Molecular detection of human bacterial pathogens
National Research Council Canada - National Science Library
Liu, Dongyou
2011-01-01
.... Molecular Detection of Human Bacterial Pathogens addresses this issue, with international scientists in respective bacterial pathogen research and diagnosis providing expert summaries on current...
Bacteriophages for detection of bacterial pathogens
International Nuclear Information System (INIS)
Kutateladze, M.
2009-01-01
The G. Eliava Institute of Bacteriophages, Microbiology and Virology (Tbilisi, Georgia) is one of the most famous institutions focused on bacteriophage research for the elaboration of appropriate phage methodologies for human and animal protection. The main direction of the institute is the study and production of bacteriophages against intestinal disorders (dysentery, typhoid, intesti) and purulent-septic infections (staphylococcus, streptococcus, pyophage, etc.). These preparations were successfully introduced during the Soviet era, and for decades were used throughout the former Soviet Union and in other Socialist countries for the treatment, prophylaxis, and diagnosis of various infectious diseases, including those caused by antibiotic-resistant bacterial strains. Bacteriophages were widely used for identifying and detecting infections caused by the most dangerous pathogens and causative agents of epidemiological outbreaks. The specific topic of this presentation is the phage typing of bacterial species, which can be an important method for epidemiological diagnostics. Together with different genetic methodologies - such as PCR-based methods, PFGE, plasmid fingerprinting, and ribosomal typing - phage typing is one method for identifying bacterial pathogens. The method has a high percentage of determination of phage types, high specificity of reaction, and is easy for interpretation and use by health workers. Phage typing was applied for inter-species differentiation of different species of Salmonella, S. typhi, Brucella spp, Staphylococcus aureus, E. col,i Clostridium deficile, Vibrio cholerae, Yersinia pestis, Yersinia enterocolitica, Lysteria monocytogenes, Clostridium perfringens, Clostridium tetani, plant pathogens, and other bacterial pathogens. In addition to addressing the utility and efficacy of phage typing, the paper will discuss the isolation and selection of diagnostic typing phages for interspecies differentiation of pathogens that is necessary
Increased detection of mastitis pathogens by real-time PCR compared to bacterial culture.
Keane, O M; Budd, K E; Flynn, J; McCoy, F
2013-09-21
Rapid and accurate identification of mastitis pathogens is important for disease control. Bacterial culture and isolate identification is considered the gold standard in mastitis diagnosis but is time consuming and results in many culture-negative samples. Identification of mastitis pathogens by PCR has been proposed as a fast and sensitive alternative to bacterial culture. The results of bacterial culture and PCR for the identification of the aetiological agent of clinical mastitis were compared. The pathogen identified by traditional culture methods was also detected by PCR in 98 per cent of cases indicating good agreement between the positive results of bacterial culture and PCR. A mastitis pathogen could not be recovered from approximately 30 per cent of samples by bacterial culture, however, an aetiological agent was identified by PCR in 79 per cent of these samples. Therefore, a mastitis pathogen was detected in significantly more milk samples by PCR than by bacterial culture (92 per cent and 70 per cent, respectively) although the clinical relevance of PCR-positive culture-negative results remains controversial. A mixed infection of two or more mastitis pathogens was also detected more commonly by PCR. Culture-negative samples due to undetected Staphylococcus aureus infections were rare. The use of PCR technology may assist in rapid mastitis diagnosis, however, accurate interpretation of PCR results in the absence of bacterial culture remains problematic.
Multiplex PCR assay for simultaneous detection of six major bacterial pathogens of rice.
Cui, Z; Ojaghian, M R; Tao, Z; Kakar, K U; Zeng, J; Zhao, W; Duan, Y; Vera Cruz, C M; Li, B; Zhu, B; Xie, G
2016-05-01
The aim of this study was to develop a multiplex PCR (mPCR) assay for rapid, sensitive and simultaneous detection of six important rice pathogens: Xanthomonas oryzae pv. oryzae, X. oryzae pv. oryzicola, Pseudomonas fuscovaginae, Burkholderia glumae, Burkholderia gladioli and Acidovorax avenae subsp. avenae. Specific primers were designed through a bioinformatics pipeline. Sensitivity of detection was established using both traditional PCR and quantitative real-time PCR on isolated DNA and on bacterial cells both in vitro and in simulated diseased seeds and the parameters were optimized for an mPCR assay. A total of 150 bacterial strains were tested for specificity. The mPCR assay accurately predicted the presence of pathogens among 44 symptomatic and asymptomatic rice seed, sheath and leaf samples. This study confirmed that this mPCR assay is a rapid, reliable and simple tool for the simultaneous detection of six important rice bacterial pathogens. This study is the first report of a method allowing simultaneous detection of six major rice pathogens. The ability to use crude extracts from plants without bacterial isolation or DNA extraction enhances the value of this mPCR technology for rapid detection and aetiological/epidemiological studies. © 2016 The Society for Applied Microbiology.
Directory of Open Access Journals (Sweden)
Peng Tian
2017-08-01
Full Text Available Bacterial pathogens and human norovirus (HuNoV are major cause for acute gastroenteritis caused by contaminated food and water. Public waterways can become contaminated from a variety of sources and flood after heavy rain events, leading to pathogen contamination of produce fields. We initiated a survey of several public watersheds in a major leafy green produce production region of the Central California Coast to determine the prevalence of HuNoV as well as bacterial pathogens. Moore swabs were used to collect environmental samples bi-monthly at over 30 sampling sites in the region. High prevalence of HuNoV and bacterial pathogens were detected in environmental water samples in the region. The overall detection rates of HuNoV, O157 Shiga toxin-producing Escherichia coli (STEC, non-O157 STEC, Salmonella, and Listeria were 25.58, 7.91, 9.42, 59.65, and 44.30%, respectively. The detection rates of Salmonella and L. monocytogenes were significantly higher in the spring. Fall and spring had elevated detection rates of O157 STEC. The overall detection rates of non-O157 STEC in the fall were lower than the other seasons but not significant. The overall detection rates of HuNoV were highest in fall, followed by spring and winter, with summer being lowest and significantly lower than other seasons. This study presented the first study of evaluating the correlation between the detection rate of HuNoV and the detection rates of four bacterial pathogens from environmental water. Overall, there was no significant difference in HuNoV detection rates between samples testing positive or negative for the four bacterial pathogens tested. Pathogens in animal-impacted and human-impacted areas were investigated. There were significant higher detection rates in animal-impacted areas than that of human-impacted areas for bacterial pathogens. However, there was no difference in HuNoV detection rates between these two areas. The overall detection levels of generic E
Nucleic Acid-based Detection of Bacterial Pathogens Using Integrated Microfluidic Platform Systems
Directory of Open Access Journals (Sweden)
Carl A. Batt
2009-05-01
Full Text Available The advent of nucleic acid-based pathogen detection methods offers increased sensitivity and specificity over traditional microbiological techniques, driving the development of portable, integrated biosensors. The miniaturization and automation of integrated detection systems presents a significant advantage for rapid, portable field-based testing. In this review, we highlight current developments and directions in nucleic acid-based micro total analysis systems for the detection of bacterial pathogens. Recent progress in the miniaturization of microfluidic processing steps for cell capture, DNA extraction and purification, polymerase chain reaction, and product detection are detailed. Discussions include strategies and challenges for implementation of an integrated portable platform.
Wagner, Karoline; Springer, Burkard; Imkamp, Frank; Opota, Onya; Greub, Gilbert; Keller, Peter M
2018-04-01
Pneumonia is a severe infectious disease. In addition to common viruses and bacterial pathogens (e.g. Streptococcus pneumoniae), fastidious respiratory pathogens like Chlamydia pneumoniae, Mycoplasma pneumoniae and Legionella spp. can cause severe atypical pneumonia. They do not respond to penicillin derivatives, which may cause failure of antibiotic empirical therapy. The same applies for infections with B. pertussis and B. parapertussis, the cause of pertussis disease, that may present atypically and need to be treated with macrolides. Moreover, these fastidious bacteria are difficult to identify by culture or serology, and therefore often remain undetected. Thus, rapid and accurate identification of bacterial pathogens causing atypical pneumonia is crucial. We performed a retrospective method evaluation study to evaluate the diagnostic performance of the new, commercially available Lightmix ® multiplex RT-PCR assay that detects these fastidious bacterial pathogens causing atypical pneumonia. In this retrospective study, 368 clinical respiratory specimens, obtained from patients suffering from atypical pneumonia that have been tested negative for the presence of common agents of pneumonia by culture and viral PCR, were investigated. These clinical specimens have been previously characterized by singleplex RT-PCR assays in our diagnostic laboratory and were used to evaluate the diagnostic performance of the respiratory multiplex Lightmix ® RT-PCR. The multiplex RT-PCR displayed a limit of detection between 5 and 10 DNA copies for different in-panel organisms and showed identical performance characteristics with respect to specificity and sensitivity as in-house singleplex RT-PCRs for pathogen detection. The Lightmix ® multiplex RT-PCR assay represents a low-cost, time-saving and accurate diagnostic tool with high throughput potential. The time-to-result using an automated DNA extraction device for respiratory specimens followed by multiplex RT-PCR detection was
Detection of mastitis pathogens by analysis of volatile bacterial metabolites.
Hettinga, K A; van Valenberg, H J F; Lam, T J G M; van Hooijdonk, A C M
2008-10-01
The ability to detect mastitis pathogens based on their volatile metabolites was studied. Milk samples from cows with clinical mastitis, caused by Staphylococcus aureus, coagulase-negative staphylococci, Streptococcus uberis, Streptococcus dysgalactiae, and Escherichia coli were collected. In addition, samples from cows without clinical mastitis and with low somatic cell count (SCC) were collected for comparison. All mastitis samples were examined by using classical microbiological methods, followed by headspace analysis for volatile metabolites. Milk from culture-negative samples contained a lower number and amount of volatile components compared with cows with clinical mastitis. Because of variability between samples within a group, comparisons between pathogens were not sufficient for classification of the samples by univariate statistics. Therefore, an artificial neural network was trained to classify the pathogen in the milk samples based on the bacterial metabolites. The trained network differentiated milk from uninfected and infected quarters very well. When comparing pathogens, Staph. aureus produced a very different pattern of volatile metabolites compared with the other samples. Samples with coagulase-negative staphylococci and E. coli had enough dissimilarity with the other pathogens, making it possible to separate these 2 pathogens from each other and from the other samples. The 2 streptococcus species did not show significant differences between each other but could be identified as a different group from the other pathogens. Five groups can thus be identified based on the volatile bacterial metabolites: Staph. aureus, coagulase-negative staphylococci, streptococci (Strep. uberis and Strep. dysgalactiae as one group), E. coli, and uninfected quarters.
Singh, Gulshan; Manohar, Murli; Adegoke, Anthony Ayodeji; Stenström, Thor Axel; Shanker, Rishi
2017-01-01
The lack of microbiologically safe water in underdeveloped nations is the prime cause of infectious disease outbreaks. The need for the specific identification and detection of microorganisms encourages the development of advanced, rapid, sensitive and highly specific methods for the monitoring of pathogens and management of potential risk to human health. The rapid molecular assays based on detection of specific molecular signatures offer advantages over conventional methods in terms of specificity and sensitivity but require complex instrumentation and skilled personnel. Nanotechnology is an emerging area and provides a robust approach for the identification of pathogenic microorganism utilizing the peculiar properties of nanomaterials, i.e. small size (1-100 nm) and large surface area. This emerging technology promises to fulfill the urgent need of a novel strategy to enhance the bacterial identification and quantitation in the environment. In this context, the peculiar properties of gold nanoparticles, their plasmonic shifts, and changes in magnetic properties have been utilized for the simple and cost-effective detection of bacterial nucleic acids, antigens and toxins with quite improved sensitivity. One of the promising leads to develop an advance detection method might be the coupling of nucleic acid aptamers (capable of interacting specifically with bacteria, protozoa, and viruses) with nanomaterials. Such aptamer-nano conjugate can be used for the specific recognition of infectious agents in different environmental matrices. This review summarizes the application of nanotechnology in the area of pathogen detection and discusses the prospects of coupling nucleic acid aptamers with nanoparticles for the specific detection of targeted pathogens.
International Nuclear Information System (INIS)
Singh, Gulshan; Manohar, Murli; Adegoke, Anthony Ayodeji; Stenström, Thor Axel; Shanker, Rishi
2017-01-01
The lack of microbiologically safe water in underdeveloped nations is the prime cause of infectious disease outbreaks. The need for the specific identification and detection of microorganisms encourages the development of advanced, rapid, sensitive and highly specific methods for the monitoring of pathogens and management of potential risk to human health. The rapid molecular assays based on detection of specific molecular signatures offer advantages over conventional methods in terms of specificity and sensitivity but require complex instrumentation and skilled personnel. Nanotechnology is an emerging area and provides a robust approach for the identification of pathogenic microorganism utilizing the peculiar properties of nanomaterials, i.e. small size (1–100 nm) and large surface area. This emerging technology promises to fulfill the urgent need of a novel strategy to enhance the bacterial identification and quantitation in the environment. In this context, the peculiar properties of gold nanoparticles, their plasmonic shifts, and changes in magnetic properties have been utilized for the simple and cost-effective detection of bacterial nucleic acids, antigens and toxins with quite improved sensitivity. One of the promising leads to develop an advance detection method might be the coupling of nucleic acid aptamers (capable of interacting specifically with bacteria, protozoa, and viruses) with nanomaterials. Such aptamer-nano conjugate can be used for the specific recognition of infectious agents in different environmental matrices. This review summarizes the application of nanotechnology in the area of pathogen detection and discusses the prospects of coupling nucleic acid aptamers with nanoparticles for the specific detection of targeted pathogens.
Energy Technology Data Exchange (ETDEWEB)
Singh, Gulshan, E-mail: gsingh.gulshan@gmail.com [Durban University of Technology, Institute for Water and Wastewater Technology (IWWT) (South Africa); Manohar, Murli [Jamia Hamdard (Hamdard University), Department of Biochemistry (India); Adegoke, Anthony Ayodeji; Stenström, Thor Axel [Durban University of Technology, Institute for Water and Wastewater Technology (IWWT) (South Africa); Shanker, Rishi [Ahmedabad University, Division of Biological & Life Sciences, School of Arts & Sciences (India)
2017-01-15
The lack of microbiologically safe water in underdeveloped nations is the prime cause of infectious disease outbreaks. The need for the specific identification and detection of microorganisms encourages the development of advanced, rapid, sensitive and highly specific methods for the monitoring of pathogens and management of potential risk to human health. The rapid molecular assays based on detection of specific molecular signatures offer advantages over conventional methods in terms of specificity and sensitivity but require complex instrumentation and skilled personnel. Nanotechnology is an emerging area and provides a robust approach for the identification of pathogenic microorganism utilizing the peculiar properties of nanomaterials, i.e. small size (1–100 nm) and large surface area. This emerging technology promises to fulfill the urgent need of a novel strategy to enhance the bacterial identification and quantitation in the environment. In this context, the peculiar properties of gold nanoparticles, their plasmonic shifts, and changes in magnetic properties have been utilized for the simple and cost-effective detection of bacterial nucleic acids, antigens and toxins with quite improved sensitivity. One of the promising leads to develop an advance detection method might be the coupling of nucleic acid aptamers (capable of interacting specifically with bacteria, protozoa, and viruses) with nanomaterials. Such aptamer-nano conjugate can be used for the specific recognition of infectious agents in different environmental matrices. This review summarizes the application of nanotechnology in the area of pathogen detection and discusses the prospects of coupling nucleic acid aptamers with nanoparticles for the specific detection of targeted pathogens.
Detection of Pathogenic Biofilms with Bacterial Amyloid Targeting Fluorescent Probe, CDy11
DEFF Research Database (Denmark)
Kim, Jun Young; Sahu, Srikanta; Yau, Yin Hoe
2016-01-01
Bacterial biofilms are responsible for a wide range of persistent infections. In the clinic, diagnosis of biofilm-associated infections relies heavily on culturing methods, which fail to detect nonculturable bacteria. Identification of novel fluorescent probes for biofilm imaging will greatly...... facilitate diagnosis of pathogenic bacterial infection. Herein, we report a novel fluorescent probe, CDy11 (compound of designation yellow 11), which targets amyloid in the Pseudomonas aeruginosa biofilm matrix through a diversity oriented fluorescent library approach (DOFLA). CDy11 was further demonstrated...
Methods to classify bacterial pathogens in cystic fibrosis
DEFF Research Database (Denmark)
Bjarnsholt, Thomas; Nielsen, Xiaohui Chen; Johansen, Ulla
2011-01-01
for identification of isolates from the Burkholderia complex to the species level. DNA typing by PFGE, which can be used for any bacterial pathogen, is described as it is employed for Pseudomonas aeruginosa. A commercially available ELISA method is described for measuring IgG antibodies against P. aeruginosa in CF......Many bacteria can be detected in CF sputum, pathogenic and commensal. Modified Koch's criteria for identification of established and emerging CF pathogens are therefore described. Methods are described to isolate bacteria and to detect bacterial biofilms in sputum or lung tissue from CF patients...
Directory of Open Access Journals (Sweden)
Law eJodi Woan-Fei
2015-01-01
Full Text Available The incidence of foodborne diseases has increased over the years and resulted in major public health problem globally. Foodborne pathogens can be found in various foods and it is important to detect foodborne pathogens to provide safe food supply and to prevent foodborne diseases. The conventional methods used to detect foodborne pathogen are time consuming and laborious. Hence, a variety of methods have been developed for rapid detection of foodborne pathogens as it is required in many food analyses. Rapid detection methods can be categorized into nucleic acid-based, biosensor-based and immunological-based methods. This review emphasizes on the principles and application of recent rapid methods for the detection of foodborne bacterial pathogens. Detection methods included are simple polymerase chain reaction (PCR, multiplex PCR, real-time PCR, nucleic acid sequence-based amplification (NASBA, loop-mediated isothermal amplification (LAMP and oligonucleotide DNA microarray which classified as nucleic acid-based methods; optical, electrochemical and mass-based biosensors which classified as biosensor-based methods; enzyme-linked immunosorbent assay (ELISA and lateral flow immunoassay which classified as immunological-based methods. In general, rapid detection methods are generally time-efficient, sensitive, specific and labor-saving. The developments of rapid detection methods are vital in prevention and treatment of foodborne diseases.
Analysis of bacterial metagenomes from the Southwestern Gulf of Mexico for pathogens detection.
Escobedo-Hinojosa, Wendy; Pardo-López, Liliana
2017-07-31
Little is known about the diversity of bacteria in the Southwestern Gulf of Mexico. The aim of the study illustrated in this perspective was to search for the presence of bacterial pathogens in this ecosystem, using metagenomic data recently generated by the Mexican research group known as the Gulf of Mexico Research Consortium. Several genera of bacteria annotated as pathogens were detected in water and sediment marine samples. As expected, native and ubiquitous pathogenic bacteria genera such as Burkolderia, Halomonas, Pseudomonas, Shewanella and Vibrio were highly represented. Surprisingly, non-native genera of public health concern were also detected, including Borrelia, Ehrlichia, Leptospira, Mycobacterium, Mycoplasma, Salmonella, Staphylococcus, Streptococcus and Treponema. While there are no previous metagenomics studies of this environment, the potential influences of natural, anthropogenic and ecological factors on the diversity of putative pathogenic bacteria found in it are reviewed. The taxonomic annotation herein reported provides a starting point for an improved understanding of bacterial biodiversity in the Southwestern Gulf of Mexico. It also represents a useful tool in public health as it may help identify infectious diseases associated with exposure to marine water and ingestion of fish or shellfish, and thus may be useful in predicting and preventing waterborne disease outbreaks. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Leydet, Brian F; Liang, Fang-Ting
2013-04-01
There are 4 major human-biting tick species in the northeastern United States, which include: Amblyomma americanum, Amblyomma maculatum, Dermacentor variabilis, and Ixodes scapularis. The black bear is a large mammal that has been shown to be parasitized by all the aforementioned ticks. We investigated the bacterial infections in ticks collected from Louisiana black bears (Ursus americanus subspecies luteolus). Eighty-six ticks were collected from 17 black bears in Louisiana from June 2010 to March 2011. All 4 common human-biting tick species were represented. Each tick was subjected to polymerase chain reaction (PCR) targeting select bacterial pathogens and symbionts. Bacterial DNA was detected in 62% of ticks (n=53). Rickettsia parkeri, the causative agent of an emerging spotted fever group rickettsiosis, was identified in 66% of A. maculatum, 28% of D. variabilis, and 11% of I. scapularis. The Lyme disease bacterium, Borrelia burgdorferi, was detected in 2 I. scapularis, while one A. americanum was positive for Borrelia bissettii, a putative human pathogen. The rickettsial endosymbionts Candidatus Rickettsia andeanae, rickettsial endosymbiont of I. scapularis, and Rickettsia amblyommii were detected in their common tick hosts at 21%, 39%, and 60%, respectively. All ticks were PCR-negative for Anaplasma phagocytophilum, Ehrlichia spp., and Babesia microti. This is the first reported detection of R. parkeri in vector ticks in Louisiana; we also report the novel association of R. parkeri with I. scapularis. Detection of both R. parkeri and B. burgdorferi in their respective vectors in Louisiana demands further investigation to determine potential for human exposure to these pathogens. Copyright © 2013 Elsevier GmbH. All rights reserved.
Li, Bing; Ju, Feng; Cai, Lin; Zhang, Tong
2015-09-01
The broad-spectrum profile of bacterial pathogens and their fate in sewage treatment plants (STPs) were investigated using high-throughput sequencing based metagenomic approach. This novel approach could provide a united platform to standardize bacterial pathogen detection and realize direct comparison among different samples. Totally, 113 bacterial pathogen species were detected in eight samples including influent, effluent, activated sludge (AS), biofilm, and anaerobic digestion sludge with the abundances ranging from 0.000095% to 4.89%. Among these 113 bacterial pathogens, 79 species were reported in STPs for the first time. Specially, compared to AS in bulk mixed liquor, more pathogen species and higher total abundance were detected in upper foaming layer of AS. This suggests that the foaming layer of AS might impose more threat to onsite workers and citizens in the surrounding areas of STPs because pathogens in foaming layer are easily transferred into air and cause possible infections. The high removal efficiency (98.0%) of total bacterial pathogens suggests that AS treatment process is effective to remove most bacterial pathogens. Remarkable similarities of bacterial pathogen compositions between influent and human gut indicated that bacterial pathogen profiles in influents could well reflect the average bacterial pathogen communities of urban resident guts within the STP catchment area.
Ranjan, R K; Singh, Dinesh; Baranwal, V K
2016-11-01
Ralstonia solanacearum (Smith) Yabuuchi et al. and Erwinia carotovora subsp. carotovora (Jones) Bergey et al. (Pectobacterium carotovorum subsp. carotovorum) are the two major bacterial pathogens of potato causing brown rot (wilt) and soft rot diseases, respectively, in the field and during storage. Reliable and early detection of these pathogens are keys to avoid occurrence of these diseases in potato crops and reduce yield loss. In the present study, multiplex polymerase chain reaction (PCR) protocol was developed for simultaneous detection of R. solanacearum and E. carotovora subsp. carotovora from potato tubers. A set of oligos targeting the pectatelyase (pel) gene of E. carotovora subsp. carotovora and the universal primers based on 16S r RNA gene of R. solanacearum were used. The standardized multiplex PCR protocol could detect R. solanacearum and E. carotovora subsp. carotovora up to 0.01 and 1.0 ng of genomic DNA, respectively. The protocol was further validated on 96 stored potato tuber samples, collected from different potato-growing states of India, viz. Uttarakhand, Odisha, Meghalaya and Delhi. 53.1 % tuber samples were positive for R. solanacearum, and 15.1 % of samples were positive for E. carotovora subsp. carotovora, and both the pathogens were positive in 26.0 % samples when BIO-PCR was used. This method offers sensitive, specific, reliable and fast detection of two major bacterial pathogens from potato tubers simultaneously, particularly pathogen-free seed certification in large scale.
Jiang, Lu Xi; Ren, Hong Yu; Zhou, Hai Jian; Zhao, Si Hong; Hou, Bo Yan; Yan, Jian Ping; Qin, Tian; Chen, Yu
2017-08-01
Lower respiratory tract infections continue to pose a significant threat to human health. It is important to accurately and rapidly detect respiratory bacteria. To compensate for the limits of current respiratory bacteria detection methods, we developed a combination of multiplex polymerase chain reaction (PCR) and capillary electrophoresis (MPCE) assay to detect thirteen bacterial pathogens responsible for lower respiratory tract infections, including Streptococcus pneumoniae, Haemophilus influenzae, Moraxella catarrhalis, Pseudomonas aeruginosa, Klebsiella pneumoniae, Escherichia coli, Staphylococcus aureus, Mycoplasma pneumoniae, Legionella spp., Bordetella pertussis, Mycobacterium tuberculosis complex, Corynebacterium diphtheriae, and Streptococcus pyogenes. Three multiplex PCR reactions were built, and the products were analyzed by capillary electrophoresis using the high-throughput DNA analyzer. The specificity of the MPCE assay was examined and the detection limit was evaluated using DNA samples from each bacterial strain and the simulative samples of each strain. This assay was further evaluated using 152 clinical specimens and compared with real-time PCR reactions. For this assay, three nested-multiplex-PCRs were used to detect these clinical specimens. The detection limits of the MPCE assay for the 13 pathogens were very low and ranged from 10-7 to 10-2 ng/μL. Furthermore, analysis of the 152 clinical specimens yielded a specificity ranging from 96.5%-100.0%, and a sensitivity of 100.0% for the 13 pathogens. This study revealed that the MPCE assay is a rapid, reliable, and high-throughput method with high specificity and sensitivity. This assay has great potential in the molecular epidemiological survey of respiratory pathogens. Copyright © 2017 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.
Miller, Melissa A; Byrne, Barbara A; Jang, Spencer S; Dodd, Erin M; Dorfmeier, Elene; Harris, Michael D; Ames, Jack; Paradies, David; Worcester, Karen; Jessup, David A; Miller, Woutrina A
2010-01-01
Although protected for nearly a century, California's sea otters have been slow to recover, in part due to exposure to fecally-associated protozoal pathogens like Toxoplasma gondii and Sarcocystis neurona. However, potential impacts from exposure to fecal bacteria have not been systematically explored. Using selective media, we examined feces from live and dead sea otters from California for specific enteric bacterial pathogens (Campylobacter, Salmonella, Clostridium perfringens, C. difficile and Escherichia coli O157:H7), and pathogens endemic to the marine environment (Vibrio cholerae, V. parahaemolyticus and Plesiomonas shigelloides). We evaluated statistical associations between detection of these pathogens in otter feces and demographic or environmental risk factors for otter exposure, and found that dead otters were more likely to test positive for C. perfringens, Campylobacter and V. parahaemolyticus than were live otters. Otters from more urbanized coastlines and areas with high freshwater runoff (near outflows of rivers or streams) were more likely to test positive for one or more of these bacterial pathogens. Other risk factors for bacterial detection in otters included male gender and fecal samples collected during the rainy season when surface runoff is maximal. Similar risk factors were reported in prior studies of pathogen exposure for California otters and their invertebrate prey, suggesting that land-sea transfer and/or facilitation of pathogen survival in degraded coastal marine habitat may be impacting sea otter recovery. Because otters and humans share many of the same foods, our findings may also have implications for human health.
Kaur, Ravinder; Wischmeyer, Jareth; Morris, Matthew; Pichichero, Michael E
2017-11-01
We compared the recovery of potential respiratory bacterial pathogens and normal flora from nasopharyngeal specimens collected from children during health and at the onset of acute otitis media (AOM) by selective direct-plating and overnight broth-enrichment. Overall, 3442 nasal wash (NW) samples collected from young children were analysed from a 10-year prospective study. NWs were cultured by (1) direct-plating to TSAII/5 % sheep blood agar and chocolate agar plates and (2) overnight broth-enrichment in BacT/ALERT SA-broth followed by plating. Standard microbiology techniques were applied to identify three dominant respiratory bacterial pathogens: Streptococcus pneumoniae (Spn), Haemophilus influenzae (Hflu) and Moraxella catarrhalis (Mcat) as well as two common nasal flora, Staphylococcus aureus (SA) and alpha-haemolytic Streptococci (AHS).Results/Key findings. Direct-plating of NW resulted in isolation of Spn from 37.8 %, Hflu from 13.6 % and Mcat from 33.2 % of samples. In comparison, overnight broth-enrichment isolated fewer Spn (30.1 %), Hflu (6.2 %) and Mcat (16.2 %) (Penrichment resulted in significant increased isolation of SA (6.0 %) and AHS (30.1 %) (Penrichment when samples were collected from healthy children but not during AOM. In middle ear fluids (MEF) at the onset of AOM, broth-enrichment resulted in higher recovery of Spn (+10.4 %, Penrichment significantly reduces the accurate detection of bacterial respiratory pathogens and increases identification of SA and AHS in NW. Broth-enrichment improves detection of bacterial respiratory pathogens in MEF samples.
Miller, Melissa A.; Byrne, Barbara A.; Jang, Spencer S.; Dodd, Erin M.; Dorfmeier, Elene; Harris, Michael D.; Ames, Jack; Paradies, David; Worcester, Karen; Jessup, David A.; Miller, Woutrina A.
2009-01-01
Although protected for nearly a century, California’s sea otters have been slow to recover, in part due to exposure to fecally-associated protozoal pathogens like Toxoplasma gondii and Sarcocystis neurona. However, potential impacts from exposure to fecal bacteria have not been systematically explored. Using selective media, we examined feces from live and dead sea otters from California for specific enteric bacterial pathogens (Campylobacter, Salmonella, Clostridium perfringens, C. difficile and Escherichia coli O157:H7), and pathogens endemic to the marine environment (Vibrio cholerae, V. parahaemolyticus and Plesiomonas shigelloides). We evaluated statistical associations between detection of these pathogens in otter feces and demographic or environmental risk factors for otter exposure, and found that dead otters were more likely to test positive for C. perfringens, Campylobacter and V. parahaemolyticus than were live otters. Otters from more urbanized coastlines and areas with high freshwater runoff (near outflows of rivers or streams) were more likely to test positive for one or more of these bacterial pathogens. Other risk factors for bacterial detection in otters included male gender and fecal samples collected during the rainy season when surface runoff is maximal. Similar risk factors were reported in prior studies of pathogen exposure for California otters and their invertebrate prey, suggesting that land-sea transfer and/or facilitation of pathogen survival in degraded coastal marine habitat may be impacting sea otter recovery. Because otters and humans share many of the same foods, our findings may also have implications for human health. PMID:19720009
Bacterial and viral pathogens detected in sea turtles stranded along the coast of Tuscany, Italy.
Fichi, G; Cardeti, G; Cersini, A; Mancusi, C; Guarducci, M; Di Guardo, G; Terracciano, G
2016-03-15
During 2014, six loggerhead turtles, Caretta caretta and one green turtle, Chelonia mydas, found stranded on the Tuscany coast of Italy, were examined for the presence of specific bacterial and viral agents, along with their role as carriers of fish and human pathogens. Thirteen different species of bacteria, 10 Gram negative and 3 Gram positive, were identified. Among them, two strains of Vibrio parahaemolyticus and one strain of Lactococcus garviae were recovered and confirmed by specific PCR protocols. No trh and tdh genes were detected in V. parahaemolyticus. The first isolation of L. garviae and the first detection of Betanodavirus in sea turtles indicate the possibility for sea turtles to act as carriers of fish pathogens. Furthermore, the isolation of two strains of V. parahaemolyticus highlights the possible role of these animals in human pathogens' diffusion. Copyright © 2016 Elsevier B.V. All rights reserved.
Molecular assessment of bacterial pathogens - a contribution to drinking water safety.
Brettar, Ingrid; Höfle, Manfred G
2008-06-01
Human bacterial pathogens are considered as an increasing threat to drinking water supplies worldwide because of the growing demand of high-quality drinking water and the decreasing quality and quantity of available raw water. Moreover, a negative impact of climate change on freshwater resources is expected. Recent advances in molecular detection technologies for bacterial pathogens in drinking water bear the promise in improving the safety of drinking water supplies by precise detection and identification of the pathogens. More importantly, the array of molecular approaches allows understanding details of infection routes of waterborne diseases, the effects of changes in drinking water treatment, and management of freshwater resources.
Ashraf, Aqeela; Imran, Muhammad; Yaqub, Tahir; Tayyab, Muhammad; Shehzad, Wasim; Thomson, Peter C
2017-06-01
For rapid and simultaneous detection of nine bovine mastitic pathogens, a sensitive and specific multiplex PCR assay was developed. The assay was standardized using reference strains and validated on mastitic milk cultures which were identified to species level based on 16S rRNA sequencing. Multiplex PCR assay also efficiently detected the target bacterial strains directly from milk. The detection limit of the assay was up to 50 pg for DNA isolated from pure cultures and 10 4 CFU/ml for spiked milk samples. As estimated by latent class analysis, the assay was sensitive up to 88% and specific up to 98% for targeted mastitic pathogens, compared with the bacterial culture method and the 16S rRNA sequence analysis. This novel molecular assay could be useful for monitoring and maintaining the bovine udder health, ensuring the bacteriological safety of milk, and conducting epidemiological studies. Copyright © 2017 Elsevier Ltd. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Lee, Dae-Young [National Water Research Institute, Environment Canada, 867 Lakeshore Road, Burlington, Ontario, L7R 4A6 (Canada)], E-mail: daeyoung.lee@ec.gc.ca; Lauder, Heather; Cruwys, Heather; Falletta, Patricia [National Water Research Institute, Environment Canada, 867 Lakeshore Road, Burlington, Ontario, L7R 4A6 (Canada); Beaudette, Lee A. [Environmental Science and Technology Centre, Environment Canada, 335 River Road South, Ottawa, Ontario, K1A 0H3 (Canada)], E-mail: lee.beaudette@ec.gc.ca
2008-07-15
Conventional microbial water quality test methods are well known for their technical limitations, such as lack of direct pathogen detection capacity and low throughput capability. The microarray assay has recently emerged as a promising alternative for environmental pathogen monitoring. In this study, bacterial pathogens were detected in municipal wastewater using a microarray equipped with short oligonucleotide probes targeting 16S rRNA sequences. To date, 62 probes have been designed against 38 species, 4 genera, and 1 family of pathogens. The detection sensitivity of the microarray for a waterborne pathogen Aeromonas hydrophila was determined to be approximately 1.0% of the total DNA, or approximately 10{sup 3}A. hydrophila cells per sample. The efficacy of the DNA microarray was verified in a parallel study where pathogen genes and E. coli cells were enumerated using real-time quantitative PCR (qPCR) and standard membrane filter techniques, respectively. The microarray and qPCR successfully detected multiple wastewater pathogen species at different stages of the disinfection process (i.e. secondary effluents vs. disinfected final effluents) and at two treatment plants employing different disinfection methods (i.e. chlorination vs. UV irradiation). This result demonstrates the effectiveness of the DNA microarray as a semi-quantitative, high throughput pathogen monitoring tool for municipal wastewater.
Identifying Pathogenicity Islands in Bacterial Pathogenomics Using Computational Approaches
Directory of Open Access Journals (Sweden)
Dongsheng Che
2014-01-01
Full Text Available High-throughput sequencing technologies have made it possible to study bacteria through analyzing their genome sequences. For instance, comparative genome sequence analyses can reveal the phenomenon such as gene loss, gene gain, or gene exchange in a genome. By analyzing pathogenic bacterial genomes, we can discover that pathogenic genomic regions in many pathogenic bacteria are horizontally transferred from other bacteria, and these regions are also known as pathogenicity islands (PAIs. PAIs have some detectable properties, such as having different genomic signatures than the rest of the host genomes, and containing mobility genes so that they can be integrated into the host genome. In this review, we will discuss various pathogenicity island-associated features and current computational approaches for the identification of PAIs. Existing pathogenicity island databases and related computational resources will also be discussed, so that researchers may find it to be useful for the studies of bacterial evolution and pathogenicity mechanisms.
Biosensors for Whole-Cell Bacterial Detection
Rushworth, Jo V.; Hirst, Natalie A.; Millner, Paul A.
2014-01-01
SUMMARY Bacterial pathogens are important targets for detection and identification in medicine, food safety, public health, and security. Bacterial infection is a common cause of morbidity and mortality worldwide. In spite of the availability of antibiotics, these infections are often misdiagnosed or there is an unacceptable delay in diagnosis. Current methods of bacterial detection rely upon laboratory-based techniques such as cell culture, microscopic analysis, and biochemical assays. These procedures are time-consuming and costly and require specialist equipment and trained users. Portable stand-alone biosensors can facilitate rapid detection and diagnosis at the point of care. Biosensors will be particularly useful where a clear diagnosis informs treatment, in critical illness (e.g., meningitis) or to prevent further disease spread (e.g., in case of food-borne pathogens or sexually transmitted diseases). Detection of bacteria is also becoming increasingly important in antibioterrorism measures (e.g., anthrax detection). In this review, we discuss recent progress in the use of biosensors for the detection of whole bacterial cells for sensitive and earlier identification of bacteria without the need for sample processing. There is a particular focus on electrochemical biosensors, especially impedance-based systems, as these present key advantages in terms of ease of miniaturization, lack of reagents, sensitivity, and low cost. PMID:24982325
Consequences of organ choice in describing bacterial pathogen assemblages in a rodent population.
Villette, P; Afonso, E; Couval, G; Levret, A; Galan, M; Tatard, C; Cosson, J F; Giraudoux, P
2017-10-01
High-throughput sequencing technologies now allow for rapid cost-effective surveys of multiple pathogens in many host species including rodents, but it is currently unclear if the organ chosen for screening influences the number and identity of bacteria detected. We used 16S rRNA amplicon sequencing to identify bacterial pathogens in the heart, liver, lungs, kidneys and spleen of 13 water voles (Arvicola terrestris) collected in Franche-Comté, France. We asked if bacterial pathogen assemblages within organs are similar and if all five organs are necessary to detect all of the bacteria present in an individual animal. We identified 24 bacteria representing 17 genera; average bacterial richness for each organ ranged from 1·5 ± 0·4 (mean ± standard error) to 2·5 ± 0·4 bacteria/organ and did not differ significantly between organs. The average bacterial richness when organ assemblages were pooled within animals was 4·7 ± 0·6 bacteria/animal; Operational Taxonomic Unit accumulation analysis indicates that all five organs are required to obtain this. Organ type influences bacterial assemblage composition in a systematic way (PERMANOVA, 999 permutations, pseudo-F 4,51 = 1·37, P = 0·001). Our results demonstrate that the number of organs sampled influences the ability to detect bacterial pathogens, which can inform sampling decisions in public health and wildlife ecology.
Directory of Open Access Journals (Sweden)
B. Stephen Inbaraj
2016-01-01
Full Text Available Food safety draws considerable attention in the modern pace of the world owing to rapid-changing food recipes and food habits. Foodborne illnesses associated with pathogens, toxins, and other contaminants pose serious threat to human health. Besides, a large amount of money is spent on both analyses and control measures, which causes significant loss to the food industry. Conventional detection methods for bacterial pathogens and toxins are time consuming and laborious, requiring certain sophisticated instruments and trained personnel. In recent years, nanotechnology has emerged as a promising field for solving food safety issues in terms of detecting contaminants, enabling controlled release of preservatives to extend the shelf life of foods, and improving food-packaging strategies. Nanomaterials including metal oxide and metal nanoparticles, carbon nanotubes, and quantum dots are gaining a prominent role in the design of sensors and biosensors for food analysis. In this review, various nanomaterial-based sensors reported in the literature for detection of several foodborne bacterial pathogens and toxins are summarized highlighting their principles, advantages, and limitations in terms of simplicity, sensitivity, and multiplexing capability. In addition, the application through a noncross-linking method without the need for any surface modification is also presented for detection of pork adulteration in meat products.
Directory of Open Access Journals (Sweden)
Chi Zhang
2018-04-01
Full Text Available Pneumonia and meningitis continue to present an enormous public health burden and pose a major threat to young children. Among the causative organisms of pneumonia and meningitis, bacteria are the most common causes of serious disease and deaths. It is challenging to accurately and rapidly identify these agents. To solve this problem, we developed and validated a 12-plex PCR coupled with matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS method (bacterial pathogen-mass spectrometry, BP-MS that can be used to simultaneously screen for 11 key bacterial pathogens related to pneumonia and meningitis. Forty-six nasopharyngeal swabs and 12 isolates were used to determine the specificity of the method. The results showed that, using the BP-MS method, we could accurately identify the expected bacteria without cross-reactivity with other pathogens. For the 11 target bacterial pathogens, the analytical sensitivity of the BP-MS method was as low as 10 copies/reaction. To further evaluate the clinical effectiveness of this method, 204 nasopharyngeal swabs from hospitalized children with suspected pneumonia were tested using this method. In total, 81.9% (167/204 of the samples were positive for at least one of the 11 target pathogens. Among the 167 bacteria-positive samples, the rate of multiple infections was 55.7% (93/167, and the most frequent combination was Streptococcus pneumoniae with Haemophilus influenzae, representing 46.2% (43/93 two-pathogen mixed infections. We used real-time PCR and nested PCR to confirm positive results, with identical results obtained for 81.4% (136/167 of the samples. The BP-MS method is a sensitive and specific molecular detection technique in a multiplex format and with high sample throughput. Therefore, it will be a powerful tool for pathogen screening and antibiotic selection at an early stage of disease.
Genome Assembly and Computational Analysis Pipelines for Bacterial Pathogens
Rangkuti, Farania Gama Ardhina
2011-06-01
Pathogens lie behind the deadliest pandemics in history. To date, AIDS pandemic has resulted in more than 25 million fatal cases, while tuberculosis and malaria annually claim more than 2 million lives. Comparative genomic analyses are needed to gain insights into the molecular mechanisms of pathogens, but the abundance of biological data dictates that such studies cannot be performed without the assistance of computational approaches. This explains the significant need for computational pipelines for genome assembly and analyses. The aim of this research is to develop such pipelines. This work utilizes various bioinformatics approaches to analyze the high-throughput genomic sequence data that has been obtained from several strains of bacterial pathogens. A pipeline has been compiled for quality control for sequencing and assembly, and several protocols have been developed to detect contaminations. Visualization has been generated of genomic data in various formats, in addition to alignment, homology detection and sequence variant detection. We have also implemented a metaheuristic algorithm that significantly improves bacterial genome assemblies compared to other known methods. Experiments on Mycobacterium tuberculosis H37Rv data showed that our method resulted in improvement of N50 value of up to 9697% while consistently maintaining high accuracy, covering around 98% of the published reference genome. Other improvement efforts were also implemented, consisting of iterative local assemblies and iterative correction of contiguated bases. Our result expedites the genomic analysis of virulent genes up to single base pair resolution. It is also applicable to virtually every pathogenic microorganism, propelling further research in the control of and protection from pathogen-associated diseases.
Bacterial reproductive pathogens of cats and dogs.
Graham, Elizabeth M; Taylor, David J
2012-05-01
With the notable exception of Brucella canis, exogenous bacterial pathogens are uncommon causes of reproductive disease in cats and dogs. Most bacterial reproductive infections are endogenous, and predisposing factors for infection are important. This article reviews the etiology, pathogenesis, clinical presentation, diagnosis, treatment, and public health significance of bacterial reproductive pathogens in cats and dogs.
Heme Synthesis and Acquisition in Bacterial Pathogens.
Choby, Jacob E; Skaar, Eric P
2016-08-28
Bacterial pathogens require the iron-containing cofactor heme to cause disease. Heme is essential to the function of hemoproteins, which are involved in energy generation by the electron transport chain, detoxification of host immune effectors, and other processes. During infection, bacterial pathogens must synthesize heme or acquire heme from the host; however, host heme is sequestered in high-affinity hemoproteins. Pathogens have evolved elaborate strategies to acquire heme from host sources, particularly hemoglobin, and both heme acquisition and synthesis are important for pathogenesis. Paradoxically, excess heme is toxic to bacteria and pathogens must rely on heme detoxification strategies. Heme is a key nutrient in the struggle for survival between host and pathogen, and its study has offered significant insight into the molecular mechanisms of bacterial pathogenesis. Copyright © 2016 Elsevier Ltd. All rights reserved.
Plant innate immunity against human bacterial pathogens
Directory of Open Access Journals (Sweden)
Maeli eMelotto
2014-08-01
Full Text Available Certain human bacterial pathogens such as the enterohemorrhagic Escherichia coli and Salmonella enterica are not proven to be plant pathogens yet. Nonetheless, under certain conditions they can survive on, penetrate into, and colonize internal plant tissues causing serious food borne disease outbreaks. In this review, we highlight current understanding on the molecular mechanisms of plant responses against human bacterial pathogens and discuss salient common and contrasting themes of plant interactions with phytopathogens or human pathogens.
Bacterial contamination of platelet concentrates: pathogen detection and inactivation methods
Directory of Open Access Journals (Sweden)
Dana Védy
2009-04-01
Full Text Available Whereas the reduction of transfusion related viral transmission has been a priority during the last decade, bacterial infection transmitted by transfusion still remains associated to a high morbidity and mortality, and constitutes the most frequent infectious risk of transfusion. This problem especially concerns platelet concentrates because of their favorable bacterial growth conditions. This review gives an overview of platelet transfusion-related bacterial contamination as well as on the different strategies to reduce this problem by using either bacterial detection or inactivation methods.
Kaushik, Rajni; Balasubramanian, Rajasekhar
2012-01-01
Bacterial pathogens in airborne particulate matter (PM) and in rainwater (RW) were detected using a robust and sensitive Real-Time PCR method. Both RW and PM were collected simultaneously in the tropical atmosphere of Singapore, which were then subjected to analysis for the presence of selected bacterial pathogens and potential pathogen of health concern ( Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa and Aeromonas hydrophila). These pathogens were found to be prevalent in both PM and RW samples with E. coli being the most prevalent potential pathogen in both types of samples. The temporal distribution of these pathogens in PM and RW was found to be similar to each other. Using the proposed microbiological technique, the atmospheric deposition (dry and wet deposition) of bacterial pathogens to lakes and reservoirs can be studied in view of growing concerns about the outbreak of waterborne diseases.
Photoinactivation of major bacterial pathogens in aquaculture
Directory of Open Access Journals (Sweden)
Heyong Jin Roh
2016-08-01
Full Text Available Abstract Background Significant increases in the bacterial resistance to various antibiotics have been found in fish farms. Non-antibiotic therapies for infectious diseases in aquaculture are needed. In recent years, light-emitting diode technology has been applied to the inactivation of pathogens, especially those affecting humans. The purpose of this study was to assess the effect of blue light (wavelengths 405 and 465 nm on seven major bacterial pathogens that affect fish and shellfish important in aquaculture. Results We successfully demonstrate inactivation activity of a 405/465-nm LED on selected bacterial pathogens. Although some bacteria were not fully inactivated by the 465-nm light, the 405-nm light had a bactericidal effect against all seven pathogens, indicating that blue light can be effective without the addition of a photosensitizer. Photobacterium damselae, Vibrio anguillarum, and Edwardsiella tarda were the most susceptible to the 405-nm light (36.1, 41.2, and 68.4 J cm−2, respectively, produced one log reduction in the bacterial populations, whereas Streptococcus parauberis was the least susceptible (153.8 J cm−2 per one log reduction. In general, optical density (OD values indicated that higher bacterial densities were associated with lower inactivating efficacy, with the exception of P. damselae and Vibrio harveyi. In conclusion, growth of the bacterial fish and shellfish pathogens evaluated in this study was inactivated by exposure to either the 405- or 465-nm light. In addition, inactivation was dependent on exposure time. Conclusions This study presents that blue LED has potentially alternative therapy for treating fish and shellfish bacterial pathogens. It has great advantages in aspect of eco-friendly treating methods differed from antimicrobial methods.
Rundell, Mark S; Pingle, Maneesh; Das, Sanchita; Hussain, Aashiq; Ocheretina, Oksana; Charles, Macarthur; Larone, Davise H; Spitzer, Eric D; Golightly, Linnie; Barany, Francis
2014-06-01
Enteric pathogens that cause gastroenteritis remain a major global health concern. The goal of this study was to develop a multiplex PCR/ligation detection reaction (LDR) assay for the detection of all NIAID category B bacterial food and water-borne pathogens directly from stool specimens. To validate the PCR/LDR assay, clinical isolates of Campylobacter spp., Vibrio spp., Shigella spp., Salmonella spp., Listeria monocytogenes, Yersinia enterocolitica, and diarrheagenic Escherichia coli were tested. The sensitivity and specificity of the assay were assessed using a large number of seeded culture-negative stool specimens and a smaller set of clinical specimens from Haiti. The overall sensitivity ranged from 91% to 100% (median 100%) depending on the species. For the majority of organisms, the sensitivity was 100%. The overall specificity based on initial testing ranged from 98% to 100% depending on the species. After additional testing of discordant samples, the lowest specificity was 99.4%. PCR/LDR detected additional category B agents (particularly diarrheagenic E. coli) in 11/40 specimens from Haiti that were culture-positive for V. cholerae and in approximately 1% of routine culture-negative stool specimens from a hospital in New York. This study demonstrated the ability of the PCR/LDR assay to detect a large comprehensive panel of category B enteric bacterial pathogens as well as mixed infections. This type of assay has the potential to provide earlier warnings of possible public health threats and more accurate surveillance of food and water-borne pathogens. Copyright © 2014 Elsevier Inc. All rights reserved.
Heme Synthesis and Acquisition in Bacterial Pathogens
Choby, Jacob E.; Skaar, Eric P.
2016-01-01
Bacterial pathogens require the iron-containing cofactor heme to cause disease. Heme is essential to the function of hemoproteins, which are involved in energy generation by the electron transport chain, detoxification of host immune effectors, and other processes. During infection, bacterial pathogens must synthesize heme or acquire heme from the host; however, host heme is sequestered in high-affinity hemoproteins. Pathogens have evolved elaborate strategies to acquire heme from host source...
Martins, Patrícia; Cleary, Daniel F R; Pires, Ana C C; Rodrigues, Ana Maria; Quintino, Victor; Calado, Ricardo; Gomes, Newton C M
2013-01-01
The present study combined a DGGE and barcoded 16S rRNA pyrosequencing approach to assess bacterial composition in the water of a recirculating aquaculture system (RAS) with a shallow raceway system (SRS) for turbot (Scophthalmus maximus) and sole (Solea senegalensis). Barcoded pyrosequencing results were also used to determine the potential pathogen load in the RAS studied. Samples were collected from the water supply pipeline (Sup), fish production tanks (Pro), sedimentation filter (Sed), biofilter tank (Bio), and protein skimmer (Ozo; also used as an ozone reaction chamber) of twin RAS operating in parallel (one for each fish species). Our results revealed pronounced differences in bacterial community composition between turbot and sole RAS, suggesting that in the systems studied there is a strong species-specific effect on water bacterial communities. Proteobacteria was the most abundant phylum in the water supply and all RAS compartments. Other important taxonomic groups included the phylum Bacteriodetes. The saltwater supplied displayed a markedly lower richness and appeared to have very little influence on bacterial composition. The following potentially pathogenic species were detected: Photobacterium damselae in turbot (all compartments), Tenacibaculum discolor in turbot and sole (all compartments), Tenacibaculum soleae in turbot (all compartments) and sole (Pro, Sed and Bio), and Serratia marcescens in turbot (Sup, Sed, Bio and Ozo) and sole (only Sed) RAS. Despite the presence of these pathogens, no symptomatic fish were observed. Although we were able to identify potential pathogens, this approach should be employed with caution when monitoring aquaculture systems, as the required phylogenetic resolution for reliable identification of pathogens may not always be possible to achieve when employing 16S rRNA gene fragments.
Directory of Open Access Journals (Sweden)
Patrícia Martins
Full Text Available The present study combined a DGGE and barcoded 16S rRNA pyrosequencing approach to assess bacterial composition in the water of a recirculating aquaculture system (RAS with a shallow raceway system (SRS for turbot (Scophthalmus maximus and sole (Solea senegalensis. Barcoded pyrosequencing results were also used to determine the potential pathogen load in the RAS studied. Samples were collected from the water supply pipeline (Sup, fish production tanks (Pro, sedimentation filter (Sed, biofilter tank (Bio, and protein skimmer (Ozo; also used as an ozone reaction chamber of twin RAS operating in parallel (one for each fish species. Our results revealed pronounced differences in bacterial community composition between turbot and sole RAS, suggesting that in the systems studied there is a strong species-specific effect on water bacterial communities. Proteobacteria was the most abundant phylum in the water supply and all RAS compartments. Other important taxonomic groups included the phylum Bacteriodetes. The saltwater supplied displayed a markedly lower richness and appeared to have very little influence on bacterial composition. The following potentially pathogenic species were detected: Photobacterium damselae in turbot (all compartments, Tenacibaculum discolor in turbot and sole (all compartments, Tenacibaculum soleae in turbot (all compartments and sole (Pro, Sed and Bio, and Serratia marcescens in turbot (Sup, Sed, Bio and Ozo and sole (only Sed RAS. Despite the presence of these pathogens, no symptomatic fish were observed. Although we were able to identify potential pathogens, this approach should be employed with caution when monitoring aquaculture systems, as the required phylogenetic resolution for reliable identification of pathogens may not always be possible to achieve when employing 16S rRNA gene fragments.
Directory of Open Access Journals (Sweden)
Owen Higgins
2018-02-01
Full Text Available Bacterial meningitis infection is a leading global health concern for which rapid and accurate diagnosis is essential to reduce associated morbidity and mortality. Loop-mediated isothermal amplification (LAMP offers an effective low-cost diagnostic approach; however, multiplex LAMP is difficult to achieve, limiting its application. We have developed novel real-time multiplex LAMP technology, TEC-LAMP, using Tth endonuclease IV and a unique LAMP primer/probe. This study evaluates the analytical specificity, limit of detection (LOD and clinical application of an internally controlled multiplex TEC-LAMP assay for detection of leading bacterial meningitis pathogens: Streptococcus pneumoniae, Neisseria meningitidis and Haemophilus influenzae. Analytical specificities were established by testing 168 bacterial strains, and LODs were determined using Probit analysis. The TEC-LAMP assay was 100% specific, with LODs for S. pneumoniae, N. meningitidis and H. influenzae of 39.5, 17.3 and 25.9 genome copies per reaction, respectively. Clinical performance was evaluated by testing 65 archived PCR-positive samples. Compared to singleplex real-time PCR, the multiplex TEC-LAMP assay demonstrated diagnostic sensitivity and specificity of 92.3% and 100%, respectively. This is the first report of a single-tube internally controlled multiplex LAMP assay for bacterial meningitis pathogen detection, and the first report of Tth endonuclease IV incorporation into nucleic acid amplification diagnostic technology.
Clancy, Eoin; Cormican, Martin; Boo, Teck Wee; Cunney, Robert
2018-01-01
Bacterial meningitis infection is a leading global health concern for which rapid and accurate diagnosis is essential to reduce associated morbidity and mortality. Loop-mediated isothermal amplification (LAMP) offers an effective low-cost diagnostic approach; however, multiplex LAMP is difficult to achieve, limiting its application. We have developed novel real-time multiplex LAMP technology, TEC-LAMP, using Tth endonuclease IV and a unique LAMP primer/probe. This study evaluates the analytical specificity, limit of detection (LOD) and clinical application of an internally controlled multiplex TEC-LAMP assay for detection of leading bacterial meningitis pathogens: Streptococcus pneumoniae, Neisseria meningitidis and Haemophilus influenzae. Analytical specificities were established by testing 168 bacterial strains, and LODs were determined using Probit analysis. The TEC-LAMP assay was 100% specific, with LODs for S. pneumoniae, N. meningitidis and H. influenzae of 39.5, 17.3 and 25.9 genome copies per reaction, respectively. Clinical performance was evaluated by testing 65 archived PCR-positive samples. Compared to singleplex real-time PCR, the multiplex TEC-LAMP assay demonstrated diagnostic sensitivity and specificity of 92.3% and 100%, respectively. This is the first report of a single-tube internally controlled multiplex LAMP assay for bacterial meningitis pathogen detection, and the first report of Tth endonuclease IV incorporation into nucleic acid amplification diagnostic technology. PMID:29425124
International Nuclear Information System (INIS)
Decho, Alan W; Beckman, Erin M; Chandler, G Thomas; Kawaguchi, Tomohiro
2008-01-01
An indirect immunofluorescence approach was developed using semiconductor quantum dot nanocrystals to label and detect a specific bacterial serotype of the bacterial human pathogen Vibrio parahaemolyticus, attached to small marine animals (i.e. benthic harpacticoid copepods), which are suspected pathogen carriers. This photostable labeling method using nanotechnology will potentially allow specific serotypes of other bacterial pathogens to be detected with high sensitivity in a range of systems, and can be easily applied for sensitive detection to other Vibrio species such as Vibrio cholerae
Microfluidic devices for sample preparation and rapid detection of foodborne pathogens.
Kant, Krishna; Shahbazi, Mohammad-Ali; Dave, Vivek Priy; Ngo, Tien Anh; Chidambara, Vinayaka Aaydha; Than, Linh Quyen; Bang, Dang Duong; Wolff, Anders
2018-03-10
Rapid detection of foodborne pathogens at an early stage is imperative for preventing the outbreak of foodborne diseases, known as serious threats to human health. Conventional bacterial culturing methods for foodborne pathogen detection are time consuming, laborious, and with poor pathogen diagnosis competences. This has prompted researchers to call the current status of detection approaches into question and leverage new technologies for superior pathogen sensing outcomes. Novel strategies mainly rely on incorporating all the steps from sample preparation to detection in miniaturized devices for online monitoring of pathogens with high accuracy and sensitivity in a time-saving and cost effective manner. Lab on chip is a blooming area in diagnosis, which exploits different mechanical and biological techniques to detect very low concentrations of pathogens in food samples. This is achieved through streamlining the sample handling and concentrating procedures, which will subsequently reduce human errors and enhance the accuracy of the sensing methods. Integration of sample preparation techniques into these devices can effectively minimize the impact of complex food matrix on pathogen diagnosis and improve the limit of detections. Integration of pathogen capturing bio-receptors on microfluidic devices is a crucial step, which can facilitate recognition abilities in harsh chemical and physical conditions, offering a great commercial benefit to the food-manufacturing sector. This article reviews recent advances in current state-of-the-art of sample preparation and concentration from food matrices with focus on bacterial capturing methods and sensing technologies, along with their advantages and limitations when integrated into microfluidic devices for online rapid detection of pathogens in foods and food production line. Copyright © 2018. Published by Elsevier Inc.
Energy Technology Data Exchange (ETDEWEB)
Kingsley, Mark T.
2001-03-13
The threat to American interests from terrorists is not limited to attacks against humans. Terrorists might seek to inflict damage to the U.S. economy by attacking our agricultural sector. Infection of commodity crops by bacterial or fungal crop pathogens could adversely impact U.S. agriculture, either directly from damage to crops or indirectly from damage to our ability to export crops suspected of contamination. Recognizing a terrorist attack against U.S. agriculture, to be able to prosecute the terrorists, is among the responsibilities of the members of Hazardous Material Response Unit (HMRU) of the Federal Bureau of Investigation (FBI). Nucleic acid analysis of plant pathogen strains by the use of polymerase chain reaction (PCR) amplification techniques is a powerful method for determining the exact identity of pathogens, as well as their possible region of origin. This type of analysis, however, requires that PCR assays be developed specific to each particular pathogen strain, and analysis protocols developed that are specific to the particular instrument used for detection. The objectives of the work described here were threefold: 1) to assess the potential terrorist threat to U.S. agricultural crops, 2) to determine whether suitable assays exist to monitor that threat, and 3) where assays are needed for priority plant pathogen threats, to modify or develop those assays for use by specialists at the HMRU. The assessment of potential threat to U.S. commodity crops and the availability of assays for those threats were described in detail in the Technical Requirements Document (9) and will be summarized in this report. This report addresses development of specific assays identified in the Technical Requirements Document, and offers recommendations for future development to ensure that HMRU specialists will be prepared with the PCR assays they need to protect against the threat of economic terrorism.
Cytosolic Access of Intracellular Bacterial Pathogens: The Shigella Paradigm.
Mellouk, Nora; Enninga, Jost
2016-01-01
Shigella is a Gram-negative bacterial pathogen, which causes bacillary dysentery in humans. A crucial step of Shigella infection is its invasion of epithelial cells. Using a type III secretion system, Shigella injects several bacterial effectors ultimately leading to bacterial internalization within a vacuole. Then, Shigella escapes rapidly from the vacuole, it replicates within the cytosol and spreads from cell-to-cell. The molecular mechanism of vacuolar rupture used by Shigella has been studied in some detail during the recent years and new paradigms are emerging about the underlying molecular events. For decades, bacterial effector proteins were portrayed as main actors inducing vacuolar rupture. This includes the effector/translocators IpaB and IpaC. More recently, this has been challenged and an implication of the host cell in the process of vacuolar rupture has been put forward. This includes the bacterial subversion of host trafficking regulators, such as the Rab GTPase Rab11. The involvement of the host in determining bacterial vacuolar integrity has also been found for other bacterial pathogens, particularly for Salmonella. Here, we will discuss our current view of host factor and pathogen effector implications during Shigella vacuolar rupture and the steps leading to it.
Fluorescence immunoassay for detecting periodontal bacterial pathogens in plaque.
Wolff, L F; Anderson, L; Sandberg, G P; Aeppli, D M; Shelburne, C E
1991-01-01
A particle concentration fluorescence immunoassay has been modified into a bacterial concentration fluorescence immunoassay (BCFIA) to rapidly detect periodontopathic bacteria in human plaque samples. The BCFIA utilizes fluorescently tagged monoclonal antibodies (MAbs) directed against the lipopolysaccharide of selected gram-negative plaque bacteria. Microorganisms closely associated with periodontal disease that can be identified in plaque with the BCFIA include Porphyromonas gingivalis, Bac...
Detection of mastitis pathogens by analysis of volatile bacterial metabolites
Hettinga, K.A.; Valenberg, van H.J.F.; Lam, T.J.G.M.; Hooijdonk, van A.C.M.
2008-01-01
The ability to detect mastitis pathogens based on their volatile metabolites was studied. Milk samples from cows with clinical mastitis, caused by Staphylococcus aureus, coagulase-negative staphylococci, Streptococcus uberis, Streptococcus dysgalactiae, and Escherichia coli were collected. In
Fluorescence techniques to detect and to assess viability of plant pathogenic bacteria
Chitarra, L.G.
2001-01-01
Plant pathogenic bacteria cause major economic losses in commercial crop production worldwide every year. The current methods used to detect and to assess the viability of bacterial pathogens and to test seed lots or plants for contamination are usually based on plate assays or on
Cytosolic access of intracellular bacterial pathogens: the Shigella paradigm
Directory of Open Access Journals (Sweden)
Nora eMellouk
2016-04-01
Full Text Available Shigella is a Gram-negative bacterial pathogen, which causes bacillary dysentery in humans. A crucial step of Shigella infection is its invasion of epithelial cells. Using a type III secretion system, Shigella injects several bacterial effectors ultimately leading to bacterial internalization within a vacuole. Then, Shigella escapes rapidly from the vacuole, it replicates within the cytosol and spreads from cell-to-cell. The molecular mechanism of vacuolar rupture used by Shigella has been studied in some detail during the recent years and new paradigms are emerging about the underlying molecular events. For decades, bacterial effector proteins were portrayed as main actors inducing vacuolar rupture. This includes the effector/translocators IpaB and IpaC. More recently, this has been challenged and an implication of the host cell in the process of vacuolar rupture has been put forward. This includes the bacterial subversion of host trafficking regulators, such as the Rab GTPase Rab11. The involvement of the host in determining bacterial vacuolar integrity has also been found for other bacterial pathogens, particularly for Salmonella. Here, we will discuss our current view of host factor and pathogen effector implications during Shigella vacuolar rupture and the steps leading to it.
Molecular mechanisms of cell-cell spread of intracellular bacterial pathogens.
Ireton, Keith
2013-07-17
Several bacterial pathogens, including Listeria monocytogenes, Shigella flexneri and Rickettsia spp., have evolved mechanisms to actively spread within human tissues. Spreading is initiated by the pathogen-induced recruitment of host filamentous (F)-actin. F-actin forms a tail behind the microbe, propelling it through the cytoplasm. The motile pathogen then encounters the host plasma membrane, forming a bacterium-containing protrusion that is engulfed by an adjacent cell. Over the past two decades, much progress has been made in elucidating mechanisms of F-actin tail formation. Listeria and Shigella produce tails of branched actin filaments by subverting the host Arp2/3 complex. By contrast, Rickettsia forms tails with linear actin filaments through a bacterial mimic of eukaryotic formins. Compared with F-actin tail formation, mechanisms controlling bacterial protrusions are less well understood. However, recent findings have highlighted the importance of pathogen manipulation of host cell-cell junctions in spread. Listeria produces a soluble protein that enhances bacterial protrusions by perturbing tight junctions. Shigella protrusions are engulfed through a clathrin-mediated pathway at 'tricellular junctions'--specialized membrane regions at the intersection of three epithelial cells. This review summarizes key past findings in pathogen spread, and focuses on recent developments in actin-based motility and the formation and internalization of bacterial protrusions.
Microfluidic devices for sample preparation and rapid detection of foodborne pathogens
DEFF Research Database (Denmark)
Kant, Krishna; Shahbazi, Mohammad-Ali; Dave, Vivek Priy
2018-01-01
and improve the limit of detections. Integration of pathogen capturing bio-receptors on microfluidic devices is a crucial step, which can facilitate recognition abilities in harsh chemical and physical conditions, offering a great commercial benefit to the food-manufacturing sector. This article reviews...... diagnosis competences. This has prompted researchers to call the current status of detection approaches into question and leverage new technologies for superior pathogen sensing outcomes. Novel strategies mainly rely on incorporating all the steps from sample preparation to detection in miniaturized devices...... recent advances in current state-of-the-art of sample preparation and concentration from food matrices with focus on bacterial capturing methods and sensing technologies, along with their advantages and limitations when integrated into microfluidic devices for online rapid detection of pathogens in foods...
Models of Caenorhabditis elegans infection by bacterial and fungal pathogens.
Powell, Jennifer R; Ausubel, Frederick M
2008-01-01
The nematode Caenorhabditis elegans is a simple model host for studying the relationship between the animal innate immune system and a variety of bacterial and fungal pathogens. Extensive genetic and molecular tools are available in C. elegans, facilitating an in-depth analysis of host defense factors and pathogen virulence factors. Many of these factors are conserved in insects and mammals, indicating the relevance of the nematode model to the vertebrate innate immune response. Here, we describe pathogen assays for a selection of the most commonly studied bacterial and fungal pathogens using the C. elegans model system.
Lin, Qun; Xu, Pusheng; Li, Jiaowu; Chen, Yin; Feng, Jieyi
2017-08-01
Loop-mediated isothermal amplification based detection assays using bacterial culture or colony for direct detection of methicillin resistant Staphylococcus aureus(MRSA) had been developed and evaluated, followed by its extensive application on a large scale of clinical MRSA isolated from respiratory origins, including nasal swabs and sputums. Six primers, including outer primers, inner primers and loop primers, were specifically designed for recognizing eight distinct sequences on four targets: 16SrRNA, femA, mecA and orfX. Twenty-seven reference strains were used to develop, evaluate and optimize this assay. Then, a total of 532 clinical MRSA isolates were employed for each detected targets. And the results were determined through both visual observation of the color change by naked eye and electrophoresis. The specific of each primer had been confirmed, and the optimal amplification was obtained under 65 °C for 40 min. The limit of detections (LOD) of bacteria culture LAMP assays were determined to be 10 4 CFU/ml for 16S rRNA, femA, as well as orfX and 10 5 CFU/ml for mecA, respectively. The established novel assays on MRSA detection may provide new strategies for rapid detection of foodborne pathogens. Copyright © 2017. Published by Elsevier Ltd.
Bacterial genome engineering and synthetic biology: combating pathogens.
Krishnamurthy, Malathy; Moore, Richard T; Rajamani, Sathish; Panchal, Rekha G
2016-11-04
The emergence and prevalence of multidrug resistant (MDR) pathogenic bacteria poses a serious threat to human and animal health globally. Nosocomial infections and common ailments such as pneumonia, wound, urinary tract, and bloodstream infections are becoming more challenging to treat due to the rapid spread of MDR pathogenic bacteria. According to recent reports by the World Health Organization (WHO) and Centers for Disease Control and Prevention (CDC), there is an unprecedented increase in the occurrence of MDR infections worldwide. The rise in these infections has generated an economic strain worldwide, prompting the WHO to endorse a global action plan to improve awareness and understanding of antimicrobial resistance. This health crisis necessitates an immediate action to target the underlying mechanisms of drug resistance in bacteria. The advent of new bacterial genome engineering and synthetic biology (SB) tools is providing promising diagnostic and treatment plans to monitor and treat widespread recalcitrant bacterial infections. Key advances in genetic engineering approaches can successfully aid in targeting and editing pathogenic bacterial genomes for understanding and mitigating drug resistance mechanisms. In this review, we discuss the application of specific genome engineering and SB methods such as recombineering, clustered regularly interspaced short palindromic repeats (CRISPR), and bacterial cell-cell signaling mechanisms for pathogen targeting. The utility of these tools in developing antibacterial strategies such as novel antibiotic production, phage therapy, diagnostics and vaccine production to name a few, are also highlighted. The prevalent use of antibiotics and the spread of MDR bacteria raise the prospect of a post-antibiotic era, which underscores the need for developing novel therapeutics to target MDR pathogens. The development of enabling SB technologies offers promising solutions to deliver safe and effective antibacterial therapies.
Kawai, Kazuhiro; Inada, Mika; Ito, Keiko; Hashimoto, Koji; Nikaido, Masaru; Hata, Eiji; Katsuda, Ken; Kiku, Yoshio; Tagawa, Yuichi; Hayashi, Tomohito
2017-12-22
Bovine mastitis causes significant economic losses in the dairy industry. Effective prevention of bovine mastitis requires an understanding of the infection status of a pathogenic microorganism in a herd that has not yet shown clinical signs of mastitis and appropriate treatment specific for the pathogenic microorganism. However, bacterial identification by culture has drawbacks in that the sensitivity may be low and the procedure can be complex. In this study, we developed a genetic detection method to identify mastitis pathogens using a simple and highly sensitive electrochemical DNA chip which can specifically detect bacterial DNA in milk specimens. First, we selected microorganisms belonging to 12 families and/or genera associated with mastitis for which testing should be performed. Next, we optimized the conditions for amplifying microorganism DNA by loop-mediated isothermal amplification (LAMP) using 32 primers and the use of a DNA chip capable of measuring all pathogens simultaneously. Sample detection could be completed in just a few hours using this method. Comparison of the results obtained with our DNA chip method and those obtained by bacterial culture verified that when the culture method was set to 100%, the total positive concordance rate of the DNA chip was 85.0% and the total negative concordance rate was 86.9%. Furthermore, the proposed method allows both rapid and highly sensitive detection of mastitis pathogens. We believe that this method will contribute to the development of an effective mastitis control program.
Haack, Sheridan K.; Duris, Joseph W.
2013-01-01
Little information exists on the co-occurrence of fecal indicator bacteria (FIB), bacterial pathogens, and organic wastewater-associated chemicals (OWCs) within Great Lakes tributaries. Fifteen watershed sites and one beach site adjacent to the Little Calumet River–Portage Burns Waterway (LCRPBW) on Lake Michigan were tested on four dates for pH, dissolved oxygen, specific conductance, chloride, color, ammonia- and nitrate-nitrogen, soluble phosphorus, sulfate, turbidity, and atrazine; for concentrations of FIB; and for genes indicating the presence of human-pathogenic enterococci (ENT) and of Shiga-toxin producing Escherichia coli (EC) from various animal sources. Nineteen samples were also tested for 60 OWCs. Half of the watershed samples met EC recreational water quality standards; none met ENT standards. Human-wastewater-associated OWC detections were correlated with human-influence indicators such as population/km2, chloride concentrations, and the presence of WWTP effluents, but EC and ENT concentrations were not. Bacterial pathogen genes indicated rural human and several potential animal sources. OWCs of human or ecosystem health concern (musk fragrances AHTN and HHCB, alkylphenols, carbamazepine) and 3 bacterial pathogen genes were detected at the mouth of the LCRPBW, but no such OWCs and only 1 pathogen gene were detected at the beach. The LCRPBW has significant potential to deliver FIB, potential bacterial pathogens, and OWCs of human or ecosystem health concern to the nearshore of Lake Michigan, under conditions enhancing nearshore transport of the river plume. Nearshore mixing of lake and river water, and the lack of relationship between OWCs and FIB or pathogen genes, pose numerous challenges for watershed and nearshore assessment and remediation.
Grossi , Marco; Riccò , Bruno; Parolin , Carola; Vitali , Beatrice
2017-01-01
International audience; The detection of bacterial concentration is important in different fields since high microbial contamination or the presence of particular pathogens can seriously endanger human health. The reference technique to measure bacterial concentration is Standard Plate Count (SPC) that, however, has long response times (24 to 72 hours) and is not suitable for automatic implementation. This paper presents a portable embedded system for bacterial concentration measurement based...
Bacterial food-borne pathogens in Indian food
International Nuclear Information System (INIS)
Bandekar, J.R.
2015-01-01
Food technology and food processing techniques have made tremendous advances in preservation of food and ensuring safety of food by killing food-borne pathogens. In addition to old techniques such as pasteurization, canning, dehydration, fermentation and salting, a number of new techniques such as radiation processing, high pressure technology and pulsed electric field technology are being applied for preservation of food and to ensure food safety. Total Quality Management (TQM) concepts have been developed to take care of food safety from farm to table. Hazard Analysis at Critical Control Points (HACCP) is being applied for mass scale production of food to make food free from pathogens. Despite these advances, food-borne diseases have become one of the most widespread public health problems in the world. About two thirds of all the outbreaks are traced to microbial contaminated food. According to World Health Organization (WHO) estimates, food-borne and waterborne diarrhoeal diseases kill an estimated 2 million people annually, including many children. Food safety is a major concern not only for developing countries but also for the developed countries. A number of factors such as emergence of new food-borne pathogens, development of drug resistance in pathogens, changing life style, globalization of the food supply etc. are responsible for the continuous persistence of food-borne diseases. The food-borne disease outbreaks due to E. coli O157:H7, Listeria monocytogenes, Salmonella and Campylobacter, are responsible for recall of many foods resulting in heavy losses to food industry. Due to consumer demand, a number of Ready-To-Eat (RTE) minimally processed foods are increasingly marketed; however, there is increased risk of foodborne diseases with these products. Food Technology Division of Bhabha Atomic Research Centre, Mumbai, has been working on food-borne bacterial pathogens particularly Salmonella, Campylobacter, Listeria monocytogenes, Vibrio and Aeromonasf
Directory of Open Access Journals (Sweden)
Muhammad H. Rasool
2016-03-01
Full Text Available Objective: To determine the occurrence of bacterial pathogens responsible for diarrhea and to engender information regarding the effectiveness of commonly used antibiotic against diarrhea. Methods: This cross-sectional study was conducted between April and July 2014. Samples were collected from the Divisional Headquarter and Allied Hospital, Faisalabad, Pakistan. The differential and selective media were used to isolate bacterial pathogens, which were identified through cultural characteristics, microscopy, and biochemical tests. Disc diffusion assay was carried out using Muller Hinton agar medium, and minimum inhibitory concentration was determined using broth dilution method against isolated pathogens. Results: One hundred and forty-one (100% samples were positive for some bacteria. Frequency of occurrence was Bacillus cereus (B. cereus (66%, Escherichia coli (E. coli (48.5%, Salmonella typhi (S. Typhi (27.7%, Pseudomonas aeruginosa (P. aeruginosa (8.5%, and Staphylococcus aureus (S. aureus (4.3%. Single pathogen was detected in 20 (14.2% samples whereas combinations were found in 121 (85.8% samples. Bacillus cereus and E. coli were the most frequently detected pathogens followed by the S. Typhi, P. aeruginosa, and Staph. aureus. The percentage occurrence of isolated pathogens was 31% in B. cereus, 31% in E. coli, 18% in S. Typhi, 5% in P. aeruginosa, and 3% in Staph. aureus. Conclusion: Pseudomonas aeruginosa showed resistance against Amoxicillin and Cefotaxime, whereas S. aureus was found resistant against Cefotaxime. Statistical analysis using one way Analysis of Variance revealed that Ofloxacin and Gentamicin had significant (p<0.05 differences against all isolates as compared with other antibiotics used in this study.
