WorldWideScience

Sample records for bacteriophage-coded gene products

  1. Cattle Candidate Genes for Meat Production Traits

    OpenAIRE

    Bláhová, Alice

    2013-01-01

    The objective of this study was to compile a summary of the most important candidate genes for meat production. The studied genes were: GH, GHR, MSTN, MyoD family, leptin, IGF, TG5, SCD, DGAT and STAT5A. Growth hormone (GH) is involved in physiological processes of growth and metabolism. Growth hormone receptor (GHR) has been proposed as a candidate gene for meat production in cattle. Myostatin is a significant marker. It affects the amount of muscle, reduces marbling and elevate meat tendern...

  2. On the bursting of gene products

    CERN Document Server

    Yvinec, Romain

    2011-01-01

    In this article we demonstrate that the so-called bursting production of molecular species during gene expression may be an artifact caused by low time resolution in experimental data collection and not an actual burst in production. We reach this conclusion through an analysis of a two-stage and binary model for gene expression, and demonstrate that in the limit when mRNA degradation is much faster than protein degradation they are equivalent. The negative binomial distribution is shown to be a limiting case of the binary model for fast "on to off" state transitions and high values of the ratio between protein synthesis and degradation rates. The gene products population increases by unity but multiple times in a time interval orders of magnitude smaller than protein half-life or the precision of the experimental apparatus employed in its detection. This rare-and-fast one-by-one protein synthesis has been interpreted as bursting.

  3. Cattle Candidate Genes for Milk Production Traits

    OpenAIRE

    Kadlec, Tomáš

    2012-01-01

    The aim of this thesis is to make an overview of important candidate genes affecting milk yield and milk quality parameters, with an emphasis on genes associated with the quantity and quality of milk proteins and milk fat.

  4. Integrating Ontological Knowledge and Textual Evidence in Estimating Gene and Gene Product Similarity

    Energy Technology Data Exchange (ETDEWEB)

    Sanfilippo, Antonio P.; Posse, Christian; Gopalan, Banu; Tratz, Stephen C.; Gregory, Michelle L.

    2006-06-08

    With the rising influence of the Gene On-tology, new approaches have emerged where the similarity between genes or gene products is obtained by comparing Gene Ontology code annotations associ-ated with them. So far, these approaches have solely relied on the knowledge en-coded in the Gene Ontology and the gene annotations associated with the Gene On-tology database. The goal of this paper is to demonstrate that improvements to these approaches can be obtained by integrating textual evidence extracted from relevant biomedical literature.

  5. Correlating Information Contents of Gene Ontology Terms to Infer Semantic Similarity of Gene Products

    Directory of Open Access Journals (Sweden)

    Mingxin Gan

    2014-01-01

    Full Text Available Successful applications of the gene ontology to the inference of functional relationships between gene products in recent years have raised the need for computational methods to automatically calculate semantic similarity between gene products based on semantic similarity of gene ontology terms. Nevertheless, existing methods, though having been widely used in a variety of applications, may significantly overestimate semantic similarity between genes that are actually not functionally related, thereby yielding misleading results in applications. To overcome this limitation, we propose to represent a gene product as a vector that is composed of information contents of gene ontology terms annotated for the gene product, and we suggest calculating similarity between two gene products as the relatedness of their corresponding vectors using three measures: Pearson’s correlation coefficient, cosine similarity, and the Jaccard index. We focus on the biological process domain of the gene ontology and annotations of yeast proteins to study the effectiveness of the proposed measures. Results show that semantic similarity scores calculated using the proposed measures are more consistent with known biological knowledge than those derived using a list of existing methods, suggesting the effectiveness of our method in characterizing functional relationships between gene products.

  6. Enhanced citrate production through gene insertion in Aspergillus niger

    DEFF Research Database (Denmark)

    Jongh, Wian de; Nielsen, Jens

    2007-01-01

    The effect of inserting genes involved in the reductive branch of the tricarboxylic acid (TCA) cycle on citrate production by Aspergillus niger was evaluated. Several different genes were inserted individually and in combination, i.e. malate dehydrogenase (mdh2) from Saccharomyces cerevisiae, two...

  7. Identification and amplification of the E. coli phr gene product.

    OpenAIRE

    Sancar, G B; Smith, F W; Sancar, A

    1983-01-01

    We have constructed a series of multicopy plasmids that complement mutations in the phr gene of Escherichia coli. By subcloning into a tac plasmid vector we obtained a phr plasmid that upon induction overproduces two proteins of Mr's 49,000 and 20,000. Tn1000 insertions into the phr gene caused the disappearance of the 49,000 dalton protein, thus demonstrating this protein to be the phr gene product, DNA photolyase. The photolyase encoded by the phr gene makes up about 15% of total cellular p...

  8. A new gene ontology-based measure for the functional similarity of gene products

    Institute of Scientific and Technical Information of China (English)

    QI Guo-long; QIAN Shi-yu; FANG Ji-qian

    2013-01-01

    Background Although biomedical ontologies have standardized the representation of gene products across species and databases,a method for determining the functional similarities of gene products has not yet been developed.Methods We proposed a new semantic similarity measure based on Gene Ontology that considers the semantic influences from all of the ancestor terms in a graph.Our measure was compared with Resnik's measure in two applications,which were based on the association of the measure used with the gene co-expression and the proteinprotein interactions.Results The results showed a considerable association between the semantic similarity and the expression correlation and between the semantic similarity and the protein-protein interactions,and our measure performed the best overall.Conclusion These results revealed the potential value of our newly proposed semantic similarity measure in studying the functional relevance of gene products.

  9. Gene analogue finder: a GRID solution for finding functionally analogous gene products

    Directory of Open Access Journals (Sweden)

    Licciulli Flavio

    2007-09-01

    Full Text Available Abstract Background To date more than 2,1 million gene products from more than 100000 different species have been described specifying their function, the processes they are involved in and their cellular localization using a very well defined and structured vocabulary, the gene ontology (GO. Such vast, well defined knowledge opens the possibility of compare gene products at the level of functionality, finding gene products which have a similar function or are involved in similar biological processes without relying on the conventional sequence similarity approach. Comparisons within such a large space of knowledge are highly data and computing intensive. For this reason this project was based upon the use of the computational GRID, a technology offering large computing and storage resources. Results We have developed a tool, GENe AnaloGue FINdEr (ENGINE that parallelizes the search process and distributes the calculation and data over the computational GRID, splitting the process into many sub-processes and joining the calculation and the data on the same machine and therefore completing the whole search in about 3 days instead of occupying one single machine for more than 5 CPU years. The results of the functional comparison contain potential functional analogues for more than 79000 gene products from the most important species. 46% of the analyzed gene products are well enough described for such an analysis to individuate functional analogues, such as well-known members of the same gene family, or gene products with similar functions which would never have been associated by standard methods. Conclusion ENGINE has produced a list of potential functionally analogous relations between gene products within and between species using, in place of the sequence, the gene description of the GO, thus demonstrating the potential of the GO. However, the current limiting factor is the quality of the associations of many gene products from non

  10. PRODUCT GENE REPRESENTATION AND ACQUISITION METHOD BASED ON POPULATION OF PRODUCT CASES

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    The representation and acquisition of a product gene is a crucial problem in product evolutionary design. A new methodology of product gene representation and acquisition from a population of product cases is proposed, and the methodology for product evolutionary design based on a population of product cases is realized. By properly classifying product cases according to its product species, the populations of product cases are divided and a model is established. Knowledge of the scheme design is extracted and formulated as the function base, principle base, and structure base, which are then combined to form a product gene. Subsequently, the product gene tree is created and represented by object-oriented method. Then combining this method with the evolutionary reasoning technology, an intelligent and automatic evolutionary scheme design of product based on the population of product cases is realized. This design method will be helpful in the processing of knowledge formulation, accumulation, and reuse, and in addressing the difficulty of acquiring design knowledge in traditional design. In addition, the disadvantages of manual case adaptation and update in case-based reasoning can be eliminated. Moreover, by optimizing the design scheme in multiple levels and aspects of product function, principle, and structure etc., the level of creativity in the scheme design can be improved.

  11. [Structure and function of neural plasticity-related gene products].

    Science.gov (United States)

    Yamagata, K; Sugiura, H; Suzuki, K

    1998-08-01

    We have isolated novel immediate early genes (IEGs) from the hippocampus by differential cloning techniques. These mRNAs are induced by synaptic activity and translated into proteins that may affect neural function. We have analyzed a variety of "effector" immediate early genes. These mRNAs encode: 1) cytoplasmic proteins, such as cyclooxygenase-2, a small G protein, Rheb, and a cytoskeleton-associated protein, Arc; 2) membrane-bound proteins, such as the cell adhesion protein Arcadlin, and a neurite-outgrowth protein, Neuritin; and 3) a secreted protein, Narp. We hypothesize that physiological stimulation induces "effector" proteins that might strengthen synaptic connections of activated synapses. In contrast, pathological conditions such as epilepsy or drug addiction may accelerate overproduction of these gene products, which cause abnormal synapse formation. Gene targeting and in vivo gene transfer techniques are required to prove this hypothesis. PMID:9866829

  12. A two-cassette reporter system for assessing target gene translation and target gene product inclusion body formation

    DEFF Research Database (Denmark)

    2016-01-01

    The present invention relates to a dual cassette reporter system capable of assessing target gene translation and target gene product folding. The present invention further relates to vectors and host cells comprising the dual cassette reporter system. In addition the invention relates to the use...... of the dual cassette reporter system for assessing target gene translation and target gene product folding....

  13. The classification of gene products in the molecular biology domain: Realism, objectivity, and the limitations of the Gene Ontology

    OpenAIRE

    Mayor, Charlie

    2012-01-01

    Background: Controlled vocabularies in the molecular biology domain exist to facilitate data integration across database resources. One such tool is the Gene Ontology (GO), a classification designed to act as a universal index for gene products from any species. The Gene Ontology is used extensively in annotating gene products and analysing gene expression data, yet very little research exists from a library and information science perspective exploring the design principles, philosophy and s...

  14. Id-1 gene and gene products as therapeutic targets for treatment of breast cancer and other types of carcinoma

    Science.gov (United States)

    Desprez, Pierre-Yves; Campisi, Judith

    2014-08-19

    A method for treatment of breast cancer and other types of cancer. The method comprises targeting and modulating Id-1 gene expression, if any, for the Id-1 gene, or gene products in breast or other epithelial cancers in a patient by delivering products that modulate Id-1 gene expression. When expressed, Id-1 gene is a prognostic indicator that cancer cells are invasive and metastatic.

  15. Use of Galerina marginata genes and proteins for peptide production

    Energy Technology Data Exchange (ETDEWEB)

    Hallen-Adams, Heather E.; Scott-Craig, John S.; Walton, Jonathan D.; Luo, Hong

    2016-03-01

    The present invention relates to compositions and methods comprising genes and peptides associated with cyclic peptides and cyclic peptide production in mushrooms. In particular, the present invention relates to using genes and proteins from Galerina species encoding peptides specifically relating to amatoxins in addition to proteins involved with processing cyclic peptide toxins. In a preferred embodiment, the present invention also relates to methods for making small peptides and small cyclic peptides including peptides similar to amanitin. Further, the present inventions relate to providing kits for making small peptides.

  16. Plasmid genes required for microcin B17 production.

    Science.gov (United States)

    San Millán, J L; Kolter, R; Moreno, F

    1985-09-01

    The production of the antibiotic substance microcin B17 (Mcc) is determined by a 3.5-kilobase DNA fragment from plasmid pMccB17. Several Mcc- mutations on plasmid pMccB17 were obtained by both transposon insertion and nitrosoguanidine mutagenesis. Plasmids carrying these mutations were tested for their ability to complement Mcc- insertion or deletion mutations on pMM102 (pMM102 is a pBR322 derivative carrying the region encoding microcin B17). Results from these experiments indicate that at least four plasmid genes are required for microcin production.

  17. Modular optimization of multi-gene pathways for fumarate production.

    Science.gov (United States)

    Chen, Xiulai; Zhu, Pan; Liu, Liming

    2016-01-01

    Microbial fumarate production from renewable feedstock is a promising and sustainable alternative to petroleum-based chemical synthesis. Here, we report a modular engineering approach that systematically removed metabolic pathway bottlenecks and led to significant titer improvements in a multi-gene fumarate metabolic pathway. On the basis of central pathway architecture, yeast fumarate biosynthesis was re-cast into three modules: reduction module, oxidation module, and byproduct module. We targeted reduction module and oxidation module to the cytoplasm and the mitochondria, respectively. Combinatorially tuning pathway efficiency by constructing protein fusions RoMDH-P160A and KGD2-SUCLG2 and optimizing metabolic balance by controlling genes RoPYC, RoMDH-P160A, KGD2-SUCLG2 and SDH1 expression strengths led to significantly improved fumarate production (20.46 g/L). In byproduct module, synthetizing DNA-guided scaffolds and designing sRNA switchs enabled further production improvement up to 33.13 g/L. These results suggest that modular pathway engineering can systematically optimize biosynthesis pathways to enable an efficient production of fumarate.

  18. Modular optimization of multi-gene pathways for fumarate production.

    Science.gov (United States)

    Chen, Xiulai; Zhu, Pan; Liu, Liming

    2016-01-01

    Microbial fumarate production from renewable feedstock is a promising and sustainable alternative to petroleum-based chemical synthesis. Here, we report a modular engineering approach that systematically removed metabolic pathway bottlenecks and led to significant titer improvements in a multi-gene fumarate metabolic pathway. On the basis of central pathway architecture, yeast fumarate biosynthesis was re-cast into three modules: reduction module, oxidation module, and byproduct module. We targeted reduction module and oxidation module to the cytoplasm and the mitochondria, respectively. Combinatorially tuning pathway efficiency by constructing protein fusions RoMDH-P160A and KGD2-SUCLG2 and optimizing metabolic balance by controlling genes RoPYC, RoMDH-P160A, KGD2-SUCLG2 and SDH1 expression strengths led to significantly improved fumarate production (20.46 g/L). In byproduct module, synthetizing DNA-guided scaffolds and designing sRNA switchs enabled further production improvement up to 33.13 g/L. These results suggest that modular pathway engineering can systematically optimize biosynthesis pathways to enable an efficient production of fumarate. PMID:26241189

  19. dcp gene of Escherichia coli: cloning, sequencing, transcript mapping, and characterization of the gene product.

    Science.gov (United States)

    Henrich, B; Becker, S; Schroeder, U; Plapp, R

    1993-01-01

    Dipeptidyl carboxypeptidase is a C-terminal exopeptidase of Escherichia coli. We have isolated the respective gene, dcp, from a low-copy-number plasmid library by its ability to complement a dcp mutation preventing the utilization of the unique substrate N-benzoyl-L-glycyl-L-histidyl-L-leucine. Sequence analysis of a 2.9-kb DNA fragment revealed an open reading frame of 2,043 nucleotides which was assigned to the dcp gene by N-terminal amino acid sequencing and electrophoretic molecular mass determination of the purified dcp product. Transcript mapping by primer extension and S1 protection experiments verified the physiological significance of potential initiation and termination signals for dcp transcription and allowed the identification of a single species of monocistronic dcp mRNA. The codon usage pattern and the effects of elevated gene copy number indicated a relatively low level of dcp expression. The predicted amino acid sequence of dipeptidyl carboxypeptidase, containing a potential zinc-binding site, is highly homologous (78.8%) to the corresponding enzyme from Salmonella typhimurium. It also displays significant homology to the products of the S. typhimurium opdA and the E. coli prlC genes and to some metalloproteases from rats and Saccharomyces cerevisiae. No potential export signals could be inferred from the amino acid sequence. Dipeptidyl carboxypeptidase was enriched 80-fold from crude extracts of E. coli and used to investigate some of its biochemical and biophysical properties. Images PMID:8226676

  20. Single gene insertion drives bioalcohol production by a thermophilic archaeon

    Energy Technology Data Exchange (ETDEWEB)

    Basen, M; Schut, GJ; Nguyen, DM; Lipscomb, GL; Benn, RA; Prybol, CJ; Vaccaro, BJ; Poole, FL; Kelly, RM; Adams, MWW

    2014-12-09

    Bioethanol production is achieved by only two metabolic pathways and only at moderate temperatures. Herein a fundamentally different synthetic pathway for bioalcohol production at 70 degrees C was constructed by insertion of the gene for bacterial alcohol dehydrogenase (AdhA) into the archaeon Pyrococcus furiosus. The engineered strain converted glucose to ethanol via acetate and acetaldehyde, catalyzed by the host-encoded aldehyde ferredoxin oxidoreductase (AOR) and heterologously expressed AdhA, in an energy-conserving, redox-balanced pathway. Furthermore, the AOR/AdhA pathway also converted exogenously added aliphatic and aromatic carboxylic acids to the corresponding alcohol using glucose, pyruvate, and/or hydrogen as the source of reductant. By heterologous coexpression of a membrane-bound carbon monoxide dehydrogenase, CO was used as a reductant for converting carboxylic acids to alcohols. Redirecting the fermentative metabolism of P. furiosus through strategic insertion of foreign genes creates unprecedented opportunities for thermophilic bioalcohol production. Moreover, the AOR/AdhA pathway is a potentially game-changing strategy for syngas fermentation, especially in combination with carbon chain elongation pathways.

  1. 76 FR 9028 - Guidance for Industry: Potency Tests for Cellular and Gene Therapy Products; Availability

    Science.gov (United States)

    2011-02-16

    ... Industry: Potency Tests for Cellular and Gene Therapy Products'' dated January 2011. The guidance document provides manufacturers of cellular and gene therapy (CGT) products with recommendations for developing... document entitled ``Guidance for Industry: Potency Tests for Cellular and Gene Therapy Products''...

  2. Multiple joined genes prevent product degradation in Escherichia coli.

    OpenAIRE

    Shen, S H

    1984-01-01

    A method is described that allows the expression of a stable human proinsulin product in Escherichia coli as encoded by either a fused or an unfused gene construction. In the fused system, the human proinsulin coding sequence is joined to the 3' side of a fragment containing the lac promoter and the coding sequence for a small part of the NH2 terminus of beta-galactosidase. In the unfused system, the proinsulin coding sequence is linked directly to a fragment containing the Tac promoter follo...

  3. Vitreoscilla hemoglobin gene ( vgb) improves lutein production in Chlorella vulgaris

    Science.gov (United States)

    Ma, Ruijuan; Lin, Xiangzhi

    2014-03-01

    Vitreoscilla hemoglobin is an oxygen-binding protein that promotes oxygen delivery and reduces oxygen consumption under low oxygen conditions to increase the efficiency of cell respiration and metabolism. In this study, we introduced a Vitreoscilla hemoglobin gene ( vgb) into Chlorella vulgaris by Agrobacterium tumefaciens -mediated transformation (ATMT). PCR analysis confirmed that the vgb gene was successfully integrated into the Chlorella vulgaris genome. Analysis of biomass obtained in shake flasks revealed transformant biomass concentrations as high as 3.28 g/L, which was 38.81% higher than that of the wild-type strain. Lutein content of transformants also increased slightly. Further experiments recovered a maximum lutein yield of 2.91 mg/L from the transformants, which was 36.77% higher than that of the wild-type strain. The above results suggest that integrated expression of the vgb gene may improve cell growth and lutein yield in Chlorella vulgaris, with applications to lutein production from Chlorella during fermentation.

  4. Functional annotation of human cytomegalovirus gene products: an update

    Directory of Open Access Journals (Sweden)

    Ellen eVan Damme

    2014-05-01

    Full Text Available Human Cytomegalovirus is an opportunistic double-stranded DNA virus with one of the largest viral genomes known. The 235kB genome is divided in a unique long (UL and a unique short (US region which are flanked by terminal and internal repeats. The expression of HCMV genes is highly complex and involves the production of protein coding transcripts, polyadenylated long non-coding RNAs, polyadenylated anti-sense transcripts and a variety of non-polyadenylated RNAs such as microRNAs. Although the function of many of these transcripts is unknown, they are suggested play a direct or regulatory role in the delicately orchestrated processes that ensure HCMV replication and life-long persistence. This review focuses on annotating the complete viral genome based on three sources of information. First, previous reviews were used as a template for the functional keywords to ensure continuity; second, the Uniprot database was used to further enrich the functional database; and finally, the literature was manually curated for novel functions of HCMV gene products. Novel discoveries were discussed in light of the viral life cycle. This functional annotation highlights still poorly understood regions of the genome but most importantly it can give insight in functional clusters and/or may be helpful in the analysis of transcriptomics and proteomics studies.

  5. Genes related to xylose fermentation and methods of using same for enhanced biofuel production

    Science.gov (United States)

    Wohlbach, Dana J.; Gasch, Audrey P.

    2014-08-05

    The present invention provides isolated gene sequences involved in xylose fermentation and related recombinant yeast which are useful in methods of enhanced biofuel production, particularly ethanol production. Methods of bioengineering recombinant yeast useful for biofuel production are also provided.

  6. Genes related to xylose fermentation and methods of using same for enhanced biofuel production

    Energy Technology Data Exchange (ETDEWEB)

    Wohlbach, Dana J.; Gasch, Audrey P.

    2015-09-29

    The present invention provides isolated gene sequences involved in xylose fermentation and related recombinant yeast which are useful in methods of enhanced biofuel production, particularly ethanol production. Methods of bioengineering recombinant yeast useful for biofuel production are also provided.

  7. Expression regulation of design process gene in product design

    DEFF Research Database (Denmark)

    Fang, Lusheng; Li, Bo; Tong, Shurong;

    2011-01-01

    To improve the design process efficiency, this paper proposes the principle and methodology that design process gene controls the characteristics of design process under the framework of design process reuse and optimization based on design process gene. First, the concept of design process gene ...... with the example of design management gene. Last, the regulation mode that the regulator gene regulates the expression of the structural gene is established and it is illustrated by taking the design process management gene as an example. © (2011) Trans Tech Publications....

  8. FSim: A Novel Functional Similarity Search Algorithm and Tool for Discovering Functionally Related Gene Products

    OpenAIRE

    2014-01-01

    Background. During the analysis of genomics data, it is often required to quantify the functional similarity of genes and their products based on the annotation information from gene ontology (GO) with hierarchical structure. A flexible and user-friendly way to estimate the functional similarity of genes utilizing GO annotation is therefore highly desired. Results. We proposed a novel algorithm using a level coefficient-weighted model to measure the functional similarity of gene products base...

  9. The Salmonella typhimurium LT2 uvrD gene is regulated by the lexA gene product.

    OpenAIRE

    Pang, P P; Walker, G C

    1983-01-01

    The uvrD gene product apparently plays a role in the repair of UV damage, in mismatch repair, and in genetic recombination. A lower level of expression of the Salmonella typhimurium LT2 uvrD gene was observed in maxicells prepared from an Escherichia coli strain that contained a lexA+ plasmid than in maxicells prepared from an E. coli strain that lacked functional LexA protein. These results suggest that the uvrD+ gene is repressed by the LexA protein and is thus a member of the set of genes ...

  10. Aflatoxin conducive and non-conducive growth conditions reveal new gene associations with aflatoxin production.

    Science.gov (United States)

    Price, Michael S; Conners, Shannon B; Tachdjian, Sabrina; Kelly, Robert M; Payne, Gary A

    2005-06-01

    Research on aflatoxin (AF) production has traditionally focused on defining the AF biosynthetic pathway with the goal of identifying potential targets for intervention. To understand the effect of nitrogen source, carbon source, temperature, and pH on the regulation of AF biosynthesis, a targeted cDNA microarray consisting of genes associated with AF production over time was employed. Expression profiles for genes involved in AF biosynthesis grouped into five clades. A putative regulon was identified consisting of 20 genes that were induced in the conducive nitrogen and pH treatments and the non-conducive carbon and temperature treatments, as well as four other putative regulons corresponding to each of the four variables studied. Seventeen genes exhibited consistent induction/repression profiles across all the experiments. One of these genes was consistently downregulated with AF production. Overexpression of this gene resulted in repression of AF biosynthesis. The cellular function of this gene is currently unresolved.

  11. Identification of alcA, a Bordetella bronchiseptica gene necessary for alcaligin production.

    Science.gov (United States)

    Giardina, P C; Foster, L A; Toth, S I; Roe, B A; Dyer, D W

    1995-12-29

    The alcA gene, essential for the production of the dihydroxamate siderophore, alcaligin, by Bordetella bronchiseptica, was cloned and sequenced. The alcA gene was identified on a 4.7-kb EcoRI genomic fragment adjacent to a Tn5lac transposon insertion that inactivated alcaligin production in strain MBORD846. Analysis of the alcA nucleotide sequence revealed a putative Fur-binding site, suggesting that expression of this gene is repressed by iron. The deduced amino-acid sequence of this open reading frame had significant homology with the Escherichia coli iucD gene product, an enzyme required for biosynthesis of the dihydroxamate siderophore aerobactin.

  12. Long-term follow-up of cancer patients treated with gene therapy medicinal products.

    Science.gov (United States)

    Galli, Maria Cristina

    2012-06-01

    European Union requirements are discussed for the long-term follow-up of advanced therapy medicinal products, as well as how they can be applied to cancer patients treated with gene therapy medicinal products in the context of clinical trials, as described in a specific guideline issued by Gene Therapy Working Party at the European Medicine Agency.

  13. Form gene clustering method about pan-ethnic-group products based on emotional semantic

    Science.gov (United States)

    Chen, Dengkai; Ding, Jingjing; Gao, Minzhuo; Ma, Danping; Liu, Donghui

    2016-09-01

    The use of pan-ethnic-group products form knowledge primarily depends on a designer's subjective experience without user participation. The majority of studies primarily focus on the detection of the perceptual demands of consumers from the target product category. A pan-ethnic-group products form gene clustering method based on emotional semantic is constructed. Consumers' perceptual images of the pan-ethnic-group products are obtained by means of product form gene extraction and coding and computer aided product form clustering technology. A case of form gene clustering about the typical pan-ethnic-group products is investigated which indicates that the method is feasible. This paper opens up a new direction for the future development of product form design which improves the agility of product design process in the era of Industry 4.0.

  14. Metabolites production improvement by identifying minimal genomes and essential genes using flux balance analysis.

    Science.gov (United States)

    Salleh, Abdul Hakim Mohamed; Mohamad, Mohd Saberi; Deris, Safaai; Illias, Rosli Md

    2015-01-01

    With the advancement in metabolic engineering technologies, reconstruction of the genome of host organisms to achieve desired phenotypes can be made. However, due to the complexity and size of the genome scale metabolic network, significant components tend to be invisible. We proposed an approach to improve metabolite production that consists of two steps. First, we find the essential genes and identify the minimal genome by a single gene deletion process using Flux Balance Analysis (FBA) and second by identifying the significant pathway for the metabolite production using gene expression data. A genome scale model of Saccharomyces cerevisiae for production of vanillin and acetate is used to test this approach. The result has shown the reliability of this approach to find essential genes, reduce genome size and identify production pathway that can further optimise the production yield. The identified genes and pathways can be extendable to other applications especially in strain optimisation. PMID:26489144

  15. Identification of potentially hazardous human gene products in GMO risk assessment.

    Science.gov (United States)

    Bergmans, Hans; Logie, Colin; Van Maanen, Kees; Hermsen, Harm; Meredyth, Michelle; Van Der Vlugt, Cécile

    2008-01-01

    Genetically modified organisms (GMOs), e.g. viral vectors, could threaten the environment if by their release they spread hazardous gene products. Even in contained use, to prevent adverse consequences, viral vectors carrying genes from mammals or humans should be especially scrutinized as to whether gene products that they synthesize could be hazardous in their new context. Examples of such potentially hazardous gene products (PHGPs) are: protein toxins, products of dominant alleles that have a role in hereditary diseases, gene products and sequences involved in genome rearrangements, gene products involved in immunomodulation or with an endocrine function, gene products involved in apoptosis, activated proto-oncogenes. For contained use of a GMO that carries a construct encoding a PHGP, the precautionary principle dictates that safety measures should be applied on a "worst case" basis, until the risks of the specific case have been assessed. The potential hazard of cloned genes can be estimated before empirical data on the actual GMO become available. Preliminary data may be used to focus hazard identification and risk assessment. Both predictive and empirical data may also help to identify what further information is needed to assess the risk of the GMO. A two-step approach, whereby a PHGP is evaluated for its conceptual dangers, then checked by data bank searches, is delineated here. PMID:18384725

  16. Characterizing Milk Production Related Genes in Holstein Using RNA-seq

    Science.gov (United States)

    Seo, Minseok; Lee, Hyun-Jeong; Kim, Kwondo; Caetano-Anolles, Kelsey; Jeong, Jin Young; Park, Sungkwon; Oh, Young Kyun; Cho, Seoae; Kim, Heebal

    2016-01-01

    Although the chemical, physical, and nutritional properties of bovine milk have been extensively studied, only a few studies have attempted to characterize milk-synthesizing genes using RNA-seq data. RNA-seq data was collected from 21 Holstein samples, along with group information about milk production ability; milk yield; and protein, fat, and solid contents. Meta-analysis was employed in order to generally characterize genes related to milk production. In addition, we attempted to investigate the relationship between milk related traits, parity, and lactation period. We observed that milk fat is highly correlated with lactation period; this result indicates that this effect should be considered in the model in order to accurately detect milk production related genes. By employing our developed model, 271 genes were significantly (false discovery rate [FDR] adjusted p-valuemilk production related differentially expressed genes. Of these genes, five (albumin, nitric oxide synthase 3, RNA-binding region (RNP1, RRM) containing 3, secreted and transmembrane 1, and serine palmitoyltransferase, small subunit B) were technically validated using quantitative real-time polymerase chain reaction (qRT-PCR) in order to check the accuracy of RNA-seq analysis. Finally, 83 gene ontology biological processes including several blood vessel and mammary gland development related terms, were significantly detected using DAVID gene-set enrichment analysis. From these results, we observed that detected milk production related genes are highly enriched in the circulation system process and mammary gland related biological functions. In addition, we observed that detected genes including caveolin 1, mammary serum amyloid A3.2, lingual antimicrobial peptide, cathelicidin 4 (CATHL4), cathelicidin 6 (CATHL6) have been reported in other species as milk production related gene. For this reason, we concluded that our detected 271 genes would be strong candidates for determining milk production

  17. Prolactin as a Candidate Gene Controlling Molting and Egg Production of Duck

    Directory of Open Access Journals (Sweden)

    Triana Susanti

    2015-03-01

    Full Text Available Incidence of molting is a crucial problem in the local ducks that need to be handled from many aspects including genetic aspect. Handling of molting genetically can be done quickly and accurately when the control genes have been found. The search for marker genes of molting can be conducted in poultry through broodiness naturally, because its physiological processes are related to the continuity of egg production. This paper describes the mechanism of molting, the relationship of molting with prolactin hormone and the association of prolactin gene polymorphism with molting and egg production. Molting and egg production were influenced by the prolactin hormone, that may be controlled by the prolactin gene. High concentration of prolactin hormone will inhibit the function of pituitary gland, decreasing production of gonadotrophin hormone (follicle stimulating hormone and luteinizing hormone hence ovulation ceased. This will stop egg production and at the same time molting proccess occurred.

  18. Cloning and characterization of the gene product of the form II ribulose-1,5-bisphosphate carboxylase gene of Rhodopseudomonas sphaeroides.

    OpenAIRE

    Muller, E D; Chory, J; Kaplan, S

    1985-01-01

    We report the cloning and characterization of the gene product of the gene for the form II ribulose bisphosphate carboxylase from Rhodopseudomonas sphaeroides. We present evidence that the form II enzyme is encoded by a single gene in R. sphaeroides; however, this gene does hybridize to a second chromosomal locus.

  19. Cloned yeast and mammalian transcription factor TFIID gene products support basal but not activated metallothionein gene transcription

    International Nuclear Information System (INIS)

    Transcription factor IID (TFIID), the TATA binding factor, is thought to play a key role in the regulation of eukaryotic transcriptional initiation. The authors studied the role of TFIID in the transcription of the yeast metallothionein gene, which is regulated by the copper-dependent activator protein ACE1. Both basal and induced transcription of the metallothionein gene require TFIID and a functional TATA binding site. Crude human and mouse TFIID fractions, prepared from mammalian cells, respond to stimulation by ACE1, In contrast, human and yeast TFIID proteins expressed from the cloned genes do not respond to ACE1, except in the presence of what germ or yeast total cell extracts. These results indicate that the cloned TFIID gene products lack a component(s) or modifications(s) that is required for regulated as compared to basal transription

  20. DNA sequence, products, and transcriptional pattern of the genes involved in production of the DNA replication inhibitor microcin B17.

    Science.gov (United States)

    Genilloud, O; Moreno, F; Kolter, R

    1989-02-01

    The 3.8-kilobase segment of plasmid DNA that contains the genes required for production of the DNA replication inhibitor microcin B17 was sequenced. The sequence contains four open reading frames which were shown to be translated in vivo by the construction of fusions to lacZ. The location of these open reading frames fits well with the location of the four microcin B17 production genes, mcbABCD, identified previously through genetic complementation. The products of the four genes have been identified, and the observed molecular weights of the proteins agree with those predicted from the nucleotide sequence. The transcription of these genes was studied by using fusions to lacZ and physical mapping of mRNA start sites. Three promoters were identified in this region. The major promoter for all the genes is a growth phase-regulated OmpR-dependent promoter located upstream of mcbA. A second promoter is located within mcbC and is responsible for a low-level basal expression of mcbD. A third promoter, located within mcbD, promotes transcription in the reverse direction starting within mcbD and extending through mcbC. The resulting mRNA appears to be an untranslated antisense transcript that could play a regulatory role in the expression of these genes.

  1. Modulation of Chaperone Gene Expression in Mutagenized Saccharomyces cerevisiae Strains Developed for Recombinant Human Albumin Production Results in Increased Production of Multiple Heterologous Proteins▿

    OpenAIRE

    Payne, T.; Finnis, C.; Evans, L R; Mead, D. J.; Avery, S V; Archer, D. B.; Sleep, D.

    2008-01-01

    The yeast Saccharomyces cerevisiae has been successfully established as a commercially viable system for the production of recombinant proteins. Manipulation of chaperone gene expression has been utilized extensively to increase recombinant protein production from S. cerevisiae, focusing predominantly on the products of the protein disulfide isomerase gene PDI1 and the hsp70 gene KAR2. Here we show that the expression of the genes SIL1, LHS1, JEM1, and SCJ1, all of which are involved in regul...

  2. Mobile antibiotic resistance - the spread of genes determining the resistance of bacteria through food products.

    Science.gov (United States)

    Godziszewska, Jolanta; Guzek, Dominika; Głąbski, Krzysztof; Wierzbicka, Agnieszka

    2016-01-01

    In recent years, more and more antibiotics have become ineffective in the treatment of bacterial nfections. The acquisition of antibiotic resistance by bacteria is associated with circulation of genes in the environment. Determinants of antibiotic resistance may be transferred to pathogenic bacteria. It has been shown that conjugation is one of the key mechanisms responsible for spread of antibiotic resistance genes, which is highly efficient and allows the barrier to restrictions and modifications to be avoided. Some conjugative modules enable the transfer of plasmids even between phylogenetically distant bacterial species. Many scientific reports indicate that food is one of the main reservoirs of these genes. Antibiotic resistance genes have been identified in meat products, milk, fruits and vegetables. The reason for such a wide spread of antibiotic resistance genes is the overuse of antibiotics by breeders of plants and animals, as well as by horizontal gene transfer. It was shown, that resistance determinants located on mobile genetic elements, which are isolated from food products, can easily be transferred to another niche. The antibiotic resistance genes have been in the environment for 30 000 years. Their removal from food products is not possible, but the risks associated with the emergence of multiresistant pathogenic strains are very large. The only option is to control the emergence, selection and spread of these genes. Therefore measures are sought to prevent horizontal transfer of genes. Promising concepts involve the combination of developmental biology, evolution and ecology in the fight against the spread of antibiotic resistance. PMID:27383577

  3. Products of vasopressin gene expression in small-cell carcinoma of the lung.

    OpenAIRE

    Friedmann, A. S.; Malott, K. A.; Memoli, V. A.; PAI, S.I.; Yu, X M; North, W. G.

    1994-01-01

    Small-cell neuroendocrine carcinoma of the lung is known to express products related to the vasopressin gene, although these products have been reported to sometimes differ from those generated by neurones of the hypothalamo-neurohypophyseal system. To further investigate vasopressin gene expression in neuroendocrine carcinomas, we performed immunohistochemistry on 24 histologically classified small-cell carcinomas using antibodies directed against different regions of the vasopressin precurs...

  4. Split-gene system for hybrid wheat seed production

    OpenAIRE

    Kempe, Katja; Rubtsova, Myroslava; Gils, Mario

    2014-01-01

    Global food security demands the development of new technologies to increase and secure cereal production on finite arable land without increasing water and fertilizer use. Although the use of heterosis through hybrid breeding has produced tremendous economic benefits in worldwide crop production, less than 1% of the global wheat area is planted with hybrids. One of the greatest bottlenecks in breeding hybrid wheat is the lack of an efficient sterility system to block self-pollination. This r...

  5. Coregulation of terpenoid pathway genes and prediction of isoprene production in Bacillus subtilis using transcriptomics

    Energy Technology Data Exchange (ETDEWEB)

    Hess, Becky M.; Xue, Junfeng; Markillie, Lye Meng; Taylor, Ronald C.; Wiley, H. S.; Ahring, Birgitte K.; Linggi, Bryan E.

    2013-06-19

    The isoprenoid pathway converts pyruvate to isoprene and related isoprenoid compounds in plants and some bacteria. Currently, this pathway is of great interest because of the critical role that isoprenoids play in basic cellular processes as well as the industrial value of metabolites such as isoprene. Although the regulation of several pathway genes has been described, there is a paucity of information regarding the system level regulation and control of the pathway. To address this limitation, we examined Bacillus subtilis grown under multiple conditions and then determined the relationship between altered isoprene production and the pattern of gene expression. We found that terpenoid genes appeared to fall into two distinct subsets with opposing correlations with respect to the amount of isoprene produced. The group whose expression levels positively correlated with isoprene production included dxs, the gene responsible for the commitment step in the pathway, as well as ispD, and two genes that participate in the mevalonate pathway, yhfS and pksG. The subset of terpenoid genes that inversely correlated with isoprene production included ispH, ispF, hepS, uppS, ispE, and dxr. A genome wide partial least squares regression model was created to identify other genes or pathways that contribute to isoprene production. This analysis showed that a subset of 213 regulated genes was sufficient to create a predictive model of isoprene production under different conditions and showed correlations at the transcriptional level. We conclude that gene expression levels alone are sufficiently informative about the metabolic state of a cell that produces increased isoprene and can be used to build a model which accurately predicts production of this secondary metabolite across many simulated environmental conditions.

  6. Id-1 and Id-2 genes and products as markers of epithelial cancer

    Science.gov (United States)

    Desprez, Pierre-Yves; Campisi, Judith

    2008-09-30

    A method for detection and prognosis of breast cancer and other types of cancer. The method comprises detecting expression, if any, for both an Id-1 and an Id-2 genes, or the ratio thereof, of gene products in samples of breast tissue obtained from a patient. When expressed, Id-1 gene is a prognostic indicator that breast cancer cells are invasive and metastatic, whereas Id-2 gene is a prognostic indicator that breast cancer cells are localized and noninvasive in the breast tissue.

  7. Major genes and QTL influencing wool production and quality: a review

    Directory of Open Access Journals (Sweden)

    Purvis Ian

    2005-12-01

    Full Text Available Abstract The opportunity exists to utilise our knowledge of major genes that influence the economically important traits in wool sheep. Genes with Mendelian inheritance have been identified for many important traits in wool sheep. Of particular importance are genes influencing pigmentation, wool quality and the keratin proteins, the latter of which are important for the morphology of the wool fibre. Gene mapping studies have identified some chromosomal regions associated with variation in wool quality and production traits. The challenge now is to build on this knowledge base in a cost-effective way to deliver molecular tools that facilitate enhanced genetic improvement programs for wool sheep.

  8. Identification and localization of a gene that specifies production of Escherichia coli DNA topoisomerase I

    Energy Technology Data Exchange (ETDEWEB)

    Trucksis, M.; Depew, R.E.

    1981-04-01

    A gene that specifies production of Escherichia coli DNA topoisomerase I (..omega.. protein) was identified with the aid of a radioimmunoassay for this protein. E. coli DNA topoisomerase I was produced by Salmonella typhimurium merodiploids that harbored E. coli plasmid F' 123, but not by strains that lost this plasmid. Analysis of strains with spontaneous deletions of F' 123 showed that the gene, topA, required for production of the E. coli ..omega.. protein was between the trp operon and the cysB gene. Deletions that eliminated topA also eliminated the supX gene. We suggest that topA is the structural gene of E. coli DNA topoisomerase I and that topA is identical to supX.

  9. Identification and manipulation of the pleuromutilin gene cluster from Clitopilus passeckerianus for increased rapid antibiotic production

    Science.gov (United States)

    Bailey, Andy M.; Alberti, Fabrizio; Kilaru, Sreedhar; Collins, Catherine M.; de Mattos-Shipley, Kate; Hartley, Amanda J.; Hayes, Patrick; Griffin, Alison; Lazarus, Colin M.; Cox, Russell J.; Willis, Christine L.; O’Dwyer, Karen; Spence, David W.; Foster, Gary D.

    2016-05-01

    Semi-synthetic derivatives of the tricyclic diterpene antibiotic pleuromutilin from the basidiomycete Clitopilus passeckerianus are important in combatting bacterial infections in human and veterinary medicine. These compounds belong to the only new class of antibiotics for human applications, with novel mode of action and lack of cross-resistance, representing a class with great potential. Basidiomycete fungi, being dikaryotic, are not generally amenable to strain improvement. We report identification of the seven-gene pleuromutilin gene cluster and verify that using various targeted approaches aimed at increasing antibiotic production in C. passeckerianus, no improvement in yield was achieved. The seven-gene pleuromutilin cluster was reconstructed within Aspergillus oryzae giving production of pleuromutilin in an ascomycete, with a significant increase (2106%) in production. This is the first gene cluster from a basidiomycete to be successfully expressed in an ascomycete, and paves the way for the exploitation of a metabolically rich but traditionally overlooked group of fungi.

  10. Gene deletion of cytosolic ATP: citrate lyase leads to altered organic acid production in Aspergillus niger

    DEFF Research Database (Denmark)

    Meijer, Susan Lisette; Nielsen, Michael Lynge; Olsson, Lisbeth;

    2009-01-01

    With the availability of the genome sequence of the filamentous fungus Aspergillus niger, the use of targeted genetic modifications has become feasible. This, together with the fact that A. niger is well established industrially, makes this fungus an attractive micro-organism for creating a cell...... factory platform for production of chemicals. Using molecular biology techniques, this study focused on metabolic engineering of A. niger to manipulate its organic acid production in the direction of succinic acid. The gene target for complete gene deletion was cytosolic ATP: citrate lyase (acl), which...... the acl gene. Additionally, the total amount of organic acids produced in the deletion strain was significantly increased. Genome-scale stoichiometric metabolic model predictions can be used for identifying gene targets. Deletion of the acl led to increased succinic acid production by A. niger....

  11. Regulation of gene expression by tobacco product preparations in cultured human dermal fibroblasts

    Energy Technology Data Exchange (ETDEWEB)

    Malpass, Gloria E., E-mail: gloria.malpass@gmail.com [Department of Physiology and Pharmacology, Wake Forest University Health Sciences, Winston-Salem, NC 27157 (United States); Arimilli, Subhashini, E-mail: sarimill@wakehealth.edu [Department of Microbiology and Immunology, Wake Forest University Health Sciences, Winston-Salem, NC 27157 (United States); Prasad, G.L., E-mail: prasadg@rjrt.com [R and D Department, R.J. Reynolds Tobacco Company, Winston-Salem, NC 27102 (United States); Howlett, Allyn C., E-mail: ahowlett@wakehealth.edu [Department of Physiology and Pharmacology, Wake Forest University Health Sciences, Winston-Salem, NC 27157 (United States)

    2014-09-01

    Skin fibroblasts comprise the first barrier of defense against wounds, and tobacco products directly contact the oral cavity. Cultured human dermal fibroblasts were exposed to smokeless tobacco extract (STE), total particulate matter (TPM) from tobacco smoke, or nicotine at concentrations comparable to those found in these extracts for 1 h or 5 h. Differences were identified in pathway-specific genes between treatments and vehicle using qRT-PCR. At 1 h, IL1α was suppressed significantly by TPM and less significantly by STE. Neither FOS nor JUN was suppressed at 1 h by tobacco products. IL8, TNFα, VCAM1, and NFκB1 were suppressed after 5 h with STE, whereas only TNFα and NFκB1 were suppressed by TPM. At 1 h with TPM, secreted levels of IL10 and TNFα were increased. Potentially confounding effects of nicotine were exemplified by genes such as ATF3 (5 h), which was increased by nicotine but suppressed by other components of STE. Within 2 h, TPM stimulated nitric oxide production, and both STE and TPM increased reactive oxygen species. The biological significance of these findings and utilization of the gene expression changes reported herein regarding effects of the tobacco product preparations on dermal fibroblasts will require additional research. - Highlights: • Tobacco product preparations (TPPs) alter gene expression in dermal fibroblasts. • Some immediate early genes critical to the inflammatory process are affected. • Different TPPs produce differential responses in certain pro-inflammatory genes.

  12. Regulation of gene expression by tobacco product preparations in cultured human dermal fibroblasts

    International Nuclear Information System (INIS)

    Skin fibroblasts comprise the first barrier of defense against wounds, and tobacco products directly contact the oral cavity. Cultured human dermal fibroblasts were exposed to smokeless tobacco extract (STE), total particulate matter (TPM) from tobacco smoke, or nicotine at concentrations comparable to those found in these extracts for 1 h or 5 h. Differences were identified in pathway-specific genes between treatments and vehicle using qRT-PCR. At 1 h, IL1α was suppressed significantly by TPM and less significantly by STE. Neither FOS nor JUN was suppressed at 1 h by tobacco products. IL8, TNFα, VCAM1, and NFκB1 were suppressed after 5 h with STE, whereas only TNFα and NFκB1 were suppressed by TPM. At 1 h with TPM, secreted levels of IL10 and TNFα were increased. Potentially confounding effects of nicotine were exemplified by genes such as ATF3 (5 h), which was increased by nicotine but suppressed by other components of STE. Within 2 h, TPM stimulated nitric oxide production, and both STE and TPM increased reactive oxygen species. The biological significance of these findings and utilization of the gene expression changes reported herein regarding effects of the tobacco product preparations on dermal fibroblasts will require additional research. - Highlights: • Tobacco product preparations (TPPs) alter gene expression in dermal fibroblasts. • Some immediate early genes critical to the inflammatory process are affected. • Different TPPs produce differential responses in certain pro-inflammatory genes

  13. dcp gene of Escherichia coli: cloning, sequencing, transcript mapping, and characterization of the gene product.

    OpenAIRE

    Henrich, B; S. Becker; Schroeder, U; Plapp, R.

    1993-01-01

    Dipeptidyl carboxypeptidase is a C-terminal exopeptidase of Escherichia coli. We have isolated the respective gene, dcp, from a low-copy-number plasmid library by its ability to complement a dcp mutation preventing the utilization of the unique substrate N-benzoyl-L-glycyl-L-histidyl-L-leucine. Sequence analysis of a 2.9-kb DNA fragment revealed an open reading frame of 2,043 nucleotides which was assigned to the dcp gene by N-terminal amino acid sequencing and electrophoretic molecular mass ...

  14. Coregulation of Terpenoid Pathway Genes and Prediction of Isoprene Production in Bacillus subtilis Using Transcriptomics.

    Directory of Open Access Journals (Sweden)

    Becky M Hess

    Full Text Available The isoprenoid pathway converts pyruvate to isoprene and related isoprenoid compounds in plants and some bacteria. Currently, this pathway is of great interest because of the critical role that isoprenoids play in basic cellular processes, as well as the industrial value of metabolites such as isoprene. Although the regulation of several pathway genes has been described, there is a paucity of information regarding system level regulation and control of the pathway. To address these limitations, we examined Bacillus subtilis grown under multiple conditions and determined the relationship between altered isoprene production and gene expression patterns. We found that with respect to the amount of isoprene produced, terpenoid genes fall into two distinct subsets with opposing correlations. The group whose expression levels positively correlated with isoprene production included dxs, which is responsible for the commitment step in the pathway, ispD, and two genes that participate in the mevalonate pathway, yhfS and pksG. The subset of terpenoid genes that inversely correlated with isoprene production included ispH, ispF, hepS, uppS, ispE, and dxr. A genome-wide partial least squares regression model was created to identify other genes or pathways that contribute to isoprene production. These analyses showed that a subset of 213 regulated genes was sufficient to create a predictive model of isoprene production under different conditions and showed correlations at the transcriptional level. We conclude that gene expression levels alone are sufficiently informative about the metabolic state of a cell that produces increased isoprene and can be used to build a model that accurately predicts production of this secondary metabolite across many simulated environmental conditions.

  15. Coregulation of Terpenoid Pathway Genes and Prediction of Isoprene Production in Bacillus subtilis Using Transcriptomics.

    Science.gov (United States)

    Hess, Becky M; Xue, Junfeng; Markillie, Lye Meng; Taylor, Ronald C; Wiley, H Steven; Ahring, Birgitte K; Linggi, Bryan

    2013-01-01

    The isoprenoid pathway converts pyruvate to isoprene and related isoprenoid compounds in plants and some bacteria. Currently, this pathway is of great interest because of the critical role that isoprenoids play in basic cellular processes, as well as the industrial value of metabolites such as isoprene. Although the regulation of several pathway genes has been described, there is a paucity of information regarding system level regulation and control of the pathway. To address these limitations, we examined Bacillus subtilis grown under multiple conditions and determined the relationship between altered isoprene production and gene expression patterns. We found that with respect to the amount of isoprene produced, terpenoid genes fall into two distinct subsets with opposing correlations. The group whose expression levels positively correlated with isoprene production included dxs, which is responsible for the commitment step in the pathway, ispD, and two genes that participate in the mevalonate pathway, yhfS and pksG. The subset of terpenoid genes that inversely correlated with isoprene production included ispH, ispF, hepS, uppS, ispE, and dxr. A genome-wide partial least squares regression model was created to identify other genes or pathways that contribute to isoprene production. These analyses showed that a subset of 213 regulated genes was sufficient to create a predictive model of isoprene production under different conditions and showed correlations at the transcriptional level. We conclude that gene expression levels alone are sufficiently informative about the metabolic state of a cell that produces increased isoprene and can be used to build a model that accurately predicts production of this secondary metabolite across many simulated environmental conditions. PMID:23840410

  16. The paf gene product modulates asexual development in Penicillium chrysogenum.

    Science.gov (United States)

    Hegedüs, Nikoletta; Sigl, Claudia; Zadra, Ivo; Pócsi, Istvan; Marx, Florentine

    2011-06-01

    Penicillium chrysogenum secretes a low molecular weight, cationic and cysteine-rich protein (PAF). It has growth inhibitory activity against the model organism Aspergillus nidulans and numerous zoo- and phytopathogenic fungi but shows only minimal conditional antifungal activity against the producing organism itself. In this study we provide evidence for an additional function of PAF which is distinct from the antifungal activity against putative ecologically concurrent microorganisms. Our data indicate that PAF enhances conidiation in P. chrysogenum by modulating the expression of brlA, the central regulatory gene for mitospore development. A paf deletion strain showed a significant impairment of mitospore formation which sustains our hypothesis that PAF plays an important role in balancing asexual differentiation in P. chrysogenum. PMID:21298690

  17. Cloning large natural product gene clusters from the environment: Piecing environmental DNA gene clusters back together with TAR

    OpenAIRE

    Kim, Jeffrey H.; Feng, Zhiyang; Bauer, John D.; Kallifidas, Dimitris; Calle, Paula Y.; Brady, Sean F

    2010-01-01

    A single gram of soil can contain thousands of unique bacterial species, of which only a small fraction is regularly cultured in the laboratory. Although the fermentation of cultured microorganisms has provided access to numerous bioactive secondary metabolites, with these same methods it is not possible to characterize the natural products encoded by the uncultured majority. The heterologous expression of biosynthetic gene clusters cloned from DNA extracted directly from environmental sample...

  18. Phylogenomic study of lipid genes involved in microalgal biofuel production-candidate gene mining and metabolic pathway analyses.

    Science.gov (United States)

    Misra, Namrata; Panda, Prasanna Kumar; Parida, Bikram Kumar; Mishra, Barada Kanta

    2012-01-01

    Optimizing microalgal biofuel production using metabolic engineering tools requires an in-depth understanding of the structure-function relationship of genes involved in lipid biosynthetic pathway. In the present study, genome-wide identification and characterization of 398 putative genes involved in lipid biosynthesis in Arabidopsis thaliana Chlamydomonas reinhardtii, Volvox carteri, Ostreococcus lucimarinus, Ostreococcus tauri and Cyanidioschyzon merolae was undertaken on the basis of their conserved motif/domain organization and phylogenetic profile. The results indicated that the core lipid metabolic pathways in all the species are carried out by a comparable number of orthologous proteins. Although the fundamental gene organizations were observed to be invariantly conserved between microalgae and Arabidopsis genome, with increased order of genome complexity there seems to be an association with more number of genes involved in triacylglycerol (TAG) biosynthesis and catabolism. Further, phylogenomic analysis of the genes provided insights into the molecular evolution of lipid biosynthetic pathway in microalgae and confirm the close evolutionary proximity between the Streptophyte and Chlorophyte lineages. Together, these studies will improve our understanding of the global lipid metabolic pathway and contribute to the engineering of regulatory networks of algal strains for higher accumulation of oil. PMID:23032611

  19. Genes, language, cognition, and culture: towards productive inquiry.

    Science.gov (United States)

    Fitch, W Tecumseh

    2011-04-01

    The Queen Mary conference on “Integrating Genetic and Cultural Evolutionary Approaches to Language,” and the papers in this special issue, clearly illustrate the excitement and potential of trans-disciplinary approaches to language as an evolved biological capacity (phylogeny) and an evolving cultural entity (glossogeny). Excepting the present author, the presenters/authors are mostly young rising stars in their respective fields, and include scientists with backgrounds in linguistics, animal communication, neuroscience, evolutionary biology, anthropology, and computer science. On display was a clear willingness to engage with different approaches and terminology and a commitment to shared standards of scientific rigor, empirically driven theory, and logical argument. Because the papers assembled here, together with the introduction, speak for themselves, I will focus in this “extro-duction” on some of the terminological and conceptual difficulties which threaten to block this exciting wave of scientific progress in understanding language evolution, in both senses of that term. In particular I will first argue against the regrettably widespread practice of opposing cultural and genetic explanations of human cognition as if they were dichotomous. Second, I will unpack the debate concerning “general-purpose” and “domain-specific” mechanisms, which masquerades as a debate about nativism but is nothing of the sort. I believe that framing discussions of language in these terms has generated more heat than light, and that a modern molecular understanding of genes, development, behavior, and evolution renders many of the assumptions underlying this debate invalid.

  20. The FRIABLE1 gene product affects cell adhesion in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Lutz Neumetzler

    Full Text Available Cell adhesion in plants is mediated predominantly by pectins, a group of complex cell wall associated polysaccharides. An Arabidopsis mutant, friable1 (frb1, was identified through a screen of T-DNA insertion lines that exhibited defective cell adhesion. Interestingly, the frb1 plants displayed both cell and organ dissociations and also ectopic defects in organ separation. The FRB1 gene encodes a Golgi-localized, plant specific protein with only weak sequence similarities to known proteins (DUF246. Unlike other cell adhesion deficient mutants, frb1 mutants do not have reduced levels of adhesion related cell wall polymers, such as pectins. Instead, FRB1 affects the abundance of galactose- and arabinose-containing oligosaccharides in the Golgi. Furthermore, frb1 mutants displayed alteration in pectin methylesterification, cell wall associated extensins and xyloglucan microstructure. We propose that abnormal FRB1 action has pleiotropic consequences on wall architecture, affecting both the extensin and pectin matrices, with consequent changes to the biomechanical properties of the wall and middle lamella, thereby influencing cell-cell adhesion.

  1. A mutant gene that increases gibberellin production in Brassica

    International Nuclear Information System (INIS)

    A single gene mutant (elongated internode [ein/ein]) with accelerated shoot elongation was identified from a rapid cycling line of Brassica rapa. Relative to normal plants, mutant plants had slightly accelerated floral development, greater stem dry weights, and particularly, increased internode and inflorescence elongation. The application of the triazole plant growth retardant, paclobutrazol, inhibited shoot elongation, returning ein to a more normal phenotype. Conversely, exogenous gibberellin A3 (GA3) can convert normal genotypes to a phenotype resembling ein. The content of endogenous GA1 and GA3 were estimated by gas chromatography-selected ion monitoring using [2H]GA1 as a quantitative internal standard and at day 14 were 1.5- and 12.1-fold higher per stem, respectively, in ein than in normal plants, although GA concentrations were more similar. The endogenous levels of GA20 and GA1, and the rate of GA19 metabolism were simultaneously analyzed. Levels of GA1 and GA20 were 4.6- and 12.9-fold higher, respectively, and conversions to GA20 and GA1 were 8.3 and 1.3 times faster in ein than normal plants. Confirming the enhanced rate of GA1 biosynthesis in ein, the conversion of [3H]GA20 to [3H] GA1 was also faster in ein than in the normal genotype. Thus, the ein allele results in accelerated GA1 biosynthesis and an elevated content of endogenous GAs, including the dihydroxylated GAs A1 and A3

  2. A mutant gene that increases gibberellin production in Brassica

    Energy Technology Data Exchange (ETDEWEB)

    Rood, S.B. (Univ. of Lethbridge, Alberta (Canada)); Williams, P.H. (Univ. of Wisconsin, Madison (USA)); Pearce, D.; Pharis, R.P. (Univ. of Calgary, Alberta (Canada)); Murofushi, Noboru (Univ. of Tokyo (Japan)); Mander, L.N. (Australian National Univ., Canberra (Australia))

    1990-07-01

    A single gene mutant (elongated internode (ein/ein)) with accelerated shoot elongation was identified from a rapid cycling line of Brassica rapa. Relative to normal plants, mutant plants had slightly accelerated floral development, greater stem dry weights, and particularly, increased internode and inflorescence elongation. The application of the triazole plant growth retardant, paclobutrazol, inhibited shoot elongation, returning ein to a more normal phenotype. Conversely, exogenous gibberellin A{sub 3} (GA{sub 3}) can convert normal genotypes to a phenotype resembling ein. The content of endogenous GA{sub 1} and GA{sub 3} were estimated by gas chromatography-selected ion monitoring using ({sup 2}H)GA{sub 1} as a quantitative internal standard and at day 14 were 1.5- and 12.1-fold higher per stem, respectively, in ein than in normal plants, although GA concentrations were more similar. The endogenous levels of GA{sub 20} and GA{sub 1}, and the rate of GA{sub 19} metabolism were simultaneously analyzed. Levels of GA{sub 1} and GA{sub 20} were 4.6- and 12.9-fold higher, respectively, and conversions to GA{sub 20} and GA{sub 1} were 8.3 and 1.3 times faster in ein than normal plants. Confirming the enhanced rate of GA{sub 1} biosynthesis in ein, the conversion of ({sup 3}H)GA{sub 20} to ({sup 3}H) GA{sub 1} was also faster in ein than in the normal genotype. Thus, the ein allele results in accelerated GA{sub 1} biosynthesis and an elevated content of endogenous GAs, including the dihydroxylated GAs A{sub 1} and A{sub 3}.

  3. Candidate genes for drought tolerance and improved productivity in rice (Oryza sativa L.)

    Indian Academy of Sciences (India)

    M S Vinod; Naveen Sharma; K Manjunatha; Adnan Kanbar; N B Prakash; H E Shashidhar

    2006-03-01

    Candidate genes are sequenced genes of known biological action involved in the development or physiology of a trait. Twenty-one putative candidate genes were designed after an exhaustive search in the public databases along with an elaborate literature survey for candidate gene products and/or regulatory sequences associated with enhanced drought resistance. The downloaded sequences were then used to design primers considering the flanking sequences as well. Polymerase chain reaction (PCR) performed on 10 diverse cultivars that involved Japonica, Indica and local accessions, revealed 12 polymorphic candidate genes. Seven polymorphic candidate genes were then utilized to genotype 148 individuals of CT9993 × IR62266 doubled haploid (DH) mapping population. The segregation data were tested for deviation from the expected Mendelian ratio (1:1) using a Chi-square test (<1%). Based on this, four candidate genes were assessed to be significant and the remaining three, as non-significant. All the significant candidate genes were biased towards CT9993, the female parent in the DH mapping population. Single-marker analysis strongly associated ( < 1%) them to different traits under both well-watered and low-moisture stress conditions. Two candidate genes, EXP15 and EXP13, were found to be associated with root number and silicon content in the stem respectively, under both well-watered and low-moisture stress conditions.

  4. Split-gene system for hybrid wheat seed production.

    Science.gov (United States)

    Kempe, Katja; Rubtsova, Myroslava; Gils, Mario

    2014-06-24

    Hybrid wheat plants are superior in yield and growth characteristics compared with their homozygous parents. The commercial production of wheat hybrids is difficult because of the inbreeding nature of wheat and the lack of a practical fertility control that enforces outcrossing. We describe a hybrid wheat system that relies on the expression of a phytotoxic barnase and provides for male sterility. The barnase coding information is divided and distributed at two loci that are located on allelic positions of the host chromosome and are therefore "linked in repulsion." Functional complementation of the loci is achieved through coexpression of the barnase fragments and intein-mediated ligation of the barnase protein fragments. This system allows for growth and maintenance of male-sterile female crossing partners, whereas the hybrids are fertile. The technology does not require fertility restorers and is based solely on the genetic modification of the female crossing partner.

  5. Functional analysis of the Erwinia herbicola tutB gene and its product.

    Science.gov (United States)

    Katayama, Takane; Suzuki, Hideyuki; Koyanagi, Takashi; Kumagai, Hidehiko

    2002-06-01

    The tutB gene, which lies just downstream of tpl, has been cloned from Erwinia herbicola, and its product was analyzed. Despite its high sequence similarity to tryptophan transporters, TutB was found to be a tyrosine-specific transporter. Tryptophan acted as a competitive inhibitor of tyrosine transport. Unlike the tryptophanase operon, the tpl and tutB genes do not constitute an operon. PMID:12003958

  6. Functional Analysis of the Erwinia herbicola tutB Gene and Its Product

    OpenAIRE

    Katayama, Takane; Suzuki, Hideyuki; Koyanagi, Takashi; Kumagai, Hidehiko

    2002-01-01

    The tutB gene, which lies just downstream of tpl, has been cloned from Erwinia herbicola, and its product was analyzed. Despite its high sequence similarity to tryptophan transporters, TutB was found to be a tyrosine-specific transporter. Tryptophan acted as a competitive inhibitor of tyrosine transport. Unlike the tryptophanase operon, the tpl and tutB genes do not constitute an operon.

  7. Genetic Resources for Advanced Biofuel Production Described with the Gene Ontology

    Directory of Open Access Journals (Sweden)

    Trudy eTorto-Alalibo

    2014-10-01

    Full Text Available Dramatic increases in research in the area of microbial biofuel production coupled with high-throughput data generation on bioenergy-related microbes has led to a deluge of information in the scientific literature and in databases. Consolidating this information and making it easily accessible requires a unified vocabulary. The Gene Ontology (GO fulfills that requirement, as it is a well-developed structured vocabulary that describes the activities and locations of gene products in a consistent manner across all kingdoms of life. The Microbial Energy Gene Ontology (MENGO: http://www.mengo.biochem.vt.edu project is extending the GO to include new terms to describe microbial processes of interest to bioenergy production. Our effort has added over 600 bioenergy related terms to the Gene Ontology. These terms will aid in the comprehensive annotation of gene products from diverse energy-related microbial genomes. An area of microbial energy research that has received a lot of attention is microbial production of advanced biofuels. These include alcohols such as butanol, isopropanol, isobutanol, and fuels derived from fatty acids, isoprenoids, and polyhydroxyalkanoates. These fuels are superior to first generation biofuels (ethanol and biodiesel esterified from vegetable oil or animal fat, can be generated from non-food feedstock sources, can be used as supplements or substitutes for gasoline, diesel and jet fuels, and can be stored and distributed using existing infrastructure. Here we review the roles of genes associated with synthesis of advanced biofuels, and at the same time introduce the use of the GO to describe the functions of these genes in a standardized way.

  8. GeneViTo: Visualizing gene-product functional and structural features in genomic datasets

    Directory of Open Access Journals (Sweden)

    Promponas Vasilis J

    2003-10-01

    Full Text Available Abstract Background The availability of increasing amounts of sequence data from completely sequenced genomes boosts the development of new computational methods for automated genome annotation and comparative genomics. Therefore, there is a need for tools that facilitate the visualization of raw data and results produced by bioinformatics analysis, providing new means for interactive genome exploration. Visual inspection can be used as a basis to assess the quality of various analysis algorithms and to aid in-depth genomic studies. Results GeneViTo is a JAVA-based computer application that serves as a workbench for genome-wide analysis through visual interaction. The application deals with various experimental information concerning both DNA and protein sequences (derived from public sequence databases or proprietary data sources and meta-data obtained by various prediction algorithms, classification schemes or user-defined features. Interaction with a Graphical User Interface (GUI allows easy extraction of genomic and proteomic data referring to the sequence itself, sequence features, or general structural and functional features. Emphasis is laid on the potential comparison between annotation and prediction data in order to offer a supplement to the provided information, especially in cases of "poor" annotation, or an evaluation of available predictions. Moreover, desired information can be output in high quality JPEG image files for further elaboration and scientific use. A compilation of properly formatted GeneViTo input data for demonstration is available to interested readers for two completely sequenced prokaryotes, Chlamydia trachomatis and Methanococcus jannaschii. Conclusions GeneViTo offers an inspectional view of genomic functional elements, concerning data stemming both from database annotation and analysis tools for an overall analysis of existing genomes. The application is compatible with Linux or Windows ME-2000-XP operating

  9. Identification of the uvrD gene product of Salmonella typhimurium LT2.

    OpenAIRE

    Pang, P P; Walker, G C

    1983-01-01

    The product of the uvrD gene of Salmonella typhimurium LT2 and Escherichia coli K-12 is thought to play a role in both the correction of mismatched bases and the repair of DNA damage, since insertion mutations in the uvrD gene increase the spontaneous mutation frequency and make the cells more sensitive to killing by UV irradiation. To clone the uvrD gene of S. typhimurium, we first generated a uvrD-specific probe by using DNA from an S. typhimurium uvrD421::Tn5 mutant. This probe was used to...

  10. Investigation of genes involved in nisin production in Enterococcus spp. strains isolated from raw goat milk.

    Science.gov (United States)

    Perin, Luana Martins; Todorov, Svetoslav Dimitrov; Nero, Luís Augusto

    2016-09-01

    Different strains of Lactococcus lactis are capable of producing the bacteriocin nisin. However, genetic transfer mechanisms allow the natural occurrence of genes involved in nisin production in members of other bacterial genera, such as Enterococcus spp. In a previous study, nisA was identified in eight enterococci capable of producing antimicrobial substances. The aim of this study was to verify the presence of genes involved in nisin production in Enterococcus spp. strains, as well as nisin expression. The nisA genes from eight Enterococcus spp. strains were sequenced and the translated amino acid sequences were compared to nisin amino-acid sequences previously described in databases. Although containing nisin structural and maturation related genes, the enterococci strains tested in the present study did not present the immunity related genes (nisFEG and nisI). The translated sequences of nisA showed some point mutations, identical to those presented by Lactococcus strains isolated from goat milk. All enterococci were inhibited by nisin, indicating the absence of immunity and thus that nisin cannot be expressed. This study demonstrated for the first time the natural occurrence of nisin structural genes in Enterococcus strains and highlights the importance of providing evidence of a link between the presence of bacteriocin genes and their expression.

  11. Investigation of genes involved in nisin production in Enterococcus spp. strains isolated from raw goat milk.

    Science.gov (United States)

    Perin, Luana Martins; Todorov, Svetoslav Dimitrov; Nero, Luís Augusto

    2016-09-01

    Different strains of Lactococcus lactis are capable of producing the bacteriocin nisin. However, genetic transfer mechanisms allow the natural occurrence of genes involved in nisin production in members of other bacterial genera, such as Enterococcus spp. In a previous study, nisA was identified in eight enterococci capable of producing antimicrobial substances. The aim of this study was to verify the presence of genes involved in nisin production in Enterococcus spp. strains, as well as nisin expression. The nisA genes from eight Enterococcus spp. strains were sequenced and the translated amino acid sequences were compared to nisin amino-acid sequences previously described in databases. Although containing nisin structural and maturation related genes, the enterococci strains tested in the present study did not present the immunity related genes (nisFEG and nisI). The translated sequences of nisA showed some point mutations, identical to those presented by Lactococcus strains isolated from goat milk. All enterococci were inhibited by nisin, indicating the absence of immunity and thus that nisin cannot be expressed. This study demonstrated for the first time the natural occurrence of nisin structural genes in Enterococcus strains and highlights the importance of providing evidence of a link between the presence of bacteriocin genes and their expression. PMID:27255139

  12. Overexpression of bacterial ethylene-forming enzyme gene in Trichoderma reesei enhanced the production of ethylene

    Directory of Open Access Journals (Sweden)

    Xi Chen, Yong Liang, Jing Hua, Li Tao, Wensheng Qin, Sanfeng Chen

    2010-01-01

    Full Text Available In order to efficiently utilize natural cellulose materials to produce ethylene, three expression vectors containing the ethylene-forming enzyme (efe gene from Pseudomonas syringae pv. glycinea were constructed. The target gene was respectively controlled by different promoters: cbh I promoter from Trichoderma reesei cellobiohydrolases I gene, gpd promoter from Aspergillus nidulans glyceraldehyde-3-phosphate dehydrogenase gene and pgk I promoter from T. reesei 3-phosphoglycerate kinase I gene. After transforming into T. reesei QM9414, 43 stable transformants were obtained by PCR amplification and ethylene determination. Southern blot analysis of 14 transformants demonstrated that the efe gene was integrated into chromosomal DNA with copy numbers from 1 to 4. Reverse transcription polymerase chain reaction (RT-PCR analysis of 6 transformants showed that the heterologous gene was transcribed. By using wheat straw as a carbon source, the ethylene production rates of aforementioned 14 transformants were measured. Transformant C30-3 with pgk I promoter had the highest ethylene production (4,012 nl h-1 l-1. This indicates that agricultural wastes could be used to produce ethylene in recombinant filamentous fungus T. reesei.

  13. The 32-kilobase exp gene cluster of Rhizobium meliloti directing the biosynthesis of galactoglucan: genetic organization and properties of the encoded gene products.

    OpenAIRE

    Becker, A.; Rüberg, S; Küster, H.; Roxlau, A A; Keller, M; Ivashina, T; H.P. Cheng; Walker, G C; Pühler, A

    1997-01-01

    Proteins directing the biosynthesis of galactoglucan (exopolysaccharide II) in Rhizobium meliloti Rm2011 are encoded by the exp genes. Sequence analysis of a 32-kb DNA fragment of megaplasmid 2 containing the exp gene cluster identified previously (J. Glazebrook and G. C. Walker, Cell 56:661-672, 1989) revealed the presence of 25 open reading frames. Homologies of the deduced exp gene products to proteins of known function suggested that the exp genes encoded four proteins involved in the bio...

  14. Associations between polymorphisms of the gene and milk production traits in water buffaloes.

    Science.gov (United States)

    Deng, T X; Pang, C Y; Lu, X R; Zhu, P; Duan, A Q; Liang, X W

    2016-03-01

    Signal transducer and activator of transcription 1 () is an important regulator of mammary gland differentiation and cell survival that has been regarded as a candidate gene affecting milk production traits in mammals. Therefore, this study was conducted to evaluate significant associations between SNP of the gene and milk production traits in buffaloes. Here, 18 SNP were identified in the buffalo gene, including 15 intronic mutations and 3 exon mutations. All the identified SNP were then genotyped using matrix-assisted laser desorption/ionization time of flight mass spectrometry methods from 192 buffaloes. All the SNP were in Hardy-Weinberg equilibrium, and 2 haplotype blocks were successfully constructed based on these SNP data, which formed 5 and 3 major haplotypes in the population (>5%), respectively. The results of association analysis showed that only SNP13 located in exon 10 was significantly associated with the milk production traits in the population ( buffalo gene are associated with milk production traits and can be used as a candidate gene for marker-assisted selection in buffalo breeding. PMID:27065255

  15. 1,3-Propanediol production by Escherichia coli using genes from Citrobacter freundii atcc 8090.

    Science.gov (United States)

    Przystałowska, Hanna; Zeyland, Joanna; Kośmider, Alicja; Szalata, Marlena; Słomski, Ryszard; Lipiński, Daniel

    2015-01-01

    Compared with chemical synthesis, fermentation has the advantage of mass production at low cost, and has been used in the production of various industrial chemicals. As a valuable organic compound, 1,3-propanediol (1,3-PDO) has numerous applications in the production of polymers, lubricants, cosmetics and medicines. Here, conversion of glycerol (a renewable substrate and waste from biodiesel production) to 1,3-PDO by E. coli bacterial strain carrying altered glycerol metabolic pathway was investigated. Two gene constructs containing the 1,3-PDO operon from Citrobacter freundii (pCF1 and pCF2) were used to transform the bacteria. The pCF1 gene expression construct contained dhaBCE genes encoding the three subunits of glycerol dehydratase, dhaF encoding the large subunit of the glycerol dehydratase reactivation factor and dhaG encoding the small subunit of the glycerol dehydratase reactivating factor. The pCF2 gene expression construct contained the dhaT gene encoding the 1,3-propanediol dehydrogenase. Expression of the genes cloned in the above constructs was under regulation of the T7lac promoter. RT-PCR, SDS-PAGE analyses and functional tests confirmed that 1,3-PDO synthesis pathway genes were expressed at the RNA and protein levels, and worked flawlessly in the heterologous host. In a batch flask culture, in a short time applied just to identify the 1,3-PDO in a preliminary study, the recombinant E. coli bacteria produced 1.53 g/L of 1,3-PDO, using 21.2 g/L of glycerol in 72 h. In the Sartorius Biostat B Plus reactor, they produced 11.7 g/L of 1,3-PDO using 24.2 g/L of glycerol, attaining an efficiency of 0.58 [mol1,3-PDO/molglycerol].

  16. Isolated fungal promoters and gene transcription terminators and methods of protein and chemical production in a fungus

    Energy Technology Data Exchange (ETDEWEB)

    Dai, Ziyu; Lasure, Linda L; Magnuson, Jon K

    2014-05-27

    The present invention encompasses isolated gene regulatory elements and gene transcription terminators that are differentially expressed in a native fungus exhibiting a first morphology relative to the native fungus exhibiting a second morphology. The invention also encompasses a method of utilizing a fungus for protein or chemical production. A transformed fungus is produced by transforming a fungus with a recombinant polynucleotide molecule. The recombinant polynucleotide molecule contains an isolated polynucleotide sequence linked operably to another molecule comprising a coding region of a gene of interest. The gene regulatory element and gene transcription terminator may temporally and spatially regulate expression of particular genes for optimum production of compounds of interest in a transgenic fungus.

  17. Isolated Fungal Promoters and Gene Transcription Terminators and Methods of Protein and Chemical Production in a Fungus

    Science.gov (United States)

    Dai, Ziyu; Lasure, Linda L.; Magnuson, Jon K.

    2008-11-11

    The present invention encompasses isolated gene regulatory elements and gene transcription terminators that are differentially expressed in a native fungus exhibiting a first morphology relative to the native fungus exhibiting a second morphology. The invention also encompasses a method of utilizing a fungus for protein or chemical production. A transformed fungus is produced by transforming a fungus with a recombinant polynucleotide molecule. The recombinant polynucleotide molecule contains an isolated polynucleotide sequence linked operably to another molecule comprising a coding region of a gene of interest. The gene regulatory element and gene transcription terminator may temporally and spatially regulate expression of particular genes for optimum production of compounds of interest in a transgenic fungus.

  18. Regulatory structures for gene therapy medicinal products in the European Union.

    Science.gov (United States)

    Klug, Bettina; Celis, Patrick; Carr, Melanie; Reinhardt, Jens

    2012-01-01

    Taking into account the complexity and technical specificity of advanced therapy medicinal products: (gene and cell therapy medicinal products and tissue engineered products), a dedicated European regulatory framework was needed. Regulation (EC) No. 1394/2007, the "ATMP Regulation" provides tailored regulatory principles for the evaluation and authorization of these innovative medicines. The majority of gene or cell therapy product development is carried out by academia, hospitals, and small- and medium-sized enterprises (SMEs). Thus, acknowledging the particular needs of these types of sponsors, the legislation also provides incentives for product development tailored to them. The European Medicines Agency (EMA) and, in particular, its Committee for Advanced Therapies (CAT) provide a variety of opportunities for early interaction with developers of ATMPs to enable them to have early regulatory and scientific input. An important tool to promote innovation and the development of new medicinal products by micro-, small-, and medium-sized enterprises is the EMA's SME initiative launched in December 2005 to offer financial and administrative assistance to smaller companies. The European legislation also foresees the involvement of stakeholders, such as patient organizations, in the development of new medicines. Considering that gene therapy medicinal products are developed in many cases for treatment of rare diseases often of monogenic origin, the involvement of patient organizations, which focus on rare diseases and genetic and congenital disorders, is fruitful. Two such organizations are represented in the CAT. Research networks play another important role in the development of gene therapy medicinal products. The European Commission is funding such networks through the EU Sixth Framework Program.

  19. MEF2B gene SNP markers of meat productivity in Severokavkazskaya sheep breed

    Directory of Open Access Journals (Sweden)

    Trukhachev Vladimir

    2016-01-01

    Full Text Available One of the new promising candidate genes defining productive qualities of sheep is MEF2B. Protein from the MEF2 group encoded by it affects the production of myostatin and the expression of the genes responsible for the growth of skeletal muscle fibers. Thus, the knowledge of the MEF2B gene structure is important for genomic selection. We have studied the structure of the MEF2B gene at sheep of Severokavkazskaya breed bred in Russia. To detect alleles we use NimbleGen sequencing technology by Roche (USA. As a result, it was revealed 14 single nucleotide polymorphisms (SNP at the given breed. The discovered SNPare located in not coding areas. From them 7 polymorphisms are in the area of 5’ upstream gene in loci: c.-1713, c.-1319, c.-839, c.-321, c.-246, c.-161, c.-3; 6 polymorphisms are in introns, loci: c.55-51, c.258+312, c.258+380, c.259-52, c.452+95, c.452+103, 1 SNP is in 3’ downstream gene, c.

