries with some of those clones [i.e., B. mori PG-specific desaturase 1 (Bmpgdesat1), PG-specific fatty acyl reductase, PG-specific acyl-CoA-binding protein, B. mori fatty acid transport protein, B. mori lipid storage droplet protein-1] characterized and demonstrated to play a role in sex pheromone production. However, most of the EST clones have yet to be fully characterized and identified. To develop an efficient system for analyzing sex pheromone production-related genes, we investigated the feasibility of a novel gene analysis system using the upstream region of Bmpgdesat1 that should contain a PG-specific gene promoter in conjunction with piggyBac vector-mediated germ line transformation. As a result, we have been able to obtain expression of our reporter gene (enhanced green fluorescent protein) in the PG but not in other tissues of transgenic B. mori. Current results indicate that we have successfully constructed a novel in vivo gene analysis system for sex pheromone production in B. mori. PMID:22649415

  13. Agroinfiltration as an Effective and Scalable Strategy of Gene Delivery for Production of Pharmaceutical Proteins

    OpenAIRE

    Chen, Qiang; Lai, Huafang; Hurtado, Jonathan; Stahnke, Jake; Leuzinger, Kahlin; Dent, Matthew

    2013-01-01

    Current human biologics are most commonly produced by mammalian cell culture-based fermentation technologies. However, its limited scalability and high cost prevent this platform from meeting the ever increasing global demand. Plants offer a novel alternative system for the production of pharmaceutical proteins that is more scalable, cost-effective, and safer than current expression paradigms. The recent development of deconstructed virus-based vectors has allowed rapid and high-level transie...

  14. MitoRes: a resource of nuclear-encoded mitochondrial genes and their products in Metazoa

    OpenAIRE

    Grillo Giorgio; Turi Antonio; Licciulli Flavio; Catalano Domenico; Saccone Cecilia; D'Elia Domenica

    2006-01-01

    Abstract Background Mitochondria are sub-cellular organelles that have a central role in energy production and in other metabolic pathways of all eukaryotic respiring cells. In the last few years, with more and more genomes being sequenced, a huge amount of data has been generated providing an unprecedented opportunity to use the comparative analysis approach in studies of evolution and functional genomics with the aim of shedding light on molecular mechanisms regulating mitochondrial biogene...

  15. Phenazine Production in The Presence of Heavy Metals in Recombinant Erwinia herbicola Bearing the Hemoglobin Gene

    Directory of Open Access Journals (Sweden)

    Hüseyin KAHRAMAN

    2014-07-01

    Full Text Available Phenazine production of the highest, and 50 ppm Cd (Fig. 2 a in the presence of recombinant bacteria observed that 72 hours (9.18 μg/ml. In the presence of wild bacteria 100 ppm Cd (Fig. 2 b observed that 72 hours (8.16 μg/ml. In the presence of 50 ppm Cd and 150 ppm Cd 72 hours recombinant bacteria and

  16. Genetic resources for methane production from biomass described with the Gene Ontology

    OpenAIRE

    Purwantini, Endang; Torto-Alalibo, Trudy; Lomax, Jane; Setubal, João C.; Tyler, Brett M.; Mukhopadhyay, Biswarup

    2014-01-01

    Methane (CH4) is a valuable fuel, constituting 70–95% of natural gas, and a potent greenhouse gas. Release of CH4 into the atmosphere contributes to climate change. Biological CH4 production or methanogenesis is mostly performed by methanogens, a group of strictly anaerobic archaea. The direct substrates for methanogenesis are H2 plus CO2, acetate, formate, methylamines, methanol, methyl sulfides, and ethanol or a secondary alcohol plus CO2. In numerous anaerobic niches in nature, methanogene...

  17. Deletion of the Saccharomyces cerevisiae ARO8 gene, encoding an aromatic amino acid transaminase, enhances phenylethanol production from glucose.

    Science.gov (United States)

    Romagnoli, Gabriele; Knijnenburg, Theo A; Liti, Gianni; Louis, Edward J; Pronk, Jack T; Daran, Jean-Marc

    2015-01-01

    Phenylethanol has a characteristic rose-like aroma that makes it a popular ingredient in foods, beverages and cosmetics. Microbial production of phenylethanol currently relies on whole-cell bioconversion of phenylalanine with yeasts that harbour an Ehrlich pathway for phenylalanine catabolism. Complete biosynthesis of phenylethanol from a cheap carbon source, such as glucose, provides an economically attractive alternative for phenylalanine bioconversion. In this study, synthetic genetic array (SGA) screening was applied to identify genes involved in regulation of phenylethanol synthesis in Saccharomyces cerevisiae. The screen focused on transcriptional regulation of ARO10, which encodes the major decarboxylase involved in conversion of phenylpyruvate to phenylethanol. A deletion in ARO8, which encodes an aromatic amino acid transaminase, was found to underlie the transcriptional upregulation of ARO10 during growth, with ammonium sulphate as the sole nitrogen source. Physiological characterization revealed that the aro8Δ mutation led to substantial changes in the absolute and relative intracellular concentrations of amino acids. Moreover, deletion of ARO8 led to de novo production of phenylethanol during growth on a glucose synthetic medium with ammonium as the sole nitrogen source. The aro8Δ mutation also stimulated phenylethanol production when combined with other, previously documented, mutations that deregulate aromatic amino acid biosynthesis in S. cerevisiae. The resulting engineered S. cerevisiae strain produced >3 mm phenylethanol from glucose during growth on a simple synthetic medium. The strong impact of a transaminase deletion on intracellular amino acid concentrations opens new possibilities for yeast-based production of amino acid-derived products. PMID:24733517

  18. Dissection of quorum-sensing genes in Burkholderia glumae reveals non-canonical regulation and the new regulatory gene tofM for toxoflavin production.

    Directory of Open Access Journals (Sweden)

    Ruoxi Chen

    Full Text Available Burkholderia glumae causes bacterial panicle blight of rice and produces major virulence factors, including toxoflavin, under the control of the quorum-sensing (QS system mediated by the luxI homolog, tofI, and the luxR homolog, tofR. In this study, a series of markerless deletion mutants of B. glumae for tofI and tofR were generated using the suicide vector system, pKKSacB, for comprehensive characterization of the QS system of this pathogen. Consistent with the previous studies by other research groups, ΔtofI and ΔtofR strains of B. glumae did not produce toxoflavin in Luria-Bertani (LB broth. However, these mutants produced high levels of toxoflavin when grown in a highly dense bacterial inoculum (∼ 10(11 CFU/ml on solid media, including LB agar and King's B (KB agar media. The ΔtofI/ΔtofR strain of B. glumae, LSUPB201, also produced toxoflavin on LB agar medium. These results indicate the presence of previously unknown regulatory pathways for the production of toxoflavin that are independent of tofI and/or tofR. Notably, the conserved open reading frame (locus tag: bglu_2g14480 located in the intergenic region between tofI and tofR was found to be essential for the production of toxoflavin by tofI and tofR mutants on solid media. This novel regulatory factor of B. glumae was named tofM after its homolog, rsaM, which was recently identified as a novel negative regulatory gene for the QS system of another rice pathogenic bacterium, Pseudomonas fuscovaginae. The ΔtofM strain of B. glumae, LSUPB286, produced a less amount of toxoflavin and showed attenuated virulence when compared with its wild type parental strain, 336gr-1, suggesting that tofM plays a positive role in toxoflavin production and virulence. In addition, the observed growth defect of the ΔtofI strain, LSUPB145, was restored by 1 µM N-octanoyl homoserine lactone (C8-HSL.

  19. Lambda bacteriophage gene products and x-ray sensitivity of Escherichia coli: comparison of red-dependent and gam-dependent radioresistance

    International Nuclear Information System (INIS)

    When gene products of lambda bacteriophage are introduced into a cell by transient induction of a lysogen, increased resistance of the cells to x rays results. This phenomenon has been called phage-induced radioresistance. Genetic studies show at least two classes of induced radioresistance. The first type depends on the products of the lambda red genes and is observed in bacteria that are mutated in the recB gene. It is thought that the lambda red products compensate for the missing RecBC nuclease in the repair of x-ray damage. An optimal effect is obtained even when the lambda red products are supplied 1 h after irradiation. The lesions that are affected by the red-dependent process are probably not deoxyribonucleic acid strand breaks because the extent of deoxyribonucleic acid strand rejoining is not altered by the red products. The second type of phage-induced radioresistance requires the gam product of lambda and is observed in wild-type and polA strains. The lambda gam+ gene product must be present immediately after irradiation to exert its full effect. In its presence, DNA breakdown is decreased, and a greater fraction of DNA is converted back to high molecular weight. Strains carrying lex, recA, or certain other combinations of mutations do not show any detectable phage-induced radioresistance. (U.S.)

  20. Validation of PDE9A Gene Identified in GWAS Showing Strong Association with Milk Production Traits in Chinese Holstein.

    Science.gov (United States)

    Yang, Shao-Hua; Bi, Xiao-Jun; Xie, Yan; Li, Cong; Zhang, Sheng-Li; Zhang, Qin; Sun, Dong-Xiao

    2015-01-01

    Phosphodiesterase9A (PDE9A) is a cyclic guanosine monophosphate (cGMP)-specific enzyme widely expressed among the tissues, which is important in activating cGMP-dependent signaling pathways. In our previous genome-wide association study, a single nucleotide polymorphism (SNP) (BTA-55340-no-rs(b)) located in the intron 14 of PDE9A, was found to be significantly associated with protein yield. In addition, we found that PDE9A was highly expressed in mammary gland by analyzing its mRNA expression in different tissues. The objectives of this study were to identify genetic polymorphisms of PDE9A and to determine the effects of these variants on milk production traits in dairy cattle. DNA sequencing identified 11 single nucleotide polymorphisms (SNPs) and six SNPs in 5' regulatory region were genotyped to test for the subsequent association analyses. After Bonferroni correction for multiple testing, all these identified SNPs were statistically significant for one or more milk production traits (p A, c.-724 A>G) were involved in the regulation of gene expression. Consequently, our findings provide confirmatory evidences for associations of PDE9A variants with milk production traits and these identified SNPs may serve as genetic markers to accelerate Chinese Holstein breeding program. PMID:26556348

  1. Expression of ORF2 partial gene of hepatitis E virus in tomatoes and immunoactivity of expression products

    Institute of Scientific and Technical Information of China (English)

    Ying Ma; Shun-Quan Lin; Yi Gao; Mei Li; Wen-Xin Luo; Jun Zhang; Ning-Shao Xia

    2003-01-01

    AIM: To transfer hepatitis E virus (HEV) ORF2 partial gene to tomato plants, to investigate its expression in transformants and the immunoactivity of expression products, and to explore the feasibility of developing a new type of plantderived HEV oral vaccine.METHODS: Plant binary expression vector p1301E2,carrying a fragment of HEV open reading frame-2 (named HEV-E2), was constructed by linking the fragment to a constitutive CaMV35s promoter and nos terminator, then directly introduced into Agrobacterium tumefaciens EHA105. With leaf-disc method, tomato plants medicated by EHA105 were transformed and hygromycin-resistant plantlets were obtained in selective medium containing hygromycin. The presence and integration of foreign DNA in transgenic tomato genome were confirmed by Gus gene expression, PCR amplification and Southern dot blotting.The immunoactivity of recombinant protein extracted from transformed plants was examined by enzyme-linked immunosorbant assay (ELISA) using a monoclonal antibody specifically against HEV. ELISA was also used to estimate the recombinant protein content in leaves and fruits of the transformants.RESULTS: Seven positive lines of HEV-E2-transgenic tomato plants confirmed by PCR and Southern blotting were obtained and the immunoactivity of recombinant protein could be detected in extracts of transformants. The expression levels of recombinant protein were 61.22 ng/g fresh weight in fruits and 6.37-47.9 ng/g fresh weight in leaves of the transformants.CONCLUSION: HEV-E2 gene was correctly expressed in transgenic tomatoes and the recombinant antigen derived from them has normal immunoactivity. Transgenic tomatoes may hold a good promise for producing a new type of lowcost oral vaccine for hepatitis E virus.

  2. Bayesian computational approaches for gene regulation studies of bioethanol and biohydrogen production

    Energy Technology Data Exchange (ETDEWEB)

    Lawrence, Charles E [Brown Univ., Providence, RI (United States); Newberg, Lee [Wadsworth Center; McCue, LeeAnn [Pacific Northwest Labs; Thomspon, Williams [Brown University

    2012-03-01

    It has recently become clear that regulatory RNAs play a major role in regulation of gene expression in bacteria. RNA secondary structures play a major role in the function of many regulatory RNAs, and structural features are often key to their interaction with other cellular components. Thus, there has been considerable interest in the prediction of the secondary structures for RNA families. A paper describing our new algorithm, RNAG, to predict consensus secondary structures for unaligned sequences using the blocked Gibbs sampler has been published[1]. This sampling algorithm iteratively samples from the conditional probability distributions: P(Structure | Alignment) and P(Alignment | Structure). Subsequent to publication of the RNAG paper we have employed the technology from RNAG in the development of an RNA motif finding algorithm. To develop and RNA motif finding algorithm, RGibbs, we capitalized on our long experience in DNA motif finding and RNA secondary structure prediction. We applied RGibbs to three data sets from the literature and compared it to existing methods: one for training and two others for tests sets. In both test sets we found RGibbs out performed existing procedures.

  3. Production, characterization, gene cloning, and nematocidal activity of the extracellular protease from Stenotrophomonas maltophilia N4.

    Science.gov (United States)

    Jankiewicz, Urszula; Larkowska, Ewa; Swiontek Brzezinska, Maria

    2016-06-01

    A rhizosphere strain of the bacterium Stenotrophomonas maltophilia N4 secretes the serine protease PN4, whose molecular mass is approximately 42 kDa. The optimal temperature for the enzyme activity of the 11-fold purified protein was 50°C and the optimal pH was 10.5. The activity of the enzyme was strongly inhibited by specific serine protease inhibitors, which allowed for its classification as an alkaline serine protease family. Ca(2+) ions stimulated the activity of the protease PN4, while Mg(2+) ions stabilized its activity, and Zn(2+) and Cd(2+) ions strongly inhibited its activity. The enzyme has broad substrate specificity. For example, it is able to hydrolyse casein, keratin, albumin, haemoglobin, and gelatin, as well as the insoluble modified substrates azure keratin and azocoll. The gene that encodes the 1740 bp precursor form of the enzyme (accession number: LC031815) was cloned. We then deduced that its amino acid sequence includes the region of the conserved domain of the S8 family of peptidases as well as the catalytic triad Asp/His/Ser. The bacterial culture fluid as well as the purified protease PN4 demonstrated biocidal activity with regard to the nematodes Caenorhabditis elegans and Panagrellus spp. PMID:26896861

  4. Monitoring Campylobacter in the poultry production chain - From culture to genes and beyond

    DEFF Research Database (Denmark)

    Josefsen, Mathilde Hasseldam; Bhunia, Arun; Engvall, Eva Olsson; Fachmann, Mette S. R.; Hoorfar, Jeffrey

    2015-01-01

    numbers of samples. The ultimate goal for rapid monitoring of Campylobacter is to prevent contaminated meat from entering the food market. Currently, real-time PCR is fulfilling abovementioned criteria to a certain extent. Further development of real-time PCR, microarray PCR, miniaturized biosensors......Improved monitoring tools are important for the control of Campylobacter bacteria in poultry production. Standardized reference culture methods issued by national and international standardization organizations are time-consuming, cumbersome and not amenable to automation for screening of large...

  5. Super gene alternation of magnetite and pyrite and the role of their alternation products in the fixation of uranium from the circulating media. Vol. 3

    International Nuclear Information System (INIS)

    In most of the Egyptian altered radioactive granites, highly magnetic heavy particles were found to be radioactive. They are a mixture of several iron oxide minerals which are products of super gene alternation of the preexisting hypo gene iron-bearing minerals especially magnetite and pyrite. The end products of this super gene alternation are mainly hydrated iron oxide minerals limonite and/or goethite. During the alternation, deformation and defects in the mineral structure took place, thereby promoting diffusion of the substitutional and interstitial ions (uranium) towards these sites. The mechanism of the alternation of the hypo gene iron-bearing minerals, magnetite and pyrite to form the secondary mineral hematite, limonite and goethite; and the role of these secondary minerals in fixing uranium from the circulating media, and as indicators to the radioactivity of the host rocks are discussed. 2 figs

  6. Single Nucleotide Polymorphism (SNP in PPARGC1A Gene Associates Milk Production Traits in Chinese Holstein Cattle

    Directory of Open Access Journals (Sweden)

    M. A. Alim§, Yipeng Fan§, Yan Xie, Xiaoping Wu, Dongxiao Sun*, Yi Zhang, Shengli Zhang, Yuan Zhang, Qin Zhang and Lin Liu1

    2012-10-01

    Full Text Available This study was designed to find out possible associations between single nucleotide polymorphism (SNP of PPARGC1A gene and milk production traits. In the current study, one SNP at g.85330C>T position was identified in 9th intron of PPARGC1A gene through pooled DNA sequencing. The identified SNP was genotyped using MALDI-TOF MS technique in 752 individuals from the Chinese Holstein cattle breed. The frequency of C allele at position g.85330C>T was more frequent in our population (0.69, followed by the T allele (0.31. From the association results, significant differences were found between PPARGC1A genotypes in the protein concentration and protein yield. Heterozygous cows with CT genotype at the g.85330C>T locus showed the highest protein yield, with more than 4.18 kg compared with homozygous cows with TT genotype; homozygous CC cows were found at intermediate position. In case of protein percentage, homozygous cows with TT genotype were significantly greater than heterozygous CT cows, with a difference of about 0.012%; CC cows were found in lowest position. The allele substitution results demonstrated that g.85330C>T-C allele decreased protein yield (1.23kg and protein percentage (0.016%. This result clearly indicated that g.85330C>T-T allele increased protein percentage and protein yield.

  7. Production of polyhydroxybutyrate in oil palm (Elaeis guineensis Jacq. mediated by microprojectile bombardment of PHB biosynthesis genes into embryogenic calli

    Directory of Open Access Journals (Sweden)

    Ahmad Parveez eGhulam Kadir

    2015-08-01

    Full Text Available Biodegradable plastics, mainly polyhydroxybutyrate (PHB, which are traditionally produced by bacterial cells, have been produced in the cells of more than 15 plant species. Since the production of biodegradable plastics and the synthesis of oil in plants share the same substrate, acetyl-coenzyme A (acetyl-CoA, producing PHB in oil bearing crops, such as oil palm, will be advantageous. In this study, three bacterial genes, bktB, phaB and phaC, which are required for the synthesis of PHB and selectable marker gene, bar, for herbicide Basta resistant, were transformed into embryogenic calli. A number of transformed embryogenic lines resistant to herbicide Basta were obtained and were later regenerated to produce few hundred plantlets. Molecular analyses, including PCR, Southern blot and real-time PCR have demonstrated stable integration and expression of the transgenes in the oil palm genome. HPLC and Nile Blue A staining analyses confirmed the synthesis of PHB in some of the plantlets.

  8. Production of polyhydroxybutyrate in oil palm (Elaeis guineensis Jacq.) mediated by microprojectile bombardment of PHB biosynthesis genes into embryogenic calli.

    Science.gov (United States)

    Parveez, Ghulam Kadir Ahmad; Bahariah, Bohari; Ayub, Nor Hanin; Masani, Mat Yunus Abdul; Rasid, Omar Abdul; Tarmizi, Ahmad Hashim; Ishak, Zamzuri

    2015-01-01

    Biodegradable plastics, mainly polyhydroxybutyrate (PHB), which are traditionally produced by bacterial cells, have been produced in the cells of more than 15 plant species. Since the production of biodegradable plastics and the synthesis of oil in plants share the same substrate, acetyl-coenzyme A (acetyl-CoA), producing PHB in oil bearing crops, such as oil palm, will be advantageous. In this study, three bacterial genes, bktB, phaB, and phaC, which are required for the synthesis of PHB and selectable marker gene, bar, for herbicide Basta resistant, were transformed into embryogenic calli. A number of transformed embryogenic lines resistant to herbicide Basta were obtained and were later regenerated to produce few hundred plantlets. Molecular analyses, including polymerase chain reaction (PCR), Southern blot, and real-time PCR have demonstrated stable integration and expression of the transgenes in the oil palm genome. HPLC and Nile blue A staining analyses confirmed the synthesis of PHB in some of the plantlets. PMID:26322053

  9. The mimivirus R355 gene product: preliminary crystallographic analysis of a putative ubiquitin-like protein-specific protease

    International Nuclear Information System (INIS)

    The genome sequence of mimivirus, the largest known double-stranded DNA virus, encodes a putative protease: the R355 gene product. Its expression in E. coli, its crystallization and the preliminary phasing of a MAD data set using the selenium signal present in a crystal of recombinant selenomethionine-substituted protein are reported. The complete genome sequence of the largest known double-stranded DNA virus, mimivirus, reveals the presence of a gene (denoted R355) that potentially encodes a cysteine protease that is expressed late (after 6 h) in the infectious cycle of the virus. In order to verify a sequence-based functional prediction and understand its role during the infectious process, the R355 protein was produced to assay its proteolytic activity and solve its three-dimensional structure. Here, the preliminary crystallographic analysis of the recombinant viral protein is reported. The crystals belonged to the orthorhombic space group P212121, with a monomer in the asymmetric unit. A MAD data set was used for preliminary phasing using the selenium signal from a selenomethionine-substituted protein crystal

  10. Glucan synthesis in the genus Lactobacillus: isolation and characterization of glucansucrase genes, enzymes and glucan products from six different strains.

    Science.gov (United States)

    Kralj, S; van Geel-Schutten, G H; Dondorff, M M G; Kirsanovs, S; van der Maarel, M J E C; Dijkhuizen, L

    2004-11-01

    Members of the genera Streptococcus and Leuconostoc synthesize various alpha-glucans (dextran, alternan and mutan). In Lactobacillus, until now, the only glucosyltransferase (GTF) enzyme that has been characterized is gtfA of Lactobacillus reuteri 121, the first GTF enzyme synthesizing a glucan (reuteran) that contains mainly alpha-(1-->4) linkages together with alpha-(1-->6) and alpha-(1-->4,6) linkages. Recently, partial sequences of glucansucrase genes were detected in other members of the genus Lactobacillus. This paper reports, for the first time, isolation and characterization of dextransucrase and mutansucrase genes and enzymes from various Lactobacillus species and the characterization of the glucan products synthesized, which mainly have alpha-(1-->6)- and alpha-(1-->3)-glucosidic linkages. The four GTF enzymes characterized from three different Lb. reuteri strains are highly similar at the amino acid level, and consequently their protein structures are very alike. Interestingly, these four Lb. reuteri GTFs have relatively large N-terminal variable regions, containing RDV repeats, and relatively short putative glucan-binding domains with conserved and less-conserved YG-repeating units. The three other GTF enzymes, isolated from Lactobacillus sakei, Lactobacillus fermentum and Lactobacillus parabuchneri, contain smaller variable regions and larger putative glucan-binding domains compared to the Lb. reuteri GTF enzymes. PMID:15528655

  11. Identification, Characterization and Down-Regulation of Cysteine Protease Genes in Tobacco for Use in Recombinant Protein Production.

    Directory of Open Access Journals (Sweden)

    Kishor Duwadi

    Full Text Available Plants are an attractive host system for pharmaceutical protein production. Many therapeutic proteins have been produced and scaled up in plants at a low cost compared to the conventional microbial and animal-based systems. The main technical challenge during this process is to produce sufficient levels of recombinant proteins in plants. Low yield is generally caused by proteolytic degradation during expression and downstream processing of recombinant proteins. The yield of human therapeutic interleukin (IL-10 produced in transgenic tobacco leaves was found to be below the critical level, and may be due to degradation by tobacco proteases. Here, we identified a total of 60 putative cysteine protease genes (CysP in tobacco. Based on their predicted expression in leaf tissue, 10 candidate CysPs (CysP1-CysP10 were selected for further characterization. The effect of CysP gene silencing on IL-10 accumulation was examined in tobacco. It was found that the recombinant protein yield in tobacco could be increased by silencing CysP6. Transient expression of CysP6 silencing construct also showed an increase in IL-10 accumulation in comparison to the control. Moreover, CysP6 localizes to the endoplasmic reticulum (ER, suggesting that ER may be the site of IL-10 degradation. Overall results suggest that CysP6 is important in determining the yield of recombinant IL-10 in tobacco leaves.

  12. Heterologous production of glidobactins/luminmycins in Escherichia coli Nissle containing the glidobactin biosynthetic gene cluster from Burkholderia DSM7029.

    Science.gov (United States)

    Bian, Xiaoying; Huang, Fan; Wang, Hailong; Klefisch, Thorsten; Müller, Rolf; Zhang, Youming

    2014-10-13

    Natural product peptide-based proteasome inhibitors show great potential as anticancer drugs. Here we have cloned the biosynthetic gene cluster of a potent proteasome inhibitor-glidobactin from Burkholderia DSM7029-and successfully detected glidobactins/luminmycins in E. coli Nissle. We have also improved the yield of glidobactin A tenfold by promoter change in a heterologous host. In addition, two new biosynthetic intermediates were identified by comparative MS/MS fragmentation analysis. Identification of acyclic luminmycin E implies substrate specificity of the TE domain for cyclization. The establishment of a heterologous expression system for syrbactins provided the basis for the generation of new syrbactins as proteasome inhibitors by molecular engineering, but the TE domain's specificity cannot be ignored. PMID:25147087

  13. The effects of vagotomy on the abomasum in calves: Radiography and protein gene product 9.5 immunohistochemistry

    International Nuclear Information System (INIS)

    Abomasal disorders of calves with total vagotomy, operated on at 1 week old, were investigated with radiography and protein gene product (PGP) 9.5 immunohistochemistry. Radiographic findings indicated abomasal atony with dilatation in all calves 2 weeks after vagotomy, while 4 weeks after vagotomy abomasal dilatation was detected in 2 calves and another 2 calves showed dilatation and impaction. The densities of PGP 9.5-immunoreactive nerves in the tunica muscularis decreased significantly in the corpus region of the greater curvature 2 weeks after vagotomy and in the pyloric region of the lesser curvature 4 weeks after vagotomy, and it was at its lowest 4 weeks after vagotomy in all regions examined. In conclusion, abomasal dilatation and / or impaction in vagotomized calves confirmed by radiography were related with a decreased frequency of nerves in the tunica muscularis of the abomasum

  14. Effects of variation in porcine MYOD1 gene on muscle fiber characteristics, lean meat production, and meat quality traits.