Rasool, Muhammad H; Siddique, Abu B; Saqalein, Muhammad; Asghar, Muhammad J; Zahoor, Muhammad A; Aslam, Bilal; Shafiq, Humerah B; Nisar, Muhammad A
2016-03-01
To determine the occurrence of bacterial pathogens responsible for diarrhea and to engender information regarding the effectiveness of commonly used antibiotic against diarrhea. This cross-sectional study was conducted between April and July 2014. Samples were collected from the Divisional Headquarter and Allied Hospital, Faisalabad, Pakistan. The differential and selective media were used to isolate bacterial pathogens, which were identified through cultural characteristics, microscopy, and biochemical tests. Disc diffusion assay was carried out using Muller Hinton agar medium, and minimum inhibitory concentration was determined using broth dilution method against isolated pathogens. One hundred and forty-one (100%) samples were positive for some bacteria. Frequency of occurrence was Bacillus cereus (B. cereus) (66%), Escherichia coli (E.coli) (48.5%), Salmonella typhi (S. Typhi) (27.7%), Pseudomonas aeruginosa (P. aeruginosa) (8.5%), and Staphylococcus aureus (S. aureus) (4.3%). Single pathogen was detected in 20 (14.2%) samples whereas combinations were found in 121 (85.8%) samples. Bacillus cereus and E.coli were the most frequently detected pathogens followed by the S. Typhi, P. aeruginosa, and Staph. aureus. The percentage occurrence of isolated pathogens was 31% in B. cereus, 31% in E. coli, 18% in S. Typhi, 5% in P. aeruginosa, and 3% in Staph. aureus. Pseudomonas aeruginosa showed resistance against Amoxicillin and Cefotaxime, whereas S. aureus was found resistant against Cefotaxime. Statistical analysis using one way Analysis of Variance revealed that Ofloxacin and Gentamicin had significant (p less than 0.05) differences against all isolates as compared with other antibiotics used in this study.
Directory of Open Access Journals (Sweden)
In Jeong Kang
2016-12-01
Full Text Available Burkholderia glumae (bacterial grain rot, Xanthomonas oryzae pv. oryzae (bacterial leaf blight, and Acidovorax avenae subsp. avenae (bacterial brown stripe are major seedborne pathogens of rice. Based on the 16S and 23S rDNA sequences for A. avenae subsp. avenae and B. glumae, and transposase A gene sequence for X. oryzae pv. oryzae, three sets of primers had been designed to produce 402 bp for B. glumae, 490 bp for X. oryzae, and 290 bp for A. avenae subsp. avenae with the 63°C as an optimum annealing temperature. Samples collected from naturally infected fields were detected with two bacteria, B. glumae and A. avenae subsp. avenae but X. oryzae pv. oryzae was not detected. This assay can be used to identify pathogens directly from infected seeds, and will be an effective tool for the identification of the three pathogens in rice plants.
Kang, In Jeong; Kang, Mi-Hyung; Noh, Tae-Hwan; Shim, Hyeong Kwon; Shin, Dong Bum; Heu, Suggi
2016-12-01
Burkholderia glumae (bacterial grain rot), Xanthomonas oryzae pv. oryzae (bacterial leaf blight), and Acidovorax avenae subsp. avenae (bacterial brown stripe) are major seedborne pathogens of rice. Based on the 16S and 23S rDNA sequences for A. avenae subsp. avenae and B. glumae , and transposase A gene sequence for X. oryzae pv. oryzae , three sets of primers had been designed to produce 402 bp for B. glumae , 490 bp for X. oryzae , and 290 bp for A. avenae subsp. avenae with the 63°C as an optimum annealing temperature. Samples collected from naturally infected fields were detected with two bacteria, B. glumae and A. avenae subsp. avenae but X. oryzae pv. oryzae was not detected. This assay can be used to identify pathogens directly from infected seeds, and will be an effective tool for the identification of the three pathogens in rice plants.
Higgins, Owen; Clancy, Eoin; Forrest, Matthew S; Piepenburg, Olaf; Cormican, Martin; Boo, Teck Wee; O'Sullivan, Nicola; McGuinness, Claire; Cafferty, Deirdre; Cunney, Robert; Smith, Terry J
2018-04-01
Recombinase polymerase amplification (RPA) is an isothermal nucleic acid amplification technology that provides rapid and robust infectious disease pathogen detection, ideal for point-of-care (POC) diagnostics in disease-prevalent low-resource countries. We have developed and evaluated three duplex RPA assays incorporating competitive internal controls for the detection of leading bacterial meningitis pathogens. Streptococcus pneumoniae, Neisseria meningitidis and Haemophilus influenzae singleplex RPA assays were initially developed and evaluated, demonstrating 100% specificity with limits of detection of 4.1, 8.5 and 3.9 genome copies per reaction, respectively. Each assay was further developed into internally controlled duplex RPA assays via the incorporation of internal amplification control templates. Clinical performance of each internally controlled duplex RPA assay was evaluated by testing 64 archived PCR-positive clinical samples. Compared to real-time PCR, all duplex RPA assays demonstrated 100% diagnostic specificity, with diagnostic sensitivities of 100%, 86.3% and 100% for the S. pneumoniae, N. meningitidis and H. influenzae assays, respectively. This study details the first report of internally controlled duplex RPA assays for the detection of bacterial meningitis pathogens: S. pneumoniae, N. meningitidis and H. influenzae. We have successfully demonstrated the clinical diagnostic utility of each duplex RPA assay, introducing effective diagnostic technology for POC bacterial meningitis identification in disease-prevalent developing countries. Copyright © 2018 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Ville-Petri Friman
2011-03-01
Full Text Available The coincidental evolution hypothesis predicts that traits connected to bacterial pathogenicity could be indirectly selected outside the host as a correlated response to abiotic environmental conditions or different biotic species interactions. To investigate this, an opportunistic bacterial pathogen, Serratia marcescens, was cultured in the absence and presence of the lytic bacteriophage PPV (Podoviridae at 25°C and 37°C for four weeks (N = 5. At the end, we measured changes in bacterial phage-resistance and potential virulence traits, and determined the pathogenicity of all bacterial selection lines in the Parasemia plantaginis insect model in vivo. Selection at 37°C increased bacterial motility and pathogenicity but only in the absence of phages. Exposure to phages increased the phage-resistance of bacteria, and this was costly in terms of decreased maximum population size in the absence of phages. However, this small-magnitude growth cost was not greater with bacteria that had evolved in high temperature regime, and no trade-off was found between phage-resistance and growth rate. As a result, phages constrained the evolution of a temperature-mediated increase in bacterial pathogenicity presumably by preferably infecting the highly motile and virulent bacteria. In more general perspective, our results suggest that the traits connected to bacterial pathogenicity could be indirectly selected as a correlated response by abiotic and biotic factors in environmental reservoirs.
Luo, Gang; Angelidaki, Irini
2014-09-01
The present study investigated the changes of bacterial community composition including bacterial pathogens along a biogas plant, i.e. from the influent, to the biogas reactor and to the post-digester. The effects of post-digestion temperature and time on the changes of bacterial community composition and bacterial pathogens were also studied. Microbial analysis was made by Ion Torrent sequencing of the PCR amplicons from ethidium monoazide treated samples, and ethidium monoazide was used to cleave DNA from dead cells and exclude it from PCR amplification. Both similarity and taxonomic analysis showed that the bacterial community composition in the influent was changed after anaerobic digestion. Firmicutes were dominant in all the samples, while Proteobacteria decreased in the biogas reactor compared with the influent. Variations of bacterial community composition in the biogas reactor with time were also observed. This could be attributed to varying composition of the influent. Batch experiments showed that the methane recovery from the digested residues (obtained from biogas reactor) was mainly related with post-digestion temperature. However, post-digestion time rather than temperature had a significant effect on the changes of bacterial community composition. The changes of bacterial community composition were also reflected in the changes of relative abundance of bacterial pathogens. The richness and relative abundance of bacterial pathogens were reduced after anaerobic digestion in the biogas reactor. It was found in batch experiments that bacterial pathogens showed the highest relative abundance and richness after 30 days' post-digestion. Streptococcus bovis was found in all the samples. Our results showed that special attention should be paid to the post-digestion since the increase in relative abundance of bacterial pathogens after post-digestion might reflect regrowth of bacterial pathogens and limit biosolids disposal vectors. Copyright © 2014 Elsevier
COMPARATIVE ACTIVITY OF CECROPIN A AND POLYMYXIN B AGAINST FROG BACTERIAL PATHOGENS
Directory of Open Access Journals (Sweden)
Ermin Schadich
2013-03-01
Full Text Available The antimicrobial activity of two antimicrobial peptides, cecropin A and polymyxin B against different bacterial pathogens associated with bacterial dermatosepticemia, a fatal bacterial infectious disease of frogs was investigated. The peptides were tested in serial of concentrations (100-0.19 µg/ml for growth inhibition of seven pathogens: Aeromonas hydrophila, Chryseobacterium meningosepticum, Citrobacter freundii, Klebsiella pneumoniae, Pseudomonas aeruginosa, Proteus mirabilis and Serratia liquefaciens. Their antimicrobial activity was compared with that of two antimicrobial peptides from frog skin, magainin 2 and aurein 2.1. Both cecropin A and polymyxin B, completely inhibited the growth of three pathogens: C. freundii, K. pneumoniae and P. aeruginosa at a concentration some sixteen times less than two skin peptides. Furthermore, cecropin A inhibited the growth of three pathogens resistant to the two skin peptides, A. hydrophila, C. meningosepticum and P. mirabilis. Polymyxin B also inhibited the growth of three pathogens resistant to the skin peptides, A. hydrophila, C. meningosepticum and S. liquefaciens. Cecropin A and polymyxin B have marked antibacterial activity against different frog bacterial pathogens indicating potential for therapeutic measures.Keywords: frogs, antimicrobial, bacteria, cecropin, polymyxin, resistance
Genetic reprogramming of host cells by bacterial pathogens.
Tran Van Nhieu, Guy; Arbibe, Laurence
2009-10-29
During the course of infection, pathogens often induce changes in gene expression in host cells and these changes can be long lasting and global or transient and of limited amplitude. Defining how, when, and why bacterial pathogens reprogram host cells represents an exciting challenge that opens up the opportunity to grasp the essence of pathogenesis and its molecular details.
Pizarro-Cerdá, Javier; Charbit, Alain; Enninga, Jost; Lafont, Frank; Cossart, Pascale
2016-12-01
Bacterial pathogens display an impressive arsenal of molecular mechanisms that allow survival in diverse host niches. Subversion of plasma membrane and cytoskeletal functions are common themes associated to infection by both extracellular and intracellular pathogens. Moreover, intracellular pathogens modify the structure/stability of their membrane-bound compartments and escape degradation from phagocytic or autophagic pathways. Here, we review the manipulation of host membranes by Listeria monocytogenes, Francisella tularensis, Shigella flexneri and Yersinia spp. These four bacterial model pathogens exemplify generalized strategies as well as specific features observed during bacterial infection processes. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.
Bacterial pathogen manipulation of host membrane trafficking.
Asrat, Seblewongel; de Jesús, Dennise A; Hempstead, Andrew D; Ramabhadran, Vinay; Isberg, Ralph R
2014-01-01
Pathogens use a vast number of strategies to alter host membrane dynamics. Targeting the host membrane machinery is important for the survival and pathogenesis of several extracellular, vacuolar, and cytosolic bacteria. Membrane manipulation promotes bacterial replication while suppressing host responses, allowing the bacterium to thrive in a hostile environment. This review provides a comprehensive summary of various strategies used by both extracellular and intracellular bacteria to hijack host membrane trafficking machinery. We start with mechanisms used by bacteria to alter the plasma membrane, delve into the hijacking of various vesicle trafficking pathways, and conclude by summarizing bacterial adaptation to host immune responses. Understanding bacterial manipulation of host membrane trafficking provides insights into bacterial pathogenesis and uncovers the molecular mechanisms behind various processes within a eukaryotic cell.
Current advances in aptamer-assisted technologies for detecting bacterial and fungal toxins.
Alizadeh, N; Memar, M Y; Mehramuz, B; Abibiglou, S S; Hemmati, F; Samadi Kafil, H
2018-03-01
Infectious diseases are among the common leading causes of morbidity and mortality worldwide. Associated with the emergence of new infectious diseases, the increasing number of antimicrobial-resistant isolates presents a serious threat to public health and hospitalized patients. A microbial pathogen may elicit several host responses and use a variety of mechanisms to evade host defences. These methods and mechanisms include capsule, lipopolysaccharides or cell wall components, adhesions and toxins. Toxins inhibit phagocytosis, cause septic shock and host cell damages by binding to host surface receptors and invasion. Bacterial and fungal pathogens are able to apply many different toxin-dependent mechanisms to disturb signalling pathways and the structural integrity of host cells for establishing and maintaining infections Initial techniques for analysis of bacterial toxins were based on in vivo or in vitro assessments. There is a permanent demand for appropriate detection methods which are affordable, practical, careful, rapid, sensitive, efficient and economical. Aptamers are DNA or RNA oligonucleotides that are selected by systematic evolution of ligands using exponential enrichment (SELEX) methods and can be applied in diagnostic applications. This review provides an overview of aptamer-based methods as a novel approach for detecting toxins in bacterial and fungal pathogens. © 2017 The Society for Applied Microbiology.
Smart phone based bacterial detection using bio functionalized fluorescent nanoparticles
International Nuclear Information System (INIS)
Rajendran, Vinoth Kumar; Bakthavathsalam, Padmavathy; Ali, Baquir Mohammed Jaffar
2014-01-01
We are describing immunochromatographic test strips with smart phone-based fluorescence readout. They are intended for use in the detection of the foodborne bacterial pathogens Salmonella spp. and Escherichia coli O157. Silica nanoparticles (SiNPs) were doped with FITC and Ru(bpy), conjugated to the respective antibodies, and then used in a conventional lateral flow immunoassay (LFIA). Fluorescence was recorded by inserting the nitrocellulose strip into a smart phone-based fluorimeter consisting of a light weight (40 g) optical module containing an LED light source, a fluorescence filter set and a lens attached to the integrated camera of the cell phone in order to acquire high-resolution fluorescence images. The images were analysed by exploiting the quick image processing application of the cell phone and enable the detection of pathogens within few minutes. This LFIA is capable of detecting pathogens in concentrations as low as 10 5 cfu mL −1 directly from test samples without pre-enrichment. The detection is one order of magnitude better compared to gold nanoparticle-based LFIAs under similar condition. The successful combination of fluorescent nanoparticle-based pathogen detection by LFIAs with a smart phone-based detection platform has resulted in a portable device with improved diagnosis features and having potential application in diagnostics and environmental monitoring. (author)
Unraveling plant responses to bacterial pathogens through proteomics
Zimaro, Tamara; Gottig, Natalia; Garavaglia, Betiana S.; Gehring, Christoph A; Ottado, Jorgelina
2011-01-01
Plant pathogenic bacteria cause diseases in important crops and seriously and negatively impact agricultural production. Therefore, an understanding of the mechanisms by which plants resist bacterial infection at the stage of the basal immune response or mount a successful specific R-dependent defense response is crucial since a better understanding of the biochemical and cellular mechanisms underlying these interactions will enable molecular and transgenic approaches to crops with increased biotic resistance. In recent years, proteomics has been used to gain in-depth understanding of many aspects of the host defense against pathogens and has allowed monitoring differences in abundance of proteins as well as posttranscriptional and posttranslational processes, protein activation/inactivation, and turnover. Proteomics also offers a window to study protein trafficking and routes of communication between organelles. Here, we summarize and discuss current progress in proteomics of the basal and specific host defense responses elicited by bacterial pathogens. Copyright 2011 Tamara Zimaro et al.
Unraveling plant responses to bacterial pathogens through proteomics
Zimaro, Tamara
2011-11-03
Plant pathogenic bacteria cause diseases in important crops and seriously and negatively impact agricultural production. Therefore, an understanding of the mechanisms by which plants resist bacterial infection at the stage of the basal immune response or mount a successful specific R-dependent defense response is crucial since a better understanding of the biochemical and cellular mechanisms underlying these interactions will enable molecular and transgenic approaches to crops with increased biotic resistance. In recent years, proteomics has been used to gain in-depth understanding of many aspects of the host defense against pathogens and has allowed monitoring differences in abundance of proteins as well as posttranscriptional and posttranslational processes, protein activation/inactivation, and turnover. Proteomics also offers a window to study protein trafficking and routes of communication between organelles. Here, we summarize and discuss current progress in proteomics of the basal and specific host defense responses elicited by bacterial pathogens. Copyright 2011 Tamara Zimaro et al.
This study examined persistence and decay of bacterial pathogens, fecal indicator bacteria (FIB), and emerging real-time quantitative PCR (qPCR) genetic markers for rapid detection of fecal pollution in manure-amended agricultural soils. Known concentrations of transformed green...
This study examined persistence and decay of bacterial pathogens, fecal indicator bacteria, and emerging real-time quantitative PCR (qPCR) genetic markers for rapid detection of fecal pollution in manre-amended agricultural soils. Known concentrations of transformed green fluore...
Advances and Challenges in Viability Detection of Foodborne Pathogens
Directory of Open Access Journals (Sweden)
Dexin Zeng
2016-11-01
Full Text Available Foodborne outbreaks are a serious public health and food safety concern worldwide. There is a great demand for rapid, sensitive, specific, and accurate methods to detect microbial pathogens in foods. Conventional methods based on cultivation of pathogens have been the gold standard protocols; however, they take up to a week to complete. Molecular assays such as polymerase chain reaction (PCR, sequencing, microarray technologies have been widely used in detection of foodborne pathogens. Among molecular assays, PCR technology conventional and real-time PCR (qPCR is most commonly used in the foodborne pathogen detection because of its high sensitivity and specificity. However, a major drawback of PCR is its inability to differentiate the DNA from dead and viable cells, and this is a critical factor for the food industry, regulatory agencies and the consumer. To remedy this shortcoming, researchers have used biological dyes such as ethidium monoazide (EMA and propidium monoazide (PMA to pretreat samples before DNA extraction to intercalate the DNA of dead cells in food samples, and then proceed with regular DNA preparation and qPCR. By combining PMA treatment with qPCR (PMA-qPCR, scientists have applied this technology to detect viable cells of various bacterial pathogens in foods. The incorporation of PMA into PCR-based assays for viability detection of pathogens in foods has increased significantly in the last decade. On the other hand, some downsides with this approach have been noted, particularly to achieve complete suppression of signal of DNA from the dead cells present in some particular food matrix. Nowadays, there is a tendency of more and more researchers adapting this approach for viability detection; and a few commercial kits based on PMA are available in the market. As time goes on, more scientists apply this approach to a broader range of pathogen detections, this viability approach (PMA or other chemicals such as platinum compound
Prevalence of gastrointestinal bacterial pathogens in a population of zoo animals.
Stirling, J; Griffith, M; Blair, I; Cormican, M; Dooley, J S G; Goldsmith, C E; Glover, S G; Loughrey, A; Lowery, C J; Matsuda, M; McClurg, R; McCorry, K; McDowell, D; McMahon, A; Cherie Millar, B; Nagano, Y; Rao, J R; Rooney, P J; Smyth, M; Snelling, W J; Xu, J; Moore, J E
2008-04-01
Faecal prevalence of gastrointestinal bacterial pathogens, including Campylobacter, Escherichia coli O157:H7, Salmonella, Shigella, Yersinia, as well as Arcobacter, were examined in 317 faecal specimens from 44 animal species in Belfast Zoological Gardens, during July-September 2006. Thermophilic campylobacters including Campylobacter jejuni, Campylobacter coli and Campylobacter lari, were the most frequently isolated pathogens, where members of this genus were isolated from 11 animal species (11 of 44; 25%). Yersinia spp. were isolated from seven animal species (seven of 44; 15.9%) and included, Yersinia enterocolitica (five of seven isolates; 71.4%) and one isolate each of Yersinia frederiksenii and Yersinia kristensenii. Only one isolate of Salmonella was obtained throughout the entire study, which was an isolate of Salmonella dublin (O 1,9,12: H g, p), originating from tiger faeces after enrichment. None of the animal species found in public contact areas of the zoo were positive for any gastrointestinal bacterial pathogens. Also, water from the lake in the centre of the grounds, was examined for the same bacterial pathogens and was found to contain C. jejuni. This study is the first report on the isolation of a number of important bacterial pathogens from a variety of novel host species, C. jejuni from the red kangaroo (Macropus rufus), C. lari from a maned wolf (Chrysocyon brachyurus), Y. kristensenii from a vicugna (Vicugna vicugna) and Y. enterocolitica from a maned wolf and red panda (Ailurus fulgens). In conclusion, this study demonstrated that the faeces of animals in public contact areas of the zoo were not positive for the bacterial gastrointestinal pathogens examined. This is reassuring for the public health of visitors, particularly children, who enjoy this educational and recreational resource.
The intrinsic resistome of bacterial pathogens.
Olivares, Jorge; Bernardini, Alejandra; Garcia-Leon, Guillermo; Corona, Fernando; B Sanchez, Maria; Martinez, Jose L
2013-01-01
Intrinsically resistant bacteria have emerged as a relevant health problem in the last years. Those bacterial species, several of them with an environmental origin, present naturally low-level susceptibility to several drugs. It has been proposed that intrinsic resistance is mainly the consequence of the impermeability of cellular envelopes, the activity of multidrug efflux pumps or the lack of appropriate targets for a given family of drugs. However, recently published articles indicate that the characteristic phenotype of susceptibility to antibiotics of a given bacterial species depends on the concerted activity of several elements, what has been named as intrinsic resistome. These determinants comprise not just classical resistance genes. Other elements, several of them involved in basic bacterial metabolic processes, are of relevance for the intrinsic resistance of bacterial pathogens. In the present review we analyze recent publications on the intrinsic resistomes of Escherichia coli and Pseudomonas aeruginosa. We present as well information on the role that global regulators of bacterial metabolism, as Crc from P. aeruginosa, may have on modulating bacterial susceptibility to antibiotics. Finally, we discuss the possibility of searching inhibitors of the intrinsic resistome in the aim of improving the activity of drugs currently in use for clinical practice.
The intrinsic resistome of bacterial pathogens
Directory of Open Access Journals (Sweden)
Jorge Andrés Olivares Pacheco
2013-04-01
Full Text Available Intrinsically resistant bacteria have emerged as a relevant health problem in the last years. Those bacterial species, several of them with an environmental origin, present naturally a low-level susceptibility to several drugs. It has been proposed that intrinsic resistance is mainly the consequence of the impermeability of cellular envelopes, the activity of multidrug efflux pumps or the lack of appropriate targets for a given family of drugs. However, recently published articles indicate that the characteristic phenotype of susceptibility to antibiotics of a given bacterial species depends on the concerted activity of several elements, what has been named as intrinsic resistome. These determinants comprise not just classical resistance genes. Other elements, several of them involved in basic bacterial metabolic processes, are of relevance for the intrinsic resistance of bacterial pathogens. In the present review we analyse recent publications on the intrinsic resistomes of Escherichia coli and Pseudomonas aeruginosa. We present as well information on the role that global regulators of bacterial metabolism, as Crc from P. aeruginosa, may have on modulating bacterial susceptibility to antibiotics. Finally, we discuss the possibility of searching inhibitors of the intrinsic resistome in the aim of improving the activity of drugs currently in use for clinical practice.
Search for microRNAs expressed by intracellular bacterial pathogens in infected mammalian cells.
Furuse, Yuki; Finethy, Ryan; Saka, Hector A; Xet-Mull, Ana M; Sisk, Dana M; Smith, Kristen L Jurcic; Lee, Sunhee; Coers, Jörn; Valdivia, Raphael H; Tobin, David M; Cullen, Bryan R
2014-01-01
MicroRNAs are expressed by all multicellular organisms and play a critical role as post-transcriptional regulators of gene expression. Moreover, different microRNA species are known to influence the progression of a range of different diseases, including cancer and microbial infections. A number of different human viruses also encode microRNAs that can attenuate cellular innate immune responses and promote viral replication, and a fungal pathogen that infects plants has recently been shown to express microRNAs in infected cells that repress host cell immune responses and promote fungal pathogenesis. Here, we have used deep sequencing of total expressed small RNAs, as well as small RNAs associated with the cellular RNA-induced silencing complex RISC, to search for microRNAs that are potentially expressed by intracellular bacterial pathogens and translocated into infected animal cells. In the case of Legionella and Chlamydia and the two mycobacterial species M. smegmatis and M. tuberculosis, we failed to detect any bacterial small RNAs that had the characteristics expected for authentic microRNAs, although large numbers of small RNAs of bacterial origin could be recovered. However, a third mycobacterial species, M. marinum, did express an ∼ 23-nt small RNA that was bound by RISC and derived from an RNA stem-loop with the characteristics expected for a pre-microRNA. While intracellular expression of this candidate bacterial microRNA was too low to effectively repress target mRNA species in infected cultured cells in vitro, artificial overexpression of this potential bacterial pre-microRNA did result in the efficient repression of a target mRNA. This bacterial small RNA therefore represents the first candidate microRNA of bacterial origin.
Search for microRNAs expressed by intracellular bacterial pathogens in infected mammalian cells.
Directory of Open Access Journals (Sweden)
Yuki Furuse
Full Text Available MicroRNAs are expressed by all multicellular organisms and play a critical role as post-transcriptional regulators of gene expression. Moreover, different microRNA species are known to influence the progression of a range of different diseases, including cancer and microbial infections. A number of different human viruses also encode microRNAs that can attenuate cellular innate immune responses and promote viral replication, and a fungal pathogen that infects plants has recently been shown to express microRNAs in infected cells that repress host cell immune responses and promote fungal pathogenesis. Here, we have used deep sequencing of total expressed small RNAs, as well as small RNAs associated with the cellular RNA-induced silencing complex RISC, to search for microRNAs that are potentially expressed by intracellular bacterial pathogens and translocated into infected animal cells. In the case of Legionella and Chlamydia and the two mycobacterial species M. smegmatis and M. tuberculosis, we failed to detect any bacterial small RNAs that had the characteristics expected for authentic microRNAs, although large numbers of small RNAs of bacterial origin could be recovered. However, a third mycobacterial species, M. marinum, did express an ∼ 23-nt small RNA that was bound by RISC and derived from an RNA stem-loop with the characteristics expected for a pre-microRNA. While intracellular expression of this candidate bacterial microRNA was too low to effectively repress target mRNA species in infected cultured cells in vitro, artificial overexpression of this potential bacterial pre-microRNA did result in the efficient repression of a target mRNA. This bacterial small RNA therefore represents the first candidate microRNA of bacterial origin.
Antibiotic resistance in bacterial pathogens causing meningitis in ...
African Journals Online (AJOL)
Antibiotic resistance in bacterial pathogens causing meningitis in children at Harare Central Hospital, Zimbabwe. M Gudza-Mugabe, R.T. Mavenyengwa, M.P. Mapingure, S Mtapuri-Zinyowera, A Tarupiwa, V.J. Robertson ...
Inoue, Daisuke; Hinoura, Takuji; Suzuki, Noriko; Pang, Junqin; Malla, Rabin; Shrestha, Sadhana; Chapagain, Saroj Kumar; Matsuzawa, Hiroaki; Nakamura, Takashi; Tanaka, Yasuhiro; Ike, Michihiko; Nishida, Kei; Sei, Kazunari
2015-01-01
Because of heavy dependence on groundwater for drinking water and other domestic use, microbial contamination of groundwater is a serious problem in the Kathmandu Valley, Nepal. This study investigated comprehensively the occurrence of pathogenic bacteria in shallow well groundwater in the Kathmandu Valley by applying DNA microarray analysis targeting 941 pathogenic bacterial species/groups. Water quality measurements found significant coliform (fecal) contamination in 10 of the 11 investigated groundwater samples and significant nitrogen contamination in some samples. The results of DNA microarray analysis revealed the presence of 1-37 pathogen species/groups, including 1-27 biosafety level 2 ones, in 9 of the 11 groundwater samples. While the detected pathogens included several feces- and animal-related ones, those belonging to Legionella and Arthrobacter, which were considered not to be directly associated with feces, were detected prevalently. This study could provide a rough picture of overall pathogenic bacterial contamination in the Kathmandu Valley, and demonstrated the usefulness of DNA microarray analysis as a comprehensive screening tool of a wide variety of pathogenic bacteria.
Molecular mechanisms underlying the emergence of bacterial pathogens: an ecological perspective.
Bartoli, Claudia; Roux, Fabrice; Lamichhane, Jay Ram
2016-02-01
The rapid emergence of new bacterial diseases negatively affects both human health and agricultural productivity. Although the molecular mechanisms underlying these disease emergences are shared between human- and plant-pathogenic bacteria, not much effort has been made to date to understand disease emergences caused by plant-pathogenic bacteria. In particular, there is a paucity of information in the literature on the role of environmental habitats in which plant-pathogenic bacteria evolve and on the stress factors to which these microbes are unceasingly exposed. In this microreview, we focus on three molecular mechanisms underlying pathogenicity in bacteria, namely mutations, genomic rearrangements and the acquisition of new DNA sequences through horizontal gene transfer (HGT). We briefly discuss the role of these mechanisms in bacterial disease emergence and elucidate how the environment can influence the occurrence and regulation of these molecular mechanisms by directly impacting disease emergence. The understanding of such molecular evolutionary mechanisms and their environmental drivers will represent an important step towards predicting bacterial disease emergence and developing sustainable management strategies for crops. © 2015 BSPP AND JOHN WILEY & SONS LTD.
Clostridium difficile is an autotrophic bacterial pathogen.
Directory of Open Access Journals (Sweden)
Michael Köpke
Full Text Available During the last decade, Clostridium difficile infection showed a dramatic increase in incidence and virulence in the Northern hemisphere. This incessantly challenging disease is the leading cause of antibiotic-associated and nosocomial infectious diarrhea and became life-threatening especially among elderly people. It is generally assumed that all human bacterial pathogens are heterotrophic organisms, being either saccharolytic or proteolytic. So far, this has not been questioned as colonization of the human gut gives access to an environment, rich in organic nutrients. Here, we present data that C. difficile (both clinical and rumen isolates is also able to grow on CO2+H2 as sole carbon and energy source, thus representing the first identified autotrophic bacterial pathogen. Comparison of several different strains revealed high conservation of genes for autotrophic growth and showed that the ability to use gas mixtures for growth decreases or is lost upon prolonged culturing under heterotrophic conditions. The metabolic flexibility of C. difficile (heterotrophic growth on various substrates as well as autotrophy could allow the organism in the gut to avoid competition by niche differentiation and contribute to its survival when stressed or in unfavorable conditions that cause death to other bacteria. This may be an important trait for the pathogenicity of C. difficile.
Directory of Open Access Journals (Sweden)
Gita Eslami
2014-06-01
Full Text Available Background: Considering the high prevalence of bacterial vaginosis and its association with urinary tract infection in women and treatment of gynecologic problems occur when a high recurrence of bacterial vaginosis is often treated with antibiotics. The purpose of this study is to investigate the inhibitory effect of Lactobacillus rhamnosus on pathogenic bacteria isolated from women with bacterial vaginosis, respectively.Materials and Methods: 96 samples from women with bacterial vaginosis discharge referred to health centers dependent Shahid Beheshti University in 91-92 were taken by a gynecologist with a dacron swab and put in sterile tubes containing TSB broth and Thioglycollate broth and were immediately sent to the lab location in cold chain for the next stages of investigation. From Thioglycollate and TSB medium was cultured on blood agar and EMB and Palkam and Differential diagnosis environments, and then incubated for 24 h at 37°C. Strains of Lactobacillus rhamnosus were cultured in MRSA environment and were transfered to the lab. After purification of pathogenic bacteria, MIC methods and antibiogram, Lactobacillus rhamnosus inhibitory effect on pathogenic bacteria is checked. Statistical analysis was done by SPSS software v.16.Results: The results of this study show the inhibitory effect of Lactobacillus rhamnosus on some pathogenic bacteria that cause bacterial vaginosis, including Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus saprophyticus, Streptococcus agalactiae, Entrococcus, Listeria monocytogenes and E.Coli. Microscopic examination of stained smears of the large number of Lactobacillus and pathogenic bacteria showed reduced. The prevalence of abnormal vaginal discharge, history of drug use means of preventing pregnancy and douching, respectively, 61%, 55%, 42% and 13% respectively. Significant difference was observed between the use and non-use of IUD in women with bacterial vaginosis infection
Directory of Open Access Journals (Sweden)
Eslami
2014-08-01
Full Text Available Background Considering the high prevalence of bacterial vaginosis and its association with urinary tract infection in women and treatment of gynecologic problems occur when a high recurrence of bacterial vaginosis is often treated with antibiotics. Objectives The purpose of this study was to investigate the inhibitory effect of Lactobacillus reuteri on pathogenic bacteria isolated from women with bacterial vaginosis. Materials and Methods Ninety-six samples were obtained from vaginal discharge of women with bacterial vaginosis by a gynecologist with a Dacron swab and put in sterile tubes containing TSB broth and Thioglycollate broth. Then were immediately sent to the laboratory in cold chain for further assessment. Afterward, culture was transferred on blood agar, EMB, Palcam and differential diagnosis environments. Then cultures were incubated for 24 hours at 37 °C. Lactobacillus reuteri strains were cultured in MRS environment and transferred to laboratory. After purification of pathogenic bacteria, Lactobacillus reuteri inhibitory effect on pathogenic bacteria was evaluated by minimum inhibitory concentration (MIC and antibiogram. Statistical analysis was performed using SPSS software v.16. Results The results of this study demonstrated the inhibitory effect of Lactobacillus reuteri on some pathogenic bacteria that cause bacterial, including Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus saprophyticus, Streptococcus agalactiae, Enterococcus, Listeria monocytogenes and E. coli. Microscopic examination of stained smears of most Lactobacillus and pathogenic bacteria showed reduced. The prevalence of abnormal vaginal discharge, history of drug use, contraceptive methods and douching were 61%, 55%, 42% and 13%, respectively. Significant difference was observed between the use and non-use of IUD in women with bacterial. Conclusions Our findings indicated the inhibitory effect of Lactobacillus reuteri on pathogenic bacteria that
Microbial minimalism: genome reduction in bacterial pathogens.
Moran, Nancy A
2002-03-08
When bacterial lineages make the transition from free-living or facultatively parasitic life cycles to permanent associations with hosts, they undergo a major loss of genes and DNA. Complete genome sequences are providing an understanding of how extreme genome reduction affects evolutionary directions and metabolic capabilities of obligate pathogens and symbionts.
Shestov, Maksim; Ontañón, Santiago; Tozeren, Aydin
2015-10-13
Bacterial infections comprise a global health challenge as the incidences of antibiotic resistance increase. Pathogenic potential of bacteria has been shown to be context dependent, varying in response to environment and even within the strains of the same genus. We used the KEGG repository and extensive literature searches to identify among the 2527 bacterial genomes in the literature those implicated as pathogenic to the host, including those which show pathogenicity in a context dependent manner. Using data on the gene contents of these genomes, we identified sets of genes highly abundant in pathogenic but relatively absent in commensal strains and vice versa. In addition, we carried out genome comparison within a genus for the seventeen largest genera in our genome collection. We projected the resultant lists of ortholog genes onto KEGG bacterial pathways to identify clusters and circuits, which can be linked to either pathogenicity or synergy. Gene circuits relatively abundant in nonpathogenic bacteria often mediated biosynthesis of antibiotics. Other synergy-linked circuits reduced drug-induced toxicity. Pathogen-abundant gene circuits included modules in one-carbon folate, two-component system, type-3 secretion system, and peptidoglycan biosynthesis. Antibiotics-resistant bacterial strains possessed genes modulating phagocytosis, vesicle trafficking, cytoskeletal reorganization, and regulation of the inflammatory response. Our study also identified bacterial genera containing a circuit, elements of which were previously linked to Alzheimer's disease. Present study produces for the first time, a signature, in the form of a robust list of gene circuitry whose presence or absence could potentially define the pathogenicity of a microbiome. Extensive literature search substantiated a bulk majority of the commensal and pathogenic circuitry in our predicted list. Scanning microbiome libraries for these circuitry motifs will provide further insights into the complex
O antigen modulates insect vector acquisition of the bacterial plant pathogen Xylella fastidiosa.
Rapicavoli, Jeannette N; Kinsinger, Nichola; Perring, Thomas M; Backus, Elaine A; Shugart, Holly J; Walker, Sharon; Roper, M Caroline
2015-12-01
Hemipteran insect vectors transmit the majority of plant pathogens. Acquisition of pathogenic bacteria by these piercing/sucking insects requires intimate associations between the bacterial cells and insect surfaces. Lipopolysaccharide (LPS) is the predominant macromolecule displayed on the cell surface of Gram-negative bacteria and thus mediates bacterial interactions with the environment and potential hosts. We hypothesized that bacterial cell surface properties mediated by LPS would be important in modulating vector-pathogen interactions required for acquisition of the bacterial plant pathogen Xylella fastidiosa, the causative agent of Pierce's disease of grapevines. Utilizing a mutant that produces truncated O antigen (the terminal portion of the LPS molecule), we present results that link this LPS structural alteration to a significant decrease in the attachment of X. fastidiosa to blue-green sharpshooter foreguts. Scanning electron microscopy confirmed that this defect in initial attachment compromised subsequent biofilm formation within vector foreguts, thus impairing pathogen acquisition. We also establish a relationship between O antigen truncation and significant changes in the physiochemical properties of the cell, which in turn affect the dynamics of X. fastidiosa adhesion to the vector foregut. Lastly, we couple measurements of the physiochemical properties of the cell with hydrodynamic fluid shear rates to produce a Comsol model that predicts primary areas of bacterial colonization within blue-green sharpshooter foreguts, and we present experimental data that support the model. These results demonstrate that, in addition to reported protein adhesin-ligand interactions, O antigen is crucial for vector-pathogen interactions, specifically in the acquisition of this destructive agricultural pathogen. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Electrochemical Methodologies for the Detection of Pathogens.
Amiri, Mandana; Bezaatpour, Abolfazl; Jafari, Hamed; Boukherroub, Rabah; Szunerits, Sabine
2018-05-25
Bacterial infections remain one of the principal causes of morbidity and mortality worldwide. The number of deaths due to infections is declining every year by only 1% with a forecast of 13 million deaths in 2050. Among the 1400 recognized human pathogens, the majority of infectious diseases is caused by just a few, about 20 pathogens only. While the development of vaccinations and novel antibacterial drugs and treatments are at the forefront of research, and strongly financially supported by policy makers, another manner to limit and control infectious outbreaks is targeting the development and implementation of early warning systems, which indicate qualitatively and quantitatively the presence of a pathogen. As toxin contaminated food and drink are a potential threat to human health and consequently have a significant socioeconomic impact worldwide, the detection of pathogenic bacteria remains not only a big scientific challenge but also a practical problem of enormous significance. Numerous analytical methods, including conventional culturing and staining techniques as well as molecular methods based on polymerase chain reaction amplification and immunological assays, have emerged over the years and are used to identify and quantify pathogenic agents. While being highly sensitive in most cases, these approaches are highly time, labor, and cost consuming, requiring trained personnel to perform the frequently complex assays. A great challenge in this field is therefore to develop rapid, sensitive, specific, and if possible miniaturized devices to validate the presence of pathogens in cost and time efficient manners. Electrochemical sensors are well accepted powerful tools for the detection of disease-related biomarkers and environmental and organic hazards. They have also found widespread interest in the last years for the detection of waterborne and foodborne pathogens due to their label free character and high sensitivity. This Review is focused on the current
Efficacy of zinc as an antibacterial agent against enteric bacterial pathogens
International Nuclear Information System (INIS)
Faiz, U.; Butt, T.; Hussain, W.; Hanif, F.
2011-01-01
Background: Diarrhoea is a serious threat all over the world with great economic implications especially evident in the developing world. This study was aimed at determining in vitro efficacy of Zinc (Zn) against common enteric bacterial pathogens. Method: A total of 100 bacterial enteric pathogens: Salmonellae (n=16), enteropathogenic Escherichia coli (EPEC) (n=26), Shigellae (n=28) and Vibrio cholerae (n=30) were isolated from diarrhoeal stool specimens at Department of Microbiology, Armed Forces Institute of Pathology Rawalpindi during April 2009 to Jan 2010. These isolates were tested against various concentrations of Zn supplemented in Mueller Hinton (MH) agar using a multipoint inoculator. A minimum inhibitory concentration of active Zn in ZnSO/sub 4/.7H/sub 2/O ranging from 0.03 mg/ml to 1 mg/ml was used. Results: Zn completely inhibited the growth of all the tested pathogens and most of them were inhibited at a concentration of 0.06 mg/ml to 0.5 mg/ml of Zn. Conclusions: Zinc has an excellent antibacterial activity against enteric bacterial pathogens common in our setup which may provide basis for treatment of diarrhoea. Clinical study based on these findings is recommended. (author)
Luciferase-Zinc-Finger System for the Rapid Detection of Pathogenic Bacteria.
Shi, Chu; Xu, Qing; Ge, Yue; Jiang, Ling; Huang, He
2017-08-09
Rapid and reliable detection of pathogenic bacteria is crucial for food safety control. Here, we present a novel luciferase-zinc finger system for the detection of pathogens that offers rapid and specific profiling. The system, which uses a zinc-finger protein domain to probe zinc finger recognition sites, was designed to bind the amplified conserved regions of 16S rDNA, and the obtained products were detected using a modified luciferase. The luciferase-zinc finger system not only maintained luciferase activity but also allowed the specific detection of different bacterial species, with a sensitivity as low as 10 copies and a linear range from 10 to 10 4 copies per microliter of the specific PCR product. Moreover, the system is robust and rapid, enabling the simultaneous detection of 6 species of bacteria in artificially contaminated samples with excellent accuracy. Thus, we envision that our luciferase-zinc finger system will have far-reaching applications.
Reduced Set of Virulence Genes Allows High Accuracy Prediction of Bacterial Pathogenicity in Humans
Iraola, Gregorio; Vazquez, Gustavo; Spangenberg, Lucía; Naya, Hugo
2012-01-01
Although there have been great advances in understanding bacterial pathogenesis, there is still a lack of integrative information about what makes a bacterium a human pathogen. The advent of high-throughput sequencing technologies has dramatically increased the amount of completed bacterial genomes, for both known human pathogenic and non-pathogenic strains; this information is now available to investigate genetic features that determine pathogenic phenotypes in bacteria. In this work we determined presence/absence patterns of different virulence-related genes among more than finished bacterial genomes from both human pathogenic and non-pathogenic strains, belonging to different taxonomic groups (i.e: Actinobacteria, Gammaproteobacteria, Firmicutes, etc.). An accuracy of 95% using a cross-fold validation scheme with in-fold feature selection is obtained when classifying human pathogens and non-pathogens. A reduced subset of highly informative genes () is presented and applied to an external validation set. The statistical model was implemented in the BacFier v1.0 software (freely available at ), that displays not only the prediction (pathogen/non-pathogen) and an associated probability for pathogenicity, but also the presence/absence vector for the analyzed genes, so it is possible to decipher the subset of virulence genes responsible for the classification on the analyzed genome. Furthermore, we discuss the biological relevance for bacterial pathogenesis of the core set of genes, corresponding to eight functional categories, all with evident and documented association with the phenotypes of interest. Also, we analyze which functional categories of virulence genes were more distinctive for pathogenicity in each taxonomic group, which seems to be a completely new kind of information and could lead to important evolutionary conclusions. PMID:22916122
Ernstsen, Christina L; Login, Frédéric H; Jensen, Helene H; Nørregaard, Rikke; Møller-Jensen, Jakob; Nejsum, Lene N
2017-08-01
To target bacterial pathogens that invade and proliferate inside host cells, it is necessary to design intervention strategies directed against bacterial attachment, cellular invasion and intracellular proliferation. We present an automated microscopy-based, fast, high-throughput method for analyzing size and number of intracellular bacterial colonies in infected tissue culture cells. Cells are seeded in 48-well plates and infected with a GFP-expressing bacterial pathogen. Following gentamicin treatment to remove extracellular pathogens, cells are fixed and cell nuclei stained. This is followed by automated microscopy and subsequent semi-automated spot detection to determine the number of intracellular bacterial colonies, their size distribution, and the average number per host cell. Multiple 48-well plates can be processed sequentially and the procedure can be completed in one working day. As a model we quantified intracellular bacterial colonies formed by uropathogenic Escherichia coli (UPEC) during infection of human kidney cells (HKC-8). Urinary tract infections caused by UPEC are among the most common bacterial infectious diseases in humans. UPEC can colonize tissues of the urinary tract and is responsible for acute, chronic, and recurrent infections. In the bladder, UPEC can form intracellular quiescent reservoirs, thought to be responsible for recurrent infections. In the kidney, UPEC can colonize renal epithelial cells and pass to the blood stream, either via epithelial cell disruption or transcellular passage, to cause sepsis. Intracellular colonies are known to be clonal, originating from single invading UPEC. In our experimental setup, we found UPEC CFT073 intracellular bacterial colonies to be heterogeneous in size and present in nearly one third of the HKC-8 cells. This high-throughput experimental format substantially reduces experimental time and enables fast screening of the intracellular bacterial load and cellular distribution of multiple
Chen, Quan; Zhu, Zhiling; Wang, Jun; Lopez, Analette I; Li, Siheng; Kumar, Amit; Yu, Fei; Chen, Haoqing; Cai, Chengzhi; Zhang, Lijuan
2017-03-01
Bacterial interference is an alternative strategy to fight against device-associated bacterial infections. Pursuing this strategy, a non-pathogenic bacterial biofilm is used as a live, protective barrier to fence off pathogen colonization. In this work, biofilms formed by probiotic Escherichia coli strain Nissle 1917 (EcN) are investigated for their potential for long-term bacterial interference against infections associated with silicone-based urinary catheters and indwelling catheters used in the digestive system, such as feeding tubes and voice prostheses. We have shown that EcN can form stable biofilms on silicone substrates, particularly those modified with a biphenyl mannoside derivative. These biofilms greatly reduced the colonization by pathogenic Enterococcus faecalis in Lysogeny broth (LB) for 11days. Bacterial interference is an alternative strategy to fight against device-associated bacterial infections. Pursuing this strategy, we use non-pathogenic bacteria to form a biofilm that serves as a live, protective barrier against pathogen colonization. Herein, we report the first use of preformed probiotic E. coli Nissle 1917 biofilms on the mannoside-presenting silicone substrates to prevent pathogen colonization. The biofilms serve as a live, protective barrier to fence off the pathogens, whereas current antimicrobial/antifouling coatings are subjected to gradual coverage by the biomass from the rapidly growing pathogens in a high-nutrient environment. It should be noted that E. coli Nissle 1917 is commercially available and has been used in many clinical trials. We also demonstrated that this probiotic strain performed significantly better than the non-commercial, genetically modified E. coli strain that we previously reported. Copyright © 2017 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.
Autophagic clearance of bacterial pathogens: molecular recognition of intracellular microorganisms.
Pareja, Maria Eugenia Mansilla; Colombo, Maria I
2013-01-01
Autophagy is involved in several physiological and pathological processes. One of the key roles of the autophagic pathway is to participate in the first line of defense against the invasion of pathogens, as part of the innate immune response. Targeting of intracellular bacteria by the autophagic machinery, either in the cytoplasm or within vacuolar compartments, helps to control bacterial proliferation in the host cell, controlling also the spreading of the infection. In this review we will describe the means used by diverse bacterial pathogens to survive intracellularly and how they are recognized by the autophagic molecular machinery, as well as the mechanisms used to avoid autophagic clearance.
Development of Quorum-Based Anti-Virulence Therapeutics Targeting Gram-Negative Bacterial Pathogens
Directory of Open Access Journals (Sweden)
Wen Shan Yew
2013-08-01
Full Text Available Quorum sensing is a cell density-dependent signaling phenomenon used by bacteria for coordination of population-wide phenotypes, such as expression of virulence genes, antibiotic resistance and biofilm formation. Lately, disruption of bacterial communication has emerged as an anti-virulence strategy with enormous therapeutic potential given the increasing incidences of drug resistance in pathogenic bacteria. The quorum quenching therapeutic approach promises a lower risk of resistance development, since interference with virulence generally does not affect the growth and fitness of the bacteria and, hence, does not exert an associated selection pressure for drug-resistant strains. With better understanding of bacterial communication networks and mechanisms, many quorum quenching methods have been developed against various clinically significant bacterial pathogens. In particular, Gram-negative bacteria are an important group of pathogens, because, collectively, they are responsible for the majority of hospital-acquired infections. Here, we discuss the current understanding of existing quorum sensing mechanisms and present important inhibitory strategies that have been developed against this group of pathogenic bacteria.
The disease complex of the gypsy moth. II. Aerobic bacterial pathogens
J.D. Podgwaite; R.W. Campbell
1972-01-01
Eighty-six pathogenic aerobic bacterial isolates from diseased gypsy moth larvae collected in both sparse and dense populations were characterized and identified as members of the families Bacillaceae, Enterobacteriaceae, Lactobacillaceae, Pseudomonadaceae, and Achromobacteraceae. The commonest pathogens were Streptococcus faecalis, Bacillus cereus, Bacillus...
16S rRNA-based detection of oral pathogens in coronary atherosclerotic plaque
Directory of Open Access Journals (Sweden)
Mahendra Jaideep
2010-01-01
Full Text Available Background: Atherosclerosis develops as a response of the vessel wall to injury. Chronic bacterial infections have been associated with an increased risk for atherosclerosis and coronary artery disease. The ability of oral pathogens to colonize in coronary atheromatous plaque is well known. Aim: The aim of this study was to detect the presence of Treponema denticola, Porphyromonas gingivalis and Campylobacter rectus in the subgingival and atherosclerotic plaques of patients with coronary artery disease. Materials and Methods: Fifty-one patients in the age group of 40-80 years with coronary artery disease were selected for the study. DNA was extracted from the plaque samples. The specific primers for T. denticola, C. rectus and P. gingivalis were used to amplify a part of the 16S rRNA gene by polymerase chain reaction. Statistical Analysis Used: Chi-square analysis, correlation coefficient and prevalence percentage of the microorganisms were carried out for the analysis. Results: Of the 51 patients, T. denticola, C. rectus and P. gingivalis were detected in 49.01%, 21.51% and 45.10% of the atherosclerotic plaque samples. Conclusions: Our study revealed the presence of bacterial DNA of the oral pathogenic microorganisms in coronary atherosclerotic plaques. The presence of the bacterial DNA in the coronary atherosclerotic plaques in significant proportion may suggest the possible relationship between periodontal bacterial infection and genesis of coronary atherosclerosis.
A Plant Immune Receptor Detects Pathogen Effectors that Target WRKY Transcription Factors.
Sarris, Panagiotis F; Duxbury, Zane; Huh, Sung Un; Ma, Yan; Segonzac, Cécile; Sklenar, Jan; Derbyshire, Paul; Cevik, Volkan; Rallapalli, Ghanasyam; Saucet, Simon B; Wirthmueller, Lennart; Menke, Frank L H; Sohn, Kee Hoon; Jones, Jonathan D G
2015-05-21
Defense against pathogens in multicellular eukaryotes depends on intracellular immune receptors, yet surveillance by these receptors is poorly understood. Several plant nucleotide-binding, leucine-rich repeat (NB-LRR) immune receptors carry fusions with other protein domains. The Arabidopsis RRS1-R NB-LRR protein carries a C-terminal WRKY DNA binding domain and forms a receptor complex with RPS4, another NB-LRR protein. This complex detects the bacterial effectors AvrRps4 or PopP2 and then activates defense. Both bacterial proteins interact with the RRS1 WRKY domain, and PopP2 acetylates lysines to block DNA binding. PopP2 and AvrRps4 interact with other WRKY domain-containing proteins, suggesting these effectors interfere with WRKY transcription factor-dependent defense, and RPS4/RRS1 has integrated a "decoy" domain that enables detection of effectors that target WRKY proteins. We propose that NB-LRR receptor pairs, one member of which carries an additional protein domain, enable perception of pathogen effectors whose function is to target that domain. Copyright © 2015 Elsevier Inc. All rights reserved.
PathogenFinder - Distinguishing Friend from Foe Using Bacterial Whole Genome Sequence Data
DEFF Research Database (Denmark)
Cosentino, Salvatore; Larsen, Mette Voldby; Aarestrup, Frank Møller
2013-01-01
approaches. We describe PathogenFinder (http://cge.cbs.dtu.dk/services/PathogenFinder/), a web-server for the prediction of bacterial pathogenicity by analysing the input proteome, genome, or raw reads provided by the user. The method relies on groups of proteins, created without regard to their annotated...
A quantum-dot-based fluoroassay for detection of food-borne pathogens.
Mohamadi, Elaheh; Moghaddasi, Mohammadali; Farahbakhsh, Afshin; Kazemi, Abbass
2017-09-01
Evaluation of the distribution capability of food-borne pathogens existing in food products by taking the advantage of quantum dots (QDs) for their photoluminescence properties was carried out. Bacteria namely Escherichia coli (E. coli) labelled with CdSe-QDs were examined both on an Agar nutrient and ground fish substrates in order to observe their growth rate in different environments in the Lab. A sample with an appropriate concentration ratio 10 7 CFU/mL of bacteria/CdSe-QDs was empirically selected from the samples which were grown on the Agar containing plates. The selected sample was also tested on a ground fish substrate as a real food sample. The bacterial growth was observed under the irradiation of UV light and the growth patterns were investigated for 3 successive days. The growth patterns indicated that E. coli can stay alive and can be distributed on food products so that the growth can be easily monitored. This approach makes bacterial growth on food products detectable so that it can be used as a bacteria-QD assay for an easy detection of food borne pathogens grown on a food sample. Copyright © 2017 Elsevier B.V. All rights reserved.
Detection of multiple potentially pathogenic bacteria in Matang mangrove estuaries, Malaysia.
Ghaderpour, Aziz; Mohd Nasori, Khairul Nazrin; Chew, Li Lee; Chong, Ving Ching; Thong, Kwai Lin; Chai, Lay Ching
2014-06-15
The deltaic estuarine system of the Matang Mangrove Forest Reserve of Malaysia is a site where several human settlements and brackish water aquaculture have been established. Here, we evaluated the level of fecal indicator bacteria (FIB) and the presence of potentially pathogenic bacteria in the surface water and sediments. Higher levels of FIB were detected at downstream sampling sites from the fishing village, indicating it as a possible source of anthropogenic pollution to the estuary. Enterococci levels in the estuarine sediments were higher than in the surface water, while total coliforms and E. coli in the estuarine sediments were not detected in all samples. Also, various types of potentially pathogenic bacteria, including Klebsiella pneumoniae, Serratia marcescens and Enterobacter cloacae were isolated. The results indicate that the Matang estuarine system is contaminated with various types of potential human bacterial pathogens which might pose a health risk to the public. Copyright © 2014 Elsevier Ltd. All rights reserved.
The role and regulation of catalase in respiratory tract opportunistic bacterial pathogens.
Eason, Mia M; Fan, Xin
2014-09-01
Respiratory tract bacterial pathogens are the etiologic agents of a variety of illnesses. The ability of these bacteria to cause disease is imparted through survival within the host and avoidance of pathogen clearance by the immune system. Respiratory tract pathogens are continually bombarded by reactive oxygen species (ROS), which may be produced by competing bacteria, normal metabolic function, or host immunological responses. In order to survive and proliferate, bacteria have adapted defense mechanisms to circumvent the effects of ROS. Bacteria employ the use of anti-oxidant enzymes, catalases and catalase-peroxidases, to relieve the effects of the oxidative stressors to which they are continually exposed. The decomposition of ROS has been shown to provide favorable conditions in which respiratory tract opportunistic bacterial pathogens such as Haemophilus influenzae, Mycobacterium tuberculosis, Legionella pneumophila, and Neisseria meningitidis are able to withstand exposure to highly reactive molecules and yet survive. Bacteria possessing mutations in the catalase gene have a decreased survival rate, yet may be able to compensate for the lack of catalatic activity if peroxidatic activity is present. An incomplete knowledge of the mechanisms by which catalase and catalase-peroxidases are regulated still persists, however, in some bacterial species, a regulatory factor known as OxyR has been shown to either up-regulate or down-regulate catalase gene expression. Yet, more research is still needed to increase the knowledge base in relation to this enzyme class. As with this review, we focus on major respiratory tract opportunistic bacterial pathogens in order to elucidate the function and regulation of catalases. The importance of the research could lead to the development of novel treatments against respiratory bacterial infections. Copyright © 2014 Elsevier Ltd. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Hagan, Bethany S.; Bruckner-Lea, Cynthia J.
2002-12-01
This project was focused on developing and testing automated routines for a microfluidic Pathogen Detection System. The basic pathogen detection routine has three primary components; cell concentration, DNA amplification, and detection. In cell concentration, magnetic beads are held in a flow cell by an electromagnet. Sample liquid is passed through the flow cell and bacterial cells attach to the beads. These beads are then released into a small volume of fluid and delivered to the peltier device for cell lysis and DNA amplification. The cells are lysed during initial heating in the peltier device, and the released DNA is amplified using polymerase chain reaction (PCR) or strand displacement amplification (SDA). Once amplified, the DNA is then delivered to a laser induced fluorescence detection unit in which the sample is detected. These three components create a flexible platform that can be used for pathogen detection in liquid and sediment samples. Future developments of the system will include on-line DNA detection during DNA amplification and improved capture and release methods for the magnetic beads during cell concentration.
Directory of Open Access Journals (Sweden)
Susan eJoseph
2012-11-01
Full Text Available Cronobacter spp. (previously known as Enterobacter sakazakii is a bacterial pathogen affecting all age groups, with particularly severe clinical complications in neonates and infants. One recognised route of infection being the consumption of contaminated infant formula. As a recently recognised bacterial pathogen of considerable importance and regulatory control, appropriate detection and identification schemes are required. The application of multilocus sequence typing (MLST and analysis (MLSA of the seven alleles atpD, fusA, glnS, gltB, gyrB, infB and ppsA (concatenated length 3036 base pairs has led to considerable advances in our understanding of the genus. This approach is supported by both the reliability of DNA sequencing over subjective phenotyping and the establishment of a MLST database which has open access and is also curated; http://www.pubMLST.org/cronobacter. MLST has been used to describe the diversity of the newly recognised genus, instrumental in the formal recognition of new Cronobacter species (C. universalis and C. condimenti and revealed the high clonality of strains and the association of clonal complex 4 with neonatal meningitis cases. Clearly the MLST approach has considerable benefits over the use of non-DNA sequence based methods of analysis for newly emergent bacterial pathogens. The application of MLST and MLSA has dramatically enabled us to better understand this opportunistic bacterium which can cause irreparable damage to a newborn baby’s brain, and has contributed to improved control measures to protect neonatal health.
What Makes a Bacterial Species Pathogenic?:Comparative Genomic Analysis of the Genus Leptospira.
Fouts, Derrick E; Matthias, Michael A; Adhikarla, Haritha; Adler, Ben; Amorim-Santos, Luciane; Berg, Douglas E; Bulach, Dieter; Buschiazzo, Alejandro; Chang, Yung-Fu; Galloway, Renee L; Haake, David A; Haft, Daniel H; Hartskeerl, Rudy; Ko, Albert I; Levett, Paul N; Matsunaga, James; Mechaly, Ariel E; Monk, Jonathan M; Nascimento, Ana L T; Nelson, Karen E; Palsson, Bernhard; Peacock, Sharon J; Picardeau, Mathieu; Ricaldi, Jessica N; Thaipandungpanit, Janjira; Wunder, Elsio A; Yang, X Frank; Zhang, Jun-Jie; Vinetz, Joseph M
2016-02-01
Leptospirosis, caused by spirochetes of the genus Leptospira, is a globally widespread, neglected and emerging zoonotic disease. While whole genome analysis of individual pathogenic, intermediately pathogenic and saprophytic Leptospira species has been reported, comprehensive cross-species genomic comparison of all known species of infectious and non-infectious Leptospira, with the goal of identifying genes related to pathogenesis and mammalian host adaptation, remains a key gap in the field. Infectious Leptospira, comprised of pathogenic and intermediately pathogenic Leptospira, evolutionarily diverged from non-infectious, saprophytic Leptospira, as demonstrated by the following computational biology analyses: 1) the definitive taxonomy and evolutionary relatedness among all known Leptospira species; 2) genomically-predicted metabolic reconstructions that indicate novel adaptation of infectious Leptospira to mammals, including sialic acid biosynthesis, pathogen-specific porphyrin metabolism and the first-time demonstration of cobalamin (B12) autotrophy as a bacterial virulence factor; 3) CRISPR/Cas systems demonstrated only to be present in pathogenic Leptospira, suggesting a potential mechanism for this clade's refractoriness to gene targeting; 4) finding Leptospira pathogen-specific specialized protein secretion systems; 5) novel virulence-related genes/gene families such as the Virulence Modifying (VM) (PF07598 paralogs) proteins and pathogen-specific adhesins; 6) discovery of novel, pathogen-specific protein modification and secretion mechanisms including unique lipoprotein signal peptide motifs, Sec-independent twin arginine protein secretion motifs, and the absence of certain canonical signal recognition particle proteins from all Leptospira; and 7) and demonstration of infectious Leptospira-specific signal-responsive gene expression, motility and chemotaxis systems. By identifying large scale changes in infectious (pathogenic and intermediately pathogenic
What Makes a Bacterial Species Pathogenic?:Comparative Genomic Analysis of the Genus Leptospira.
Directory of Open Access Journals (Sweden)
Derrick E Fouts
2016-02-01
Full Text Available Leptospirosis, caused by spirochetes of the genus Leptospira, is a globally widespread, neglected and emerging zoonotic disease. While whole genome analysis of individual pathogenic, intermediately pathogenic and saprophytic Leptospira species has been reported, comprehensive cross-species genomic comparison of all known species of infectious and non-infectious Leptospira, with the goal of identifying genes related to pathogenesis and mammalian host adaptation, remains a key gap in the field. Infectious Leptospira, comprised of pathogenic and intermediately pathogenic Leptospira, evolutionarily diverged from non-infectious, saprophytic Leptospira, as demonstrated by the following computational biology analyses: 1 the definitive taxonomy and evolutionary relatedness among all known Leptospira species; 2 genomically-predicted metabolic reconstructions that indicate novel adaptation of infectious Leptospira to mammals, including sialic acid biosynthesis, pathogen-specific porphyrin metabolism and the first-time demonstration of cobalamin (B12 autotrophy as a bacterial virulence factor; 3 CRISPR/Cas systems demonstrated only to be present in pathogenic Leptospira, suggesting a potential mechanism for this clade's refractoriness to gene targeting; 4 finding Leptospira pathogen-specific specialized protein secretion systems; 5 novel virulence-related genes/gene families such as the Virulence Modifying (VM (PF07598 paralogs proteins and pathogen-specific adhesins; 6 discovery of novel, pathogen-specific protein modification and secretion mechanisms including unique lipoprotein signal peptide motifs, Sec-independent twin arginine protein secretion motifs, and the absence of certain canonical signal recognition particle proteins from all Leptospira; and 7 and demonstration of infectious Leptospira-specific signal-responsive gene expression, motility and chemotaxis systems. By identifying large scale changes in infectious (pathogenic and intermediately
Bacterial toxins as pathogen weapons against phagocytes
Directory of Open Access Journals (Sweden)
Ana edo Vale
2016-02-01
Full Text Available Bacterial toxins are virulence factors that manipulate host cell functions and take over the control of vital processes of living organisms to favour microbial infection. Some toxins directly target innate immune cells, thereby annihilating a major branch of the host immune response. In this review we will focus on bacterial toxins that act from the extracellular milieu and hinder the function of macrophages and neutrophils. In particular, we will concentrate on toxins from Gram-positive and Gram-negative bacteria that manipulate cell signalling or induce cell death by either imposing direct damage to the host cells cytoplasmic membrane or enzymatically modifying key eukaryotic targets. Outcomes regarding pathogen dissemination, host damage and disease progression will be discussed.
Water Microbiology. Bacterial Pathogens and Water
Directory of Open Access Journals (Sweden)
João P. S. Cabral
2010-10-01
Full Text Available Water is essential to life, but many people do not have access to clean and safe drinking water and many die of waterborne bacterial infections. In this review a general characterization of the most important bacterial diseases transmitted through water—cholera, typhoid fever and bacillary dysentery—is presented, focusing on the biology and ecology of the causal agents and on the diseases’ characteristics and their life cycles in the environment. The importance of pathogenic Escherichia coli strains and emerging pathogens in drinking water-transmitted diseases is also briefly discussed. Microbiological water analysis is mainly based on the concept of fecal indicator bacteria. The main bacteria present in human and animal feces (focusing on their behavior in their hosts and in the environment and the most important fecal indicator bacteria are presented and discussed (focusing on the advantages and limitations of their use as markers. Important sources of bacterial fecal pollution of environmental waters are also briefly indicated. In the last topic it is discussed which indicators of fecal pollution should be used in current drinking water microbiological analysis. It was concluded that safe drinking water for all is one of the major challenges of the 21st century and that microbiological control of drinking water should be the norm everywhere. Routine basic microbiological analysis of drinking water should be carried out by assaying the presence of Escherichia coli by culture methods. Whenever financial resources are available, fecal coliform determinations should be complemented with the quantification of enterococci. More studies are needed in order to check if ammonia is reliable for a preliminary screening for emergency fecal pollution outbreaks. Financial resources should be devoted to a better understanding of the ecology and behavior of human and animal fecal bacteria in environmental waters.
Water microbiology. Bacterial pathogens and water.
Cabral, João P S
2010-10-01
Water is essential to life, but many people do not have access to clean and safe drinking water and many die of waterborne bacterial infections. In this review a general characterization of the most important bacterial diseases transmitted through water-cholera, typhoid fever and bacillary dysentery-is presented, focusing on the biology and ecology of the causal agents and on the diseases' characteristics and their life cycles in the environment. The importance of pathogenic Escherichia coli strains and emerging pathogens in drinking water-transmitted diseases is also briefly discussed. Microbiological water analysis is mainly based on the concept of fecal indicator bacteria. The main bacteria present in human and animal feces (focusing on their behavior in their hosts and in the environment) and the most important fecal indicator bacteria are presented and discussed (focusing on the advantages and limitations of their use as markers). Important sources of bacterial fecal pollution of environmental waters are also briefly indicated. In the last topic it is discussed which indicators of fecal pollution should be used in current drinking water microbiological analysis. It was concluded that safe drinking water for all is one of the major challenges of the 21st century and that microbiological control of drinking water should be the norm everywhere. Routine basic microbiological analysis of drinking water should be carried out by assaying the presence of Escherichia coli by culture methods. Whenever financial resources are available, fecal coliform determinations should be complemented with the quantification of enterococci. More studies are needed in order to check if ammonia is reliable for a preliminary screening for emergency fecal pollution outbreaks. Financial resources should be devoted to a better understanding of the ecology and behavior of human and animal fecal bacteria in environmental waters.
Directory of Open Access Journals (Sweden)
Jeni Vuong
Full Text Available Neisseria meningitidis (Nm, Haemophilus influenzae (Hi, and Streptococcus pneumoniae (Sp are the lead causes of bacterial meningitis. Detection of these pathogens from clinical specimens using traditional real-time PCR (rt-PCR requires DNA extraction to remove the PCR inhibitors prior to testing, which is time consuming and labor intensive. In this study, five species-specific (Nm-sodC and -ctrA, Hi-hpd#1 and -hpd#3 and Sp-lytA and six serogroup-specific rt-PCR tests (A, B, C, W, X, Y targeting Nm capsular genes were evaluated in the two direct rt-PCR methods using PerfeCTa and 5x Omni that do not require DNA extraction. The sensitivity and specify of the two direct rt-PCR methods were compared to TaqMan traditional rt-PCR, the current standard rt-PCR method for the detection of meningitis pathogens. The LLD for all 11 rt-PCR tests ranged from 6,227 to 272,229 CFU/ml for TaqMan, 1,824-135,982 for 5x Omni, and 168-6,836 CFU/ml for PerfeCTa. The diagnostic sensitivity using TaqMan ranged from 89.2%-99.6%, except for NmB-csb, which was 69.7%. For 5x Omni, the sensitivity varied from 67.1% to 99.8%, with three tests below 90%. The sensitivity of these tests using PerfeCTa varied from 89.4% to 99.8%. The specificity ranges of the 11 tests were 98.0-99.9%, 97.5-99.9%, and 92.9-99.9% for TaqMan, 5x Omni, and PerfeCTa, respectively. PerfeCTa direct rt-PCR demonstrated similar or better sensitivity compared to 5x Omni direct rt-PCR or TaqMan traditional rt-PCR. Since the direct rt-PCR method does not require DNA extraction, it reduces the time and cost for processing CSF specimens, increases testing throughput, decreases the risk of cross-contamination, and conserves precious CSF. The direct rt-PCR method will be beneficial to laboratories with high testing volume.
Ghaju Shrestha, Rajani; Tanaka, Yasuhiro; Malla, Bikash; Bhandari, Dinesh; Tandukar, Sarmila; Inoue, Daisuke; Sei, Kazunari; Sherchand, Jeevan B; Haramoto, Eiji
2017-12-01
Bacteriological analysis of drinking water leads to detection of only conventional fecal indicator bacteria. This study aimed to explore and characterize bacterial diversity, to understand the extent of pathogenic bacterial contamination, and to examine the relationship between pathogenic bacteria and fecal indicator bacteria in different water sources in the Kathmandu Valley, Nepal. Sixteen water samples were collected from shallow dug wells (n=12), a deep tube well (n=1), a spring (n=1), and rivers (n=2) in September 2014 for 16S rRNA gene next-generation sequencing. A total of 525 genera were identified, of which 81 genera were classified as possible pathogenic bacteria. Acinetobacter, Arcobacter, and Clostridium were detected with a relatively higher abundance (>0.1% of total bacterial genes) in 16, 13, and 5 of the 16 samples, respectively, and the highest abundance ratio of Acinetobacter (85.14%) was obtained in the deep tube well sample. Furthermore, the bla OXA23-like genes of Acinetobacter were detected using SYBR Green-based quantitative PCR in 13 (35%) of 37 water samples, including the 16 samples that were analyzed for next-generation sequencing, with concentrations ranging 5.3-7.5logcopies/100mL. There was no sufficient correlation found between fecal indicator bacteria, such as Escherichia coli and total coliforms, and potential pathogenic bacteria, as well as the bla OXA23-like gene of Acinetobacter. These results suggest the limitation of using conventional fecal indicator bacteria in evaluating the pathogenic bacteria contamination of different water sources in the Kathmandu Valley. Copyright © 2017 Elsevier B.V. All rights reserved.
Survey of bacterial pathogens on leaves and seeds of red mangrove ...
African Journals Online (AJOL)
Bacterial pathogens of red mangrove (Rhizophora mangle) were investigated. 50 samples each of leaves and seeds (healthy and diseased) were randomly collected and used for the analysis. Mean bacterial counts obtained were: healthy and diseased leaves; 8.26 x 103 and 5.9 l x l03 cfu/ml respectively; healthy seeds ...
Hammarlöf, Disa L; Canals, Rocío; Hinton, Jay C D
2013-10-01
The availability of thousands of genome sequences of bacterial pathogens poses a particular challenge because each genome contains hundreds of genes of unknown function (FUN). How can we easily discover which FUN genes encode important virulence factors? One solution is to combine two different functional genomic approaches. First, transcriptomics identifies bacterial FUN genes that show differential expression during the process of mammalian infection. Second, global mutagenesis identifies individual FUN genes that the pathogen requires to cause disease. The intersection of these datasets can reveal a small set of candidate genes most likely to encode novel virulence attributes. We demonstrate this approach with the Salmonella infection model, and propose that a similar strategy could be used for other bacterial pathogens. Copyright © 2013 Elsevier Ltd. All rights reserved.
Biosensors for plant pathogen detection.
Khater, Mohga; de la Escosura-Muñiz, Alfredo; Merkoçi, Arben
2017-07-15
Infectious plant diseases are caused by pathogenic microorganisms such as fungi, bacteria, viruses, viroids, phytoplasma and nematodes. Worldwide, plant pathogen infections are among main factors limiting crop productivity and increasing economic losses. Plant pathogen detection is important as first step to manage a plant disease in greenhouses, field conditions and at the country boarders. Current immunological techniques used to detect pathogens in plant include enzyme-linked immunosorbent assays (ELISA) and direct tissue blot immunoassays (DTBIA). DNA-based techniques such as polymerase chain reaction (PCR), real time PCR (RT-PCR) and dot blot hybridization have also been proposed for pathogen identification and detection. However these methodologies are time-consuming and require complex instruments, being not suitable for in-situ analysis. Consequently, there is strong interest for developing new biosensing systems for early detection of plant diseases with high sensitivity and specificity at the point-of-care. In this context, we revise here the recent advancement in the development of advantageous biosensing systems for plant pathogen detection based on both antibody and DNA receptors. The use of different nanomaterials such as nanochannels and metallic nanoparticles for the development of innovative and sensitive biosensing systems for the detection of pathogens (i.e. bacteria and viruses) at the point-of-care is also shown. Plastic and paper-based platforms have been used for this purpose, offering cheap and easy-to-use really integrated sensing systems for rapid on-site detection. Beside devices developed at research and development level a brief revision of commercially available kits is also included in this review. Copyright © 2016 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Sheng-He eHuang
2016-02-01
Full Text Available Bacterial meningitis remains the leading cause of disabilities worldwide. This life-threatening disease has a high mortality rate despite the availability of antibiotics and improved critical care. The interactions between bacterial surface components and host defense systems that initiate bacterial meningitis have been studied in molecular and cellular detail over the past several decades. Bacterial meningitis commonly exhibits triad hallmark features (THFs: pathogen penetration, nuclear factor-kappaB (NF-B activation in coordination with type 1 interferon (IFN signaling and leukocyte transmigration that occur at the blood-brain barrier (BBB, which consists mainly of brain microvascular endothelial cells (BMEC. This review outlines the progression of these early inter-correlated events contributing to the central nervous system (CNS inflammation and injury during the pathogenesis of bacterial meningitis. A better understanding of these issues is not only imperative to elucidating the pathogenic mechanism of bacterial meningitis, but may also provide the in-depth insight into the development of novel therapeutic interventions against this disease.