  20. Effects of medium composition on the production of plasmid DNA vector potentially for human gene therapy

    Institute of Scientific and Technical Information of China (English)

    XU Zhi-nan; SHEN Wen-he; CHEN Hao; CEN Pei-lin

    2005-01-01

    Plasmid vector is increasingly applied to gene therapy or gene vaccine. The production of plasmid pCMV-AP3 for cancer gene therapy was conducted in a modified MBL medium using a recombinant E. coli BL21 system. The effects of different MMBL components on plasmid yield, cell mass and specific plasmid DNA productivity were evaluated on shake-flask scale. The results showed that glucose was the optimal carbon source. High plasmid yield (58.3 mg/L) was obtained when 5.0 g/L glucose was added to MMBL. Glycerol could be chosen as a complementary carbon source because of the highest specific plasmid productivity (37.9 mg DNA/g DCW). After tests of different levels of nitrogen source and inorganic phosphate, a modified MMBL medium was formulated for optimal plasmid production. Further study showed that the initial acetate addition (less than 4.0 g/L) in MMBL improved plasmid production significantly, although it inhibited cell growth. The results will be useful for large-scale plasmid production using recombinant E. coli system.

  1. Efficient production of multi-modified pigs for xenotransplantation by 'combineering', gene stacking and gene editing.

    Science.gov (United States)

    Fischer, Konrad; Kraner-Scheiber, Simone; Petersen, Björn; Rieblinger, Beate; Buermann, Anna; Flisikowska, Tatiana; Flisikowski, Krzysztof; Christan, Susanne; Edlinger, Marlene; Baars, Wiebke; Kurome, Mayuko; Zakhartchenko, Valeri; Kessler, Barbara; Plotzki, Elena; Szczerbal, Izabela; Switonski, Marek; Denner, Joachim; Wolf, Eckhard; Schwinzer, Reinhard; Niemann, Heiner; Kind, Alexander; Schnieke, Angelika

    2016-01-01

    Xenotransplantation from pigs could alleviate the shortage of human tissues and organs for transplantation. Means have been identified to overcome hyperacute rejection and acute vascular rejection mechanisms mounted by the recipient. The challenge is to combine multiple genetic modifications to enable normal animal breeding and meet the demand for transplants. We used two methods to colocate xenoprotective transgenes at one locus, sequential targeted transgene placement - 'gene stacking', and cointegration of multiple engineered large vectors - 'combineering', to generate pigs carrying modifications considered necessary to inhibit short to mid-term xenograft rejection. Pigs were generated by serial nuclear transfer and analysed at intermediate stages. Human complement inhibitors CD46, CD55 and CD59 were abundantly expressed in all tissues examined, human HO1 and human A20 were widely expressed. ZFN or CRISPR/Cas9 mediated homozygous GGTA1 and CMAH knockout abolished α-Gal and Neu5Gc epitopes. Cells from multi-transgenic piglets showed complete protection against human complement-mediated lysis, even before GGTA1 knockout. Blockade of endothelial activation reduced TNFα-induced E-selectin expression, IFNγ-induced MHC class-II upregulation and TNFα/cycloheximide caspase induction. Microbial analysis found no PERV-C, PCMV or 13 other infectious agents. These animals are a major advance towards clinical porcine xenotransplantation and demonstrate that livestock engineering has come of age. PMID:27353424

  2. Ethanol production by Escherichia coli strains co-expressing Zymomonas PDC and ADH genes

    Energy Technology Data Exchange (ETDEWEB)

    Ingram, Lonnie O. (Gainesville, FL); Conway, Tyrrell (Lincoln, NE); Alterthum, Flavio (Gainesville, FL)

    1991-01-01

    A novel operon and plasmids comprising genes which code for the alcohol dehydrogenase and pyruvate decarboxylase activities of Zymomonas mobilis are described. Also disclosed are methods for increasing the growth of microorganisms or eukaryotic cells and methods for reducing the accumulation of undesirable metabolic products in the growth medium of microorganisms or cells.

  3. Nonlinear Biosynthetic Gene Cluster Dose Effect on Penicillin Production by Penicillium chrysogenum

    NARCIS (Netherlands)

    Nijland, Jeroen G.; Ebbendorf, Bjorg; Woszczynska, Marta; Boer, Remon; Bovenberg, Roel A. L.; Driessen, Arnold J. M.

    2010-01-01

    Industrial penicillin production levels by the filamentous fungus Penicillium chrysogenum increased dramatically by classical strain improvement. High-yielding strains contain multiple copies of the penicillin biosynthetic gene cluster that encodes three key enzymes of the beta-lactam biosynthetic p

  4. Hematological- and Neurological-Expressed Sequence 1 Gene Products in Progenitor Cells during Newt Retinal Development

    Directory of Open Access Journals (Sweden)

    Tatsushi Goto

    2012-01-01

    Full Text Available Urodele amphibians such as Japanese common newts have a remarkable ability to regenerate their injured neural retina, even as adults. We found that hematological- and neurological-expressed sequence 1 (Hn1 gene was induced in depigmented retinal pigment epithelial (RPE cells, and its expression was maintained at later stages of newt retinal regeneration. In this study, we investigated the distribution of the HN1 protein, the product of the Hn1 gene, in the developing retinas. Our immunohistochemical analyses suggested that the HN1 protein was highly expressed in an immature retina, and the subcellular localization changed during this retinogenesis as observed in newt retinal regeneration. We also found that the expression of Hn1 gene was not induced in mouse after retinal removal. Our results showed that Hn1 gene can be useful for detection of undifferentiated and dedifferentiated cells during both newt retinal development and regeneration.

  5. Aerobic conditions increase isoprenoid biosynthesis pathway gene expression levels for carotenoid production in Enterococcus gilvus.

    Science.gov (United States)

    Hagi, Tatsuro; Kobayashi, Miho; Nomura, Masaru

    2015-06-01

    Some lactic acid bacteria that harbour carotenoid biosynthesis genes (crtNM) can produce carotenoids. Although aerobic conditions can increase carotenoid production and crtNM expression levels, their effects on the pathways that synthesize carotenoid precursors such as mevalonate and isoprene are not completely understood. In this study, we investigated whether aerobic conditions affected gene expression levels involved in the isoprenoid biosynthesis pathway that includes the mevalonate and isoprene biosynthesis pathways in Enterococcus gilvus using real-time quantitative reverse transcription PCR. NADH oxidase (nox) and superoxide dismutase (sod) gene expression levels were investigated as controls for aerobic conditions. The expression levels of nox and sod under aerobic conditions were 7.2- and 8.0-fold higher, respectively, than those under anaerobic conditions. Aerobic conditions concomitantly increased the expression levels of crtNM carotenoid biosynthesis genes. HMG-CoA synthase gene expression levels in the mevalonate pathway were only slightly increased under aerobic conditions, whereas the expression levels of HMG-CoA reductase and five other genes in the isoprene biosynthesis pathways were 1.2-2.3-fold higher than those under anaerobic conditions. These results demonstrated that aerobic conditions could increase the expression levels of genes involved in the isoprenoid biosynthesis pathway via mevalonate in E. gilvus.

  6. Phenazine Production in The Presence of Heavy Metals in Recombinant Erwinia herbicola Bearing the Hemoglobin Gene

    OpenAIRE

    KAHRAMAN, Hüseyin; Emel AYTAN; GİRAY KURT, Aslı; Duygu ÖZCAN

    2014-01-01

    In this study, from Vitreoscilla sp. recombinant strains were obtained from cloned bacterial hemoglobin (VHb) gene (vgb) Eh [pUC8:15] and its wild-type strain Erwinia herbicola phenazine production in the presence of heavy metals were investigated. Time-dependent production of phenazine in the wild bacteria not shows a significant change. In generally, at the end of 96 hours in the presence of Pb in terms of production of wild-type bacteria phenazine 2.91 μg/ml of recombinant bacteria is to ...

  7. Rhamnolipids in perspective: gene regulatory pathways, metabolic engineering, production and technological forecasting.

    Science.gov (United States)

    Dobler, Leticia; Vilela, Leonardo F; Almeida, Rodrigo V; Neves, Bianca C

    2016-01-25

    Rhamnolipids have emerged as a very promising class of biosurfactants in the last decades, exhibiting properties of great interest in several industrial applications, and have represented a suitable alternative to chemically-synthesized surfactants. This class of biosurfactants has been extensively studied in recent years, aiming at their large-scale production based on renewable resources, which still require high financial costs. Development of non-pathogenic, high-producing strains has been the focus of a number of studies involving heterologous microbial hosts as platforms. However, the intricate gene regulation network controlling rhamnolipid biosynthesis represents a challenge to metabolic engineering and remains to be further understood and explored. This article provides an overview of the biosynthetic pathways and the main gene regulatory factors involved in rhamnolipid production within Pseudomonas aeruginosa, the prototypal producing species. In addition, we provide a perspective view into the main strategies applied to metabolic engineering and biotechnological production. PMID:26409933

  8. Correlation of methane production and functional gene transcriptional activity in a peat soil.

    Science.gov (United States)

    Freitag, Thomas E; Prosser, James I

    2009-11-01

    The transcription dynamics of subunit A of the key gene in methanogenesis (methyl coenzyme M reductase; mcrA) was studied to evaluate the relationship between process rate (methanogenesis) and gene transcription dynamics in a peat soil ecosystem. Soil methanogen process rates were determined during incubation of peat slurries at temperatures from 4 to 37 degrees C, and real-time quantitative PCR was applied to quantify the abundances of mcrA genes and transcripts; corresponding transcriptional dynamics were calculated from mcrA transcript/gene ratios. Internal standards suggested unbiased recovery of mRNA abundances in comparison to DNA levels. In comparison to those in pure-culture studies, mcrA transcript/gene ratios indicated underestimation by 1 order of magnitude, possibly due to high proportions of inactive or dead methanogens. Methane production rates were temperature dependent, with maxima at 25 degrees C, but changes in abundance and transcription of the mcrA gene showed no correlation with temperature. However, mcrA transcript/gene ratios correlated weakly (regression coefficient = 0.76) with rates of methanogenesis. Methanogen process rates increased over 3 orders of magnitude, while the corresponding maximum transcript/gene ratio increase was only 18-fold. mcrA transcript dynamics suggested steady-state expression in peat soil after incubation for 24 and 48 h, similar to that in stationary-phase cultures. mcrA transcript/gene ratios are therefore potential in situ indicators of methanogen process rate changes in complex soil systems.

  9. Correlation of gene expression and protein production rate - a system wide study

    Directory of Open Access Journals (Sweden)

    Arvas Mikko

    2011-12-01

    Full Text Available Abstract Background Growth rate is a major determinant of intracellular function. However its effects can only be properly dissected with technically demanding chemostat cultivations in which it can be controlled. Recent work on Saccharomyces cerevisiae chemostat cultivations provided the first analysis on genome wide effects of growth rate. In this work we study the filamentous fungus Trichoderma reesei (Hypocrea jecorina that is an industrial protein production host known for its exceptional protein secretion capability. Interestingly, it exhibits a low growth rate protein production phenotype. Results We have used transcriptomics and proteomics to study the effect of growth rate and cell density on protein production in chemostat cultivations of T. reesei. Use of chemostat allowed control of growth rate and exact estimation of the extracellular specific protein production rate (SPPR. We find that major biosynthetic activities are all negatively correlated with SPPR. We also find that expression of many genes of secreted proteins and secondary metabolism, as well as various lineage specific, mostly unknown genes are positively correlated with SPPR. Finally, we enumerate possible regulators and regulatory mechanisms, arising from the data, for this response. Conclusions Based on these results it appears that in low growth rate protein production energy is very efficiently used primarly for protein production. Also, we propose that flux through early glycolysis or the TCA cycle is a more fundamental determining factor than growth rate for low growth rate protein production and we propose a novel eukaryotic response to this i.e. the lineage specific response (LSR.

  10. Production of 2-ketoisocaproate with Corynebacterium glutamicum strains devoid of plasmids and heterologous genes.

    Science.gov (United States)

    Vogt, Michael; Haas, Sabine; Polen, Tino; van Ooyen, Jan; Bott, Michael

    2015-03-01

    2-Ketoisocaproate (KIC), the last intermediate in l-leucine biosynthesis, has various medical and industrial applications. After deletion of the ilvE gene for transaminase B in l-leucine production strains of Corynebacterium glutamicum, KIC became the major product, however, the strains were auxotrophic for l-isoleucine. To avoid auxotrophy, reduction of IlvE activity by exchanging the ATG start codon of ilvE by GTG was tested instead of an ilvE deletion. The resulting strains were indeed able to grow in glucose minimal medium without amino acid supplementation, but at the cost of lowered growth rates and KIC production parameters. The best production performance was obtained with strain MV-KICF1, which carried besides the ilvE start codon exchange three copies of a gene for a feedback-resistant 2-isopropylmalate synthase, one copy of a gene for a feedback-resistant acetohydroxyacid synthase and deletions of ltbR and iolR encoding transcriptional regulators. In the presence of 1 mM l-isoleucine, MV-KICF1 accumulated 47 mM KIC (6.1 g l(-1)) with a yield of 0.20 mol/mol glucose and a volumetric productivity of 1.41 mmol KIC l(-1)  h(-1). Since MV-KICF1 is plasmid free and lacks heterologous genes, it is an interesting strain for industrial application and as platform for the production of KIC-derived compounds, such as 3-methyl-1-butanol. PMID:25488800

  11. Increase of Clavulanic acid production by using recombinant Streptomyces clavuligerus strain including claR gene

    Directory of Open Access Journals (Sweden)

    Maryam Kay

    2014-07-01

    Full Text Available   Introduction : Clavulanic acid is a major β-lactam antibiotic which is produced by Streptomyces clavuligerus. Clavulanic acid is used in combination of strong but sensitive to β-lactamase antibiotics. The claR gene has an important role in regulation of clavulanic acid production and is needed for the expression of the genes in final step of clavulanic acid biosynthesis.   Materials and methods: The recombinant construct pMTclaR which contains claR gene is obtained from Isfahan University and plasmid extraction was done from Streptomyces lividans for next steps. The Streptomyces clavuligerus protoplast was prepared and transformation was done by using polyethylene glycol. Transformation was confirmed by plasmid extraction and PCR. Finally, bioassay method was used to survey the effect of extra copy of claR on clavulanic acid production .   Results : The typical chalky white colony of Streptomyces clavuligerus was seen on GYME plates containing thiostrepton antibiotic. Plasmid extraction was initially carried out. Furthermore, PCR reaction was done by claR specific primers and the 1334 bp band which was belonging to claR was detected. Finally, the bioassay was done and the diameters of zone of inhibition in control and sample were compared. The results of the bioassay show that amplification of the claR gene in multicopy plasmids resulted in a 2.5 fold increase in clavulanic acid production .   Discussion and conclusion : In this study the 3.3 fold increase in clavulanic acid production was obtained by using an expression vector containing claR. According to the clinical use of clavulanic acid, production of bacterial strains which are able to produce high level of antibiotic can help significantly in customization of antibiotic production.

  12. Epstein-Barr virus immediate-early gene product trans-activates gene expression from the human immunodeficiency virus long terminal repeat

    International Nuclear Information System (INIS)

    Acquired immunodeficiency syndrome patients are frequently coinfected with Epstein-Barr virus (EBV). In this report, the authors demonstrate that an EBV immediate-early gene product, BamHI MLF1, stimulates expression of the bacterial chloramphenicol acetyltransferase (CAT) gene linked to the human immunodeficiency virus (HIV) promoter. The HIV promoter sequences necessary for trans-activation by EBV do not include the tat-responsive sequences. In addition, in contrast to the other herpesvirus trans-activators previously studied, the EBV BamHI MLF1 gene product appears to function in part by a posttranscriptional mechanism, since it increases pHIV-CAT protein activity more than it increases HIV-CAT mRNA. This ability of an EBV gene product to activate HIV gene expression may have biologic consequences in persons coinfected with both viruses

  13. Enhanced hydrogen production by insertional inactivation of adhE gene in Klebsiella oxytoca HP1

    Institute of Scientific and Technical Information of China (English)

    ZHU JunBo; LONG MinNan; XU FangCheng; WU XiaoBing; XU HuiJuan

    2007-01-01

    Ethanol is the main byproduct of anaerobic H2-producing fermentation in Klebsiella oxytoca HP1. Two moles of NAD(P)H are consumed to yield one mole of ethanol that may decrease bacterial hydrogen production. In this article the adhE gene that codes for acetaldehyde dehydrogenase was disrupted for the first time. A homologous recombination vector pTA-Str was constructed in which the adhE gene was disrupted by inserting an aminoglycoside-3'-adenyltransferase (aadA) gene. As expected, the vector includes the insertion 5'-adhE-aadA-adhE-3'. The amplified DNA fragment 5'-adhE-aadA-adhE-3' from pTA-Str was transformed into K. Oxytoca HP1 and one recombinant was obtained. PCR analysis of the resulting genomic DNA indicated the appropriate deletion and insertion. Compared with the H2-production of wild type K. Oxytoca HP1, the hydrogen yield of the mutant increased by 16.07% and ethanol concentration decreased by 77.47%, suggesting that inactivation of the adhE gene in K. Oxytoca HP1 is a potential method for enhancing bacterial H2-production.

  14. STAPHYLOCOCCUS AUREUS ISOLATES FROM CAMELS DIFFER IN COAGULASE PRODUCTION, GENOTYPE AND METHICILLIN RESISTANCE GENE PROFILES

    Directory of Open Access Journals (Sweden)

    Ziad Jaradat

    2013-06-01

    Full Text Available Accurate and rapid typing of S. aureus is crucial to the control of its infections and minimizing its leakage to the food chain. The primary purpose of this research was to isolate S. aureus from camels’ meat and nasal swabs and to characterize the isolates for coagulase production and the presence of methicillin gene using PCR-RFLP of coagulase gene. A total of 264 camel’s meat and nasal swabs were collected from abattoirs or meat markets and were used in the study. Ninety two percent of samples showed typical colonies of S. aureus on Baird-Parker agar with a mean count 2.5 × 104 ± 1.8 × 104 CFU g-1. Upon confirmation of the isolates using S. aureus specific thermonuclease gene (nuc PCR primers, only 64 isolates contained the specific product and thus were confirmed as S. aureus. However, when tested for the presence of coagulase gene, only 48 of them were positive while the other 16 were coagulase negative. Coagulase gene-RFLP revealed 19 distinct patterns when the gene was digested with Alu I and Cfo I. The typing revealed that the 48 classified isolates were genetically diverse and comprised a heterogeneous population with 14 genotypes at a 44.4% similarity level. When the coagulase positive isolates were tested for the presence of methicillin resistance (mec A gene, 37 of the isolates were positive while the other 11 isolates were negative. The high heterogeneity among S. aureus isolates might be due to cross contamination between camel carcasses in slaughter houses and from handlers and their utensils.

  15. Identification of Drosophila gene products required for phagocytosis of Candida albicans.

    Directory of Open Access Journals (Sweden)

    Shannon L Stroschein-Stevenson

    2006-01-01

    Full Text Available Phagocytosis is a highly conserved aspect of innate immunity. We used Drosophila melanogaster S2 cells as a model system to study the phagocytosis of Candida albicans, the major fungal pathogen of humans, by screening an RNAi library representing 7,216 fly genes conserved among metazoans. After rescreening the initial genes identified and eliminating certain classes of housekeeping genes, we identified 184 genes required for efficient phagocytosis of C. albicans. Diverse biological processes are represented, with actin cytoskeleton regulation, vesicle transport, signaling, and transcriptional regulation being prominent. Secondary screens using Escherichia coli and latex beads revealed several genes specific for C. albicans phagocytosis. Characterization of one of those gene products, Macroglobulin complement related (Mcr, shows that it is secreted, that it binds specifically to the surface of C. albicans, and that it promotes its subsequent phagocytosis. Mcr is closely related to the four Drosophila thioester proteins (Teps, and we show that TepII is required for efficient phagocytosis of E. coli (but not C. albicans or Staphylococcus aureus and that TepIII is required for the efficient phagocytosis of S. aureus (but not C. albicans or E. coli. Thus, this family of fly proteins distinguishes different pathogens for subsequent phagocytosis.

  16. The SKP1-like gene family of Arabidopsis exhibits a high degree of differential gene expression and gene product interaction during development.

    Directory of Open Access Journals (Sweden)

    Mohammad H Dezfulian

    Full Text Available The Arabidopsis thaliana genome encodes several families of polypeptides that are known or predicted to participate in the formation of the SCF-class of E3-ubiquitin ligase complexes. One such gene family encodes the Skp1-like class of polypeptide subunits, where 21 genes have been identified and are known to be expressed in Arabidopsis. Phylogenetic analysis based on deduced polypeptide sequence organizes the family of ASK proteins into 7 clades. The complexity of the ASK gene family, together with the close structural similarity among its members raises the prospect of significant functional redundancy among select paralogs. We have assessed the potential for functional redundancy within the ASK gene family by analyzing an expanded set of criteria that define redundancy with higher resolution. The criteria used include quantitative expression of locus-specific transcripts using qRT-PCR, assessment of the sub-cellular localization of individual ASK:YFP auto-fluorescent fusion proteins expressed in vivo as well as the in planta assessment of individual ASK-F-Box protein interactions using bimolecular fluorescent complementation techniques in combination with confocal imagery in live cells. The results indicate significant functional divergence of steady state transcript abundance and protein-protein interaction specificity involving ASK proteins in a pattern that is poorly predicted by sequence-based phylogeny. The information emerging from this and related studies will prove important for defining the functional intersection of expression, localization and gene product interaction that better predicts the formation of discrete SCF complexes, as a prelude to investigating their molecular mode of action.

  17. Identification of a splicing coactivator gene that affects the production of ochratoxin a in Aspergillus carbonarius

    Directory of Open Access Journals (Sweden)

    Lígia Uno Lunardi

    2009-11-01

    Full Text Available Ochratoxin A is a mycotoxin produced by some fungi species. Among them, Aspergillus carbonarius is considered a powerful producer. Genes involved in the ochratoxin A biosynthesis pathway have been identified in some producer species. However, there are few studies that purpose to identify these genes in A. carbonarius. The use of insertion mutants to identify genes associated with certain properties has been increased in the literature. In this work, the region of T-DNA integration was investigated in one A. carbonarius ochratoxin-defective mutant previously obtained by Agrobacterium tumefaciens-mediated transformation, in order to find an association between interrupted gene and the biosynthesis of ochratoxin A. The integration occurred in a gene that possibly encodes a splicing coactivator protein. The analysis of the relative expression of the splicing coativator gene from A. carbonarius wild type strain in four different media showed high correlation between the transcript levels and the ochratoxin A production.A ocratoxina A é uma micotoxina frequentemente encontrada em uma grande variedade de produtos alimentares e apresenta efeitos nefrotóxicos e potencial carcinogênico para animais e humanos. É naturalmente produzida por algumas espécies fúngicas, como Aspergillus carbonarius, que é considerado um potente produtor. Apesar disso, o número de estudos que visam identificar genes que são essenciais para a biossíntese de ocratoxina em A. carbonarius é ainda reduzido. Um mutante de A. carbonarius com baixa produção de ocratoxina A previamente obtido por transformação mediada por Agrobacterium tumefaciens foi investigado com o objetivo de encontrar uma associação entre o gene interrompido e a biossíntese desta micotoxina. Os resultados mostraram a ocorrência de uma junção não exata entre o T-DNA e o DNA genômico do fungo durante o evento de integração. A integração do T-DNA no genoma do mutante T188 provocou dele

  18. Improving heterologous polyketide production in Escherichia coli by overexpression of an S-adenosylmethionine synthetase gene.

    Science.gov (United States)

    Wang, Yong; Boghigian, Brett A; Pfeifer, Blaine A

    2007-11-01

    An S-adenosylmethionine synthetase gene (metK) from Streptomyces spectabilis was cloned into an expression plasmid under the control of an inducible T7 promoter and introduced into a strain of Escherichia coli (BAP1(pBP130/pBP144)) capable of producing the polyketide product 6-deoxyerythronolide B (6-dEB). The metK coexpression in BAP1(pBP130/pBP144) improved the specific production of 6-dEB from 10.86 to 20.08 mg l(-1) OD(600)(-1). In an effort to probe the reason for this improvement, a series of gene deletion and expression experiments were conducted based on a metK metabolic pathway that branches between propionyl-CoA (a 6-dEB precursor) and autoinducer compounds. The deletion and expression studies suggested that the autoinducer pathway had a larger impact on improved 6-dEB biosynthesis. Supporting these results were experiments demonstrating the positive effect conditioned media (the suspected location of the autoinducer compounds) had on 6-dEB production. Taken together, the results of this study show an increase in heterologous 6-dEB production concomitant with heterologous metK gene expression and suggest that the mechanism for this improvement is linked to native autoinducer compounds. PMID:17876579

  19. Yeast homologous recombination-based promoter engineering for the activation of silent natural product biosynthetic gene clusters.

    Science.gov (United States)

    Montiel, Daniel; Kang, Hahk-Soo; Chang, Fang-Yuan; Charlop-Powers, Zachary; Brady, Sean F

    2015-07-21

    Large-scale sequencing of prokaryotic (meta)genomic DNA suggests that most bacterial natural product gene clusters are not expressed under common laboratory culture conditions. Silent gene clusters represent a promising resource for natural product discovery and the development of a new generation of therapeutics. Unfortunately, the characterization of molecules encoded by these clusters is hampered owing to our inability to express these gene clusters in the laboratory. To address this bottleneck, we have developed a promoter-engineering platform to transcriptionally activate silent gene clusters in a model heterologous host. Our approach uses yeast homologous recombination, an auxotrophy complementation-based yeast selection system and sequence orthogonal promoter cassettes to exchange all native promoters in silent gene clusters with constitutively active promoters. As part of this platform, we constructed and validated a set of bidirectional promoter cassettes consisting of orthogonal promoter sequences, Streptomyces ribosome binding sites, and yeast selectable marker genes. Using these tools we demonstrate the ability to simultaneously insert multiple promoter cassettes into a gene cluster, thereby expediting the reengineering process. We apply this method to model active and silent gene clusters (rebeccamycin and tetarimycin) and to the silent, cryptic pseudogene-containing, environmental DNA-derived Lzr gene cluster. Complete promoter refactoring and targeted gene exchange in this "dead" cluster led to the discovery of potent indolotryptoline antiproliferative agents, lazarimides A and B. This potentially scalable and cost-effective promoter reengineering platform should streamline the discovery of natural products from silent natural product biosynthetic gene clusters.

  20. Genome Wide Association Analysis Reveals New Production Trait Genes in a Male Duroc Population.

    Directory of Open Access Journals (Sweden)

    Kejun Wang

    Full Text Available In this study, 796 male Duroc pigs were used to identify genomic regions controlling growth traits. Three production traits were studied: food conversion ratio, days to 100 KG, and average daily gain, using a panel of 39,436 single nucleotide polymorphisms. In total, we detected 11 genome-wide and 162 chromosome-wide single nucleotide polymorphism trait associations. The Gene ontology analysis identified 14 candidate genes close to significant single nucleotide polymorphisms, with growth-related functions: six for days to 100 KG (WT1, FBXO3, DOCK7, PPP3CA, AGPAT9, and NKX6-1, seven for food conversion ratio (MAP2, TBX15, IVL, ARL15, CPS1, VWC2L, and VAV3, and one for average daily gain (COL27A1. Gene ontology analysis indicated that most of the candidate genes are involved in muscle, fat, bone or nervous system development, nutrient absorption, and metabolism, which are all either directly or indirectly related to growth traits in pigs. Additionally, we found four haplotype blocks composed of suggestive single nucleotide polymorphisms located in the growth trait-related quantitative trait loci and further narrowed down the ranges, the largest of which decreased by ~60 Mb. Hence, our results could be used to improve pig production traits by increasing the frequency of favorable alleles via artificial selection.

  1. Recombinant Streptomyces clavuligerus strain including cas2 gene production and analysis its antibiotic overproduction by bioassay

    Directory of Open Access Journals (Sweden)

    Zohreh Hojati

    2014-03-01

    Full Text Available Background: Streptomyces clavuligerus is one of the most important strain that produce clavulanic acid that wildly used in combination of strong but sensitive to β-lactamase antibiotics in clinics. The cas2 is one of the important genes in the biosynthesis pathway of clavulanic acid. Materials and Methods: The recombinant construct pMTcas2 which contain cas2 gene is obtained from Isfahan University. Recombinant plasmid extracts from streptomyces lividans and confirm by enzyme digestion. The streptomyces clavuligerus protoplast was prepared and transformation was done by using polyethylene glycol. Transformation was confirmed by plasmid extraction and PCR using cas2 specific primers. Finally, bioassay method was used to survey the effect of extra copy of cas2 on clavulanic acid production. Result: Plasmid extraction was initially carried out and the structure of plasmid was confirmed by digestion. The typical white colony was seen on protoplast recovery culture containing thiostrepton antibiotic and gray spores were detected after one week. Plasmid extraction was done from transformed strain and transformation was confirmed by PCR. The results of the bioassay show that amplification of the cas2 gene in multicopy plasmids resulted in a 4.1 fold increase in clavulanic acid production. Conclusion: The bioassay was done and the diameters of zone of inhibition in control and sample were compared. The results of the bioassay show that amplification of the cas2 gene in multicopy plasmids resulted in a 4.1 fold increase in clavulanic acid production. Overproduction of clavulanic acid decreases the cost of its dependent drug production.

  2. Automated type specific ELISA probe detection of amplified NS3 gene products of dengue viruses.

    OpenAIRE

    Chow, V T; Yong, R Y; Ngoh, B L; Chan, Y. C.

    1997-01-01

    AIM: To apply an automated system of nucleic acid hybridisation coupled with the enzyme linked immunosorbent assay (ELISA) for the type specific detection of amplification products of dengue viruses. METHODS: Non-structural 3 (NS3) gene targets of reference strains of all four dengue and other flaviviruses, as well as dengue patient viraemic sera, were subjected to reverse transcription and polymerase chain reaction using consensus and dengue type specific primers and digoxigenin-11-dUTP labe...

  3. Genetic resources for methane production from biomass described with gene ontology

    Directory of Open Access Journals (Sweden)

    Endang ePurwantini

    2014-12-01

    Full Text Available Methane (CH4 is a valuable fuel, constituting 70-95% of natural gas, and a potent greenhouse gas. Release of CH4 into the atmosphere contributes to climate change. Biological CH4 production or methanogenesis is mostly performed by methanogens, a group of strictly anaerobic archaea. The direct substrates for methanogenesis are H2 plus CO2, acetate, formate, methylamines, methanol, methyl sulfides, and ethanol or a secondary alcohol plus CO2. In numerous anaerobic niches in nature, methanogenesis facilitates mineralization of complex biopolymers such as carbohydrates, lipids and proteins generated by primary producers. Thus, methanogens are critical players in the global carbon cycle. The same process is used in anaerobic treatment of municipal, industrial and agricultural wastes, reducing the biological pollutants in the wastes and generating methane. It also holds potential for commercial production of natural gas from renewable resources. This process operates in digestive systems of many animals, including cattle, and humans. In contrast, in deep-sea hydrothermal vents methanogenesis is a primary production process, allowing chemosynthesis of biomaterials from H2 plus CO2. In this report we present Gene Ontology (GO terms that can be used to describe processes, functions and cellular components involved in methanogenic biodegradation and biosynthesis of specialized coenzymes that methanogens use. Some of these GO terms were previously available and the rest were generated in our Microbial Energy Gene Ontology (MENGO project. A recently discovered non-canonical CH4 production process is also described. We have performed manual GO annotation of selected methanogenesis genes, based on experimental evidence, providing gold standards for machine annotation and automated discovery of methanogenesis genes or systems in diverse genomes. Most of the GO-related information presented in this report is available at the MENGO website (http://www.mengo.biochem.vt.edu/.

  4. Steroid receptor RNA activator (SRA1): unusual bifaceted gene products with suspected relevance to breast cancer

    OpenAIRE

    Leygue, Etienne

    2007-01-01

    The steroid receptor RNA activator (SRA) is a unique modulator of steroid receptor transcriptional activity, as it is able to mediate its coregulatory effects as a RNA molecule. Recent findings, however, have painted a more complex picture of the SRA gene (SRA1) products. Indeed, even though SRA was initially thought to be noncoding, several RNA isoforms have now been found to encode an endogenous protein (SRAP), which is well conserved among Chordata. Although the function of SRAP remains la...

  5. Gene Disruption Technologies Have the Potential to Transform Stored Product Insect Pest Control

    Science.gov (United States)

    Perkin, Lindsey C.; Adrianos, Sherry L.; Oppert, Brenda

    2016-01-01

    Stored product insects feed on grains and processed commodities manufactured from grain post-harvest, reducing the nutritional value and contaminating food. Currently, the main defense against stored product insect pests is the pesticide fumigant phosphine. Phosphine is highly toxic to all animals, but is the most effective and economical control method, and thus is used extensively worldwide. However, many insect populations have become resistant to phosphine, in some cases to very high levels. New, environmentally benign and more effective control strategies are needed for stored product pests. RNA interference (RNAi) may overcome pesticide resistance by targeting the expression of genes that contribute to resistance in insects. Most data on RNAi in stored product insects is from the coleopteran genetic model, Tribolium castaneum, since it has a strong RNAi response via injection of double stranded RNA (dsRNA) in any life stage. Additionally, Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) technology has been suggested as a potential resource for new pest control strategies. In this review we discuss background information on both gene disruption technologies and summarize the advances made in terms of molecular pest management in stored product insects, mainly T. castaneum, as well as complications and future needs. PMID:27657138

  6. Gene Disruption Technologies Have the Potential to Transform Stored Product Insect Pest Control

    Directory of Open Access Journals (Sweden)

    Lindsey C. Perkin

    2016-09-01

    Full Text Available Stored product insects feed on grains and processed commodities manufactured from grain post-harvest, reducing the nutritional value and contaminating food. Currently, the main defense against stored product insect pests is the pesticide fumigant phosphine. Phosphine is highly toxic to all animals, but is the most effective and economical control method, and thus is used extensively worldwide. However, many insect populations have become resistant to phosphine, in some cases to very high levels. New, environmentally benign and more effective control strategies are needed for stored product pests. RNA interference (RNAi may overcome pesticide resistance by targeting the expression of genes that contribute to resistance in insects. Most data on RNAi in stored product insects is from the coleopteran genetic model, Tribolium castaneum, since it has a strong RNAi response via injection of double stranded RNA (dsRNA in any life stage. Additionally, Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR technology has been suggested as a potential resource for new pest control strategies. In this review we discuss background information on both gene disruption technologies and summarize the advances made in terms of molecular pest management in stored product insects, mainly T. castaneum, as well as complications and future needs.

  7. Production of transgenic mice by random recombination of targeted genes in female germline stem cells

    Institute of Scientific and Technical Information of China (English)

    Yong Zhang; Ji Xiong; Jie Xiang; Ji Wu; Zhaojuan Yang; Yunze Yang; Shuzeng Wang; Lingjun Shi; Wenhai Xie; Kejing Sun; Kang Zou; Lei Wang

    2011-01-01

    Oocyte production in most mammalian species is believed to cease before birth. However, this idea has been challenged with the finding that postnatal mouse ovaries possess mitotically active germ cells. A recent study showed that female germline stem cells (FGSCs) from adult mice were isolated, cultured long term and produced oocytes and progeny after transplantation into infertile mice. Here, we demonstrate the successful generation of transgenic or gene knock-down mice using FGSCs. The FGSCs from ovaries of 5-day-old and adult mice were isolated and either infected with recombinant viruses carrying green fluorescent protein, Oocyte-G1 or the mouse dynein axonemal intermediate chain 2 gene, or transfected with the Oocyte-G1 specific shRNA expression vector (pRS shOocyte-G1 vector), and then transplanted into infertile mice. Transplanted cells in the ovaries underwent oogenesis and produced heterozygous offspring after mating with wild-type male mice. The offspring were genetically characterized and the biological functions of the transferred or knock-down genes were investigated. Efficiency of genetransfer or gene knock-down was 29%-37% and it took 2 months to produce transgenic offspring. Gene manipulation of FGSCs is a rapid and efficient method of animal transgenesis and may serve as a powerful tool for biomedical science and biotechnology.

  8. Characterization of Toxin Genes and Antimicrobial Susceptibility of Staphylococcus aureus Isolates in Fishery Products in Iran

    Science.gov (United States)

    Arfatahery, Noushin; Davoodabadi, Abolfazl; Abedimohtasab, Taranehpeimaneh

    2016-01-01

    Staphylococcus aureus is one of the most common causes of seafood-borne diseases worldwide, which are attributable to the contamination of food by preformed enterotoxins. In this study, a total of 206 (34.3%) Staphylococcus aureus strains were obtained from 600 fish and shrimp samples and were tested for their antimicrobial susceptibility. We assessed the prevalence of the genes responsible for the staphylococcal enterotoxins (SEA, SEB) and toxic shock syndrome toxin 1 (TSST-1) genes. The results indicated that 34% of aqua food samples were contaminated with S. aureus, and 23.8% of these isolates were mec-A-positive. Sixty-four percent of the strains isolated from contaminated seafood was enterotoxigenic S. aureus, and 28.2% of SEs were MRSA-positive. The most prevalent genotype was characterized by the presence of the sea gene (45.2%), followed by the seb gene (18.5%), and the tst gene encoding TSST-1 was found in eight strains (3.9%). Of the 206 S. aureus isolates, 189 strains (84.9%) were resistant to at least one antibiotic. Given the frequent outbreaks of enterotoxigenic MRSA, it is necessary to make revisions to mandatory programmes to facilitate improved hygiene practices during fishing, aquaculture, processing, and sales to prevent the contamination of fishery products in Iran.

  9. Association between the enterotoxin production and presence of Coa, Nuc genes among Staphylococcus aureus isolated from various sources, in Shiraz.

    Science.gov (United States)

    Moghassem Hamidi, R; Hosseinzadeh, S; Shekarforoush, S S; Poormontaseri, M; Derakhshandeh, A

    2015-01-01

    The present study was aimed to identify the frequency of coagulase (Coa) and thermonuclease (Nuc) genes and Staphylococcal enterotoxin A (Sea) production among Staphylococcus aureus isolated from various sources in Shiraz. Moreover, the correlation between the Sea gene and coagulase and thermonuclease enzymes is also considered. A total of 100 S. aureus were isolated from various sources including 40 humans, 30 animals and 30 food samples by the routine biochemical tests. The frequency of Coa, Nuc and Sea genes was evaluated by PCR assay. Correlation among those genes was finally evaluated by statistical analysis. The PCR results showed that the prevalence of Coa, Nuc and Sea genes was 91%, 100% and 14%, respectively. The evaluation of the enterotoxin production indicated that 78.6% of the Sea gene was expressed. The presence of enterotoxin A was not necessarily correlated to the production of toxin. As a final conclusion to detect the enterotoxigenic strains, both genotypic and phenotypic methods are highly recommended.

  10. Excision of foreign gene product with cathepsin D in chicken hepatoma cell line

    International Nuclear Information System (INIS)

    To easily and rapidly recover exogenous gene products from chicken egg yolk, we constructed pVTG-catD (VTG, vitellogenin; catD, cathepsin D), a vector cassette carrying two catD-recognition signal peptides (catD-RSPs) in addition to the cloning site. An enhanced green fluorescence protein (EGFP)-encoding DNA fragment was ligated into the pVTG-catD. When the resultant construct pVTG-EGFP-catD containing histidine- and myc-tags was transfected into the chicken hepatoma cell line LMH, EGFP-expression at 24 h post-cultivation was confirmed by fluorescence microscopy. Because a signal peptide (NTVLAEF) encoded in pVTG-EGFP-catD is recognized by catD, the VTG-EGFP fusion protein digested with catD was detectable by Western blotting. Digested exogenous gene product was recovered with nickel resin. These results indicate that catD-recognition sites bearing pVTG-catD and His-tags are functional in chicken LMH cells. Therefore, the system described here may be of use in making excision exogenous gene products in the chicken and in creating homozygous knock-in chickens

  11. Products of the iron-molybdenum cofactor-specific biosynthetic genes, nifE and nifN, are structurally homologous to the products of the nitrogenase molybdenum-iron protein genes, nifD and nifK.

    OpenAIRE

    Brigle, K E; Weiss, M C; Newton, W E; Dean, D R

    1987-01-01

    The genes from Azotobacter vinelandii, which are homologous to the iron-molybdenum cofactor biosynthetic genes, nifE and nifN, from Klebsiella pneumoniae, have been cloned and sequenced. These genes comprise a single transcription unit and are located immediately downstream from the nitrogenase structural gene cluster (nifHDK). DNA sequence analysis has revealed that the products of the nifE and nifN genes contain considerable homology when compared with the nifD (MoFe protein alpha subunit) ...

  12. Tetracycline residues and tetracycline resistance genes in groundwater impacted by swine production facilities

    Science.gov (United States)

    Mackie, R.I.; Koike, S.; Krapac, I.; Chee-Sanford, J.; Maxwell, Susan; Aminov, R.I.

    2006-01-01

    Antibiotics are used at therapeutic levels to treat disease; at slightly lower levels as prophylactics; and at low, subtherapeutic levels for growth promotion and improvement of feed efficiency. Over 88% of swine producers in the United States gave antimicrobials to grower/finisher pigs in feed as a growth promoter in 2000. It is estimated that ca. 75% of antibiotics are not absorbed by animals and are excreted in urine and feces. The extensive use of antibiotics in swine production has resulted in antibiotic resistance in many intestinal bacteria, which are also excreted in swine feces, resulting in dissemination of resistance genes into the environment.To assess the impact of manure management on groundwater quality, groundwater samples have been collected near two swine confinement facilities that use lagoons for manure storage and treatment. Several key contaminant indicators-including inorganic ions, antibiotics, and antibiotic resistance genes-were analyzed in groundwater collected from the monitoring wells. Chloride, ammonium, potassium, and sodium were predominant inorganic constituents in the manure samples and served as indicators of groundwater contamination. Based on these analyses, shallow groundwater has been impacted by lagoon seepage at both sites. Liquid chromatography-mass spectroscopy (LC-MS) was used to measure the dissolved concentrations of tetracycline, chlortetracycline, and oxytetracycline in groundwater and manure. Although tetracyclines were regularly used at both facilities, they were infrequently detected in manure samples and then at relatively trace concentrations. Concentrations of all tetracyclines and their breakdown products in the groundwater sampled were generally less than 0.5 ??g/L.Bacterial tetracycline resistance genes served as distinct genotypic markers to indicate the dissemination and mobility of antibiotic resistance genes that originated from the lagoons. Applying PCR to genomic DNA extracted from the lagoon and

  13. Prevalence of ten putative virulence genes in the emerging foodborne pathogen Arcobacter isolated from food products.

    Science.gov (United States)

    Girbau, Cecilia; Guerra, Cristian; Martínez-Malaxetxebarria, Irati; Alonso, Rodrigo; Fernández-Astorga, Aurora

    2015-12-01

    Arcobacter spp. are considered to be emerging food- and waterborne pathogens for both humans and animals. However, their virulence mechanisms are still poorly understood. In this study the presence of ten virulence genes (cadF, ciaB, cj1349, hecA, hecB, mviN, pldA, irgA, tlyA and iroE) was assessed in a set of 47 strains of Arcobacter butzleri, 10 of Arcobacter cryaerophilus and 1 Arcobacter skirrowii strain recovered from different food products (pork, chicken, beef, milk, clams and mussels). Overall, the genes cadF, ciaB, cj1349, mviN, pldA and tlyA were detected in all A. butzleri and A. skirrowii strains. Lower detection rates were observed for irgA, iroE, hecA and hecB. The genes hecB and iroE were detected neither in A. cryaerophilus nor in A. skirrowii. The genes hecA and irgA were not detected in A. skirrowii. It was noteworthy that the genes hecA and hecB were significantly (P < 0.05) highly detected in A. butzleri strains isolated from clams compared with strains isolated from milk and chicken. Therefore, our findings underline clams as a source of A. butzleri strains with high prevalence of putative virulence genes. This could be hazardous to human health, especially because these bivalves are usually consumed raw or undercooked.

  14. nusB: a protein factor necessary for transcription antitermination in vitro by phage lambda N gene product.

    OpenAIRE

    Ghosh, B.; Das, A.

    1984-01-01

    We demonstrate that the protein product of the Escherichia coli nusB gene is essential for transcription antitermination in vitro by phage lambda N gene product. We recently have described a convenient biochemical assay for N protein activity in the S30-coupled transcription translation system and demonstrated that N action requires the 69-kDa L factor (nusA), the product of E. coli nusA gene. Using a complementation assay for the restoration of N activity specifically in the nusB mutant extr...

  15. Relationships of growth hormone gene and milk protein polymorphisms to milk production traits in Simmental cattle.

    Science.gov (United States)

    Falaki, M; Prandi, A; Corradini, C; Sneyers, M; Gengler, N; Massart, S; Fazzini, U; Burny, A; Portetelle, D; Renaville, R

    1997-02-01

    The importance of milk proteins and the positive effect of administration of growth hormone (GH) on milk production, and the presence in some dairy cattle lines of greater GH concentrations prompted us to examine the presence of restriction fragment length polymorphism at the GH gene using the restriction enzyme TaqI and to investigate associations between this polymorphism in Simmental cows and bulls, as well as milk protein variants in Simmental cows, and milk production traits. Blood and milk were sampled from 279 Italian Simmental cows and semen was collected from 148 bulls of the same breed. Two fragment bands, denoted A and B, of 6200 and 5200 bp respectively, were examined and three patterns, AA, AB and BB, were found in both animal samples. All variants previously reported in other studies, for kappa, beta, and alpha s1-caseins, and beta-lactoglobulin, were found in the cows' samples. For the cows' samples, a BLUP (Best Linear Unbiased Predictor) analysis of results was performed using a REML (Restricted Maximum Likelihood) program and known heritabilities, whereas for bulls we have performed a General Linear Model analysis. The effect of GH gene polymorphism, using TaqI restriction enzyme, on milk production traits was not significant, but bulls of BB pattern had a higher breeding value for milk yield than AA bulls (P casein genotypic effects, cows of AB genotype gave milk with 1.53 +/- 0.70 g/kg less fat than cows of AA genotype. In addition, breeding values for milk protein content were significantly higher in BB bulls, with 0.87 +/- 0.32 and 0.71 +/- 0.34 g/kg more milk protein than AA and AB bulls respectively. Thus, our results revealed a GH gene polymorphism and indicated significant effects of milk protein polymorphisms on milk production traits in the Italian Simmental breed.

  16. Lessons in Détente or know thy host: The immunomodulatory gene products of myxoma virus

    Indian Academy of Sciences (India)

    Martha C Zúñiga

    2003-04-01

    The poxvirus, myxoma virus, encodes within its genome at least eleven different proteins that compromise, skew, or disable the innate and adaptive responses of its hosts. In the laboratory rabbit, Oryctolagus cuniculus, these effects result in myxomatosis, a fatal condition characterized by skin lesions and systemic immunosuppression. Interestingly, while myxoma infection also causes skin lesions in its natural host and in natural populations of O. cuniculus in Australia where this novel host and the virus have co-evolved, the condition of myxomatosis does not ensue and infection is not fatal. In this review I discuss the biochemical properties of the characterized immunomodulatory proteins of myxoma virus, and their pathogenic effects in laboratory rabbits. Disruption of any one myxoma immunomodulatory gene diminishes the severity of the infection without compromising infectivity. Thus, the characterized immunomodulatory genes appear not to be required for a productive infection in vivo. The differences in the severity of their effects in laboratory-bred versus wild O. cuniculus suggest that the outcome of myxoma infection is a consequence of the interplay between the viral immunomodulatory gene products and the cells and molecules of the host immune system.

  17. POLYMORPHISM IN PROMOTER OF PROLACTIN GENE AND ITS ASSOCIATION WITH PRODUCTION TRAITS IN CHICKENS

    Directory of Open Access Journals (Sweden)

    Mitrofanova O. V.

    2015-09-01

    Full Text Available Prolactin (PRL - is a peptide hormone. It effects on metabolic processes in mammals and birds. Indel genotype mutations in a prolactin gene were determined in 595 hens and cocks. Polymerase chain reaction (PCR were used. We studied four different breeds: Cornish, White Russian, Pushkin, Yurlov crower. Homozygous of insertion II, homozygous deletion of DD and heterozygous ID were observed in all groups. The differences in frequencies of genotypes and alleles were observed in all groups. Homozygotes II and allele I (frequency is 0,83 were the most common for Russian white chickens with high egg production and the lack of the instinct of incubation. Prolactin gene deletion was more common for beef Cornish. The frequency of D allele was 0,84. Pushkin chickens proved to be closer to the egg type. A significant number of heterozygotes with this mutation were noted in a population of Yurlov crower. It is recommended to use gene prolactin as a marker of productive indicators in chickens

  18. Metabolic engineering of Escherichia coli for ethanol production without foreign genes

    Science.gov (United States)

    Kim, Youngnyun

    Worldwide dependence on finite petroleum-based energy necessitates alternative energy sources that can be produced from renewable resources. A successful example of an alternative transportation fuel is bioethanol, produced by microorganisms, from corn starch that is blended with gasoline. However, corn, currently the main feedstock for bioethanol production, also occupies a significant role in human food and animal feed chains. As more corn is diverted to bioethanol, the cost of corn is expected to increase with an increase in the price of food, feed and ethanol. Using lignocellulosic biomass for ethanol production is considered to resolve this problem. However, this requires a microbial biocatalyst that can ferment hexoses and pentoses to ethanol. Escherichia coli is an efficient biocatalyst that can use all the monomeric sugars in lignocellulose, and recombinant derivatives of E. coli have been engineered to produce ethanol as the major fermentation product. In my study, ethanologenic E. coli strains were isolated from a ldhA-, pflB- derivative without introduction of foreign genes. These isolates grew anaerobically and produced ethanol as the main fermentation product. The mutation responsible for anaerobic growth and ethanol production was mapped in the lpdA gene and the mutation was identified as E354K in three of the isolates tested. Another three isolates carried an lpdA mutation, H352Y. Enzyme kinetic studies revealed that the mutated form of the dihydrolipoamide dehydrogenase (LPD) encoded by the lpdA was significantly less sensitive to NADH inhibition than the native LPD. This reduced NADH sensitivity of the mutated LPD was translated into lower sensitivity to NADH of the pyruvate dehydrogenase complex in strain SE2378. The net yield of 4 moles of NADH and 2 moles of acetyl-CoA per mole of glucose produced by a combination of glycolysis and PDH provided a logical basis to explain the production of 2 moles of ethanol per glucose. The development of E

  19. Phytoalexin detoxification genes and gene products: Implication for the evolution of host specific traits for pathogenicity. Final report

    Energy Technology Data Exchange (ETDEWEB)

    VanEtten, H.

    1997-06-01

    The overall objectives of this research were to determine which differences among PDA genes were associated with different levels of virulence on pea and to clone and characterize a MAK gene. The authors also proposed to characterize the pisatin detoxifying system in pea pathogens in addition to N. haematococca to assess whether pathogens of a common host had evolved similar pathogenicity genes.

  20. Phytoalexin detoxification genes and gene products: Implication for the evolution of host specific traits for pathogenicity. Final report

    International Nuclear Information System (INIS)

    The overall objectives of this research were to determine which differences among PDA genes were associated with different levels of virulence on pea and to clone and characterize a MAK gene. The authors also proposed to characterize the pisatin detoxifying system in pea pathogens in addition to N. haematococca to assess whether pathogens of a common host had evolved similar pathogenicity genes

  1. Analysis of the ruv locus of Escherichia coli K-12 and identification of the gene product

    International Nuclear Information System (INIS)

    The ruv gene of Escherichia coli, which is associated with inducible mechanisms of DNA repair and recombination, has been cloned into the low-copy plasmid vector pHSG415. The recombinant plasmid pPVA101 fully complements the DNA repair-deficient phenotype of ruv mutants. Restriction endonuclease analysis of this plasmid revealed a 10.6-kilobase (kb) HindIII DNA insert which contained a 7.7-kb PstI fragment identified as being from the chromosomal ruv region. Deletion analysis and Tn1000 insertional inactivation of ruv function located the ruv coding region to a 2.2-kb section of the cloned DNA fragment. A comparison of the proteins encoded by ruv wild-type and mutant plasmids identified the gene product as a protein of molecular weight 41,000

  2. The PKS4 gene in Fusarium graminearum is essential for zearalenone production

    DEFF Research Database (Denmark)

    Lysøe, E.; Klemsdal, S. S.; Bone, K.R.;

    2006-01-01

    Zearalenones are produced by several Fusarium species and can cause reproductive problems in animals. Some aurofusarin mutants of Fusarium pseudograminearum produce elevated levels of zearalenone (ZON), one of the estrogenic mycotoxins comprising the zearalenones. An analysis of transcripts from......4. High-performance liquid chromatography analysis showed that the PKS4 replacement mutant did not produce ZON. Thus, PKS4 encodes an enzyme required for the production of ZON in F. graminearum. Barley root infection studies revealed no alteration in the pathogenicity of the PKS4 mutant compared...... protocol was used to replace the central part of the PKS4 gene with a hygB resistance gene through double homologous recombination in an F. graminearum strain producing a high level of ZON. PCR and Southern analysis of transformants were used to identify isolates with single insertional replacements of PKS...

  3. Increased isobutanol production in Saccharomyces cerevisiae by overexpression of genes in valine metabolism

    DEFF Research Database (Denmark)

    Chen, Xiao; Nielsen, Kristian Fog; Borodina, Irina;

    2011-01-01

    overexpression of biosynthetic genes ILV2, ILV3, and ILV5 in valine metabolism in anaerobic fermentation of glucose in mineral medium in S. cerevisiae. Isobutanol yield was further improved by twofold by the additional overexpression of BAT2, encoding the cytoplasmic branched-chain amino-acid aminotransferase...... were 3.86 and 0.28 mg per g glucose, respectively. They increased to 4.12 and 2.4 mg per g glucose in yeast extract/peptone/dextrose (YPD) complex medium under aerobic conditions, respectively. CONCLUSIONS: Overexpression of genes ILV2, ILV3, ILV5, and BAT2 in valine metabolism led to an increase...... in isobutanol production in S. cerevisiae. Additional overexpression of ILV6 in the ILV2 ILV3 ILV5 overexpression strain had a negative effect, presumably by increasing the sensitivity of Ilv2 to valine inhibition, thus weakening the positive impact of overexpression of ILV2, ILV3, and ILV5 on isobutanol...

  4. Regulated expression of the obese gene product (leptin) in white adipose tissue and 3T3-L1 adipocytes.

    OpenAIRE

    MacDougald, O A; Hwang, C. S.; Fan, H; Lane, M D

    1995-01-01

    A mutation within the obese gene was recently identified as the genetic basis for obesity in the ob/ob mouse. The obese gene product, leptin, is a 16-kDa protein expressed predominantly in adipose tissue. Consistent with leptin's postulated role as an extracellular signaling protein, human embryonic kidney 293 cells transfected with the obese gene secreted leptin with minimal intracellular accumulation. Upon differentiation of 3T3-L1 preadipocytes into adipocytes, the leptin mRNA was expresse...

  5. Directed natural product biosynthesis gene cluster capture and expression in the model bacterium Bacillus subtilis

    Science.gov (United States)

    Li, Yongxin; Li, Zhongrui; Yamanaka, Kazuya; Xu, Ying; Zhang, Weipeng; Vlamakis, Hera; Kolter, Roberto; Moore, Bradley S.; Qian, Pei-Yuan

    2015-03-01

    Bacilli are ubiquitous low G+C environmental Gram-positive bacteria that produce a wide assortment of specialized small molecules. Although their natural product biosynthetic potential is high, robust molecular tools to support the heterologous expression of large biosynthetic gene clusters in Bacillus hosts are rare. Herein we adapt transformation-associated recombination (TAR) in yeast to design a single genomic capture and expression vector for antibiotic production in Bacillus subtilis. After validating this direct cloning ``plug-and-play'' approach with surfactin, we genetically interrogated amicoumacin biosynthetic gene cluster from the marine isolate Bacillus subtilis 1779. Its heterologous expression allowed us to explore an unusual maturation process involving the N-acyl-asparagine pro-drug intermediates preamicoumacins, which are hydrolyzed by the asparagine-specific peptidase into the active component amicoumacin A. This work represents the first direct cloning based heterologous expression of natural products in the model organism B. subtilis and paves the way to the development of future genome mining efforts in this genus.

  6. Improvement of hydrogen production with expression of lba gene in chloroplast of Chlamydomonas reinhardtii

    Energy Technology Data Exchange (ETDEWEB)

    Wu, Shuangxiu; Yan, Guangyu; Xu, Lili; Wang, Quanxi; Liu, Xiaolei [Department of Biology, college of life and environmental science, Shanghai Normal University, Guilin road 100, 200234, Shanghai City (China)

    2010-12-15

    An ORF cDNA fragment of one of leghemoglobin genes, lba was cloned from Glycine max and transferred into chloroplasts of Chlamydomonas reinhardtii. More rapidly O{sub 2} consumption, lower O{sub 2} content and higher H{sub 2} output were monitored in the transgenic algal cultures than those in WT cultures either in S-free or S-containing medium. Maximum expression of lba in the transgenic algae consisted with the time when minimal O{sub 2} contents and maximal H{sub 2} evolution occurred. The highest H{sub 2} production achieved in sulfur-free medium for both algal cultures. When restoring sulfate in the medium, H{sub 2} production in the transgenic algal cultures kept steadily around 130-145 {mu}l per bottle while that in WT cultures decreased gradually from 98 {mu}l per bottle at 12.5 {mu}M sulfate to 40 {mu}l per bottle at 100 {mu}M sulfate. The results indicated that heteroexpression of lehemoglaobin genes in chloroplasts of green algae improved H{sub 2} yield by decreasing O{sub 2} content in the medium. This protein had potential to be used in improvement of H{sub 2} production in green algae. (author)

  7. Directed natural product biosynthesis gene cluster capture and expression in the model bacterium Bacillus subtilis

    KAUST Repository

    Li, Yongxin

    2015-03-24

    Bacilli are ubiquitous low G+C environmental Gram-positive bacteria that produce a wide assortment of specialized small molecules. Although their natural product biosynthetic potential is high, robust molecular tools to support the heterologous expression of large biosynthetic gene clusters in Bacillus hosts are rare. Herein we adapt transformation-associated recombination (TAR) in yeast to design a single genomic capture and expression vector for antibiotic production in Bacillus subtilis. After validating this direct cloning plug-and-playa approach with surfactin, we genetically interrogated amicoumacin biosynthetic gene cluster from the marine isolate Bacillus subtilis 1779. Its heterologous expression allowed us to explore an unusual maturation process involving the N-acyl-asparagine pro-drug intermediates preamicoumacins, which are hydrolyzed by the asparagine-specific peptidase into the active component amicoumacin A. This work represents the first direct cloning based heterologous expression of natural products in the model organism B. subtilis and paves the way to the development of future genome mining efforts in this genus.

  8. Suppression of Tla1 gene expression for improved solar conversion efficiency and photosynthetic productivity in plants and algae

    Science.gov (United States)

    Melis, Anastasios; Mitra, Mautusi

    2010-06-29

    The invention provides method and compositions to minimize the chlorophyll antenna size of photosynthesis by decreasing TLA1 gene expression, thereby improving solar conversion efficiencies and photosynthetic productivity in plants, e.g., green microalgae, under bright sunlight conditions.

  9. Characterization of foot-and-mouth disease virus gene products with antisera against bacterially synthesized fusion proteins

    International Nuclear Information System (INIS)

    Defined segments of the cloned foot-and-mouth disease virus genome corresponding to all parts of the coding region were expressed in Escherichia coli as fusions to the N-terminal part of the MS2-polymerase gene under the control of the inducible λPL promoter. All constructs yielded large amounts of proteins, which were purified and used to raise sequence-specific antisera in rabbits. These antisera were used to identify the corresponding viral gene products in 35S-labeled extracts from foot-and-mouth disease virus-infected BHK cells. This allowed us to locate unequivocally all mature foot-and-mouth disease virus gene products in the nucleotide sequence, to identify precursor-product relationships, and to detect several foot-and mouth disease virus gene products not previously identified in vivo or in vitro

  10. Functional analysis of the gene cluster involved in production of the bacteriocin circularin A by Clostridium beijerinckii ATCC 25752

    NARCIS (Netherlands)

    Kemperman, R; Jonker, M; Nauta, A; Kuipers, OP; Kok, J

    2003-01-01

    A region of 12 kb flanking the structural gene of the cyclic antibacterial peptide circularin A of Clostridium beijerinckii ATCC 25752 was sequenced, and the putative proteins involved in the production and secretion of circularin A were identified. The genes are tightly organized in overlapping ope

  11. An in vitro complementation assay for the Escherichia coli uvrD gene product.

    OpenAIRE

    Kuemmerle, N B; Masker, W E

    1983-01-01

    An in vitro assay specific for the product of the uvrD gene of Escherichia coli has been developed. This assay, derived from properties of uvrD mutants revealed by in vivo experiments, is based on the necessity for a functional UvrD protein for complete rejoining of covalently closed circular DNA during the excision repair of UV-induced damage. Extracts prepared from gently lysed uvrD101 mutant cells are capable of restoring UV-damaged DNA to its covalently closed circular form when provided ...

  12. Genetic assignment of multiple E2 gene products in bovine papillomavirus-transformed cells.

    OpenAIRE

    Lambert, P F; Hubbert, N L; Howley, P M; Schiller, J T

    1989-01-01

    The E2 open reading frame of bovine papillomavirus type 1 has been shown genetically to encode at least three transcriptional regulatory factors, and three E2 specific proteins have been recently identified in virally transformed rodent cells. In this study, the genes encoding these E2 specific proteins have been determined. The 48-kilodalton (kDa) protein was identified as the product of a full-length E2 open reading frame cDNA, which confirmed that this polypeptide is the E2 transactivator....

  13. Synergistic Effect of Elicitors in Enhancement of Ganoderic Acid Production: Optimization and Gene Expression Studies

    Directory of Open Access Journals (Sweden)

    Motaharehsadat Heydarian

    2015-06-01

    Full Text Available AbstractGanoderma lucidum is one of the most well-known fungi, and has many applications in medicine. Ganoderic acid is among the valuable secondary metabolites of Ganoderma lucidum, and responsible for the inhibition of the tumor cell growth and cancer treatment. Application of ganoderic acid has been limited because of low yields of its production from Ganoderma lucidum. The present study aims to investigate the synergistic effect of elicitors including methyl jasmonate and aspirin on the production of ganoderic acid derived from Ganoderma lucidum mushroom in a shaken flasks using response surface methodology. The results showed that the optimal dose of methyl jasmonate and asprin significantly impacts on the amount of ganoderic acid production as a response (p<0.05. The proposed model predicted the maximum ganoderic acid production as 0.085 mg/ml in which the optimal concentrations obtained for methyl jasmonate and asprin were 250mM and 4.4mM, respectively. Also the influence of ganoderic acid production on the expression of 3-hydroxy-3-methyl-glutaryl coenzyme A reductase and squalene synthase (two important metabolic pathway genes in ganoderic acid was investigated, and the results showed that these genes’ expression has increased by 10 and 11 folds, respectively.  

  14. SpeedyGenes: Exploiting an Improved Gene Synthesis Method for the Efficient Production of Synthetic Protein Libraries for Directed Evolution.

    Science.gov (United States)

    Currin, Andrew; Swainston, Neil; Day, Philip J; Kell, Douglas B

    2017-01-01

    Gene synthesis is a fundamental technology underpinning much research in the life sciences. In particular, synthetic biology and biotechnology utilize gene synthesis to assemble any desired DNA sequence, which can then be incorporated into novel parts and pathways. Here, we describe SpeedyGenes, a gene synthesis method that can assemble DNA sequences with greater fidelity (fewer errors) than existing methods, but that can also be used to encode extensive, statistically designed sequence variation at any position in the sequence to create diverse (but accurate) variant libraries. We summarize the integrated use of GeneGenie to design DNA and oligonucleotide sequences, followed by the procedure for assembling these accurately and efficiently using SpeedyGenes. PMID:27671932

  15. 5-Aminolevulinate production by Escherichia coli containing the Rhodobacter sphaeroides hemA gene

    Energy Technology Data Exchange (ETDEWEB)

    Van Der Werf, M.J. [Michigan State Univ., East Lansing, MI (United States); Zeikus, J.G. [Michigan State Univ., East Lansing, MI (United States)]|[MBI International, Lansing, MI (United States)

    1996-10-01

    The Rhodobacter sphaeroides hemA gene codes for 5-aminolevulinate (ALA) synthase. This enzyme catalyzes the pyridoxal phosphate-dependent condensation of succinyl coenzyme A and glycine-forming ALA. The R. sphaeroides hemA gene in the pUC18/19 vector system was transformed into Escherichia coli. The effects of both genetic and physiological factors on the expression of ALA synthase and the production of ALA were studied. ALA synthase activity levels were maximal when hemA had the same transcription direction as the lac promoter. The distance between the lac promoter and hemA affected the expression of ALA synthase on different growth substrates. The E. coli host strain used had an enormous effect on the ALA synthase activity level and on the production of ALA, with E. coli DH1 being best suited. The ALA synthase activity level was also dependent on the carbon source. Succinate, L-malate, fumarate, and L-aspartate gave the highest levels of ALA synthase activity, while the use of lactose as a carbon source resulted in a repression of ALA synthase. After growth on succinate, ALA synthase represented {approx}5% of total cellular protein. The ALA synthase activity level was also dependent on the pH of the medium, with maximal activity occurring at pH 6.5. ALA production by whole cells was limited by the availability of glycine, and the addition of 2 g of glycine per liter to the growth medium increased the production of ALA fivefold, to 2.25 mM. In recombinant E. coli extracts, up to 22 mM ALA was produced from succinate, glycine, and ATP. 58 refs., 4 figs., 7 tabs.

  16. c-Myb influences HIV type 1 gene expression and virus production.

    Science.gov (United States)

    Churchill, M J; Ramsay, R G; Rhodes, D I; Deacon, N J

    2001-11-01

    c-Myb is expressed in proliferating T cells. Fifteen c-Myb-binding sites can be identified in the HIV-1 long terminal repeat (LTR), suggesting that c-Myb may regulate HIV-1 gene expression and virus replication. Increasing the cellular levels of c-Myb by transient transfection of CEM cells resulted in a 10- to 20-fold activation of HIV-1 LTR-driven gene expression and mutation of one high-affinity Myb-binding site within the LTR reduced this activation by 60 to 70%. Conversely, inhibition of c-Myb expression in MT-2 cells by treatment with c-myb antisense oligonucleotides decreased HIV-1 replication by 85%, as measured by reverse transcriptase activity and cytopathic effects. The effect of c-myb antisense oligonucleotides on HIV-1 gene expression and virus particle production appeared to be independent of cell proliferation, but dependent on the presence of c-Myb activity mediated through the HIV-1 LTR. These data show that c-myb expression affects HIV-1 replication in CD4(+) T cells.

  17. Enhancement of ganoderic acid production by constitutively expressing Vitreoscilla hemoglobin gene in Ganoderma lucidum.

    Science.gov (United States)

    Li, Huan-Jun; He, Yi-Long; Zhang, De-Huai; Yue, Tong-Hui; Jiang, Lu-Xi; Li, Na; Xu, Jun-Wei

    2016-06-10

    The Vitreoscilla hemoglobin (VHb) gene was expressed in Ganoderma lucidum to enhance antitumor ganoderic acid (GA) production. The effects of VHb expression on the accumulation of GAs and lanosterol (intermediate) and the transcription of GA biosynthesis genes were also investigated. In VHb-expressing G. lucidum, the maximum concentrations of four individual GAs (GA-S, GA-T, GA-Mk and GA-Me) were 19.1±1.8, 34.6±2.1, 191.5±13.1 and 45.2±2.8μg/100mg dry weight, respectively, which were 1.4-, 2.2, 1.9- and 2.0-fold higher than those obtained in the wild-type strain. Moreover, the maximum lanosterol concentration in the strain expressing VHb was 1.28-fold lower than that in the wild-type strain. The transcription levels of 3-hydroxy-3-methylglutaryl coenzyme A reductase, squalene synthase, and lanosterol synthase genes were up-regulated by 1.6-, 1.5-, and 1.6-fold, respectively, in the strain expressing VHb. This work is beneficial in developing an efficient fermentation process for the hyperproduction of GAs. PMID:27080449

  18. Production of human glucocerebrosidase in mice after retroviral gene transfer into multipotential hematopoietic progenitor cells

    International Nuclear Information System (INIS)

    The human glucocerebrosidase (GC) gene has been transferred efficiently into spleen colony-forming unit (CFU-S) multipotential hematopoietic progenitor cells, and production of human GC RNA and protein has been achieved in transduced CFU-S colonies. High-titer retroviral vectors containing the human GC cDNA were constructed. Four vectors were compared with respect to gene-transfer efficiency into CFU-S progenitors. One vector (G vector) required high concentrations of interleukins 3 and 6 during stimulation and coculture for efficient transduction of CFU-S progenitors. The remaining three vectors (NTG, GTN, and GI vectors) transduced these progenitors at infection frequencies approaching 100% using low concentrations of hematopoietic growth factors to simulate cell division prior to and during the infection. Vectors using the viral long terminal repeat enhancer/promoter to drive the human GC cDNA produced high levels of human GC RNA in the progeny of CFU-S progenitors after gene transfer. All three vectors producing human GC RNA in CFU-S colonies can generate human GC as detected by immunochemical analysis of CFU-S colonies. The capacity of the viral long terminal repeat and the internal thymidine kinase promoter to direct synthesis of RNA in transduced bone marrow and spleen cells 5 months after bone marrow transplantation reflected the performance of these promoters in NTG-transduced CFU-S colonies

  19. Essential Oils Modulate Gene Expression and Ochratoxin A Production in Aspergillus carbonarius.

    Science.gov (United States)

    El Khoury, Rachelle; Atoui, Ali; Verheecke, Carol; Maroun, Richard; El Khoury, Andre; Mathieu, Florence

    2016-08-19

    Ochratoxin A (OTA) is a mycotoxin, mainly produced on grapes by Aspergillus carbonarius, that causes massive health problems for humans. This study aims to reduce the occurrence of OTA by using the ten following essential oils (E.Os): fennel, cardamom, anise, chamomile, celery, cinnamon, thyme, taramira, oregano and rosemary at 1 µL/mL and 5 µL/mL for each E.O.As a matter of fact, their effects on the OTA production and the growth of A. carbonarius S402 cultures were evaluated, after four days at 28 °C on a Synthetic Grape Medium (SGM). Results showed that A. carbonarius growth was reduced up to 100%, when cultured with the E.Os of cinnamon, taramira, and oregano at both concentrations and the thyme at 5 µL/mL. As for the other six E.Os, their effect on A. carbonarius growth was insignificant, but highly important on the OTA production. Interestingly, the fennel E.O at 5 µL/mL reduced the OTA production up to 88.9% compared to the control, with only 13.8% of fungal growth reduction. We further investigated the effect of these E.Os on the expression levels of the genes responsible for the OTA biosynthesis (acOTApks and acOTAnrps along with the acpks gene) as well as the two regulatory genes laeA and vea, using the quantitative Reverse Transcription-Polymerase Chain Reaction (qRT-PCR) method. The results revealed that these six E.Os reduced the expression of the five studied genes, where the ackps was downregulated by 99.2% (the highest downregulation in this study) with 5 µL/mL of fennel E.O.As for the acOTApks, acOTAnrps, veA and laeA, their reduction levels ranged between 10% and 96% depending on the nature of the E.O and its concentration in the medium.

  20. Essential Oils Modulate Gene Expression and Ochratoxin A Production in Aspergillus carbonarius

    Science.gov (United States)

    El Khoury, Rachelle; Atoui, Ali; Verheecke, Carol; Maroun, Richard; El Khoury, Andre; Mathieu, Florence

    2016-01-01

    Ochratoxin A (OTA) is a mycotoxin, mainly produced on grapes by Aspergillus carbonarius, that causes massive health problems for humans. This study aims to reduce the occurrence of OTA by using the ten following essential oils (E.Os): fennel, cardamom, anise, chamomile, celery, cinnamon, thyme, taramira, oregano and rosemary at 1 µL/mL and 5 µL/mL for each E.O.As a matter of fact, their effects on the OTA production and the growth of A. carbonarius S402 cultures were evaluated, after four days at 28 °C on a Synthetic Grape Medium (SGM). Results showed that A. carbonarius growth was reduced up to 100%, when cultured with the E.Os of cinnamon, taramira, and oregano at both concentrations and the thyme at 5 µL/mL. As for the other six E.Os, their effect on A. carbonarius growth was insignificant, but highly important on the OTA production. Interestingly, the fennel E.O at 5 µL/mL reduced the OTA production up to 88.9% compared to the control, with only 13.8% of fungal growth reduction. We further investigated the effect of these E.Os on the expression levels of the genes responsible for the OTA biosynthesis (acOTApks and acOTAnrps along with the acpks gene) as well as the two regulatory genes laeA and vea, using the quantitative Reverse Transcription-Polymerase Chain Reaction (qRT-PCR) method. The results revealed that these six E.Os reduced the expression of the five studied genes, where the ackps was downregulated by 99.2% (the highest downregulation in this study) with 5 µL/mL of fennel E.O.As for the acOTApks, acOTAnrps, veA and laeA, their reduction levels ranged between 10% and 96% depending on the nature of the E.O and its concentration in the medium. PMID:27548221

  1. Nucleotide and protein sequences for dog masticatory tropomyosin identify a novel Tpm4 gene product.

    Science.gov (United States)

    Brundage, Elizabeth A; Biesiadecki, Brandon J; Reiser, Peter J

    2015-10-01

    Jaw-closing muscles of several vertebrate species, including members of Carnivora, express a unique, "masticatory", isoform of myosin heavy chain, along with isoforms of other myofibrillar proteins that are not expressed in most other muscles. It is generally believed that the complement of myofibrillar isoforms in these muscles serves high force generation for capturing live prey, breaking down tough plant material and defensive biting. A unique isoform of tropomyosin (Tpm) was reported to be expressed in cat jaw-closing muscle, based upon two-dimensional gel mobility, peptide mapping, and immunohistochemistry. The objective of this study was to obtain protein and gene sequence information for this unique Tpm isoform. Samples of masseter (a jaw-closing muscle), tibialis (predominantly fast-twitch fibers), and the deep lateral gastrocnemius (predominantly slow-twitch fibers) were obtained from adult dogs. Expressed Tpm isoforms were cloned and sequencing yielded cDNAs that were identical to genomic predicted striated muscle Tpm1.1St(a,b,b,a) (historically referred to as αTpm), Tpm2.2St(a,b,b,a) (βTpm) and Tpm3.12St(a,b,b,a) (γTpm) isoforms (nomenclature reflects predominant tissue expression ("St"-striated muscle) and exon splicing pattern), as well as a novel 284 amino acid isoform observed in jaw-closing muscle that is identical to a genomic predicted product of the Tpm4 gene (δTpm) family. The novel isoform is designated as Tpm4.3St(a,b,b,a). The myofibrillar Tpm isoform expressed in dog masseter exhibits a unique electrophoretic mobility on gels containing 6 M urea, compared to other skeletal Tpm isoforms. To validate that the cloned Tpm4.3 isoform is the Tpm expressed in dog masseter, E. coli-expressed Tpm4.3 was electrophoresed in the presence of urea. Results demonstrate that Tpm4.3 has identical electrophoretic mobility to the unique dog masseter Tpm isoform and is of different mobility from that of muscle Tpm1.1, Tpm2.2 and Tpm3.12 isoforms. We

  2. Essential Oils Modulate Gene Expression and Ochratoxin A Production in Aspergillus carbonarius.

    Science.gov (United States)

    El Khoury, Rachelle; Atoui, Ali; Verheecke, Carol; Maroun, Richard; El Khoury, Andre; Mathieu, Florence

    2016-01-01

    Ochratoxin A (OTA) is a mycotoxin, mainly produced on grapes by Aspergillus carbonarius, that causes massive health problems for humans. This study aims to reduce the occurrence of OTA by using the ten following essential oils (E.Os): fennel, cardamom, anise, chamomile, celery, cinnamon, thyme, taramira, oregano and rosemary at 1 µL/mL and 5 µL/mL for each E.O.As a matter of fact, their effects on the OTA production and the growth of A. carbonarius S402 cultures were evaluated, after four days at 28 °C on a Synthetic Grape Medium (SGM). Results showed that A. carbonarius growth was reduced up to 100%, when cultured with the E.Os of cinnamon, taramira, and oregano at both concentrations and the thyme at 5 µL/mL. As for the other six E.Os, their effect on A. carbonarius growth was insignificant, but highly important on the OTA production. Interestingly, the fennel E.O at 5 µL/mL reduced the OTA production up to 88.9% compared to the control, with only 13.8% of fungal growth reduction. We further investigated the effect of these E.Os on the expression levels of the genes responsible for the OTA biosynthesis (acOTApks and acOTAnrps along with the acpks gene) as well as the two regulatory genes laeA and vea, using the quantitative Reverse Transcription-Polymerase Chain Reaction (qRT-PCR) method. The results revealed that these six E.Os reduced the expression of the five studied genes, where the ackps was downregulated by 99.2% (the highest downregulation in this study) with 5 µL/mL of fennel E.O.As for the acOTApks, acOTAnrps, veA and laeA, their reduction levels ranged between 10% and 96% depending on the nature of the E.O and its concentration in the medium. PMID:27548221

  3. Effect of retS gene on antibiotics production in Pseudomonas fluorescens FD6.

    Science.gov (United States)

    Zhang, Qingxia; Xiao, Qi; Xu, Jingyou; Tong, Yunhui; Wen, Jia; Chen, Xijun; Wei, Lihui

    2015-11-01

    A hybrid sensor kinase termed RetS (regulator of exopolysaccharide and Type III secretion) controls expression of numerous genes in Pseudomonas aeruginosa. To investigate the function of RetS in P. fluorescens FD6, the retS gene was disrupted. Genetic inactivation of retS resulted in enhanced production of 2, 4-diacetylphloroglucinol, pyrrolnitrin, and pyoluteorin. The retS mutant also exhibited significant increase in phlA-lacZ, prnA-lacZ, and pltA-lacZ transcription levels, influencing expression levels of the small regulatory RNAs RsmX and RsmZ. In the gacSretS double mutant, all the phenotypic changes caused by the retS deletion were reversed to the level of gacS single mutant. Furthermore, the retS mutation drastically elevated biofilm formation and improved the colonization ability of strain FD6 on wheat rhizospheres. Based on these results, we proposed that RetS negatively controlled the production of antibiotics through the Gac/Rsm pathway in P. fluorescens FD6. PMID:26505308

  4. Quantitative trait loci linked to PRNP gene controlling health and production traits in INRA 401 sheep

    Directory of Open Access Journals (Sweden)

    Brunel Jean-Claude

    2007-07-01

    Full Text Available Abstract In this study, the potential association of PrP genotypes with health and productive traits was investigated. Data were recorded on animals of the INRA 401 breed from the Bourges-La Sapinière INRA experimental farm. The population consisted of 30 rams and 852 ewes, which produced 1310 lambs. The animals were categorized into three PrP genotype classes: ARR homozygous, ARR heterozygous, and animals without any ARR allele. Two analyses differing in the approach considered were carried out. Firstly, the potential association of the PrP genotype with disease (Salmonella resistance and production (wool and carcass traits was studied. The data used included 1042, 1043 and 1013 genotyped animals for the Salmonella resistance, wool and carcass traits, respectively. The different traits were analyzed using an animal model, where the PrP genotype effect was included as a fixed effect. Association analyses do not indicate any evidence of an effect of PrP genotypes on traits studied in this breed. Secondly, a quantitative trait loci (QTL detection approach using the PRNP gene as a marker was applied on ovine chromosome 13. Interval mapping was used. Evidence for one QTL affecting mean fiber diameter was found at 25 cM from the PRNP gene. However, a linkage between PRNP and this QTL does not imply unfavorable linkage disequilibrium for PRNP selection purposes.