    Science.gov (United States)

    Lee, E A; Kim, J M; Lim, K S; Ryu, Y C; Jeon, W M; Hong, K C

    2012-09-01

    Three single nucleotide polymorphisms (SNPs) in the porcine MYOD1 gene were used for association analysis and haplotype construction to evaluate the effects of their substitution. Four hundred and three pigs of Yorkshire and Berkshire breeds were used. The mRNA expression levels of MYOD1 were examined. The g.489C>T and g.1264C>A SNPs were significantly associated with several muscle fiber characteristics, the loin eye area, and lightness. Particularly, animals having hetero-genotypes of both sites showed good performance both in lean meat production and meat quality traits. The results of haplotype substitution were similar to the associations of individual SNPs. Moreover, the 2 SNPs had significant effects on mRNA expression. Therefore, the g.489C>T and g.1264C>A SNPs in MYOD1 may be meaningful DNA markers that can be used for improving important porcine economic traits. PMID:22554470

  15. Intracellular localization of the HCS2 gene products in identified snail neurons in vivo and in vitro.

    Science.gov (United States)

    Ivanova, J L; Leonova, O G; Popenko, V I; Ierusalimsky, V N; Korshunova, T A; Boguslavsky, D V; Malyshev, A Y; Balaban, P M; Belyavsky, A V

    2006-03-01

    1. The HCS2 (Helix command specific 2) gene expressed in giant command neurons for withdrawal behavior of the terrestrial snail Helix lucorum encodes a unique hybrid precursor protein that contains a Ca-binding (EF-hand motif) protein and four small peptides (CNP1-CNP4) with similar Tyr-Pro-Arg-X aminoacid sequence at the C terminus. Previous studies suggest that under conditions of increased intracellular Ca(2+) concentration the HCS2 peptide precursor may be cleaved, and small physiologically active peptides transported to the release sites. In the present paper, intracellular localization of putative peptide products of the HCS2-encoded precursor was studied immunocytochemically by means of light and electron microscopy. 2. Polyclonal antibodies against the CNP3 neuropeptide and a Ca-binding domain of the precursor protein were used for gold labeling of ultrathin sections of identified isolated neurons maintained in culture for several days, and in same identified neurons freshly isolated from the central nervous system. 3. In freshly isolated neurons, the gold particles were mainly localized over the cytoplasmic secretory granules, with the density of labeling for the CNP3 neuropeptide being two-fold higher than for the calcium-binding domain. In cultured neurons, both antibodies mostly labeled clusters of secretory granules in growth cones and neurites of the neuron. The density of labeling for cultured neurons was the same for both antibodies, and was two-fold higher than for the freshly isolated from the central nervous system neurons. 4. The immunogold particles were practically absent in the bodies of cultured neurons. 5. The data obtained conform to the suggestion that the HCS2 gene products are transported from the cell body to the regions of growth or release sites. PMID:16763780

  16. Pleiotropic regulatory genes bldA, adpA and absB are implicated in production of phosphoglycolipid antibiotic moenomycin.

    Science.gov (United States)

    Makitrynskyy, Roman; Ostash, Bohdan; Tsypik, Olga; Rebets, Yuriy; Doud, Emma; Meredith, Timothy; Luzhetskyy, Andriy; Bechthold, Andreas; Walker, Suzanne; Fedorenko, Victor

    2013-10-01

    Unlike the majority of actinomycete secondary metabolic pathways, the biosynthesis of peptidoglycan glycosyltransferase inhibitor moenomycin in Streptomyces ghanaensis does not involve any cluster-situated regulators (CSRs). This raises questions about the regulatory signals that initiate and sustain moenomycin production. We now show that three pleiotropic regulatory genes for Streptomyces morphogenesis and antibiotic production-bldA, adpA and absB-exert multi-layered control over moenomycin biosynthesis in native and heterologous producers. The bldA gene for tRNA(Leu)UAA is required for the translation of rare UUA codons within two key moenomycin biosynthetic genes (moe), moeO5 and moeE5. It also indirectly influences moenomycin production by controlling the translation of the UUA-containing adpA and, probably, other as-yet-unknown repressor gene(s). AdpA binds key moe promoters and activates them. Furthermore, AdpA interacts with the bldA promoter, thus impacting translation of bldA-dependent mRNAs-that of adpA and several moe genes. Both adpA expression and moenomycin production are increased in an absB-deficient background, most probably because AbsB normally limits adpA mRNA abundance through ribonucleolytic cleavage. Our work highlights an underappreciated strategy for secondary metabolism regulation, in which the interaction between structural genes and pleiotropic regulators is not mediated by CSRs. This strategy might be relevant for a growing number of CSR-free gene clusters unearthed during actinomycete genome mining. PMID:24153004

  17. Posttranslational modifications, localization, and protein interactions of optineurin, the product of a glaucoma gene.

    Directory of Open Access Journals (Sweden)

    Hongyu Ying

    Full Text Available BACKGROUND: Glaucoma is a major blinding disease. The most common form of this disease, primary open angle glaucoma (POAG, is genetically heterogeneous. One of the candidate genes, optineurin, is linked principally to normal tension glaucoma, a subtype of POAG. The present study was undertaken to illustrate the basic characteristics of optineurin. METHODOLOGY/PRINCIPAL FINDINGS: Lysates from rat retinal ganglion RGC5 cells were subjected to N- or O-deglycosylation or membrane protein extraction. The phosphorylation status was evaluated after immunoprecipitation. It was found that while phosphorylated, optineurin was neither N- nor O-glycosylated, and was by itself not a membrane protein. RGC5 and human retinal pigment epithelial cells were double stained with anti-optineurin and anti-GM130. The endogenous optineurin exhibited a diffuse, cytoplasmic distribution, but a population of the protein was associated with the Golgi apparatus. Turnover experiments showed that the endogenous optineurin was relatively short-lived, with a half-life of approximately 8 hours. Native blue gel electrophoresis revealed that the endogenous optineurin formed homohexamers. Optineurin also interacted with molecules including Rab8, myosin VI, and transferrin receptor to assemble into supermolecular complexes. When overexpressed, optineurin-green fluorescence protein (GFP fusion protein formed punctate structures termed "foci" in the perinuclear region. Treatment of nocadazole resulted in dispersion of the optineurin foci. In addition, tetracycline-regulated optineurin-GFPs expressing RGC5 stable cell lines were established for the first time. CONCLUSIONS/SIGNIFICANCE: The present study provides new information regarding basic characteristics of optineurin that are important for future efforts in defining precisely how optineurin functions normally and how mutations may result in pathology. The inducible optineurin-GFP-expressing cell lines are also anticipated to

  18. A cell engineering strategy to enhance supercoiled plasmid DNA production for gene therapy.

    Science.gov (United States)

    Hassan, Sally; Keshavarz-Moore, Eli; Ward, John

    2016-09-01

    With the recent revival of the promise of plasmid DNA vectors in gene therapy, a novel synthetic biology approach was used to enhance the quantity, (yield), and quality of the plasmid DNA. Quality was measured by percentage supercoiling and supercoiling density, as well as improving segregational stability in fermentation. We examined the hypothesis that adding a Strong Gyrase binding Site (SGS) would increase DNA gyrase-mediated plasmid supercoiling. SGS from three different replicons, (the Mu bacteriophage and two plasmids, pSC101 and pBR322) were inserted into the plasmid, pUC57. Different sizes of these variants were transformed into E. coli DH5α, and their supercoiling properties and segregational stability measured. A 36% increase in supercoiling density was found in pUC57-SGS, but only when SGS was derived from the Mu phage and was the larger sized version of this fragment. These results were also confirmed at fermentation scale. Total percentage supercoiled monomer was maintained to 85-90%. A twofold increase in plasmid yield was also observed for pUC57-SGS in comparison to pUC57. pUC57-SGS displayed greater segregational stability than pUC57-cer and pUC57, demonstrating a further potential advantage of the SGS site. These findings should augment the potential of plasmid DNA vectors in plasmid DNA manufacture. Biotechnol. Bioeng. 2016;113: 2064-2071. © 2016 The Authors. Biotechnology and Bioengineering Published by Wiley Periodicals, Inc. PMID:26928284

  19. Schizophrenia susceptibility gene product dysbindin-1 regulates the homeostasis of cyclin D1.

    Science.gov (United States)

    Ito, Hidenori; Morishita, Rika; Nagata, Koh-Ichi

    2016-08-01

    Dysbindin-1 (dystrobrevin binding protein-1, DTNBP1) is now widely accepted as a potential schizophrenia susceptibility gene and accumulating evidence indicates its functions in the neural development. In this study, we tried to identify new binding partners for dysbindin-1 to clarify the novel function of this molecule. When consulted with BioGRID protein interaction database, cyclin D3 was found to be a possible binding partner for dysbindin-1. We then examined the interaction between various dysbindin-1 isoforms (dysbindin-1A, -1B and -1C) and all three D-type cyclins (cyclin D1, D2, and D3) by immunoprecipitation with the COS7 cell expression system, and found that dysbindin-1A preferentially interacts with cyclin D1. The mode of interaction between these molecules was considered as direct binding since recombinant dysbindin-1A and cyclin D1 formed a complex in vitro. Mapping analyses revealed that the C-terminal region of dysbindin-1A binds to the C-terminal of cyclin D1. Consistent with the results of the biochemical analyses, endogenous dysbindin-1was partially colocalized with cyclin D1 in NIH3T3 fibroblast cells and in neuronal stem and/or progenitor cells in embryonic mouse brain. While co-expression of dysbindin-1A with cyclin D1 changed the localization of the latter from the nucleus to cytosol, cyclin D1-binding partner CDK4 inhibited the dysbindin-cyclin D1 interaction. Meanwhile, depletion of endogenous dysbindin-1A increased cyclin D1 expression. These results indicate that dysbindin-1A may control the cyclin D1 function spatiotemporally and might contribute to better understanding of the pathophysiology of dysbindin-1-associated disorders. PMID:27130439

  20. Derepression of prophage P2 by satellite phage P4: cloning of the P4 epsilon gene and identification of its product.

    OpenAIRE

    Liu, T; Renberg, S K; Haggård-Ljungquist, E

    1997-01-01

    Escherichia coli phage P4 lacks all of the genetic information necessary for capsid, tail, and lysis functions. P4 is therefore dependent on a helper phage, such as P2, for lytic propagation. During P4 superinfection of a P2 lysogen, the P2 prophage is derepressed by the action of the P4-encoded epsilon gene. We have cloned the epsilon gene and identified the 10-kDa E protein. The epsilon gene product is the only P4 protein required to derepress prophage P2, which leads to in situ P2 DNA repl...

  1. Analysis of single nucleotide polymorphisms in major and candidate genes for production traits in Nero Siciliano pig breed

    Directory of Open Access Journals (Sweden)

    Alessandro Zumbo

    2010-01-01

    Full Text Available Nero Siciliano (NS; Sicilian Black is a local pig breed reared on the island of Sicily mainly under extensive management.The breed is well adapted to marginal conditions and is appreciated for its reproductive performance, disease resistanceand production of tasty meat. For a genetic characterization of this breed we analyzed the allele frequencies of singlenucleotide polymorphisms (SNPs in eight major or candidate genes (ryanodine receptor 1, RYR1; Na+, K+ ATPase subunitα 2, ATP1A2; myosin heavy chain 2B, MYH4; sarcolipin, SLN; cathepsin B, CTSB; cystatin B, CSTB; estrogen receptor,ESR; melanocortin receptor 1, MC1R for performance and phenotypic traits. The animals that were sampled andanalyzed represent about 6-8% of the total NS pig population. PCR-RFLP or PCR-SSCP techniques were used to type theDNA markers in the selected loci. Exact test of Hardy-Weinberg equilibrium was computed for each locus, Fis statisticsand heterozygosity were calculated for each locus and over all loci. Allele frequencies obtained in NS breed were comparedto the frequencies already available in literature for the Large White, Landrace, Duroc, Belgian Landrace, Piétrain,Hampshire and Meishan breeds. For the ESR locus, as no information on the distribution of the two alleles were available,we typed a sample of unrelated pigs from the considered breeds.Even if only eight loci were studied in NS breed, important elements were obtained from the data. The 1843T (n alleleat the RYR1 locus is present in NS breed, thus the molecular test to identify the carriers of this allele should be adoptedto avoid its spreading in the population. Moreover, other studies are needed to clarify the allelic structure of the MC1Rgene, which affects coat color, in order to evaluate if this gene could be used in genetic tests for the traceability of themeat products of this breed. Finally, the present work represents an attempt to evaluate data on mutations within majorand candidate genes

  2. Evolution and origin of merlin, the product of the Neurofibromatosis type 2 (NF2 tumor-suppressor gene

    Directory of Open Access Journals (Sweden)

    Omelyanchuk Leonid V

    2005-12-01

    Full Text Available Abstract Background Merlin, the product of the Neurofibromatosis type 2 (NF2 tumor suppressor gene, belongs to the ezrin-radixin-moesin (ERM subgroup of the protein 4.1 superfamily, which links cell surface glycoproteins to the actin cytoskeleton. While merlin's functional activity has been examined in mammalian and Drosophila models, little is understood about its evolution, diversity, and overall distribution among different taxa. Results By combining bioinformatic and phylogenetic approaches, we demonstrate that merlin homologs are present across a wide range of metazoan lineages. While the phylogenetic tree shows a monophyletic origin of the ERM family, the origin of the merlin proteins is robustly separated from that of the ERM proteins. The derivation of merlin is thought to be in early metazoa. We have also observed the expansion of the ERM-like proteins within the vertebrate clade, which occurred after its separation from Urochordata (Ciona intestinalis. Amino acid sequence alignment reveals the absence of an actin-binding site in the C-terminal region of all merlin proteins from various species but the presence of a conserved internal binding site in the N-terminal domain of the merlin and ERM proteins. In addition, a more conserved pattern of amino acid residues is found in the region containing the so-called "Blue Box," although some amino acid substitutions in this region exist in the merlin sequences of worms, fish, and Ciona. Examination of sequence variability at functionally significant sites, including the serine-518 residue, the phosphorylation of which modulates merlin's intra-molecular association and function as a tumor suppressor, identifies several potentially important sites that are conserved among all merlin proteins but divergent in the ERM proteins. Secondary structure prediction reveals the presence of a conserved α-helical domain in the central to C-terminal region of the merlin proteins of various species. The

  3. Regulating ehrlich and demethiolation pathways for alcohols production by the expression of ubiquitin-protein ligase gene HUWE1.

    Science.gov (United States)

    Zhang, Quan; Jia, Kai-Zhi; Xia, Shi-Tao; Xu, Yang-Hua; Liu, Rui-Sang; Li, Hong-Mei; Tang, Ya-Jie

    2016-01-01

    Ehrlich and demethiolation pathways as two competing branches converted amino acid into alcohols. Controlling both pathways offers considerable potential for industrial applications including alcohols overproduction, flavor-quality control and developing new flavors. While how to regulate ehrlich and demethiolation pathways is still not applicable. Taking the conversion of methionine into methionol and methanethiol for example, we constructed two suppression subtractive cDNA libraries of Clonostachys rosea by using suppression subtractive hybridization (SSH) technology for screening regulators controlling the conversion. E3 ubiquitin-protein ligase gene HUWE1 screened from forward SSH library was validated to be related with the biosynthesis of end products. Overexpressing HUWE1 in C. rosea and S. cerevisiae significantly increased the biosynthesis of methanethiol and its derivatives in demethiolation pathway, while suppressed the biosynthesis of methional and methionol in ehrlich pathway. These results attained the directional regulation of both pathways by overexpressing HUWE1. Thus, HUWE1 has potential to be a key target for controlling and enhancing alcohols production by metabolic engineering. PMID:26860895

  4. Nutrient depletion as a key factor for manipulating gene expression and product formation in different branches of the flavonoid pathway.

    Science.gov (United States)

    Lillo, Cathrine; Lea, Unni S; Ruoff, Peter

    2008-05-01

    The content of flavonoids increases in response to nitrogen and phosphorus depletion in plants. Manipulation of these macronutrients may therefore be used to control the levels of desirable compounds and improve plant quality. Key enzymes in the shikimate pathway, which feeds precursors into the flavonoid pathway, are regulated post-translationally by feedback from aromatic amino acids, and possibly by redox control through photosynthesis. Use of microarrays for global transcript analysis in Arabidopsis has revealed that transcript levels are less influenced by mineral nutrients in the shikimate pathway compared with the flavonoid pathway. The responses in the shikimate pathway appear complex, whereas in the flavonoid pathway, a single gene often responds similarly to mineral depletion, high light intensity and sucrose. MYB [production of anthocyanin pigment 1 (PAP1)/production of anthocyanin pigment 2 (PAP2)] and bHLH [GLABRA3 (GL3)] transcription factors are important for the nutrient depletion response. PAP1/2 stimulate gross activation of the flavonoid pathway, and different investigations support merging signal transduction chains for various abiotic treatments on PAP1/2. Flavonol synthase is not part of the PAP1/2 regulon, and expression is mainly enhanced by high light intensity and sucrose, not mineral depletion. Nevertheless, both cyanidin and flavonol derivatives increase in response to nitrogen depletion. Kaempferols are the dominating flavonols in Arabidopsis leaves under normal cultivation conditions, but quercetin accumulation can be triggered by nitrogen depletion in combination with other abiotic factors. PMID:18031469

  5. Mesenchymal stromal cell proliferation, gene expression and protein production in human platelet-rich plasma-supplemented media.

    Directory of Open Access Journals (Sweden)

    Paola Romina Amable

    Full Text Available BACKGROUND: Platelet-rich plasma (PRP is increasingly used as a cell culture supplement, in order to reduce the contact of human cells with animal-derived products during in vitro expansion. The effect of supplementation changes on cell growth and protein production is not fully characterized. METHODS: Human mesenchymal stromal cells from bone marrow, adipose tissue and Wharton's Jelly were isolated and cultured in PRP-supplemented media. Proliferation, in vitro differentiation, expression of cell surface markers, mRNA expression of key genes and protein secretion were quantified. RESULTS: 10% PRP sustained five to tenfold increased cell proliferation as compared to 10% fetal bovine serum. Regarding cell differentiation, PRP reduced adipogenic differentiation and increased calcium deposits in bone marrow and adipose tissue-mesenchymal stromal cells. Wharton's Jelly derived mesenchymal stromal cells secreted higher concentrations of chemokines and growth factors than other mesenchymal stromal cells when cultured in PRP-supplemented media. Bone marrow derived mesenchymal stromal cells secreted higher concentrations of pro-inflammatory and pro-angiogenic proteins. Mesenchymal stromal cells isolated from adipose tissue secreted higher amounts of extracellular matrix components. CONCLUSIONS: Mesenchymal stromal cells purified from different tissues have distinct properties regarding differentiation, angiogenic, inflammatory and matrix remodeling potential when cultured in PRP supplemented media. These abilities should be further characterized in order to choose the best protocols for their therapeutic use.

  6. The products of the SUP45 (eRF1) and SUP35 genes interact to mediate translation termination in Saccharomyces cerevisiae.

    OpenAIRE

    Stansfield, I; Jones, K M; Kushnirov, V V; Dagkesamanskaya, A. R.; Poznyakovski, A I; Paushkin, S V; Nierras, C R; Cox, B S; Ter-Avanesyan, M D; Tuite, M F

    1995-01-01

    The product of the yeast SUP45 gene (Sup45p) is highly homologous to the Xenopus eukaryote release factor 1 (eRF1), which has release factor activity in vitro. We show, using the two-hybrid system, that in Saccharomyces cerevisiae Sup45p and the product of the SUP35 gene (Sup35p) interact in vivo. The ability of Sup45p C-terminally tagged with (His)6 to specifically precipitate Sup35p from a cell lysate was used to confirm this interaction in vitro. Although overexpression of either the SUP45...

  7. A selective genotyping approach identifies single nucleotide polymorphisms in porcine chromosome 2 genes associated with production and carcass traits in Italian heavy pigs

    OpenAIRE

    Vincenzo Russo; Luca Buttazzoni; Camilla Speroni; Emilio Scotti; Luca Fontanesi

    2011-01-01

    Several studies have shown that porcine chromosome 2 (SSC2) harbors important quantitative trait loci (QTL) for production traits. In particular, an imprinted QTL for muscle mass production is determined by a mutation in the IGF2 gene (intron3-g.3072G>A). We recently identified and analysed single nucleotide polymorphisms (SNPs) in genes (cathepsin D, CTSD g.70G>A; cathepsin F, CTSF g.22G>C; lactate dehydrogenase A, LDHA g.46G>T) localized on SSC2 (including the IGF2 intron3-g.3072G>A SNP) sh...

  8. Production of reproductively sterile fish by a non-transgenic gene silencing technology.

    Science.gov (United States)

    Wong, Ten-Tsao; Zohar, Yonathan

    2015-01-01

    We developed a novel bath-immersion technology to produce large numbers of infertile fish. As seafood consumption shifts from fishery harvests towards artificially propagated species, optimization of aquaculture practices will be necessary to maximize food production and minimize ecological impact. Farming infertile fish is the most effective genetic-containment strategy to support the development of environmentally-responsible aquaculture. We discovered that a molecular transporter, Vivo, can effectively carry the Morpholino oligomer (MO) across the chorion, enter the embryo and reach target cells. Vivo-conjugated MO against zebrafish deadend (dnd-MO-Vivo) effectively caused primordial germ cell mis-migration and differentiation into somatic cells, which resulted in generation of infertile fish. Optimal conditions were achieved when embryos, immediately after fertilization, were immersed with dnd-MO-Vivo at the initial concentration of either 60 or 40 μM followed by a lower serially diluted concentration. Under these conditions, 100% induced sterility was achieved even when the total immersion time was reduced from 24 to 5 hours. In 8 independent experiments, 736 adults developed from these conditions were all found to be infertile fish that possessed minimally-developed gonads that lacked any gametes. The results demonstrate that dnd-MO-Vivo bath immersion is an effective strategy to produce infertile fish without introducing transgenic modifications. PMID:26510515

  9. IDENTIFICATION OF TECHNOLOGICALLY IMPORTANT GENES AND THEIR PRODUCTS IN THE COLLECTION OF BREAD WHEAT GENOTYPES

    Directory of Open Access Journals (Sweden)

    Milan Chňapek

    2015-02-01

    Full Text Available Wheat is the second most cultivated crop on the world and is very important plant for feed not only mankind but also animals. Because of this is necessary to develop new varieties with better properties. Bread making quality of wheat grain is one of the most important paramaters for quality evaluation. Sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE of wheat storage proteins and allelic specific polymerase chain reaction (AS-PCR are analysis suitable for identification, differentiation and characterization of bread wheat (Triticum aestivum L.. There were analysed 16 genotypes of new varieties of bread wheat in our work by SDS-PAGE and obtained results were verified by AS-PCR. Analysed genotypes of bread wheat genotypes were homogenous and single line with very good bread making quality. Our results confirmed hypothesis, that cultivated bread wheat genotypes are uniformed with high production and quality but there is a risk of sensitivity to environmental conditions. SDS-PAGE analyses of wheat grain proteins are fast and not very expensive technique, which provide us information of bread making quality of grains. However, there is possibility of environmental influence on protein synthesis and because of this is necessary to couple these analysis with analysis of DNA.

  10. A systems biology approach to investigate the effect of pH-induced gene regulation on solvent production by Clostridium acetobutylicum in continuous culture

    Directory of Open Access Journals (Sweden)

    Bahl Hubert

    2011-01-01

    Full Text Available Abstract Background Clostridium acetobutylicum is an anaerobic bacterium which is known for its solvent-producing capabilities, namely regarding the bulk chemicals acetone and butanol, the latter being a highly efficient biofuel. For butanol production by C. acetobutylicum to be optimized and exploited on an industrial scale, the effect of pH-induced gene regulation on solvent production by C. acetobutylicum in continuous culture must be understood as fully as possible. Results We present an ordinary differential equation model combining the metabolic network governing solvent production with regulation at the genetic level of the enzymes required for this process. Parameterizing the model with experimental data from continuous culture, we demonstrate the influence of pH upon fermentation products: at high pH (pH 5.7 acids are the dominant product while at low pH (pH 4.5 this switches to solvents. Through steady-state analyses of the model we focus our investigations on how alteration in gene expression of C. acetobutylicum could be exploited to increase butanol yield in a continuous culture fermentation. Conclusions Incorporating gene regulation into the model of solvent production by C. acetobutylicum enables an accurate representation of the pH-induced switch to solvent production to be obtained and theoretical investigations of possible synthetic-biology approaches to be pursued. Steady-state analyses suggest that, to increase butanol yield, alterations in the expression of single solvent-associated genes are insufficient; a more complex approach targeting two or more genes is required.

  11. Exploring and dissecting genome-wide gene expression responses of Penicillium chrysogenum to phenylacetic acid consumption and penicillinG production

    Directory of Open Access Journals (Sweden)

    Hage Susanne

    2009-02-01

    Full Text Available Abstract Background Since the discovery of the antibacterial activity of penicillin by Fleming 80 years ago, improvements of penicillin titer were essentially achieved by classical strain improvement through mutagenesis and screening. The recent sequencing of Penicillium chrysogenum strain Wisconsin1255-54 and the availability of genomics tools such as DNA-microarray offer new perspective. Results In studies on β-lactam production by P. chrysogenum, addition and omission of a side-chain precursor is commonly used to generate producing and non-producing scenarios. To dissect effects of penicillinG production and of its side-chain precursor phenylacetic acid (PAA, a derivative of a penicillinG high-producing strain without a functional penicillin-biosynthesis gene cluster was constructed. In glucose-limited chemostat cultures of the high-producing and cluster-free strains, PAA addition caused a small reduction of the biomass yield, consistent with PAA acting as a weak-organic-acid uncoupler. Microarray-based analysis on chemostat cultures of the high-producing and cluster-free strains, grown in the presence and absence of PAA, showed that: (i Absence of a penicillin gene cluster resulted in transcriptional upregulation of a gene cluster putatively involved in production of the secondary metabolite aristolochene and its derivatives, (ii The homogentisate pathway for PAA catabolism is strongly transcriptionally upregulated in PAA-supplemented cultures (iii Several genes involved in nitrogen and sulfur metabolism were transcriptionally upregulated under penicillinG producing conditions only, suggesting a drain of amino-acid precursor pools. Furthermore, the number of candidate genes for penicillin transporters was strongly reduced, thus enabling a focusing of functional analysis studies. Conclusion This study demonstrates the usefulness of combinatorial transcriptome analysis in chemostat cultures to dissect effects of biological and process

  12. Structural and functional characterization of the exonuclease I (sbcB) gene and gene product from Escherichia coli and a Markov chain analysis of DNA sequences

    International Nuclear Information System (INIS)

    The nucleotide sequence for the structural gene for exonuclease I (sbcB) from Escherichia coli was determined. Two putative promotes for this gene were identified and were predicted to have weak transcription initiation activity. In addition, the sbcB coding region contains many non-optimal codons. These observations are consistent with the suggestions that sbcB is a poorly expressed gene. Several mutant exonuclease I genes were cloned onto pBR322 plasmids. These genes represented both sbcB and xonA mutation. One of the xonA mutation (xonA6) was associated with a 1.2-kb insertion of an IS-30 related mobile genetic element in the 3'-region of the gene. Two of the mutations (xonA2 and xonA6) encode unstable polypeptides. Determination of exonucleolytic activity on single-stranded DNA from cell extracts containing each of the cloned mutant genes revealed no correlation between residual exonucleolytic activity and the pheno-types of sbcB and xonA mutants. A proposal that the exonuclease I protein contains an additional activity besides its ability to degrade single-stranded DNA is presented. Characterization of E. coli strains which overproduce exonuclease I showed increased sensitivity to UV irradiation

  13. The Haemophilus influenzae dprABC genes constitute a competence-inducible operon that requires the product of the tfoX (sxy) gene for transcriptional activation.

    OpenAIRE

    Karudapuram, S; Barcak, G J

    1997-01-01

    We previously showed that dprA is required for efficient processing of linear DNA during cellular transformation in Haemophilus influenzae. In this study the transcriptional regulation of dprA and two downstream genes, dprB and dprC, is examined. We demonstrate by Northern blot analysis that the dprABC genes are transcriptionally coregulated and competence inducible. We used primer extension analysis to map the transcriptional start site of dprA and of rec-2, another transformation gene invol...