Rasool, Muhammad H.; Siddique, Abu B.; Saqalein, Muhammad; Asghar, Muhammad J.; Zahoor, Muhammad A.; Aslam, Bilal; Shafiq, Humerah B.; Nisar, Muhammad A.
2016-01-01
Objective: To determine the occurrence of bacterial pathogens responsible for diarrhea and to engender information regarding the effectiveness of commonly used antibiotic against diarrhea. Methods: This cross-sectional study was conducted between April and July 2014. Samples were collected from the Divisional Headquarter and Allied Hospital, Faisalabad, Pakistan. The differential and selective media were used to isolate bacterial pathogens, which were identified through cultural character...
Zhang, D F; Zhang, Q Q; Li, A H
2014-11-01
Species of genus Aeromonas, Vibrio, Edwardsiella and Streptococcus are the most common fish pathogenic bacteria that cause economically devastating losses in aquaculture. A multiplex polymerase chain reaction (mPCR) was developed for the simultaneous detection and differentiation of the four genera of fish pathogenic bacteria. Through the use of genus-specific primers instead of species-specific ones, the current mPCR covered much more target bacterial species compared with previously reported species-specific mPCR methods. The specificity of the four putative genus-specific primers was validated experimentally while used exclusively (uniplex PCR) or combined (mPCR) against bacterial genomic DNA templates of the target bacteria and nontarget bacteria. The PCR amplicons for the following genera were obtained as expected: Aeromonas (875 bp), Vibrio (524 bp), Edwardsiella (302 bp) and Streptococcus (197 bp), and the fragments could be separated clearly on the agarose gel electrophoresis. The mPCR did not produce nonspecific amplification products when used to amplify 21 nontarget species of bacteria. The mPCR detection limits for each target bacterial genera were 50 colony-forming units (CFU) in pure culture and 100 CFU in fish tissue samples. In conclusion, the mPCR assay was proven to be a powerful alternative to the conventional culture-based method, given its rapid, specific, sensitive and reliable detection of target pathogens. The fish pathogenic bacteria of genus Aeromonas, Vibrio, Edwardsiella and Streptococcus frequently cause severe outbreaks of diseases in cultured fish, and the genus-specific multiplex PCR assay developed in this study can detect the bacteria of the four genera when present in the samples either alone or mixed. The mPCR assay is expected to identify the causative agents more efficiently than uniplex PCR or species-specific multiplex PCR for clinical diagnosis, resulting in the earlier implementation of control measures. This m
Detection of hepatitis E virus and other livestock-related pathogens in Iowa streams
Givens, Carrie E.; Kolpin, Dana W.; Borchardt, Mark A.; Duris, Joseph W.; Moorman, Thomas B.; Spencer, Susan K.
2016-01-01
Manure application is a source of pathogens to the environment. Through overland runoff and tile drainage, zoonotic pathogens can contaminate surface water and streambed sediment and could affect both wildlife and human health. This study examined the environmental occurrence of gene markers for livestock-related bacterial, protozoan, and viral pathogens and antibiotic resistance in surface waters within the South Fork Iowa River basin before and after periods of swine manure application on agricultural land. Increased concentrations of indicator bacteria after manure application exceeding Iowa's state bacteria water quality standards suggest that swine manure contributes to diminished water quality and may pose a risk to human health. Additionally, the occurrence of HEV and numerous bacterial pathogen genes for Escherichia coli, Enterococcus spp., Salmonella sp., and Staphylococcus aureus in both manure samples and in corresponding surface water following periods of manure application suggests a potential role for swine in the spreading of zoonotic pathogens to the surrounding environment. During this study, several zoonotic pathogens were detected including Shiga-toxin producing E. coli, Campylobacter jejuni, pathogenic enterococci, and S. aureus; all of which can pose mild to serious health risks to swine, humans, and other wildlife. This research provides the foundational understanding required for future assessment of the risk to environmental health from livestock-related zoonotic pathogen exposures in this region. This information could also be important for maintaining swine herd biosecurity and protecting the health of wildlife near swine facilities.
Dayao, Denise Ann Estarez; Seddon, Jennifer M; Gibson, Justine S; Blackall, Patrick J; Turni, Conny
2016-10-01
Macrolides are often used to treat and control bacterial pathogens causing respiratory disease in pigs. This study analyzed the whole genome sequences of one clinical isolate of Actinobacillus pleuropneumoniae, Haemophilus parasuis, Pasteurella multocida, and Bordetella bronchiseptica, all isolated from Australian pigs to identify the mechanism underlying the elevated minimum inhibitory concentrations (MICs) for erythromycin, tilmicosin, or tulathromycin. The H. parasuis assembled genome had a nucleotide transition at position 2059 (A to G) in the six copies of the 23S rRNA gene. This mutation has previously been associated with macrolide resistance but this is the first reported mechanism associated with elevated macrolide MICs in H. parasuis. There was no known macrolide resistance mechanism identified in the other three bacterial genomes. However, strA and sul2, aminoglycoside and sulfonamide resistance genes, respectively, were detected in one contiguous sequence (contig 1) of A. pleuropneumoniae assembled genome. This contig was identical to plasmids previously identified in Pasteurellaceae. This study has provided one possible explanation of elevated MICs to macrolides in H. parasuis. Further studies are necessary to clarify the mechanism causing the unexplained macrolide resistance in other Australian pig respiratory pathogens including the role of efflux systems, which were detected in all analyzed genomes.
Aptamer-Based Technologies in Foodborne Pathogen Detection.
Teng, Jun; Yuan, Fang; Ye, Yingwang; Zheng, Lei; Yao, Li; Xue, Feng; Chen, Wei; Li, Baoguang
2016-01-01
Aptamers are single stranded DNA or RNA ligands, which can be selected by a method called systematic evolution of ligands by exponential enrichment (SELEX); and they can specifically recognize and bind to their targets. These unique characteristics of aptamers offer great potentials in applications such as pathogen detection and biomolecular screening. Pathogen detection is the critical means in detecting and identifying the problems related to public health and food safety; and only the rapid, sensitive and efficient detection technologies can enable the users to make the accurate assessments on the risks of infections (humans and animals) or contaminations (foods and other commodities) caused by various pathogens. This article reviews the development in the field of the aptamer-based approaches for pathogen detection, including whole-cell SELEX and Genomic SELEX. Nowadays, a variety of aptamer-based biosensors have been developed for pathogen detection. Thus, in this review, we also cover the development in aptamer-based biosensors including optical biosensors for multiple pathogen detection by multiple-labeling or label-free models such as fluorescence detection and surface plasmon resonance, electrochemical biosensors and lateral chromatography test strips, and their applications in pathogen detection and biomolecular screening. While notable progress has been made in the field in the last decade, challenges or drawbacks in their applications such as pathogen detection and biomolecular screening remain to be overcome.
Aptamer-Based Technologies in Foodborne Pathogen Detection
Directory of Open Access Journals (Sweden)
Jun Teng
2016-09-01
Full Text Available Aptamers are single stranded DNA or RNA ligands, which can be selected by a method called systematic evolution of ligands by exponential enrichment (SELEX; and they can specifically recognize and bind to their targets. These unique characteristics of aptamers offer great potentials in applications such as pathogen detection and biomolecular screening. Pathogen detection is the first and critical means in detecting and identifying the problems related to public health and food safety; and only the rapid, sensitive and efficient detection technologies can enable the users to make to accurate assessments on the risk of infections (humans and animals or contaminations (foods and other commodities caused by various pathogens. This article reviews the developments in the field of the aptamer-based approaches for pathogen detection, including whole-cell SELEX and Genomic SELEX. Nowadays, a variety of aptamer-based biosensors have been developed for pathogen detection. Thus, in this review, we also cover the development of aptamer-based biosensors including optical biosensors for multiple pathogen detection in multiple-labeling or label-free models such as fluorescence detection and surface plasmon resonance, electrochemical biosensors, and lateral chromatography test strips, and their applications in the pathogen detection and biomolecular screening. While notable progress has been made in the field in the last decade, challenges or drawbacks in their applications such as pathogen detection and biomolecular screening, remain to be overcome.
Duris, Joseph W.; Reif, Andrew G.; Donna A. Crouse,; Isaacs, Natasha M.
2013-01-01
, stx1, and rfbO157 genes, but no genes were related exclusively to an individual MST marker. The human source pharmaceuticals (HSPs) acetaminophen and caffeine were correlated with Giardia, and the presence of HSPs proved to be more useful than MST markers in distinguishing the occurrence of Giardia. The HSPs caffeine and carbamazepine were correlated with the sum total of pathogen genes detected in a sample, demonstrating the value of using HSPs as an indicator of fecally derived pathogens. Sites influenced by urban land use with less forest were more likely to have greater FIB and Giardia densities and sum of the array of pathogen genes. Sites dominated by shallow carbonate bedrock in the upstream catchment were likely to have greater FIB densities and higher sum totals of pathogen genes but no correlation with Giardia detection. Our study provides a range of specific environmental, chemical, geologic, and land-use variables related to occurrence and distribution of FIB and selected bacterial and protozoan pathogens in Pennsylvania streams. The information presented could be useful for resource managers in understanding bacterial and protozoan pathogen occurrence and their relation to fecal indicator bacteria in similar settings.
Rapid detection of pathogenic bacteria by volatile organic compound (VOC) analysis
Senecal, Andre G.; Magnone, Joshua; Yeomans, Walter; Powers, Edmund M.
2002-02-01
Developments in rapid detection technologies have made countless improvements over the years. However, because of the limited sample that these technologies can process in a single run, the chance of capturing and identifying a small amount of pathogens is difficult. The problem is further magnified by the natural random distribution of pathogens in foods. Methods to simplify pathogenic detection through the identification of bacteria specific VOC were studied. E. coli O157:H7 and Salmonella typhimurium were grown on selected agar medium to model protein, and carbohydrate based foods. Pathogenic and common spoilage bacteria (Pseudomonas and Morexella) were screened for unique VOC production. Bacteria were grown on agar slants in closed vials. Headspace sampling was performed at intervals up to 24 hours using Solid Phase Micro-Extraction (SPME) techniques followed by GC/MS analysis. Development of unique volatiles was followed to establish sensitivity of detection. E. coli produced VOC not found in either Trypticase Soy Yeast (TSY) agar blanks or spoilage organism samples were - indole, 1-decanol, and 2-nonanone. Salmonella specific VOC grown on TSY were 3-methyl-1-butanol, dimethyl sulfide, 2-undecanol, 2-pentadecanol and 1-octanol. Trials on potato dextrose agar (PDA) slants indicated VOC specific for E. coli and Salmonella when compared to PDA blanks and Pseudomonas samples. However, these VOC peaks were similar for both pathogens. Morexella did not grow on PDA slants. Work will continue with model growth mediums at various temperatures, and mixed flora inoculums. As well as, VOC production based on the dynamics of bacterial growth.
Clark, Emily L; Emmadi, Madhu; Krupp, Katharine L; Podilapu, Ananda R; Helble, Jennifer D; Kulkarni, Suvarn S; Dube, Danielle H
2016-12-16
Bacterial glycans contain rare, exclusively bacterial monosaccharides that are frequently linked to pathogenesis and essentially absent from human cells. Therefore, bacterial glycans are intriguing molecular targets. However, systematic discovery of bacterial glycoproteins is hampered by the presence of rare deoxy amino sugars, which are refractory to traditional glycan-binding reagents. Thus, the development of chemical tools that label bacterial glycans is a crucial step toward discovering and targeting these biomolecules. Here, we explore the extent to which metabolic glycan labeling facilitates the studying and targeting of glycoproteins in a range of pathogenic and symbiotic bacterial strains. We began with an azide-containing analog of the naturally abundant monosaccharide N-acetylglucosamine and discovered that it is not broadly incorporated into bacterial glycans, thus revealing a need for additional azidosugar substrates to broaden the utility of metabolic glycan labeling in bacteria. Therefore, we designed and synthesized analogs of the rare deoxy amino d-sugars N-acetylfucosamine, bacillosamine, and 2,4-diacetamido-2,4,6-trideoxygalactose and established that these analogs are differentially incorporated into glycan-containing structures in a range of pathogenic and symbiotic bacterial species. Further application of these analogs will refine our knowledge of the glycan repertoire in diverse bacteria and may find utility in treating a variety of infectious diseases with selectivity.
Intracellular phase for an extracellular bacterial pathogen: MgtC shows the way
Directory of Open Access Journals (Sweden)
Audrey Bernut
2015-08-01
Full Text Available Pseudomonas aeruginosa is an extracellular pathogen known to impair host phagocytic functions. However, our recent results identify MgtC as a novel actor in P. aeruginosa virulence, which plays a role in an intramacrophage phase of this pathogen. In agreement with its intracellular function, P. aeruginosa mgtC gene expression is strongly induced when the bacteria reside within macrophages. MgtC was previously known as a horizontally-acquired virulence factor important for multiplication inside macrophages in several intracellular bacterial pathogens. MgtC thus provides a singular example of a virulence determinant that subverts macrophages both in intracellular and extracellular pathogens. Moreover, we demonstrate that P. aeru-ginosa MgtC is required for optimal growth in Mg2+ deprived medium, a property shared by MgtC factors from intracellular pathogens and, under Mg2+ limitation, P. aeruginosaMgtC prevents biofilm formation. We propose that MgtC has a similar function in intracellular and extracellular pathogens, which contributes to macrophage resistance and fine-tune adaptation to the host in relation to the different bacterial lifestyles. MgtC thus appears as an attractive target for antivirulence strategies and our work provides a natural peptide as MgtC antagonist, which paves the way for the development of MgtC inhibitors.
A Rab-centric perspective of bacterial pathogen-occupied vacuoles.
Sherwood, Racquel Kim; Roy, Craig R
2013-09-11
The ability to create and maintain a specialized organelle that supports bacterial replication is an important virulence property for many intracellular pathogens. Living in a membrane-bound vacuole presents inherent challenges, including the need to remodel a plasma membrane-derived organelle into a novel structure that will expand and provide essential nutrients to support replication, while also having the vacuole avoid membrane transport pathways that target bacteria for destruction in lysosomes. It is clear that pathogenic bacteria use different strategies to accomplish these tasks. The dynamics by which host Rab GTPases associate with pathogen-occupied vacuoles provide insight into the mechanisms used by different bacteria to manipulate host membrane transport. In this review we highlight some of the strategies bacteria use to maintain a pathogen-occupied vacuole by focusing on the Rab proteins involved in biogenesis and maintenance of these novel organelles. Copyright © 2013 Elsevier Inc. All rights reserved.
Histo-FISH protocol to detect bacterial compositions and biofilms formation in vivo.
Madar, M; Slizova, M; Czerwinski, J; Hrckova, G; Mudronova, D; Gancarcikova, S; Popper, M; Pistl, J; Soltys, J; Nemcova, R
2015-01-01
The study of biofilm function in vivo in various niches of the gastrointestinal tract (GIT) is rather limited. It is more frequently used in in vitro approaches, as an alternative to the studies focused on formation mechanisms and function of biofilms, which do not represent the actual in vivo complexity of microbial structures. Additionally, in vitro tests can sometimes lead to unreliable results. The goal of this study was to develop a simple approach to detect bacterial populations, particularly Lactobacillus and Bifidobacterium in biofilms, in vivo by the fluorescent in situ hybridisation (FISH) method. We standardised a new Histo-FISH method based on specific fluorochrome labelling probes which are able to detect Lactobacillus spp. and Bifidobacterium spp. within biofilms on the mucosal surface of the GIT embedded in paraffin in histological slices. This method is also suitable for visualisation of bacterial populations in the GIT internal content. Depending on the labelling probes, the Histo-FISH method has the potential to detect other probiotic strains or pathogenic bacteria. This original approach permits us to analyse bacterial colonisation processes as well as biofilm formation in stomach and caecum of BALB/c and germ-free mice.
Hemocytes from Pediculus humanus humanus are hosts for human bacterial pathogens.
Directory of Open Access Journals (Sweden)
Eric eGhigo
2015-01-01
Full Text Available Pediculus humanus humanus is an human ectoparasite which represents a serious public health threat because it is vector for pathogenic bacteria. It is important to understand and identify where bacteria reside in human body lice to define new strategies to counterstroke the capacity of vectorization of the bacterial pathogens by body lice. It is known that phagocytes from vertebrates can be hosts or reservoirs for several microbes. Therefore, we wondered if Pediculus humanus humanus phagocytes could hide pathogens. In this study, we characterized the phagocytes from Pediculus humanus humanus and evaluated their contribution as hosts for human pathogens such as Rickettsia prowazekii, Bartonella quintana and Acinetobacter baumannii.
Bacterial Serine/Threonine Protein Kinases in Host-Pathogen Interactions*
Canova, Marc J.; Molle, Virginie
2014-01-01
In bacterial pathogenesis, monitoring and adapting to the dynamically changing environment in the host and an ability to disrupt host immune responses are critical. The virulence determinants of pathogenic bacteria include the sensor/signaling proteins of the serine/threonine protein kinase (STPK) family that have a dual role of sensing the environment and subverting specific host defense processes. STPKs can sense a wide range of signals and coordinate multiple cellular processes to mount an appropriate response. Here, we review some of the well studied bacterial STPKs that are essential virulence factors and that modify global host responses during infection. PMID:24554701
Bacterial serine/threonine protein kinases in host-pathogen interactions.
Canova, Marc J; Molle, Virginie
2014-04-04
In bacterial pathogenesis, monitoring and adapting to the dynamically changing environment in the host and an ability to disrupt host immune responses are critical. The virulence determinants of pathogenic bacteria include the sensor/signaling proteins of the serine/threonine protein kinase (STPK) family that have a dual role of sensing the environment and subverting specific host defense processes. STPKs can sense a wide range of signals and coordinate multiple cellular processes to mount an appropriate response. Here, we review some of the well studied bacterial STPKs that are essential virulence factors and that modify global host responses during infection.
Characterisation of bacterial brown spot pathogen from dry bean ...
African Journals Online (AJOL)
Pseudomonas syringae pv. syringae (Pss) causes bacterial brown spot (BBS) of beans (Phaseolus vulgaris L.), with yield losses of up to 55% in South Africa. Pss has a wide host range and for many of these, the pathogen has been biochemically and genetically characterised. However, few studies have been conducted on ...
Directory of Open Access Journals (Sweden)
Coutinho Henrique
2008-11-01
Full Text Available Abstract Cystic fibrosis is the most common and best known genetic disease involving a defect in transepithelial Cl- transport by mutations in the CF gene on chromosome 7, which codes for the cystic fibrosis transmembrane conductance regulator protein (CFTR. The most serious symptoms are observed in the lungs, augmenting the risk of bacterial infection. The objective of this review was to describe the bacterial pathogens colonizing patients with cystic fibrosis. A systematic search was conducted using the international bibliographic databanks SCIELO, HIGHWIRE, PUBMED, SCIRUS and LILACS to provide a useful and practical review for healthcare workers to make them aware of these microorganisms. Today, B. cepacia, P. aeruginosa and S. aureus are the most important infectious agents in cystic fibrosis patients. However, healthcare professionals must pay attention to emerging infectious agents in these patients, because they represent a potentially serious future problem. Therefore, these pathogens should be pointed out as a risk to these patients, and hospitals all over the world must be prepared to detect and combat these bacteria.
Wang, Zhenzhen; Chen, Zhaowei; Gao, Nan; Ren, Jinsong; Qu, Xiaogang
2015-10-07
Herein, for the first time, we presented a simple and general approach by using personal glucose meters (PGM) for portable and ultrasensitive detection of microbial pathogens. Upon addition of pathogenic bacteria, glucoamylase-quaternized magnetic nanoparticles (GA-QMNPS) conjugates were disrupted by the competitive multivalent interactions between bacteria and QMNPS, resulting in the release of GA. After magnetic separation, the free GA could catalyze the hydrolysis of amylose into glucose for quantitative readout by PGM. In such way, PGM was transmuted into a bacterial detection device and extremely low detection limits down to 20 cells mL(-1) was achieved. More importantly, QMNPS could inhibit the growth of the bacteria and destroy its cellular structure, which enabled bacteria detection and inhibition simultaneously. The simplicity, portability, sensitivity and low cost of presented work make it attractive for clinical applications. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Bithionol blocks pathogenicity of bacterial toxins, ricin, and Zika virus
Disease pathways form overlapping networks, and hub proteins represent attractive targets for broad-spectrum drugs. Using bacterial toxins as a proof of concept, we describe a new approach of discovering broad-spectrum therapies capable of inhibiting host proteins that mediate multiple pathogenic pa...
Antibacterial Activity of Polyphenolic Fraction of Kombucha Against Enteric Bacterial Pathogens.
Bhattacharya, Debanjana; Bhattacharya, Semantee; Patra, Madhu Manti; Chakravorty, Somnath; Sarkar, Soumyadev; Chakraborty, Writachit; Koley, Hemanta; Gachhui, Ratan
2016-12-01
The emergence of multi-drug-resistant enteric pathogens has prompted the scientist community to explore the therapeutic potentials of traditional foods and beverages. The present study was undertaken to investigate the efficacy of Kombucha, a fermented beverage of sugared black tea, against enterotoxigenic Escherichia coli, Vibrio cholerae, Shigella flexneri and Salmonella Typhimurium followed by the identification of the antibacterial components present in Kombucha. The antibacterial activity was evaluated by determining the inhibition zone diameter, minimal inhibitory concentration and minimal bactericidal concentration. Kombucha fermented for 14 days showed maximum activity against the bacterial strains. Its ethyl acetate extract was found to be the most effective upon sequential solvent extraction of the 14-day Kombucha. This potent ethyl acetate extract was then subjected to thin layer chromatography for further purification of antibacterial ingredients which led to the isolation of an active polyphenolic fraction. Catechin and isorhamnetin were detected as the major antibacterial compounds present in this polyphenolic fraction of Kombucha by High Performance Liquid Chromatography. Catechin, one of the primary antibacterial polyphenols in tea was also found to be present in Kombucha. But isorhamnetin is not reported to be present in tea, which may thereby suggest the role of fermentation process of black tea for its production in Kombucha. To the best of our knowledge, this is the first report on the presence of isorhamnetin in Kombucha. The overall study suggests that Kombucha can be used as a potent antibacterial agent against entero-pathogenic bacterial infections, which mainly is attributed to its polyphenolic content.
Waterborne Pathogens: Detection Methods and Challenges
Directory of Open Access Journals (Sweden)
Flor Yazmín Ramírez-Castillo
2015-05-01
Full Text Available Waterborne pathogens and related diseases are a major public health concern worldwide, not only by the morbidity and mortality that they cause, but by the high cost that represents their prevention and treatment. These diseases are directly related to environmental deterioration and pollution. Despite the continued efforts to maintain water safety, waterborne outbreaks are still reported globally. Proper assessment of pathogens on water and water quality monitoring are key factors for decision-making regarding water distribution systems’ infrastructure, the choice of best water treatment and prevention waterborne outbreaks. Powerful, sensitive and reproducible diagnostic tools are developed to monitor pathogen contamination in water and be able to detect not only cultivable pathogens but also to detect the occurrence of viable but non-culturable microorganisms as well as the presence of pathogens on biofilms. Quantitative microbial risk assessment (QMRA is a helpful tool to evaluate the scenarios for pathogen contamination that involve surveillance, detection methods, analysis and decision-making. This review aims to present a research outlook on waterborne outbreaks that have occurred in recent years. This review also focuses in the main molecular techniques for detection of waterborne pathogens and the use of QMRA approach to protect public health.
Sharma, Manan; Reynnells, Russell
2016-08-01
Biological soil amendments (BSAs) such as manure and compost are frequently used as organic fertilizers to improve the physical and chemical properties of soils. However, BSAs have been known to be a reservoir for enteric bacterial pathogens such as enterohemorrhagic Escherichia coli (EHEC), Salmonella spp., and Listeria spp. There are numerous mechanisms by which manure may transfer pathogens to growing fruits and vegetables, and several outbreaks of infections have been linked to manure-related contamination of leafy greens. In the United States several commodity-specific guidelines and current and proposed federal rules exist to provide guidance on the application of BSAs as fertilizers to soils, some of which require an interval between the application of manure to soils and the harvest of fruits and vegetables. This review examines the survival, persistence, and regrowth/resuscitation of bacterial pathogens in manure, biosolids, and composts. Moisture, along with climate and the physicochemical properties of soil, manure, or compost, plays a significant role in the ability of pathogens to persist and resuscitate in amended soils. Adaptation of enteric bacterial pathogens to the nonhost environment of soils may also extend their persistence in manure- or compost-amended soils. The presence of antibiotic-resistance genes in soils may also be increased by manure application. Overall, BSAs applied as fertilizers to soils can support the survival and regrowth of pathogens. BSAs should be handled and applied in a manner that reduces the prevalence of pathogens in soils and the likelihood of transfer of food-borne pathogens to fruits and vegetables. This review will focus on two BSAs-raw manure and composted manure (and other feedstocks)-and predominantly on the survival of enteric bacterial pathogens in BSAs as applied to soils as organic fertilizers.
Directed antigen delivery as a vaccine strategy for an intracellular bacterial pathogen
Bouwer, H. G. Archie; Alberti-Segui, Christine; Montfort, Megan J.; Berkowitz, Nathan D.; Higgins, Darren E.
2006-03-01
We have developed a vaccine strategy for generating an attenuated strain of an intracellular bacterial pathogen that, after uptake by professional antigen-presenting cells, does not replicate intracellularly and is readily killed. However, after degradation of the vaccine strain within the phagolysosome, target antigens are released into the cytosol for endogenous processing and presentation for stimulation of CD8+ effector T cells. Applying this strategy to the model intracellular pathogen Listeria monocytogenes, we show that an intracellular replication-deficient vaccine strain is cleared rapidly in normal and immunocompromised animals, yet antigen-specific CD8+ effector T cells are stimulated after immunization. Furthermore, animals immunized with the intracellular replication-deficient vaccine strain are resistant to lethal challenge with a virulent WT strain of L. monocytogenes. These studies suggest a general strategy for developing safe and effective, attenuated intracellular replication-deficient vaccine strains for stimulation of protective immune responses against intracellular bacterial pathogens. CD8+ T cell | replication-deficient | Listeria monocytogenes
Integrated Detection of Pathogens and Host Biomarkers for Wounds
Energy Technology Data Exchange (ETDEWEB)
Jaing, C
2012-03-19
The increasing incidence and complications arising from combat wounds has necessitated a reassessment of methods for effective treatment. Infection, excessive inflammation, and incidence of drug-resistant organisms all contribute toward negative outcomes for afflicted individuals. The organisms and host processes involved in wound progression, however, are incompletely understood. We therefore set out, using our unique technical resources, to construct a profile of combat wounds which did or did not successfully resolve. We employed the Lawrence Livermore Microbial Detection Array and identified a number of nosocomial pathogens present in wound samples. Some of these identities corresponded with bacterial isolates previously cultured, while others were not obtained via standard microbiology. Further, we optimized proteomics protocols for the identification of host biomarkers indicative of various stages in wound progression. In combination with our pathogen data, our biomarker discovery efforts will provide a profile corresponding to wound complications, and will assist significantly in treatment of these complex cases.
Convergent use of RhoGAP toxins by eukaryotic parasites and bacterial pathogens.
Directory of Open Access Journals (Sweden)
Dominique Colinet
2007-12-01
Full Text Available Inactivation of host Rho GTPases is a widespread strategy employed by bacterial pathogens to manipulate mammalian cellular functions and avoid immune defenses. Some bacterial toxins mimic eukaryotic Rho GTPase-activating proteins (GAPs to inactivate mammalian GTPases, probably as a result of evolutionary convergence. An intriguing question remains whether eukaryotic pathogens or parasites may use endogenous GAPs as immune-suppressive toxins to target the same key genes as bacterial pathogens. Interestingly, a RhoGAP domain-containing protein, LbGAP, was recently characterized from the parasitoid wasp Leptopilina boulardi, and shown to protect parasitoid eggs from the immune response of Drosophila host larvae. We demonstrate here that LbGAP has structural characteristics of eukaryotic RhoGAPs but that it acts similarly to bacterial RhoGAP toxins in mammals. First, we show by immunocytochemistry that LbGAP enters Drosophila immune cells, plasmatocytes and lamellocytes, and that morphological changes in lamellocytes are correlated with the quantity of LbGAP they contain. Demonstration that LbGAP displays a GAP activity and specifically interacts with the active, GTP-bound form of the two Drosophila Rho GTPases Rac1 and Rac2, both required for successful encapsulation of Leptopilina eggs, was then achieved using biochemical tests, yeast two-hybrid analysis, and GST pull-down assays. In addition, we show that the overall structure of LbGAP is similar to that of eukaryotic RhoGAP domains, and we identify distinct residues involved in its interaction with Rac GTPases. Altogether, these results show that eukaryotic parasites can use endogenous RhoGAPs as virulence factors and that despite their differences in sequence and structure, eukaryotic and bacterial RhoGAP toxins are similarly used to target the same immune pathways in insects and mammals.
Directory of Open Access Journals (Sweden)
Niraj Shrestha
Full Text Available Here we show that cells lacking the heme-regulated inhibitor (HRI are highly resistant to infection by bacterial pathogens. By examining the infection process in wild-type and HRI null cells, we found that HRI is required for pathogens to execute their virulence-associated cellular activities. Specifically, unlike wild-type cells, HRI null cells infected with the gram-negative bacterial pathogen Yersinia are essentially impervious to the cytoskeleton-damaging effects of the Yop virulence factors. This effect is due to reduced functioning of the Yersinia type 3 secretion (T3S system which injects virulence factors directly into the host cell cytosol. Reduced T3S activity is also observed in HRI null cells infected with the bacterial pathogen Chlamydia which results in a dramatic reduction in its intracellular proliferation. We go on to show that a HRI-mediated process plays a central role in the cellular infection cycle of the Gram-positive pathogen Listeria. For this pathogen, HRI is required for the post-invasion trafficking of the bacterium to the infected host cytosol. Thus by depriving Listeria of its intracellular niche, there is a highly reduced proliferation of Listeria in HRI null cells. We provide evidence that these infection-associated functions of HRI (an eIF2α kinase are independent of its activity as a regulator of protein synthesis. This is the first report of a host factor whose absence interferes with the function of T3S secretion and cytosolic access by pathogens and makes HRI an excellent target for inhibitors due to its broad virulence-associated activities.
The neglected intrinsic resistome of bacterial pathogens.
Directory of Open Access Journals (Sweden)
Alicia Fajardo
Full Text Available Bacteria with intrinsic resistance to antibiotics are a worrisome health problem. It is widely believed that intrinsic antibiotic resistance of bacterial pathogens is mainly the consequence of cellular impermeability and activity of efflux pumps. However, the analysis of transposon-tagged Pseudomonas aeruginosa mutants presented in this article shows that this phenotype emerges from the action of numerous proteins from all functional categories. Mutations in some genes make P. aeruginosa more susceptible to antibiotics and thereby represent new targets. Mutations in other genes make P. aeruginosa more resistant and therefore define novel mechanisms for mutation-driven acquisition of antibiotic resistance, opening a new research field based in the prediction of resistance before it emerges in clinical environments. Antibiotics are not just weapons against bacterial competitors, but also natural signalling molecules. Our results demonstrate that antibiotic resistance genes are not merely protective shields and offer a more comprehensive view of the role of antibiotic resistance genes in the clinic and in nature.
Charlermroj, Ratthaphol; Himananto, Orawan; Seepiban, Channarong; Kumpoosiri, Mallika; Warin, Nuchnard; Gajanandana, Oraprapai; Elliott, Christopher T; Karoonuthaisiri, Nitsara
2014-07-15
The global seed market is considered to be an important industry with a total value of $10,543 million US dollars in 2012. Because plant pathogens such as bacteria and viruses cause a significant economic loss to both producers and exporters, the seed export industry urgently requires rapid, sensitive, and inexpensive testing for the pathogens to prevent disease spreading worldwide. This study developed an antibody array in a multiwell plate format to simultaneously detect four crucial plant pathogens, namely, a bacterial fruit blotch bacterium Acidovorax avenae subsp. citrulli (Aac), Chilli veinal mottle virus (ChiVMV, potyvirus), Watermelon silver mottle virus (WSMoV, tospovirus serogroup IV), and Melon yellow spot virus (MYSV, tospovirus). The capture antibodies specific to the pathogens were immobilized on each well at preassigned positions by an automatic microarrayer. The antibodies on the arrays specifically captured the corresponding pathogens present in the sample extracts. The presence of pathogens bound on the capture antibodies was subsequently detected by a cocktail of fluorescently conjugated secondary antibodies. The limits of detection of the developed antibody array for the detection of Aac, ChiVMV, WSMoV, and MYSV were 5 × 10(5) CFU/mL, 30 ng/mL, 1000 ng/mL, and 160 ng/mL, respectively, which were very similar to those of the conventional ELISA method. The antibody array in a multiwell plate format accurately detected plant pathogens in single and multiple detections. Moreover, this format enables easy handling of the assay at a higher speed of operation.
Liu, Xiang-Ye; Gong, Xiang-Yao; Zheng, Chen; Song, Qi-Yuan; Chen, Ting; Wang, Jing; Zheng, Jie; Deng, Hong-Kuan; Zheng, Kui-Yang
2017-03-01
Ticks are able to transmit various pathogens-viruses, bacteria, and parasites-to their host during feeding. Several molecular epidemiological surveys have been performed to evaluate the risk of tick-borne pathogens in China, but little is known about pathogens circulating in ticks from eastern China. Therefore, this study aimed to investigate the presence of bacteria and parasites in ticks collected from Xuzhou, a 11258km 2 region in eastern China. In the present study, ticks were collected from domestic goats and grasses in urban districts of Xuzhou region from June 2015 to July 2016. After tick species identification, the presence of tick-borne bacterial and parasitic pathogens, including Anaplasma phagocytophilum, Borrelia burgdorferi, Rickettsia sp., Bartonella sp., Babesia sp., and Theileria sp., was established via conventional or nested polymerase chain reaction assays (PCR) and sequence analysis. Finally, a total of 500 questing adult ticks, identified as Haemaphysalis longicornis, were investigated. Among them, 28/500 tick samples (5.6%) were infected with A. phagocytophilum, and 23/500 (4.6%) with Theileria luwenshuni, whereas co-infection with these pathogens was detected in only 1/51 (2%) of all infected ticks. In conclusion, H. longicornis is the dominant tick species in the Xuzhou region and plays an important role in zoonotic pathogen transmission. Both local residents and animals are at a significant risk of exposure to anaplasmosis and theileriosis, due to the high rates of A. phagocytophilum and T. luwenshuni tick infection. Copyright © 2016 Elsevier B.V. All rights reserved.
Dohrmann, Anja B; Baumert, Susann; Klingebiel, Lars; Weiland, Peter; Tebbe, Christoph C
2011-03-01
Microbial conversion of organic waste or harvested plant material into biogas has become an attractive technology for energy production. Biogas is produced in reactors under anaerobic conditions by a consortium of microorganisms which commonly include bacteria of the genus Clostridium. Since the genus Clostridium also harbors some highly pathogenic members in its phylogenetic cluster I, there has been some concern that an unintended growth of such pathogens might occur during the fermentation process. Therefore this study aimed to follow how process parameters affect the diversity of Bacteria in general, and the diversity of Clostridium cluster I members in particular. The development of both communities was followed in model biogas reactors from start-up during stable methanogenic conditions. The biogas reactors were run with either cattle or pig manures as substrates, and both were operated at mesophilic and thermophilic conditions. The structural diversity was analyzed independent of cultivation using a PCR-based detection of 16S rRNA genes and genetic profiling by single-strand conformation polymorphism (SSCP). Genetic profiles indicated that both bacterial and clostridial communities evolved in parallel, and the community structures were highly influenced by both substrate and temperature. Sequence analysis of 16S rRNA genes recovered from prominent bands from SSCP profiles representing Clostridia detected no pathogenic species. Thus, this study gave no indication that pathogenic clostridia would be enriched as dominant community members in biogas reactors fed with manure.
Radiation Sensitivity of some Food Borne Bacterial Pathogens in Animal Foods and Minced Meat
International Nuclear Information System (INIS)
Mohammed, W.S.; Ali, A.R.; Alexan, A.F.
2010-01-01
Bacteriological examination of 100 samples of animal food stuffs (fish meal and bone and meat meal; as models of dry food materials) and 50 samples of minced meat (as a model of moist food materials) revealed the isolation of different bacterial pathogens; Escherichia coli, Klebsiella spp., Pseudomonas aeruginosa, Proteus spp., Staph. aureus and Salmonella species, in a decreasing order of occurrence. In the experiment; the dry food stuffs were sterilized in autoclave and the minced meat was sterilized by gamma irradiation at 10 kGy. The efficacy of gamma irradiation against the inoculated bacterial isolates (E coli 0157: H7, Salmonella enteritidis and Staph. aureus) in animal food stuffs and minced meat was investigated. Irradiated samples were stored at room temperature (25 degree C) for 2 weeks. The food borne pathogens used in this study showed a difference in radiation sensitivity. E. coli 0157: H7, Staphylococcus aureus and Salmonella enteritidis were eradicated at 1, 2 and 3 kGy, respectively. Also, inoculated pathogens in minced meat were more sensitive to ionizing radiation than dry animal food stuffs. It could be concluded that low doses of gamma irradiation are effective means of inactivating pathogenic bacteria. This radiation sensitivity is related to the bacterial isolates and the evaluated growth
Molecular Epidemiologic Typing Systems of Bacterial Pathogens: Current Issues and Perpectives
Directory of Open Access Journals (Sweden)
Struelens Marc J
1998-01-01
Full Text Available The epidemiologic typing of bacterial pathogens can be applied to answer a number of different questions: in case of outbreak, what is the extent and mode of transmission of epidemic clone(s ? In case of long-term surveillance, what is the prevalence over time and the geographic spread of epidemic and endemic clones in the population? A number of molecular typing methods can be used to classify bacteria based on genomic diversity into groups of closely-related isolates (presumed to arise from a common ancestor in the same chain of transmission and divergent, epidemiologically-unrelated isolates (arising from independent sources of infection. Ribotyping, IS-RFLP fingerprinting, macrorestriction analysis of chromosomal DNA and PCR-fingerprinting using arbitrary sequence or repeat element primers are useful methods for outbreak investigations and regional surveillance. Library typing systems based on multilocus sequence-based analysis and strain-specific probe hybridization schemes are in development for the international surveillance of major pathogens like Mycobacterium tuberculosis. Accurate epidemiological interpretation of data obtained with molecular typing systems still requires additional research on the evolution rate of polymorphic loci in bacterial pathogens.
Microfluidic system for the identification of bacterial pathogens causing urinary tract infections
Becker, Holger; Hlawatsch, Nadine; Haraldsson, Tommy; van der Wijngaart, Wouter; Lind, Anders; Malhotra-Kumar, Surbi; Turlej-Rogacka, Agata; Goossens, Herman
2015-03-01
Urinary tract infections (UTIs) are among the most common bacterial infections and pose a significant healthcare burden. The growing trend in antibiotic resistance makes it mandatory to develop diagnostic kits which allow not only the determination of a pathogen but also the antibiotic resistances. We have developed a microfluidic cartridge which takes a direct urine sample, extracts the DNA, performs an amplification using batch-PCR and flows the sample over a microarray which is printed into a microchannel for fluorescence detection. The cartridge is injection-molded out of COP and contains a set of two-component injection-molded rotary valves to switch between input and to isolate the PCR chamber during thermocycling. The hybridization probes were spotted directly onto a functionalized section of the outlet microchannel. We have been able to successfully perform PCR of E.coli in urine in this chip and perform a fluorescence detection of PCR products. An upgraded design of the cartridge contains the buffers and reagents in blisters stored on the chip.
Prediction of molecular mimicry candidates in human pathogenic bacteria.
Doxey, Andrew C; McConkey, Brendan J
2013-08-15
Molecular mimicry of host proteins is a common strategy adopted by bacterial pathogens to interfere with and exploit host processes. Despite the availability of pathogen genomes, few studies have attempted to predict virulence-associated mimicry relationships directly from genomic sequences. Here, we analyzed the proteomes of 62 pathogenic and 66 non-pathogenic bacterial species, and screened for the top pathogen-specific or pathogen-enriched sequence similarities to human proteins. The screen identified approximately 100 potential mimicry relationships including well-characterized examples among the top-scoring hits (e.g., RalF, internalin, yopH, and others), with about 1/3 of predicted relationships supported by existing literature. Examination of homology to virulence factors, statistically enriched functions, and comparison with literature indicated that the detected mimics target key host structures (e.g., extracellular matrix, ECM) and pathways (e.g., cell adhesion, lipid metabolism, and immune signaling). The top-scoring and most widespread mimicry pattern detected among pathogens consisted of elevated sequence similarities to ECM proteins including collagens and leucine-rich repeat proteins. Unexpectedly, analysis of the pathogen counterparts of these proteins revealed that they have evolved independently in different species of bacterial pathogens from separate repeat amplifications. Thus, our analysis provides evidence for two classes of mimics: complex proteins such as enzymes that have been acquired by eukaryote-to-pathogen horizontal transfer, and simpler repeat proteins that have independently evolved to mimic the host ECM. Ultimately, computational detection of pathogen-specific and pathogen-enriched similarities to host proteins provides insights into potentially novel mimicry-mediated virulence mechanisms of pathogenic bacteria.
Impact of Aerosol Dust on xMAP Multiplex Detection of Different Class Pathogens
Directory of Open Access Journals (Sweden)
Denis A. Kleymenov
2017-11-01
Full Text Available Environmental or city-scale bioaerosol surveillance can provide additional value for biodefense and public health. Efficient bioaerosol monitoring should rely on multiplex systems capable of detecting a wide range of biologically hazardous components potentially present in air (bacteria, viruses, toxins and allergens. xMAP technology from LuminexTM allows multiplex bead-based detection of antigens or nucleic acids, but its use for simultaneous detection of different classes of pathogens (bacteria, virus, toxin is questionable. Another problem is the detection of pathogens in complex matrices, e.g., in the presence of dust. In the this research, we developed the model xMAP multiplex test-system aiRDeTeX 1.0, which enables detection of influenza A virus, Adenovirus type 6 Salmonella typhimurium, and cholera toxin B subunit representing RNA virus, DNA virus, gram-negative bacteria and toxin respectively as model organisms of biologically hazardous components potentially present in or spreadable through the air. We have extensively studied the effect of matrix solution (PBS, distilled water, environmental dust and ultrasound treatment for monoplex and multiplex detection efficiency of individual targets. All targets were efficiently detectable in PBS and in the presence of dust. Ultrasound does not improve the detection except for bacterial LPS.
Directory of Open Access Journals (Sweden)
Isaac-Márquez Angélica Patricia
2003-01-01
Full Text Available We investigated the bacterial flora present in skin lesions of patients with chiclero's ulcer from the Yucatan peninsula of Mexico using conventional culture methods (11 patients, and an immunocolorimetric detection of pathogenic Streptococcus pyogenes (15 patients. Prevalence of bacteria isolated by culture methods was 90.9% (10/11. We cultured, from chiclero's ulcers (60%, pathogenic bacterial such as Staphylococcus aureus (20%, S. pyogenes (1.6%, Pseudomonas aeruginosa (1.6%, Morganella morganii (1.6%, and opportunist pathogenic bacteria such as Klebsiella spp. (20.0%, Enterobacter spp. (20%, and Enterococcus spp. (20%. We also cultured coagulase-negative staphylococci in 40% (4/10 of the remaining patients. Micrococcus spp. and coagulase-negative staphylococci constituted the bacterial genuses more frequently isolated in the normal skin of patients with chiclero's ulcer and healthy individuals used as controls. We also undertook another study to find out the presence of S. pyogenes by an immunocolorimetric assay. This study indicated that 60% (9/15 of the ulcerated lesions, but not normal controls, were contaminated with S. pyogenes. Importantly, individuals with purulent secretion and holding concomitant infections with S. pyogenes, S. aureus, P. aeruginosa, M. morganii, and E. durans took longer to heal Leishmania (L. mexicana infections treated with antimonial drugs. Our results suggest the need to eliminate bacterial purulent infections, by antibiotic treatment, before starting antimonial administration to patients with chiclero's ulcer.
Molecular detection of pathogens in water--the pros and cons of molecular techniques.
Girones, Rosina; Ferrús, Maria Antonia; Alonso, José Luis; Rodriguez-Manzano, Jesus; Calgua, Byron; Corrêa, Adriana de Abreu; Hundesa, Ayalkibet; Carratala, Anna; Bofill-Mas, Sílvia
2010-08-01
Pollution of water by sewage and run-off from farms produces a serious public health problem in many countries. Viruses, along with bacteria and protozoa in the intestine or in urine are shed and transported through the sewer system. Even in highly industrialized countries, pathogens, including viruses, are prevalent throughout the environment. Molecular methods are used to monitor viral, bacterial, and protozoan pathogens, and to track pathogen- and source-specific markers in the environment. Molecular techniques, specifically polymerase chain reaction-based methods, provide sensitive, rapid, and quantitative analytical tools with which to study such pathogens, including new or emerging strains. These techniques are used to evaluate the microbiological quality of food and water, and to assess the efficiency of virus removal in drinking and wastewater treatment plants. The range of methods available for the application of molecular techniques has increased, and the costs involved have fallen. These developments have allowed the potential standardization and automation of certain techniques. In some cases they facilitate the identification, genotyping, enumeration, viability assessment, and source-tracking of human and animal contamination. Additionally, recent improvements in detection technologies have allowed the simultaneous detection of multiple targets in a single assay. However, the molecular techniques available today and those under development require further refinement in order to be standardized and applicable to a diversity of matrices. Water disinfection treatments may have an effect on the viability of pathogens and the numbers obtained by molecular techniques may overestimate the quantification of infectious microorganisms. The pros and cons of molecular techniques for the detection and quantification of pathogens in water are discussed. (c) 2010 Elsevier Ltd. All rights reserved.
Dutta, Bhabesh; Gitaitis, Ronald; Smith, Samuel; Langston, David
2014-01-01
The ability of seed-borne bacterial pathogens (Acidovorax citrulli, Clavibacter michiganensis subsp. michiganensis, Pseudomonas syringae pv. tomato, Xanthomonas euvesicatoria, and Pseudomonas syringae pv. glycinea) to infest seeds of host and non-host plants (watermelon, tomato, pepper, and soybean) and subsequent pathogen transmission to seedlings was investigated. A non-pathogenic, pigmented strain of Serratia marcescens was also included to assess a null-interacting situation with the same plant species. Flowers of host and non-host plants were inoculated with 1 × 10(6) colony forming units (CFUs)/flower for each bacterial species and allowed to develop into fruits or umbels (in case of onion). Seeds harvested from each host/non-host bacterial species combination were assayed for respective bacteria by plating on semi-selective media. Additionally, seedlots for each host/non-host bacterial species combination were also assayed for pathogen transmission by seedling grow-out (SGO) assays under greenhouse conditions. The mean percentage of seedlots infested with compatible and incompatible pathogens was 31.7 and 30.9% (by plating), respectively and they were not significantly different (P = 0.67). The percentage of seedlots infested with null-interacting bacterial species was 16.8% (by plating) and it was significantly lower than the infested lots generated with compatible and incompatible bacterial pathogens (P = 0.03). None of the seedlots with incompatible/null-interacting bacteria developed symptoms on seedlings; however, when seedlings were assayed for epiphytic bacterial presence, 19.5 and 9.4% of the lots were positive, respectively. These results indicate that the seeds of non-host plants can become infested with incompatible and null-interacting bacterial species through flower colonization and they can be transmitted via epiphytic colonization of seedlings. In addition, it was also observed that flowers and seeds of non-host plants can be colonized by
Directory of Open Access Journals (Sweden)
Bhabesh Dutta
Full Text Available The ability of seed-borne bacterial pathogens (Acidovorax citrulli, Clavibacter michiganensis subsp. michiganensis, Pseudomonas syringae pv. tomato, Xanthomonas euvesicatoria, and Pseudomonas syringae pv. glycinea to infest seeds of host and non-host plants (watermelon, tomato, pepper, and soybean and subsequent pathogen transmission to seedlings was investigated. A non-pathogenic, pigmented strain of Serratia marcescens was also included to assess a null-interacting situation with the same plant species. Flowers of host and non-host plants were inoculated with 1 × 10(6 colony forming units (CFUs/flower for each bacterial species and allowed to develop into fruits or umbels (in case of onion. Seeds harvested from each host/non-host bacterial species combination were assayed for respective bacteria by plating on semi-selective media. Additionally, seedlots for each host/non-host bacterial species combination were also assayed for pathogen transmission by seedling grow-out (SGO assays under greenhouse conditions. The mean percentage of seedlots infested with compatible and incompatible pathogens was 31.7 and 30.9% (by plating, respectively and they were not significantly different (P = 0.67. The percentage of seedlots infested with null-interacting bacterial species was 16.8% (by plating and it was significantly lower than the infested lots generated with compatible and incompatible bacterial pathogens (P = 0.03. None of the seedlots with incompatible/null-interacting bacteria developed symptoms on seedlings; however, when seedlings were assayed for epiphytic bacterial presence, 19.5 and 9.4% of the lots were positive, respectively. These results indicate that the seeds of non-host plants can become infested with incompatible and null-interacting bacterial species through flower colonization and they can be transmitted via epiphytic colonization of seedlings. In addition, it was also observed that flowers and seeds of non-host plants can be
Directory of Open Access Journals (Sweden)
Yu Yang
2012-01-01
Full Text Available We have developed novel Bio-Plex assays for simultaneous detection of Bacillus anthracis, Yersinia pestis, Brucella spp., Francisella tularensis, and Burkholderia pseudomallei. Universal primers were used to amplify highly conserved region located within the 16S rRNA amplicon, followed by hybridized to pathogen-specific probes for identification of these five organisms. The other assay is based on multiplex PCR to simultaneously amplify five species-specific pathogen identification-targeted regions unique to individual pathogen. Both of the two arrays are validated to be flexible and sensitive for simultaneous detection of bioterrorism bacteria. However, universal primer PCR-based array could not identify Bacillus anthracis, Yersinia pestis, and Brucella spp. at the species level because of the high conservation of 16S rDNA of the same genus. The two suspension arrays can be utilized to detect Bacillus anthracis sterne spore and Yersinia pestis EV76 from mimic “write powder” samples, they also proved that the suspension array system will be valuable tools for diagnosis of bacterial biothreat agents in environmental samples.
Zuo, Peng; Li, XiuJun; Dominguez, Delfina C; Ye, Bang-Ce
2013-10-07
Infectious pathogens often cause serious public health concerns throughout the world. There is an increasing demand for simple, rapid and sensitive approaches for multiplexed pathogen detection. In this paper we have developed a polydimethylsiloxane (PDMS)/paper/glass hybrid microfluidic system integrated with aptamer-functionalized graphene oxide (GO) nano-biosensors for simple, one-step, multiplexed pathogen detection. The paper substrate used in this hybrid microfluidic system facilitated the integration of aptamer biosensors on the microfluidic biochip, and avoided complicated surface treatment and aptamer probe immobilization in a PDMS or glass-only microfluidic system. Lactobacillus acidophilus was used as a bacterium model to develop the microfluidic platform with a detection limit of 11.0 cfu mL(-1). We have also successfully extended this method to the simultaneous detection of two infectious pathogens - Staphylococcus aureus and Salmonella enterica. This method is simple and fast. The one-step 'turn on' pathogen assay in a ready-to-use microfluidic device only takes ~10 min to complete on the biochip. Furthermore, this microfluidic device has great potential in rapid detection of a wide variety of different other bacterial and viral pathogens.
Murdoch, Sarah L.; Trunk, Katharina; English, Grant; Fritsch, Maximilian J.; Pourkarimi, Ehsan; Coulthurst, Sarah J.
2011-01-01
The type VI secretion system (T6SS) is the most recently described and least understood of the protein secretion systems of Gram-negative bacteria. It is widely distributed and has been implicated in the virulence of various pathogens, but its mechanism and exact mode of action remain to be defined. Additionally there have been several very recent reports that some T6SSs can target bacteria rather than eukaryotic cells. Serratia marcescens is an opportunistic enteric pathogen, a class of bacteria responsible for a significant proportion of hospital-acquired infections. We describe the identification of a functional T6SS in S. marcescens strain Db10, the first report of type VI secretion by an opportunist enteric bacterium. The T6SS of S. marcescens Db10 is active, with secretion of Hcp to the culture medium readily detected, and is expressed constitutively under normal growth conditions from a large transcriptional unit. Expression of the T6SS genes did not appear to be dependent on the integrity of the T6SS. The S. marcescens Db10 T6SS is not required for virulence in three nonmammalian virulence models. It does, however, exhibit dramatic antibacterial killing activity against several other bacterial species and is required for S. marcescens to persist in a mixed culture with another opportunist pathogen, Enterobacter cloacae. Importantly, this antibacterial killing activity is highly strain specific, with the S. marcescens Db10 T6SS being highly effective against another strain of S. marcescens with a very similar and active T6SS. We conclude that type VI secretion plays a crucial role in the competitiveness, and thus indirectly the virulence, of S. marcescens and other opportunistic bacterial pathogens. PMID:21890705
Cladophora (Chlorophyta) spp. Harbor Human Bacterial Pathogens in Nearshore Water of Lake Michigan†
Ishii, Satoshi; Yan, Tao; Shively, Dawn A.; Byappanahalli, Muruleedhara N.; Whitman, Richard L.; Sadowsky, Michael J.
2006-01-01
Cladophora glomerata, a macrophytic green alga, is commonly found in the Great Lakes, and significant accumulations occur along shorelines during the summer months. Recently, Cladophora has been shown to harbor high densities of the fecal indicator bacteria Escherichia coli and enterococci. Cladophora may also harbor human pathogens; however, until now, no studies to address this question have been performed. In the present study, we determined whether attached Cladophora, obtained from the Lake Michigan and Burns Ditch (Little Calumet River, Indiana) sides of a breakwater during the summers of 2004 and 2005, harbored the bacterial pathogens Shiga toxin-producing Escherichia coli (STEC), Salmonella, Shigella, and Campylobacter. The presence of potential pathogens and numbers of organisms were determined by using cultural methods and by using conventional PCR, most-probable-number PCR (MPN-PCR), and quantitative PCR (QPCR) performed with genus- and toxin-specific primers and probes. While Shigella and STEC were detected in 100% and 25%, respectively, of the algal samples obtained near Burns Ditch in 2004, the same pathogens were not detected in samples collected in 2005. MPN-PCR and QPCR allowed enumeration of Salmonella in 40 to 80% of the ditch- and lakeside samples, respectively, and the densities were up to 1.6 × 103 cells per g Cladophora. Similarly, these PCR methods allowed enumeration of up to 5.4 × 102 Campylobacter cells/g Cladophora in 60 to 100% of lake- and ditchside samples. The Campylobacter densities were significantly higher (P Cladophora samples than in the ditchside Cladophora samples. DNA fingerprint analyses indicated that genotypically identical Salmonella isolates were associated with geographically and temporally distinct Cladophora samples. However, Campylobacter isolates were genetically diverse. Since animal hosts are thought to be the primary habitat for Campylobacter and Salmonella species, our results suggest that Cladophora is a
Cladophora (Chlorophyta) spp. harbor human bacterial pathogens in nearshore water of Lake Michigan.
Ishii, Satoshi; Yan, Tao; Shively, Dawn A; Byappanahalli, Muruleedhara N; Whitman, Richard L; Sadowsky, Michael J
2006-07-01
Cladophora glomerata, a macrophytic green alga, is commonly found in the Great Lakes, and significant accumulations occur along shorelines during the summer months. Recently, Cladophora has been shown to harbor high densities of the fecal indicator bacteria Escherichia coli and enterococci. Cladophora may also harbor human pathogens; however, until now, no studies to address this question have been performed. In the present study, we determined whether attached Cladophora, obtained from the Lake Michigan and Burns Ditch (Little Calumet River, Indiana) sides of a breakwater during the summers of 2004 and 2005, harbored the bacterial pathogens Shiga toxin-producing Escherichia coli (STEC), Salmonella, Shigella, and Campylobacter. The presence of potential pathogens and numbers of organisms were determined by using cultural methods and by using conventional PCR, most-probable-number PCR (MPN-PCR), and quantitative PCR (QPCR) performed with genus- and toxin-specific primers and probes. While Shigella and STEC were detected in 100% and 25%, respectively, of the algal samples obtained near Burns Ditch in 2004, the same pathogens were not detected in samples collected in 2005. MPN-PCR and QPCR allowed enumeration of Salmonella in 40 to 80% of the ditch- and lakeside samples, respectively, and the densities were up to 1.6 x 10(3) cells per g Cladophora. Similarly, these PCR methods allowed enumeration of up to 5.4 x 10(2) Campylobacter cells/g Cladophora in 60 to 100% of lake- and ditchside samples. The Campylobacter densities were significantly higher (P Cladophora samples than in the ditchside Cladophora samples. DNA fingerprint analyses indicated that genotypically identical Salmonella isolates were associated with geographically and temporally distinct Cladophora samples. However, Campylobacter isolates were genetically diverse. Since animal hosts are thought to be the primary habitat for Campylobacter and Salmonella species, our results suggest that Cladophora is a
Forde, Taya L.; Orsel, Karin; Zadoks, Ruth N.; Biek, Roman; Adams, Layne G.; Checkley, Sylvia L.; Davison, Tracy; De Buck, Jeroen; Dumond, Mathieu; Elkin, Brett T.; Finnegan, Laura; Macbeth, Bryan J.; Nelson, Cait; Niptanatiak, Amanda; Sather, Shane; Schwantje, Helen M.; van der Meer, Frank; Kutz, Susan J.
2016-01-01
Northern ecosystems are currently experiencing unprecedented ecological change, largely driven by a rapidly changing climate. Pathogen range expansion, and emergence and altered patterns of infectious disease, are increasingly reported in wildlife at high latitudes. Understanding the causes and consequences of shifting pathogen diversity and host-pathogen interactions in these ecosystems is important for wildlife conservation, and for indigenous populations that depend on wildlife. Among the key questions are whether disease events are associated with endemic or recently introduced pathogens, and whether emerging strains are spreading throughout the region. In this study, we used a phylogenomic approach to address these questions of pathogen endemicity and spread for Erysipelothrix rhusiopathiae, an opportunistic multi-host bacterial pathogen associated with recent mortalities in arctic and boreal ungulate populations in North America. We isolated E. rhusiopathiae from carcasses associated with large-scale die-offs of muskoxen in the Canadian Arctic Archipelago, and from contemporaneous mortality events and/or population declines among muskoxen in northwestern Alaska and caribou and moose in western Canada. Bacterial genomic diversity differed markedly among these locations; minimal divergence was present among isolates from muskoxen in the Canadian Arctic, while in caribou and moose populations, strains from highly divergent clades were isolated from the same location, or even from within a single carcass. These results indicate that mortalities among northern ungulates are not associated with a single emerging strain of E. rhusiopathiae, and that alternate hypotheses need to be explored. Our study illustrates the value and limitations of bacterial genomic data for discriminating between ecological hypotheses of disease emergence, and highlights the importance of studying emerging pathogens within the broader context of environmental and host factors.
Infection of an Insect Vector with a Bacterial Plant Pathogen Increases Its Propensity for Dispersal
Coy, Monique R.; Stelinski, Lukasz L.; Pelz-Stelinski, Kirsten S.
2015-01-01
The spread of vector-transmitted pathogens relies on complex interactions between host, vector and pathogen. In sessile plant pathosystems, the spread of a pathogen highly depends on the movement and mobility of the vector. However, questions remain as to whether and how pathogen-induced vector manipulations may affect the spread of a plant pathogen. Here we report for the first time that infection with a bacterial plant pathogen increases the probability of vector dispersal, and that such movement of vectors is likely manipulated by a bacterial plant pathogen. We investigated how Candidatus Liberibacter asiaticus (CLas) affects dispersal behavior, flight capacity, and the sexual attraction of its vector, the Asian citrus psyllid (Diaphorina citri Kuwayama). CLas is the putative causal agent of huanglongbing (HLB), which is a disease that threatens the viability of commercial citrus production worldwide. When D. citri developed on CLas-infected plants, short distance dispersal of male D. citri was greater compared to counterparts reared on uninfected plants. Flight by CLas-infected D. citri was initiated earlier and long flight events were more common than by uninfected psyllids, as measured by a flight mill apparatus. Additionally, CLas titers were higher among psyllids that performed long flights than psyllid that performed short flights. Finally, attractiveness of female D. citri that developed on infected plants to male conspecifics increased proportionally with increasing CLas bacterial titers measured within female psyllids. Our study indicates that the phytopathogen, CLas, may manipulate movement and mate selection behavior of their vectors, which is a possible evolved mechanism to promote their own spread. These results have global implications for both current HLB models of disease spread and control strategies. PMID:26083763
Directory of Open Access Journals (Sweden)
Xavier Martini
Full Text Available The spread of vector-transmitted pathogens relies on complex interactions between host, vector and pathogen. In sessile plant pathosystems, the spread of a pathogen highly depends on the movement and mobility of the vector. However, questions remain as to whether and how pathogen-induced vector manipulations may affect the spread of a plant pathogen. Here we report for the first time that infection with a bacterial plant pathogen increases the probability of vector dispersal, and that such movement of vectors is likely manipulated by a bacterial plant pathogen. We investigated how Candidatus Liberibacter asiaticus (CLas affects dispersal behavior, flight capacity, and the sexual attraction of its vector, the Asian citrus psyllid (Diaphorina citri Kuwayama. CLas is the putative causal agent of huanglongbing (HLB, which is a disease that threatens the viability of commercial citrus production worldwide. When D. citri developed on CLas-infected plants, short distance dispersal of male D. citri was greater compared to counterparts reared on uninfected plants. Flight by CLas-infected D. citri was initiated earlier and long flight events were more common than by uninfected psyllids, as measured by a flight mill apparatus. Additionally, CLas titers were higher among psyllids that performed long flights than psyllid that performed short flights. Finally, attractiveness of female D. citri that developed on infected plants to male conspecifics increased proportionally with increasing CLas bacterial titers measured within female psyllids. Our study indicates that the phytopathogen, CLas, may manipulate movement and mate selection behavior of their vectors, which is a possible evolved mechanism to promote their own spread. These results have global implications for both current HLB models of disease spread and control strategies.
Directory of Open Access Journals (Sweden)
Siripun Sarin
2011-01-01
Full Text Available The aims of this research were to study biosurfactant producing bacteria isolated from soil and to determine their property and efficiency as biosurfactants in order to inhibit bacterial pathogens. The result showed that there were 8 bacterial isolates out of 136 isolates of the total biosurfactant producing bacteria screened that exhibited the diameter of clear zone more than 1.5 cm. in the oil spreading test. The highest potential of emulsifying activity (%EA24 of 54.4 and the maximum additive concentration, (%MAC of 24.2 was obtained from the fermentation broth of the G7 isolate which the G7 isolate was later identified as Pseudomonas fluorescens. Escherichia coli, Staphylococcus aureus and Psuedomonas aeruginosa were the tested bacterial pathogens that were most sensitive to the acid precipitated biosurfactant obtained from P. fluorescens G7 with the lowest minimum inhibitory concentration (MIC of 41.6 mg/ml and minimum bactericidal concentration (MBC of 41.6 mg/ml compared with the acid precipitated bisurfactants of the other isolates used in the antimicrobial activity test. The type of the separated crude biosurfactant produced by P. fluorescens G7 analyzed later by using the rhamose test, TLC and FT-IR techniques was rhamnolipid.
Nested PCR Assay for Eight Pathogens: A Rapid Tool for Diagnosis of Bacterial Meningitis.
Bhagchandani, Sharda P; Kubade, Sushant; Nikhare, Priyanka P; Manke, Sonali; Chandak, Nitin H; Kabra, Dinesh; Baheti, Neeraj N; Agrawal, Vijay S; Sarda, Pankaj; Mahajan, Parikshit; Ganjre, Ashish; Purohit, Hemant J; Singh, Lokendra; Taori, Girdhar M; Daginawala, Hatim F; Kashyap, Rajpal S
2016-02-01
Bacterial meningitis is a dreadful infectious disease with a high mortality and morbidity if remained undiagnosed. Traditional diagnostic methods for bacterial meningitis pose a challenge in accurate identification of pathogen, making prognosis difficult. The present study is therefore aimed to design and evaluate a specific and sensitive nested 16S rDNA genus-based polymerase chain reaction (PCR) assay using clinical cerebrospinal fluid (CSF) for rapid diagnosis of eight pathogens causing the disease. The present work was dedicated to development of an in-house genus specific 16S rDNA nested PCR covering pathogens of eight genera responsible for causing bacterial meningitis using newly designed as well as literature based primers for respective genus. A total 150 suspected meningitis CSF obtained from the patients admitted to Central India Institute of Medical Sciences (CIIMS), India during the period from August 2011 to May 2014, were used to evaluate clinical sensitivity and clinical specificity of optimized PCR assays. The analytical sensitivity and specificity of our newly designed genus-specific 16S rDNA PCR were found to be ≥92%. With such a high sensitivity and specificity, our in-house nested PCR was able to give 100% sensitivity in clinically confirmed positive cases and 100% specificity in clinically confirmed negative cases indicating its applicability in clinical diagnosis. Our in-house nested PCR system therefore can diagnose the accurate pathogen causing bacterial meningitis and therefore be useful in selecting a specific treatment line to minimize morbidity. Results are obtained within 24 h and high sensitivity makes this nested PCR assay a rapid and accurate diagnostic tool compared to traditional culture-based methods.
Directory of Open Access Journals (Sweden)
Yongming Zhou
2018-05-01
Full Text Available Objectives: To conduct a one-year pathogen surveillance of acute diarrheal disease based on outpatient clinics in township hospitals in rural Hongta District of Yunnan Province, China. Methods: Fecal specimens of acute diarrhea cases and relevant epidemiological information were collected. Salmonella, Shigella, Vibrio, Aeromonas, Plesiomonas shigelloides and diarrheogenic Escherichia coli (DEC were examined. Results: Among the 797 stool specimens sampled, 198 samples (24.8% were positive in pathogen isolation, and 223 strains were isolated. The order of isolation rates from high to low were DEC, Aeromonas, P. shigelloides, Salmonella, Shigella and Vibrio. The overall positive rate in middle school students and preschool children was relatively high; while the overall positive rate of less than 1-year-old infants and above 55 years olds was relatively low. The isolates were analyzed by pulsed-field gel electrophoresis (PFGE. Some cases had the same or very close onset time, and the isolates had similar PFGE patterns, suggesting a possible outbreak once occurred but was not detected by the current infectious disease reporting system. Conclusions: Pathogen infection and transmission in rapidly urbanized rural areas is a serious issue. There is a great need for a more sensitive and accurate mode of monitoring, reporting and outbreak identification of diarrheal disease. Keywords: Diarrheal disease, Diarrheogenic pathogen, Molecular typing, Surveillance, Bacterial pathogen
Genetic diversity of citrus bacterial canker pathogens preserved in herbarium specimens.
Li, Wenbin; Song, Qijian; Brlansky, Ronald H; Hartung, John S
2007-11-20
Citrus bacterial canker (CBC) caused by Xanthomonas axonopodis pv. citri (Xac) was first documented in India and Java in the mid 19th century. Since that time, the known distribution of the disease has steadily increased. Concurrent with the dispersion of the pathogen, the diversity of described strains continues to increase, with novel strains appearing in Saudi Arabia, Iran, and Florida in the last decade. Herbarium specimens of infected plants provide an historical record documenting both the geographic distribution and genetic diversity of the pathogen in the past. However, no method was available to assess the genetic diversity within these herbarium samples. We have developed a method, insertion event scanning (IES), and applied the method to characterize the diversity present within CBC populations documented as herbarium specimens over the past century. IES is based on the specific amplification of junction fragments that define insertion events. The potential for IES in current forensic applications is demonstrated by finding an exact match of pathogen genotypes preserved in herbarium specimens from Japan and Florida, demonstrating the source of the original outbreak of citrus canker in Florida in 1911. IES is a very sensitive technique for differentiating bacterial strains and can be applied to any of the several hundred bacteria for which full genomic sequence data are available.
Nodeomics: pathogen detection in vertebrate lymph nodes using meta-transcriptomics.
Directory of Open Access Journals (Sweden)
Nicola E Wittekindt
Full Text Available The ongoing emergence of human infections originating from wildlife highlights the need for better knowledge of the microbial community in wildlife species where traditional diagnostic approaches are limited. Here we evaluate the microbial biota in healthy mule deer (Odocoileus hemionus by analyses of lymph node meta-transcriptomes. cDNA libraries from five individuals and two pools of samples were prepared from retropharyngeal lymph node RNA enriched for polyadenylated RNA and sequenced using Roche-454 Life Sciences technology. Protein-coding and 16S ribosomal RNA (rRNA sequences were taxonomically profiled using protein and rRNA specific databases. Representatives of all bacterial phyla were detected in the seven libraries based on protein-coding transcripts indicating that viable microbiota were present in lymph nodes. Residents of skin and rumen, and those ubiquitous in mule deer habitat dominated classifiable bacterial species. Based on detection of both rRNA and protein-coding transcripts, we identified two new proteobacterial species; a Helicobacter closely related to Helicobacter cetorum in the Helicobacter pylori/Helicobacter acinonychis complex and an Acinetobacter related to Acinetobacter schindleri. Among viruses, a novel gamma retrovirus and other members of the Poxviridae and Retroviridae were identified. We additionally evaluated bacterial diversity by amplicon sequencing the hypervariable V6 region of 16S rRNA and demonstrate that overall taxonomic diversity is higher with the meta-transcriptomic approach. These data provide the most complete picture to date of the microbial diversity within a wildlife host. Our research advances the use of meta-transcriptomics to study microbiota in wildlife tissues, which will facilitate detection of novel organisms with pathogenic potential to human and animals.
Pyrosequencing detects human and animal pathogenic taxa in the grapevine endosphere.
Yousaf, Sohail; Bulgari, Daniela; Bergna, Alessandro; Pancher, Michael; Quaglino, Fabio; Casati, Paola; Campisano, Andrea
2014-01-01
Generally, plants are not considered as hosts for human and animal pathogens (HAP). The recent produce-associated outbreaks of food-borne diseases have drawn attention toward significant deficiencies in our understanding of the ecology of HAP, and their potential for interkingdom transfer. To examine the association of microorganisms classified as HAP with plants, we surveyed the presence and distribution of HAP bacterial taxa (henceforth HAPT, for brevity's sake) in the endosphere of grapevine (Vitis vinifera L.) both in the plant stems and leaves. An enrichment protocol was used on leaves to detect taxa with very low abundance in undisturbed tissues. We used pyrosequencing and phylogenetic analyses of the 16S rDNA gene. We identified several HAPT, and focused on four genera (Propionibacterium, Staphylococcus, Clostridium, and Burkholderia). The majority of the bacterial sequences in the genus Propionibacterium, from grapevine leaf and stem, were identified as P. acnes. Clostridia were detected in leaves and stems, but their number was much higher in leaves after enrichment. HAPT were indentified both in leaves and wood of grapevines. This depicts the ability of these taxa to be internalized within plant tissues and maintain their population levels in a variety of environments. Our analysis highlighted the presence of HAPT in the grapevine endosphere and unexpected occurrence of these bacterial taxa in this atypical environment.
Daeschlein, G; Fenske, C; Scholz, S; Dahlke, S; Jünger, M; Kramer, A
2015-01-01
As a result of their mode of filter feeding, zebra mussels (Dreissena polymorpha Pall.) have been observed to purify natural water bodies and in vitro. Therefore, the possibility of using zebra mussels for water purification was investigated in a slightly brackish water body of a large lagoon. In this study, water samples were taken above, near and at distance from zebra mussel beds (MB) in the Odra Lagoon in North East Germany. Near typical bacterial species like Aeromonas spp. pathogenic bacteria with potential relation to hospital wastewater pollution (Burkholderia cepacia, Staphylococcus aureus, Weeksella spp.) were detected. There were no correlations found between either total bacteria or pathogens and distance to MB and no antimicrobial effect of the mussels could be deduced. For bioremediation in larger water bodies like lagoons, natural zebra MB do not seem to play a major antimicrobial role and the effect of artificial mussel grids especially against hospital pathogens should be investigated.
Bacterial and protozoal pathogens found in ticks collected from humans in Corum province of Turkey.
Directory of Open Access Journals (Sweden)
Djursun Karasartova
2018-04-01
Full Text Available Tick-borne diseases are increasing all over the word, including Turkey. The aim of this study was to determine the bacterial and protozoan vector-borne pathogens in ticks infesting humans in the Corum province of Turkey.From March to November 2014 a total of 322 ticks were collected from patients who attended the local hospitals with tick bites. Ticks were screened by real time-PCR and PCR, and obtained amplicons were sequenced. The dedected tick was belonging to the genus Hyalomma, Haemaphysalis, Rhipicephalus, Dermacentor and Ixodes. A total of 17 microorganism species were identified in ticks. The most prevalent Rickettsia spp. were: R. aeschlimannii (19.5%, R. slovaca (4.5%, R. raoultii (2.2%, R. hoogstraalii (1.9%, R. sibirica subsp. mongolitimonae (1.2%, R. monacensis (0.31%, and Rickettsia spp. (1.2%. In addition, the following pathogens were identified: Borrelia afzelii (0.31%, Anaplasma spp. (0.31%, Ehrlichia spp. (0.93%, Babesia microti (0.93%, Babesia ovis (0.31%, Babesia occultans (3.4%, Theileria spp. (1.6%, Hepatozoon felis (0.31%, Hepatozoon canis (0.31%, and Hemolivia mauritanica (2.1%. All samples were negative for Francisella tularensis, Coxiella burnetii, Bartonella spp., Toxoplasma gondii and Leishmania spp.Ticks in Corum carry a large variety of human and zoonotic pathogens that were detected not only in known vectors, but showed a wider vector diversity. There is an increase in the prevalence of ticks infected with the spotted fever group and lymphangitis-associated rickettsiosis, while Ehrlichia spp. and Anaplasma spp. were reported for the first time from this region. B. microti was detected for the first time in Hyalomma marginatum infesting humans. The detection of B. occultans, B. ovis, Hepatozoon spp., Theileria spp. and Hemolivia mauritanica indicate the importance of these ticks as vectors of pathogens of veterinary importance, therefore patients with a tick infestation should be followed for a variety of pathogens
Hasan, Mohammad R.; Rawat, Arun; Tang, Patrick; Jithesh, Puthen V.; Thomas, Eva; Tan, Rusung; Tilley, Peter
2016-01-01
Next-generation sequencing (NGS) technology has shown promise for the detection of human pathogens from clinical samples. However, one of the major obstacles to the use of NGS in diagnostic microbiology is the low ratio of pathogen DNA to human DNA in most clinical specimens. In this study, we aimed to develop a specimen-processing protocol to remove human DNA and enrich specimens for bacterial and viral DNA for shotgun metagenomic sequencing. Cerebrospinal fluid (CSF) and nasopharyngeal aspi...