  5. Gene-based vaccine development for improving animal production in developing countries

    International Nuclear Information System (INIS)

    Full text: The cloning and expression of microbial genes in alternate hosts to enhance production of antigens for animal vaccines against all disease is theoretically achievable. It is essential, however, that antigens expressed in this way are known to be protective. Many years of costly research usually precedes the identification of such antigens or combinations of antigens. Thus, while conventional vaccines based on living, attenuated or inactivated microorganisms may be effective, the protective components contained in them i.e. the candidates for cloning, have yet to be found. The principal protective antigen in vaccines against foot rot of sheep and goats is fimbrial protein of Dichelobacter nodosus. Recombinant vaccines against this infection are ineffective if the protein subunits are not assembled and presented to the host in a manner morphologically indistinguishable from those of the natural fimbriae. Availability of recombinant antigen does not necessarily avoid the need for the use of adjuvants to potentiate response. Oil emulsion vaccines, while enhancing immune response, almost inevitably cause a marked reaction at the site of injection. Livestock owners in developing countries are as likely as those elsewhere to object to these reactions. The need to find an acceptable and effective formulation adds to the cost of recombinant vaccines and their application in countries with limited resources for disease control. Another costly feature of recombinant vaccines has been the patenting of processes involving gene technology and licencing agreements for production under the protection of these patents. In some systems antigenic competition between similar and disparate antigens limits the usefulness of even recombinant antigens that, administered individually, are highly potent. In the case of programs for the control and eventual eradication of footrot in sheep and goats in Nepal this problem was overcome by the prior identification of causal serotypes

  6. Diversity, Distribution and Quantification of Antibiotic Resistance Genes in Goat and Lamb Slaughterhouse Surfaces and Meat Products

    Science.gov (United States)

    Lavilla Lerma, Leyre; Benomar, Nabil; Knapp, Charles W.; Correa Galeote, David; Gálvez, Antonio; Abriouel, Hikmate

    2014-01-01

    The distribution and quantification of tetracycline, sulfonamide and beta-lactam resistance genes were assessed in slaughterhouse zones throughout meat chain production and the meat products; this study represents the first to report quantitatively monitor antibiotic resistance genes (ARG) in goat and lamb slaughterhouse using a culture independent approach, since most studies focused on individual bacterial species and their specific resistance types. Quantitative PCR (qPCR) revealed a high prevalence of tetracycline resistance genes tetA and tetB in almost all slaughterhouse zones. Sulfonamide resistance genes were largely distributed, while beta-lactam resistance genes were less predominant. Statistical analysis revealed that resistant bacteria, in most cases, were spread by the same route in almost all slaughterhouse zones, except for tetB, blaCTX and blaTEM genes, which occurred in few zones as isolated ‘hot spots.’ The sum of all analyzed ARG indicated that slaughterhouse surfaces and end products act as reservoirs of ARG, mainly tet genes, which were more prevalent in slaughtering room (SR), cutting room (CR) and commercial meat products (MP). Resistance gene patterns suggest they were disseminated throughout slaughterhouse zones being also detected in commercial meat products, with significant correlations between different sampling zones/end products and total resistance in SR, CR and white room (WR) zones, and also refrigerator 4 (F4) and MP were observed. Strategically controlling key zones in slaughterhouse (SR, CR and WR) by adequate disinfection methods could strategically reduce the risks of ARG transmission and minimize the issues of food safety and environment contamination. PMID:25479100

  7. Diversity, distribution and quantification of antibiotic resistance genes in goat and lamb slaughterhouse surfaces and meat products.

    Directory of Open Access Journals (Sweden)

    Leyre Lavilla Lerma

    Full Text Available The distribution and quantification of tetracycline, sulfonamide and beta-lactam resistance genes were assessed in slaughterhouse zones throughout meat chain production and the meat products; this study represents the first to report quantitatively monitor antibiotic resistance genes (ARG in goat and lamb slaughterhouse using a culture independent approach, since most studies focused on individual bacterial species and their specific resistance types. Quantitative PCR (qPCR revealed a high prevalence of tetracycline resistance genes tetA and tetB in almost all slaughterhouse zones. Sulfonamide resistance genes were largely distributed, while beta-lactam resistance genes were less predominant. Statistical analysis revealed that resistant bacteria, in most cases, were spread by the same route in almost all slaughterhouse zones, except for tetB, blaCTX and blaTEM genes, which occurred in few zones as isolated 'hot spots.' The sum of all analyzed ARG indicated that slaughterhouse surfaces and end products act as reservoirs of ARG, mainly tet genes, which were more prevalent in slaughtering room (SR, cutting room (CR and commercial meat products (MP. Resistance gene patterns suggest they were disseminated throughout slaughterhouse zones being also detected in commercial meat products, with significant correlations between different sampling zones/end products and total resistance in SR, CR and white room (WR zones, and also refrigerator 4 (F4 and MP were observed. Strategically controlling key zones in slaughterhouse (SR, CR and WR by adequate disinfection methods could strategically reduce the risks of ARG transmission and minimize the issues of food safety and environment contamination.

  8. A gene optimization strategy that enhances production of fully functional P-glycoprotein in Pichia pastoris.

    Directory of Open Access Journals (Sweden)

    Jiangping Bai

    Full Text Available BACKGROUND: Structural and biochemical studies of mammalian membrane proteins remain hampered by inefficient production of pure protein. We explored codon optimization based on highly expressed Pichia pastoris genes to enhance co-translational folding and production of P-glycoprotein (Pgp, an ATP-dependent drug efflux pump involved in multidrug resistance of cancers. METHODOLOGY/PRINCIPAL FINDINGS: Codon-optimized "Opti-Pgp" and wild-type Pgp, identical in primary protein sequence, were rigorously analyzed for differences in function or solution structure. Yeast expression levels and yield of purified protein from P. pastoris (∼130 mg per kg cells were about three-fold higher for Opti-Pgp than for wild-type protein. Opti-Pgp conveyed full in vivo drug resistance against multiple anticancer and fungicidal drugs. ATP hydrolysis by purified Opti-Pgp was strongly stimulated ∼15-fold by verapamil and inhibited by cyclosporine A with binding constants of 4.2±2.2 µM and 1.1±0.26 µM, indistinguishable from wild-type Pgp. Maximum turnover number was 2.1±0.28 µmol/min/mg and was enhanced by 1.2-fold over wild-type Pgp, likely due to higher purity of Opti-Pgp preparations. Analysis of purified wild-type and Opti-Pgp by CD, DSC and limited proteolysis suggested similar secondary and ternary structure. Addition of lipid increased the thermal stability from T(m ∼40 °C to 49 °C, and the total unfolding enthalpy. The increase in folded state may account for the increase in drug-stimulated ATPase activity seen in presence of lipids. CONCLUSION: The significantly higher yields of protein in the native folded state, higher purity and improved function establish the value of our gene optimization approach, and provide a basis to improve production of other membrane proteins.

  9. ASSOCIATIONS BETWEEN SNPs IN BOVINE ESTROGEN RECEPTOR GENE AND PRODUCTION TRAITS IN HOLSTEIN CATTLE

    Directory of Open Access Journals (Sweden)

    Nina Moravčíková

    2015-02-01

    Full Text Available aim of this study was to determine allelic and genotypic frequency of two SNPs in ERα gene and evaluate the associations between ERα genetic variants and milk production traits in Holstein cattle. Analysis of the molecular mechanisms involved in the regulation of reproduction in connection with milk production and followed genotyping of the individuals with optimal genetic potential may facilitate the animal selection in dairy cattle farms. Genomic DNA was obtained in total from 150 hair root samples of Holstein cows. Two polymorphic sites in 5´region on ERα gene (BTA6 were analysed. Genotyping of animals was carried out by PCR-RFLP method using SnaBI and BglI restriction endonucleases. After restriction analyses was detected in population the presence of two ERα/SnaBI (GG, AG, and three ERα/BglI genotypes (GG, AG, AA. The highest proportion was found for individuals with ERα/SnaBI GG (85% and ERα/BglI AA (83% genotypes. The missing of ERα/SnaBI AA genotype was reflected to the higher distribution of G allele (0.92± 0.02. For the ERα/BglI polymorphism was observed the higher frequency of A allele (0.91±0.02. The differences between observed and expected genotype frequencies caused the deviations from HWE in locus ERα/SnaBI. The statistical analyses of ERα genotypes effect on milk production traits was performed with linear models (GLM procedure. Based on the selected effect we were able to estimate the variability of analyzed traits on 80%. The ERα/SnaBI and ERα/BglI genotypes affected the variability of milk, protein and fat yield only non-significant (P > 0.05.

  10. Production of staphylococcal enterotoxins in microbial broth and milk by Staphylococcus aureus strains harboring seh gene.

    Science.gov (United States)

    Schubert, Justyna; Podkowik, Magdalena; Bystroń, Jarosław; Bania, Jacek

    2016-10-17

    Twenty Staphylococcus aureus strains harboring seh gene, including one carrying also sec gene and 11 sea gene, were grown in BHI+YE broth and milk and were tested for SEA, SEC and SEH production. All strains decreased pH of BHI+YE broth at 24h and increased them at 48h. Seventeen S. aureus strains grown in milk changed pH for no >0.3 unit until 48h. Three other S. aureus strains significantly decreased pH during growth in milk. All S. aureus produced SEH in BHI+YE broth in amounts ranging from 95 to 1292ng/ml, and from 170 to 4158ng/ml at 24 and 48h, respectively. SEH production in milk by 17 strains did not exceed 23ng/ml at 24h and 36ng/ml at 48h. Three S. aureus strains able to decrease milk pH produced 107-3029ng/ml and 320-4246ng/ml of SEH in milk at 24 and 48h, respectively. These strains were grown in milk and BHI+YE broth with pH stabilized at values near neutral leading to a significant decrease of SEH production. Representative weak SEH producers were grown in milk at reduced pH resulting in moderate increase in SEH production. SEA was produced in milk by 10S. aureus strains at 24-151ng/ml at 24h, and 31-303ng/ml at 48h. SEA production in milk was higher or comparable as in BHI+YE broth in 3 strains and lower for remaining strains. Production of SEC by sec-positive S. aureus strains was lower in milk than in BHI+YE broth, ranging from 131 to 2319ng/ml at 24 and 48h in milk and 296-30,087ng/ml in BHI+YE at 24 and 48h. Both lacE and lacG transcripts involved in lactose metabolism were significantly up-regulated in milk in strong SEH producers. In these strains hld, rot and sarA transcripts were up-regulated in milk as compared to weak SEH producers. Stabilization of milk pH at a value of raw milk significantly down-regulated hld, rot and sarA RNA in strong SEH producers. Milk was generally found unfavorable for enterotoxin production. However, certain S. aureus strains were not restricted in SEH and SEA expression in milk, unlike SEC which remained down

  11. Production of host shutoff-defective mutants of herpes simplex virus type 1 by inactivation of the UL13 gene.

    Science.gov (United States)

    Overton, H; McMillan, D; Hope, L; Wong-Kai-In, P

    1994-07-01

    Two mutants of HSV-1(SC16) carrying disrupted UL13 genes have been generated independently by recombination of wild-type genomic DNA with a plasmid-cloned copy of the UL13 gene containing multiple stop codons. The two mutants were shown to be deficient in UL13 gene expression by Western blotting of infected cells. A revertant virus, in which UL13 expression was restored to a near-normal level, was generated by recombination of one of the UL13-negative mutants with a plasmid carrying the wild-type UL13 gene. The replication of the two UL13-negative viruses in cell culture was somewhat reduced compared to their wild-type parent, and the viruses were unable to produce shutoff of host protein synthesis. The replication of the revertant virus was intermediate between that of the UL13-negative and wild-type viruses, as was its ability to produce host shutoff. Cells infected with the UL13-negative mutants were shown to contain much lower levels than normal of the UL41 gene product, which is known to be required for virion host shutoff. However, there was no significant difference between levels of the UL41 gene product in wild-type and mutant virions. The UL13-negative viruses exhibited different patterns of protein phosphorylation from wild-type virus when infected cells were metabolically labeled with [32P]-orthophosphate and when lysates of infected cells and of virions were subjected to in vitro phosphorylation. However, the UL41 gene product could still be phosphorylated in lysates of UL13-negative virions. We conclude that the UL13 gene is necessary to produce the virion host shutoff effect, but it seems unlikely that the role of UL13 is simply to activate the UL41 gene product by phosphorylation.

  12. Cellulosic Ethanol Production by Recombinant Cellulolytic Bacteria Harbouring pdc and adh II Genes of Zymomonas mobilis.

    Science.gov (United States)

    Piriya, P Sobana; Vasan, P Thirumalai; Padma, V S; Vidhyadevi, U; Archana, K; Vennison, S John

    2012-01-01

    The ethanol fermenting genes such as pyruvate decarboxylase (pdc) and alcohol dehydrogenase II (adh II) were cloned from Zymomonas mobilis and transformed into three different cellulolytic bacteria, namely Enterobacter cloacae JV, Proteus mirabilis JV and Erwinia chrysanthemi and their cellulosic ethanol production capability was studied. Recombinant E. cloacae JV was found to produce 4.5% and 3.5% (v/v) ethanol, respectively, when CMC and 4% NaOH pretreated bagasse were used as substrates, whereas recombinant P. mirabilis and E. chrysanthemi with the same substrates could only produce 4%, 3.5%, 1%, and 1.5 % of ethanol, respectively. The recombinant E. cloacae strain produced twofold higher percentage of ethanol than the wild type. The recombinant E. cloacae strain could be improved further by increasing its ethanol tolerance capability through media optimization and also by combining multigene cellulase expression for enhancing ethanol production from various types of lignocellulosic biomass so that it can be used for industrial level ethanol production.

  13. Improvement of clavulanic acid production in Streptomyces clavuligerus by genetic manipulation of structural biosynthesis genes.

    Science.gov (United States)

    Jnawali, Hum Nath; Yoo, Jin Cheol; Sohng, Jae Kyung

    2011-06-01

    To enhance clavulanic acid production, four structural clavulanic acid biosynthesis genes, carboxyethylarginine synthase (ceas2), β-lactam synthetase (bls2), clavaminate synthase (cas2) and proclavaminate amidinohydrolase (pah2), were amplified from Streptomyces clavuligerus genomic DNA. They were cloned in the pSET152 integration and pIBR25 expression vectors containing the strong ermE* promoter to generate pHN18 and pHN19, respectively, and both plasmids were introduced into S. clavuligerus by protoplast transformation. Clavulanic acid production was increased by 8.7-fold (to ~310 mg/l) in integrative pHN18 transformants and by 5.1-fold in pHN19 transformants compared to controls. Transcriptional analyses showed that the expression levels of ceas2, bls2, cas2 and pah2 were markedly increased in both transformants as compared with wild-type. The elevation of the ceas2, bls2, cas2 and pah2 transcripts was consistent with the enhanced production of clavulanic acid.

  14. Deletion of cagA gene of Helicobacter pylori by PCR products

    Institute of Scientific and Technical Information of China (English)

    Xun Zeng; Li-Hua He; Yan Yin; Mao-Jun Zhang; Jian-Zhong Zhang

    2005-01-01

    AIM: Cytotoxin-associated protein (antigen) A (CagA)plays an important role in Helicobacter pylori(H pylori)pathogenesis. Our aim was to obtain cagA mutant strains by a new mutation method so as to better understand the mechanism of CagA in epithelial cells. METHODS: In contrast with the traditional method using suicide plasmid, we constructed cagA- mutant strains directly with PCR products. The constructed mutant clones grew on selective media and allelic exchange was confirmed by Southern blot. Furthermore, two different transformation methods, electroporation, and natural transformation, were compared with regard to the efficiency of recombination.RESULTS: The mutation by PCR products could be completed within 3-5 d, and the recombination rate by electroporation and natural transformation was 4.02×10-8 and 1.03x 10-9 respectively. Mutation rate by electroporation (4.02× 10-8) was far higher than by natural transformation (1.03× 10-9) (P = 0.000<0.005).CONCLUSION: cagA- mutant strains have been constructed,which is important for further study on the function of CagA in epithelial cells. A mutation method by directly using PCR products has been proved successful with a much higher mutation rate, and is easier, especially when in combination with electroporation. This method could be widely used in gene deletion of H pylori.

  15. Cellulosic Ethanol Production by Recombinant Cellulolytic Bacteria Harbouring pdc and adh II Genes of Zymomonas mobilis

    Directory of Open Access Journals (Sweden)

    P. Sobana Piriya

    2012-01-01

    Full Text Available The ethanol fermenting genes such as pyruvate decarboxylase (pdc and alcohol dehydrogenase II (adh II were cloned from Zymomonas mobilis and transformed into three different cellulolytic bacteria, namely Enterobacter cloacae JV, Proteus mirabilis JV and Erwinia chrysanthemi and their cellulosic ethanol production capability was studied. Recombinant E. cloacae JV was found to produce 4.5% and 3.5% (v/v ethanol, respectively, when CMC and 4% NaOH pretreated bagasse were used as substrates, whereas recombinant P. mirabilis and E. chrysanthemi with the same substrates could only produce 4%, 3.5%, 1%, and 1.5 % of ethanol, respectively. The recombinant E. cloacae strain produced twofold higher percentage of ethanol than the wild type. The recombinant E. cloacae strain could be improved further by increasing its ethanol tolerance capability through media optimization and also by combining multigene cellulase expression for enhancing ethanol production from various types of lignocellulosic biomass so that it can be used for industrial level ethanol production.

  16. Gene

    Data.gov (United States)

    U.S. Department of Health & Human Services — Gene integrates information from a wide range of species. A record may include nomenclature, Reference Sequences (RefSeqs), maps, pathways, variations, phenotypes,...

  17. Increasing Avermectin Production in Streptomyces avermitilis by Manipulating the Expression of a Novel TetR-Family Regulator and Its Target Gene Product.

    Science.gov (United States)

    Liu, Wenshuai; Zhang, Qinling; Guo, Jia; Chen, Zhi; Li, Jilun; Wen, Ying

    2015-08-01

    Avermectins produced by Streptomyces avermitilis are commercially important anthelmintic agents. The detailed regulatory mechanisms of avermectin biosynthesis remain unclear. Here, we identified SAV3619, a TetR-family transcriptional regulator designated AveT, to be an activator for both avermectin production and morphological differentiation in S. avermitilis. AveT was shown to indirectly stimulate avermectin production by affecting transcription of the cluster-situated activator gene aveR. AveT directly repressed transcription of its own gene (aveT), adjacent gene pepD2 (sav_3620), sav_7490 (designated aveM), and sav_7491 by binding to an 18-bp perfect palindromic sequence (CGAAACGKTKYCGTTTCG, where K is T or G and Y is T or C and where the underlining indicates inverted repeats) within their promoter regions. aveM (which encodes a putative transmembrane efflux protein belonging to the major facilitator superfamily [MFS]), the important target gene of AveT, had a striking negative effect on avermectin production and morphological differentiation. Overexpression of aveT and deletion of aveM in wild-type and industrial strains of S. avermitilis led to clear increases in the levels of avermectin production. In vitro gel-shift assays suggested that C-5-O-B1, the late pathway precursor of avermectin B1, acts as an AveT ligand. Taken together, our findings indicate positive-feedback regulation of aveT expression and avermectin production by a late pathway intermediate and provide the basis for an efficient strategy to increase avermectin production in S. avermitilis by manipulation of AveT and its target gene product, AveM.

  18. Lactobacillus reuteri-specific immunoregulatory gene rsiR modulates histamine production and immunomodulation by Lactobacillus reuteri.

    Science.gov (United States)

    Hemarajata, P; Gao, C; Pflughoeft, K J; Thomas, C M; Saulnier, D M; Spinler, J K; Versalovic, J

    2013-12-01

    Human microbiome-derived strains of Lactobacillus reuteri potently suppress proinflammatory cytokines like human tumor necrosis factor (TNF) by converting the amino acid l-histidine to the biogenic amine histamine. Histamine suppresses mitogen-activated protein (MAP) kinase activation and cytokine production by signaling via histamine receptor type 2 (H2) on myeloid cells. Investigations of the gene expression profiles of immunomodulatory L. reuteri ATCC PTA 6475 highlighted numerous genes that were highly expressed during the stationary phase of growth, when TNF suppression is most potent. One such gene was found to be a regulator of genes involved in histidine-histamine metabolism by this probiotic species. During the course of these studies, this gene was renamed the Lactobacillus reuteri-specific immunoregulatory (rsiR) gene. The rsiR gene is essential for human TNF suppression by L. reuteri and expression of the histidine decarboxylase (hdc) gene cluster on the L. reuteri chromosome. Inactivation of rsiR resulted in diminished TNF suppression in vitro and reduced anti-inflammatory effects in vivo in a trinitrobenzene sulfonic acid (TNBS)-induced mouse model of acute colitis. A L. reuteri strain lacking an intact rsiR gene was unable to suppress colitis and resulted in greater concentrations of serum amyloid A (SAA) in the bloodstream of affected animals. The PhdcAB promoter region targeted by rsiR was defined by reporter gene experiments. These studies support the presence of a regulatory gene, rsiR, which modulates the expression of a gene cluster known to mediate immunoregulation by probiotics at the transcriptional level. These findings may point the way toward new strategies for controlling gene expression in probiotics by dietary interventions or microbiome manipulation. PMID:24123819

  19. SYBR® Green qPCR Screening Methods for Detection of Anti-herbicide Genes in Genetically Modiifed Processed Products

    Institute of Scientific and Technical Information of China (English)

    Zhen Zhen; Lv Wei; Tang Zhi-fen; Liu Ying; Ao Jin-xia; Yuan Xiao-han; Zhang Ming-hui; Qiu You-wen; Gao Xue-jun

    2016-01-01

    The use of genetically modified organisms (GMOs) as food products becomes more and more widespread. The European Union has implemented a set of very strict procedures for the approval to grow, import and/or utilize GMOs as food or food ingredients. Thus, analytical methods for detection of GMOs are necessary in order to verify compliance with labelling requirements. There are few effective screening methods for processed GM (genetically modified) products. Three anti-herbicide genes (CP4-EPSPS,BAR andPAT) are common exogenous genes used in commercialized transgenic soybean, maize and rice. In the present study, a new SYBR® Green qPCR screening method was developed to simultaneously detect the three exogenous anti-herbicide genes and one endogenous gene in a run. We tested seven samples of representative processed products (soya lecithin, soya protein powder, chocolate beverage, infant rice cereal, maize protein powder, maize starch, and maize jam) using the developed method, and amplicons of endogenous gene and transgenic fragments were obtained from all the processed products, and the sensitivity was 0.1%. These results indicated that SYBR® Green qPCR screening method was appropriate for qualitative detection of transgenic soybean, maize and rice in processed products.

  20. The early gene product EUO is a transcriptional repressor that selectively regulates promoters of Chlamydia late genes.

    Science.gov (United States)

    Rosario, Christopher J; Tan, Ming

    2012-06-01

    The obligate intracellular bacterium Chlamydia has an unusual developmental cycle in which there is conversion between two forms that are specialized for either intracellular replication or propagation of the infection to a new host cell. Expression of late chlamydial genes is upregulated during conversion from the replicating to the infectious form, but the mechanism for this temporal regulation is unknown. We found that EUO, which is expressed from an early gene, binds to two sites upstream of the late operon omcAB, but only the downstream site was necessary for transcriptional repression. Using gel shift and in vitro transcription assays we showed that EUO specifically bound and repressed promoters of Chlamydia trachomatis late genes, but not early or mid genes. These findings support a role for EUO as a temporal repressor that negatively regulates late chlamydial genes and prevents their premature expression. The basis of this specificity is the ability of EUO to selectively bind promoter regions of late genes, which would prevent their transcription by RNA polymerase. Thus, we propose that EUO is a master regulator that prevents the terminal differentiation of the replicating form of chlamydiae into the infectious form until sufficient rounds of replication have occurred.

  1. Advanced Glycation End-Products affect transcription factors regulating insulin gene expression

    International Nuclear Information System (INIS)

    Advanced Glycation End-Products (AGEs) are generated by the covalent interaction of reducing sugars with proteins, lipids or nucleic acids. AGEs are implicated in diabetic complications and pancreatic β-cell dysfunction. We previously demonstrated that exposure of the pancreatic islet cell line HIT-T15 to high concentrations of AGEs leads to a significant decrease of insulin secretion and content. Insulin gene transcription is positively regulated by the beta cell specific transcription factor PDX-1 (Pancreatic and Duodenal Homeobox-1). On the contrary, the forkhead transcription factor FoxO1 inhibits PDX-1 gene transcription. Activity of FoxO1 is regulated by post-translational modifications: phosphorylation deactivates FoxO1, and acetylation prevents FoxO1 ubiquitination. In this work we investigated whether AGEs affect expression and subcellular localization of PDX-1 and FoxO1. HIT-T15 cells were cultured for 5 days in presence of AGEs. Cells were then lysed and processed for subcellular fractionation. We determined intracellular insulin content, then we assessed the expression and subcellular localization of PDX-1, FoxO1, phosphoFoxO1 and acetylFoxO1. As expected intracellular insulin content was lower in HIT-T15 cells cultured with AGEs. The results showed that AGEs decreased expression and nuclear localization of PDX-1, reduced phosphorylation of FoxO1, and increased expression and acetylation of FoxO1. These results suggest that AGEs decrease insulin content unbalancing transcription factors regulating insulin gene expression.

  2. Gene-based vaccine development for improving animal production in developing countries. Possibilities and constraints

    International Nuclear Information System (INIS)

    For vaccine production, recombinant antigens must be protective. Identifying protective antigens or candidate antigens is an essential precursor to vaccine development. Even when a protective antigen has been identified, cloning of its gene does not lead directly to vaccine development. The fimbrial protein of Dichelobacter nodosus, the agent of foot-rot in ruminants, was known to be protective. Recombinant vaccines against this infection are ineffective if expressed protein subunits are not assembled as mature fimbriae. Antigenic competition between different, but closely related, recombinant antigens limited the use of multivalent vaccines based on this technology. Recombinant antigens may need adjuvants to enhance response. DNA vaccines, potentiated with genes for different cytokines, may replace the need for aggressive adjuvants, and especially where cellular immunity is essential for protection. The expression of antigens from animal pathogens in plants and the demonstration of some immunity to a disease like rinderpest after ingestion of these, suggests an alternative approach to vaccination by injection. Research on disease pathogenesis and the identification of candidate antigens is specific to the disease agent. The definition of expression systems and the formulation of a vaccine for each disease must be followed by research to establish safety and efficacy. Where vaccines are based on unique gene sequences, the intellectual property is likely to be protected by patent. Organizations, licensed to produce recombinant vaccines, expect to recover their costs and to make a profit. The consequence is that genetically-derived vaccines are expensive. The capacity of vaccines to help animal owners of poorer countries depends not only on quality and cost but also on the veterinary infrastructure where they are used. Ensuring the existence of an effective animal health infrastructure in developing countries is as great a challenge for the developed world as

  3. Effects of CSN3 and LGB gene polymorphisms on production traits in beef cattle

    Directory of Open Access Journals (Sweden)

    Rogério A. Curi

    2005-01-01

    Full Text Available The objective of the present study was to estimate the allele and genotype frequencies of the CSN3/HinfI and LGB/HaeIII gene polymorphisms in beef cattle belonging to different genetic groups, and to determine the effects of these polymorphisms on growth and carcass traits in these animals, which are submitted to an intensive production model. Genotyping was performed on 79 Nelore, 30 Canchim (5/8 Charolais + 3/8 Zebu and 275 crossbred cattle originating from the crosses of Simmental (n = 30 and Angus (n = 245 sires with Nelore females. Body weight, weight gain, dressing percentage, longissimus dorsi area and backfat thickness were fitted using the GLM procedure, and least square means of the genotypes were compared by the F test. The results showed that the CSN3/HinfI and LGB/HaeIII polymorphisms did not have any effect on growth or carcass traits (p > 0.05.

  4. In vitro complementation assay for the Escherichia coli uvrD gene product

    Energy Technology Data Exchange (ETDEWEB)

    Kuemmerle, N.B.; Masker, W.E.

    1983-01-01

    An in vitro assay for the product of the uvrD gene of Escherichia coli has been developed. This assay, derived from properties of uvrD mutants revealed by in vivo experiments, is based on the necessity for a functional uvrD protein for complete rejoining of covalently closed circular DNA during the excision repair of UV-induced damage. Extracts prepared from gently lysed uvrD101 mutant cells are capable of restoring UV-damaged DNA to its covalently closed circular form when provided with a functional uvrD protein from other repair-deficient cell extracts or from partially purified protein fractions. This assay was employed to monitor the activity of the uvrD protein after several steps of fractionation.

  5. Analysis of β-galactosidase production and their genes of two strains of Lactobacillus bulgaricus.

    Science.gov (United States)

    Zhang, Wen; Wang, Chuan; Huang, Cheng-Yu; Yu, Qian; Liu, Heng-Chuan; Zhang, Chao-Wu; Pei, Xiao-Fang; Xu, Xin; Wang, Guo-Qing

    2012-06-01

    A bacterial β-galactosidase delivery system is a potential therapy for lactose intolerance. Currently, two Lactobacillus bulgaricus strains with different biological characteristics are under consideration as potential sources. However, differences in these β-galactosidase genes and their resulting production levels are poorly characterized. The β-galactosidase ORF of L. bulgaricus yogurt isolate had high variability and was terminated at site 1924 due to a stop codon. However, the full 114 kDa β-galactosidase band was still resolved by SDS-PAGE, which may indicate that the interrupted ORF was translated into more than one peptide, and they together were folded into the complete enzyme protein that showed much higher β-galactosidase activity (6.2 U/mg protein) than the enzyme generated from L. bulgaricus reference strain (2.5 U/mg protein).

  6. Gene expression profiling defined pathways correlated with fibroblast cell proliferation induced by Opisthorchis viverrini excretory/secretory product

    Institute of Scientific and Technical Information of China (English)

    Chanitra Thuwajit; Peti Thuwajit; Kazuhiko Uchida; Daoyot Daorueang; Sasithorn Kaewkes; Sopit Wongkham; Masanao Miwa

    2006-01-01

    AIM: To investigate the mechanism of fibroblast cell proliferation stimulated by the Opisthorchis viverrini excretory/secretory (ES) product.METHODS: NIH-3T3, mouse fibroblast cells were treated with O. viverrini ES product by non-contact co-cultured with the adult parasites. Total RNA from NIH-3T3 treated and untreated with O. viverrini was extracted, reverse transcribed and hybridized with the mouse 15K complementary DNA (cDNA) array. The result was analyzed by ArrayVision version 5 and GeneSpring version 5 softwares. After normalization, the ratios of gene expression of parasite treated to untreated NIH3T3 cells of 2-and more-fold upregulated was defined as the differentially expressed genes. The expression levels of the signal transduction genes were validated by semiquantitative SYBR-based real-time RT-PCR.RESULTS: Among a total of 15 000 genes/ESTs, 239genes with established cell proliferation-related function were 2 fold-and more-up-regulated by O. viverrini ES product compared to those in cells without exposure to the parasitic product. These genes were classified into groups including energy and metabolism, signal transduction, protein synthesis and translation, matrix and structural protein, transcription control, cell cycle and DNA replication. Moreover, the expressions of serinethreonine kinase receptor, receptor tyrosine kinase and collagen production-related genes were up-regulated by O. viverrini ES product. The expression level of signal transduction genes; pkC, pdgfrα, jak 1, eps 8, tgfβ 1/4,strap and h ras measured by real-time RT-PCR confirmed their expression levels to those obtained from cDNA array. However, only the up-regulated expression of pkC, eps 8 and tgfβ 1/4 which are the downstream signaling molecules of either epidermal growth factor (EGF) or transforming growth factor-β (TGF-β) showed statistical significance (P < 0.05). CONCLUSION: O. viverrini ES product stimulates the significant changes of gene expression in several

  7. Functional analysis of the Borrelia burgdorferi bba64 gene product in murine infection via tick infestation.

    Directory of Open Access Journals (Sweden)

    Toni G Patton

    Full Text Available Borrelia burgdorferi, the causative agent of Lyme borreliosis, is transmitted to humans from the bite of Ixodes spp. ticks. During the borrelial tick-to-mammal life cycle, B. burgdorferi must adapt to many environmental changes by regulating several genes, including bba64. Our laboratory recently demonstrated that the bba64 gene product is necessary for mouse infectivity when B. burgdorferi is transmitted by an infected tick bite, but not via needle inoculation. In this study we investigated the phenotypic properties of a bba64 mutant strain, including 1 replication during tick engorgement, 2 migration into the nymphal salivary glands, 3 host transmission, and 4 susceptibility to the MyD88-dependent innate immune response. Results revealed that the bba64 mutant's attenuated infectivity by tick bite was not due to a growth defect inside an actively feeding nymphal tick, or failure to invade the salivary glands. These findings suggested there was either a lack of spirochete transmission to the host dermis or increased susceptibility to the host's innate immune response. Further experiments showed the bba64 mutant was not culturable from mouse skin taken at the nymphal bite site and was unable to establish infection in MyD88-deficient mice via tick infestation. Collectively, the results of this study indicate that BBA64 functions at the salivary gland-to-host delivery interface of vector transmission and is not involved in resistance to MyD88-mediated innate immunity.

  8. SOR1, a gene associated with bioherbicide production in sorghum root hairs.

    Science.gov (United States)

    Yang, Xiaohan; Scheffler, Brian E; Weston, Leslie A

    2004-10-01

    Sorghum [Sorghum bicolor (L.) Moench] roots exude a potent bioherbicide known as sorgoleone, which is produced in living root hairs and is phytotoxic to broadleaf and grass weeds at concentrations as low as 10 microM. Differential gene expression was studied in sorghum (S. bicolorxS. sudanense) cv. SX17 between roots with abundant root hairs and those without root hairs using a modified differential display approach. A differentially expressed gene, named SOR1, was cloned by using Rapid Amplification of the 5' ends of cDNA (5'-RACE). Real-time PCR analysis of multiple tissues of sorghum SX17 revealed that the SOR1 transcript level in root hairs was more than 1000 times higher than that of other tissues evaluated, including immature leaf, mature leaf, mature stem, panicle, and roots with hairs removed. Semi-quantitative RT-PCR revealed that SOR1 was expressed in the sorgoleone-producing roots of sorghum SX17, shattercane [S. bicolor (L.) Moench], and johnsongrass [S. halepense (L.) Pers.], but not in the shoots of sorghum or in the roots of sweet corn (Zea mays L.) 'Summer Flavor 64Y', in which sorgoleone production was not detected by HPLC analysis. Similarity searches indicated that SOR1 probably encodes a novel desaturase, which might be involved in the formation of a unique and specific double bonding pattern within the long hydrocarbon tail of sorgoleone.

  9. Invertase production by Aspergillus and Penicillium and sequencing of an inv gene fragment

    Directory of Open Access Journals (Sweden)

    A. C. Flores-Gallegos

    2012-01-01

    Full Text Available Invertase (B-fructofuranosidase is an enzyme used in the food industry, where sugar mixtures are preferred to glucose because they are sweeter and do not crystallize easily. In this study, a biochemical characterization of five fungal strains isolated from a Mexican semi-desert (Aspergillus niger GH1, A. fumigatus GS, Penicillium purpurogenum GH2, P. citrinum ESS, P. pinophilum EH2 was carried out. Evaluation of maximal growth of the strains on potato dextrose agar at several temperatures and pH values, as well as the assessment of invertase production using polyurethane foam as a non-biodegradable support, were performed. The highest growth rates corresponded to A. niger GH1 (0.2831 mm/h, and P. citrinum ESS (0.1931 mm/h. The maximum invertase yield was 81,270 U/L per min, determined for A. niger GH1 at 72 h. Oligonucleotide primers were designed for amplification of sequences from the invertase gene, InvF 5 ACGTCTGGCTGTCCGGTGAC and InvR 5 ACCGAACCCAAGTACTCAACGCA 3, showing an optimum annealing temperature of 61.6 C. DNA fragments of about 560 bp were obtained and sequenced, corresponding to the putative invertase gene of Aspergillus.

  10. Relationship between gene polymorphism and milk production traits in Teleorman Black Head sheep breed

    Directory of Open Access Journals (Sweden)

    Gras MA

    2015-12-01

    Full Text Available Objective. This study is a preliminary step of a larger national program aimed to develop a strategy for “in situ” preservation of Teleorman Black Head sheep population. In this paper we estimated the effect of β-lactoglobulin, casein and prolactin on some quantitative and qualitative milk traits in this local sheep population. Material and methods. Genotyping methodology included PCR for CSN3 (A and B alleles and PCR-RFLP for LGB (A and B alleles and PRL (T and C alleles, respectively. Repeated milking and milk composition analysis were used for the polymorphism effect estimation. Results. No association between CSN3 polymorphism and milk traits was found. Effect of LGB on production traits was quite constant. Genotype AA performed better than BB. PRL marker effect showed small differences than LGB. Concerning milk, fat and protein yield, AA genotype for PRL had a smaller positive impact than AA genotype for LGB. Regarding fat and protein content, PRL showed a negative effect for AA and positive for BB genotype, respectively. Conclusions. Positive association between LGB and milk yield and composition recommend this candidate gene like marker for a future MAS program. Although PRL gene is also associated with an increased milk quantity, inverse response over milk composition must be considered in MAS strategy. Our study demonstrated that both LGB and PRL markers could became an advent of MAS utilization in Romanian dairy sheep breeding industry.

  11. Prokaryotic Expression of Rice Ospgip1 Gene and Bioinformatic Analysis of Encoded Product

    Institute of Scientific and Technical Information of China (English)

    CHEN Xi-jun; LIU Xiao-wei; Zuo Si-min; MA Yu-yin; TONG Yun-hui; PAN Xue-biao; XU Jing-you

    2011-01-01

    Using the reference sequences of pgip genes in GenBank,a fragment of 930 bp covering the open reading frame (ORF) of rice Ospgip1 (Oryza sativa polygalacturonase-inhibiting protein 1) was amplified.The prokaryotic expression product of the gene inhibited the growth of Rhizoctonia solani,the causal agent of rice sheath blight,and reduced its polygalacturonase activity.Bioinformatic analysis showed that OsPGIP1 is a hydrophobic protein with a molecular weight of 32.8 kDa and an isoelectric point (pl) of 7.26.The protein is mainly located in the cell wall of rice,and its signal peptide cleavage site is located between the 17th and 18th amino acids.There are four cysteines in both the N-and C-termini of the deduced protein,which can form three disulfide bonds (between the 56th and 63rd,the 278th and 298th,and the 300th and308th amino acids).The protein has a typical leucine-rich repeat (LRR) domain,and its secondary structure comprises α-helices,β-sheets and irregular coils.Compared with polygalacturonase-inhibiting proteins (PGIPs) from other plants,the 7th LRR is absent in OsPGIP1.The nine LRRs could form a cleft that might associate with proteins from pathogenic fungi,such as polygalacturonase.

  12. Structural and mechanistic studies of the orf12 gene product from the clavulanic acid biosynthesis pathway.

    Science.gov (United States)

    Valegård, Karin; Iqbal, Aman; Kershaw, Nadia J; Ivison, David; Généreux, Catherine; Dubus, Alain; Blikstad, Cecilia; Demetriades, Marina; Hopkinson, Richard J; Lloyd, Adrian J; Roper, David I; Schofield, Christopher J; Andersson, Inger; McDonough, Michael A

    2013-08-01

    Structural and biochemical studies of the orf12 gene product (ORF12) from the clavulanic acid (CA) biosynthesis gene cluster are described. Sequence and crystallographic analyses reveal two domains: a C-terminal penicillin-binding protein (PBP)/β-lactamase-type fold with highest structural similarity to the class A β-lactamases fused to an N-terminal domain with a fold similar to steroid isomerases and polyketide cyclases. The C-terminal domain of ORF12 did not show β-lactamase or PBP activity for the substrates tested, but did show low-level esterase activity towards 3'-O-acetyl cephalosporins and a thioester substrate. Mutagenesis studies imply that Ser173, which is present in a conserved SXXK motif, acts as a nucleophile in catalysis, consistent with studies of related esterases, β-lactamases and D-Ala carboxypeptidases. Structures of wild-type ORF12 and of catalytic residue variants were obtained in complex with and in the absence of clavulanic acid. The role of ORF12 in clavulanic acid biosynthesis is unknown, but it may be involved in the epimerization of (3S,5S)-clavaminic acid to (3R,5R)-clavulanic acid.

  13. Heterologous expression of leader-less pga gene in Pichia pastoris: intracellular production of prokaryotic enzyme

    Directory of Open Access Journals (Sweden)

    Kyslík Pavel

    2010-02-01

    Full Text Available Abstract Background Penicillin G acylase of Escherichia coli (PGAEc is a commercially valuable enzyme for which efficient bacterial expression systems have been developed. The enzyme is used as a catalyst for the hydrolytic production of β-lactam nuclei or for the synthesis of semi-synthetic penicillins such as ampicillin, amoxicillin and cephalexin. To become a mature, periplasmic enzyme, the inactive prepropeptide of PGA has to undergo complex processing that begins in the cytoplasm (autocatalytic cleavage, continues at crossing the cytoplasmic membrane (signal sequence removing, and it is completed in the periplasm. Since there are reports on impressive cytosolic expression of bacterial proteins in Pichia, we have cloned the leader-less gene encoding PGAEc in this host and studied yeast production capacity and enzyme authenticity. Results Leader-less pga gene encoding PGAEcunder the control of AOX1 promoter was cloned in Pichia pastoris X-33. The intracellular overproduction of heterologous PGAEc(hPGAEc was evaluated in a stirred 10 litre bioreactor in high-cell density, fed batch cultures using different profiles of transient phases. Under optimal conditions, the average volumetric activity of 25900 U l-1 was reached. The hPGAEc was purified, characterized and compared with the wild-type PGAEc. The α-subunit of the hPGAEc formed in the cytosol was processed aberrantly resulting in two forms with C- terminuses extended to the spacer peptide. The enzyme exhibited modified traits: the activity of the purified enzyme was reduced to 49%, the ratios of hydrolytic activities with cephalexin, phenylacetamide or 6-nitro-3-phenylacetylamidobenzoic acid (NIPAB to penicillin G increased and the enzyme showed a better synthesis/hydrolysis ratio for the synthesis of cephalexin. Conclusions Presented results provide useful data regarding fermentation strategy, intracellular biosynthetic potential, and consequences of the heterologous expression of PGAEc

  14. Lactobacillus reuteri-Specific Immunoregulatory Gene rsiR Modulates Histamine Production and Immunomodulation by Lactobacillus reuteri

    OpenAIRE

    Hemarajata, P; Gao, C; Pflughoeft, K. J.; Thomas, C M; Saulnier, D. M.; Spinler, J. K.; Versalovic, J

    2013-01-01

    Human microbiome-derived strains of Lactobacillus reuteri potently suppress proinflammatory cytokines like human tumor necrosis factor (TNF) by converting the amino acid l-histidine to the biogenic amine histamine. Histamine suppresses mitogen-activated protein (MAP) kinase activation and cytokine production by signaling via histamine receptor type 2 (H2) on myeloid cells. Investigations of the gene expression profiles of immunomodulatory L. reuteri ATCC PTA 6475 highlighted numerous genes th...

  15. Overexpression of D-Xylose Reductase (xyl1) Gene and Antisense Inhibition of D-Xylulokinase (xyiH) Gene Increase Xylitol Production in Trichoderma reesei

    Science.gov (United States)

    Hong, Yuanyuan; Dashtban, Mehdi; Kepka, Greg; Chen, Sanfeng; Qin, Wensheng

    2014-01-01

    T. reesei is an efficient cellulase producer and biomass degrader. To improve xylitol production in Trichoderma reesei strains by genetic engineering, two approaches were used in this study. First, the presumptive D-xylulokinase gene in T. reesei (xyiH), which has high homology to known fungi D-xylulokinase genes, was silenced by transformation of T. reesei QM9414 strain with an antisense construct to create strain S6-2-2. The expression of the xyiH gene in the transformed strain S6-2-2 decreased at the mRNA level, and D-xylulokinase activity decreased after 48 h of incubation. This led to an increase in xylitol production from undetectable levels in wild-type T. reesei QM9414 to 8.6 mM in S6-2-2. The T. reesei Δxdh is a xylose dehydrogenase knockout strain with increased xylitol production compared to the wild-type T. reesei QM9414 (22.8 mM versus undetectable). The copy number of the xylose reductase gene (xyl1) in T. reesei Δxdh strain was increased by genetic engineering to create a new strain Δ9-5-1. The Δ9-5-1 strain showed a higher xyl1 expression and a higher yield of xylose reductase, and xylitol production was increased from 22.8 mM to 24.8 mM. Two novel strains S6-2-2 and Δ9-5-1 are capable of producing higher yields of xylitol. T. reesei has great potential in the industrial production of xylitol. PMID:25013760

  16. Overexpression of D-Xylose Reductase (xyl1 Gene and Antisense Inhibition of D-Xylulokinase (xyiH Gene Increase Xylitol Production in Trichoderma reesei

    Directory of Open Access Journals (Sweden)

    Yuanyuan Hong

    2014-01-01

    Full Text Available T. reesei is an efficient cellulase producer and biomass degrader. To improve xylitol production in Trichoderma reesei strains by genetic engineering, two approaches were used in this study. First, the presumptive D-xylulokinase gene in T. reesei (xyiH, which has high homology to known fungi D-xylulokinase genes, was silenced by transformation of T. reesei QM9414 strain with an antisense construct to create strain S6-2-2. The expression of the xyiH gene in the transformed strain S6-2-2 decreased at the mRNA level, and D-xylulokinase activity decreased after 48 h of incubation. This led to an increase in xylitol production from undetectable levels in wild-type T. reesei QM9414 to 8.6 mM in S6-2-2. The T. reesei Δxdh is a xylose dehydrogenase knockout strain with increased xylitol production compared to the wild-type T. reesei QM9414 (22.8 mM versus undetectable. The copy number of the xylose reductase gene (xyl1 in T. reesei Δxdh strain was increased by genetic engineering to create a new strain Δ9-5-1. The Δ9-5-1 strain showed a higher xyl1 expression and a higher yield of xylose reductase, and xylitol production was increased from 22.8 mM to 24.8 mM. Two novel strains S6-2-2 and Δ9-5-1 are capable of producing higher yields of xylitol. T. reesei has great potential in the industrial production of xylitol.

  17. Enhanced production of shikimic acid using a multi-gene co-expression system in Escherichia coli.

    Science.gov (United States)

    Liu, Xiang-Lei; Lin, Jun; Hu, Hai-Feng; Zhou, Bin; Zhu, Bao-Quan

    2016-04-01

    Shikimic acid (SA) is the key synthetic material for the chemical synthesis of Oseltamivir, which is prescribed as the front-line treatment for serious cases of influenza. Multi-gene expression vector can be used for expressing the plurality of the genes in one plasmid, so it is widely applied to increase the yield of metabolites. In the present study, on the basis of a shikimate kinase genetic defect strain Escherichia coli BL21 (ΔaroL/aroK, DE3), the key enzyme genes aroG, aroB, tktA and aroE of SA pathway were co-expressed and compared systematically by constructing a series of multi-gene expression vectors. The results showed that different gene co-expression combinations (two, three or four genes) or gene orders had different effects on the production of SA. SA production of the recombinant BL21-GBAE reached to 886.38 mg·L(-1), which was 17-fold (P < 0.05) of the parent strain BL21 (ΔaroL/aroK, DE3). PMID:27114316

  18. Production of p53 gene knockout rats by homologous recombination in embryonic stem cells

    OpenAIRE

    Tong, Chang; Li, Ping; Wu, Nancy L; Yan, Youzhen; Ying, Qi-Long

    2010-01-01

    The use of homologous recombination to modify genes in embryonic stem (ES) cells provides a powerful means to elucidate gene function and create disease models1. Application of this technology to engineer genes in rats has previously been impossible in the absence of germline competent ES cells in this species. We have recently established authentic rat ES cells2, 3. Here we report the generation of the first gene knockout rats using the ES cell-based gene targeting technology. We designed a ...

  19. A lentiviral gene therapy strategy for the in vitro production of feline erythropoietin.

    Directory of Open Access Journals (Sweden)

    Natalia Vapniarsky

    Full Text Available Nonregenerative anemia due to chronic renal failure is a common problem in domestic cats. Unfortunately, administration of recombinant human erythropoietin often only improves anemia temporarily due to antibody development. In this in vitro study, feline erythropoietin cDNA was cloned from feline renal tissue and utilized in the construction of a replication-defective lentiviral vector. The native recombinant feline erythropoietin (rfEPO sequence was confirmed by sequencing. Upon viral vector infection of human 293H cells, Crandall Renal Feline Kidney cell line and primary feline peripheral blood mononuclear cells, bioactive rfEPO protein was produced. The presence of cellular rfEPO cDNA was confirmed by standard PCR, production of abundant rfEPO mRNA was confirmed by real-time PCR, and secretion of rfEPO protein was demonstrated by Western blot analyses, while rfEPO protein bioactivity was confirmed via an MTT proliferation bioassay. This in vitro study demonstrates the feasibility of a replication-defective lentiviral vector delivery system for the in vitro production of biologically active feline erythropoietin. Anemic cats with chronic renal failure represent a potential in vivo application of a lentiviral gene therapy system.

  20. Early Determination of Animals with Favorable Genes in Milk Production for Profitable Private Farms

    Directory of Open Access Journals (Sweden)

    Daniela E. Ilie

    2010-05-01

    Full Text Available The primary goal of dairy industry has been to identify an efficient and economical way of increasing milk production and its constituents without increasing the size of the dairy herd. The use of milk protein polymorphisms as detectable molecular markers has been studied intensively because of their effect on the yield and processing properties of milk and its products. Thus, molecular markers are promising alternative to the current methods of trait selection once these genes are proven to be associated with traits of interest in animals. Kappa-casein (CSN3 and beta-lactoglobulin (BLG are two of the most important proteins in the milk of mammals that play a crucial role in the milk quality and coagulation, an essential process for cheese and butter. The A and B variant of k-casein and β-lactoglobulin were distinguished by Polymerase Chain Reaction and Restriction Fragment Length Polymorphism (PCR-RFLP analysis in 108 Romanian Simmental and 60 Holstein Friesian cattle.

  1. Purification and characterization of the nifN and nifE gene products from Azotobacter vinelandii mutant UW45.

    OpenAIRE

    Paustian, T D; Shah, V K; Roberts, G P

    1989-01-01

    The nifN and -E gene products are involved in the synthesis of the iron-molybdenum cofactor of dinitrogenase, the enzyme responsible for the reduction of dinitrogen to ammonia. By using the in vitro iron-molybdenum cofactor biosynthesis assay, we have followed the purification of these gene products 450-fold to greater than 95% purity. An overall recovery of 20% was obtained with the purified protein having a specific activity of 6900 units/mg of protein. The protein (hereafter referred to as...

  2. Cloning and verification of the Lactococcus lactis pyrG gene and characterization of the gene product, CTP synthase

    DEFF Research Database (Denmark)

    Wadskov-Hansen, Steen Lyders Lerche; Willemoës, M.; Martinussen, Jan;

    2001-01-01

    The pyrG gene of Lactococcus lactis subsp. cremoris, encoding CTP synthase, has been cloned and sequenced. It is flanked upstream by an open reading frame showing homology to several aminotransferases and downstream by an open reading frame of unknown function. L. lactis strains harboring disrupted...

  3. Expression of genes responsible for ethylene production and wilting are differently regulated in carnation (Dianthus caryophyllus L.) petals.

    Science.gov (United States)

    Kosugi; Shibuya; Tsuruno; Iwazaki; Mochizuki; Yoshioka; Hashiba; Satoh

    2000-09-01

    Carnation petals exhibit autocatalytic ethylene production and wilting during senescence. The autocatalytic ethylene production is caused by the expression of 1-aminocyclopropane-1-carboxylate (ACC) synthase and ACC oxidase genes, whereas the wilting of petals is related to the expression of the cysteine proteinase (CPase) gene. So far, it has been believed that the ethylene production and wilting are regulated in concert in senescing carnation petals, since the two events occurred closely in parallel with time. In the present study, we investigated the expression of these genes in petals of a transgenic carnation harboring a sense ACC oxidase transgene and in petals of carnation flowers treated with 1,1-dimethyl-4-(phenylsulfonyl)semicarbazide (DPSS). In petals of the transgenic carnation flowers, treatment with exogenous ethylene caused accumulation of the transcript for CPase and in-rolling (wilting), whereas it caused no or little accumulation of the transcripts for ACC oxidase and ACC synthase and negligible ethylene production. In petals of the flowers treated with DPSS, the transcripts for ACC synthase and ACC oxidase were accumulated, but no significant change in the level of the transcript for CPase was observed. These results suggest that the expression of ACC synthase and ACC oxidase genes, which leads to ethylene production, is differentially regulated from the expression of CPase, which leads to wilting, in carnation petals.

  4. Identification of candidate genes for yeast engineering to improve bioethanol production in very high gravity and lignocellulosic biomass industrial fermentations

    Directory of Open Access Journals (Sweden)

    Pereira Francisco B

    2011-12-01

    Full Text Available Abstract Background The optimization of industrial bioethanol production will depend on the rational design and manipulation of industrial strains to improve their robustness against the many stress factors affecting their performance during very high gravity (VHG or lignocellulosic fermentations. In this study, a set of Saccharomyces cerevisiae genes found, through genome-wide screenings, to confer resistance to the simultaneous presence of different relevant stresses were identified as required for maximal fermentation performance under industrial conditions. Results Chemogenomics data were used to identify eight genes whose expression confers simultaneous resistance to high concentrations of glucose, acetic acid and ethanol, chemical stresses relevant for VHG fermentations; and eleven genes conferring simultaneous resistance to stresses relevant during lignocellulosic fermentations. These eleven genes were identified based on two different sets: one with five genes granting simultaneous resistance to ethanol, acetic acid and furfural, and the other with six genes providing simultaneous resistance to ethanol, acetic acid and vanillin. The expression of Bud31 and Hpr1 was found to lead to the increase of both ethanol yield and fermentation rate, while Pho85, Vrp1 and Ygl024w expression is required for maximal ethanol production in VHG fermentations. Five genes, Erg2, Prs3, Rav1, Rpb4 and Vma8, were found to contribute to the maintenance of cell viability in wheat straw hydrolysate and/or the maximal fermentation rate of this substrate. Conclusions The identified genes stand as preferential targets for genetic engineering manipulation in order to generate more robust industrial strains, able to cope with the most significant fermentation stresses and, thus, to increase ethanol production rate and final ethanol titers.

  5. Dynamics of plc gene transcription and α-toxin production during growth of Clostridium perfringens strains with contrasting α-toxin production

    DEFF Research Database (Denmark)

    Abildgaard, Lone; Schramm, Andreas; Rudi, Knut;

    2009-01-01

    The aim of the present study was to investigate transcription dynamics of the α-toxin-encoding plc gene relative to two housekeeping genes (gyrA and rplL) in batch cultures of three Clostridium perfringens strains with low, intermediate, and high levels of α-toxin production, respectively. The plc...... transcript level was always low in the low α-toxin producing strain. For the two other strains, plc transcription showed an inducible pattern and reached a maximum level in the late exponential growth phase. The transcription levels were however inversely correlated to α-toxin production for the two strains....... We propose that this discrepancy is due to differences in plc translation rates between the strains and that strain-specific translational rates therefore must be determined before α-toxin production can be extrapolated from transcript levels in C. perfringens....

  6. Cloning of a catabolite repression control (crc) gene from Pseudomonas aeruginosa, expression of the gene in Escherichia coli, and identification of the gene product in Pseudomonas aeruginosa.

    OpenAIRE

    MacGregor, C H; Wolff, J A; Arora, S K; Phibbs, P V

    1991-01-01

    Mutants which are defective in catabolite repression control (CRC) of multiple independently regulated catabolic pathways have been previously described. The mutations were mapped at 11 min on the Pseudomonas aeruginosa chromosome and designated crc. This report describes the cloning of a gene which restores normal CRC to these Crc- mutants in trans. The gene expressing this CRC activity was subcloned on a 2-kb piece of DNA. When this 2-kb fragment was placed in a plasmid behind a phage T7 pr...

  7. Experimental Model to Study the Role of Retinoblastoma Gene Product (pRb) for Determination of Adipocyte Differentiation.

    Science.gov (United States)

    Popov, B V; Shilo, P S; Zhidkova, O V; Zaichik, A M; Petrov, N S

    2015-06-01

    Using stable constitutive expression of retinoblastoma gene product (pRb) in polypotent mesenchymal 10T1/2 cells we obtained stable cell lines hyperexpressing functionally active or inactive mutant pRb. The cells producing active exogenous pRb demonstrated high sensitivity to adipocyte differentiation inductors, whereas production of inactive form of the exogenous protein suppressed adipocyte differentiation. The obtained lines can serve as the experimental model for studying the role of pRb in determination of adipocyte differentiation.

  8. A Transposable Partitioning Locus Used To Stabilize Plasmid-Borne Hydrogen Oxidation and Trifolitoxin Production Genes in a Sinorhizobium Strain

    OpenAIRE

    Kent, Angela D.; Wojtasiak, Michelle L.; Robleto, Eduardo A.; Eric W Triplett

    1998-01-01

    Improved nitrogen-fixing inoculum strains for leguminous crops must be able to effectively compete with indigenous strains for nodulation, enhance legume productivity compared to the productivity obtained with indigenous strains, and maintain stable expression of any added genes in the absence of selection pressure. We constructed a transposable element containing the tfx region for expression of increased nodulation competitiveness and the par locus for plasmid stability. The transposon was ...

  9. Study of gene expression and OTA production by Penicillium nordicum during a small-scale seasoning process of salami.

    Science.gov (United States)

    Ferrara, Massimo; Magistà, Donato; Epifani, Filomena; Cervellieri, Salvatore; Lippolis, Vincenzo; Gallo, Antonia; Perrone, Giancarlo; Susca, Antonia

    2016-06-16

    Penicillium nordicum, an important and consistent producer of ochratoxin A (OTA), is a widely distributed contaminant of protein rich food with elevated NaCl. It is usually found on dry-cured meat products and is considered the main species responsible for their contamination by OTA. The aim of this work was to study the gene expression of a polyketide synthase (otapksPN) involved in P. nordicum OTA biosynthesis, and OTA production during a small-scale seasoning process. Fresh pork sausages were surface inoculated with P. nordicum and seasoned for 30days. Gene expression and OTA production were monitored throughout the seasoning process after 4, 5, 6, 7, 10, 14, and 30days. The expression of otapksPN gene was already detected after 4days and increased significantly after 7days of seasoning, reaching the maximum expression level after 10days (1.69×10(4)copies/100mg). Consistently with gene expression monitoring, OTA was detected from the 4th day and its content increased significantly from the 7th day, reaching the maximum level after 10days. In the late stages of the seasoning process, OTA did not increase further and the number of gene copies was progressively reduced after 14 and 30days.

  10. Wounding tomato fruit elicits ripening-stage specific changes in gene expression and production of volatile compounds.

    Science.gov (United States)

    Baldassarre, Valentina; Cabassi, Giovanni; Spadafora, Natasha D; Aprile, Alessio; Müller, Carsten T; Rogers, Hilary J; Ferrante, Antonio

    2015-03-01

    Fleshy fruits develop from an unripe organ that needs to be protected from damage to a ripe organ that attracts frugivores for seed dispersal through production of volatile organic compounds (VOCs). Thus, different responses to wounding damage are predicted. The aim of this study was to discover whether wound-induced changes in the transcriptome and VOC production alter as tomato transitions from unripe to ripe. Transcript changes were analysed 3h post-wounding using microarray analysis in two commercial salad-tomato (Solanum lycopersicum L.) cultivars: Luna Rossa and AVG, chosen for their high aroma production. This was followed by quantitative PCR on Luna Rossa genes involved in VOC biosynthesis and defence responses. VOCs elicited by wounding at different ripening stages were analysed by solid phase micro extraction and gas chromatography-mass spectrometry. Approximately 4000 differentially expressed genes were identified in the cultivar AVG and 2500 in Luna Rossa. In both cultivars the majority of genes were up-regulated and the most affected pathways were metabolism of terpenes, carotenoids, and lipids. Defence-related genes were mostly up-regulated in immature stages of development, whereas expression of genes related to VOCs changed at riper stages. More than 40 VOCs were detected and profiles changed with ripening stage. Thus, both transcriptome and VOC profiles elicited by wounding depend on stage of ripening, indicating a shift from defence to attraction.

  11. Dynamic Linkages between Denitrification Functional Genes/Enzymes and Biogeochemical Reaction Rates of Nitrate and Its Reduction Products

    Science.gov (United States)

    Li, M.; Shi, L.; Qian, W.; Gao, Y.; Liu, Y.; Liu, C.

    2015-12-01

    Denitrification is a respiratory process in which oxidized nitrogen compounds are used as alternative electron acceptors for energy production when oxygen is limited. Denitrification is an important process that not only accounts for the significant loss of nitrogen fertilizers from soils but also leads to NO, N2O and CO2 emissions, which are important greenhouse gas species. In this study, denitrification was investigated in Columbia River sediments, focusing on the dynamic linkages between functional genes/enzymes and biogeochemical reaction rates of nitrate and its reduction products. NO3-, NO2- and N2O were assayed in different incubation time. DNA was extracted from the sediments and functional genes were quantified as a function of time during the denitrification. Functional enzymes were extracted from the sediments and measured using a newly developed, targeted protein method. The biogeochemical, functional gene, and enzyme data were collectively used to establish the dynamic correlation of functional genes/enzymes and biogeochemical reaction rates. The results provide fundamental insights regarding the dynamic regulation of functional genes and enzymes in the processes of denitrification and greenhouse gas production, and also provide experimental data critical for the development of biogeochemical reaction models that incorporate genome-scale insights and describe macroscopic biogeochemical reaction rates in ecosystems.

  12. Increased Production of Fatty Acids and Triglycerides in Aspergillus oryzae by Enhancing Expressions of Fatty Acid Synthesis-Related Genes

    Energy Technology Data Exchange (ETDEWEB)

    Tamano, Koichi; Bruno, Kenneth S.; Karagiosis, Sue A.; Culley, David E.; Deng, Shuang; Collett, James R.; Umemura, Myco; Koike, Hideaki; Baker, Scott E.; Machida, Masa

    2013-01-01

    Microbial production of fats and oils is being developedas a means of converting biomass to biofuels. Here we investigate enhancing expression of enzymes involved in the production of fatty acids and triglycerides as a means to increase production of these compounds in Aspergillusoryzae. Examination of the A.oryzaegenome demonstrates that it contains twofatty acid synthases and several other genes that are predicted to be part of this biosynthetic pathway. We enhancedthe expressionof fatty acid synthesis-related genes by replacing their promoters with thepromoter fromthe constitutively highly expressedgene tef1. We demonstrate that by simply increasing the expression of the fatty acid synthasegenes we successfullyincreasedtheproduction of fatty acids and triglyceridesby more than two fold. Enhancement of expression of the fatty acid pathway genes ATP-citrate lyase and palmitoyl-ACP thioesteraseincreasedproductivity to a lesser extent.Increasing expression ofacetyl-CoA carboxylase caused no detectable change in fatty acid levels. Increases in message level for each gene were monitored usingquantitative real-time RT-PCR. Our data demonstrates that a simple increase in the abundance of fatty acid synthase genes can increase the detectable amount of fatty acids.

  13. Model-guided metabolic gene knockout of gnd for enhanced succinate production in Escherichia coli from glucose and glycerol substrates.

    Science.gov (United States)

    Mienda, Bashir Sajo; Shamsir, Mohd Shahir; Illias, Rosli Md

    2016-04-01

    The metabolic role of 6-phosphogluconate dehydrogenase (gnd) under anaerobic conditions with respect to succinate production in Escherichia coli remained largely unspecified. Herein we report what are to our knowledge the first metabolic gene knockout of gnd to have increased succinic acid production using both glucose and glycerol substrates in E. coli. Guided by a genome scale metabolic model, we engineered the E. coli host metabolism to enhance anaerobic production of succinic acid by deleting the gnd gene, considering its location in the boundary of oxidative and non-oxidative pentose phosphate pathway. This strategy induced either the activation of malic enzyme, causing up-regulation of phosphoenolpyruvate carboxylase (ppc) and down regulation of phosphoenolpyruvate carboxykinase (ppck) and/or prevents the decarboxylation of 6 phosphogluconate to increase the pool of glyceraldehyde-3-phosphate (GAP) that is required for the formation of phosphoenolpyruvate (PEP). This approach produced a mutant strain BMS2 with succinic acid production titers of 0.35 g l(-1) and 1.40 g l(-1) from glucose and glycerol substrates respectively. This work further clearly elucidates and informs other studies that the gnd gene, is a novel deletion target for increasing succinate production in E. coli under anaerobic condition using glucose and glycerol carbon sources. The knowledge gained in this study would help in E. coli and other microbial strains development for increasing succinate production and/or other industrial chemicals. PMID:26878126

  14. Ethanol production by recombinant Escherichia coli carrying genes from Zymomonas mobilis.

    Science.gov (United States)

    Lawford, H G; Rousseau, J D

    1991-01-01

    Efficient utilization of lignocellulosic feedstocks offers an opportunity to reduce the cost of producing fuel ethanol. The fermentation performance characteristics of recombinant Escherichia coli ATCC 11303 carrying the "PET plasmid" (pLOI297) with the lac operon controlling the expression of pyruvate decarboxylase (pdc) and alcohol dehydrogenase II (adhB) genes cloned from Zymomonas mobilis CP4 (Alterthum & Ingram, 1989) were assessed in batch and continuous processes with sugar mixtures designed to mimic process streams from lignocellulosic hydrolysis systems. Growth was pseudoexponential at a rate (generation time) of 1.28 h at pH 6.8 and 1.61 h at pH 6.0. The molar growth yields for glucose and xylose were 17.28 and 7.65 g DW cell/mol, respectively (at pH 6.3 and 30 degrees C), suggesting that the net yield of ATP from xylose metabolism is only 50% compared to glucose. In pH-stat batch fermentations (Luria broth with 6% sugar, pH 6.3), glucose was converted to ethanol 4-6 times faster than xylose, but the glucose conversion rate was much less than can be achieved with comparable cell densities of Zymomonas. Sugar-to-ethanol conversion efficiencies in nutrient-rich, complex LB medium were near theoretical at 98 and 88% for glucose and xylose, respectively. The yield was 10-20% less in a defined-mineral-salts medium. Acetate at a concentration of 0.1M (present in lignocellulosic hydrolysates from thermochemical processing) inhibited glucose utilization (about 50%) much more than xylose, and caused a decrease in product yield of about 30% for both sugars. With phosphate-buffered media (pH 7), glucose was a preferred substrate in mixtures with a ratio of hexose to pentose of 2.3 to 1. Xylose was consumed after glucose, and the product yield was less (0.37 g/g). Under steady-state conditions of continuous culture, the specific productivity ranged from 0.76-1.24 g EtOH/g cell/h, and the maximum volumetric productivity, 2.5 g EtOH/L/h, was achieved with a rich

  15. Mapping of a gene that regulates hemolysin production in Vibrio cholerae.

    OpenAIRE

    von Mechow, S; Vaidya, A B; Bramucci, M G

    1985-01-01

    A gene that regulates the hemolysin structural gene (hly) was found to be tightly linked to the tox-1000 locus of Vibrio cholerae RJ1 and separated from hly by a large section of the V. cholerae genetic map. This hemolysin regulatory gene was designated hlyR.

  16. Identification of genes implicated in toxin production in the cyanobacterium Cylindrospermopsis raciborskii

    DEFF Research Database (Denmark)

    Schembri, Mark; Neilan, B.A.; Saint, C.P.

    2001-01-01

    of the strain-specific distribution of the PKS and PS genes in C. raciborskii isolates demonstrated a direct link between the presence of these two genes and the ability to produce cylindrospermopsin. Interestingly, the possession of these two genes was also linked. They were also identified in an Anabaena...

  17. Exploring the Transcriptome Landscape of Pomegranate Fruit Peel for Natural Product Biosynthetic Gene and SSR Marker Discovery

    Institute of Scientific and Technical Information of China (English)

    Nadia Nicole Ono; Monica Therese Britton; Joseph Nathaniel Fass; Charles Meyer Nicolet; Dawei Lin; Li Tian

    2011-01-01

    Pomegranate fruit peel is rich in bioactive plant natural products,such as hydrolyzable tannins and anthocyanins.Despite their documented roles in human nutrition and fruit quality,genes involved in natural product biosynthesis have not been cloned from pomegranate and very little sequence information is available on pomegranate in the public domain.Shotgun transcriptome sequencing of pomegranate fruit peel cDNA was performed using RNA-Seq on the Illumina Genome Analyzer platform.Over 100 million raw sequence reads were obtained and assembled into 9,839 transcriptome assemblies (TAs) (>200 bp).Candidate genes for hydrolyzable tannin,anthocyanin,flavonoid,terpenoid and fatty acid biosynthesis and/or regulation were identified.Three lipid transfer proteins were obtained that may contribute to the previously reported IgE reactivity of pomegranate fruit extracts.In addition,115 SSR markers were identified from the pomegranate fruit peel transcriptome and primers were designed for 77 SSR markers.The pomegranate fruit peel transcriptome set provides a valuable platform for natural product biosynthetic gene and SSR marker discovery in pomegranate.This work also demonstrates that next-generation transcriptome sequencing is an economical and effective approach for investigating natural product biosynthesis,identifying genes controlling important agronomic traits,and discovering molecular markers in non-model specialty crop species.

  18. High-level production of beta-carotene in Saccharomyces cerevisiae by successive transformation with carotenogenic genes from Xanthophyllomyces dendrorhous

    NARCIS (Netherlands)

    Verwaal, R.; Wang, J.; Meijnen, J.P.; Visser, H.; Sandmann, G.; Berg, van den J.A.; Ooyen, van A.J.J.

    2007-01-01

    To determine whether Saccharomyces cerevisiae can serve as a host for efficient carotenoid and especially ß-carotene production, carotenogenic genes from the carotenoid-producing yeast Xanthophyllomyces dendrorhous were introduced and overexpressed in S. cerevisiae. Because overexpression of these g

  19. Improved polysaccharide production in a submerged culture of Ganoderma lucidum by the heterologous expression of Vitreoscilla hemoglobin gene.

    Science.gov (United States)

    Li, Huan-Jun; Zhang, De-Huai; Yue, Tong-Hui; Jiang, Lu-Xi; Yu, Xuya; Zhao, Peng; Li, Tao; Xu, Jun-Wei

    2016-01-10

    Expression of Vitreoscilla hemoglobin (VHb) gene was used to improve polysaccharide production in Ganoderma lucidum. The VHb gene, vgb, under the control of the constitutive glyceraldehyde-3-phosphate dehydrogenase gene promoter was introduced into G. lucidum. The activity of expressed VHb was confirmed by the observation of VHb specific CO-difference spectrum with a maximal absorption at 419 nm for the transformant. The effects of VHb expression on intracellular polysaccharide (IPS) content, extracellular polysaccharide (EPS) production and transcription levels of three genes encoding the enzymes involved in polysaccharide biosynthesis, including phosphoglucomutase (PGM), uridine diphosphate glucose pyrophosphorylase (UGP), and β-1,3-glucan synthase (GLS), were investigated. The maximum IPS content and EPS production in the vgb-bearing G. lucidum were 26.4 mg/100mg dry weight and 0.83 g/L, respectively, which were higher by 30.5% and 88.2% than those of the wild-type strain. The transcription levels of PGM, UGP and GLS were up-regulated by 1.51-, 1.55- and 3.83-fold, respectively, in the vgb-bearing G. lucidum. This work highlights the potential of VHb to enhance G. lucidum polysaccharide production by large scale fermentation.

  20. Improved polysaccharide production in a submerged culture of Ganoderma lucidum by the heterologous expression of Vitreoscilla hemoglobin gene.

    Science.gov (United States)

    Li, Huan-Jun; Zhang, De-Huai; Yue, Tong-Hui; Jiang, Lu-Xi; Yu, Xuya; Zhao, Peng; Li, Tao; Xu, Jun-Wei

    2016-01-10

    Expression of Vitreoscilla hemoglobin (VHb) gene was used to improve polysaccharide production in Ganoderma lucidum. The VHb gene, vgb, under the control of the constitutive glyceraldehyde-3-phosphate dehydrogenase gene promoter was introduced into G. lucidum. The activity of expressed VHb was confirmed by the observation of VHb specific CO-difference spectrum with a maximal absorption at 419 nm for the transformant. The effects of VHb expression on intracellular polysaccharide (IPS) content, extracellular polysaccharide (EPS) production and transcription levels of three genes encoding the enzymes involved in polysaccharide biosynthesis, including phosphoglucomutase (PGM), uridine diphosphate glucose pyrophosphorylase (UGP), and β-1,3-glucan synthase (GLS), were investigated. The maximum IPS content and EPS production in the vgb-bearing G. lucidum were 26.4 mg/100mg dry weight and 0.83 g/L, respectively, which were higher by 30.5% and 88.2% than those of the wild-type strain. The transcription levels of PGM, UGP and GLS were up-regulated by 1.51-, 1.55- and 3.83-fold, respectively, in the vgb-bearing G. lucidum. This work highlights the potential of VHb to enhance G. lucidum polysaccharide production by large scale fermentation. PMID:26603122

  1. Gene Sequence Based Clustering Assists in Dereplication of Pseudoalteromonas luteoviolacea Strains with Identical Inhibitory Activity and Antibiotic Production

    DEFF Research Database (Denmark)

    Vynne, Nikolaj Grønnegaard; Månsson, Maria; Gram, Lone

    2012-01-01

    Some microbial species are chemically homogenous, and the same secondary metabolites are found in all strains. In contrast, we previously found that five strains of P. luteoviolacea were closely related by 16S rRNA gene sequence but produced two different antibiotic profiles. The purpose...... antibacterial profiles based on inhibition assays against Vibrio anguillarum and Staphylococcus aureus. To determine whether chemotype and inhibition profile are reflected by phylogenetic clustering we sequenced 16S rRNA, gyrB and recA genes. Clustering based on 16S rRNA gene sequences alone showed little...... correlation to chemotypes and inhibition profiles, while clustering based on concatenated 16S rRNA, gyrB, and recA gene sequences resulted in three clusters, two of which uniformly consisted of strains of identical chemotype and inhibition profile. A major time sink in natural products discovery is the effort...

  2. The electron transfer flavoprotein fixABCX gene products from Azospirillum brasilense show a NifA-dependent promoter regulation.

    Science.gov (United States)

    Sperotto, Raul Antonio; Gross, Jeferson; Vedoy, Cleber; Passaglia, Luciane Maria Pereira; Schrank, Irene Silveira

    2004-10-01

    The complete nucleotide sequence of the A. brasilense fixA, fixB, fixC, and fixX genes is reported here. Sequence similarities between the protein sequences deduced from fixABCX genes and many electron transfer flavoproteins (ETFs) have been noted. Comparison of the amino acid sequences of both subunits of ETF with the A. brasilense fixA and fixB gene products exhibits an identity of 30%. The amino acid sequence of the other two genes, fixC and fixX, revealed similarity with the membrane-bound electron transfer flavoprotein ubiquinone oxidoreductase (ETF-QO). Using site-directed mutagenesis, mutations were introduced in the fixA promoter element of the A. brasilense fixABCX operon and chimeric p fixA-lacZ reporter gene fusions were constructed. The activation of the fixA promoter of A. brasilense is dependent upon the presence of the NifA protein being approximately 7 times less active than the A. brasilense nifH promoter. These results indicate that NifA from Klebsiella pneumoniae activates the fix promoter of A. brasilense and provide further evidence in support of the regulatory model of NifA activation in A. brasilense. Although no specific function has been assigned to the fixABCX gene products they are apparently required for symbiotic nitrogen fixation. An electron-transferring capacity in the nitrogen fixation pathway has been suggested for the fix gene products based on sequence homologies to the ETFs and ETF-QO proteins and by the absence of orthologous electron transfer proteins NifJ and NifF in A. brasilense.

  3. Variation in siderophore biosynthetic gene distribution and production across environmental and faecal populations of Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Laura J Searle

    Full Text Available Iron is essential for Escherichia coli growth and survival in the host and the external environment, but its availability is generally low due to the poor solubility of its ferric form in aqueous environments and the presence of iron-withholding proteins in the host. Most E. coli can increase access to iron by excreting siderophores such as enterobactin, which have a very strong affinity for Fe3+. A smaller proportion of isolates can generate up to 3 additional siderophores linked with pathogenesis; aerobactin, salmochelin, and yersiniabactin. However, non-pathogenic E. coli are also able to synthesise these virulence-associated siderophores. This raises questions about their role in the ecology of E. coli, beyond virulence, and whether specific siderophores might be linked with persistence in the external environment. Under the assumption that selection favours phenotypes that confer a fitness advantage, we compared siderophore production and gene distribution in E. coli isolated either from agricultural plants or the faeces of healthy mammals. This population-level comparison has revealed that under iron limiting growth conditions plant-associated isolates produced lower amounts of siderophores than faecal isolates. Additionally, multiplex PCR showed that environmental isolates were less likely to contain loci associated with aerobactin and yersiniabactin synthesis. Although aerobactin was linked with strong siderophore excretion, a significant difference in production was still observed between plant and faecal isolates when the analysis was restricted to strains only able to synthesise enterobactin. This finding suggests that the regulatory response to iron limitation may be an important trait associated with adaptation to the non-host environment. Our findings are consistent with the hypothesis that the ability to produce multiple siderophores facilitates E. coli gut colonisation and plays an important role in E. coli commensalism.