  14. The Cyclic Di-GMP Phosphodiesterase Gene Rv1357c/BCG1419c Affects BCG Pellicle Production and In Vivo Maintenance.

    Science.gov (United States)

    Flores-Valdez, Mario Alberto; Aceves-Sánchez, Michel de Jesús; Pedroza-Roldán, César; Vega-Domínguez, Perla Jazmín; Prado-Montes de Oca, Ernesto; Bravo-Madrigal, Jorge; Laval, Françoise; Daffé, Mamadou; Koestler, Ben; Waters, Christopher M

    2015-02-01

    Bacteria living in a surface-attached community that contains a heterogeneous population, coated with an extracellular matrix, and showing drug tolerance (biofilms) are often linked to chronic infections. In mycobacteria, the pellicle mode of growth has been equated to an in vitro biofilm and meets several of the criteria mentioned above, while tuberculosis infection presents a chronic (latent) phase of infection. As mycobacteria lack most genes required to control biofilm production by other microorganisms, we deleted or expressed from the hsp60 strong promoter the only known c-di-GMP phosphodiesterase (PDE) gene in Mycobacterium bovis BCG. We found changes in pellicle production, cellular protein profiles, lipid production, resistance to nitrosative stress and maintenance in lungs and spleens of immunocompetent BALB/mice. Our results show that pellicle production and capacity to remain within the host are linked in BCG. PMID:25865678

  15. Rv2131c gene product: An unconventional enzyme that is both inositol monophosphatase and fructose-1,6-bisphosphatase

    International Nuclear Information System (INIS)

    Inositol monophosphatase is an enzyme in the biosynthesis of myo-inostiol, a crucial substrate for the synthesis of phosphatidylinositol, which has been demonstrated to be an essential component of mycobacteria. In this study, the Rv2131c gene from Mycobacterium tuberculosis H37Rv was cloned into the pET28a vector and the recombinant plasmid was transformed into Escherichia coli BL21 (DE3) strain, allowing the expression of the enzyme in fusion with a histidine-rich peptide on the N-terminal. The fusion protein was purified from the soluble fraction of the lysed cells under native conditions by immobilized metal affinity chromatography (IMAC). The purified Rv2131c gene product showed inositol monophosphatase activity but with substrate specificity that was broader than those of several bacterial and eukaryotic inositol monophosphatases, and it also acted as fructose-1,6-bisphosphatase. The dimeric enzyme exhibited dual activities of IMPase and FBPase, with K m of 0.22 ± 0.03 mM for inositol-1-phosphate and K m of 0.45 ± 0.05 mM for fructose-1,6-bisphosphatase. To better understand the relationship between the function and structure of the Rv2131c enzyme, we constructed D40N, L71A, and D94N mutants and purified these corresponding proteins. Mutations of D40N and D94N caused the proteins to almost completely lose both the inositol monophosphatase and fructose-1,6-bisphosphatase activities. However, L71A mutant did not cause loss either of the activities, but the activity toward the inositol was 12-fold more resistant to inhibition by lithium (IC5 ∼ 60 mM). Based on the substrate specificity and presence of conserved sequence motifs of the M. tuberculosis Rv2131c, we proposed that the enzyme belonged to class IV fructose-1,6-bisphosphatase (FBPase IV)

  16. Three genes expressing Kunitz domains in the epididymis are related to genes of WFDC-type protease inhibitors and semen coagulum proteins in spite of lacking similarity between their protein products

    Directory of Open Access Journals (Sweden)

    Lilja Hans

    2011-10-01

    Full Text Available Abstract Background We have previously identified a locus on human chromosome 20q13.1, encompassing related genes of postulated WFDC-type protease inhibitors and semen coagulum proteins. Three of the genes with WFDC motif also coded for the Kunitz-type protease inhibitor motif. In this report, we have reinvestigated the locus for homologous genes encoding Kunitz motif only. The identified genes have been analyzed with respect to structure, expression and function. Results We identified three novel genes; SPINT3, SPINT4 and SPINT5, and the structure of their transcripts were determined by sequencing of DNA generated by rapid amplification of cDNA ends. Each gene encodes a Kunitz domain preceded by a typical signal peptide sequence, which indicates that the proteins of 7.6, 8.7, and 9.7 kDa are secreted. Analysis of transcripts in 26 tissues showed that the genes predominantly are expressed in the epididymis. The recombinantly produced proteins could not inhibit the amidolytic activity of trypsin, chymotrypsin, plasmin, thrombin, coagulation factor Xa, elastase, urokinase and prostate specific antigen, whereas similarly made bovine pancreatic trypsin inhibitor (BPTI had the same bioactivity as the protein isolated from bovine pancreas. Conclusions The similar organization, chromosomal location and site of expression, suggests that the novel genes are homologous with the genes of WFDC-type protease inhibitors and semen coagulum proteins, despite the lack of similarity in primary structure of their protein products. Their restricted expression to the epididymis suggests that they could be important for male reproduction. The recombinantly produced proteins are presumably bioactive, as demonstrated with similarly made BPTI, but may have a narrower spectrum of inhibition, as indicated by the lacking activity against eight proteases with differing specificity. Another possibility is that they have lost the protease inhibiting properties, which is

  17. Production of β-ionone by combined expression of carotenogenic and plant CCD1 genes in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Lopez, Javiera; Essus, Karen; Kim, Il-Kwon;

    2015-01-01

    number episomal vectors, in an engineered strain that accumulates FPP. Results: Integration of an extra copy of the geranylgeranyl diphosphate synthase gene (BTS1), together with the carotenogenic genes crtYB and crtI from the ascomycete Xanthophyllomyces dendrorhous, resulted in carotenoid producing...... cells. The additional integration of the carotenoid cleavage dioxygenase gene from the plant Petunia hybrida (PhCCD1) let to the production of low amounts of beta-ionone (0.073 ± 0.01 mg/g DCW) and changed the color of the strain from orange to yellow. The expression of the crtYB gene from a high copy......, the carotenogenic crtYB, crtI genes and the plant PhCCD1 gene-the highest β-ionone concentration reported to date by a cell factory was achieved. This microbial cell factory represents a starting point for flavor production by a sustainable and efficient process that could replace current methods....

  18. Multiplex PCR for the Rapid Simultaneous Speciation and Detection of Methicillin-Resistance and Genes Encoding Toxin Production in Staphylococcus aureus.

    Science.gov (United States)

    Jones, M E; Köhrer, K; Schmitz, F J

    2001-01-01

    The use of polymerase chain reaction (PCR) to rapidly amplify target DNA molecules has evolved a place within diagnostic microbiology allowing the sensitive and specific identification of microorganisms concurrent with the detection of specific genes involved in resistance or virulence. This is particularly helpful when dealing with problem pathogens such as Staphylococcus aureus, where the rapid diagnosis and detection of methicillin-resistance can assist in the fast implementation of appropriate treatment and infection control measures (1-4). In addition, the rapid assessment of toxin production can ascertain whether toxin-related symptoms need to be considered (5). The protocol described here enables the simultaneous differentiation between S. aureus (and coagulase negative staphylococci) from other eubacterial organisms. Concomitant with species identification this protocol allows for the detection of specific staphylococcal resistance genes, such as mecA, encoding methicillin resistance, or staphylococcal virulence genes, such as seb, sec1 and tst, encoding enterotoxin B, enterotoxin C, and toxic shock syndrome toxin-1, respectively. In S. aureus the detection of methicillin-resistance using agar diffusion or broth micro-dilution techniques, or toxin production using immunodiffusion, agglutination, or ELISA is often difficult. This is because the mecA gene and the genes involved in toxin production may be poorly expressed and influenced significantly by culture conditions (5-10). Other methods, in particular various hybridization techniques have been used as diagnostic tools. However. PMID:21374410

  19. Study on isolation, molecular detection of virulence gene and antibiotic sensitivity pattern of Escherichia coli isolated from milk and milk products

    OpenAIRE

    M. N. Brahmbhatt; H. C. Thaker; J. B. Nayak; P. K. Virpari

    2013-01-01

    Aim: The study was undertaken to isolate pathogenic E. coli from milk and various milk products, detection of virulence gene using Polymerase chain reaction (PCR) and investigate their antibiotic sensitivity pattern. Materials and Methods: Altogether 250 milk and various milk products samples consisting of raw milk (50), cheese (50), ice-cream (50), mawa (50) and dahi (50) were collected from milk vendors, retail shops located in Anand city, under aseptic precautions. For the enrichment of th...

  20.  Mutations of noncollagen genes in osteogenesis imperfecta – implications of the gene products in collagen biosynthesis and pathogenesis of disease

    Directory of Open Access Journals (Sweden)

    Anna Galicka

    2012-06-01

    Full Text Available  Recent investigations revealed that the “brittle bone” phenotype in osteogenesis imperfecta (OI is caused not only by dominant mutations in collagen type I genes, but also by recessively inherited mutations in genes responsible for the post-translational processing of type I procollagen as well as for bone formation. The phenotype of patients with mutations in noncollagen genes overlaps with very severe type III and lethal type II OI caused by mutations in collagen genes. Mutations in genes that encode proteins involved in collagen prolyl 3-hydroxylation (P3H1/CRTAP/CyPB eliminated Pro986 hydroxylation and caused an increase in modification of collagen helix by prolyl 4-hydroxylase and lysyl hydroxylase. However, the importance of these disturbances in the disease pathomechanism is not known. Loss of complex proteins’ function as collagen chaperones may dominate the disease mechanism. The latest findings added to the spectrum of OI-causing and collagen-influencing factors other chaperones (HSP47 and FKBP65 and protein BMP-1, which emphasizes the complexity of collagen folding and secretion as well as their importance in bone formation. Furthermore, mutations in genes encoding transcription factor SP7/Osterix and pigment epithelium-derived factor (PEDF constitute a novel mechanism for OI, which is independent of changes in biosynthesis and processing of collagen.

  1. Application of gene-based technologies directed at commensal gut bacteria to solve animal productivity constraints in developing countries

    International Nuclear Information System (INIS)

    problems faced by microbial ecologists studying the gut ecosystem are the inevitable bias introduced by culture-based enumeration and characterization techniques, and the lack of a phylogenetically based classification scheme. These limitations can be overcome by the application of modern molecular techniques based on sequence comparisons of nucleic acids and used to provide genotypic characterization while at the same time providing a classification scheme which predicts natural evolutionary relationships. Importantly this molecular approach does not rely on cultivation but rather the analysis of community DNA, representing all resident microbes, extracted from intestinal samples. The powerful combination of molecular biology and Woese's new phylogeny has created the now recognized field of molecular microbial ecology. This is defined as the application of molecular technology, usually based on comparative nucleic acid sequence information, to identify specific microorganisms in the gut environment, to assign functional roles to these specific microorganisms, and to assess their significance or contribution to specific metabolic and physiological processes in the gastrointestinal tract. The advantages and limitations of various techniques employed for molecular microbial ecology studies will be reviewed in an effort to identify which gene-based technologies directed at commensal gut bacteria are most relevant and applicable to solving animal productivity constraints in developing countries. The use of these techniques has lead to major advances in our knowledge and will provide the first complete description of the gastrointestinal ecosystem. The latest and most powerful technologies revolutionizing microbiology are based on genomics - the mapping and sequencing of genomes and analysis of gene and genome function. Genomics refers to a suite of functional and comparative methods that capitalize on the availability of entire or high coverage draft sequence. More than 100

  2. Pseudomonas aeruginosa biofilms exposed to imipenem exhibit changes in global gene expression and beta-lactamase and alginate production

    DEFF Research Database (Denmark)

    Bagge, Niels; Schuster, Martin; Hentzer, Morten;

    2004-01-01

    , on gene expression in biofilm populations. Many genes showed small but statistically significant differential expression in response to imipenem. We identified 34 genes that were induced or repressed in biofilms exposed to imipenem more than fivefold compared to the levels of induction or repression...

  3. Tumor promoter and epidermal growth factor stimulate phosphorylation of the c-erbB-2 gene product in MKN-7 human adenocarcinoma cells

    Energy Technology Data Exchange (ETDEWEB)

    Akiyama, T.; Saito, T.; Ogawara, H.; Toyoshima, K.; Yamamoto, T.

    1988-03-01

    Treatment of human adenocarcinoma MKN-7 cells with epidermal growth factor (EGF) or phorbol tetradecanoate acetate (TPA) stimulated phosphorylation of the c-erbB-2 gene product. EGF induced a rapid increase in phosphotyrosine followed by relatively gradual increases in phosphoserine and phosphothreonine. On the other hand, the TPA-induced increase in phosphorylations occurred exclusively on serine and threonine residues. Tryptic phosphopeptide mapping analysis suggested that treatments with EGF and TPA induced phosphorylation of many common sites in the c-erbB-2 gene product. However, in contrast to TPA, EGF increased the phosphorylation of the c-erbB-2 protein in cells whose protein kinase C had been down-regulated by long-term pretreatment with TPA, suggesting that EGF and TPA induce phosphorylation by different mechanisms. Since the c-erbB-2 gene product did not show detectable EGF-binding activity, phosphorylation of tyrosine of the c-erbB-2 gene product might be catalyzed directly by the EGF receptor kinase that was activated by EGF.

  4. Association of single nucleotide polymorphic sites in candidate genes with aggressiveness and deoxynivalenol production in Fusarium graminearum causing wheat head blight

    Directory of Open Access Journals (Sweden)

    Talas Firas

    2012-03-01

    Full Text Available Abstract Background Fusarium graminearum sensu stricto (s.s. is an ubiquitous pathogen of cereals. The economic impact of Fusarium head blight (FHB is characterized by crop losses and mycotoxin contamination. Our objective was to associate SNP diversity within candidate genes with phenotypic traits. A total of 77 F. graminearum s.s. isolates was tested for severity of fungal infection (= aggressiveness and deoxynivalenol (DON production in an inoculated field experiment at two locations in each of two years. For seven genes known to control fungal growth (MetAP1, Erf2 or DON production (TRI1, TRI5, TRI6 TRI10 and TRI14 single nucleotides polymorphic sites (SNPs were determined and evaluated for the extent of linkage disequilibrium (LD. Associations of SNPs with both phenotypic traits were tested using linear mixed models. Results Decay of LD was in most instances fast. Two neighboring SNPs in MetAP1 and one SNP in Erf2 were significantly (P pG of 25.6%, 0.5%, and 13.1%, respectively. One SNP in TRI1 was significantly associated with DON production (pG = 4.4. Conclusions We argue that using the published sequence information of Fusarium graminearum as a template to amplify comparative sequence parts of candidate genes is an effective method to detect quantitative trait loci. Our findings underline the potential of candidate gene association mapping approaches to identify functional SNPs underlying aggressiveness and DON production for F. graminearum s.s populations.

  5. Enhancement of malate-production and increase in sensitivity to dimethyl succinate by mutation of the VID24 gene in Saccharomyces cerevisiae.

    Science.gov (United States)

    Negoro, Hiroaki; Kotaka, Atsushi; Matsumura, Kengo; Tsutsumi, Hiroko; Hata, Yoji

    2016-06-01

    Malate in sake (a Japanese alcoholic beverage) is an important component for taste that is produced by yeasts during alcoholic fermentation. To date, many researchers have developed methods for breeding high-malate-producing yeasts; however, genes responsible for the high-acidity phenotype are not known. We determined the mutated gene involved in high malate production in yeast, isolated as a sensitive mutant to dimethyl succinate. In the comparative whole genome analysis between high-malate-producing strain and its parent strain, one of the non-synonymous substitutions was identified in the VID24 gene. The mutation of VID24 resulted in enhancement of malate-productivity and sensitivity to dimethyl succinate. The mutation appeared to lead to a deficiency in Vid24p function. Furthermore, disruption of cytoplasmic malate dehydrogenase (Mdh2p) gene in the VID24 mutant inhibited the high-malate-producing phenotype. Vid24p is known as a component of the multisubunit ubiquitin ligase and participates in the degradation of gluconeogenic enzymes such as Mdh2p. We suggest that the enhancement of malate-productivity results from an accumulation of Mdh2p due to the loss of Vid24p function. These findings propose a novel mechanism for the regulation of organic acid production in yeast cells by the component of ubiquitin ligase, Vid24p. PMID:26983942

  6. Id-1 and Id-2 genes and products as therapeutic targets for treatment of breast cancer and other types of carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Desprez, Pierre-Yves; Campisi, Judith

    2014-09-30

    A method for treatment and amelioration of breast, cervical, ovarian, endometrial, squamous cells, prostate cancer and melanoma in a patient comprising targeting Id-1 or Id-2 gene expression with a delivery vehicle comprising a product which modulates Id-1 or Id-2 expression.

  7. MVE1 Encoding the velvet gene product homolog in Mycosphaerella graminicola is associated with aerial mycelium formation, melanin biosynthesis, hyphal swelling, and light signaling

    Science.gov (United States)

    The ascomycete fungus Mycosphaerella graminicola is an important pathogen of wheat that causes the disease septoria tritici blotch. Despite the serious impact of M. graminicola on wheat production worldwide, knowledge about its molecular biology is limited. The velvet gene, veA, is one of the key re...

  8. FAO/IAEA international symposium on applications of gene-based technologies for improving animal production and health in developing countries. Book of extended synopses

    International Nuclear Information System (INIS)

    Genetic engineering is at the forefront of much biological research - basic, adaptive and applied or near market. Manipulation of genes to bring about the expression of a specific product, or to produce a characteristic or trait, offers exciting possibilities within both the plant and the animal kingdom. The opportunities, in terms of improving livestock productivity or reducing losses from disease, lie in a number of areas. In almost all areas of this research, isotopic markers are extensively used and are in most cases essential for achieving the levels of sensitivity required for genetic characterization and manipulation. Genetic engineering has the potential to solve many problems relating to animal productivity and health. At present the focus is on the problems that face livestock producers in the developed world. If the full benefit of this technology is to be realized globally, the problems confronting livestock farmers in developing countries will have to be considered. The characterization and application of methods in these regions has to be managed and exploited. It is hoped that this Symposium will stimulate the international exchange of information and ideas that contribute to greater accessibility and enhanced use of gene based technologies in animal agriculture in developing countries. OBJECTIVES: To create an interactive environment to discuss the role and future potential of gene based technologies for improving animal production and health; To identify constraints in the use of gene based technologies in developing countries and to determine how to use these technologies in a simple, practical way; To identify and prioritize specific research needs; To explore the possibility of international co-ordination in the area of gene based technologies in animal agriculture; To examine ethical, technological, policy and environmental issues and the role of nuclear techniques in the further development and application of gene based technologies with

  9. Cloning and Characterization of a Pyruvate Carboxylase Gene from Penicillium rubens and Overexpression of the Genein the Yeast Yarrowia lipolytica for Enhanced Citric Acid Production.

    Science.gov (United States)

    Fu, Ge-Yi; Lu, Yi; Chi, Zhe; Liu, Guang-Lei; Zhao, Shou-Feng; Jiang, Hong; Chi, Zhen-Ming

    2016-02-01

    In this study, a pyruvate carboxylase gene (PYC1) from a marine fungus Penicillium rubens I607 was cloned and characterized. ORF of the gene (accession number: KM397349.1) had 3534 bp encoding 1177 amino acids with a molecular weight of 127.531 kDa and a PI of 6.20. The promoter of the gene was located at -1200 bp and contained a TATAA box, several CAAT boxes and a sequence 5'-SYGGRG-3'. The PYC1 deduced from the gene had no signal peptide, was a homotetramer (α4), and had the four functional domains. After expression of the PYC1 gene from the marine fungus in the marine-derived yeast Yarrowia lipolytica SWJ-1b, the transformant PR32 obtained had much higher specific pyruvate carboxylase activity (0.53 U/mg) than Y. lipolytica SWJ-1b (0.07 U/mg), and the PYC1 gene expression (133.8%) and citric acid production (70.2 g/l) by the transformant PR32 were also greatly enhanced compared to those (100 % and 27.3 g/l) by Y. lipolytica SWJ-1b. When glucose concentration in the medium was 60.0 g/l, citric acid (CA) concentration formed by the transformant PR32 was 36.1 g/l, leading to conversion of 62.1% of glucose into CA. During a 10-l fed-batch fermentation, the final concentration of CA was 111.1 ± 1.3 g/l, the yield was 0.93 g/g, the productivity was 0.46 g/l/h, and only 1.72 g/l reducing sugar was left in the fermented medium within 240 h. HPLC analysis showed that most of the fermentation products were CA. However, minor malic acid and other unknown products also existed in the culture. PMID:26470708

  10. Bovine Host Genetic Variation Influences Rumen Microbial Methane Production with Best Selection Criterion for Low Methane Emitting and Efficiently Feed Converting Hosts Based on Metagenomic Gene Abundance.

    Directory of Open Access Journals (Sweden)

    Rainer Roehe

    2016-02-01

    Full Text Available Methane produced by methanogenic archaea in ruminants contributes significantly to anthropogenic greenhouse gas emissions. The host genetic link controlling microbial methane production is unknown and appropriate genetic selection strategies are not developed. We used sire progeny group differences to estimate the host genetic influence on rumen microbial methane production in a factorial experiment consisting of crossbred breed types and diets. Rumen metagenomic profiling was undertaken to investigate links between microbial genes and methane emissions or feed conversion efficiency. Sire progeny groups differed significantly in their methane emissions measured in respiration chambers. Ranking of the sire progeny groups based on methane emissions or relative archaeal abundance was consistent overall and within diet, suggesting that archaeal abundance in ruminal digesta is under host genetic control and can be used to genetically select animals without measuring methane directly. In the metagenomic analysis of rumen contents, we identified 3970 microbial genes of which 20 and 49 genes were significantly associated with methane emissions and feed conversion efficiency respectively. These explained 81% and 86% of the respective variation and were clustered in distinct functional gene networks. Methanogenesis genes (e.g. mcrA and fmdB were associated with methane emissions, whilst host-microbiome cross talk genes (e.g. TSTA3 and FucI were associated with feed conversion efficiency. These results strengthen the idea that the host animal controls its own microbiota to a significant extent and open up the implementation of effective breeding strategies using rumen microbial gene abundance as a predictor for difficult-to-measure traits on a large number of hosts. Generally, the results provide a proof of principle to use the relative abundance of microbial genes in the gastrointestinal tract of different species to predict their influence on traits e

  11. Bovine Host Genetic Variation Influences Rumen Microbial Methane Production with Best Selection Criterion for Low Methane Emitting and Efficiently Feed Converting Hosts Based on Metagenomic Gene Abundance.

    Science.gov (United States)

    Roehe, Rainer; Dewhurst, Richard J; Duthie, Carol-Anne; Rooke, John A; McKain, Nest; Ross, Dave W; Hyslop, Jimmy J; Waterhouse, Anthony; Freeman, Tom C; Watson, Mick; Wallace, R John

    2016-02-01

    Methane produced by methanogenic archaea in ruminants contributes significantly to anthropogenic greenhouse gas emissions. The host genetic link controlling microbial methane production is unknown and appropriate genetic selection strategies are not developed. We used sire progeny group differences to estimate the host genetic influence on rumen microbial methane production in a factorial experiment consisting of crossbred breed types and diets. Rumen metagenomic profiling was undertaken to investigate links between microbial genes and methane emissions or feed conversion efficiency. Sire progeny groups differed significantly in their methane emissions measured in respiration chambers. Ranking of the sire progeny groups based on methane emissions or relative archaeal abundance was consistent overall and within diet, suggesting that archaeal abundance in ruminal digesta is under host genetic control and can be used to genetically select animals without measuring methane directly. In the metagenomic analysis of rumen contents, we identified 3970 microbial genes of which 20 and 49 genes were significantly associated with methane emissions and feed conversion efficiency respectively. These explained 81% and 86% of the respective variation and were clustered in distinct functional gene networks. Methanogenesis genes (e.g. mcrA and fmdB) were associated with methane emissions, whilst host-microbiome cross talk genes (e.g. TSTA3 and FucI) were associated with feed conversion efficiency. These results strengthen the idea that the host animal controls its own microbiota to a significant extent and open up the implementation of effective breeding strategies using rumen microbial gene abundance as a predictor for difficult-to-measure traits on a large number of hosts. Generally, the results provide a proof of principle to use the relative abundance of microbial genes in the gastrointestinal tract of different species to predict their influence on traits e.g. human metabolism

  12. High-level expression of human butyrylcholinesterase gene in Bombyx mori and biochemical-pharmacological characteristic study of its product.

    Science.gov (United States)

    Wei, W L; Qin, J C; Sun, M J

    2000-07-01

    The human butyrylcholinesterase (BChE, EC 3.1.1.8) gene was highly expressed in Bombyx mori using baculovirus vector, and the biochemical-pharmacological properties of its product were studied. BChE cDNA was cloned into transfer vector pBn96 and co-transfected with wild-type Bombyx mori nucleopolyhedrovirus (BmNPV) DNA into BmN cells. The recombinant virus with the highest enzyme activity was sorted out and purified. Once the BmN cells or silkworm larvae had been infected with the recombinant virus, recombinant human BChE (rhBChE) could be secreted into the culture medium or the hemolymph of the larvae at levels of 1.5 mg x L(-1) and 35 mg x L(-1), respectively. Western blot and enzymatic staining of the electrophoresis gel of non-denatured protein showed that rhBChE manifested similar antigenicity and enzyme activity to native human BChE (nhBChE). The production of rhBChE in the hemolymph was 23-fold higher than that in BmN cells and about 280-fold that in Chinese hamster overy cells (125 microg x L(-1)). This is the first report of human BChE expression in silkworm with the highest level of yield so far. rhBChE was highly similar to nhBChE in respect to substrate affinity, inhibitor sensitivity, and reactivity of the inhibited enzyme. It is suggested that rhBChE functions as well as nhBChE and has potential practical value. PMID:10807953

  13. A simple, economical method of converting gene expression products of insulin into recombinant insulin and its application

    Institute of Scientific and Technical Information of China (English)

    ZHANG Zhou; CHEN Hui; TANG Yuehua; FENG Youmin

    2003-01-01

    A method, by which the gene expression product of recombinant single chain insulin can be converted into insulin by directly digesting with trypsin, has been established. This method has been used in process of porcine insulin precursor (PIP), [B16Ala]PIP and [B26Ala]PIP into (desB30)insulin, (desB30)[B16Ala]insulin and (desB30)[B26Ala]insulin, respectively, and all of them retain full biological activity of that of their corresponding parent, recombinant human insulin, [B16Ala]insulin and [B26Ala]insulin. The results further demonstrate that the C-terminal residue of B chain is not necessary for insulin's biological activity. Compared with the method of transpeptidation, this method is simple, with a high yield, and avoids the use of organic reagents, and in comparison with the trypsin/carboxypeptidase method, it omits the use of carboxylpeptidase. Besides, (desB30)[B16Ala]insulin and (desB30)[B26Ala]insulin still remained without self-association property as that of their parents, which demonstrate that they are monomeric insulin. So they can be used for substituting for monomeric insulin, [B16Ala]insulin and [B26Ala]insulin, in clinical applications.