Haney, Cara H; Wiesmann, Christina L; Shapiro, Lori R; Melnyk, Ryan A; O'Sullivan, Lucy R; Khorasani, Sophie; Xiao, Li; Han, Jiatong; Bush, Jenifer; Carrillo, Juli; Pierce, Naomi E; Ausubel, Frederick M
2017-10-31
Plant-associated soil microbes are important mediators of plant defence responses to diverse above-ground pathogen and insect challengers. For example, closely related strains of beneficial rhizosphere Pseudomonas spp. can induce systemic resistance (ISR), systemic susceptibility (ISS) or neither against the bacterial foliar pathogen Pseudomonas syringae pv. tomato DC3000 (Pto DC3000). Using a model system composed of root-associated Pseudomonas spp. strains, the foliar pathogen Pto DC3000 and the herbivore Trichoplusia ni (cabbage looper), we found that rhizosphere-associated Pseudomonas spp. that induce either ISS and ISR against Pto DC3000 all increased resistance to herbivory by T. ni. We found that resistance to T. ni and resistance to Pto DC3000 are quantitative metrics of the jasmonic acid (JA)/salicylic acid (SA) trade-off and distinct strains of rhizosphere-associated Pseudomonas spp. have distinct effects on the JA/SA trade-off. Using genetic analysis and transcriptional profiling, we provide evidence that treatment of Arabidopsis with Pseudomonas sp. CH267, which induces ISS against bacterial pathogens, tips the JA/SA trade-off towards JA-dependent defences against herbivores at the cost of a subset of SA-mediated defences against bacterial pathogens. In contrast, treatment of Arabidopsis with the ISR strain Pseudomonas sp. WCS417 disrupts JA/SA antagonism and simultaneously primes plants for both JA- and SA-mediated defences. Our findings show that ISS against the bacterial foliar pathogens triggered by Pseudomonas sp. CH267, which is a seemingly deleterious phenotype, may in fact be an adaptive consequence of increased resistance to herbivory. Our work shows that pleiotropic effects of microbiome modulation of plant defences are important to consider when using microbes to modify plant traits in agriculture. © 2017 John Wiley & Sons Ltd.
Daily variations in pathogenic bacterial populations in a monsoon influenced tropical environment
Digital Repository Service at National Institute of Oceanography (India)
Khandeparker, L.; Anil, A.C.; Naik, S.D.; Gaonkar, C.C.
and an assessment of the health of such an ecosystem benefits from high resolution observations. Virulent pathogenic Vibrio species are expected more frequently in tropical marine environments, since the virulence gene expression seems to increase at elevated... cells ml−1 (July 2009) to 5.9 x 107 cells ml−1 (February 2011) (Fig. 2b). Inter annual variations point out that the total bacterial abundance increased 5 from 2009 to 2011, while the viable bacterial numbers decreased. Complex physical, chemical...
Directory of Open Access Journals (Sweden)
Malkit Singh
2013-01-01
Full Text Available Background: Reactive arthritis (ReA/Reiter′s syndrome (RS may be caused as a sequel of infections caused by enteric bacterial pathogens, although the mechanisms through, which different pathogens cause similar disease are not clear. Aim: This study was done to look for the presence and role of any common bacterial antigen among the pathogens isolated from such patients. Materials and Methods: A total of 51 patients of ReA and 75 controls (three groups of 25 subjects each: Group 1: Patients who did not develop arthritic complications within 3 months after bacillary dysentery/diarrhea; Group 2: Patients with other arthritic diseases and Group 3: Normal healthy subjects were included. The isolated enteric pathogens were tested to detect the immunodominant antigens. Results and Conclusions: A common 30 kDa antigen was found to be specifically present among seven arthritogenic enteric bacterial strains belonging to three genera, Salmonella, Shigella and Hafnia. Post-dysenteric ReA patients′ sera show higher levels of immunoglobulin G, immunoglobulin M and immunoglobulin A antibodies against this antigen as compared to the controls. Lymphocytes of ReA patients recognize this antigen, proliferate and produce interleukin-2 in response to this antigen more than the lymphocytes of controls. 30 kDa antigen may be a common arthritogenic factor associated with post-dysenteric ReA/RS. The association of Hafnia alvei with post-dysenteric ReA is described for the first time. Four cases of mycobacterial ReA had an association with this antigen, suggesting that the arthritogenic antigen of mycobacteria and enteric bacteria may be of a similar nature.
Relationship between lactobacilli and opportunistic bacterial pathogens associated with vaginitis.
Razzak, Mohammad Sabri A; Al-Charrakh, Alaa H; Al-Greitty, Bara Hamid
2011-04-01
Vaginitis, is an infectious inflammation of the vaginal mucosa, which sometimes involves the vulva. The balance of the vaginal flora is maintained by the Lactobacilli and its protective and probiotic role in treating and preventing vaginal infection by producing antagonizing compounds which are regarded as safe for humans. The aim of this study was to evaluate the protective role of Lactobacilli against common bacterial opportunistic pathogens in vaginitis and study the effects of some antibiotics on Lactobacilli isolates. In this study (110) vaginal swabs were obtained from women suffering from vaginitis who admitted to Babylon Hospital of Maternity and Paediatrics in Babylon province, Iraq. The study involved the role of intrauterine device among married women with vaginitis and also involved isolation of opportunistic bacterial isolates among pregnant and non pregnant women. This study also involved studying probiotic role of Lactobacilli by production of some defense factors like hydrogen peroxide, bacteriocin, and lactic acid. Results revealed that a total of 130 bacterial isolates were obtained. Intrauterine device was a predisposing factor for vaginitis. The most common opportunistic bacterial isolates were Staphylococcus aureus, Escherichia coli, Streptococcus agalactiae, and Klebsiella pneumoniae. All Lactobacilli were hydrogen peroxide producers while some isolates were bacteriocin producers that inhibited some of opportunistic pathogens (S. aureus, E. coli). Lactobacilli were sensitive to erythromycin while 93.3% of them were resistant to ciprofloxacin and (40%, 53.3%) of them were resistant to amoxicillin and gentamycin respectively. Results revealed that there was an inverse relationship between Lactobacilli presence and organisms causing vaginitis. This may be attributed to the production of defense factors by Lactobacilli. The types of antibiotics used to treat vaginitis must be very selective in order not to kill the beneficial bacteria
Directory of Open Access Journals (Sweden)
Matthew D Dyer
2010-08-01
Full Text Available Bacillus anthracis, Francisella tularensis, and Yersinia pestis are bacterial pathogens that can cause anthrax, lethal acute pneumonic disease, and bubonic plague, respectively, and are listed as NIAID Category A priority pathogens for possible use as biological weapons. However, the interactions between human proteins and proteins in these bacteria remain poorly characterized leading to an incomplete understanding of their pathogenesis and mechanisms of immune evasion.In this study, we used a high-throughput yeast two-hybrid assay to identify physical interactions between human proteins and proteins from each of these three pathogens. From more than 250,000 screens performed, we identified 3,073 human-B. anthracis, 1,383 human-F. tularensis, and 4,059 human-Y. pestis protein-protein interactions including interactions involving 304 B. anthracis, 52 F. tularensis, and 330 Y. pestis proteins that are uncharacterized. Computational analysis revealed that pathogen proteins preferentially interact with human proteins that are hubs and bottlenecks in the human PPI network. In addition, we computed modules of human-pathogen PPIs that are conserved amongst the three networks. Functionally, such conserved modules reveal commonalities between how the different pathogens interact with crucial host pathways involved in inflammation and immunity.These data constitute the first extensive protein interaction networks constructed for bacterial pathogens and their human hosts. This study provides novel insights into host-pathogen interactions.
Rapid Detection and Characterization of Emerging Foreign Animal Disease Pathogens
Energy Technology Data Exchange (ETDEWEB)
Jaing, C. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)
2016-11-18
To best safeguard human and animal health requires early detection and characterization of disease events. This must include effective surveillance for emerging infectious diseases. Both deliberate and natural outbreaks have enormous economic and public health impacts, and can present serious threats to national security. In this project, we developed novel next generation detection technologies to protect the agricultural economy and biosecurity. The first technology is a multiplexed assay to simultaneously detection 10 swine viral and bacterial pathogens. The second one is the Lawrence Livermore Microbial Detection Array (LLMDA) which can detect more than 10,000 microbial species including 4219 viruses, 5367 bacteria, 265 fungi, 117 protozoa and 293 archaea. We analyzed a series of swine clinical samples from past disease events to demonstrate the utility of the assays for faster and cheaper detection of emerging and foreign animal disease pathogens, and their utility as s routine diagnosis and surveillance tool. A second goal of the study is to better understand mechanisms of African swine fever virus (ASFV) infection in pigs to aid the development of countermeasures and diagnostics. There is no vaccine available for ASF. ASF outbreak is on the rise on several European countries. Though ASF is not currently in the U.S., a potential outbreak in the U.S. would be detrimental to the swine industry and the US agricultural economy. We pursued a genome-wide approach to characterize the pig immune responses after ASFV infection. We used RNA sequencing and bioinformatics methods to identify genes and pathways that are affected during ASF infection. We have identified a list of most differentially expressed genes that are in the immune response pathways.
Responses of a bacterial pathogen to phosphorus limitation of its aquatic invertebrate host
Frost, P. C.; Ebert, D.; Smith, V. H.
2008-01-01
Host nutrition is thought to affect the establishment, persistence, and severity of pathogenic infections. Nutrient-deficient foods possibly benefit pathogens by constraining host immune function or benefit hosts by limiting parasite growth and reproduction. However, the effects of poor elemental food quality on a host's susceptibility to infection and disease have received little study. Here we show that the bacterial microparasite Pasteuria ramosa is affected by the elemental nutrition of i...
Rasche, F; Velvis, H; Zachow, C; Berg, G; Van Elsas, JD; Sessitsch, A
1. Blackleg and soft rot disease of potatoes Solanum tuberosum L., mainly caused by the bacterial pathogen Erwinia carotovora ssp. atrospetica (Eca), lead to enormous yield losses world-wide. Genetically modified (GM) potatoes producing anti-bacterial agents, such as cecropin/attacin and T4
Rasche, F.; Velvis, H.; Zachow, C.; Berg, G.; Elsas, van J.D.; Sessitsch, A.
2006-01-01
1. Blackleg and soft rot disease of potatoes Solanum tuberosum L., mainly caused by the bacterial pathogen Erwinia carotovora ssp. atrospetica (Eca), lead to enormous yield losses world-wide. Genetically modified (GM) potatoes producing anti-bacterial agents, such as cecropin/attacin and T4
Directory of Open Access Journals (Sweden)
Koziel Monika
2012-11-01
Full Text Available Abstract Campylobacter jejuni and coli are collectively regarded as the most prevalent cause of bacterial foodborne illness worldwide. An emerging species, Campylobacter ureolyticus has recently been detected in patients with gastroenteritis, however, the source of this organism has, until now, remained unclear. Herein, we describe the molecular-based detection of this pathogen in bovine faeces (1/20 and unpasteurized milk (6/47 but not in poultry (chicken wings and caeca. This is, to the best of our knowledge, the first report of the presence of this potential gastrointestinal pathogen in an animal source, possibly suggesting a route for its transmission to humans.
Field-applied manure is an important source of pathogenic exposure in surface water bodies for humans and ecological receptors. We analyzed the persistence and decay of fecal indicator bacteria and bacterial pathogens from three sources (cattle, poultry, swine) for agricultural f...
Moghtader, Farzaneh; Tomak, Aysel; Zareie, Hadi M; Piskin, Erhan
2018-03-27
This study attemps to develop bacterial detection strategies using bacteriophages and gold nanorods (GNRs) by Raman spectral analysis. Escherichia coli was selected as the target and its specific phage was used as the bioprobe. Target bacteria and phages were propagated/purified by traditional techniques. GNRs were synthesized by using hexadecyltrimethyl ammonium bromide (CTAB) as stabilizer. A two-step detection strategy was applied: Firstly, the target bacteria were interacted with GNRs in suspensions, and then they were dropped onto silica substrates for detection. It was possible to obtain clear surface-enchanced Raman spectroscopy (SERS) peaks of the target bacteria, even without using phages. In the second step, the phage nanoemulsions were droped onto the bacterial-GNRs complexes on those surfaces and time-dependent changes in the Raman spectra were monitored at different time intervals upto 40 min. These results demonstrated that how one can apply phages with plasmonic nanoparticles for detection of pathogenic bacteria very effectively in a quite simple test.
Defense reactions of bean genotypes to bacterial pathogens in controlled conditions
Uysal, B.; Bastas, K. K.
2018-03-01
This study was focused on the role of antioxidant enzymes and total protein in imparting resistance against common bacterial blight caused by Xanthomonas axonopodis pv. phaseoli (Xap) and halo blight caused by Pseudomonas syringae pv. phaseolicola (Psp) in bean. Activities of Ascorbate peroxidase (APX), Catalase (CAT) and total protein were studied in resistant and susceptible bean genotypes. Five-day-old seedlings were inoculated with a bacterial suspension (108 CFU ml-1) and harvested at different time intervals (0, 12, 24 and 36 up to 72 h) under controlled growing conditions and assayed for antioxidant enzymes and total protein. Temporal increase of CAT, APX enzymes activities showed maximum activity at 12 h after both pathogens inoculation (hpi) in resistant cultivar, whereas in susceptible it increased at 72 h after both pathogens inoculation for CAT and 12, 24 h for APX enzymes. Maximum total protein activities were observed at 12 h and 24 h respectively after Xap, Psp inoculation (hpi) in resistant and maximum activities were observed at 24 h and 72 h respectively after Xap, Psp inoculation (hpi) in susceptible. Increase of antioxidant enzyme and total protein activities might be an important component in the defense strategy of resistance and susceptible bean genotypes against the bacterial infection. These findings suggest that disease protection is proportional to the amount of enhanced CAT, APX enzyme and total protein activity.
DEFF Research Database (Denmark)
Ahmed, Shakil
Due to an increased public concern for food safety and quality, food processing industries have an urgent need for fast and reliable contaminant detection technologies. Conventional pathogen detection methods are time consuming, cost intensive, require skilled laboratory workers and are inappropr...... and detect pathogens in food, feed or beverage industries in real-time and has the potential to offer significant advantages compared to conventional systems.......Due to an increased public concern for food safety and quality, food processing industries have an urgent need for fast and reliable contaminant detection technologies. Conventional pathogen detection methods are time consuming, cost intensive, require skilled laboratory workers...... diacetate (CFDA) was used to evaluate the viability of the cell. Under final optimized condition, the developed method showed 98 % capture efficiency towards the specific antigen Salmonella Typhimurium and very low (target bacterial strains. Subsequently, IMS was implemented...
An Overview of the Control of Bacterial Pathogens in Cattle Manure
Directory of Open Access Journals (Sweden)
Christy E. Manyi-Loh
2016-08-01
Full Text Available Cattle manure harbors microbial constituents that make it a potential source of pollution in the environment and infections in humans. Knowledge of, and microbial assessment of, manure is crucial in a bid to prevent public health and environmental hazards through the development of better management practices and policies that should govern manure handling. Physical, chemical and biological methods to reduce pathogen population in manure do exist, but are faced with challenges such as cost, odor pollution, green house gas emission, etc. Consequently, anaerobic digestion of animal manure is currently one of the most widely used treatment method that can help to salvage the above-mentioned adverse effects and in addition, produces biogas that can serve as an alternative/complementary source of energy. However, this method has to be monitored closely as it could be fraught with challenges during operation, caused by the inherent characteristics of the manure. In addition, to further reduce bacterial pathogens to a significant level, anaerobic digestion can be combined with other methods such as thermal, aerobic and physical methods. In this paper, we review the bacterial composition of cattle manure as well as methods engaged in the control of pathogenic microbes present in manure and recommendations that need to be respected and implemented in order to prevent microbial contamination of the environment, animals and humans.
Oster, Ryan J; Wijesinghe, Rasanthi U; Haack, Sheridan K; Fogarty, Lisa R; Tucker, Taaja R; Riley, Stephen C
2014-12-16
Quantitative assessment of bacterial pathogens, their geographic variability, and distribution in various matrices at Great Lakes beaches are limited. Quantitative PCR (qPCR) was used to test for genes from E. coli O157:H7 (eaeO157), shiga-toxin producing E. coli (stx2), Campylobacter jejuni (mapA), Shigella spp. (ipaH), and a Salmonella enterica-specific (SE) DNA sequence at seven Great Lakes beaches, in algae, water, and sediment. Overall, detection frequencies were mapA>stx2>ipaH>SE>eaeO157. Results were highly variable among beaches and matrices; some correlations with environmental conditions were observed for mapA, stx2, and ipaH detections. Beach seasonal mean mapA abundance in water was correlated with beach seasonal mean log10 E. coli concentration. At one beach, stx2 gene abundance was positively correlated with concurrent daily E. coli concentrations. Concentration distributions for stx2, ipaH, and mapA within algae, sediment, and water were statistically different (Non-Detect and Data Analysis in R). Assuming 10, 50, or 100% of gene copies represented viable and presumably infective cells, a quantitative microbial risk assessment tool developed by Michigan State University indicated a moderate probability of illness for Campylobacter jejuni at the study beaches, especially where recreational water quality criteria were exceeded. Pathogen gene quantification may be useful for beach water quality management.
Arrieta-Ortiz, Mario L; Rodríguez-R, Luis M; Pérez-Quintero, Álvaro L; Poulin, Lucie; Díaz, Ana C; Arias Rojas, Nathalia; Trujillo, Cesar; Restrepo Benavides, Mariana; Bart, Rebecca; Boch, Jens; Boureau, Tristan; Darrasse, Armelle; David, Perrine; Dugé de Bernonville, Thomas; Fontanilla, Paula; Gagnevin, Lionel; Guérin, Fabien; Jacques, Marie-Agnès; Lauber, Emmanuelle; Lefeuvre, Pierre; Medina, Cesar; Medina, Edgar; Montenegro, Nathaly; Muñoz Bodnar, Alejandra; Noël, Laurent D; Ortiz Quiñones, Juan F; Osorio, Daniela; Pardo, Carolina; Patil, Prabhu B; Poussier, Stéphane; Pruvost, Olivier; Robène-Soustrade, Isabelle; Ryan, Robert P; Tabima, Javier; Urrego Morales, Oscar G; Vernière, Christian; Carrere, Sébastien; Verdier, Valérie; Szurek, Boris; Restrepo, Silvia; López, Camilo; Koebnik, Ralf; Bernal, Adriana
2013-01-01
Xanthomonas axonopodis pv. manihotis (Xam) is the causal agent of bacterial blight of cassava, which is among the main components of human diet in Africa and South America. Current information about the molecular pathogenicity factors involved in the infection process of this organism is limited. Previous studies in other bacteria in this genus suggest that advanced draft genome sequences are valuable resources for molecular studies on their interaction with plants and could provide valuable tools for diagnostics and detection. Here we have generated the first manually annotated high-quality draft genome sequence of Xam strain CIO151. Its genomic structure is similar to that of other xanthomonads, especially Xanthomonas euvesicatoria and Xanthomonas citri pv. citri species. Several putative pathogenicity factors were identified, including type III effectors, cell wall-degrading enzymes and clusters encoding protein secretion systems. Specific characteristics in this genome include changes in the xanthomonadin cluster that could explain the lack of typical yellow color in all strains of this pathovar and the presence of 50 regions in the genome with atypical nucleotide composition. The genome sequence was used to predict and evaluate 22 variable number of tandem repeat (VNTR) loci that were subsequently demonstrated as polymorphic in representative Xam strains. Our results demonstrate that Xanthomonas axonopodis pv. manihotis strain CIO151 possesses ten clusters of pathogenicity factors conserved within the genus Xanthomonas. We report 126 genes that are potentially unique to Xam, as well as potential horizontal transfer events in the history of the genome. The relation of these regions with virulence and pathogenicity could explain several aspects of the biology of this pathogen, including its ability to colonize both vascular and non-vascular tissues of cassava plants. A set of 16 robust, polymorphic VNTR loci will be useful to develop a multi-locus VNTR analysis
DEFF Research Database (Denmark)
Sun, Yi; Phuoc Long, Truong; Wolff, Anders
2016-01-01
Gold nanoparticles (AuNPs)-based biosensors are emerging technologies for rapid detection of pathogens. However, it is very challenging to develop chip-based AuNP-biosensors for whole cells. This paper describes a novel AuNPs-DNA aptamer-based plasmonic assay which allows DNA aptamers...
Detection of Pathogen Exposure in African Buffalo Using Non-Specific Markers of Inflammation
Directory of Open Access Journals (Sweden)
Caroline K. Glidden
2018-01-01
Full Text Available Detecting exposure to new or emerging pathogens is a critical challenge to protecting human, domestic animal, and wildlife health. Yet, current techniques to detect infections typically target known pathogens of humans or economically important animals. In the face of the current surge in infectious disease emergence, non-specific disease surveillance tools are urgently needed. Tracking common host immune responses indicative of recent infection may have potential as a non-specific diagnostic approach for disease surveillance. The challenge to immunologists is to identify the most promising markers, which ideally should be highly conserved across pathogens and host species, become upregulated rapidly and consistently in response to pathogen invasion, and remain elevated beyond clearance of infection. This study combined an infection experiment and a longitudinal observational study to evaluate the utility of non-specific markers of inflammation [NSMI; two acute phase proteins (haptoglobin and serum amyloid A, two pro-inflammatory cytokines (IFNγ and TNF-α] as indicators of pathogen exposure in a wild mammalian species, African buffalo (Syncerus caffer. Specifically, in the experimental study, we asked (1 How quickly do buffalo mount NSMI responses upon challenge with an endemic pathogen, foot-and-mouth disease virus; (2 for how long do NSMI remain elevated after viral clearance and; (3 how pronounced is the difference between peak NSMI concentration and baseline NSMI concentration? In the longitudinal study, we asked (4 Are elevated NSMI associated with recent exposure to a suite of bacterial and viral respiratory pathogens in a wild population? Among the four NSMI that we tested, haptoglobin showed the strongest potential as a surveillance marker in African buffalo: concentrations quickly and consistently reached high levels in response to experimental infection, remaining elevated for almost a month. Moreover, elevated haptoglobin was
Cladophora (Chlorophyta) spp. harbor human bacterial pathogens in nearshore water of Lake Michigan
Ishii, S.; Yan, T.; Shively, D.A.; Byappanahalli, M.N.; Whitman, R.L.; Sadowsky, M.J.
2006-01-01
Cladophora glomerata, a macrophytic green alga, is commonly found in the Great Lakes, and significant accumulations occur along shorelines during the summer months. Recently, Cladophora has been shown to harbor high densities of the fecal indicator bacteria Escherichia coli and enterococci. Cladophora may also harbor human pathogens; however, until now, no studies to address this question have been performed. In the present study, we determined whether attachedCladophora, obtained from the Lake Michigan and Burns Ditch (Little Calumet River, Indiana) sides of a breakwater during the summers of 2004 and 2005, harbored the bacterial pathogens Shiga toxin-producing Escherichia coli (STEC),Salmonella, Shigella, and Campylobacter. The presence of potential pathogens and numbers of organisms were determined by using cultural methods and by using conventional PCR, most-probable-number PCR (MPN-PCR), and quantitative PCR (QPCR) performed with genus- and toxin-specific primers and probes. WhileShigella and STEC were detected in 100% and 25%, respectively, of the algal samples obtained near Burns Ditch in 2004, the same pathogens were not detected in samples collected in 2005. MPN-PCR and QPCR allowed enumeration of Salmonella in 40 to 80% of the ditch- and lakeside samples, respectively, and the densities were up to 1.6 × 103 cells per g Cladophora. Similarly, these PCR methods allowed enumeration of up to 5.4 × 102 Campylobacter cells/gCladophora in 60 to 100% of lake- and ditchside samples. The Campylobacterdensities were significantly higher (P fingerprint analyses indicated that genotypically identical Salmonella isolates were associated with geographically and temporally distinct Cladophora samples. However, Campylobacter isolates were genetically diverse. Since animal hosts are thought to be the primary habitat forCampylobacter and Salmonella species, our results suggest that Cladophora is a likely secondary habitat for pathogenic
Yadhav Ml, Kala
2014-04-01
Bacterial meningitis is one of the most serious infections seen in infants and children, which is associated with acute complications and chronic morbidity. Infections of Central Nervous System (CNS) still dominate the scene of childhood neurological disorders in most of the developing tropical countries. To isolate, identify and determine the antibiotic susceptibility patterns of pathogens associated with bacterial meningitis. We also aimed to comparatively evaluate of Gram staining, culture and bacterial antigen detection in cerebrospinal fluid samples. Present comparative study included 100 CSF samples of children below the age of 5 years, who were clinically suspected meningitis cases. The samples were subjected to Gram staining, culture and Latex agglutination test (LAT). The organisms isolated in the study were characterized and antibiotic susceptibility test was done according to standard guidelines. It was done by using Gaussian test. Of the 100 cases, 24 were diagnosed as Acute bacterial meningitis (ABM) cases by. Gram staining, culture and latex agglutination test. 21 (87.5%) cases were culture positive, with 2 cases being positive for polymicrobial isolates. Gram staining was positive in 17 (70.53%) cases and LAT was positive in 18 (33.33%) cases. Streptococcus pneumoniae was the predominant organism which was isolated and it was sensitive to antibiotics. In the present study, male to female ratio was 1.27:1, which showed a male preponderance. With the combination of Gram staining, culture, and LAT, 100% sensitivity and specificity can be achieved (p Gram staining and LAT can detect 85% of cases of ABM. Bacterial meningitis is a medical emergency and making an early diagnosis and providing treatment early are life saving and they reduce chronic morbidity.
The BER necessities: the repair of DNA damage in human-adapted bacterial pathogens.
van der Veen, Stijn; Tang, Christoph M
2015-02-01
During colonization and disease, bacterial pathogens must survive the onslaught of the host immune system. A key component of the innate immune response is the generation of reactive oxygen and nitrogen species by phagocytic cells, which target and disrupt pathogen molecules, particularly DNA, and the base excision repair (BER) pathway is the most important mechanism for the repair of such oxidative DNA damage. In this Review, we discuss how the human-specific pathogens Mycobacterium tuberculosis, Helicobacter pylori and Neisseria meningitidis have evolved specialized mechanisms of DNA repair, particularly their BER pathways, compared with model organisms such as Escherichia coli. This specialization in DNA repair is likely to reflect the distinct niches occupied by these important human pathogens in the host.
Matsunaga, James; Barocchi, Michele A.; Croda, Julio; Young, Tracy A.; Sanchez, Yolanda; Siqueira, Isadora; Bolin, Carole A.; Reis, Mitermayer G.; Riley, Lee W.; Haake, David A.; Ko, Albert I.
2005-01-01
Summary Proteins with bacterial immunoglobulin-like (Big) domains, such as the Yersinia pseudotuberculosis invasin and Escherichia coli intimin, are surface-expressed proteins that mediate host mammalian cell invasion or attachment. Here, we report the identification and characterization of a new family of Big domain proteins, referred to as Lig (leptospiral Ig-like) proteins, in pathogenic Leptospira. Screening of L. interrogans and L. kirschneri expression libraries with sera from leptospirosis patients identified 13 lambda phage clones that encode tandem repeats of the 90 amino acid Big domain. Two lig genes, designated ligA and ligB, and one pseudo-gene, ligC, were identified. The ligA and ligB genes encode amino-terminal lipoprotein signal peptides followed by 10 or 11 Big domain repeats and, in the case of ligB, a unique carboxy-terminal non-repeat domain. The organization of ligC is similar to that of ligB but contains mutations that disrupt the reading frame. The lig sequences are present in pathogenic but not saprophytic Leptospira species. LigA and LigB are expressed by a variety of virulent leptospiral strains. Loss of Lig protein and RNA transcript expression is correlated with the observed loss of virulence during culture attenuation of pathogenic strains. High-pressure freeze substitution followed by immunocytochemical electron microscopy confirmed that the Lig proteins were localized to the bacterial surface. Immunoblot studies with patient sera found that the Lig proteins are a major antigen recognized during the acute host infection. These observations demonstrate that the Lig proteins are a newly identified surface protein of pathogenic Leptospira, which by analogy to other bacterial immunoglobulin superfamily virulence factors, may play a role in host cell attachment and invasion during leptospiral pathogenesis. PMID:12890019
FISHing for bacteria in food--a promising tool for the reliable detection of pathogenic bacteria?
Rohde, Alexander; Hammerl, Jens Andre; Appel, Bernd; Dieckmann, Ralf; Al Dahouk, Sascha
2015-04-01
Foodborne pathogens cause millions of infections every year and are responsible for considerable economic losses worldwide. The current gold standard for the detection of bacterial pathogens in food is still the conventional cultivation following standardized and generally accepted protocols. However, these methods are time-consuming and do not provide fast information about food contaminations and thus are limited in their ability to protect consumers in time from potential microbial hazards. Fluorescence in situ hybridization (FISH) represents a rapid and highly specific technique for whole-cell detection. This review aims to summarize the current data on FISH-testing for the detection of pathogenic bacteria in different food matrices and to evaluate its suitability for the implementation in routine testing. In this context, the use of FISH in different matrices and their pretreatment will be presented, the sensitivity and specificity of FISH tests will be considered and the need for automation shall be discussed as well as the use of technological improvements to overcome current hurdles for a broad application in monitoring food safety. In addition, the overall economical feasibility will be assessed in a rough calculation of costs, and strengths and weaknesses of FISH are considered in comparison with traditional and well-established detection methods. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.
DEFF Research Database (Denmark)
Lievens, B.; Frans, I.; Heusdens, C.
2011-01-01
for the simultaneous detection and identification of all cyprinid herpesviruses (CyHV‐1, CyHV‐2 and CyHV‐3) and some of the most important fish pathogenic Flavobacterium species, including F. branchiophilum, F. columnare and F. psychrophilum. For virus identification, the DNA polymerase and helicase genes were...
Schmalz, Gerhard; Tsigaras, Sandra; Rinke, Sven; Kottmann, Tanja; Haak, Rainer; Ziebolz, Dirk
2016-07-01
The aim of this study was to compare the microbial analysis methods of polymerase chain reaction (PCR) and real-time PCR (RT-PCR) in terms of detection of five selected potentially periodontal pathogenic bacteria in peri-implant disease. Therefore 45 samples of healthy, mucositis and peri-implantitis (n = 15 each) were assessed according to presence of the following bacteria using PCR (DNA-strip technology) and RT-PCR (fluorescent dye SYBR green-system): Aggregatibacter actinomycetemcomitans (Aa), Porphyromonas gingivalis (Pg), Treponema denticola (Td), Tanerella forsythia (Tf), and Fusobacterium nucleatum (Fn). There were no significant correlations between the bacterial and disease patterns, so the benefit of using microbiological tests for the diagnosis of peri-implant diseases is questionable. Correlations between the methods were highest for Tf (Kendall's Tau: 0.65, Spearman: 0.78), Fn (0.49, 0.61) and Td (0.49, 0.59). For Aa (0.38, 0.42) and Pg (0.04, 0.04), lower correlation values were detected. Accordingly, conventional semi-quantitative PCR seems to be sufficient for analyzing potentially periodontal pathogenic bacterial species. Copyright © 2016 Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Ernstsen, Christina L; Login, Frédéric H; Jensen, Helene H
2017-01-01
To target bacterial pathogens that invade and proliferate inside host cells, it is necessary to design intervention strategies directed against bacterial attachment, cellular invasion and intracellular proliferation. We present an automated microscopy-based, fast, high-throughput method for analy...
Quorum sensing and bacterial pathogenicity: From molecules to disease
Directory of Open Access Journals (Sweden)
Antariksh Deep
2011-01-01
Full Text Available Quorum sensing in prokaryotic biology refers to the ability of a bacterium to sense information from other cells in the population when they reach a critical concentration (i.e. a Quorum and communicate with them. The "language" used for this intercellular communication is based on small, self-generated signal molecules called as autoinducers. Quorum sensing is thought to afford pathogenic bacteria a mechanism to minimize host immune responses by delaying the production of tissue-damaging virulence factors until sufficient bacteria have amassed and are prepared to overwhelm host defense mechanisms and establish infection. Quorum sensing systems are studied in a large number of gram-negative bacterial species belonging to α, β, and γ subclasses of proteobacteria. Among the pathogenic bacteria, Pseudomonas aeruginosa is perhaps the best understood in terms of the virulence factors regulated and the role the Quorum sensing plays in pathogenicity. Presently, Quorum sensing is considered as a potential novel target for antimicrobial therapy to control multi/all drug-resistant infections. This paper reviews Quorum sensing in gram positive and gram negative bacteria and its role in biofilm formation.
Relationship between lactobacilli and opportunistic bacterial pathogens associated with vaginitis
Razzak, Mohammad Sabri A.; Al-Charrakh, Alaa H.; AL-Greitty, Bara Hamid
2011-01-01
Background: Vaginitis, is an infectious inflammation of the vaginal mucosa, which sometimes involves the vulva. The balance of the vaginal flora is maintained by the Lactobacilli and its protective and probiotic role in treating and preventing vaginal infection by producing antagonizing compounds which are regarded as safe for humans. Aim: The aim of this study was to evaluate the protective role of Lactobacilli against common bacterial opportunistic pathogens in vaginitis and study the effec...
Directory of Open Access Journals (Sweden)
A. Hatmanti
2008-01-01
Full Text Available Investigation of pathogenic bacteria and its inhibitor on grouper culture in some places of Lampung Bay had been carried out. Six strains of pathogenic bacteria and 28 strains of inhibitior bacteria were found in grouper and its habitat. By inhibition test, 4 strains inhibited pathogenic bacteria were obtained. Inhibition test for Vibrio harveyi had also been performed using a bacterial collection of Marine Microbiology Laboratory of Research Center of Oceanography-LIPI. The result showed that 3 strains could be used against bacterial infection. This study offers a positive prospect to prevent outbreak of bacterial diseases in grouper culture. Keywords: grouper culture, Lampung, inhibitor bacteria, pathogenic bacteria, inhibition test ABSTRAK Penelitian penyakit bakterial dan bakteri penghambatnya pada budidaya ikan kerapu di beberapa tempat di perairan Teluk Lampung telah dilakukan. Enam strain bakteri patogen dan 28 strain bakteri penghambat telah berhasil diisolasi dari ikan kerapu dan habitat tempat hidupnya. Dari hasil uji tantang (inhibition test yang dilakukan, diperoleh 4 strain bakteri penghambat yang mampu menekan pertumbuhan bakteri patogen. Selain itu, uji tantang terhadap bakteri patogen Vibrio harveyi, menggunakan bakteri penghambat koleksi Laboratorium Mikrobiologi Laut Puslit Oseanografi LIPI juga telah dilakukan. Hasil penelitian menunjukkan bahwa 3 strain bakteri mampu memberikan hambatan terhadap pertumbuhan Vibrio harveyi. Studi ini memberikan prospek positif terhadap penanggulangan penyakit bakterial pada budidaya ikan kerapu. Kata kunci: budidaya kerapu, Lampung, bakteri penghambat, bakteri patogen, uji tantang
Directory of Open Access Journals (Sweden)
Md. Tareq-Uz-Zaman
2014-04-01
Full Text Available Aeromonas hydrophila, a bacterial pathogen, was isolated form Pangasius hypophthalmus. For pathogenicity test, different doses were injected intramuscularly in Barbonymus gonionotus. Crude extracts were prepared from various parts Azadirachta indica, Curcuma longa, C. zedoaria, and Callotropis gigentia and applied to B. gonionotus for 7 days. Bath treatment was done up to their tolerance level and well ventilation was confirmed for aeration and 50% water was exchanged daily. Minimum inhibitory dose was detected as 7 mg/ml. High inhibitory effect was observed in case of A. indica and mixed extract of A. indica and C. gigentia. Both A. indica and C. gigentia showed the best result with 90-95% recovery of infected fish at a dose of 7 mg/l. C. zedoaria showed moderate to weak effect with 50-60% recovery at the same dose. The present study showed that medicinal plants would be an effective control measure against A. hydrophila.
Cebrián, Guillermo; Mañas, Pilar; Condón, Santiago
2016-01-01
In this paper the resistance of bacterial foodborne pathogens to manosonication (MS), pulsed electric fields (PEFs), high hydrostatic pressure (HHP), and UV-light (UV) is reviewed and compared. The influence of different factors on the resistance of bacterial foodborne pathogens to these technologies is also compared and discussed. Only results obtained under harmonized experimental conditions have been considered. This has allowed us to establish meaningful comparisons and draw significant conclusions. Among the six microorganisms here considered, Staphyloccocus aureus is the most resistant foodborne pathogen to MS and HHP and Listeria monocytogenes to UV. The target microorganism of PEF would change depending on the treatment medium pH. Thus, L. monocytogenes is the most PEF resistant microorganism at neutral pH but Gram-negatives (Escherichia coli, Salmonella spp., Cronobacter sakazakii, Campylobacter jejuni) would display a similar or even higher resistance at acidic pH. It should be noted that, in acidic products, the baroresistance of some E. coli strains would be comparable to that of S. aureus. The factors affecting the resistance of bacterial foodborne pathogens, as well as the magnitude of the effect, varied depending on the technology considered. Inter- and intra-specific differences in microbial resistance to PEF and HHP are much greater than to MS and UV. Similarly, both the pH and aw of the treatment medium highly condition microbial resistance to PEF and HHP but no to MS or UV. Growth phase also drastically affected bacterial HHP resistance. Regarding UV, the optical properties of the medium are, by far, the most influential factor affecting its lethal efficacy. Finally, increasing treatment temperature leads to a significant increase in lethality of the four technologies, what opens the possibility of the development of combined processes including heat. The appearance of sublethally damaged cells following PEF and HHP treatments could also be
Cebrián, Guillermo; Mañas, Pilar; Condón, Santiago
2016-01-01
In this paper the resistance of bacterial foodborne pathogens to manosonication (MS), pulsed electric fields (PEFs), high hydrostatic pressure (HHP), and UV-light (UV) is reviewed and compared. The influence of different factors on the resistance of bacterial foodborne pathogens to these technologies is also compared and discussed. Only results obtained under harmonized experimental conditions have been considered. This has allowed us to establish meaningful comparisons and draw significant conclusions. Among the six microorganisms here considered, Staphyloccocus aureus is the most resistant foodborne pathogen to MS and HHP and Listeria monocytogenes to UV. The target microorganism of PEF would change depending on the treatment medium pH. Thus, L. monocytogenes is the most PEF resistant microorganism at neutral pH but Gram-negatives (Escherichia coli, Salmonella spp., Cronobacter sakazakii, Campylobacter jejuni) would display a similar or even higher resistance at acidic pH. It should be noted that, in acidic products, the baroresistance of some E. coli strains would be comparable to that of S. aureus. The factors affecting the resistance of bacterial foodborne pathogens, as well as the magnitude of the effect, varied depending on the technology considered. Inter- and intra-specific differences in microbial resistance to PEF and HHP are much greater than to MS and UV. Similarly, both the pH and aw of the treatment medium highly condition microbial resistance to PEF and HHP but no to MS or UV. Growth phase also drastically affected bacterial HHP resistance. Regarding UV, the optical properties of the medium are, by far, the most influential factor affecting its lethal efficacy. Finally, increasing treatment temperature leads to a significant increase in lethality of the four technologies, what opens the possibility of the development of combined processes including heat. The appearance of sublethally damaged cells following PEF and HHP treatments could also be
Directory of Open Access Journals (Sweden)
Guillermo eCebrián
2016-05-01
Full Text Available In this paper the resistance of bacterial foodborne pathogens to manosonication (MS, pulsed electric fields (PEF, high hydrostatic pressure (HHP and UV-light (UV is reviewed and compared. The influence of different factors on the resistance of bacterial foodborne pathogens to these technologies is also compared and discussed. Only results obtained under harmonized experimental conditions have been considered. This has allowed us to establish meaningful comparisons and draw significant conclusions. Among the six microorganisms here considered, Staphyloccocus aureus is the most resistant foodborne pathogen to MS and HHP and Listeria monocytogenes to UV. The target microorganism of PEF would change depending on the treatment medium pH. Thus, L. monocytogenes is the most PEF resistant microorganism at neutral pH but Gram-negatives (Escherichia coli, Salmonella spp., Cronobacter sakazakii, Campylobacter jejuni would display a similar or even higher resistance at acidic pH. It should be noted that, in acidic products, the baroresistance of some E. coli strains would be comparable to that of S. aureus. The factors affecting the resistance of bacterial foodborne pathogens, as well as the magnitude of the effect, varied depending on the technology considered. Inter- and intra-specific differences in microbial resistance to PEF and HHP are much greater than to MS and UV. Similarly, both the pH and aw of the treatment medium highly condition microbial resistance to PEF and HHP but no to MS or UV. Growth phase also drastically affected bacterial HHP resistance. Regarding UV, the optical properties of the medium are, by far, the most influential factor affecting its lethal efficacy. Finally, increasing treatment temperature leads to a significant increase in lethality of the four technologies, what opens the possibility of the development of combined processes including heat. The appearance of sublethally damaged cells following PEF and HHP treatments could
Modulation of Intestinal Paracellular Transport by Bacterial Pathogens.
Roxas, Jennifer Lising; Viswanathan, V K
2018-03-25
The passive and regulated movement of ions, solutes, and water via spaces between cells of the epithelial monolayer plays a critical role in the normal intestinal functioning. This paracellular pathway displays a high level of structural and functional specialization, with the membrane-spanning complexes of the tight junctions, adherens junctions, and desmosomes ensuring its integrity. Tight junction proteins, like occludin, tricellulin, and the claudin family isoforms, play prominent roles as barriers to unrestricted paracellular transport. The past decade has witnessed major advances in our understanding of the architecture and function of epithelial tight junctions. While it has been long appreciated that microbes, notably bacterial and viral pathogens, target and disrupt junctional complexes and alter paracellular permeability, the precise mechanisms remain to be defined. Notably, renewed efforts will be required to interpret the available data on pathogen-mediated barrier disruption in the context of the most recent findings on tight junction structure and function. While much of the focus has been on pathogen-induced dysregulation of junctional complexes, commensal microbiota and their products may influence paracellular permeability and contribute to the normal physiology of the gut. Finally, microbes and their products have become important tools in exploring host systems, including the junctional properties of epithelial cells. © 2018 American Physiological Society. Compr Physiol 8:823-842, 2018. Copyright © 2018 American Physiological Society. All rights reserved.
Microbiological food safety issues in Brazil: bacterial pathogens.
Gomes, Bruna Carrer; Franco, Bernadette Dora Gombossy de Melo; De Martinis, Elaine Cristina Pereira
2013-03-01
The globalization of food supply impacts patterns of foodborne disease outbreaks worldwide, and consumers are having increased concern about microbiological food safety. In this sense, the assessment of epidemiological data of foodborne diseases in different countries has not only local impact, but it can also be of general interest, especially in the case of major global producers and exporters of several agricultural food products, such as Brazil. In this review, the most common agents of foodborne illnesses registered in Brazil will be presented, compiled mainly from official databases made available to the public. In addition, some representative examples of studies on foodborne bacterial pathogens commonly found in Brazilian foods are provided.
Urbanus, Malene L; Quaile, Andrew T; Stogios, Peter J; Morar, Mariya; Rao, Chitong; Di Leo, Rosa; Evdokimova, Elena; Lam, Mandy; Oatway, Christina; Cuff, Marianne E; Osipiuk, Jerzy; Michalska, Karolina; Nocek, Boguslaw P; Taipale, Mikko; Savchenko, Alexei; Ensminger, Alexander W
2016-12-16
Pathogens deliver complex arsenals of translocated effector proteins to host cells during infection, but the extent to which these proteins are regulated once inside the eukaryotic cell remains poorly defined. Among all bacterial pathogens, Legionella pneumophila maintains the largest known set of translocated substrates, delivering over 300 proteins to the host cell via its Type IVB, Icm/Dot translocation system. Backed by a few notable examples of effector-effector regulation in L. pneumophila, we sought to define the extent of this phenomenon through a systematic analysis of effector-effector functional interaction. We used Saccharomyces cerevisiae, an established proxy for the eukaryotic host, to query > 108,000 pairwise genetic interactions between two compatible expression libraries of ~330 L. pneumophila-translocated substrates. While capturing all known examples of effector-effector suppression, we identify fourteen novel translocated substrates that suppress the activity of other bacterial effectors and one pair with synergistic activities. In at least nine instances, this regulation is direct-a hallmark of an emerging class of proteins called metaeffectors, or "effectors of effectors". Through detailed structural and functional analysis, we show that metaeffector activity derives from a diverse range of mechanisms, shapes evolution, and can be used to reveal important aspects of each cognate effector's function. Metaeffectors, along with other, indirect, forms of effector-effector modulation, may be a common feature of many intracellular pathogens-with unrealized potential to inform our understanding of how pathogens regulate their interactions with the host cell. © 2016 The Authors. Published under the terms of the CC BY 4.0 license.
Effects of Lactobacillus rhamnosus and Lactobacillus acidophilus on bacterial vaginal pathogens.
Bertuccini, Lucia; Russo, Rosario; Iosi, Francesca; Superti, Fabiana
2017-06-01
The human vagina is colonized by a variety of microbes. Lactobacilli are the most common, mainly in healthy women; however, the microbiota composition can change rapidly, leading to infection or to a state in which potential pathogenic microorganisms co-exist with other commensals. In premenopausal women, urogenital infections, such as bacterial vaginosis and aerobic vaginitis, remain an important health problem. Treatment of these infections involves different kind of antibiotics; however, the recurrence rate remains high, and it must be also underlined that antibiotics are unable to spontaneously restore normal flora characterized by an abundant community of Lactobacilli. The main limitation is the inability to offer a long-term defensive barrier, thus facilitating relapses and recurrences. We report here the antimicrobial activities of two commercially existing Lactobacillus strains, Lactobacillus rhamnosus HN001 and Lactobacillus acidophilus GLA-14 strains and their combination (Respecta® probiotic blend) against four different pathogens responsible for both bacterial vaginosis ( Gardenerella vaginalis and Atopobium vaginae) and aerobic vaginitis ( Staphylococcus aureus and Escherichia coli) by co-culturing assay. The probiotic combination, even if resulting in a different microbicidal activity against the different strains tested, demonstrated the efficacy of combined Lactobacillus strain treatment.
The diagnosis of plant pathogenic bacteria: a state of art.
Scala, Valeria; Pucci, Nicoletta; Loreti, Stefania
2018-03-01
Plant protection plays an important role in agriculture for the food quality and quantity. The diagnosis of plant diseases and the identification of the pathogens are essential prerequisites for their understanding and control. Among the plant pests, the bacterial pathogens have devastating effects on plant productivity and yield. Different techniques (microscopy, serology, biochemical, physiological, molecular tools and culture propagation) are currently used to detect and identify bacterial pathogens. Detection and identification are critical steps for the appropriate application of phytosanitary measures. The "harmonization of phytosanitary regulations and all other areas of official plant protection action" mean the good practices for plant protection and plant material certification. The prevention of diseases progression and spread by early detection are a valuable strategy for proper pest management and disease control. For this purpose, innovative methods aim achieving results within a shorter time and higher performance, to provide rapidly, accurately and reliably diagnosis. In this review, we focus on the techniques for plant bacterial diagnosis and on the regulations for harmonizing plant protection issue.
Wan, Jingjing; Jing, Yuhang; Rao, Yue; Zhang, Shicheng; Luo, Gang
2018-03-15
Thermophilic alkaline fermentation followed by mesophilic anaerobic digestion (TM) for hydrogen and methane production from waste-activated sludge (WAS) was investigated. The TM process was also compared to a process with mesophilic alkaline fermentation followed by a mesophilic anaerobic digestion (MM) and one-stage mesophilic anaerobic digestion (M) process. The results showed that both hydrogen yield (74.5 ml H 2 /g volatile solids [VS]) and methane yield (150.7 ml CH 4 /g VS) in the TM process were higher than those (6.7 ml H 2 /g VS and 127.8 ml CH 4 /g VS, respectively) in the MM process. The lowest methane yield (101.2 ml CH 4 /g VS) was obtained with the M process. Taxonomic results obtained from metagenomic analysis showed that different microbial community compositions were established in the hydrogen reactors of the TM and MM processes, which also significantly changed the microbial community compositions in the following methane reactors compared to that with the M process. The dynamics of bacterial pathogens were also evaluated. For the TM process, the reduced diversity and total abundance of bacterial pathogens in WAS were observed in the hydrogen reactor and were further reduced in the methane reactor, as revealed by metagenomic analysis. The results also showed not all bacterial pathogens were reduced in the reactors. For example, Collinsella aerofaciens was enriched in the hydrogen reactor, which was also confirmed by quantitative PCR (qPCR) analysis. The study further showed that qPCR was more sensitive for detecting bacterial pathogens than metagenomic analysis. Although there were some differences in the relative abundances of bacterial pathogens calculated by metagenomic and qPCR approaches, both approaches demonstrated that the TM process was more efficient for the removal of bacterial pathogens than the MM and M processes. IMPORTANCE This study developed an efficient process for bioenergy (H 2 and CH 4 ) production from WAS and elucidates the
Peng, Mengfei; Biswas, Debabrata
2017-12-12
As a major source of microbes and their numerous beneficial effects, the gut microflora/microbiome is intimately linked to human health and disease. The exclusion of enteric pathogens by these commensal microbes partially depends upon the production of bioactive compounds such as short-chain fatty acids (SCFAs) and polyunsaturated fatty acids (PUFAs). These key intestinal microbial byproducts are crucial to the maintenance of a healthy gut microbial community. Moreover, SCFAs and PUFAs play multiple critical roles in host defense and immunity, including anti-cancer, anti-inflammation, and anti-oxidant activities, as well as out-competition of enteric bacterial pathogens. In this review article, we hereby aim to highlight the importance of SCFAs and PUFAs and the microbes involved in production of these beneficial intestinal components, and their biological functions, specifically as to their immunomodulation and interactions with enteric bacterial pathogens. Finally, we also advance potential applications of these fatty acids with regards to food safety and human gut health.
DEFF Research Database (Denmark)
Luo, Gang; Angelidaki, Irini
2014-01-01
with time were also observed. This could be attributed to varying composition of the influent. Batch experiments showed that the methane recovery from the digested residues (obtained from biogas reactor) was mainly related with post-digestion temperature. However, post-digestion time rather than temperature......The present study investigated the changes of bacterial community composition including bacterial pathogens along a biogas plant, i.e. from the influent, to the biogas reactor and to the post-digester. The effects of post-digestion temperature and time on the changes of bacterial community...... showed that the bacterial community composition in the influent was changed after anaerobic digestion. Firmicutes were dominant in all the samples, while Proteobacteria decreased in the biogas reactor compared with the influent. Variations of bacterial community composition in the biogas reactor...
Detecting Release of Bacterial dsDNA into the Host Cytosol Using Fluorescence Microscopy.
Dreier, Roland Felix; Santos, José Carlos; Broz, Petr
2018-01-01
Recognition of pathogens by the innate immune system relies on germline-encoded pattern recognition receptors (PRRs) that recognize unique microbial molecules, so-called pathogen-associated molecular patterns (PAMPs). Nucleic acids and their derivatives are one of the most important groups of PAMPs, and are recognized by a number of surface-associated as well as cytosolic PRRs. Cyclic GMP-AMP synthase (cGAS) recognizes the presence of pathogen- or host-derived dsDNA in the cytosol and initiates type-I-IFN production. Here, we describe a methodology that allows for evaluating the association of cGAS with released bacterial dsDNA during Francisella novicida infection of macrophages, by fluorescence confocal microscopy. This method can be adapted to the study of cGAS-dependent responses elicited by other intracellular bacterial pathogens and in other cell types.
Multiplex detection of plant pathogens using a microsphere immunoassay technology.
Directory of Open Access Journals (Sweden)
Ratthaphol Charlermroj
Full Text Available Plant pathogens are a serious problem for seed export, plant disease control and plant quarantine. Rapid and accurate screening tests are urgently required to protect and prevent plant diseases spreading worldwide. A novel multiplex detection method was developed based on microsphere immunoassays to simultaneously detect four important plant pathogens: a fruit blotch bacterium Acidovorax avenae subsp. citrulli (Aac, chilli vein-banding mottle virus (CVbMV, potyvirus, watermelon silver mottle virus (WSMoV, tospovirus serogroup IV and melon yellow spot virus (MYSV, tospovirus. An antibody for each plant pathogen was linked on a fluorescence-coded magnetic microsphere set which was used to capture corresponding pathogen. The presence of pathogens was detected by R-phycoerythrin (RPE-labeled antibodies specific to the pathogens. The assay conditions were optimized by identifying appropriate antibody pairs, blocking buffer, concentration of RPE-labeled antibodies and assay time. Once conditions were optimized, the assay was able to detect all four plant pathogens precisely and accurately with substantially higher sensitivity than enzyme-linked immunosorbent assay (ELISA when spiked in buffer and in healthy watermelon leaf extract. The assay time of the microsphere immunoassay (1 hour was much shorter than that of ELISA (4 hours. This system was also shown to be capable of detecting the pathogens in naturally infected plant samples and is a major advancement in plant pathogen detection.
Multiplex detection of plant pathogens using a microsphere immunoassay technology.
Charlermroj, Ratthaphol; Himananto, Orawan; Seepiban, Channarong; Kumpoosiri, Mallika; Warin, Nuchnard; Oplatowska, Michalina; Gajanandana, Oraprapai; Grant, Irene R; Karoonuthaisiri, Nitsara; Elliott, Christopher T
2013-01-01
Plant pathogens are a serious problem for seed export, plant disease control and plant quarantine. Rapid and accurate screening tests are urgently required to protect and prevent plant diseases spreading worldwide. A novel multiplex detection method was developed based on microsphere immunoassays to simultaneously detect four important plant pathogens: a fruit blotch bacterium Acidovorax avenae subsp. citrulli (Aac), chilli vein-banding mottle virus (CVbMV, potyvirus), watermelon silver mottle virus (WSMoV, tospovirus serogroup IV) and melon yellow spot virus (MYSV, tospovirus). An antibody for each plant pathogen was linked on a fluorescence-coded magnetic microsphere set which was used to capture corresponding pathogen. The presence of pathogens was detected by R-phycoerythrin (RPE)-labeled antibodies specific to the pathogens. The assay conditions were optimized by identifying appropriate antibody pairs, blocking buffer, concentration of RPE-labeled antibodies and assay time. Once conditions were optimized, the assay was able to detect all four plant pathogens precisely and accurately with substantially higher sensitivity than enzyme-linked immunosorbent assay (ELISA) when spiked in buffer and in healthy watermelon leaf extract. The assay time of the microsphere immunoassay (1 hour) was much shorter than that of ELISA (4 hours). This system was also shown to be capable of detecting the pathogens in naturally infected plant samples and is a major advancement in plant pathogen detection.
Shellfish as reservoirs of bacterial pathogens
Directory of Open Access Journals (Sweden)
Harry Hariharan
2016-04-01
Full Text Available The objective of this article is to present an overview on bacterial pathogens associated with shellfish in Grenada and other countries including the authors’ experience. Although there have been considerable published work on vibrios, there is a lack of information on Salmonella serovars associated with various shellfish. In Grenada, for instance the blue land crabs collected from their habitats were found to harbor several Salmonella serovars. Also, it is notable that only minimal research has been done on shellfish such as conchs and whelks, which are common in the Caribbean and West Indies. Information on anaerobic bacteria, particularly, non-spore forming bacteria associated with shellfish, in general, is also scanty. This review re-examines this globally important topic based on the recent findings as well as past observations. Strategies for reduction of bacteria in oysters are briefly mentioned because of the fact that oysters are consumed commonly without complete cooking.
Directory of Open Access Journals (Sweden)
Mari Narusaka
Full Text Available Housaku Monogatari (HM is a plant activator prepared from a yeast cell wall extract. We examined the efficacy of HM application and observed that HM treatment increased the resistance of Arabidopsis thaliana and Brassica rapa leaves to bacterial and fungal infections. HM reduced the severity of bacterial leaf spot and anthracnose on A. thaliana and Brassica crop leaves with protective effects. In addition, gene expression analysis of A. thaliana plants after treatment with HM indicated increased expression of several plant defense-related genes. HM treatment appears to induce early activation of jasmonate/ethylene and late activation of salicylic acid (SA pathways. Analysis using signaling mutants revealed that HM required SA accumulation and SA signaling to facilitate resistance to the bacterial pathogen Pseudomonas syringae pv. maculicola and the fungal pathogen Colletotrichum higginsianum. In addition, HM-induced resistance conferred chitin-independent disease resistance to bacterial pathogens in A. thaliana. These results suggest that HM contains multiple microbe-associated molecular patterns that activate defense responses in plants. These findings suggest that the application of HM is a useful tool that may facilitate new disease control methods.
Detection of Bacterial Pathogens from Broncho-Alveolar Lavage by Next-Generation Sequencing.
Leo, Stefano; Gaïa, Nadia; Ruppé, Etienne; Emonet, Stephane; Girard, Myriam; Lazarevic, Vladimir; Schrenzel, Jacques
2017-09-20
The applications of whole-metagenome shotgun sequencing (WMGS) in routine clinical analysis are still limited. A combination of a DNA extraction procedure, sequencing, and bioinformatics tools is essential for the removal of human DNA and for improving bacterial species identification in a timely manner. We tackled these issues with a broncho-alveolar lavage (BAL) sample from an immunocompromised patient who had developed severe chronic pneumonia. We extracted DNA from the BAL sample with protocols based either on sequential lysis of human and bacterial cells or on the mechanical disruption of all cells. Metagenomic libraries were sequenced on Illumina HiSeq platforms. Microbial community composition was determined by k-mer analysis or by mapping to taxonomic markers. Results were compared to those obtained by conventional clinical culture and molecular methods. Compared to mechanical cell disruption, a sequential lysis protocol resulted in a significantly increased proportion of bacterial DNA over human DNA and higher sequence coverage of Mycobacterium abscessus , Corynebacterium jeikeium and Rothia dentocariosa , the bacteria reported by clinical microbiology tests. In addition, we identified anaerobic bacteria not searched for by the clinical laboratory. Our results further support the implementation of WMGS in clinical routine diagnosis for bacterial identification.
Molecular analysis of bacterial pathogens in otitis media with effusion.
Post, J C; Preston, R A; Aul, J J; Larkins-Pettigrew, M; Rydquist-White, J; Anderson, K W; Wadowsky, R M; Reagan, D R; Walker, E S; Kingsley, L A; Magit, A E; Ehrlich, G D
To determine if the polymerase chain reaction (PCR) can detect bacterial DNA in pediatric middle ear effusions that are sterile by standard cultural methods. Single-center, blinded, comparative study of diagnostic assays. The PCR-based detection systems for Moraxella catarrhalis, Haemophilus influenzae, and Streptococcus pneumoniae were designed and validated using a battery of DNAs obtained from cultured bacteria. Chronic middle ear effusion specimens were collected and comparatively analyzed by culture and the PCR. Tertiary care pediatric hospital. A total of 97 middle ear effusions were collected from pediatric outpatients at Children's Hospital of Pittsburgh (Pa) during myringotomy and tube placement for chronic otitis media with effusion (duration > 3 months). All patients had failed multiple courses of antimicrobial therapy and were diagnosed by a combination of validated otoscopy and tympanograms. Differences in the percentage of positive test results between PCR-based assays and culture for M catarrhalis, H influenzae, and S pneumoniae. Of the 97 specimens of otitis media with effusion, 28 (28.9%) tested positive by both culture and PCR for M catarrhalis, H influenzae, or S pneumoniae. An additional 47 specimens (48%) were PCR positive/culture negative for these three bacterial species. Thus, 75 (77.3%) of the 97 specimens tested PCR positive for one or more of the three test organisms. The minimum number of bacterial genomic equivalents present in the average culture-negative ear was estimated to be greater than 10(4) based on dilutional experiments. The PCR-based assay systems can detect the presence of bacterial DNA in a significant percentage of culturally sterile middle ear effusions. While this finding is not proof of an active bacterial infectious process, the large number of bacterial genomic equivalents present in the ears is suggestive of an active process.
DNA Checkerboard Method for Bacterial Pathogen Identification in Oral Diseases
Nascimento, Cássio do; Issa, João Paulo Mardegan; Watanabe, Evandro; Ito, Izabel Yoko
2006-01-01
This work aim to show by literature review the principal characteristics of the DNA checkerboard method for bacterial pathogens identification in oral diseases, showing the most varieties uses and applications of this technique Este trabajo tiene como objetivo, presentar en una revisión de la literatura, las principales características del método de chequeo del DNA para la identificación de bacterias patógenas en la cavidad oral, mostrando las diferentes utilizaciones y aplicaciones de est...
Visser, M; Stephan, D; Jaynes, J M; Burger, J T
2012-06-01
Natural and synthetic antimicrobial peptides (AMPs) are of increasing interest as potential resistance conferring elements in plants against pathogen infection. The efficacy of AMPs against pathogens is prescreened by in vitro assays, and promising AMP candidates are introduced as transgenes into plants. As in vitro and in planta environments differ, a prescreening procedure of the AMP efficacy in the plant environment is desired. Here, we report the efficacy of the purified synthetic peptide D4E1 against the grapevine-infecting bacterial pathogens Agrobacterium vitis and Xylophilus ampelinus in vitro and describe for the first time an in planta prescreening procedure based on transiently expressed D4E1. The antimicrobial effect of D4E1 against Ag. vitis and X. ampelinus was shown by a reduction in colony-forming units in vitro in a traditional plate-based assay and by a reduction in bacterial titres in planta as measured by quantitative real-time PCR (qPCR) in grapevine leaves transiently expressing D4E1. A statistically significant reduction in titre was shown for X. ampelinus, but for Ag. vitis, a significant reduction in titre was only observed in a subset of plants. The titres of both grapevine-infecting bacterial pathogens were reduced in an in vitro assay and for X. ampelinus in an in planta assay by D4E1 application. This widens the applicability of D4E1 as a potential resistance-enhancing element to additional pathogens and in a novel plant species. D4E1 is a promising candidate to confer enhanced resistance against the two tested grapevine bacterial pathogens, and the applied transient expression system proved to be a valuable tool for prescreening of D4E1 efficacy in an in planta environment. The described prescreening procedure can be used for other AMPs and might be adapted to other plant species and pathogens before the expensive and tedious development of stably transgenic lines is started. © 2012 The Authors. Letters in Applied Microbiology © 2012
Campuzano, Susana; Yáñez-Sedeño, Paloma; Pingarrón, José Manuel
2017-11-03
Rapid and reliable diagnosis of infectious diseases caused by pathogens, and timely initiation of appropriate treatment are critical determinants to promote optimal clinical outcomes and general public health. Conventional in vitro diagnostics for infectious diseases are time-consuming and require centralized laboratories, experienced personnel and bulky equipment. Recent advances in electrochemical affinity biosensors have demonstrated to surpass conventional standards in regards to time, simplicity, accuracy and cost in this field. The tremendous potential offered by electrochemical affinity biosensors to detect on-site infectious pathogens at clinically relevant levels in scarcely treated body fluids is clearly stated in this review. The development and application of selected examples using different specific receptors, assay formats and electrochemical approaches focusing on the determination of specific circulating biomarkers of different molecular (genetic, regulatory and functional) levels associated with bacterial and viral pathogens are critically discussed. Existing challenges still to be addressed and future directions in this rapidly advancing and highly interesting field are also briefly pointed out.
Pandey, Ashish; Gurbuz, Yasar; Ozguz, Volkan; Niazi, Javed H; Qureshi, Anjum
2017-05-15
E. coli O157:H7 is an enterohemorrhagic bacteria responsible for serious foodborne outbreaks that causes diarrhoea, fever and vomiting in humans. Recent foodborne E. coli outbreaks has left a serious concern to public health. Therefore, there is an increasing demand for a simple, rapid and sensitive method for pathogen detection in contaminated foods. In this study, we developed a label-free electrical biosensor interfaced with graphene for sensitive detection of pathogenic bacteria. This biosensor was fabricated by interfacing graphene with interdigitated microelectrodes of capacitors that were biofunctionalized with E. coli O157:H7 specific antibodies for sensitive pathogenic bacteria detection. Here, graphene nanostructures on the sensor surface provided superior chemical properties such as high carrier mobility and biocompatibility with antibodies and bacteria. The sensors transduced the signal based on changes in dielectric properties (capacitance) through (i) polarization of captured cell-surface charges, (ii) cells' internal bioactivity, (iii) cell-wall's electronegativity or dipole moment and their relaxation and (iv) charge carrier mobility of graphene that modulated the electrical properties once the pathogenic E. coli O157:H7 captured on the sensor surface. Sensitive capacitance changes thus observed with graphene based capacitors were specific to E. coli O157:H7 strain with a sensitivity as low as 10-100 cells/ml. The proposed graphene based electrical biosensor provided advantages of speed, sensitivity, specificity and in-situ bacterial detection with no chemical mediators, represents a versatile approach for detection of a wide variety of other pathogens. Copyright © 2016 Elsevier B.V. All rights reserved.
Janse, J.; Wenneker, M.
2002-01-01
Testing of planting material for freedom from phytopathogenic bacteria is an important, although not exclusive, method for control of bacterial diseases of plants. Ideally, pathogen-free or pathogen-/disease-resistant planting material is desirable, but this situation is not always possible on a
Directory of Open Access Journals (Sweden)
Berit Schulte
Full Text Available Severe pneumonia remains an important cause of morbidity and mortality. Polymerase chain reaction (PCR has been shown to be more sensitive than current standard microbiological methods--particularly in patients with prior antibiotic treatment--and therefore, may improve the accuracy of microbiological diagnosis for hospitalized patients with pneumonia. Conventional detection techniques and multiplex PCR for 14 typical bacterial pneumonia-associated pathogens were performed on respiratory samples collected from adult hospitalized patients enrolled in a prospective multi-center study. Patients were enrolled from March until September 2012. A total of 739 fresh, native samples were eligible for analysis, of which 75 were sputa, 421 aspirates, and 234 bronchial lavages. 276 pathogens were detected by microbiology for which a valid PCR result was generated (positive or negative detection result by Curetis prototype system. Among these, 120 were identified by the prototype assay, 50 pathogens were not detected. Overall performance of the prototype for pathogen identification was 70.6% sensitivity (95% confidence interval (CI lower bound: 63.3%, upper bound: 76.9% and 95.2% specificity (95% CI lower bound: 94.6%, upper bound: 95.7%. Based on the study results, device cut-off settings were adjusted for future series production. The overall performance with the settings of the CE series production devices was 78.7% sensitivity (95% CI lower bound: 72.1% and 96.6% specificity (95% CI lower bound: 96.1%. Time to result was 5.2 hours (median for the prototype test and 43.5 h for standard-of-care. The Pneumonia Application provides a rapid and moderately sensitive assay for the detection of pneumonia-causing pathogens with minimal hands-on time.Deutsches Register Klinischer Studien (DRKS DRKS00005684.
Oster, Ryan J.; Wijesinghe, Rasanthi U.; Fogarty, Lisa Reynolds; Haack, Sheridan K.; Fogarty, Lisa R.; Tucker, Taaja R.; Riley, Stephen
2014-01-01
Quantitative assessment of bacterial pathogens, their geographic variability, and distribution in various matrices at Great Lakes beaches are limited. Quantitative PCR (qPCR) was used to test for genes from E. coli O157:H7 (eaeO157), shiga-toxin producing E. coli (stx2), Campylobacter jejuni (mapA), Shigella spp. (ipaH), and a Salmonella enterica-specific (SE) DNA sequence at seven Great Lakes beaches, in algae, water, and sediment. Overall, detection frequencies were mapA>stx2>ipaH>SE>eaeO157. Results were highly variable among beaches and matrices; some correlations with environmental conditions were observed for mapA, stx2, and ipaH detections. Beach seasonal mean mapA abundance in water was correlated with beach seasonal mean log10E. coli concentration. At one beach, stx2 gene abundance was positively correlated with concurrent daily E. coli concentrations. Concentration distributions for stx2, ipaH, and mapA within algae, sediment, and water were statistically different (Non-Detect and Data Analysis in R). Assuming 10, 50, or 100% of gene copies represented viable and presumably infective cells, a quantitative microbial risk assessment tool developed by Michigan State University indicated a moderate probability of illness for Campylobacter jejuni at the study beaches, especially where recreational water quality criteria were exceeded. Pathogen gene quantification may be useful for beach water quality management.
Clemens-Grisham, Rachel Andrea; Bhattacharya, Sharmila; Wade, William
2016-01-01
After spaceflight, the number of immune cells is reduced in humans. In other research models, including Drosophila, not only is there a reduction in the number of plasmatocytes, but expression of immune-related genes is also changed after spaceflight. These observations suggest that the immune system is compromised after exposure to microgravity. It has also been reported that there is a change in virulence of some bacterial pathogens after spaceflight. We recently observed that samples of gram-negative S. marcescens retrieved from spaceflight is more virulent than ground controls, as determined by reduced survival and increased bacterial growth in the host. We were able to repeat this finding of increased virulence after exposure to simulated microgravity using the rotating wall vessel, a ground based analog to microgravity. With the ground and spaceflight samples, we looked at involvement of the Toll and Imd pathways in the Drosophila host in fighting infection by ground and spaceflight samples. We observed that Imd-pathway mutants were more susceptible to infection by the ground bacterial samples, which aligns with the known role of this pathway in fighting infections by gram-negative bacteria. When the Imd-pathway mutants were infected with the spaceflight sample, however, they exhibited the same susceptibility as seen with the ground control bacteria. Interestingly, all mutant flies show the same susceptibility to the spaceflight bacterial sample as do wild type flies. This suggests that neither humoral immunity pathway is effectively able to counter the increased pathogenicity of the space-flown S. marcescens bacteria.
Awan, Uzma Azeem; Andleeb, Saiqa; Kiyani, Ayesha; Zafar, Atiya; Shafique, Irsa; Riaz, Nazia; Azhar, Muhammad Tehseen; Uddin, Hafeez
2013-11-01
Chloroformic and isoamyl alcohol extracts of Cinnnamomum zylanicum, Cuminum cyminum, Curcuma long Linn, Trachyspermum ammi and selected standard antibiotics were investigated for their in vitro antibacterial activity against six human bacterial pathogens. The antibacterial activity was evaluated and based on the zone of inhibition using agar disc diffusion method. The tested bacterial strains were Streptococcus pyogenes, Staphylococcus epidermidis, Klebsiella pneumonia, Staphylococcus aurues, Serratia marcesnces, and Pseudomonas aeruginosa. Ciprofloxacin showed highly significant action against K. pneumonia and S. epidermidis while Ampicillin and Amoxicillin indicated lowest antibacterial activity against tested pathogens. Among the plants chloroform and isoamyl alcohol extracts of C. cyminum, S. aromaticum and C. long Linn had significant effect against P. aeruginosa, S. marcesnces and S. pyogenes. Comparison of antibacterial activity of medicinal herbs and standard antibiotics was also recorded via activity index. Used medicinal plants have various phytochemicals which reasonably justify their use as antibacterial agent.
van Spijk, J N; Schmitt, S; Fürst, A E; Schoster, A
2016-06-01
Antimicrobial resistance has become an important concern in veterinary medicine. The aim of this study was to describe the rate of antimicrobial resistance in common equine pathogens and to determine the occurrence of multidrug-resistant isolates. A retrospective analysis of all susceptibility testing results from bacterial pathogens cultured from horses at the University of Zurich Equine Hospital (2012-2015) was performed. Strains exhibiting resistance to 3 or more antimicrobial categories were defined as multidrug-resistant. Susceptibility results from 303 bacterial pathogens were analyzed, most commonly Escherichia coli (60/303, 20%) and Staphylococcus aureus (40/303, 13%). High rates of acquired resistance against commonly used antimicrobials were found in most of the frequently isolated equine pathogens. The highest rate of multidrug resistance was found in isolates of Acinetobacter baumannii (23/24, 96%), followed by Enterobacter cloacae complex (24/28, 86%) and Escherichia coli (48/60, 80%). Overall, 60% of Escherichia coli isolates were phenotypically ESBL-producing and 68% of Staphylococcus spp. were phenotypically methicillin-resistant. High rates of acquired antimicrobial resistance towards commonly used antibiotics are concerning and underline the importance of individual bacteriological and antimicrobial susceptibility testing to guide antimicrobial therapy. Minimizing and optimizing antimicrobial therapy in horses is needed.
Towle, Dana; Callan, Deborah A; Farrel, Patricia A; Egan, Marie E; Murray, Thomas S
2013-09-01
Contaminated nebulizers are a potential source of bacterial infection but no single method is universally accepted for disinfection. We hypothesized that baby-bottle steam sterilizers effectively disinfect home nebulizers. Home nebulizers were inoculated with the common CF respiratory pathogens methicillin resistant Staphylococcus aureus, Burkholderia cepacia, Haemophilus influenzae, mucoid and non mucoid Pseudomonas aeruginosa, and Stenotrophomonas maltophilia. The nebulizers were swabbed for bacterial growth, treated with either the AVENT (Philips), the NUK Quick & Ready (Gerber) or DRY-POD (Camera Baby) baby bottle steam sterilizer and reswabbed for bacterial growth. All steam sterilizers were effective at disinfecting all home nebulizers. Viable bacteria were not recovered from any inoculated site after steam treatment, under any conditions tested. Steam treatment is an effective disinfection method. Additional studies are needed to confirm whether these results are applicable to the clinical setting. Copyright © 2012 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.
el-Abyad, M S; el-Sayed, M A; el-Shanshoury, A R; el-Sabbagh, S M
1996-01-01
Thirty-seven actinomycete species isolated from fertile cultivated soils in Egypt were screened for the production of antimicrobial compounds against a variety of test organisms. Most of the isolates exhibited antimicrobial activities against Gram-positive, Gram-negative, and acid-fast bacteria, yeasts and filamentous fungi, with special attention to fungal and bacterial pathogens of tomato. On starch-nitrate agar, 14 strains were active against Fusarium oxysporum f.sp. lycopersici (the cause of Fusarium wilt), 18 against Verticillium albo-atrum (the cause of Verticillium wilt), and 18 against Alternaria solani (the cause of early blight). In liquid media, 14 isolates antagonized Pseudomonas solanacearum (the cause of bacterial wilt) and 20 antagonized Clavibacter michiganensis ssp. michiganensis (the cause of bacterial canker). The most active antagonists of the pathogenic microorganisms studied were found to be Streptomyces pulcher, S. canescens (syn. S. albidoflavus) and S. citreofluorescens (syn. S. anulatus). The antagonistic activities of S. pulcher and S. canescens against pathogenic fungi were assessed on solid media, and those of S. pulcher and S. citreofluorescens against pathogenic bacteria in liquid media under shaking conditions. The optimum culture conditions were determined.