  4. Evaluation of three herbicide resistance genes for use in genetic transformations and for potential crop protection in algae production.

    Science.gov (United States)

    Brueggeman, Andrew J; Bruggeman, Andrew J; Kuehler, Daniel; Weeks, Donald P

    2014-09-01

    Genes conferring resistance to the herbicides glyphosate, oxyfluorfen and norflurazon were developed and tested for use as dominant selectable markers in genetic transformation of Chlamydomonas reinhardtii and as potential tools for the protection of commercial-scale algal production facilities against contamination by organisms sensitive to these broad-spectrum herbicides. A synthetic glyphosate acetyltransferase (GAT) gene, when fitted with a strong Chlamydomonas promoter, conferred a 2.7×-fold increase in tolerance to the EPSPS inhibitor, glyphosate, in transgenic cells compared with progenitor WT cells. A mutant Chlamydomonas protoporphyrinogen oxidase (protox, PPO) gene previously shown to produce an enzyme insensitive to PPO-inhibiting herbicides, when genetically engineered, generated transgenic cells able to tolerate up to 136× higher levels of the PPO inhibitor, oxyfluorfen, than nontransformed cells. Genetic modification of the Chlamydomonas phytoene desaturase (PDS) gene-based gene sequences found in various norflurazon-resistant organisms allowed production of transgenic cells tolerant to 40× higher levels of norflurazon than nontransgenic cells. The high efficiency of all three herbicide resistance genes in producing transgenic cells demonstrated their suitability as dominant selectable markers for genetic transformation of Chlamydomonas and, potentially, other eukaryotic algae. However, the requirement for high concentrations of glyphosate and its associated negative effects on cell growth rates preclude its consideration for use in large-scale production facilities. In contrast, only low doses of norflurazon and oxyfluorfen (~1.5 μm and ~0.1 μm, respectively) are required for inhibition of cell growth, suggesting that these two herbicides may prove effective in large-scale algal production facilities in suppressing growth of organisms sensitive to these herbicides.

  5. Evaluation of three herbicide resistance genes for use in genetic transformations and for potential crop protection in algae production.

    Science.gov (United States)

    Brueggeman, Andrew J; Bruggeman, Andrew J; Kuehler, Daniel; Weeks, Donald P

    2014-09-01

    Genes conferring resistance to the herbicides glyphosate, oxyfluorfen and norflurazon were developed and tested for use as dominant selectable markers in genetic transformation of Chlamydomonas reinhardtii and as potential tools for the protection of commercial-scale algal production facilities against contamination by organisms sensitive to these broad-spectrum herbicides. A synthetic glyphosate acetyltransferase (GAT) gene, when fitted with a strong Chlamydomonas promoter, conferred a 2.7×-fold increase in tolerance to the EPSPS inhibitor, glyphosate, in transgenic cells compared with progenitor WT cells. A mutant Chlamydomonas protoporphyrinogen oxidase (protox, PPO) gene previously shown to produce an enzyme insensitive to PPO-inhibiting herbicides, when genetically engineered, generated transgenic cells able to tolerate up to 136× higher levels of the PPO inhibitor, oxyfluorfen, than nontransformed cells. Genetic modification of the Chlamydomonas phytoene desaturase (PDS) gene-based gene sequences found in various norflurazon-resistant organisms allowed production of transgenic cells tolerant to 40× higher levels of norflurazon than nontransgenic cells. The high efficiency of all three herbicide resistance genes in producing transgenic cells demonstrated their suitability as dominant selectable markers for genetic transformation of Chlamydomonas and, potentially, other eukaryotic algae. However, the requirement for high concentrations of glyphosate and its associated negative effects on cell growth rates preclude its consideration for use in large-scale production facilities. In contrast, only low doses of norflurazon and oxyfluorfen (~1.5 μm and ~0.1 μm, respectively) are required for inhibition of cell growth, suggesting that these two herbicides may prove effective in large-scale algal production facilities in suppressing growth of organisms sensitive to these herbicides. PMID:24796724

  6. Model-driven in Silico glpC Gene Knockout Predicts Increased Succinate Production from Glycerol in Escherichia Coli

    Directory of Open Access Journals (Sweden)

    Bashir Sajo Mienda

    2015-04-01

    Full Text Available Metabolic engineered targeting for increased succinate production in Escherichia coli using glycerol as a low cost carbon source has attracted global attention in recent years. Succinate production in engineered E. coli has progressed significantly using an experimental trial and error approach. The use of a model-guided, targeted metabolic gene knockout prediction for increased succinate production from glycerol under anaerobic conditions in E. coli still remains largely underexplored. In this study, we applied a model-driven, targeted glpC/b2243 in silico metabolic gene knockout using E. coli genome scale model iJO1366 under the OptFlux software platform with the aim of predicting high succinate flux. The results indicated that the mutant model lacking the glpC/b2243 gene will demonstrate increased succinate flux that is 30% higher than its wild-type control model. We can hypothesize that an additional NADH molecule was generated following the deletion of the gene and/or the alternatively preferred GldA-DhaKLM fermentative route for glycerol metabolism in E. coli may have been activated. Although the exact metabolic mechanism involved in increasing the succinate flux still remains obscure; the current study informs other studies that a model-driven, metabolic glpC/b2243 gene knockout could be applicable in filling our knowledge gap using a comprehensive experimental inquiry in the future; leading to a better understanding of the underlying metabolic function of this gene in relation to succinate production in E. coli from glycerol.

  7. Improvement of L-valine production at high temperature in Brevibacterium flavum by overexpressing ilvEBNrC genes.

    Science.gov (United States)

    Hou, Xiaohu; Ge, Xiangyang; Wu, Di; Qian, He; Zhang, Weiguo

    2012-01-01

    Brevibacterium flavum ATCC14067 was engineered for L: -valine production by overexpression of different ilv genes; the ilvEBN(r)C genes from B. flavum NV128 provided the best candidate for L: -valine production. In traditional fermentation, L: -valine production reached 30.08 ± 0.92 g/L at 31°C in 72 h with a low conversion efficiency of 0.129 g/g. To further improve the L: -valine production and conversion efficiency based on the optimum temperatures of L: -valine biosynthesis enzymes (above 35°C) and the thermotolerance of B. flavum, the fermentation temperature was increased to 34, 37, and 40°C. As a result, higher metabolic rate and L: -valine biosynthesis enzymes activity were obtained at high temperature, and the maximum L: -valine production, conversion efficiency, and specific L: -valine production rate reached 38.08 ± 1.32 g/L, 0.241 g/g, and 0.133 g g(-1) h(-1), respectively, at 37°C in 48 h fermentation. The strategy for enhancing L: -valine production by overexpression of key enzymes in thermotolerant strains may provide an alternative approach to enhance branched-chain amino acids production with other strains.

  8. Protein gene product 9.5-immunoreactive nerve fibres and cells in human skin.

    Science.gov (United States)

    Wang, L; Hilliges, M; Jernberg, T; Wiegleb-Edström, D; Johansson, O

    1990-07-01

    Sections of human skin were processed according to the indirect immunofluorescence technique with a rabbit antiserum against human protein gene product 9.5 (PGP 9.5). Immunoreactivity was detected in intraepidermal and dermal nerve fibres and cells. The intraepidermal nerves were varicose or smooth with different diameters, running as single processes or branched, straight or bent, projecting in various directions and terminating in the stratum basale, spinosum or granulosum. The density of the intraepidermal nerves varied between the different skin areas investigated. PGP 9.5-containing axons of the lower dermis were found in large bundles. They separated into smaller axon bundles within the upper dermis, entering this portion of the skin perpendicular to the surface. Then they branched into fibres mainly arranged parallel to the epidermal-dermal junctional zone. However, the fibres en route to the epidermis traversed the upper dermis more or less perpendicularly. Furthermore, immunoreactive dermal nerve fibres were found in the Meissner corpuscles, the arrector pili muscles, hair follicles, around the eccrine and apocrine sweat glands and around certain blood vessels. Such fibres were also observed around most subcutaneous blood vessels, sometimes heavily innervating these structures. Numerous weakly-to-strongly PGP 9.5-immunoreactive cells were found both in the epidermis and in the dermis. PMID:2143435

  9. Deletion of alcohol dehydrogenase 2 gene in Pachysolen tannophilus improves ethanol production from corn stover hydrolysates

    Directory of Open Access Journals (Sweden)

    Sen Yang

    2015-12-01

    Full Text Available Although ethanol derived from lignocellulosic biomass is a promising alternative biofuel, the conversion rate of xylose to ethanol by fermentation is not ideal due to the low efficiency of many common yeasts in utilizing xylose. Pachysolen tannophilus can convert hexose and pentose such as L-arabinose, xylose and glucose in lignocellulosic hydrolysates to ethanol simultaneously. To increase the conversion of corn stover hydrolysates to bioethanol, the effect of alcohol dehydrogenase 2 gene (adh2 deletion in P. tannophilus on bioethanol production from corn stover hydrolysates was investigated. Two adh2 deletants (heterozygote ND and homozygote MC were constructed by using the short flanking homology PCR (SFH-PCR. The ND and MC strains showed lower alcohol dehydrogenase 2 (ADH2 activity than the initial strain P-01. In the fermented pentose and hexose sugars of MC and ND, the ethanol concentrations (g/L reached 15.8 and 18.9 versus14.6 of the initial P-01, while in the corn stover hydrolysate medium, the ethanol concentrations (g/L were 9.1 for MC and 9.8 for ND versus 7.5 for the initial strain P-01. This research provides useful information for improving the conversion efficiency of hexose and pentose to bioethanol by Pachysolen tannophilus.

  10. Production of L-DOPA and dopamine in recombinant bacteria bearing the Vitreoscilla hemoglobin gene.

    Science.gov (United States)

    Kurt, Asli Giray; Aytan, Emel; Ozer, Ufuk; Ates, Burhan; Geckil, Hikmet

    2009-07-01

    Given the well-established beneficial effects of Vitreoscilla hemoglobin (VHb) on heterologous organisms, the potential of this protein for the production of L-DOPA and dopamine in two bacteria, Citrobacter freundii and Erwinia herbicola, was investigated. The constructed recombinants bearing the VHb gene (vgb(+)) had substantially higher levels of cytoplasmic L-DOPA (112 mg/L for C. freundii and 97 mg/L for E. herbicola) than their respective hosts (30.4 and 33.8 mg/L) and the vgb(-) control strains (35.6 and 35.8 mg/L). Further, the vgb(+) recombinants of C. freundii and E. herbicola had 20-fold and about two orders of magnitude higher dopamine levels than their hosts, repectively. The activity of tyrosine phenol-lyase, the enzyme converting L-tyrosine to L-DOPA, was well-correlated to cytoplasmic L-DOPA levels. As cultures aged, higher tyrosine phenol-lyase activity of the vgb(+) strains was more apparent. PMID:19585534

  11. Association of genetic polymorphism in GH gene with milk production traits in Beijing Holstein cows

    Indian Academy of Sciences (India)

    Guo Li Zhou; Hai Guo Jin; Chen Liu; Shan Li; Qi Zhu; Yu Hou Wu

    2005-12-01

    Associations were analysed between polymorphisms of the growth hormone gene (GH-MspI) (localized in intron 3) and milk production traits of Beijing Holstein cows (a total of 543 cows). Polymerase chain reaction (PCR)-restriction fragment length polymorphism (RFLP) method was used for identification of various genotypes. Frequencies of genotypes were 0.77, 0.21 and 0.02 for A/A, A/B and B/B, respectively. The frequency of the allele is 0.875. The results of the least squares means show that in all three lactations, the GH A/A cows yielded more milk ( < 0.01 for lactation I and < 0.05 for lactations II and III), whereas A/B cows showed higher milk fat content than A/A individuals ( < 0.05 for lactations I and II, and < 0.01 for lactation III). The A/A cows yielded more fat than A/B individuals ( < 0.01 only in lactation I). The A/A cows yielded more milk protein than A/B individuals ( < 0.01 for lactations I, II, and III). The A/A cows produced milk of higher protein content than of A/B individuals ( < 0.05 only in lactation II).

  12. Linking gene regulation and the exo-metabolome: A comparative transcriptomics approach to identify genes that impact on the production of volatile aroma compounds in yeast

    Directory of Open Access Journals (Sweden)

    Bauer Florian F

    2008-11-01

    Full Text Available Abstract Background 'Omics' tools provide novel opportunities for system-wide analysis of complex cellular functions. Secondary metabolism is an example of a complex network of biochemical pathways, which, although well mapped from a biochemical point of view, is not well understood with regards to its physiological roles and genetic and biochemical regulation. Many of the metabolites produced by this network such as higher alcohols and esters are significant aroma impact compounds in fermentation products, and different yeast strains are known to produce highly divergent aroma profiles. Here, we investigated whether we can predict the impact of specific genes of known or unknown function on this metabolic network by combining whole transcriptome and partial exo-metabolome analysis. Results For this purpose, the gene expression levels of five different industrial wine yeast strains that produce divergent aroma profiles were established at three different time points of alcoholic fermentation in synthetic wine must. A matrix of gene expression data was generated and integrated with the concentrations of volatile aroma compounds measured at the same time points. This relatively unbiased approach to the study of volatile aroma compounds enabled us to identify candidate genes for aroma profile modification. Five of these genes, namely YMR210W, BAT1, AAD10, AAD14 and ACS1 were selected for overexpression in commercial wine yeast, VIN13. Analysis of the data show a statistically significant correlation between the changes in the exo-metabome of the overexpressing strains and the changes that were predicted based on the unbiased alignment of transcriptomic and exo-metabolomic data. Conclusion The data suggest that a comparative transcriptomics and metabolomics approach can be used to identify the metabolic impacts of the expression of individual genes in complex systems, and the amenability of transcriptomic data to direct applications of

  13. Increased glycopeptide production after overexpression of shikimate pathway genes being part of the balhimycin biosynthetic gene cluster

    DEFF Research Database (Denmark)

    Thykær, Jette; Nielsen, Jens; Wohlleben, W.;

    2010-01-01

    Amycolatopsis balhimycina produces the vancomycin-analogue balhimycin. The strain therefore serves as a model strain for glycopeptide antibiotic production. Previous characterisation of the balhimycin biosynthetic cluster had shown that the border sequences contained both, a putative 3-deoxy-d-ar...

  14. Effects of excretory/secretory products from Anisakis simplex (Nematoda) on immune gene expression in rainbow trout (Oncorhynchus mykiss).

    Science.gov (United States)

    Bahlool, Qusay Z M; Skovgaard, Alf; Kania, Per W; Buchmann, Kurt

    2013-09-01

    Excretory/secretory (ES) products are molecules produced by parasitic nematodes, including larval Anisakis simplex, a parasite occurring in numerous marine fish hosts. The effects of these substances on host physiology have not been fully described. The present work elucidates the influence of ES substances on the fish immune system by measuring immune gene expression in spleen and liver of rainbow trout (Oncorhynchus mykiss) injected intraperitoneally with ES products isolated from A. simplex third stage larvae. The overall gene expression profile of exposed fish showed a generalized down-regulation of the immune genes tested, suggesting a role of ES proteins in immunomodulation. We also tested the enzymatic activity of the ES proteins and found that lipase, esterase/lipase, valine and cysteine arylamidases, naphthol-AS-BI-phosphohydrolase and α-galactosidase activities were present in the ES solution. This type of hydrolytic enzyme activity may play a role in nematode penetration of host tissue. In addition, based on the notion that A. simplex ES products may have an immune-depressive effect (by minimizing immune gene expression) it could also be suggested that worm enzymes directly target host immune molecules which would add to a decreased host immune response and increased worm survival.

  15. Overexpression of the laeA gene leads to increased production of cyclopiazonic acid in Aspergillus fumisynnematus.

    Science.gov (United States)

    Hong, Eun Jin; Kim, Na Kyeong; Lee, Doyup; Kim, Won Gon; Lee, Inhyung

    2015-11-01

    To explore novel bioactive compounds produced via activation of secondary metabolite (SM) gene clusters, we overexpressed an ortholog of laeA, a gene that encodes a global positive regulator of secondary metabolism in Aspergillus fumisynnematus F746. Overexpression of the laeA gene under the alcA promoter resulted in the production of less pigment, shorter conidial head chains, and fewer conidia. Thin-layer chromatography (TLC) and high-performance liquid chromatography (HPLC) analysis revealed that SM production in OE::laeA was significantly increased, and included new metabolites that were not detected in the wild type. Among them, a compound named F1 was selected on the basis of its high production levels and antibacterial effects. F1 was purified by column chromatography and preparative TLC and identified as cyclopiazonic acid (CPA) by LC/MS, which had been previously known as mycotoxin. As A. fumisynnematus was not known to produce CPA, these results suggest that overexpression of the laeA gene can be used to explore the synthesis of useful bioactive compounds, even in a fungus for which the genome sequence is unavailable.

  16. SxtA and sxtG Gene Expression and Toxin Production in the Mediterranean Alexandrium minutum (Dinophyceae

    Directory of Open Access Journals (Sweden)

    Federico Perini

    2014-10-01

    Full Text Available The dinoflagellate Alexandrium minutum is known for the production of potent neurotoxins affecting the health of human seafood consumers via paralytic shellfish poisoning (PSP. The aim of this study was to investigate the relationship between the toxin content and the expression level of the genes involved in paralytic shellfish toxin (PST production. The algal cultures were grown both in standard f/2 medium and in phosphorus/nitrogen limitation. In our study, LC-HRMS analyses of PST profile and content in different Mediterranean A. minutum strains confirmed that this species was able to synthesize mainly the saxitoxin analogues Gonyautoxin-1 (GTX1 and Gonyautoxin-4 (GTX4. The average cellular toxin content varied among different strains, and between growth phases, highlighting a decreasing trend from exponential to stationary phase in all culture conditions tested. The absolute quantities of intracellular sxtA1 and sxtG mRNA were not correlated with the amount of intracellular toxins in the analysed A. minutum suggesting that the production of toxins may be regulated by post-transcriptional mechanisms and/or by the concerted actions of alternative genes belonging to the PST biosynthesis gene cluster. Therefore, it is likely that the sxtA1 and sxtG gene expression could not reflect the PST accumulation in the Mediterranean A. minutum populations under the examined standard and nutrient limiting conditions.

  17. Exploring the role of sigma factor gene expression on production by Corynebacterium glutamicum: sigma factor H and FMN as example

    Directory of Open Access Journals (Sweden)

    Hironori eTaniguchi

    2015-07-01

    Full Text Available Bacteria are known to cope with environmental changes by using alternative sigma factors binding to RNA polymerase core enzyme. Sigma factor is one of the targets to modify transcription regulation in bacteria and to influence production capacities. In this study, the effect of overexpressing each annotated sigma factor gene in C. glutamicum WT was assayed using an IPTG inducible plasmid system and different IPTG concentrations. It was revealed that growth was severely decreased when sigD or sigH were overexpressed with IPTG concentrations higher than 50 μM. Overexpression of sigH led to an obvious phenotypic change, a yellow-colored supernatant. HPLC analysis revealed that riboflavin was excreted to the medium when sigH was overexpressed and DNA microarray analysis confirmed increased expression of riboflavin biosynthesis genes. In addition, genes for enzymes related to the pentose phosphate pathway and for enzymes dependent on FMN, FAD or NADPH as cofactor were upregulated when sigH was overexpressed. To test if sigH overexpression can be exploited for production of riboflavin-derived FMN or FAD, the endogenous gene for bifunctional riboflavin kinase/FMN adenyltransferase was co-expressed with sigH from a plasmid. Balanced expression of sigH and ribF improved accumulation of riboflavin (19.8 ± 0.3 μM and allowed for its conversion to FMN (33.1 ± 1.8 μM in the supernatant. While a proof-of-concept was reached, conversion was not complete and titers were not high. This study revealed that inducible and gradable overexpression of sigma factor genes is an interesting approach to switch gene expression profiles and to discover untapped potential of bacteria for chemical production.

  18. Enhanced production of ε-caprolactone by coexpression of bacterial hemoglobin gene in recombinant Escherichia coli expressing cyclohexanone monooxygenase gene.

    Science.gov (United States)

    Lee, Won-Heong; Park, Eun-Hee; Kim, Myoung-Dong

    2014-12-28

    Baeyer-Villiger (BV) oxidation of cyclohexanone to epsilon-caprolactone in a microbial system expressing cyclohexanone monooxygenase (CHMO) can be influenced by not only the efficient regeneration of NADPH but also a sufficient supply of oxygen. In this study, the bacterial hemoglobin gene from Vitreoscilla stercoraria (vhb) was introduced into the recombinant Escherichia coli expressing CHMO to investigate the effects of an oxygen-carrying protein on microbial BV oxidation of cyclohexanone. Coexpression of Vhb allowed the recombinant E. coli strain to produce a maximum epsilon-caprolactone concentration of 15.7 g/l in a fed-batch BV oxidation of cyclohexanone, which corresponded to a 43% improvement compared with the control strain expressing CHMO only under the same conditions.

  19. Myostatin gene (MSTN) polymorphism with a negative effect on meat productivity in Dzhalginsky Merino sheep breed

    OpenAIRE

    VLADIMIR TRUKHACHEV; VALERY BELYAEV; ANDREY KVOCHKO; ALEXANDER KULICHENKO; DMITRY KOVALEV; SERGEY PISARENKO; ANNA VOLYNKINA; MARINA SELIONOVA; MAGOMET AYBAZOV; SVETLANA SHUMAENKO; ARSLAN OMAROV; TATYANA MAMONTOVA; NATALIA GOLOVANOVA; OLESYA YATSYK; ALEXANDER KRIVORUCHKO

    2015-01-01

    One of the most important negative regulator of muscle grow in mammalians is myostatin. Some mutations in myostatin gene (MSTN) can decrease the effect of protein and play role in meat quality of sheep. Therefore, in genome selection, knowledge of MSTN gene structure is very important. We investigated the polymorphism of the MSTN gene and its influence on body parameters in Russian sheep breed Dzhalginsky Merino. To detect alleles, we use NimbleGen sequencing technolog). In this breed, we fou...

  20. Characterization of foot-and-mouth disease virus gene products with antisera against bacterially synthesized fusion proteins.

    OpenAIRE

    Strebel, K; De Beck, E.; K Strohmaier; Schaller, H

    1986-01-01

    Defined segments of the cloned foot-and-mouth disease virus genome corresponding to all parts of the coding region were expressed in Escherichia coli as fusions to the N-terminal part of the MS2-polymerase gene under the control of the inducible lambda PL promoter. All constructs yielded large amounts of proteins, which were purified and used to raise sequence-specific antisera in rabbits. These antisera were used to identify the corresponding viral gene products in 35S-labeled extracts from ...

  1. Short communication: Presence of neutral metallopeptidase (npr) gene and proteolytic activity of Bacillus cereus isolated from dairy products.

    Science.gov (United States)

    Montanhini, M T M; Colombo, M; Nero, L A; Bersot, L S

    2013-09-01

    The control of proteolytic microorganisms is one of the main challenges of the dairy industry, due to their spoilage activity that jeopardizes the quality of their products. Seventy-four Bacillus cereus strains isolated from powdered, UHT, and pasteurized milks were tested for the presence of the neutral metallopeptidase (npr) gene and proteolytic activity at 7, 10, 25, 30, and 37°C. All strains had the npr gene, and proteolytic activity increased with the incubation temperature. The obtained results highlight the relevance of B. cereus as a spoiling agent in the dairy industry in terms of its genetic predisposition for proteolytic capacity, especially at room temperature. PMID:23849645

  2. Distribution of Salmonella paratyphi A outer membrane protein X gene and immune-protective effect related to its recombinant expressed products

    Institute of Scientific and Technical Information of China (English)

    李明雷

    2014-01-01

    Objective To determine the distribution and sequence conservation of outer membrane protein X(ompX)gene in Salmonella paratyphi A isolates as well as the immunogenicity and immono-protection of ompX gene products.Methods OmpX gene in Salmonella paratyphi A isolates was detected by PCR and the amplification products were sequenced after the T-A cloning process.OmpX gene product was expressed with E.coli expression system and the expressed rOmpX was extracted by Ni-NTA affinity

  3. TranscriptomeBrowser: a powerful and flexible toolbox to explore productively the transcriptional landscape of the Gene Expression Omnibus database.

    Directory of Open Access Journals (Sweden)

    Fabrice Lopez

    Full Text Available BACKGROUND: As public microarray repositories are constantly growing, we are facing the challenge of designing strategies to provide productive access to the available data. METHODOLOGY: We used a modified version of the Markov clustering algorithm to systematically extract clusters of co-regulated genes from hundreds of microarray datasets stored in the Gene Expression Omnibus database (n = 1,484. This approach led to the definition of 18,250 transcriptional signatures (TS that were tested for functional enrichment using the DAVID knowledgebase. Over-representation of functional terms was found in a large proportion of these TS (84%. We developed a JAVA application, TBrowser that comes with an open plug-in architecture and whose interface implements a highly sophisticated search engine supporting several Boolean operators (http://tagc.univ-mrs.fr/tbrowser/. User can search and analyze TS containing a list of identifiers (gene symbols or AffyIDs or associated with a set of functional terms. CONCLUSIONS/SIGNIFICANCE: As proof of principle, TBrowser was used to define breast cancer cell specific genes and to detect chromosomal abnormalities in tumors. Finally, taking advantage of our large collection of transcriptional signatures, we constructed a comprehensive map that summarizes gene-gene co-regulations observed through all the experiments performed on HGU133A Affymetrix platform. We provide evidences that this map can extend our knowledge of cellular signaling pathways.

  4. Reference genes selection and relative expression analysis from Shiraia sp. SUPER-H168 productive of hypocrellin.

    Science.gov (United States)

    Deng, Huaxiang; Gao, Ruijie; Liao, Xiangru; Cai, Yujie

    2016-04-10

    Shiraia bambusicola is an essential pharmaceutical fungus due to its production of hypocrellin with antiviral, antidepressant, and antiretroviral properties. Based on suitable reference gene (RG) normalization, gene expression analysis enables the exploitation of significant genes relative to hypocrellin biosynthesis by quantitative real-time polymerase chain reaction. We selected and assessed nine candidate RGs in the presence and absence of hypocrellin biosynthesis using GeNorm and NormFinder algorithms. After stepwise exclusion of unstable genes, GeNorm analysis identified glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and cytochrome oxidase (CyO) as the most stable expression, while NormFinder determined 18S ribosomal RNA (18S rRNA) as the most appropriate candidate gene for normalization. Tubulin (Tub) was observed to be the least stable gene and should be avoided for relative expression analysis. We further analyzed relative expression levels of essential proteins correlative with hypocrellin biosynthesis, including polyketide synthase (PKS), O-methyltransferase (Omef), FAD/FMN-dependent oxidoreductase (FAD), and monooxygenase (Mono). Compared to PKS, Mono kept a similar expression pattern and simulated PKS expression, while FAD remained constantly expressed. Omef presented lower transcript levels and had no relation to PKS expression. These relative expression analyses will pave the way for further interpretation of the hypocrellin biosynthesis pathway.

  5. Modulation of steroidogenic gene expression and hormone production of H295R cells by pharmaceuticals and other environmentally active compounds

    International Nuclear Information System (INIS)

    The H295R cell bioassay was used to evaluate the potential endocrine disrupting effects of 18 of the most commonly used pharmaceuticals in the United States. Exposures for 48 h with single pharmaceuticals and binary mixtures were conducted; the expression of five steroidogenic genes, 3βHSD2, CYP11β1, CYP11β2, CYP17 and CYP19, was quantified by Q-RT-PCR. Production of the steroid hormones estradiol (E2), testosterone (T) and progesterone (P) was also evaluated. Antibiotics were shown to modulate gene expression and hormone production. Amoxicillin up-regulated the expression of CYP11β2 and CYP19 by more than 2-fold and induced estradiol production up to almost 3-fold. Erythromycin significantly increased CYP11β2 expression and the production of P and E2 by 3.5- and 2.4-fold, respectively, while production of T was significantly decreased. The β-blocker salbutamol caused the greatest induction of CYP17, more than 13-fold, and significantly decreased E2 production. The binary mixture of cyproterone and salbutamol significantly down-regulated expression of CYP19, while a mixture of ethynylestradiol and trenbolone, increased E2 production 3.7-fold. Estradiol production was significantly affected by changes in concentrations of trenbolone, cyproterone, and ethynylestradiol. Exposures with individual pharmaceuticals showed the possible secondary effects that drugs may exert on steroid production. Results from binary mixture exposures suggested the possible type of interactions that may occur between drugs and the joint effects product of such interactions. Dose-response results indicated that although two chemicals may share a common mechanism of action the concentration effects observed may be significantly different

  6. Thermophile-specific proteins: the gene product of aq_1292 from Aquifex aeolicus is an NTPase

    Directory of Open Access Journals (Sweden)

    Howe Rebecca

    2003-09-01

    Full Text Available Abstract Background To identify thermophile-specific proteins, we performed phylogenetic patterns searches of 66 completely sequenced microbial genomes. This analysis revealed a cluster of orthologous groups (COG1618 which contains a protein from every thermophile and no sequence from 52 out of 53 mesophilic genomes. Thus, COG1618 proteins belong to the group of thermophile-specific proteins (THEPs and therefore we here designate COG1618 proteins as THEP1s. Since no THEP1 had been analyzed biochemically thus far, we characterized the gene product of aq_1292 which is THEP1 from the hyperthermophilic bacterium Aquifex aeolicus (aaTHEP1. Results aaTHEP1 was cloned in E. coli, expressed and purified to homogeneity. At a temperature optimum between 70 and 80°C, aaTHEP1 shows enzymatic activity in hydrolyzing ATP to ADP + Pi with kcat = 5 × 10-3 s-1 and Km = 5.5 × 10-6 M. In addition, the enzyme exhibits GTPase activity (kcat = 9 × 10-3 s-1 and Km= 45 × 10-6 M. aaTHEP1 is inhibited competitively by CTP, UTP, dATP, dGTP, dCTP, and dTTP. As shown by gel filtration, aaTHEP1 in its purified state appears as a monomer. The enzyme is resistant to limited proteolysis suggesting that it consists of a single domain. Although THEP1s are annotated as "predicted nucleotide kinases" we could not confirm such an activity experimentally. Conclusion Since aaTHEP1 is the first member of COG1618 that is characterized biochemically and functional information about one member of a COG may be transferred to the entire COG, we conclude that COG1618 proteins are a family of thermophilic NTPases.

  7. Neuronal and glial expression of the multidrug resistance gene product in an experimental epilepsy model.

    Science.gov (United States)

    Lazarowski, Alberto; Ramos, Alberto Javier; García-Rivello, Hernán; Brusco, Alicia; Girardi, Elena

    2004-02-01

    1. Failure of anticonvulsive drugs to prevent seizures is a common complication of epilepsy treatment known as drug-refractory epilepsy but their causes are not well understood. It is hypothesized that the multidrug resistance P-glycoprotein (Pgp-170), the product of the MDR-1 gene that is normally expressed in several excretory tissues including the blood brain barrier, may be participating in the refractory epilepsy. 2. Using two monoclonal antibodies against Pgp-170, we investigated the expression and cellular distribution of this protein in the rat brain during experimentally induced epilepsy. Repeated seizures were induced in male Wistar rats by daily administration of 3-mercaptopropionic acid (MP) 45 mg/kg i.p. for either 4 days (MP-4) or 7 days (MP-7). Control rats received an equivalent volume of vehicle. One day after the last injection, rats were sacrificed and brains were processed for immunohistochemistry for Pgp-170. As it was previously described, Pgp-170 immunostaining was observed in some brain capillary endothelial cells of animals from control group. 3. Increased Pgp-170 immunoreactivity was detected in MP-treated animals. Besides the Pgp-170 expressed in blood vessels, neuronal, and glial immunostaining was detected in hippocampus, striatum, and cerebral cortex of MP-treated rats. Pgp-170 immunolabeled neurons and glial cells were observed in a nonhomogeneous distribution. MP-4 animals presented a very prominent Pgp-170 immunostaining in the capillary endothelium, surrounding astrocytes and some neighboring neurons while MP-7 group showed increased neuronal labeling. 4. Our results demonstrate a selective increase in Pgp-170 immunoreactivity in the brain capillary endothelial cells, astrocytes, and neurons during repetitive MP-induced seizures. 5. The role for this Pgp-170 overexpression in endothelium and astrocytes as a clearance mechanism in the refractory epilepsy, and the consequences of neuronal Pgp-170 expression remain to be disclosed.

  8. Identification of Genetic Associations and Functional Polymorphisms of SAA1 Gene Affecting Milk Production Traits in Dairy Cattle.

    Science.gov (United States)

    Yang, Shaohua; Gao, Yahui; Zhang, Shengli; Zhang, Qin; Sun, Dongxiao

    2016-01-01

    Our initial RNA sequencing (RNA-seq) revealed that the Serum amyloid A1 (SAA1) gene was differentially expressed in the mammary glands of lactating Holstein cows with extremely high versus low phenotypic values of milk protein and fat percentage. To further validate the genetic effect and potential molecular mechanisms of SAA1 gene involved in regulating milk production traits in dairy cattle, we herein performed a study through genotype-phenotype associations. Six identified SNPs were significantly associated with one or more milk production traits (0.00002milk production traits in dairy cows. Subsequently, both luciferase assay and electrophoretic mobility shift assay (EMSA) clearly demonstrated that the allele A of g.-963C>A increased the promoter activity by binding the PARP factor while allele C did not. Bioinformatics analysis indicated that the secondary structure of SAA protein changed by the substitution A/G in the locus c. +2510A>G. Our findings were the first to reveal the significant associations of the SAA1 gene with milk production traits, providing basis for further biological function validation, and two identified SNPs, g.-963C>A and c. +2510A>G, may be considered as genetic markers for breeding in dairy cattle. PMID:27610623

  9. Identification of Genetic Associations and Functional Polymorphisms of SAA1 Gene Affecting Milk Production Traits in Dairy Cattle

    Science.gov (United States)

    Zhang, Shengli; Zhang, Qin; Sun, Dongxiao

    2016-01-01

    Our initial RNA sequencing (RNA-seq) revealed that the Serum amyloid A1 (SAA1) gene was differentially expressed in the mammary glands of lactating Holstein cows with extremely high versus low phenotypic values of milk protein and fat percentage. To further validate the genetic effect and potential molecular mechanisms of SAA1 gene involved in regulating milk production traits in dairy cattle, we herein performed a study through genotype-phenotype associations. Six identified SNPs were significantly associated with one or more milk production traits (0.00002milk production traits in dairy cows. Subsequently, both luciferase assay and electrophoretic mobility shift assay (EMSA) clearly demonstrated that the allele A of g.-963C>A increased the promoter activity by binding the PARP factor while allele C did not. Bioinformatics analysis indicated that the secondary structure of SAA protein changed by the substitution A/G in the locus c. +2510A>G. Our findings were the first to reveal the significant associations of the SAA1 gene with milk production traits, providing basis for further biological function validation, and two identified SNPs, g.-963C>A and c. +2510A>G, may be considered as genetic markers for breeding in dairy cattle. PMID:27610623

  10. Production of Truncated Candida antarctica Lipase B Gene Using Automated PCR Gene Assembly Protocol and Expression in Yeast for use in Ethanol and Biodiesel Production.

    Science.gov (United States)

    An improved column-based process for production of biodiesel was developed using a column containing a strongly basic anion-exchange resin in sequence with a column containing a resin to which a lipase biocatalyst is bound. Currently most biodiesel is produced by transesterification of triglyceride...

  11. The genetic effects of the dopamine D1 receptor gene on chicken egg production and broodiness traits

    Directory of Open Access Journals (Sweden)

    Zeng Hua

    2010-03-01

    Full Text Available Abstract Background The elevation of egg production and the inhibition of incubation behavior are the aims of modern poultry production. Prolactin (PRL gene is confirmed to be critical for the onset and maintenance of these reproductive behaviors in birds. Through PRL, dopamine D1 receptor (DRD1 was also involved in the regulation of chicken reproductive behavior. However, the genetic effects of this gene on chicken egg production and broodiness have not been studied extensively. The objective of this research was to evaluate the genetic effects of the DRD1 gene on chicken egg production and broodiness traits. Results In this study, the chicken DRD1 gene was screened for the polymorphisms by cloning and sequencing and 29 variations were identified in 3,342 bp length of this gene. Seven single nucleotide polymorphism (SNPs among these variations, including a non-synonymous mutation (A+505G, Ser169Gly, were located in the coding region and were chosen to analyze their association with chicken egg production and broodiness traits in 644 Ningdu Sanhuang individuals. Two SNPs, G+123A and C+1107T, were significantly associated with chicken broody frequency (P DRD1 mRNA was observed and the expression difference was compared between broodiness and non-broodiness chickens. The DRD1 mRNA was predominantly expressed in subcutaneous fat and abdominal fat of non-broodiness chicken, and then in heart, kidney, oviduct, glandular stomach, hypothalamus, and pituitary. In subcutaneous fat and abdominal fat, the level of non-broodiness was 26 to 28 times higher than that of broodiness. In pituitary, it was 5-fold higher. In heart, oviduct, and kidney, a 2-3 times decrease from non-broodiness to broodiness was displayed. In glandular stomach and hypothalamus, the level seen in non-broodiness and broodiness was almost the same. Conclusion The polymorphisms of the DRD1 gene and their haplotypes were associated with chicken broody frequency and some egg production

  12. Cloning of the Thermomonospora fusca Endoglucanase E2 gene in Streptomyces lividans: Affinity purification and functional domains of the cloned gene product

    Energy Technology Data Exchange (ETDEWEB)

    Ghangas, G.S.; Wilson, D.B. (Cornell Univ., Ithaca, NY (USA))

    1988-10-01

    Thermomonospora fusca YX grown in the presence of cellulose produces a number of {beta}-1-4-endoglucanases, some of which bind to microcrystalline cellulose. By using a multicopy plasmid, pIJ702, a gene coding for one of these enzymes (E2) was cloned into Streptomyces lividans and then mobilized into both Escherichia coli and Streptomyces albus. The gene was localized to a 1.6-kilobase PvuII-ClaI segment of the originally cloned 3.0-kilobase SstI fragment of Thermomonospora DNA. The culture supernatants of Streptomyces transformants contain a major endoglucanase that cross-reacts with antibody against Thermomonospora cellulase E2 and has the same molecular weight (43,000) as T. fusca E2. This protein binds quickly and tightly to Avicel. It also binds to filter paper but at a slower rate than to Avicel. Several large proteolytic degradation products of this enzyme generated in vivo lose the ability to bind to Avicel and have higher activity on carboxymethyl cellulose than the native enzyme. Other smaller products bind to Avicel but lack activity. A weak cellobiose-binding site not observed in the native enzyme was present in one of the degradation products. In E. coli, the cloned gene produced a cellulase that also binds tightly to Avicel but appeared to be slightly larger than T. fusca E2. The activity of intact E2 from all organisms can be inactivated by Hg{sup 2+} ions. Dithiothreitol protected against Hg{sup 2+} inactivation and reactivated both unbound and Avicel-bound Hg{sub 2+}-inhibited E2, but at different rates.

  13. De novo assembly, gene annotation, and marker discovery in stored-product pest Liposcelis entomophila (Enderlein using transcriptome sequences.

    Directory of Open Access Journals (Sweden)

    Dan-Dan Wei

    Full Text Available BACKGROUND: As a major stored-product pest insect, Liposcelis entomophila has developed high levels of resistance to various insecticides in grain storage systems. However, the molecular mechanisms underlying resistance and environmental stress have not been characterized. To date, there is a lack of genomic information for this species. Therefore, studies aimed at profiling the L. entomophila transcriptome would provide a better understanding of the biological functions at the molecular levels. METHODOLOGY/PRINCIPAL FINDINGS: We applied Illumina sequencing technology to sequence the transcriptome of L. entomophila. A total of 54,406,328 clean reads were obtained and that de novo assembled into 54,220 unigenes, with an average length of 571 bp. Through a similarity search, 33,404 (61.61% unigenes were matched to known proteins in the NCBI non-redundant (Nr protein database. These unigenes were further functionally annotated with gene ontology (GO, cluster of orthologous groups of proteins (COG, and Kyoto Encyclopedia of Genes and Genomes (KEGG databases. A large number of genes potentially involved in insecticide resistance were manually curated, including 68 putative cytochrome P450 genes, 37 putative glutathione S-transferase (GST genes, 19 putative carboxyl/cholinesterase (CCE genes, and other 126 transcripts to contain target site sequences or encoding detoxification genes representing eight types of resistance enzymes. Furthermore, to gain insight into the molecular basis of the L. entomophila toward thermal stresses, 25 heat shock protein (Hsp genes were identified. In addition, 1,100 SSRs and 57,757 SNPs were detected and 231 pairs of SSR primes were designed for investigating the genetic diversity in future. CONCLUSIONS/SIGNIFICANCE: We developed a comprehensive transcriptomic database for L. entomophila. These sequences and putative molecular markers would further promote our understanding of the molecular mechanisms underlying

  14. Environmental effects on resistance gene expression in milk stage popcorn kernels and associations with mycotoxin production.

    Science.gov (United States)

    Dowd, Patrick F; Johnson, Eric T

    2015-05-01

    Like other forms of maize, popcorn is subject to increased levels of contamination by a variety of different mycotoxins under stress conditions, although levels generally are less than dent maize under comparable stress. Gene array analysis was used to determine expression differences of disease resistance-associated genes in milk stage kernels from commercial popcorn fields over 3 years. Relatively lower expression of resistance gene types was noted in years with higher temperatures and lower rainfall, which was consistent with prior results for many previously identified resistance response-associated genes. The lower rates of expression occurred for genes such as chitinases, protease inhibitors, and peroxidases; enzymes involved in the synthesis of cell wall barriers and secondary metabolites; and regulatory proteins. However, expression of several specific resistance genes previously associated with mycotoxins, such as aflatoxin in dent maize, was not affected. Insect damage altered the spectrum of resistance gene expression differences compared to undamaged ears. Correlation analyses showed expression differences of some previously reported resistance genes that were highly associated with mycotoxin levels and included glucanases, protease inhibitors, peroxidases, and thionins. PMID:25512225

  15. Efficient production of multi-modified pigs for xenotransplantation by ‘combineering’, gene stacking and gene editing

    Science.gov (United States)

    Fischer, Konrad; Kraner-Scheiber, Simone; Petersen, Björn; Rieblinger, Beate; Buermann, Anna; Flisikowska, Tatiana; Flisikowski, Krzysztof; Christan, Susanne; Edlinger, Marlene; Baars, Wiebke; Kurome, Mayuko; Zakhartchenko, Valeri; Kessler, Barbara; Plotzki, Elena; Szczerbal, Izabela; Switonski, Marek; Denner, Joachim; Wolf, Eckhard; Schwinzer, Reinhard; Niemann, Heiner; Kind, Alexander; Schnieke, Angelika

    2016-01-01

    Xenotransplantation from pigs could alleviate the shortage of human tissues and organs for transplantation. Means have been identified to overcome hyperacute rejection and acute vascular rejection mechanisms mounted by the recipient. The challenge is to combine multiple genetic modifications to enable normal animal breeding and meet the demand for transplants. We used two methods to colocate xenoprotective transgenes at one locus, sequential targeted transgene placement - ‘gene stacking’, and cointegration of multiple engineered large vectors - ‘combineering’, to generate pigs carrying modifications considered necessary to inhibit short to mid-term xenograft rejection. Pigs were generated by serial nuclear transfer and analysed at intermediate stages. Human complement inhibitors CD46, CD55 and CD59 were abundantly expressed in all tissues examined, human HO1 and human A20 were widely expressed. ZFN or CRISPR/Cas9 mediated homozygous GGTA1 and CMAH knockout abolished α-Gal and Neu5Gc epitopes. Cells from multi-transgenic piglets showed complete protection against human complement-mediated lysis, even before GGTA1 knockout. Blockade of endothelial activation reduced TNFα-induced E-selectin expression, IFNγ-induced MHC class-II upregulation and TNFα/cycloheximide caspase induction. Microbial analysis found no PERV-C, PCMV or 13 other infectious agents. These animals are a major advance towards clinical porcine xenotransplantation and demonstrate that livestock engineering has come of age. PMID:27353424

  16. The Role of PPAR Ligands in Controlling Growth-Related Gene Expression and their Interaction with Lipoperoxidation Products

    Directory of Open Access Journals (Sweden)

    Giuseppina Barrera

    2008-01-01

    Full Text Available Peroxisome proliferators-activated receptors (PPARs are ligand-activated transcription factors that belong to the nuclear hormone receptor superfamily. The three PPAR isoforms (, and / have been found to play a pleiotropic role in cell fat metabolism. Furthermore, in recent years, evidence has been found regarding the antiproliferative, proapoptotic, and differentiation-promoting activities displayed by PPAR ligands, particularly by PPAR ligands. PPAR ligands affect the expression of different growth-related genes through both PPAR-dependent and PPAR-independent mechanisms. Moreover, an interaction between PPAR ligands and other molecules which strengthen the effects of PPAR ligands has been described. Here we review the action of PPAR on the control of gene expression with particular regard to the effect of PPAR ligands on the expression of genes involved in the regulation of cell-cycle, differentiation, and apoptosis. Moreover, the interaction between PPAR ligands and 4-hydroxynonenal (HNE, the major product of the lipid peroxidation, has been reviewed.

  17. Production of DNA microarray and expression analysis of genes from Xylella fastidiosa in different culture media

    Directory of Open Access Journals (Sweden)

    Regiane de Fátima Travensolo

    2009-06-01

    Full Text Available DNA Microarray was developed to monitor the expression of many genes from Xylella fastidiosa, allowing the side by-side comparison of two situations in a single experiment. The experiments were performed using X. fastidiosa cells grown in two culture media: BCYE and XDM2. The primers were synthesized, spotted onto glass slides and the array was hybridized against fluorescently labeled cDNAs. The emitted signals were quantified, normalized and the data were statistically analyzed to verify the differentially expressed genes. According to the data, 104 genes were differentially expressed in XDM2 and 30 genes in BCYE media. The present study showed that DNA microarray technique efficiently differentiate the expressed genes under different conditions.DNA Microarray foi desenvolvida para monitorar a expressão de muitos genes de Xylella fastidiosa, permitindo a comparação de duas situações distintas em um único experimento. Os experimentos foram feitos utilizando células de X. fastidiosa cultivada em dois meios de cultura: BCYE e XDM2. Pares de oligonucleotídeos iniciadores foram sintetizados, depositados em lâminas de vidro e o arranjo foi hibridizado contra cDNAs marcados fluorescentemente. Os sinais emitidos foram quantificados, normalizados e os dados foram estatisticamente analisados para verificar os genes diferencialmente expressos. De acordo com nossos dados, 104 genes foram diferencialmente expressos para o meio de cultura XDM2 e 30 genes para o BCYE. No presente estudo, nós demonstramos que a técnica de DNA microarrays eficientemente diferencia genes expressos sob diferentes condições de cultivo.

  18. Unraveling antimicrobial resistance genes and phenotype patterns among Enterococcus faecalis isolated from retail chicken products in Japan.

    Science.gov (United States)

    Hidano, Arata; Yamamoto, Takehisa; Hayama, Yoko; Muroga, Norihiko; Kobayashi, Sota; Nishida, Takeshi; Tsutsui, Toshiyuki

    2015-01-01

    Multidrug-resistant enterococci are considered crucial drivers for the dissemination of antimicrobial resistance determinants within and beyond a genus. These organisms may pass numerous resistance determinants to other harmful pathogens, whose multiple resistances would cause adverse consequences. Therefore, an understanding of the coexistence epidemiology of resistance genes is critical, but such information remains limited. In this study, our first objective was to determine the prevalence of principal resistance phenotypes and genes among Enterococcus faecalis isolated from retail chicken domestic products collected throughout Japan. Subsequent analysis of these data by using an additive Bayesian network (ABN) model revealed the co-appearance patterns of resistance genes and identified the associations between resistance genes and phenotypes. The common phenotypes observed among E. faecalis isolated from the domestic products were the resistances to oxytetracycline (58.4%), dihydrostreptomycin (50.4%), and erythromycin (37.2%), and the gene tet(L) was detected in 46.0% of the isolates. The ABN model identified statistically significant associations between tet(L) and erm(B), tet(L) and ant(6)-Ia, ant(6)-Ia and aph(3')-IIIa, and aph(3')-IIIa and erm(B), which indicated that a multiple-resistance profile of tetracycline, erythromycin, streptomycin, and kanamycin is systematic rather than random. Conversely, the presence of tet(O) was only negatively associated with that of erm(B) and tet(M), which suggested that in the presence of tet(O), the aforementioned multiple resistance is unlikely to be observed. Such heterogeneity in linkages among genes that confer the same phenotypic resistance highlights the importance of incorporating genetic information when investigating the risk factors for the spread of resistance. The epidemiological factors that underlie the persistence of systematic multiple-resistance patterns warrant further investigations with appropriate

  19. Unraveling antimicrobial resistance genes and phenotype patterns among Enterococcus faecalis isolated from retail chicken products in Japan.

    Directory of Open Access Journals (Sweden)

    Arata Hidano

    Full Text Available Multidrug-resistant enterococci are considered crucial drivers for the dissemination of antimicrobial resistance determinants within and beyond a genus. These organisms may pass numerous resistance determinants to other harmful pathogens, whose multiple resistances would cause adverse consequences. Therefore, an understanding of the coexistence epidemiology of resistance genes is critical, but such information remains limited. In this study, our first objective was to determine the prevalence of principal resistance phenotypes and genes among Enterococcus faecalis isolated from retail chicken domestic products collected throughout Japan. Subsequent analysis of these data by using an additive Bayesian network (ABN model revealed the co-appearance patterns of resistance genes and identified the associations between resistance genes and phenotypes. The common phenotypes observed among E. faecalis isolated from the domestic products were the resistances to oxytetracycline (58.4%, dihydrostreptomycin (50.4%, and erythromycin (37.2%, and the gene tet(L was detected in 46.0% of the isolates. The ABN model identified statistically significant associations between tet(L and erm(B, tet(L and ant(6-Ia, ant(6-Ia and aph(3'-IIIa, and aph(3'-IIIa and erm(B, which indicated that a multiple-resistance profile of tetracycline, erythromycin, streptomycin, and kanamycin is systematic rather than random. Conversely, the presence of tet(O was only negatively associated with that of erm(B and tet(M, which suggested that in the presence of tet(O, the aforementioned multiple resistance is unlikely to be observed. Such heterogeneity in linkages among genes that confer the same phenotypic resistance highlights the importance of incorporating genetic information when investigating the risk factors for the spread of resistance. The epidemiological factors that underlie the persistence of systematic multiple-resistance patterns warrant further investigations with

  20. Functional genomics reveals that a compact terpene synthase gene family can account for terpene volatile production in apple.

    Science.gov (United States)

    Nieuwenhuizen, Niels J; Green, Sol A; Chen, Xiuyin; Bailleul, Estelle J D; Matich, Adam J; Wang, Mindy Y; Atkinson, Ross G

    2013-02-01

    Terpenes are specialized plant metabolites that act as attractants to pollinators and as defensive compounds against pathogens and herbivores, but they also play an important role in determining the quality of horticultural food products. We show that the genome of cultivated apple (Malus domestica) contains 55 putative terpene synthase (TPS) genes, of which only 10 are predicted to be functional. This low number of predicted functional TPS genes compared with other plant species was supported by the identification of only eight potentially functional TPS enzymes in apple 'Royal Gala' expressed sequence tag databases, including the previously characterized apple (E,E)-α-farnesene synthase. In planta functional characterization of these TPS enzymes showed that they could account for the majority of terpene volatiles produced in cv Royal Gala, including the sesquiterpenes germacrene-D and (E)-β-caryophyllene, the monoterpenes linalool and α-pinene, and the homoterpene (E)-4,8-dimethyl-1,3,7-nonatriene. Relative expression analysis of the TPS genes indicated that floral and vegetative tissues were the primary sites of terpene production in cv Royal Gala. However, production of cv Royal Gala floral-specific terpenes and TPS genes was observed in the fruit of some heritage apple cultivars. Our results suggest that the apple TPS gene family has been shaped by a combination of ancestral and more recent genome-wide duplication events. The relatively small number of functional enzymes suggests that the remaining terpenes produced in floral and vegetative and fruit tissues are maintained under a positive selective pressure, while the small number of terpenes found in the fruit of modern cultivars may be related to commercial breeding strategies. PMID:23256150

  1. Functional Genomics Reveals That a Compact Terpene Synthase Gene Family Can Account for Terpene Volatile Production in Apple1[W

    Science.gov (United States)

    Nieuwenhuizen, Niels J.; Green, Sol A.; Chen, Xiuyin; Bailleul, Estelle J.D.; Matich, Adam J.; Wang, Mindy Y.; Atkinson, Ross G.

    2013-01-01

    Terpenes are specialized plant metabolites that act as attractants to pollinators and as defensive compounds against pathogens and herbivores, but they also play an important role in determining the quality of horticultural food products. We show that the genome of cultivated apple (Malus domestica) contains 55 putative terpene synthase (TPS) genes, of which only 10 are predicted to be functional. This low number of predicted functional TPS genes compared with other plant species was supported by the identification of only eight potentially functional TPS enzymes in apple ‘Royal Gala’ expressed sequence tag databases, including the previously characterized apple (E,E)-α-farnesene synthase. In planta functional characterization of these TPS enzymes showed that they could account for the majority of terpene volatiles produced in cv Royal Gala, including the sesquiterpenes germacrene-D and (E)-β-caryophyllene, the monoterpenes linalool and α-pinene, and the homoterpene (E)-4,8-dimethyl-1,3,7-nonatriene. Relative expression analysis of the TPS genes indicated that floral and vegetative tissues were the primary sites of terpene production in cv Royal Gala. However, production of cv Royal Gala floral-specific terpenes and TPS genes was observed in the fruit of some heritage apple cultivars. Our results suggest that the apple TPS gene family has been shaped by a combination of ancestral and more recent genome-wide duplication events. The relatively small number of functional enzymes suggests that the remaining terpenes produced in floral and vegetative and fruit tissues are maintained under a positive selective pressure, while the small number of terpenes found in the fruit of modern cultivars may be related to commercial breeding strategies. PMID:23256150

  2. Isoepoxydon dehydrogenase (idh) gene expression in relation to patulin production by Penicillium expansum under different temperature and atmosphere.

    Science.gov (United States)

    De Clercq, N; Vlaemynck, G; Van Pamel, E; Van Weyenberg, S; Herman, L; Devlieghere, F; De Meulenaer, B; Van Coillie, E

    2016-03-01

    Penicillium expansum growth and patulin production occur mainly at post-harvest stage during the long-term storage of apples. Low temperature in combination with reduced oxygen concentrations is commonly applied as a control strategy to extend apple shelf life and supply the market throughout the year. Our in vitro study investigated the effect of temperature and atmosphere on expression of the idh gene in relation to the patulin production by P. expansum. The idh gene encodes the isoepoxydon dehydrogenase enzyme, a key enzyme in the patulin biosynthesis pathway. First, a reverse transcription real-time PCR (RT-qPCR) method was optimized to measure accurately the P. expansum idh mRNA levels relative to the mRNA levels of three reference genes (18S, β-tubulin, calmodulin), taking into account important parameters such as PCR inhibition and multiple reference gene stability. Subsequently, two P. expansum field isolates and one reference strain were grown on apple puree agar medium (APAM) under three conditions of temperature and atmosphere: 20 °C - air, 4 °C - air and 4 °C - controlled atmosphere (CA; 3% O2). When P. expansum strains reached a 0.5 and 2.0 cm colony diameter, idh expression and patulin concentrations were determined by means of the developed RT-qPCR and an HPLC-UV method, respectively. The in vitro study showed a clear reduction in patulin production and down-regulation of the idh gene expression when P. expansum was grown under 4 °C - CA. The results suggest that stress (low temperature and oxygen level) caused a delay of the fungal metabolism rather than a complete inhibition of toxin biosynthesis. A good correlation was found between the idh expression and patulin production, corroborating that temperature and atmosphere affected patulin production by acting at the transcriptional level of the idh gene. Finally, a reliable RT-qPCR can be considered as an alternative tool to investigate the effect of control strategies on the toxin formation in

  3. Heterologous expression of an orphan NRPS gene cluster from Paenibacillus larvae in Escherichia coli revealed production of sevadicin.

    Science.gov (United States)

    Tang, Ying; Frewert, Simon; Harmrolfs, Kirsten; Herrmann, Jennifer; Karmann, Lisa; Kazmaier, Uli; Xia, Liqiu; Zhang, Youming; Müller, Rolf

    2015-01-20

    The Gram-positive bacterium Paenibacillus larvae is the causative agent of the fateful honey bee disease American Foulbrood (AFB). Sequence analysis of P. larvae genomic DNA showed the presence of numerous nonribosomal peptide synthetase (NRPS) and polyketide synthase (PKS) encoding gene clusters, not correlating with secondary metabolite production. As NRPS and PKS derived metabolites are known to exhibit diverse biological activities, their identification is of particular interest for infection and drug research. Here an 11.6kb orphan NRPS gene cluster was directly cloned from the genomic DNA of P. larvae and expressed in Escherichia coli resulting in the production of sevadicin. Isolation of the metabolite was followed by structural characterization, synthesis and bioactivity studies. PMID:25529345

  4. Elevated PC responsive B cells and anti-PC antibody production in transgenic mice harboring anti-PC immunoglobulin genes.

    Science.gov (United States)

    Pinkert, C A; Manz, J; Linton, P J; Klinman, N R; Storb, U

    1989-12-01

    The rearrangement of heavy and light chain immunoglobulin genes is necessary for the production of functional antibody molecules. The myeloma MOPC 167 produces specific antibodies to the antigen phosphorylcholine (PC), which is present on bacterial surfaces, fungi and other environmental contaminants. Rearranged heavy and light chain immunoglobulin genes cloned from MOPC 167 were microinjected into mouse eggs. Within the resulting transgenic mice, expression of the transgenes were limited to lymphoid tissues. Transgenic mice produced elevated levels of anti-PC antibodies constitutively, at 16 days of age, when normal non-transgenic mice were not fully immunocompetent. A triggering antigenic stimulus was not necessary to evoke anti-PC immunoglobulin production. Additionally, the frequency of PC-responsive B cells in these transgenic mice was further increased upon specific immunization.

  5. The gene bap, involved in biofilm production, is present in Staphylococcus spp. strains from nosocomial infections.

    Science.gov (United States)

    Potter, Amina; Ceotto, Hilana; Giambiagi-Demarval, Marcia; dos Santos, Kátia Regina Netto; Nes, Ingolf F; Bastos, Maria do Carmo de Freire

    2009-06-01

    This study analyzed ten strains of coagulase-negative staphylococci (CNS) involved in nosocomial infections in three Brazilian hospitals. Their antibiotic susceptibility profile showed that most strains exhibited multiple antibiotic resistance and possessed the mecA gene. The ability of these strains to adhere to polystyrene microtiter plates was also tested and nine of them proved to be biofilm producers at least in one of the three conditions tested: growth in TSB, in TSB supplemented with NaCl, or in TSB supplemented with glucose. The presence of the bap gene, which codes for the biofilm-associated protein (Bap), was investigated in all ten strains by PCR. AU strains were bop-positive and DNA sequencing experiments confirmed that the fragments amplified were indeed part of a bap gene. The presence of the icaA gene, one of the genes involved in polysaccharide intercellular adhesin (PIA) formation, was also detected by PCR in eight of the ten strains tested. The two icaA-negative strains were either weak biofilm producer or no biofilm producer, although they were bop-positive. To our knowledge, this is the first report demonstrating the presence of the bap gene in nosocomial isolates of CNS, being also the first report on the presence of this gene in Staphylococcus haemolyticus and S. cohnii.

  6. Occurrence and Diversity of Tetracycline Resistance Genes in Lagoons and Groundwater Underlying Two Swine Production Facilities

    Science.gov (United States)

    Chee-Sanford, J. C.; Aminov, R.I.; Krapac, I.J.; Garrigues-Jeanjean, N.; Mackie, R.I.

    2001-01-01

    In this study, we used PCR typing methods to assess the presence of tetracycline resistance determinants conferring ribosomal protection in waste lagoons and in groundwater underlying two swine farms. All eight classes of genes encoding this mechanism of resistance [tet(O), tet(Q), tet(W), tet(M), tetB(P), tet(S), tet(T), and otrA] were found in total DNA extracted from water of two lagoons. These determinants were found to be seeping into the underlying groundwater and could be detected as far as 250 m downstream from the lagoons. The identities and origin of these genes in groundwater were confirmed by PCR-denaturing gradient gel electrophoresis and sequence analyses. Tetracycline-resistant bacterial isolates from groundwater harbored the tet(M) gene, which was not predominant in the environmental samples and was identical to tet(M) from the lagoons. The presence of this gene in some typical soil inhabitants suggests that the vector of antibiotic resistance gene dissemination is not limited to strains of gastrointestinal origin carrying the gene but can be mobilized into the indigenous soil microbiota. This study demonstrated that tet genes occur in the environment as a direct result of agriculture and suggested that groundwater may be a potential source of antibiotic resistance in the food chain.

  7. Gene detection and toxin production evaluation of hemolysin BL of Bacillus cereus isolated from milk and dairy products marketed in Brazil.

    Science.gov (United States)

    Reis, Andre L S; Montanhini, Maike T M; Bittencourt, Juliana V M; Destro, Maria T; Bersot, Luciano S

    2013-12-01

    Bacillus cereusis an ubiquitous, spore-forming bacteria that can survive pasteurization and the majority of the heating processes used in the dairy industry. Besides, it is a pathogen responsible for different types of food poisoning. One type of foodborne disease caused by B.cereusis the diarrheal syndrome, which is caused by the ingestion of vegetative cells producing toxins in the small intestine. One virulence factor for the diarrheal syndrome is the toxin hemolysin BL (HBL), a three-component protein formed by the L1, L2 and B components. In order to evaluate the presence of diarrheal strains isolated from milk and dairy products, 63 B. cereus isolates were obtained from 260 samples of UHT milk, pasteurized milk and powdered milk, sold in commercial establishments and from different brands. The isolates were subjected to the Polymerase Chain Reaction (PCR) for the detection of the encoding genes for the L1, L2 and B components and the toxin production capacity were evaluated with an immunoassay. A total of 23 [36.5%] isolates were identified carrying simultaneously the three tested genes, from which, 20 [86.9%] showed toxigenic capacity. 26 [41.3%] isolates did not carry any of genes tested and the other 14 [22.2%] were positive for one or two of them. The results showed a high toxigenic capacity among the B. cereus isolates able to produce the HBL, indicating a potential risk for consumers.

  8. Gene detection and toxin production evaluation of hemolysin BL of Bacillus cereus isolated from milk and dairy products marketed in Brazil

    Directory of Open Access Journals (Sweden)

    Andre L.S. Reis

    2013-12-01

    Full Text Available Bacillus cereusis an ubiquitous, spore-forming bacteria that can survive pasteurization and the majority of the heating processes used in the dairy industry. Besides, it is a pathogen responsible for different types of food poisoning. One type of foodborne disease caused by B.cereusis the diarrheal syndrome, which is caused by the ingestion of vegetative cells producing toxins in the small intestine. One virulence factor for the diarrheal syndrome is the toxin hemolysin BL (HBL, a three-component protein formed by the L1, L2 and B components. In order to evaluate the presence of diarrheal strains isolated from milk and dairy products, 63 B. cereus isolates were obtained from 260 samples of UHT milk, pasteurized milk and powdered milk, sold in commercial establishments and from different brands. The isolates were subjected to the Polymerase Chain Reaction (PCR for the detection of the encoding genes for the L1, L2 and B components and the toxin production capacity were evaluated with an immunoassay. A total of 23 [36.5%] isolates were identified carrying simultaneously the three tested genes, from which, 20 [86.9%] showed toxigenic capacity. 26 [41.3%] isolates did not carry any of genes tested and the other 14 [22.2%] were positive for one or two of them. The results showed a high toxigenic capacity among the B. cereus isolates able to produce the HBL, indicating a potential risk for consumers.

  9. Efficient Production of Gene-Modified Mice using Staphylococcus aureus Cas9

    Science.gov (United States)

    Zhang, Xiya; Liang, Puping; Ding, Chenhui; Zhang, Zhen; Zhou, Jianwen; Xie, Xiaowei; Huang, Rui; Sun, Ying; Sun, Hongwei; Zhang, Jinran; Xu, Yanwen; Songyang, Zhou; Huang, Junjiu

    2016-01-01

    The CRISPR/Cas system is an efficient genome-editing tool to modify genes in mouse zygotes. However, only the Streptococcus pyogenes Cas9 (SpCas9) has been systematically tested for generating gene-modified mice. The protospacer adjacent motif (PAM, 5′-NGG-3′) recognized by SpCas9 limits the number of potential target sites for this system. Staphylococcus aureus Cas9 (SaCas9), with its smaller size and unique PAM (5′-NNGRRT-3′) preferences, presents an alternative for genome editing in zygotes. Here, we showed that SaCas9 could efficiently and specifically edit the X-linked gene Slx2 and the autosomal gene Zp1 in mouse zygotes. SaCas9-mediated disruption of the tyrosinase (Tyr) gene led to C57BL/6J mice with mosaic coat color. Furthermore, multiplex targeting proved efficient multiple genes disruption when we co-injected gRNAs targeting Slx2, Zp1, and Tyr together with SaCas9 mRNA. We were also able to insert a Flag tag at the C-terminus of histone H1c, when a Flag-encoding single-stranded DNA oligo was co-introduced into mouse zygotes with SaCas9 mRNA and the gRNA. These results indicate that SaCas9 can specifically cleave the target gene locus, leading to successful gene knock-out and precise knock-in in mouse zygotes, and highlight the potential of using SaCas9 for genome editing in preimplantation embryos and producing gene-modified animal models. PMID:27586692

  10. Microbial production of indolylglucosinolate through engineering of a multi-gene pathway in a versatile yeast expression platform

    DEFF Research Database (Denmark)

    Mikkelsen, Michael Dalgaard; Buron, Line Due; Salomonsen, Bo;

    2012-01-01

    Epidemiological studies have shown that consumption of cruciferous vegetables, such as, broccoli and cabbages, is associated with a reduced risk of developing cancer. This phenomenon has been attributed to specific glucosinolates among the ∼30 glucosinolates that are typically present as natural...... products characteristic of cruciferous plants. Accordingly, there has been a strong interest to produce these compounds in microbial cell factories as it will allow production of selected beneficial glucosinolates. We have developed a versatile platform for stable expression of multi-gene pathways...... endogenous yeast activities with plant-derived enzymes. Production of indolylglucosinolate serves as a proof-of-concept for our expression platform, and provides a basis for large-scale microbial production of specific glucosinolates for the benefit of human health....

  11. Expression and state of phosphorylation of the retinoblastoma susceptibility gene product in cycling and noncycling human hematopoietic cells.

    OpenAIRE

    Furukawa, Y.; DeCaprio, J A; Freedman, A.; Kanakura, Y.; Nakamura, M.; Ernst, T J; Livingston, D M; Griffin, J D

    1990-01-01

    The product of the retinoblastoma susceptibility gene RB1 (Rb) is likely to function as an inhibitor of cell growth. Previous studies have suggested that certain growth-suppressing effects of Rb are exerted in G0/G1 phase and that phosphorylation can inactivate these functions. We tested this hypothesis by examining the expression and state of phosphorylation of Rb in several lineages of primary hematopoietic cells that spontaneously arrest in G0 phase. Resting lymphocytes were found to expre...

  12. The retinoblastoma-susceptibility gene product becomes phosphorylated in multiple stages during cell cycle entry and progression.

    OpenAIRE

    DeCaprio, J A; Furukawa, Y.; Ajchenbaum, F; Griffin, J D; Livingston, D M

    1992-01-01

    The retinoblastoma-susceptibility gene product (RB) undergoes cell cycle-dependent phosphorylation and dephosphorylation. We characterized RB phosphorylation after mitogenic stimulation of primary human T lymphocytes, initially arrested in the G0 state. RB is phosphorylated in at least three steps when T cells are driven into the cell cycle. The first event occurs during mid G1 phase, the second during S phase, and the third in G2/M. Tryptic phosphopeptide mapping indicates that the different...

  13. Purification of the inlB Gene Product of Listeria monocytogenes and Demonstration of Its Biological Activity

    OpenAIRE

    Müller, Simone; Hain, Torsten; Pashalidis, Philippos; Lingnau, Andreas; Domann, Eugen; Chakraborty, Trinad; Wehland, Jürgen

    1998-01-01

    Entry of Listeria monocytogenes into nonphagocytic cells requires the inlAB gene products. InlA and InlB are bacterial cell wall-associated polypeptides that can be released by sodium dodecyl sulfate treatment. By applying more gentle extraction methods, we have purified InlB in its native form. Treatment of bacteria with various nondenaturating agents including mutanolysin, thiol reagents, sodium chloride, and detergents like Triton X-100 or 3-[(3-cholamidopropyl)-dimethylammonio]-1-propanes...

  14. Identification of candidate genes for yeast engineering to improve bioethanol production in very high gravity and lignocellulosic biomass industrial fermentations

    OpenAIRE

    Pereira Francisco B; Guimarães Pedro; Gomes Daniel G; Mira Nuno P; Teixeira Miguel C; Sá-Correia Isabel; Domingues Lucília

    2011-01-01

    Abstract Background The optimization of industrial bioethanol production will depend on the rational design and manipulation of industrial strains to improve their robustness against the many stress factors affecting their performance during very high gravity (VHG) or lignocellulosic fermentations. In this study, a set of Saccharomyces cerevisiae genes found, through genome-wide screenings, to confer resistance to the simultaneous presence of different relevant stresses were identified as req...

  15. Identification of candidate genes for yeast engineering to improve bioethanol production in very high gravity and lignocellulosic biomass industrial fermentations

    OpenAIRE

    Pereira, Francisco B; Guimarães, Pedro M. R.; Gomes, Daniel Gonçalves; Mira, Nuno P.; Teixeira, Miguel C

    2011-01-01

    Background: The optimization of industrial bioethanol production will depend on the rational design and manipulation of industrial strains to improve their robustness against the many stress factors affecting their performance during very high gravity (VHG) or lignocellulosic fermentations. In this study, a set of Saccharomyces cerevisiae genes found, through genome-wide screenings, to confer resistance to the simultaneous presence of different relevant stresses were identified as...

  16. FUM gene expression profile and fumonisin production by Fusarium verticillioides inoculated in Bt and non-Bt maize

    Directory of Open Access Journals (Sweden)

    Liliana Oliveira Rocha

    2016-01-01

    Full Text Available This study aimed to determine the levels of fumonisins produced by F. verticillioides and FUM gene expression on Bt (Bacillus thuringiensis and non-Bt maize, post harvest, during different periods of incubation. Transgenic hybrids 30F35 YG, 2B710 Hx and their isogenic (30F35 and 2B710 were collected from the field and a subset of 30 samples selected for the experiments. Maize samples were sterilized by gamma radiation at a dose of 20 kGy. Samples were then inoculated with Fusarium verticillioides and analysed under controlled conditions of temperature and relative humidity for fumonisin B1 and B2 (FB¬1 and FB2 production and FUM1, FUM3, FUM6, FUM7, FUM8, FUM13, FUM14, FUM15 and FUM19 expression. 2B710 Hx and 30F35 YG kernel samples were virtually intact when compared to the non-Bt hybrids that came from the field. Statistical analysis showed that FB¬1 production was significantly lower in 30F35 YG and 2B710 Hx than in the 30F35 and 2B710 hybrids (P 0.05. The kernel injuries observed in the non-Bt samples have possibly facilitated F. verticillioides penetration and promoted FB1 production under controlled conditions. FUM genes were expressed by F. verticillioides in all of the samples. However, there was indication of lower expression of a few FUM genes in the Bt hybrids; and a weak association between FB1 production and the relative expression of some of the FUM genes were observed in the 30F35 YG hybrid.

  17. FUM Gene Expression Profile and Fumonisin Production by Fusarium verticillioides Inoculated in Bt and Non-Bt Maize

    Science.gov (United States)

    Rocha, Liliana O.; Barroso, Vinícius M.; Andrade, Ludmila J.; Pereira, Gustavo H. A.; Ferreira-Castro, Fabiane L.; Duarte, Aildson P.; Michelotto, Marcos D.; Correa, Benedito

    2016-01-01

    This study aimed to determine the levels of fumonisins produced by Fusarium verticillioides and FUM gene expression on Bt (Bacillus thuringiensis) and non-Bt maize, post harvest, during different periods of incubation. Transgenic hybrids 30F35 YG, 2B710 Hx and their isogenic (30F35 and 2B710) were collected from the field and a subset of 30 samples selected for the experiments. Maize samples were sterilized by gamma radiation at a dose of 20 kGy. Samples were then inoculated with F. verticillioides and analyzed under controlled conditions of temperature and relative humidity for fumonisin B1 and B2 (FB1 and FB2) production and FUM1, FUM3, FUM6, FUM7, FUM8, FUM13, FUM14, FUM15, and FUM19 expression. 2B710 Hx and 30F35 YG kernel samples were virtually intact when compared to the non-Bt hybrids that came from the field. Statistical analysis showed that FB1 production was significantly lower in 30F35 YG and 2B710 Hx than in the 30F35 and 2B710 hybrids (P 0.05). The kernel injuries observed in the non-Bt samples have possibly facilitated F. verticillioides penetration and promoted FB1 production under controlled conditions. FUM genes were expressed by F. verticillioides in all of the samples. However, there was indication of lower expression of a few FUM genes in the Bt hybrids; and a weak association between FB1 production and the relative expression of some of the FUM genes were observed in the 30F35 YG hybrid. PMID:26779158

  18. L-lactic acid production from D-xylose with Candida sonorensis expressing a heterologous lactate dehydrogenase encoding gene

    OpenAIRE

    Koivuranta, Kari T; Ilmén, Marja; Wiebe, Marilyn G.; Ruohonen, Laura; Suominen, Pirkko; Penttilä, Merja

    2014-01-01

    Background Bioplastics, like polylactic acid (PLA), are renewable alternatives for petroleum-based plastics. Lactic acid, the monomer of PLA, has traditionally been produced biotechnologically with bacteria. With genetic engineering, yeast have the potential to replace bacteria in biotechnological lactic acid production, with the benefits of being acid tolerant and having simple nutritional requirements. Lactate dehydrogenase genes have been introduced to various yeast to demonstrate this pot...

  19. Heterologous expression of Mus musculus immunoresponsive gene 1 (irg1 in Escherichia coli results in itaconate production

    Directory of Open Access Journals (Sweden)

    Kiira S Vuoristo

    2015-08-01

    Full Text Available Itaconic acid, a C5-dicarboxylic acid, is a potential biobased building block for the polymer industry. It is obtained from the citric acid cycle by decarboxylation of cis-aconitic acid. This reaction is catalysed by CadA in the native itaconic acid producer Aspergillus terreus. Recently, another enzyme encoded by the mammalian immunoresponsive gene 1 (irg1, was found to decarboxylate cis-aconitate to itaconate in vitro. We show that heterologous expression of irg1 enabled itaconate production in E. coli with production titres up to 560 mg/L.

  20. Effects of carbon, nitrogen and ambient pH on patulin production and related gene expression in Penicillium expansum.

    Science.gov (United States)

    Zong, Yuanyuan; Li, Boqiang; Tian, Shiping

    2015-08-01

    Patulin, a potent mycotoxin which can cause serious health concerns, is mainly produced in foods by Penicillium expansum. Environmental factors play important roles in regulating biosynthesis of mycotoxins; however, information about the effects of environmental factors on patulin production and the involved mechanisms in P. expansum is limited. Here, we investigated the effects of different carbon (C) and nitrogen (N) sources, and ambient pH on patulin production in three P. expansum strains T01, M1 and Pe21, and the expression profile of 15 genes involved in patulin biosynthetic pathway. It was found that C and N sources and pH had great influence on patulin production in P. expansum. In general, patulin production of all three P. expansum strains showed similar trends under different C and N sources and pH conditions, though there were some differences in the optimal conditions among these strains. Glucose-containing sugars, complex N sources, and acidic conditions were favorable conditions for patulin production. The results of RT-qPCR showed that the relative expressions of most of the patulin genes were up-regulated under patulin-permissive conditions, indicating that patulin biosynthesis was mainly regulated at transcriptional level by these environmental factors. These findings will provide useful information to better understand the regulation mechanisms of patulin biosynthesis, and be helpful in developing effective means for controlling patulin contamination.

  1. Oxalic acid production by citric acid-producing Aspergillus niger overexpressing the oxaloacetate hydrolase gene oahA.

    Science.gov (United States)

    Kobayashi, Keiichi; Hattori, Takasumi; Honda, Yuki; Kirimura, Kohtaro

    2014-05-01

    The filamentous fungus Aspergillus niger is used worldwide in the industrial production of citric acid. However, under specific cultivation conditions, citric acid-producing strains of A. niger accumulate oxalic acid as a by-product. Oxalic acid is used as a chelator, detergent, or tanning agent. Here, we sought to develop oxalic acid hyperproducers using A. niger as a host. To generate oxalic acid hyperproducers by metabolic engineering, transformants overexpressing the oahA gene, encoding oxaloacetate hydrolase (OAH; EC 3.7.1.1), were constructed in citric acid-producing A. niger WU-2223L as a host. The oxalic acid production capacity of this strain was examined by cultivation of EOAH-1 under conditions appropriate for oxalic acid production with 30 g/l glucose as a carbon source. Under all the cultivation conditions tested, the amount of oxalic acid produced by EOAH-1, a representative oahA-overexpressing transformant, exceeded that produced by A. niger WU-2223L. A. niger WU-2223L and EOAH-1 produced 15.6 and 28.9 g/l oxalic acid, respectively, during the 12-day cultivation period. The yield of oxalic acid for EOAH-1 was 64.2 % of the maximum theoretical yield. Our method for oxalic acid production gave the highest yield of any study reported to date. Therefore, we succeeded in generating oxalic acid hyperproducers by overexpressing a single gene, i.e., oahA, in citric acid-producing A. niger as a host.

  2. Association of a novel single nucleotide polymorphism in growth hormone receptor gene with production traits in Bali cattle

    Directory of Open Access Journals (Sweden)

    Maskur .