  14. The Neurofibromatosis 2 Tumor Suppressor Gene Product, Merlin, Regulates Human Meningioma Cell Growth by Signaling through YAP

    Directory of Open Access Journals (Sweden)

    Katherine Striedinger

    2008-11-01

    Full Text Available Neurofibromatosis type 2 (NF2 is an autosomal dominant disorder characterized by the occurrence of schwannomas and meningiomas. Several studies have examined the ability of the NF2 gene product, merlin, to function as a tumor suppressor in diverse cell types; however, little is known about merlin growth regulation in meningiomas. In Drosophila, merlin controls cell proliferation and apoptosis by signaling through the Hippo pathway to inhibit the function of the transcriptional coactivator Yorkie. The Hippo pathway is conserved in mammals. On the basis of these observations, we developed human meningioma cell lines matched for merlin expression to evaluate merlin growth regulation and investigate the relationship between NF2 status and Yes-associated protein (YAP, the mammalian homolog of Yorkie. NF2 loss in meningioma cells was associated with loss of contact-dependent growth inhibition, enhanced anchorage-independent growth and increased cell proliferation due to increased S-phase entry. In addition, merlin loss in both meningioma cell lines and primary tumors resulted in increased YAP expression and nuclear localization. Finally, siRNA-mediated reduction of YAP in NF2-deficient meningioma cells rescued the effects of merlin loss on cell proliferation and S-phase entry. Collectively, these results represent the first demonstration that merlin regulates cell growth in human cancer cells by suppressing YAP.

  15. Metabolic design based on a coupled gene expression-metabolic network model of tryptophan production in Escherichia coli.

    Science.gov (United States)

    Schmid, Joachim W; Mauch, Klaus; Reuss, Matthias; Gilles, Ernst D; Kremling, Andreas

    2004-10-01

    The presumably high potential of a holistic design approach for complex biochemical reaction networks is exemplified here for the network of tryptophan biosynthesis from glucose, a system whose components have been investigated thoroughly before. A dynamic model that combines the behavior of the trp operon gene expression with the metabolic network of central carbon metabolism and tryptophan biosynthesis is investigated. This model is analyzed in terms of metabolic fluxes, metabolic control, and nonlinear optimization. We compare two models for a wild-type strain and another model for a tryptophan producer. An integrated optimization of the whole network leads to a significant increase in tryptophan production rate for all systems under study. This enhancement is well above the increase that can be achieved by an optimization of subsystems. A constant ratio of control coefficients on tryptophan synthesis rate has been identified for the models regarding or disregarding trp operon expression. Although we found some examples where flux control coefficients even contradict the trends of enzyme activity changes in an optimized profile, flux control can be used as an indication for enzymes that have to be taken into account in optimization. PMID:15491865

  16. PhAP protease from Pseudoalteromonas haloplanktis TAC125: Gene cloning, recombinant production in E. coli and enzyme characterization

    Science.gov (United States)

    de Pascale, D.; Giuliani, M.; De Santi, C.; Bergamasco, N.; Amoresano, A.; Carpentieri, A.; Parrilli, E.; Tutino, M. L.

    2010-08-01

    Cold-adapted proteases have been found to be the dominant activity throughout the cold marine environment, indicating their importance in bacterial acquisition of nitrogen-rich complex organic compounds. However, few extracellular proteases from marine organisms have been characterized so far, and the mechanisms that enable their activity in situ are still largely unknown. Aside from their ecological importance and use as model enzyme for structure/function investigations, cold-active proteolytic enzymes offer great potential for biotechnological applications. Our studies on cold adapted proteases were performed on exo-enzyme produced by the Antarctic marine bacterium Pseudoalteromonas haloplanktis TAC125. By applying a proteomic approach, we identified several proteolytic activities from its culture supernatant. PhAP protease was selected for further investigations. The encoding gene was cloned and the protein was recombinantly produced in E. coli cells. The homogeneous product was biochemically characterised and it turned out that the enzyme is a Zn-dependent aminopeptidase, with an activity dependence from assay temperature typical of psychrophilic enzymes.

  17. Disruption of cagA, the apoprotein gene of chromoprotein antibiotic C-1027, eliminates holo-antibiotic production, but not the cytotoxic chromophore.

    Science.gov (United States)

    Cui, Zhihui; Wang, Lifei; Wang, Songmei; Li, Guangwei; Hong, Bin

    2009-11-01

    C-1027 is a chromoprotein of the nine-membered enediyne antitumour antibiotic family, comprising apoprotein to stabilize and transport the enediyne chromophore. The disruption of apoprotein gene cagA within the C-1027 biosynthetic gene cluster abolished C-1027 holo-antibiotic production detected by an antibacterial assay, as well as the expression of the apoprotein and C-1027 chromophore extracted following protein precipitation of the culture supernatant. Complementation of the cagA-disrupted mutant AKO with the intact cagA gene restored C-1027 production, suggesting that cagA is indispensable for holo-antibiotic production. Overexpression of cagA in the wild-type strain resulted in a significant increase in C-1027 production as expected. Surprisingly, electrospray ionization (ESI)-MS and ESI-MS/MS analyses suggested that the AKO mutant still produced the C-1027 enediyne chromophore [m/z=844 (M+H)(+)] and its aromatized product [m/z=846 (M+H)(+)]. Consistent with this, the results from gene expression analysis using real-time reverse transcriptase-PCR showed that transcripts of the positive regulator sgcR3 and the structural genes sgcA1, sgcC4, sgcD6 and sgcE were readily detected in the AKO mutant as well as in the wild-type and the complementation strain. These results provided, for the first time, evidence suggesting that the apoprotein of C-1027 is not essential in the self-resistance mechanism for the enediyne chromophore. PMID:19845765

  18. Estrogenic activity of bio-degradation products of C-heavy oil revealed by gene-expression profiling using an oligo-DNA microarray system

    International Nuclear Information System (INIS)

    Degradation of heavy oil by bacteria to decompose organic compounds such as aliphatic and aromatic hydrocarbons has been used in bioremediation. However, the biological and environmental effects of the degradation products including intermediates are still not clear. Here, we monitored the degradation of C-heavy oil by analyzing the products formed in cultures with oil-degrading bacteria (complex microbes or a single bacterial strain). Furthermore, proliferation assays using breast cancer MCF-7 cells and gene-expression profiling of MCF-7 cells using oligonucleotide-DNA microarrays were performed to evaluate the estrogenic activity of the degradation products. While the products did not show any significant cell-proliferative activity, the oil samples cultured for longer periods (2–3 months), whether cultured with mixed microbes or a single bacterial strain, showed gene-expression profiles similar to that of 17β-estradiol (E2). These results suggest that oil-degradation products have estrogenic activity, and estrogen-like components could possibly be produced during the degradation process. - Highlights: ► Oligonucleotide-DNA microarrays were used to monitor bio-degradation of C-heavy oil. ► The oil samples showed gene-expression profiles similar to that of 17β-estradiol. ► Estrogen-like components were produced during the degradation process. ► The effect of bio-degradation products on ecosystems needs more attention. ► DNA microarray assays may be useful for monitoring such products. - We found that the degradation products of C-heavy oil contained estrogen-like components, suggesting the effect of bio-degradation products on ecosystems.

  19. L-asparaginase genes in Escherichia coli: isolation of mutants and characterization of the ansA gene and its protein product.

    Science.gov (United States)

    Spring, K J; Jerlström, P G; Burns, D M; Beacham, I R

    1986-04-01

    Mutants of Escherichia coli have been isolated which are resistant to beta-aspartyl hydroxamate, a lethal substrate of asparaginase II in fungi and a substrate for asparaginase II in E. coli. Among the many phenotypic classes observed, a single mutant (designated GU16) was found with multiple defects affecting asparaginases I and II and aspartase. Other asparaginase II-deficient mutants have also been derived from an asparaginase I-deficient mutant. The mutant strain, GU16, was unable to utilize asparagine and grew poorly on aspartate as the sole source of carbon; transformation of this strain with an E. coli recombinant plasmid library resulted in a large recombinant plasmid which complemented both these defects. Two subclones were isolated, designated pDK1 and pDK2; the former complemented the partial defect in the utilization of aspartate, although its exact function was not established. pDK2 encoded the asparaginase I gene (ansA), the coding region of which was further defined within a 1.7-kilobase fragment. The ansA gene specified a polypeptide, identified in maxicells, with a molecular weight of 43,000. Strains carrying recombinant plasmids encoding the ansA gene overproduced asparaginase I approximately 130-fold, suggesting that the ansA gene might normally be under negative regulation. Extracts from strains overproducing asparaginase I were electrophoresed, blotted, and probed with asparaginase II-specific antisera; no cross-reaction of the antisera with asparaginase I was observed, indicating that asparaginases I and II are not appreciably related immunologically. When a DNA fragment containing the ansA gene was used to probe Southern blots of restriction endonuclease-digested E. coli chromosomal DNA, no homologous sequences were revealed other than the expected ansA-containing fragments. Therefore, the genes encoding asparaginases I and II are highly sequence related. PMID:3514575

  20. Genetic and molecular biological studies of the products of nitrogen regulatory genes ntrB and ntrC of enteric bacteria

    International Nuclear Information System (INIS)

    EcoR1 restriction fragments of 4.1 kilobase pairs carrying wild type or mutant ntrB and ntrC genes of Salmonella typhimurium have been subcloned into a variety of plasmid vectors. In vivo and in vitro protein synthesis from the plasmids, as monitored by 35S-methionine labelling, has resulted in the identification of the ntrB and ntrC gene products as proteins with apparent molecular weights of 38 and 54 kilodaltons, respectively. Regulation of the gInA and ntrB promoters by purified ntrC product has been studied using a bacterial in vitro transcription/translation system. The reaction is programmed with templates carrying a fusion of the Salmonella gInA or ntrB structural gene and upstream promoter/regulatory sequences to lacZ. Use of such templates allows regulation to be monitored as changes in beta-galactosidase activity. Studies comparing regulation by a mutant form of the ntrC product, here called NtrC(Con), to regulation by the wild type protein, NtrC(wt), are discussed. Initial in vitro studies exploring activity of the ntrA product present in the S30's are described. Finally, the ntrA product is identified as a protein with an apparent molecular weight of 73 kilodaltons

  1. Genome Wide Re-Annotation of Caldicellulosiruptor saccharolyticus with New Insights into Genes Involved in Biomass Degradation and Hydrogen Production

    Science.gov (United States)

    Chowdhary, Nupoor; Selvaraj, Ashok; KrishnaKumaar, Lakshmi; Kumar, Gopal Ramesh

    2015-01-01

    Caldicellulosiruptor saccharolyticus has proven itself to be an excellent candidate for biological hydrogen (H2) production, but still it has major drawbacks like sensitivity to high osmotic pressure and low volumetric H2 productivity, which should be considered before it can be used industrially. A whole genome re-annotation work has been carried out as an attempt to update the incomplete genome information that causes gap in the knowledge especially in the area of metabolic engineering, to improve the H2 producing capabilities of C. saccharolyticus. Whole genome re-annotation was performed through manual means for 2,682 Coding Sequences (CDSs). Bioinformatics tools based on sequence similarity, motif search, phylogenetic analysis and fold recognition were employed for re-annotation. Our methodology could successfully add functions for 409 hypothetical proteins (HPs), 46 proteins previously annotated as putative and assigned more accurate functions for the known protein sequences. Homology based gene annotation has been used as a standard method for assigning function to novel proteins, but over the past few years many non-homology based methods such as genomic context approaches for protein function prediction have been developed. Using non-homology based functional prediction methods, we were able to assign cellular processes or physical complexes for 249 hypothetical sequences. Our re-annotation pipeline highlights the addition of 231 new CDSs generated from MicroScope Platform, to the original genome with functional prediction for 49 of them. The re-annotation of HPs and new CDSs is stored in the relational database that is available on the MicroScope web-based platform. In parallel, a comparative genome analyses were performed among the members of genus Caldicellulosiruptor to understand the function and evolutionary processes. Further, with results from integrated re-annotation studies (homology and genomic context approach), we strongly suggest that Csac

  2. Genome Wide Re-Annotation of Caldicellulosiruptor saccharolyticus with New Insights into Genes Involved in Biomass Degradation and Hydrogen Production.

    Directory of Open Access Journals (Sweden)

    Nupoor Chowdhary

    Full Text Available Caldicellulosiruptor saccharolyticus has proven itself to be an excellent candidate for biological hydrogen (H2 production, but still it has major drawbacks like sensitivity to high osmotic pressure and low volumetric H2 productivity, which should be considered before it can be used industrially. A whole genome re-annotation work has been carried out as an attempt to update the incomplete genome information that causes gap in the knowledge especially in the area of metabolic engineering, to improve the H2 producing capabilities of C. saccharolyticus. Whole genome re-annotation was performed through manual means for 2,682 Coding Sequences (CDSs. Bioinformatics tools based on sequence similarity, motif search, phylogenetic analysis and fold recognition were employed for re-annotation. Our methodology could successfully add functions for 409 hypothetical proteins (HPs, 46 proteins previously annotated as putative and assigned more accurate functions for the known protein sequences. Homology based gene annotation has been used as a standard method for assigning function to novel proteins, but over the past few years many non-homology based methods such as genomic context approaches for protein function prediction have been developed. Using non-homology based functional prediction methods, we were able to assign cellular processes or physical complexes for 249 hypothetical sequences. Our re-annotation pipeline highlights the addition of 231 new CDSs generated from MicroScope Platform, to the original genome with functional prediction for 49 of them. The re-annotation of HPs and new CDSs is stored in the relational database that is available on the MicroScope web-based platform. In parallel, a comparative genome analyses were performed among the members of genus Caldicellulosiruptor to understand the function and evolutionary processes. Further, with results from integrated re-annotation studies (homology and genomic context approach, we strongly

  3. Overexpression of a tobacco small G protein gene NtRop1 causes salt sensitivity and hydrogen peroxide production in transgenic plants

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    The small GTPases of Rop/Rho family is central regulators of important cellular processes in plants. Tobacco small G protein gene NtRop1 has been isolated; however, its roles in stress responses were unknown. In the present study, the genomic sequence of NtRop1 was cloned, which has seven exons and six introns, similar to the Rop gene structure from Arabidopsis. The NtRop1 gene was constitutively expressed in the different organs whereas the other six Rop genes from tobacco had differential expression patterns. The expression of the NtRop1 gene was moderately induced by methyl viologen, NaCl, and ACC treatments, but slightly inhibited by ABA treatment, with no significant induction by NAA treatment. The transgenic Arabidopsis plants overexpressing the NtRop1 showed increased salt sensitivity as can be seen from the reduced root growth and elevated relative electrolyte leakage. The hydrogen peroxide production was also promoted in the NtRop1-trangenic plants in comparison with wild type plants. These results imply that the NtRop1 may confer salt sensitivity through activation of H2O2 production during plant response to salt stress.

  4. Overexpression of a tobacco small G protein gene NtRop1 causes salt sensitivity and hydrogen peroxide production in transgenic plants.

    Science.gov (United States)

    Cao, YangRong; Li, ZhiGang; Chen, Tao; Zhang, ZhiGang; Zhang, JinSong; Chen, ShouYi

    2008-05-01

    The small GTPases of Rop/Rho family is central regulators of important cellular processes in plants. Tobacco small G protein gene NtRop1 has been isolated; however, its roles in stress responses were unknown. In the present study, the genomic sequence of NtRop1 was cloned, which has seven exons and six introns, similar to the Rop gene structure from Arabidopsis. The NtRop1 gene was constitutively expressed in the different organs whereas the other six Rop genes from tobacco had differential expression patterns. The expression of the NtRop1 gene was moderately induced by methyl viologen, NaCl, and ACC treatments, but slightly inhibited by ABA treatment, with no significant induction by NAA treatment. The transgenic Arabidopsis plants overexpressing the NtRop1 showed increased salt sensitivity as can be seen from the reduced root growth and elevated relative electrolyte leakage. The hydrogen peroxide production was also promoted in the NtRop1-trangenic plants in comparison with wild type plants. These results imply that the NtRop1 may confer salt sensitivity through activation of H2O2 production during plant response to salt stress. PMID:18785583

  5. Modification of genetic regulation of a heterologous chitosanase gene in Streptomyces lividans TK24 leads to chitosanase production in the absence of chitosan

    Directory of Open Access Journals (Sweden)

    Brzezinski Ryszard

    2011-02-01

    Full Text Available Abstract Background Chitosanases are enzymes hydrolysing chitosan, a β-1,4 linked D-glucosamine bio-polymer. Chitosan oligosaccharides have numerous emerging applications and chitosanases can be used for industrial enzymatic hydrolysis of chitosan. These extracellular enzymes, produced by many organisms including fungi and bacteria, are well studied at the biochemical and enzymatic level but very few works were dedicated to the regulation of their gene expression. This is the first study on the genetic regulation of a heterologous chitosanase gene (csnN106 in Streptomyces lividans. Results Two S. lividans strains were used for induction experiments: the wild type strain and its mutant (ΔcsnR, harbouring an in-frame deletion of the csnR gene, encoding a negative transcriptional regulator. Comparison of chitosanase levels in various media indicated that CsnR regulates negatively the expression of the heterologous chitosanase gene csnN106. Using the ΔcsnR host and a mutated csnN106 gene with a modified transcription operator, substantial levels of chitosanase could be produced in the absence of chitosan, using inexpensive medium components. Furthermore, chitosanase production was of higher quality as lower levels of extracellular protease and protein contaminants were observed. Conclusions This new chitosanase production system is of interest for biotechnology as only common media components are used and enzyme of high degree of purity is obtained directly in the culture supernatant.

  6. Overexpression of a tobacco small G protein gene NtRop1 causes salt sensitivity and hydrogen peroxide production in transgenic plants

    Institute of Scientific and Technical Information of China (English)

    CAO YangRong; LI ZhiGang; CHEN Tao; ZHANG ZhiGang; ZHANG JinSong; CHEN ShouYi

    2008-01-01

    The small GTPases of Rop/Rho family is central regulators of important cellular processes in plants.Tobacco small G protein gene NtRop1 has been isolated; however, its roles in stress responses were unknown. In the present study, the genomic sequence of NtRop1 was cloned, which has seven exons and six introns, similar to the Rop gene structure from Arabidopsis. The NtRopl gene was constitutively expressed in the different organs whereas the other six Rop genes from tobacco had differential expression patterns. The expression of the NtRop1 gene was moderately induced by methyl viologen,NaCl, and ACC treatments, but slightly inhibited by ABA treatment, with no significant induction by NAA treatment. The trsnsgenic Arabidopsis plants overexpressing the NtRop1 showed increased salt sensitivity as can be seen from the reduced root growth and elevated relative electrolyte leakage. The hydrogen peroxide production was also promoted in the NtRop1-trangenic plants in comparison with wild type plants. These results imply that the NtRopl may confer salt sensitivity through activation of H2O2 production during plant response to salt stress.

  7. Improvement of Ethanol Production in Saccharomyces cerevisiae by High-Efficient Disruption of the ADH2 Gene Using a Novel Recombinant TALEN Vector

    Science.gov (United States)

    Ye, Wei; Zhang, Weimin; Liu, Taomei; Tan, Guohui; Li, Haohua; Huang, Zilei

    2016-01-01

    Bioethanol is becoming increasingly important in energy supply and economic development. However, the low yield of bioethanol and the insufficiency of high-efficient genetic manipulation approaches limit its application. In this study, a novel transcription activator-like effector nuclease (TALEN) vector containing the left and right arms of TALEN was electroporated into Saccharomyces cerevisiae strain As2.4 to sequence the alcohol dehydrogenase gene ADH2 and the hygromycin-resistant gene hyg. Western blot analysis using anti-FLAG monoclonal antibody proved the successful expression of TALE proteins in As2.4 strains. qPCR and sequencing demonstrated the accurate knockout of the 17 bp target gene with 80% efficiency. The TALEN vector and ADH2 PCR product were electroporated into ΔADH2 to complement the ADH2 gene (ADH2+ As2.4). LC–MS and GC were employed to detect ethanol yields in the native As2.4, ΔADH2 As2.4, and ADH2+ As2.4 strains. Results showed that ethanol production was improved by 52.4 ± 5.3% through the disruption of ADH2 in As2.4. The bioethanol yield of ADH2+ As2.4 was nearly the same as that of native As2.4. This study is the first to report on the disruption of a target gene in S. cerevisiae by employing Fast TALEN technology to improve bioethanol yield. This work provides a novel approach for the disruption of a target gene in S. cerevisiae with high efficiency and specificity, thereby promoting the improvement of bioethanol production in S. cerevisiae by metabolic engineering. PMID:27462304

  8. The defH9-iaaM auxin-synthesizing gene increases plant fecundity and fruit production in strawberry and raspberry

    Directory of Open Access Journals (Sweden)

    Pandolfini Tiziana

    2004-03-01

    Full Text Available Abstract Background The DefH9-iaaM gene fusion which is expressed specifically in placenta/ovules and promotes auxin-synthesis confers parthenocarpic fruit development to eggplant, tomato and tobacco. Transgenic DefH9-iaaM eggplants and tomatoes show increased fruit production due mainly to an improved fruit set. However, the weight of the fruits is also frequently increased. Results DefH9-iaaM strawberry and raspberry plants grown under standard cultivation conditions show a significant increase in fruit number and size and fruit yield. In all three Rosaceae species tested, Fragaria vesca, Fragaria x ananassa and Rubus idaeus, DefH9-iaaM plants have an increased number of flowers per inflorescence and an increased number of inflorescences per plant. This results in an increased number of fruits per plant. Moreover, the weight and size of transgenic fruits was also increased. The increase in fruit yield was approximately 180% in cultivated strawberry, 140% in wild strawberry, and 100% in raspberry. The DefH9-iaaM gene is expressed in the flower buds of all three species. The total IAA (auxin content of young flower buds of strawberry and raspberry expressing the DefH9-iaaM gene is increased in comparison to untransformed flower buds. The DefH9-iaaM gene promotes parthenocarpy in emasculated flowers of both strawberry and raspberry. Conclusions The DefH9-iaaM gene is expressed and biologically active in Rosaceae. The DefH9-iaaM gene can be used, under cultivation conditions that allow pollination and fertilization, to increase fruit productivity significantly in Rosaceae species. The finding that the DefH9-iaaM auxin-synthesizing gene increases the number of inflorescences per plant and the number of flowers per inflorescence indicates that auxin plays a role in plant fecundity in these three perennial Rosaceae species.

  9. Production of Candida antaractica Lipase B Gene Open Reading Frame using Automated PCR Gene Assembly Protocol on Robotic Workcell & Expression in Ethanologenic Yeast for use as Resin-Bound Biocatalyst in Biodiesel Production

    Science.gov (United States)

    A synthetic Candida antarctica lipase B (CALB) gene open reading frame (ORF) for expression in yeast was produced using an automated PCR assembly and DNA purification protocol on an integrated robotic workcell. The lycotoxin-1 (Lyt-1) C3 variant gene ORF was added in-frame with the CALB ORF to pote...

  10. Detection of genes mediating beta-lactamase production in isolates of enterobacteria recovered from wild pets in Saudi Arabia

    OpenAIRE

    Sabry A. Hassan; Mohamed Y. Shobrak

    2015-01-01

    Aim: To determine the genetic basis and types of beta-lactamase encountered among enterobacterial isolates of wild pets from the animal exhibit. Materials and Methods: A total of 17 beta-lactamase-producing enterobacteria recovered from fecal samples of wild pet animals were analyzed for a selected beta-lactamase gene by polymerase chain reaction. Results: Molecular analysis identified one or more β-lactamase-encoding genes in 14 enterobacterial isolates as a single or gene combination....

  11. The product of the mei3+ gene, expressed under control of the mating-type locus, induces meiosis and sporulation in fission yeast.

    OpenAIRE

    McLeod, M; Stein, M.; Beach, D

    1987-01-01

    In fission yeast the ability to undergo meiosis and sporulation is conferred by the matP+ and matM+ genes of the mating-type locus. Inactivation of ran1+, a negative regulator of meiosis, is thought to be an essential step in meiotic initiation. We have isolated a further meiotic control gene mei3+, and have shown the following: a null allele of mei3 totally inhibits meiosis; the mei3+ RNA transcript and its translational product are expressed only in matP+/matM+ diploids entering meiosis; fo...

  12. The HAC1 Gene from Pichia Pastoris: Characterization and Effect of its Overexpression on the Production of Secreted, Surface Displayed and Membrane Proteins

    OpenAIRE

    Jacobs Pieter P; Ryckaert Stefan; Guerfal Mouna; Ameloot Paul; Van Craenenbroeck Kathleen; Derycke Riet; Callewaert Nico

    2010-01-01

    Abstract Background The unfolded protein response (UPR) in eukaryotes upregulates factors that restore ER homeostasis upon protein folding stress and in yeast is activated by a non-conventional splicing of the HAC1 mRNA. The spliced HAC1 mRNA encodes an active transcription factor that binds to UPR-responsive elements in the promoter of UPR target genes. Overexpression of the HAC1 gene of S. cerevisiae can reportedly lead to increased production of heterologous proteins. To further such studi...

  13. Identification of related genes in phages phi 80 and P22 whose products are inhibitory for phage growth in Escherichia coli IHF mutants.

    OpenAIRE

    Henthorn, K S; Friedman, D I

    1995-01-01

    Bacteriophage lambda grows in both IHF+ and IHF- host strains, but the lambdoid phage phi 80 and hybrid phage lambda (QSRrha+)80 fail to grow in IHF- host strains. We have identified a gene, rha, in the phi80 region of the lambda(QSRrha+)80 genome whose product, Rha, inhibits phage growth in an IHF- host. A search of the GenBank database identified a homolog of rha, ORF201, a previously identified gene in phage P22, which similarly inhibits phage growth in IHF- hosts. Both rha and ORF201 cont...

  14. Genetics of xanthan production in Xanthomonas campestris: the xanA and xanB genes are involved in UDP-glucose and GDP-mannose biosynthesis.

    OpenAIRE

    Köplin, R; Arnold, W.; Hötte, B; Simon, R; Wang, G; Pühler, A

    1992-01-01

    The nucleotide sequence of a 3.4-kb EcoRI-PstI DNA fragment of Xanthomonas campestris pv. campestris revealed two open reading frames, which were designated xanA and xanB. The genes xanA and xanB encode proteins of 448 amino acids (molecular weight of 48,919) and 466 amino acids (molecular weight of 50,873), respectively. These genes were identified by analyzing insertion mutants which were known to be involved in xanthan production. Specific tests for the activities of enzymes involved in th...

  15. Regulation of the Bacillus subtilis alsS, alsD, and alsR genes involved in post-exponential-phase production of acetoin.

    OpenAIRE

    Renna, M C; Najimudin, N.; Winik, L R; Zahler, S A

    1993-01-01

    Acetoin is a major extracellular product of Bacillus subtilis grown on glucose and other fermentable carbon sources. The enzymes responsible for the formation of acetoin, acetolactate synthase, and acetolactate decarboxylase are synthesized in detectable amounts only in cells that have reached stationary phase. We have cloned and sequenced the genes encoding these enzymes, alsS and alsD, as well as a gene, alsR, that regulates their expression. alsS and alsD appear to compose a single operon,...

  16. Dynamics of plc gene transcription and α-toxin production during growth of Clostridium perfringens strains with contrasting α-toxin production

    DEFF Research Database (Denmark)

    Abildgaard, Lone; Schramm, Andreas; Rudi, Knut;

    2009-01-01

    The aim of the present study was to investigate transcription dynamics of the α-toxin-encoding plc gene relative to two housekeeping genes (gyrA and rplL) in batch cultures of three Clostridium perfringens strains with low, intermediate, and high levels of α-toxin production, respectively. The plc...... transcript level was always low in the low α-toxin producing strain. For the two other strains, plc transcription showed an inducible pattern and reached a maximum level in the late exponential growth phase. The transcription levels were however inversely correlated to α-toxin production for the two strains....... We propose that this discrepancy is due to differences in plc translation rates between the strains and that strain-specific translational rates therefore must be determined before α-toxin production can be extrapolated from transcript levels in C. perfringens....