Digital PCR for detection of citrus pathogens
Citrus trees are often infected with multiple pathogens of economic importance, especially those with insect or mite vectors. Real-time/quantitative PCR (qPCR) has been used for high-throughput detection and relative quantification of pathogens; however, target reference or standards are required. I...
From cholera to corals: Viruses as drivers of virulence in a major coral bacterial pathogen
Weynberg, Karen D.
2015-12-08
Disease is an increasing threat to reef-building corals. One of the few identified pathogens of coral disease is the bacterium Vibrio coralliilyticus. In Vibrio cholerae, infection by a bacterial virus (bacteriophage) results in the conversion of non-pathogenic strains to pathogenic strains and this can lead to cholera pandemics. Pathogenicity islands encoded in the V. cholerae genome play an important role in pathogenesis. Here we analyse five whole genome sequences of V. coralliilyticus to examine whether virulence is similarly driven by horizontally acquired elements. We demonstrate that bacteriophage genomes encoding toxin genes with homology to those found in pathogenic V. cholerae are integrated in V. coralliilyticus genomes. Virulence factors located on chromosomal pathogenicity islands also exist in some strains of V. coralliilyticus. The presence of these genetic signatures indicates virulence in V. coralliilyticus is driven by prophages and other horizontally acquired elements. Screening for pathogens of coral disease should target conserved regions in these elements.
From cholera to corals: Viruses as drivers of virulence in a major coral bacterial pathogen
Weynberg, Karen D.; Voolstra, Christian R.; Neave, Matthew J.; Buerger, Patrick; van Oppen, Madeleine J. H.
2015-01-01
Disease is an increasing threat to reef-building corals. One of the few identified pathogens of coral disease is the bacterium Vibrio coralliilyticus. In Vibrio cholerae, infection by a bacterial virus (bacteriophage) results in the conversion of non-pathogenic strains to pathogenic strains and this can lead to cholera pandemics. Pathogenicity islands encoded in the V. cholerae genome play an important role in pathogenesis. Here we analyse five whole genome sequences of V. coralliilyticus to examine whether virulence is similarly driven by horizontally acquired elements. We demonstrate that bacteriophage genomes encoding toxin genes with homology to those found in pathogenic V. cholerae are integrated in V. coralliilyticus genomes. Virulence factors located on chromosomal pathogenicity islands also exist in some strains of V. coralliilyticus. The presence of these genetic signatures indicates virulence in V. coralliilyticus is driven by prophages and other horizontally acquired elements. Screening for pathogens of coral disease should target conserved regions in these elements.
A new oligonucleotide microarray for detection of pathogenic and non-pathogenic Legionella spp.
Directory of Open Access Journals (Sweden)
Boyang Cao
Full Text Available Legionella pneumophila has been recognized as the major cause of legionellosis since the discovery of the deadly disease. Legionella spp. other than L. pneumophila were later found to be responsible to many non-pneumophila infections. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this report, we have sequenced the 16S-23S rRNA gene internal transcribed spacer (ITS of 10 Legionella species and subspecies, including L. anisa, L. bozemanii, L. dumoffii, L. fairfieldensis, L. gormanii, L. jordanis, L. maceachernii, L. micdadei, L. pneumophila subspp. fraseri and L. pneumophila subspp. pasculleii, and developed a rapid oligonucleotide microarray detection technique accordingly to identify 12 most common Legionella spp., which consist of 11 pathogenic species of L. anisa, L. bozemanii, L. dumoffii, L. gormanii, L. jordanis, L. longbeachae, L. maceachernii, L. micdadei, and L. pneumophila (including subspp. pneumophila, subspp. fraseri, and subspp. pasculleii and one non-pathogenic species, L. fairfieldensis. Twenty-nine probes that reproducibly detected multiple Legionella species with high specificity were included in the array. A total of 52 strains, including 30 target pathogens and 22 non-target bacteria, were used to verify the oligonucleotide microarray assay. The sensitivity of the detection was at 1.0 ng with genomic DNA or 13 CFU/100 mL with Legionella cultures. The microarray detected seven samples of air conditioner-condensed water with 100% accuracy, validating the technique as a promising method for applications in basic microbiology, clinical diagnosis, food safety, and epidemiological surveillance. The phylogenetic study based on the ITS has also revealed that the non-pathogenic L. fairfieldensis is the closest to L. pneumophila than the nine other pathogenic Legionella spp.
A New Oligonucleotide Microarray for Detection of Pathogenic and Non-Pathogenic Legionella spp.
Cao, Boyang; Liu, Xiangqian; Yu, Xiang; Chen, Min; Feng, Lu; Wang, Lei
2014-01-01
Legionella pneumophila has been recognized as the major cause of legionellosis since the discovery of the deadly disease. Legionella spp. other than L. pneumophila were later found to be responsible to many non-pneumophila infections. The non-L. pneumophila infections are likely under-detected because of a lack of effective diagnosis. In this report, we have sequenced the 16S-23S rRNA gene internal transcribed spacer (ITS) of 10 Legionella species and subspecies, including L. anisa, L. bozemanii, L. dumoffii, L. fairfieldensis, L. gormanii, L. jordanis, L. maceachernii, L. micdadei, L. pneumophila subspp. fraseri and L. pneumophila subspp. pasculleii, and developed a rapid oligonucleotide microarray detection technique accordingly to identify 12 most common Legionella spp., which consist of 11 pathogenic species of L. anisa, L. bozemanii, L. dumoffii, L. gormanii, L. jordanis, L. longbeachae, L. maceachernii, L. micdadei, and L. pneumophila (including subspp. pneumophila, subspp. fraseri, and subspp. pasculleii) and one non-pathogenic species, L. fairfieldensis. Twenty-nine probes that reproducibly detected multiple Legionella species with high specificity were included in the array. A total of 52 strains, including 30 target pathogens and 22 non-target bacteria, were used to verify the oligonucleotide microarray assay. The sensitivity of the detection was at 1.0 ng with genomic DNA or 13 CFU/100 mL with Legionella cultures. The microarray detected seven samples of air conditioner-condensed water with 100% accuracy, validating the technique as a promising method for applications in basic microbiology, clinical diagnosis, food safety, and epidemiological surveillance. The phylogenetic study based on the ITS has also revealed that the non-pathogenic L. fairfieldensis is the closest to L. pneumophila than the nine other pathogenic Legionella spp. PMID:25469776
Sensitive Detection of Deliquescent Bacterial Capsules through Nanomechanical Analysis.
Nguyen, Song Ha; Webb, Hayden K
2015-10-20
Encapsulated bacteria usually exhibit strong resistance to a wide range of sterilization methods, and are often virulent. Early detection of encapsulation can be crucial in microbial pathology. This work demonstrates a fast and sensitive method for the detection of encapsulated bacterial cells. Nanoindentation force measurements were used to confirm the presence of deliquescent bacterial capsules surrounding bacterial cells. Force/distance approach curves contained characteristic linear-nonlinear-linear domains, indicating cocompression of the capsular layer and cell, indentation of the capsule, and compression of the cell alone. This is a sensitive method for the detection and verification of the encapsulation status of bacterial cells. Given that this method was successful in detecting the nanomechanical properties of two different layers of cell material, i.e. distinguishing between the capsule and the remainder of the cell, further development may potentially lead to the ability to analyze even thinner cellular layers, e.g. lipid bilayers.
The Sit-and-Wait Hypothesis in Bacterial Pathogens: A Theoretical Study of Durability and Virulence
Directory of Open Access Journals (Sweden)
Liang Wang
2017-11-01
Full Text Available The intriguing sit-and-wait hypothesis predicts that bacterial durability in the external environment is positively correlated with their virulence. Since its first proposal in 1987, the hypothesis has been spurring debates in terms of its validity in the field of bacterial virulence. As a special case of the vector-borne transmission versus virulence tradeoff, where vector is now replaced by environmental longevity, there are only sporadic studies over the last three decades showing that environmental durability is possibly linked with virulence. However, no systematic study of these works is currently available and epidemiological analysis has not been updated for the sit-and-wait hypothesis since the publication of Walther and Ewald’s (2004 review. In this article, we put experimental evidence, epidemiological data and theoretical analysis together to support the sit-and-wait hypothesis. According to the epidemiological data in terms of gain and loss of virulence (+/- and durability (+/- phenotypes, we classify bacteria into four groups, which are: sit-and-wait pathogens (++, vector-borne pathogens (+-, obligate-intracellular bacteria (--, and free-living bacteria (-+. After that, we dive into the abundant bacterial proteomic data with the assistance of bioinformatics techniques in order to investigate the two factors at molecular level thanks to the fast development of high-throughput sequencing technology. Sequences of durability-related genes sourced from Gene Ontology and UniProt databases and virulence factors collected from Virulence Factor Database are used to search 20 corresponding bacterial proteomes in batch mode for homologous sequences via the HMMER software package. Statistical analysis only identified a modest, and not statistically significant correlation between mortality and survival time for eight non-vector-borne bacteria with sit-and-wait potentials. Meanwhile, through between-group comparisons, bacteria with higher
[Detection of biofilm formation by selected pathogens relevant to the food industry].
Šilhová-Hrušková, L; Moťková, P; Šilha, D; Vytřasová, J
2015-09-01
Detection of biofilm formation by microbial pathogens relevant to the food industry and comparison of biofilm formation under different conditions of culture. The following microorganisms were selected for the study: Staphylococcus aureus, Listeria innocua, Listeria ivanovii, Cronobacter sakazakii, Cronobacter muytjensii, Arcobacter butzleri, Arcobacter cryaerophilus, Campylobacter jejuni, and Campylobacter coli. To detect biofilm formation the microtiter plate assay, as described by Christensen and culture on stainless steel coupons were used. The biofilm forming capacity was confirmed in all microorganisms tested, both on the microtiter plates and stainless steel coupons. Biofilm formation was influenced by the culture medium, material used, and culture duration as well as by the test microorganism. It was found that different species and strains of the same genus differ in biofilm formation. Differences were also found between the collection strains and isolates from the environment. Some bacteria tended to form biofilm more readily on the surface of the polyethylene microtiter plates and less readily on stainless steel coupons while others appeared to have an opposite tendency. Some pathogens were able to increase the planktonic cell density in the initial suspension even by three orders of magnitude within 72 hours while producing plenty of biofilm. The study of biofilm formation by high risk pathogens is of utmost importance, not only to the food industry. From the obtained results, it is evident that bacterial biofilms form rapidly (within 24 hours in the present study). Due to their architecture, these biofilms are difficult to eradicate, and therefore, it is crucial to prevent biofilm formation.
Culture -independent Pathogenic Bacterial Communities in Bottled Mineral Water
Directory of Open Access Journals (Sweden)
Hamdy A. Hassan
2015-08-01
Full Text Available Bottled mineral water (BMW is an alternative to mains water and consider it to be better and safer. Access to safe BMW from the bacteria involving potential health hazard is essential to health. Cultivation-independent technique PCR-based single-strand conformation polymorphism (SSCP for genetic profiling of PCR-amplified 16S rRNA genes was performed using Com primer set targeting the 16S rRNA genes for detection of pathogenic bacteria in bottled mineral water from the final product of six factories for bottled mineral drinking water in Wadi El-natron region- Egypt. These factories use often ozone technology to treat large quantities of water because of its effectiveness in purifying and conditioning water. A total of 27 single products were isolated from the profiles by PCR re-amplification and cloning. Sequence analysis of 27 SSCP bands revealed that the 16S rRNA sequences were clustered into seven operational taxonomic units (OTUs and the compositions of the communities of the six samples were all common. The results showed that most communities from phyla Alphaproteobacteria and certainly in the Sphingomonas sp. Culture-independent approaches produced complementary information, thus generating a more accurate view for the bacterial community in the BMW, particularly in the disinfection step, as it constitutes the final barrier before BMW distribution to the consumer
Zhenyu, Xie; Shaowen, Ke; Chaoqun, Hu; Zhixiong, Zhu; Shifeng, Wang; Yongcan, Zhou
2013-01-01
White syndrome, a term for scleractinian coral disease with progressive tissue loss, is known to cause depressed growth and increased morality of coral reefs in the major oceans around the world, and the occurrence of this disease has been frequently reported in the past few decades. Investigations during April to September in both 2010 and 2011 identified widespread Porites andrewsi White syndrome (PAWS) in Xisha Archipelago, South China Sea. However, the causes and etiology of PAWS have been unknown. A transmission experiment was performed on P. andrewsi in the Qilianyu Subgroup (QLY). The results showed that there was a significant (P ≤ 0.05) difference between test and control groups after 28 days if the invalid replicates were excluded. Rates of tissue loss ranged from 0.90-10.76 cm(2) d(-1) with a mean of 5.40 ± 3.34 cm(2) d(-1) (mean ± SD). Bacterial strains were isolated from the PAWS corals at the disease outbreak sites in QLY of the Xisha Archipelago, South China Sea, and included in laboratory-based infection trials to satisfy Koch's postulates for establishing causality. Following exposure to bacterial concentrations of 10(5) cells mL(-1), the infected colonies exhibited similar signs to those observed in the field. Using phylogenetic 16S rRNA gene analysis, classical phenotypic trait comparison, Biolog automatic identification system, MALDI-TOF mass spectrometry and MALDI Biotyper method, two pathogenic strains were identified as Vibrio alginolyticus . This is the first report of V. alginolyticus as a pathogenic agent of PAWS in the South China Sea. Our results point out an urgent need to develop sensitive detection methods for V. alginolyticus virulence strains and robust diagnostics for coral disease caused by this and Vibrio pathogenic bacterium in the South China Sea.
Han, Il; Congeevaram, Shankar; Ki, Dong-Won; Oh, Byoung-Taek; Park, Joonhong
2011-02-01
Due to the environmental problems associated with disposal of livestock sludge, many stabilization studies emphasizing on the sludge volume reduction were performed. However, little is known about the microbial risk present in sludge and its stabilized products. This study microbiologically explored the effects of anaerobic lagoon fermentation (ALF) and autothermal thermophilic aerobic digestion (ATAD) on pathogen-related risk of raw swine manure by using culture-independent 16S rDNA cloning and sequencing methods. In raw swine manure, clones closely related to pathogens such as Dialister pneumosintes, Erysipelothrix rhusiopathiae, Succinivibrioan dextrinosolvens, and Schineria sp. were detected. Meanwhile, in the mesophilic ALF-treated swine manure, bacterial community clones closely related to pathogens such as Schineria sp. and Succinivibrio dextrinosolvens were still detected. Interestingly, the ATAD treatment resulted in no detection of clones closely related to pathogens in the stabilized thermophilic bacterial community, with the predominance of novel Clostridia class populations. These findings support the superiority of ATAD in selectively reducing potential human and animal pathogens compared to ALF, which is a typical manure stabilization method used in livestock farms.
Nasal chemosensory cells use bitter taste signaling to detect irritants and bacterial signals.
Tizzano, Marco; Gulbransen, Brian D; Vandenbeuch, Aurelie; Clapp, Tod R; Herman, Jake P; Sibhatu, Hiruy M; Churchill, Mair E A; Silver, Wayne L; Kinnamon, Sue C; Finger, Thomas E
2010-02-16
The upper respiratory tract is continually assaulted with harmful dusts and xenobiotics carried on the incoming airstream. Detection of such irritants by the trigeminal nerve evokes protective reflexes, including sneezing, apnea, and local neurogenic inflammation of the mucosa. Although free intra-epithelial nerve endings can detect certain lipophilic irritants (e.g., mints, ammonia), the epithelium also houses a population of trigeminally innervated solitary chemosensory cells (SCCs) that express T2R bitter taste receptors along with their downstream signaling components. These SCCs have been postulated to enhance the chemoresponsive capabilities of the trigeminal irritant-detection system. Here we show that transduction by the intranasal solitary chemosensory cells is necessary to evoke trigeminally mediated reflex reactions to some irritants including acyl-homoserine lactone bacterial quorum-sensing molecules, which activate the downstream signaling effectors associated with bitter taste transduction. Isolated nasal chemosensory cells respond to the classic bitter ligand denatonium as well as to the bacterial signals by increasing intracellular Ca(2+). Furthermore, these same substances evoke changes in respiration indicative of trigeminal activation. Genetic ablation of either G alpha-gustducin or TrpM5, essential elements of the T2R transduction cascade, eliminates the trigeminal response. Because acyl-homoserine lactones serve as quorum-sensing molecules for gram-negative pathogenic bacteria, detection of these substances by airway chemoreceptors offers a means by which the airway epithelium may trigger an epithelial inflammatory response before the bacteria reach population densities capable of forming destructive biofilms.
Post; White; Aul; Zavoral; Wadowsky; Zhang; Preston; Ehrlich
1996-06-01
Background: Conventional simplex polymerase chain reaction (PCR)-based assays are limited in that they only provide for the detection of a single infectious agent. Many clinical diseases, however, present in a nonspecific, or syndromic, fashion, thereby necessitating the simultaneous assessment of multiple pathogens. Panel-based molecular diagnostic testing can be accomplished by the development of multiplex PCR-based assays, which can detect, individually or severally, different pathogens that are associated with syndromic illness. As part of a larger program of panel development, an assay that can simultaneously detect Haemophilus influenzae, Streptococcus pneumoniae, and Moraxella catarrhalis was developed. These organisms were chosen as they are the most common bacterial pathogens associated with both the acute and chronic forms of otitis media; they are also responsible for a high percentage of sinus infections in both children and adults. In addition, H. influenzae and S. pneumoniae are commonly associated with septic meningitits. Methods and Results: Multiple individual PCR-based assays were developed for each of the three target organisms which were then evaluated for sensitivity and specificity. Utilizing the simplex assays that met our designated performance criteria, a matrix style approach was used to develop a duplex H. influenzae-S. pneumoniae assay. The duplex assay was then used as a single component in the development of a triplex assay, wherein the various M. catarrhalis primer-probe sets were tested for compatibility with the existing assay. A single-step PCR protocol, with species-specific primers for each of the three target organisms and a liquid hybridization-gel retardation amplimer detection system, was developed, which amplifies and then discriminates among each of the amplification products according to size. This assay is able to detect all three organisms in a specific manner, either individually or severally. Dilutional experiments
Exploration of Simple Analytical Approaches for Rapid Detection of Pathogenic Bacteria
Energy Technology Data Exchange (ETDEWEB)
Rahman, Salma [Iowa State Univ., Ames, IA (United States)
2005-01-01
Many of the current methods for pathogenic bacterial detection require long sample-preparation and analysis time, as well as complex instrumentation. This dissertation explores simple analytical approaches (e.g., flow cytometry and diffuse reflectance spectroscopy) that may be applied towards ideal requirements of a microbial detection system, through method and instrumentation development, and by the creation and characterization of immunosensing platforms. This dissertation is organized into six sections. In the general Introduction section a literature review on several of the key aspects of this work is presented. First, different approaches for detection of pathogenic bacteria will be reviewed, with a comparison of the relative strengths and weaknesses of each approach, A general overview regarding diffuse reflectance spectroscopy is then presented. Next, the structure and function of self-assembled monolayers (SAMs) formed from organosulfur molecules at gold and micrometer and sub-micrometer patterning of biomolecules using SAMs will be discussed. This section is followed by four research chapters, presented as separate manuscripts. Chapter 1 describes the efforts and challenges towards the creation of imunosensing platforms that exploit the flexibility and structural stability of SAMs of thiols at gold. 1H, 1H, 2H, 2H-perfluorodecyl-1-thiol SAM (PFDT) and dithio-bis(succinimidyl propionate)-(DSP)-derived SAMs were used to construct the platform. Chapter 2 describes the characterization of the PFDT- and DSP-derived SAMs, and the architectures formed when it is coupled to antibodies as well as target bacteria. These studies used infrared reflection spectroscopy (IRS), X-ray photoelectron spectroscopy (XPS), and electrochemical quartz crystal microbalance (EQCM), Chapter 3 presents a new sensitive, and portable diffuse reflection based technique for the rapid identification and quantification of pathogenic bacteria. Chapter 4 reports research efforts in the
Lu, Xin; Zhang, Xu-Xiang; Wang, Zhu; Huang, Kailong; Wang, Yuan; Liang, Weigang; Tan, Yunfei; Liu, Bo; Tang, Junying
2015-01-01
This study used 454 pyrosequencing, Illumina high-throughput sequencing and metagenomic analysis to investigate bacterial pathogens and their potential virulence in a sewage treatment plant (STP) applying both conventional and advanced treatment processes. Pyrosequencing and Illumina sequencing consistently demonstrated that Arcobacter genus occupied over 43.42% of total abundance of potential pathogens in the STP. At species level, potential pathogens Arcobacter butzleri, Aeromonas hydrophila and Klebsiella pneumonia dominated in raw sewage, which was also confirmed by quantitative real time PCR. Illumina sequencing also revealed prevalence of various types of pathogenicity islands and virulence proteins in the STP. Most of the potential pathogens and virulence factors were eliminated in the STP, and the removal efficiency mainly depended on oxidation ditch. Compared with sand filtration, magnetic resin seemed to have higher removals in most of the potential pathogens and virulence factors. However, presence of the residual A. butzleri in the final effluent still deserves more concerns. The findings indicate that sewage acts as an important source of environmental pathogens, but STPs can effectively control their spread in the environment. Joint use of the high-throughput sequencing technologies is considered a reliable method for deep and comprehensive overview of environmental bacterial virulence. PMID:25938416
Hasibuan, M.; Safni, I.; Lisnawita; Lubis, K.
2018-02-01
Burkholderia glumae is a quarantine seed-borne bacterial pathogen causing panicle blight disease on rice. This pathogen has been detected in some locations in Java, and recently, farmers in North Sumatra have reported rice yield loss with symptoms similar with those on rice infeced by the rice-pathogenic bacterium B. glumae. This research was aimed to isolate several bacterial strains from several rice varieties in various locations in North Sumatra and characterize the morphology of the strains to detect and identify the unknown bacterial strains presumably B. glumae. Several rice seed varieties were collected from Medan and Deli Serdang Districts. The seed samples were extracted, isolated and purified, then grown in semi-selective media PPGA. The morphological characteristics of the bacterial strains were determined including Gram staining, bacterial colony’s and bacterial cell’s morphology. The results showed that of eleven strains isolated, two strains were Gram negative and nine strains were Gram positive. On the basis of colony morphology, all strains had circular form, flat elevation and cream colour while the colony margin varied, i.e. entire and undulate. Most strains had bacillus/rod shape (8 strains) and only 3 strains were coccus.
Davin-Regli, Anne; Pagès, Jean-Marie
2015-01-01
Enterobacter aerogenes and E. cloacae have been reported as important opportunistic and multiresistant bacterial pathogens for humans during the last three decades in hospital wards. These Gram-negative bacteria have been largely described during several outbreaks of hospital-acquired infections in Europe and particularly in France. The dissemination of Enterobacter sp. is associated with the presence of redundant regulatory cascades that efficiently control the membrane permeability ensuring the bacterial protection and the expression of detoxifying enzymes involved in antibiotic degradation/inactivation. In addition, these bacterial species are able to acquire numerous genetic mobile elements that strongly contribute to antibiotic resistance. Moreover, this particular fitness help them to colonize several environments and hosts and rapidly and efficiently adapt their metabolism and physiology to external conditions and environmental stresses. Enterobacter is a versatile bacterium able to promptly respond to the antibiotic treatment in the colonized patient. The balance of the prevalence, E. aerogenes versus E. cloacae, in the reported hospital infections during the last period, questions about the horizontal transmission of mobile elements containing antibiotic resistance genes, e.g., the efficacy of the exchange of resistance genes Klebsiella pneumoniae to Enterobacter sp. It is also important to mention the possible role of antibiotic use in the treatment of bacterial infectious diseases in this E. aerogenes/E. cloacae evolution. PMID:26042091
Bacterial identification and subtyping using DNA microarray and DNA sequencing.
Al-Khaldi, Sufian F; Mossoba, Magdi M; Allard, Marc M; Lienau, E Kurt; Brown, Eric D
2012-01-01
The era of fast and accurate discovery of biological sequence motifs in prokaryotic and eukaryotic cells is here. The co-evolution of direct genome sequencing and DNA microarray strategies not only will identify, isotype, and serotype pathogenic bacteria, but also it will aid in the discovery of new gene functions by detecting gene expressions in different diseases and environmental conditions. Microarray bacterial identification has made great advances in working with pure and mixed bacterial samples. The technological advances have moved beyond bacterial gene expression to include bacterial identification and isotyping. Application of new tools such as mid-infrared chemical imaging improves detection of hybridization in DNA microarrays. The research in this field is promising and future work will reveal the potential of infrared technology in bacterial identification. On the other hand, DNA sequencing by using 454 pyrosequencing is so cost effective that the promise of $1,000 per bacterial genome sequence is becoming a reality. Pyrosequencing technology is a simple to use technique that can produce accurate and quantitative analysis of DNA sequences with a great speed. The deposition of massive amounts of bacterial genomic information in databanks is creating fingerprint phylogenetic analysis that will ultimately replace several technologies such as Pulsed Field Gel Electrophoresis. In this chapter, we will review (1) the use of DNA microarray using fluorescence and infrared imaging detection for identification of pathogenic bacteria, and (2) use of pyrosequencing in DNA cluster analysis to fingerprint bacterial phylogenetic trees.
Bacterial Dissemination. Main Pathogens and Hygiene in Chicken Slaughter: A Review
Sales, Ronaldo de Oliveira; Universidade Federal do Ceará; Porto, Ernani; Universidade Luis de Queiroz - Piracicaba - SP
2013-01-01
In this bibliographical review, the different types of bacterial dissemination are presented, as well as the main pathogenic bacteria involved in chicken slaughter. The influence of hygiene in chicken slaughter upon storage and sale conditions on the retail market is also discussed. Nesta revisão bibliográfica são apresentados os diferentes tipos de disseminação bacteriana, como também as principais bactérias patogênicas envolvidas no abate de frangos. Discute-se ainda a influência da higi...
Establishment and Application of a Visual DNA Microarray for the Detection of Food-borne Pathogens.
Li, Yongjin
2016-01-01
The accurate detection and identification of food-borne pathogenic microorganisms is critical for food safety nowadays. In the present work, a visual DNA microarray was established and applied to detect pathogens commonly found in food, including Salmonella enterica, Shigella flexneri, E. coli O157:H7 and Listeria monocytogenes in food samples. Multiplex PCR (mPCR) was employed to simultaneously amplify specific gene fragments, fimY for Salmonella, ipaH for Shigella, iap for L. monocytogenes and ECs2841 for E. coli O157:H7, respectively. Biotinylated PCR amplicons annealed to the microarray probes were then reacted with a streptavidin-alkaline phosphatase conjugate and nitro blue tetrazolium/5-bromo-4-chloro-3'-indolylphosphate, p-toluidine salt (NBT/BCIP); the positive results were easily visualized as blue dots formatted on the microarray surface. The performance of a DNA microarray was tested against 14 representative collection strains and mock-contamination food samples. The combination of mPCR and a visual micro-plate chip specifically and sensitively detected Salmonella enterica, Shigella flexneri, E. coli O157:H7 and Listeria monocytogenes in standard strains and food matrices with a sensitivity of ∼10(2) CFU/mL of bacterial culture. Thus, the developed method is advantageous because of its high throughput, cost-effectiveness and ease of use.
Directory of Open Access Journals (Sweden)
Zongxin Ling
Full Text Available BACKGROUND: Bacterial vaginosis (BV is one of the most common urogenital infections among women of reproductive age that represents shifts in microbiota from Lactobacillus spp. to diverse anaerobes. The aim of our study was to evalute the diagnostic values of Gardnerella, Atopobium, Eggerthella, Megasphaera typeI, Leptotrichia/Sneathia and Prevotella, defined as a vaginal pathogenic community for BV and their associations with vaginal pH and Nugent scores. METHODS AND FINDINGS: We investigated the vaginal pathogenic bacteria and Lactobacillus spp. with species-specific real-time quantitative PCR (qPCR in 50 BV-positive and 50 BV-negative Chinese women of reproductive age. Relative to BV-negative subjects, a siginificant decline in Lactobacillus and an obvious increase in bacteria in the vaginal pathogenic community were observed in BV-postive subjects (P<0.05. With the exception of Megasphaera typeI, other vaginal pathogenic bacteria were highly predictable for BV with a better sensitivity and specificity. The vaginal pathogenic community was positively associated with vaginal pH and Nugent scores, while Lactobacillus spp., such as L. iners and L. crispatus was negatively associated with them (P<0.05. CONCLUSIONS: Our data implied that the prevalance of vaginal pathogenic bacteria as well as the depletion of Lactobacillus was highly accurate for BV diagnosis. Vaginal microbiota shifts, especially the overgrowth of the vaginal pathogenic community, showed well diagnostic values in predicting BV. Postive correlations between those vaginal pathogenic bacteria and vaginal pH, Nugent score indicated the vaginal pathogenic community rather than a single vaginal microorganism, was participated in the onset of BV directly.
Jorge, Sérgio; Monte, Leonardo G; Coimbra, Marco Antonio; Albano, Ana Paula; Hartwig, Daiane D; Lucas, Caroline; Seixas, Fabiana K; Dellagostin, Odir A; Hartleben, Cláudia P
2012-10-01
Leptospirosis is a globally prevalent zoonosis caused by pathogenic Leptospira spp.; several serologic variants have reservoirs in synanthropic rodents. The capybara is the largest living rodent in the world, and it has a wide geographical distribution in Central and South America. This rodent is a significant source of Leptospira since the agent is shed via urine into the environment and is a potential public health threat. In this study, we isolated and identified by molecular techniques a pathogenic Leptospira from capybara in southern Brazil. The isolated strain was characterized by partial rpoB gene sequencing and variable-number tandem-repeats analysis as L. interrogans, serogroup Icterohaemorrhagiae. In addition, to confirm the expression of virulence factors, the bacterial immunoglobulin-like proteins A and B expression was detected by indirect immunofluorescence using leptospiral specific monoclonal antibodies. This report identifies capybaras as an important source of infection and provides insight into the epidemiology of leptospirosis.
Directory of Open Access Journals (Sweden)
Waqas Ahmed
2016-10-01
Full Text Available Pathogenic bacteria possess intricate regulatory networks that temporally control the production of virulence factors, and enable the bacteria to survive and proliferate within host cell. Small non-coding RNAs (sRNAs have been identified as important regulators of gene expression in diverse biological contexts. Recent research has shown bacterial sRNAs involved in growth and development, cell proliferation, differentiation, metabolism, cell signaling and immune response through regulating protein–protein interactions or via their ability to base pair with RNA and DNA. In this review, we provide a brief overview of mechanism of action employed by immune-related sRNAs, their known functions in immunity, and how they can be integrated into regulatory circuits that govern virulence, which will facilitates to understand pathogenesis and the development of novel, more effective therapeutic approaches to treat infections caused by intracellular bacterial pathogens.
Directory of Open Access Journals (Sweden)
Clarissa Schwab
Full Text Available BACKGROUND: Diet and environment impact the composition of mammalian intestinal microbiota; dietary or health disturbances trigger alterations in intestinal microbiota composition and render the host susceptible to enteric pathogens. To date no long term monitoring data exist on the fecal microbiota and pathogen load of carnivores either in natural environments or in captivity. This study investigates fecal microbiota composition and the presence of pathogenic Escherichia coli and toxigenic clostridia in wild and captive grizzly bears (Ursus arctos and relates these to food resources consumed by bears. METHODOLOGY/PRINCIPAL FINDINGS: Feces were obtained from animals of two wild populations and from two captive animals during an active bear season. Wild animals consumed a diverse diet composed of plant material, animal prey and insects. Captive animals were fed a regular granulated diet with a supplement of fruits and vegetables. Bacterial populations were analyzed using quantitative PCR. Fecal microbiota composition fluctuated in wild and in captive animals. The abundance of Clostridium clusters I and XI, and of C. perfringens correlated to regular diet protein intake. Enteroaggregative E. coli were consistently present in all populations. The C. sordellii phospholipase C was identified in three samples of wild animals and for the first time in Ursids. CONCLUSION: This is the first longitudinal study monitoring the fecal microbiota of wild carnivores and comparing it to that of captive individuals of the same species. Location and diet affected fecal bacterial populations as well as the presence of enteric pathogens.
Schwab, Clarissa; Cristescu, Bogdan; Northrup, Joseph M; Stenhouse, Gordon B; Gänzle, Michael
2011-01-01
Diet and environment impact the composition of mammalian intestinal microbiota; dietary or health disturbances trigger alterations in intestinal microbiota composition and render the host susceptible to enteric pathogens. To date no long term monitoring data exist on the fecal microbiota and pathogen load of carnivores either in natural environments or in captivity. This study investigates fecal microbiota composition and the presence of pathogenic Escherichia coli and toxigenic clostridia in wild and captive grizzly bears (Ursus arctos) and relates these to food resources consumed by bears. Feces were obtained from animals of two wild populations and from two captive animals during an active bear season. Wild animals consumed a diverse diet composed of plant material, animal prey and insects. Captive animals were fed a regular granulated diet with a supplement of fruits and vegetables. Bacterial populations were analyzed using quantitative PCR. Fecal microbiota composition fluctuated in wild and in captive animals. The abundance of Clostridium clusters I and XI, and of C. perfringens correlated to regular diet protein intake. Enteroaggregative E. coli were consistently present in all populations. The C. sordellii phospholipase C was identified in three samples of wild animals and for the first time in Ursids. This is the first longitudinal study monitoring the fecal microbiota of wild carnivores and comparing it to that of captive individuals of the same species. Location and diet affected fecal bacterial populations as well as the presence of enteric pathogens.
Rapid identification and detection of pathogenic Fungi by padlock probes
Tsui, C.K.M.; Wang, B.; Schoen, C.D.; Hamelin, R.C.
2013-01-01
Fungi are important pathogens of human diseases, as well as to agricultural crop and trees. Molecular diagnostics can detect diseases early, and improve identification accuracy and follow-up disease management. The use of padlock probe is effective to facilitate these detections and pathogen
Molecular detection and identification of Rickettsiales pathogens in dog ticks from Costa Rica.
Campos-Calderón, Liliana; Ábrego-Sánchez, Leyda; Solórzano-Morales, Antony; Alberti, Alberto; Tore, Gessica; Zobba, Rosanna; Jiménez-Rocha, Ana E; Dolz, Gaby
2016-10-01
Although vector-borne diseases are globally widespread with considerable impact on animal production and on public health, few reports document their presence in Central America. This study focuses on the detection and molecular identification of species belonging to selected bacterial genera (Ehrlichia, Anaplasma and Rickettsia) in ticks sampled from dogs in Costa Rica by targeting several genes: 16S rRNA/dsb genes for Ehrlichia; 16S rRNA/groEL genes for Anaplasma, and ompA/gltA/groEL genes for Rickettsia. PCR and sequence analyses provides evidences of Ehrlichia canis, Anaplasma platys, and Anaplasma phagocytophilum infection in Rhipicephalus sanguineus s.l ticks, and allow establishing the presence of Rickettsia monacensis in Ixodes boliviensis. Furthermore, the presence of recently discovered Mediterranean A. platys-like strains is reported for the first time in Central America. Results provide new background on geographical distribution of selected tick-transmitted bacterial pathogens in Costa Rica and on their molecular epidemiology, and are pivotal to the development of effective and reliable diagnostic tools in Central America. Copyright © 2016 Elsevier GmbH. All rights reserved.
Ruedl, C; Frühwirth, M; Wick, G; Wolf, H
1994-03-01
We have investigated the local immune response of the BALB/c mouse respiratory tract after oral immunization with a bacterial lysate of seven common respiratory pathogens. After two immunization on five consecutive days, we examined the immunoglobulin (immunoglobulin G [IgG], IgM, and IgA) secretion rates of cells isolated from the lungs and compared them with those of spleen cells of orally immunized and nonimmunized animals by using a new test system based on time-resolved fluorescence. The procedure followed the principle of the classical ELISPOT test with nitrocellulose-bottomed microtiter plates, but europium (Eu3+)-linked streptavidin rather than enzyme-conjugated streptavidin was used, with the advantage of quantifying secreted immunoglobulins instead of detecting single antibody-secreting cells. Lymphocytes isolated from the lungs of treated animals revealed significant increases in total and antigen-specific IgA synthesis compared with the rates of the controls, whereas IgG and IgM production rates showed no remarkable differences. In addition, the sera of treated mice revealed higher antigen-specific IgA titers but not increased IgM and IgG levels. We conclude that priming the gut-associated lymphoid tissue with bacterial antigens of pneumotropic microorganisms can elicit an enhanced IgA response in a distant mucosal effector site, such as the respiratory tract, according to the concept of a common mucosa-associated immune system.
Future research needs involving pathogens in groundwater
Bradford, Scott A.; Harvey, Ronald W.
2017-01-01
Contamination of groundwater by enteric pathogens has commonly been associated with disease outbreaks. Proper management and treatment of pathogen sources are important prerequisites for preventing groundwater contamination. However, non-point sources of pathogen contamination are frequently difficult to identify, and existing approaches for pathogen detection are costly and only provide semi-quantitative information. Microbial indicators that are readily quantified often do not correlate with the presence of pathogens. Pathogens of emerging concern and increasing detections of antibiotic resistance among bacterial pathogens in groundwater are topics of growing concern. Adequate removal of pathogens during soil passage is therefore critical for safe groundwater extraction. Processes that enhance pathogen transport (e.g., high velocity zones and preferential flow) and diminish pathogen removal (e.g., reversible retention and enhanced survival) are of special concern because they increase the risk of groundwater contamination, but are still incompletely understood. Improved theory and modeling tools are needed to analyze experimental data, test hypotheses, understand coupled processes and controlling mechanisms, predict spatial and/or temporal variability in model parameters and uncertainty in pathogen concentrations, assess risk, and develop mitigation and best management approaches to protect groundwater.
Future research needs involving pathogens in groundwater
Bradford, Scott A.; Harvey, Ronald W.
2017-06-01
Contamination of groundwater by enteric pathogens has commonly been associated with disease outbreaks. Proper management and treatment of pathogen sources are important prerequisites for preventing groundwater contamination. However, non-point sources of pathogen contamination are frequently difficult to identify, and existing approaches for pathogen detection are costly and only provide semi-quantitative information. Microbial indicators that are readily quantified often do not correlate with the presence of pathogens. Pathogens of emerging concern and increasing detections of antibiotic resistance among bacterial pathogens in groundwater are topics of growing concern. Adequate removal of pathogens during soil passage is therefore critical for safe groundwater extraction. Processes that enhance pathogen transport (e.g., high velocity zones and preferential flow) and diminish pathogen removal (e.g., reversible retention and enhanced survival) are of special concern because they increase the risk of groundwater contamination, but are still incompletely understood. Improved theory and modeling tools are needed to analyze experimental data, test hypotheses, understand coupled processes and controlling mechanisms, predict spatial and/or temporal variability in model parameters and uncertainty in pathogen concentrations, assess risk, and develop mitigation and best management approaches to protect groundwater.
Directory of Open Access Journals (Sweden)
Peter eRobertson
2014-12-01
Full Text Available Legionella pneumophila is a natural intracellular bacterial parasite of free-living freshwater protozoa and an accidental human pathogen that causes Legionnaires’ disease. L. pneumophila differentiates, and does it in style. Recent experimental data on L. pneumophila’s differentiation point at the existence of a complex network that involves many developmental forms. We intend readers to: (i understand the biological relevance of L. pneumophila’s forms found in freshwater and their potential to transmit Legionnaires’ disease, and (ii learn that the common depiction of L. pneumophila’s differentiation as a biphasic developmental cycle that alternates between a replicative and a transmissive form is but an oversimplification of the actual process. Our specific objectives are to provide updates on the molecular factors that regulate L. pneumophila’s differentiation (section 2, and describe the developmental network of L. pneumophila (section 3, which for clarity’s sake we have dissected into five separate developmental cycles. Finally, since each developmental form seems to contribute differently to the human pathogenic process and the transmission of Legionnaires’ disease, readers are presented with a challenge to develop novel methods to detect the various L. pneumophila forms present in water (section 4, as a means to improve our assessment of risk and more effectively prevent legionellosis outbreaks.
Phage-based surface plasmon resonance strategies for the detection of pathogens
Tawil, Nancy
We start by reviewing the basic principles and recent advances in biosensing technologies using optical, electrochemical and acoustic platforms for phage-based diagnostics. Although much notable work has been done, a low cost, specific, sensitive optical method for detecting low concentrations of pathogens, in a few minutes, has not been established. We conclude from the limited body of work on the subject that improving immobilization strategies and finding more suitable phage recognition elements would allow for a more sensitive approach. Our aim was to better describe the attachment process of MRSA specific phages on gold surfaces, and the subsequent biodetection of their bacterial hosts by surface plasmon resonance (SPR). With the knowledge that the adsorption characteristics of thiol-containing molecules are necessary for applications involving the attachment of recognition elements to a functionalized surface, we start by providing comparative details on the kinetics of self-assembly of L-cysteine and 11-mercaptoundecanoic acid (MUA) monolayers on gold using SPR[1]. Our purpose, in carrying out these measurements was to establish each molecule's validity and applicability as a linker element for use in biosensing. We find that monolayer formation, for both L-cysteine and MUA, is described by the Langmuir isotherm at low concentrations only. For L-cysteine, both the amine and thiol groups contribute to the initial attachment of the molecule, followed by the replacement of the amine-gold complexes initially formed with more stable thiol-gold complexes. The reorganization of L-cysteine creates more space on the gold surface, and the zwitterionic form of the molecule permits the physisorption of a second layer through electrostatic interactions. On the other hand, MUA deposits randomly onto the surface of gold as a SAM and slowly reorganizes into a denser, vertical state. Surface plasmon resonance was then used for the real-time monitoring of the attachment of
Isolation and identification of bacterial pathogen from mastitis milk in Central Java Indonesia
Harjanti, D. W.; Ciptaningtyas, R.; Wahyono, F.; Setiatin, ET
2018-01-01
Mastitis is a multi-etiologic disease of the mammary gland characterized mainly by reduction in milk production and milk quality due to intramammary infection by pathogenic bacteria. Nearly 83% of lactating dairy cows in Indonesia are infected with mastitis in various inflammation degrees. This study was conducted to isolate and identify the pathogen in milk collected from mastitis-infected dairy cows. The study was carried out in ten smallholder dairy farms in Central Java Indonesia based on animal examination, California mastitis test, isolation bacterial pathogens, Gram staining, Catalase and Coagulase test, and identification of bacteria species using Vitek. Bacteriological examination of milk samples revealed 15 isolates where Streptococcus was predominant species (73.3%) and the coagulase negative Staphylococcus species was identified at the least bacteria (26.7%). The Streptococcus bacteria found were Streptococcus uberis (2 isolates), Streptococcus sanguinis(6 isolates), Streptococcus dysgalactiaessp dysgalactiae(1 isolate) , Streptococcus mitis (1 isolate) and Streptococcus agalactiae (1 isolate). The Staphylococcus isolates comprising of Staphylococcus simulans (1 isolate) and Staphylococcus chromogens (3 isolates). Contamination of raw milkwith pathogenic bacteria can cause outbreaks of human disease (milk borne disease). Thus, proper milk processing method that couldinhibit the growth or kill these pathogenic bacteria is important to ensure the safety of milk and milk products.
Greig, J; Rajić, A; Young, I; Mascarenhas, M; Waddell, L; LeJeune, J
2015-06-01
Wildlife can contribute to environmental contamination with bacterial pathogens and their transfer to the human food chain. Global usage and frequent misuse of antimicrobials contribute to emergence of new antimicrobial resistant (AMR) strains of foodborne pathogens. We conducted a scoping review of published research to identify and characterize the evidence on wildlife's role in transmission of AMR and/or bacterial pathogens to the food chain. An advisory group (AG) of 13 North American experts from diverse disciplines was surveyed to solicit insight in the review scope, priority topics and research characteristics. A pre-tested search strategy was implemented in seven bibliographic databases (1990 to January 2013). Citations were relevance screened, and key characteristics on priority topics extracted independently by two reviewers. Analysis identified topic areas with solid evidence and main knowledge gaps. North America reported 30% of 866 relevant articles. The prevalence of five targeted bacterial pathogens and/or AMR in any pathogen in wildlife was reported in 582 articles. Transmission risk factors for selected bacteria or AMR in any bacteria were reported in 300. Interventions to control transmission were discussed in 124 articles and formally evaluated in 50. The majority of primary research investigated birds, cervids, rodents, feral pigs, opossums, E. coli (n = 329), Salmonella (n = 293) and Campylobacter (n = 124). An association between wildlife and transmission of bacterial pathogens and/or AMR to the food chain was supported in 122 studies. The scoping review identified a significant body of research on the role of wild birds in the prevalence and transmission of E. coli, Salmonella and Campylobacter. There was little research employing molecular methods contributing to the evidence concerning the importance and direction of transmission of wildlife/pathogen combinations. Given the advancements of these methods, future research should focus in this
Gram-Negative Bacterial Sensors for Eukaryotic Signal Molecules
Directory of Open Access Journals (Sweden)
Olivier Lesouhaitier
2009-09-01
Full Text Available Ample evidence exists showing that eukaryotic signal molecules synthesized and released by the host can activate the virulence of opportunistic pathogens. The sensitivity of prokaryotes to host signal molecules requires the presence of bacterial sensors. These prokaryotic sensors, or receptors, have a double function: stereospecific recognition in a complex environment and transduction of the message in order to initiate bacterial physiological modifications. As messengers are generally unable to freely cross the bacterial membrane, they require either the presence of sensors anchored in the membrane or transporters allowing direct recognition inside the bacterial cytoplasm. Since the discovery of quorum sensing, it was established that the production of virulence factors by bacteria is tightly growth-phase regulated. It is now obvious that expression of bacterial virulence is also controlled by detection of the eukaryotic messengers released in the micro-environment as endocrine or neuro-endocrine modulators. In the presence of host physiological stress many eukaryotic factors are released and detected by Gram-negative bacteria which in return rapidly adapt their physiology. For instance, Pseudomonas aeruginosa can bind elements of the host immune system such as interferon-γ and dynorphin and then through quorum sensing circuitry enhance its virulence. Escherichia coli sensitivity to the neurohormones of the catecholamines family appears relayed by a recently identified bacterial adrenergic receptor. In the present review, we will describe the mechanisms by which various eukaryotic signal molecules produced by host may activate Gram-negative bacteria virulence. Particular attention will be paid to Pseudomonas, a genus whose representative species, P. aeruginosa, is a common opportunistic pathogen. The discussion will be particularly focused on the pivotal role played by these new types of pathogen sensors from the sensing to the transduction
Classification of human pathogen bacteria for early screening using electronic nose
Zulkifli, Syahida Amani; Mohamad, Che Wan Syarifah Robiah; Abdullah, Abu Hassan
2017-10-01
This paper present human pathogen bacteria for early screening using electronic nose. Electronic nose (E-nose) known as gas sensor array is a device that analyze the odor measurement give the fast response and less time consuming for clinical diagnosis. Many bacterial pathogens could lead to life threatening infections. Accurate and rapid diagnosis is crucial for the successful management of these infections disease. The conventional method need more time to detect the growth of bacterial. Alternatively, the bacteria are Pseudomonas aeruginosa and Shigella cultured on different media agar can be detected and classifies according to the volatile compound in shorter time using electronic nose (E-nose). Then, the data from electronic nose (E-nose) is processed using statistical method which is principal component analysis (PCA). The study shows the capability of electronic nose (E-nose) for early screening for bacterial infection in human stomach.
Directory of Open Access Journals (Sweden)
Pignatari Antonio CC
2011-10-01
Full Text Available Abstract Background Upper and lower respiratory tract infections (RTIs account for a substantial portion of outpatient antibiotic utilization. However, the pharmacodynamic activity of commonly used oral antibiotic regimens has not been studied against clinically relevant pathogens. The objective of this study was to assess the probability of achieving the requisite pharmacodynamic exposure for oral antibacterial regimens commonly prescribed for RTIs in adults against bacterial isolates frequently involved in these processes (S. pneumoniae, H. influenzae, and M. catharralis. Methods Using a 5000-subject Monte Carlo simulation, the cumulative fractions of response (CFR, (i.e., probabilities of achieving requisite pharmacodynamic targets for the most commonly prescribed oral antibiotic regimens, as determined by a structured survey of medical prescription patterns, were assessed against local respiratory bacterial isolates from adults in São Paulo collected during the same time period. Minimal inhibitory concentration (MIC of 230 isolates of Streptococcus pneumoniae (103, Haemophilus influenzae (98, and Moraxella catharralis (29 from a previous local surveillance were used. Results The most commonly prescribed antibiotic regimens were azithromycin 500 mg QD, amoxicillin 500 mg TID, and levofloxacin 500 mg QD, accounting for 58% of the prescriptions. Varied doses of these agents, plus gatifloxacin, amoxicillin-clavulanate, moxifloxacin, and cefaclor made up the remaining regimens. Utilizing aggressive pharmacodynamic exposure targets, the only regimens to achieve greater than 90% CFR against all three pathogens were amoxicillin/amoxicillin-clavulanate 500 mg TID (> 91%, gatifloxacin 400 mg QD (100%, and moxifloxacin 400 mg QD (100%. Considering S. pneumoniae isolates alone, azithromycin 1000 mg QD also achieved greater than 90% CFR (91.3%. Conclusions The only regimens to achieve high CFR against all three pathogen populations in both scenarios
DNA microarray technique for detecting food-borne pathogens
Directory of Open Access Journals (Sweden)
Xing GAO
2012-08-01
Full Text Available Objective To study the application of DNA microarray technique for screening and identifying multiple food-borne pathogens. Methods The oligonucleotide probes were designed by Clustal X and Oligo 6.0 at the conserved regions of specific genes of multiple food-borne pathogens, and then were validated by bioinformatic analyses. The 5' end of each probe was modified by amino-group and 10 Poly-T, and the optimized probes were synthesized and spotted on aldehyde-coated slides. The bacteria DNA template incubated with Klenow enzyme was amplified by arbitrarily primed PCR, and PCR products incorporated into Aminoallyl-dUTP were coupled with fluorescent dye. After hybridization of the purified PCR products with DNA microarray, the hybridization image and fluorescence intensity analysis was acquired by ScanArray and GenePix Pro 5.1 software. A series of detection conditions such as arbitrarily primed PCR and microarray hybridization were optimized. The specificity of this approach was evaluated by 16 different bacteria DNA, and the sensitivity and reproducibility were verified by 4 food-borne pathogens DNA. The samples of multiple bacteria DNA and simulated water samples of Shigella dysenteriae were detected. Results Nine different food-borne bacteria were successfully discriminated under the same condition. The sensitivity of genomic DNA was 102 -103pg/ μl, and the coefficient of variation (CV of the reproducibility of assay was less than 15%. The corresponding specific hybridization maps of the multiple bacteria DNA samples were obtained, and the detection limit of simulated water sample of Shigella dysenteriae was 3.54×105cfu/ml. Conclusions The DNA microarray detection system based on arbitrarily primed PCR can be employed for effective detection of multiple food-borne pathogens, and this assay may offer a new method for high-throughput platform for detecting bacteria.
Ravasi, Timothy; Mavromatis, Charalampos Harris; Bokil, Nilesh J.; Schembri, Mark A.; Sweet, Matthew J.
2016-01-01
Intramacrophage pathogens subvert antimicrobial defence pathways using various mechanisms, including the targeting of host TLR-mediated transcriptional responses. Conversely, TLR-inducible host defence mechanisms subject intramacrophage pathogens to stress, thus altering pathogen gene expression programs. Important biological insights can thus be gained through the analysis of gene expression changes in both the host and the pathogen during an infection. Traditionally, research methods have involved the use of qPCR, microarrays and/or RNA sequencing to identify transcriptional changes in either the host or the pathogen. Here we describe the application of RNA sequencing using samples obtained from in vitro infection assays to simultaneously quantify both host and bacterial pathogen gene expression changes, as well as general approaches that can be undertaken to interpret the RNA sequencing data that is generated. These methods can be used to provide insights into host TLR-regulated transcriptional responses to microbial challenge, as well as pathogen subversion mechanisms against such responses.
Ravasi, Timothy
2016-01-24
Intramacrophage pathogens subvert antimicrobial defence pathways using various mechanisms, including the targeting of host TLR-mediated transcriptional responses. Conversely, TLR-inducible host defence mechanisms subject intramacrophage pathogens to stress, thus altering pathogen gene expression programs. Important biological insights can thus be gained through the analysis of gene expression changes in both the host and the pathogen during an infection. Traditionally, research methods have involved the use of qPCR, microarrays and/or RNA sequencing to identify transcriptional changes in either the host or the pathogen. Here we describe the application of RNA sequencing using samples obtained from in vitro infection assays to simultaneously quantify both host and bacterial pathogen gene expression changes, as well as general approaches that can be undertaken to interpret the RNA sequencing data that is generated. These methods can be used to provide insights into host TLR-regulated transcriptional responses to microbial challenge, as well as pathogen subversion mechanisms against such responses.
Oetama, Vincensius S P; Hennersdorf, Philipp; Abdul-Aziz, Muslihudeen A; Mrotzek, Grit; Haryanti, Haryanti; Saluz, Hans Peter
2016-09-30
Penaeus monodon, the Asian black tiger shrimp is one of the most widely consumed marine crustaceans worldwide. In this study, we examine and compare the fecal microbiota of P. monodon from highly polluted waters around Jakarta Bay, with those of less polluted waters of Bali. Using next generation sequencing techniques, we identified potential bacterial pathogens and common viral diseases of shrimp. Proteobacteria (96.08%) was found to be the most predominant phylum, followed by Bacteriodetes (2.32%), Fusobacteria (0.96%), and Firmicutes (0.53%). On the order level, Vibrionales (66.20%) and Pseudoaltermonadales (24.81%) were detected as predominant taxa. qPCR profiling was used as a confirmatory step and further revealed Vibrio alginolyticus and Photobacterium damselae as two potential pathogenic species present in most of the samples. In addition, viral diseases for shrimp were discovered among the samples, WSSV in Jakarta free-living samples, YHV in Bali free-living samples and IHHNV in both. Copyright © 2016 Elsevier Ltd. All rights reserved.
He, Ying-Hong; Isono, Sayaka; Shibuya, Makoto; Tsuji, Masaharu; Adkar Purushothama, Charith-Raj; Tanaka, Kazuaki; Sano, Teruo
2012-01-01
To monitor the richness in microbial inhabitants in the phyllosphere of apple trees cultivated under various cultural and environmental conditions, we developed an oligo-DNA macroarray for major pathogenic and non-pathogenic fungi and bacteria inhabiting the phyllosphere of apple trees. First, we isolated culturable fungi and bacteria from apple orchards by an agar-plate culture method, and detected 32 fungal and 34 bacterial species. Alternaria, Aureobasidium, Cladosporium, Rhodotorula, Cystofilobasidium, and Epicoccum genera were predominant among the fungi, and Bacillus, Pseudomonas, Sphingomonas, Methylobacterium, and Pantoea genera were predominant among the bacteria. Based on the data, we selected 29 major non-pathogenic and 12 phytopathogenic fungi and bacteria as the targets of macroarray. Forty-one species-specific 40-base pair long oligo-DNA sequences were selected from the nucleotide sequences of rDNA-internal transcribed spacer region for fungi and 16S rDNA for bacteria. The oligo-DNAs were fixed on nylon membrane and hybridized with digoxigenin-labeled cRNA probes prepared for each species. All arrays except those for Alternaria, Bacillus, and their related species, were specifically hybridized. The array was sensitive enough to detect 10(3) CFU for Aureobasidium pullulans and Bacillus cereus. Nucleotide sequencing of 100 each of independent fungal rDNA-ITS and bacterial 16S-rDNA sequences from apple tree was in agreement with the macroarray data obtained using the same sample. Finally, we analyzed the richness in the microbial inhabitants in the samples collected from apple trees in four orchards. Major apple pathogens that cause scab, Alternaria blotch, and Marssonina blotch were detected along with several non-phytopathogenic fungal and bacterial inhabitants. The macroarray technique presented here is a strong tool to monitor the major microbial species and the community structures in the phyllosphere of apple trees and identify key species
Directory of Open Access Journals (Sweden)
Ying-Hong He
Full Text Available BACKGROUND: To monitor the richness in microbial inhabitants in the phyllosphere of apple trees cultivated under various cultural and environmental conditions, we developed an oligo-DNA macroarray for major pathogenic and non-pathogenic fungi and bacteria inhabiting the phyllosphere of apple trees. METHODS AND FINDINGS: First, we isolated culturable fungi and bacteria from apple orchards by an agar-plate culture method, and detected 32 fungal and 34 bacterial species. Alternaria, Aureobasidium, Cladosporium, Rhodotorula, Cystofilobasidium, and Epicoccum genera were predominant among the fungi, and Bacillus, Pseudomonas, Sphingomonas, Methylobacterium, and Pantoea genera were predominant among the bacteria. Based on the data, we selected 29 major non-pathogenic and 12 phytopathogenic fungi and bacteria as the targets of macroarray. Forty-one species-specific 40-base pair long oligo-DNA sequences were selected from the nucleotide sequences of rDNA-internal transcribed spacer region for fungi and 16S rDNA for bacteria. The oligo-DNAs were fixed on nylon membrane and hybridized with digoxigenin-labeled cRNA probes prepared for each species. All arrays except those for Alternaria, Bacillus, and their related species, were specifically hybridized. The array was sensitive enough to detect 10(3 CFU for Aureobasidium pullulans and Bacillus cereus. Nucleotide sequencing of 100 each of independent fungal rDNA-ITS and bacterial 16S-rDNA sequences from apple tree was in agreement with the macroarray data obtained using the same sample. Finally, we analyzed the richness in the microbial inhabitants in the samples collected from apple trees in four orchards. Major apple pathogens that cause scab, Alternaria blotch, and Marssonina blotch were detected along with several non-phytopathogenic fungal and bacterial inhabitants. CONCLUSIONS: The macroarray technique presented here is a strong tool to monitor the major microbial species and the community structures in
Detection and treatment of chemical weapons and/or biological pathogens
Mariella Jr., Raymond P.
2004-09-07
A system for detection and treatment of chemical weapons and/or biological pathogens uses a detector system, an electrostatic precipitator or scrubber, a circulation system, and a control. The precipitator or scrubber is activated in response to a signal from the detector upon the detection of chemical weapons and/or biological pathogens.
Soobhany, Nuhaa; Mohee, Romeela; Garg, Vinod Kumar
2017-06-01
Waste management strategies for organic residues, such as composting and vermicomposting, have been implemented in some developed and developing countries to solve the problem of organic solid waste (OSW). Yet, these biological treatment technologies do not always result in good quality compost or vermicompost with regards to sanitation capacity owing to the presence of bacterial pathogenic substances in objectionable concentrations. The presence of pathogens in soil conditioners poses a potential health hazard and their occurrence is of particular significance in composts and/or vermicomposts produced from organic materials. Past and present researches demonstrated a high-degree of agreement that various pathogens survive after the composting of certain OSW but whether similar changes in bacterial pathogenic loads arise during vermitechnology has not been thoroughly elucidated. This review garners information regarding the status of various pathogenic bacteria which survived or diffused after the composting process compared to the status of these pathogens after the vermicomposting of OSW with the aim of achieving sanitation goals. This work is also indispensable for the specification of compost quality guidelines concerning pathogen loads which would be specific to treatment technology. It was hypothesized that vermicomposting process for OSW can be efficacious in sustaining the existence of pathogenic organisms most specifically; human pathogens under safety levels. In summary, earthworms can be regarded as a way of obliterating pathogenic bacteria from OSW in a manner equivalent to earthworm gut transit mechanism which classifies vermicomposting as a promising sanitation technique in comparison to composting processes. Copyright © 2017 Elsevier Ltd. All rights reserved.
Quantitative multiplex detection of pathogen biomarkers
Energy Technology Data Exchange (ETDEWEB)
Mukundan, Harshini; Xie, Hongzhi; Swanson, Basil I.; Martinez, Jennifer; Grace, Wynne K.
2016-02-09
The present invention addresses the simultaneous detection and quantitative measurement of multiple biomolecules, e.g., pathogen biomarkers through either a sandwich assay approach or a lipid insertion approach. The invention can further employ a multichannel, structure with multi-sensor elements per channel.
Quantitative multiplex detection of pathogen biomarkers
Mukundan, Harshini; Xie, Hongzhi; Swanson, Basil I; Martinez, Jennifer; Grace, Wynne K
2014-10-14
The present invention addresses the simultaneous detection and quantitative measurement of multiple biomolecules, e.g., pathogen biomarkers through either a sandwich assay approach or a lipid insertion approach. The invention can further employ a multichannel, structure with multi-sensor elements per channel.
Procedures involving lipid media for detection of bacterial contamination in breweries.
Van Vuuren, H J; Louw, H A; Loos, M A; Meisel, R
1977-02-01
The liquid equivalent of universal beer agar, designated universal beer liquid medium, and its beer-free equivalent, universal liquid medium (UL), were equally effective in demonstrating bacterial contamination in 120 of 200 samples from different stages of commercial brewing process. Growth of the contaminants after 3 days was consistently more luxuriant in the UL medium. A yeast-water substrate medium failed to reveal many contaminants detected with UL in 392 samples from three breweries and revealed only a few not detected with UL. The use of UL and a lactose-peptone medium, with microscope examination of the media for bacterial growth, permitted detection of 93% of the known contaminants compared to 87%, detected with UL alone; this combination or universal beer liquid medium plus lactose-peptone medium can therefore be recommended for the detection of bacterial contaminants in brewery samples. Bacterial contamination of pitching yeasts appeared to be a particular problem in the breweries investigated.
A Bacterial Pathogen Targets a Host Rab-Family GTPase Defense Pathway with a GAP.
Spanò, Stefania; Gao, Xiang; Hannemann, Sebastian; Lara-Tejero, María; Galán, Jorge E
2016-02-10
Cell-autonomous defense mechanisms are potent strategies that protect individual cells against intracellular pathogens. The Rab-family GTPase Rab32 was previously shown to restrict the intracellular human pathogen Salmonella Typhi, but its potential broader role in antimicrobial defense remains unknown. We show that Rab32 represents a general cell-autonomous, antimicrobial defense that is counteracted by two Salmonella effectors. Mice lacking Rab-32 or its nucleotide exchange factor BLOC-3 are permissive to S. Typhi infection and exhibit increased susceptibility to S. Typhimurium. S. Typhimurium counters this defense pathway by delivering two type III secretion effectors, SopD2, a Rab32 GAP, and GtgE, a specific Rab32 protease. An S. Typhimurium mutant strain lacking these two effectors exhibits markedly reduced virulence, which is fully restored in BLOC-3-deficient mice. These results demonstrate that a cell-autonomous, Rab32-dependent host defense pathway plays a central role in the defense against vacuolar pathogens and describe a mechanism evolved by a bacterial pathogen to counter it. Copyright © 2016 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Peterson, Kristin L.; Reid, William C.; Freeman, Alexandra F.; Holland, Steven M.; Pettigrew, Roderic I.; Gharib, Ahmed M.; Hammoud, Dima A.
2013-01-01
Currently available infectious disease imaging techniques cannot differentiate between infection and sterile inflammation or between different types of infections. Recently, radiolabeled FIAU was found to be a substrate for the thymidine kinase (TK) enzyme of multiple pathogenic bacteria, leading to its translational use in the imaging of bacterial infections. Patients with immunodeficiencies, however, are susceptible to a different group of pathogenic bacteria when compared to immunocompetent subjects. In this study, we wanted to predict the usefulness of radiolabeled FIAU in the detection of bacterial infections commonly occurring in patients with immunodeficiencies, in vitro, prior to attempting in vivo imaging with 124 I-FIAU-PET. Methods: We obtained representative strains of bacterial pathogens isolated from actual patients with genetic immunodeficiencies. We evaluated the bacterial susceptibility of different strains to the effect of incubation with FIAU, which would implicate the presence of the thymidine kinase (TK) enzyme. We also incubated the bacteria with 14 C-FIAU and consequently measured its rate of incorporation in the bacterial DNA using a liquid scintillation counter. Results: Unlike the other bacterial strains, the growth of Pseudomonas aeruginosa was not halted by FIAU at any concentration. All the tested clinical isolates demonstrated different levels of 14 C-FIAU uptake, except for P. aeruginosa. Conclusion: Radiolabeled FIAU has been successful in delineating bacterial infections, both in preclinical and pilot translational studies. In patients with immunodeficiencies, Pseudomonas infections are commonly encountered and are usually difficult to differentiate from fungal infections. The use of radiolabeled FIAU for in vivo imaging of those patients, however, would not be useful, considering the apparent lack of TK enzyme in Pseudomonas. One has to keep in mind that not all pathogenic bacteria possess the TK enzyme and as such will not all
Rapid detection, characterization, and enumeration of foodborne pathogens.
Hoorfar, J
2011-11-01
As food safety management further develops, microbiological testing will continue to play an important role in assessing whether Food Safety Objectives are achieved. However, traditional microbiological culture-based methods are limited, particularly in their ability to provide timely data. The present review discusses the reasons for the increasing interest in rapid methods, current developments in the field, the research needs, and the future trends. The advent of biotechnology has introduced new technologies that led to the emergence of rapid diagnostic methods and altered food testing practices. Rapid methods are comprised of many different detection technologies, including specialized enzyme substrates, antibodies and DNA, ranging from simple differential plating media to the use of sophisticated instruments. The use of non-invasive sampling techniques for live animals especially came into focus with the 1990s outbreak of bovine spongiform encephalopathy that was linked to the human outbreak of Creutzfeldt Jakob's Disease. Serology is still an important tool in preventing foodborne pathogens to enter the human food supply through meat and milk from animals. One of the primary uses of rapid methods is for fast screening of large number of samples, where most of them are expected to be test-negative, leading to faster product release for sale. This has been the main strength of rapid methods such as real-time Polymerase Chain Reaction (PCR). Enrichment PCR, where a primary culture broth is tested in PCR, is the most common approach in rapid testing. Recent reports show that it is possible both to enrich a sample and enumerate by pathogen-specific real-time PCR, if the enrichment time is short. This can be especially useful in situations where food producers ask for the level of pathogen in a contaminated product. Another key issue is automation, where the key drivers are miniaturization and multiple testing, which mean that not only one instrument is flexible
Detection of Foodborne Pathogenic Bacteria using Bacteriophage Tail Spike Proteins
Poshtiban, Somayyeh
Foodborne infections are worldwide health problem with tremendous social and financial impacts. Efforts are focused on developing accurate and reliable technologies for detection of food contaminations in early stages preferably on-site. This thesis focuses on interfacing engineering and biology by combining phage receptor binding proteins (RBPs) with engineered platforms including microresonator-based biosensors, magnetic particles and polymerase chain reaction (PCR) to develop bacterial detection sensors. We used phage RBPs as target specific bioreceptors to develop an enhanced microresonator array for bacterial detection. These resonator beams are optimized to feature a high natural frequency while offer large surface area for capture of bacteria. Theoretical analysis indicates a high mass sensitivity with a threshold for the detection of a single bacterial cell. We used phage RBPs as target specific bioreceptors, and successfully demonstrated the application of these phage RBB-immobilized arrays for specific detection of C. jejuni cells. We also developed a RBP-derivatized magnetic pre-enrichment method as an upstream sample preparation method to improve sensitivity and specificity of PCR for detection of bacterial cells in various food samples. The combination of RBP-based magnetic separation and real-time PCR allowed the detection of small number of bacteria in artificially contaminated food samples without any need for time consuming pre-enrichment step through culturing. We also looked into integration of the RBP-based magnetic separation with PCR onto a single microfluidic lab-on-a-chip to reduce the overall turnaround time.
Keller, Peter M.; Rampini, Silvana K.; Bloemberg, Guido V.
2010-01-01
We describe the identification of two bacterial pathogens from a culture-negative brain abscess by the use of broad-spectrum 16S rRNA gene PCR. Simultaneous detection of Fusobacterium nucleatum and Porphyromonas endodontalis was possible due to a 24-bp length difference of their partially amplified 16S rRNA genes, which allowed separation by high-resolution polyacrylamide gel electrophoresis. PMID:20392909
Directory of Open Access Journals (Sweden)
Wahner Verena
2009-06-01
Full Text Available Abstract Background Plant matrix metalloproteinases (MMP are conserved proteolytic enzymes found in a wide range of monocotyledonous and dicotyledonous plant species. Acting on the plant extracellular matrix, they play crucial roles in many aspects of plant physiology including growth, development and the response to stresses such as pathogen attack. Results We have identified the first tobacco MMP, designated NtMMP1, and have isolated the corresponding cDNA sequence from the tobacco suspension cell line BY-2. The overall domain structure of NtMMP1 is similar to known MMP sequences, although certain features suggest it may be constitutively active rather than dependent on proteolytic processing. The protein appears to be expressed in two forms with different molecular masses, both of which are enzymatically active as determined by casein zymography. Exchanging the catalytic domain of NtMMP1 with green fluorescent protein (GFP facilitated subcellular localization by confocal laser scanning microscopy, showing the protein is normally inserted into the plasma membrane. The NtMMP1 gene is expressed constitutively at a low level but can be induced by exposure to bacterial pathogens. Conclusion Our biochemical analysis of NtMMP1 together with bioinformatic data on the primary sequence indicate that NtMMP1 is a constitutively-active protease. Given its induction in response to bacterial pathogens and its localization in the plasma membrane, we propose a role in pathogen defense at the cell periphery.
Nguyen, Thao Thi; Chon, Tae-Soo; Kim, Jaehan; Seo, Young-Su; Heo, Muyoung
2017-07-01
Secreted proteins (secretomes) play crucial roles during bacterial pathogenesis in both plant and human hosts. The identification and characterization of secretomes in the two plant pathogens Burkholderia glumae BGR1 and B. gladioli BSR3, which cause diseases in rice such as seedling blight, panicle blight, and grain rot, are important steps to not only understand the disease-causing mechanisms but also find remedies for the diseases. Here, we identified two datasets of secretomes in B. glumae BGR1 and B. gladioli BSR3, which consist of 118 and 111 proteins, respectively, using mass spectrometry approach and literature curation. Next, we characterized the functional properties, potential secretion pathways and sequence information properties of secretomes of two plant pathogens in a comparative analysis by various computational approaches. The ratio of potential non-classically secreted proteins (NCSPs) to classically secreted proteins (CSPs) in B. glumae BGR1 was greater than that in B. gladioli BSR3. For CSPs, the putative hydrophobic regions (PHRs) which are essential for secretion process of CSPs were screened in detail at their N-terminal sequences using hidden Markov model (HMM)-based method. Total 31 pairs of homologous proteins in two bacterial secretomes were indicated based on the global alignment (identity ≥ 70%). Our results may facilitate the understanding of the species-specific features of secretomes in two plant pathogenic Burkholderia species.
Directory of Open Access Journals (Sweden)
Choong-Min eRyu
2016-02-01
Full Text Available Biological control (biocontrol agents act on plants via numerous mechanisms, and can be used to protect plants from pathogens. Biocontrol agents can act directly as pathogen antagonists or competitors or indirectly to promote plant induced systemic resistance (ISR. Whether a biocontrol agent acts directly or indirectly depends on the specific strain and the pathosystem type. We reported previously that bacterial volatile organic compounds (VOCs are determinants for eliciting plant ISR. Emerging data suggest that bacterial VOCs also can directly inhibit fungal and plant growth. The aim of the current study was to differentiate direct and indirect mechanisms of bacterial VOC effects against Botrytis cinerea infection of Arabidopsis. Volatile emissions from Bacillus subtilis GB03 successfully protected Arabidopsis seedlings against B. cinerea. First, we investigated the direct effects of bacterial VOCs on symptom development and different phenological stages of B. cinerea including spore germination, mycelial attachment to the leaf surface, mycelial growth, and sporulation in vitro and in planta. Volatile emissions inhibited hyphal growth in a dose-dependent manner in vitro, and interfered with fungal attachment on the hydrophobic leaf surface. Second, the optimized bacterial concentration that did not directly inhibit fungal growth successfully protected Arabidopsis from fungal infection, which indicates that bacterial VOC-elicited plant ISR has a more important role in biocontrol than direct inhibition of fungal growth on Arabidopsis. We performed qRT-PCR to investigate the priming of the defense-related genes PR1, PDF1.2, and ChiB at 0, 12, 24, and 36 hours post-infection and 14 days after the start of plant exposure to bacterial VOCs. The results indicate that bacterial VOCs potentiate expression of PR1 and PDF1.2 but not ChiB, which stimulates SA- and JA-dependent signaling pathways in plant ISR and protects plants against pathogen
Energy Technology Data Exchange (ETDEWEB)
Dewanti-Hariyadi, R. [Center for Assessment of Traditional Foods, Department of Food Technology and Human Nutrition, Bogor Agricultural University (Indonesia); Suliantari,; Nuraida, L. [Department of Food Technology and Human Nutrition, Faculty of Agricultural Technology, Bogor Agricultural University (Indonesia); Fardiaz, S. [Inter University for Food and Nutrition, Bogor Agricultural University, Bogor (Indonesia)
2005-01-15
Shrimp continues to be an important export commodity for Indonesia and contributed significantly to the country’s revenue. However, shrimp exports have been frequently rejected by importing countries due to filth, Salmonella and insanitary conditions. This study was conducted to evaluate the profiles of bacterial contamination of ocean and aquaculture shrimp obtained from the area of West, Central and East Java; frozen shrimp and shrimp during industry production of frozen shrimp. The study indicated that both ocean and aquaculture shrimp obtained from the study area were heavily contaminated. On the average, shrimp obtained from West Java were more contaminated than those obtained from East and Central Java. The total bacterial counts were generally higher in ocean shrimp than those of aquaculture ones. Salmonella was present in two of 32 samples of ocean shrimp and in four of 32 samples of aquaculture shrimp obtained from the study area. Vibrio cholerae was not detected in shrimp from West Java, but was found in three out of 16 samples obtained from East and Central Java. V. parahaemolyticus was frequently identified in aquaculture shrimp but absent in fresh ocean shrimp. Studies on shrimp collected from six sampling points during frozen shrimp production revealed that processing will reduce the number of total bacterial, E. coli, and Staphylococal counts. However, the processing did not effectively reduce the incidence of Salmonella or V. parahaemolyticus when the raw material has been contaminated with the pathogens. Sizing and grading as well as arrangement of shrimp before freezing were considered as the critical points where bacteria should be controlled to inhibit growth and cross contamination with bacteria such as Listeria. Implementation of Good Agricultural Practices in production of raw shrimp as well as Hazard Analysis Critical Control Point at the line processing are expected to improve the quality of fresh and frozen shrimp. (author)
Patel, Seema
2016-11-01
Despite the advent of next-generation sequencing (NGS) technologies, sophisticated data analysis and drug development efforts, bacterial drug resistance persists and is escalating in magnitude. To better control the pathogens, a thorough understanding of their genomic architecture and dynamics is vital. Bacterial genome is extremely complex, a mosaic of numerous co-operating and antagonizing components, altruistic and self-interested entities, behavior of which are predictable and conserved to some extent, yet largely dictated by an array of variables. In this regard, mobile genetic elements (MGE), DNA repair systems, post-segregation killing systems, toxin-antitoxin (TA) systems, restriction-modification (RM) systems etc. are dominant agents and horizontal gene transfer (HGT), gene redundancy, epigenetics, phase and antigenic variation etc. processes shape the genome. By illegitimate recombinations, deletions, insertions, duplications, amplifications, inversions, conversions, translocations, modification of intergenic regions and other alterations, bacterial genome is modified to tackle stressors like drugs, and host immune effectors. Over the years, thousands of studies have investigated this aspect and mammoth amount of insights have been accumulated. This review strives to distillate the existing information, formulate hypotheses and to suggest directions, that might contribute towards improved mitigation of the vicious pathogens. Copyright © 2016 Elsevier B.V. All rights reserved.