    2014-11-01

    Full Text Available The growth hormone (GH is the main regulator of postnatal growth and metabolism in mammals. The action of GH on target cells depends on the growth hormone receptor (GHR. This is mediated through induced transcription of other genes. GHR gene is one of the candidate genes employed in selection strategy using DNA markers (marker assisted selection. This study was designed to identify the novel single nucleotide polymorphisms (SNPs in exon 8 and intron 8 of GHR gene that may affect production traits in Bali cattle. A SNP was identified by the direct sequencing technique. Genotypes of the SNPs were identified using PCR-RFLP. The SNP was located in intron 8 of the GHR gene and was caused by an A/G transition. It was identified using the HpyCH4III restriction enzyme. Polymorphism of GHR/HpyCH4III has a significant influence on weaning weight and average daily gain, but not on birth weight of Bali cattle.

  3. Evaluation of Gene Expression and Alginate Production in Response to Oxygen Transfer in Continuous Culture of Azotobacter vinelandii

    Science.gov (United States)

    Díaz-Barrera, Alvaro; Martínez, Fabiola; Guevara Pezoa, Felipe; Acevedo, Fernando

    2014-01-01

    Alginates are polysaccharides used as food additives and encapsulation agents in biotechnology, and their functional properties depend on its molecular weight. In this study, different steady-states in continuous cultures of A. vinelandii were established to determine the effect of the dilution rate (D) and the agitation rate on alginate production and expression of genes involved in alginate polymerization and depolymerization. Both, the agitation and dilution rates, determined the partitioning of the carbon utilization from sucrose into alginate and CO2 under oxygen-limiting conditions. A low D (0.07 h−1) and 500 rpm resulted in the highest carbon utilization into alginate (25%). Quantitative real-time polymerase chain reaction was used to determine the transcription level of six genes involved in alginate polymerization and depolymerization. In chemostat cultures at 0.07 h−1, the gene expression was affected by changes in the agitation rate. By increasing the agitation rate from 400 to 600 rpm, the algE7 gene expression decreased tenfold, whereas alyA1, algL and alyA2 gene expression increased between 1.5 and 2.8 times under similar conditions evaluated. Chemostat at 0.07 h−1 showed a highest alginate molecular weight (580 kDa) at 500 rpm whereas similar molecular weights (480 kDa) were obtained at 400 and 600 rpm. The highest molecular weight was not explained by changes in the expression of alg8 and alg44 (genes involved in alginate polymerization). Nonetheless, a different expression pattern observed for lyases could explain the highest alginate molecular weight obtained. Overall, the results suggest that the control of alginate molecular weight in A. vinelandii cells growing in continuous mode is determined by a balance between the gene expression of intracellular and extracellular lyases in response to oxygen availability. These findings better our understanding of the biosynthesis of bacterial alginate and help us progress toward obtain tailor

  4. Evaluation of gene expression and alginate production in response to oxygen transfer in continuous culture of Azotobacter vinelandii.

    Directory of Open Access Journals (Sweden)

    Alvaro Díaz-Barrera

    Full Text Available Alginates are polysaccharides used as food additives and encapsulation agents in biotechnology, and their functional properties depend on its molecular weight. In this study, different steady-states in continuous cultures of A. vinelandii were established to determine the effect of the dilution rate (D and the agitation rate on alginate production and expression of genes involved in alginate polymerization and depolymerization. Both, the agitation and dilution rates, determined the partitioning of the carbon utilization from sucrose into alginate and CO2 under oxygen-limiting conditions. A low D (0.07 h(-1 and 500 rpm resulted in the highest carbon utilization into alginate (25%. Quantitative real-time polymerase chain reaction was used to determine the transcription level of six genes involved in alginate polymerization and depolymerization. In chemostat cultures at 0.07 h(-1, the gene expression was affected by changes in the agitation rate. By increasing the agitation rate from 400 to 600 rpm, the algE7 gene expression decreased tenfold, whereas alyA1, algL and alyA2 gene expression increased between 1.5 and 2.8 times under similar conditions evaluated. Chemostat at 0.07 h(-1 showed a highest alginate molecular weight (580 kDa at 500 rpm whereas similar molecular weights (480 kDa were obtained at 400 and 600 rpm. The highest molecular weight was not explained by changes in the expression of alg8 and alg44 (genes involved in alginate polymerization. Nonetheless, a different expression pattern observed for lyases could explain the highest alginate molecular weight obtained. Overall, the results suggest that the control of alginate molecular weight in A. vinelandii cells growing in continuous mode is determined by a balance between the gene expression of intracellular and extracellular lyases in response to oxygen availability. These findings better our understanding of the biosynthesis of bacterial alginate and help us progress toward obtain

  5. The Effect of IL-4 Gene Polymorphisms on Cytokine Production in Patients with Chronic Periodontitis and in Healthy Controls

    Directory of Open Access Journals (Sweden)

    Jirina Bartova

    2014-01-01

    Full Text Available Chronic periodontitis (CP is an inflammatory disease of the teeth-supporting tissues in which genetic predisposition, dental plaque bacteria, and immune mechanisms all play important roles. The aim of this study was to evaluate the occurrence of IL-4 gene polymorphisms in chronic periodontitis and to investigate the association between polymorphisms and cytokines production after bacterial stimulation. Sixty-two subjects (47 CP patients and 15 healthy controls with detected two polymorphisms in the IL-4 gene (-590C/T and intron 3 VNTR were examined. Production of cytokines (IL-1α, IL-1β, IL-4, IL-5, IL-6, IL-10, IL-17, TNFα, INFγ, and VEGF was studied after in vitro stimulation of isolated peripheral blood by mitogens (Pokeweed mitogen, Concanavalin A, dental plaque bacteria (Aggregatibacter actinomycetemcomitans, Tannerella forsythia, Porphyromonas gingivalis, and Prevotella intermedia, and Heat Shock Protein (HSP 70 by the Luminex multiplex cytokine analysis system. The results were correlated with IL-4 genotypes in patients with CP and healthy controls. The mononuclear cells isolated from peripheral blood of CP patients with selected IL-4 polymorphisms significantly altered the production of IFNγ, IL-10, IL-1β, IL-1α, TNFα, and IL-6 after stimulation by HSP 70 or selected bacteria (from P<0.001 to P<0.05. IL-4 gene polymorphisms may influence the function of mononuclear cells to produce not only interleukin-4 but also other cytokines, especially in patients with CP.

  6. Secretive Expression of Insect Antifungal Peptide-Encoded Genes in Pichia pastoris and Activity Assay of the Products

    Institute of Scientific and Technical Information of China (English)

    SANG Yan-xia; DENG Xiao-juan; YANG Wan-ying; WANG Wen-xian; WEN Shuo-yang; LIU Wen-quan; HUANG Ya-dong; CAO Yang

    2007-01-01

    The antifungal peptides, drosomycin (Drs) and its isoform drosomycin-like C (Drs-lC) from Drosophila melanogaster and Thanatin from Podisus maculiventris, have potent activity with broad spectrum against filamentous fungi. Secretive expression of these genes in yeasts makes it possible to utilize the supernatants of yeast culture as protective reagents on fruit, vegetable, food and other agricultural products. So the study of effective secretion by yeast expression system is of great importance. Three genes, Drs, Drs-lC, and Thanatin, were cloned into pPICZαA and the recombinant vectors,pPICZαA-Drs, pPICZαA-Drs-IC, and pPICZαA-Thanatin were transformed into Pichia pastoris by the electric transfer method. The recombinant P. pastoris, which was screened by phenotype selection and PCR amplification, wasinduced to express antifungal peptide by methanol. The expressive products of the three recombinants showed antifungal activity against 5 out of 6 test fungi strains, and the products of Thanatin also had strong activity against the tested bacteria. The three antifungal peptide genes, Drs, Drs-lC, and Thanatin, were constructed into yeast P. pastoris. The expressed peptides were successfully secreted into the culture medium and exhibited potent activities against the test strains.

  7. Analysis of the L1 gene product of human papillomavirus type 16 by expression in a vaccinia virus recombinant.

    Science.gov (United States)

    Browne, H M; Churcher, M J; Stanley, M A; Smith, G L; Minson, A C

    1988-06-01

    The L1 open reading frame of human papillomavirus type 16 (HPV16) has been expressed in vaccinia virus under the control of both the 7.5K early and late promoter, and the 4b major late promoter. Antibodies to a beta-galactosidase fusion protein containing a C-terminal portion of the HPV16 L1 gene product were used to compare the levels of L1 expression in the two recombinants, and showed that greater levels of expression were obtained when the gene was placed under the control of the 4b late promoter. Immunofluorescence studies revealed a nuclear location of the L1 gene product when expressed in vaccinia virus. Antibodies to the beta-galactosidase fusion protein detected a major polypeptide species of 57K and a minor species of 64K in Western blots of recombinant-infected cell lysates. The 64K species was not detected when cells were infected in the presence of tunicamycin, indicating that the primary translation product of the HPV16 L1 open reading frame is modified by N-linked glycosylation when expressed in vaccinia virus. Whereas antibodies to HPV16 L1 fusion proteins and to a peptide containing amino acids from the C terminus of HPV16 L1 reacted well in Western blots with the HPV16 L1 target expressed in vaccinia virus, no reactivity was observed with antibodies to bovine papillomavirus type 1 particles or to a HPV6b fusion protein.

  8. Both decrease in ACL1 gene expression and increase in ICL1 gene expression in marine-derived yeast Yarrowia lipolytica expressing INU1 gene enhance citric acid production from inulin.

    Science.gov (United States)

    Liu, Xiao-Yan; Chi, Zhe; Liu, Guang-Lei; Madzak, Catherine; Chi, Zhen-Ming

    2013-02-01

    In this study, some of the ATP-citrate lyase genes (ACL1) were deleted and the copy number of the iso-citrate lyase gene (ICL1) was increased in the marine-derived yeast Yarrowia lipolytica SWJ-1b displaying the recombinant inulinase. It was found that lipid content and iso-citric acid in the transformant 30 obtained were greatly reduced and citric acid production was greatly enhanced. It was also found that the ACL1 gene expression and ATP-citrate lyase activity in the transformant 30 were declined and the ICL1 gene expression and iso-citrate lyase activity were promoted. During the 2-l fermentation, 84.0 g/l of citric acid and 1.8 g/l of iso-citric acid in the fermented medium were attained from 10.0 % of inulin by the transformant 30 within 214 h. The results showed that only 0.36 % of the residual reducing sugar and 1.0 % of the residual total sugar were left in the fermented medium, suggesting that 89.6 % of the total sugar was used for citric acid production and cell growth by the transformant 30.

  9. Immunofluorescence on avian sarcoma virus-transformed cells: localization of the src gene product.

    Science.gov (United States)

    Rohrschneider, L R

    1979-01-01

    The localization of the avian sarcoma virus src gene product (termed p60src) was examined by indirect immunofluorescence in cells transformed by the Schmidt-Ruppin strain of Rous sarcoma virus, subgroup D (SR-RSV-D). Antiserum to p60src was obtained from rabbits bearing SR-RSV-D-induced tumors, and immunofluorescence was performed on chicken embryo fibroblasts (CEF) transformed with SR-RSV-D, as well as normal rat kidney (NRK) cells transformed by the same virus (termed SR-RK cells). Both acetone and formaldehyde fixation were used for the immunofluorescence tests. The specificity of the anti-tumor serum was first demonstrated in both cell systems by gel electrophoresis of immunoprecipitates prepared from 35S--methionine-labeled cells. Anti-tumor serum precipitated p60src from SR-RSV-D-transformed CEF but not from CEF infected with a transformation-defective mutant of SR-RSV-D. All viral structural proteins and precursors contained in these immunoprecipitates could be eliminated by competition with unlabeled virus. Similar experiments on SR-RK cells indicated that no viral proteins other than p60src were expressed in these cells, and this observation was supported by immunofluorescence tests using antiserum to whole virus. For immunofluorescence localization of p60src, reactions with viral structural proteins were blocked with unlabeled virus. This presaturation step, obligatory for p60src detection in the SR-RSV-D-transformed CEF, was unnecessary when antitumor serum was tested on SR-RK cells, since p60src was the only viral protein detectable in these cells. With acetone-fixed cells, p60src-specific immunofluorescence revealed a characteristic fluorescence pattern which was similar in both cell systems. The principal pattern was diffuse and situated in the cytoplasm. A clear nuclear fluorescence was never observed. Immunofluorescence on formaldehyde-fixed cells also indicated the cytoplasmic location of p60src and revealed a specific subcytoplasmic concentration

  10. Retroviral-mediated transfer of genomic globin genes leads to regulated production of RNA and protein

    International Nuclear Information System (INIS)

    A high-titer amphotropic retroviral vector containing the neomycin resistance gene and a hybrid γ-β genomic human globin gene has been constructed. Mouse erythroleukemia cells infected with this virus were found to contain the full transcriptional unit of the transferred human globin gene by Southern blot analysis. These cells contain normally initiated, spliced, and terminated human globin mRNA. The human globin mRNA level increased 5- to 10-fold upon induction of the mouse erythroleukemia cells. Human globin chains were produced but only in a fraction of the cells as detected by immunofluorescent staining. A similar retrovirus containing a human β-globin gene was used to transduce mouse erythroleukemia cells resulting in much higher levels of human globin synthesis than detected in mouse erythroleukemia cells transduced with the γ-β globin virus

  11. Production Data - Captive Broodstock Gene Rescue Program for Odd Year Class Elwha River Pink Salmon

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Conduct captive brood stock gene rescue program for Elwha River odd-year class pink salmon. Information on the number of smolts received into the program is...

  12. Drosophila eggshell production: identification of new genes and coordination by Pxt.

    Directory of Open Access Journals (Sweden)

    Tina L Tootle

    Full Text Available Drosophila ovarian follicles complete development using a spatially and temporally controlled maturation process in which they resume meiosis and secrete a multi-layered, protective eggshell before undergoing arrest and/or ovulation. Microarray analysis revealed more than 150 genes that are expressed in a stage-specific manner during the last 24 hours of follicle development. These include all 30 previously known eggshell genes, as well as 19 new candidate chorion genes and 100 other genes likely to participate in maturation. Mutations in pxt, encoding a putative Drosophila cyclooxygenase, cause many transcripts to begin expression prematurely, and are associated with eggshell defects. Somatic activity of Pxt is required, as RNAi knockdown of pxt in the follicle cells recapitulates both the temporal expression and eggshell defects. One of the temporally regulated genes, cyp18a1, which encodes a cytochromome P450 protein mediating ecdysone turnover, is downregulated in pxt mutant follicles, and cyp18a1 mutation itself alters eggshell gene expression. These studies further define the molecular program of Drosophila follicle maturation and support the idea that it is coordinated by lipid and steroid hormonal signals.

  13. Staphylococcus aureus Biofilm and Planktonic cultures differentially impact gene expression, mapk phosphorylation, and cytokine production in human keratinocytes

    Directory of Open Access Journals (Sweden)

    Olerud John E

    2011-06-01

    Full Text Available Abstract Background Many chronic diseases, such as non-healing wounds are characterized by prolonged inflammation and respond poorly to conventional treatment. Bacterial biofilms are a major impediment to wound healing. Persistent infection of the skin allows the formation of complex bacterial communities termed biofilm. Bacteria living in biofilms are phenotypically distinct from their planktonic counterparts and are orders of magnitude more resistant to antibiotics, host immune response, and environmental stress. Staphylococcus aureus is prevalent in cutaneous infections such as chronic wounds and is an important human pathogen. Results The impact of S. aureus soluble products in biofilm-conditioned medium (BCM or in planktonic-conditioned medium (PCM on human keratinocytes was investigated. Proteomic analysis of BCM and PCM revealed differential protein compositions with PCM containing several enzymes involved in glycolysis. Global gene expression of keratinocytes exposed to biofilm and planktonic S. aureus was analyzed after four hours of exposure. Gene ontology terms associated with responses to bacteria, inflammation, apoptosis, chemotaxis, and signal transduction were enriched in BCM treated keratinocytes. Several transcripts encoding cytokines were also upregulated by BCM after four hours. ELISA analysis of cytokines confirmed microarray results at four hours and revealed that after 24 hours of exposure, S. aureus biofilm induced sustained low level cytokine production compared to near exponential increases of cytokines in planktonic treated keratinocytes. The reduction in cytokines produced by keratinocytes exposed to biofilm was accompanied by suppressed phosphorylation of MAPKs. Chemical inhibition of MAPKs did not drastically reduce cytokine production in BCM-treated keratinocytes suggesting that the majority of cytokine production is mediated through MAPK-independent mechanisms. Conclusions Collectively the results indicate that S

  14. Effect of casein genes - beta-LGB, DGAT1, GH, and LHR - on milk production and milk composition traits in crossbred Holsteins.

    Science.gov (United States)

    Molee, A; Poompramun, C; Mernkrathoke, P

    2015-03-30

    The objectives of this study were to determine the effects of a single gene and composite genotype of the casein gene family, including the beta-lactoglobulin gene (beta-LGB), acyl-CoA: diacylglycerol acyltransferase 1 gene (DGAT1), growth hormone gene (GH), and luteinizing hormone receptor gene (LHR) on milk yield, milk composition, the percentage of fat, protein, solids-not-fat, and total solid in crossbred Holsteins. A total of 231 crossbred Holstein cows were examined for the study. The genotype of the beta-casein gene was analyzed by allele-specific polymerase chain reaction, while the alpha-S1, alpha-S2, kappa-casein, DGAT1, beta-LGB, and GH genes were analyzed using a polymerase chain reaction-restriction fragment length polymorphism assay. The association between genes and milk yield and milk composition was analyzed. Three pairs of genes, for which significant associations were detected, were beta + kappa-casein, DGAT1 + beta-casein, and GH + beta-LGB. In the single-gene model, most loci are significantly associated with traits. A significant association between the composite genotype and the traits was detected in all composite genotypes. GH + beta-LGB appears to be the most suitable variants for improving milk production and percentage of milk protein. Overall, the effects of the composite genotype and single gene were different. A physical or functional relationship between genes is necessary for investigating gene markers.

  15. Detection and Diversity evaluation of tetracycline resistance genes in grassland-based production systems in Colombia, South America

    Directory of Open Access Journals (Sweden)

    Johanna eSantamaría

    2011-12-01

    Full Text Available Grassland-based production systems use approximately 26 percent of land surface on earth. However, there are no evaluations of these systems as a source of antibiotic pollution. This study was conducted to evaluate the presence, diversity, and distribution of tetracycline resistance genes in the grasslands of the Colombian Andes, where administration of antibiotics to animals is limited to treat disease and growth promoters are not included in animals’ diet. Animal (ruminal fluid and feces and environmental (soil and water samples were collected from six different dairy cattle farms and evaluated by PCR for the genes encoding ribosomal protection proteins (RPPs tet(M, tet(O, tetB(P, tet(Q tet(W, tet(S, tet(T, tet(A, and tetracycline efflux pumps tet(A, tet(B, tet(D, tet(H, tet(J, tet(Z, and tet(D. A wide distribution and high frequency for genes tet(W and tet(Q were found in both sample types. Other genes encoding RPPs ( tetB(P, tet(O, tet(M, tet(S and tet(T were detected at lower frequencies and more restricted distributions. Genes encoding efflux pumps were not common in this region, and only two of them, tet(B and tet(Z, were detected. DGGE-PCR followed by comparative sequence analysis of tet(W and tet(Q showed that the sequences detected in animals did not differ from those coming from soil and water, suggesting the transmission of tet genes from animal reservoirs to the environment. Additionally, there seems to be a differential flow of tet genes from one reservoir to the other because gene tet(O and tetB(P, detected in high frequencies in feces, were detected in low frequencies or not detected at all in the environment. Finally, the farms sampled in this study showed more than 50% similarity in relation to the tet genes detected and their frequencies. However, farms closer in space and under the influence of the same hydrographic network were significantly more similar to each other.

  16. Enhancing hydrogen production of Enterobacter aerogenes by heterologous expression of hydrogenase genes originated from Synechocystis sp.

    Science.gov (United States)

    Song, Wenlu; Cheng, Jun; Zhao, Jinfang; Zhang, Chuanxi; Zhou, Junhu; Cen, Kefa

    2016-09-01

    The hydrogenase genes (hoxEFUYH) of Synechocystis sp. PCC 6803 were cloned and heterologously expressed in Enterobacter aerogenes ATCC13408 for the first time in this study, and the hydrogen yield was significantly enhanced using the recombinant strain. A recombinant plasmid containing the gene in-frame with Glutathione-S-Transferase (GST) gene was transformed into E. aerogenes ATCC13408 to produce a GST-fusion protein. SDS-PAGE and western blot analysis confirm the successful expression of the hox genes. The hydrogenase activity of the recombinant strain is 237.6±9.3ml/(g-DW·h), which is 152% higher than the wild strain. The hydrogen yield of the recombinant strain is 298.3ml/g-glucose, which is 88% higher than the wild strain. During hydrogen fermentation, the recombinant strain produces more acetate and butyrate, but less ethanol. This is corresponding to the NADH metabolism in the cell due to the higher hydrogenase activity with the heterologous expression of hox genes. PMID:27343449

  17. VH Replacement Footprint Analyzer-I, a Java-Based Computer Program for Analyses of Immunoglobulin Heavy Chain Genes and Potential VH Replacement Products in Human and Mouse.

    Science.gov (United States)

    Huang, Lin; Lange, Miles D; Zhang, Zhixin

    2014-01-01

    VH replacement occurs through RAG-mediated secondary recombination between a rearranged VH gene and an upstream unrearranged VH gene. Due to the location of the cryptic recombination signal sequence (cRSS, TACTGTG) at the 3' end of VH gene coding region, a short stretch of nucleotides from the previous rearranged VH gene can be retained in the newly formed VH-DH junction as a "footprint" of VH replacement. Such footprints can be used as markers to identify Ig heavy chain (IgH) genes potentially generated through VH replacement. To explore the contribution of VH replacement products to the antibody repertoire, we developed a Java-based computer program, VH replacement footprint analyzer-I (VHRFA-I), to analyze published or newly obtained IgH genes from human or mouse. The VHRFA-1 program has multiple functional modules: it first uses service provided by the IMGT/V-QUEST program to assign potential VH, DH, and JH germline genes; then, it searches for VH replacement footprint motifs within the VH-DH junction (N1) regions of IgH gene sequences to identify potential VH replacement products; it can also analyze the frequencies of VH replacement products in correlation with publications, keywords, or VH, DH, and JH gene usages, and mutation status; it can further analyze the amino acid usages encoded by the identified VH replacement footprints. In summary, this program provides a useful computation tool for exploring the biological significance of VH replacement products in human and mouse.

  18. The Impact of Kappa Casein Gene Polymorphism on Milk Components and Other Productive Performance Traits of Chinese Holstein Cattle

    Directory of Open Access Journals (Sweden)

    A. E. Hamza1, 2, Z. P.Yang1*, X. L. Wang1, R. J. Chen1, H. T. Wu1 and A. I. Ibrahim3

    2011-04-01

    Full Text Available Polymorphism of kappa casein gene (κ-Cn at exon 5 in 259 Chinese Holstein cattle was investigated using polymerase chain reaction-single strand conformation (PCR-SSCP technique, to verify its effect on milk composition (fat, protein, lactose, total solids (TS and solids not fat (SNF content and influence of other factors such as parity and season of calving; aiming at utilizing it as a genetic aid in selection to improve the quality of production of this herd. A 218 bp fragment containing exon 1V of kappa casein gene was amplified by PCR and SSCP was applied to identify the structural gene polymorphism of κ-Cn. General linear model (GLM was used to analyze differences between genotypes. The results indicated that κ-Cn genotypes significantly (P0.05 on TS and SNF. However, cows with genotype TT showed higher fat and protein contents (3.89 and 3.50%, respectively than those of genotypes CC and TC (3.62 and 3.66% for fat; 3.35 and 3.36 % for protein, respectively. Except for lactose content; parity had no effect on milk components. Also, the results disclosed that season of calving did not affect (P>0.05 milk composition. This study indicated that the κ-Cn genetic variants may be used as a genetic aid through increasing the frequency of desired genotypes to improve the quality of production of this herd.

  19. ASSOCIATIONS BETWEEN POLYMORPHISM OF GROWTH HORMONE GENE WITH MILK PRODUCTION, FAT AND PROTEIN CONTENT IN FRIESIAN HOLSTEIN CATTLE

    Directory of Open Access Journals (Sweden)

    T. Hartatik

    2016-02-01

    Full Text Available The aim of the research was to determine the associations between polymorphism of the bovine growth hormone (GH gene (Leu/Val and milk production of Friesian Holstein Cattle. A total of 62 cows which consist of two Friesian Holstein cattle groups (from New Zealand=19 heads and Australia=43 heads were used for the research. We performed the Polymerase Chain Reaction and followed by Restriction Fragment Length Polymorphism using AluI restriction enzyme. The genotype was observed base on the target gene GH 211 bp in the part of intron 4 and exon 5 of growth hormone gene. The frequencies of genotypes LL were found higher than genotype LV in both groups. Friesian Holstein cattle from New Zealand showed the genotype LL and LV as 84% and 16%, respectively. Friesian Holstein cattle from Australia show the genotype LL and LV as 79% and 21%, respectively. The association between Leu/Val polymorphism on milk production, fat and protein content in both groups did not show the significant effect. Base on two groups of the origin of cattle, the result showed the significant different on fat and protein content of milk. Fat and protein contents of milk were higher in breed of FH imported from Australia compared to those in breed of FH imported from New Zailand.

  20. Lessons in détente or know thy host: the immunomodulatory gene products of myxoma virus.

    Science.gov (United States)

    Zúñiga, Martha C

    2003-04-01

    The poxvirus, myxoma virus, encodes within its genome at least eleven different proteins that compromise, skew, or disable the innate and adaptive responses of its hosts. In the laboratory rabbit, Oryctolagus cuniculus, these effects result in myxomatosis, a fatal condition characterized by skin lesions and systemic immunosuppression. Interestingly, while myxoma infection also causes skin lesions in its natural host and in natural populations of O. cuniculus in Australia where this novel host and the virus have co-evolved, the condition of myxomatosis does not ensue and infection is not fatal. In this review I discuss the biochemical properties of the characterized immunomodulatory proteins of myxoma virus, and their pathogenic effects in laboratory rabbits. Disruption of any one myxoma immunomodulatory gene diminishes the severity of the infection without compromising infectivity. Thus, the characterized immunomodulatory genes appear not to be required for a productive infection in vivo. The differences in the severity of their effects in laboratory-bred versus wild O. cuniculus suggest that the outcome of myxoma infection is a consequence of the interplay between the viral immunomodulatory gene products and the cells and molecules of the host immune system. PMID:12734406

  1. Cloning, reassembling and integration of the entire nikkomycin biosynthetic gene cluster into Streptomyces ansochromogenes lead to an improved nikkomycin production

    Directory of Open Access Journals (Sweden)

    Yang Haihua

    2010-01-01

    Full Text Available Abstract Background Nikkomycins are a group of peptidyl nucleoside antibiotics produced by Streptomyces ansochromogenes. They are competitive inhibitors of chitin synthase and show potent fungicidal, insecticidal, and acaricidal activities. Nikkomycin X and Z are the main components produced by S. ansochromogenes. Generation of a high-producing strain is crucial to scale up nikkomycins production for further clinical trials. Results To increase the yields of nikkomycins, an additional copy of nikkomycin biosynthetic gene cluster (35 kb was introduced into nikkomycin producing strain, S. ansochromogenes 7100. The gene cluster was first reassembled into an integrative plasmid by Red/ET technology combining with classic cloning methods and then the resulting plasmid(pNIKwas introduced into S. ansochromogenes by conjugal transfer. Introduction of pNIK led to enhanced production of nikkomycins (880 mg L-1, 4 -fold nikkomycin X and 210 mg L-1, 1.8-fold nikkomycin Z in the resulting exconjugants comparing with the parent strain (220 mg L-1 nikkomycin X and 120 mg L-1 nikkomycin Z. The exconjugants are genetically stable in the absence of antibiotic resistance selection pressure. Conclusion A high nikkomycins producing strain (1100 mg L-1 nikkomycins was obtained by introduction of an extra nikkomycin biosynthetic gene cluster into the genome of S. ansochromogenes. The strategies presented here could be applicable to other bacteria to improve the yields of secondary metabolites.

  2. Volatile Gas Production by Methyl Halide Transferase: An In Situ Reporter Of Microbial Gene Expression In Soil.

    Science.gov (United States)

    Cheng, Hsiao-Ying; Masiello, Caroline A; Bennett, George N; Silberg, Jonathan J

    2016-08-16

    Traditional visual reporters of gene expression have only very limited use in soils because their outputs are challenging to detect through the soil matrix. This severely restricts our ability to study time-dependent microbial gene expression in one of the Earth's largest, most complex habitats. Here we describe an approach to report on dynamic gene expression within a microbial population in a soil under natural water levels (at and below water holding capacity) via production of methyl halides using a methyl halide transferase. As a proof-of-concept application, we couple the expression of this gas reporter to the conjugative transfer of a bacterial plasmid in a soil matrix and show that gas released from the matrix displays a strong correlation with the number of transconjugant bacteria that formed. Gas reporting of gene expression will make possible dynamic studies of natural and engineered microbes within many hard-to-image environmental matrices (soils, sediments, sludge, and biomass) at sample scales exceeding those used for traditional visual reporting. PMID:27415416

  3. Targeted disruption of the mouse adenine phosphoribosyltransferase (aprt) gene and the production of APRT-deficient mice

    Energy Technology Data Exchange (ETDEWEB)

    Engle, S.J.; Chen, J.; Tischfield, J.A. [Indiana Univ., School of Medicine, Indianapolis, IN (United States)] [and others

    1994-09-01

    Adenine phosphoribosyltransferase (APRT: EC 2.4.2.7), a ubiquitously expressed purine salvage enzyme, catalyzes the synthesis of AMP and inorganic pyrophosphate from existing adenine and 5-phosphoribosyl-1-pyrophosphate. Deficiency of this enzyme in humans results in the accumulation of 2,8-dihydroxyadenine leading to crystalluria and nephrolithiasis. In order to facilitate our study of this rare, autosomal recessive disorder, we applied the advances in gene targeting technology and mouse embryonic stem (ES) cell culture to the production of APRT-deficient mice. A positive-negative targeting strategy was used. The tageting vector contain 5.6 kb of the mouse APRT gene, a neomycin resistance gene in exon 3 as a positive selection marker, and a HSV thymidine kinase gene at the 3{prime} end of the homology as a negative selection marker. The vector was introduced into D3 ES cells by electroporation and the cells were selected for G418 and ganciclovir (GANC) resistance. G418-GANC resistant clones were screened by Southern blot. One of several correctly targeted clones was expanded and used for blastocyst microinjection to produce chimeric mice. Chimeric animals were bred and agouti progeny heterozygous for the targeted allele were obtained. Heterozygous animals have been bred to produce APRT-deficient animals. Matings are currently underway to determine the phenotype of APRT/HPRT-deficient animals.

  4. A Sulfonylurea Herbicide Resistance Gene from Arabidopsis thaliana as a New Selectable Marker for Production of Fertile Transgenic Rice Plants.

    Science.gov (United States)

    Li, Z; Hayashimoto, A; Murai, N

    1992-10-01

    A mutant acetolactate synthase (ALS) gene, csr1-1, isolated from sulfonylurea herbicide-resistant Arabidopsis thaliana, was placed under control of a cauliflower mosaic virus 35S promoter (35S). Rice protoplasts were transformed with the 35S/ALS chimeric gene and regenerated into fertile transgenic rice (Oryza sativa) plants. The 35S/ALS gene was expressed effectively as demonstrated by northern blot hybridization analysis, and conferred to transformed calli at least 200-fold greater chlorsulfuron resistance than nontransformed control calli. Effective selection of 35S/ALS-transformed protoplasts was achieved at extremely low chlorsulfuron concentrations of 10 nm. The results demonstrated that the 35S/ALS gene is an alternative selectable marker for rice protoplast transformation and fertile transgenic rice production. The results also suggest that the mutant form of Arabidopsis ALS enzyme operates normally in rice cells. Thus, the mechanism of protein transport to chloroplast and ALS inhibition by chlorsulfuron is apparently conserved among plant species as diverse as Arabidopsis (dicotyledon) and rice (monocotyledon). PMID:16653044

  5. Prenatal exposure to dexamethasone disturbs sex-determining gene expression and fetal testosterone production in male embryos.

    Science.gov (United States)

    Yun, Hyo Jung; Lee, Ji-Yeon; Kim, Myoung Hee

    2016-02-26

    Prenatal stress is known to cause intrauterine fetal growth retardation, and is also associated with various long-term effects in the form of metabolic and neurodevelopmental diseases in adults. Many of the diseases associated with prenatal stress exhibit a sex bias. Perturbations and vulnerability to prenatal stress are often more profound in males, but the mechanisms responsible for this relationship are not clear. We have previously shown that administration of the synthetic glucocorticoid, dexamethasone (Dex), at embryonic days 7.5, 8.5, and 9.5, induces embryonic growth restriction in a sex-dependent manner in a mouse model. Here we examined the effect of prenatal exposure to Dex on gonadal development. During male gonadal development, sex-determining genes, such as Sry, Sox9, and other downstream genes, were found to be dysregulated in response to prenatal Dex, whereas the genes for the ovarian pathway were affected to a lesser degree in females. In addition, fetal testosterone concentrations were decreased by prenatal exposure to Dex, in parallel with reduced numbers of 3β-hydroxysteroid dehydrogenase (3β-HSD)-positive cells in the embryonic testis. These results show that prenatal exposure to Dex differentially influences male versus female on the gene expression and hormone production during sex determination. We believe these studies provide valuable insights into possible mechanisms responsible for sex-specific responses to prenatal stress. PMID:26827828

  6. Reprogramming Hansenula polymorpha for penicillin production : expression of the Penicillium chrysogenum pcl gene

    NARCIS (Netherlands)

    Gidijala, Loknath; van der Klei, Ida J.; Veenhuis, Marten; Kiel, Jan A. K. W.

    2007-01-01

    We aim to introduce the penicillin biosynthetic pathway into the methylotrophic yeast Hansenula polymorpha. To allow simultaneous expression of the multiple genes of the penicillin biosynthetic pathway, additional markers were required. To this end, we constructed a novel host-vector system based on

  7. BIOFILTRATION INCORPORATING GENE SILENCING TECHNOLOGY FOR THE PRODUCTION OF METHANOL FROM METHANE CONTAINING WASTE GASES

    Science.gov (United States)

    I expect the proposed and revised approach will work, as there are multiple examples of plasmid-based gene silencing systems in nature (HOK/SOK is a perfect example). The challenge will be in developing a strong plasmid for use in methanotrophs. Potential to ...

  8. Myostatin gene (MSTN polymorphism with a negative effect on meat productivity in Dzhalginsky Merino sheep breed

    Directory of Open Access Journals (Sweden)

    VLADIMIR TRUKHACHEV

    2015-08-01

    Full Text Available One of the most important negative regulator of muscle grow in mammalians is myostatin. Some mutations in myostatin gene (MSTN can decrease the effect of protein and play role in meat quality of sheep. Therefore, in genome selection, knowledge of MSTN gene structure is very important. We investigated the polymorphism of the MSTN gene and its influence on body parameters in Russian sheep breed Dzhalginsky Merino. To detect alleles, we use NimbleGen sequencing technolog. In this breed, we found 20 single nucleotide polymorphism (SNP. That is SNP in promoter: с.-1866, с.-1404, с.-1401, с.-1213, с.-1128, с.-958, с.-783; 5'UTR: с.-40; exon I: с.101; intron 1-2: c.373+18, c.373+241, c.373+243, c.373+259, c.373+563; intron 2-3: с.747+164, с.747+309, с.748-810, с.748-229G>A, с.748-475; 3'UTR: с.*1232. Three of detected SNP (c.-1128, c.-958, c.-40 have a negative effect on the body parameters – decrease weight, height and other. Other three SNP (c.101, c.373+18, с.*1232 have not significant influence on this parameters. Our investigation is a base of next research of affection of different MSTN gene alleles on meat quality and can be used to prepare a PCR test-system for genomic selection.

  9. Pollen and seed mediated gene flow in commercial alfalfa seed production fields

    Science.gov (United States)

    The potential for gene flow has been widely recognized since alfalfa is pollinated by bees. The Western US is a major exporter of alfalfa seed and hay and the organic dairy industry is one of the fastest growing agricultural sectors. Because of this, many alfalfa producers are impacted by market sen...

  10. Chlamydia trachomatis contains a protein similar to the Legionella pneumophila mip gene product

    DEFF Research Database (Denmark)

    Lundemose, AG; Birkelund, Svend; Fey, SJ;

    1991-01-01

    A 27kDa Chlamydia trachomatis L2 protein was characterized by the use of monoclonal antibodies and by two-dimensional gel electrophoresis. The protein was shown to be located in the membrane of reticulate bodies as well as elementary bodies. Its synthesis could be detected from 10 hours post-infe...... potentiator (mip) gene of Legionella pneumophila....

  11. Environmental effects on resistance gene expression in milk stage popcorn kernels and associations with mycotoxin production

    Science.gov (United States)

    Like other forms of maize, popcorn is subject to increased levels of contamination by a variety of different mycotoxins under stress conditions, although levels generally are less than dent maize under comparable stress. Gene array analysis was used to determine expression differences of disease res...

  12. Identification of the Pr1 gene product completes the anthocyanin biosynthesis pathway of maize

    Science.gov (United States)

    In maize, mutations in the pr1 locus lead to the accumulation of pelargonidin (red) rather than cyanidin (purple) pigments in aleurone cells where the anthocyanin biosynthetic pathway is active. We characterized pr1 mutation and isolated a putative F3'H encoding gene (Zmf3'h1), and showed by segrega...

  13. Expression of a cyanobacterial {del}{sup 6}-desaturase gene results in {gamma}-linolenic acid production in transgenic plants

    Energy Technology Data Exchange (ETDEWEB)

    Reddy, A.S.; Thomas, T.L. [Texas A & M Univ., College Station, TX (United States)

    1996-05-01

    Gamma-linolenic acid (GLA), a nutritionally important fatty acid in human and animal diets, is not produced in oil seed crops. Many oil seed plants, however, produce significant quantities of linoleic acid, a fatty acid that could be converted to GLA by the enzyme {del}{sup 6}-desaturase if it were present. As a first step to producing GLA in oil seed crops, we have cloned a cyanobacterial {del}{sup 6}-desaturase gene. Expression of this gene in transgenic tobacco resulted in GLA accumulation. Octadecatetraenoic acid, a highly unsaturated, industrially important fatty acid, was also found in transgenic tobacco plants expressing the cyanobacterial {del}{sup 6}-desaturase. This is the first example of engineering the production of `novel` polyunsaturated fatty acids in transgenic plants. 28 refs., 4 figs., 1 tab.

  14. Identification of a novel gene product that promotes survival of Mycobacterium smegmatis in macrophages.

    Directory of Open Access Journals (Sweden)

    Assunta Pelosi

    Full Text Available BACKGROUND: Bacteria of the suborder Corynebacterineae include significant human pathogens such as Mycobacterium tuberculosis and M. leprae. Drug resistance in mycobacteria is increasingly common making identification of new antimicrobials a priority. Mycobacteria replicate intracellularly, most commonly within the phagosomes of macrophages, and bacterial proteins essential for intracellular survival and persistence are particularly attractive targets for intervention with new generations of anti-mycobacterial drugs. METHODOLOGY/PRINCIPAL FINDINGS: We have identified a novel gene that, when inactivated, leads to accelerated death of M. smegmatis within a macrophage cell line in the first eight hours following infection. Complementation of the mutant with an intact copy of the gene restored survival to near wild type levels. Gene disruption did not affect growth compared to wild type M. smegmatis in axenic culture or in the presence of low pH or reactive oxygen intermediates, suggesting the growth defect is not related to increased susceptibility to these stresses. The disrupted gene, MSMEG_5817, is conserved in all mycobacteria for which genome sequence information is available, and designated Rv0807 in M. tuberculosis. Although homology searches suggest that MSMEG_5817 is similar to the serine:pyruvate aminotransferase of Brevibacterium linens suggesting a possible role in glyoxylate metabolism, enzymatic assays comparing activity in wild type and mutant strains demonstrated no differences in the capacity to metabolize glyoxylate. CONCLUSIONS/SIGNIFICANCE: MSMEG_5817 is a previously uncharacterized gene that facilitates intracellular survival of mycobacteria. Interference with the function of MSMEG_5817 may provide a novel therapeutic approach for control of mycobacterial pathogens by assisting the host immune system in clearance of persistent intracellular bacteria.

  15. Effects of Cytokine IL-18 Gene on Antibody Production Induced by Ag85A DNA Vaccine

    Institute of Scientific and Technical Information of China (English)

    CHENHai-wen; WANGZi-ming; FANXiong-lin; GANWei-min; SHITao; XUZhi-kai; LIYuan

    2004-01-01

    Objective: To investigate the effects of plasmid containing human IL-18 gene on the humoral immune response of mice immunized by Ag85A DNA vaccines of Mycobacterium tuberculosis H37 Rv strain. Methods: Human IL-18 cDNA was amplified from RNA of peripheral blood mononuclear cells(PBMCs)by RT-PCR and cloned into the pGEM-TEasy vector.After sequencing IL-18 gene was subcloned into the the sites of BamH I and EooR I digestion of pcDNA3.1. BALB/c mice were injected intramuscularly with eukaryotic expression plasmid pclL18, together with MTB pcAg85A DNA vaccines. The same immunization was repeated three times at intervals of two weeks. Mouse serawere collected at two weeks after the each injection. The titers of anti-Ag85A antibody were detected by ELISA. Results:IL-18 cDNA was amplified successfully from RNA of human PBMCs by RT-PCR and the result of sequencing was correct. The IL-18 gene was correctly inserted into the vector pcDNA3.1, which was confirmed with BamH I and EooR I digestion analysis. The positive plasmid was called pcIL18.After being immtmized with DNA vaccines,the titers of antibody obtained from mice being immtmized by pcAg85A combining with pclL18 were superior to mice inmunized by pcAg85A independently. Conc/us/on: Combination of IL-18 gene with MTB pcAg85A DNA vaccine could observably enhance the humoral immune responses to pcAg85A. It remains further investigated whether IL-18 gene plus MTB pcAg85A DNA vaccine could markedly induce the cellular mediated immune response to Ag85A or not.

  16. Structural analysis of the RH-like blood group gene products in nonhuman primates

    Energy Technology Data Exchange (ETDEWEB)

    Salvignol, I. [Centre Regional de Transfusion Sanguine, Toulouse (France); Calvas, P.; Blancher, A. [Universitaire d`Immunogenetique moleculaire, Toulouse (France); Socha, W.W. [University Medical Center, New York, NY (United States); Colin, Y.; Le Van Kim, C.; Bailly, P.; Cartron, J.P. [Institut National de la Transfusion Sanguine, Paris (France); Ruffie, J.; Blancher, A. [College de France, Paris (France)

    1995-03-01

    Rh-related transcripts present in bone marrow samples from several species of nonhuman primates (chimpanzee, gorilla, gibbon, crab-eating macaque) have been amplified by RT-polymerase chain reaction using primers deduced from the sequence of human RH genes. Nucleotide sequence analysis of the nonhuman transcripts revealed a high degree of similarity to human blood group Rh sequences, suggesting a great conservation of the RH genes throughout evolution. Full-length transcripts, potentially encoding 417 amino acid long proteins homologous to Rh polypeptides, were characterized, as well as mRNA isoforms which harbored nucleotide deletions or insertions and potentially encode truncated proteins. Proteins of 30-40,000 M{sub r}, immunologically related to human Rh proteins, were detected by western blot analysis with antipeptide antibodies, indicating that Rh-like transcripts are translated into membrane proteins. Comparison of human and nonhuman protein sequences was pivotal in clarifying the molecular basis of the blood group C/c polymorphism, showing that only the Pro103Ser substitution was correlated with C/c polymorphism. In addition, it was shown that a proline residue at position 102 was critical in the expression of C and c epitopes, most likely by providing an appropriate conformation of Rh polypeptides. From these data a phylogenetic reconstruction of the RH locus evolution has been calculated from which an unrooted phylogenetic tree could be proposed, indicating that African ape Rh-like genes would be closer to the human RhD gene than to the human RhCE gene. 55 refs., 4 figs., 1 tab.

  17. Evaluation of bovine chemerin (RARRES2 gene variation on beef cattle production traits

    Directory of Open Access Journals (Sweden)

    Amanda K Lindholm-Perry

    2012-03-01

    Full Text Available A previous study in cattle based on >48,000 markers identified markers on chromosome 4 near the chemerin gene associated with average daily feed intake (ADFI in steers (P<0.008. Chemerin is an adipokine associated with obesity and metabolic syndrome in humans, representing a strong candidate gene potentially underlying the observed association. To evaluate whether the bovine chemerin gene is involved in feed intake, 16 markers within and around the gene were tested for association in the same resource population. Eleven were nominally significant for ADFI (P<0.05 and two were significant after Bonferroni correction. Two and five SNP in this region were nominally significant for the related traits of average daily gain (ADG and residual feed intake (RFI, respectively. All markers were evaluated for effects on meat quality and carcass phenotypes. Many of the markers associated with ADFI were associated with hot carcass weight (HCW, adjusted fat thickness (AFT, and marbling (P<0.05. Marker alleles that were associated with lower ADFI were also associated with lower HCW, AFT, and marbling. Markers associated with ADFI were genotyped in a validation population of steers representing 14 breeds to determine predictive merit across populations. No consistent relationships for ADFI were detected. To determine whether cattle feed intake or growth phenotypes might be related to chemerin transcript abundance, the expression of chemerin was evaluated in adipose of 114 heifers that were siblings of the steers in the discovery population. Relative chemerin transcript abundance was not correlated with ADFI, ADG, or RFI, but associations with body condition score and yearling weight were observed. We conclude that variation in the chemerin gene may underlie observed association in the resource population, but that additional research is required to determine if this variation is widespread among breeds and to develop robust markers with predictive merit across

  18. Wild-type Escherichia coli producing microcins B17, D93, J25, and L; cloning of genes for microcin L production and immunity.

    Science.gov (United States)

    Sablé, S; Duarte, M; Bravo, D; Lanneluc, I; Pons, A M; Cottenceau, G; Moreno, F

    2003-05-01

    For the first time, an Escherichia coli strain producing four microcins (Mcc), B17, D93, J25, and L, and showing immunity to Mcc V was isolated and characterized. Each of the gene clusters encoding the production of Mcc B17, D93, and L was cloned separately. The gene cluster for Mcc L was cloned within a 13.5-kb HindIII-SalI fragment, which includes the Mcc V immunity gene, cvi.

  19. Accumulation of VH Replacement Products in IgH Genes Derived from Autoimmune Diseases and Anti-Viral Responses in Human.

    Science.gov (United States)

    Lange, Miles D; Huang, Lin; Yu, Yangsheng; Li, Song; Liao, Hongyan; Zemlin, Michael; Su, Kaihong; Zhang, Zhixin

    2014-01-01

    VH replacement refers to RAG-mediated secondary recombination of the IgH genes, which renews almost the entire VH gene coding region but retains a short stretch of nucleotides as a VH replacement footprint at the newly generated VH-DH junction. To explore the biological significance of VH replacement to the antibody repertoire, we developed a Java-based VH replacement footprint analyzer program and analyzed the distribution of VH replacement products in 61,851 human IgH gene sequences downloaded from the NCBI database. The initial assignment of the VH, DH, and JH gene segments provided a comprehensive view of the human IgH repertoire. To our interest, the overall frequency of VH replacement products is 12.1%; the frequencies of VH replacement products in IgH genes using different VH germline genes vary significantly. Importantly, the frequencies of VH replacement products are significantly elevated in IgH genes derived from different autoimmune diseases, including rheumatoid arthritis, systemic lupus erythematosus, and allergic rhinitis, and in IgH genes encoding various autoantibodies or anti-viral antibodies. The identified VH replacement footprints preferentially encoded charged amino acids to elongate IgH CDR3 regions, which may contribute to their autoreactivities or anti-viral functions. Analyses of the mutation status of the identified VH replacement products suggested that they had been actively involved in immune responses. These results provide a global view of the distribution of VH replacement products in human IgH genes, especially in IgH genes derived from autoimmune diseases and anti-viral immune responses.

  20. The piggyBac-Based Gene Delivery System Can Confer Successful Production of Cloned Porcine Blastocysts with Multigene Constructs.

    Science.gov (United States)

    Sato, Masahiro; Maeda, Kosuke; Koriyama, Miyu; Inada, Emi; Saitoh, Issei; Miura, Hiromi; Ohtsuka, Masato; Nakamura, Shingo; Sakurai, Takayuki; Watanabe, Satoshi; Miyoshi, Kazuchika

    2016-01-01

    The introduction of multigene constructs into single cells is important for improving the performance of domestic animals, as well as understanding basic biological processes. In particular, multigene constructs allow the engineering and integration of multiple genes related to xenotransplantation into the porcine genome. The piggyBac (PB) transposon system allows multiple genes to be stably integrated into target genomes through a single transfection event. However, to our knowledge, no attempt to introduce multiple genes into a porcine genome has been made using this system. In this study, we simultaneously introduced seven transposons into a single porcine embryonic fibroblast (PEF). PEFs were transfected with seven transposons containing genes for five drug resistance proteins and two (red and green) fluorescent proteins, together with a PB transposase expression vector, pTrans (experimental group). The above seven transposons (without pTrans) were transfected concomitantly (control group). Selection of these transfected cells in the presence of multiple selection drugs resulted in the survival of several clones derived from the experimental group, but not from the control. PCR analysis demonstrated that approximately 90% (12/13 tested) of the surviving clones possessed all of the introduced transposons. Splinkerette PCR demonstrated that the transposons were inserted through the TTAA target sites of PB. Somatic cell nuclear transfer (SCNT) using a PEF clone with multigene constructs demonstrated successful production of cloned blastocysts expressing both red and green fluorescence. These results indicate the feasibility of this PB-mediated method for simultaneous transfer of multigene constructs into the porcine cell genome, which is useful for production of cloned transgenic pigs expressing multiple transgenes. PMID:27589724

  1. The piggyBac-Based Gene Delivery System Can Confer Successful Production of Cloned Porcine Blastocysts with Multigene Constructs

    Science.gov (United States)

    Sato, Masahiro; Maeda, Kosuke; Koriyama, Miyu; Inada, Emi; Saitoh, Issei; Miura, Hiromi; Ohtsuka, Masato; Nakamura, Shingo; Sakurai, Takayuki; Watanabe, Satoshi; Miyoshi, Kazuchika

    2016-01-01

    The introduction of multigene constructs into single cells is important for improving the performance of domestic animals, as well as understanding basic biological processes. In particular, multigene constructs allow the engineering and integration of multiple genes related to xenotransplantation into the porcine genome. The piggyBac (PB) transposon system allows multiple genes to be stably integrated into target genomes through a single transfection event. However, to our knowledge, no attempt to introduce multiple genes into a porcine genome has been made using this system. In this study, we simultaneously introduced seven transposons into a single porcine embryonic fibroblast (PEF). PEFs were transfected with seven transposons containing genes for five drug resistance proteins and two (red and green) fluorescent proteins, together with a PB transposase expression vector, pTrans (experimental group). The above seven transposons (without pTrans) were transfected concomitantly (control group). Selection of these transfected cells in the presence of multiple selection drugs resulted in the survival of several clones derived from the experimental group, but not from the control. PCR analysis demonstrated that approximately 90% (12/13 tested) of the surviving clones possessed all of the introduced transposons. Splinkerette PCR demonstrated that the transposons were inserted through the TTAA target sites of PB. Somatic cell nuclear transfer (SCNT) using a PEF clone with multigene constructs demonstrated successful production of cloned blastocysts expressing both red and green fluorescence. These results indicate the feasibility of this PB-mediated method for simultaneous transfer of multigene constructs into the porcine cell genome, which is useful for production of cloned transgenic pigs expressing multiple transgenes. PMID:27589724

  2. Use of aiiA gene amplification for AHL-lactonase production from endophytic bacterium Enterobacter species.

    Science.gov (United States)

    Rajesh, P S; Rai, V Ravishankar

    2015-01-01

    AHL-lactonase has gained renewed interest due to biotechnological applications such as antiquorum sensing, antibiofilm strategies, biofouling, etc. In our study, the production of AHL-lactonase from endophytic bacteria Enterobacter aerogenes VT66 was optimized by response surface methodology (RSM) using central composite design (CCD) for four different cultural conditions. The relative activity of AHL-lactonase was correlated with amplification of aiiA homologous gene amplification with respect to cultural conditions. Statistical analysis by ANOVA of the quadratic regression model showed that the RSM model constructed is highly significant, as indicated by F-test with a low probability value (p(model) < 0.0001) and high regression coefficient (0.9997) as well as lower coefficient of variation (1.86%) indicate that suitability of variable parameters. The quadratic regression model of AHL-lactonase production in terms of relative activity was built and the optimal cultural conditions for maximum enzyme production were determined as 32.5 °C temperature, pH 7.0, 350 μM of substrate concentration and 33 h of incubation time. The enhanced AHL-lactonase yielded 1.33 fold increases in relative activity and it positively correlated with the amplification of aiiA gene. PMID:25451751

  3. Sodium houttuyfonate affects production of N-acyl homoserine lactone and quorum sensing-regulated genes expression in Pseudomonas aeruginosa

    Directory of Open Access Journals (Sweden)

    Daqiang eWu

    2014-11-01

    Full Text Available Quorum sensing (QS is a means of cell-to-cell communication that uses diffusible signaling molecules that are sensed by the population to determine population density, thus allowing co-ordinate gene regulation in response to population density. In Pseudomonas aeruginosa, production of the QS signaling molecule, N-acyl homoserine lactone (AHL, co-ordinates expression of key factors of pathogenesis, including biofilm formation and toxin secretion. It is predicted that the inhibition of AHL sensing would provide an effective clinical treatment to reduce the expression of virulence factors and increase the effectiveness of antimicrobial agents. We previously demonstrated that sodium houttuyfonate (SH, commonly used in traditional Chinese medicine to treat infectious diseases, can effectively inhibit QS-regulated processes, including biofilm formation. Here, using a model system, we demonstrate that SH causes the dose-dependent inhibition of AHL production, through down-regulation of the AHL biosynthesis gene, lasI. Addition of SH also resulted in down-regulation of expression of the AHL sensor and transcriptional regulator, LasR, and inhibited the production of the QS-regulated virulence factors, pyocyanin and LasA. These results suggest that the antimicrobial activity of SH may be due to its ability to disrupt QS in P. aeruginosa.

  4. PCR detection of seven virulence and toxin genes of Campylobacter jejuni and Campylobacter coli isolates from Danish pigs and cattle and cytolethal distending toxin production of the isolates

    DEFF Research Database (Denmark)

    Bang, Dang Duong; Nielsen, E.M.; Scheutz, F.;

    2003-01-01

    Aims: To study the prevalence of seven virulence and toxin genes, and cytolethal distending toxin (CDT) production of Campylobacter jejuni and C. coli isolates from Danish pigs and cattle. Methods and Results: The presence of the cadF, ceuE, virB11, flaA, cdtA, cdtB, cdtC and the cdt gene cluster...

  5. Design and construction of a first-generation high-throughput integrated molecular biology platform for production of optimized synthetic genes and improved industrial strains

    Science.gov (United States)

    The molecular biological techniques for plasmid-based assembly and cloning of synthetic assembled gene open reading frames are essential for elucidating the function of the proteins encoded by the genes. These techniques involve the production of full-length cDNA libraries as a source of plasmid-bas...

  6. Cyclic Lipopeptide Biosynthetic Genes and Products, and Inhibitory Activity of Plant-Associated Bacillus against Phytopathogenic Bacteria.

    Directory of Open Access Journals (Sweden)

    Isabel Mora

    Full Text Available The antibacterial activity against bacterial plant pathogens and its relationships with the presence of the cyclic lipopeptide (cLP biosynthetic genes ituC (iturin, bmyB (bacillomycin, fenD (fengycin and srfAA (surfactin, and their corresponding antimicrobial peptide products have been studied in a collection of 64 strains of Bacillus spp. isolated from plant environments. The most frequent antimicrobial peptide (AMP genes were bmyB, srfAA and fenD (34-50% of isolates. Most isolates (98.4% produced surfactin isoforms, 90.6% iturins and 79.7% fengycins. The antibacterial activity was very frequent and generally intense among the collection of strains because 75% of the isolates were active against at least 6 of the 8 bacterial plant pathogens tested. Hierarchical and correspondence analysis confirmed the presence of two clearly differentiated groups. One group consisted of Bacillus strains that showed a strong antibacterial activity, presented several cLPs genes and produced several isoforms of cLPs simultaneously, mainly composed of B. subtilis and B. amyloliquefaciens, although the last one was exclusive to this group. Another group was characterized by strains with very low or none antibacterial activity, that showed one or none of the cLP genes and produced a few or none of the corresponding cLPs, and was the most heterogenous group including B. subtilis, B. licheniformis, B. megaterium, B. pumilus, B. cereus and B. thuringiensis, although the last two were exclusive to this group. This work demonstrated that the antagonistic capacity of plant-associated Bacillus against plant pathogenic bacteria is related to the presence of cLP genes and to the production of the corresponding cLPs, and it is mainly associated to the species B. subtilis and B. amyloliquefaciens. Our findings would help to increase the yield and efficiency of screening methods to obtain candidate strains to biocontrol agents with a mechanism of action relaying on the

  7. Cyclic Lipopeptide Biosynthetic Genes and Products, and Inhibitory Activity of Plant-Associated Bacillus against Phytopathogenic Bacteria.

    Science.gov (United States)

    Mora, Isabel; Cabrefiga, Jordi; Montesinos, Emilio

    2015-01-01

    The antibacterial activity against bacterial plant pathogens and its relationships with the presence of the cyclic lipopeptide (cLP) biosynthetic genes ituC (iturin), bmyB (bacillomycin), fenD (fengycin) and srfAA (surfactin), and their corresponding antimicrobial peptide products have been studied in a collection of 64 strains of Bacillus spp. isolated from plant environments. The most frequent antimicrobial peptide (AMP) genes were bmyB, srfAA and fenD (34-50% of isolates). Most isolates (98.4%) produced surfactin isoforms, 90.6% iturins and 79.7% fengycins. The antibacterial activity was very frequent and generally intense among the collection of strains because 75% of the isolates were active against at least 6 of the 8 bacterial plant pathogens tested. Hierarchical and correspondence analysis confirmed the presence of two clearly differentiated groups. One group consisted of Bacillus strains that showed a strong antibacterial activity, presented several cLPs genes and produced several isoforms of cLPs simultaneously, mainly composed of B. subtilis and B. amyloliquefaciens, although the last one was exclusive to this group. Another group was characterized by strains with very low or none antibacterial activity, that showed one or none of the cLP genes and produced a few or none of the corresponding cLPs, and was the most heterogenous group including B. subtilis, B. licheniformis, B. megaterium, B. pumilus, B. cereus and B. thuringiensis, although the last two were exclusive to this group. This work demonstrated that the antagonistic capacity of plant-associated Bacillus against plant pathogenic bacteria is related to the presence of cLP genes and to the production of the corresponding cLPs, and it is mainly associated to the species B. subtilis and B. amyloliquefaciens. Our findings would help to increase the yield and efficiency of screening methods to obtain candidate strains to biocontrol agents with a mechanism of action relaying on the production of

  8. Large-scale production and evaluation of marker-free indica rice IR64 expressing phytoferritin genes.

    Science.gov (United States)

    Oliva, Norman; Chadha-Mohanty, Prabhjit; Poletti, Susanna; Abrigo, Editha; Atienza, Genelou; Torrizo, Lina; Garcia, Ruby; Dueñas, Conrado; Poncio, Mar Aristeo; Balindong, Jeanette; Manzanilla, Marina; Montecillo, Florencia; Zaidem, Maricris; Barry, Gerard; Hervé, Philippe; Shou, Huxia; Slamet-Loedin, Inez H

    2014-01-01

    Biofortification of rice (Oryza sativa L.) using a transgenic approach to increase the amount of iron in the grain is proposed as a low-cost, reliable, and sustainable solution to help developing countries combat anemia. In this study, we generated and evaluated a large number of rice or soybean ferritin over-accumulators in rice mega-variety IR64, including marker-free events, by introducing soybean or rice ferritin genes into the endosperm for product development. Accumulation of the protein was confirmed by ELISA, in situ immunological detection, and Western blotting. As much as a 37- and 19-fold increase in the expression of ferritin gene in single and co-transformed plants, respectively, and a 3.4-fold increase in Fe content in the grain over the IR64 wild type was achieved using this approach. Agronomic characteristics of a total of 1,860 progenies from 58 IR64 single independent transgenic events and 768 progenies from 27 marker-free transgenic events were evaluated and most trait characteristics did not show a penalty. Grain quality evaluation of high-Fe IR64 transgenic events showed quality similar to that of the wild-type IR64. To understand the effect of transgenes on iron homeostasis, transcript analysis was conducted on a subset of genes involved in iron uptake and loading. Gene expression of the exogenous ferritin gene in grain correlates with protein accumulation and iron concentration. The expression of NAS2 and NAS3 metal transporters increased during the grain milky stage. PMID:24482599

  9. The genes involved in production of and immunity to sakacin A, a bacteriocin from Lactobacillus sake Lb706.

    OpenAIRE

    Axelsson, L.; Holck, A

    1995-01-01

    Sakacin A is a small, heat-stable, antilisterial bacteriocin produced by Lactobacillus sake Lb706. The nucleotide sequence of a 8,668-bp fragment, shown to contain all information necessary for sakacin A production and immunity, was determined. The sequence revealed the presence of two divergently transcribed operons. The first encompassed the structural gene sapA (previously designated sakA) and saiA, which encoded a putative peptide of 90 amino acid residues. The second encompassed sapK (pr...

  10. Immediate-early gene product ICP22 inhibits the trans-transcription activating function of P53-mdm-2

    Institute of Scientific and Technical Information of China (English)

    GUO HongXiong; CUN Wei; LIU LongDing; WANG LiChun; ZHAO HongLing; DONG ChengHong; LI QiHan

    2007-01-01

    As a product of HSVI immediate-early gene, ICP22 is capable of interacting with various cellular transcriptive and regulatory molecules during viral infection so as to impact the normal cellular molecular mechanism. ICP22 expressed in transfected cells can push the cells' entering into S phase with binding to mdm-1 promoter region and impact its trans-transcription activating effect by P53. Consequently, the MDM-2 binds to P53, and the degradation effects by the ubiquitous pathway are decreased, improving indirectly the P53 levels in cells and making the cells progress into the S phase.

  11. Immediate-early gene product ICP22 inhibits the trans-transcription activating function of P53-mdm-2

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    As a product of HSVI immediate-early gene, ICP22 is capable of interacting with various cellular tran-scriptive and regulatory molecules during viral infection so as to impact the normal cellular molecular mechanism. ICP22 expressed in transfected cells can push the cells’ entering into S phase with binding to mdm-1 promoter region and impact its trans-transcription activating effect by P53. Consequently, the MDM-2 binds to P53, and the degradation effects by the ubiquitous pathway are decreased, improving indirectly the P53 levels in cells and making the cells progress into the S phase.

  12. DHA Production in Escherichia coli by Expressing Reconstituted Key Genes of Polyketide Synthase Pathway from Marine Bacteria.

    Science.gov (United States)

    Peng, Yun-Feng; Chen, Wen-Chao; Xiao, Kang; Xu, Lin; Wang, Lian; Wan, Xia

    2016-01-01

    The gene encoding phosphopantetheinyl transferase (PPTase), pfaE, a component of the polyketide synthase (PKS) pathway, is crucial for the production of docosahexaenoic acid (DHA, 22:6ω3), along with the other pfa cluster members pfaA, pfaB, pfaC and pfaD. DHA was produced in Escherichia coli by co-expressing pfaABCD from DHA-producing Colwellia psychrerythraea 34H with one of four pfaE genes from bacteria producing arachidonic acid (ARA, 20:4ω6), eicosapentaenoic acid (EPA, 20:5ω3) or DHA, respectively. Substitution of the pfaE gene from different strain source in E. coli did not influence the function of the PKS pathway producing DHA, although they led to different DHA yields and fatty acid profiles. This result suggested that the pfaE gene could be switchable between these strains for the production of DHA. The DHA production by expressing the reconstituted PKS pathway was also investigated in different E. coli strains, at different temperatures, or with the treatment of cerulenin. The highest DHA production, 2.2 mg of DHA per gram of dry cell weight or 4.1% of total fatty acids, was obtained by co-expressing pfaE(EPA) from the EPA-producing strain Shewanella baltica with pfaABCD in DH5α. Incubation at low temperature (10-15°C) resulted in higher accumulation of DHA compared to higher temperatures. The addition of cerulenin to the medium increased the proportion of DHA and saturated fatty acids, including C12:0, C14:0 and C16:0, at the expense of monounsaturated fatty acids, including C16:1 and C18:1. Supplementation with 1 mg/L cerulenin resulted in the highest DHA yield of 2.4 mg/L upon co-expression of pfaE(DHA) from C. psychrerythraea. PMID:27649078

  13. Production of Xylitol from d-Xylose by a Xylitol Dehydrogenase Gene-Disrupted Mutant of Candida tropicalis

    OpenAIRE

    Ko, Byoung Sam; Kim, Jinmi; Kim, Jung Hoe

    2006-01-01

    Xylitol dehydrogenase (XDH) is one of the key enzymes in d-xylose metabolism, catalyzing the oxidation of xylitol to d-xylulose. Two copies of the XYL2 gene encoding XDH in the diploid yeast Candida tropicalis were sequentially disrupted using the Ura-blasting method. The XYL2-disrupted mutant, BSXDH-3, did not grow on a minimal medium containing d-xylose as a sole carbon source. An enzyme assay experiment indicated that BSXDH-3 lost apparently all XDH activity. Xylitol production by BSXDH-3 ...

  14. Production of polyhydroxybutyrate in oil palm (Elaeis guineensis Jacq.) mediated by microprojectile bombardment of PHB biosynthesis genes into embryogenic calli

    OpenAIRE

    Parveez, Ghulam Kadir Ahmad; Bahariah, Bohari; Ayub, Nor Hanin; Masani, Mat Yunus Abdul; Rasid, Omar Abdul; Tarmizi, Ahmad Hashim; Ishak, Zamzuri

    2015-01-01

    Biodegradable plastics, mainly polyhydroxybutyrate (PHB), which are traditionally produced by bacterial cells, have been produced in the cells of more than 15 plant species. Since the production of biodegradable plastics and the synthesis of oil in plants share the same substrate, acetyl-coenzyme A (acetyl-CoA), producing PHB in oil bearing crops, such as oil palm, will be advantageous. In this study, three bacterial genes, bktB, phaB, and phaC, which are required for the synthesis of PHB and...

  15. Deletion of the Saccharomyces cerevisiae ARO8 gene, encoding an aromatic amino acid transaminase, enhances phenylethanol production from glucose.

    Science.gov (United States)

    Romagnoli, Gabriele; Knijnenburg, Theo A; Liti, Gianni; Louis, Edward J; Pronk, Jack T; Daran, Jean-Marc

    2015-01-01

    Phenylethanol has a characteristic rose-like aroma that makes it a popular ingredient in foods, beverages and cosmetics. Microbial production of phenylethanol currently relies on whole-cell bioconversion of phenylalanine with yeasts that harbour an Ehrlich pathway for phenylalanine catabolism. Complete biosynthesis of phenylethanol from a cheap carbon source, such as glucose, provides an economically attractive alternative for phenylalanine bioconversion. In this study, synthetic genetic array (SGA) screening was applied to identify genes involved in regulation of phenylethanol synthesis in Saccharomyces cerevisiae. The screen focused on transcriptional regulation of ARO10, which encodes the major decarboxylase involved in conversion of phenylpyruvate to phenylethanol. A deletion in ARO8, which encodes an aromatic amino acid transaminase, was found to underlie the transcriptional upregulation of ARO10 during growth, with ammonium sulphate as the sole nitrogen source. Physiological characterization revealed that the aro8Δ mutation led to substantial changes in the absolute and relative intracellular concentrations of amino acids. Moreover, deletion of ARO8 led to de novo production of phenylethanol during growth on a glucose synthetic medium with ammonium as the sole nitrogen source. The aro8Δ mutation also stimulated phenylethanol production when combined with other, previously documented, mutations that deregulate aromatic amino acid biosynthesis in S. cerevisiae. The resulting engineered S. cerevisiae strain produced >3 mm phenylethanol from glucose during growth on a simple synthetic medium. The strong impact of a transaminase deletion on intracellular amino acid concentrations opens new possibilities for yeast-based production of amino acid-derived products.

  16. MeSH-Informed Enrichment Analysis and MeSH-Guided Semantic Similarity Among Functional Terms and Gene Products in Chicken.

    Science.gov (United States)

    Morota, Gota; Beissinger, Timothy M; Peñagaricano, Francisco

    2016-01-01

    Biomedical vocabularies and ontologies aid in recapitulating biological knowledge. The annotation of gene products is mainly accelerated by Gene Ontology (GO), and more recently by Medical Subject Headings (MeSH). Here, we report a suite of MeSH packages for chicken in Bioconductor, and illustrate some features of different MeSH-based analyses, including MeSH-informed enrichment analysis and MeSH-guided semantic similarity among terms and gene products, using two lists of chicken genes available in public repositories. The two published datasets that were employed represent (i) differentially expressed genes, and (ii) candidate genes under selective sweep or epistatic selection. The comparison of MeSH with GO overrepresentation analyses suggested not only that MeSH supports the findings obtained from GO analysis, but also that MeSH is able to further enrich the representation of biological knowledge and often provide more interpretable results. Based on the hierarchical structures of MeSH and GO, we computed semantic similarities among vocabularies, as well as semantic similarities among selected genes. These yielded the similarity levels between significant functional terms, and the annotation of each gene yielded the measures of gene similarity. Our findings show the benefits of using MeSH as an alternative choice of annotation in order to draw biological inferences from a list of genes of interest. We argue that the use of MeSH in conjunction with GO will be instrumental in facilitating the understanding of the genetic basis of complex traits.

  17. Flagellar structure and hyperthermophily: analysis of a single flagellin gene and its product in Aquifex pyrophilus.

    OpenAIRE

    Behammer, W; Shao, Z; Mages, W; Rachel, R; Stetter, K O; Schmitt, R.

    1995-01-01

    The polytrichously inserted flagella of Aquifex pyrophilus, a marine hyperthermophilic bacterium growing at 85 degrees C, were isolated and purified. Electron micrographs of the 19-nm-diameter flagellar filaments show prominent helical arrays of subunits. The primary structure of these 54-kDa flagellin monomers determining the helical shape and heat stability of filaments was of particular interest. The genomic region encoding the flagellin subunit (flaA gene) and an upstream open reading fra...

  18. The HP0256 gene product is involved in motility and cell envelope architecture of Helicobacter pylori

    LENUS (Irish Health Repository)

    Douillard, Francois P

    2010-04-08

    Abstract Background Helicobacter pylori is the causative agent for gastritis, and peptic and duodenal ulcers. The bacterium displays 5-6 polar sheathed flagella that are essential for colonisation and persistence in the gastric mucosa. The biochemistry and genetics of flagellar biogenesis in H. pylori has not been fully elucidated. Bioinformatics analysis suggested that the gene HP0256, annotated as hypothetical, was a FliJ homologue. In Salmonella, FliJ is a chaperone escort protein for FlgN and FliT, two proteins that themselves display chaperone activity for components of the hook, the rod and the filament. Results Ablation of the HP0256 gene in H. pylori significantly reduced motility. However, flagellin and hook protein synthesis was not affected in the HP0256 mutant. Transmission electron transmission microscopy revealed that the HP0256 mutant cells displayed a normal flagellum configuration, suggesting that HP0256 was not essential for assembly and polar localisation of the flagella in the cell. Interestingly, whole genome microarrays of an HP0256 mutant revealed transcriptional changes in a number of genes associated with the flagellar regulon and the cell envelope, such as outer membrane proteins and adhesins. Consistent with the array data, lack of the HP0256 gene significantly reduced adhesion and the inflammatory response in host cells. Conclusions We conclude that HP0256 is not a functional counterpart of FliJ in H. pylori. However, it is required for full motility and it is involved, possibly indirectly, in expression of outer membrane proteins and adhesins involved in pathogenesis and adhesion.

  19. Posttranslational Modifications, Localization, and Protein Interactions of Optineurin, the Product of a Glaucoma Gene

    OpenAIRE

    Hongyu Ying; Xiang Shen; BumChan Park; Beatrice Y J T Yue

    2010-01-01

    BACKGROUND: Glaucoma is a major blinding disease. The most common form of this disease, primary open angle glaucoma (POAG), is genetically heterogeneous. One of the candidate genes, optineurin, is linked principally to normal tension glaucoma, a subtype of POAG. The present study was undertaken to illustrate the basic characteristics of optineurin. METHODOLOGY/PRINCIPAL FINDINGS: Lysates from rat retinal ganglion RGC5 cells were subjected to N- or O-deglycosylation or membrane protein extract...

  20. The Tangier disease gene product ABC1 controls the cellular apolipoprotein-mediated lipid removal pathway

    OpenAIRE

    Lawn, Richard M.; Wade, David P.; Garvin, Michael R.; Wang, Xingbo; Schwartz, Karen; Porter, J. Gordon; Seilhamer, Jeffrey J.; Ashley M Vaughan; Oram, John F.

    1999-01-01

    The ABC1 transporter was identified as the defect in Tangier disease by a combined strategy of gene expression microarray analysis, genetic mapping, and biochemical studies. Patients with Tangier disease have a defect in cellular cholesterol removal, which results in near zero plasma levels of HDL and in massive tissue deposition of cholesteryl esters. Blocking the expression or activity of ABC1 reduces apolipoprotein-mediated lipid efflux from cultured cells, and increasing expression of ABC...

  1. A Genetic Strategy to Measure Circulating Drosophila Insulin Reveals Genes Regulating Insulin Production and Secretion

    OpenAIRE

    Sangbin Park; Alfa, Ronald W.; Topper, Sydni M.; Grace E S Kim; Lutz Kockel; Kim, Seung K.

    2014-01-01

    Insulin is a major regulator of metabolism in metazoans, including the fruit fly Drosophila melanogaster. Genome-wide association studies (GWAS) suggest a genetic basis for reductions of both insulin sensitivity and insulin secretion, phenotypes commonly observed in humans with type 2 diabetes mellitus (T2DM). To identify molecular functions of genes linked to T2DM risk, we developed a genetic tool to measure insulin-like peptide 2 (Ilp2) levels in Drosophila, a model organism with superb exp...

  2. A cell engineering strategy to enhance supercoiled plasmid DNA production for gene therapy

    OpenAIRE

    Hassan, S.; Keshavarz-Moore, E.; J. Ward

    2016-01-01

    With the recent revival of the promise of plasmid DNA vectors in gene therapy, a novel synthetic biology approach was used to enhance the quantity, (yield), and quality of the plasmid DNA. Quality was measured by percentage supercoiling and supercoiling density, as well as improving segregational stability in fermentation. We examined the hypothesis that adding a Strong Gyrase binding Site (SGS) would increase DNA gyrase-mediated plasmid supercoiling. SGS from 3 different replicons, (the Mu b...

  3. Arabidopsis ethylene-response gene ETR1: Similiarity of product to two-component regulators

    Energy Technology Data Exchange (ETDEWEB)

    Chang, C.; Kwok, S.F.; Bleecker, A.B.; Meyerowitz, E.M. (California Institute of Technology, Pasadena, CA (United States))

    1993-10-22

    Ethylene behaves as a hormone in plants, regulating such aspects of growth and development as fruit ripening, flower senescence, and abscission. Ethylene insensitivity is conferred by dominant mutations in the ETR1 gene early in the ethylene signal transduction pathway of Arabidopsis thaliana. The ETR1 gene was cloned by the method of chromosome walking. Each of the four known etr1 mutant alleles contains a missense mutation near the amino terminus of the predicted protein. Although the sequence of the amino-terminal half of the deduced ETR1 protein appears to be novel, the carboxyl-terminal half is similar in sequence to both components of the prokaryotic family of signal transducers known as the two-component systems. Thus, an early step in ethylene signal transduction in plants may involve transfer of phosphate as in prokaryotic two-component systems. The dominant etr1-1 mutant gene conferred ethylene insensitivity to wild-type Arabidopsis plants when introduced by transformation.

  4. A single ataxia telangiectasia gene with a product similar to PI-3 kinase

    Energy Technology Data Exchange (ETDEWEB)

    Savitsky, K.; Bar-Shira, A.; Gilad, S.; Rotman, G.; Ziv, Y.; Vanagaite, L.; Smith, S.; Uziel, T.; Sfez, S.; Ashkenazi, M. [Tel Aviv Univ. (Israel)] [and others

    1995-06-23

    A gene, ATM, that is mutated in the autosomal recessive disorder ataxia telangiectasia (AT) was identified by positional cloning on chromosome 11q22-23. AT is characterized by cerebellar degeneration, immunodeficiency, chromosomal instability, cancer predisposition, radiation sensitivity, and cell cycle abnormalities. The disease is genetically heterogeneous, with four complementation groups that have been suspected to represent different genes. ATM, which has a transcript of 12 kilobases, was found to be mutated in AT patients from all complementation groups, indicating that it is probably the sole gene responsible for this disorder. A partial ATM complementary DNA clone of 5.9 kilobases encoded a putative protein that is similar to several yeast and mammalian phosphatidylinositol-3{prime} kinases that are involved in mitogenic signal transduction, meiotic recombination, and cell cycle control. The discovery of ATM should enhance understanding of AT and related syndromes and may allow the identification of AT heterozygotes, who are at increased risk of cancer. 54 refs., 5 figs., 1 tab.

  5. Whole-Genome Microarray and Gene Deletion Studies Reveal Regulation of the Polyhydroxyalkanoate Production Cycle by the Stringent Response in Ralstonia eutropha H16

    Energy Technology Data Exchange (ETDEWEB)

    Brigham, CJ; Speth, DR; Rha, C; Sinskey, AJ

    2012-10-22

    Poly(3-hydroxybutyrate) (PHB) production and mobilization in Ralstonia eutropha are well studied, but in only a few instances has PHB production been explored in relation to other cellular processes. We examined the global gene expression of wild-type R. eutropha throughout the PHB cycle: growth on fructose, PHB production using fructose following ammonium depletion, and PHB utilization in the absence of exogenous carbon after ammonium was resupplied. Our results confirm or lend support to previously reported results regarding the expression of PHB-related genes and enzymes. Additionally, genes for many different cellular processes, such as DNA replication, cell division, and translation, are selectively repressed during PHB production. In contrast, the expression levels of genes under the control of the alternative sigma factor sigma(54) increase sharply during PHB production and are repressed again during PHB utilization. Global gene regulation during PHB production is strongly reminiscent of the gene expression pattern observed during the stringent response in other species. Furthermore, a ppGpp synthase deletion mutant did not show an accumulation of PHB, and the chemical induction of the stringent response with DL-norvaline caused an increased accumulation of PHB in the presence of ammonium. These results indicate that the stringent response is required for PHB accumulation in R. eutropha, helping to elucidate a thus-far-unknown physiological basis for this process.