  17. Stimulation of later functions of the yeast meiotic protein kinase Ime2p by the IDS2 gene product.

    OpenAIRE

    Sia, R A; Mitchell, A P

    1995-01-01

    Ime2p is a protein kinase that is expressed only during meiosis in Saccharomyces cerevisiae. Ime2p stimulates early, middle, and late meiotic gene expression and down-regulates expression of IME1, which specifies an activator of early meiotic genes that acts independently of Ime2p. We have identified a new gene, IDS2 (for IME2-dependent signaling), which has a functional relationship to Ime2p. An ids2 null mutation delays down-regulation of IME1 and expression of middle and late meiotic genes...

  18. The Putative Glycosyltransferase-Encoding Gene cylJ and the Group B Streptococcus (GBS)-Specific Gene cylK Modulate Hemolysin Production and Virulence of GBS▿ †

    OpenAIRE

    Forquin, Marie-Pierre; Tazi, Asmae; Rosa-Fraile, Manuel; Poyart, Claire; Trieu-Cuot, Patrick; Dramsi, Shaynoor

    2007-01-01

    Group B streptococcus (GBS) expresses a hemolysin/cytolysin that plays an important role in pathogenesis. Using the Himar1 transposon mutagenesis system, a hypohemolytic mutant carrying an interrupted cylJ gene was characterized. cylJ, encoding a putative glycosyltransferase, and cylK, whose product is unknown, are both required for the full hemolytic/cytolytic activity, pigment formation, and virulence of GBS.

  19. Study on isolation, molecular detection of virulence gene and antibiotic sensitivity pattern of Escherichia coli isolated from milk and milk products

    Directory of Open Access Journals (Sweden)

    M. N. Brahmbhatt

    2013-06-01

    Full Text Available Aim: The study was undertaken to isolate pathogenic E. coli from milk and various milk products, detection of virulence gene using Polymerase chain reaction (PCR and investigate their antibiotic sensitivity pattern. Materials and Methods: Altogether 250 milk and various milk products samples consisting of raw milk (50, cheese (50, ice-cream (50, mawa (50 and dahi (50 were collected from milk vendors, retail shops located in Anand city, under aseptic precautions. For the enrichment of the organism from the collected samples, MacConkey broth was used and inoculation was carried out on MacConkey agar and EMB agar. Later on, to confirm the isolates, various biochemical tests such as IMViC test, Urease test were performed. Evaluation of antibiotic sensitivity pattern of E. coli was assessed by disk diffusion method. Finally the E. coli isolates were screened for the presence of virulence associated genes by PCR . Results: The prevalence of E. coli was observed 32 % in the samples comprising of milk (52.00%, cheese (28.00%, icecream (20.00%, mawa (44.00%, and dahi (16.00%. Antibiotic sensitivity was recorded high for Co-trimoxazole (100% followed by Gentamicin (96.73%, Trimithoprime (93.47% and Doxycycline hydochloride (92.39%. Least sensitivity was recorded for Ampicillin (8.69%. In this study, out of 80 E. coli isolates, 25 isolates (31.25% were positive for stx genes, of which 7 (8.75% isolates were positive for stx1 gene only, while 12 (15.00% isolates were positive for stx2 gene only and 5 (6.25% isolates were positive for both stx1 and stx2, 7 isolates (8.75% were positive for eaeA gene and all the isolate were negetive for rfb O157 gene. Conclusions: Current study supports the finding that raw milk and various milk products can be regarded as critical source of pathogenic E. coli This explains the need of strict monitoring and surveillance for effective measures of hygiene and sanitary practice during production of milk and various milk

  20. Sulfur source-mediated transcriptional regulation of the rhlABC genes involved in biosurfactants production by Pseudomonas sp. strain AK6U

    Science.gov (United States)

    Ismail, Wael; El Nayal, Ashraf M.; Ramadan, Ahmed R.; Abotalib, Nasser

    2014-01-01

    Despite the nutritional significance of sulfur, its influence on biosurfactants production has not been sufficiently studied. We investigated the expression of key biosurfactants production genes, rhlABC, in cultures of Pseudomonas sp. AK6U grown with inorganic or organic sulfur sources. AK6U grew with either inorganic sulfate (MgSO4), dibenzothiophene (DBT), or DBT-sulfone as a sole sulfur source in the presence of glucose as a carbon source. The AK6U cultures produced variable amounts of biosurfactants depending on the utilized sulfur source. Biosurfactants production profile of the DBT cultures was significantly different from that of the DBT-sulfone and inorganic sulfate cultures. The last two cultures were very similar in terms of biosurfactants productivity. Biosurfactants yield in the DBT cultures (1.3 g/L) was higher than that produced by the DBT-sulfone (0.5 g/L) and the inorganic sulfate (0.44 g/L) cultures. Moreover, the surface tension reduction in the DBT cultures (33 mN/m) was much stronger than that measured in the DBT-sulfone (58 mN/m) or inorganic sulfate (54 mN/m) cultures. RT-qPCR revealed variations in the expression levels of the rhlABC genes depending on the sulfur source. The DBT cultures had higher expression levels for the three genes as compared to the DBT-sulfone and inorganic sulfate cultures. There was no significant difference in the expression profiles between the DBT-sulfone and the MgSO4 cultures. The increased expression of rhlC in the DBT cultures is indicative for production of higher amounts of dirhamnolipids compared to the DBT-sulfone and inorganic sulfate cultures. The gene expression results were in good agreement with the biosurfactants production yields and surface tension measurements. The sulfur source mediates a fine-tuned mechanism of transcriptional regulation of biosurfactants production genes. Our findings can have an impact on industrial production of biosurfactants and other biotechnological processes like

  1. / production

    Indian Academy of Sciences (India)

    François Arleo; Pol-Bernard Gossiaux; Thierry Gousset; Jörg Aichelin

    2003-04-01

    For more than 25 years /Ψ production has helped to sharpen our understanding of QCD. In proton induced reaction some observations are rather well understood while others are still unclear. The current status of the theory of /Ψ production will be sketched, paying special attention to the issues of formation time and /Ψ re-interaction in a nuclear medium.

  2. Relationships between functional genes in Lactobacillus delbrueckii ssp. bulgaricus isolates and phenotypic characteristics associated with fermentation time and flavor production in yogurt elucidated using multilocus sequence typing.

    Science.gov (United States)

    Liu, Wenjun; Yu, Jie; Sun, Zhihong; Song, Yuqin; Wang, Xueni; Wang, Hongmei; Wuren, Tuoya; Zha, Musu; Menghe, Bilige; Heping, Zhang

    2016-01-01

    Lactobacillus delbrueckii ssp. bulgaricus (L. bulgaricus) is well known for its worldwide application in yogurt production. Flavor production and acid producing are considered as the most important characteristics for starter culture screening. To our knowledge this is the first study applying functional gene sequence multilocus sequence typing technology to predict the fermentation and flavor-producing characteristics of yogurt-producing bacteria. In the present study, phenotypic characteristics of 35 L. bulgaricus strains were quantified during the fermentation of milk to yogurt and during its subsequent storage; these included fermentation time, acidification rate, pH, titratable acidity, and flavor characteristics (acetaldehyde concentration). Furthermore, multilocus sequence typing analysis of 7 functional genes associated with fermentation time, acid production, and flavor formation was done to elucidate the phylogeny and genetic evolution of the same L. bulgaricus isolates. The results showed that strains significantly differed in fermentation time, acidification rate, and acetaldehyde production. Combining functional gene sequence analysis with phenotypic characteristics demonstrated that groups of strains established using genotype data were consistent with groups identified based on their phenotypic traits. This study has established an efficient and rapid molecular genotyping method to identify strains with good fermentation traits; this has the potential to replace time-consuming conventional methods based on direct measurement of phenotypic traits. PMID:26547656

  3. Ethylene Production and 1-Aminocyclopropane-1-Carboxylate (ACC) Synthase Gene Expression in Tomato(Lycopsicon esculentum Mill.) Leaves Under Enhanced UV-B Radiation

    Institute of Scientific and Technical Information of China (English)

    Lizhe An; Xunling Wang; Xiaofeng Xu; Hongguan Tang; Manxiao Zhang; Zongdong Hou; Yanhong Liu; Zhiguang Zhao; Huyuan Feng; Shijian Xu

    2006-01-01

    Tomato (Lycopsicon esculentum Mill.) plants grown in a greenhouse were irradiated with two different levels of UV-B, namely 8.82 (T1) and 12.6 kJ/m2 per day (T2). Ethylene production, 1-aminocyclopropane-1carboxylate (ACC) content, 1-(malonylamino) cyclopvopane-1-carboxylic acid (MACC) content, gene expression of ACC synthase (EC 4.4.1.14), and ACC oxidase activity in tomato leaves were determined. The results indicated that ACC content, the activity of ACC synthase and ACC oxidase, and ethylene production increased continuously under low doses of UV-B radiation, whereas at high doses of radiation these parameters increased during the first 12 d and then started to decrease. The MACC content increased continuously over 18 d under both doses of UV-B irradiation. The changes in ACC content, ACC synthase activity,ACC oxidase activity, the transcriptional level of the ACC synthase gene, and ethylene production were consistent with each other, suggesting that ACC synthase was the key enzyme in ethylene biosynthesis and that ethylene production in tomato leaf tissues under UV-B radiation could be regulated by the expression of the ACC synthase gene. The results also indicate that the change in ethylene metabolism may be an adaptive mechanism to enhanced UV-B radiation.

  4. Improved ethyl caproate production of Chinese liquor yeast by overexpressing fatty acid synthesis genes with OPI1 deletion.

    Science.gov (United States)

    Chen, Yefu; Luo, Weiwei; Gong, Rui; Xue, Xingxiang; Guan, Xiangyu; Song, Lulu; Guo, Xuewu; Xiao, Dongguang

    2016-09-01

    During yeast fermentation, ethyl esters play a key role in the development of the flavor profiles of Chinese liquor. Ethyl caproate, an ethyl ester eliciting apple-like flavor, is the characteristic flavor of strong aromatic liquor, which is the best selling liquor in China. In the traditional fermentation process, ethyl caproate is mainly produced at the later fermentation stage by aroma-producing yeast, bacteria, and mold in a mud pit instead of Saccharomyces cerevisiae at the expense of grains and fermentation time. To improve the production of ethyl caproate by Chinese liquor yeast (S. cerevisiae) with less food consumption and shorter fermentation time, we constructed three recombinant strains, namely, α5-ACC1ΔOPI1, α5-FAS1ΔOPI1, and α5-FAS2ΔOPI1 by overexpressing acetyl-CoA carboxylase (ACC1), fatty acid synthase 1 (FAS1), and fatty acid synthase 2 (FAS2) with OPI1 (an inositol/choline-mediated negative regulatory gene) deletion, respectively. In the liquid fermentation of corn hydrolysate, the contents of ethyl caproate produced by α5-ACC1ΔOPI1, α5-FAS1ΔOPI1, and α5-FAS2ΔOPI1 increased by 0.40-, 1.75-, and 0.31-fold, correspondingly, compared with the initial strain α5. The contents of other fatty acid ethyl esters (FAEEs) (C8:0, C10:0, C12:0) also increased. In comparison, the content of FAEEs produced by α5-FAS1ΔOPI1 significantly improved. Meanwhile, the contents of acetyl-CoA and ethyl acetate were enhanced by α5-FAS1ΔOPI1. Overall, this study offers a promising platform for the development of pure yeast culture fermentation of Chinese strong aromatic liquor without the use of a mud pit. PMID:27344573

  5. Association between the Advanced Glycosylation End Product-Specific Receptor Gene and Cardiovascular Death in Older Men.

    Directory of Open Access Journals (Sweden)

    Erik Biros

    Full Text Available Advanced glycosylation end product-specific receptor (AGER signaling has been implicated in atherosclerosis. The aim of this study was to evaluate whether a common genetic variation in the AGER gene is associated with cardiovascular (CV death. We included 1304 older men who were genotyped for rs1035798:C>T, which is a single nucleotide polymorphism (SNP mapped to the third intron of AGER. Cox proportional hazard analysis was used to estimate the association of rs1035798:C>T with CV death. In addition we analyzed total RNA extracted from carotid atherosclerosis biopsies of 18 patients that did or did not have recent symptoms of cerebral embolization by quantitative real-time reverse transcription PCR (qRT-PCR. The minor T-allele of rs1035798:C>T was found to be associated with CV death under dominant (HR = 1.43, 95% CI: 1.01-2.02, P = 0.04 and recessive (HR = 2.05, 95% CI: 1.11-3.81, P = 0.02 models of inheritance even after adjustment for traditional cardiovascular risk factors. No association was found between rs1035798:C>T and non-CV death. qRT-PCR results suggested that median relative expression of AGER isoform 1 and isoform 6 transcripts were approximately 6- (P = 0.01 and 2-fold (P = 0.02 greater, respectively, within carotid biopsies of symptomatic compared to asymptomatic patients. These data suggest that the minor (T allele of rs1035798:C>T represents an independent susceptibility factor for CV death. The expression of AGER isoforms is different in atheroma from patients with recent symptoms. Further studies are needed to investigate if rs1035798:C>T influences the alternative splicing of AGER.

  6. Overexpressing enzymes of the Ehrlich pathway and deleting genes of the competing pathway in Saccharomyces cerevisiae for increasing 2-phenylethanol production from glucose.

    Science.gov (United States)

    Shen, Li; Nishimura, Yuya; Matsuda, Fumio; Ishii, Jun; Kondo, Akihiko

    2016-07-01

    2-Phenylethanol (2-PE) is a higher aromatic alcohol that is used in the cosmetics and food industries. The budding yeast Saccharomyces cerevisiae is considered to be a suitable host for the industrial production of higher alcohols, including 2-PE. To produce 2-PE from glucose in S. cerevisiae, we searched for suitable 2-keto acid decarboxylase (KDC) and alcohol dehydrogenase (ADH) enzymes of the Ehrlich pathway for overexpression in strain YPH499, and found that overexpression of the ARO10 and/or ADH1 genes increased 2-PE production from glucose. Further, we screened ten BY4741 single-deletion mutants of genes involved in the competing pathways for 2-PE production, and found that strains aro8Δ and aat2Δ displayed increased 2-PE production. Based on these results, we engineered a BY4741 strain that overexpressed ARO10 and contained an aro8Δ deletion, and demonstrated that the strain produced 96 mg/L 2-PE from glucose as the sole carbon source. As this engineered S. cerevisiae strain showed a significant increase in 2-PE production from glucose without the addition of an intermediate carbon substrate, it is a promising candidate for the large-scale production of 2-PE. PMID:26975754

  7. Enteral peptide formulas inhibit radiation induced enteritis and apoptosis in intestinal epithelial cells and suppress the expression and function of Alzheimer's and cell division control gene products

    International Nuclear Information System (INIS)

    Studies have shown that patients receiving enteral peptide formulas prior to irradiation have a significantly reduced incidence of enteritis and express a profound increase in intestinal cellularity. Two conceptual approaches were taken to describe this response. First was the evaluation in changes in programmed intestinal cell death and secondly the evaluation of a gene product controlling cell division cycling. This study provided a relationship between the ratio of cell death to cell formulations. The results indicate that in the canine and murine models, irradiation induces expression of the Alzheimer's gene in intestinal crypt cells, while the incidence of apoptosis in apical cells is significantly increased. The use of peptide enteral formulations suppresses the expression of the Alzheimer's gene in crypt cells, while apoptosis is eliminated in the apical cells of the intestine. Concomitantly, enteral peptide formulations suppress the function of the CK-II gene product in the basal and baso-lateral cells of the intestine. These data indicate that although the mitotic index is significantly reduced in enterocytes, this phenomenon alone is not sufficient to account for the peptide-induced radio-resistance of the intestine. The data also indicate a significant reduction of normal apoptosis in the upper lateral and apical cells of the intestinal villi. Thus, the ratio of cell death to cell replacement is significantly decreased resulting in an increase in villus height and hypertrophy of the apical villus cells. Thus, peptide solutions should be considered as an adjunct treatment both in radio- and chemotherapy

  8. Characterization of a gamma-butyrolactone synthetase gene homologue (stcA) involved in bafilomycin production and aerial mycelium formation in Streptomyces sp. SBI034.

    Science.gov (United States)

    Intra, Bungonsiri; Euanorasetr, Jirayut; Nihira, Takuya; Panbangred, Watanalai

    2016-03-01

    Streptomyces SBI034 produces several bafilomycin derivatives. Its afsA homologue (stcA) and putative γ-butyrolactone receptor gene (stcB) were cloned. Construction of a stcA disruptant (stcA gene knockout) resulted in complete abolishment of all bafilomycin production. Electron microscopic analysis showed a defect of aerial mycelium formation and sporulation in the stcA disruptant. Restoration of all phenotypic defects and bafilomycin production was observed in a stcA complemented strain. Addition of exogenous γ-butyrolactone (GBL) extracted from the culture broth of the wild-type strain could stimulate the aerial mycelium and spore formation of the stcA disruptant. These results suggest that stcA plays a role in GBL-mediated regulation of bafilomycin biosynthesis and morphological development in Streptomyces strain SBI034. PMID:26603758

  9. Production of recombinant granulocyte colony-stimulating factor by knocking into the active immunoglobulin heavy chain gene locus in the hybridoma cell line

    OpenAIRE

    Kuwana, Yoshihisa; Funayama, Kikuko; Miyaji, Hiromasa; Hasegawa, Mamoru; Yoshida, Hajime; Itoh, Seiga

    2001-01-01

    The hybridoma cell line KM50 originally produces a monoclonal antibody at a concentration of ∼40 mg ml-1 in ascites. To investigate the possibility to apply this expression system to the production of useful proteins, the cDNA encoding human granulocyte colony-stimulating factor was inserted by homologous recombination into just downstream of the promoter of the active immunoglobulin heavy chain gene of KM50. Site directed integration of targeting DNAs resulted in the disruption of expression...

  10. prlA-mediated suppression of signal sequence mutations is modulated by the secA gene product of Escherichia coli K-12.

    OpenAIRE

    Oliver, D B; Liss, L R

    1985-01-01

    We studied the dependence of prlA-mediated suppression of signal sequence mutations in maltose-binding protein on cellular SecA levels in Escherichia coli. Reduction of SecA levels within the cell had strong positive and negative effects on prlA-mediated suppression, depending on the particular signal sequence mutations involved. This finding suggests that prlA and secA gene products are both components of a common export system.

  11. Identification of Select Fumonisin Forming Fusarium Species Using PCR Applications of the Polyketide Synthase Gene and its Relationship to Fumonisin Production in vitro

    OpenAIRE

    Mary Scruggs; Leigh Hawkins; Rowena Kelley; Peter Ma; Sonya Baird; Paul Williams; Gary Windham; Hamed K. Abbas; Richard Baird

    2008-01-01

    A polymerase chain reaction (PCR) based diagnostic assay was used to develop markers for detection of Fusarium verticillioides (=F. moniliforme), a fumonisin producing fungus in maize tissues. Species-specific primers were designed based on sequence data from the polyketide synthase (PKS) gene (FUM1- previously FUM5) responsible for fumonisin production in fungi. Four sets of oligonucleotide primers were tested for their specificity using 24 strains of F. verticillioides, 10 F. proliferatum, ...

  12. Trans-activation function of a 3' truncated X gene-cell fusion product from integrated hepatitis B virus DNA in chronic hepatitis tissues

    International Nuclear Information System (INIS)

    To investigate the expression and transactivation function of the X gene in integrated hepatitis B virus (HBV) DNA from chronic hepatitis tissues, a series of transfectants containing cloned integrated HBV DNAs was made and analyzed for X mRNA expression and trans-activation activity by using a chloramphenicol acetyltransferase assay. Most of the integrated HBV DNAs expressed X mRNA and encoded a product with trans-activation activity in spite of the loss of the 3' end region of the X gene due to integration. From cDNA cloning and sequence analysis of X mRNA transcribed from native or integrated HBV DNA, the X protein was found to be translated from the X open reading frame without splicing. For integrated HBV DNA, transcription was extended to a cellular flanking DNA and an X gene-cell fusion transcript was terminated by using a cellular poly(A) signal. The amino acid sequence deduced from an X-cell fusion transcript indicated truncation of the carboxyl-terminal five amino acids, but the upstream region of seven amino acids conserved among hepadnaviruses was retained in the integrated HBV DNA, suggesting that this conserved region is essential for the transactivation function of the X protein. These findings support the following explanation for hepatocarcinogenesis by HBV DNA integration: the expression of a cellular oncogene(s) is transactivated at the time of chronic infection by the increasing amounts of the integrated HBV gene product(s), such as the X-cell fusion product

  13. Metabolic engineering of Escherichia coli for the production of l-valine based on transcriptome analysis and in silico gene knockout simulation

    OpenAIRE

    Park, Jin Hwan; Lee, Kwang Ho; Kim, Tae Yong; Lee, Sang Yup

    2007-01-01

    The l-valine production strain of Escherichia coli was constructed by rational metabolic engineering and stepwise improvement based on transcriptome analysis and gene knockout simulation of the in silico genome-scale metabolic network. Feedback inhibition of acetohydroxy acid synthase isoenzyme III by l-valine was removed by site-directed mutagenesis, and the native promoter containing the transcriptional attenuator leader regions of the ilvGMEDA and ilvBN operon was replaced with the tac pro...

  14. Differences in the gene expression profiles of haemocytes from schistosome-susceptible and -resistant biomphalaria glabrata exposed to Schistosoma mansoni excretory-secretory products.

    Directory of Open Access Journals (Sweden)

    Zahida Zahoor

    Full Text Available During its life cycle, the helminth parasite Schistosoma mansoni uses the freshwater snail Biomphalaria glabrata as an intermediate host to reproduce asexually generating cercariae for infection of the human definitive host. Following invasion of the snail, the parasite develops from a miracidium to a mother sporocyst and releases excretory-secretory products (ESPs that likely influence the outcome of host infection. To better understand molecular interactions between these ESPs and the host snail defence system, we determined gene expression profiles of haemocytes from S. mansoni-resistant or -susceptible strains of B. glabrata exposed in vitro to S. mansoni ESPs (20 μg/ml for 1 h, using a 5K B. glabrata cDNA microarray. Ninety-eight genes were found differentially expressed between haemocytes from the two snail strains, 57 resistant specific and 41 susceptible specific, 60 of which had no known homologue in GenBank. Known differentially expressed resistant-snail genes included the nuclear factor kappa B subunit Relish, elongation factor 1α, 40S ribosomal protein S9, and matrilin; known susceptible-snail specific genes included cathepsins D and L, and theromacin. Comparative analysis with other gene expression studies revealed 38 of the 98 identified genes to be uniquely differentially expressed in haemocytes in the presence of ESPs, thus identifying for the first time schistosome ESPs as important molecules that influence global snail host-defence cell gene expression profiles. Such immunomodulation may benefit the schistosome, enabling its survival and successful development in the snail host.

  15. Rhizobium nodM and nodN genes are common nod genes: nodM encodes functions for efficiency of nod signal production and bacteroid maturation.

    OpenAIRE

    Baev, N; Schultze, M; Barlier, I; Ha, D C; Virelizier, H.; Kondorosi, E.; Kondorosi, A

    1992-01-01

    Earlier, we showed that Rhizobium meliloti nodM codes for glucosamine synthase and that nodM and nodN mutants produce strongly reduced root hair deformation activity and display delayed nodulation of Medicago sativa (Baev et al., Mol. Gen. Genet. 228:113-124, 1991). Here, we demonstrate that nodM and nodN genes from Rhizobium leguminosarum biovar viciae restore the root hair deformation activity of exudates of the corresponding R. meliloti mutant strains. Partial restoration of the nodulation...

  16. Transcription and translation products of the cytolysin gene psm-mec on the mobile genetic element SCCmec regulate Staphylococcus aureus virulence.

    Directory of Open Access Journals (Sweden)

    Chikara Kaito

    Full Text Available The F region downstream of the mecI gene in the SCCmec element in hospital-associated methicillin-resistant Staphylococcus aureus (HA-MRSA contains two bidirectionally overlapping open reading frames (ORFs, the fudoh ORF and the psm-mec ORF. The psm-mec ORF encodes a cytolysin, phenol-soluble modulin (PSM-mec. Transformation of the F region into the Newman strain, which is a methicillin-sensitive S. aureus (MSSA strain, or into the MW2 (USA400 and FRP3757 (USA300 strains, which are community-acquired MRSA (CA-MRSA strains that lack the F region, attenuated their virulence in a mouse systemic infection model. Introducing the F region to these strains suppressed colony-spreading activity and PSMα production, and promoted biofilm formation. By producing mutations into the psm-mec ORF, we revealed that (i both the transcription and translation products of the psm-mec ORF suppressed colony-spreading activity and promoted biofilm formation; and (ii the transcription product of the psm-mec ORF, but not its translation product, decreased PSMα production. These findings suggest that both the psm-mec transcript, acting as a regulatory RNA, and the PSM-mec protein encoded by the gene on the mobile genetic element SCCmec regulate the virulence of Staphylococcus aureus.

  17. Effects of Thyme Extract Oils (from Thymus vulgaris, Thymus zygis, and Thymus hyemalis on Cytokine Production and Gene Expression of oxLDL-Stimulated THP-1-Macrophages

    Directory of Open Access Journals (Sweden)

    A. Ocaña

    2012-01-01

    Full Text Available Properties of thyme extracts from three different species (Thymus vulgaris, Thymus zygis, and Thymus hyemalis were examined. Two oil fractions from each species were obtained by CO2 supercritical fluid extraction. Main compounds presented in the supercritical extracts of the three thyme varieties were 1,8 cineole, thymol, camphor, borneol, and carvacrol. As a cellular model of inflammation/atherogenesis, we use human macrophages derived from THP-1 monocytes and activated by oxidized LDLs. These cells were incubated with the thyme fraction oils, and the productions and gene expressions of the inflammatory mediators TNF-α, IL-1B, IL-6, and IL-10 were determined. Thyme extracts significantly reduced production and gene expression of the proinflammatory mediators TNF-α, IL-1B, and IL-6 and highly increased these parameters on the anti-inflammatory IL-10 cytokine. Changes on production and gene expressions were dose dependent and according to the thyme content of each species. Taken together, these results may suggest that thyme extracts could have anti-inflammatory effects.

  18. Early and late trisporoids differentially regulate β-carotene production and gene transcript Levels in the mucoralean fungi Blakeslea trispora and Mucor mucedo.