Dong, Qiaolin; Luo, Ju; Qiu, Wen; Cai, Li; Anjum, Syed Ishtiaq; Li, Bin; Hou, Mingsheng; Xie, Guanlin; Sun, Guochang
2016-07-27
Camptothecin (CPT) has anticancer, antiviral, and antifungal properties. However, there is a dearth of information about antibacterial activity of CPT. Therefore, in this study, we investigated the inhibitory effect of CPT on Acidovorax avenae subsp. avenae strain RS-2, the pathogen of rice bacterial brown stripe, by measuring cell growth, DNA damage, cell membrane integrity, the expression of secretion systems, and topoisomerase-related genes, as well as the secretion of effector protein Hcp. Results indicated that CPT solutions at 0.05, 0.25, and 0.50 mg/mL inhibited the growth of strain RS-2 in vitro, while the inhibitory efficiency increased with an increase in CPT concentration, pH, and incubation time. Furthermore, CPT treatment affected bacterial growth and replication by causing membrane damage, which was evidenced by transmission electron microscopic observation and live/dead cell staining. In addition, quantitative real-time PCR analysis indicated that CPT treatment caused differential expression of eight secretion system-related genes and one topoisomerase-related gene, while the up-regulated expression of hcp could be justified by the increased secretion of Hcp based on the ELISA test. Overall, this study indicated that CPT has the potential to control the bacterial brown stripe pathogen of rice.
Directory of Open Access Journals (Sweden)
Qiaolin Dong
2016-07-01
Full Text Available Camptothecin (CPT has anticancer, antiviral, and antifungal properties. However, there is a dearth of information about antibacterial activity of CPT. Therefore, in this study, we investigated the inhibitory effect of CPT on Acidovorax avenae subsp. avenae strain RS-2, the pathogen of rice bacterial brown stripe, by measuring cell growth, DNA damage, cell membrane integrity, the expression of secretion systems, and topoisomerase-related genes, as well as the secretion of effector protein Hcp. Results indicated that CPT solutions at 0.05, 0.25, and 0.50 mg/mL inhibited the growth of strain RS-2 in vitro, while the inhibitory efficiency increased with an increase in CPT concentration, pH, and incubation time. Furthermore, CPT treatment affected bacterial growth and replication by causing membrane damage, which was evidenced by transmission electron microscopic observation and live/dead cell staining. In addition, quantitative real-time PCR analysis indicated that CPT treatment caused differential expression of eight secretion system-related genes and one topoisomerase-related gene, while the up-regulated expression of hcp could be justified by the increased secretion of Hcp based on the ELISA test. Overall, this study indicated that CPT has the potential to control the bacterial brown stripe pathogen of rice.
Tracz, Dobryan M; Tyler, Andrea D; Cunningham, Ian; Antonation, Kym S; Corbett, Cindi R
2017-03-01
A high-quality custom database of MALDI-TOF mass spectral profiles was developed with the goal of improving clinical diagnostic identification of high-consequence bacterial pathogens. A biomarker discovery method is presented for identifying and evaluating MALDI-TOF MS spectra to potentially differentiate biothreat bacteria from less-pathogenic near-neighbour species. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Rosalie A. Multari
2013-01-01
Full Text Available Laser-Induced Breakdown Spectroscopy (LIBS is a rapid, in situ, diagnostic technique in which light emissions from a laser plasma formed on the sample are used for analysis allowing automated analysis results to be available in seconds to minutes. This speed of analysis coupled with little or no sample preparation makes LIBS an attractive detection tool. In this study, it is demonstrated that LIBS can be utilized to discriminate both the bacterial species and strains of bacterial colonies grown on blood agar. A discrimination algorithm was created based on multivariate regression analysis of spectral data. The algorithm was deployed on a simulated LIBS instrument system to demonstrate discrimination capability using 6 species. Genetically altered Staphylococcus aureus strains grown on BA, including isogenic sets that differed only by the acquisition of mutations that increase fusidic acid or vancomycin resistance, were also discriminated. The algorithm successfully identified all thirteen cultures used in this study in a time period of 2 minutes. This work provides proof of principle for a LIBS instrumentation system that could be developed for the rapid discrimination of bacterial species and strains demonstrating relatively minor genomic alterations using data collected directly from pathogen isolation media.
Bacterial contamination of platelet components not detected by BacT/ALERT®.
Abela, M A; Fenning, S; Maguire, K A; Morris, K G
2018-02-01
To investigate the possible causes for false negative results in BacT/ALERT ® 3D Signature System despite bacterial contamination of platelet units. The Northern Ireland Blood Transfusion Service (NIBTS) routinely extends platelet component shelf life to 7 days. Components are sampled and screened for bacterial contamination using an automated microbial detection system, the BacT/ALERT ® 3D Signature System. We report on three platelet components with confirmed bacterial contamination, which represent false negative BacT/ALERT ® results and near-miss serious adverse events. NIBTS protocols for risk reduction of bacterial contamination of platelet components are described. The methodology for bacterial detection using BacT/ALERT ® is outlined. Laboratory tests, relevant patient details and relevant follow-up information are analysed. In all three cases, Staphylococcus aureus was isolated from the platelet residue and confirmed on terminal sub-culture using BacT/ALERT ® . In two cases, S. aureus with similar genetic makeup was isolated from the donors. Risk reduction measures for bacterial contamination of platelet components are not always effective. Automated bacterial culture detection does not eliminate the risk of bacterial contamination. Visual inspection of platelet components prior to release, issue and administration remains an important last line of defence. © 2017 British Blood Transfusion Society.
Rapid detection of E. coli on goat meat by electronic nose
Much attention has been paid on the foodborne illness of food, which is easily contaminated with bacterial or pathogens. Escherichia coli (E. coli) is one of these bacterial that commonly live in the contaminated animal meat. There is a growing need in the food industry for pathogen detection syst...
A Bacterial Pathogen Displaying Temperature-Enhanced Virulence of the Microalga Emiliania huxleyi.
Mayers, Teaghan J; Bramucci, Anna R; Yakimovich, Kurt M; Case, Rebecca J
2016-01-01
Emiliania huxleyi is a globally abundant microalga that plays a significant role in biogeochemical cycles. Over the next century, sea surface temperatures are predicted to increase drastically, which will likely have significant effects on the survival and ecology of E. huxleyi. In a warming ocean, this microalga may become increasingly vulnerable to pathogens, particularly those with temperature-dependent virulence. Ruegeria is a genus of Rhodobacteraceae whose population size tracks that of E. huxleyi throughout the alga's bloom-bust lifecycle. A representative of this genus, Ruegeria sp. R11, is known to cause bleaching disease in a red macroalga at elevated temperatures. To investigate if the pathogenicity of R11 extends to microalgae, it was co-cultured with several cell types of E. huxleyi near the alga's optimum (18°C), and at an elevated temperature (25°C) known to induce virulence in R11. The algal populations were monitored using flow cytometry and pulse-amplitude modulated fluorometry. Cultures of algae without bacteria remained healthy at 18°C, but lower cell counts in control cultures at 25°C indicated some stress at the elevated temperature. Both the C (coccolith-bearing) and S (scale-bearing swarming) cell types of E. huxleyi experienced a rapid decline resulting in apparent death when co-cultured with R11 at 25°C, but had no effect on N (naked) cell type at either temperature. R11 had no initial negative impact on C and S type E. huxleyi population size or health at 18°C, but caused death in older co-cultures. This differential effect of R11 on its host at 18 and 25°C suggest it is a temperature-enhanced opportunistic pathogen of E. huxleyi. We also detected caspase-like activity in dying C type cells co-cultured with R11, which suggests that programmed cell death plays a role in the death of E. huxleyi triggered by R11 - a mechanism induced by viruses (EhVs) and implicated in E. huxleyi bloom collapse. Given that E. huxleyi has recently been
A Bacterial Pathogen Displaying Temperature-Enhanced Virulence of the Microalga Emiliania huxleyi
Mayers, Teaghan J.; Bramucci, Anna R.; Yakimovich, Kurt M.; Case, Rebecca J.
2016-01-01
Emiliania huxleyi is a globally abundant microalga that plays a significant role in biogeochemical cycles. Over the next century, sea surface temperatures are predicted to increase drastically, which will likely have significant effects on the survival and ecology of E. huxleyi. In a warming ocean, this microalga may become increasingly vulnerable to pathogens, particularly those with temperature-dependent virulence. Ruegeria is a genus of Rhodobacteraceae whose population size tracks that of E. huxleyi throughout the alga’s bloom–bust lifecycle. A representative of this genus, Ruegeria sp. R11, is known to cause bleaching disease in a red macroalga at elevated temperatures. To investigate if the pathogenicity of R11 extends to microalgae, it was co-cultured with several cell types of E. huxleyi near the alga’s optimum (18°C), and at an elevated temperature (25°C) known to induce virulence in R11. The algal populations were monitored using flow cytometry and pulse-amplitude modulated fluorometry. Cultures of algae without bacteria remained healthy at 18°C, but lower cell counts in control cultures at 25°C indicated some stress at the elevated temperature. Both the C (coccolith-bearing) and S (scale-bearing swarming) cell types of E. huxleyi experienced a rapid decline resulting in apparent death when co-cultured with R11 at 25°C, but had no effect on N (naked) cell type at either temperature. R11 had no initial negative impact on C and S type E. huxleyi population size or health at 18°C, but caused death in older co-cultures. This differential effect of R11 on its host at 18 and 25°C suggest it is a temperature-enhanced opportunistic pathogen of E. huxleyi. We also detected caspase-like activity in dying C type cells co-cultured with R11, which suggests that programmed cell death plays a role in the death of E. huxleyi triggered by R11 – a mechanism induced by viruses (EhVs) and implicated in E. huxleyi bloom collapse. Given that E. huxleyi has
PCR-Independent Detection of Bacterial Species-Specific 16S rRNA at 10 fM by a Pore-Blockage Sensor
Directory of Open Access Journals (Sweden)
Leyla Esfandiari
2016-07-01
Full Text Available A PCR-free, optics-free device is used for the detection of Escherichia coli (E. coli 16S rRNA at 10 fM, which corresponds to ~100–1000 colony forming units/mL (CFU/mL depending on cellular rRNA levels. The development of a rapid, sensitive, and cost-effective nucleic acid detection platform is sought for the detection of pathogenic microbes in food, water and body fluids. Since 16S rRNA sequences are species specific and are present at high copy number in viable cells, these nucleic acids offer an attractive target for microbial pathogen detection schemes. Here, target 16S rRNA of E. coli at 10 fM concentration was detected against a total RNA background using a conceptually simple approach based on electromechanical signal transduction, whereby a step change reduction in ionic current through a pore indicates blockage by an electrophoretically mobilized bead-peptide nucleic acid probe conjugate hybridized to target nucleic acid. We investigated the concentration detection limit for bacterial species-specific 16S rRNA at 1 pM to 1 fM and found a limit of detection of 10 fM for our device, which is consistent with our previous finding with single-stranded DNA of similar length. In addition, no false positive responses were obtained with control RNA and no false negatives with target 16S rRNA present down to the limit of detection (LOD of 10 fM. Thus, this detection scheme shows promise for integration into portable, low-cost systems for rapid detection of pathogenic microbes in food, water and body fluids.
Liu, Hai-Tao; Wen, Zhi-Yu; Xu, Yi; Shang, Zheng-Guo; Peng, Jin-Lan; Tian, Peng
2017-09-01
In this paper, an integrated microfluidic analysis microsystems with bacterial capture enrichment and in-situ impedance detection was purposed based on microfluidic chips dielectrophoresis technique and electrochemical impedance detection principle. The microsystems include microfluidic chip, main control module, and drive and control module, and signal detection and processing modulet and result display unit. The main control module produce the work sequence of impedance detection system parts and achieve data communication functions, the drive and control circuit generate AC signal which amplitude and frequency adjustable, and it was applied on the foodborne pathogens impedance analysis microsystems to realize the capture enrichment and impedance detection. The signal detection and processing circuit translate the current signal into impendence of bacteria, and transfer to computer, the last detection result is displayed on the computer. The experiment sample was prepared by adding Escherichia coli standard sample into chicken sample solution, and the samples were tested on the dielectrophoresis chip capture enrichment and in-situ impedance detection microsystems with micro-array electrode microfluidic chips. The experiments show that the Escherichia coli detection limit of microsystems is 5 × 104 CFU/mL and the detection time is within 6 min in the optimization of voltage detection 10 V and detection frequency 500 KHz operating conditions. The integrated microfluidic analysis microsystems laid the solid foundation for rapid real-time in-situ detection of bacteria.
Disinfection and removal of human pathogenic bacteria in arctic waste stabilization ponds
DEFF Research Database (Denmark)
Huang, Yannan; Hansen, Lisbeth Truelstrup; Ragush, Colin M.
2017-01-01
Wastewater stabilization ponds (WSPs) are commonly used to treat municipal wastewater in Arctic Canada. The biological treatment in the WSPs is strongly influenced by climatic conditions. Currently, there is limited information about the removal of fecal and pathogenic bacteria during the short...... cool summer treatment season. With relevance to public health, the objectives of this paper were to determine if treatment in arctic WSPs resulted in the disinfection (i.e., removal of fecal indicator bacteria, Escherichia coli) and removal of selected human bacterial pathogens from the treated...... treatment of the wastewater with a 2–3 Log removal of generic indicator E. coli. The bacterial pathogens Salmonella spp., pathogenic E. coli, and Listeria monocytogenes, but not Campylobacter spp. and Helicobacter pylori, were detected in the untreated and treated wastewater, indicating that human...
Starliper, Clifford E.; Cipriano, R.C.; Bruckner, A.W.; Shchelkunov, I.S.
2011-01-01
Unionid mussels are recognized as important contributors to healthy aquatic ecosystems, as well as bioindicators of environmental perturbations. Because they are sedentary, filter feeding animals and require hosts (i.e., fishes) to transform embryonic glochidia, mussels are susceptible to direct adverse environmental parameters, and indirect parameters that restrict the timely presence of the host(s). Their numbers have declined in recent decades to a point that this fauna is regarded as one of the most imperiled in North America. The most significant threat to populations of native unionids in recent years has been the introduction and spread of zebra mussels Dreissena polymorpha. Many federal and state agencies, and private interests are now engaged in mussel conservation efforts, including collecting selected imperiled species from impacted rivers and lakes and propagating them at refuges for future population augmentations. One essential consideration with mussel propagation and their intensive culture at refugia is the prevention of pathogen introductions and control of diseases. Currently, there are few reports of etiological agents causing diseases among freshwater mussels; however, because of increased observations of mussel die-offs in conjunction with transfers of live animals between natural waters and refugia, disease problems can be anticipated to emerge. This review summarizes research to develop bacterial isolation techniques, study pathogen transmission between fish and mussels, identify causes of seasonal mussel die-offs, and develop non-destructive methods for pathogen detection. These efforts were done to develop disease preventative techniques for use by resource managers to avoid potential large-scale disease problems in restoration and population augmentation efforts among imperiled populations.
Directory of Open Access Journals (Sweden)
Ayele Kebede
2017-12-01
Full Text Available Abstract Background The frequent occurrence of bacterial gastroenteritis among HIV-infected individuals together with increased antimicrobial drug resistance pose a significant public health challenge in developing countries. This study aimed to determine the prevalence of enteric bacterial pathogens and their antimicrobial susceptibility pattern among HIV-infected patients in a tertiary hospital in southern Ethiopia. Methods A hospital-based cross-sectional study was conducted at Hawassa University Comprehensive Specialized Hospital from February to May, 2016. A consecutive 215 HIV-infected patients, with complaints of gastrointestinal tract disease, were enrolled. Data on socio-demography and related factors was collected using a structured questionnaire. A stool sample was collected from each study participant and cultured to isolate enteric bacterial pathogens; isolates were characterized using biochemical tests. Antimicrobial susceptibility was determined using the Kirby- Bauer disk diffusion technique. Results Out of 215 patients, 27(12.6% were culture positive for various bacterial pathogens. Campylobacter species was the most common bacterial isolate (6.04%, followed by Salmonella species (5.1%. The majority of isolates was sensitive to norfloxacin, nalidixic acid, gentamicin, ceftriaxone and ciprofloxacin and showed resistance to trimethoprim sulfamethoxazole (SXT and chloramphenicol. Consumption of raw food was the only risk factor found to be significantly associated with enteric bacterial infection (crude odds ratio 3.41 95% CI 1.13–10.3. Conclusions The observed rate of enteric bacterial pathogens and their antimicrobial resistance pattern to the commonly prescribed antibiotics highlights the need to strengthen intervention efforts and promote rational use of antimicrobials. In this regard, the need to strengthen antimicrobial stewardship efforts should be emphasized to slow grown antimicrobial resistance among this population
Gram stains: a resource for retrospective analysis of bacterial pathogens in clinical studies.
Srinivasan, Usha; Ponnaluri, Sreelatha; Villareal, Lisa; Gillespie, Brenda; Wen, Ai; Miles, Arianna; Bucholz, Brigette; Marrs, Carl F; Iyer, Ram K; Misra, Dawn; Foxman, Betsy
2012-01-01
We demonstrate the feasibility of using qPCR on DNA extracted from vaginal Gram stain slides to estimate the presence and relative abundance of specific bacterial pathogens. We first tested Gram stained slides spiked with a mix of 10(8) cfu/ml of Escherichia coli and 10(5) cfu/ml of Lactobacillus acidophilus. Primers were designed for amplification of total and species-specific bacterial DNA based on 16S ribosomal gene regions. Sample DNA was pre-amplified with nearly full length 16S rDNA ribosomal gene fragment, followed by quantitative PCR with genera and species-specific 16S rDNA primers. Pre-amplification PCR increased the bacterial amounts; relative proportions of Escherichia coli and Lactobacillus recovered from spiked slides remained unchanged. We applied this method to forty two archived Gram stained slides available from a clinical trial of cerclage in pregnant women at high risk of preterm birth. We found a high correlation between Nugent scores based on bacterial morphology of Lactobacillus, Gardenerella and Mobiluncus and amounts of quantitative PCR estimated genus specific DNA (rrn copies) from Gram stained slides. Testing of a convenience sample of eight paired vaginal swabs and Gram stains freshly collected from healthy women found similar qPCR generated estimates of Lactobacillus proportions from Gram stained slides and vaginal swabs. Archived Gram stained slides collected from large scale epidemiologic and clinical studies represent a valuable, untapped resource for research on the composition of bacterial communities that colonize human mucosal surfaces.
Advances in genetic manipulation of obligate intracellular bacterial pathogens
Directory of Open Access Journals (Sweden)
Paul eBeare
2011-05-01
Full Text Available Infections by obligate intracellular bacterial pathogens result in significant morbidity and mortality worldwide. These bacteria include Chlamydia spp., which causes millions of cases of sexually transmitted disease and blinding trachoma annually, and members of the α-proteobacterial genera Anaplasma, Ehrlichia, Orientia and Rickettsia, agents of serious human illnesses including epidemic typhus. Coxiella burnetii, the agent of human Q fever, has also been considered a prototypical obligate intracellular bacterium, but recent host cell-free (axenic growth has rescued it from obligatism. The historic genetic intractability of obligate intracellular bacteria has severely limited molecular dissection of their unique lifestyles and virulence factors involved in pathogenesis. Host cell restricted growth is a significant barrier to genetic transformation that can make simple procedures for free-living bacteria, such as cloning, exceedingly difficult. Low transformation efficiency requiring long term culture in host cells to expand small transformant populations is another obstacle. Despite numerous technical limitations, the last decade has witnessed significant gains in genetic manipulation of obligate intracellular bacteria including allelic exchange. Continued development of genetic tools should soon enable routine mutation and complementation strategies for virulence factor discovery and stimulate renewed interest in these refractory pathogens. In this review, we discuss the technical challenges associated with genetic transformation of obligate intracellular bacteria and highlight advances made with individual genera.
Detection and identification of Staphylococcus aureus in raw milk by ...
African Journals Online (AJOL)
Staphylococcus aureus causes foodborne diseases if consumed in contaminated milk products. Rapid detection and characterization of foodborne pathogen S. aureus is crucial for epidemiological investigations and food safety surveillance. It is still a challenge to detect and identify bacterial pathogens quickly and ...
Pathogen Presence in European Starlings Inhabiting Commercial Piggeries in South Australia.
Pearson, Hayley E; Lapidge, Steven J; Hernández-Jover, Marta; Toribio, Jenny-Ann L M L
2016-06-01
The majority of bacterial diarrhea-causing illnesses in domestic pigs result from infection with Escherichia coli, Salmonella spp., or Campylobacter spp. These bacterial enteropathogens also correspond with the most-common bacteria isolated from wild birds. Additionally, viral pathogens such as avian influenza virus (AIV), West Nile virus (WNV, including Kunjin disease), and Newcastle disease virus (NDV) may also be carried and transmitted by birds in Australia. Introduced European starlings (Sturnus vulgarus) are one of the most-frequently reported birds on piggeries in Australia. The presence of the three bacterial pathogens, Salmonella spp., Campylobacter spp., and Escherichia coli , as well as the three viral pathogens AIV, WNV, and NDV, were evaluated in starlings captured on four commercial piggeries in South Australia. A total of 473 starlings were captured on the four piggeries in 2008 and 2009. A cloacal swab was taken from each bird and cultured for bacterial identification, with follow-up serotyping of any positives, whilst fifty samples were analyzed by PCR for the three target viral pathogens. There was no AIV, WNV, or NDV detected in the 50 starlings sampled. Escherichia coli was found to be present in the starling populations on all four piggeries whilst Salmonella spp. and Campylobacter jejuni were found to be present only in the starling population sampled on one piggery. Serotyping identified pig-pathogenic strains of the bacteria. The prevalence of these production-limiting bacterial pathogens in starlings, coupled with the large starling populations often found inside piggeries during daylight hours in the summer months, presents a disease transmission risk and jeopardizes piggery disease management. Removal of starlings from agricultural enterprises (as shown by international studies), or prevention of starling access to animal feed and water, could substantially reduce the risk of transmission of enterobacterial pathogens from starlings to
Pathogens in drinking water: Are there any new ones
Energy Technology Data Exchange (ETDEWEB)
Reasoner, D.J.
1993-01-01
Since 1976 three newly recognized human pathogens have become familiar to the drinking water industry as waterborne disease agents. These are: the legionnaires disease agent, Legionella pneumophila and related species; and two protozoan pathogens, Giardia lamblia and Cryptosporidium parvum, both of which form highly disinfectant resistant cysts that are shed in the feces of infected individuals. The question frequently arises - are there other emerging waterborne pathogens that may pose a human health problem that the drinking water industry will have to deal with. The paper will review the current state of knowledge of the occurrence and incidence of pathogens and opportunistic pathogens other than Legionella, Giardia and Cryptosporidium in treated and untreated drinking water. Bacterial agents that will be reviewed include Aeromonas, Pseudomonas, Campylobacter, Mycobacterium, Yersinia and Plesiomonas. Aspects of detection of these agents including detection methods and feasibility of monitoring will be addressed.
Biocontrol and Rapid Detection of Food-borne Pathogens Using Bacteriophages and Endolysins
Directory of Open Access Journals (Sweden)
Jaewoo eBai
2016-04-01
Full Text Available Bacteriophages have been suggested as natural food preservatives as well as rapid detection materials for food-borne pathogens in various foods. Since Listeria monocytogenes-targeting phage cocktail (ListShield was approved for applications in foods, numerous phages have been screened and experimentally characterized for phage applications in foods. A single phage and phage cocktail treatments to various foods contaminated with food-borne pathogens including E. coli O157:H7, Salmonella enterica, Campylobacter jejuni, Listeria monocytogenes, Staphylococcus aureus, Cronobacter sakazakii, and Vibrio spp. revealed that they have great potential to control various food-borne pathogens and may be alternative for conventional food preservatives. In addition, phage-derived endolysins with high host specificity and host lysis activities may be preferred to food applications rather than phages. For rapid detection of food-borne pathogens, cell-wall binding domains (CBDs from endolysins have been suggested due to their high host-specific binding. Fluorescence-tagged CBDs have been successfully evaluated and suggested to be alternative materials of expensive antibodies for various detection applications. Most recently, reporter phage systems have been developed and tested to confirm their usability and accuracy for specific detection. These systems revealed some advantages like rapid detection of only viable pathogenic cells without interference by food components in a very short reaction time, suggesting that these systems may be suitable for monitoring of pathogens in foods. Consequently, phage is the next-generation biocontrol agent as well as rapid detection tool to confirm and even identify the food-borne pathogens present in various foods.
Xu, Yueshuang; Wang, Huan; Luan, Chengxin; Liu, Yuxiao; Chen, Baoan; Zhao, Yuanjin
2018-02-15
Rapid and sensitive diagnosing hematological infections based on the separation and detection of pathogenic bacteria in the patient's blood is a significant challenge. To address this, we herein present a new barcodes technology that can simultaneously capture and detect multiple types of pathogenic bacteria from a complex sample. The barcodes are poly (ethylene glycol) (PEG) hydrogel inverse opal particles with characteristic reflection peak codes that remain stable during bacteria capture on their surfaces. As the spherical surface of the particles has ordered porous nanostructure, the barcodes can provide not only more surface area for probe immobilization and reaction, but also a nanopatterned platform for highly efficient bioreactions. In addition, the PEG hydrogel scaffold could decrease the non-specificity adsorption by its anti-adhesive effect, and the decorated aptamer probes in the scaffolds could increase the sensitivity, reliability, and specificity of the bacteria capture and detection. Moreover, the tagged magnetic nanoparticles in the PEG scaffold could impart the barcodes with controllable movement under magnetic fields, which can be used to significantly increase the reaction speed and simplify the processing of the bioassays. Based on the describe barcodes, it was demonstrated that the bacteria could be captured and identified even at low bacterial concentrations (100 CFU mL -1 ) within 2.5h, which is effectively shortened in comparison with the "gold standard" in clinic. These features make the barcodes ideal for capturing and detecting multiple bacteria from clinical samples for hematological infection diagnostics. Copyright © 2017 Elsevier B.V. All rights reserved.
Animals devoid of pulmonary system as infection models in the study of lung bacterial pathogens
López Hernández, Yamilé; Yero, Daniel; Pinos-Rodríguez, Juan M.; Gibert, Isidre
2015-01-01
Biological disease models can be difficult and costly to develop and use on a routine basis. Particularly, in vivo lung infection models performed to study lung pathologies use to be laborious, demand a great time and commonly are associated with ethical issues. When infections in experimental animals are used, they need to be refined, defined, and validated for their intended purpose. Therefore, alternative and easy to handle models of experimental infections are still needed to test the virulence of bacterial lung pathogens. Because non-mammalian models have less ethical and cost constraints as a subjects for experimentation, in some cases would be appropriated to include these models as valuable tools to explore host–pathogen interactions. Numerous scientific data have been argued to the more extensive use of several kinds of alternative models, such as, the vertebrate zebrafish (Danio rerio), and non-vertebrate insects and nematodes (e.g., Caenorhabditis elegans) in the study of diverse infectious agents that affect humans. Here, we review the use of these vertebrate and non-vertebrate models in the study of bacterial agents, which are considered the principal causes of lung injury. Curiously none of these animals have a respiratory system as in air-breathing vertebrates, where respiration takes place in lungs. Despite this fact, with the present review we sought to provide elements in favor of the use of these alternative animal models of infection to reveal the molecular signatures of host–pathogen interactions. PMID:25699030
International Nuclear Information System (INIS)
El-Semary, N.A.; Osman, M.E.; Ahmed, A.S.; Botros, H.W.; Farag, A.T.
2014-01-01
The search for broad spectrum antimicrobial agents against microbial pathogens, as the available bioactive compounds, has decreasing efficacy and the multidrug resistance trait is spreading among pathogens. Accordingly, the study was carried out to investigate the antimicrobial bioactivity of extracts derived from a cyano bacterial strain from Egypt. The solvents used were diethyl ether, chloroform and methanol. The antimicrobial bioassay of the lipophilic fraction dissolved in diethyl ether of Synechococcus spp. (isolated from Wadi El-Natroun, Egypt) showed the highest broad spectrum bioactivity as it inhibited the growth of both plant and human pathogens. The extract was also effective on the filamentous plant pathogenic fungi Aspergillus flavus and Aspergillus niger. The effects of incubation periods, growth media and pH values on both growth and antimicrobial activity of Synechococcus spp. were investigated. Chu medium was the medium that gave the highest growth followed by BG11 medium then Oscillatoria medium and all these three media showed antibacterial activities but only BG11 showed both antibacterial and antifungal activities after 18 days of incubation. The pH value 10 proved to be the best for growth and antimicrobial activities of Synechococcus spp. in BG11 medium
Nurul Najian, A B; Engku Nur Syafirah, E A R; Ismail, Nabilah; Mohamed, Maizan; Yean, Chan Yean
2016-01-15
In recent years extensive numbers of molecular diagnostic methods have been developed to meet the need of point-of-care devices. Efforts have been made towards producing rapid, simple and inexpensive DNA tests, especially in the diagnostics field. We report on the development of a label-based lateral flow dipstick for the rapid and simple detection of multiplex loop-mediated isothermal amplification (m-LAMP) amplicons. A label-based m-LAMP lateral flow dipstick assay was developed for the simultaneous detection of target DNA template and a LAMP internal control. This biosensor operates through a label based system, in which probe-hybridization and the additional incubation step are eliminated. We demonstrated this m-LAMP assay by detecting pathogenic Leptospira, which causes the re-emerging disease Leptospirosis. The lateral flow dipstick was developed to detect of three targets, the LAMP target amplicon, the LAMP internal control amplicon and a chromatography control. Three lines appeared on the dipstick, indicating positive results for all representative pathogenic Leptospira species, whereas two lines appeared, indicating negative results, for other bacterial species. The specificity of this biosensor assay was 100% when it was tested with 13 representative pathogenic Leptospira species, 2 intermediate Leptospira species, 1 non-pathogenic Leptospira species and 28 other bacteria species. This study found that this DNA biosensor was able to detect DNA at concentrations as low as 3.95 × 10(-1) genomic equivalent ml(-1). An integrated m-LAMP and label-based lateral flow dipstick was successfully developed, promising simple and rapid visual detection in clinical diagnostics and serving as a point-of-care device. Copyright © 2015 Elsevier B.V. All rights reserved.
Hyperspectral imaging using a color camera and its application for pathogen detection
Yoon, Seung-Chul; Shin, Tae-Sung; Heitschmidt, Gerald W.; Lawrence, Kurt C.; Park, Bosoon; Gamble, Gary
2015-02-01
This paper reports the results of a feasibility study for the development of a hyperspectral image recovery (reconstruction) technique using a RGB color camera and regression analysis in order to detect and classify colonies of foodborne pathogens. The target bacterial pathogens were the six representative non-O157 Shiga-toxin producing Escherichia coli (STEC) serogroups (O26, O45, O103, O111, O121, and O145) grown in Petri dishes of Rainbow agar. The purpose of the feasibility study was to evaluate whether a DSLR camera (Nikon D700) could be used to predict hyperspectral images in the wavelength range from 400 to 1,000 nm and even to predict the types of pathogens using a hyperspectral STEC classification algorithm that was previously developed. Unlike many other studies using color charts with known and noise-free spectra for training reconstruction models, this work used hyperspectral and color images, separately measured by a hyperspectral imaging spectrometer and the DSLR color camera. The color images were calibrated (i.e. normalized) to relative reflectance, subsampled and spatially registered to match with counterpart pixels in hyperspectral images that were also calibrated to relative reflectance. Polynomial multivariate least-squares regression (PMLR) was previously developed with simulated color images. In this study, partial least squares regression (PLSR) was also evaluated as a spectral recovery technique to minimize multicollinearity and overfitting. The two spectral recovery models (PMLR and PLSR) and their parameters were evaluated by cross-validation. The QR decomposition was used to find a numerically more stable solution of the regression equation. The preliminary results showed that PLSR was more effective especially with higher order polynomial regressions than PMLR. The best classification accuracy measured with an independent test set was about 90%. The results suggest the potential of cost-effective color imaging using hyperspectral image
Harris, Jordan Lee; Balci, Yilmaz
2015-01-01
Bacterial leaf scorch, associated with the bacterial pathogen Xylella fastidiosa, is a widely established and problematic disease of landscape ornamentals in Washington D.C. A multi-locus sequence typing analysis was performed using 10 housekeeping loci for X. fastidiosa strains in order to better understand the epidemiology of leaf scorch disease in this municipal environment. Samples were collected from 7 different tree species located throughout the District of Columbia, consisting of 101 samples of symptomatic and asymptomatic foliage from 84 different trees. Five strains of the bacteria were identified. Consistent with prior data, these strains were host specific, with only one strain associated with members of the red oak family, one strain associated with American elm, one strain associated with American sycamore, and two strains associated with mulberry. Strains found for asymptomatic foliage were the same as strains from the symptomatic foliage on individual trees. Cross transmission of the strains was not observed at sites with multiple species of infected trees within an approx. 25 m radius of one another. X. fastidiosa strain specificity observed for each genus of tree suggests a highly specialized host-pathogen relationship.
Directory of Open Access Journals (Sweden)
Jordan Lee Harris
Full Text Available Bacterial leaf scorch, associated with the bacterial pathogen Xylella fastidiosa, is a widely established and problematic disease of landscape ornamentals in Washington D.C. A multi-locus sequence typing analysis was performed using 10 housekeeping loci for X. fastidiosa strains in order to better understand the epidemiology of leaf scorch disease in this municipal environment. Samples were collected from 7 different tree species located throughout the District of Columbia, consisting of 101 samples of symptomatic and asymptomatic foliage from 84 different trees. Five strains of the bacteria were identified. Consistent with prior data, these strains were host specific, with only one strain associated with members of the red oak family, one strain associated with American elm, one strain associated with American sycamore, and two strains associated with mulberry. Strains found for asymptomatic foliage were the same as strains from the symptomatic foliage on individual trees. Cross transmission of the strains was not observed at sites with multiple species of infected trees within an approx. 25 m radius of one another. X. fastidiosa strain specificity observed for each genus of tree suggests a highly specialized host-pathogen relationship.
Directory of Open Access Journals (Sweden)
J.A. Khan
2013-09-01
Full Text Available Among current in vitro methods for identification of pathogenic Listeria monocytogenes (L. monocytogenes rely on growth in culture media, followed by isolation, and biochemical and serological identification. Now PCR (Polymerase Chain Reaction has been used for the rapid, sensitive and specific detection of pathogenic L. monocytogenes. The pathogenicity of the organism is highly correlated with haemolytic factor known as listeriolysin O (LLO. A total of 400 samples from meat and 250 samples from raw milk and their products were collected from various local dairy farms, dairy units and butcheries in Bareilly, India. Pure isolates of L. monocytogenes obtained after enrichment in Buffered Listeria enrichment broth (BLEB followed by plating onto Listeria oxford agar. The DNA extracted from pure isolates and used for the detection of bacterial pathogen. The oligonucleotide primer pairs (F: CGGAGGTTCCGCAAAAGATG; R: CCTCCAGAGTGATCGATGTT complementary to the nucleotide sequence of the hlyA gene selected for detection of L. monocytogenes using polymerase chain reaction (PCR. PCR products of 234 bp generated with DNA from all of L. monocytogenes isolates. The highest occurrence of haemolytic L. monocytogenes isolates from various meat samples was in raw chicken (6.0%, followed by fish meat (4.0%, and then beef (2.5%. Among various milk and milk products, curd (2.0% showed the highest prevalence, followed by raw milk (1.3%. The cytotoxic effects of haemolytic L. monocytogenes isolates were screened on vero cell lines. The cell lines with cell free culture supernatant (CFCS examined at 1 min, 10 min, 30 min, and 60 min. The significant changes in vero cells were observed at 30 min with both 30 µL and 50 µL of volume. We conclude that application of PCR approaches can provide critical information on distribution of haemolytic strains of L. monocytogenes in food processing environments. Vero cell cytotoxicity assay (in vitro resulted positive in twenty four
Microconductometric Detection of Bacterial Contamination
Directory of Open Access Journals (Sweden)
Sarra EL ICHI
2014-05-01
Full Text Available Several approaches can be used for the electrochemical detection of bacterial contamination. Their performance can be assessed by the ability to detect bacteria at very low concentrations within a short-time response. We have already demonstrated that a conductometric biosensor based on interdigitated thin-film electrodes is adapted to detect bacteria in clinical samples like serum and compatible with microfluidic fabrication. The type of interdigitated microelectrodes influences the performance of the biosensor. This was shown by the results obtained in this work. A magnetic-nanoparticles based immunosensor was designed using gold screen-printed electrodes. The immunosensor was able to specifically detect E. coli in the range of 1-103 CFU mL-1. The new transducer offered a larger active sensing surface with a lower cost and a robust material. Accuracy of the conductance value was enhanced by differential measurements. The immunosensor is compatible with a microfluidic system.
Martínez, Isidoro; Oliveros, Juan C.; Cuesta, Isabel; de la Barrera, Jorge; Ausina, Vicente; Casals, Cristina; de Lorenzo, Alba; García, Ernesto; García-Fojeda, Belén; Garmendia, Junkal; González-Nicolau, Mar; Lacoma, Alicia; Menéndez, Margarita; Moranta, David; Nieto, Amelia; Ortín, Juan; Pérez-González, Alicia; Prat, Cristina; Ramos-Sevillano, Elisa; Regueiro, Verónica; Rodriguez-Frandsen, Ariel; Solís, Dolores; Yuste, José; Bengoechea, José A.; Melero, José A.
2017-01-01
Lower respiratory tract infections are among the top five leading causes of human death. Fighting these infections is therefore a world health priority. Searching for induced alterations in host gene expression shared by several relevant respiratory pathogens represents an alternative to identify new targets for wide-range host-oriented therapeutics. With this aim, alveolar macrophages were independently infected with three unrelated bacterial (Streptococcus pneumoniae, Klebsiella pneumoniae, and Staphylococcus aureus) and two dissimilar viral (respiratory syncytial virus and influenza A virus) respiratory pathogens, all of them highly relevant for human health. Cells were also activated with bacterial lipopolysaccharide (LPS) as a prototypical pathogen-associated molecular pattern. Patterns of differentially expressed cellular genes shared by the indicated pathogens were searched by microarray analysis. Most of the commonly up-regulated host genes were related to the innate immune response and/or apoptosis, with Toll-like, RIG-I-like and NOD-like receptors among the top 10 signaling pathways with over-expressed genes. These results identify new potential broad-spectrum targets to fight the important human infections caused by the bacteria and viruses studied here. PMID:28298903
Prevalence of Bovine Mastitis Pathogens in Bulk Tank Milk in China
Wang, Ya Jing; Qin, Yun; Guix Vallverdú, Roger; Maldonado García, Jaime; Sun, Wei; Li, Shengli; Cao, Zhijun
2016-01-01
The objectives of this study were to estimate the herd prevalence of major mastitis pathogens in bulk tank milk (BTM) in China dairy herds, to determine the relationship between the presence of mastitis pathogens and bulk tank milk somatic cell counts (BTSCC), and to investigate the impact of different dairy cattle farming modes and region on bacterial species. BTM samples collected from 894 dairy herds in China were examined for the presence of mastitis pathogens. The Flinders Technology Associates (FTA) cards were used for BTM sample collection, storage, and transportation and bacterial DNA amplification by real-time PCR. Among contagious pathogens, Staphylococcus aureus, Streptococcus agalactiae, and Streptococcus dysgalactiae were detected in 50.1, 92.2, and 72.3% of the 894 BTM samples, respectively. Among environmental pathogens, E. coli, Streptococcus uberis, Enterococcus spp., Klebsiella spp., Serratia marcescens, Corynebacterium bovis, and Arcanobacterium pyogenes were detected in 28.6, 8.9, 35.7, 20.0, 1.3, 17.0, and 67.2% of the BTM samples, respectively. Staphylococcal β-lactamase gene was detected in 61.7% of the BTM samples. The presence of Staphylococcus aureus and Arcanobacterium pyogenes were significantly associated with high BTSCC, respectively. Significant differences were found in presence of Staphylococcus aureus, Streptococcus agalactiae, and Streptococcus dysgalactiae in BTM sampled from the small household farms, dairy-farming communities, and large-scaled dairy farms. There were significant differences in the presence of Streptococcus agalactiae, Streptococcus dysgalactiae, Arcanobacterium pyogenes, staphylococcal β-lactamase gene, Staphylococcus spp., Klebsiella spp., Enterococcus spp., and Streptococcus uberis in BTM among Inner Mongolia, Heilongjiang, and Hebei province. In conclusion, contagious mammary pathogens are predominated among pathogens in BTM samples in China. PMID:27187065
Vercoe, Reuben B; Chang, James T; Dy, Ron L; Taylor, Corinda; Gristwood, Tamzin; Clulow, James S; Richter, Corinna; Przybilski, Rita; Pitman, Andrew R; Fineran, Peter C
2013-04-01
In prokaryotes, clustered regularly interspaced short palindromic repeats (CRISPRs) and their associated (Cas) proteins constitute a defence system against bacteriophages and plasmids. CRISPR/Cas systems acquire short spacer sequences from foreign genetic elements and incorporate these into their CRISPR arrays, generating a memory of past invaders. Defence is provided by short non-coding RNAs that guide Cas proteins to cleave complementary nucleic acids. While most spacers are acquired from phages and plasmids, there are examples of spacers that match genes elsewhere in the host bacterial chromosome. In Pectobacterium atrosepticum the type I-F CRISPR/Cas system has acquired a self-complementary spacer that perfectly matches a protospacer target in a horizontally acquired island (HAI2) involved in plant pathogenicity. Given the paucity of experimental data about CRISPR/Cas-mediated chromosomal targeting, we examined this process by developing a tightly controlled system. Chromosomal targeting was highly toxic via targeting of DNA and resulted in growth inhibition and cellular filamentation. The toxic phenotype was avoided by mutations in the cas operon, the CRISPR repeats, the protospacer target, and protospacer-adjacent motif (PAM) beside the target. Indeed, the natural self-targeting spacer was non-toxic due to a single nucleotide mutation adjacent to the target in the PAM sequence. Furthermore, we show that chromosomal targeting can result in large-scale genomic alterations, including the remodelling or deletion of entire pre-existing pathogenicity islands. These features can be engineered for the targeted deletion of large regions of bacterial chromosomes. In conclusion, in DNA-targeting CRISPR/Cas systems, chromosomal interference is deleterious by causing DNA damage and providing a strong selective pressure for genome alterations, which may have consequences for bacterial evolution and pathogenicity.
Screening of Viral Pathogens from Pediatric Ileal Tissue Samples after Vaccination
Directory of Open Access Journals (Sweden)
Laura Hewitson
2014-01-01
Full Text Available In 2010, researchers reported that the two US-licensed rotavirus vaccines contained DNA or DNA fragments from porcine circovirus (PCV. Although PCV, a common virus among pigs, is not thought to cause illness in humans, these findings raised several safety concerns. In this study, we sought to determine whether viruses, including PCV, could be detected in ileal tissue samples of children vaccinated with one of the two rotavirus vaccines. A broad spectrum, novel DNA detection technology, the Lawrence Livermore Microbial Detection Array (LLMDA, was utilized, and confirmation of viral pathogens using the polymerase chain reaction (PCR was conducted. The LLMDA technology was recently used to identify PCV from one rotavirus vaccine. Ileal tissue samples were analyzed from 21 subjects, aged 15–62 months. PCV was not detected in any ileal tissue samples by the LLMDA or PCR. LLMDA identified a human rotavirus A from one of the vaccinated subjects, which is likely due to a recent infection from a wild type rotavirus. LLMDA also identified human parechovirus, a common gastroenteritis viral infection, from two subjects. Additionally, LLMDA detected common gastrointestinal bacterial organisms from the Enterobacteriaceae, Bacteroidaceae, and Streptococcaceae families from several subjects. This study provides a survey of viral and bacterial pathogens from pediatric ileal samples, and may shed light on future studies to identify pathogen associations with pediatric vaccinations.
Oberbach, Andreas; Schlichting, Nadine; Feder, Stefan; Lehmann, Stefanie; Kullnick, Yvonne; Buschmann, Tilo; Blumert, Conny; Horn, Friedemann; Neuhaus, Jochen; Neujahr, Ralph; Bagaev, Erik; Hagl, Christian; Pichlmaier, Maximilian; Rodloff, Arne Christian; Gräber, Sandra; Kirsch, Katharina; Sandri, Marcus; Kumbhari, Vivek; Behzadi, Armirhossein; Behzadi, Amirali; Correia, Joao Carlos; Mohr, Friedrich Wilhelm; Friedrich, Maik
2017-01-01
In infective endocarditis (IE), a severe inflammatory disease of the endocardium with an unchanged incidence and mortality rate over the past decades, only 1% of the cases have been described as polymicrobial infections based on microbiological approaches. The aim of this study was to identify potential biodiversity of bacterial species from infected native and prosthetic valves. Furthermore, we compared the ultrastructural micro-environments to detect the localization and distribution patterns of pathogens in IE. Using next-generation sequencing (NGS) of 16S rDNA, which allows analysis of the entire bacterial community within a single sample, we investigated the biodiversity of infectious bacterial species from resected native and prosthetic valves in a clinical cohort of 8 IE patients. Furthermore, we investigated the ultrastructural infected valve micro-environment by focused ion beam scanning electron microscopy (FIB-SEM). Biodiversity was detected in 7 of 8 resected heart valves. This comprised 13 bacterial genera and 16 species. In addition to 11 pathogens already described as being IE related, 5 bacterial species were identified as having a novel association. In contrast, valve and blood culture-based diagnosis revealed only 4 species from 3 bacterial genera and did not show any relevant antibiotic resistance. The antibiotics chosen on this basis for treatment, however, did not cover the bacterial spectra identified by our amplicon sequencing analysis in 4 of 8 cases. In addition to intramural distribution patterns of infective bacteria, intracellular localization with evidence of bacterial immune escape mechanisms was identified. The high frequency of polymicrobial infections, pathogen diversity, and intracellular persistence of common IE-causing bacteria may provide clues to help explain the persistent and devastating mortality rate observed for IE. Improved bacterial diagnosis by 16S rDNA NGS that increases the ability to tailor antibiotic therapy may
Schötta, Anna-Margarita; Wijnveld, Michiel; Stockinger, Hannes; Stanek, Gerold
2017-07-01
Ticks transmit a large number of pathogens capable of causing human disease. In this study, the PCR-reverse line blot (RLB) method was used to screen for pathogens in a total of 554 Ixodes ricinus ticks collected from all provinces of Austria. These pathogens belong to the genera Borrelia , Rickettsiae , Anaplasma / Ehrlichia (including " Candidatus Neoehrlichia"), Babesia , and Coxiella The pathogens with the highest detected prevalence were spirochetes of the Borrelia burgdorferi sensu lato complex, in 142 ticks (25.6%). Borrelia afzelii (80/142) was the most frequently detected species, followed by Borrelia burgdorferi sensu stricto (38/142) and Borrelia valaisiana (36/142). Borrelia garinii/Borrelia bavariensis , Borrelia lusitaniae , and Borrelia spielmanii were found in 28 ticks, 5 ticks, and 1 tick, respectively. Rickettsia spp. were detected in 93 ticks (16.8%): R. helvetica (39/93), R. raoultii (38/93), R. monacensis (2/93), and R. slovaca (1/93). Thirteen Rickettsia samples remain uncharacterized. " Candidatus Neoehrlichia mikurensis," Babesia spp. ( B. venatorum , B. divergens , B. microti ), and Anaplasma phagocytophilum were found in 4.5%, 2.7%, and 0.7%, respectively. Coxiella burnetii was not detected. Multiple microorganisms were detected in 40 ticks (7.2%), and the cooccurrence of Babesia spp. and " Candidatus Neoehrlichia mikurensis" showed a significant positive correlation. We also compared different PCR-RLBs for detection of Borrelia burgdorferi sensu lato and Rickettsia spp. and showed that different detection approaches provide highly diverse results, indicating that analysis of environmental samples remains challenging. IMPORTANCE This study determined the wide spectrum of tick-borne bacterial and protozoal pathogens that can be encountered in Austria. Surveillance of (putative) pathogenic microorganisms occurring in the environment is of medical importance, especially when those agents can be transmitted by ticks and cause disease. The
Tann, Cally J; Nkurunziza, Peter; Nakakeeto, Margaret; Oweka, James; Kurinczuk, Jennifer J; Were, Jackson; Nyombi, Natasha; Hughes, Peter; Willey, Barbara A; Elliott, Alison M; Robertson, Nicola J; Klein, Nigel; Harris, Kathryn A
2014-01-01
In neonatal encephalopathy (NE), infectious co-morbidity is difficult to diagnose accurately, but may increase the vulnerability of the developing brain to hypoxia-ischemia. We developed a novel panel of species-specific real-time PCR assays to identify bloodstream pathogens amongst newborns with and without NE in Uganda. Multiplex real-time PCR assays for important neonatal bloodstream pathogens (gram positive and gram negative bacteria, cytomegalovirus (CMV), herpes simplex virus(HSV) and P. falciparum) were performed on whole blood taken from 202 encephalopathic and 101 control infants. Automated blood culture (BACTEC) was performed for all cases and unwell controls. Prevalence of pathogenic bacterial species amongst infants with NE was 3.6%, 6.9% and 8.9%, with culture, PCR and both tests in combination, respectively. More encephalopathic infants than controls had pathogenic bacterial species detected (8.9%vs2.0%, p = 0.028) using culture and PCR in combination. PCR detected bacteremia in 11 culture negative encephalopathic infants (3 Group B Streptococcus, 1 Group A Streptococcus, 1 Staphylococcus aureus and 6 Enterobacteriacae). Coagulase negative staphylococcus, frequently detected by PCR amongst case and control infants, was considered a contaminant. Prevalence of CMV, HSV and malaria amongst cases was low (1.5%, 0.5% and 0.5%, respectively). This real-time PCR panel detected more bacteremia than culture alone and provides a novel tool for detection of neonatal bloodstream pathogens that may be applied across a range of clinical situations and settings. Significantly more encephalopathic infants than controls had pathogenic bacterial species detected suggesting that infection may be an important risk factor for NE in this setting.
Directory of Open Access Journals (Sweden)
Cally J Tann
Full Text Available In neonatal encephalopathy (NE, infectious co-morbidity is difficult to diagnose accurately, but may increase the vulnerability of the developing brain to hypoxia-ischemia. We developed a novel panel of species-specific real-time PCR assays to identify bloodstream pathogens amongst newborns with and without NE in Uganda.Multiplex real-time PCR assays for important neonatal bloodstream pathogens (gram positive and gram negative bacteria, cytomegalovirus (CMV, herpes simplex virus(HSV and P. falciparum were performed on whole blood taken from 202 encephalopathic and 101 control infants. Automated blood culture (BACTEC was performed for all cases and unwell controls.Prevalence of pathogenic bacterial species amongst infants with NE was 3.6%, 6.9% and 8.9%, with culture, PCR and both tests in combination, respectively. More encephalopathic infants than controls had pathogenic bacterial species detected (8.9%vs2.0%, p = 0.028 using culture and PCR in combination. PCR detected bacteremia in 11 culture negative encephalopathic infants (3 Group B Streptococcus, 1 Group A Streptococcus, 1 Staphylococcus aureus and 6 Enterobacteriacae. Coagulase negative staphylococcus, frequently detected by PCR amongst case and control infants, was considered a contaminant. Prevalence of CMV, HSV and malaria amongst cases was low (1.5%, 0.5% and 0.5%, respectively.This real-time PCR panel detected more bacteremia than culture alone and provides a novel tool for detection of neonatal bloodstream pathogens that may be applied across a range of clinical situations and settings. Significantly more encephalopathic infants than controls had pathogenic bacterial species detected suggesting that infection may be an important risk factor for NE in this setting.
Fox, Karen A; Rouse, Natalie M; Huyvaert, Kathryn P; Griffin, Karen A; Killion, Halcyon J; Jennings-Gaines, Jessica; Edwards, William H; Quackenbush, Sandra L; Miller, Michael W
2015-01-01
Bighorn sheep (Ovis canadensis) sinus tumors are hyperplastic to neoplastic, predominantly stromal masses of the paranasal sinuses that expand the sinus lining and obstruct the sinus cavities. Obstruction of the sinus cavities and disruption of normal sinus lining anatomy may interfere with clearance of bacterial pathogens from the upper respiratory tract. To examine this possibility, we explored whether the presence of sinus tumor features (tumor score) affected the likelihood of detecting potentially pathogenic bacteria from upper respiratory sinus lining tissues in bighorn sheep. We developed or used existing PCR assays for the detection of leukotoxigenic Pasteurellaceae and Mycoplasma ovipneumoniae in sinus lining tissues collected from 97 bighorn sheep in Colorado, US from 2009 to 2012. With the use of logistic regression analyses we found that tumor score was a good predictor of the probability of detecting potentially pathogenic bacteria in sinus lining tissues; we were more likely to detect potentially pathogenic bacteria from samples with high tumor scores. These findings add to our understanding of possible mechanisms for the maintenance and shedding of bacterial agents from the upper respiratory tracts of bighorn sheep.
Viršek, Manca Kovač; Lovšin, Marija Nika; Koren, Špela; Kržan, Andrej; Peterlin, Monika
2017-12-15
Microplastics is widespread in the marine environment where it can cause numerous negative effects. It can provide space for the growth of organisms and serves as a vector for the long distance transfer of marine microorganisms. In this study, we examined the sea surface concentrations of microplastics in the North Adriatic and characterized bacterial communities living on the microplastics. DNA from microplastics particles was isolated by three different methods, followed by PCR amplification of 16S rDNA, clone libraries preparation and phylogenetic analysis. 28 bacterial species were identified on the microplastics particles including Aeromonas spp. and hydrocarbon-degrading bacterial species. Based on the 16S rDNA sequences the pathogenic fish bacteria Aeromonas salmonicida was identified for the first time on microplastics. Because A. salmonicida is responsible for illnesses in fish, it is crucial to get answers if and how microplastics pollution is responsible for spreading of diseases. Copyright © 2017 Elsevier Ltd. All rights reserved.
Ernstsen, Christina L; Login, Frédéric H; Jensen, Helene H; Nørregaard, Rikke; Møller-Jensen, Jakob; Nejsum, Lene N
2017-10-01
Quantification of intracellular bacterial colonies is useful in strategies directed against bacterial attachment, subsequent cellular invasion and intracellular proliferation. An automated, high-throughput microscopy-method was established to quantify the number and size of intracellular bacterial colonies in infected host cells (Detection and quantification of intracellular bacterial colonies by automated, high-throughput microscopy, Ernstsen et al., 2017 [1]). The infected cells were imaged with a 10× objective and number of intracellular bacterial colonies, their size distribution and the number of cell nuclei were automatically quantified using a spot detection-tool. The spot detection-output was exported to Excel, where data analysis was performed. In this article, micrographs and spot detection data are made available to facilitate implementation of the method.
DETECTION OF BACTERIAL SMALL TRANSCRIPTS FROM RNA-SEQ DATA: A COMPARATIVE ASSESSMENT.
Peña-Castillo, Lourdes; Grüell, Marc; Mulligan, Martin E; Lang, Andrew S
2016-01-01
Small non-coding RNAs (sRNAs) are regulatory RNA molecules that have been identified in a multitude of bacterial species and shown to control numerous cellular processes through various regulatory mechanisms. In the last decade, next generation RNA sequencing (RNA-seq) has been used for the genome-wide detection of bacterial sRNAs. Here we describe sRNA-Detect, a novel approach to identify expressed small transcripts from prokaryotic RNA-seq data. Using RNA-seq data from three bacterial species and two sequencing platforms, we performed a comparative assessment of five computational approaches for the detection of small transcripts. We demonstrate that sRNA-Detect improves upon current standalone computational approaches for identifying novel small transcripts in bacteria.
International Nuclear Information System (INIS)
Nurul Najian, A.B.; Engku Nur Syafirah, E.A.R.; Ismail, Nabilah; Mohamed, Maizan; Yean, Chan Yean
2016-01-01
In recent years extensive numbers of molecular diagnostic methods have been developed to meet the need of point-of-care devices. Efforts have been made towards producing rapid, simple and inexpensive DNA tests, especially in the diagnostics field. We report on the development of a label-based lateral flow dipstick for the rapid and simple detection of multiplex loop-mediated isothermal amplification (m-LAMP) amplicons. A label-based m-LAMP lateral flow dipstick assay was developed for the simultaneous detection of target DNA template and a LAMP internal control. This biosensor operates through a label based system, in which probe-hybridization and the additional incubation step are eliminated. We demonstrated this m-LAMP assay by detecting pathogenic Leptospira, which causes the re-emerging disease Leptospirosis. The lateral flow dipstick was developed to detect of three targets, the LAMP target amplicon, the LAMP internal control amplicon and a chromatography control. Three lines appeared on the dipstick, indicating positive results for all representative pathogenic Leptospira species, whereas two lines appeared, indicating negative results, for other bacterial species. The specificity of this biosensor assay was 100% when it was tested with 13 representative pathogenic Leptospira species, 2 intermediate Leptospira species, 1 non-pathogenic Leptospira species and 28 other bacteria species. This study found that this DNA biosensor was able to detect DNA at concentrations as low as 3.95 × 10 −1 genomic equivalent ml −1 . An integrated m-LAMP and label-based lateral flow dipstick was successfully developed, promising simple and rapid visual detection in clinical diagnostics and serving as a point-of-care device. - Highlights: • We develop multiplex LAMP label-based lateral flow dipstick biosensor for detection of pathogenic Leptospira. • We design primers for multiplex LAMP targeting the conserved LipL32 gene of pathogenic Leptospira and LAMP internal
Energy Technology Data Exchange (ETDEWEB)
Nurul Najian, A.B.; Engku Nur Syafirah, E.A.R.; Ismail, Nabilah [Department of Medical Microbiology & Parasitology, School of Medical Sciences, Health Campus, Universiti Sains Malaysia, 16150 Kubang Kerian, Kelantan (Malaysia); Mohamed, Maizan [Faculty of Veterinary Medicine, Universiti Malaysia Kelantan, City Campus, Pengkalan Chepa, Locked Bag 36, 16100 Kota Bharu, Kelantan (Malaysia); Yean, Chan Yean, E-mail: yeancyn@yahoo.com [Department of Medical Microbiology & Parasitology, School of Medical Sciences, Health Campus, Universiti Sains Malaysia, 16150 Kubang Kerian, Kelantan (Malaysia); Institute for Research in Molecular Medicine (INFORMM), Health Campus, Universiti Sains Malaysia, 16150 Kubang Kerian, Kelantan (Malaysia)
2016-01-15
In recent years extensive numbers of molecular diagnostic methods have been developed to meet the need of point-of-care devices. Efforts have been made towards producing rapid, simple and inexpensive DNA tests, especially in the diagnostics field. We report on the development of a label-based lateral flow dipstick for the rapid and simple detection of multiplex loop-mediated isothermal amplification (m-LAMP) amplicons. A label-based m-LAMP lateral flow dipstick assay was developed for the simultaneous detection of target DNA template and a LAMP internal control. This biosensor operates through a label based system, in which probe-hybridization and the additional incubation step are eliminated. We demonstrated this m-LAMP assay by detecting pathogenic Leptospira, which causes the re-emerging disease Leptospirosis. The lateral flow dipstick was developed to detect of three targets, the LAMP target amplicon, the LAMP internal control amplicon and a chromatography control. Three lines appeared on the dipstick, indicating positive results for all representative pathogenic Leptospira species, whereas two lines appeared, indicating negative results, for other bacterial species. The specificity of this biosensor assay was 100% when it was tested with 13 representative pathogenic Leptospira species, 2 intermediate Leptospira species, 1 non-pathogenic Leptospira species and 28 other bacteria species. This study found that this DNA biosensor was able to detect DNA at concentrations as low as 3.95 × 10{sup −1} genomic equivalent ml{sup −1}. An integrated m-LAMP and label-based lateral flow dipstick was successfully developed, promising simple and rapid visual detection in clinical diagnostics and serving as a point-of-care device. - Highlights: • We develop multiplex LAMP label-based lateral flow dipstick biosensor for detection of pathogenic Leptospira. • We design primers for multiplex LAMP targeting the conserved LipL32 gene of pathogenic Leptospira and LAMP
Directory of Open Access Journals (Sweden)
Boknam Jung
2013-12-01
Full Text Available The ascomycete fungus Fusarium graminearum is a major causal agent for Fusarium head blight in cereals and produces mycotoxins such as trichothecenes and zearalenone. Isolation of the fungal strains from air or cereals can be hampered by various other airborne fungal pathogens and saprophytic fungi. In this study, we developed a selective medium specific to F. graminearum using toxoflavin produced by the bacterial pathogen Burkholderia glumae. F. graminearum was resistant to toxoflavin, while other fungi were sensitive to this toxin. Supplementing toxoflavin into medium enhanced the isolation of F. graminearum from rice grains by suppressing the growth of saprophytic fungal species. In addition, a medium with or without toxoflavin exposed to wheat fields for 1 h had 84% or 25%, respectively, of colonies identified as F. graminearum. This selection medium provides an efficient tool for isolating F. graminearum, and can be adopted by research groups working on genetics and disease forecasting.
Molecular evidence for bacterial and protozoan pathogens in hard ticks from Romania.
Ionita, Mariana; Mitrea, Ioan Liviu; Pfister, Kurt; Hamel, Dietmar; Silaghi, Cornelia
2013-09-01
The aim of the present study was to provide a preliminary insight into the diversity of tick-borne pathogens circulating at the domestic host-tick interface in Romania. For this, feeding and questing ticks were analyzed by real-time polymerase chain reaction (PCR) for the presence of Anaplasma phagocytophilum, Anaplasma platys, Ehrlichia canis, Borrelia burgdorferi sensu latu, and by PCR and subsequent sequencing for Rickettsia spp., Babesia spp. and Theileria spp. A total of 382 ticks, encompassing 5 species from 4 genera, were collected in April-July 2010 from different areas of Romania; of them, 40 were questing ticks and the remainder was collected from naturally infested cattle, sheep, goats, horses or dogs. Tick species analyzed included Ixodes ricinus, Dermacentor marginatus, Hyalomma marginatum, Rhipicephalus bursa, and Rhipicephalus sanguineus. Four rickettsiae of the spotted fever group of zoonotic concern were identified for the first time in Romania: Rickettsia monacensis and Rickettsia helvetica in I. ricinus, and Rickettsia slovaca and Rickettsia raoultii in D. marginatus. Other zoonotic pathogens such as A. phagocytophilum, Borrelia afzelii, and Babesia microti were found in I. ricinus. Pathogens of veterinary importance were also identified, including Theileria equi in H. marginatum, Babesia occultans in D. marginatus and H. marginatum, Theileria orientalis/sergenti/buffeli-group in I. ricinus and in H. marginatum and E. canis in R. sanguineus. These findings show a wide distribution of very diverse bacterial and protozoan pathogens at the domestic host-tick interface in Romania, with the potential of causing both animal and human diseases. Copyright © 2013 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Maaike evan Agtmaal
2015-07-01
Full Text Available There is increasing evidence that microbial volatiles (VOCs play an important role in natural suppression of soil-borne diseases, but little is known on the factors that influence production of suppressing VOCs. In the current study we examined whether a stress-induced change in soil microbial community composition would affect the production by soils of VOCs suppressing the plant-pathogenic oomycete Pythium. Using pyrosequencing of 16S ribosomal gene fragments we compared the composition of bacterial communities in sandy soils that had been exposed to anaerobic disinfestation (AD, a treatment used to kill harmful soil organisms, with the composition in untreated soils. Three months after the AD treatment had been finished, there was still a clear legacy effect of the former anaerobic stress on bacterial community composition with a strong increase in relative abundance of the phylum Bacteroidetes and a significant decrease of the phyla Acidobacteria, Planctomycetes, Nitrospirae, Chloroflexi and Chlorobi. This change in bacterial community composition coincided with loss of production of Pythium suppressing soil volatiles (VOCs and of suppression of Pythium impacts on Hyacinth root development. One year later, the composition of the bacterial community in the AD soils was reflecting that of the untreated soils. In addition, both production of Pythium-suppressing VOCs and suppression of Pythium in Hyacinth bioassays had returned to the levels of the untreated soil. GC/MS analysis identified several VOCs, among which compounds known to be antifungal, that were produced in the untreated soils but not in the AD soils. These compounds were again produced 15 months after the AD treatment. Our data indicate that soils exposed to a drastic stress can temporarily lose pathogen suppressive characteristics and that both loss and return of these suppressive characteristics coincides with shifts in the soil bacterial community composition. Our data are
Inhibition of Fungal Pathogens across Genotypes and Temperatures by Amphibian Skin Bacteria
Directory of Open Access Journals (Sweden)
Carly R. Muletz-Wolz
2017-08-01
Full Text Available Symbiotic bacteria may dampen the impacts of infectious diseases on hosts by inhibiting pathogen growth. However, our understanding of the generality of pathogen inhibition by different bacterial taxa across pathogen genotypes and environmental conditions is limited. Bacterial inhibitory properties are of particular interest for the amphibian-killing fungal pathogens (Batrachochytrium dendrobatidis and Batrachochytrium salamandrivorans, for which probiotic applications as conservation strategies have been proposed. We quantified the inhibition strength of five putatively B. dendrobatidis-inhibitory bacteria isolated from woodland salamander skin against six Batrachochytrium genotypes at two temperatures (12 and 18°C. We selected six genotypes from across the Batrachochytrium phylogeny: B. salamandrivorans, B. dendrobatidis-Brazil and four genotypes of the B. dendrobatidis Global Panzootic Lineage (GPL1: JEL647, JEL404; GPL2: SRS810, JEL423. We performed 96-well plate challenge assays in a full factorial design. We detected a Batrachochytrium genotype by temperature interaction on bacterial inhibition score for all bacteria, indicating that bacteria vary in ability to inhibit Batrachochytrium depending on pathogen genotype and temperature. Acinetobacter rhizosphaerae moderately inhibited B. salamandrivorans at both temperatures (μ = 46–53%, but not any B. dendrobatidis genotypes. Chryseobacterium sp. inhibited three Batrachochytrium genotypes at both temperatures (μ = 5–71%. Pseudomonas sp. strain 1 inhibited all Batrachochytrium genotypes at 12°C and four Batrachochytrium genotypes at 18°C (μ = 5–100%. Pseudomonas sp. strain 2 and Stenotrophomonas sp. moderately to strongly inhibited all six Batrachochytrium genotypes at both temperatures (μ = 57–100%. All bacteria consistently inhibited B. salamandrivorans. Using cluster analysis of inhibition scores, we found that more closely related Batrachochytrium genotypes grouped together
Langiano, E; Atrei, P; La Torre, G; De Vito, E; Ricciardi, G
2002-01-01
The presence of bacterial food pathogens was evaluated in 154 food samples collected from supermarkets and butchers in the city of Cassino (South-Central Italy). Food pathogens were identified in 17.5% of the total food samples. In the raw meat samples, 24.6% tested positives for Listeria monocytogenes, 4.3% for Salmonella and 2.9% for Escherichia coli O157. Y. enterocolitica, only investigated in pork meat, was identified in 7.4% of the samples. In poultry, L. monocytogenes was identified in 55% of the samples.
Lu, Hoang D.; Yang, Shirley S.; Wilson, Brian K.; McManus, Simon A.; Chen, Christopher V. H.-H.; Prud'homme, Robert K.
2017-04-01
Antimicrobial resistance is a healthcare problem of increasing significance, and there is increasing interest in developing new tools to address bacterial infections. Bacteria-targeting nanoparticles hold promise to improve drug efficacy, compliance, and safety. In addition, nanoparticles can also be used for novel applications, such as bacterial imaging or bioseperations. We here present the use of a scalable block-copolymer-directed self-assembly process, Flash NanoPrecipitation, to form zinc(II)-bis(dipicolylamine) modified nanoparticles that bind to both Gram-positive and Gram-negative bacteria with specificity. Particles have tunable surface ligand densities that change particle avidity and binding efficacy. A variety of materials can be encapsulated into the core of the particles, such as optical dyes or iron oxide colloids, to produce imageable and magnetically active bacterial targeting constructs. As a proof-of-concept, these particles are used to bind and separate bacteria from solution in a magnetic column. Magnetic manipulation and separation would translate to a platform for pathogen identification or removal. These magnetic and targeted nanoparticles enable new methods to address bacterial infections.
Kang, In Jeong; Kang, Mi-Hyung; Noh, Tae-Hwan; Shim, Hyeong Kwon; Shin, Dong Bum; Heu, Suggi
2016-01-01
Burkholderia glumae (bacterial grain rot), Xanthomonas oryzae pv. oryzae (bacterial leaf blight), and Acidovorax avenae subsp. avenae (bacterial brown stripe) are major seedborne pathogens of rice. Based on the 16S and 23S rDNA sequences for A. avenae subsp. avenae and B. glumae, and transposase A gene sequence for X. oryzae pv. oryzae, three sets of primers had been designed to produce 402 bp for B. glumae, 490 bp for X. oryzae, and 290 bp for A. avenae subsp. avenae with the 63°C as an opti...
Host-pathogen interactions: A cholera surveillance system
Energy Technology Data Exchange (ETDEWEB)
Wright, Aaron T.
2016-02-22
Bacterial pathogen-secreted proteases may play a key role in inhibiting a potentially widespread host-pathogen interaction. Activity-based protein profiling enabled the identification of a major Vibrio cholerae serine protease that limits the ability of a host-derived intestinal lectin to bind to the bacterial pathogen in vivo.
High Throughput Sequencing for Detection of Foodborne Pathogens
Directory of Open Access Journals (Sweden)
Camilla Sekse
2017-10-01
Full Text Available High-throughput sequencing (HTS is becoming the state-of-the-art technology for typing of microbial isolates, especially in clinical samples. Yet, its application is still in its infancy for monitoring and outbreak investigations of foods. Here we review the published literature, covering not only bacterial but also viral and Eukaryote food pathogens, to assess the status and potential of HTS implementation to inform stakeholders, improve food safety and reduce outbreak impacts. The developments in sequencing technology and bioinformatics have outpaced the capacity to analyze and interpret the sequence data. The influence of sample processing, nucleic acid extraction and purification, harmonized protocols for generation and interpretation of data, and properly annotated and curated reference databases including non-pathogenic “natural” strains are other major obstacles to the realization of the full potential of HTS in analytical food surveillance, epidemiological and outbreak investigations, and in complementing preventive approaches for the control and management of foodborne pathogens. Despite significant obstacles, the achieved progress in capacity and broadening of the application range over the last decade is impressive and unprecedented, as illustrated with the chosen examples from the literature. Large consortia, often with broad international participation, are making coordinated efforts to cope with many of the mentioned obstacles. Further rapid progress can therefore be prospected for the next decade.
Ruedl, C; Frühwirth, M; Wick, G; Wolf, H
1994-01-01
We have investigated the local immune response of the BALB/c mouse respiratory tract after oral immunization with a bacterial lysate of seven common respiratory pathogens. After two immunization on five consecutive days, we examined the immunoglobulin (immunoglobulin G [IgG], IgM, and IgA) secretion rates of cells isolated from the lungs and compared them with those of spleen cells of orally immunized and nonimmunized animals by using a new test system based on time-resolved fluorescence. The...
Question: In the absence of antibiotic use within pastured poultry production, what are potential environmental variables that drive the antimicrobial sensitivity patterns of bacterial foodborne pathogens isolated from these flocks? Purpose: The objective of this study is to examine environmental f...
Plant-phytopathogen interactions: bacterial responses to environmental and plant stimuli.
Leonard, Simon; Hommais, Florence; Nasser, William; Reverchon, Sylvie
2017-05-01
Plant pathogenic bacteria attack numerous agricultural crops, causing devastating effects on plant productivity and yield. They survive in diverse environments, both in plants, as pathogens, and also outside their hosts as saprophytes. Hence, they are confronted with numerous changing environmental parameters. During infection, plant pathogens have to deal with stressful conditions, such as acidic, oxidative and osmotic stresses; anaerobiosis; plant defenses; and contact with antimicrobial compounds. These adverse conditions can reduce bacterial survival and compromise disease initiation and propagation. Successful bacterial plant pathogens must detect potential hosts and also coordinate their possibly conflicting programs for survival and virulence. Consequently, these bacteria have a strong and finely tuned capacity for sensing and responding to environmental and plant stimuli. This review summarizes our current knowledge of the signals and genetic circuits that affect survival and virulence factor expression in three important and well-studied plant pathogenic bacteria with wide host ranges and the capacity for long-term environmental survival. These are: Ralstonia solanacerarum, a vascular pathogen that causes wilt disease; Agrobacterium tumefaciens, a biotrophic tumorigenic pathogen responsible for crown gall disease and Dickeya, a brute force apoplastic pathogen responsible for soft-rot disease. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Reuben B Vercoe
2013-04-01
Full Text Available In prokaryotes, clustered regularly interspaced short palindromic repeats (CRISPRs and their associated (Cas proteins constitute a defence system against bacteriophages and plasmids. CRISPR/Cas systems acquire short spacer sequences from foreign genetic elements and incorporate these into their CRISPR arrays, generating a memory of past invaders. Defence is provided by short non-coding RNAs that guide Cas proteins to cleave complementary nucleic acids. While most spacers are acquired from phages and plasmids, there are examples of spacers that match genes elsewhere in the host bacterial chromosome. In Pectobacterium atrosepticum the type I-F CRISPR/Cas system has acquired a self-complementary spacer that perfectly matches a protospacer target in a horizontally acquired island (HAI2 involved in plant pathogenicity. Given the paucity of experimental data about CRISPR/Cas-mediated chromosomal targeting, we examined this process by developing a tightly controlled system. Chromosomal targeting was highly toxic via targeting of DNA and resulted in growth inhibition and cellular filamentation. The toxic phenotype was avoided by mutations in the cas operon, the CRISPR repeats, the protospacer target, and protospacer-adjacent motif (PAM beside the target. Indeed, the natural self-targeting spacer was non-toxic due to a single nucleotide mutation adjacent to the target in the PAM sequence. Furthermore, we show that chromosomal targeting can result in large-scale genomic alterations, including the remodelling or deletion of entire pre-existing pathogenicity islands. These features can be engineered for the targeted deletion of large regions of bacterial chromosomes. In conclusion, in DNA-targeting CRISPR/Cas systems, chromosomal interference is deleterious by causing DNA damage and providing a strong selective pressure for genome alterations, which may have consequences for bacterial evolution and pathogenicity.