  6. Optimization to the Culture Conditions for Phellinus Production with Regression Analysis and Gene-Set Based Genetic Algorithm.

    Science.gov (United States)

    Li, Zhongwei; Xin, Yuezhen; Wang, Xun; Sun, Beibei; Xia, Shengyu; Li, Hui; Zhu, Hu

    2016-01-01

    Phellinus is a kind of fungus and is known as one of the elemental components in drugs to avoid cancers. With the purpose of finding optimized culture conditions for Phellinus production in the laboratory, plenty of experiments focusing on single factor were operated and large scale of experimental data were generated. In this work, we use the data collected from experiments for regression analysis, and then a mathematical model of predicting Phellinus production is achieved. Subsequently, a gene-set based genetic algorithm is developed to optimize the values of parameters involved in culture conditions, including inoculum size, PH value, initial liquid volume, temperature, seed age, fermentation time, and rotation speed. These optimized values of the parameters have accordance with biological experimental results, which indicate that our method has a good predictability for culture conditions optimization. PMID:27610365

  7. The promoter polymorphism of the interleukin-6 gene regulates interleukin-6 production in neonates but not in adults.

    Science.gov (United States)

    Kilpinen, S; Hulkkonen, J; Wang, X Y; Hurme, M

    2001-03-01

    In the promoter region of the IL-6 gene there is a single base exchange (G --> C) polymorphism at position -174. Recent findings suggest that this polymorphism may affect the transcription rate of the IL-6 gene and IL-6 plasma levels. To analyse its biological significance, we examined IL-6 plasma levels in cord blood and IL-6 production by neonatal cells after LPS-stimulation in relation to the presence of the IL-6G and IL-6C alleles. We hypothesized that since healthy neonates lack a previous exposure to exogenous antigens, their cytokine production could be genetically regulated. We also assumed that the normal labour-related stress could provide a physiological stimulus for IL-6 production. Cord blood was collected from 50 healthy, full-term neonates after normal vaginal delivery (VD) and from 42 healthy, full-term neonates after elective caesarean section (ECS). Adult samples were obtained from 450 healthy adult controls. The -174 polymorphism was analysed using PCR. IL-6 plasma levels and in vitro IL-6 production were measured using an ELISA method. Generally, IL-6 plasma levels in neonates were significantly higher than those in adults (neonates born by VD versus adults p < 0.001 and neonates born by ECS versus adults p < 0.001); the median value for neonates born by VD was 11.4 pg/ml (4.5-45.9), for neonates born by ECS 2.9 pg/ml (1.9-6.4) and for adults, 1.2 pg/ml (0.7-2.0). Surprisingly, cord blood IL-6 levels after VD differed significantly from those after ECS (p < 0.001). An analysis was carried out to ascertain if there was a genetic association between different IL-6 genotypes and IL-6 plasma levels in neonates. In the group of VD neonates with the CC genotype, non-carriers of the G allele, secreted significantly more IL-6 than carriers of the G allele (p < 0.03); 21.4 pg/ml (9.5-81.3) and 9.6 pg/ml (3.5-36.2) respectively. In line with this, ECS newborns with the CC genotype had higher IL-6 plasma levels than carriers of the G allele (p < 0

  8. Phylogenomic Analysis of Natural Products Biosynthetic Gene Clusters Allows Discovery of Arseno-Organic Metabolites in Model Streptomycetes.

    Science.gov (United States)

    Cruz-Morales, Pablo; Kopp, Johannes Florian; Martínez-Guerrero, Christian; Yáñez-Guerra, Luis Alfonso; Selem-Mojica, Nelly; Ramos-Aboites, Hilda; Feldmann, Jörg; Barona-Gómez, Francisco

    2016-01-01

    Natural products from microbes have provided humans with beneficial antibiotics for millennia. However, a decline in the pace of antibiotic discovery exerts pressure on human health as antibiotic resistance spreads, a challenge that may better faced by unveiling chemical diversity produced by microbes. Current microbial genome mining approaches have revitalized research into antibiotics, but the empirical nature of these methods limits the chemical space that is explored.Here, we address the problem of finding novel pathways by incorporating evolutionary principles into genome mining. We recapitulated the evolutionary history of twenty-three enzyme families previously uninvestigated in the context of natural product biosynthesis in Actinobacteria, the most proficient producers of natural products. Our genome evolutionary analyses where based on the assumption that expanded-repurposed enzyme families-from central metabolism, occur frequently and thus have the potential to catalyze new conversions in the context of natural products biosynthesis. Our analyses led to the discovery of biosynthetic gene clusters coding for hidden chemical diversity, as validated by comparing our predictions with those from state-of-the-art genome mining tools; as well as experimentally demonstrating the existence of a biosynthetic pathway for arseno-organic metabolites in Streptomyces coelicolor and Streptomyces lividans, Using a gene knockout and metabolite profile combined strategy.As our approach does not rely solely on sequence similarity searches of previously identified biosynthetic enzymes, these results establish the basis for the development of an evolutionary-driven genome mining tool termed EvoMining that complements current platforms. We anticipate that by doing so real 'chemical dark matter' will be unveiled. PMID:27289100

  9. Phylogenomic Analysis of Natural Products Biosynthetic Gene Clusters Allows Discovery of Arseno-Organic Metabolites in Model Streptomycetes

    Science.gov (United States)

    Cruz-Morales, Pablo; Kopp, Johannes Florian; Martínez-Guerrero, Christian; Yáñez-Guerra, Luis Alfonso; Selem-Mojica, Nelly; Ramos-Aboites, Hilda; Feldmann, Jörg; Barona-Gómez, Francisco

    2016-01-01

    Natural products from microbes have provided humans with beneficial antibiotics for millennia. However, a decline in the pace of antibiotic discovery exerts pressure on human health as antibiotic resistance spreads, a challenge that may better faced by unveiling chemical diversity produced by microbes. Current microbial genome mining approaches have revitalized research into antibiotics, but the empirical nature of these methods limits the chemical space that is explored. Here, we address the problem of finding novel pathways by incorporating evolutionary principles into genome mining. We recapitulated the evolutionary history of twenty-three enzyme families previously uninvestigated in the context of natural product biosynthesis in Actinobacteria, the most proficient producers of natural products. Our genome evolutionary analyses where based on the assumption that expanded—repurposed enzyme families—from central metabolism, occur frequently and thus have the potential to catalyze new conversions in the context of natural products biosynthesis. Our analyses led to the discovery of biosynthetic gene clusters coding for hidden chemical diversity, as validated by comparing our predictions with those from state-of-the-art genome mining tools; as well as experimentally demonstrating the existence of a biosynthetic pathway for arseno-organic metabolites in Streptomyces coelicolor and Streptomyces lividans, Using a gene knockout and metabolite profile combined strategy. As our approach does not rely solely on sequence similarity searches of previously identified biosynthetic enzymes, these results establish the basis for the development of an evolutionary-driven genome mining tool termed EvoMining that complements current platforms. We anticipate that by doing so real ‘chemical dark matter’ will be unveiled. PMID:27289100

  10. Phylogenomic Analysis of Natural Products Biosynthetic Gene Clusters Allows Discovery of Arseno-Organic Metabolites in Model Streptomycetes.

    Science.gov (United States)

    Cruz-Morales, Pablo; Kopp, Johannes Florian; Martínez-Guerrero, Christian; Yáñez-Guerra, Luis Alfonso; Selem-Mojica, Nelly; Ramos-Aboites, Hilda; Feldmann, Jörg; Barona-Gómez, Francisco

    2016-01-01

    Natural products from microbes have provided humans with beneficial antibiotics for millennia. However, a decline in the pace of antibiotic discovery exerts pressure on human health as antibiotic resistance spreads, a challenge that may better faced by unveiling chemical diversity produced by microbes. Current microbial genome mining approaches have revitalized research into antibiotics, but the empirical nature of these methods limits the chemical space that is explored.Here, we address the problem of finding novel pathways by incorporating evolutionary principles into genome mining. We recapitulated the evolutionary history of twenty-three enzyme families previously uninvestigated in the context of natural product biosynthesis in Actinobacteria, the most proficient producers of natural products. Our genome evolutionary analyses where based on the assumption that expanded-repurposed enzyme families-from central metabolism, occur frequently and thus have the potential to catalyze new conversions in the context of natural products biosynthesis. Our analyses led to the discovery of biosynthetic gene clusters coding for hidden chemical diversity, as validated by comparing our predictions with those from state-of-the-art genome mining tools; as well as experimentally demonstrating the existence of a biosynthetic pathway for arseno-organic metabolites in Streptomyces coelicolor and Streptomyces lividans, Using a gene knockout and metabolite profile combined strategy.As our approach does not rely solely on sequence similarity searches of previously identified biosynthetic enzymes, these results establish the basis for the development of an evolutionary-driven genome mining tool termed EvoMining that complements current platforms. We anticipate that by doing so real 'chemical dark matter' will be unveiled.

  11. Production of Transgenic Anliucheng Sweet Orange (Citrus sinensis Osbeck) with Xa21 Gene for Potential Canker Resistance

    Institute of Scientific and Technical Information of China (English)

    LI Ding-li; XIAO Xuan; and GUO Wen-wu

    2014-01-01

    Citrus canker, an epidemic quarantine disease caused by Xanthomonas axonopodis pv. citri, has brought a great damage in citrus production worldwide. Herein, a rice PRR (pattern recognition receptor) gene Xa21 together with GUS reporter gene and hygromycin phosphotransferase gene (HPT) was introduced into Anliucheng sweet orange (Citrus sinensis Osbeck) via Agrobacterium-mediated transformation of embryogenic callus. The transgenic calluses were screened on MT basal medium containing hygromycin (HYG) and detected by histochemical GUS staining. The transgenic plantlets were recovered through somatic embryogenesis pathway. The regenerated plantlets were accustomed to and maintained in the greenhouse. The transgene integration of recovered plantlets was identiifed by PCR and Southern blot hybridization. It showed that all the transgenic plantlets tested had undergone single copy integration, the expression of Xa21 in eight different transgenic lines detected by qRT-PCR can be divided into three grades, high for T5 and T6, middle for T4 and low for the rest. The tolerance to citrus canker disease of the three recovered transgenic lines T2, T4 and T6 was assessed by in vitro pin-puncture inoculation. The results showed that all the three transgenic lines conferred improved resistance to citrus canker bacterium infection and the T4 transgenic line displayed the highest resistance. The mechanism and feasibility of rice Xa21 in triggering innate immunity in citrus was brielfy discussed.

  12. Silencing of vacuolar invertase and asparagine synthetase genes and its impact on acrylamide formation of fried potato products.

    Science.gov (United States)

    Zhu, Xiaobiao; Gong, Huiling; He, Qunyan; Zeng, Zixian; Busse, James S; Jin, Weiwei; Bethke, Paul C; Jiang, Jiming

    2016-02-01

    Acrylamide is produced in a wide variety of carbohydrate-rich foods during high-temperature cooking. Dietary acrylamide is a suspected human carcinogen, and health concerns related to dietary acrylamide have been raised worldwide. French fries and potato chips contribute a significant proportion to the average daily intake of acrylamide, especially in developed countries. One way to mitigate health concerns related to acrylamide is to develop potato cultivars that have reduced contents of the acrylamide precursors asparagine, glucose and fructose in tubers. We generated a large number of silencing lines of potato cultivar Russet Burbank by targeting the vacuolar invertase gene VInv and the asparagine synthetase genes StAS1 and StAS2 with a single RNA interference construct. The transcription levels of these three genes were correlated with reducing sugar (glucose and fructose) and asparagine content in tubers. Fried potato products from the best VInv/StAS1/StAS2-triple silencing lines contained only one-fifteenth of the acrylamide content of the controls. Interestingly, the extent of acrylamide reduction of the best triple silencing lines was similar to that of the best VInv-single silencing lines developed previously from the same potato cultivar Russet Burbank. These results show that an acrylamide mitigation strategy focused on developing potato cultivars with low reducing sugars is likely to be an effective and sufficient approach for minimizing the acrylamide-forming potential of French fry processing potatoes. PMID:26079224

  13. Optimization protein productivity of human interleukin-2 through codon usage, gene copy number and intracellular tRNA concentration in CHO cells.

    Science.gov (United States)

    Ou, Kua-Chun; Wang, Chih-Yang; Liu, Kuan-Ting; Chen, Yi-Ling; Chen, Yi-Chen; Lai, Ming-Derg; Yen, Meng-Chi

    2014-11-14

    Transfer RNA (tRNA) abundance is one of the critical factors for the enhancement of protein productivity in prokaryotic and eukaryotic hosts. Gene copy number of tRNA and tRNA codon usage bias are generally used to match tRNA abundance of protein-expressing hosts and to optimize the codons of recombinant proteins. Because sufficient concentration of intracellular tRNA and optimized codons of recombinant proteins enhanced translation efficiency, we hypothesized that sufficient supplement of host's tRNA improved protein productivity in mammalian cells. First, the small tRNA sequencing results of CHO-K1 cells showed moderate positive correlation with gene copy number and codon usage bias. Modification of human interleukin-2 (IL-2) through codons with high gene copy number and high codon usage bias (IL-2 HH, modified on Leu, Thr, Glu) significantly increased protein productivity in CHO-K1 cells. In contrast, modification through codons with relatively high gene copy number and low codon usage bias (IL-2 HL, modified on Ala, Thr, Val), or relatively low gene copy number and low codon usage bias (IL-2 LH, modified on Ala, Thr, Val) did not increase IL-2 productivity significantly. Furthermore, supplement of the alanine tRNA or threonine tRNA increased IL-2 productivity of IL-2 HL. In summary, we revealed a potential strategy to enhance productivity of recombinant proteins, which may be applied in production of protein drug or design of DNA vaccine.

  14. Characterization of a Thioredoxin-1 Gene from Taenia solium and Its Encoding Product.

    Science.gov (United States)

    Jiménez, Lucía; Rodríguez-Lima, Oscar; Ochoa-Sánchez, Alicia; Landa, Abraham

    2015-01-01

    Taenia solium thioredoxin-1 gene (TsTrx-1) has a length of 771 bp with three exons and two introns. The core promoter gene presents two putative stress transcription factor binding sites, one putative TATA box, and a transcription start site (TSS). TsTrx-1 mRNA is expressed higher in larvae than in adult. This gene encodes a protein of 107 amino acids that presents the Trx active site (CGPC), the classical secondary structure of the thioredoxin fold, and the highest degree of identity with the Echinococcus granulosus Trx. A recombinant TsTrx-1 (rTsTrx-1) was produced in Escherichia coli with redox activity. Optimal activity for rTsTrx-1 was at pH 6.5 in the range of 15 to 25°C. The enzyme conserved activity for 3 h and lost it in 24 h at 37°C. rTsTrx-1 lost 50% activity after 1 h and lost activity completely in 24 h at temperatures higher than 55°C. Best storage temperature for rTsTrx-1 was at -70°C. It was inhibited by high concentrations of H₂O₂ and methylglyoxal (MG), but it was inhibited neither by NaCl nor by anti-rTsTrx-1 rabbit antibodies that strongly recognized a ~12 kDa band in extracts from several parasites. These TsTrx-1 properties open the opportunity to study its role in relationship T. solium-hosts.

  15. DNA repair in Escherichia coli: identification of the uvrD gene product.

    OpenAIRE

    Maples, V F; Kushner, S R

    1982-01-01

    A 2.9-kilobase (kb) Pvu II DNA fragment that contains the uvrD gene of Escherichia coli K-12 has been cloned in both low-copy and multiple-copy plasmid vehicles. The low-copy uvrD plasmid (pVMK49) complements a variety of uvrD, uvrE, and recL mutations. In contrast, the same strains carrying the 2.9-kb fragment in a multiple-copy plasmid (pVMK45) remain sensitive to ultraviolet light (UV). Additionally, pVMK45 transformants of wild-type E. coli are sensitive to UV and methyl methanesulfonate ...

  16. Gene products specifying adhesion of uropathogenic Escherichia coli are minor components of pili.

    OpenAIRE

    Lindberg, F; Lund, B; Normark, S

    1986-01-01

    The papE, papF, and papG genes of uropathogenic Escherichia coli are dispensable for the synthesis and assembly of pili associated with pyelonephritis, called Pap pili. Phenotypically, papF and papG mediate digalactoside [alpha-D-Galp-(1----4)-beta-D-Galp)-specific adhesion. Although whole bacterial cells of a papE mutant bind to this receptor, purified pili from such a mutant do not. This is in contrast to pili purified from the wild type, which bind specifically. The DNA sequences of the pa...

  17. Sequence and structural requirements for high-affinity DNA binding by the WT1 gene product.

    OpenAIRE

    Nakagama, H; Heinrich, G.; Pelletier, J; Housman, D E

    1995-01-01

    The Wilms' tumor suppressor gene, WT1, encodes a zinc finger polypeptide which plays a key role regulating cell growth and differentiation in the urogenital system. Using the whole-genome PCR approach, we searched murine genomic DNA for high-affinity WT1 binding sites and identified a 10-bp motif 5'GCGTGGGAGT3' which we term WTE). The WTE motif is similar to the consensus binding sequence 5'GCG(G/T)GGGCG3' recognized by EGR-1 and is also suggested to function as a binding site for WT1, settin...

  18. Recombinant polycistronic structure of hydantoinase process genes in Escherichia coli for the production of optically pure D-amino acids.

    Science.gov (United States)

    Martínez-Gómez, Ana Isabel; Martínez-Rodríguez, Sergio; Clemente-Jiménez, Josefa María; Pozo-Dengra, Joaquín; Rodríguez-Vico, Felipe; Las Heras-Vázquez, Francisco Javier

    2007-03-01

    Two recombinant reaction systems for the production of optically pure D-amino acids from different D,L-5-monosubstituted hydantoins were constructed. Each system contained three enzymes, two of which were D-hydantoinase and D-carbamoylase from Agrobacterium tumefaciens BQL9. The third enzyme was hydantoin racemase 1 for the first system and hydantoin racemase 2 for the second system, both from A. tumefaciens C58. Each system was formed by using a recombinant Escherichia coli strain with one plasmid harboring three genes coexpressed with one promoter in a polycistronic structure. The D-carbamoylase gene was cloned closest to the promoter in order to obtain the highest level of synthesis of the enzyme, thus avoiding intermediate accumulation, which decreases the reaction rate. Both systems were able to produce 100% conversion and 100% optically pure D-methionine, D-leucine, D-norleucine, D-norvaline, D-aminobutyric acid, D-valine, D-phenylalanine, D-tyrosine, and D-tryptophan from the corresponding hydantoin racemic mixture. For the production of almost all D-amino acids studied in this work, system 1 hydrolyzed the 5-monosubstituted hydantoins faster than system 2. PMID:17220246

  19. Deoxycytidine kinase and deoxyguanosine kinase of Lactobacillus acidophilus R-26 are colinear products of a single gene.

    Science.gov (United States)

    Ma, N; Ikeda, S; Guo, S; Fieno, A; Park, I; Grimme, S; Ikeda, T; Ives, D H

    1996-12-10

    Three of the four deoxynucleoside kinases required for growth of Lactobacillus acidophilus R-26 exist as heterodimeric pairs specific for deoxyadenosine (dAK) and deoxycytidine (dCK) or dAK and deoxyguanosine (dGK). However, only two tandem genes, dak/dgk, are found, and are expressed only as dAK/dGK in transformed Escherichia coli. Sequencing peptides spanning 63% of the native dCK subunit revealed a sequence identical to that deduced from dgk (beginning MTVIVL...), except that dCK lacks residues 2 and 3 (dCK is M..IVL; dGK is .TVIVL). Also, mass spectrometry indicates that native dCK and dGK subunits are identical in mass adjusted for the first three residues. Furthermore, the native enzymes have identical isoelectric pH values, indicating an equal number of charged residues. To enable E. coli to express peptide having the native dCK sequence, codons 2 and 3 were deleted from the dgk portion of the tandem genes, resulting in expression of protein having the specificities and regulatory properties of native dAK/dCK, including heterotropic stimulation of dAK activity by deoxycytidine or dCTP (not deoxyguanosine or dGTP) and end-product inhibition of the respective activities by dATP and dCTP. Subcloning normal and mutant dgk yielded homodimeric dGK and dCK, respectively. The dCK homodimer strongly resembles human dCK, with a low K(m) for deoxycytidine, the ability to phosphorylate deoxyadenosine and deoxyguanosine at much higher K(m) values, and end-product inhibition by dCTP. Thus two distinct and specific enzymes evidently are derived from a single Lactobacillus gene. The mechanism by which this occurs in vivo has yet to be elucidated.

  20. Enhanced production of steviol glycosides in mycorrhizal plants: a concerted effect of arbuscular mycorrhizal symbiosis on transcription of biosynthetic genes.

    Science.gov (United States)

    Mandal, Shantanu; Upadhyay, Shivangi; Singh, Ved Pal; Kapoor, Rupam

    2015-04-01

    Stevia rebaudiana (Bertoni) produces steviol glycosides (SGs)--stevioside (stev) and rebaudioside-A (reb-A) that are valued as low calorie sweeteners. Inoculation with arbuscular mycorrhizal fungi (AMF) augments SGs production, though the effect of this interaction on SGs biosynthesis has not been studied at molecular level. In this study transcription profiles of eleven key genes grouped under three stages of the SGs biosynthesis pathway were compared. The transcript analysis showed upregulation of genes encoding 2-C-methyl-D-erythritol-4-phosphate (MEP) pathway enzymes viz.,1-deoxy-D-xylulose 5-phospate synthase (DXS), 1-deoxy-D-xylulose 5-phospate reductoisomerase (DXR) and 2-C-methyl-D-erytrithol 2,4-cyclodiphosphate synthase (MDS) in mycorrhizal (M) plants. Zn and Mn are imperative for the expression of MDS and their enhanced uptake in M plants could be responsible for the increased transcription of MDS. Furthermore, in the second stage of SGs biosynthesis pathway, mycorrhization enhanced the transcription of copalyl diphosphate synthase (CPPS) and kaurenoic acid hydroxylase (KAH). Their expression is decisive for SGs biosynthesis as CPPS regulates flow of metabolites towards synthesis of kaurenoid precursors and KAH directs these towards steviol synthesis instead of gibberellins. In the third stage glucosylation of steviol to reb-A by four specific uridine diphosphate (UDP)-dependent glycosyltransferases (UGTs) occurs. While higher transcription of all the three characterized UGTs in M plants explains augmented production of SGs; higher transcript levels of UGT76G1, specifically improved reb-A to stev ratio implying increased sweetness. The work signifies that AM symbiosis upregulates the transcription of all eleven SGs biosynthesis genes as a result of improved nutrition and enhanced sugar concentration due to increased photosynthesis in M plants. PMID:25734328

  1. Targeted Sequencing Reveals Large-Scale Sequence Polymorphism in Maize Candidate Genes for Biomass Production and Composition.

    Directory of Open Access Journals (Sweden)

    Moses M Muraya

    Full Text Available A major goal of maize genomic research is to identify sequence polymorphisms responsible for phenotypic variation in traits of economic importance. Large-scale detection of sequence variation is critical for linking genes, or genomic regions, to phenotypes. However, due to its size and complexity, it remains expensive to generate whole genome sequences of sufficient coverage for divergent maize lines, even with access to next generation sequencing (NGS technology. Because methods involving reduction of genome complexity, such as genotyping-by-sequencing (GBS, assess only a limited fraction of sequence variation, targeted sequencing of selected genomic loci offers an attractive alternative. We therefore designed a sequence capture assay to target 29 Mb genomic regions and surveyed a total of 4,648 genes possibly affecting biomass production in 21 diverse inbred maize lines (7 flints, 14 dents. Captured and enriched genomic DNA was sequenced using the 454 NGS platform to 19.6-fold average depth coverage, and a broad evaluation of read alignment and variant calling methods was performed to select optimal procedures for variant discovery. Sequence alignment with the B73 reference and de novo assembly identified 383,145 putative single nucleotide polymorphisms (SNPs, of which 42,685 were non-synonymous alterations and 7,139 caused frameshifts. Presence/absence variation (PAV of genes was also detected. We found that substantial sequence variation exists among genomic regions targeted in this study, which was particularly evident within coding regions. This diversification has the potential to broaden functional diversity and generate phenotypic variation that may lead to new adaptations and the modification of important agronomic traits. Further, annotated SNPs identified here will serve as useful genetic tools and as candidates in searches for phenotype-altering DNA variation. In summary, we demonstrated that sequencing of captured DNA is a powerful

  2. Cloning and Sequence Analysis of the Full-length cDNA of a Novel yp05 Gene Associated With Citrinin Production in Monascus aurantiacus

    Institute of Scientific and Technical Information of China (English)

    YON-GHUA XIONG; YANG XU; WEI-HUA LAI; YAN-PIN LI; HUA WEI

    2007-01-01

    Objective To obtain the full-length cDNA of a novel gene (named yp05) associated with citrinin production-related genes in Monascus aurantiacus. Methods Total RNA was extracted from mycelium, 3' and 5' cDNA end of yp05 gene was amplified using smartTM trace cDNA amplification kit, and the full-length cDNA of a novel gene (named yp05) was obtained from the electronic assembly of 3'-RACE and 5'- RACE products. Results This yp05 gene was 787 bp including a 597 bp open reading frame (ORF) and encoded a deduced protein with 199 amino acid residues, and the amino acid sequence of this protein was found similar with the sequences of many fungal manganese-superoxide dismutases in the GenBank with the aid of BLASTp. The transcription of yp05 gene in Monascus strains was analyzed with the aid of Northern blotting. The transcription of yp05 gene was only detected in Monascus strains, provided that citrinin was produced. Conclusion The transcription of yp05 gene belongs to differential expression genes of citrinin yielded from Monascus and has no correlation with the biosynthesis pathway of red pigments.

  3. L-lactic acid production by Aspergillus brasiliensis overexpressing the heterologous ldha gene from Rhizopus oryzae

    OpenAIRE

    Liaud, Nadège; Rosso, Marie-Noëlle; Fabre, Nicolas; Crapart, Sylvaine; Herpoël-Gimbert, Isabelle; Sigoillot, Jean-Claude; Raouche, Sana; Levasseur, Anthony

    2015-01-01

    International audience Background: Lactic acid is the building block of poly-lactic acid (PLA), a biopolymer that could be set to replace petroleum-based plastics. To make lactic acid production cost-effective, the production process should be carried out at low pH, in low-nutrient media, and with a low-cost carbon source. Yeasts have been engineered to produce high levels of lactic acid at low pH from glucose but not from carbohydrate polymers (e.g. cellulose, hemicellulose, starch). Aspe...

  4. Replication, gene expression and particle production by a consensus Merkel Cell Polyomavirus (MCPyV genome.

    Directory of Open Access Journals (Sweden)

    Friederike Neumann

    Full Text Available Merkel Cell Polyomavirus (MCPyV genomes are clonally integrated in tumor tissues of approximately 85% of all Merkel cell carcinoma (MCC cases, a highly aggressive tumor of the skin which predominantly afflicts elderly and immunosuppressed patients. All integrated viral genomes recovered from MCC tissue or MCC cell lines harbor signature mutations in the early gene transcript encoding for the large T-Antigen (LT-Ag. These mutations selectively abrogate the ability of LT-Ag to support viral replication while still maintaining its Rb-binding activity, suggesting a continuous requirement for LT-Ag mediated cell cycle deregulation during MCC pathogenesis. To gain a better understanding of MCPyV biology, in vitro MCPyV replication systems are required. We have generated a synthetic MCPyV genomic clone (MCVSyn based on the consensus sequence of MCC-derived sequences deposited in the NCBI database. Here, we demonstrate that transfection of recircularized MCVSyn DNA into some human cell lines recapitulates efficient replication of the viral genome, early and late gene expression together with virus particle formation. However, serial transmission of infectious virus was not observed. This in vitro culturing system allows the study of viral replication and will facilitate the molecular dissection of important aspects of the MCPyV lifecycle.

  5. The Saccharomyces Genome Database: Gene Product Annotation of Function, Process, and Component.

    Science.gov (United States)

    Cherry, J Michael

    2015-12-01

    An ontology is a highly structured form of controlled vocabulary. Each entry in the ontology is commonly called a term. These terms are used when talking about an annotation. However, each term has a definition that, like the definition of a word found within a dictionary, provides the complete usage and detailed explanation of the term. It is critical to consult a term's definition because the distinction between terms can be subtle. The use of ontologies in biology started as a way of unifying communication between scientific communities and to provide a standard dictionary for different topics, including molecular functions, biological processes, mutant phenotypes, chemical properties and structures. The creation of ontology terms and their definitions often requires debate to reach agreement but the result has been a unified descriptive language used to communicate knowledge. In addition to terms and definitions, ontologies require a relationship used to define the type of connection between terms. In an ontology, a term can have more than one parent term, the term above it in an ontology, as well as more than one child, the term below it in the ontology. Many ontologies are used to construct annotations in the Saccharomyces Genome Database (SGD), as in all modern biological databases; however, Gene Ontology (GO), a descriptive system used to categorize gene function, is the most extensively used ontology in SGD annotations. Examples included in this protocol illustrate the structure and features of this ontology. PMID:26631125

  6. The Saccharomyces Genome Database: Gene Product Annotation of Function, Process, and Component.

    Science.gov (United States)

    Cherry, J Michael

    2015-12-01

    An ontology is a highly structured form of controlled vocabulary. Each entry in the ontology is commonly called a term. These terms are used when talking about an annotation. However, each term has a definition that, like the definition of a word found within a dictionary, provides the complete usage and detailed explanation of the term. It is critical to consult a term's definition because the distinction between terms can be subtle. The use of ontologies in biology started as a way of unifying communication between scientific communities and to provide a standard dictionary for different topics, including molecular functions, biological processes, mutant phenotypes, chemical properties and structures. The creation of ontology terms and their definitions often requires debate to reach agreement but the result has been a unified descriptive language used to communicate knowledge. In addition to terms and definitions, ontologies require a relationship used to define the type of connection between terms. In an ontology, a term can have more than one parent term, the term above it in an ontology, as well as more than one child, the term below it in the ontology. Many ontologies are used to construct annotations in the Saccharomyces Genome Database (SGD), as in all modern biological databases; however, Gene Ontology (GO), a descriptive system used to categorize gene function, is the most extensively used ontology in SGD annotations. Examples included in this protocol illustrate the structure and features of this ontology.

  7. Engineering the Production of Major Catechins by Escherichia coli Carrying Metabolite Genes of Camellia sinensis

    Directory of Open Access Journals (Sweden)

    Kabir Mustapha Umar

    2012-01-01

    Full Text Available A mimicked biosynthetic pathway of catechin metabolite genes from C. sinensis, consisting of flavanone 3 hydroxylase (F3H, dihydroflavonol reductase (DFR, and leucoanthocyanidin reductase (LCR, was designed and arranged in two sets of constructs: (a single promoter in front of F3H and ribosome-binding sequences both in front of DFR and LCR; (b three different promoters with each in the front of the three genes and ribosome-binding sequences at appropriate positions. Recombinant E. coli BL (DE3 harbouring the constructs were cultivated for 65 h at 26°C in M9 medium consisting of 40 g/L glucose, 1 mM IPTG, and 3 mM eriodictyol. Compounds produced were extracted in ethyl acetate in alkaline conditions after 1 h at room temperature and identified by HPLC. Two of the four major catechins, namely, (−-epicatechin (0.01  and (−-epicatechin gallate (0.36 mg/L, and two other types ((+-catechin hydrate (0.13 mg/L and (−-catechin gallate (0.04 mg/L were successfully produced.

  8. Polymorphisms at Cytokine Genes May Determine the Effect of Vitamin E on Cytokine Production in the Elderly1–3

    Science.gov (United States)

    Belisle, Sarah E.; Leka, Lynette S.; Delgado-Lista, Javier; Jacques, Paul F.; Ordovas, Jose M.; Meydani, Simin Nikbin

    2009-01-01

    Vitamin E has been shown to affect cytokine production. However, individual response to vitamin E supplementation varies. Previous studies indicate that cytokine production is heritable and common single nucleotide polymorphisms (SNP) may explain differences in cytokine production between individuals. We hypothesize that the differential response to the immunomodulatory actions of vitamin E reflects genetic differences among individuals, including SNP at cytokine genes that modulate cytokine production. We used data from a double-blind, placebo-controlled 1-y vitamin E (182 mg d,l-α-tocopherol) intervention study in elderly men and women (mean age 83 y) to test this hypothesis (vitamin E, n = 47; placebo, n = 63). We found that the effect of vitamin E on tumor necrosis factor (TNF)-α production in whole blood stimulated for 24 h with lipopolysaccharide (1.0 mg/L) is dependent on TNFα -308G > A. Participants with the A/A and A/G genotypes at TNFα -308G > A who were treated with vitamin E had lower TNFα production than those with the A allele treated with placebo. These observations suggest that individual immune responses to vitamin E supplementation are in part mediated by genetic factors. Because the A allele at TNFα has been previously associated with higher TNFα levels in whole blood and isolated immune cells, our observations suggest that the antiinflammatory effect of vitamin E is specific to those genetically predisposed to higher inflammation. Further studies are needed to determine the biological mechanism driving the interaction between vitamin E treatment and TNFα -308G > A and its implications for disease resistance. PMID:19710156

  9. Detection of Integrase Gene in E. coli Isolated from Pigs at Different Stages of Production System

    Directory of Open Access Journals (Sweden)

    Eulalia de la Torre

    2014-01-01

    Full Text Available Integrons are one of the genetic elements involved in the acquisition of antibiotic resistance. The aim of the present research is to investigate the presence of integrons in commensal Escherichia coli (E. coli strains, isolated from pigs at different stages of production system and from the environment in an Argentinian farm. Five sows postpartum and five randomly chosen piglets from each litter were sampled by rectal swabs. They were sampled again at day 21 and at day 70. Environmental samples from the farm were also obtained. E. coli containing any integron class or combination of both integrons was detected by polymerase chain reaction in 100% of sows and in piglets at different stages of production: farrowing pen stage 68.1%;, weaning 60%, and growing/finishing 85.8%, showing an increase along the production system. From environmental samples 78.4% of E. coli containing any integron class was detected. We conclude that animals and farm environment can act as reservoirs for potential spread of resistant bacteria by means of mobile genetic elements as integrons, which has a major impact on production of food animals and that can reach man through the food chain, constituting a problem for public health.

  10. Efficient production of Cre-mediated site-directed recombinants through the utilization of the puromycin resistance gene, pac: a transient gene-integration marker for ES cells.

    OpenAIRE

    Taniguchi, M.; Sanbo, M; S. Watanabe; Naruse, I.; Mishina, M; Yagi, T

    1998-01-01

    Gene targeting in embryonic stem (ES) cells is a powerful tool for generating mice carrying specifically designed mutations in the germline. Puromycin can completely kill ES cells within 24 to 48 h whereas G418 and hygromycin cannot. We have, therefore, proposed that the puromycin N-acetyltransferase ( pac ) gene, may be utilized as a transient gene-integration marker. Using a circular expression vector of cre and pac genes, Cre-mediated mutant cells were effectively enriched by pulse treatme...

  11. Production, purification and titration of a lentivirus-based vector for gene delivery purposes.

    Science.gov (United States)

    Nasri, Masoud; Karimi, Ali; Allahbakhshian Farsani, Mehdi

    2014-12-01

    Viral vectors are valuable tools to deliver genetic materials into cells. Vectors derived from human immunodeficiency virus type 1 are being widely used for gene delivery, mainly because they are able to transduce both dividing and non-dividing cells which leads to stable and long term gene expression. In addition, these types of vectors are safe, with low toxicity, high stability and cell type specificity. Therefore, this work was aimed to produce lentivirus-based vector using a three-plasmid system. To produce this system, the eGFP marker gene was cloned into the plasmid pWPXLd. Subsequently, this vector plasmid, along with packaging plasmids, psPAX2 and envelope plasmid, pMD2.G, was co-transfected into packaging cell line (293T) using calcium phosphate method. 48 h post transfection, the constructed viral vector was harvested, purified and concentrated and stored at -80 °C for next experiments. The titration of the vector was carried out, using ELISA, flowcytometry, and fluorescent microscopy. Finally, transduction of HEK-293T, CHO, HepG2, MCF-7, MEFs and Jurkat cell lines was carried out with indicated cell numbers and multiplicities of infections of the vector in the presence of polybrene. Using this system, high titer lentivirus at titers of up to 2 × 10(8) transducing units/ml (TU/ml) was successfully generated and its transduction efficacy was improved by seven to over 20-fold in various cell types. We demonstrate the applicability of this vector for the efficient transduction of dividing and non-dividing cells, including HEK-293T, CHO, HepG2, MCF-7, MEFs and Jurkat cell line. Transduction efficiency yielded titers of (6.3 ± 1.2) 10(5) TU/ml. Furthermore, lentivirus transferred transgene was expressed at high level in the target cells and expression was followed until 90 days after transduction. Thus, the vector generated in this work, might be able to deliver the transgene into a wide range of mammalian cells.

  12. End-to-end gene fusions and their impact on the production of multifunctional biomass degrading enzymes

    Energy Technology Data Exchange (ETDEWEB)

    Rizk, Mazen, E-mail: mazen.rizk@tuhh.de [Institute of Technical Microbiology, Hamburg University of Technology (TUHH), Kasernenstr. 12, D-21073 Hamburg (Germany); Antranikian, Garabed, E-mail: antranikian@tuhh.de [Institute of Technical Microbiology, Hamburg University of Technology (TUHH), Kasernenstr. 12, D-21073 Hamburg (Germany); Elleuche, Skander, E-mail: skander.elleuche@tuhh.de [Institute of Technical Microbiology, Hamburg University of Technology (TUHH), Kasernenstr. 12, D-21073 Hamburg (Germany)

    2012-11-09

    Highlights: Black-Right-Pointing-Pointer Multifunctional enzymes offer an interesting approach for biomass degradation. Black-Right-Pointing-Pointer Size and conformation of separate constructs play a role in the effectiveness of chimeras. Black-Right-Pointing-Pointer A connecting linker allows for maximal flexibility and increased thermostability. Black-Right-Pointing-Pointer Genes with functional similarities are the best choice for fusion candidates. -- Abstract: The reduction of fossil fuels, coupled with its increase in price, has made the search for alternative energy resources more plausible. One of the topics gaining fast interest is the utilization of lignocellulose, the main component of plants. Its primary constituents, cellulose and hemicellulose, can be degraded by a series of enzymes present in microorganisms, into simple sugars, later used for bioethanol production. Thermophilic bacteria have proven to be an interesting source of enzymes required for hydrolysis since they can withstand high and denaturing temperatures, which are usually required for processes involving biomass degradation. However, the cost associated with the whole enzymatic process is staggering. A solution for cost effective and highly active production is through the construction of multifunctional enzyme complexes harboring the function of more than one enzyme needed for the hydrolysis process. There are various strategies for the degradation of complex biomass ranging from the regulation of the enzymes involved, to cellulosomes, and proteins harboring more than one enzymatic activity. In this review, the construction of multifunctional biomass degrading enzymes through end-to-end gene fusions, and its impact on production and activity by choosing the enzymes and linkers is assessed.

  13. Phenotypes and gene expression profiles of Saccharopolyspora erythraea rifampicin-resistant (rif mutants affected in erythromycin production

    Directory of Open Access Journals (Sweden)

    Bicciato Silvio

    2009-03-01

    Full Text Available Abstract Background There is evidence from previous works that bacterial secondary metabolism may be stimulated by genetic manipulation of RNA polymerase (RNAP. In this study we have used rifampicin selection as a strategy to genetically improve the erythromycin producer Saccharopolyspora erythraea. Results Spontaneous rifampicin-resistant (rif mutants were isolated from the parental strain NRRL2338 and two rif mutations mapping within rpoB, S444F and Q426R, were characterized. With respect to the parental strain, S444F mutants exhibited higher respiratory performance and up to four-fold higher final erythromycin yields; in contrast, Q426R mutants were slow-growing, developmental-defective and severely impaired in erythromycin production. DNA microarray analysis demonstrated that these rif mutations deeply changed the transcriptional profile of S. erythraea. The expression of genes coding for key enzymes of carbon (and energy and nitrogen central metabolism was dramatically altered in turn affecting the flux of metabolites through erythromycin feeder pathways. In particular, the valine catabolic pathway that supplies propionyl-CoA for biosynthesis of the erythromycin precursor 6-deoxyerythronolide B was strongly up-regulated in the S444F mutants, while the expression of the biosynthetic gene cluster of erythromycin (ery was not significantly affected. In contrast, the ery cluster was down-regulated ( Conclusion Rifampicin selection is a simple and reliable tool to investigate novel links between primary and secondary metabolism and morphological differentiation in S. erythraea and to improve erythromycin production. At the same time genome-wide analysis of expression profiles using DNA microarrays allowed information to be gained about the mechanisms underlying the stimulatory/inhibitory effects of the rif mutations on erythromycin production.

  14. Physical and functional analyses of the syrA and syrB genes involved in syringomycin production by Pseudomonas syringae pv. syringae.

    OpenAIRE

    Xu, G W; Gross, D. C.

    1988-01-01

    The syrA and syrB genes involved in syringomycin production in Pseudomonas syringae pv. syringae B301D were identified from an EcoRI-pLAFR3 cosmid library and then physically and functionally analyzed in relation to plant pathogenicity. Homologous recombination of the genes required for syringomycin production from cosmids pGX183 (syrA) and pGX56 (syrB), respectively, introduced into nontoxigenic (Tox-) Tn5 mutants W4S2545 and W4S770 resulted in the concomitant restoration of toxin production...

  15. Multiple chromosomal gene integration for production of pharmaceutical proteins in S. cerevisiae

    DEFF Research Database (Denmark)

    Jensen, Malene; Mortensen, Uffe Hasbro; Gunnarsson, Nina;

    2014-01-01

    When studying protein folding and secretion the general conception is that all cells in a population express an equal amount of protein. Recent work has shown that expression levels vary greatly in cell populations which express proteins on plasmids. Hence a yeast expression platform has been...... developed at the Department of Systems Biology, DTU. The platform offers the opportunity to express genes on the chromosome in 1 to 10 copies. A comparison between the expression of CFP and RFP by the platform and by plasmids reveals the problems of plasmid expression. FACS analyses of two cell populations......, expressing CFP and RFP on the separate plasmids or expressing CFP and RFP using the yeast expression platform shows expression varies greatly in a cell population based on plasmid expression compared to the yeast expression platform. When expressed on plasmids a few cells are high performers on both proteins...

  16. Agroinfiltration as an Effective and Scalable Strategy of Gene Delivery for Production of Pharmaceutical Proteins

    OpenAIRE

    Chen, Qiang; Lai, Huafang; Hurtado, Jonathan; Stahnke, Jake; Leuzinger, Kahlin; Dent, Matthew

    2013-01-01

    Current human biologics are most commonly produced by mammalian cell culture-based fermentation technologies. However, its limited scalability and high cost prevent this platform from meeting the ever increasing global demand. Plants offer a novel alternative system for the production of pharmaceutical proteins that is more scalable, cost-effective, and safer than current expression paradigms. The recent development of deconstructed virus-based vectors has allowed rapid and high-level transie...

  17. Phenazine Production in The Presence of Heavy Metals in Recombinant Erwinia herbicola Bearing the Hemoglobin Gene

    Directory of Open Access Journals (Sweden)

    Hüseyin KAHRAMAN

    2014-07-01

    Full Text Available Phenazine production of the highest, and 50 ppm Cd (Fig. 2 a in the presence of recombinant bacteria observed that 72 hours (9.18 μg/ml. In the presence of wild bacteria 100 ppm Cd (Fig. 2 b observed that 72 hours (8.16 μg/ml. In the presence of 50 ppm Cd and 150 ppm Cd 72 hours recombinant bacteria and

  18. Relationship between fumonisin production and FUM gene expression in Fusarium verticillioides under different environmental conditions

    DEFF Research Database (Denmark)

    Fanelli, Francesca; Iversen, Anita; Logrieco, Antonio F.;

    2013-01-01

    Fusarium verticillioides is the main source of fumonisins, a group of mycotoxins that can contaminate maize-based food and feed and cause diseases in humans and animals. The study of the effect of different environmental conditions on toxin production should provide information that can be used...... to develop strategies to minimize the risk. This study analysed the effect of temperature (15°C-35°C), water activity (aw: 0.999-0.93), salinity (0-125 g l-1 NaCl) and pH (5-8) on the growth and production of fumonisins B1 (FB1), B2 (FB2) and B3 (FB3) and the expression of FUM1 and FUM21 in F....... verticillioides. The highest growth rate was measured at 25°C, aw of 0.998-0.99 and 0-25 g l-1 of NaCl. Optimal conditions for fumonisin production were 30°C, aw of 0.99, 25 g l-1 of NaCl and pH 5; nevertheless, the strain showed a good adaptability and was able to produce moderate levels of fumonisins under...

  19. Enhancement of lipase r27RCL production in Pichia pastoris by regulating gene dosage and co-expression with chaperone protein disulfide isomerase.

    Science.gov (United States)

    Sha, Chong; Yu, Xiao-Wei; Lin, Nai-Xin; Zhang, Meng; Xu, Yan

    2013-12-10

    Pichia pastoris has been successfully used in the production of many secreted and intracellular recombinant proteins, but there is still a large room of improvement for this expression system. Two factors drastically influence the lipase r27RCL production from Rhizopus chinensis CCTCC M201021, which are gene dosage and protein folding in the endoplasmic reticulum (ER). Regarding the effect of gene dosage, the enzyme activity for recombinant strain with three copies lipase gene was 1.95-fold higher than that for recombinant strain with only one copy lipase gene. In addition, the lipase production was further improved by co-expression with chaperone PDI involved in the disulfide bond formation in the ER. Overall, the maximum enzyme activity reached 355U/mL by the recombinant strain with one copy chaperone gene PDI plus five copies lipase gene proRCL in shaking flasks, which was 2.74-fold higher than that for the control strain with only one copy lipase gene. Overall, co-expression with PDI vastly increased the capacity for processing proteins of ER in P. pastoris. PMID:24315648

  20. Identification of genes for melatonin synthetic enzymes in 'Red Fuji' apple (Malus domestica Borkh.cv.Red) and their expression and melatonin production during fruit development.

    Science.gov (United States)

    Lei, Qiong; Wang, Lin; Tan, Dun-Xian; Zhao, Yu; Zheng, Xiao-Dong; Chen, Hao; Li, Qing-Tian; Zuo, Bi-Xiao; Kong, Jin

    2013-11-01

    Melatonin is present in many edible fruits; however, the presence of melatonin in apple has not previously been reported. In this study, the genes for melatonin synthetic enzymes including tryptophan decarboxylase, tryptamine 5-hydroxylase (T5H), arylalkylamine N-acetyltransferase, and N-acetylserotonin methyltransferase were identified in 'Red Fuji' apple. Each gene has several homologous genes. Sequence analysis shows that these genes have little homology with those of animals and they only have limited homology with known genes of rice melatonin synthetic enzymes. Multiple origins of melatonin synthetic genes during the evolution are expected. The expression of these genes is fully coordinated with melatonin production in apple development. Melatonin levels in apple exhibit an inverse relationship with the content of malondialdehyde, a product of lipid peroxidation. Two major melatonin synthetic peaks appeared on July 17 and on October 8 in both unbagged and bagged apple samples. At the periods mentioned above, apples experienced rapid expansion and increased respiration. These episodes significantly elevate reactive oxygen species production in the apple. Current data further confirmed that melatonin produced in apple was used to neutralize the toxic oxidants and protect the developing apple against oxidative stress.

  1. Loss of retrovirus production in JB/RH melanoma cells transfected with H-2Kb and TAP-1 genes.

    Science.gov (United States)

    Li, M; Xu, F; Muller, J; Huang, X; Hearing, V J; Gorelik, E

    1999-01-20

    JB/RH1 melanoma cells, as well as other melanomas of C57BL/6 mice (B16 and JB/MS), express a common melanoma-associated antigen (MAA) encoded by an ecotropic melanoma-associated retrovirus (MelARV). JB/RH1 cells do not express the H-2Kb molecules due to down-regulation of the H-2Kb and TAP-1 genes. When JB/RH1 cells were transfected with the H-2Kb and cotransfected with the TAP-1 gene, it resulted in the appearance of H-2Kb molecules and an increase in their immunogenicity, albeit they lost expression of retrovirus-encoded MAA recognized by MM2-9B6 mAb. Loss of MAA was found to result from a complete and stable elimination of ecotropic MelARV production in the H-2Kb/TAP-1-transfected JB/RH1 cells. Northern blot analysis showed no differences in ecotropic retroviral messages in MelARV-producing and -nonproducing melanoma cells, suggesting that loss of MelARV production was not due to down-regulation of MelARV transcription. Southern blot analysis revealed several rearrangements in the proviral DNA of H-2Kb-positive JB/RH1 melanoma cells. Sequence analysis of the ecotropic proviral DNA from these cells showed numerous nucleotide substitutions, some of which resulted in the appearance of a novel intraviral PstI restriction site and the loss of a HindIII restriction site in the pol region. PCR amplification of the proviral DNAs indicates that an ecotropic provirus found in the H-2Kb-positive cells is novel and does not preexist in the parental H-2Kb-negative melanoma cells. Conversely, the ecotropic provirus of the parental JB/RH1 cells was not amplifable from the H-2Kb-positive cells. Our data indicate that stable loss of retroviral production in the H-2Kb/TAP-1-transfected melanoma cells is probably due to the induction of recombination between a productive ecotropic MelARV and a defective nonecotropic provirus leading to the generation of a defective ecotropic provirus and the loss of MelARV production and expression of the retrovirus-encoded MAA.

  2. Dissection of quorum-sensing genes in Burkholderia glumae reveals non-canonical regulation and the new regulatory gene tofM for toxoflavin production.

    Directory of Open Access Journals (Sweden)

    Ruoxi Chen

    Full Text Available Burkholderia glumae causes bacterial panicle blight of rice and produces major virulence factors, including toxoflavin, under the control of the quorum-sensing (QS system mediated by the luxI homolog, tofI, and the luxR homolog, tofR. In this study, a series of markerless deletion mutants of B. glumae for tofI and tofR were generated using the suicide vector system, pKKSacB, for comprehensive characterization of the QS system of this pathogen. Consistent with the previous studies by other research groups, ΔtofI and ΔtofR strains of B. glumae did not produce toxoflavin in Luria-Bertani (LB broth. However, these mutants produced high levels of toxoflavin when grown in a highly dense bacterial inoculum (∼ 10(11 CFU/ml on solid media, including LB agar and King's B (KB agar media. The ΔtofI/ΔtofR strain of B. glumae, LSUPB201, also produced toxoflavin on LB agar medium. These results indicate the presence of previously unknown regulatory pathways for the production of toxoflavin that are independent of tofI and/or tofR. Notably, the conserved open reading frame (locus tag: bglu_2g14480 located in the intergenic region between tofI and tofR was found to be essential for the production of toxoflavin by tofI and tofR mutants on solid media. This novel regulatory factor of B. glumae was named tofM after its homolog, rsaM, which was recently identified as a novel negative regulatory gene for the QS system of another rice pathogenic bacterium, Pseudomonas fuscovaginae. The ΔtofM strain of B. glumae, LSUPB286, produced a less amount of toxoflavin and showed attenuated virulence when compared with its wild type parental strain, 336gr-1, suggesting that tofM plays a positive role in toxoflavin production and virulence. In addition, the observed growth defect of the ΔtofI strain, LSUPB145, was restored by 1 µM N-octanoyl homoserine lactone (C8-HSL.

  3. Analysis of heterogeneity of gene products(interferon)expressed in yeast

    Institute of Scientific and Technical Information of China (English)

    王洪海; 高卜渝; 陈佩丽; 董灵; 李育阳

    1995-01-01

    FPLC,SDS-PAGE and Western blot techniques are used to analyse the heterogeneity ofinterferon αA(IFN-αA) expressed in yeast.The heterogeneity consists of (i) the presence of IFN polymer,(ii)partial processing of signal leader peptide and (iii) internal degradation.The reasons for heterogeneity ofgene products in expression system of yeast are analysed.The methods of avoiding heterogeneity,such asdepolymerization,adding inhibitors of protease to the culture supernatant,the oligonucleotide-directed deletionmutagenesis and improvements of fermentation,are discussed.

  4. Expression of the CagA gene of H. pylori and application of its product

    Institute of Scientific and Technical Information of China (English)

    Feng Chan Han; Xiao Jun Yan; Cheng Zhi Su

    2000-01-01

    @@ INTRODUCTION Helicobacter pylori (Hp) plays an important role in the upper digestive tract diseases. It can be divided into two main groups (toxic and non-toxic Hp )according to the production of vacuolating cytotoxin (VacA). The toxic bacteria also produce cytotoxin associated protein A (CagA) which might have something to do with the transcription, folding,transportation or the function of VacA. Studies showed that CagA positive Hp ( CagA+ Hp )accounted for more than 50% of all kinds of Hp,and peptic ulcer and gastric cancer were closely related to their infection[1-7].

  5. Monitoring Campylobacter in the poultry production chain - From culture to genes and beyond

    DEFF Research Database (Denmark)

    Josefsen, Mathilde Hasseldam; Bhunia, Arun; Engvall, Eva Olsson;

    2015-01-01

    Improved monitoring tools are important for the control of Campylobacter bacteria in poultry production. Standardized reference culture methods issued by national and international standardization organizations are time-consuming, cumbersome and not amenable to automation for screening of large...... numbers of samples. The ultimate goal for rapid monitoring of Campylobacter is to prevent contaminated meat from entering the food market. Currently, real-time PCR is fulfilling abovementioned criteria to a certain extent. Further development of real-time PCR, microarray PCR, miniaturized biosensors...

  6. Analysis of Ellis van Creveld syndrome gene products: implications for cardiovascular development and disease.

    Science.gov (United States)

    Sund, Kristen Lipscomb; Roelker, Stephanie; Ramachandran, Vijaya; Durbin, Lisa; Benson, D Woodrow

    2009-05-15

    Mutations identified in a cohort of patients with atrioventricular septal defects as a part of Ellis van Creveld syndrome (EvC syndrome) led us to study the role of two non-homologous genes, EVC and LBN, in heart development and disease pathogenesis. To address the cause of locus heterogeneity resulting in an indistinguishable heart-hand phenotype, we carried out in situ hybridization and immunofluorescence and identified co-localization of Evc and Lbn mRNA and protein. In the heart, expression was identified to be strongest in the secondary heart field, including both the outflow tract and the dorsal mesenchymal protrusion, but was also found in mesenchymal structures of the atrial septum and the atrioventricular cushions. Finally, we studied the transcriptional hierarchy of EVC and LBN but did not find any evidence of direct transcriptional interregulation between the two. Due to the locus heterogeneity of human mutations predicted to result in a loss of protein function, a bidirectional genomic organization and overlapping expression patterns, we speculate that these proteins function coordinately in cardiac development and that loss of this coordinate function results in the characteristics of EvC syndrome.

  7. Bayesian computational approaches for gene regulation studies of bioethanol and biohydrogen production

    Energy Technology Data Exchange (ETDEWEB)

    Lawrence, Charles E [Brown Univ., Providence, RI (United States); Newberg, Lee [Wadsworth Center; McCue, LeeAnn [Pacific Northwest Labs; Thomspon, Williams [Brown University

    2012-03-01

    It has recently become clear that regulatory RNAs play a major role in regulation of gene expression in bacteria. RNA secondary structures play a major role in the function of many regulatory RNAs, and structural features are often key to their interaction with other cellular components. Thus, there has been considerable interest in the prediction of the secondary structures for RNA families. A paper describing our new algorithm, RNAG, to predict consensus secondary structures for unaligned sequences using the blocked Gibbs sampler has been published[1]. This sampling algorithm iteratively samples from the conditional probability distributions: P(Structure | Alignment) and P(Alignment | Structure). Subsequent to publication of the RNAG paper we have employed the technology from RNAG in the development of an RNA motif finding algorithm. To develop and RNA motif finding algorithm, RGibbs, we capitalized on our long experience in DNA motif finding and RNA secondary structure prediction. We applied RGibbs to three data sets from the literature and compared it to existing methods: one for training and two others for tests sets. In both test sets we found RGibbs out performed existing procedures.

  8. Production, characterization, gene cloning, and nematocidal activity of the extracellular protease from Stenotrophomonas maltophilia N4.

    Science.gov (United States)

    Jankiewicz, Urszula; Larkowska, Ewa; Swiontek Brzezinska, Maria

    2016-06-01

    A rhizosphere strain of the bacterium Stenotrophomonas maltophilia N4 secretes the serine protease PN4, whose molecular mass is approximately 42 kDa. The optimal temperature for the enzyme activity of the 11-fold purified protein was 50°C and the optimal pH was 10.5. The activity of the enzyme was strongly inhibited by specific serine protease inhibitors, which allowed for its classification as an alkaline serine protease family. Ca(2+) ions stimulated the activity of the protease PN4, while Mg(2+) ions stabilized its activity, and Zn(2+) and Cd(2+) ions strongly inhibited its activity. The enzyme has broad substrate specificity. For example, it is able to hydrolyse casein, keratin, albumin, haemoglobin, and gelatin, as well as the insoluble modified substrates azure keratin and azocoll. The gene that encodes the 1740 bp precursor form of the enzyme (accession number: LC031815) was cloned. We then deduced that its amino acid sequence includes the region of the conserved domain of the S8 family of peptidases as well as the catalytic triad Asp/His/Ser. The bacterial culture fluid as well as the purified protease PN4 demonstrated biocidal activity with regard to the nematodes Caenorhabditis elegans and Panagrellus spp. PMID:26896861

  9. Expression of ORF2 partial gene of hepatitis E virus in tomatoes and immunoactivity of expression products

    Institute of Scientific and Technical Information of China (English)

    Ying Ma; Shun-Quan Lin; Yi Gao; Mei Li; Wen-Xin Luo; Jun Zhang; Ning-Shao Xia

    2003-01-01

    AIM: To transfer hepatitis E virus (HEV) ORF2 partial gene to tomato plants, to investigate its expression in transformants and the immunoactivity of expression products, and to explore the feasibility of developing a new type of plantderived HEV oral vaccine.METHODS: Plant binary expression vector p1301E2,carrying a fragment of HEV open reading frame-2 (named HEV-E2), was constructed by linking the fragment to a constitutive CaMV35s promoter and nos terminator, then directly introduced into Agrobacterium tumefaciens EHA105. With leaf-disc method, tomato plants medicated by EHA105 were transformed and hygromycin-resistant plantlets were obtained in selective medium containing hygromycin. The presence and integration of foreign DNA in transgenic tomato genome were confirmed by Gus gene expression, PCR amplification and Southern dot blotting.The immunoactivity of recombinant protein extracted from transformed plants was examined by enzyme-linked immunosorbant assay (ELISA) using a monoclonal antibody specifically against HEV. ELISA was also used to estimate the recombinant protein content in leaves and fruits of the transformants.RESULTS: Seven positive lines of HEV-E2-transgenic tomato plants confirmed by PCR and Southern blotting were obtained and the immunoactivity of recombinant protein could be detected in extracts of transformants. The expression levels of recombinant protein were 61.22 ng/g fresh weight in fruits and 6.37-47.9 ng/g fresh weight in leaves of the transformants.CONCLUSION: HEV-E2 gene was correctly expressed in transgenic tomatoes and the recombinant antigen derived from them has normal immunoactivity. Transgenic tomatoes may hold a good promise for producing a new type of lowcost oral vaccine for hepatitis E virus.

  10. Effects of variation in porcine MYOD1 gene on muscle fiber characteristics, lean meat production, and meat quality traits.

    Science.gov (United States)

    Lee, E A; Kim, J M; Lim, K S; Ryu, Y C; Jeon, W M; Hong, K C

    2012-09-01

    Three single nucleotide polymorphisms (SNPs) in the porcine MYOD1 gene were used for association analysis and haplotype construction to evaluate the effects of their substitution. Four hundred and three pigs of Yorkshire and Berkshire breeds were used. The mRNA expression levels of MYOD1 were examined. The g.489C>T and g.1264C>A SNPs were significantly associated with several muscle fiber characteristics, the loin eye area, and lightness. Particularly, animals having hetero-genotypes of both sites showed good performance both in lean meat production and meat quality traits. The results of haplotype substitution were similar to the associations of individual SNPs. Moreover, the 2 SNPs had significant effects on mRNA expression. Therefore, the g.489C>T and g.1264C>A SNPs in MYOD1 may be meaningful DNA markers that can be used for improving important porcine economic traits.

  11. Effects of variation in porcine MYOD1 gene on muscle fiber characteristics, lean meat production, and meat quality traits.

    Science.gov (United States)

    Lee, E A; Kim, J M; Lim, K S; Ryu, Y C; Jeon, W M; Hong, K C

    2012-09-01

    Three single nucleotide polymorphisms (SNPs) in the porcine MYOD1 gene were used for association analysis and haplotype construction to evaluate the effects of their substitution. Four hundred and three pigs of Yorkshire and Berkshire breeds were used. The mRNA expression levels of MYOD1 were examined. The g.489C>T and g.1264C>A SNPs were significantly associated with several muscle fiber characteristics, the loin eye area, and lightness. Particularly, animals having hetero-genotypes of both sites showed good performance both in lean meat production and meat quality traits. The results of haplotype substitution were similar to the associations of individual SNPs. Moreover, the 2 SNPs had significant effects on mRNA expression. Therefore, the g.489C>T and g.1264C>A SNPs in MYOD1 may be meaningful DNA markers that can be used for improving important porcine economic traits. PMID:22554470

  12. Knocking out the MFE-2 gene of Candida bombicola leads to improved medium-chain sophorolipid production.

    Science.gov (United States)

    Van Bogaert, Inge N A; Sabirova, Julia; Develter, Dirk; Soetaert, Wim; Vandamme, Erick J

    2009-06-01

    The nonpathogenic yeast Candida bombicola synthesizes sophorolipids. These biosurfactants are composed of the disaccharide sophorose linked to a long-chain hydroxy fatty acid and have potential applications in the food, pharmaceutical, cosmetic and cleaning industries. In order to expand the range of application, a shift of the fatty acid moiety towards medium-chain lengths would be recommendable. However, the synthesis of medium-chain sophorolipids by C. bombicola is a challenging objective. First of all, these sophorolipids can only be obtained by fermentations on unconventional carbon sources, which often have a toxic effect on the cells. Furthermore, medium-chain substrates are partially metabolized in the beta-oxidation pathway. In order to redirect unconventional substrates towards sophorolipid synthesis, the beta-oxidation pathway was blocked on the genome level by knocking out the multifunctional enzyme type 2 (MFE-2) gene. The total gene sequence of the C. bombicola MFE-2 (6033 bp) was cloned (GenBank accession number EU371724), and the obtained nucleotide sequence was used to construct a knock-out cassette. Several knock-out mutants with the correct geno- and phenotype were evaluated in a fermentation on 1-dodecanol. All mutants showed a 1.7-2.9 times higher production of sophorolipids, indicating that in those strains the substrate is redirected towards the sophorolipid synthesis.

  13. Identification, Characterization and Down-Regulation of Cysteine Protease Genes in Tobacco for Use in Recombinant Protein Production.

    Directory of Open Access Journals (Sweden)

    Kishor Duwadi

    Full Text Available Plants are an attractive host system for pharmaceutical protein production. Many therapeutic proteins have been produced and scaled up in plants at a low cost compared to the conventional microbial and animal-based systems. The main technical challenge during this process is to produce sufficient levels of recombinant proteins in plants. Low yield is generally caused by proteolytic degradation during expression and downstream processing of recombinant proteins. The yield of human therapeutic interleukin (IL-10 produced in transgenic tobacco leaves was found to be below the critical level, and may be due to degradation by tobacco proteases. Here, we identified a total of 60 putative cysteine protease genes (CysP in tobacco. Based on their predicted expression in leaf tissue, 10 candidate CysPs (CysP1-CysP10 were selected for further characterization. The effect of CysP gene silencing on IL-10 accumulation was examined in tobacco. It was found that the recombinant protein yield in tobacco could be increased by silencing CysP6. Transient expression of CysP6 silencing construct also showed an increase in IL-10 accumulation in comparison to the control. Moreover, CysP6 localizes to the endoplasmic reticulum (ER, suggesting that ER may be the site of IL-10 degradation. Overall results suggest that CysP6 is important in determining the yield of recombinant IL-10 in tobacco leaves.

  14. Single Nucleotide Polymorphism (SNP in PPARGC1A Gene Associates Milk Production Traits in Chinese Holstein Cattle

    Directory of Open Access Journals (Sweden)

    M. A. Alim§, Yipeng Fan§, Yan Xie, Xiaoping Wu, Dongxiao Sun*, Yi Zhang, Shengli Zhang, Yuan Zhang, Qin Zhang and Lin Liu1

    2012-10-01

    Full Text Available This study was designed to find out possible associations between single nucleotide polymorphism (SNP of PPARGC1A gene and milk production traits. In the current study, one SNP at g.85330C>T position was identified in 9th intron of PPARGC1A gene through pooled DNA sequencing. The identified SNP was genotyped using MALDI-TOF MS technique in 752 individuals from the Chinese Holstein cattle breed. The frequency of C allele at position g.85330C>T was more frequent in our population (0.69, followed by the T allele (0.31. From the association results, significant differences were found between PPARGC1A genotypes in the protein concentration and protein yield. Heterozygous cows with CT genotype at the g.85330C>T locus showed the highest protein yield, with more than 4.18 kg compared with homozygous cows with TT genotype; homozygous CC cows were found at intermediate position. In case of protein percentage, homozygous cows with TT genotype were significantly greater than heterozygous CT cows, with a difference of about 0.012%; CC cows were found in lowest position. The allele substitution results demonstrated that g.85330C>T-C allele decreased protein yield (1.23kg and protein percentage (0.016%. This result clearly indicated that g.85330C>T-T allele increased protein percentage and protein yield.

  15. Glucan synthesis in the genus Lactobacillus: isolation and characterization of glucansucrase genes, enzymes and glucan products from six different strains.

    Science.gov (United States)

    Kralj, S; van Geel-Schutten, G H; Dondorff, M M G; Kirsanovs, S; van der Maarel, M J E C; Dijkhuizen, L

    2004-11-01

    Members of the genera Streptococcus and Leuconostoc synthesize various alpha-glucans (dextran, alternan and mutan). In Lactobacillus, until now, the only glucosyltransferase (GTF) enzyme that has been characterized is gtfA of Lactobacillus reuteri 121, the first GTF enzyme synthesizing a glucan (reuteran) that contains mainly alpha-(1-->4) linkages together with alpha-(1-->6) and alpha-(1-->4,6) linkages. Recently, partial sequences of glucansucrase genes were detected in other members of the genus Lactobacillus. This paper reports, for the first time, isolation and characterization of dextransucrase and mutansucrase genes and enzymes from various Lactobacillus species and the characterization of the glucan products synthesized, which mainly have alpha-(1-->6)- and alpha-(1-->3)-glucosidic linkages. The four GTF enzymes characterized from three different Lb. reuteri strains are highly similar at the amino acid level, and consequently their protein structures are very alike. Interestingly, these four Lb. reuteri GTFs have relatively large N-terminal variable regions, containing RDV repeats, and relatively short putative glucan-binding domains with conserved and less-conserved YG-repeating units. The three other GTF enzymes, isolated from Lactobacillus sakei, Lactobacillus fermentum and Lactobacillus parabuchneri, contain smaller variable regions and larger putative glucan-binding domains compared to the Lb. reuteri GTF enzymes. PMID:15528655

  16. Production of polyhydroxybutyrate in oil palm (Elaeis guineensis Jacq. mediated by microprojectile bombardment of PHB biosynthesis genes into embryogenic calli

    Directory of Open Access Journals (Sweden)

    Ahmad Parveez eGhulam Kadir

    2015-08-01

    Full Text Available Biodegradable plastics, mainly polyhydroxybutyrate (PHB, which are traditionally produced by bacterial cells, have been produced in the cells of more than 15 plant species. Since the production of biodegradable plastics and the synthesis of oil in plants share the same substrate, acetyl-coenzyme A (acetyl-CoA, producing PHB in oil bearing crops, such as oil palm, will be advantageous. In this study, three bacterial genes, bktB, phaB and phaC, which are required for the synthesis of PHB and selectable marker gene, bar, for herbicide Basta resistant, were transformed into embryogenic calli. A number of transformed embryogenic lines resistant to herbicide Basta were obtained and were later regenerated to produce few hundred plantlets. Molecular analyses, including PCR, Southern blot and real-time PCR have demonstrated stable integration and expression of the transgenes in the oil palm genome. HPLC and Nile Blue A staining analyses confirmed the synthesis of PHB in some of the plantlets.

  17. Production of polyhydroxybutyrate in oil palm (Elaeis guineensis Jacq.) mediated by microprojectile bombardment of PHB biosynthesis genes into embryogenic calli.

    Science.gov (United States)

    Parveez, Ghulam Kadir Ahmad; Bahariah, Bohari; Ayub, Nor Hanin; Masani, Mat Yunus Abdul; Rasid, Omar Abdul; Tarmizi, Ahmad Hashim; Ishak, Zamzuri

    2015-01-01

    Biodegradable plastics, mainly polyhydroxybutyrate (PHB), which are traditionally produced by bacterial cells, have been produced in the cells of more than 15 plant species. Since the production of biodegradable plastics and the synthesis of oil in plants share the same substrate, acetyl-coenzyme A (acetyl-CoA), producing PHB in oil bearing crops, such as oil palm, will be advantageous. In this study, three bacterial genes, bktB, phaB, and phaC, which are required for the synthesis of PHB and selectable marker gene, bar, for herbicide Basta resistant, were transformed into embryogenic calli. A number of transformed embryogenic lines resistant to herbicide Basta were obtained and were later regenerated to produce few hundred plantlets. Molecular analyses, including polymerase chain reaction (PCR), Southern blot, and real-time PCR have demonstrated stable integration and expression of the transgenes in the oil palm genome. HPLC and Nile blue A staining analyses confirmed the synthesis of PHB in some of the plantlets. PMID:26322053

  18. High-level recombinant protein production in CHO cells using an adenoviral vector and the cumate gene-switch.

    Science.gov (United States)

    Gaillet, Bruno; Gilbert, Rénald; Amziani, Rachid; Guilbault, Claire; Gadoury, Christine; Caron, Antoine W; Mullick, Alaka; Garnier, Alain; Massie, Bernard

    2007-01-01

    To facilitate and accelerate the production of eukaryotic proteins with correct post-translational modifications, we have developed a protein production system based on the transduction of Chinese hamster ovary (CHO) cells using adenovirus vectors (AdVs). We have engineered a CHO cell line (CHO-cTA) that stably expresses the transactivator (cTA) of our newly developed cumate gene-switch transcription system. This cell line is adapted to suspension culture and can grow in serum-free and protein-free medium. To increase the transduction level of AdVs, we have also generated a cell line (CHO-cTA-CAR) that expresses additional amounts of the coxackievirus and adenovirus receptor (CAR) on its surface. Recombinant protein production was tested using an AdV carrying the secreted alkaline phosphatase (SEAP) under the control of the CR5 promoter, which is strongly and specifically activated by binding to cTA. The SEAP expression was linked to the expression of the green fluorescent protein (GFP) through an internal ribosome entry site (IRES) to facilitate titration of the AdV. We monitored SEAP expression on a daily basis for 9 days after transduction of CHO-cTA and CHO-cTA-CAR using different quantities of AdVs at 37 and 30 degrees C. Incubation at the latter temperature increased the production of SEAP at least 10-fold, and the presence of CAR increased the transduction level of the AdV. Maximum SEAP production (63 mg/L) was achieved at 6-7 days post-infection at 30 degrees C by transducing CHO-cTA-CAR with 500 infectious particles/cell. Because numerous AdVs can now be generated within a few weeks and large-scale production of AdVs is now a routine procedure, this system could be used to produce rapidly milligram quantities of a battery of recombinant proteins as well as for large-scale protein production.

  19. Intracellular localization of the HCS2 gene products in identified snail neurons in vivo and in vitro.

    Science.gov (United States)

    Ivanova, J L; Leonova, O G; Popenko, V I; Ierusalimsky, V N; Korshunova, T A; Boguslavsky, D V; Malyshev, A Y; Balaban, P M; Belyavsky, A V

    2006-03-01

    1. The HCS2 (Helix command specific 2) gene expressed in giant command neurons for withdrawal behavior of the terrestrial snail Helix lucorum encodes a unique hybrid precursor protein that contains a Ca-binding (EF-hand motif) protein and four small peptides (CNP1-CNP4) with similar Tyr-Pro-Arg-X aminoacid sequence at the C terminus. Previous studies suggest that under conditions of increased intracellular Ca(2+) concentration the HCS2 peptide precursor may be cleaved, and small physiologically active peptides transported to the release sites. In the present paper, intracellular localization of putative peptide products of the HCS2-encoded precursor was studied immunocytochemically by means of light and electron microscopy. 2. Polyclonal antibodies against the CNP3 neuropeptide and a Ca-binding domain of the precursor protein were used for gold labeling of ultrathin sections of identified isolated neurons maintained in culture for several days, and in same identified neurons freshly isolated from the central nervous system. 3. In freshly isolated neurons, the gold particles were mainly localized over the cytoplasmic secretory granules, with the density of labeling for the CNP3 neuropeptide being two-fold higher than for the calcium-binding domain. In cultured neurons, both antibodies mostly labeled clusters of secretory granules in growth cones and neurites of the neuron. The density of labeling for cultured neurons was the same for both antibodies, and was two-fold higher than for the freshly isolated from the central nervous system neurons. 4. The immunogold particles were practically absent in the bodies of cultured neurons. 5. The data obtained conform to the suggestion that the HCS2 gene products are transported from the cell body to the regions of growth or release sites. PMID:16763780

  20. Posttranslational modifications, localization, and protein interactions of optineurin, the product of a glaucoma gene.

    Directory of Open Access Journals (Sweden)

    Hongyu Ying

    Full Text Available BACKGROUND: Glaucoma is a major blinding disease. The most common form of this disease, primary open angle glaucoma (POAG, is genetically heterogeneous. One of the candidate genes, optineurin, is linked principally to normal tension glaucoma, a subtype of POAG. The present study was undertaken to illustrate the basic characteristics of optineurin. METHODOLOGY/PRINCIPAL FINDINGS: Lysates from rat retinal ganglion RGC5 cells were subjected to N- or O-deglycosylation or membrane protein extraction. The phosphorylation status was evaluated after immunoprecipitation. It was found that while phosphorylated, optineurin was neither N- nor O-glycosylated, and was by itself not a membrane protein. RGC5 and human retinal pigment epithelial cells were double stained with anti-optineurin and anti-GM130. The endogenous optineurin exhibited a diffuse, cytoplasmic distribution, but a population of the protein was associated with the Golgi apparatus. Turnover experiments showed that the endogenous optineurin was relatively short-lived, with a half-life of approximately 8 hours. Native blue gel electrophoresis revealed that the endogenous optineurin formed homohexamers. Optineurin also interacted with molecules including Rab8, myosin VI, and transferrin receptor to assemble into supermolecular complexes. When overexpressed, optineurin-green fluorescence protein (GFP fusion protein formed punctate structures termed "foci" in the perinuclear region. Treatment of nocadazole resulted in dispersion of the optineurin foci. In addition, tetracycline-regulated optineurin-GFPs expressing RGC5 stable cell lines were established for the first time. CONCLUSIONS/SIGNIFICANCE: The present study provides new information regarding basic characteristics of optineurin that are important for future efforts in defining precisely how optineurin functions normally and how mutations may result in pathology. The inducible optineurin-GFP-expressing cell lines are also anticipated to

  1. Schizophrenia susceptibility gene product dysbindin-1 regulates the homeostasis of cyclin D1.

    Science.gov (United States)

    Ito, Hidenori; Morishita, Rika; Nagata, Koh-Ichi

    2016-08-01

    Dysbindin-1 (dystrobrevin binding protein-1, DTNBP1) is now widely accepted as a potential schizophrenia susceptibility gene and accumulating evidence indicates its functions in the neural development. In this study, we tried to identify new binding partners for dysbindin-1 to clarify the novel function of this molecule. When consulted with BioGRID protein interaction database, cyclin D3 was found to be a possible binding partner for dysbindin-1. We then examined the interaction between various dysbindin-1 isoforms (dysbindin-1A, -1B and -1C) and all three D-type cyclins (cyclin D1, D2, and D3) by immunoprecipitation with the COS7 cell expression system, and found that dysbindin-1A preferentially interacts with cyclin D1. The mode of interaction between these molecules was considered as direct binding since recombinant dysbindin-1A and cyclin D1 formed a complex in vitro. Mapping analyses revealed that the C-terminal region of dysbindin-1A binds to the C-terminal of cyclin D1. Consistent with the results of the biochemical analyses, endogenous dysbindin-1was partially colocalized with cyclin D1 in NIH3T3 fibroblast cells and in neuronal stem and/or progenitor cells in embryonic mouse brain. While co-expression of dysbindin-1A with cyclin D1 changed the localization of the latter from the nucleus to cytosol, cyclin D1-binding partner CDK4 inhibited the dysbindin-cyclin D1 interaction. Meanwhile, depletion of endogenous dysbindin-1A increased cyclin D1 expression. These results indicate that dysbindin-1A may control the cyclin D1 function spatiotemporally and might contribute to better understanding of the pathophysiology of dysbindin-1-associated disorders. PMID:27130439

  2. A cell engineering strategy to enhance supercoiled plasmid DNA production for gene therapy.

    Science.gov (United States)

    Hassan, Sally; Keshavarz-Moore, Eli; Ward, John

    2016-09-01

    With the recent revival of the promise of plasmid DNA vectors in gene therapy, a novel synthetic biology approach was used to enhance the quantity, (yield), and quality of the plasmid DNA. Quality was measured by percentage supercoiling and supercoiling density, as well as improving segregational stability in fermentation. We examined the hypothesis that adding a Strong Gyrase binding Site (SGS) would increase DNA gyrase-mediated plasmid supercoiling. SGS from three different replicons, (the Mu bacteriophage and two plasmids, pSC101 and pBR322) were inserted into the plasmid, pUC57. Different sizes of these variants were transformed into E. coli DH5α, and their supercoiling properties and segregational stability measured. A 36% increase in supercoiling density was found in pUC57-SGS, but only when SGS was derived from the Mu phage and was the larger sized version of this fragment. These results were also confirmed at fermentation scale. Total percentage supercoiled monomer was maintained to 85-90%. A twofold increase in plasmid yield was also observed for pUC57-SGS in comparison to pUC57. pUC57-SGS displayed greater segregational stability than pUC57-cer and pUC57, demonstrating a further potential advantage of the SGS site. These findings should augment the potential of plasmid DNA vectors in plasmid DNA manufacture. Biotechnol. Bioeng. 2016;113: 2064-2071. © 2016 The Authors. Biotechnology and Bioengineering Published by Wiley Periodicals, Inc. PMID:26928284

  3. Monitoring Campylobacter in the poultry production chain—from culture to genes and beyond.

    Science.gov (United States)

    Josefsen, Mathilde H; Bhunia, Arun K; Engvall, Eva Olsson; Fachmann, Mette S R; Hoorfar, Jeffrey

    2015-05-01

    Improved monitoring tools are important for the control of Campylobacter bacteria in poultry production. Standardized reference culture methods issued by national and international standardization organizations are time-consuming, cumbersome and not amenable to automation for screening of large numbers of samples. The ultimate goal for rapid monitoring of Campylobacter is to prevent contaminated meat from entering the food market. Currently, real-time PCR is fulfilling abovementioned criteria to a certain extent. Further development of real-time PCR, microarray PCR, miniaturized biosensors, chromatographic techniques and DNA sequencing can improve our monitoring capacity at a lower cost. Combined with innovative sampling and sample treatment, these techniques could become realistic options for on-farm and liquid-sample monitoring at slaughterhouses.