    Science.gov (United States)

    Sahadevan, Yamuna; Richter-Fecken, Mareike; Kaerger, Kerstin; Voigt, Kerstin; Boland, Wilhelm

    2013-12-01

    The multistep cleavage of carotenoids in Mucorales during the sexual phase results in a cocktail of trisporic acid (C18) sex pheromones. We hypothesized that the C18 trisporoid intermediates have a specific regulatory function for sex pheromone production and carotenogenesis that varies with genus/species and vegetative and sexual phases of their life cycles. Real-time quantitative PCR kinetics determined for Blakeslea trispora displayed a very high transcript turnover in the gene for carotenoid cleavage dioxygenase, tsp3, during the sexual phase. An in vivo enzyme assay and chromatographic analysis led to the identification of β-apo-12'-carotenal as the first apocarotenoid involved in trisporic acid biosynthesis in B. trispora. Supplementation of C18 trisporoids, namely D'orenone, methyl trisporate C, and trisporin C, increased tsp3 transcripts in the plus compared to minus partners. Interestingly, the tsp1 gene, which is involved in trisporic acid biosynthesis, was downregulated compared to tsp3 irrespective of asexual or sexual phase. Only the minus partners of both B. trispora and Mucor mucedo had enhanced β-carotene production after treatment with C20 apocarotenoids, 15 different trisporoids, and their analogues. We conclude that the apocarotenoids and trisporoids influence gene transcription and metabolite production, depending upon the fungal strain, corresponding genus, and developmental phase, representing a "chemical dialect" during sexual communication. PMID:24056470

  19. Detection of genes mediating beta-lactamase production in isolates of enterobacteria recovered from wild pets in Saudi Arabia

    Directory of Open Access Journals (Sweden)

    Sabry A. Hassan

    2015-12-01

    Full Text Available Aim: To determine the genetic basis and types of beta-lactamase encountered among enterobacterial isolates of wild pets from the animal exhibit. Materials and Methods: A total of 17 beta-lactamase-producing enterobacteria recovered from fecal samples of wild pet animals were analyzed for a selected beta-lactamase gene by polymerase chain reaction. Results: Molecular analysis identified one or more β-lactamase-encoding genes in 14 enterobacterial isolates as a single or gene combination. The most frequent extended-spectrum β-lactamases types were transmission electron microscopy and CTX-M, and the most common AmpC enzymes were CMY-2 and DHA types. Conclusions: The study is the first in Saudi Arabia, have established the presence of β-lactamase-encoding genes in the fecal isolates of wild pets.

  20. Pseudomonas aeruginosa biofilms exposed to imipenem exhibit changes in global gene expression and beta-lactamase and alginate production

    DEFF Research Database (Denmark)

    Bagge, N.; Schuster, M.; Hentzer, Morten;

    2004-01-01

    The lungs of cystic fibrosis (CF) patients are commonly colonized with Pseudomonas aeruginosa biofilms. Chronic endobronchial P. aeruginosa infections are impossible to eradicate with antibiotics, but intensive suppressive antibiotic therapy is essential to maintain the lung function of CF patients....... The treatment often includes beta-lactam antibiotics. How these antibiotics influence gene expression in the surviving biofilm population of P. aeruginosa is not clear. Thus, we used the microarray technology to study the effects of subinhibitory concentrations of a beta-lactam antibiotic, imipenem......, on gene expression in biofilm populations. Many genes showed small but statistically significant differential expression in response to imipenem. We identified 34 genes that were induced or repressed in biofilms exposed to imipenem more than fivefold compared to the levels of induction or repression...

  1. Differences in gene expression and cytokine production by crystalline vs. amorphous silica in human lung epithelial cells

    Directory of Open Access Journals (Sweden)

    Perkins Timothy N

    2012-02-01

    Full Text Available Abstract Background Exposure to respirable crystalline silica particles, as opposed to amorphous silica, is associated with lung inflammation, pulmonary fibrosis (silicosis, and potentially with lung cancer. We used Affymetrix/GeneSifter microarray analysis to determine whether gene expression profiles differed in a human bronchial epithelial cell line (BEAS 2B exposed to cristobalite vs. amorphous silica particles at non-toxic and equal surface areas (75 and 150 × 106μm2/cm2. Bio-Plex analysis was also used to determine profiles of secreted cytokines and chemokines in response to both particles. Finally, primary human bronchial epithelial cells (NHBE were used to comparatively assess silica particle-induced alterations in gene expression. Results Microarray analysis at 24 hours in BEAS 2B revealed 333 and 631 significant alterations in gene expression induced by cristobalite at low (75 and high (150 × 106μm2/cm2 amounts, respectively (p 6μm2/cm2 induced 108 significant gene changes. Bio-Plex analysis of 27 human cytokines and chemokines revealed 9 secreted mediators (p FOS, ATF3, IL6 and IL8 early and over time (2, 4, 8, and 24 h. Patterns of gene expression in NHBE cells were similar overall to BEAS 2B cells. At 75 × 106μm2/cm2, there were 339 significant alterations in gene expression induced by cristobalite and 42 by amorphous silica. Comparison of genes in response to cristobalite (75 × 106μm2/cm2 revealed 60 common, significant gene alterations in NHBE and BEAS 2B cells. Conclusions Cristobalite silica, as compared to synthetic amorphous silica particles at equal surface area concentrations, had comparable effects on the viability of human bronchial epithelial cells. However, effects on gene expression, as well as secretion of cytokines and chemokines, drastically differed, as the crystalline silica induced more intense responses. Our studies indicate that toxicological testing of particulates by surveying viability and

  2. Mutational Analysis of the sbo-alb Locus of Bacillus subtilis: Identification of Genes Required for Subtilosin Production and Immunity

    OpenAIRE

    Zheng, Guolu; Hehn, Robin; Zuber, Peter

    2000-01-01

    The Bacillus subtilis 168 derivative JH642 produces a bacteriocin, subtilosin, which possesses activity against Listeria monocytogenes. Inspection of the amino acid sequence of the presubtilosin polypeptide encoded by the gene sboA and sequence data from analysis of mature subtilosin indicate that the precursor subtilosin peptide undergoes several unique and unusual chemical modifications during its maturation process. The genes of the sbo-alb operon are believed to function in the synthesis ...

  3. Viral Vectors for In Vivo Gene Transfer in Parkinson’s disease: Properties and Clinical Grade Production

    OpenAIRE

    Mandel, Ronald J.; Burger, Corinna; Snyder, Richard O.

    2007-01-01

    Because Parkinson’s disease is a progressive degenerative disorder that is mainly confined to the basal ganglia, gene transfer to deliver therapeutic molecules is an attractive treatment avenue. The present review focuses on direct in vivo gene transfer vectors that have been developed to a degree that they have been successfully used in animal model of Parkinson’s disease. Accordingly, the properties of recombinant adenovirus, recombinant adeno-associated virus, herpes simplex virus, and len...

  4. Rates of N2 production and diversity and abundance of functional genes associated with denitrification and anaerobic ammonium oxidation in the sediment of the Amundsen Sea Polynya, Antarctica

    Science.gov (United States)

    Choi, Ayeon; Cho, Hyeyoun; Kim, Sung-Han; Thamdrup, Bo; Lee, SangHoon; Hyun, Jung-Ho

    2016-01-01

    A combination of molecular microbiological analyses and metabolic rate measurements was conducted to elucidate the diversity and abundance of denitrifying and anaerobic ammonium oxidation (anammox) bacteria and the nitrogen gas (N2) production rates in sediment underlying the highly productive polynya (Stns. 10 and 17) and the sea-ice zone on the outer shelf (Stn. 83) of the Amundsen Sea, Antarctica. Despite the high water column productivity, the N2 production rates by denitrification (0.04-0.31 nmol N cm-3sed. h-1) and anammox (0.13-0.26 nmol N cm-3 sed. h-1) were lower than those measured in other polar regions. In contrast, gene copy number (106-107 copies cm-3 of nirS and nosZ genes targeting denitirifiers and 105-107 copies cm-3 of 16S rRNA genes related to anammox bacteria) of the two bacterial groups at Stn. 17 was similar compared to those of other organic-rich environments. The majority of the nirS sequences were affiliated with Gammaproteobacteria (54% and 61% of the total nirS gene at Stns. 17 and 83, respectively), which were closely related to Pseudomonas aeruginosa. Most nosZ sequences (92% and 72% of the total nosZ genes at Stns. 17 and 83, respectively) were related to the Alphaproteobacteria, which were closely related to Ruegeria pomeroyi and Roseobacter denitrificans. Most (98%) of the sequences related to anammox bacteria were affiliated with Candidatus Scalindua at Stn. 17. Consequently, despite the low metabolic activity, the abundance and composition of most denitrifying and anammox bacteria detected from the ASP were similar to those reported from a variety of marine environments. Our results further imply that increased labile organic matter production resulting from a shift of the phytoplankton community from Phaeocystis to diatoms in response to rapid melting of sea ice stimulates metabolic activities of the denitrifying and anammox bacteria, thereby enhancing the N removal process in the ASP.

  5. Mitochondrial DNA variants mediate energy production and expression levels for CFH, C3 and EFEMP1 genes: implications for age-related macular degeneration.

    Directory of Open Access Journals (Sweden)

    M Cristina Kenney

    Full Text Available BACKGROUND: Mitochondrial dysfunction is associated with the development and progression of age-related macular degeneration (AMD. Recent studies using populations from the United States and Australia have demonstrated that AMD is associated with mitochondrial (mt DNA haplogroups (as defined by combinations of mtDNA polymorphisms that represent Northern European Caucasians. The aim of this study was to use the cytoplasmic hybrid (cybrid model to investigate the molecular and biological functional consequences that occur when comparing the mtDNA H haplogroup (protective for AMD versus J haplogroup (high risk for AMD. METHODOLOGY/PRINCIPAL FINDINGS: Cybrids were created by introducing mitochondria from individuals with either H or J haplogroups into a human retinal epithelial cell line (ARPE-19 that was devoid of mitochondrial DNA (Rho0. In cybrid lines, all of the cells carry the same nuclear genes but vary in mtDNA content. The J cybrids had significantly lower levels of ATP and reactive oxygen/nitrogen species production, but increased lactate levels and rates of growth. Q-PCR analyses showed J cybrids had decreased expressions for CFH, C3, and EFEMP1 genes, high risk genes for AMD, and higher expression for MYO7A, a gene associated with retinal degeneration in Usher type IB syndrome. The H and J cybrids also have comparatively altered expression of nuclear genes involved in pathways for cell signaling, inflammation, and metabolism. CONCLUSION/SIGNIFICANCE: Our findings demonstrate that mtDNA haplogroup variants mediate not only energy production and cell growth, but also cell signaling for major molecular pathways. These data support the hypothesis that mtDNA variants play important roles in numerous cellular functions and disease processes, including AMD.

  6. Blue Light Signaling Inactivates the Mating Type Genes-Mediated Repression of Asexual Spore Production in the Higher Basidiomycete Coprinopsis cinerea

    Directory of Open Access Journals (Sweden)

    Prayook Srivilai

    2009-01-01

    Full Text Available Monokaryotic mycelia of several wild-type strains of the homobasidiomycete Coprinopsis cinerea form abundant numbers of oidia both in the light and dark due to the regulation of oidia production by the A and B mating type genes. Nevertheless, little is known about whether and how the mating type loci and light signal regulate the oidiation in C. cinerea. Herein, the experimental results demonstrated that the self-compatible homokaryon AmutBmut strain, the mycelia whose nuclei carry mutations in both the A and B loci, can produce only a few oidia in the dark, whereas the formation of numerous numbers of oidia is induced by the light. The semi-compatible homokaryon AmutB, but not ABmut, has the production and behavior of oidia formation similar to those of AmutBmut. These findings indicated that in AmutBmut strain the mutation at the A locus results in repression of oidiation in the dark and the blue light alleviates this effect, whereas the mutated B genes function has no effects. Since, the oidia production relies on both A and light signal, it is possible that A locus might be linked to the blue light receptor genes. The present results demonstrated for the first time that the secondary hyphal knot formation(skn1, fruiting body maturation (mat and basidiospore formation (bad genes which are essential in the C. cinerea fruiting pathway are not involved in the regulation of asexual sporulation. In addition, the positive light effect on oidiation could also occur in C. cinerea dikaryons.

  7. Production of the Anaerobic GMAX-L Yeast Using High-Throughput Mating and Transformation of Saccharomyces cerevisiae With Identified Genes For Simultaneous Cellulosic Ethanol and Biodiesel Production

    Science.gov (United States)

    Tailored GMAX-L yeast engineering for strains capable of universal ethanol production industrially with coproduction of an expressed lipase catalyst for coproduction of ethyl esters from corn oil and ethanol from the modern dry grind ethanol facility: Production of the stable baseline glucose, mann...

  8. Impact of Nitrogen Sources on Gene Expression and Toxin Production in the Diazotroph Cylindrospermopsis raciborskii CS-505 and Non-Diazotroph Raphidiopsis brookii D9

    Directory of Open Access Journals (Sweden)

    Karina Stucken

    2014-06-01

    Full Text Available Different environmental nitrogen sources play selective roles in the development of cyanobacterial blooms and noxious effects are often exacerbated when toxic cyanobacteria are dominant. Cylindrospermopsis raciborskii CS-505 (heterocystous, nitrogen fixing and Raphidiopsis brookii D9 (non-N2 fixing produce the nitrogenous toxins cylindrospermopsin (CYN and paralytic shellfish toxins (PSTs, respectively. These toxin groups are biosynthesized constitutively by two independent putative gene clusters, whose flanking genes are target for nitrogen (N regulation. It is not yet known how or if toxin biosynthetic genes are regulated, particularly by N-source dependency. Here we show that binding boxes for NtcA, the master regulator of N metabolism, are located within both gene clusters as potential regulators of toxin biosynthesis. Quantification of intra- and extracellular toxin content in cultures at early stages of growth under nitrate, ammonium, urea and N-free media showed that N-sources influence neither CYN nor PST production. However, CYN and PST profiles were altered under N-free medium resulting in a decrease in the predicted precursor toxins (doCYN and STX, respectively. Reduced STX amounts were also observed under growth in ammonium. Quantification of toxin biosynthesis and transport gene transcripts revealed a constitutive transcription under all tested N-sources. Our data support the hypothesis that PSTs and CYN are constitutive metabolites whose biosynthesis is correlated to cyanobacterial growth rather than directly to specific environmental conditions. Overall, the constant biosynthesis of toxins and expression of the putative toxin-biosynthesis genes supports the usage of qPCR probes in water quality monitoring of toxic cyanobacteria.

  9. Impact of Nitrogen Sources on Gene Expression and Toxin Production in the Diazotroph Cylindrospermopsis raciborskii CS-505 and Non-Diazotroph Raphidiopsis brookii D9

    Science.gov (United States)

    Stucken, Karina; John, Uwe; Cembella, Allan; Soto-Liebe, Katia; Vásquez, Mónica

    2014-01-01

    Different environmental nitrogen sources play selective roles in the development of cyanobacterial blooms and noxious effects are often exacerbated when toxic cyanobacteria are dominant. Cylindrospermopsis raciborskii CS-505 (heterocystous, nitrogen fixing) and Raphidiopsis brookii D9 (non-N2 fixing) produce the nitrogenous toxins cylindrospermopsin (CYN) and paralytic shellfish toxins (PSTs), respectively. These toxin groups are biosynthesized constitutively by two independent putative gene clusters, whose flanking genes are target for nitrogen (N) regulation. It is not yet known how or if toxin biosynthetic genes are regulated, particularly by N-source dependency. Here we show that binding boxes for NtcA, the master regulator of N metabolism, are located within both gene clusters as potential regulators of toxin biosynthesis. Quantification of intra- and extracellular toxin content in cultures at early stages of growth under nitrate, ammonium, urea and N-free media showed that N-sources influence neither CYN nor PST production. However, CYN and PST profiles were altered under N-free medium resulting in a decrease in the predicted precursor toxins (doCYN and STX, respectively). Reduced STX amounts were also observed under growth in ammonium. Quantification of toxin biosynthesis and transport gene transcripts revealed a constitutive transcription under all tested N-sources. Our data support the hypothesis that PSTs and CYN are constitutive metabolites whose biosynthesis is correlated to cyanobacterial growth rather than directly to specific environmental conditions. Overall, the constant biosynthesis of toxins and expression of the putative toxin-biosynthesis genes supports the usage of qPCR probes in water quality monitoring of toxic cyanobacteria. PMID:24956074

  10. The ipdC, hisC1 and hisC2 genes involved in indole-3-acetic production used as alternative phylogenetic markers in Azospirillum brasilense.

    Science.gov (United States)

    Jijón-Moreno, Saúl; Marcos-Jiménez, Cynthia; Pedraza, Raúl O; Ramírez-Mata, Alberto; de Salamone, I García; Fernández-Scavino, Ana; Vásquez-Hernández, Claudia A; Soto-Urzúa, Lucia; Baca, Beatriz E

    2015-06-01

    Plant growth-promoting bacteria of the genus Azospirillum are present in the rhizosphere and as endophytes of many crops. In this research we studied 40 Azospirillum strains isolated from different plants and geographic regions. They were first characterized by 16S rDNA restriction analysis, and their phylogenetic position was established by sequencing the genes 16S rDNA, ipdC, hisC1, and hisC2. The latter three genes are involved in the indole-3-pyruvic acid (IPyA) biosynthesis pathway of indole-3-acetic acid (IAA). Furthermore, the suitability of the 16S-23S rDNA intergenic spacer sequence (IGS) for the differentiation of closely related Azospirillum taxa and development of PCR protocols allows for specific detection of strains. The IGS-RFLP analysis enabled intraspecies differentiation, particularly of Azospirillum brasilense and Azospirillum lipoferum strains. Results demonstrated that the ipdC, hisC1, and hisC2 genes are highly conserved in all the assessed A. brasilense isolates, suggesting that these genes can be used as an alternative phylogenetic marker. In addition, IAA production determined by HPLC ranged from 0.17 to 98.2 μg mg(-1) protein. Southern hybridization with the A. brasilense ipdC gene probe did not show, a hybridization signal with A. lipoferum, Azospirillum amazonense, Azospirillum halopreferans and Azospirillum irakense genomic DNA. This suggests that these species produce IAA by other pathways. Because IAA is mainly synthesized via the IPyA pathway in A. brasilense strains, a species that is used worldwide in agriculture, the identification of ipdC, hisC1, and hisC2 genes by PCR may be suitable for selecting exploitable strains. PMID:25842039

  11. Production of γ-linolenic acid and stearidonic acid by Synechococcus sp. PCC7002 containing cyanobacterial fatty acid desaturase genes

    Science.gov (United States)

    Dong, Xuewei; He, Qingfang; Peng, Zhenying; Yu, Jinhui; Bian, Fei; Li, Youzhi; Bi, Yuping

    2015-11-01

    Genetic modification is useful for improving the nutritional qualities of cyanobacteria. To increase the total unsaturated fatty acid content, along with the ratio of ω-3/ω-6 fatty acids, genetic engineering can be used to modify fatty acid metabolism. Synechococcus sp. PCC7002, a fast-growing cyanobacterium, does not contain a Δ6 desaturase gene and is therefore unable to synthesize γ-linolenic acid (GLA) and stearidonic acid (SDA), which are important in human health. In this work, we constructed recombinant vectors Syd6D, Syd15D and Syd6Dd15D to express the Δ15 desaturase and Δ6 desaturase genes from Synechocystis PCC6803 in Synechococcus sp. PCC7002, with the aim of expressing polyunsaturated fatty acids. Overexpression of the Δ15 desaturase gene in Synechococcus resulted in 5.4 times greater accumulation of α-linolenic acid compared with the wild-type while Δ6 desaturase gene expression produced both GLA and SDA. Co-expression of the two genes resulted in low-level accumulation of GLA but much larger amounts of SDA, accounting for as much to 11.64% of the total fatty acid content.

  12. Genes and Gene Therapy

    Science.gov (United States)

    ... correctly, a child can have a genetic disorder. Gene therapy is an experimental technique that uses genes to ... or prevent disease. The most common form of gene therapy involves inserting a normal gene to replace an ...

  13. RecET driven chromosomal gene targeting to generate a RecA deficient Escherichia coli strain for Cre mediated production of minicircle DNA

    Directory of Open Access Journals (Sweden)

    Coutelle Charles

    2006-03-01

    Full Text Available Abstract Background Minicircle DNA is the non-replicating product of intramolecular site-specific recombination within a bacterial minicircle producer plasmid. Minicircle DNA can be engineered to contain predominantly human sequences which have a low content of CpG dinucleotides and thus reduced immunotoxicity for humans, whilst the immunogenic bacterial origin and antibiotic resistance marker gene sequences are entirely removed by site-specific recombination. This property makes minicircle DNA an excellent vector for non-viral gene therapy. Large-scale production of minicircle DNA requires a bacterial strain expressing tightly controlled site-specific recombinase, such as Cre recombinase. As recombinant plasmids tend to be more stable in RecA-deficient strains, we aimed to construct a recA- bacterial strain for generation of minicircle vector DNA with less chance of unwanted deletions. Results We describe here the construction of the RecA-deficient minicircle DNA producer Escherichia coli HB101Cre with a chromosomally located Cre recombinase gene under the tight control of the araC regulon. The Cre gene expression cassette was inserted into the chromosomal lacZ gene by creating transient homologous recombination proficiency in the recA- strain HB101 using plasmid-born recET genes and homology-mediated chromosomal "pop-in, pop-out" of the plasmid pBAD75Cre containing the Cre gene and a temperature sensitive replication origin. Favourably for the Cre gene placement, at the "pop-out" step, the observed frequency of RecET-led recombination between the proximal regions of homology was 10 times higher than between the distal regions. Using the minicircle producing plasmid pFIXluc containing mutant loxP66 and loxP71 sites, we isolated pure minicircle DNA from the obtained recA- producer strain HB101Cre. The minicircle DNA preparation consisted of monomeric and, unexpectedly, also multimeric minicircle DNA forms, all containing the hybrid loxP66

  14. Ability of structurally diverse natural products and synthetic chemicals to induce gene expression mediated by estrogen receptors from various species.

    Science.gov (United States)

    Matthews, J B; Fertuck, K C; Celius, T; Huang, Y-W; Fong, C J; Zacharewski, T R

    2002-10-01

    The ability of 14 structurally diverse estrogenic compounds to induce reporter gene expression mediated by estrogen receptors (ERs) from different species was examined. MCF-7 cells were transiently transfected with a Gal4-regulated luciferase reporter gene (17m5-G-Luc) and Gal4-ER chimeric receptors containing the D, E and F domains of the human alpha (Gal4-hERalphadef), mouse alpha (Gal4-mERalphadef), mouse beta (Gal4-mERbetadef), chicken (Gal4-cERalphadef), green anole (Gal4-aERalphadef), Xenopus (Gal4-xERdef) or rainbow trout alpha ERs (Gal4-rtERalphadef). The efficacy of 17beta-estradiol (E2) in inducing reporter gene expression was similar among the different constructs overall, with EC(50) values ranging from 0.05 to 0.7nM. However, Gal4-rtERalphadef had an EC(50) value at 37 degrees C of 28nM, though at 20 degrees C an EC(50) value of 1nM was observed. Despite a similar response to E2 treatment among the ERs, many differences were observed in the magnitude of the response to other structurally diverse chemicals. For example, coumestrol induced Gal4-mERbetadef- and Gal4-aERdef-mediated reporter gene expression 164- and 8-fold greater, respectively, than mediated with the other Gal4-ERs. As well, in contrast to results with other Gal4-ERs, alpha-zearalenol consistently induced Gal4-rtERalphadef-mediated reporter gene activity at lower concentrations than did E2. Overall, the results demonstrate that selected estrogenic compounds exhibit a differential ability to induce reporter gene activity mediated by ERs from different vertebrate species. These data also highlight the importance of incubation temperature when examining rtERalpha-mediated activity. PMID:12477484

  15. Targeting exogenous GDNF gene to the bovine somatic cell beta-casein locus for the production of transgenic bovine animals.

    Science.gov (United States)

    Zhang, X M; Luo, F H; Ding, H M; Li, B; Zhang, J J; Wu, Y J

    2015-01-01

    Considerable attention is currently being directed toward methods for producing recombinant human proteins in the mammary glands of genetically modified transgenic livestock. However, the expression of inserted genes in transgenic animals is variable and often very low because of the randomness of the site of transgene integration. One possible strategy to avoid the expression problem associated with random integration is to use site-specific integration by targeting integration to a high expression locus and, thereby, to improve expression of the transferred gene. In the present study, we focused on glial cell line-derived neurotrophic factor (GDNF), a novel type of neurotrophic factor first cloned in 1993. Research has shown that GDNF may have potential applications in the treatment of Parkinson's disease and other diseases of the central nervous system since it acts as a protective factor for central dopaminergic neurons. Here, we constructed a gene targeting vector to knock-in the human GDNF gene at the bovine beta-casein gene locus as a first step to producing transgenic animals with a high level of expression of human GDNF protein in their mammary glands. Bovine fetal fibroblast cells were transfected with linearized pNRTCNbG by electroporation. Three cell clones were identified with successful targeting to the beta-casein locus; and were confirmed using both polymerase chain reaction analysis and sequencing. Gene-targeted cells were used as nuclear donors; a total of 161 embryos were reconstructed, 23 of which developed to the blastocyst stage. These blastocysts were transferred to 8 recipient cows, but no offspring were obtained. PMID:26634460

  16. Specific interaction between hnRNP H and HPV16 L1 proteins: Implications for late gene auto-regulation enabling rapid viral capsid protein production

    International Nuclear Information System (INIS)

    Highlights: ► The RNA-binding hnRNP H regulates late viral gene expression. ► hnRNP H activity was inhibited by a late viral protein. ► Specific interaction between HPV L1 and hnRNP H was demonstrated. ► Co-localization of HPV L1 and hnRNP H inside cells was observed. ► Viral capsid protein production, enabling rapid capsid assembly, was implicated. -- Abstract: Heterogeneous nuclear ribonucleoproteins (hnRNPs), including hnRNP H, are RNA-binding proteins that function as splicing factors and are involved in downstream gene regulation. hnRNP H, which binds to G triplet regions in RNA, has been shown to play an important role in regulating the staged expression of late proteins in viral systems. Here, we report that the specific association between hnRNP H and a late viral capsid protein, human papillomavirus (HPV) L1 protein, leads to the suppressed function of hnRNP H in the presence of the L1 protein. The direct interaction between the L1 protein and hnRNP H was demonstrated by complex formation in solution and intracellularly using a variety of biochemical and immunochemical methods, including peptide mapping, specific co-immunoprecipitation and confocal fluorescence microscopy. These results support a working hypothesis that a late viral protein HPV16 L1, which is down regulated by hnRNP H early in the viral life cycle may provide an auto-regulatory positive feedback loop that allows the rapid production of HPV capsid proteins through suppression of the function of hnRNP H at the late stage of the viral life cycle. In this positive feedback loop, the late viral gene products that were down regulated earlier themselves disable their suppressors, and this feedback mechanism could facilitate the rapid production of capsid proteins, allowing staged and efficient viral capsid assembly

  17. Specific interaction between hnRNP H and HPV16 L1 proteins: Implications for late gene auto-regulation enabling rapid viral capsid protein production

    Energy Technology Data Exchange (ETDEWEB)

    Zheng, Zi-Zheng; Sun, Yuan-Yuan; Zhao, Min; Huang, Hui [National Institute of Diagnostics and Vaccine Development in Infectious Diseases, Xiamen University, Xiamen, Fujian 361005 (China); School of Life Sciences, Xiamen University, Xiamen, Fujian 361005 (China); Zhang, Jun; Xia, Ning-Shao [National Institute of Diagnostics and Vaccine Development in Infectious Diseases, Xiamen University, Xiamen, Fujian 361005 (China); School of Life Sciences, Xiamen University, Xiamen, Fujian 361005 (China); School of Public Health, Xiamen University, Xiamen, Fujian 361005 (China); Miao, Ji, E-mail: jmiao@xmu.edu.cn [National Institute of Diagnostics and Vaccine Development in Infectious Diseases, Xiamen University, Xiamen, Fujian 361005 (China); School of Life Sciences, Xiamen University, Xiamen, Fujian 361005 (China); Zhao, Qinjian, E-mail: qinjian_zhao@xmu.edu.cn [National Institute of Diagnostics and Vaccine Development in Infectious Diseases, Xiamen University, Xiamen, Fujian 361005 (China); School of Public Health, Xiamen University, Xiamen, Fujian 361005 (China)

    2013-01-18

    Highlights: ► The RNA-binding hnRNP H regulates late viral gene expression. ► hnRNP H activity was inhibited by a late viral protein. ► Specific interaction between HPV L1 and hnRNP H was demonstrated. ► Co-localization of HPV L1 and hnRNP H inside cells was observed. ► Viral capsid protein production, enabling rapid capsid assembly, was implicated. -- Abstract: Heterogeneous nuclear ribonucleoproteins (hnRNPs), including hnRNP H, are RNA-binding proteins that function as splicing factors and are involved in downstream gene regulation. hnRNP H, which binds to G triplet regions in RNA, has been shown to play an important role in regulating the staged expression of late proteins in viral systems. Here, we report that the specific association between hnRNP H and a late viral capsid protein, human papillomavirus (HPV) L1 protein, leads to the suppressed function of hnRNP H in the presence of the L1 protein. The direct interaction between the L1 protein and hnRNP H was demonstrated by complex formation in solution and intracellularly using a variety of biochemical and immunochemical methods, including peptide mapping, specific co-immunoprecipitation and confocal fluorescence microscopy. These results support a working hypothesis that a late viral protein HPV16 L1, which is down regulated by hnRNP H early in the viral life cycle may provide an auto-regulatory positive feedback loop that allows the rapid production of HPV capsid proteins through suppression of the function of hnRNP H at the late stage of the viral life cycle. In this positive feedback loop, the late viral gene products that were down regulated earlier themselves disable their suppressors, and this feedback mechanism could facilitate the rapid production of capsid proteins, allowing staged and efficient viral capsid assembly.