Vercoe, Reuben B.; Chang, James T.; Dy, Ron L.; Taylor, Corinda; Gristwood, Tamzin; Clulow, James S.; Richter, Corinna; Przybilski, Rita; Pitman, Andrew R.; Fineran, Peter C.
2013-01-01
In prokaryotes, clustered regularly interspaced short palindromic repeats (CRISPRs) and their associated (Cas) proteins constitute a defence system against bacteriophages and plasmids. CRISPR/Cas systems acquire short spacer sequences from foreign genetic elements and incorporate these into their CRISPR arrays, generating a memory of past invaders. Defence is provided by short non-coding RNAs that guide Cas proteins to cleave complementary nucleic acids. While most spacers are acquired from phages and plasmids, there are examples of spacers that match genes elsewhere in the host bacterial chromosome. In Pectobacterium atrosepticum the type I-F CRISPR/Cas system has acquired a self-complementary spacer that perfectly matches a protospacer target in a horizontally acquired island (HAI2) involved in plant pathogenicity. Given the paucity of experimental data about CRISPR/Cas–mediated chromosomal targeting, we examined this process by developing a tightly controlled system. Chromosomal targeting was highly toxic via targeting of DNA and resulted in growth inhibition and cellular filamentation. The toxic phenotype was avoided by mutations in the cas operon, the CRISPR repeats, the protospacer target, and protospacer-adjacent motif (PAM) beside the target. Indeed, the natural self-targeting spacer was non-toxic due to a single nucleotide mutation adjacent to the target in the PAM sequence. Furthermore, we show that chromosomal targeting can result in large-scale genomic alterations, including the remodelling or deletion of entire pre-existing pathogenicity islands. These features can be engineered for the targeted deletion of large regions of bacterial chromosomes. In conclusion, in DNA–targeting CRISPR/Cas systems, chromosomal interference is deleterious by causing DNA damage and providing a strong selective pressure for genome alterations, which may have consequences for bacterial evolution and pathogenicity. PMID:23637624
9 CFR 113.36 - Detection of pathogens by the chicken inoculation test.
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Detection of pathogens by the chicken... REQUIREMENTS Standard Procedures § 113.36 Detection of pathogens by the chicken inoculation test. The test for...,000 doses. (b) At least 25 healthy susceptible young chickens, properly identified and obtained from...
Whitten, Miranda M A; Davies, Charlotte E; Kim, Anita; Tlusty, Michael; Wootton, Emma C; Chistoserdov, Andrei; Rowley, Andrew F
2014-06-01
Diseases of lobster shells have a significant impact on fishing industries but the risk of disease transmission between different lobster species has yet to be properly investigated. This study compared bacterial biofilm communities from American (Homarus americanus) and European lobsters (H. gammarus), to assess both healthy cuticle and diseased cuticle during lesion formation. Culture-independent molecular techniques revealed diversity in the bacterial communities of cuticle biofilms both within and between the two lobster species, and identified three bacterial genera associated with shell lesions plus two putative beneficial bacterial species (detected exclusively in healthy cuticle or healing damaged cuticle). In an experimental aquarium shared between American and European lobsters, heterospecific transmission of potentially pathogenic bacteria appeared to be very limited; however, the claws of European lobsters were more likely to develop lesions when reared in the presence of American lobsters. Aquarium biofilms were also examined but revealed no candidate pathogens for environmental transmission. Aquimarina sp. 'homaria' (a potential pathogen associated with a severe epizootic form of shell disease) was detected at a much higher prevalence among American than European lobsters, but its presence correlated more with exacerbation of existing lesions rather than with lesion initiation. © 2014 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.
Rapid detection and identification of pathogenic microorganisms naturally occurring during food processing are important in developing intervention and verification strategies. In the poultry industry, contamination of poultry meat with foodborne pathogens (especially, Salmonella and Campylobacter) ...
Epidemiology of bacterial pathogens associated with infectious diarrhea in Djibouti.
Mikhail, I A; Fox, E; Haberberger, R L; Ahmed, M H; Abbatte, E A
1990-01-01
During a survey examining the causes of diarrhea in the East African country of Djibouti, 140 bacterial pathogens were recovered from 209 diarrheal and 100 control stools. The following pathogens were isolated at comparable frequencies from both diarrheal and control stools: enteroadherent Escherichia coli (EAEC) (10.6 versus 13%), enterotoxigenic E. coli (ETEC) (11 versus 10%), enteropathogenic E. coli (EPEC) (7.7 versus 12%), Salmonella spp. (2.9 versus 3%), and Campylobacter jejuni-C. coli (3.3 versus 5%). Surprisingly, the EAEC strains isolated did not correspond to well-recognized EPEC serogroups. No Yersinia spp., enteroinvasive E. coli, or enterohemorrhagic E. coli were isolated during the course of this study. Only the following two genera were recovered from diarrheal stools exclusively: Shigella spp. (7.7%) and Aeromonas hydrophila group organisms (3.3%). Shigella flexneri was the most common Shigella species isolated. Patients with Shigella species were of a higher average age than were controls (27 versus 13 years), while subjects with Campylobacter or Salmonella species belonged to younger age groups (2.6 and 1.6 years, respectively). Salmonella cases were more often in females. Shigella diarrhea was associated with fecal blood or mucus and leukocytes. ETEC was not associated with nausea or vomiting. Anorexia, weight loss, and fever were associated with the isolation of Salmonella and Aeromonas species. EAEC, ETEC, EPEC, and Shigella species were resistant to most drugs used for treating diarrhea in Africa, while the antibiotic most active against all bacteria tested was norfloxacin. We conclude that in Djibouti in 1989, Shigella and Aeromonas species must be considered as potential pathogens whenever they are isolated from diarrheal stools and that norfloxacin should be considered the drug of choice in adults for treating severe shigellosis and for diarrhea prophylaxis in travelers. PMID:2351738
DEFF Research Database (Denmark)
Zou, S Betty; Roy, Hervé; Ibba, Michael
2012-01-01
Bacterial pathogens detect and integrate multiple environmental signals to coordinate appropriate changes in gene expression including the selective expression of virulence factors, changes to metabolism and the activation of stress response systems. Mutations that abolish the ability of the path......Bacterial pathogens detect and integrate multiple environmental signals to coordinate appropriate changes in gene expression including the selective expression of virulence factors, changes to metabolism and the activation of stress response systems. Mutations that abolish the ability...... our laboratory and others now suggests that EF-P, previously thought to be essential, instead plays an ancillary role in translation by regulating the synthesis of a relatively limited subset of proteins. Other observations suggest that the eukaryotic homolog of EF-P, eIF5A, may illicit similar...
Pereira, Rui P A; Peplies, Jörg; Höfle, Manfred G; Brettar, Ingrid
2017-10-01
Cooling towers are the major source of outbreaks of legionellosis in Europe and worldwide. These outbreaks are mostly associated with Legionella species, primarily L. pneumophila, and its surveillance in cooling tower environments is of high relevance to public health. In this study, a combined NGS-based approach was used to study the whole bacterial community, specific waterborne and water-based bacterial pathogens, especially Legionella species, targeting the 16S rRNA gene. This approach was applied to water from a cooling tower obtained by monthly sampling during two years. The studied cooling tower was an open circuit cooling tower with lamellar cooling situated in Braunschweig, Germany. A highly diverse bacterial community was observed with 808 genera including 25 potentially pathogenic taxa using universal 16S rRNA primers. Sphingomonas and Legionella were the most abundant pathogenic genera. By applying genus-specific primers for Legionella, a diverse community with 85 phylotypes, and a representative core community with substantial temporal heterogeneity was observed. A high percentage of sequences (65%) could not be affiliated to an acknowledged species. L. pneumophila was part of the core community and the most abundant Legionella species reinforcing the importance of cooling towers as its environmental reservoir. Major temperature shifts (>10 °C) were the key environmental factor triggering the reduction or dominance of the Legionella species in the Legionella community dynamics. In addition, interventions by chlorine dioxide had a strong impact on the Legionella community composition but not on the whole bacterial community. Overall, the presented results demonstrated the value of a combined NGS approach for the molecular monitoring and surveillance of health related pathogens in man-made freshwater systems. Copyright © 2017 Elsevier Ltd. All rights reserved.
Reptiles as Reservoirs of Bacterial Infections: Real Threat or Methodological Bias?
Zancolli, Giulia; Mahsberg, Dieter; Sickel, Wiebke; Keller, Alexander
2015-10-01
Bacterial infections secondary to snakebites and human pathogens (e.g., Salmonella) have been linked to the oral microbiota of snakes and pet reptiles. Based on culture-dependent studies, it is speculated that snakes' oral microbiota reflects the fecal flora of their ingested preys. However, cultured-based techniques have been shown to be limited as they fail to identify unculturable microorganisms which represent the vast majority of the microbial diversity. Here, we used culture-independent high-throughput sequencing to identify reptile-associated pathogens and to characterize the oral microbial community of five snakes, one gecko, and two terrapins. Few potential human pathogens were detected at extremely low frequencies. Moreover, bacterial taxa represented in the snake's oral cavity bore little resemblance to their preys' fecal microbiota. Overall, we found distinct, highly diverse microbial communities with consistent, species-specific patterns contrary to previous culture-based studies. Our study does not support the widely held assumption that reptiles' oral cavity acts as pathogen reservoir and provides important insights for future research.
Molecular Survey of Bacterial Zoonotic Agents in Bats from the Country of Georgia (Caucasus.
Directory of Open Access Journals (Sweden)
Ying Bai
Full Text Available Bats are important reservoirs for many zoonotic pathogens. However, no surveys of bacterial pathogens in bats have been performed in the Caucasus region. To understand the occurrence and distribution of bacterial infections in these mammals, 218 bats belonging to eight species collected from four regions of Georgia were examined for Bartonella, Brucella, Leptospira, and Yersinia using molecular approaches. Bartonella DNA was detected in 77 (35% bats from all eight species and was distributed in all four regions. The prevalence ranged 6-50% per bat species. The Bartonella DNA represented 25 unique genetic variants that clustered into 21 lineages. Brucella DNA was detected in two Miniopterus schreibersii bats and in two Myotis blythii bats, all of which were from Imereti (west-central region. Leptospira DNA was detected in 25 (13% bats that included four M. schreibersii bats and 21 M. blythii bats collected from two regions. The Leptospira sequences represented five genetic variants with one of them being closely related to the zoonotic pathogen L. interrogans (98.6% genetic identity. No Yersinia DNA was detected in the bats. Mixed infections were observed in several cases. One M. blythii bat and one M. schreibersii bat were co-infected with Bartonella, Brucella, and Leptospira; one M. blythii bat and one M. schreibersii bat were co-infected with Bartonella and Brucella; 15 M. blythii bats and three M. schreibersii bats were co-infected with Bartonella and Leptospira. Our results suggest that bats in Georgia are exposed to multiple bacterial infections. Further studies are needed to evaluate pathogenicity of these agents to bats and their zoonotic potential.
Fungal Innate Immunity Induced by Bacterial Microbe-Associated Molecular Patterns (MAMPs
Directory of Open Access Journals (Sweden)
Simon Ipcho
2016-06-01
Full Text Available Plants and animals detect bacterial presence through Microbe-Associated Molecular Patterns (MAMPs which induce an innate immune response. The field of fungal–bacterial interaction at the molecular level is still in its infancy and little is known about MAMPs and their detection by fungi. Exposing Fusarium graminearum to bacterial MAMPs led to increased fungal membrane hyperpolarization, a putative defense response, and a range of transcriptional responses. The fungus reacted with a different transcript profile to each of the three tested MAMPs, although a core set of genes related to energy generation, transport, amino acid production, secondary metabolism, and especially iron uptake were detected for all three. Half of the genes related to iron uptake were predicted MirA type transporters that potentially take up bacterial siderophores. These quick responses can be viewed as a preparation for further interactions with beneficial or pathogenic bacteria, and constitute a fungal innate immune response with similarities to those of plants and animals.
LENUS (Irish Health Repository)
O'Leary, James
2009-11-01
The EntericBio system uses a multiplex PCR assay for the simultaneous detection of Campylobacter spp., Salmonella enterica, Shigella spp., and Escherichia coli O157 from feces. It combines overnight broth enrichment with PCR amplification and detection by hybridization. An evaluation of this system was conducted by comparing the results obtained with the system with those obtained by routine culture, supplemented with alternative PCR detection methods. In a study of 773 samples, routine culture and the EntericBio system yielded 94.6 and 92.4% negative results, respectively. Forty-two samples had positive results by culture, and all of these were positive with the EntericBio system. This system detected an additional 17 positive samples (Campylobacter spp., n = 12; Shigella spp., n = 1; E. coli O157, n = 4), but the results for 5 samples (Campylobacter spp., n = 2; Shigella spp., n = 1; E. coli O157, n = 2) could not be confirmed. The target for Shigella spp. detected by the EntericBio system is the ipaH gene, and the molecular indication of the presence of Shigella spp. was investigated by sequence analysis, which confirmed that the ipaH gene was present in a Klebsiella pneumoniae isolate from the patient. The sensitivity, specificity, positive predictive value, and negative predictive value were 100%, 99.3%, 91.5%, and 100%, respectively. Turnaround times were significantly reduced with the EntericBio system, and a result was available between 24 and 32 h after receipt of the sample in the laboratory. In addition, the amount of laboratory waste was significantly reduced by use of this system. In summary, the EntericBio system proved convenient to use, more sensitive than the conventional culture used in this study, and highly specific; and it generated results significantly faster than routine culture for the pathogens tested.
Morris, Cindy E; Barny, Marie-Anne; Berge, Odile; Kinkel, Linda L; Lacroix, Christelle
2017-02-01
Methods to ensure the health of crops owe their efficacy to the extent to which we understand the ecology and biology of environmental microorganisms and the conditions under which their interactions with plants lead to losses in crop quality or yield. However, in the pursuit of this knowledge, notions of the ecology of plant-pathogenic microorganisms have been reduced to a plant-centric and agro-centric focus. With increasing global change, i.e. changes that encompass not only climate, but also biodiversity, the geographical distribution of biomes, human demographic and socio-economic adaptations and land use, new plant health problems will emerge via a range of processes influenced by these changes. Hence, knowledge of the ecology of plant pathogens will play an increasingly important role in the anticipation and response to disease emergence. Here, we present our opinion on the major challenges facing the study of the ecology of plant-pathogenic bacteria. We argue that the discovery of markedly novel insights into the ecology of plant-pathogenic bacteria is most likely to happen within a framework of more extensive scales of space, time and biotic interactions than those that currently guide much of the research on these bacteria. This will set a context that is more propitious for the discovery of unsuspected drivers of the survival and diversification of plant-pathogenic bacteria and of the factors most critical for disease emergence, and will set the foundation for new approaches to the sustainable management of plant health. We describe the contextual background of, justification for and specific research questions with regard to the following challenges: Development of terminology to describe plant-bacterial relationships in terms of bacterial fitness. Definition of the full scope of the environments in which plant-pathogenic bacteria reside or survive. Delineation of pertinent phylogenetic contours of plant-pathogenic bacteria and naming of strains
Deoxyribonucleic Acid Probes Analyses for the Detection of Periodontal Pathogens.
Al Yahfoufi, Zoubeida; Hadchiti, Wahib; Berberi, Antoine
2015-09-01
In clinical microbiology several techniques have been used to identify bacteria. Recently, Deoxyribonucleic acid (DNA)-based techniques have been introduced to detect human microbial pathogens in periodontal diseases. Deoxyribonucleic acid probes can detect bacteria at a very low level if we compared with the culture methods. These probes have shown rapid and cost-effective microbial diagnosis, good sensitivity and specificity for some periodontal pathogens in cases of severe periodontitis. Eighty-five patients were recruited for the study. Twenty-one subjects ranging between 22 and 48 years of age fulfilled the inclusion and exclusion criteria. Seventy-eight samples became available for DNA probe analysis from the deepest pockets in each quadrant. All 21 patients showed positive results for Prevotella intermedia; also, Prevotella gingivalis was identified in 19 subjects, Aggregatibacter actinomycetemcomitans in 6 subjects. P. intermedia was diagnosed positive in 82% of the subgingival samples taken, 79% for P. gingivalis, and 23% for A. actinomycetemcomitans. This study shows a high frequency of putative periodontal pathogens by using DNA probe technology, which is semi-quantitative in this study. Deoxyribonucleic acid probes can detect bacteria at very low level about 10(3) which is below the detection level of culture methods. The detection threshold of cultural methods. The three types of bacteria can be detected rapidly with high sensitivity by using the DNA probe by general practitioners, and thus can help in the diagnosis process and the treatment.
Gold Nanoparticles: An Efficient Antimicrobial Agent against Enteric Bacterial Human Pathogen
Directory of Open Access Journals (Sweden)
Shahzadi Shamaila
2016-04-01
Full Text Available Enteric bacterial human pathogens, i.e., Escherichia coli, Staphylococcus aureus, Bacillus subtilis and Klebsiella pneumoniae, are the major cause of diarrheal infections in children and adults. Their structure badly affects the human immune system. It is important to explore new antibacterial agents instead of antibiotics for treatment. This project is an attempt to explain how gold nanoparticles affect these bacteria. We investigated the important role of the mean particle size, and the inhibition of a bacterium is dose-dependent. Ultra Violet (UV-visible spectroscopy revealed the size of chemically synthesized gold nanoparticle as 6–40 nm. Atomic force microscopy (AFM analysis confirmed the size and X-ray diffractometry (XRD analysis determined the polycrystalline nature of gold nanoparticles. The present findings explained how gold nanoparticles lyse Gram-negative and Gram-positive bacteria.
Liu, Yu; Zhou, Haibo; Hu, Ziwei; Yu, Guangxia; Yang, Danting; Zhao, Jinshun
2017-08-15
Rapid, accurate detection of pathogen bacteria is a highly topical research area for the sake of food safety and public health. Surface-enhanced Raman scattering (SERS) is being considered as a powerful and attractive technique for pathogen bacteria detection, due to its sensitivity, high speed, comparatively low cost, multiplexing ability and portability. This contribution aims to give a comprehensive overview of SERS as a technique for rapid detection of pathogen bacteria based on label and label-free strategies. A brief tutorial on SERS is given first of all. Then we summarize the recent trends and developments of label and label-free based SERS applied to detection of pathogen bacteria, including the relatively complete interpretation of SERS spectra. In addition, multifunctional SERS platforms for pathogen bacteria in matrix are discussed as well. Furthermore, an outlook of the work done and a perspective on the future directions of SERS as a reliable tool for real-time pathogen bacteria detection are given. Copyright © 2017 Elsevier B.V. All rights reserved.
Pires, Frederico Ribeiro; Franco, Andréia Christine Bonotto Farias; Gilio, Alfredo Elias; Troster, Eduardo Juan
2017-01-01
ABSTRACT Objective To measure the role of enterovirus detection in cerebrospinal fluid compared with the Bacterial Meningitis Score in children with meningitis. Methods A retrospective cohort based on analysis of medical records of pediatric patients diagnosed as meningitis, seen at a private and tertiary hospital in São Paulo, Brazil, between 2011 and 2014. Excluded were patients with critical illness, purpura, ventricular shunt or recent neurosurgery, immunosuppression, concomitant bacterial infection requiring parenteral antibiotic therapy, and those who received antibiotics 72 hours before lumbar puncture. Results The study included 503 patients. Sixty-four patients were excluded and 94 were not submitted to all tests for analysis. Of the remaining 345 patients, 7 were in the Bacterial Meningitis Group and 338 in the Aseptic Meningitis Group. There was no statistical difference between the groups. In the Bacterial Meningitis Score analysis, of the 338 patients with possible aseptic meningitis (negative cultures), 121 of them had one or more points in the Bacterial Meningitis Score, with sensitivity of 100%, specificity of 64.2%, and negative predictive value of 100%. Of the 121 patients with positive Bacterial Meningitis Score, 71% (86 patients) had a positive enterovirus detection in cerebrospinal fluid. Conclusion Enterovirus detection in cerebrospinal fluid was effective to differentiate bacterial from viral meningitis. When the test was analyzed together with the Bacterial Meningitis Score, specificity was higher when compared to Bacterial Meningitis Score alone. PMID:28767914
Directory of Open Access Journals (Sweden)
Carson J Butler
Full Text Available Respiratory disease has been a persistent problem for the recovery of bighorn sheep (Ovis canadensis, but has uncertain etiology. The disease has been attributed to several bacterial pathogens including Mycoplasma ovipneumoniae and Pasteurellaceae pathogens belonging to the Mannheimia, Bibersteinia, and Pasteurella genera. We estimated detection probability for these pathogens using protocols with diagnostic tests offered by a fee-for-service laboratory and not offered by a fee-for-service laboratory. We conducted 2861 diagnostic tests on swab samples collected from 476 bighorn sheep captured across Montana and Wyoming to gain inferences regarding detection probability, pathogen prevalence, and the power of different sampling methodologies to detect pathogens in bighorn sheep populations. Estimated detection probability using fee-for-service protocols was less than 0.50 for all Pasteurellaceae and 0.73 for Mycoplasma ovipneumoniae. Non-fee-for-service Pasteurellaceae protocols had higher detection probabilities, but no single protocol increased detection probability of all Pasteurellaceae pathogens to greater than 0.50. At least one protocol resulted in an estimated detection probability of 0.80 for each pathogen except Mannheimia haemolytica, for which the highest detection probability was 0.45. In general, the power to detect Pasteurellaceae pathogens at low prevalence in populations was low unless many animals were sampled or replicate samples were collected per animal. Imperfect detection also resulted in low precision when estimating prevalence for any pathogen. Low and variable detection probabilities for respiratory pathogens using live-sampling protocols may lead to inaccurate conclusions regarding pathogen community dynamics and causes of bighorn sheep respiratory disease epizootics. We recommend that agencies collect multiples samples per animal for Pasteurellaceae detection, and one sample for Mycoplasma ovipneumoniae detection from
Engel, Philipp; Salzburger, Walter; Liesch, Marius; Chang, Chao-Chin; Maruyama, Soichi; Lanz, Christa; Calteau, Alexandra; Lajus, Aurélie; Médigue, Claudine; Schuster, Stephan C; Dehio, Christoph
2011-02-10
Adaptive radiation is the rapid origination of multiple species from a single ancestor as the result of concurrent adaptation to disparate environments. This fundamental evolutionary process is considered to be responsible for the genesis of a great portion of the diversity of life. Bacteria have evolved enormous biological diversity by exploiting an exceptional range of environments, yet diversification of bacteria via adaptive radiation has been documented in a few cases only and the underlying molecular mechanisms are largely unknown. Here we show a compelling example of adaptive radiation in pathogenic bacteria and reveal their genetic basis. Our evolutionary genomic analyses of the α-proteobacterial genus Bartonella uncover two parallel adaptive radiations within these host-restricted mammalian pathogens. We identify a horizontally-acquired protein secretion system, which has evolved to target specific bacterial effector proteins into host cells as the evolutionary key innovation triggering these parallel adaptive radiations. We show that the functional versatility and adaptive potential of the VirB type IV secretion system (T4SS), and thereby translocated Bartonella effector proteins (Beps), evolved in parallel in the two lineages prior to their radiations. Independent chromosomal fixation of the virB operon and consecutive rounds of lineage-specific bep gene duplications followed by their functional diversification characterize these parallel evolutionary trajectories. Whereas most Beps maintained their ancestral domain constitution, strikingly, a novel type of effector protein emerged convergently in both lineages. This resulted in similar arrays of host cell-targeted effector proteins in the two lineages of Bartonella as the basis of their independent radiation. The parallel molecular evolution of the VirB/Bep system displays a striking example of a key innovation involved in independent adaptive processes and the emergence of bacterial pathogens
Yu, Mengqun; Wang, Hong; Fu, Fei; Li, Linyao; Li, Jing; Li, Gan; Song, Yang; Swihart, Mark T; Song, Erqun
2017-04-04
The effective monitoring, identification, and quantification of pathogenic bacteria is essential for addressing serious public health issues. In this study, we present a universal and facile one-step strategy for sensitive and selective detection of pathogenic bacteria using a dual-molecular affinity-based Förster (fluorescence) resonance energy transfer (FRET) platform based on the recognition of bacterial cell walls by antibiotic and aptamer molecules, respectively. As a proof of concept, Vancomycin (Van) and a nucleic acid aptamer were employed in a model dual-recognition scheme for detecting Staphylococcus aureus (Staph. aureus). Within 30 min, by using Van-functionalized gold nanoclusters and aptamer-modified gold nanoparticles as the energy donor and acceptor, respectively, the FRET signal shows a linear variation with the concentration of Staph. aureus in the range from 20 to 10 8 cfu/mL with a detection limit of 10 cfu/mL. Other nontarget bacteria showed negative results, demonstrating the good specificity of the approach. When employed to assay Staph. aureus in real samples, the dual-recognition FRET strategy showed recoveries from 99.00% to the 109.75% with relative standard derivations (RSDs) less than 4%. This establishes a universal detection platform for sensitive, specific, and simple pathogenic bacteria detection, which could have great impact in the fields of food/public safety monitoring and infectious disease diagnosis.
Directory of Open Access Journals (Sweden)
Bing Zhang
Full Text Available Bacterial pathogenicity and antibiotic resistance are of concern for environmental safety and public health. Accumulating evidence suggests that wastewater treatment plants (WWTPs are as an important sink and source of pathogens and antibiotic resistance genes (ARGs. Virulence genes (encoding virulence factors are good indicators for bacterial pathogenic potentials. To achieve a comprehensive understanding of bacterial pathogenic potentials and antibiotic resistance in WWTPs, bacterial virulence genes and ARGs in 19 WWTPs covering a majority of latitudinal zones of China were surveyed by using GeoChip 4.2. A total of 1610 genes covering 13 virulence factors and 1903 genes belonging to 11 ARG families were detected respectively. The bacterial virulence genes exhibited significant spatial distribution patterns of a latitudinal biodiversity gradient and a distance-decay relationship across China. Moreover, virulence genes tended to coexist with ARGs as shown by their strongly positive associations. In addition, key environmental factors shaping the overall virulence gene structure were identified. This study profiles the occurrence, composition and distribution of virulence genes and ARGs in current WWTPs in China, and uncovers spatial patterns and important environmental variables shaping their structure, which may provide the basis for further studies of bacterial virulence factors and antibiotic resistance in WWTPs.
Thin-layer chromatographic technique for rapid detection of bacterial phospholipases.
Legakis, N J; Papavassiliou, J
1975-11-01
Silica gel thin-layer chromatography was employed to detect lecithinase activity induced from bacterial resting cell preparations induced from bacterial resting cell preparations incubated at 37 C for 4 h in the presence of purified egg yolk lecithin. Bacillus subtilis, Bacillus cereus, Serratia marcescens, and Pseudomonas aeruginosa hydrolyzed lecithin with the formation of free fatty acids as the sole lipid-soluble product. In none of the Escherichia coli and Citrobacter freundii strains tested could lecithinase activity be detected. Four among eight strains of Enterobacter aerogenes and one among 12 strains of Proteus tested produced negligible amounts of free fatty acid.
Göhler, André; Hetzer, Adrian; Holtfreter, Birte; Geisel, Marie Henrike; Schmidt, Carsten Oliver; Steinmetz, Ivo; Kocher, Thomas
2014-01-01
Periodontitis is a multi-microbial oral infection with high prevalence among adults. Putative oral pathogens are commonly found in periodontally diseased individuals. However, these organisms can be also detected in the oral cavity of healthy subjects. This leads to the hypothesis, that alterations in the proportion of these organisms relative to the total amount of oral microorganisms, namely their abundance, rather than their simple presence might be important in the transition from health to disease. Therefore, we developed a quantitative molecular method to determine the abundance of various oral microorganisms and the portion of bacterial and archaeal nucleic acid relative to the total nucleic acid extracted from individual samples. We applied quantitative real-time PCRs targeting single-copy genes of periodontal bacteria and 16S-rRNA genes of Bacteria and Archaea. Testing tongue scrapings of 88 matched pairs of periodontally diseased and healthy subjects revealed a significantly higher abundance of P. gingivalis and a higher total bacterial abundance in diseased subjects. In fully adjusted models the risk of being periodontally diseased was significantly higher in subjects with high P. gingivalis and total bacterial abundance. Interestingly, we found that moderate abundances of A. actinomycetemcomitans were associated with reduced risk for periodontal disease compared to subjects with low abundances, whereas for high abundances, this protective effect leveled off. Moderate archaeal abundances were health associated compared to subjects with low abundances. In conclusion, our methodological approach unraveled associations of the oral flora with periodontal disease, which would have gone undetected if only qualitative data had been determined. PMID:25029268
Sulakvelidze, Alexander
2013-10-01
Bacteriophages (also called 'phages') are viruses that kill bacteria. They are arguably the oldest (3 billion years old, by some estimates) and most ubiquitous (total number estimated to be 10(30) -10(32) ) known organisms on Earth. Phages play a key role in maintaining microbial balance in every ecosystem where bacteria exist, and they are part of the normal microflora of all fresh, unprocessed foods. Interest in various practical applications of bacteriophages has been gaining momentum recently, with perhaps the most attention focused on using them to improve food safety. That approach, called 'phage biocontrol', typically includes three main types of applications: (i) using phages to treat domesticated livestock in order to reduce their intestinal colonization with, and shedding of, specific bacterial pathogens; (ii) treatments for decontaminating inanimate surfaces in food-processing facilities and other food establishments, so that foods processed on those surfaces are not cross-contaminated with the targeted pathogens; and (iii) post-harvest treatments involving direct applications of phages onto the harvested foods. This mini-review primarily focuses on the last type of intervention, which has been gaining the most momentum recently. Indeed, the results of recent studies dealing with improving food safety, and several recent regulatory approvals of various commercial phage preparations developed for post-harvest food safety applications, strongly support the idea that lytic phages may provide a safe, environmentally-friendly, and effective approach for significantly reducing contamination of various foods with foodborne bacterial pathogens. However, some important technical and nontechnical problems may need to be addressed before phage biocontrol protocols can become an integral part of routine food safety intervention strategies implemented by food industries in the USA. © 2013 Society of Chemical Industry.
Medrano, E G; Grauke, L J; Stanford, R L; Thompson, T E
2017-08-01
To determine whether Venturia effusa, the causative fungal agent of pecan scab, harbours a bacterial symbiont. Venturia effusa isolates were maintained on potato dextrose agar amended with antibiotics (chloramphenicol (100 μg ml -1 ) and tetracycline 100 (μg ml -1 )). Genomic DNA extracted from mycelia was used to target eubacterial 16S rDNA. A 1·4-kbp PCR amplified product using 16S rDNA degenerate primers was cloned, sequenced and found to have 99% identities with Actinobacteria representatives. Attempts to culture the detected bacteria apart from the fungus following agitation and fungal cell lysis were unsuccessful using standard bacteriological media under either aerobic or anaerobic conditions. Fungal structures were visualized using scanning electron microscopy and putative bacterial formations associated with the fungal mycelia were observed. Fluorescence in situ hybridization using 16S rDNA oligonucleotides illuminated spores and portions of the hyphae. This is the first report to provide both molecular microbiological and microscopic evidence in support of the hypothesis that V. effusa harbours endosymbiotic bacteria. Findings from this research contribute fundamental information regarding the biology of the fungus that may ultimately lead to identifying a target of the pathogen for use in management and/or avoidance strategies. Published 2017. This article is a U.S. Government work and is in the public domain in the USA.
9 CFR 113.37 - Detection of pathogens by the chicken embryo inoculation test.
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Detection of pathogens by the chicken... VECTORS STANDARD REQUIREMENTS Standard Procedures § 113.37 Detection of pathogens by the chicken embryo...-serum mixture shall be inoculated into each of at least 20 fully susceptible chicken embryos. (1) Twenty...
Lievens, B.; Thomma, B.P.H.J.
2005-01-01
The failure to adequately identify plant pathogens from culture-based morphological techniques has led to the development of culture-independent molecular approaches. Increasingly, diagnostic laboratories are pursuing fast routine methods that provide reliable identification, sensitive detection,
Bacterial Prostatitis: Bacterial Virulence, Clinical Outcomes, and New Directions.
Krieger, John N; Thumbikat, Praveen
2016-02-01
Four prostatitis syndromes are recognized clinically: acute bacterial prostatitis, chronic bacterial prostatitis, chronic prostatitis/chronic pelvic pain syndrome, and asymptomatic prostatitis. Because Escherichia coli represents the most common cause of bacterial prostatitis, we investigated the importance of bacterial virulence factors and antimicrobial resistance in E. coli strains causing prostatitis and the potential association of these characteristics with clinical outcomes. A structured literature review revealed that we have limited understanding of the virulence-associated characteristics of E. coli causing acute prostatitis. Therefore, we completed a comprehensive microbiological and molecular investigation of a unique strain collection isolated from healthy young men. We also considered new data from an animal model system suggesting certain E. coli might prove important in the etiology of chronic prostatitis/chronic pelvic pain syndrome. Our human data suggest that E. coli needs multiple pathogenicity-associated traits to overcome anatomic and immune responses in healthy young men without urological risk factors. The phylogenetic background and accumulation of an exceptional repertoire of extraintestinal pathogenic virulence-associated genes indicate that these E. coli strains belong to a highly virulent subset of uropathogenic variants. In contrast, antibiotic resistance confers little added advantage to E. coli strains in these healthy outpatients. Our animal model data also suggest that certain pathogenic E. coli may be important in the etiology of chronic prostatitis/chronic pelvic pain syndrome through mechanisms that are dependent on the host genetic background and the virulence of the bacterial strain.
Abubakar, I; Irvine, L; Aldus, C F; Wyatt, G M; Fordham, R; Schelenz, S; Shepstone, L; Howe, A; Peck, M; Hunter, P R
2007-09-01
analysis, on many occasions the rapid test outperforms culture, detecting additional 'truly' positive cases of food-borne illness. The significance of these additional positives requires further investigation. Economic modelling suggests that adoption of rapid tests in combination with routine culture is unlikely to be cost-effective, however, as the cost of rapid technologies decreases; total replacement with rapid technologies may be feasible. Despite the relatively poor quality of reporting of studies evaluating rapid detection methods, the reviewed evidence shows that PCR for Campylobacter, Salmonella and E. coli O157 is potentially very successful in identifying pathogens, possibly detecting more than the number currently reported using culture. Less is known about the benefits of testing for B. cereus, C. perfringens and S. aureus. Further investigation is needed on how clinical outcomes may be altered if test results are available more quickly and at a greater precision than in the current practice of bacterial culture.
Li, Jun; Tai, Cui; Deng, Zixin; Zhong, Weihong; He, Yongqun; Ou, Hong-Yu
2017-01-10
VRprofile is a Web server that facilitates rapid investigation of virulence and antibiotic resistance genes, as well as extends these trait transfer-related genetic contexts, in newly sequenced pathogenic bacterial genomes. The used backend database MobilomeDB was firstly built on sets of known gene cluster loci of bacterial type III/IV/VI/VII secretion systems and mobile genetic elements, including integrative and conjugative elements, prophages, class I integrons, IS elements and pathogenicity/antibiotic resistance islands. VRprofile is thus able to co-localize the homologs of these conserved gene clusters using HMMer or BLASTp searches. With the integration of the homologous gene cluster search module with a sequence composition module, VRprofile has exhibited better performance for island-like region predictions than the other widely used methods. In addition, VRprofile also provides an integrated Web interface for aligning and visualizing identified gene clusters with MobilomeDB-archived gene clusters, or a variety set of bacterial genomes. VRprofile might contribute to meet the increasing demands of re-annotations of bacterial variable regions, and aid in the real-time definitions of disease-relevant gene clusters in pathogenic bacteria of interest. VRprofile is freely available at http://bioinfo-mml.sjtu.edu.cn/VRprofile. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Molecular Detection and Characterization of Tick-borne Pathogens in Dogs and Ticks from Nigeria
Kamani, Joshua; Baneth, Gad; Mumcuoglu, Kosta Y.; Waziri, Ndadilnasiya E.; Eyal, Osnat; Guthmann, Yifat; Harrus, Shimon
2013-01-01
Background Only limited information is currently available on the prevalence of vector borne and zoonotic pathogens in dogs and ticks in Nigeria. The aim of this study was to use molecular techniques to detect and characterize vector borne pathogens in dogs and ticks from Nigeria. Methodology/Principal Findings Blood samples and ticks (Rhipicephalus sanguineus, Rhipicephalus turanicus and Heamaphysalis leachi) collected from 181 dogs from Nigeria were molecularly screened for human and animal vector-borne pathogens by PCR and sequencing. DNA of Hepatozoon canis (41.4%), Ehrlichia canis (12.7%), Rickettsia spp. (8.8%), Babesia rossi (6.6%), Anaplasma platys (6.6%), Babesia vogeli (0.6%) and Theileria sp. (0.6%) was detected in the blood samples. DNA of E. canis (23.7%), H. canis (21.1%), Rickettsia spp. (10.5%), Candidatus Neoehrlichia mikurensis (5.3%) and A. platys (1.9%) was detected in 258 ticks collected from 42 of the 181 dogs. Co- infections with two pathogens were present in 37% of the dogs examined and one dog was co-infected with 3 pathogens. DNA of Rickettsia conorii israelensis was detected in one dog and Rhipicephalus sanguineus tick. DNA of another human pathogen, Candidatus N. mikurensis was detected in Rhipicephalus sanguineus and Heamaphysalis leachi ticks, and is the first description of Candidatus N. mikurensis in Africa. The Theileria sp. DNA detected in a local dog in this study had 98% sequence identity to Theileria ovis from sheep. Conclusions/Significance The results of this study indicate that human and animal pathogens are abundant in dogs and their ticks in Nigeria and portray the potential high risk of human exposure to infection with these agents. PMID:23505591
Molecular detection and characterization of tick-borne pathogens in dogs and ticks from Nigeria.
Directory of Open Access Journals (Sweden)
Joshua Kamani
Full Text Available BACKGROUND: Only limited information is currently available on the prevalence of vector borne and zoonotic pathogens in dogs and ticks in Nigeria. The aim of this study was to use molecular techniques to detect and characterize vector borne pathogens in dogs and ticks from Nigeria. METHODOLOGY/PRINCIPAL FINDINGS: Blood samples and ticks (Rhipicephalus sanguineus, Rhipicephalus turanicus and Heamaphysalis leachi collected from 181 dogs from Nigeria were molecularly screened for human and animal vector-borne pathogens by PCR and sequencing. DNA of Hepatozoon canis (41.4%, Ehrlichia canis (12.7%, Rickettsia spp. (8.8%, Babesia rossi (6.6%, Anaplasma platys (6.6%, Babesia vogeli (0.6% and Theileria sp. (0.6% was detected in the blood samples. DNA of E. canis (23.7%, H. canis (21.1%, Rickettsia spp. (10.5%, Candidatus Neoehrlichia mikurensis (5.3% and A. platys (1.9% was detected in 258 ticks collected from 42 of the 181 dogs. Co- infections with two pathogens were present in 37% of the dogs examined and one dog was co-infected with 3 pathogens. DNA of Rickettsia conorii israelensis was detected in one dog and Rhipicephalus sanguineus tick. DNA of another human pathogen, Candidatus N. mikurensis was detected in Rhipicephalus sanguineus and Heamaphysalis leachi ticks, and is the first description of Candidatus N. mikurensis in Africa. The Theileria sp. DNA detected in a local dog in this study had 98% sequence identity to Theileria ovis from sheep. CONCLUSIONS/SIGNIFICANCE: The results of this study indicate that human and animal pathogens are abundant in dogs and their ticks in Nigeria and portray the potential high risk of human exposure to infection with these agents.
Molecular Mechanisms of Bacterial Pathogenicity
Fuchs, Thilo Martin
Cautious optimism has arisen over recent decades with respect to the long struggle against bacteria, viruses, and parasites. This has been offset, however, by a fatal complacency stemming from previous successes such as the development of antimicrobial drugs, the eradication of smallpox, and global immunization programs. Infectious diseases nevertheless remain the world's leading cause of death, killing at least 17 million persons annually [61]. Diarrheal diseases caused by Vibrio cholerae or Shigella dysenteriae kill about 3 million persons every year, most of them young children: Another 4 million die of tuberculosis or tetanus. Outbreaks of diphtheria in Eastern Europe threatens the population with a disease that had previously seemed to be overcome. Efforts to control infectious diseases more comprehensively are undermined not only by socioeconomic conditions but also by the nature of the pathogenic organisms itself; some isolates of Staphylococcus aureus and Enterobacter have become so resistant to drugs by horizontal gene transfer that they are almost untreatable. In addition, the mechanism of genetic variability helps pathogens to evade the human immune system, thus compromising the development of powerful vaccines. Therefore detailed knowledge of the molecular mechanisms of microbial pathogenicity is absolutely necessary to develop new strategies against infectious diseases and thus to lower their impact on human health and social development.
Evolutionary biology of bacterial and fungal pathogens
National Research Council Canada - National Science Library
Baquero, F
2008-01-01
... and Evolutionary Dynamics of Pathogens * 21 Keith A. Crandall and Marcos Pérez-Losada II. Evolutionary Genetics of Microbial Pathogens 4. Environmental and Social Influences on Infectious Disea...
Haack, S.K.; Duris, J.W.; Fogarty, L.R.; Kolpin, D.W.; Focazio, M.J.; Furlong, E.T.; Meyer, M.T.
2009-01-01
The objective of this study was to compare fecal indicator bacteria (FIB) (fecal coliforms, Escherichia coli [EC], and enterococci [ENT]) concentrations with a wide array of typical organic wastewater chemicals and selected bacterial genes as indicators of fecal pollution in water samples collected at or near 18 surface water drinking water intakes. Genes tested included esp (indicating human-pathogenic ENT) and nine genes associated with various animal sources of shiga-toxin-producing EC (STEC). Fecal pollution was indicated by genes and/or chemicals for 14 of the 18 tested samples, with little relation to FIB standards. Of 13 samples with animal sources of STEC) were detected in eight. Only the EC eaeA gene was positively correlated with FIB concentrations. Human-source fecal pollution was indicated by the esp gene and the human pharmaceutical carbamazepine in one of the nine samples that met all FIB recreational water quality standards. Escherichia coli rfbO157 and stx2c genes, which are typically associated with cattle sources and are of potential human health significance, were detected in one sample in the absence of tested chemicals. Chemical and gene-based indicators of fecal contamination may be present even when FIB standards are met, and some may, unlike FIB, indicate potential sources. Application of multiple water quality indicators with variable environmental persistence and fate may yield greater confidence in fecal pollution assessment and may inform remediation decisions. Copyright ?? 2009 by the American Society of Agronomy, Crop Science Society of America, and Soil Science Society of America. All rights reserved.
Single-Walled Carbon Nanotubes as Fluorescence Biosensors for Pathogen Recognition in Water Systems
Directory of Open Access Journals (Sweden)
Venkata K. K. Upadhyayula
2008-01-01
Full Text Available The possibility of using single-walled carbon nanotubes (SWCNTs aggregates as fluorescence sensors for pathogen recognition in drinking water treatment applications has been studied. Batch adsorption study is conducted to adsorb large concentrations of Staphylococcus aureus aureus SH 1000 and Escherichia coli pKV-11 on single-walled carbon nanotubes. Subsequently the immobilized bacteria are detected with confocal microscopy by coating the nanotubes with fluorescence emitting antibodies. The Freundlich adsorption equilibrium constant (k for S.aureus and E.coli determined from batch adsorption study was found to be 9×108 and 2×108 ml/g, respectively. The visualization of bacterial cells adsorbed on fluorescently modified carbon nanotubes is also clearly seen. The results indicate that hydrophobic single-walled carbon nanotubes have excellent bacterial adsorption capacity and fluorescent detection capability. This is an important advancement in designing fluorescence biosensors for pathogen recognition in water systems.
M13 virus based detection of bacterial infections in living hosts.
Bardhan, Neelkanth M; Ghosh, Debadyuti; Belcher, Angela M
2014-08-01
We report a first method for using M13 bacteriophage as a multifunctional scaffold for optically imaging bacterial infections in vivo. We demonstrate that M13 virus conjugated with hundreds of dye molecules (M13-Dye) can target and distinguish pathogenic infections of F-pili expressing and F-negative strains of E. coli. Further, in order to tune this M13-Dye complex suitable for targeting other strains of bacteria, we have used a 1-step reaction for creating an anti-bacterial antibody-M13-Dye probe. As an example, we show anti-S. aureus-M13-Dye able to target and image infections of S. aureus in living hosts, with a 3.7× increase in fluorescence over background. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Detection of pathogens from periodontal lesions
Directory of Open Access Journals (Sweden)
Malheiros Veruska de João
2004-01-01
Full Text Available OBJECTIVE: To comparatively detect A. actinomycetemcomitans and F. nucleatum from periodontal and healthy sites. METHODS: Subgingival clinical samples from 50 periodontitis adult patients and 50 healthy subjects were analyzed. Both organisms were isolated using a trypticase soy agar-bacitracin-vancomycin (TSBV medium and detected by PCR. Conventional biochemical tests were used for bacteria identification. RESULTS: A. actinomycetemcomitans and F. nucleatum were isolated in 18% and 20% of the patients, respectively, and in 2% and 24% of healthy subjects. Among A. actinomycetemcomitans isolates, biotype II was the most prevalent. Primer pair AA was 100% sensitive in the detection of A. actinomycetemcomitans from both subject groups. Primers ASH and FU were also 100% sensitive to detect this organism in healthy subject samples. Primer pair FN5047 was more sensitive to detect F. nucleatum in patients or in healthy samples than primer 5059S. Primers ASH and 5059S were more specific in the detection of A. actinomycetemcomitans and F. nucleatum, respectively, in patients and in healthy subject samples. CONCLUSIONS: PCR is an effective tool for detecting periodontal pathogens in subgingival samples, providing a faster and safer diagnostic tool of periodontal diseases. The method's sensitivity and specificity is conditioned by the choice of the set of primers used.
A portable cell-based optical detection device for rapid detection of Listeria and Bacillus toxins
Banerjee, Pratik; Banada, Padmapriya P.; Rickus, Jenna L.; Morgan, Mark T.; Bhunia, Arun K.
2005-11-01
A mammalian cell-based optical biosensor was built to detect pathogenic Listeria and Bacillus species. This sensor measures the ability of the pathogens to infect and induce cytotoxicity on hybrid lymphocyte cell line (Ped-2E9) resulting in the release of alkaline phosphatase (ALP) that can be detected optically using a portable spectrophotometer. The Ped-2E9 cells were encapsulated in collagen gel matrices and grown in 48-well plates or in specially designed filtration tube units. Toxin preparations or bacterial cells were introduced and ALP release was assayed after 3-5 h. Pathogenic L. monocytogenes strains or the listeriolysin toxins preparation showed cytotoxicity ranging from 55% - 92%. Toxin preparations (~20 μg/ml) from B. cereus strains showed 24 - 98% cytotoxicity. In contrast, a non-pathogenic L. innocua (F4247) and a B. substilis induced only 2% and 8% cytotoxicity, respectively. This cell-based detection device demonstrates its ability to detect the presence of pathogenic Listeria and Bacillus species and can potentially be used onsite for food safety or in biosecurity application.
Rapid detection, characterization, and enumeration of foodborne pathogens
DEFF Research Database (Denmark)
Hoorfar, Jeffrey
2011-01-01
. The present review discusses the reasons for the increasing interest in rapid methods; current developments in the field, the research needs, and the future trends. The advent of biotechnology has introduced new technologies that led to the emergence of rapid diagnostic methods and altered food testing...... of rapid methods is for fast screening of large number of samples, where most of them are expected to be test-negative, leading to faster product release for sale. This has been the main strength of rapid methods such as real-time Polymerase Chain Reaction (PCR). Enrichment PCR, where a primary culture...... of pathogen in a contaminated product. Another key issue is automation, where the key drivers are miniaturization and multiple testing, which mean that not only one instrument is flexible enough to test for many pathogens but also many pathogens can be detected with one test. The review is mainly based...
Pathogen detection by the polymerase chain reaction
Energy Technology Data Exchange (ETDEWEB)
Chitpatima, S T; Settachan, D; Pornsilpatip, J; Visawapoka, U [Pramongkutklao College of Medicine, Bangkok (Thailand). Molecular Biology Lab.; Dvorak, D R [Amersham International Ltd., Singapore (Singapore)
1994-05-01
In recent years, significant advances in the knowledge of DNA and its make up have led to the development of a powerful technique called polymerase chain reaction (PCR). Since the advent of PCR, laboratories around the globe have been exploiting this technology to bridge limitations or to overcome common problems encountered in molecular biology techniques. In addition, this technology has been employed successfully in diagnostic and basic scientific research and development. The true potentials of this technology is realized in early detection of pathogens and genetic abnormalities. In this paper two PCR protocols are described. The first is for detection of HIV-1 DNA in blood, the other for detection of rabies virus RNA in brain cells. 6 refs, 3 figs, 1 tab.
A historical review of the key bacterial and viral pathogens of Scottish wild fish.
Wallace, I S; McKay, P; Murray, A G
2017-12-01
Thousands of Scottish wild fish were screened for pathogens by Marine Scotland Science. A systematic review of published and unpublished data on six key pathogens (Renibacterium salmoninarum, Aeromonas salmonicida, IPNV, ISAV, SAV and VHSV) found in Scottish wild and farmed fish was undertaken. Despite many reported cases in farmed fish, there was a limited number of positive samples from Scottish wild fish, however, there was evidence for interactions between wild and farmed fish. A slightly elevated IPNV prevalence was reported in wild marine fish caught close to Atlantic salmon, Salmo salar L., farms that had undergone clinical IPN. Salmonid alphavirus was isolated from wild marine fish caught near Atlantic salmon farms with a SAV infection history. Isolations of VHSV were made from cleaner wrasse (Labridae) used on Scottish Atlantic salmon farms and VHSV was detected in local wild marine fish. However, these pathogens have been detected in wild marine fish caught remotely from aquaculture sites. These data suggest that despite the large number of samples taken, there is limited evidence for clinical disease in wild fish due to these pathogens (although BKD and furunculosis historically occurred) and they are likely to have had a minimal impact on Scottish wild fish. © 2017 Crown Copyright. Journal of Fish Diseases © 2017 John Wiley & Sons Ltd.
Sundin, George W; Castiblanco, Luisa F; Yuan, Xiaochen; Zeng, Quan; Yang, Ching-Hong
2016-12-01
Plant diseases caused by bacterial pathogens place major constraints on crop production and cause significant annual losses on a global scale. The attainment of consistent effective management of these diseases can be extremely difficult, and management potential is often affected by grower reliance on highly disease-susceptible cultivars because of consumer preferences, and by environmental conditions favouring pathogen development. New and emerging bacterial disease problems (e.g. zebra chip of potato) and established problems in new geographical regions (e.g. bacterial canker of kiwifruit in New Zealand) grab the headlines, but the list of bacterial disease problems with few effective management options is long. The ever-increasing global human population requires the continued stable production of a safe food supply with greater yields because of the shrinking areas of arable land. One major facet in the maintenance of the sustainability of crop production systems with predictable yields involves the identification and deployment of sustainable disease management solutions for bacterial diseases. In addition, the identification of novel management tactics has also come to the fore because of the increasing evolution of resistance to existing bactericides. A number of central research foci, involving basic research to identify critical pathogen targets for control, novel methodologies and methods of delivery, are emerging that will provide a strong basis for bacterial disease management into the future. Near-term solutions are desperately needed. Are there replacement materials for existing bactericides that can provide effective disease management under field conditions? Experience should inform the future. With prior knowledge of bactericide resistance issues evolving in pathogens, how will this affect the deployment of newer compounds and biological controls? Knowledge is critical. A comprehensive understanding of bacterial pathosystems is required to not
O’Ryan, Miguel; Vidal, Roberto; del Canto, Felipe; Carlos Salazar, Juan; Montero, David
2015-01-01
In Part II we discuss the following bacterial pathogens: Shigella, Salmonella (non-typhoidal), diarrheogenic E. coli (enterotoxigenic and enterohemorragic) and Campylobacter jejuni. In contrast to the enteric viruses and Vibrio cholerae discussed in Part I of this series, for the bacterial pathogens described here there is only one licensed vaccine, developed primarily for Vibrio cholerae and which provides moderate protection against enterotoxigenic E. coli (ETEC) (Dukoral®), as well as a few additional candidates in advanced stages of development for ETEC and one candidate for Shigella spp. Numerous vaccine candidates in earlier stages of development are discussed. PMID:25715096
Roine, Antti; Saviauk, Taavi; Kumpulainen, Pekka; Karjalainen, Markus; Tuokko, Antti; Aittoniemi, Janne; Vuento, Risto; Lekkala, Jukka; Lehtimäki, Terho; Tammela, Teuvo L; Oksala, Niku K J
2014-01-01
Urinary tract infection (UTI) is a common disease with significant morbidity and economic burden, accounting for a significant part of the workload in clinical microbiology laboratories. Current clinical chemisty point-of-care diagnostics rely on imperfect dipstick analysis which only provides indirect and insensitive evidence of urinary bacterial pathogens. An electronic nose (eNose) is a handheld device mimicking mammalian olfaction that potentially offers affordable and rapid analysis of samples without preparation at athmospheric pressure. In this study we demonstrate the applicability of ion mobility spectrometry (IMS) -based eNose to discriminate the most common UTI pathogens from gaseous headspace of culture plates rapidly and without sample preparation. We gathered a total of 101 culture samples containing four most common UTI bacteries: E. coli, S. saprophyticus, E. faecalis, Klebsiella spp and sterile culture plates. The samples were analyzed using ChemPro 100i device, consisting of IMS cell and six semiconductor sensors. Data analysis was conducted by linear discriminant analysis (LDA) and logistic regression (LR). The results were validated by leave-one-out and 5-fold cross validation analysis. In discrimination of sterile and bacterial samples sensitivity of 95% and specificity of 97% were achieved. The bacterial species were identified with sensitivity of 95% and specificity of 96% using eNose as compared to urine bacterial cultures. These findings strongly demonstrate the ability of our eNose to discriminate bacterial cultures and provides a proof of principle to use this method in urinanalysis of UTI.
Directory of Open Access Journals (Sweden)
Céline Langendorf
Full Text Available Although rotavirus is the leading cause of severe diarrhea among children in sub-Saharan Africa, better knowledge of circulating enteric pathogenic bacteria and their antimicrobial resistance is crucial for prevention and treatment strategies.As a part of rotavirus gastroenteritis surveillance in Maradi, Niger, we performed stool culture on a sub-population of children under 5 with moderate-to-severe diarrhea between April 2010 and March 2012. Campylobacter, Shigella and Salmonella were sought with conventional culture and biochemical methods. Shigella and Salmonella were serotyped by slide agglutination. Enteropathogenic Escherichia coli (EPEC were screened by slide agglutination with EPEC O-typing antisera and confirmed by detection of virulence genes. Antimicrobial susceptibility was determined by disk diffusion. We enrolled 4020 children, including 230 with bloody diarrhea. At least one pathogenic bacterium was found in 28.0% of children with watery diarrhea and 42.2% with bloody diarrhea. Mixed infections were found in 10.3% of children. EPEC, Salmonella and Campylobacter spp. were similarly frequent in children with watery diarrhea (11.1%, 9.2% and 11.4% respectively and Shigella spp. were the most frequent among children with bloody diarrhea (22.1%. The most frequent Shigella serogroup was S. flexneri (69/122, 56.5%. The most frequent Salmonella serotypes were Typhimurimum (71/355, 20.0%, Enteritidis (56/355, 15.8% and Corvallis (46/355, 13.0%. The majority of putative EPEC isolates was confirmed to be EPEC (90/111, 81.1%. More than half of all Enterobacteriaceae were resistant to amoxicillin and co-trimoxazole. Around 13% (46/360 Salmonella exhibited an extended-spectrum beta-lactamase phenotype.This study provides updated information on enteric bacteria diversity and antibiotic resistance in the Sahel region, where such data are scarce. Whether they are or not the causative agent of diarrhea, bacterial infections and their antibiotic
Nested polymerase chain reaction (PCR) targeting 16S rDNA for bacterial identification in empyema.
Prasad, Rajniti; Kumari, Chhaya; Das, B K; Nath, Gopal
2014-05-01
Empyema in children causes significant morbidity and mortality. However, identification of organisms is a major concern. To detect bacterial pathogens in pus specimens of children with empyema by 16S rDNA nested polymerase chain reaction (PCR) and correlate it with culture and sensitivity. Sixty-six children admitted to the paediatric ward with a diagnosis of empyema were enrolled prospectively. Aspirated pus was subjected to cytochemical examination, culture and sensitivity, and nested PCR targeting 16S rDNA using a universal eubacterial primer. Mean (SD) age was 5·8 (1·8) years (range 1-13). Analysis of aspirated pus demonstrated total leucocyte count >1000×10(6)/L, elevated protein (≧20 g/L) and decreased glucose (≤2·2 mmol/L) in 80·3%, 98·5% and 100%, respectively. Gram-positive cocci were detected in 29 (43·9%) and Gram-negative bacilli in two patients. Nested PCR for the presence of bacterial pathogens was positive in 50·0%, compared with 36·3% for culture. 16S rDNA PCR improves rates of detection of bacteria in pleural fluid, and can detect bacterial species in a single assay as well as identifying unusual and unexpected causal agents.
Castro, Felipe D; Sedman, Jacqueline; Ismail, Ashraf A; Asadishad, Bahareh; Tufenkji, Nathalie
2010-06-01
The effects of dissolved oxygen tension during bacterial growth and acclimation on the cell surface properties and biochemical composition of the bacterial pathogens Escherichia coli O157:H7 and Yersinia enterocolitica are characterized. Three experimental techniques are used in an effort to understand the influence of bacterial growth and acclimation conditions on cell surface charge and the composition of the bacterial cell: (i) electrophoretic mobility measurements; (ii) potentiometric titration; and (iii) ATR-FTIR spectroscopy. Potentiometric titration data analyzed using chemical speciation software are related to measured electrophoretic mobilities at the pH of interest. Titration of bacterial cells is used to identify the major proton-active functional groups and the overall concentration of these cell surface ligands at the cell membrane. Analysis of titration data shows notable differences between strains and conditions, confirming the appropriateness of this tool for an overall charge characterization. ATR-FTIR spectroscopy of whole cells is used to further characterize the bacterial biochemical composition and macromolecular structures that might be involved in the development of the net surficial charge of the organisms examined. The evaluation of the integrated intensities of HPO(2)(-) and carbohydrate absorption bands in the IR spectra reveals clear differences between growth protocols. Taken together, the three techniques seem to indicate that the dissolved oxygen tension during cell growth or acclimation can noticeably influence the expression of cell surface molecules and the measurable cell surface charge, though in a strain-dependent fashion.
Siembieda, Jennifer L; Miller, Woutrina A; Byrne, Barbara A; Ziccardi, Michael H; Anderson, Nancy; Chouicha, Nadira; Sandrock, Christian E; Johnson, Christine K
2011-03-15
To determine types and estimate prevalence of potentially zoonotic enteric pathogens shed by wild animals admitted to either of 2 wildlife hospitals and to characterize distribution of these pathogens and of aerobic bacteria in a hospital environment. Cross-sectional study. Fecal samples from 338 animals in 2 wildlife hospitals and environmental samples from 1 wildlife hospital. Fecal samples were collected within 24 hours of hospital admission. Environmental samples were collected from air and surfaces. Samples were tested for zoonotic pathogens via culture techniques and biochemical analyses. Prevalence of pathogen shedding was compared among species groups, ages, sexes, and seasons. Bacterial counts were determined for environmental samples. Campylobacter spp, Vibrio spp, Salmonella spp, Giardia spp, and Cryptosporidium spp (alone or in combination) were detected in 105 of 338 (31%) fecal samples. Campylobacter spp were isolated only from birds. Juvenile passerines were more likely to shed Campylobacter spp than were adults; prevalence increased among juvenile passerines during summer. Non-O1 serotypes of Vibrio cholerae were isolated from birds; during an oil-spill response, 9 of 10 seabirds screened were shedding this pathogen, which was also detected in environmental samples. Salmonella spp and Giardia spp were isolated from birds and mammals; Cryptosporidium spp were isolated from mammals only. Floors of animal rooms had higher bacterial counts than did floors with only human traffic. Potentially zoonotic enteric pathogens were identified in samples from several species admitted to wildlife hospitals, indicating potential for transmission if prevention is not practiced.
Advanced biosensors for detection of pathogens related to livestock and poultry.
Vidic, Jasmina; Manzano, Marisa; Chang, Chung-Ming; Jaffrezic-Renault, Nicole
2017-02-21
Infectious animal diseases caused by pathogenic microorganisms such as bacteria and viruses threaten the health and well-being of wildlife, livestock, and human populations, limit productivity and increase significantly economic losses to each sector. The pathogen detection is an important step for the diagnostics, successful treatment of animal infection diseases and control management in farms and field conditions. Current techniques employed to diagnose pathogens in livestock and poultry include classical plate-based methods and conventional biochemical methods as enzyme-linked immunosorbent assays (ELISA). These methods are time-consuming and frequently incapable to distinguish between low and highly pathogenic strains. Molecular techniques such as polymerase chain reaction (PCR) and real time PCR (RT-PCR) have also been proposed to be used to diagnose and identify relevant infectious disease in animals. However these DNA-based methodologies need isolated genetic materials and sophisticated instruments, being not suitable for in field analysis. Consequently, there is strong interest for developing new swift point-of-care biosensing systems for early detection of animal diseases with high sensitivity and specificity. In this review, we provide an overview of the innovative biosensing systems that can be applied for livestock pathogen detection. Different sensing strategies based on DNA receptors, glycan, aptamers and antibodies are presented. Besides devices still at development level some are validated according to standards of the World Organization for Animal Health and are commercially available. Especially, paper-based platforms proposed as an affordable, rapid and easy to perform sensing systems for implementation in field condition are included in this review.
Directory of Open Access Journals (Sweden)
Francis Hassard
2017-10-01
Full Text Available To assess fecal pollution in coastal waters, current monitoring is reliant on culture-based enumeration of bacterial indicators, which does not account for the presence of viable but non-culturable or sediment-associated micro-organisms, preventing effective quantitative microbial risk assessment (QMRA. Seasonal variability in viable but non-culturable or sediment-associated bacteria challenge the use of fecal indicator organisms (FIOs for water monitoring. We evaluated seasonal changes in FIOs and human enteric pathogen abundance in water and sediments from the Ribble and Conwy estuaries in the UK. Sediments possessed greater bacterial abundance than the overlying water column, however, key pathogenic species (Shigella spp., Campylobacter jejuni, Salmonella spp., hepatitis A virus, hepatitis E virus and norovirus GI and GII were not detected in sediments. Salmonella was detected in low levels in the Conwy water in spring/summer and norovirus GII was detected in the Ribble water in winter. The abundance of E. coli and Enterococcus spp. quantified by culture-based methods, rarely matched the abundance of these species when measured by qPCR. The discrepancy between these methods was greatest in winter at both estuaries, due to low CFU's, coupled with higher gene copies (GC. Temperature accounted for 60% the variability in bacterial abundance in water in autumn, whilst in winter salinity explained 15% of the variance. Relationships between bacterial indicators/pathogens and physicochemical variables were inconsistent in sediments, no single indicator adequately described occurrence of all bacterial indicators/pathogens. However, important variables included grain size, porosity, clay content and concentrations of Zn, K, and Al. Sediments with greater organic matter content and lower porosity harbored a greater proportion of non-culturable bacteria (including dead cells and extracellular DNA in winter. Here, we show the link between physicochemical
Prevalent bacterial species and novel phylotypes in advanced noma lesions.
Paster, B J; Falkler Jr, W A; Enwonwu, C O; Idigbe, E O; Savage, K O; Levanos, V A; Tamer, M A; Ericson, R L; Lau, C N; Dewhirst, F E
2002-06-01
The purpose of this study was to determine the bacterial diversity in advanced noma lesions using culture-independent molecular methods. 16S ribosomal DNA bacterial genes from DNA isolated from advanced noma lesions of four Nigerian children were PCR amplified with universally conserved primers and spirochetal selective primers and cloned into Escherichia coli. Partial 16S rRNA sequences of approximately 500 bases from 212 cloned inserts were used initially to determine species identity or closest relatives by comparison with sequences of known species or phylotypes. Nearly complete sequences of approximately 1,500 bases were obtained for most of the potentially novel species. A total of 67 bacterial species or phylotypes were detected, 25 of which have not yet been grown in vitro. Nineteen of the species or phylotypes, including Propionibacterium acnes, Staphylococcus spp., and the opportunistic pathogens Stenotrophomonas maltophilia and Ochrobactrum anthropi were detected in more than one subject. Other known species that were detected included Achromobacter spp., Afipia spp., Brevundimonas diminuta, Capnocytophaga spp., Cardiobacterium sp., Eikenella corrodens, Fusobacterium spp., Gemella haemoylsans, and Neisseria spp. Phylotypes that were unique to noma infections included those in the genera Eubacterium, Flavobacterium, Kocuria, Microbacterium, and Porphyromonas and the related Streptococcus salivarius and genera Sphingomonas and TREPONEMA: Since advanced noma lesions are infections open to the environment, it was not surprising to detect species not commonly associated with the oral cavity, e.g., from soil. Several species previously implicated as putative pathogens of noma, such as spirochetes and Fusobacterium spp., were detected in at least one subject. However, due to the limited number of available noma subjects, it was not possible at this time to associate specific species with the disease.
Single-Walled Carbon Nano tubes as Fluorescence Biosensors for Pathogen Recognition in Water Systems
International Nuclear Information System (INIS)
Upadhyayula, V.K.K
2008-01-01
The possibility of using single-walled carbon nanotubes (SWCNTs) aggregates as fluorescence sensors for pathogen recognition in drinking water treatment applications has been studied. Batch adsorption study is conducted to adsorb large concentrations of Staphylococcus aureus aureus SH 1000 and Escherichia coli pKV-11 on single-walled carbon nanotubes. Subsequently the immobilized bacteria are detected with confocal microscopy by coating the nanotubes with fluorescence emitting antibodies. The Freundlich adsorption equilibrium constant (k) for S.aureus and E.coli determined from batch adsorption study was found to be 9 x108 and 2 x108 ml/g, respectively. The visualization of bacterial cells adsorbed on fluorescently modified carbon nanotubes is also clearly seen. The results indicate that hydrophobic single-walled carbon nanotubes have excellent bacterial adsorption capacity and fluorescent detection capability. This is an important advancement in designing fluorescence biosensors for pathogen recognition in water systems.
Zarnowiec, Paulina; Lechowicz, Łukasz; Czerwonka, Grzegorz; Kaca, Wiesław
2015-01-01
Methods of human bacterial pathogen identification need to be fast, reliable, inexpensive, and time efficient. These requirements may be met by vibrational spectroscopic techniques. The method that is most often used for bacterial detection and identification is Fourier transform infrared spectroscopy (FTIR). It enables biochemical scans of whole bacterial cells or parts thereof at infrared frequencies (4,000-600 cm(-1)). The recorded spectra must be subsequently transformed in order to minimize data variability and to amplify the chemically-based spectral differences in order to facilitate spectra interpretation and analysis. In the next step, the transformed spectra are analyzed by data reduction tools, regression techniques, and classification methods. Chemometric analysis of FTIR spectra is a basic technique for discriminating between bacteria at the genus, species, and clonal levels. Examples of bacterial pathogen identification and methods of differentiation up to the clonal level, based on infrared spectroscopy, are presented below.
International Nuclear Information System (INIS)
Nacci, Diane; Huber, Marina; Champlin, Denise; Jayaraman, Saro; Cohen, Sarah; Gauger, Eric; Fong, Allison; Gomez-Chiarri, Marta
2009-01-01
A population of the non-migratory estuarine fish Fundulus heteroclitus (Atlantic killifish) resident to New Bedford (NB), Massachusetts, USA, an urban harbor highly contaminated with polychlorinated biphenyls (PCBs), demonstrates recently evolved tolerance to some aspects of PCB toxicity. PCB toxicology, ecological theory, and some precedence supported expectations of increased susceptibility to pathogens in NB killifish. However, laboratory bacterial challenges of the marine pathogen Vibrio harveyi to wild fish throughout the reproductive season and to their mature laboratory-raised progeny demonstrated comparable survival by NB and reference killifish, and improved survival by NB males. These results are inconsistent with hypothesized trade-offs of adaptation, and suggest that evolved tolerance in NB killifish may include mechanisms that minimize the immunosuppressive effects of PCBs. Compensatory strategies of populations persisting in highly contaminated environments provide a unique perspective for understanding the long-term ecological effects of toxic chemicals. - Killifish resident to a highly PCB-contaminated estuary survive pathogenic bacterial challenges well, suggesting their tolerance to PCB immunosuppression
Methods for detecting pathogens in the beef food chain: detecting particular pathogens
The main food-borne pathogens of concern in the beef food chain are Shiga toxin-producing Escherichia coli (STEC) and Salmonella spp.; however, the presence of other pathogens, including Listeria monocytogenes, Campylobacter spp., Clostridium spp., Bacillus cereus, and Mycobacterium avium subsp. par...
Nano-particle enhanced impedimetric biosensor for detection of foodborne pathogens
International Nuclear Information System (INIS)
Kim, G; Om, A S; Mun, J H
2007-01-01
Recent outbreaks of foodborne illness have been increased the need for rapid and sensitive methods for detection of these pathogens. Conventional methods for pathogens detection and identification involve prolonged multiple enrichment steps. Even though some immunological rapid assays are available, these assays still need enrichment steps result in delayed detection. Biosensors have shown great potential for rapid detection of foodborne pathogens. They are capable of direct monitoring the antigen-antibody reactions in real time. Among the biosensors, impedimetric biosensors have been widely adapted as an analysis tool for the study of various biological binding reactions because of their high sensitivity and reagentless operation. In this study a nanoparticle-enhanced impedimetric biosensor for Salmonella enteritidis detection was developed which detected impedance changes caused by the attachment of the cells to the anti-Salmonella antibodies immobilized on interdigitated gold electrodes. Successive immobilization of neutravidin followed by anti-Salmonella antibodies was performed to the sensing area to create a biological detection surface. To enhance the impedance responses generated by antigen-antibody reactions, anti-Salmonella antibody conjugated nanoparticles were introduced on the sensing area. Using a portable impedance analyzer, the impedance across the interdigital electrodes was measured after the series of antigen-antibody bindings. Bacteria cells present in solution attached to capture antibodies and became tethered to the sensor surface. Attached bacteria cells changed the dielectric constant of the media between the electrodes thereby causing a change in measured impedance. Optimum input frequency was determined by analyzing frequency characteristics of the biosensor over ranges of applied frequencies from 10 Hz to 400 Hz. At 100 Hz of input frequency, the biosensor was most sensitive to the changes of the bacteria concentration and this frequency
Rehse, Steven J.; Miziolek, Andrzej W.
2012-06-01
Laser-induced breakdown spectroscopy (LIBS) has made tremendous progress in becoming a viable technology for rapid bacterial pathogen detection and identification. The significant advantages of LIBS include speed (present the latest advances achieved in LIBS-based bacterial sensing including the ability to uniquely identify species from more than five bacterial genera with high-sensitivity and specificity. Bacterial identifications are completely unaffected by environment, nutrition media, or state of growth and accurate diagnoses can be made on autoclaved or UV-irradiated specimens. Efficient discrimination of bacteria at the strain level has been demonstrated. A rapid urinary tract infection diagnosis has been simulated with no sample preparation and a one second diagnosis of a pathogen surrogate has been demonstrated using advanced chemometric analysis with a simple "stop-light" user interface. Stand-off bacterial identification at a 20-m distance has been demonstrated on a field-portable instrument. This technology could be implemented in doctors' offices, clinics, or hospital laboratories for point-of-care medical specimen analysis; mounted on military medical robotic platforms for in-the- field diagnostics; or used in stand-off configuration for remote sensing and detection.
DEFF Research Database (Denmark)
Lorenzen, Niels; Lorenzen, Ellen; Einer-Jensen, Katja
2002-01-01
whereas no increased survival was found upon challenge with bacterial pathogens. Within two months after vaccination, the cross-protection disappeared while the specific immunity to homologous virus remained high. The early immunity induced by the DNA vaccines thus appeared to involve short-lived non......It was recently reported that DNA vaccination of rainbow trout fingerlings against viral hemorrhagic septicaemia virus (VHSV) induced protection within 8 days after intramuscular injection of plasmid DNA. In order to analyse the specificity of this early immunity, fish were vaccinated with plasmid...... DNA encoding the VHSV or the infectious haematopoietic necrosis virus (IHNV) glycoprotein genes and later challenged with homologous or heterologous pathogens. Challenge experiments revealed that immunity established shortly after vaccination was cross-protective between the two viral pathogens...
SERS based point-of-care detection of food-borne pathogens
International Nuclear Information System (INIS)
Mungroo, Nawfal Adam; Oliveira, Gustavo; Neethirajan, Suresh
2016-01-01
The authors have developed a microfluidic platform for improved detection of pathogenic bacteria by using silver nanoparticles and new platforms for chemometric data analysis, viz. a combination of principle component analysis and linear discriminant analysis. The method can distinguish eight key food borne pathogens (E. coli, S. typhimirium, S. enteritis, Pseudomonas aeruginosa, L. monocytogenes, L. innocua, MRSA 35 and MRSA 86) and, hence, holds good promise for use in the food industry. (author)
Directory of Open Access Journals (Sweden)
Ashkan Javid
Full Text Available Insulin-insufficient type 1 diabetes is associated with attenuated bactericidal function of neutrophils, which are key mediators of innate immune responses to microbes as well as pathological inflammatory processes. Neutrophils are central to immune responses to the Lyme pathogen Borrelia burgdorferi. The effect of hyperglycemia on host susceptibility to and outcomes of B. burgdorferi infection has not been examined. The present study investigated the impact of sustained obesity-independent hyperglycemia in mice on bacterial clearance, inflammatory pathology and neutrophil responses to B. burgdorferi. Hyperglycemia was associated with reduced arthritis incidence but more widespread tissue colonization and reduced clearance of bacterial DNA in multiple tissues including brain, heart, liver, lung and knee joint. B. burgdorferi uptake and killing were impaired in neutrophils isolated from hyperglycemic mice. Thus, attenuated neutrophil function in insulin-insufficient hyperglycemia was associated with reduced B. burgdorferi clearance in target organs. These data suggest that investigating the effects of comorbid conditions such as diabetes on outcomes of B. burgdorferi infections in humans may be warranted.