  4. Immunocytochemical localization and identification of prosomatostatin gene products in medullary carcinoma of human thyroid gland.

    Science.gov (United States)

    Scopsi, L; Ferrari, C; Pilotti, S; Holst, J J; Rehfeld, J F; Fossati, G; Rilke, F

    1990-08-01

    Thirty-three cases of histologically proven calcitonin-positive medullary thyroid carcinoma were studied immunocytochemically for the occurrence of prosomatostatin-related peptides. Positive cells, identified with a panel of antisera raised against four different regions of the prosomatostatin molecule, were found in 100% of the tumors. Most but not all somatostatin-positive cells were also immunoreactive for calcitonin. Notably, seven patients harboring somatostatin-rich tumors revealed a more favorable clinical course. The results (1) indicate that somatostatin production is a universal concomitant of thyroid medullary carcinoma, (2) suggest that these cells are likely to produce a somatostatin precursor molecule similar to mammalian prosomatostatin, and (3) imply that somatostatin-reactive cells may have as yet unknown roles in these tumors, possibly in the realm of paracrine and autocrine regulation of cell growth.

  5. Pleiotropic regulatory genes bldA, adpA and absB are implicated in production of phosphoglycolipid antibiotic moenomycin.

    Science.gov (United States)

    Makitrynskyy, Roman; Ostash, Bohdan; Tsypik, Olga; Rebets, Yuriy; Doud, Emma; Meredith, Timothy; Luzhetskyy, Andriy; Bechthold, Andreas; Walker, Suzanne; Fedorenko, Victor

    2013-10-01

    Unlike the majority of actinomycete secondary metabolic pathways, the biosynthesis of peptidoglycan glycosyltransferase inhibitor moenomycin in Streptomyces ghanaensis does not involve any cluster-situated regulators (CSRs). This raises questions about the regulatory signals that initiate and sustain moenomycin production. We now show that three pleiotropic regulatory genes for Streptomyces morphogenesis and antibiotic production-bldA, adpA and absB-exert multi-layered control over moenomycin biosynthesis in native and heterologous producers. The bldA gene for tRNA(Leu)UAA is required for the translation of rare UUA codons within two key moenomycin biosynthetic genes (moe), moeO5 and moeE5. It also indirectly influences moenomycin production by controlling the translation of the UUA-containing adpA and, probably, other as-yet-unknown repressor gene(s). AdpA binds key moe promoters and activates them. Furthermore, AdpA interacts with the bldA promoter, thus impacting translation of bldA-dependent mRNAs-that of adpA and several moe genes. Both adpA expression and moenomycin production are increased in an absB-deficient background, most probably because AbsB normally limits adpA mRNA abundance through ribonucleolytic cleavage. Our work highlights an underappreciated strategy for secondary metabolism regulation, in which the interaction between structural genes and pleiotropic regulators is not mediated by CSRs. This strategy might be relevant for a growing number of CSR-free gene clusters unearthed during actinomycete genome mining. PMID:24153004

  6. Analysis of single nucleotide polymorphisms in major and candidate genes for production traits in Nero Siciliano pig breed

    Directory of Open Access Journals (Sweden)

    Alessandro Zumbo

    2010-01-01

    Full Text Available Nero Siciliano (NS; Sicilian Black is a local pig breed reared on the island of Sicily mainly under extensive management.The breed is well adapted to marginal conditions and is appreciated for its reproductive performance, disease resistanceand production of tasty meat. For a genetic characterization of this breed we analyzed the allele frequencies of singlenucleotide polymorphisms (SNPs in eight major or candidate genes (ryanodine receptor 1, RYR1; Na+, K+ ATPase subunitα 2, ATP1A2; myosin heavy chain 2B, MYH4; sarcolipin, SLN; cathepsin B, CTSB; cystatin B, CSTB; estrogen receptor,ESR; melanocortin receptor 1, MC1R for performance and phenotypic traits. The animals that were sampled andanalyzed represent about 6-8% of the total NS pig population. PCR-RFLP or PCR-SSCP techniques were used to type theDNA markers in the selected loci. Exact test of Hardy-Weinberg equilibrium was computed for each locus, Fis statisticsand heterozygosity were calculated for each locus and over all loci. Allele frequencies obtained in NS breed were comparedto the frequencies already available in literature for the Large White, Landrace, Duroc, Belgian Landrace, Piétrain,Hampshire and Meishan breeds. For the ESR locus, as no information on the distribution of the two alleles were available,we typed a sample of unrelated pigs from the considered breeds.Even if only eight loci were studied in NS breed, important elements were obtained from the data. The 1843T (n alleleat the RYR1 locus is present in NS breed, thus the molecular test to identify the carriers of this allele should be adoptedto avoid its spreading in the population. Moreover, other studies are needed to clarify the allelic structure of the MC1Rgene, which affects coat color, in order to evaluate if this gene could be used in genetic tests for the traceability of themeat products of this breed. Finally, the present work represents an attempt to evaluate data on mutations within majorand candidate genes

  7. Human Immunodeficiency Virus-Type 1 LTR DNA contains an intrinsic gene producing antisense RNA and protein products

    Directory of Open Access Journals (Sweden)

    Hsiao Chiu-Bin

    2006-11-01

    Full Text Available Abstract Background While viruses have long been shown to capitalize on their limited genomic size by utilizing both strands of DNA or complementary DNA/RNA intermediates to code for viral proteins, it has been assumed that human retroviruses have all their major proteins translated only from the plus or sense strand of RNA, despite their requirement for a dsDNA proviral intermediate. Several studies, however, have suggested the presence of antisense transcription for both HIV-1 and HTLV-1. More recently an antisense transcript responsible for the HTLV-1 bZIP factor (HBZ protein has been described. In this study we investigated the possibility of an antisense gene contained within the human immunodeficiency virus type 1 (HIV-1 long terminal repeat (LTR. Results Inspection of published sequences revealed a potential transcription initiator element (INR situated downstream of, and in reverse orientation to, the usual HIV-1 promoter and transcription start site. This antisense initiator (HIVaINR suggested the possibility of an antisense gene responsible for RNA and protein production. We show that antisense transcripts are generated, in vitro and in vivo, originating from the TAR DNA of the HIV-1 LTR. To test the possibility that protein(s could be translated from this novel HIV-1 antisense RNA, recombinant HIV antisense gene-FLAG vectors were designed. Recombinant protein(s were produced and isolated utilizing carboxy-terminal FLAG epitope (DYKDDDDK sequences. In addition, affinity-purified antisera to an internal peptide derived from the HIV antisense protein (HAP sequences identified HAPs from HIV+ human peripheral blood lymphocytes. Conclusion HIV-1 contains an antisense gene in the U3-R regions of the LTR responsible for both an antisense RNA transcript and proteins. This antisense transcript has tremendous potential for intrinsic RNA regulation because of its overlap with the beginning of all HIV-1 sense RNA transcripts by 25 nucleotides. The

  8. Evolution and origin of merlin, the product of the Neurofibromatosis type 2 (NF2 tumor-suppressor gene

    Directory of Open Access Journals (Sweden)

    Omelyanchuk Leonid V

    2005-12-01

    Full Text Available Abstract Background Merlin, the product of the Neurofibromatosis type 2 (NF2 tumor suppressor gene, belongs to the ezrin-radixin-moesin (ERM subgroup of the protein 4.1 superfamily, which links cell surface glycoproteins to the actin cytoskeleton. While merlin's functional activity has been examined in mammalian and Drosophila models, little is understood about its evolution, diversity, and overall distribution among different taxa. Results By combining bioinformatic and phylogenetic approaches, we demonstrate that merlin homologs are present across a wide range of metazoan lineages. While the phylogenetic tree shows a monophyletic origin of the ERM family, the origin of the merlin proteins is robustly separated from that of the ERM proteins. The derivation of merlin is thought to be in early metazoa. We have also observed the expansion of the ERM-like proteins within the vertebrate clade, which occurred after its separation from Urochordata (Ciona intestinalis. Amino acid sequence alignment reveals the absence of an actin-binding site in the C-terminal region of all merlin proteins from various species but the presence of a conserved internal binding site in the N-terminal domain of the merlin and ERM proteins. In addition, a more conserved pattern of amino acid residues is found in the region containing the so-called "Blue Box," although some amino acid substitutions in this region exist in the merlin sequences of worms, fish, and Ciona. Examination of sequence variability at functionally significant sites, including the serine-518 residue, the phosphorylation of which modulates merlin's intra-molecular association and function as a tumor suppressor, identifies several potentially important sites that are conserved among all merlin proteins but divergent in the ERM proteins. Secondary structure prediction reveals the presence of a conserved α-helical domain in the central to C-terminal region of the merlin proteins of various species. The

  9. Derepression of prophage P2 by satellite phage P4: cloning of the P4 epsilon gene and identification of its product.

    OpenAIRE

    Liu, T; Renberg, S K; Haggård-Ljungquist, E

    1997-01-01

    Escherichia coli phage P4 lacks all of the genetic information necessary for capsid, tail, and lysis functions. P4 is therefore dependent on a helper phage, such as P2, for lytic propagation. During P4 superinfection of a P2 lysogen, the P2 prophage is derepressed by the action of the P4-encoded epsilon gene. We have cloned the epsilon gene and identified the 10-kDa E protein. The epsilon gene product is the only P4 protein required to derepress prophage P2, which leads to in situ P2 DNA repl...

  10. MeSH-Informed Enrichment Analysis and MeSH-Guided Semantic Similarity Among Functional Terms and Gene Products in Chicken

    Directory of Open Access Journals (Sweden)

    Gota Morota

    2016-08-01

    Full Text Available Biomedical vocabularies and ontologies aid in recapitulating biological knowledge. The annotation of gene products is mainly accelerated by Gene Ontology (GO, and more recently by Medical Subject Headings (MeSH. Here, we report a suite of MeSH packages for chicken in Bioconductor, and illustrate some features of different MeSH-based analyses, including MeSH-informed enrichment analysis and MeSH-guided semantic similarity among terms and gene products, using two lists of chicken genes available in public repositories. The two published datasets that were employed represent (i differentially expressed genes, and (ii candidate genes under selective sweep or epistatic selection. The comparison of MeSH with GO overrepresentation analyses suggested not only that MeSH supports the findings obtained from GO analysis, but also that MeSH is able to further enrich the representation of biological knowledge and often provide more interpretable results. Based on the hierarchical structures of MeSH and GO, we computed semantic similarities among vocabularies, as well as semantic similarities among selected genes. These yielded the similarity levels between significant functional terms, and the annotation of each gene yielded the measures of gene similarity. Our findings show the benefits of using MeSH as an alternative choice of annotation in order to draw biological inferences from a list of genes of interest. We argue that the use of MeSH in conjunction with GO will be instrumental in facilitating the understanding of the genetic basis of complex traits.

  11. MeSH-Informed Enrichment Analysis and MeSH-Guided Semantic Similarity Among Functional Terms and Gene Products in Chicken.

    Science.gov (United States)

    Morota, Gota; Beissinger, Timothy M; Peñagaricano, Francisco

    2016-01-01

    Biomedical vocabularies and ontologies aid in recapitulating biological knowledge. The annotation of gene products is mainly accelerated by Gene Ontology (GO), and more recently by Medical Subject Headings (MeSH). Here, we report a suite of MeSH packages for chicken in Bioconductor, and illustrate some features of different MeSH-based analyses, including MeSH-informed enrichment analysis and MeSH-guided semantic similarity among terms and gene products, using two lists of chicken genes available in public repositories. The two published datasets that were employed represent (i) differentially expressed genes, and (ii) candidate genes under selective sweep or epistatic selection. The comparison of MeSH with GO overrepresentation analyses suggested not only that MeSH supports the findings obtained from GO analysis, but also that MeSH is able to further enrich the representation of biological knowledge and often provide more interpretable results. Based on the hierarchical structures of MeSH and GO, we computed semantic similarities among vocabularies, as well as semantic similarities among selected genes. These yielded the similarity levels between significant functional terms, and the annotation of each gene yielded the measures of gene similarity. Our findings show the benefits of using MeSH as an alternative choice of annotation in order to draw biological inferences from a list of genes of interest. We argue that the use of MeSH in conjunction with GO will be instrumental in facilitating the understanding of the genetic basis of complex traits. PMID:27261003

  12. Evaluation of modified hodge test as an indicator of klebsiella pneumoniae carbapenemase (KPC production by using bla kpc gene PCR

    Directory of Open Access Journals (Sweden)

    Priyadarshini Shanmugam, Nirupa Soundararajan, Jeya Meenakshisundaram

    2014-03-01

    Full Text Available Introduction: Carbapenems belong to the Beta Lactam group of antimicrobial agents. They are often used as “last-line agents” or “antibiotics of last resort” in critically ill patients. Carbapenem resistance in Enterobacteriaceae may be due to various reasons but Klebsiella pneumoniae Carbapenemase (KPC enzyme production is the commonest. Phenotypic as well as genotypic methods can be used to detect Carbapenemases. Among the phenotypic tests, Modified Hodge Test (MHT is relatively easy to perform. Aims and Objectives: This study aimed to determine the prevalence of carbapenem resistance among Enterobacteriaceae isolates and calculate the sensitivity of MHT as an indicator of KPC production. Materials and Methods: All Enterobacteriaceae isolates from clinical samples were included in this study and were screened for Carbapenem resistance. 45 randomly chosen Carbapenem Resistant Enterobacteriaceae isolates were subjected to MHT and blaKPC gene detection by PCR. Results: 2035 Enterobacteriaceae isolates were tested and 5.2% were found to be resistant to Imipenem, 22.9 % were resistant to Meropenem and 4.42 % were resistant to both Imipenem and Meropenem. The sensitivity of MHT was calculated to be 90% and specificity was calculated to be 60%

  13. The products of the SUP45 (eRF1) and SUP35 genes interact to mediate translation termination in Saccharomyces cerevisiae.

    OpenAIRE

    Stansfield, I; Jones, K M; Kushnirov, V V; Dagkesamanskaya, A. R.; Poznyakovski, A I; Paushkin, S V; Nierras, C R; Cox, B S; Ter-Avanesyan, M D; Tuite, M F

    1995-01-01

    The product of the yeast SUP45 gene (Sup45p) is highly homologous to the Xenopus eukaryote release factor 1 (eRF1), which has release factor activity in vitro. We show, using the two-hybrid system, that in Saccharomyces cerevisiae Sup45p and the product of the SUP35 gene (Sup35p) interact in vivo. The ability of Sup45p C-terminally tagged with (His)6 to specifically precipitate Sup35p from a cell lysate was used to confirm this interaction in vitro. Although overexpression of either the SUP45...

  14. [Expression of Mortierella isabellina delta6-fatty acid desaturase gene in gamma-linolenic acid production in transgenic tobacco].

    Science.gov (United States)

    Li, Ming-Chun; Liu, Li; Hu, Guo-Wu; Xing, Lai-Jun

    2003-03-01

    Gamma-linolenic acid (GLA, C18:3delta6.9.12) is nutritional and important polyunsaturated fatty acid in human and animal diets. GLA play an important role in hormone regulation and fatty acid metabolization. Furthermore it is also the biological precursor of a group of molecules, including prostaglandins, leukotrienes and thromboxanes. Vast majority of oilseed crops do not produce GLA, but linoleic acid (LA, C18:2delta9.12) as its substrate. GLA is only produced by a small number of oilseed plants such as evening promrose ( Oenotheera spp.), borage (Borago officinalis) and etc. delta6-fatty acid desaturase (D6D) is the rate-limiting enzyme in the production of GLA. It can convert from linoleic acid to linolenic acid. To produce GLA in tobacco, plant expression vector was first constructed. To facilitate preparation of plant expression constructs, flanking Xba I and Bgl II restriction enzyme sites were added to the coding region of clone pTMICL6 by PCR amplification. pTMICL6 contains delta6-fatty acid desaturase gene cloned from Mortierella isabellina which is an oil-producing fugus. The PCR product was purified and subcloned into the plant expression vector pGA643 to generate the recombinant vector pGAMICL6 which contains the ORF of the D6D gene of Mortierella isabellina, together with regulatory elements consisting of the cauliflower mosaic virus 35S promoter and the nopaline synthase (nos) termination sequence. The plasmid pGAMICL6 was transformed into Agrobacterium tumefaciens strain LBA4404 by method of freeze thawing of liquid nitrogen. Transformants were selected by plating on YEB medium plates containing kanamycin and streptomycin and grown overnight at 28 degrees C, then transformants were further identified by PCR. The positive transformant containing the plant expression vector pGAMICL6 was transformed into tobacco ( Nicotiana tabacum cv. Xanthi) via Agrobacterium infection. Transgenic plants were selected on 100 microg/mL kanamycin. Plants were

  15. A systems biology approach to investigate the effect of pH-induced gene regulation on solvent production by Clostridium acetobutylicum in continuous culture

    Directory of Open Access Journals (Sweden)

    Bahl Hubert

    2011-01-01

    Full Text Available Abstract Background Clostridium acetobutylicum is an anaerobic bacterium which is known for its solvent-producing capabilities, namely regarding the bulk chemicals acetone and butanol, the latter being a highly efficient biofuel. For butanol production by C. acetobutylicum to be optimized and exploited on an industrial scale, the effect of pH-induced gene regulation on solvent production by C. acetobutylicum in continuous culture must be understood as fully as possible. Results We present an ordinary differential equation model combining the metabolic network governing solvent production with regulation at the genetic level of the enzymes required for this process. Parameterizing the model with experimental data from continuous culture, we demonstrate the influence of pH upon fermentation products: at high pH (pH 5.7 acids are the dominant product while at low pH (pH 4.5 this switches to solvents. Through steady-state analyses of the model we focus our investigations on how alteration in gene expression of C. acetobutylicum could be exploited to increase butanol yield in a continuous culture fermentation. Conclusions Incorporating gene regulation into the model of solvent production by C. acetobutylicum enables an accurate representation of the pH-induced switch to solvent production to be obtained and theoretical investigations of possible synthetic-biology approaches to be pursued. Steady-state analyses suggest that, to increase butanol yield, alterations in the expression of single solvent-associated genes are insufficient; a more complex approach targeting two or more genes is required.

  16. Further increased production of free fatty acids by overexpressing a predicted transketolase gene of the pentose phosphate pathway in Aspergillus oryzae faaA disruptant.

    Science.gov (United States)

    Tamano, Koichi; Miura, Ai

    2016-09-01

    Free fatty acids are useful as source materials for the production of biodiesel fuel and various chemicals such as pharmaceuticals and dietary supplements. Previously, we attained a 9.2-fold increase in free fatty acid productivity by disrupting a predicted acyl-CoA synthetase gene (faaA, AO090011000642) in Aspergillus oryzae. In this study, we achieved further increase in the productivity by overexpressing a predicted transketolase gene of the pentose phosphate pathway in the faaA disruptant. The A. oryzae genome is predicted to have three transketolase genes and overexpression of AO090023000345, one of the three genes, resulted in phenotypic change and further increase (corresponding to an increased production of 0.38 mmol/g dry cell weight) in free fatty acids at 1.4-fold compared to the faaA disruptant. Additionally, the biomass of hyphae increased at 1.2-fold by the overexpression. As a result, free fatty acid production yield per liter of liquid culture increased at 1.7-fold by the overexpression.

  17. Exploring and dissecting genome-wide gene expression responses of Penicillium chrysogenum to phenylacetic acid consumption and penicillinG production

    Directory of Open Access Journals (Sweden)

    Hage Susanne

    2009-02-01

    Full Text Available Abstract Background Since the discovery of the antibacterial activity of penicillin by Fleming 80 years ago, improvements of penicillin titer were essentially achieved by classical strain improvement through mutagenesis and screening. The recent sequencing of Penicillium chrysogenum strain Wisconsin1255-54 and the availability of genomics tools such as DNA-microarray offer new perspective. Results In studies on β-lactam production by P. chrysogenum, addition and omission of a side-chain precursor is commonly used to generate producing and non-producing scenarios. To dissect effects of penicillinG production and of its side-chain precursor phenylacetic acid (PAA, a derivative of a penicillinG high-producing strain without a functional penicillin-biosynthesis gene cluster was constructed. In glucose-limited chemostat cultures of the high-producing and cluster-free strains, PAA addition caused a small reduction of the biomass yield, consistent with PAA acting as a weak-organic-acid uncoupler. Microarray-based analysis on chemostat cultures of the high-producing and cluster-free strains, grown in the presence and absence of PAA, showed that: (i Absence of a penicillin gene cluster resulted in transcriptional upregulation of a gene cluster putatively involved in production of the secondary metabolite aristolochene and its derivatives, (ii The homogentisate pathway for PAA catabolism is strongly transcriptionally upregulated in PAA-supplemented cultures (iii Several genes involved in nitrogen and sulfur metabolism were transcriptionally upregulated under penicillinG producing conditions only, suggesting a drain of amino-acid precursor pools. Furthermore, the number of candidate genes for penicillin transporters was strongly reduced, thus enabling a focusing of functional analysis studies. Conclusion This study demonstrates the usefulness of combinatorial transcriptome analysis in chemostat cultures to dissect effects of biological and process

  18. The Haemophilus influenzae dprABC genes constitute a competence-inducible operon that requires the product of the tfoX (sxy) gene for transcriptional activation.

    OpenAIRE

    Karudapuram, S; Barcak, G J

    1997-01-01

    We previously showed that dprA is required for efficient processing of linear DNA during cellular transformation in Haemophilus influenzae. In this study the transcriptional regulation of dprA and two downstream genes, dprB and dprC, is examined. We demonstrate by Northern blot analysis that the dprABC genes are transcriptionally coregulated and competence inducible. We used primer extension analysis to map the transcriptional start site of dprA and of rec-2, another transformation gene invol...

  19. The Cyclic Di-GMP Phosphodiesterase Gene Rv1357c/BCG1419c Affects BCG Pellicle Production and In Vivo Maintenance.

    Science.gov (United States)

    Flores-Valdez, Mario Alberto; Aceves-Sánchez, Michel de Jesús; Pedroza-Roldán, César; Vega-Domínguez, Perla Jazmín; Prado-Montes de Oca, Ernesto; Bravo-Madrigal, Jorge; Laval, Françoise; Daffé, Mamadou; Koestler, Ben; Waters, Christopher M

    2015-02-01

    Bacteria living in a surface-attached community that contains a heterogeneous population, coated with an extracellular matrix, and showing drug tolerance (biofilms) are often linked to chronic infections. In mycobacteria, the pellicle mode of growth has been equated to an in vitro biofilm and meets several of the criteria mentioned above, while tuberculosis infection presents a chronic (latent) phase of infection. As mycobacteria lack most genes required to control biofilm production by other microorganisms, we deleted or expressed from the hsp60 strong promoter the only known c-di-GMP phosphodiesterase (PDE) gene in Mycobacterium bovis BCG. We found changes in pellicle production, cellular protein profiles, lipid production, resistance to nitrosative stress and maintenance in lungs and spleens of immunocompetent BALB/mice. Our results show that pellicle production and capacity to remain within the host are linked in BCG.

  20. Rv2131c gene product: An unconventional enzyme that is both inositol monophosphatase and fructose-1,6-bisphosphatase

    International Nuclear Information System (INIS)

    Inositol monophosphatase is an enzyme in the biosynthesis of myo-inostiol, a crucial substrate for the synthesis of phosphatidylinositol, which has been demonstrated to be an essential component of mycobacteria. In this study, the Rv2131c gene from Mycobacterium tuberculosis H37Rv was cloned into the pET28a vector and the recombinant plasmid was transformed into Escherichia coli BL21 (DE3) strain, allowing the expression of the enzyme in fusion with a histidine-rich peptide on the N-terminal. The fusion protein was purified from the soluble fraction of the lysed cells under native conditions by immobilized metal affinity chromatography (IMAC). The purified Rv2131c gene product showed inositol monophosphatase activity but with substrate specificity that was broader than those of several bacterial and eukaryotic inositol monophosphatases, and it also acted as fructose-1,6-bisphosphatase. The dimeric enzyme exhibited dual activities of IMPase and FBPase, with K m of 0.22 ± 0.03 mM for inositol-1-phosphate and K m of 0.45 ± 0.05 mM for fructose-1,6-bisphosphatase. To better understand the relationship between the function and structure of the Rv2131c enzyme, we constructed D40N, L71A, and D94N mutants and purified these corresponding proteins. Mutations of D40N and D94N caused the proteins to almost completely lose both the inositol monophosphatase and fructose-1,6-bisphosphatase activities. However, L71A mutant did not cause loss either of the activities, but the activity toward the inositol was 12-fold more resistant to inhibition by lithium (IC5 ∼ 60 mM). Based on the substrate specificity and presence of conserved sequence motifs of the M. tuberculosis Rv2131c, we proposed that the enzyme belonged to class IV fructose-1,6-bisphosphatase (FBPase IV)

  1. Osteopontin Modulates Inflammation, Mucin Production, and Gene Expression Signatures After Inhalation of Asbestos in a Murine Model of Fibrosis

    Science.gov (United States)

    Sabo-Attwood, Tara; Ramos-Nino, Maria E.; Eugenia-Ariza, Maria; MacPherson, Maximilian B.; Butnor, Kelly J.; Vacek, Pamela C.; McGee, Sean P.; Clark, Jessica C.; Steele, Chad; Mossman, Brooke T.

    2011-01-01

    Inflammation and lung remodeling are hallmarks of asbestos-induced fibrosis, but the molecular mechanisms that control these events are unclear. Using laser capture microdissection (LCM) of distal bronchioles in a murine asbestos inhalation model, we show that osteopontin (OPN) is up-regulated by bronchiolar epithelial cells after chrysotile asbestos exposures. In contrast to OPN wild-type mice (OPN+/+) inhaling asbestos, OPN null mice (OPN−/−) exposed to asbestos showed less eosinophilia in bronchoalveolar lavage fluids, diminished lung inflammation, and decreased mucin production. Bronchoalveolar lavage fluid concentrations of inflammatory cytokines (IL-1β, IL-4, IL-6, IL-12 subunit p40, MIP1α, MIP1β, and eotaxin) also were significantly less in asbestos-exposed OPN−/− mice. Microarrays performed on lung tissues from asbestos-exposed OPN+/+ and OPN−/− mice showed that OPN modulated the expression of a number of genes (Col1a2, Timp1, Tnc, Eln, and Col3a1) linked to fibrosis via initiation and cross talk between IL-1β and epidermal growth factor receptor-related signaling pathways. Novel targets of OPN identified include genes involved in cell signaling, immune system/defense, extracellular matrix remodeling, and cell cycle regulation. Although it is unclear whether the present findings are specific to chrysotile asbestos or would be observed after inhalation of other fibers in general, these results highlight new potential mechanisms and therapeutic targets for asbestosis and other diseases (asthma, smoking-related interstitial lung diseases) linked to OPN overexpression. PMID:21514415

  2. Presence of exoY, exoS, exoU and exoT genes, antibiotic resistance and biofilm production among Pseudomonas aeruginosa isolates in Northwest Iran

    OpenAIRE

    Azimi, Somayeh; Kafil, Hossein Samadi; Baghi, Hossein Bannazadeh; Shokrian, Saeed; Najaf, Khadijeh; ASGHARZADEH, Mohammad; Yousefi, Mehdi; Shahrivar, Firooz; Aghazadeh, Mohammad

    2016-01-01

    Background: Pseudomonas aeruginosa, as Gram-negative rod bacilli, has an important role in human infection. In the present study we aimed to investigate the presence of exo genes and biofilm production among Pseudomonas aeruginosa isolates in Northwest Iran. Material and methods: 160 isolates of P. aeruginosa were collected and identified by biochemical tests and were characterized for antibiotic resistance. Biofilm production was evaluated by microtiter plate assay and the presence of exo ge...

  3. Association of neuropeptide Y and gonadotrophin-releasing hormone receptor gene SNPs with breeding value for growth and egg production traits in Mazandaran native chickens.

    Science.gov (United States)

    Fatemi, S A; Mehrabani-Yeganeh, H; Nejati-Javaremi, A; Niknafs, Sh

    2012-08-16

    Neuropeptide Y (NPY) and gonadotrophin-releasing hormone receptor (GnRHR) are two candidate genes with a wide variety of physiological functions in growth and especially in reproduction processes. We examined the association of one SNP from each of these genes with growth- and egg production-related traits in Mazandaran native chickens. Two hundred and six individuals were genotyped by PCR-RFLP. Marker-trait association analyses were performed using both breeding value and phenotypic information. The data came from 18 successive generations of selection at a Mazandaran native chicken breeding station in Iran. Data were analyzed with a univariate animal model in an ASREML procedure to estimate breeding values of the birds for these traits. Two alleles were found for both genes, A and a alleles for GnRHR, with frequencies of 0.614 and 0.386, B and b alleles for NPY, with frequencies of 0.780 and 0.221, respectively. The additive genetic effects of the GnRHR gene on egg number and egg mass were significant. Also, body weight at sexual maturity was significantly influenced by the NPY gene. We conclude that GnRHR and NPY genes are associated with egg production and growth traits, respectively.

  4. Three genes expressing Kunitz domains in the epididymis are related to genes of WFDC-type protease inhibitors and semen coagulum proteins in spite of lacking similarity between their protein products

    Directory of Open Access Journals (Sweden)

    Lilja Hans

    2011-10-01

    Full Text Available Abstract Background We have previously identified a locus on human chromosome 20q13.1, encompassing related genes of postulated WFDC-type protease inhibitors and semen coagulum proteins. Three of the genes with WFDC motif also coded for the Kunitz-type protease inhibitor motif. In this report, we have reinvestigated the locus for homologous genes encoding Kunitz motif only. The identified genes have been analyzed with respect to structure, expression and function. Results We identified three novel genes; SPINT3, SPINT4 and SPINT5, and the structure of their transcripts were determined by sequencing of DNA generated by rapid amplification of cDNA ends. Each gene encodes a Kunitz domain preceded by a typical signal peptide sequence, which indicates that the proteins of 7.6, 8.7, and 9.7 kDa are secreted. Analysis of transcripts in 26 tissues showed that the genes predominantly are expressed in the epididymis. The recombinantly produced proteins could not inhibit the amidolytic activity of trypsin, chymotrypsin, plasmin, thrombin, coagulation factor Xa, elastase, urokinase and prostate specific antigen, whereas similarly made bovine pancreatic trypsin inhibitor (BPTI had the same bioactivity as the protein isolated from bovine pancreas. Conclusions The similar organization, chromosomal location and site of expression, suggests that the novel genes are homologous with the genes of WFDC-type protease inhibitors and semen coagulum proteins, despite the lack of similarity in primary structure of their protein products. Their restricted expression to the epididymis suggests that they could be important for male reproduction. The recombinantly produced proteins are presumably bioactive, as demonstrated with similarly made BPTI, but may have a narrower spectrum of inhibition, as indicated by the lacking activity against eight proteases with differing specificity. Another possibility is that they have lost the protease inhibiting properties, which is

  5. Triple immunoglobulin gene knockout transchromosomic cattle: bovine lambda cluster deletion and its effect on fully human polyclonal antibody production.

    Directory of Open Access Journals (Sweden)

    Hiroaki Matsushita

    Full Text Available Towards the goal of producing fully human polyclonal antibodies (hpAbs or hIgGs in transchromosomic (Tc cattle, we previously reported that Tc cattle carrying a human artificial chromosome (HAC comprising the entire unrearranged human immunoglobulin (Ig heavy-chain (hIGH, kappa-chain (hIGK, and lambda-chain (hIGL germline loci produced physiological levels of hIgGs when both of the bovine immunoglobulin mu heavy-chains, bIGHM and bIGHML1, were homozygously inactivated (bIGHM-/-, bIGHML1-/-; double knockouts or DKO. However, because endogenous bovine immunoglobulin light chain loci are still intact, the light chains are produced both from the hIGK and hIGL genomic loci on the HAC and from the endogenous bovine kappa-chain (bIGK and lambda-chain (bIGL genomic loci, resulting in the production of fully hIgGs (both Ig heavy-chains and light-chains are of human origin: hIgG/hIgκ or hIgG/hIgλ and chimeric hIgGs (Ig heavy-chains are of human origin while the Ig light-chains are of bovine origin: hIgG/bIgκ or hIgG/bIgλ. To improve fully hIgG production in Tc cattle, we here report the deletion of the entire bIGL joining (J and constant (C gene cluster (bIGLJ1-IGLC1 to bIGLJ5-IGLC5 by employing Cre/loxP mediated site-specific chromosome recombination and the production of triple knockout (bIGHM-/-, bIGHML1-/- and bIGL-/-; TKO Tc cattle. We further demonstrate that bIGL cluster deletion greatly improves fully hIgGs production in the sera of TKO Tc cattle, with 51.3% fully hIgGs (hIgG/hIgκ plus hIgG/hIgλ.

  6. Application of gene-based technologies directed at commensal gut bacteria to solve animal productivity constraints in developing countries

    International Nuclear Information System (INIS)

    problems faced by microbial ecologists studying the gut ecosystem are the inevitable bias introduced by culture-based enumeration and characterization techniques, and the lack of a phylogenetically based classification scheme. These limitations can be overcome by the application of modern molecular techniques based on sequence comparisons of nucleic acids and used to provide genotypic characterization while at the same time providing a classification scheme which predicts natural evolutionary relationships. Importantly this molecular approach does not rely on cultivation but rather the analysis of community DNA, representing all resident microbes, extracted from intestinal samples. The powerful combination of molecular biology and Woese's new phylogeny has created the now recognized field of molecular microbial ecology. This is defined as the application of molecular technology, usually based on comparative nucleic acid sequence information, to identify specific microorganisms in the gut environment, to assign functional roles to these specific microorganisms, and to assess their significance or contribution to specific metabolic and physiological processes in the gastrointestinal tract. The advantages and limitations of various techniques employed for molecular microbial ecology studies will be reviewed in an effort to identify which gene-based technologies directed at commensal gut bacteria are most relevant and applicable to solving animal productivity constraints in developing countries. The use of these techniques has lead to major advances in our knowledge and will provide the first complete description of the gastrointestinal ecosystem. The latest and most powerful technologies revolutionizing microbiology are based on genomics - the mapping and sequencing of genomes and analysis of gene and genome function. Genomics refers to a suite of functional and comparative methods that capitalize on the availability of entire or high coverage draft sequence. More than 100

  7. MVE1 Encoding the velvet gene product homolog in Mycosphaerella graminicola is associated with aerial mycelium formation, melanin biosynthesis, hyphal swelling, and light signaling

    Science.gov (United States)

    The ascomycete fungus Mycosphaerella graminicola is an important pathogen of wheat that causes the disease septoria tritici blotch. Despite the serious impact of M. graminicola on wheat production worldwide, knowledge about its molecular biology is limited. The velvet gene, veA, is one of the key re...

  8. Effects of ammonium ion, acetate and aerobic conditions on hydrogen production and expression levels of nitrogenase genes in Rhodobacter sphaeroides O.U.001

    Energy Technology Data Exchange (ETDEWEB)

    Akkoese, Sevilay; Guenduez, Ufuk; Yuecel, Meral [Middle East Technical University, Department of Biological Sciences, 06531 Ankara (Turkey); Eroglu, Inci [Middle East Technical University, Department of Chemical Engineering, 06531 Ankara (Turkey)

    2009-11-15

    In the present study, expression levels of nitrogenase encoding nifH and control genes nifA and prrA were examined at different physiological conditions in Rhodobacter sphaeroides O.U.001. In addition to variations in expression levels, changes in hydrogen production and growth were also investigated in response to different concentrations of ammonium source, acetate and aerobic conditions. In the present study, increasing concentration of ammonium chloride was found to be caused decrease in hydrogen production. Glutamate containing medium had the capacity for higher hydrogen production. Hydrogen production was observed even in aerobic conditions. The expression levels of nifH and nifA genes decreased with the increasing concentrations of ammonium chloride. Although the expression of nifA was present in the highest concentrations of NH{sub 4}Cl under anaerobic conditions, no expression was observed under aerobic conditions of the same culture conditions. This was likely due to transcriptional level inhibition of nitrogenase in the presence of ammonium ion. Negative correlation was observed between the expression levels of prrA gene and its target, nifA gene. (author)

  9. Id-1 and Id-2 genes and products as therapeutic targets for treatment of breast cancer and other types of carcinoma

    Energy Technology Data Exchange (ETDEWEB)

    Desprez, Pierre-Yves; Campisi, Judith

    2014-09-30

    A method for treatment and amelioration of breast, cervical, ovarian, endometrial, squamous cells, prostate cancer and melanoma in a patient comprising targeting Id-1 or Id-2 gene expression with a delivery vehicle comprising a product which modulates Id-1 or Id-2 expression.

  10. Transcriptional regulation of the redD transcriptional activator gene accounts for growth-phase-dependent production of the antibiotic undecylprodigiosin in Streptomyces coelicolor A3(2)

    NARCIS (Netherlands)

    Takano, E.; Gramajo, H.C.; Strauch, E.; White, J.; Bibb, M.J.

    1992-01-01

    Transcription of redD, the activator gene required for production of the red-pigmented antibiotic undecylprodigiosin by Streptomyces coelicolor A3(2), showed a dramatic increase during the transition from exponential to stationary phase. The increase in redD expression was followed by transcription

  11. Cloning and Characterization of a Pyruvate Carboxylase Gene from Penicillium rubens and Overexpression of the Genein the Yeast Yarrowia lipolytica for Enhanced Citric Acid Production.

    Science.gov (United States)

    Fu, Ge-Yi; Lu, Yi; Chi, Zhe; Liu, Guang-Lei; Zhao, Shou-Feng; Jiang, Hong; Chi, Zhen-Ming

    2016-02-01

    In this study, a pyruvate carboxylase gene (PYC1) from a marine fungus Penicillium rubens I607 was cloned and characterized. ORF of the gene (accession number: KM397349.1) had 3534 bp encoding 1177 amino acids with a molecular weight of 127.531 kDa and a PI of 6.20. The promoter of the gene was located at -1200 bp and contained a TATAA box, several CAAT boxes and a sequence 5'-SYGGRG-3'. The PYC1 deduced from the gene had no signal peptide, was a homotetramer (α4), and had the four functional domains. After expression of the PYC1 gene from the marine fungus in the marine-derived yeast Yarrowia lipolytica SWJ-1b, the transformant PR32 obtained had much higher specific pyruvate carboxylase activity (0.53 U/mg) than Y. lipolytica SWJ-1b (0.07 U/mg), and the PYC1 gene expression (133.8%) and citric acid production (70.2 g/l) by the transformant PR32 were also greatly enhanced compared to those (100 % and 27.3 g/l) by Y. lipolytica SWJ-1b. When glucose concentration in the medium was 60.0 g/l, citric acid (CA) concentration formed by the transformant PR32 was 36.1 g/l, leading to conversion of 62.1% of glucose into CA. During a 10-l fed-batch fermentation, the final concentration of CA was 111.1 ± 1.3 g/l, the yield was 0.93 g/g, the productivity was 0.46 g/l/h, and only 1.72 g/l reducing sugar was left in the fermented medium within 240 h. HPLC analysis showed that most of the fermentation products were CA. However, minor malic acid and other unknown products also existed in the culture.

  12. FAO/IAEA international symposium on applications of gene-based technologies for improving animal production and health in developing countries. Book of extended synopses

    International Nuclear Information System (INIS)

    Genetic engineering is at the forefront of much biological research - basic, adaptive and applied or near market. Manipulation of genes to bring about the expression of a specific product, or to produce a characteristic or trait, offers exciting possibilities within both the plant and the animal kingdom. The opportunities, in terms of improving livestock productivity or reducing losses from disease, lie in a number of areas. In almost all areas of this research, isotopic markers are extensively used and are in most cases essential for achieving the levels of sensitivity required for genetic characterization and manipulation. Genetic engineering has the potential to solve many problems relating to animal productivity and health. At present the focus is on the problems that face livestock producers in the developed world. If the full benefit of this technology is to be realized globally, the problems confronting livestock farmers in developing countries will have to be considered. The characterization and application of methods in these regions has to be managed and exploited. It is hoped that this Symposium will stimulate the international exchange of information and ideas that contribute to greater accessibility and enhanced use of gene based technologies in animal agriculture in developing countries. OBJECTIVES: To create an interactive environment to discuss the role and future potential of gene based technologies for improving animal production and health; To identify constraints in the use of gene based technologies in developing countries and to determine how to use these technologies in a simple, practical way; To identify and prioritize specific research needs; To explore the possibility of international co-ordination in the area of gene based technologies in animal agriculture; To examine ethical, technological, policy and environmental issues and the role of nuclear techniques in the further development and application of gene based technologies with

  13. Bovine Host Genetic Variation Influences Rumen Microbial Methane Production with Best Selection Criterion for Low Methane Emitting and Efficiently Feed Converting Hosts Based on Metagenomic Gene Abundance.

    Directory of Open Access Journals (Sweden)

    Rainer Roehe

    2016-02-01

    Full Text Available Methane produced by methanogenic archaea in ruminants contributes significantly to anthropogenic greenhouse gas emissions. The host genetic link controlling microbial methane production is unknown and appropriate genetic selection strategies are not developed. We used sire progeny group differences to estimate the host genetic influence on rumen microbial methane production in a factorial experiment consisting of crossbred breed types and diets. Rumen metagenomic profiling was undertaken to investigate links between microbial genes and methane emissions or feed conversion efficiency. Sire progeny groups differed significantly in their methane emissions measured in respiration chambers. Ranking of the sire progeny groups based on methane emissions or relative archaeal abundance was consistent overall and within diet, suggesting that archaeal abundance in ruminal digesta is under host genetic control and can be used to genetically select animals without measuring methane directly. In the metagenomic analysis of rumen contents, we identified 3970 microbial genes of which 20 and 49 genes were significantly associated with methane emissions and feed conversion efficiency respectively. These explained 81% and 86% of the respective variation and were clustered in distinct functional gene networks. Methanogenesis genes (e.g. mcrA and fmdB were associated with methane emissions, whilst host-microbiome cross talk genes (e.g. TSTA3 and FucI were associated with feed conversion efficiency. These results strengthen the idea that the host animal controls its own microbiota to a significant extent and open up the implementation of effective breeding strategies using rumen microbial gene abundance as a predictor for difficult-to-measure traits on a large number of hosts. Generally, the results provide a proof of principle to use the relative abundance of microbial genes in the gastrointestinal tract of different species to predict their influence on traits e

  14. Bovine Host Genetic Variation Influences Rumen Microbial Methane Production with Best Selection Criterion for Low Methane Emitting and Efficiently Feed Converting Hosts Based on Metagenomic Gene Abundance.

    Science.gov (United States)

    Roehe, Rainer; Dewhurst, Richard J; Duthie, Carol-Anne; Rooke, John A; McKain, Nest; Ross, Dave W; Hyslop, Jimmy J; Waterhouse, Anthony; Freeman, Tom C; Watson, Mick; Wallace, R John

    2016-02-01

    Methane produced by methanogenic archaea in ruminants contributes significantly to anthropogenic greenhouse gas emissions. The host genetic link controlling microbial methane production is unknown and appropriate genetic selection strategies are not developed. We used sire progeny group differences to estimate the host genetic influence on rumen microbial methane production in a factorial experiment consisting of crossbred breed types and diets. Rumen metagenomic profiling was undertaken to investigate links between microbial genes and methane emissions or feed conversion efficiency. Sire progeny groups differed significantly in their methane emissions measured in respiration chambers. Ranking of the sire progeny groups based on methane emissions or relative archaeal abundance was consistent overall and within diet, suggesting that archaeal abundance in ruminal digesta is under host genetic control and can be used to genetically select animals without measuring methane directly. In the metagenomic analysis of rumen contents, we identified 3970 microbial genes of which 20 and 49 genes were significantly associated with methane emissions and feed conversion efficiency respectively. These explained 81% and 86% of the respective variation and were clustered in distinct functional gene networks. Methanogenesis genes (e.g. mcrA and fmdB) were associated with methane emissions, whilst host-microbiome cross talk genes (e.g. TSTA3 and FucI) were associated with feed conversion efficiency. These results strengthen the idea that the host animal controls its own microbiota to a significant extent and open up the implementation of effective breeding strategies using rumen microbial gene abundance as a predictor for difficult-to-measure traits on a large number of hosts. Generally, the results provide a proof of principle to use the relative abundance of microbial genes in the gastrointestinal tract of different species to predict their influence on traits e.g. human metabolism

  15. PhAP protease from Pseudoalteromonas haloplanktis TAC125: Gene cloning, recombinant production in E. coli and enzyme characterization

    Science.gov (United States)

    de Pascale, D.; Giuliani, M.; De Santi, C.; Bergamasco, N.; Amoresano, A.; Carpentieri, A.; Parrilli, E.; Tutino, M. L.

    2010-08-01

    Cold-adapted proteases have been found to be the dominant activity throughout the cold marine environment, indicating their importance in bacterial acquisition of nitrogen-rich complex organic compounds. However, few extracellular proteases from marine organisms have been characterized so far, and the mechanisms that enable their activity in situ are still largely unknown. Aside from their ecological importance and use as model enzyme for structure/function investigations, cold-active proteolytic enzymes offer great potential for biotechnological applications. Our studies on cold adapted proteases were performed on exo-enzyme produced by the Antarctic marine bacterium Pseudoalteromonas haloplanktis TAC125. By applying a proteomic approach, we identified several proteolytic activities from its culture supernatant. PhAP protease was selected for further investigations. The encoding gene was cloned and the protein was recombinantly produced in E. coli cells. The homogeneous product was biochemically characterised and it turned out that the enzyme is a Zn-dependent aminopeptidase, with an activity dependence from assay temperature typical of psychrophilic enzymes.

  16. The Neurofibromatosis 2 Tumor Suppressor Gene Product, Merlin, Regulates Human Meningioma Cell Growth by Signaling through YAP

    Directory of Open Access Journals (Sweden)

    Katherine Striedinger

    2008-11-01

    Full Text Available Neurofibromatosis type 2 (NF2 is an autosomal dominant disorder characterized by the occurrence of schwannomas and meningiomas. Several studies have examined the ability of the NF2 gene product, merlin, to function as a tumor suppressor in diverse cell types; however, little is known about merlin growth regulation in meningiomas. In Drosophila, merlin controls cell proliferation and apoptosis by signaling through the Hippo pathway to inhibit the function of the transcriptional coactivator Yorkie. The Hippo pathway is conserved in mammals. On the basis of these observations, we developed human meningioma cell lines matched for merlin expression to evaluate merlin growth regulation and investigate the relationship between NF2 status and Yes-associated protein (YAP, the mammalian homolog of Yorkie. NF2 loss in meningioma cells was associated with loss of contact-dependent growth inhibition, enhanced anchorage-independent growth and increased cell proliferation due to increased S-phase entry. In addition, merlin loss in both meningioma cell lines and primary tumors resulted in increased YAP expression and nuclear localization. Finally, siRNA-mediated reduction of YAP in NF2-deficient meningioma cells rescued the effects of merlin loss on cell proliferation and S-phase entry. Collectively, these results represent the first demonstration that merlin regulates cell growth in human cancer cells by suppressing YAP.

  17. Linking Gene Expression in the Intestine to Production of Gametes Through the Phosphate Transporter PITR-1 in Caenorhabditis elegans

    Science.gov (United States)

    Balklava, Zita; Rathnakumar, Navin D.; Vashist, Shilpa; Schweinsberg, Peter J.; Grant, Barth D.

    2016-01-01

    Inorganic phosphate is an essential mineral for both prokaryotic and eukaryotic cell metabolism and structure. Its uptake into the cell is mediated by membrane-bound transporters and coupled to Na+ transport. Mammalian sodium-dependent Pi cotransporters have been grouped into three families NaPi-I, NaPi-II, and NaPi-III. Despite being discovered more than two decades ago, very little is known about requirements for NaPi-III transporters in vivo, in the context of intact animal models. Here we find that impaired function of the Caenorhabditis elegans NaPi-III transporter, pitr-1, results in decreased brood size and dramatically increased expression of vitellogenin by the worm intestine. Unexpectedly, we found that the effects of pitr-1 mutation on vitellogenin expression in the intestine could only be rescued by expression of pitr-1 in the germline, and not by expression of pitr-1 in the intestine itself. Our results indicate the existence of a signal from the germline that regulates gene expression in the intestine, perhaps linking nutrient export from the intestine to production of gametes by the germline. PMID:27449055

  18. The Dahlia mosaic virus gene VI product N-terminal region is involved in self-association.

    Science.gov (United States)

    Raikhy, Gaurav; Krause, Charles; Leisner, Scott

    2011-07-01

    The genome of the floriculture pathogen Dahlia mosaic caulimovirus (DMV) encodes six open reading frames. Generally, caulimovirus gene VI products (P6s) are thought to be multifunctional proteins required for viral infection and it is likely that self-association is required for some of these functions. In this study, yeast two-hybrid and maltose binding protein (MBP) pull-down assays indicated that full-length DMV P6 specifically self-associates. Further analyses indicated that only the DMV P6 N-terminal region, consisting of 115 amino acids, interacts with full-length P6 and with itself. This distinguishes the DMV P6 from its Cauliflower mosaic virus counterpart, which contains four regions involved in self-association. Thus, our results suggest that each caulimovirus P6 may possess a unique pattern of protein-protein interactions. Bioinformatic tools identified a putative nuclear exclusion signal located between amino acid residues 10-20, suggesting another possible function for the P6 N-terminal region. PMID:21571015

  19. A simple, economical method of converting gene expression products of insulin into recombinant insulin and its application

    Institute of Scientific and Technical Information of China (English)

    ZHANG Zhou; CHEN Hui; TANG Yuehua; FENG Youmin

    2003-01-01

    A method, by which the gene expression product of recombinant single chain insulin can be converted into insulin by directly digesting with trypsin, has been established. This method has been used in process of porcine insulin precursor (PIP), [B16Ala]PIP and [B26Ala]PIP into (desB30)insulin, (desB30)[B16Ala]insulin and (desB30)[B26Ala]insulin, respectively, and all of them retain full biological activity of that of their corresponding parent, recombinant human insulin, [B16Ala]insulin and [B26Ala]insulin. The results further demonstrate that the C-terminal residue of B chain is not necessary for insulin's biological activity. Compared with the method of transpeptidation, this method is simple, with a high yield, and avoids the use of organic reagents, and in comparison with the trypsin/carboxypeptidase method, it omits the use of carboxylpeptidase. Besides, (desB30)[B16Ala]insulin and (desB30)[B26Ala]insulin still remained without self-association property as that of their parents, which demonstrate that they are monomeric insulin. So they can be used for substituting for monomeric insulin, [B16Ala]insulin and [B26Ala]insulin, in clinical applications.

  20. Metabolic design based on a coupled gene expression-metabolic network model of tryptophan production in Escherichia coli.

    Science.gov (United States)

    Schmid, Joachim W; Mauch, Klaus; Reuss, Matthias; Gilles, Ernst D; Kremling, Andreas

    2004-10-01

    The presumably high potential of a holistic design approach for complex biochemical reaction networks is exemplified here for the network of tryptophan biosynthesis from glucose, a system whose components have been investigated thoroughly before. A dynamic model that combines the behavior of the trp operon gene expression with the metabolic network of central carbon metabolism and tryptophan biosynthesis is investigated. This model is analyzed in terms of metabolic fluxes, metabolic control, and nonlinear optimization. We compare two models for a wild-type strain and another model for a tryptophan producer. An integrated optimization of the whole network leads to a significant increase in tryptophan production rate for all systems under study. This enhancement is well above the increase that can be achieved by an optimization of subsystems. A constant ratio of control coefficients on tryptophan synthesis rate has been identified for the models regarding or disregarding trp operon expression. Although we found some examples where flux control coefficients even contradict the trends of enzyme activity changes in an optimized profile, flux control can be used as an indication for enzymes that have to be taken into account in optimization. PMID:15491865

  1. Cadmium increases ferroportin-1 gene expression in J774 macrophage cells via the production of reactive oxygen species.

    Science.gov (United States)

    Park, Bo-Yeon; Chung, Jayong

    2009-01-01

    Cadmium intoxication has been associated with the dysregulation of iron homeostasis. In the present study, we investigated the effect of cadmium on the expression of ferroportin 1 (FPN1), an important iron transporter protein that is involved in iron release from macrophages. When we incubated cadmium with J774 mouse macrophage cells, FPN1 mRNA levels were significantly increased in a dose- and time-dependent manner. Furthermore, the cadmium-induced FPN1 mRNA expression was associated with increased levels of FPN1 protein. On the other hand, cadmium-mediated FPN1 mRNA induction in J774 cells was completely blocked when cells were co-treated with a transcription inhibitor, acitomycin D. Also, cadmium directly stimulated the activity of the FPN1-promoter driven luciferase reporter, suggesting that the cadmium up-regulates FPN1 gene expression in a transcription-dependent manner. Finally, cadmium exposure to J774 macrophages increased intracellular reactive oxygen species (ROS) levels by ~ 2-fold, compared to untreated controls. When J774 cells were co-treated with antioxidant N-acetylcystein, the cadmium-induced FPN1 mRNA induction was significantly attenuated. In summary, the results of this study clearly demonstrated that cadmium increased FPN1 expression in macrophages through a mechanism that involves ROS production, and suggests another important interaction between iron and cadmium metabolism. PMID:20090884

  2. / production

    Indian Academy of Sciences (India)

    François Arleo; Pol-Bernard Gossiaux; Thierry Gousset; Jörg Aichelin

    2003-04-01

    For more than 25 years /Ψ production has helped to sharpen our understanding of QCD. In proton induced reaction some observations are rather well understood while others are still unclear. The current status of the theory of /Ψ production will be sketched, paying special attention to the issues of formation time and /Ψ re-interaction in a nuclear medium.

  3. Disruption of cagA, the apoprotein gene of chromoprotein antibiotic C-1027, eliminates holo-antibiotic production, but not the cytotoxic chromophore.

    Science.gov (United States)

    Cui, Zhihui; Wang, Lifei; Wang, Songmei; Li, Guangwei; Hong, Bin

    2009-11-01

    C-1027 is a chromoprotein of the nine-membered enediyne antitumour antibiotic family, comprising apoprotein to stabilize and transport the enediyne chromophore. The disruption of apoprotein gene cagA within the C-1027 biosynthetic gene cluster abolished C-1027 holo-antibiotic production detected by an antibacterial assay, as well as the expression of the apoprotein and C-1027 chromophore extracted following protein precipitation of the culture supernatant. Complementation of the cagA-disrupted mutant AKO with the intact cagA gene restored C-1027 production, suggesting that cagA is indispensable for holo-antibiotic production. Overexpression of cagA in the wild-type strain resulted in a significant increase in C-1027 production as expected. Surprisingly, electrospray ionization (ESI)-MS and ESI-MS/MS analyses suggested that the AKO mutant still produced the C-1027 enediyne chromophore [m/z=844 (M+H)(+)] and its aromatized product [m/z=846 (M+H)(+)]. Consistent with this, the results from gene expression analysis using real-time reverse transcriptase-PCR showed that transcripts of the positive regulator sgcR3 and the structural genes sgcA1, sgcC4, sgcD6 and sgcE were readily detected in the AKO mutant as well as in the wild-type and the complementation strain. These results provided, for the first time, evidence suggesting that the apoprotein of C-1027 is not essential in the self-resistance mechanism for the enediyne chromophore. PMID:19845765

  4. Enterotoxin Gene Profile and Molecular Characterization of Staphylococcus aureus Isolates from Bovine Bulk Milk and Milk Products of Tigray Region, Northern Ethiopia.

    Science.gov (United States)

    Tarekgne, Enquebaher K; Skjerdal, Taran; Skeie, Siv; Rudi, Knut; Porcellato, Davide; Félix, Benjamin; Narvhus, Judith A

    2016-08-01

    Staphylococcal food poisoning (SFP) is an important foodborne disease worldwide, and milk and milk products are commonly associated with SFP outbreaks. The objectives of this study were to investigate the distribution of staphylococcal enterotoxin (se) genes in Staphylococcus aureus from raw cow's milk and milk products and to assess their genetic background with the spa typing method. Of the 549 samples (297 bulk milk and 162 milk product samples) collected from Tigray region, Northern Ethiopia, 160 (29.1%) were positive for S. aureus, of which 82 (51%) were found to harbor se genes by a modified multiplex PCR. Nine se genes were identified: sea (n = 12), seb (n = 3), sec (n = 3), sed(n = 4), seg (n = 49), seh (n = 2), sei (n = 40), sej (n = 1), and tsst-1 (n = 24). The classical type of genes accounted for 27%. Of the 82 enterotoxigenic isolates, 41.5 and 12.4% harbored two or more se genes, respectively. The highest gene association was observed between sei and seg, whereas sea and seb were always found together with the new types of se genes. Altogether, 18 genotypes of toxin genes were identified, and 33% of the samples contained > 5 log CFU ml(-1) S. aureus. spa typing identified 22 spa types and three novel spa sequences, which showed the high genetic diversity of the isolates. No apparent relationship was observed between spa type and se genes. Of the 25 spa types, 13 (52%) were from raw milk, 3 (12%) from milk products, and 9 (36%) from both types of sample. Types t314 (20.7%,n = 17), t458 (18.3%, n = 15), and t6218 (9.8%, n= 8) were the most common spa types identified and were widely distributed in three of the eight studied localities. This is the first study from the Tigray region to report the high distribution of enterotoxigenic S. aureus with a diversified genetic background from dairy food. The study may provide valuable data for microbial food safety risk assessment, molecular epidemiology, and phylogenetic studies of S. aureus in Ethiopia.

  5. Enterotoxin Gene Profile and Molecular Characterization of Staphylococcus aureus Isolates from Bovine Bulk Milk and Milk Products of Tigray Region, Northern Ethiopia.

    Science.gov (United States)

    Tarekgne, Enquebaher K; Skjerdal, Taran; Skeie, Siv; Rudi, Knut; Porcellato, Davide; Félix, Benjamin; Narvhus, Judith A

    2016-08-01

    Staphylococcal food poisoning (SFP) is an important foodborne disease worldwide, and milk and milk products are commonly associated with SFP outbreaks. The objectives of this study were to investigate the distribution of staphylococcal enterotoxin (se) genes in Staphylococcus aureus from raw cow's milk and milk products and to assess their genetic background with the spa typing method. Of the 549 samples (297 bulk milk and 162 milk product samples) collected from Tigray region, Northern Ethiopia, 160 (29.1%) were positive for S. aureus, of which 82 (51%) were found to harbor se genes by a modified multiplex PCR. Nine se genes were identified: sea (n = 12), seb (n = 3), sec (n = 3), sed(n = 4), seg (n = 49), seh (n = 2), sei (n = 40), sej (n = 1), and tsst-1 (n = 24). The classical type of genes accounted for 27%. Of the 82 enterotoxigenic isolates, 41.5 and 12.4% harbored two or more se genes, respectively. The highest gene association was observed between sei and seg, whereas sea and seb were always found together with the new types of se genes. Altogether, 18 genotypes of toxin genes were identified, and 33% of the samples contained > 5 log CFU ml(-1) S. aureus. spa typing identified 22 spa types and three novel spa sequences, which showed the high genetic diversity of the isolates. No apparent relationship was observed between spa type and se genes. Of the 25 spa types, 13 (52%) were from raw milk, 3 (12%) from milk products, and 9 (36%) from both types of sample. Types t314 (20.7%,n = 17), t458 (18.3%, n = 15), and t6218 (9.8%, n= 8) were the most common spa types identified and were widely distributed in three of the eight studied localities. This is the first study from the Tigray region to report the high distribution of enterotoxigenic S. aureus with a diversified genetic background from dairy food. The study may provide valuable data for microbial food safety risk assessment, molecular epidemiology, and phylogenetic studies of S. aureus in Ethiopia. PMID

  6. Genome Wide Re-Annotation of Caldicellulosiruptor saccharolyticus with New Insights into Genes Involved in Biomass Degradation and Hydrogen Production.

    Directory of Open Access Journals (Sweden)

    Nupoor Chowdhary

    Full Text Available Caldicellulosiruptor saccharolyticus has proven itself to be an excellent candidate for biological hydrogen (H2 production, but still it has major drawbacks like sensitivity to high osmotic pressure and low volumetric H2 productivity, which should be considered before it can be used industrially. A whole genome re-annotation work has been carried out as an attempt to update the incomplete genome information that causes gap in the knowledge especially in the area of metabolic engineering, to improve the H2 producing capabilities of C. saccharolyticus. Whole genome re-annotation was performed through manual means for 2,682 Coding Sequences (CDSs. Bioinformatics tools based on sequence similarity, motif search, phylogenetic analysis and fold recognition were employed for re-annotation. Our methodology could successfully add functions for 409 hypothetical proteins (HPs, 46 proteins previously annotated as putative and assigned more accurate functions for the known protein sequences. Homology based gene annotation has been used as a standard method for assigning function to novel proteins, but over the past few years many non-homology based methods such as genomic context approaches for protein function prediction have been developed. Using non-homology based functional prediction methods, we were able to assign cellular processes or physical complexes for 249 hypothetical sequences. Our re-annotation pipeline highlights the addition of 231 new CDSs generated from MicroScope Platform, to the original genome with functional prediction for 49 of them. The re-annotation of HPs and new CDSs is stored in the relational database that is available on the MicroScope web-based platform. In parallel, a comparative genome analyses were performed among the members of genus Caldicellulosiruptor to understand the function and evolutionary processes. Further, with results from integrated re-annotation studies (homology and genomic context approach, we strongly

  7. The chicken c-erbA alpha-product induces expression of thyroid hormone-responsive genes in 3,5,3'-triiodothyronine receptor-deficient rat hepatoma cells

    DEFF Research Database (Denmark)

    Muñoz, A; Höppner, W; Sap, J;

    1990-01-01

    To determine the capacity of the chicken c-erbA (cTR-alpha) gene product in regulating expression of known thyroid hormone-responsive genes, both the cTR-alpha and the viral v-erbA genes were expressed in FAO cells, a rat hepatoma cell line defective for functional thyroid hormone receptors. Upon...

  8. Modification of genetic regulation of a heterologous chitosanase gene in Streptomyces lividans TK24 leads to chitosanase production in the absence of chitosan

    Directory of Open Access Journals (Sweden)

    Brzezinski Ryszard

    2011-02-01

    Full Text Available Abstract Background Chitosanases are enzymes hydrolysing chitosan, a β-1,4 linked D-glucosamine bio-polymer. Chitosan oligosaccharides have numerous emerging applications and chitosanases can be used for industrial enzymatic hydrolysis of chitosan. These extracellular enzymes, produced by many organisms including fungi and bacteria, are well studied at the biochemical and enzymatic level but very few works were dedicated to the regulation of their gene expression. This is the first study on the genetic regulation of a heterologous chitosanase gene (csnN106 in Streptomyces lividans. Results Two S. lividans strains were used for induction experiments: the wild type strain and its mutant (ΔcsnR, harbouring an in-frame deletion of the csnR gene, encoding a negative transcriptional regulator. Comparison of chitosanase levels in various media indicated that CsnR regulates negatively the expression of the heterologous chitosanase gene csnN106. Using the ΔcsnR host and a mutated csnN106 gene with a modified transcription operator, substantial levels of chitosanase could be produced in the absence of chitosan, using inexpensive medium components. Furthermore, chitosanase production was of higher quality as lower levels of extracellular protease and protein contaminants were observed. Conclusions This new chitosanase production system is of interest for biotechnology as only common media components are used and enzyme of high degree of purity is obtained directly in the culture supernatant.

  9. Overexpression of a tobacco small G protein gene NtRop1 causes salt sensitivity and hydrogen peroxide production in transgenic plants

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    The small GTPases of Rop/Rho family is central regulators of important cellular processes in plants. Tobacco small G protein gene NtRop1 has been isolated; however, its roles in stress responses were unknown. In the present study, the genomic sequence of NtRop1 was cloned, which has seven exons and six introns, similar to the Rop gene structure from Arabidopsis. The NtRop1 gene was constitutively expressed in the different organs whereas the other six Rop genes from tobacco had differential expression patterns. The expression of the NtRop1 gene was moderately induced by methyl viologen, NaCl, and ACC treatments, but slightly inhibited by ABA treatment, with no significant induction by NAA treatment. The transgenic Arabidopsis plants overexpressing the NtRop1 showed increased salt sensitivity as can be seen from the reduced root growth and elevated relative electrolyte leakage. The hydrogen peroxide production was also promoted in the NtRop1-trangenic plants in comparison with wild type plants. These results imply that the NtRop1 may confer salt sensitivity through activation of H2O2 production during plant response to salt stress.

  10. Overexpression of a tobacco small G protein gene NtRop1 causes salt sensitivity and hydrogen peroxide production in transgenic plants

    Institute of Scientific and Technical Information of China (English)

    CAO YangRong; LI ZhiGang; CHEN Tao; ZHANG ZhiGang; ZHANG JinSong; CHEN ShouYi

    2008-01-01

    The small GTPases of Rop/Rho family is central regulators of important cellular processes in plants.Tobacco small G protein gene NtRop1 has been isolated; however, its roles in stress responses were unknown. In the present study, the genomic sequence of NtRop1 was cloned, which has seven exons and six introns, similar to the Rop gene structure from Arabidopsis. The NtRopl gene was constitutively expressed in the different organs whereas the other six Rop genes from tobacco had differential expression patterns. The expression of the NtRop1 gene was moderately induced by methyl viologen,NaCl, and ACC treatments, but slightly inhibited by ABA treatment, with no significant induction by NAA treatment. The trsnsgenic Arabidopsis plants overexpressing the NtRop1 showed increased salt sensitivity as can be seen from the reduced root growth and elevated relative electrolyte leakage. The hydrogen peroxide production was also promoted in the NtRop1-trangenic plants in comparison with wild type plants. These results imply that the NtRopl may confer salt sensitivity through activation of H2O2 production during plant response to salt stress.

  11. Improvement of Ethanol Production in Saccharomyces cerevisiae by High-Efficient Disruption of the ADH2 Gene Using a Novel Recombinant TALEN Vector

    Science.gov (United States)

    Ye, Wei; Zhang, Weimin; Liu, Taomei; Tan, Guohui; Li, Haohua; Huang, Zilei

    2016-01-01

    Bioethanol is becoming increasingly important in energy supply and economic development. However, the low yield of bioethanol and the insufficiency of high-efficient genetic manipulation approaches limit its application. In this study, a novel transcription activator-like effector nuclease (TALEN) vector containing the left and right arms of TALEN was electroporated into Saccharomyces cerevisiae strain As2.4 to sequence the alcohol dehydrogenase gene ADH2 and the hygromycin-resistant gene hyg. Western blot analysis using anti-FLAG monoclonal antibody proved the successful expression of TALE proteins in As2.4 strains. qPCR and sequencing demonstrated the accurate knockout of the 17 bp target gene with 80% efficiency. The TALEN vector and ADH2 PCR product were electroporated into ΔADH2 to complement the ADH2 gene (ADH2+ As2.4). LC–MS and GC were employed to detect ethanol yields in the native As2.4, ΔADH2 As2.4, and ADH2+ As2.4 strains. Results showed that ethanol production was improved by 52.4 ± 5.3% through the disruption of ADH2 in As2.4. The bioethanol yield of ADH2+ As2.4 was nearly the same as that of native As2.4. This study is the first to report on the disruption of a target gene in S. cerevisiae by employing Fast TALEN technology to improve bioethanol yield. This work provides a novel approach for the disruption of a target gene in S. cerevisiae with high efficiency and specificity, thereby promoting the improvement of bioethanol production in S. cerevisiae by metabolic engineering. PMID:27462304

  12. Improvement of Ethanol Production in Saccharomyces cerevisiae by High-Efficient Disruption of the ADH2 Gene Using a Novel Recombinant TALEN Vector.

    Science.gov (United States)

    Ye, Wei; Zhang, Weimin; Liu, Taomei; Tan, Guohui; Li, Haohua; Huang, Zilei

    2016-01-01

    Bioethanol is becoming increasingly important in energy supply and economic development. However, the low yield of bioethanol and the insufficiency of high-efficient genetic manipulation approaches limit its application. In this study, a novel transcription activator-like effector nuclease (TALEN) vector containing the left and right arms of TALEN was electroporated into Saccharomyces cerevisiae strain As2.4 to sequence the alcohol dehydrogenase gene ADH2 and the hygromycin-resistant gene hyg. Western blot analysis using anti-FLAG monoclonal antibody proved the successful expression of TALE proteins in As2.4 strains. qPCR and sequencing demonstrated the accurate knockout of the 17 bp target gene with 80% efficiency. The TALEN vector and ADH2 PCR product were electroporated into ΔADH2 to complement the ADH2 gene (ADH2 (+) As2.4). LC-MS and GC were employed to detect ethanol yields in the native As2.4, ΔADH2 As2.4, and ADH2 (+) As2.4 strains. Results showed that ethanol production was improved by 52.4 ± 5.3% through the disruption of ADH2 in As2.4. The bioethanol yield of ADH2 (+) As2.4 was nearly the same as that of native As2.4. This study is the first to report on the disruption of a target gene in S. cerevisiae by employing Fast TALEN technology to improve bioethanol yield. This work provides a novel approach for the disruption of a target gene in S. cerevisiae with high efficiency and specificity, thereby promoting the improvement of bioethanol production in S. cerevisiae by metabolic engineering. PMID:27462304

  13. Effect of polymorphic variants of GH, Pit-1, and beta-LG genes on milk production of Holstein cows.

    Science.gov (United States)

    Heidari, M; Azari, M A; Hasani, S; Khanahmadi, A; Zerehdaran, S

    2012-04-01

    Effect of polymorphic variants of growth hormone (GH), beta-lactoglobulin (beta-LG), and Pit-1 genes on milk yield was analyzed in a Holstein herd. Genotypes of the cows for these genes were determined by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. Allele frequencies were 0.884 and 0.116 for L and V variants of GH, 0.170 and 0.830 for A and B variants of Pit-1, and 0.529 and 0.471 for A and B variants of beta-LG, respectively. GLM procedure of SAS software was used to test the effects of these genes on milk yield. Results indicated significant effects of these genes on milk yield (P LG gene, milk yield of animals with AA genotype was more than BB genotype (P LG (AA) were superior compared to heterozygote genotypes, whereas, the heterozygote genotype of Pit-1 gene (AB) was desirable.

  14. Production of Candida antaractica Lipase B Gene Open Reading Frame using Automated PCR Gene Assembly Protocol on Robotic Workcell & Expression in Ethanologenic Yeast for use as Resin-Bound Biocatalyst in Biodiesel Production

    Science.gov (United States)

    A synthetic Candida antarctica lipase B (CALB) gene open reading frame (ORF) for expression in yeast was produced using an automated PCR assembly and DNA purification protocol on an integrated robotic workcell. The lycotoxin-1 (Lyt-1) C3 variant gene ORF was added in-frame with the CALB ORF to pote...

  15. The defH9-iaaM auxin-synthesizing gene increases plant fecundity and fruit production in strawberry and raspberry

    Directory of Open Access Journals (Sweden)

    Pandolfini Tiziana

    2004-03-01

    Full Text Available Abstract Background The DefH9-iaaM gene fusion which is expressed specifically in placenta/ovules and promotes auxin-synthesis confers parthenocarpic fruit development to eggplant, tomato and tobacco. Transgenic DefH9-iaaM eggplants and tomatoes show increased fruit production due mainly to an improved fruit set. However, the weight of the fruits is also frequently increased. Results DefH9-iaaM strawberry and raspberry plants grown under standard cultivation conditions show a significant increase in fruit number and size and fruit yield. In all three Rosaceae species tested, Fragaria vesca, Fragaria x ananassa and Rubus idaeus, DefH9-iaaM plants have an increased number of flowers per inflorescence and an increased number of inflorescences per plant. This results in an increased number of fruits per plant. Moreover, the weight and size of transgenic fruits was also increased. The increase in fruit yield was approximately 180% in cultivated strawberry, 140% in wild strawberry, and 100% in raspberry. The DefH9-iaaM gene is expressed in the flower buds of all three species. The total IAA (auxin content of young flower buds of strawberry and raspberry expressing the DefH9-iaaM gene is increased in comparison to untransformed flower buds. The DefH9-iaaM gene promotes parthenocarpy in emasculated flowers of both strawberry and raspberry. Conclusions The DefH9-iaaM gene is expressed and biologically active in Rosaceae. The DefH9-iaaM gene can be used, under cultivation conditions that allow pollination and fertilization, to increase fruit productivity significantly in Rosaceae species. The finding that the DefH9-iaaM auxin-synthesizing gene increases the number of inflorescences per plant and the number of flowers per inflorescence indicates that auxin plays a role in plant fecundity in these three perennial Rosaceae species.

  16. Detection of genes mediating beta-lactamase production in isolates of enterobacteria recovered from wild pets in Saudi Arabia

    OpenAIRE

    Sabry A. Hassan; Mohamed Y. Shobrak

    2015-01-01

    Aim: To determine the genetic basis and types of beta-lactamase encountered among enterobacterial isolates of wild pets from the animal exhibit. Materials and Methods: A total of 17 beta-lactamase-producing enterobacteria recovered from fecal samples of wild pet animals were analyzed for a selected beta-lactamase gene by polymerase chain reaction. Results: Molecular analysis identified one or more β-lactamase-encoding genes in 14 enterobacterial isolates as a single or gene combination....

  17. Style perception-oriented product family shape gene design%面向风格意象的产品族外形基因设计

    Institute of Scientific and Technical Information of China (English)

    傅业焘; 罗仕鉴

    2012-01-01

    为继承和传递工业设计中的产品族外形知识,保持特殊的产品族外形和风格,塑造差异化品牌形象,将生物界基因遗传与变异理论引入产品族外形设计中,提出一种面向风格意象的产品族外形基因设计方法。通过分析产品族风格意象,构建产品族外形基因体系,划分了基因层次,建立了产品族风格意象(心理的意象特征)和外形基因(物理的外形特征)之间的映射模型。以电话机产品为例,提取了风格意象和外形基因,计算了外形基因在各风格意象中的贡献率,基于映射模型构建了面向风格意象的产品族外形基因建模与设计系统,实现了产品族外形基因与风格意象之间的双向推理。该系统能提高电话机的开发设计效率,验证了面向风格意象的产品族外形基因理论体系。%To inherit and transform shape knowledge of product family in industrial design, keep the unique shape and design style of product family and build different brand image, a perception-oriented product family shape gene de- sign method was proposed by introducing the gene theory and variability theory of biology into product family shape design. Through analyzing the perception of product family, the construction system of product family shape gene was constructed, the gene representation level was divided and the mapping model between style perception(mental perception)and shape gene(physical appearance)was set up. The telephone product was taken as an example, the style perception and shape gene were extracted, and the contribution rate of shape gene was calculated in style per- ception. Based on the mapping model, a style perception-oriented gene rapid modeling and design system was built to support the bidirectional reasoning between product family shape gene and style perception. Through this system, the design performance of telephone shape could be improved, and the theory

  18. Genetics of xanthan production in Xanthomonas campestris: the xanA and xanB genes are involved in UDP-glucose and GDP-mannose biosynthesis.

    OpenAIRE

    Köplin, R; Arnold, W.; Hötte, B; Simon, R; Wang, G; Pühler, A

    1992-01-01

    The nucleotide sequence of a 3.4-kb EcoRI-PstI DNA fragment of Xanthomonas campestris pv. campestris revealed two open reading frames, which were designated xanA and xanB. The genes xanA and xanB encode proteins of 448 amino acids (molecular weight of 48,919) and 466 amino acids (molecular weight of 50,873), respectively. These genes were identified by analyzing insertion mutants which were known to be involved in xanthan production. Specific tests for the activities of enzymes involved in th...

  19. The product of the mei3+ gene, expressed under control of the mating-type locus, induces meiosis and sporulation in fission yeast.

    OpenAIRE

    McLeod, M; Stein, M.; Beach, D

    1987-01-01

    In fission yeast the ability to undergo meiosis and sporulation is conferred by the matP+ and matM+ genes of the mating-type locus. Inactivation of ran1+, a negative regulator of meiosis, is thought to be an essential step in meiotic initiation. We have isolated a further meiotic control gene mei3+, and have shown the following: a null allele of mei3 totally inhibits meiosis; the mei3+ RNA transcript and its translational product are expressed only in matP+/matM+ diploids entering meiosis; fo...

  20. The HAC1 Gene from Pichia Pastoris: Characterization and Effect of its Overexpression on the Production of Secreted, Surface Displayed and Membrane Proteins

    OpenAIRE

    Jacobs Pieter P; Ryckaert Stefan; Guerfal Mouna; Ameloot Paul; Van Craenenbroeck Kathleen; Derycke Riet; Callewaert Nico

    2010-01-01

    Abstract Background The unfolded protein response (UPR) in eukaryotes upregulates factors that restore ER homeostasis upon protein folding stress and in yeast is activated by a non-conventional splicing of the HAC1 mRNA. The spliced HAC1 mRNA encodes an active transcription factor that binds to UPR-responsive elements in the promoter of UPR target genes. Overexpression of the HAC1 gene of S. cerevisiae can reportedly lead to increased production of heterologous proteins. To further such studi...