  18. High Trap Formation and Low Metabolite Production by Disruption of the Polyketide Synthase Gene Involved in the Biosynthesis of Arthrosporols from Nematode-Trapping Fungus Arthrobotrys oligospora.

    Science.gov (United States)

    Xu, Zi-Fei; Wang, Bai-Le; Sun, Hong-Kai; Yan, Ni; Zeng, Zhi-Jun; Zhang, Ke-Qin; Niu, Xue-Mei

    2015-10-21

    A group of morphology regulatory arthrosporol metabolites have been recently characterized from carnivorous fungus Arthrobotrys oligospora that can develop trapping networks to capture their prey. A combination of genetic manipulation and chemical analyses was applied to characterize the function of one polyketide synthase (PKS) gene AOL_s00215g283 in A. oligospora, which was putatively involved in the production of 6-methylsalicylic acid. High-performance liquid chromatography analysis showed that the disruption of the PKS gene not only led to the total loss of the arthrosporol A but also resulted in significant reduction in the production of secondary metabolites in the cultural broth of the mutant ΔAOL_s00215g283 strain. Interestingly, the mutant strain displayed significant increases in the trap formation and the nematicidal activity by 10 and 2 times, respectively, higher than the wild-type strain. These findings revealed a pathogenicity-related biosynthetic gene of this agriculturally important biological agent and have implications for establishment of efficient fungal biocontrol agents. PMID:26422178

  19. Industrial-scale production and purification of a heterologous protein in Lactococcus lactis using the nisin-controlled gene expression system NICE: The case of lysostaphin

    Directory of Open Access Journals (Sweden)

    Floris Esther

    2005-05-01

    Full Text Available Abstract Background The NIsin-Controlled gene Expression system NICE of Lactococcus lactis is one of the most widespread used expression systems of Gram-positive bacteria. It is used in more than 100 laboratories for laboratory-scale gene expression experiments. However, L. lactis is also a micro-organism with a large biotechnological potential. Therefore, the aim of this study was to test whether protein production in L. lactis using the NICE system can also effectively be performed at the industrial-scale of fermentation. Results Lysostaphin, an antibacterial protein (mainly against Staphylococcus aureus from S. simulans biovar. Staphylolyticus, was used as a model system. Food-grade lysostaphin expression constructs in L. lactis were grown at 1L-, 300-L and 3000-L scale and induced with nisin for lysostaphin production. The induction process was equally effective at all scales and yields of about 100 mg/L were obtained. Up-scaling was easy and required no specific effort. Furthermore, we describe a simple and effective way of downstream processing to obtain a highly purified lysostaphin, which has been used for clinical phase I trials. Conclusion This is the first example that shows that nisin-regulated gene expression in L. lactis can be used at industrial scale to produce large amounts of a target protein, such as lysostaphin. Downstream processing was simple and in a few steps produced a highly purified and active enzyme.

  20. Positive selection of mutants with cell envelope defects of a Salmonella typhimurium strain hypersensitive to the products of genes hisF and hisH

    International Nuclear Information System (INIS)

    Strain SB564 and its derivative DA78 are hypersensitive to the inhibitory action of the proteins coded for by genes hisF and hisH on cell division. Transduction of hisO1242, a regulatory mutation that elicits a very high level of expression of the histidine operon, into these strains resulted in the production of long filamentous cells carrying large balloons and in growth failure. Forty-one hisO1242 derivatives that escaped inhibition were isolated. These strains showed a large variety of alterations, many of which were related to the cell envelope. The more-frequent alterations included: changes in cell shape, increased sensitivity to one or more of several drugs (deoxycholate, cycloserine, penicillin, novobiocin, acridine orange), increased autolytic activity in alkaline buffer, anomalous fermentation of maltose on eosin--methylene blue plates, and temperature-conditional cell division. The alterations are produced, in some of the strains, by pleiotropic mutations in gene envB. Strains affected in divC, divD, and rodA loci have also been identified. Genetic analaysis has shown that several strains carry more than one envelope mutation. It is assumed that envelope mutations are positively selected because they somehow alleviate the particularly severe inhibition of cell division caused, in strains SB564 and DA78, by the excessive synthesis of hisF and hisH gene products

  1. Impact of alg3 gene deletion on growth, development, pigment production, protein secretion, and functions of recombinant Trichoderma reesei cellobiohydrolases in Aspergillus niger

    Energy Technology Data Exchange (ETDEWEB)

    Dai, Ziyu; Aryal, Uma K.; Shukla, Anil; Qian, Wei-Jun; Smith, Richard D.; Magnuson, Jon K.; Adney, William S.; Beckham, Gregg T.; Brunecky, Roman; Himmel, Michael E.; Decker, Stephen R.; Ju, Xiaohui; Zhang, Xiao; Baker, Scott E.

    2013-12-01

    ALG3 is a Family 58 glycosyltransferase enzyme involved in early N-linked glycan synthesis. Here, we investigated the effect of the alg3 gene disruption on growth, development, metabolism, and protein secretion in Aspergillus niger. The alg3 gene deletion resulted in a significant reduction of growth on complete (CM) and potato dextrose agar (PDA) media and a substantial reduction of spore production on CM. It also delayed spore germination in the liquid cultures of both CM and PDA media, but led to a significant accumulation of red pigment on both CM and liquid modified minimal medium (MM) supplemented with yeast extract. The relative abundance of 55 proteins of the total 190 proteins identified in the secretome was significantly different as a result of alg3 gene deletion. Comparison of a Trichoderma reesei cellobiohydrolase (Cel7A) heterologously expressed in A. niger parental and Δalg3 strains showed that the recombinant Cel7A expressed in the mutant background was smaller in size than that from the parental strains. This study suggests that ALG3 is critical for growth and development, pigment production, and protein secretion in A. niger. Functional analysis of recombinant Cel7A with aberrant glycosylation demonstrates the feasibility of this alternative approach to evaluate the role of N-linked glycosylation in glycoprotein secretion and function.

  2. Characterization of the wzc gene from Pantoea sp. strain PPE7 and its influence on extracellular polysaccharide production and virulence on Pleurotus eryngii.

    Science.gov (United States)

    Kim, Min Keun; Lee, Young Han; Kim, Hyeran; Lee, Jeongyeo; Ryu, Jae San

    2015-01-01

    To characterize of the pathogenicity gene from the soft rot pathogen Pantoea sp. PPE7 in Pleurotus eryngii, we constructed over 10,000 kanamycin-resistant transposon mutants of Pantoea sp. strain PPE7 by transposon mutagenesis. One mutant, Pantoea sp. NPPE9535, did not cause a soft rot disease on Pleurotus eryngii was confirmed by the pathogenicity test. The transposon was inserted into the wzc gene and the disruption of the wzc gene resulted in the reduction of polysaccharide production and abolished the virulence of Pantoea sp. strain PPE7 in P. eryngii. Analysis of the hydropathic profile of this protein indicated that it is composed of two main domains: an N-terminal domain including two transmembrane α-helices and a C-terminal cytoplasmic domain consisting of a tyrosine-rich region. Comparative analysis indicated that the amino acid sequence of Wzc is similar to that of a number of proteins involved in the synthesis or export of polysaccharides in other bacterial species. Purified GST-Wzc was found to affect the phosphorylation of tyrosine residue in vivo. These results showed that the wzc gene might play an important role in the virulence of Pantoea sp. strain PPE7 in P. eryngii. PMID:25183654

  3. Transcriptome sequencing and annotation of the microalgae Dunaliella tertiolecta: Pathway description and gene discovery for production of next-generation biofuels

    Directory of Open Access Journals (Sweden)

    Bibby Kyle

    2011-03-01

    Full Text Available Abstract Background Biodiesel or ethanol derived from lipids or starch produced by microalgae may overcome many of the sustainability challenges previously ascribed to petroleum-based fuels and first generation plant-based biofuels. The paucity of microalgae genome sequences, however, limits gene-based biofuel feedstock optimization studies. Here we describe the sequencing and de novo transcriptome assembly for the non-model microalgae species, Dunaliella tertiolecta, and identify pathways and genes of importance related to biofuel production. Results Next generation DNA pyrosequencing technology applied to D. tertiolecta transcripts produced 1,363,336 high quality reads with an average length of 400 bases. Following quality and size trimming, ~ 45% of the high quality reads were assembled into 33,307 isotigs with a 31-fold coverage and 376,482 singletons. Assembled sequences and singletons were subjected to BLAST similarity searches and annotated with Gene Ontology (GO and Kyoto Encyclopedia of Genes and Genomes (KEGG orthology (KO identifiers. These analyses identified the majority of lipid and starch biosynthesis and catabolism pathways in D. tertiolecta. Conclusions The construction of metabolic pathways involved in the biosynthesis and catabolism of fatty acids, triacylglycrols, and starch in D. tertiolecta as well as the assembled transcriptome provide a foundation for the molecular genetics and functional genomics required to direct metabolic engineering efforts that seek to enhance the quantity and character of microalgae-based biofuel feedstock.

  4. Identification of a second Escherichia coli groE gene whose product is necessary for bacteriophage morphogenesis.

    OpenAIRE

    Tilly, K; Murialdo, H; Georgopoulos, C

    1981-01-01

    Previous work has uncovered the existence of an Escherichia coli locus, groE, that is essential for bacterial growth, lambda phage and T4 phage head morphogenesis, and T5 phage tail assembly. Our genetic and biochemical analyses of lambda groE+ transducing phages and their deletion and point mutant derivatives show that the groE locus consists of two closely linked genes. One groE gene, groEL, has been shown to encode the synthesis of a 65,000 Mr polypeptide, whereas the second, groES, codes ...

  5. Coordinate genetic regulation of glycogen catabolism and biosynthesis in Escherichia coli via the CsrA gene product.

    OpenAIRE

    Yang, H.; Liu, M Y; Romeo, T

    1996-01-01

    The carbon storage regulator gene, csrA, encodes a factor which negatively modulates the expression of the glycogen biosynthetic gene glgC by enhancing the decay of its mRNA (M. Y. Liu, H. Yang, and T. Romeo, J. Bacteriol. 177:2663-2672, 1995). When endogenous glycogen levels in isogenic csrA+ and csrA::kanR strains were quantified during the growth curve, both the rate of glycogen accumulation during late exponential or early stationary phase and its subsequent rate of degradation were found...

  6. Characterization and overexpression of the Lactococcus lactis pepN gene and localization of its product, aminopeptidase N.

    OpenAIRE

    van Alen-Boerrigter, I J; Baankreis, R; de Vos, W M

    1991-01-01

    The chromosomal pepN gene encoding lysyl-aminopeptidase activity in Lactococcus lactis has been identified in a lambda EMBL3 library in Escherichia coli by using an immunological screening with antiserum against a purified aminopeptidase fraction. The pepN gene was localized and subcloned in E. coli on the basis of its expression and hybridization to a mixed-oligonucleotide probe for the previously determine N-terminal amino acid sequence of lysyl-aminopeptidase (P. S. T. Tan and W. N. Koning...

  7. Differential regulation of gene products in newly synthesized Brassica napus allotetraploids is not related to protein function nor subcellular localization

    Directory of Open Access Journals (Sweden)

    Valot Benoît

    2007-02-01

    -represented among the proteins displaying non-additive values in the allopolyploids. Conclusion Protein identification showed that functionally related polypeptides (isoforms and complex subunits could be differentially regulated in synthetic B. napus in comparison to its diploid progenitors while such proteins are usually expected to display co-regulation. The genetic redundancy within an allopolyploid could explain why functionally related proteins could display imbalanced levels of expression. No functional category, no metabolic pathway and no subcellular localization was found to be over- or under-represented within non-additive polypeptides, suggesting that the differential regulation of gene products was not related to functional properties of the proteins. Thus, at the protein level, there is no evidence for the "genomic shock" expected in neo-polyploids and the overall topology of protein networks and metabolic pathways is conserved in synthetic allotetraploids of B. napus in comparison to its diploid progenitors B. rapa and B. oleracea.

  8. The gpsX gene encoding a glycosyltransferase is important for polysaccharide production and required for full virulence in Xanthomonas citri subsp. citri

    Directory of Open Access Journals (Sweden)

    Li Jinyun

    2012-03-01

    Full Text Available Abstract Background The Gram-negative bacterium Xanthomonas citri subsp. citri (Xac causes citrus canker, one of the most destructive diseases of citrus worldwide. In our previous work, a transposon mutant of Xac strain 306 with an insertion in the XAC3110 locus was isolated in a screening that aimed at identifying genes related to biofilm formation. The XAC3110 locus was named as bdp24 for biofilm-defective phenotype and the mutant was observed to be affected in extracellular polysaccharide (EPS and lipopolysaccharide (LPS biosynthesis and cell motility. In this study, we further characterized the bdp24 (XAC3110 gene (designated as gpsX using genetic complementation assays and expanded the knowledge about the function of the gpsX gene in Xac pathogenesis by investigating the roles of gpsX in EPS and LPS production, cell motility, biofilm formation on host leaves, stress tolerance, growth in planta, and host virulence of the citrus canker bacterium. Results The gpsX gene encodes a putative glycosyltransferase, which is highly conserved in the sequenced strains of Xanthomonas. Mutation of gpsX resulted in a significant reduction of the amount of EPS and loss of two LPS bands visualized on sodium dodecylsulphate- polyacrylamide gels. Biofilm assays revealed that the gpsX mutation affected biofilm formation by Xac on abiotic and biotic surfaces. The gpsX mutant showed delayed bacterial growth and caused reduced development of disease symptoms in susceptible citrus leaves. The gpsX mutant was more sensitive than the wild-type strain to various stresses, including the H2O2 oxidative stress. The mutant also showed attenuated ability in cell motility but not in flagellar formation. Quantitative reverse transcription-PCR assays indicated that mutation of gpsX did not affect the expression of virulence genes such as pthA in Xac strain 306. The affected phenotypes of the gpsX mutant could be complemented to wild-type levels by the intact gpsX gene

  9. Circadian Clock genes Per2 and clock regulate steroid production, cell proliferation, and luteinizing hormone receptor transcription in ovarian granulosa cells

    International Nuclear Information System (INIS)

    Highlights: → Treatment with Per2 and Clock siRNAs decreased the number of granulosa cells and LHr expression. →Per2 siRNA treatment did not stimulate the production of estradiol and expression of P450arom. → Clock siRNA treatment inhibited the production of estradiol and expression of P450arom mRNA. →Per2 and Clock siRNA treatment increased and unchanged, respectively, progesterone production in FSH-treated granulosa cells. → The expression of StAR mRNA was increased by Per2 siRNA and unchanged by Clock siRNA. -- Abstract: Circadian Clock genes are associated with the estrous cycle in female animals. Treatment with Per2 and Clock siRNAs decreased the number of granulosa cells and LHr expression in follicle-stimulating hormone FSH-treated granulosa cells. Per2 siRNA treatment did not stimulate the production of estradiol and expression of P450arom, whereas Clock siRNA treatment inhibited the production of estradiol and expression of P450arom mRNA. Per2 and Clock siRNA treatment increased and unchanged, respectively, progesterone production in FSH-treated granulosa cells. Similarly, expression of StAR mRNA was increased by Per2 siRNA and unchanged by Clock siRNA. Our data provide a new insight that Per2 and Clock have different action on ovarian granulosa cell functions.

  10. Production of Polyclonal Antiobies to a Recombinant Potato Mop-top Virus Non-structural Triple Gene Block Protein l

    Czech Academy of Sciences Publication Activity Database

    Čeřovská, Noemi; Filigarová, Marie; Pečenková, Tamara

    2006-01-01

    Roč. 154, - (2006), s. 422-427. ISSN 0931-1785 R&D Projects: GA ČR GA522/04/1329 Institutional research plan: CEZ:AV0Z50380511 Keywords : Potato mop-top virus * recombinant protein * triple gene block * polyclonal antibodies Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.817, year: 2006

  11. Gene Sequence Based Clustering Assists in Dereplication of Pseudoalteromonas luteoviolacea Strains with Identical Inhibitory Activity and Antibiotic Production

    DEFF Research Database (Denmark)

    Vynne, Nikolaj Grønnegaard; Månsson, Maria; Gram, Lone

    2012-01-01

    Some microbial species are chemically homogenous, and the same secondary metabolites are found in all strains. In contrast, we previously found that five strains of P. luteoviolacea were closely related by 16S rRNA gene sequence but produced two different antibiotic profiles. The purpose of the p...

  12. Aberrant splicing and missense mutations cause steroid 21-hydroxylase [P-450(C21)] deficiency in humans: Possible gene conversion products

    International Nuclear Information System (INIS)

    Four steroid 21-hydroxylase B [P-450(C21)B] genes (designated P.7, P.10-1, P.10-2, and P.3) from three P-450(C21)-deficient patients were isolated to analyze their structures and functions. Several base changes were observed in the sequences of the four P-450(C21)B genes as compared to that of the functional B gene. Many of these base changes were identical to those of the P-450(C21)A pseudogene. The three DNAs (P.10-1, P.10.2, and P.3) produced no P-450(C21) activity in a functional assay for P-450(C21) by the COS cell expression system, while the P.7 DNA expressed the activity. The P.10-1 and P.10-2 DNAs were shown to have a point mutation in the second intron, causing aberrant splicing. The P.3 DNA carried three clustered missense mutations in the sixty exon, which impaired P-450(C21) activity. All these critical mutations could be seen in the corresponding site of the P-450(C21)A pseudogene. These data strongly suggest the involvement of gene conversion in this genetic disease

  13. The Retrovirus pol Gene Encodes a Product Required for DNA Integration: Identification of a Retrovirus int Locus

    Science.gov (United States)

    Panganiban, Antonito T.; Temin, Howard M.

    1984-12-01

    We mutagenized cloned spleen necrosis virus DNA to identify a region of the retrovirus genome encoding a polypeptide required for integration of viral DNA. Five plasmids bearing different lesions in the 3' end of the pol gene were examined for the ability to integrate or replicate following transfection of chicken embryo fibroblasts. Transfection with one of these DNAs resulted in the generation of mutant virus incapable of integrating but able to replicate at low levels; this phenotype is identical to that of mutants bearing alterations in the cis-acting region, att. To determine whether the 3' end of the pol gene encodes a protein that interacts with att, we did a complementation experiment. Cells were first infected with an att- virus and then superinfected with the integration-deficient virus containing a lesion in the pol gene and a wild-type att site. The results showed that the att- virus provided a trans-acting function allowing integration of viral DNA derived from the mutant bearing a wild-type att site. Thus, the 3' end of the pol gene serves as an ``int'' locus and encodes a protein mediating integration of retrovirus DNA through interaction with att.

  14. Amino-terminal domains of c-myc and N-myc proteins mediate binding to the retinoblastoma gene product

    NARCIS (Netherlands)

    Rustgi, A.K.; Dyson, N.; Bernards, R.A.

    1991-01-01

    The proteins encoded by the myc gene family are involved is the control of cell proliferation and differentiation, and aberrant expression of myc proteins has been implicated in the genesis of a variety of neoplasms. In the carboxyl terminus, myc proteins have two domains that encode a basic domain/

  15. Male- and female-specific variants of doublesex gene products have different roles to play towards regulation of Sex combs reduced expression and sex comb morphogenesis in Drosophila

    Indian Academy of Sciences (India)

    Thangjam Ranjita Devi; B V Shyamala

    2013-09-01

    Sexually dimorphic characters have two-fold complexities in pattern formation as they have to get input fromboth somatic sex determination as well as the positional determining regulators. Sex comb development in Drosophila requires functions of the somatic sex-determining gene doublesex and the homeotic gene Sex combs reduced. Attempts have not been made to decipher the role of dsx in imparting sexually dimorphic expression of SCR and the differential function of sex-specific variants of dsx products in sex comb development. Our results in this study indicate that male-like pattern of SCR expression is independent of dsx function, and dsxF must be responsible for bringing about dimorphism in SCR expression, whereas dsxM function is required with Scr for the morphogenesis of sex comb.

  16. Production and processing studies on calpain-system gene markers for tenderness in Brahman cattle: 2. Objective meat quality.

    Science.gov (United States)

    Cafe, L M; McIntyre, B L; Robinson, D L; Geesink, G H; Barendse, W; Pethick, D W; Thompson, J M; Greenwood, P L

    2010-09-01

    Effects and interactions of calpain-system tenderness gene markers on objective meat quality traits of Brahman (Bos indicus) cattle were quantified within 2 concurrent experiments at different locations. Cattle were selected for study from commercial and research herds at weaning based on their genotype for calpastatin (CAST) and calpain 3 (CAPN3) gene markers for beef tenderness. Gene marker status for mu-calpain (CAPN1-4751 and CAPN1-316) was also determined for inclusion in statistical analyses. Eighty-two heifer and 82 castrated male cattle with 0 or 2 favorable alleles for CAST and CAPN3 were studied in New South Wales (NSW), and 143 castrated male cattle with 0, 1, or 2 favorable alleles for CAST and CAPN3 were studied in Western Australia (WA). The cattle were backgrounded for 6 to 8 mo and grain-fed for 117 d (NSW) or 80 d (WA) before slaughter. One-half the cattle in each experiment were implanted with a hormonal growth promotant during feedlotting. One side of each carcass was suspended from the Achilles tendon (AT) and the other from the pelvis (tenderstretch). The M. longissimus lumborum from both sides and the M. semitendinosus from the AT side were collected; then samples of each were aged at 1 degrees C for 1 or 7 d. Favorable alleles for one or more markers reduced shear force, with little effect on other meat quality traits. The size of effects of individual markers varied with site, muscle, method of carcass suspension, and aging period. Individual marker effects were additive as evident in cattle with 4 favorable alleles for CAST and CAPN3 markers, which had shear force reductions of 12.2 N (P 0.05) of interactions between the gene markers, or between the hormonal growth promotant and gene markers for any meat quality traits. This study provides further evidence that selection based on the CAST or CAPN3 gene markers improves meat tenderness in Brahman cattle, with little if any detrimental effects on other meat quality traits. The CAPN1-4751 gene

  17. Putrescine production by Lactococcus lactis subsp. cremoris CECT 8666 is reduced by NaCl via a decrease in bacterial growth and the repression of the genes involved in putrescine production.

    Science.gov (United States)

    Del Rio, Beatriz; Redruello, Begoña; Ladero, Victor; Fernandez, Maria; Martin, Maria Cruz; Alvarez, Miguel A

    2016-09-01

    The reduction of NaCl in food is a public health priority; high NaCl intakes have been associated with serious health problems. However, it is reported that reducing the NaCl content of cheeses may lead to an increase in the content of biogenic amines (BAs). The present work examines the effect of NaCl on the accumulation of putrescine (one of the BAs often detected at high concentration in cheese) in experimental Cabrales-like cheeses containing Lactococcus lactis subsp. cremoris CECT 8666, a dairy strain that catabolises agmatine to putrescine via the agmatine deiminase (AGDI) pathway. The genes responsible for this pathway are grouped in the AGDI cluster. This comprises a regulatory gene (aguR) (transcribed independently), followed by the catabolic genes that together form an operon (aguBDAC). Reducing the NaCl concentration of the cheese led to increased putrescine accumulation. In contrast, increasing the NaCl concentration of both pH-uncontrolled and pH-controlled (pH 6) cultures of L. lactis subsp. cremoris CECT 8666 significantly inhibited its growth and the production of putrescine. Such production appeared to be inhibited via a reduction in the transcription of the aguBDAC operon; no effect on the transcription of aguR was recorded. The present results suggest that low-sodium cheeses are at risk of accumulating higher concentrations of putrescine. PMID:27218410

  18. Enhancement of carotenoid production by disrupting the C22-sterol desaturase gene (CYP61 in Xanthophyllomyces dendrorhous

    Directory of Open Access Journals (Sweden)

    Loto Iris

    2012-10-01

    Full Text Available Abstract Background Xanthophyllomyces dendrorhous is a basidiomycetous yeast that synthesizes astaxanthin, which is a carotenoid with a great biotechnological impact. The ergosterol and carotenoid synthesis pathways are derived from the mevalonate pathway, and in both pathways, cytochrome P450 enzymes are involved. Results In this study, we isolated and described the X. dendrorhous CYP61 gene, which encodes a cytochrome P450 involved in ergosterol biosynthesis. This gene is composed of nine exons and encodes a 526 amino acid polypeptide that shares significant percentages of identity and similitude with the C22-sterol desaturase, CYP61, from other fungi. Mutants derived from different parental strains were obtained by disrupting the CYP61 gene with an antibiotic selection marker. These mutants were not able to produce ergosterol and accumulated ergosta-5,8,22-trien-3-ol and ergosta-5,8-dien-3-ol. Interestingly, all of the mutants had a more intense red color phenotype than their respective parental strains. The carotenoid composition was qualitatively and quantitatively analyzed by RP-HPLC, revealing that the carotenoid content was higher in the mutant strains without major changes in their composition. The expression of the HMGR gene, which encodes an enzyme involved in the mevalonate pathway (3-hydroxy-3-methylglutaryl-CoA reductase, was analyzed by RT-qPCR showing that its transcript levels are higher in the CYP61 mutants. Conclusions These results suggest that in X. dendrorhous, ergosterol regulates HMGR gene expression by a negative feedback mechanism and in this way; it contributes in the regulation of the carotenoid biosynthesis.

  19. Evaluation of the utility of the FecB gene to improve the productivity of Deccani sheep in Maharashtra, India

    International Nuclear Information System (INIS)

    Reproductive performance was analysed of 1/4 Garole ewes (with 3/4 comprising different combinations of Deccani and Bannur genes), 97 of them heterozygous (B+) for the FecB (Booroola) gene and 99 non-carrier (++). These ewes belong to the first backcross in the programme of introgression of the FecB gene into the Deccani breed, which is one of the main meat-producing breeds in India. Compared with ++ ewes, B+ ewes gave birth to 0.5 more lambs per ewe lambing, weaned 0.3 more lambs and produced 1.1 kg greater lamb weight at 105 days, and this was a significant effect. Of the litters produced by B+ ewes, 49 percent were twins, 2.5 percent triplets and the rest singles. The effect of FecB thus appears to be smaller compared with literature reports based on Booroola Merino and its crosses. A moderate effect implies easier manageability. Management efforts are still needed to reduce lamb mortality, especially among multiple-born lambs. Compared with single-bearing ewes, twin-bearing ewes weaned 0.7 more lambs and produced 2.4 kg more weight of lamb at 105 days. Triplet-bearing ewes weaned 0.5 more lambs and 4.7 kg more weight of lamb than twin-bearing ewes. Genes from the small-sized and locally unadapted Garole, with inferior mothering ability, probably had an adverse effect on milk yield, lamb survival and growth. Weaning percentage is likely to improve with further backcrossing. Two unique features of this study are that the gene was introgressed from the Garole and not the Booroola Merino, and all ewes were genotyped using a DNA test rather than classified according to the ovulation rate criterion. The participation of local smallholder sheep owners in the project will improve its chances of successful implementation. (author)

  20. An Overgrowth Disorder Associated with Excessive Production of cGMP Due to a Gain-of-Function Mutation of the Natriuretic Peptide Receptor 2 Gene

    Science.gov (United States)

    Miura, Kohji; Namba, Noriyuki; Fujiwara, Makoto; Ohata, Yasuhisa; Ishida, Hidekazu; Kitaoka, Taichi; Kubota, Takuo; Hirai, Haruhiko; Higuchi, Chikahisa; Tsumaki, Noriyuki; Yoshikawa, Hideki; Sakai, Norio; Michigami, Toshimi; Ozono, Keiichi

    2012-01-01

    We describe a three-generation family with tall stature, scoliosis and macrodactyly of the great toes and a heterozygous p.Val883Met mutation in Npr2, the gene that encodes the CNP receptor NPR2 (natriuretic peptide receptor 2). When expressed in HEK293A cells, the mutant Npr2 cDNA generated intracellular cGMP (cyclic guanosine monophosphate) in the absence of CNP ligand. In the presence of CNP, cGMP production was greater in cells that had been transfected with the mutant Npr2 cDNA compared to wild-type cDNA. Transgenic mice in which the mutant Npr2 was expressed in chondrocytes driven by the promoter and intronic enhancer of the Col11a2 gene exhibited an enhanced production of cGMP in cartilage, leading to a similar phenotype to that observed in the patients. In addition, blood cGMP concentrations were elevated in the patients. These results indicate that p.Val883Met is a constitutive active gain-of-function mutation and elevated levels of cGMP in growth plates lead to the elongation of long bones. Our findings reveal a critical role for NPR2 in skeletal growth in both humans and mice, and may provide a potential target for prevention and treatment of diseases caused by impaired production of cGMP. PMID:22870295

  1. An overgrowth disorder associated with excessive production of cGMP due to a gain-of-function mutation of the natriuretic peptide receptor 2 gene.

    Directory of Open Access Journals (Sweden)

    Kohji Miura

    Full Text Available We describe a three-generation family with tall stature, scoliosis and macrodactyly of the great toes and a heterozygous p.Val883Met mutation in Npr2, the gene that encodes the CNP receptor NPR2 (natriuretic peptide receptor 2. When expressed in HEK293A cells, the mutant Npr2 cDNA generated intracellular cGMP (cyclic guanosine monophosphate in the absence of CNP ligand. In the presence of CNP, cGMP production was greater in cells that had been transfected with the mutant Npr2 cDNA compared to wild-type cDNA. Transgenic mice in which the mutant Npr2 was expressed in chondrocytes driven by the promoter and intronic enhancer of the Col11a2 gene exhibited an enhanced production of cGMP in cartilage, leading to a similar phenotype to that observed in the patients. In addition, blood cGMP concentrations were elevated in the patients. These results indicate that p.Val883Met is a constitutive active gain-of-function mutation and elevated levels of cGMP in growth plates lead to the elongation of long bones. Our findings reveal a critical role for NPR2 in skeletal growth in both humans and mice, and may provide a potential target for prevention and treatment of diseases caused by impaired production of cGMP.

  2. Increased enzyme production under liquid culture conditions in the industrial fungus Aspergillus oryzae by disruption of the genes encoding cell wall α-1,3-glucan synthase.

    Science.gov (United States)

    Miyazawa, Ken; Yoshimi, Akira; Zhang, Silai; Sano, Motoaki; Nakayama, Mayumi; Gomi, Katsuya; Abe, Keietsu

    2016-09-01

    Under liquid culture conditions, the hyphae of filamentous fungi aggregate to form pellets, which reduces cell density and fermentation productivity. Previously, we found that loss of α-1,3-glucan in the cell wall of the fungus Aspergillus nidulans increased hyphal dispersion. Therefore, here we constructed a mutant of the industrial fungus A. oryzae in which the three genes encoding α-1,3-glucan synthase were disrupted (tripleΔ). Although the hyphae of the tripleΔ mutant were not fully dispersed, the mutant strain did form smaller pellets than the wild-type strain. We next examined enzyme productivity under liquid culture conditions by transforming the cutinase-encoding gene cutL1 into A. oryzae wild-type and the tripleΔ mutant (i.e. wild-type-cutL1, tripleΔ-cutL1). A. oryzae tripleΔ-cutL1 formed smaller hyphal pellets and showed both greater biomass and increased CutL1 productivity compared with wild-type-cutL1, which might be attributable to a decrease in the number of tripleΔ-cutL1 cells under anaerobic conditions. PMID:27442340

  3. Involvement of helicase II (uvrD gene product) and DNA polymerase I in excision mediated by the uvrABC protein complex

    Energy Technology Data Exchange (ETDEWEB)

    Caron, P.R.; Kushner, S.R.; Grossman, L.

    1985-08-01

    The bimodal-incision nature of the reaction of UV-irradiated DNA catalyzed by the Escherichia coli uvrABC protein complex potentially leads to excision of a 12- to 13-nucleotide-long damaged fragment. However, the oligonucleotide fragment containing the UV-induced pyrimidine dimer is not released under nondenaturing in vitro reaction conditions. Also, the uvrABC proteins are stably bound to the incised DNA and do not turn over after the incision event. In this communication it is shown that release of the damaged fragment from the parental uvrABC-incised DNA is dependent upon either chelating conditions or the simultaneous addition of the uvrD gene product (helicase II) and the polA gene product (DNA polymerase I) when polymerization of deoxynucleoside triphosphate substrates is concomitantly catalyzed. The product of this multiprotein-catalyzed series of reactions serves as a substrate for polynucleotide ligase, resulting in the restoration of the integrity of the strands of DNA. The addition of the uvrD protein to the incised DNA-uvrABC complex also results in turnover of the uvrC protein. It is suggested that the repair processes of incision, excision, resynthesis, and ligation are coordinately catalyzed by a complex of proteins in a ''repairosome'' configuration.

  4. Involvement of helicase II (uvrD gene product) and DNA polymerase I in excision mediated by the uvrABC protein complex

    International Nuclear Information System (INIS)

    The bimodal-incision nature of the reaction of UV-irradiated DNA catalyzed by the Escherichia coli uvrABC protein complex potentially leads to excision of a 12- to 13-nucleotide-long damaged fragment. However, the oligonucleotide fragment containing the UV-induced pyrimidine dimer is not released under nondenaturing in vitro reaction conditions. Also, the uvrABC proteins are stably bound to the incised DNA and do not turn over after the incision event. In this communication it is shown that release of the damaged fragment from the parental uvrABC-incised DNA is dependent upon either chelating conditions or the simultaneous addition of the uvrD gene product (helicase II) and the polA gene product (DNA polymerase I) when polymerization of deoxynucleoside triphosphate substrates is concomitantly catalyzed. The product of this multiprotein-catalyzed series of reactions serves as a substrate for polynucleotide ligase, resulting in the restoration of the integrity of the strands of DNA. The addition of the uvrD protein to the incised DNA-uvrABC complex also results in turnover of the uvrC protein. It is suggested that the repair processes of incision, excision, resynthesis, and ligation are coordinately catalyzed by a complex of proteins in a ''repairosome'' configuration

  5. Advanced cell culture technology for essential oil production and micro array studies leading to discovery of genes for fragrance compounds in Michelia alba (Cempaka Putih)

    International Nuclear Information System (INIS)

    Michelia spp. is known to produce high value essential oil for perfumery industry. The essence of world's most expensive perfumes, such as JOY and Jadore, is based on the oil of Michelia spp. One major problem anticipated in this approach, based on our early experiments, is limited amount of fragrance produced in cell cultures. The appropriate strategy is to superimpose DNA micro array studies on top of the cell culture project. The study covers natural flower development phases that led to the identification of genes or sets of genes that regulate the production of the fragrance. Seven developmental stages of Michelia alba flower namely Stage 5 to 11 were investigated for their volatile constituents. The essential oil was isolated by Simultaneous Distillation Extraction technique and the oil obtained was subjected to GC-MS analysis. In total, seventy-seven compounds representing 93-98% of the overall volatiles compounds were identified on the basis of mass spectra and retention indices. Thirty-three of these compounds belonged to isoprenoids group which comprised 30-50% of the total volatile compounds whereas the remaining belonged to fatty acid derivatives, benzenoid, phenylpropanoid and other hydrocarbon compounds. Studies were conducted to optimize culture parameters for scaling-up the production of callus, suspension cell cultures and somatic and product accumulation of essential oils using bioreactor technology. (Author)

  6. The effects of disruption of phosphoglucose isomerase gene on carbon utilisation and cellulase production in Trichoderma reesei Rut-C30

    Directory of Open Access Journals (Sweden)

    Pakula Tiina

    2011-05-01

    Full Text Available Abstract Background Cellulase and hemicellulase genes in the fungus Trichoderma reesei are repressed by glucose and induced by lactose. Regulation of the cellulase genes is mediated by the repressor CRE1 and the activator XYR1. T. reesei strain Rut-C30 is a hypercellulolytic mutant, obtained from the natural strain QM6a, that has a truncated version of the catabolite repressor gene, cre1. It has been previously shown that bacterial mutants lacking phosphoglucose isomerase (PGI produce more nucleotide precursors and amino acids. PGI catalyzes the second step of glycolysis, the formation of fructose-6-P from glucose-6-P. Results We deleted the gene pgi1, encoding PGI, in the T. reesei strain Rut-C30 and we introduced the cre1 gene in a Δpgi1 mutant. Both Δpgi1 and cre1+Δpgi1 mutants showed a pellet-like and growth as well as morphological alterations compared with Rut-C30. None of the mutants grew in media with fructose, galactose, xylose, glycerol or lactose but they grew in media with glucose, with fructose and glucose, with galactose and fructose or with lactose and fructose. No growth was observed in media with xylose and glucose. On glucose, Δpgi1 and cre1+Δpgi1 mutants showed higher cellulase activity than Rut-C30 and QM6a, respectively. But in media with lactose, none of the mutants improved the production of the reference strains. The increase in the activity did not correlate with the expression of mRNA of the xylanase regulator gene, xyr1. Δpgi1 mutants were also affected in the extracellular β-galactosidase activity. Levels of mRNA of the glucose 6-phosphate dehydrogenase did not increase in Δpgi1 during growth on glucose. Conclusions The ability to grow in media with glucose as the sole carbon source indicated that Trichoderma Δpgi1 mutants were able to use the pentose phosphate pathway. But, they did not increase the expression of gpdh. Morphological characteristics were the result of the pgi1 deletion. Deletion of pgi1 in

  7. Itaconic acid production from glycerol using Escherichia coli harboring a random synonymous codon-substituted 5'-coding region variant of the cadA gene.

    Science.gov (United States)

    Jeon, Ho-Geun; Cheong, Dae-Eun; Han, Yunjon; Song, Jae Jun; Choi, Jong Hyun

    2016-07-01

    Aspergillus terreus cadA, encoding cis-aconitate decarboxylase, is an essential gene for itaconic acid (IA) biosynthesis, but it is primarily expressed as insoluble aggregates in most industrial hosts. This has been a hurdle for the development of recombinant strategies for IA production. Here, we created a library of synonymous codon variants (scv) of the cadA gene containing synonymous codons in the first 10 codons (except ATG) and screened it in Escherichia coli. Among positive clones, E. coli scvCadA_No8 showed more than 95% of expressed CadA in the soluble fraction, and in production runs, produced threefold more IA than wild-type E. coli in Luria-Bertani broth supplemented with 0.5% glucose. In M9 minimal media containing 0.85 g/L citrate and 1% glycerol, E. coli scvCadA_No8 produced 985.6 ± 33.4 mg/L IA during a 72-h culture after induction with isopropyl β-D-1-thiogalactopyranoside. In a 2-L fed-batch fermentation consisting of two stages (growth and nitrogen limitation conditions), we obtained 7.2 g/L IA by using E. coli by introducing only the scv_cadA gene and optimizing culture conditions for IA production. These results could be combined with metabolic engineering and generate an E. coli strain as an industrial IA producer. Biotechnol. Bioeng. 2016;113: 1504-1510. © 2015 Wiley Periodicals, Inc. PMID:26704570

  8. A selective genotyping approach identifies single nucleotide polymorphisms in porcine chromosome 2 genes associated with production and carcass traits in Italian heavy pigs

    Directory of Open Access Journals (Sweden)

    Vincenzo Russo

    2011-04-01

    Full Text Available Several studies have shown that porcine chromosome 2 (SSC2 harbors important quantitative trait loci (QTL for production traits. In particular, an imprinted QTL for muscle mass production is determined by a mutation in the IGF2 gene (intron3-g.3072G>A. We recently identified and analysed single nucleotide polymorphisms (SNPs in genes (cathepsin D, CTSD g.70G>A; cathepsin F, CTSF g.22G>C; lactate dehydrogenase A, LDHA g.46G>T localized on SSC2 (including the IGF2 intron3-g.3072G>A SNP showing association with production traits in Italian Large White pigs and/or localizing them on QTL regions. Here we analysed these markers applying a selective genotyping approach based on estimated breeding values (EBVs. Three groups of Italian Large White pigs each made by animals with the most positive (n. 50 and most negative (n. 50 EBVs for average daily gain (ADG, backfat thickness (BFT or weight of lean cuts (LC and one group of Italian Duroc pigs made by 50 animals with most positive and 50 animals with most negative EBV for visible intermuscular fat (VIF were genotyped. In Italian Large White pigs, allele frequency differences for the IGF2 intron3-g.3072G>A SNP between the two extreme tails for all groups were highly significant (considering all analysed animals: P=9.53E-20 for LC; P=3.16E-15 for BFT; P=4.41E-6 for ADG. Significant allele frequency differences were also observed for the CTSD g.70G>A (P=0.0002 for ADG; P=0.00068 and LDHA g.46G>T (P=2.32E-5 for ADG polymorphisms. These results provide further support on the effects of these polymorphisms or genes whose application on marker assisted selection programs could be envisaged.

  9. The defH9-iaaM auxin-synthesizing gene increases plant fecundity and fruit production in strawberry and raspberry

    OpenAIRE

    Pandolfini Tiziana; Landi Lucia; Mezzetti Bruno; Spena Angelo

    2004-01-01

    Abstract Background The DefH9-iaaM gene fusion which is expressed specifically in placenta/ovules and promotes auxin-synthesis confers parthenocarpic fruit development to eggplant, tomato and tobacco. Transgenic DefH9-iaaM eggplants and tomatoes show increased fruit production due mainly to an improved fruit set. However, the weight of the fruits is also frequently increased. Results DefH9-iaaM strawberry and raspberry plants grown under standard cultivation conditions show a significant incr...

  10. The Use of Cytochrome b Gene as a Specific Marker of the Rat Meat (Rattus norvegicus) on Meat and Meat Products

    OpenAIRE

    C Sumantri; E. Andreas; A. Primasari; H. Nuraini

    2012-01-01

    Falsification of the origin of livestock meat and its processed with rat meat is a problem that must be overcome to ensure food safety. One way that is often used to detect forgeries by using cytochrome b gene as a marker. The purpose of this study was to create a specific primer derived from cytochrome b sequences in rat (Rattus norvegicus) as the DNA marker to detect any contamination of rat meat on fresh livestock meat and its processed meat products. Meatballs were made from beef meat wit...

  11. Simian virus 40 T antigen can transcriptionally activate and mediate viral DNA replication in cells which lack the retinoblastoma susceptibility gene product.

    OpenAIRE

    Trifillis, P; Picardi, J; Alwine, J C

    1990-01-01

    Simian virus 40 T antigen is a multifunctional protein which has recently been shown to form a complex with the retinoblastoma susceptibility gene product (Rb protein) (J.A. DeCaprio, J.W. Ludlow, J. Figge, J.-Y. Shaw, C.-M. Huang, W.-H. Lee, E. Marsilio, E. Paucha, and D.M. Livingston, Cell 54:275-283, 1988; P. Whyte, K.J. Buchkovich, J.M. Horowitz, S.H. Friend, M. Raybuck, R.A. Weinberg, and E. Harlow, Nature (London) 334:124-129, 1988). This interaction may facilitate some of the functions...

  12. Construction of an in vivo System for Functional Analysis of the Genes Involved in Sex Pheromone Production in the Silkmoth, Bombyx mori

    OpenAIRE

    Ken-IchiMoto

    2012-01-01

    Moths produce species-specific sex pheromones to attract conspecific mates. The biochemical processes that comprise sex pheromone biosynthesis are precisely regulated and a number of gene products are involved in this biosynthesis and regulation. In recent years, at least 300 EST clones have been isolated from Bombyx mori pheromone gland (PG) specific cDNA libraries with some of those clones (i.e., B. mori PG-specific desaturase1 (Bmpgdesat1), PG-specific fatty-acyl reductase (pgFAR), PG-spec...

  13. The Vaccinia Virus E8R Gene Product: a Viral Membrane Protein That Is Made Early in Infection and Packaged into the Virions' Core

    OpenAIRE

    Doglio, Laura; de Marco, Ario; Schleich, Sibylle; Roos, Norbert; Krijnse Locker, Jacomine

    2002-01-01

    Vaccinia virus (VV), a member of the poxvirus family, is unique among most other DNA viruses in that both transcription and DNA replication occur in the cytoplasm of the host cell. It was recently shown by electron microscopy (EM) that soon after viral DNA synthesis is initiated in HeLa cells, the replication sites become enwrapped by the membrane of the endoplasmic reticulum (ER). In the same study, a novel VV membrane protein, the E8R gene product, that may play a role in the ER wrapping pr...

  14. Astrocyte production of the chemokine macrophage inflammatory protein-2 is inhibited by the spice principle curcumin at the level of gene transcription

    Directory of Open Access Journals (Sweden)

    Santoro Thomas J

    2005-02-01

    Full Text Available Abstract Background In neuropathological processes associated with neutrophilic infiltrates, such as experimental allergic encephalitis and traumatic injury of the brain, the CXC chemokine, macrophage inflammatory protein-2 (MIP-2 is thought to play a pivotal role in the induction and perpetuation of inflammation in the central nervous system (CNS. The origin of MIP-2 in inflammatory disorders of the brain has not been fully defined but astrocytes appear to be a dominant source of this chemokine. Curcumin is a spice principle in, and constitutes approximately 4 percent of, turmeric. Curcumin's immunomodulating and antioxidant activities suggest that it might be a useful adjunct in the treatment of neurodegenerative illnesses characterized by inflammation. Relatively unexplored, but relevant to its potential therapeutic efficacy in neuroinflammatory syndromes is the effect of curcumin on chemokine production. To examine the possibility that curcumin may influence CNS inflammation by mechanisms distinct from its known anti-oxidant activities, we studied the effect of this spice principle on the synthesis of MIP-2 by astrocytes. Methods Primary astrocytes were prepared from neonatal brains of CBA/CaJ mice. The cells were stimulated with lipopolysaccharide in the presence or absence of various amount of curcumin or epigallocatechin gallate. MIP-2 mRNA was analyzed using semi-quantitative PCR and MIP-2 protein production in the culture supernatants was quantified by ELISA. Astrocytes were transfected with a MIP-2 promoter construct, pGL3-MIP-2, and stimulated with lipopolysaccharide in the presence or absence of curcumin. Results The induction of MIP-2 gene expression and the production of MIP-2 protein were inhibited by curcumin. Curcumin also inhibited lipopolysaccharide-induced transcription of the MIP-2 promoter reporter gene construct in primary astrocytes. However MIP-2 gene induction by lipopolysaccharide was not inhibited by another anti

  15. An alternate pathway to long-chain polyunsaturates: the FADS2 gene product Δ8-desaturates 20:2n-6 and 20:3n-3

    OpenAIRE

    Park, Woo Jung; Kothapalli, Kumar S. D.; Lawrence, Peter; Tyburczy, Cynthia; Brenna, J. Thomas

    2009-01-01

    The mammalian Δ6-desaturase coded by fatty acid desaturase 2 (FADS2; HSA11q12-q13.1) catalyzes the first and rate-limiting step for the biosynthesis of long-chain polyunsaturated fatty acids. FADS2 is known to act on at least five substrates, and we hypothesized that the FADS2 gene product would have Δ8-desaturase activity. Saccharomyces cerevisiae transformed with a FADS2 construct from baboon neonate liver cDNA gained the function to desaturate 11,14-eicosadienoic acid (20:2n-6) and 11,14,1...

  16. Evaluating the influence of light intensity in mcyA gene expression and microcystin production in toxic strains of Planktothrix agardhii and Microcystis aeruginosa.

    Science.gov (United States)

    Salvador, Daniel; Churro, Catarina; Valério, Elisabete

    2016-04-01

    Cyanobacteria are phytoplanktonic organisms widely occurring in freshwaters, being frequently associated with the production of toxins, namely microcystins (MCs). MCs are produced non-ribosomally by a multienzyme complex (mcy genes). It has been reported that environmental factors, such as light intensity, can influence toxin production. The aim of this study was to assess the influence of light intensity in the transcription of the mcyA gene and corresponding production of microcystins in toxic isolates of Planktothrix agardhii, where little is known, and compare them to Microcystis aeruginosa. For that purpose, cultures were exposed to three different light intensities (4, 20 and 30μmol photons m(-2)s(-1)) for 18days at 20±1°C. The growth was followed daily using absorbance readings. Samples were collected at each growth stage for cell counting, microcystins quantification and RNA extraction. The level of transcripts was quantified by RT-qPCR and the relative expression determined using 16S rDNA, gltA and rpoC1 as reference genes. The most stable reference genes in M. aeruginosa were rpoC1 and gltA, whereas in P. agardhii were 16S rDNA and gltA. There was a correspondence between the growth rate and light intensity in M. aeruginosa and P. agardhii. The growth rates for both species were lower at 4 and higher at 30μmol photons m(-2)s(-1). Microcystin concentration per cell was similar between light intensities in M. aeruginosa and over time, while in P. agardhii it was higher in the stationary phase at 4μmol photons m(-2)s(-1). There were differences in the expression of mcyA between the two species. In M. aeruginosa, the highest levels of expression occurred at 4μmol photons m(-2)s(-1) in the adaptation phase, whereas for P. agardhii it was at 4μmol photons m(-2)s(-1) in the exponential growth phase. Our results indicate that the light intensities tested had distinct influences on the growth, microcystin production and mcyA expression levels, presenting

  17. Spontaneous wheat-Aegilops biuncialis, Ae. geniculata and Ae. triuncialis amphiploid production, a potential way of gene transference

    Energy Technology Data Exchange (ETDEWEB)

    Loureiro, I.; Escorial, C.; Garcia-Baudin, J. M.; Chueca, M. C.

    2009-07-01

    Some F1 hybrid plants between three species of the Aegilops genus and different hexaploid wheat Triticum aestivum cultivars show certain self-fertility, with averages of F{sub 1} hybrids bearing F{sub 2} seeds of 8.17%, 5.12% and 48.14% for Aegilops biuncialis, Aegilops geniculata and Aegilops triuncialis respectively. In the Ae. triuncialis-wheat combination with Astral wheat cultivar, the fertility was higher than that found in the other combinations. All the F2 seeds studied were spontaneous amphiploids (2n=10x=70). The present study evidences the possibility of spontaneous formation of amphiploids between these three Aegilops species and hexaploid wheat and discusses their relevance for gene transference. Future risk assessment of transgenic wheat cultivars needs to evaluate the importance of amphiploids as a bridge for transgene introgression and for gene escape to the wild. (Author)

  18. RAD24 (=R1/sup S/) gene product of Saccharomyces cerevisiae participates in two different pathways of DNA repair

    International Nuclear Information System (INIS)

    The moderately UV- and X-ray-sensitive mutant of Saccharomyces cerevisiae originally designated r1/sup s/ complements all rad and mms mutants available. Therefore, the new nomination rad24-1 according to the RAD nomenclature is suggested. RAD24 maps on chromosome V, close to RAD3 (1.3 cM). In order to associate the RAD24 gene with one of the three repair pathways, double mutants of rad24 and various representative genes of each pathway were constructed. The UV and X-ray sensitivities of the double mutants compared to the single mutants indicate that RAD24 is involved in excision repair of UV damage (RAD3 epistasis group), as well as in recombination repair of UV and X-ray damage (RAD52 epistasis group). Properties of the mutant are discussed which hint at the control of late steps in the pathways

  19. Immunological identification of a high molecular weight protein as a condidate for the product of the Duchenne muscular dystrophy gene

    International Nuclear Information System (INIS)

    An oligopeptide was synthesized based on translation of the nucleotide sequence of the putative exon region of clone pERT87-25 from the gene for Duchenne muscular dystrophy. Immunization of rabbits with this oligopeptide induced the formation of antibodies directed against a protein present in human, rat, and rabbit skeletal muscle. This protein, which is missing in the skeletal muscle of two patients with Duchenne muscular dystrophy, has a molecular mass of ∼320-420 kDa and is clearly different from the putative Duchenne muscular dystrophy-related protein nebulin. The data suggest that this 320-420-kDa protein is produced by the Duchenne muscular dystrophy gene

  20. Prevalence and Characterization of Enterotoxin Gene-Carrying Clostridium perfringens Isolates from Retail Meat Products in Japan▿

    OpenAIRE

    Miki, Yasuhiro; Miyamoto, Kazuaki; Kaneko-Hirano, Ikuko; Fujiuchi, Kanako; Akimoto, Shigeru

    2008-01-01

    Clostridium perfringens is an important anaerobic pathogen causing food-borne gastrointestinal (GI) diseases in humans and animals. It is thought that C. perfringens food poisoning isolates typically carry the enterotoxin gene (cpe) on their chromosome, while isolates from other GI diseases, such as antibiotic-associated diarrhea, carry cpe on a transferable plasmid. However, food-borne GI disease outbreaks associated with C. perfringens isolates carrying plasmid-borne cpe (plasmid cpe isolat...