  1. Effects of excretory/secretory products from Anisakis simplex (Nematoda) on immune gene expression in rainbow trout (Oncorhynchus mykiss)

    DEFF Research Database (Denmark)

    Bahlool, Qusay Zuhair Mohammad; Skovgaard, Alf; Kania, Per Walter;

    2013-01-01

    -regulation of the immune genes tested, suggesting a role of ES proteins in immunomodulation. We also tested the enzymatic activity of the ES proteins and found that lipase, esterase/lipase, valine and cysteine arylamidases, naphthol-AS-BI-phosphohydrolase and a-galactosidase activities were present in the ES solution....... This type of hydrolytic enzyme activity may play a role in nematode penetration of host tissue. In addition, based on the notion that A. simplex ES products may have an immune-depressive effect (by minimizing immune gene expression) it could also be suggested that worm enzymes directly target host immune...

  2. Genome-Based Genetic Tool Development for Bacillus methanolicus: Theta- and Rolling Circle-Replicating Plasmids for Inducible Gene Expression and Application to Methanol-Based Cadaverine Production

    Science.gov (United States)

    Irla, Marta; Heggeset, Tonje M. B.; Nærdal, Ingemar; Paul, Lidia; Haugen, Tone; Le, Simone B.; Brautaset, Trygve; Wendisch, Volker F.

    2016-01-01

    Bacillus methanolicus is a thermophilic methylotroph able to overproduce amino acids from methanol, a substrate not used for human or animal nutrition. Based on our previous RNA-seq analysis a mannitol inducible promoter and a putative mannitol activator gene mtlR were identified. The mannitol inducible promoter was applied for controlled gene expression using fluorescent reporter proteins and a flow cytometry analysis, and improved by changing the -35 promoter region and by co-expression of the mtlR regulator gene. For independent complementary gene expression control, the heterologous xylose-inducible system from B. megaterium was employed and a two-plasmid gene expression system was developed. Four different replicons for expression vectors were compared with respect to their copy number and stability. As an application example, methanol-based production of cadaverine was shown to be improved from 11.3 to 17.5 g/L when a heterologous lysine decarboxylase gene cadA was expressed from a theta-replicating rather than a rolling-circle replicating vector. The current work on inducible promoter systems and compatible theta- or rolling circle-replicating vectors is an important extension of the poorly developed B. methanolicus genetic toolbox, valuable for genetic engineering and further exploration of this bacterium.

  3. Study on isolation, molecular detection of virulence gene and antibiotic sensitivity pattern of Escherichia coli isolated from milk and milk products

    Directory of Open Access Journals (Sweden)

    M. N. Brahmbhatt

    2013-06-01

    Full Text Available Aim: The study was undertaken to isolate pathogenic E. coli from milk and various milk products, detection of virulence gene using Polymerase chain reaction (PCR and investigate their antibiotic sensitivity pattern. Materials and Methods: Altogether 250 milk and various milk products samples consisting of raw milk (50, cheese (50, ice-cream (50, mawa (50 and dahi (50 were collected from milk vendors, retail shops located in Anand city, under aseptic precautions. For the enrichment of the organism from the collected samples, MacConkey broth was used and inoculation was carried out on MacConkey agar and EMB agar. Later on, to confirm the isolates, various biochemical tests such as IMViC test, Urease test were performed. Evaluation of antibiotic sensitivity pattern of E. coli was assessed by disk diffusion method. Finally the E. coli isolates were screened for the presence of virulence associated genes by PCR . Results: The prevalence of E. coli was observed 32 % in the samples comprising of milk (52.00%, cheese (28.00%, icecream (20.00%, mawa (44.00%, and dahi (16.00%. Antibiotic sensitivity was recorded high for Co-trimoxazole (100% followed by Gentamicin (96.73%, Trimithoprime (93.47% and Doxycycline hydochloride (92.39%. Least sensitivity was recorded for Ampicillin (8.69%. In this study, out of 80 E. coli isolates, 25 isolates (31.25% were positive for stx genes, of which 7 (8.75% isolates were positive for stx1 gene only, while 12 (15.00% isolates were positive for stx2 gene only and 5 (6.25% isolates were positive for both stx1 and stx2, 7 isolates (8.75% were positive for eaeA gene and all the isolate were negetive for rfb O157 gene. Conclusions: Current study supports the finding that raw milk and various milk products can be regarded as critical source of pathogenic E. coli This explains the need of strict monitoring and surveillance for effective measures of hygiene and sanitary practice during production of milk and various milk

  4. Sulfur source-mediated transcriptional regulation of the rhlABC genes involved in biosurfactants production by Pseudomonas sp. strain AK6U

    Science.gov (United States)

    Ismail, Wael; El Nayal, Ashraf M.; Ramadan, Ahmed R.; Abotalib, Nasser

    2014-01-01

    Despite the nutritional significance of sulfur, its influence on biosurfactants production has not been sufficiently studied. We investigated the expression of key biosurfactants production genes, rhlABC, in cultures of Pseudomonas sp. AK6U grown with inorganic or organic sulfur sources. AK6U grew with either inorganic sulfate (MgSO4), dibenzothiophene (DBT), or DBT-sulfone as a sole sulfur source in the presence of glucose as a carbon source. The AK6U cultures produced variable amounts of biosurfactants depending on the utilized sulfur source. Biosurfactants production profile of the DBT cultures was significantly different from that of the DBT-sulfone and inorganic sulfate cultures. The last two cultures were very similar in terms of biosurfactants productivity. Biosurfactants yield in the DBT cultures (1.3 g/L) was higher than that produced by the DBT-sulfone (0.5 g/L) and the inorganic sulfate (0.44 g/L) cultures. Moreover, the surface tension reduction in the DBT cultures (33 mN/m) was much stronger than that measured in the DBT-sulfone (58 mN/m) or inorganic sulfate (54 mN/m) cultures. RT-qPCR revealed variations in the expression levels of the rhlABC genes depending on the sulfur source. The DBT cultures had higher expression levels for the three genes as compared to the DBT-sulfone and inorganic sulfate cultures. There was no significant difference in the expression profiles between the DBT-sulfone and the MgSO4 cultures. The increased expression of rhlC in the DBT cultures is indicative for production of higher amounts of dirhamnolipids compared to the DBT-sulfone and inorganic sulfate cultures. The gene expression results were in good agreement with the biosurfactants production yields and surface tension measurements. The sulfur source mediates a fine-tuned mechanism of transcriptional regulation of biosurfactants production genes. Our findings can have an impact on industrial production of biosurfactants and other biotechnological processes like

  5. Improved ethyl caproate production of Chinese liquor yeast by overexpressing fatty acid synthesis genes with OPI1 deletion.

    Science.gov (United States)

    Chen, Yefu; Luo, Weiwei; Gong, Rui; Xue, Xingxiang; Guan, Xiangyu; Song, Lulu; Guo, Xuewu; Xiao, Dongguang

    2016-09-01

    During yeast fermentation, ethyl esters play a key role in the development of the flavor profiles of Chinese liquor. Ethyl caproate, an ethyl ester eliciting apple-like flavor, is the characteristic flavor of strong aromatic liquor, which is the best selling liquor in China. In the traditional fermentation process, ethyl caproate is mainly produced at the later fermentation stage by aroma-producing yeast, bacteria, and mold in a mud pit instead of Saccharomyces cerevisiae at the expense of grains and fermentation time. To improve the production of ethyl caproate by Chinese liquor yeast (S. cerevisiae) with less food consumption and shorter fermentation time, we constructed three recombinant strains, namely, α5-ACC1ΔOPI1, α5-FAS1ΔOPI1, and α5-FAS2ΔOPI1 by overexpressing acetyl-CoA carboxylase (ACC1), fatty acid synthase 1 (FAS1), and fatty acid synthase 2 (FAS2) with OPI1 (an inositol/choline-mediated negative regulatory gene) deletion, respectively. In the liquid fermentation of corn hydrolysate, the contents of ethyl caproate produced by α5-ACC1ΔOPI1, α5-FAS1ΔOPI1, and α5-FAS2ΔOPI1 increased by 0.40-, 1.75-, and 0.31-fold, correspondingly, compared with the initial strain α5. The contents of other fatty acid ethyl esters (FAEEs) (C8:0, C10:0, C12:0) also increased. In comparison, the content of FAEEs produced by α5-FAS1ΔOPI1 significantly improved. Meanwhile, the contents of acetyl-CoA and ethyl acetate were enhanced by α5-FAS1ΔOPI1. Overall, this study offers a promising platform for the development of pure yeast culture fermentation of Chinese strong aromatic liquor without the use of a mud pit. PMID:27344573

  6. Inhibitory effect of eugenol on aflatoxin B1 production in Aspergillus parasiticus by downregulating the expression of major genes in the toxin biosynthetic pathway.

    Science.gov (United States)

    Jahanshiri, Zahra; Shams-Ghahfarokhi, Masoomeh; Allameh, Abdolamir; Razzaghi-Abyaneh, Mehdi

    2015-07-01

    Aflatoxin contamination of grains and agro-products is a serious food safety issue and a significant economic concern worldwide. In the present study, the effects of eugenol on Aspergillus parasiticus growth and aflatoxin production were studied in relation to the expression of some essential genes involved in aflatoxin biosynthetic pathway. The fungus was cultured in presence of serial two-fold concentrations of eugenol (15.62-500 μg mL(-1)) for 3 days at 28 °C. Mycelia dry weight was determined as an index of fungal growth, while aflatoxin production was assessed by high performance liquid chromatography. The expression of aflatoxin biosynthetic genes including ver-1, nor-1, pksA, omtA and aflR were evaluated by real-time PCR. Eugenol strongly inhibited A. parasiticus growth in the range of 19.16-95.83 % in a dose-dependent manner. Aflatoxin B1 production was also inhibited by the compound in the range of 15.07-98.0 %. The expressions of ver-1, nor-1, pksA, omtA and aflR genes were significantly suppressed by eugenol at concentrations of 62.5 and 125 μg mL(-1). These results indicate that eugenol may be considered as a good candidate to control toxigenic fungal growth and the subsequent contamination of food, feed and agricultural commodities by carcinogenic aflatoxins.

  7. Ethylene Production and 1-Aminocyclopropane-1-Carboxylate (ACC) Synthase Gene Expression in Tomato(Lycopsicon esculentum Mill.) Leaves Under Enhanced UV-B Radiation

    Institute of Scientific and Technical Information of China (English)

    Lizhe An; Xunling Wang; Xiaofeng Xu; Hongguan Tang; Manxiao Zhang; Zongdong Hou; Yanhong Liu; Zhiguang Zhao; Huyuan Feng; Shijian Xu

    2006-01-01

    Tomato (Lycopsicon esculentum Mill.) plants grown in a greenhouse were irradiated with two different levels of UV-B, namely 8.82 (T1) and 12.6 kJ/m2 per day (T2). Ethylene production, 1-aminocyclopropane-1carboxylate (ACC) content, 1-(malonylamino) cyclopvopane-1-carboxylic acid (MACC) content, gene expression of ACC synthase (EC 4.4.1.14), and ACC oxidase activity in tomato leaves were determined. The results indicated that ACC content, the activity of ACC synthase and ACC oxidase, and ethylene production increased continuously under low doses of UV-B radiation, whereas at high doses of radiation these parameters increased during the first 12 d and then started to decrease. The MACC content increased continuously over 18 d under both doses of UV-B irradiation. The changes in ACC content, ACC synthase activity,ACC oxidase activity, the transcriptional level of the ACC synthase gene, and ethylene production were consistent with each other, suggesting that ACC synthase was the key enzyme in ethylene biosynthesis and that ethylene production in tomato leaf tissues under UV-B radiation could be regulated by the expression of the ACC synthase gene. The results also indicate that the change in ethylene metabolism may be an adaptive mechanism to enhanced UV-B radiation.

  8. Relationships between functional genes in Lactobacillus delbrueckii ssp. bulgaricus isolates and phenotypic characteristics associated with fermentation time and flavor production in yogurt elucidated using multilocus sequence typing.

    Science.gov (United States)

    Liu, Wenjun; Yu, Jie; Sun, Zhihong; Song, Yuqin; Wang, Xueni; Wang, Hongmei; Wuren, Tuoya; Zha, Musu; Menghe, Bilige; Heping, Zhang

    2016-01-01

    Lactobacillus delbrueckii ssp. bulgaricus (L. bulgaricus) is well known for its worldwide application in yogurt production. Flavor production and acid producing are considered as the most important characteristics for starter culture screening. To our knowledge this is the first study applying functional gene sequence multilocus sequence typing technology to predict the fermentation and flavor-producing characteristics of yogurt-producing bacteria. In the present study, phenotypic characteristics of 35 L. bulgaricus strains were quantified during the fermentation of milk to yogurt and during its subsequent storage; these included fermentation time, acidification rate, pH, titratable acidity, and flavor characteristics (acetaldehyde concentration). Furthermore, multilocus sequence typing analysis of 7 functional genes associated with fermentation time, acid production, and flavor formation was done to elucidate the phylogeny and genetic evolution of the same L. bulgaricus isolates. The results showed that strains significantly differed in fermentation time, acidification rate, and acetaldehyde production. Combining functional gene sequence analysis with phenotypic characteristics demonstrated that groups of strains established using genotype data were consistent with groups identified based on their phenotypic traits. This study has established an efficient and rapid molecular genotyping method to identify strains with good fermentation traits; this has the potential to replace time-consuming conventional methods based on direct measurement of phenotypic traits.

  9. Conversion of MDCK cell line to suspension culture by transfecting with human siat7e gene and its application for influenza virus production.

    Science.gov (United States)

    Chu, Chia; Lugovtsev, Vladimir; Golding, Hana; Betenbaugh, Michael; Shiloach, Joseph

    2009-09-01

    MDCK cells are currently being considered as an alternative to embryonated eggs for influenza virus propagation and hemagglutinin (HA) production intended for vaccine manufacturing. MDCK cells were found suitable for the virus production but their inability to grow in suspension burdens the process of scale up and hence their production capability. Anchorage-dependent MDCK cells were converted to anchorage-independent cells, capable of growing in suspension as a result of transfection with the human siat7e gene (ST6GalNac V). This gene was previously identified as having an important role in cellular adhesion when the transcriptions of genes from anchorage-dependent and anchorage-independent HeLa cells were compared. Unlike the parental MDCK cells, the siat7e-expressing cells were capable of growing in shake flasks as suspension cultures, achieving maximum concentration of 7 x 10(5) cells/mL while keeping close to 100% viability throughout the growth phase. In production experiments, the siat7e-expressing cells were infected with the Influenza B/Victoria/504/2000 strain. It was determined that the cell-derived viruses retained similar antigenic properties as those obtained from egg-derived viruses and their nucleotide sequences were identical. The specific production of hemagglutinin (expressed in hemagglutination units per 10(6) cells) from the siat7e-expressing cells was approximately 20 times higher than the specific production from the parental MDCK cells. If this suspension process scales up, the production potential of HA from 10 L of siat7e-expressing cells at a concentration of 10(6) cells/mL would be equivalent to the amount of HA obtained from 10,000 embryonated eggs. PMID:19706449

  10. Association of Single Nucleotide Polymorphisms in the IL-18 Gene with Production of IL-18 Protein by Mononuclear Cells from Healthy Donors

    Directory of Open Access Journals (Sweden)

    Khripko Olga Pavlovna

    2008-01-01

    Full Text Available IL-18 has proinflammatory effects and participates in both innate and adaptive cellular and humoral immunity. A number of SNPs that influence IL-18 production are found in the gene promoter region. We investigated the association of SNPs in the IL-18 promoter at −607 and −137 with the level of IL-18 protein production by PBMC from healthy donors from Southwestern Siberia. The genetic distribution of these SNPs in the promoter site was established by PCR. IL-18 protein production was determined by ELISA. Our results showed that PBMC from donors carrying allele 137C have lower levels of both spontaneous and LPS-stimulated IL-18 production. In contrast, PBMC from donors carrying allele 607A showed significant increases in spontaneous and stimulated IL-18 production compared to wild type. Our study suggests that the SNPs −607 and −137 in the promoter region of the IL-18 gene influence the level of IL-18 protein production by PBMC from healthy donors in Southwestern Siberia.

  11. Overexpressing enzymes of the Ehrlich pathway and deleting genes of the competing pathway in Saccharomyces cerevisiae for increasing 2-phenylethanol production from glucose.

    Science.gov (United States)

    Shen, Li; Nishimura, Yuya; Matsuda, Fumio; Ishii, Jun; Kondo, Akihiko

    2016-07-01

    2-Phenylethanol (2-PE) is a higher aromatic alcohol that is used in the cosmetics and food industries. The budding yeast Saccharomyces cerevisiae is considered to be a suitable host for the industrial production of higher alcohols, including 2-PE. To produce 2-PE from glucose in S. cerevisiae, we searched for suitable 2-keto acid decarboxylase (KDC) and alcohol dehydrogenase (ADH) enzymes of the Ehrlich pathway for overexpression in strain YPH499, and found that overexpression of the ARO10 and/or ADH1 genes increased 2-PE production from glucose. Further, we screened ten BY4741 single-deletion mutants of genes involved in the competing pathways for 2-PE production, and found that strains aro8Δ and aat2Δ displayed increased 2-PE production. Based on these results, we engineered a BY4741 strain that overexpressed ARO10 and contained an aro8Δ deletion, and demonstrated that the strain produced 96 mg/L 2-PE from glucose as the sole carbon source. As this engineered S. cerevisiae strain showed a significant increase in 2-PE production from glucose without the addition of an intermediate carbon substrate, it is a promising candidate for the large-scale production of 2-PE. PMID:26975754

  12. Analysis of 0.5-kilobase-pair repeats in the Mycoplasma hominis lmp gene system and identification of gene products

    DEFF Research Database (Denmark)

    Ladefoged, Søren; Jensen, Lise Torp; Brock, B;

    1996-01-01

    Mycoplasma hominis, an opportunistic pathogenic bacterium of humans, has a small genome of 700 kb. Despite this, multiple copies of gene sequences with similarities to the structural gene (lmp1) of a 135-kDa surface-located membrane protein (Lmp1) have been identified on the genome of M. hominis PG...... repeats with 51 to 90% similarity to 10 similar repeats found in the lmp1-lmp2 region. The 0.5-kb DNA repeats thus comprised about 1% of the entire genome. In both regions, a base change in one of the repeats gave rise to a stop codon, and thereby lmp2 and lmp4 occurred. By PCR amplification of reverse...

  13. Detection of Staphylococcus aureus enterotoxin production genes from patient samples using an automated extraction platform and multiplex real-time PCR.

    Science.gov (United States)

    Chiefari, Amy K; Perry, Michael J; Kelly-Cirino, Cassandra; Egan, Christina T

    2015-12-01

    To minimize specimen volume, handling and testing time, we have developed two TaqMan(®) multiplex real-time PCR (rtPCR) assays to detect staphylococcal enterotoxins A-E and Toxic Shock Syndrome Toxin production genes directly from clinical patient stool specimens utilizing a novel lysis extraction process in parallel with the Roche MagNA Pure Compact. These assays are specific, sensitive and reliable for the detection of the staphylococcal enterotoxin encoding genes and the tst1 gene from known toxin producing strains of Staphylococcus aureus. Specificity was determined by testing a total of 47 microorganism strains, including 8 previously characterized staphylococcal enterotoxin producing strains against each rtPCR target. Sensitivity for these assays range from 1 to 25 cfu per rtPCR reaction for cultured isolates and 8-20 cfu per rtPCR for the clinical stool matrix.

  14. Characterization of RbmD (glycosyltransferase in ribostamycin gene cluster) through neomycin production reconstituted from the engineered Streptomyces fradiae BS1.

    Science.gov (United States)

    Nepal, Keshav Kumar; Oh, Tae-Jin; Subba, Bimala; Yoo, Jin Cheol; Sohng, Jae Kyung

    2009-01-31

    Amino acid homology analysis predicted that rbmD, a putative glycosyltransferase from Streptomyces ribosidificus ATCC 21294, has the highest homology with neoD in neomycin biosynthesis. S. fradiae BS1, in which the production of neomycin was abolished, was generated by disruption of the neoD gene in the neomycin producer S. fradiae. The restoration of neomycin by self complementation suggested that there was no polar effect in the mutant. In addition, S. fradiae BS6 was created with complementation by rbmD in S. fradiae BS1, and secondary metabolite analysis by ESI/MS, LC/MS and MS/MS showed the restoration of neomycin production in S. fradiae BS6. These gene inactivation and complementation studies suggested that, like neoD, rbmD functions as a 2-N-acetlyglucosaminyltransferase and demonstrated the potential for the generation of novel aminoglycoside antibiotics using glycosyltransferases in vivo.

  15. RD2-MolPack-Chim3, a packaging cell line for stable production of lentiviral vectors for anti-HIV gene therapy.

    Science.gov (United States)

    Stornaiuolo, Anna; Piovani, Bianca Maria; Bossi, Sergio; Zucchelli, Eleonora; Corna, Stefano; Salvatori, Francesca; Mavilio, Fulvio; Bordignon, Claudio; Rizzardi, Gian Paolo; Bovolenta, Chiara

    2013-08-01

    Over the last two decades, several attempts to generate packaging cells for lentiviral vectors (LV) have been made. Despite different technologies, no packaging clone is currently employed in clinical trials. We developed a new strategy for LV stable production based on the HEK-293T progenitor cells; the sequential insertion of the viral genes by integrating vectors; the constitutive expression of the viral components; and the RD114-TR envelope pseudotyping. We generated the intermediate clone PK-7 expressing constitutively gag/pol and rev genes and, by adding tat and rd114-tr genes, the stable packaging cell line RD2-MolPack, which can produce LV carrying any transfer vector (TV). Finally, we obtained the RD2-MolPack-Chim3 producer clone by transducing RD2-MolPack cells with the TV expressing the anti-HIV transgene Chim3. Remarkably, RD114-TR pseudovirions have much higher potency when produced by stable compared with transient technology. Most importantly, comparable transduction efficiency in hematopoietic stem cells (HSC) is obtained with 2-logs less physical particles respect to VSV-G pseudovirions produced by transient transfection. Altogether, RD2-MolPack technology should be considered a valid option for large-scale production of LV to be used in gene therapy protocols employing HSC, resulting in the possibility of downsizing the manufacturing scale by about 10-fold in respect to transient technology.

  16. Enteral peptide formulas inhibit radiation induced enteritis and apoptosis in intestinal epithelial cells and suppress the expression and function of Alzheimer's and cell division control gene products

    International Nuclear Information System (INIS)

    Studies have shown that patients receiving enteral peptide formulas prior to irradiation have a significantly reduced incidence of enteritis and express a profound increase in intestinal cellularity. Two conceptual approaches were taken to describe this response. First was the evaluation in changes in programmed intestinal cell death and secondly the evaluation of a gene product controlling cell division cycling. This study provided a relationship between the ratio of cell death to cell formulations. The results indicate that in the canine and murine models, irradiation induces expression of the Alzheimer's gene in intestinal crypt cells, while the incidence of apoptosis in apical cells is significantly increased. The use of peptide enteral formulations suppresses the expression of the Alzheimer's gene in crypt cells, while apoptosis is eliminated in the apical cells of the intestine. Concomitantly, enteral peptide formulations suppress the function of the CK-II gene product in the basal and baso-lateral cells of the intestine. These data indicate that although the mitotic index is significantly reduced in enterocytes, this phenomenon alone is not sufficient to account for the peptide-induced radio-resistance of the intestine. The data also indicate a significant reduction of normal apoptosis in the upper lateral and apical cells of the intestinal villi. Thus, the ratio of cell death to cell replacement is significantly decreased resulting in an increase in villus height and hypertrophy of the apical villus cells. Thus, peptide solutions should be considered as an adjunct treatment both in radio- and chemotherapy

  17. Persistence of viral genes in a variant of MDBK cell after productive replication of a mutant of influenza virus A/WSN.

    Science.gov (United States)

    Urabe, M; Tanaka, T; Odagiri, T; Tashiro, M; Tobita, K

    1993-01-01

    The MDBK-R cell line is a variant of the MDBK cell line, which was derived by three consecutive high multiplicity superinfections of MDBK cells with AWBY-140 virus, a mutant of influenza virus A/WSN (H 1N 1). MDBK-R cells are permissive for productive replication of AWBY-140, but resist lysis by the virus and grew normally without producing infectious virus after replication of the mutant occurred there. By polymerase chain reaction (PCR), we demonstrated nucleotide sequences specific to all the 8 genes of AWBY-140 in MDBK-R cells which had been infected with the mutant at a high multiplicity and subsequently received 25 passages. This suggests that the genes of influenza virus mutant persisted in the dividing host cells for a long time after productive infection, when none of the cells was producing virus. We were also able to amplify the M gene related sequence of the mutant from both poly(A)+ and poly(A)- fractions of the RNA extracted from the cells at 27th passage level by PCR, which suggests that the persisting genes were replicated and transcribed, but we failed to demonstrate any viral protein in the cells by Western blotting.

  18. Loss of msnA, a putative stress regulatory gene, in Aspergillus parasiticus and Aspergillus flavus increased production of conidia, aflatoxins and kojic acid.

    Science.gov (United States)

    Chang, Perng-Kuang; Scharfenstein, Leslie L; Luo, Meng; Mahoney, Noreen; Molyneux, Russell J; Yu, Jiujiang; Brown, Robert L; Campbell, Bruce C

    2011-01-01

    Production of the harmful carcinogenic aflatoxins by Aspergillus parasiticus and Aspergillus flavus has been postulated to be a mechanism to relieve oxidative stress. The msnA gene of A. parasiticus and A. flavus is the ortholog of Saccharomyces cerevisiae MSN2 that is associated with multi-stress response. Compared to wild type strains, the msnA deletion (∆msnA) strains of A. parasiticus and A. flavus exhibited retarded colony growth with increased conidiation. The ∆msnA strains also produced slightly higher amounts of aflatoxins and elevated amounts of kojic acid on mixed cereal medium. Microarray assays showed that expression of genes encoding oxidative stress defense enzymes, i.e., superoxide dismutase, catalase, and cytochrome c peroxidase in A. parasiticus ∆msnA, and the catalase A gene in A. flavus ∆msnA, was up-regulated. Both A. parasiticus and A. flavus ∆msnA strains produced higher levels of reactive oxygen species (ROS), and ROS production of A. flavus msnA addback strains was decreased to levels comparable to that of the wild type A. flavus. The msnA gene appears to be required for the maintenance of the normal oxidative state. The impairment of msnA resulted in the aforementioned changes, which might be used to combat the increased oxidative stress in the cells. PMID:22069691

  19. Loss of msnA, a Putative Stress Regulatory Gene, in Aspergillus parasiticus and Aspergillus flavus Increased Production of Conidia, Aflatoxins and Kojic Acid

    Directory of Open Access Journals (Sweden)

    Robert L. Brown

    2011-01-01

    Full Text Available Production of the harmful carcinogenic aflatoxins by Aspergillus parasiticus and Aspergillus flavus has been postulated to be a mechanism to relieve oxidative stress. The msnA gene of A. parasiticus and A. flavus is the ortholog of Saccharomyces cerevisiae MSN2 that is associated with multi-stress response. Compared to wild type strains, the msnA deletion (∆msnA strains of A. parasiticus and A. flavus exhibited retarded colony growth with increased conidiation. The ∆msnA strains also produced slightly higher amounts of aflatoxins and elevated amounts of kojic acid on mixed cereal medium. Microarray assays showed that expression of genes encoding oxidative stress defense enzymes, i.e., superoxide dismutase, catalase, and cytochrome c peroxidase in A. parasiticus ∆msnA, and the catalase A gene in A. flavus ∆msnA, was up-regulated. Both A. parasiticus and A. flavus ∆msnA strains produced higher levels of reactive oxygen species (ROS, and ROS production of A. flavus msnA addback strains was decreased to levels comparable to that of the wild type A. flavus. The msnA gene appears to be required for the maintenance of the normal oxidative state. The impairment of msnA resulted in the aforementioned changes, which might be used to combat the increased oxidative stress in the cells.

  20. Metabolic engineering of Escherichia coli for the production of l-valine based on transcriptome analysis and in silico gene knockout simulation

    OpenAIRE

    Park, Jin Hwan; Lee, Kwang Ho; Kim, Tae Yong; Lee, Sang Yup

    2007-01-01

    The l-valine production strain of Escherichia coli was constructed by rational metabolic engineering and stepwise improvement based on transcriptome analysis and gene knockout simulation of the in silico genome-scale metabolic network. Feedback inhibition of acetohydroxy acid synthase isoenzyme III by l-valine was removed by site-directed mutagenesis, and the native promoter containing the transcriptional attenuator leader regions of the ilvGMEDA and ilvBN operon was replaced with the tac pro...

  1. Relationship among growth parameters for Clostridium butyricum, hydA gene expression, and biohydrogen production in a sucrose-supplemented batch reactor.

    Science.gov (United States)

    Wang, Mei-Yun; Olson, Betty H; Chang, Jo-Shu

    2008-03-01

    This study was undertaken to identify the relationship between the performance of dark H2 fermentation and expression of the key functional gene (i.e., hydrogenase gene) involved in the bioH2 production process. Clostridium butyricum CGS5 isolated from anaerobic sewage sludge was used as the model strain for this study. Copy number of the hydrogenase gene (hydA) and mRNA transcripts (cDNA hydA) (after amplification) and the total DNA and RNA (before amplification) were measured over the course of the growth of strain CGS5. Cell concentration was also determined by optical density and converted to dry weight. After amplification, the hydA gene increased 1,500-fold during late exponential growth phase after normalization to the copy number at time 0, and cDNA from mRNA transcripts of hydA also increased 500-fold after normalization. mRNA transcripts of hydA lagged behind the increase of total DNA and RNA, and increases in hydA more closely mimicked those of total DNA. Increases in both of these parameters corresponded with hydrogen production. Transcripts of 16s ribosomal RNA reached a maximum value earlier (38 h) than did those of hydA (47 h). All molecular characteristics matched those for sucrose utilization, growth, and hydrogen production. These experiments indicated that transcription as measured by cDNA can be related to hydrogen production and possesses the potential to be used as tool for process control.

  2. Production of recombinant granulocyte colony-stimulating factor by knocking into the active immunoglobulin heavy chain gene locus in the hybridoma cell line

    OpenAIRE

    Kuwana, Yoshihisa; Funayama, Kikuko; Miyaji, Hiromasa; Hasegawa, Mamoru; Yoshida, Hajime; Itoh, Seiga

    2001-01-01

    The hybridoma cell line KM50 originally produces a monoclonal antibody at a concentration of ∼40 mg ml-1 in ascites. To investigate the possibility to apply this expression system to the production of useful proteins, the cDNA encoding human granulocyte colony-stimulating factor was inserted by homologous recombination into just downstream of the promoter of the active immunoglobulin heavy chain gene of KM50. Site directed integration of targeting DNAs resulted in the disruption of expression...

  3. Transcription and translation products of the cytolysin gene psm-mec on the mobile genetic element SCCmec regulate Staphylococcus aureus virulence.

    Directory of Open Access Journals (Sweden)

    Chikara Kaito

    Full Text Available The F region downstream of the mecI gene in the SCCmec element in hospital-associated methicillin-resistant Staphylococcus aureus (HA-MRSA contains two bidirectionally overlapping open reading frames (ORFs, the fudoh ORF and the psm-mec ORF. The psm-mec ORF encodes a cytolysin, phenol-soluble modulin (PSM-mec. Transformation of the F region into the Newman strain, which is a methicillin-sensitive S. aureus (MSSA strain, or into the MW2 (USA400 and FRP3757 (USA300 strains, which are community-acquired MRSA (CA-MRSA strains that lack the F region, attenuated their virulence in a mouse systemic infection model. Introducing the F region to these strains suppressed colony-spreading activity and PSMα production, and promoted biofilm formation. By producing mutations into the psm-mec ORF, we revealed that (i both the transcription and translation products of the psm-mec ORF suppressed colony-spreading activity and promoted biofilm formation; and (ii the transcription product of the psm-mec ORF, but not its translation product, decreased PSMα production. These findings suggest that both the psm-mec transcript, acting as a regulatory RNA, and the PSM-mec protein encoded by the gene on the mobile genetic element SCCmec regulate the virulence of Staphylococcus aureus.

  4. sbmC, a stationary-phase induced SOS Escherichia coli gene, whose product protects cells from the DNA replication inhibitor microcin B17.

    Science.gov (United States)

    Baquero, M R; Bouzon, M; Varea, J; Moreno, F

    1995-10-01

    Microcin B17 (MccB17) is a ribosomally synthesized peptide antibiotic of 43 amino acids that induces double-strand breaking of DNA in a DNA gyrase-dependent reaction. As a consequence, the SOS regulon is induced and massive DNA degradation occurs. In this work we have characterized an Escherichia coli gene, sbmC, that in high copy number determines high cell resistance to MccB17. sbmC encodes a cytoplasmic polypeptide of 157 amino acids (M(r), 18,095) that has been visualized in SDS-polyacrylamide gels. The gene is located at min 44 of the E. coli genetic map, close to the sbcB gene. sbmC expression is induced by DNA-damaging agents and, also, by the entry of cells into the stationary growth phase. A G-->T transversion at the fifth nucleotide of the quasicanonical LexA-box preceding the gene makes recA cells 16-fold more resistant to exogenous MccB17. The gene product, SbmC, also blocks MccB17 export from producing cells. Altogether, our results suggest that SbmC recognizes and sequesters MccB17 in a reversible way.

  5. Highly efficient production of the staphylococcal nuclease reporter in Lactobacillus bulgaricus governed by the promoter of the hlbA gene.

    Science.gov (United States)

    Chouayekh, Hichem; Serror, Pascale; Boudebbouze, Samira; Maguin, Emmanuelle

    2009-04-01

    Lactobacillus delbrueckii ssp. bulgaricus (L. bulgaricus) genome sequence analysis revealed the presence of two genes that encode histone-like HU proteins (hlbA and hlbB) showing extensive similarity to other bacterial homologues. These genes were found to be extremely conserved among several L. bulgaricus strains. The hlbA gene was shown to be constitutively transcribed from a unique promoter (phlbA) during normal growth, whereas hlbB did not seem to be expressed under usual laboratory conditions. Using a reporter cassette in which the staphylococcal nuclease was fused at its N-terminus to the lactococcal signal peptide Usp45 (SP Usp45), we have demonstrated that phlbA promotes high expression of the reporter in L. bulgaricus, which correlated with an abundant secretion of the mature nuclease in the supernatant fraction. Quantification of the exported enzyme reveals a secretion level approximately threefold higher when the expression of the reporter was under the control of phlbA compared with the lactococcal usp45 promoter. Together, these results indicate that phlbA is suitable for gene expression in L. bulgaricus, that SP Usp45 is functionally recognized and processed by the L. bulgaricus secretion machinery and that the nuclease reporter gene can be used for the identification of exported products in this bacterium.

  6. Strain improvement by overexpression of the laeA gene in Monascus pilosus for the production of monascus-fermented rice.

    Science.gov (United States)

    Lee, Sang Sub; Lee, Jin Hee; Lee, Inhyung

    2013-01-01

    Monascus species have been used to produce fermented rice called Monascus-fermented rice (MFR). To improve a Monascus strain via activation of secondary metabolite (SM) gene clusters for use in the production of MFR, we overexpressed an ortholog of the laeA gene, which encodes a global positive regulator of secondary metabolism under the control of the strong heterologous Aspergillus nidulans alcA promoter in Monascus pilosus. The OE::laeA transformant produced more SMs, including those not detected under uninduced conditions. MFR produced using the M. pilosus OE::laeA strain contained 4 times more monacolin K, a cholesterol-lowering agent, than MFR produced using the wild-type strain. In addition, pigment production was remarkably increased, and the antioxidant activity was increased as well. The results from this study suggest that Monascus species, which are important industrial fermentative fungi in Asia, can be improved for the production of functional foods by overexpressing the laeA gene.

  7. Presence of exoY, exoS, exoU and exoT genes, antibiotic resistance and biofilm production among Pseudomonas aeruginosa isolates in Northwest Iran

    Directory of Open Access Journals (Sweden)

    Azimi, Somayeh

    2016-02-01

    Full Text Available Background: , as Gram-negative rod bacilli, has an important role in human infection. In the present study we aimed to investigate the presence of genes and biofilm production among isolates in Northwest Iran.Material and methods: 160 isolates of were collected and identified by biochemical tests and were characterized for antibiotic resistance. Biofilm production was evaluated by microtiter plate assay and the presence of genes was evaluated by allele-specific PCR (polymerase chain reaction. Chi-square test was used for statistical analysis.Results: The most effective antibiotics against isolates were colistin and polymyxin B. 87% of the isolates were biofilm producers of which 69% were strongly biofilm producers. 55% of the isolates carried , 52% of the isolates carried , and 26.3% and 5% carried and , respectively.Conclusion: Our findings showed different distribution of genes in clinical isolates of in Northwest Iran. and were more prevalent in non-biofilm producers and was more prevalent in biofilm producer isolates. These results might indicate the importance of in biofilm production of .

  8. Early and late trisporoids differentially regulate β-carotene production and gene transcript Levels in the mucoralean fungi Blakeslea trispora and Mucor mucedo.

    Science.gov (United States)

    Sahadevan, Yamuna; Richter-Fecken, Mareike; Kaerger, Kerstin; Voigt, Kerstin; Boland, Wilhelm

    2013-12-01

    The multistep cleavage of carotenoids in Mucorales during the sexual phase results in a cocktail of trisporic acid (C18) sex pheromones. We hypothesized that the C18 trisporoid intermediates have a specific regulatory function for sex pheromone production and carotenogenesis that varies with genus/species and vegetative and sexual phases of their life cycles. Real-time quantitative PCR kinetics determined for Blakeslea trispora displayed a very high transcript turnover in the gene for carotenoid cleavage dioxygenase, tsp3, during the sexual phase. An in vivo enzyme assay and chromatographic analysis led to the identification of β-apo-12'-carotenal as the first apocarotenoid involved in trisporic acid biosynthesis in B. trispora. Supplementation of C18 trisporoids, namely D'orenone, methyl trisporate C, and trisporin C, increased tsp3 transcripts in the plus compared to minus partners. Interestingly, the tsp1 gene, which is involved in trisporic acid biosynthesis, was downregulated compared to tsp3 irrespective of asexual or sexual phase. Only the minus partners of both B. trispora and Mucor mucedo had enhanced β-carotene production after treatment with C20 apocarotenoids, 15 different trisporoids, and their analogues. We conclude that the apocarotenoids and trisporoids influence gene transcription and metabolite production, depending upon the fungal strain, corresponding genus, and developmental phase, representing a "chemical dialect" during sexual communication.

  9. Effects of Thyme Extract Oils (from Thymus vulgaris, Thymus zygis, and Thymus hyemalis on Cytokine Production and Gene Expression of oxLDL-Stimulated THP-1-Macrophages

    Directory of Open Access Journals (Sweden)

    A. Ocaña

    2012-01-01

    Full Text Available Properties of thyme extracts from three different species (Thymus vulgaris, Thymus zygis, and Thymus hyemalis were examined. Two oil fractions from each species were obtained by CO2 supercritical fluid extraction. Main compounds presented in the supercritical extracts of the three thyme varieties were 1,8 cineole, thymol, camphor, borneol, and carvacrol. As a cellular model of inflammation/atherogenesis, we use human macrophages derived from THP-1 monocytes and activated by oxidized LDLs. These cells were incubated with the thyme fraction oils, and the productions and gene expressions of the inflammatory mediators TNF-α, IL-1B, IL-6, and IL-10 were determined. Thyme extracts significantly reduced production and gene expression of the proinflammatory mediators TNF-α, IL-1B, and IL-6 and highly increased these parameters on the anti-inflammatory IL-10 cytokine. Changes on production and gene expressions were dose dependent and according to the thyme content of each species. Taken together, these results may suggest that thyme extracts could have anti-inflammatory effects.

  10. Pseudomonas aeruginosa biofilms exposed to imipenem exhibit changes in global gene expression and beta-lactamase and alginate production

    DEFF Research Database (Denmark)

    Bagge, Niels; Schuster, Martin; Hentzer, Morten;

    2004-01-01

    expression in biofilm populations. Many genes showed small but statistically significant differential expression in response to imipenem. We identified 34 genes that were induced or repressed in biofilms exposed to imipenem more than fivefold compared to the levels of induction or repression for the controls......The lungs of cystic fibrosis (CF) patients are commonly colonized with Pseudomonas aeruginosa biofilms. Chronic endobronchial P. aeruginosa infections are impossible to eradicate with antibiotics, but intensive suppressive antibiotic therapy is essential to maintain the lung function of CF patients....... The treatment often includes beta-lactam antibiotics. How these antibiotics influence gene expression in the surviving biofilm population of P. aeruginosa is not clear. Thus, we used the microarray technology to study the effects of subinhibitory concentrations of a beta-lactam antibiotic, imipenem, on gene...

  11. Detection of genes mediating beta-lactamase production in isolates of enterobacteria recovered from wild pets in Saudi Arabia

    Directory of Open Access Journals (Sweden)

    Sabry A. Hassan

    2015-12-01

    Full Text Available Aim: To determine the genetic basis and types of beta-lactamase encountered among enterobacterial isolates of wild pets from the animal exhibit. Materials and Methods: A total of 17 beta-lactamase-producing enterobacteria recovered from fecal samples of wild pet animals were analyzed for a selected beta-lactamase gene by polymerase chain reaction. Results: Molecular analysis identified one or more β-lactamase-encoding genes in 14 enterobacterial isolates as a single or gene combination. The most frequent extended-spectrum β-lactamases types were transmission electron microscopy and CTX-M, and the most common AmpC enzymes were CMY-2 and DHA types. Conclusions: The study is the first in Saudi Arabia, have established the presence of β-lactamase-encoding genes in the fecal isolates of wild pets.

  12. Mutational Analysis of the sbo-alb Locus of Bacillus subtilis: Identification of Genes Required for Subtilosin Production and Immunity

    OpenAIRE

    Zheng, Guolu; Hehn, Robin; Zuber, Peter

    2000-01-01

    The Bacillus subtilis 168 derivative JH642 produces a bacteriocin, subtilosin, which possesses activity against Listeria monocytogenes. Inspection of the amino acid sequence of the presubtilosin polypeptide encoded by the gene sboA and sequence data from analysis of mature subtilosin indicate that the precursor subtilosin peptide undergoes several unique and unusual chemical modifications during its maturation process. The genes of the sbo-alb operon are believed to function in the synthesis ...

  13. Production of the Anaerobic GMAX-L Yeast Using High-Throughput Mating and Transformation of Saccharomyces cerevisiae With Identified Genes For Simultaneous Cellulosic Ethanol and Biodiesel Production

    Science.gov (United States)

    Tailored GMAX-L yeast engineering for strains capable of universal ethanol production industrially with coproduction of an expressed lipase catalyst for coproduction of ethyl esters from corn oil and ethanol from the modern dry grind ethanol facility: Production of the stable baseline glucose, mann...

  14. Rates of N2 production and diversity and abundance of functional genes associated with denitrification and anaerobic ammonium oxidation in the sediment of the Amundsen Sea Polynya, Antarctica

    Science.gov (United States)

    Choi, Ayeon; Cho, Hyeyoun; Kim, Sung-Han; Thamdrup, Bo; Lee, SangHoon; Hyun, Jung-Ho

    2016-01-01

    A combination of molecular microbiological analyses and metabolic rate measurements was conducted to elucidate the diversity and abundance of denitrifying and anaerobic ammonium oxidation (anammox) bacteria and the nitrogen gas (N2) production rates in sediment underlying the highly productive polynya (Stns. 10 and 17) and the sea-ice zone on the outer shelf (Stn. 83) of the Amundsen Sea, Antarctica. Despite the high water column productivity, the N2 production rates by denitrification (0.04-0.31 nmol N cm-3sed. h-1) and anammox (0.13-0.26 nmol N cm-3 sed. h-1) were lower than those measured in other polar regions. In contrast, gene copy number (106-107 copies cm-3 of nirS and nosZ genes targeting denitirifiers and 105-107 copies cm-3 of 16S rRNA genes related to anammox bacteria) of the two bacterial groups at Stn. 17 was similar compared to those of other organic-rich environments. The majority of the nirS sequences were affiliated with Gammaproteobacteria (54% and 61% of the total nirS gene at Stns. 17 and 83, respectively), which were closely related to Pseudomonas aeruginosa. Most nosZ sequences (92% and 72% of the total nosZ genes at Stns. 17 and 83, respectively) were related to the Alphaproteobacteria, which were closely related to Ruegeria pomeroyi and Roseobacter denitrificans. Most (98%) of the sequences related to anammox bacteria were affiliated with Candidatus Scalindua at Stn. 17. Consequently, despite the low metabolic activity, the abundance and composition of most denitrifying and anammox bacteria detected from the ASP were similar to those reported from a variety of marine environments. Our results further imply that increased labile organic matter production resulting from a shift of the phytoplankton community from Phaeocystis to diatoms in response to rapid melting of sea ice stimulates metabolic activities of the denitrifying and anammox bacteria, thereby enhancing the N removal process in the ASP.

  15. ROS production and gene expression in alveolar macrophages exposed to PM(2.5) from Baghdad, Iraq: Seasonal trends and impact of chemical composition.

    Science.gov (United States)

    Hamad, Samera H; Schauer, James J; Antkiewicz, Dagmara S; Shafer, Martin M; Kadhim, Ahmed Kh

    2016-02-01

    The objective of this study was to assess the impact of changes in atmospheric particulate matter (PM) composition on oxidative stress markers in an in-vitro alveolar macrophage (AM) model. Fifty-three PM2.5 samples were collected during a year-long PM sampling campaign in Baghdad, Iraq, a semi-arid region of the country. Monthly composites were analyzed for chemical composition and for biological activity using in-vitro measurements of ROS production and gene expression in the AM model. Twelve genes that were differentially expressed upon PM exposure were identified and their co-associations with the composition of PM2.5 were examined. Ten of those genes were up-regulated in January and April composites; samples which also exhibited high ROS activity and relatively high PM mass concentration. ROS production was statistically correlated with total PM2.5 mass, levoglucosan (a wood burning tracer) and several trace elements of the PM (especially V and Ni, which are associated with oil combustion). The expression of several cytokine genes was found to be moderately associated with PM mass, crustal materials (indication of dusty days or dust storms) and certain metals (e.g. V, Fe and Ni) in the PM. Thus, the ROS activity association with PM2.5, may, in part, be driven by redox-active metals. The antioxidant response genes (Nqo1 and Hmox1) were moderately associated with polyaromatic hydrocarbons (PAHs) and showed a good correlation (r-Pearson of >0.7) with metals linked to vehicle-related emissions (i.e. Cu, Zn and Sb). Examining these associations in a larger sample pool (e.g. daily samples) would improve the power of the analysis and may strengthen the implication of these chemicals in the oxidative stress of biological systems, which could aid in the development of new metrics of PM toxicity. PMID:26618301

  16. Variation in Fumonisin and Ochratoxin Production Associated with Differences in Biosynthetic Gene Content in Aspergillus niger and A. welwitschiae Isolates from Multiple Crop and Geographic Origins.

    Science.gov (United States)

    Susca, Antonia; Proctor, Robert H; Morelli, Massimiliano; Haidukowski, Miriam; Gallo, Antonia; Logrieco, Antonio F; Moretti, Antonio

    2016-01-01

    The fungi Aspergillus niger and A. welwitschiae are morphologically indistinguishable species used for industrial fermentation and for food and beverage production. The fungi also occur widely on food crops. Concerns about their safety have arisen with the discovery that some isolates of both species produce fumonisin (FB) and ochratoxin A (OTA) mycotoxins. Here, we examined FB and OTA production as well as the presence of genes responsible for synthesis of the mycotoxins in a collection of 92 A. niger/A. welwitschiae isolates from multiple crop and geographic origins. The results indicate that (i) isolates of both species differed in ability to produce the mycotoxins; (ii) FB-nonproducing isolates of A. niger had an intact fumonisin biosynthetic gene (fum) cluster; (iii) FB-nonproducing isolates of A. welwitschiae exhibited multiple patterns of fum gene deletion; and (iv) OTA-nonproducing isolates of both species lacked the ochratoxin A biosynthetic gene (ota) cluster. Analysis of genome sequence data revealed a single pattern of ota gene deletion in the two species. Phylogenetic analysis suggest that the simplest explanation for this is that ota cluster deletion occurred in a common ancestor of A. niger and A. welwitschiae, and subsequently both the intact and deleted cluster were retained as alternate alleles during divergence of the ancestor into descendent species. Finally, comparison of results from this and previous studies indicate that a majority of A. niger isolates and a minority of A. welwitschiae isolates can produce FBs, whereas, a minority of isolates of both species produce OTA. The comparison also suggested that the relative abundance of each species and frequency of FB/OTA-producing isolates can vary with crop and/or geographic origin. PMID:27667988

  17. Mitochondrial DNA variants mediate energy production and expression levels for CFH, C3 and EFEMP1 genes: implications for age-related macular degeneration.

    Directory of Open Access Journals (Sweden)

    M Cristina Kenney

    Full Text Available BACKGROUND: Mitochondrial dysfunction is associated with the development and progression of age-related macular degeneration (AMD. Recent studies using populations from the United States and Australia have demonstrated that AMD is associated with mitochondrial (mt DNA haplogroups (as defined by combinations of mtDNA polymorphisms that represent Northern European Caucasians. The aim of this study was to use the cytoplasmic hybrid (cybrid model to investigate the molecular and biological functional consequences that occur when comparing the mtDNA H haplogroup (protective for AMD versus J haplogroup (high risk for AMD. METHODOLOGY/PRINCIPAL FINDINGS: Cybrids were created by introducing mitochondria from individuals with either H or J haplogroups into a human retinal epithelial cell line (ARPE-19 that was devoid of mitochondrial DNA (Rho0. In cybrid lines, all of the cells carry the same nuclear genes but vary in mtDNA content. The J cybrids had significantly lower levels of ATP and reactive oxygen/nitrogen species production, but increased lactate levels and rates of growth. Q-PCR analyses showed J cybrids had decreased expressions for CFH, C3, and EFEMP1 genes, high risk genes for AMD, and higher expression for MYO7A, a gene associated with retinal degeneration in Usher type IB syndrome. The H and J cybrids also have comparatively altered expression of nuclear genes involved in pathways for cell signaling, inflammation, and metabolism. CONCLUSION/SIGNIFICANCE: Our findings demonstrate that mtDNA haplogroup variants mediate not only energy production and cell growth, but also cell signaling for major molecular pathways. These data support the hypothesis that mtDNA variants play important roles in numerous cellular functions and disease processes, including AMD.

  18. Variation in Fumonisin and Ochratoxin Production Associated with Differences in Biosynthetic Gene Content in Aspergillus niger and A. welwitschiae Isolates from Multiple Crop and Geographic Origins

    Science.gov (United States)

    Susca, Antonia; Proctor, Robert H.; Morelli, Massimiliano; Haidukowski, Miriam; Gallo, Antonia; Logrieco, Antonio F.; Moretti, Antonio

    2016-01-01

    The fungi Aspergillus niger and A. welwitschiae are morphologically indistinguishable species used for industrial fermentation and for food and beverage production. The fungi also occur widely on food crops. Concerns about their safety have arisen with the discovery that some isolates of both species produce fumonisin (FB) and ochratoxin A (OTA) mycotoxins. Here, we examined FB and OTA production as well as the presence of genes responsible for synthesis of the mycotoxins in a collection of 92 A. niger/A. welwitschiae isolates from multiple crop and geographic origins. The results indicate that (i) isolates of both species differed in ability to produce the mycotoxins; (ii) FB-nonproducing isolates of A. niger had an intact fumonisin biosynthetic gene (fum) cluster; (iii) FB-nonproducing isolates of A. welwitschiae exhibited multiple patterns of fum gene deletion; and (iv) OTA-nonproducing isolates of both species lacked the ochratoxin A biosynthetic gene (ota) cluster. Analysis of genome sequence data revealed a single pattern of ota gene deletion in the two species. Phylogenetic analysis suggest that the simplest explanation for this is that ota cluster deletion occurred in a common ancestor of A. niger and A. welwitschiae, and subsequently both the intact and deleted cluster were retained as alternate alleles during divergence of the ancestor into descendent species. Finally, comparison of results from this and previous studies indicate that a majority of A. niger isolates and a minority of A. welwitschiae isolates can produce FBs, whereas, a minority of isolates of both species produce OTA. The comparison also suggested that the relative abundance of each species and frequency of FB/OTA-producing isolates can vary with crop and/or geographic origin. PMID:27667988

  19. Domain structures and molecular evolution of class I and class II major histocompatibility gene complex (MHC) products deduced from amino acid and nucleotide sequence homologies

    Science.gov (United States)

    Ohnishi, Koji

    1984-12-01

    Domain structures of class I and class II MHC products were analyzed from a viewpoint of amino acid and nucleotide sequence homologies. Alignment statistics revealed that class I (transplantation) antigen H chains consist of four mutually homologous domains, and that class II (HLA-DR) antigen β and α chains are both composed of three mutually homologous ones. The N-terminal three and two domains of class I and class II (both β and α) gene products, respectively, all of which being ˜90 residues long, were concluded to be homologous to β2-microglobulin (β2M). The membraneembedded C-terminal shorter domains of these MHC products were also found to be homologous to one another and to the third domain of class I H chains. Class I H chains were found to be more closely related to class II α chains than to class II β chains. Based on these findings, an exon duplication history from a common ancestral gene encoding a β2M-like primodial protein of one-domain-length up to the contemporary MHC products was proposed.

  20. The immediate early gene product EGR1 and polycomb group proteins interact in epigenetic programming during chondrogenesis.

    Directory of Open Access Journals (Sweden)

    Frank Spaapen

    Full Text Available Initiation of and progression through chondrogenesis is driven by changes in the cellular microenvironment. At the onset of chondrogenesis, resting mesenchymal stem cells are mobilized in vivo and a complex, step-wise chondrogenic differentiation program is initiated. Differentiation requires coordinated transcriptomic reprogramming and increased progenitor proliferation; both processes require chromatin remodeling. The nature of early molecular responses that relay differentiation signals to chromatin is poorly understood. We here show that immediate early genes are rapidly and transiently induced in response to differentiation stimuli in vitro. Functional ablation of the immediate early factor EGR1 severely deregulates expression of key chondrogenic control genes at the onset of differentiation. In addition, differentiating cells accumulate DNA damage, activate a DNA damage response and undergo a cell cycle arrest and prevent differentiation associated hyper-proliferation. Failed differentiation in the absence of EGR1 affects global acetylation and terminates in overall histone hypermethylation. We report novel molecular connections between EGR1 and Polycomb Group function: Polycomb associated histone H3 lysine27 trimethylation (H3K27me3 blocks chromatin access of EGR1. In addition, EGR1 ablation results in abnormal Ezh2 and Bmi1 expression. Consistent with this functional interaction, we identify a number of co-regulated targets genes in a chondrogenic gene network. We here describe an important role for EGR1 in early chondrogenic epigenetic programming to accommodate early gene-environment interactions in chondrogenesis.

  1. Production of γ-linolenic acid and stearidonic acid by Synechococcus sp. PCC7002 containing cyanobacterial fatty acid desaturase genes

    Science.gov (United States)

    Dong, Xuewei; He, Qingfang; Peng, Zhenying; Yu, Jinhui; Bian, Fei; Li, Youzhi; Bi, Yuping

    2016-07-01

    Genetic modification is useful for improving the nutritional qualities of cyanobacteria. To increase the total unsaturated fatty acid content, along with the ratio of ω-3/ω-6 fatty acids, genetic engineering can be used to modify fatty acid metabolism. Synechococcus sp. PCC7002, a fast-growing cyanobacterium, does not contain a Δ6 desaturase gene and is therefore unable to synthesize γ-linolenic acid (GLA) and stearidonic acid (SDA), which are important in human health. In this work, we constructed recombinant vectors Syd6D, Syd15D and Syd6Dd15D to express the Δ15 desaturase and Δ6 desaturase genes from Synechocystis PCC6803 in Synechococcus sp. PCC7002, with the aim of expressing polyunsaturated fatty acids. Overexpression of the Δ15 desaturase gene in Synechococcus resulted in 5.4 times greater accumulation of α-linolenic acid compared with the wild-type while Δ6 desaturase gene expression produced both GLA and SDA. Co-expression of the two genes resulted in low-level accumulation of GLA but much larger amounts of SDA, accounting for as much to 11.64% of the total fatty acid content.

  2. The ipdC, hisC1 and hisC2 genes involved in indole-3-acetic production used as alternative phylogenetic markers in Azospirillum brasilense.

    Science.gov (United States)

    Jijón-Moreno, Saúl; Marcos-Jiménez, Cynthia; Pedraza, Raúl O; Ramírez-Mata, Alberto; de Salamone, I García; Fernández-Scavino, Ana; Vásquez-Hernández, Claudia A; Soto-Urzúa, Lucia; Baca, Beatriz E

    2015-06-01

    Plant growth-promoting bacteria of the genus Azospirillum are present in the rhizosphere and as endophytes of many crops. In this research we studied 40 Azospirillum strains isolated from different plants and geographic regions. They were first characterized by 16S rDNA restriction analysis, and their phylogenetic position was established by sequencing the genes 16S rDNA, ipdC, hisC1, and hisC2. The latter three genes are involved in the indole-3-pyruvic acid (IPyA) biosynthesis pathway of indole-3-acetic acid (IAA). Furthermore, the suitability of the 16S-23S rDNA intergenic spacer sequence (IGS) for the differentiation of closely related Azospirillum taxa and development of PCR protocols allows for specific detection of strains. The IGS-RFLP analysis enabled intraspecies differentiation, particularly of Azospirillum brasilense and Azospirillum lipoferum strains. Results demonstrated that the ipdC, hisC1, and hisC2 genes are highly conserved in all the assessed A. brasilense isolates, suggesting that these genes can be used as an alternative phylogenetic marker. In addition, IAA production determined by HPLC ranged from 0.17 to 98.2 μg mg(-1) protein. Southern hybridization with the A. brasilense ipdC gene probe did not show, a hybridization signal with A. lipoferum, Azospirillum amazonense, Azospirillum halopreferans and Azospirillum irakense genomic DNA. This suggests that these species produce IAA by other pathways. Because IAA is mainly synthesized via the IPyA pathway in A. brasilense strains, a species that is used worldwide in agriculture, the identification of ipdC, hisC1, and hisC2 genes by PCR may be suitable for selecting exploitable strains.

  3. Impact of Nitrogen Sources on Gene Expression and Toxin Production in the Diazotroph Cylindrospermopsis raciborskii CS-505 and Non-Diazotroph Raphidiopsis brookii D9

    Directory of Open Access Journals (Sweden)

    Karina Stucken

    2014-06-01

    Full Text Available Different environmental nitrogen sources play selective roles in the development of cyanobacterial blooms and noxious effects are often exacerbated when toxic cyanobacteria are dominant. Cylindrospermopsis raciborskii CS-505 (heterocystous, nitrogen fixing and Raphidiopsis brookii D9 (non-N2 fixing produce the nitrogenous toxins cylindrospermopsin (CYN and paralytic shellfish toxins (PSTs, respectively. These toxin groups are biosynthesized constitutively by two independent putative gene clusters, whose flanking genes are target for nitrogen (N regulation. It is not yet known how or if toxin biosynthetic genes are regulated, particularly by N-source dependency. Here we show that binding boxes for NtcA, the master regulator of N metabolism, are located within both gene clusters as potential regulators of toxin biosynthesis. Quantification of intra- and extracellular toxin content in cultures at early stages of growth under nitrate, ammonium, urea and N-free media showed that N-sources influence neither CYN nor PST production. However, CYN and PST profiles were altered under N-free medium resulting in a decrease in the predicted precursor toxins (doCYN and STX, respectively. Reduced STX amounts were also observed under growth in ammonium. Quantification of toxin biosynthesis and transport gene transcripts revealed a constitutive transcription under all tested N-sources. Our data support the hypothesis that PSTs and CYN are constitutive metabolites whose biosynthesis is correlated to cyanobacterial growth rather than directly to specific environmental conditions. Overall, the constant biosynthesis of toxins and expression of the putative toxin-biosynthesis genes supports the usage of qPCR probes in water quality monitoring of toxic cyanobacteria.

  4. Impact of Nitrogen Sources on Gene Expression and Toxin Production in the Diazotroph Cylindrospermopsis raciborskii CS-505 and Non-Diazotroph Raphidiopsis brookii D9

    Science.gov (United States)

    Stucken, Karina; John, Uwe; Cembella, Allan; Soto-Liebe, Katia; Vásquez, Mónica

    2014-01-01

    Different environmental nitrogen sources play selective roles in the development of cyanobacterial blooms and noxious effects are often exacerbated when toxic cyanobacteria are dominant. Cylindrospermopsis raciborskii CS-505 (heterocystous, nitrogen fixing) and Raphidiopsis brookii D9 (non-N2 fixing) produce the nitrogenous toxins cylindrospermopsin (CYN) and paralytic shellfish toxins (PSTs), respectively. These toxin groups are biosynthesized constitutively by two independent putative gene clusters, whose flanking genes are target for nitrogen (N) regulation. It is not yet known how or if toxin biosynthetic genes are regulated, particularly by N-source dependency. Here we show that binding boxes for NtcA, the master regulator of N metabolism, are located within both gene clusters as potential regulators of toxin biosynthesis. Quantification of intra- and extracellular toxin content in cultures at early stages of growth under nitrate, ammonium, urea and N-free media showed that N-sources influence neither CYN nor PST production. However, CYN and PST profiles were altered under N-free medium resulting in a decrease in the predicted precursor toxins (doCYN and STX, respectively). Reduced STX amounts were also observed under growth in ammonium. Quantification of toxin biosynthesis and transport gene transcripts revealed a constitutive transcription under all tested N-sources. Our data support the hypothesis that PSTs and CYN are constitutive metabolites whose biosynthesis is correlated to cyanobacterial growth rather than directly to specific environmental conditions. Overall, the constant biosynthesis of toxins and expression of the putative toxin-biosynthesis genes supports the usage of qPCR probes in water quality monitoring of toxic cyanobacteria. PMID:24956074

  5. High Production of 2,3-Butanediol (2,3-BD) by Raoultella ornithinolytica B6 via Optimizing Fermentation Conditions and Overexpressing 2,3-BD Synthesis Genes

    Science.gov (United States)

    Kim, Taeyeon; Cho, Sukhyeong; Lee, Sun-Mi; Woo, Han Min; Lee, Jinwon; Seo, Jin-Ho

    2016-01-01

    Biological production of 2,3-butandiol (2,3-BD) has received great attention as an alternative to the petroleum-based 2,3-BD production. In this study, a high production of 2,3-BD in fed-batch fermentation was investigated with a newly isolated bacterium designated as Raoultella ornithinolytica B6. The isolate produced 2,3-BD as the main product using hexoses (glucose, galactose, and fructose), pentose (xylose) and disaccharide (sucrose). The effects of temperature, pH-control schemes, and agitation speeds on 2,3-BD production were explored to optimize the fermentation conditions. Notably, cell growth and 2,3-BD production by R. ornithinolytica B6 were higher at 25°C than at 30°C. When three pH control schemes (no pH control, pH control at 7, and pH control at 5.5 after the pH was decreased to 5.5 during fermentation) were tested, the best 2,3-BD titer and productivity along with reduced by-product formation were achieved with pH control at 5.5. Among different agitation speeds (300, 400, and 500 rpm), the optimum agitation speed was 400 rpm with 2,3-BD titer of 68.27 g/L, but acetic acid was accumulated up to 23.32 g/L. Further enhancement of the 2,3-BD titer (112.19 g/L), yield (0.38 g/g), and productivity (1.35 g/L/h) as well as a significant reduction of acetic acid accumulation (9.71 g/L) was achieved by the overexpression of homologous budABC genes, the 2,3-BD-synthesis genes involved in the conversion of pyruvate to 2,3-BD. This is the first report presenting a high 2,3-BD production by R.ornithinolytica which has attracted little attention with respect to 2,3-BD production, extending the microbial spectrum of 2,3-BD producers. PMID:27760200

  6. RecET driven chromosomal gene targeting to generate a RecA deficient Escherichia coli strain for Cre mediated production of minicircle DNA

    Directory of Open Access Journals (Sweden)

    Coutelle Charles

    2006-03-01

    Full Text Available Abstract Background Minicircle DNA is the non-replicating product of intramolecular site-specific recombination within a bacterial minicircle producer plasmid. Minicircle DNA can be engineered to contain predominantly human sequences which have a low content of CpG dinucleotides and thus reduced immunotoxicity for humans, whilst the immunogenic bacterial origin and antibiotic resistance marker gene sequences are entirely removed by site-specific recombination. This property makes minicircle DNA an excellent vector for non-viral gene therapy. Large-scale production of minicircle DNA requires a bacterial strain expressing tightly controlled site-specific recombinase, such as Cre recombinase. As recombinant plasmids tend to be more stable in RecA-deficient strains, we aimed to construct a recA- bacterial strain for generation of minicircle vector DNA with less chance of unwanted deletions. Results We describe here the construction of the RecA-deficient minicircle DNA producer Escherichia coli HB101Cre with a chromosomally located Cre recombinase gene under the tight control of the araC regulon. The Cre gene expression cassette was inserted into the chromosomal lacZ gene by creating transient homologous recombination proficiency in the recA- strain HB101 using plasmid-born recET genes and homology-mediated chromosomal "pop-in, pop-out" of the plasmid pBAD75Cre containing the Cre gene and a temperature sensitive replication origin. Favourably for the Cre gene placement, at the "pop-out" step, the observed frequency of RecET-led recombination between the proximal regions of homology was 10 times higher than between the distal regions. Using the minicircle producing plasmid pFIXluc containing mutant loxP66 and loxP71 sites, we isolated pure minicircle DNA from the obtained recA- producer strain HB101Cre. The minicircle DNA preparation consisted of monomeric and, unexpectedly, also multimeric minicircle DNA forms, all containing the hybrid loxP66

  7. A Penicillium expansum glucose oxidase-encoding gene, GOX2, is essential for gluconic acid production and acidification during colonization of deciduous fruit.

    Science.gov (United States)

    Barad, Shiri; Horowitz, Sigal Brown; Moscovitz, Oren; Lichter, Amnon; Sherman, Amir; Prusky, Dov

    2012-06-01

    Penicillium expansum, the causal agent of blue mold rot, causes severe postharvest maceration of fruit through secretion of total, d-gluconic acid (GLA). Two P. expansum glucose oxidase (GOX)-encoding genes, GOX1 and GOX2, were analyzed. GOX activity and GLA accumulation were strongly related to GOX2 expression, which increased with pH to a maximum at pH 7.0, whereas GOX1 was expressed at pH 4.0, where no GOX activity or extracellular GLA were detected. This differential expression was also observed at the leading edge of the decaying tissue, where GOX2 expression was dominant. The roles of the GOX genes in pathogenicity were further studied through i) development of P. expansum goxRNAi mutants exhibiting differential downregulation of GOX2, ii) heterologous expression of the P. expansum GOX2 gene in the nondeciduous fruit-pathogen P. chrysogenum, and iii) modulation of GLA production by FeSO(4) chelation. Interestingly, in P. expansum, pH and GLA production elicited opposite effects on germination and biomass accumulation: 26% of spores germinated at pH 7.0 when GOX activity and GLA were highest whereas, in P. chrysogenum at the same pH, when GLA did not accumulate, 72% of spores germinated. Moreover, heterologous expression of P. expansum GOX2 in P. chrysogenum resulted in enhanced GLA production and reduced germination, suggesting negative regulation of spore germination and GLA production. These results demonstrate that pH modulation, mediated by GLA accumulation, is an important factor in generating the initial signal or signals for fungal development leading to host-tissue colonization by P. expansum.

  8. Specific interaction between hnRNP H and HPV16 L1 proteins: Implications for late gene auto-regulation enabling rapid viral capsid protein production

    Energy Technology Data Exchange (ETDEWEB)

    Zheng, Zi-Zheng; Sun, Yuan-Yuan; Zhao, Min; Huang, Hui [National Institute of Diagnostics and Vaccine Development in Infectious Diseases, Xiamen University, Xiamen, Fujian 361005 (China); School of Life Sciences, Xiamen University, Xiamen, Fujian 361005 (China); Zhang, Jun; Xia, Ning-Shao [National Institute of Diagnostics and Vaccine Development in Infectious Diseases, Xiamen University, Xiamen, Fujian 361005 (China); School of Life Sciences, Xiamen University, Xiamen, Fujian 361005 (China); School of Public Health, Xiamen University, Xiamen, Fujian 361005 (China); Miao, Ji, E-mail: jmiao@xmu.edu.cn [National Institute of Diagnostics and Vaccine Development in Infectious Diseases, Xiamen University, Xiamen, Fujian 361005 (China); School of Life Sciences, Xiamen University, Xiamen, Fujian 361005 (China); Zhao, Qinjian, E-mail: qinjian_zhao@xmu.edu.cn [National Institute of Diagnostics and Vaccine Development in Infectious Diseases, Xiamen University, Xiamen, Fujian 361005 (China); School of Public Health, Xiamen University, Xiamen, Fujian 361005 (China)

    2013-01-18

    Highlights: ► The RNA-binding hnRNP H regulates late viral gene expression. ► hnRNP H activity was inhibited by a late viral protein. ► Specific interaction between HPV L1 and hnRNP H was demonstrated. ► Co-localization of HPV L1 and hnRNP H inside cells was observed. ► Viral capsid protein production, enabling rapid capsid assembly, was implicated. -- Abstract: Heterogeneous nuclear ribonucleoproteins (hnRNPs), including hnRNP H, are RNA-binding proteins that function as splicing factors and are involved in downstream gene regulation. hnRNP H, which binds to G triplet regions in RNA, has been shown to play an important role in regulating the staged expression of late proteins in viral systems. Here, we report that the specific association between hnRNP H and a late viral capsid protein, human papillomavirus (HPV) L1 protein, leads to the suppressed function of hnRNP H in the presence of the L1 protein. The direct interaction between the L1 protein and hnRNP H was demonstrated by complex formation in solution and intracellularly using a variety of biochemical and immunochemical methods, including peptide mapping, specific co-immunoprecipitation and confocal fluorescence microscopy. These results support a working hypothesis that a late viral protein HPV16 L1, which is down regulated by hnRNP H early in the viral life cycle may provide an auto-regulatory positive feedback loop that allows the rapid production of HPV capsid proteins through suppression of the function of hnRNP H at the late stage of the viral life cycle. In this positive feedback loop, the late viral gene products that were down regulated earlier themselves disable their suppressors, and this feedback mechanism could facilitate the rapid production of capsid proteins, allowing staged and efficient viral capsid assembly.

  9. Targeting exogenous GDNF gene to the bovine somatic cell beta-casein locus for the production of transgenic bovine animals.

    Science.gov (United States)

    Zhang, X M; Luo, F H; Ding, H M; Li, B; Zhang, J J; Wu, Y J

    2015-01-01

    Considerable attention is currently being directed toward methods for producing recombinant human proteins in the mammary glands of genetically modified transgenic livestock. However, the expression of inserted genes in transgenic animals is variable and often very low because of the randomness of the site of transgene integration. One possible strategy to avoid the expression problem associated with random integration is to use site-specific integration by targeting integration to a high expression locus and, thereby, to improve expression of the transferred gene. In the present study, we focused on glial cell line-derived neurotrophic factor (GDNF), a novel type of neurotrophic factor first cloned in 1993. Research has shown that GDNF may have potential applications in the treatment of Parkinson's disease and other diseases of the central nervous system since it acts as a protective factor for central dopaminergic neurons. Here, we constructed a gene targeting vector to knock-in the human GDNF gene at the bovine beta-casein gene locus as a first step to producing transgenic animals with a high level of expression of human GDNF protein in their mammary glands. Bovine fetal fibroblast cells were transfected with linearized pNRTCNbG by electroporation. Three cell clones were identified with successful targeting to the beta-casein locus; and were confirmed using both polymerase chain reaction analysis and sequencing. Gene-targeted cells were used as nuclear donors; a total of 161 embryos were reconstructed, 23 of which developed to the blastocyst stage. These blastocysts were transferred to 8 recipient cows, but no offspring were obtained. PMID:26634460

  10. Ability of structurally diverse natural products and synthetic chemicals to induce gene expression mediated by estrogen receptors from various species.

    Science.gov (United States)

    Matthews, J B; Fertuck, K C; Celius, T; Huang, Y-W; Fong, C J; Zacharewski, T R

    2002-10-01

    The ability of 14 structurally diverse estrogenic compounds to induce reporter gene expression mediated by estrogen receptors (ERs) from different species was examined. MCF-7 cells were transiently transfected with a Gal4-regulated luciferase reporter gene (17m5-G-Luc) and Gal4-ER chimeric receptors containing the D, E and F domains of the human alpha (Gal4-hERalphadef), mouse alpha (Gal4-mERalphadef), mouse beta (Gal4-mERbetadef), chicken (Gal4-cERalphadef), green anole (Gal4-aERalphadef), Xenopus (Gal4-xERdef) or rainbow trout alpha ERs (Gal4-rtERalphadef). The efficacy of 17beta-estradiol (E2) in inducing reporter gene expression was similar among the different constructs overall, with EC(50) values ranging from 0.05 to 0.7nM. However, Gal4-rtERalphadef had an EC(50) value at 37 degrees C of 28nM, though at 20 degrees C an EC(50) value of 1nM was observed. Despite a similar response to E2 treatment among the ERs, many differences were observed in the magnitude of the response to other structurally diverse chemicals. For example, coumestrol induced Gal4-mERbetadef- and Gal4-aERdef-mediated reporter gene expression 164- and 8-fold greater, respectively, than mediated with the other Gal4-ERs. As well, in contrast to results with other Gal4-ERs, alpha-zearalenol consistently induced Gal4-rtERalphadef-mediated reporter gene activity at lower concentrations than did E2. Overall, the results demonstrate that selected estrogenic compounds exhibit a differential ability to induce reporter gene activity mediated by ERs from different vertebrate species. These data also highlight the importance of incubation temperature when examining rtERalpha-mediated activity. PMID:12477484

  11. Impact of alg3 gene deletion on growth, development, pigment production, protein secretion, and functions of recombinant Trichoderma reesei cellobiohydrolases in Aspergillus niger

    Energy Technology Data Exchange (ETDEWEB)

    Dai, Ziyu; Aryal, Uma K.; Shukla, Anil; Qian, Wei-Jun; Smith, Richard D.; Magnuson, Jon K.; Adney, William S.; Beckham, Gregg T.; Brunecky, Roman; Himmel, Michael E.; Decker, Stephen R.; Ju, Xiaohui; Zhang, Xiao; Baker, Scott E.

    2013-12-01

    ALG3 is a Family 58 glycosyltransferase enzyme involved in early N-linked glycan synthesis. Here, we investigated the effect of the alg3 gene disruption on growth, development, metabolism, and protein secretion in Aspergillus niger. The alg3 gene deletion resulted in a significant reduction of growth on complete (CM) and potato dextrose agar (PDA) media and a substantial reduction of spore production on CM. It also delayed spore germination in the liquid cultures of both CM and PDA media, but led to a significant accumulation of red pigment on both CM and liquid modified minimal medium (MM) supplemented with yeast extract. The relative abundance of 55 proteins of the total 190 proteins identified in the secretome was significantly different as a result of alg3 gene deletion. Comparison of a Trichoderma reesei cellobiohydrolase (Cel7A) heterologously expressed in A. niger parental and Δalg3 strains showed that the recombinant Cel7A expressed in the mutant background was smaller in size than that from the parental strains. This study suggests that ALG3 is critical for growth and development, pigment production, and protein secretion in A. niger. Functional analysis of recombinant Cel7A with aberrant glycosylation demonstrates the feasibility of this alternative approach to evaluate the role of N-linked glycosylation in glycoprotein secretion and function.

  12. Positive selection of mutants with cell envelope defects of a Salmonella typhimurium strain hypersensitive to the products of genes hisF and hisH. [uv radiation

    Energy Technology Data Exchange (ETDEWEB)

    Anton, D.N.

    1979-03-01

    Strain SB564 and its derivative DA78 are hypersensitive to the inhibitory action of the proteins coded for by genes hisF and hisH on cell division. Transduction of hisO1242, a regulatory mutation that elicits a very high level of expression of the histidine operon, into these strains resulted in the production of long filamentous cells carrying large balloons and in growth failure. Forty-one hisO1242 derivatives that escaped inhibition were isolated. These strains showed a large variety of alterations, many of which were related to the cell envelope. The more-frequent alterations included: changes in cell shape, increased sensitivity to one or more of several drugs (deoxycholate, cycloserine, penicillin, novobiocin, acridine orange), increased autolytic activity in alkaline buffer, anomalous fermentation of maltose on eosin--methylene blue plates, and temperature-conditional cell division. The alterations are produced, in some of the strains, by pleiotropic mutations in gene envB. Strains affected in divC, divD, and rodA loci have also been identified. Genetic analaysis has shown that several strains carry more than one envelope mutation. It is assumed that envelope mutations are positively selected because they somehow alleviate the particularly severe inhibition of cell division caused, in strains SB564 and DA78, by the excessive synthesis of hisF and hisH gene products.

  13. Industrial-scale production and purification of a heterologous protein in Lactococcus lactis using the nisin-controlled gene expression system NICE: The case of lysostaphin

    Directory of Open Access Journals (Sweden)

    Floris Esther

    2005-05-01

    Full Text Available Abstract Background The NIsin-Controlled gene Expression system NICE of Lactococcus lactis is one of the most widespread used expression systems of Gram-positive bacteria. It is used in more than 100 laboratories for laboratory-scale gene expression experiments. However, L. lactis is also a micro-organism with a large biotechnological potential. Therefore, the aim of this study was to test whether protein production in L. lactis using the NICE system can also effectively be performed at the industrial-scale of fermentation. Results Lysostaphin, an antibacterial protein (mainly against Staphylococcus aureus from S. simulans biovar. Staphylolyticus, was used as a model system. Food-grade lysostaphin expression constructs in L. lactis were grown at 1L-, 300-L and 3000-L scale and induced with nisin for lysostaphin production. The induction process was equally effective at all scales and yields of about 100 mg/L were obtained. Up-scaling was easy and required no specific effort. Furthermore, we describe a simple and effective way of downstream processing to obtain a highly purified lysostaphin, which has been used for clinical phase I trials. Conclusion This is the first example that shows that nisin-regulated gene expression in L. lactis can be used at industrial scale to produce large amounts of a target protein, such as lysostaphin. Downstream processing was simple and in a few steps produced a highly purified and active enzyme.

  14. Positive selection of mutants with cell envelope defects of a Salmonella typhimurium strain hypersensitive to the products of