Directory of Open Access Journals (Sweden)
Maria Karanika
Full Text Available BACKGROUND: Childhood meningitis continues to be an important cause of mortality in many countries. The search for rapid diagnosis of acute bacterial meningitis has lead to the further exploration of prognostic factors. This study was scheduled in an attempt to analyze various clinical symptoms as well as rapid laboratory results and provide an algorithm for the prediction of specific bacterial aetiology of childhood bacterial meningitis. METHODOLOGY AND PRINCIPAL FINDINGS: During the 32 year period, 2477 cases of probable bacterial meningitis (BM were collected from the Meningitis Registry (MR. Analysis was performed on a total of 1331 confirmed bacterial meningitis cases of patients aged 1 month to 14 years. Data was analysed using EPI INFO (version 3.4.3-CDC-Atlanta and SPSS (version 15.0-Chicago software. Statistically significant (p or = 15000/microL (OR 2.19 with a PPV of 77.8% (95%CI 40.0-97.2. For the diagnosis of Haemophilus influenzae, the most significant group of diagnostic criteria included, absence of haemorrhagic rash (OR 13.61, age > or = 1 year (OR 2.04, absence of headache (OR 3.01, CSF Glu < 40 mg/dL (OR 3.62 and peripheral WBC < 15,000/microL (OR 1.74 with a PPV of 58.5% (95%CI 42.1-73.7. CONCLUSIONS: The use of clinical and laboratory predictors for the assessment of the causative bacterial pathogen rather than just for predicting outcome of mortality seems to be a useful tool in the clinical management and specific treatment of BM. These findings should be further explored and studied.
Bacterial and viral pathogens in live oysters: 2007 United States market survey.
DePaola, Angelo; Jones, Jessica L; Woods, Jacquelina; Burkhardt, William; Calci, Kevin R; Krantz, Jeffrey A; Bowers, John C; Kasturi, Kuppuswamy; Byars, Robin H; Jacobs, Emily; Williams-Hill, Donna; Nabe, Khamphet
2010-05-01
Two samples of market oysters, primarily from retail establishments, were collected twice each month in each of nine states during 2007. Samples were shipped refrigerated overnight to five U.S. Food and Drug Administration laboratories on a rotating basis and analyzed by most probable number (MPN) for total and pathogenic Vibrio parahaemolyticus and V. vulnificus numbers and for the presence of toxigenic V. cholerae, Salmonella spp., norovirus (NoV), and hepatitis A virus (HAV). Levels of indicator organisms, including fecal coliforms (MPN), Escherichia coli (MPN), male-specific bacteriophage, and aerobic plate counts, were also determined. V. parahaemolyticus and V. vulnificus levels were distributed seasonally and geographically by harvest region and were similar to levels observed in a previous study conducted in 1998-1999. Levels of pathogenic V. parahaemolyticus were typically several logs lower than total V. parahaemolyticus levels regardless of season or region. Pathogenic V. parahaemolyticus levels in the Gulf and Mid-Atlantic regions were about two logs greater than the levels observed in the Pacific and North Atlantic regions. Pathogens generally associated with fecal pollution were detected sporadically or not at all (toxigenic V. cholerae, 0%; Salmonella, 1.5%; NoV, 3.9%; HAV, 4.4%). While seasonal prevalences of NoV and HAV were generally greater in oysters harvested from December to March, the low detection frequency obscured any apparent seasonal effects. Overall, there was no relationship between the levels of indicator microorganisms and the presence of enteric viruses. These data provide a baseline that can be used to further validate risk assessment predictions, determine the effectiveness of new control measures, and compare the level of protection provided by the U.S. shellfish sanitation system to those in other countries.
Engel, Philipp; Salzburger, Walter; Liesch, Marius; Chang, Chao-Chin; Maruyama, Soichi; Lanz, Christa; Calteau, Alexandra; Lajus, Aurélie; Médigue, Claudine; Schuster, Stephan C.; Dehio, Christoph
2011-01-01
Adaptive radiation is the rapid origination of multiple species from a single ancestor as the result of concurrent adaptation to disparate environments. This fundamental evolutionary process is considered to be responsible for the genesis of a great portion of the diversity of life. Bacteria have evolved enormous biological diversity by exploiting an exceptional range of environments, yet diversification of bacteria via adaptive radiation has been documented in a few cases only and the underlying molecular mechanisms are largely unknown. Here we show a compelling example of adaptive radiation in pathogenic bacteria and reveal their genetic basis. Our evolutionary genomic analyses of the α-proteobacterial genus Bartonella uncover two parallel adaptive radiations within these host-restricted mammalian pathogens. We identify a horizontally-acquired protein secretion system, which has evolved to target specific bacterial effector proteins into host cells as the evolutionary key innovation triggering these parallel adaptive radiations. We show that the functional versatility and adaptive potential of the VirB type IV secretion system (T4SS), and thereby translocated Bartonella effector proteins (Beps), evolved in parallel in the two lineages prior to their radiations. Independent chromosomal fixation of the virB operon and consecutive rounds of lineage-specific bep gene duplications followed by their functional diversification characterize these parallel evolutionary trajectories. Whereas most Beps maintained their ancestral domain constitution, strikingly, a novel type of effector protein emerged convergently in both lineages. This resulted in similar arrays of host cell-targeted effector proteins in the two lineages of Bartonella as the basis of their independent radiation. The parallel molecular evolution of the VirB/Bep system displays a striking example of a key innovation involved in independent adaptive processes and the emergence of bacterial pathogens
Directory of Open Access Journals (Sweden)
Philipp Engel
2011-02-01
Full Text Available Adaptive radiation is the rapid origination of multiple species from a single ancestor as the result of concurrent adaptation to disparate environments. This fundamental evolutionary process is considered to be responsible for the genesis of a great portion of the diversity of life. Bacteria have evolved enormous biological diversity by exploiting an exceptional range of environments, yet diversification of bacteria via adaptive radiation has been documented in a few cases only and the underlying molecular mechanisms are largely unknown. Here we show a compelling example of adaptive radiation in pathogenic bacteria and reveal their genetic basis. Our evolutionary genomic analyses of the α-proteobacterial genus Bartonella uncover two parallel adaptive radiations within these host-restricted mammalian pathogens. We identify a horizontally-acquired protein secretion system, which has evolved to target specific bacterial effector proteins into host cells as the evolutionary key innovation triggering these parallel adaptive radiations. We show that the functional versatility and adaptive potential of the VirB type IV secretion system (T4SS, and thereby translocated Bartonella effector proteins (Beps, evolved in parallel in the two lineages prior to their radiations. Independent chromosomal fixation of the virB operon and consecutive rounds of lineage-specific bep gene duplications followed by their functional diversification characterize these parallel evolutionary trajectories. Whereas most Beps maintained their ancestral domain constitution, strikingly, a novel type of effector protein emerged convergently in both lineages. This resulted in similar arrays of host cell-targeted effector proteins in the two lineages of Bartonella as the basis of their independent radiation. The parallel molecular evolution of the VirB/Bep system displays a striking example of a key innovation involved in independent adaptive processes and the emergence of bacterial
Gugala, Natalie; Lemire, Joe A; Turner, Raymond J
2017-06-01
The emergence of multidrug-resistant pathogens and the prevalence of biofilm-related infections have generated a demand for alternative anti-microbial therapies. Metals have not been explored in adequate detail for their capacity to combat infectious disease. Metal compounds can now be found in textiles, medical devices and disinfectants-yet, we know little about their efficacy against specific pathogens. To help fill this knowledge gap, we report on the anti-microbial and antibiofilm activity of seven metals: silver, copper, titanium, gallium, nickel, aluminum and zinc against three bacterial strains, Pseudomonas aeruginosa, Staphylococcus aureus and Escherichia coli. To evaluate the capacity of metal ions to prevent the growth of, and eradicate biofilms and planktonic cells, bacterial cultures were inoculated in the Calgary Biofilm Device (minimal biofilm eradication concentration) in the presence of the metal salts. Copper, gallium and titanium were capable of preventing planktonic and biofilm growth, and eradicating established biofilms of all tested strains. Further, we observed that the efficacies of the other tested metal salts displayed variable efficacy against the tested strains. Further, contrary to the enhanced resistance anticipated from bacterial biofilms, particular metal salts were observed to be more effective against biofilm communities versus planktonic cells. In this study, we have demonstrated that the identity of the bacterial strain must be considered before treatment with a particular metal ion. Consequent to the use of metal ions as anti-microbial agents to fight multidrug-resistant and biofilm-related infections increases, we must aim for more selective deployment in a given infectious setting.
The Bacterial Pathogen Xylella fastidiosa Affects the Leaf Ionome of Plant Hosts during Infection
De La Fuente, Leonardo; Parker, Jennifer K.; Oliver, Jonathan E.; Granger, Shea; Brannen, Phillip M.; van Santen, Edzard; Cobine, Paul A.
2013-01-01
Xylella fastidiosa is a plant pathogenic bacterium that lives inside the host xylem vessels, where it forms biofilm believed to be responsible for disrupting the passage of water and nutrients. Here, Nicotiana tabacum was infected with X. fastidiosa, and the spatial and temporal changes in the whole-leaf ionome (i.e. the mineral and trace element composition) were measured as the host plant transitioned from healthy to diseased physiological status. The elemental composition of leaves was used as an indicator of the physiological changes in the host at a specific time and relative position during plant development. Bacterial infection was found to cause significant increases in concentrations of calcium prior to the appearance of symptoms and decreases in concentrations of phosphorous after symptoms appeared. Field-collected leaves from multiple varieties of grape, blueberry, and pecan plants grown in different locations over a four-year period in the Southeastern US showed the same alterations in Ca and P. This descriptive ionomics approach characterizes the existence of a mineral element-based response to X. fastidiosa using a model system suitable for further manipulation to uncover additional details of the role of mineral elements during plant-pathogen interactions. This is the first report on the dynamics of changes in the ionome of the host plant throughout the process of infection by a pathogen. PMID:23667547
The bacterial pathogen Xylella fastidiosa affects the leaf ionome of plant hosts during infection.
Directory of Open Access Journals (Sweden)
Leonardo De La Fuente
Full Text Available Xylella fastidiosa is a plant pathogenic bacterium that lives inside the host xylem vessels, where it forms biofilm believed to be responsible for disrupting the passage of water and nutrients. Here, Nicotiana tabacum was infected with X. fastidiosa, and the spatial and temporal changes in the whole-leaf ionome (i.e. the mineral and trace element composition were measured as the host plant transitioned from healthy to diseased physiological status. The elemental composition of leaves was used as an indicator of the physiological changes in the host at a specific time and relative position during plant development. Bacterial infection was found to cause significant increases in concentrations of calcium prior to the appearance of symptoms and decreases in concentrations of phosphorous after symptoms appeared. Field-collected leaves from multiple varieties of grape, blueberry, and pecan plants grown in different locations over a four-year period in the Southeastern US showed the same alterations in Ca and P. This descriptive ionomics approach characterizes the existence of a mineral element-based response to X. fastidiosa using a model system suitable for further manipulation to uncover additional details of the role of mineral elements during plant-pathogen interactions. This is the first report on the dynamics of changes in the ionome of the host plant throughout the process of infection by a pathogen.
International Nuclear Information System (INIS)
Yeh, N.; Lee, Y.C.; Chang, C.Y.; Cheng, T.C.
2013-01-01
This paper demonstrates a fish pathogen reduction procedure that uses TiO 2 sol–gel coating Fe 3 O 4 @TiO 2 powder on glass substrate. Such procedure can effectively relieve two constraints that haunt TiO 2 sterilization applications: 1) the need for UV for overcoming the wide band gap of pure TiO 2 and 2) the difficulty of its recovering from water for reuse. In the process, visible light responsive Fe 3 O 4 /TiO 2 nanoparticles are synthesized and immobilized on glass using TiO 2 sol–gel as the binder for fish bacterial pathogen disinfection test. After 3 h of visible light irradiation, the immobilized Fe 3 O 4 @TiO 2 's inhibition efficiencies for fish bacterial pathogen are, respectively, 50% for Edwardsiella tarda (BCRC 10670) and 23% for Aeromonas hydrophila (BCRC 13018)
Williams-Newkirk, Amanda Jo; Rowe, Lori A; Mixson-Hayden, Tonya R; Dasch, Gregory A
2014-01-01
The lone star tick (Amblyomma americanum) is an abundant and aggressive biter of humans, domestic animals, and wildlife in the southeastern-central USA and an important vector of several known and suspected zoonotic bacterial pathogens. However, the biological drivers of bacterial community variation in this tick are still poorly defined. Knowing the community context in which tick-borne bacterial pathogens exist and evolve is required to fully understand the ecology and immunobiology of the ticks and to design effective public health and veterinary interventions. We performed a metagenomic survey of the bacterial communities of questing A. americanum and tested 131 individuals (66 nymphs, 24 males, and 41 females) from five sites in three states. Pyrosequencing was performed with barcoded eubacterial primers targeting variable 16S rRNA gene regions 5-3. The bacterial communities were dominated by Rickettsia (likely R. amblyommii) and an obligate Coxiella symbiont, together accounting for 6.7-100% of sequences per tick. DNAs from Midichloria, Borrelia, Wolbachia, Ehrlichia, Pseudomonas, or unidentified Bacillales, Enterobacteriaceae, or Rhizobiales groups were also detected frequently. Wolbachia and Midichloria significantly co-occurred in Georgia (pmales containing more Rickettsia and females containing more Coxiella. Comparisons among adult ticks collected in New York and North Carolina supported the findings from the Georgia collection despite differences in geography, collection date, and sample handling, implying that the differences detected are consistent attributes. The data also suggest that some members of the bacterial community change during the tick life cycle and that some sex-specific attributes may be detectable in nymphs.
Molecular analysis of cross-bacterial contamination detected in ...
African Journals Online (AJOL)
... the isolate Delftia acidovorans BP(R2) and it is also coupled to protein with molecular weight 25-26 KDa. As well as, this bacterial contamination was the reason for the false positive results observed during the detection of HCV infections. Journal of Applied Sciences and Environmental Management Vol. 9(1) 2005: 5-10.
Viral-bacterial associations in acute apical abscesses.
Ferreira, Dennis C; Rôças, Isabela N; Paiva, Simone S M; Carmo, Flávia L; Cavalcante, Fernanda S; Rosado, Alexandre S; Santos, Kátia R N; Siqueira, José F
2011-08-01
Viral-bacterial and bacterial synergism have been suggested to contribute to the pathogenesis of several human diseases. This study sought to investigate the possible associations between 9 candidate endodontic bacterial pathogens and 9 human viruses in samples from acute apical abscesses. DNA extracts from purulent exudate aspirates of 33 cases of acute apical abscess were surveyed for the presence of 9 selected bacterial species using a 16S ribosomal RNA gene-based nested polymerase chain reaction (PCR) approach. Single or nested PCR assays were used for detection of the human papillomavirus (HPV) and herpesviruses types 1 to 8. Two-thirds of the abscess samples were positive for at least one of the target viruses. Specifically, the most frequently detected viruses were HHV-8 (54.5%); HPV (9%); and varicella zoster virus (VZV), Epstein-Barr virus (EBV), and HHV-6 (6%). Bacterial DNA was present in all cases and the most prevalent bacterial species were Treponema denticola (70%), Tannerella forsythia (67%), Porphyromonas endodontalis (67%), Dialister invisus (61%), and Dialister pneumosintes (57.5%). HHV-8 was positively associated with 7 of the target bacterial species and HPV with 4, but all these associations were weak. Several bacterial pairs showed a moderate positive association. Viral coinfection was found in 6 abscess cases, but no significant viral association could be determined. Findings demonstrated that bacterial and viral DNA occurred concomitantly in two-thirds of the samples from endodontic abscesses. Although this may suggest a role for viruses in the etiology of apical abscesses, the possibility also exists that the presence of viruses in abscess samples is merely a consequence of the bacterially induced disease process. Further studies are necessary to clarify the role of these viral-bacterial interactions, if any, in the pathogenesis of acute apical abscesses. Copyright © 2011 Mosby, Inc. All rights reserved.
Detection of foodborne pathogens by qPCR: A practical approach for food industry applications
Directory of Open Access Journals (Sweden)
María-José Chapela
2015-12-01
Full Text Available Microbiological analysis of food is an integrated part of microbial safety management in the food chain. Monitoring and controlling foodborne pathogens are traditionally carried out by conventional microbiological methods based on culture-dependent approaches in control laboratories and private companies. However, polymerase chain reaction (PCR has revolutionized microbiological analysis allowing detection of pathogenic microorganisms in food, without the necessity of classical isolation and identification. However, at present, PCR and quantitative polymerase chain reaction (qPCR are essential analytical tools for researchers working in the field of foodborne pathogens. This manuscript reviews recently described qPCR methods applied for foodborne bacteria detection, serving as economical, safe, and reliable alternatives for application in the food industry and control laboratories. Multiplex qPCR, which allows the simultaneous detection of more than one pathogen in one single reaction, saving considerable effort, time, and money, is emphasized in the article.
Gannon, V.; Graham, T. A.; Read, S.; Ziebell, K.; Muckle, A.; Thomas, J.; Selinger, B.; Kienzle, S.; Lapp, S. L.; Townshend, I.; Byrne, J.
2002-12-01
Southern Alberta has the highest rate of gastrointestinal illness in the province, and some of the highest infection rates in Canada. The region has extensive field crop irrigation system supporting a rapidly expanding animal agriculture industry. Recently, there has been much public concern about the safety and quality of water in this region, particularly with respect to drinking water supplies for farm residences and rural communities, where water treatment may be less than optimal. We have tested raw river and irrigation water in the Oldman River Basin in southern Alberta for the presence of bacterial pathogens (E. coli O157:H7 and Salmonella spp ) as well as made counts of total and faecal coliforms over the last two years (2000-2001). E. coli O157:H7 and Salmonella spp. isolations and coliform counts peak in raw water from this system during the summer months. E. coli O157:H7 was only isolated from 27/1624 (1.7%) and Salmonella was isolated from 158/1624 (9.7%) of raw water samples over the two year period. Certain sites had multiple pathogen isolations and high indicator bacteria counts in the same year and from year to year. Certain sites had multiple pathogen isolations and high indicator bacteria counts in the same year and from year to year. S. Rublislaw was the most common Salmonella serovar isolated in both years. While this serovar is rarely associated with human or animal disease in Alberta, other Salmonella serovars isolated, such as Typhimurium, are commonly disease-associated. This poster presents initial analyses of the spatial and temporal properties of pathogen occurrences in the Oldman Basin in 2000 and 2001. Seasonal variability in the occurrence of pathogens is particularly interesting and of concern. Early results demonstrate the pathogen occurrences peak during the height of the summer recreation season; posing a substantial infection risk for the public and tourism populations. Human consumption of inadequately treated water in this
Colonization of plants by human pathogenic bacteria in the course of organic vegetable production
Directory of Open Access Journals (Sweden)
Andreas eHofmann
2014-05-01
Full Text Available In recent years, increasing numbers of outbreaks caused by the consumption of vegetables contaminated with human pathogenic bacteria were reported. The application of organic fertilizers during vegetable production is one of the possible reasons for contamination with those pathogens. In this study laboratory experiments in axenic and soil systems following common practices in organic farming were conducted to identify the minimal dose needed for bacterial colonization of plants and to identify possible factors like bacterial species or serovariation, plant species or organic fertilizer types used, influencing the success of plant colonization by human pathogenic bacteria. Spinach and corn salad were chosen as model plants and were inoculated with different concentrations of Salmonella enterica sv. Weltevreden, Listeria monocytogenes sv. 4b and EGD-E sv. 1/2a either directly (axenic system or via agricultural soil amended with spiked organic fertilizers (soil system. In addition to PCR- and culture-based detection methods, fluorescence in situ hybridization (FISH was applied in order to localize bacteria on or in plant tissues. Our results demonstrate that shoots were colonized by the pathogenic bacteria at inoculation doses as low as 4x10CFU/ml in the axenic system or 4x105CFU/g in the soil system. In addition, plant species dependent effects were observed. Spinach was colonized more often and at lower inoculation doses compared to corn salad. Differential colonization sites on roots, depending on the plant species could be detected using FISH-CLSM analysis. Furthermore, the transfer of pathogenic bacteria to plants via organic fertilizers was observed more often and at lower initial inoculation doses when fertilization was performed with inoculated slurry compared to inoculated manure. Finally, it could be shown that by introducing a simple washing step, the bacterial contamination was reduced in most cases or even was removed completely in
Rapid Magnetic Nanobiosensor for the detection of Serratia marcescen
Aljabali, Alaa A. A.; Hussein, Emad; Aljumaili, Omar; Zoubi, Mazhar Al; Altrad, Bahaa; Albatayneh, Khaled; Al-razaq, Mutaz A. Abd
2018-02-01
The development of rapid, sensitive, accurate and reliable bacterial detection methods are of keen interest to ensure food safety and hospital security. Therefore, the development of a fast, specific, low-cost and trusted methods is in high demand. Magnetic nanoparticles with their unique material properties have been utilized as a tool for pathogen detection. Here, we present a novel iron oxide nanoparticles labeled with specific targeting antibodies to improve specificity and extend the use of nanoparticles as nanosensors. The results indicated that antibody labeled iron oxide platform that binds specifically to Serriata marcescenst in a straightforward method is very specific and sensitive. The system is capable of rapid and specific detection of various clinically relevant bacterial species, with sensitivity down to single bacteria. The generic platform could be used to identify pathogens for a variety of applications rapidly.
Directory of Open Access Journals (Sweden)
Antti Roine
Full Text Available Urinary tract infection (UTI is a common disease with significant morbidity and economic burden, accounting for a significant part of the workload in clinical microbiology laboratories. Current clinical chemisty point-of-care diagnostics rely on imperfect dipstick analysis which only provides indirect and insensitive evidence of urinary bacterial pathogens. An electronic nose (eNose is a handheld device mimicking mammalian olfaction that potentially offers affordable and rapid analysis of samples without preparation at athmospheric pressure. In this study we demonstrate the applicability of ion mobility spectrometry (IMS -based eNose to discriminate the most common UTI pathogens from gaseous headspace of culture plates rapidly and without sample preparation. We gathered a total of 101 culture samples containing four most common UTI bacteries: E. coli, S. saprophyticus, E. faecalis, Klebsiella spp and sterile culture plates. The samples were analyzed using ChemPro 100i device, consisting of IMS cell and six semiconductor sensors. Data analysis was conducted by linear discriminant analysis (LDA and logistic regression (LR. The results were validated by leave-one-out and 5-fold cross validation analysis. In discrimination of sterile and bacterial samples sensitivity of 95% and specificity of 97% were achieved. The bacterial species were identified with sensitivity of 95% and specificity of 96% using eNose as compared to urine bacterial cultures.These findings strongly demonstrate the ability of our eNose to discriminate bacterial cultures and provides a proof of principle to use this method in urinanalysis of UTI.
Genome-Enhanced Detection and Identification (GEDI of plant pathogens
Directory of Open Access Journals (Sweden)
Nicolas Feau
2018-02-01
Full Text Available Plant diseases caused by fungi and Oomycetes represent worldwide threats to crops and forest ecosystems. Effective prevention and appropriate management of emerging diseases rely on rapid detection and identification of the causal pathogens. The increase in genomic resources makes it possible to generate novel genome-enhanced DNA detection assays that can exploit whole genomes to discover candidate genes for pathogen detection. A pipeline was developed to identify genome regions that discriminate taxa or groups of taxa and can be converted into PCR assays. The modular pipeline is comprised of four components: (1 selection and genome sequencing of phylogenetically related taxa, (2 identification of clusters of orthologous genes, (3 elimination of false positives by filtering, and (4 assay design. This pipeline was applied to some of the most important plant pathogens across three broad taxonomic groups: Phytophthoras (Stramenopiles, Oomycota, Dothideomycetes (Fungi, Ascomycota and Pucciniales (Fungi, Basidiomycota. Comparison of 73 fungal and Oomycete genomes led the discovery of 5,939 gene clusters that were unique to the targeted taxa and an additional 535 that were common at higher taxonomic levels. Approximately 28% of the 299 tested were converted into qPCR assays that met our set of specificity criteria. This work demonstrates that a genome-wide approach can efficiently identify multiple taxon-specific genome regions that can be converted into highly specific PCR assays. The possibility to easily obtain multiple alternative regions to design highly specific qPCR assays should be of great help in tackling challenging cases for which higher taxon-resolution is needed.
Progress in rapid detection and identification of unknown human and agricultural pathogens
International Nuclear Information System (INIS)
Barnes, T; Holzrichter, J F; Milanovich, F P
1999-01-01
The medical industry is driving pathogen detection technology from its present characteristics of$50/sample, 100 sample capability systems, with several day time responses, having several percent error rates in reported outcomes. The systems described above are capable of providing samples at and lt;$5/test, managing several million samples, and lt; 1-hour cycle times, (or just minutes in some cases) and and lt; 0.1% error rates. Because of their importance to the medical and agricultural communities, all ''important'' pathogens will have detection kits available (within air transport times, anywhere in the world) by 2020, and the most well known pathogens will have kits available within a few years. Many are available now. Because of the importance of the food supply to modern nations, these technologies will be employed everywhere in this industry. For example, the United States imports 30 B tons of food a year, but inspects and lt; 1%. Portable inspection systems will make it possible to test for dangerous pathogens in feed lots, food processing plants, markets, and points of use. Outbreaks of animal or plant disease will be immediately detectable using field instrumentation, and more complex samples can be sent to central testing laboratories where more sophisticated test systems will be available. Unusual pathogens either naturally or purposefully selected or developed, will require special attention because there is not a commercial economic driver for the development of detection systems and curative agents. Their development, and production for sufficient availability, will require significant investments by the world community. The strategy and costs for developing vaccines or curative drugs will be very expensive and will need special attention. However it is important that attention be directed to these problems because such attention has a strong deterrent effect on potential developers or users. The capacity to use the full information content
Imperfect pathogen detection from non-invasive skin swabs biases disease inference
DiRenzo, Graziella V.; Grant, Evan H. Campbell; Longo, Ana; Che-Castaldo, Christian; Zamudio, Kelly R.; Lips, Karen
2018-01-01
1. Conservation managers rely on accurate estimates of disease parameters, such as pathogen prevalence and infection intensity, to assess disease status of a host population. However, these disease metrics may be biased if low-level infection intensities are missed by sampling methods or laboratory diagnostic tests. These false negatives underestimate pathogen prevalence and overestimate mean infection intensity of infected individuals. 2. Our objectives were two-fold. First, we quantified false negative error rates of Batrachochytrium dendrobatidis on non-invasive skin swabs collected from an amphibian community in El Copé, Panama. We swabbed amphibians twice in sequence, and we used a recently developed hierarchical Bayesian estimator to assess disease status of the population. Second, we developed a novel hierarchical Bayesian model to simultaneously account for imperfect pathogen detection from field sampling and laboratory diagnostic testing. We evaluated the performance of the model using simulations and varying sampling design to quantify the magnitude of bias in estimates of pathogen prevalence and infection intensity. 3. We show that Bd detection probability from skin swabs was related to host infection intensity, where Bd infections information in advance, we advocate that the most cautious approach is to assume all errors are possible and to accommodate them by adjusting sampling designs. The modeling framework presented here improves the accuracy in estimating pathogen prevalence and infection intensity.
Directory of Open Access Journals (Sweden)
Daniel Spira
Full Text Available To search for imaging characteristics distinguishing patients with successful from those with futile microbiological pathogen detection by CT-guided biopsy in suspected spondylodiscitis.34 consecutive patients with suspected spondylodiscitis underwent CT-guided biopsy for pathogen detection. MR-images were assessed for inflammatory infiltration of disks, adjacent vertebrae, epidural and paravertebral space. CT-images were reviewed for arrosion of adjacent end plates and reduced disk height. Biopsy samples were sent for microbiological examination in 34/34 patients, and for additional histological analysis in 28/34 patients.Paravertebral infiltration was present in all 10/10 patients with positive microbiology and occurred in only 12/24 patients with negative microbiology, resulting in a sensitivity of 100% and a specificity of 50% for pathogen detection. Despite its limited sensitivities, epidural infiltration and paravertebral abscesses showed considerably higher specificities of 83.3% and 90.9%, respectively. Paravertebral infiltration was more extensive in patients with positive as compared to negative microbiology (p = 0.002. Even though sensitivities for pathogen detection were also high in case of vertebral and disk infiltration, or end plate arrosion, specificities remained below 10%.Inflammatory infiltration of the paravertebral space indicated successful pathogen detection by CT-guided biopsy. Specificity was increased by the additional occurrence of epidural infiltration or paravertebral abscesses.
Bacteriophages: the possible solution to treat infections caused by pathogenic bacteria.
El-Shibiny, Ayman; El-Sahhar, Salma
2017-11-01
Since their discovery in 1915, bacteriophages have been used to treat bacterial infections in animals and humans because of their unique ability to infect their specific bacterial hosts without affecting other bacterial populations. The research carried out in this field throughout the 20th century, largely in Georgia, part of USSR and Poland, led to the establishment of phage therapy protocols. However, the discovery of penicillin and sulfonamide antibiotics in the Western World during the 1930s was a setback in the advancement of phage therapy. The misuse of antibiotics has reduced their efficacy in controlling pathogens and has led to an increase in the number of antibiotic-resistant bacteria. As an alternative to antibiotics, bacteriophages have become a topic of interest with the emergence of multidrug-resistant bacteria, which are a threat to public health. Recent studies have indicated that bacteriophages can be used indirectly to detect pathogenic bacteria or directly as biocontrol agents. Moreover, they can be used to develop new molecules for clinical applications, vaccine production, drug design, and in the nanomedicine field via phage display.
International Nuclear Information System (INIS)
Shawki, H.A.; El-Hanafy, A.E.A.; Shagar, G.I.A.
2014-01-01
The usefulness of Gamma irradiation to control of internal parasites and pathogenic bacteria found in silver side fish (Atherina) (Bissaria) was investigated. The detected parasites and the prevalence were adult Trematode (37.5%); Cestodes (95%) and Nematode (22.5%) for control silver side fish. The counts of detected microorganisms, (Total bacterial count; Psychrophilic bacteria; Mold and yeast; E.coli and Staphyloccous aureus ) were 4.89 ; 2.30; 2.32; 2.31 and 2.04 log 10 cfu/g for control silver side fish, respectively. Applied irradiation doses reduce the infected rate by Trematode, Cestodes and Nematode, furthermore, gamma irradiation with different doses (0.5, 1, 2, 4 and 5 kGy) reduce the microorganisms count of silver side fish (Bissaria) samples and the rate of decrement increase with the dose increase. Total bacterial count was not detected by using dose 5 kGy while Psychrophilic bacteria were completely eliminated using dose 1 kGy. On the other hand mold and yeast; E.coli and Staph aureus in silver side fish samples were not detected after subjected to gamma irradiation with dose 4 kGy. The results suggest that the applied doses completely elimination different internal parasites and pathogenic bacteria found in silver side fish. Thus, it could be conclude that the irradiation dose of 4 kGy can be effectively applied to ensure the safety of internal parasites and pathogenic bacteria found in silver side fish (Atherina) (Bissaria) with regards to these harmful parasites and pathogenic bacteria
May, Fiona J; Stafford, Russell J; Carroll, Heidi; Robson, Jennifer Mb; Vohra, Renu; Nimmo, Graeme R; Bates, John; Kirk, Martyn D; Fearnley, Emily J; Polkinghorne, Benjamin G
2017-09-01
Changes in diagnostic laboratory testing procedures can impact on the number of cases notified and the public health surveillance of enteric pathogens. Culture independent diagnostic testing using a multiplex polymerase chain reaction (PCR) test was introduced for the rapid detection of bacterial enteric pathogens in pathology laboratories in Queensland, Australia, from late 2013 onwards. We conducted a retrospective descriptive study using laboratory data to assess the impact of the introduction of PCR testing on four common enteric pathogens, Salmonella, Campylobacter, Shigella and Yersinia, in Queensland between 2010 and 2014. The number of stool specimens tested and the proportion positive for each of the four pathogens increased in 2014 after the introduction of culture independent diagnostic testing. Among the specimens tested by both PCR and culture, 12% of Salmonella positive stools, 36% of Campylobacter positive stools, 74% of Shigella / enteroinvasive Escherichia coli positive stools and 65% of Yersinia positive stools were PCR positive only. Including those where culture was not performed, 19% of Salmonella positive stools, 44% of Campylobacter positive stools, 83% of Shigella positive stools and 79% of Yersinia positive stools had no cultured isolate available for further characterisation. The detection and tracking of foodborne and non-foodborne gastrointestinal outbreaks will become more difficult as culture independent diagnostic testing becomes more widespread. Until new techniques for characterisation of pathogens directly from clinical specimens have been developed, we recommend laboratories continue to culture specimens concurrently or reflexively with culture independent diagnostic tests. This work is copyright. You may download, display, print and reproduce the whole or part of this work in unaltered form for your own personal use or, if you are part of an organisation, for internal use within your organisation, but only if you or your
Wu, Qingzhong; Prager, Katherine C; Goldstein, Tracey; Alt, David P; Galloway, Renee L; Zuerner, Richard L; Lloyd-Smith, James O; Schwacke, Lori
2014-08-11
Several real-time PCR assays are currently used for detection of pathogenic Leptospira spp.; however, few methods have been described for the successful evaluation of clinical urine samples. This study reports a rapid assay for the detection of pathogenic Leptospira spp. in California sea lions Zalophus californianus using real-time PCR with primers and a probe targeting the lipL32 gene. The PCR assay had high analytic sensitivity-the limit of detection was 3 genome copies per PCR volume using L. interrogans serovar Pomona DNA and 100% analytic specificity; it detected all pathogenic leptospiral serovars tested and none of the non-pathogenic Leptospira species (L. biflexa and L. meyeri serovar Semaranga), the intermediate species L. inadai, or the non-Leptospira pathogens tested. Our assay had an amplification efficiency of 1.00. Comparisons between the real-time PCR assay and culture isolation for detection of pathogenic Leptospira spp. in urine and kidney tissue samples from California sea lions showed that samples were more often positive by real-time PCR than by culture methods. Inclusion of an internal amplification control in the real-time PCR assay showed no inhibitory effects in PCR negative samples. These studies indicated that our real-time PCR assay has high analytic sensitivity and specificity for the rapid detection of pathogenic Leptospira species in urine and kidney tissue samples.
A Host-Produced Autoinducer-2 Mimic Activates Bacterial Quorum Sensing.
Ismail, Anisa S; Valastyan, Julie S; Bassler, Bonnie L
2016-04-13
Host-microbial symbioses are vital to health; nonetheless, little is known about the role crosskingdom signaling plays in these relationships. In a process called quorum sensing, bacteria communicate with one another using extracellular signal molecules called autoinducers. One autoinducer, AI-2, is proposed to promote interspecies bacterial communication, including in the mammalian gut. We show that mammalian epithelia produce an AI-2 mimic activity in response to bacteria or tight-junction disruption. This AI-2 mimic is detected by the bacterial AI-2 receptor, LuxP/LsrB, and can activate quorum-sensing-controlled gene expression, including in the enteric pathogen Salmonella typhimurium. AI-2 mimic activity is induced when epithelia are directly or indirectly exposed to bacteria, suggesting that a secreted bacterial component(s) stimulates its production. Mutagenesis revealed genes required for bacteria to both detect and stimulate production of the AI-2 mimic. These findings uncover a potential role for the mammalian AI-2 mimic in fostering crosskingdom signaling and host-bacterial symbioses. Copyright © 2016 Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Yuan-yuan Sun
2016-08-01
Full Text Available Pseudomonas fluorescens is a common bacterial pathogen to a wide range of aquaculture animals including various species of fish. In this study, we employed proteomic analysis and identified filamentous hemagglutinin (FHA as an iron-responsive protein secreted by TSS, a pathogenic P. fluorescens isolate. In vitro study showed that compared to the wild type, the fha mutant TSSfha (i exhibited a largely similar vegetative growth profile but significantly retarded in the ability of biofilm growth and producing extracellular matrix, (ii displayed no apparent flagella and motility, (iii was defective in the attachment to host cells and unable to form self-aggregation, (iv displayed markedly reduced capacity of hemagglutination and surviving in host serum. In vivo infection analysis revealed that TSSfha was significantly attenuated in the ability of dissemination in fish tissues and inducing host mortality, and that antibody blocking of the natural FHA produced by the wild type TSS impaired the infectivity of the pathogen. Furthermore, when introduced into turbot as a subunit vaccine, recombinant FHA elicited a significant protection against lethal TSS challenge. Taken together, these results indicate for the first time that P. fluorescens FHA is a key virulence factor essential to multiple biological processes associated with pathogenicity.
Ballados-González, G G; Sánchez-Montes, S; Romero-Salas, D; Colunga Salas, P; Gutiérrez-Molina, R; León-Paniagua, L; Becker, I; Méndez-Ojeda, M L; Barrientos-Salcedo, C; Serna-Lagunes, R; Cruz-Romero, A
2018-06-01
The genus Leptospira encompass 22 species of spirochaetes, with ten pathogenic species that have been recorded in more than 160 mammals worldwide. In the last two decades, the numbers of records of these agents associated with bats have increased exponentially, particularly in America. Although order Chiroptera represents the second most diverse order of mammals in Mexico, and leptospirosis represents a human and veterinary problem in the country, few studies have been conducted to identify potential wildlife reservoirs. The aim of this study was to detect the presence and diversity of Leptospira sp. in communities of bats in an endemic state of leptospirosis in Mexico. During January to September 2016, 81 bats of ten species from three localities of Veracruz, Mexico, were collected with mist nets. Kidney samples were obtained from all specimens. For the detection of Leptospira sp., we amplified several genes using specific primers. Amplicons of the expected size were submitted to sequencing, and sequences recovered were compared with those of reference deposited in GenBank using the BLAST tool. To identify their phylogenetic position, we realized a reconstruction using maximum-likelihood (ML) method. Twenty-five samples from three bat species (Artibeus lituratus, Choeroniscus godmani and Desmodus rotundus) showed the presence of Leptospira DNA. Sequences recovered were close to Leptospira noguchii, Leptospira weilii and Leptospira interrogans. Our results include the first record of Leptospira in bats from Mexico and exhibit a high diversity of these pathogens circulating in the state. Due to the finding of a large number of positive wild animals, it is necessary to implement a surveillance system in populations of the positive bats as well as in related species, in order to understand their role as carriers of this bacterial genus. © 2018 Blackwell Verlag GmbH.
Bacterial fingerprints across Europe
Glasner, Corinna
2014-01-01
Bacterial pathogens, such as Staphylococcus aureus and carbapenemase-producing Enterobacteriaceae (CPE), impose major threats to human health worldwide. Both have a ‘Jekyll & Hyde’ character, since they can be present as human commensals, but can also become harmful invasive pathogens especially
Towards On-site Pathogen Detection Using Antibody-based Sensors
DEFF Research Database (Denmark)
Skottrup, Peter Durand; Nicolaisen, Mogens; Justesen, Annemarie Fejer
2008-01-01
In this paper the recent progress within biosensors for plant pathogen detection will be reviewed. Bio-recognition layers on sensors can be designed in various ways, however the most popular approach is to immobilise antibodies for specific capture of analytes. Focus will be put on antibody surfa...
Plasticity in early immune evasion strategies of a bacterial pathogen.
Bernard, Quentin; Smith, Alexis A; Yang, Xiuli; Koci, Juraj; Foor, Shelby D; Cramer, Sarah D; Zhuang, Xuran; Dwyer, Jennifer E; Lin, Yi-Pin; Mongodin, Emmanuel F; Marques, Adriana; Leong, John M; Anguita, Juan; Pal, Utpal
2018-04-17
Borrelia burgdorferi is one of the few extracellular pathogens capable of establishing persistent infection in mammals. The mechanisms that sustain long-term survival of this bacterium are largely unknown. Here we report a unique innate immune evasion strategy of B. burgdorferi , orchestrated by a surface protein annotated as BBA57, through its modulation of multiple spirochete virulent determinants. BBA57 function is critical for early infection but largely redundant for later stages of spirochetal persistence, either in mammals or in ticks. The protein influences host IFN responses as well as suppresses multiple host microbicidal activities involving serum complement, neutrophils, and antimicrobial peptides. We also discovered a remarkable plasticity in BBA57-mediated spirochete immune evasion strategy because its loss, although resulting in near clearance of pathogens at the inoculum site, triggers nonheritable adaptive changes that exclude detectable nucleotide alterations in the genome but incorporate transcriptional reprograming events. Understanding the malleability in spirochetal immune evasion mechanisms that ensures their host persistence is critical for the development of novel therapeutic and preventive approaches to combat long-term infections like Lyme borreliosis.
Directory of Open Access Journals (Sweden)
E. Mahmoudi
2007-08-01
Full Text Available Pectobacterium is one of the major destructive causal agent in most crop plants throughout the world. During a survey in spring of 2005 in the rangeland of Kermanshah and Isfahan, provinces of Iran, samples of bulbs and stems of crown imperial with brown spot and soft rot were collected. Eight strains of pectolytic Erwinia were isolated and purified from these samples. Phenotypic tests indicated that the strains were gram-negative, facultative anaerobic, rod shaped, motile with peritrichous flagella. They were oxidase negative, catalase positive and also able to macerate potato slices. Pathogenicity of all the strains were confirmed on corn, philodendron and crown imperial by inoculation of these crops with a bacterial suspension and reisolation of the strain from symptomatic tissues. A pair of specific PCR primers was used to detect these bacterial strains. The primer set (EXPCCF/EXPCCR amplified a single fragment of the expected size (0.55 kb from genomic DNA of all strains used in this study. In nested PCR, the primer set (INPCCR/INPCCF amplified the expected single fragment (0.4 kb from the PCR product of first PCR amplification. On the basis of the biochemical and phenotypic characteristics and PCR amplification by the specific PCR primers, these strains were identified as Pectobacterium carotovorum subsp. carotovorum. This is the first report of occurrence of crown imperial bacterial soft-rot in Iran.
Yoshii, Atsushi; Moriyama, Hiromitsu; Fukuhara, Toshiyuki
2012-08-01
Kasugamycin (KSM), a unique aminoglycoside antibiotic, has been used in agriculture for many years to control not only rice blast caused by the fungus Magnaporthe grisea but also rice bacterial grain and seedling rot or rice bacterial brown stripe caused by Burkholderia glumae or Acidovorax avenae subsp. avenae, respectively. Since both bacterial pathogens are seed-borne and cause serious injury to rice seedlings, the emergence of KSM-resistant B. glumae and A. avenae isolates highlights the urgent need to understand the mechanism of resistance to KSM. Here, we identified a novel gene, aac(2')-IIa, encoding a KSM 2'-N-acetyltransferase from both KSM-resistant pathogens but not from KSM-sensitive bacteria. AAC(2')-IIa inactivates KSM, although it reveals no cross-resistance to other aminoglycosides. The aac(2')-IIa gene from B. glumae strain 5091 was identified within the IncP genomic island inserted into the bacterial chromosome, indicating the acquisition of this gene by horizontal gene transfer. Although excision activity of the IncP island and conjugational gene transfer was not detected under the conditions tested, circular intermediates containing the aac(2')-IIa gene were detected. These results indicate that the aac(2')-IIa gene had been integrated into the IncP island of a donor bacterial species. Molecular detection of the aac(2')-IIa gene could distinguish whether isolates are resistant or susceptible to KSM. This may contribute to the production of uninfected rice seeds and lead to the effective control of these pathogens by KSM.
Directory of Open Access Journals (Sweden)
Petra Rogina
2014-01-01
Full Text Available We compared a commercial broad range 16S rRNA gene PCR assay (SepsiTest to an in-house developed assay (IHP. We assessed whether CD64 index, a biomarker of bacterial infection, can be used to exclude patients with a low probability of systemic bacterial infection. From January to March 2010, 23 patients with suspected sepsis were enrolled. CD64 index, procalcitonin, and C-reactive protein were measured on admission. Broad range 16S rRNA gene PCR was performed from whole blood (SepsiTest or blood plasma (IHP and compared to blood culture results. Blood samples spiked with Staphylococcus aureus were used to assess sensitivity of the molecular assays in vitro. CD64 index was lower in patients where possible sepsis was excluded than in patients with microbiologically confirmed sepsis (P=0.004. SepsiTest identified more relevant pathogens than blood cultures (P=0.008; in three patients (13% results from blood culture and SepsiTest were congruent, whereas in four cases (17.4% relevant pathogens were detected by SepsiTest only. In vitro spiking experiments suggested equal sensitivity of SepsiTest and IHP. A diagnostic algorithm using CD64 index as a decision maker to perform SepsiTest shows improved detection of pathogens in patients with suspected blood stream infection and may enable earlier targeted antibiotic therapy.
Prevention of bacterial adhesion
DEFF Research Database (Denmark)
Klemm, Per; Vejborg, Rebecca Munk; Hancock, Viktoria
2010-01-01
. As such, adhesion represents the Achilles heel of crucial pathogenic functions. It follows that interference with adhesion can reduce bacterial virulence. Here, we illustrate this important topic with examples of techniques being developed that can inhibit bacterial adhesion. Some of these will become...
Energy Technology Data Exchange (ETDEWEB)
Benami, Maya; Busgang, Allison; Gillor, Osnat; Gross, Amit, E-mail: amgross@exchange.bgu.ac.il
2016-08-15
to provide more accurate quantification of small amounts of viable, aerosolized bacterial pathogens. - Highlights: • Greywater aerosols had higher bacterial counts compared to background amounts. • Low pathogen counts were detected on settle-plates from greywater aerosols. • Before enrichment no bacteria were found in greywater aerosols, using a BioSampler®. • After enrichment some pathogens were occasionally found in the greywater aerosols. • QMRA results show that greywater aerosols were below safety limits for S. aureus.
International Nuclear Information System (INIS)
Benami, Maya; Busgang, Allison; Gillor, Osnat; Gross, Amit
2016-01-01
more accurate quantification of small amounts of viable, aerosolized bacterial pathogens. - Highlights: • Greywater aerosols had higher bacterial counts compared to background amounts. • Low pathogen counts were detected on settle-plates from greywater aerosols. • Before enrichment no bacteria were found in greywater aerosols, using a BioSampler®. • After enrichment some pathogens were occasionally found in the greywater aerosols. • QMRA results show that greywater aerosols were below safety limits for S. aureus.
Ebrahimi, Aida; Alam, Muhammad A.
Rapid detection of bacterial pathogens is of great importance in healthcare, food safety, environmental monitoring, and homeland security. Most bacterial detection platforms rely on binary fission (i.e. cell growth) to reach a threshold cell population that can be resolved by the sensing method. Since cell division depends on the bacteria type, the detection time of such methods can vary from hours to days. In contrast, in this work, we show that bacteria cells can be detected within minutes by relying on activation of specific protein channels, i.e. mechanosensitive channels (MS channels). When cells are exposed to hypotonic solutions, MS channels allow efflux of solutes to the external solution which leads to release the excessive membrane tension. Release of the cytoplasmic solutes, in turn, results in increase of the electrical conductance measured by droplet-based impedance sensing. The approach can be an effective technique for fast, pre-screening of bacterial contamination at ultra-low concentration.
Relationship of periodontal clinical parameters with bacterial composition in human dental plaque.
Fujinaka, Hidetake; Takeshita, Toru; Sato, Hirayuki; Yamamoto, Tetsuji; Nakamura, Junji; Hase, Tadashi; Yamashita, Yoshihisa
2013-06-01
More than 600 bacterial species have been identified in the oral cavity, but only a limited number of species show a strong association with periodontitis. The purpose of the present study was to provide a comprehensive outline of the microbiota in dental plaque related to periodontal status. Dental plaque from 90 subjects was sampled, and the subjects were clustered based on bacterial composition using the terminal restriction fragment length polymorphism of 16S rRNA genes. Here, we evaluated (1) periodontal clinical parameters between clusters; (2) the correlation of subgingival bacterial composition with supragingival bacterial composition; and (3) the association between bacterial interspecies in dental plaque using a graphical Gaussian model. Cluster 1 (C1) having high prevalence of pathogenic bacteria in subgingival plaque showed increasing values of the parameters. The values of the parameters in Cluster 2a (C2a) having high prevalence of non-pathogenic bacteria were markedly lower than those in C1. A cluster having low prevalence of non-pathogenic bacteria in supragingival plaque showed increasing values of the parameters. The bacterial patterns between subgingival plaque and supragingival plaque were significantly correlated. Chief pathogens, such as Porphyromonas gingivalis, formed a network with other pathogenic species in C1, whereas a network of non-pathogenic species, such as Rothia sp. and Lautropia sp., tended to compete with a network of pathogenic species in C2a. Periodontal status relates to non-pathogenic species as well as to pathogenic species, suggesting that the bacterial interspecies connection affects dental plaque virulence.
DEFF Research Database (Denmark)
Yoo, S. M.; Baek, Y. K.; Shin, S.
2016-01-01
We herein describe the development of a single-walled carbon nanotube (SWNT)-based electrical biosensor consisting of a two-terminal resistor, and report its use for the specific, label-free detection of pathogenic bacteria via changes in conductance. The ability of this biosensor to recognize...... different pathogenic bacteria was analyzed, and conditions were optimized with different probe concentrations. Using this system, the reference strains and clinical isolates of Staphylococcus aureus and Escherichia coli were successfully detected; in both cases, the sensor showed a detection limit of 10 CFU....... This SWNT-based electrical biosensor will prove useful for the development of highly sensitive and specific handheld pathogen detectors....
She, Siyuan; Niu, Jiaojiao; Zhang, Chao; Xiao, Yunhua; Chen, Wu; Dai, Linjian; Liu, Xueduan; Yin, Huaqun
2017-03-01
Soil bacteria are very important in biogeochemical cycles and play significant role in soil-borne disease suppression. Although continuous cropping is responsible for soil-borne disease enrichment, its effect on tobacco plant health and how soil bacterial communities change are yet to be elucidated. In this study, soil bacterial communities across tobacco continuous cropping time-series fields were investigated through high-throughput sequencing of 16S ribosomal RNA genes. The results showed that long-term continuous cropping could significantly alter soil microbial communities. Bacterial diversity indices and evenness indices decreased over the monoculture span and obvious variations for community structures across the three time-scale tobacco fields were detected. Compared with the first year, the abundances of Arthrobacter and Lysobacter showed a significant decrease. Besides, the abundance of the pathogen Ralstonia spp. accumulated over the monoculture span and was significantly correlated with tobacco bacterial wilt disease rate. Moreover, Pearson's correlation demonstrated that the abundance of Arthrobacter and Lysobacter, which are considered to be beneficial bacteria had significant negative correlation with tobacco bacterial wilt disease. Therefore, after long-term continuous cropping, tobacco bacterial wilt disease could be ascribed to the alteration of the composition as well as the structure of the soil microbial community.
Deoxyribonucleoside kinases activate nucleoside antibiotics in severely pathogenic bacteria
DEFF Research Database (Denmark)
Sandrini, Michael; Shannon, O.; Clausen, A.R.
2007-01-01
Common bacterial pathogens are becoming progressively more resistant to traditional antibiotics, representing a major public-health crisis. Therefore, there is a need for a variety of antibiotics with alternative modes of action. In our study, several nucleoside analogs were tested against pathog...... alternative for combating pathogenic bacteria.......Common bacterial pathogens are becoming progressively more resistant to traditional antibiotics, representing a major public-health crisis. Therefore, there is a need for a variety of antibiotics with alternative modes of action. In our study, several nucleoside analogs were tested against...... pathogenic staphylococci and streptococci. We show that pyrimidine-based nucleoside analogs, like 3'-azido-3'-deoxythymidine (AZT) and 2',2'-difluoro-2'deoxycytidine (gemcitabine), are specifically activated by the endogenous bacterial deoxyribonucleoside kinases, leading to cell death. Deoxyribonucleoside...
Nest Material Shapes Eggs Bacterial Environment.
Directory of Open Access Journals (Sweden)
Cristina Ruiz-Castellano
Full Text Available Selective pressures imposed by pathogenic microorganisms to embryos have selected in hosts for a battery of antimicrobial lines of defenses that includes physical and chemical barriers. Due to the antimicrobial properties of volatile compounds of green plants and of chemicals of feather degrading bacteria, the use of aromatic plants and feathers for nest building has been suggested as one of these barriers. However, experimental evidence suggesting such effects is scarce in the literature. During two consecutive years, we explored experimentally the effects of these nest materials on loads of different groups of bacteria (mesophilic bacteria, Enterobacteriaceae, Staphylococcus and Enterococcus of eggshells in nests of spotless starlings (Sturnus unicolor at the beginning and at the end of the incubation period. This was also explored in artificial nests without incubation activity. We also experimentally increased bacterial density of eggs in natural and artificial nests and explored the effects of nest lining treatments on eggshell bacterial load. Support for the hypothetical antimicrobial function of nest materials was mainly detected for the year and location with larger average values of eggshell bacterial density. The beneficial effects of feathers and plants were more easily detected in artificial nests with no incubation activity, suggesting an active role of incubation against bacterial colonization of eggshells. Pigmented and unpigmented feathers reduced eggshell bacterial load in starling nests and artificial nest boxes. Results from artificial nests allowed us to discuss and discard alternative scenarios explaining the detected association, particularly those related to the possible sexual role of feathers and aromatic plants in starling nests. All these results considered together confirm the antimicrobial functionality mainly of feathers but also of plants used as nest materials, and highlight the importance of temporally and
Nest Material Shapes Eggs Bacterial Environment.
Ruiz-Castellano, Cristina; Tomás, Gustavo; Ruiz-Rodríguez, Magdalena; Martín-Gálvez, David; Soler, Juan José
2016-01-01
Selective pressures imposed by pathogenic microorganisms to embryos have selected in hosts for a battery of antimicrobial lines of defenses that includes physical and chemical barriers. Due to the antimicrobial properties of volatile compounds of green plants and of chemicals of feather degrading bacteria, the use of aromatic plants and feathers for nest building has been suggested as one of these barriers. However, experimental evidence suggesting such effects is scarce in the literature. During two consecutive years, we explored experimentally the effects of these nest materials on loads of different groups of bacteria (mesophilic bacteria, Enterobacteriaceae, Staphylococcus and Enterococcus) of eggshells in nests of spotless starlings (Sturnus unicolor) at the beginning and at the end of the incubation period. This was also explored in artificial nests without incubation activity. We also experimentally increased bacterial density of eggs in natural and artificial nests and explored the effects of nest lining treatments on eggshell bacterial load. Support for the hypothetical antimicrobial function of nest materials was mainly detected for the year and location with larger average values of eggshell bacterial density. The beneficial effects of feathers and plants were more easily detected in artificial nests with no incubation activity, suggesting an active role of incubation against bacterial colonization of eggshells. Pigmented and unpigmented feathers reduced eggshell bacterial load in starling nests and artificial nest boxes. Results from artificial nests allowed us to discuss and discard alternative scenarios explaining the detected association, particularly those related to the possible sexual role of feathers and aromatic plants in starling nests. All these results considered together confirm the antimicrobial functionality mainly of feathers but also of plants used as nest materials, and highlight the importance of temporally and geographically
Khalaf, Eman M.; Raizada, Manish N.
2018-01-01
The cucurbit vegetables, including cucumbers, melons and pumpkins, have been cultivated for thousands of years without fungicides. However, their seed germination stage is prone to be infected by soil-borne fungal and oomycete pathogens. Endophytes are symbionts that reside inside plant tissues including seeds. Seed endophytes are founders of the juvenile plant microbiome and can promote host defense at seed germination and later stages. We previously isolated 169 bacterial endophytes associated with seeds of diverse cultivated cucurbits. We hypothesized that these endophytes can antagonize major fungal and oomycete pathogens. Here we tested the endophytes for in vitro antagonism (dual culture assays) against important soil-borne pathogens (Rhizoctonia solani, Fusarium graminearum, Phytophthora capsici, Pythium aphanideratum). The endophytes were also assayed in planta (leaf disk and detached leaf bioassays) for antagonism against a foliar pathogen of global importance, Podosphaera fuliginea, the causative agent of cucurbit powdery mildew. The endophytes were further tested in vitro for secretion of volatile organic compounds (VOCs) known to induce plant defense. Extracellular ribonuclease activity was also tested, as a subset of pathogenesis-related (PR) proteins of plant hosts implicated in suppression of fungal pathogens, displays ribonuclease activity. An unexpected majority of the endophytes (70%, 118/169) exhibited antagonism to the five phytopathogens, of which 68% (50/73) of in vitro antagonists belong to the genera Bacillus and Paenibacillus. All Lactococcus and Pantoea endophytes exhibited anti-oomycete activity. However, amongst the most effective inoculants against Podosphaera fuliginea were Pediococcus and Pantoea endophytes. Interestingly, 67% (113/169) of endophytes emitted host defense inducing VOCs (acetoin/diacetyl) and 62% (104/169) secreted extracellular ribonucleases in vitro, respectively. These results show that seeds of cultivated cucurbits
Directory of Open Access Journals (Sweden)
Eman M. Khalaf
2018-02-01
Full Text Available The cucurbit vegetables, including cucumbers, melons and pumpkins, have been cultivated for thousands of years without fungicides. However, their seed germination stage is prone to be infected by soil-borne fungal and oomycete pathogens. Endophytes are symbionts that reside inside plant tissues including seeds. Seed endophytes are founders of the juvenile plant microbiome and can promote host defense at seed germination and later stages. We previously isolated 169 bacterial endophytes associated with seeds of diverse cultivated cucurbits. We hypothesized that these endophytes can antagonize major fungal and oomycete pathogens. Here we tested the endophytes for in vitro antagonism (dual culture assays against important soil-borne pathogens (Rhizoctonia solani, Fusarium graminearum, Phytophthora capsici, Pythium aphanideratum. The endophytes were also assayed in planta (leaf disk and detached leaf bioassays for antagonism against a foliar pathogen of global importance, Podosphaera fuliginea, the causative agent of cucurbit powdery mildew. The endophytes were further tested in vitro for secretion of volatile organic compounds (VOCs known to induce plant defense. Extracellular ribonuclease activity was also tested, as a subset of pathogenesis-related (PR proteins of plant hosts implicated in suppression of fungal pathogens, displays ribonuclease activity. An unexpected majority of the endophytes (70%, 118/169 exhibited antagonism to the five phytopathogens, of which 68% (50/73 of in vitro antagonists belong to the genera Bacillus and Paenibacillus. All Lactococcus and Pantoea endophytes exhibited anti-oomycete activity. However, amongst the most effective inoculants against Podosphaera fuliginea were Pediococcus and Pantoea endophytes. Interestingly, 67% (113/169 of endophytes emitted host defense inducing VOCs (acetoin/diacetyl and 62% (104/169 secreted extracellular ribonucleases in vitro, respectively. These results show that seeds of cultivated
Directory of Open Access Journals (Sweden)
Eman M. Khalaf
2018-02-01
Full Text Available The cucurbit vegetables, including cucumbers, melons and pumpkins, have been cultivated for thousands of years without fungicides. However, their seed germination stage is prone to be infected by soil-borne fungal and oomycete pathogens. Endophytes are symbionts that reside inside plant tissues including seeds. Seed endophytes are founders of the juvenile plant microbiome and can promote host defense at seed germination and later stages. We previously isolated 169 bacterial endophytes associated with seeds of diverse cultivated cucurbits. We hypothesized that these endophytes can antagonize major fungal and oomycete pathogens. Here we tested the endophytes for in vitro antagonism (dual culture assays against important soil-borne pathogens (Rhizoctonia solani, Fusarium graminearum, Phytophthora capsici, Pythium aphanidermatum. The endophytes were also assayed in planta (leaf disk and detached leaf bioassays for antagonism against a foliar pathogen of global importance, Podosphaera fuliginea, the causative agent of cucurbit powdery mildew. The endophytes were further tested in vitro for secretion of volatile organic compounds (VOCs known to induce plant defense. Extracellular ribonuclease activity was also tested, as a subset of pathogenesis-related (PR proteins of plant hosts implicated in suppression of fungal pathogens, displays ribonuclease activity. An unexpected majority of the endophytes (70%, 118/169 exhibited antagonism to the five phytopathogens, of which 68% (50/73 of in vitro antagonists belong to the genera Bacillus and Paenibacillus. All Lactococcus and Pantoea endophytes exhibited anti-oomycete activity. However, amongst the most effective inoculants against Podosphaera fuliginea were Pediococcus and Pantoea endophytes. Interestingly, 67% (113/169 of endophytes emitted host defense inducing VOCs (acetoin/diacetyl and 62% (104/169 secreted extracellular ribonucleases in vitro, respectively. These results show that seeds of cultivated
Detection of Bacterial Endospores in Soil by Terbium Fluorescence
Directory of Open Access Journals (Sweden)
Andrea Brandes Ammann
2011-01-01
Full Text Available Spore formation is a survival mechanism of microorganisms when facing unfavorable environmental conditions resulting in “dormant” states. We investigated the occurrence of bacterial endospores in soils from various locations including grasslands (pasture, meadow, allotment gardens, and forests, as well as fluvial sediments. Bacterial spores are characterized by their high content of dipicolinic acid (DPA. In the presence of terbium, DPA forms a complex showing a distinctive photoluminescence spectrum. DPA was released from soil by microwaving or autoclaving. The addition of aluminium chloride reduced signal quenching by interfering compounds such as phosphate. The highest spore content (up to 109 spores per gram of dry soil was found in grassland soils. Spore content is related to soil type, to soil depth, and to soil carbon-to-nitrogen ratio. Our study might provide a basis for the detection of “hot spots” of bacterial spores in soil.
Chronic bacterial prostatitis in men with spinal cord injury.
Krebs, Jörg; Bartel, Peter; Pannek, Jürgen
2014-12-01
Recurrent urinary tract infections (UTI) are a major problem affecting spinal cord injury (SCI) patients and may stem from chronic bacterial prostatitis. We have therefore investigated the presence of chronic bacterial prostatitis and its role in the development of recurrent symptomatic UTI in SCI men. This study is a prospective cross-sectional investigation of bacterial prostatitis in SCI men in a single SCI rehabilitation center. In 50 men with chronic SCI presenting for a routine urologic examination, urine samples before and after prostate massage were taken for microbiologic investigation and white blood cell counting. Furthermore, patient characteristics, bladder diary details, and the annual rate of symptomatic UTI were collected retrospectively. No participant reported current symptoms of UTI or prostatitis. In most men (39/50, 78 %), the microbiologic analysis of the post-massage urine sample revealed growth of pathogenic bacteria. The majority of these men (32/39, 82 %) also presented with mostly (27/39, 69 %) the same pathogenic bacteria in the pre-massage sample. There was no significant (p = 0.48) difference in the number of symptomatic UTI in men with a positive post-massage culture compared with those with a negative culture. No significant (p = 0.67) difference in the frequency distribution of positive versus negative post-massage cultures was detected between men with recurrent and sporadic UTI. Most SCI men are affected by asymptomatic bacterial prostatitis; however, bacterial prostatitis does not play a major role in the development of recurrent UTI. The indication for antibiotic treatment of chronic bacterial prostatitis in asymptomatic SCI men with recurrent UTI is questionable.
Efficiency of Airborne Sample Analysis Platform (ASAP Bioaerosol Sampler for Pathogen Detection
Directory of Open Access Journals (Sweden)
Anurag eSharma
2015-05-01
Full Text Available The threat of bioterrorism and pandemics has highlighted the urgency for rapid and reliable bioaerosol detection in different environments. Safeguarding against such threats requires continuous sampling of the ambient air for pathogen detection. In this study we investigated the efficacy of the Airborne Sample Analysis Platform (ASAP 2800 bioaerosol sampler to collect representative samples of air and identify specific viruses suspended as bioaerosols. To test this concept, we aerosolized an innocuous replication-defective bovine adenovirus serotype 3 (BAdV3 in a controlled laboratory environment. The ASAP efficiently trapped the surrogate virus at 5×10E3 plaque-forming units (p.f.u. [2×10E5 genome copy equivalent] concentrations or more resulting in the successful detection of the virus using quantitative PCR. These results support the further development of ASAP for bioaerosol pathogen detection.
High level bacterial contamination of secondary school students' mobile phones.
Kõljalg, Siiri; Mändar, Rando; Sõber, Tiina; Rööp, Tiiu; Mändar, Reet
2017-06-01
While contamination of mobile phones in the hospital has been found to be common in several studies, little information about bacterial abundance on phones used in the community is available. Our aim was to quantitatively determine the bacterial contamination of secondary school students' mobile phones. Altogether 27 mobile phones were studied. The contact plate method and microbial identification using MALDI-TOF mass spectrometer were used for culture studies. Quantitative PCR reaction for detection of universal 16S rRNA, Enterococcus faecalis 16S rRNA and Escherichia coli allantoin permease were performed, and the presence of tetracycline ( tet A, tet B, tet M), erythromycin ( erm B) and sulphonamide ( sul 1) resistance genes was assessed. We found a high median bacterial count on secondary school students' mobile phones (10.5 CFU/cm 2 ) and a median of 17,032 bacterial 16S rRNA gene copies per phone. Potentially pathogenic microbes ( Staphylococcus aureus , Acinetobacter spp. , Pseudomonas spp., Bacillus cereus and Neisseria flavescens ) were found among dominant microbes more often on phones with higher percentage of E. faecalis in total bacterial 16S rRNA. No differences in contamination level or dominating bacterial species between phone owner's gender and between phone types (touch screen/keypad) were found. No antibiotic resistance genes were detected on mobile phone surfaces. Quantitative study methods revealed high level bacterial contamination of secondary school students' mobile phones.
Experimental single-strain mobilomics reveals events that shape pathogen emergence.
Schoeniger, Joseph S; Hudson, Corey M; Bent, Zachary W; Sinha, Anupama; Williams, Kelly P
2016-08-19
Virulence genes on mobile DNAs such as genomic islands (GIs) and plasmids promote bacterial pathogen emergence. Excision is an early step in GI mobilization, producing a circular GI and a deletion site in the chromosome; circular forms are also known for some bacterial insertion sequences (ISs). The recombinant sequence at the junctions of such circles and deletions can be detected sensitively in high-throughput sequencing data, using new computational methods that enable empirical discovery of mobile DNAs. For the rich mobilome of a hospital Klebsiella pneumoniae strain, circularization junctions (CJs) were detected for six GIs and seven IS types. Our methods revealed differential biology of multiple mobile DNAs, imprecision of integrases and transposases, and differential activity among identical IS copies for IS26, ISKpn18 and ISKpn21 Using the resistance of circular dsDNA molecules to exonuclease, internally calibrated with the native plasmids, showed that not all molecules bearing GI CJs were circular. Transpositions were also detected, revealing replicon preference (ISKpn18 prefers a conjugative IncA/C2 plasmid), local action (IS26), regional preferences, selection (against capsule synthesis) and IS polarity inversion. Efficient discovery and global characterization of numerous mobile elements per experiment improves accounting for the new gene combinations that arise in emerging pathogens. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Detection of Acute Gastroenteritis Agents By Molecular Methods
Directory of Open Access Journals (Sweden)
Şafak Göktaş
2018-03-01
Full Text Available Objective: Gastroenteritis is the most important cause of morbidity and mortality in all age groups all over the world. Multiplex PCR tests give sensitive and specific results in the investigation of bacterial, viral, parasitic agents. In this study, it was aimed to determine the agents of the stool specimens of patients with acute diarrhea by multiplex PCR. Materials and Methods: Stool sample taken from 471 patients sent to Istanbul Gelişim Laboratories between January 1, 2015 and September 30, 2016 was included in the study. All stool samples were processed according to manufacturer’s instructions with GastroFinder SMART 18 FAST multiplex PCR test (Pathofinder, Holland. 18 different gastrointestinal pathogens were diagnosed in one study. Results: Of the 471 patients stool sample included in the study. The agent was negative in 241 (51.2%, while the agent was isolated in 230 (48.8%. 190 (82% had a single pathogen, 40 had two or more pathogens. Of the 190 samples detected with single agent, 149 (31.6% were bacterial, 26 (5.5% were parasitic and 15 (3.1% were viral agents. Of the 149 bacterial agents, 108 (23% was detected as Salmonella spp, 14 (6% as EHEC, 8 (3.5% as Clostridium difficile toxin A / B, 8 (3.5% as Campylobacter spp., 7 (3% Aeromonas spp., 2 (0.8% Yersinia enterocolitica, 2 (0.8% Enterotoxigenic E. coli (ETEC. Of 26 parasitic agents, 18 (7.8% was detected as Giardia lamblia, 6 (2.6% as Dientamoeba fragilis and 2 (0.8% as Cryptosporidium spp. Conclusion: Identification of enteric pathogens by multiplex PCR will avoids the use of unnecessary antibiotic treatments
2008-01-01
pathogens also have been detected and identified by numerous nucleic acid-based techniques, including Southern blot hybridization and direct nucleotide...Xanthomonas axonopodis pv. vitians FB-1309; ATCC19320 Lettuce ; USA 1 Xanthomonas axonopodis sp. alfalfae XA129; Med. 2 Alfalfa; Sudan 1 Xanthomonas
Lin, Yunfeng
2015-01-01
Bacteria such as Salmonella and E. coli present a great challenge in public health care in today’s society. Protection of public safety against bacterial contamination and rapid diagnosis of infection require simple and fast assays for the detection and elimination of bacterial pathogens. After utilizing Salmonella DT104 as an example bacterial strain for our investigation, we report a rapid and sensitive assay for the qualitative and quantitative detection of bacteria by using antibody affinity binding, popcorn shaped gold nanoparticle (GNPOPs) labeling, surfance enchanced Raman spectroscopy (SERS), and inductively coupled plasma mass spectrometry (ICP-MS) detection. For qualitative analysis, our assay can detect Salmonella within 10 min by Raman spectroscopy; for quantitative analysis, our assay has the ability to measure as few as 100 Salmonella DT104 in a 1 mL sample (100 CFU/mL) within 40 min. Based on the quantitative detection, we investigated the quantitative destruction of Salmonella DT104, and the assay’s photothermal efficiency in order to reduce the amount of GNPOPs in the assay to ultimately to eliminate any potential side effects/toxicity to the surrounding cells in vivo. Results suggest that our assay may serve as a promising candidate for qualitative and quantitative detection and elimination of a variety of bacterial pathogens. PMID:26417447
Bacterial and Viral Pathogens in Live Oysters: 2007 United States Market Survey ▿
DePaola, Angelo; Jones, Jessica L.; Woods, Jacquelina; Burkhardt, William; Calci, Kevin R.; Krantz, Jeffrey A.; Bowers, John C.; Kasturi, Kuppuswamy; Byars, Robin H.; Jacobs, Emily; Williams-Hill, Donna; Nabe, Khamphet
2010-01-01
Two samples of market oysters, primarily from retail establishments, were collected twice each month in each of nine states during 2007. Samples were shipped refrigerated overnight to five U.S. Food and Drug Administration laboratories on a rotating basis and analyzed by most probable number (MPN) for total and pathogenic Vibrio parahaemolyticus and V. vulnificus numbers and for the presence of toxigenic V. cholerae, Salmonella spp., norovirus (NoV), and hepatitis A virus (HAV). Levels of indicator organisms, including fecal coliforms (MPN), Escherichia coli (MPN), male-specific bacteriophage, and aerobic plate counts, were also determined. V. parahaemolyticus and V. vulnificus levels were distributed seasonally and geographically by harvest region and were similar to levels observed in a previous study conducted in 1998-1999. Levels of pathogenic V. parahaemolyticus were typically several logs lower than total V. parahaemolyticus levels regardless of season or region. Pathogenic V. parahaemolyticus levels in the Gulf and Mid-Atlantic regions were about two logs greater than the levels observed in the Pacific and North Atlantic regions. Pathogens generally associated with fecal pollution were detected sporadically or not at all (toxigenic V. cholerae, 0%; Salmonella, 1.5%; NoV, 3.9%; HAV, 4.4%). While seasonal prevalences of NoV and HAV were generally greater in oysters harvested from December to March, the low detection frequency obscured any apparent seasonal effects. Overall, there was no relationship between the levels of indicator microorganisms and the presence of enteric viruses. These data provide a baseline that can be used to further validate risk assessment predictions, determine the effectiveness of new control measures, and compare the level of protection provided by the U.S. shellfish sanitation system to those in other countries. PMID:20190085
Directory of Open Access Journals (Sweden)
Purnomo Soeharso
2005-12-01
Full Text Available Bioassay of Ureaplasma urealyticum is necessary for detection as well as determination of pathogenic factors in order to understand the pathogenesis of diseases associate with ureaplasma infection. Cultivation and verification of ureaplasma is the first step of this study in the purpose of discovering sensitive method for ureaplasma detection. Cultivation of ureaplasma either in liquid or in solid media are able to detect the existence of ureaplasma in samples analyzed. However, application of PCR using specific primers to be compatible with urease gene (ure would confirm the presence of ureaplasma. The pathogenicity of ureaplasma is potentially monitored using reporter gene as a marker for gene expression. IceC was chosen as reporter gene for ureaplasma pathogenic determination as the gene has great sensitivity, easily detectable and quantitated in simple method of ice nucleation assay. Transposon 916 (Tn916 was selected as a vector for iceC gene to transform ureaplasma. The application of recombinant Tn916-iceC which is considered as pUI, allow detection of ureaplasma activities when transform ureaplasma is tested by ice nucleation assay. It was expected that ureaplasma transformation is the manifestation of mutagenesis which interfere genes responsible for bacterial pathogenicity, in order pathogenesis of bacterial infection to be analyzed accurately. IgA1 protease is considered to be an important factor for ureaplasma pathogenicity as the enzyme is required for successful colonization. Identification of iga gene and determination of IgA1 protease activity are important for understanding the pathogenesis of ureaplasma infection. Putative iga gene of Mycoplasma genitalium was used as a reference to identify the presence of iga nucleotide sequence in U. urealyticum. Convincing evidence were obtained after PCR amplification of ureaplasma DNA using primers designed to be compatible with putative iga gene of M. genitalium followed by the
Pathogenic agents in freshwater resources
Geldreich, Edwin E.
1996-02-01
Numerous pathogenic agents have been found in freshwaters used as sources for water supplies, recreational bathing and irrigation. These agents include bacterial pathogens, enteric viruses, several protozoans and parasitic worms more common to tropical waters. Although infected humans are a major source of pathogens, farm animals (cattle, sheep, pigs), animal pets (dogs, cats) and wildlife serve as significant reservoirs and should not be ignored. The range of infected individuals within a given warm-blooded animal group (humans included) may range from 1 to 25%. Survival times for pathogens in the water environment may range from a few days to as much as a year (Ascaris, Taenia eggs), with infective dose levels varying from one viable cell for several primary pathogenic agents to many thousands of cells for a given opportunistic pathogen.As pathogen detection in water is complex and not readily incorporated into routine monitoring, a surrogate is necessary. In general, indicators of faecal contamination provide a positive correlation with intestinal pathogen occurrences only when appropriate sample volumes are examined by sensitive methodology.Pathways by which pathogens reach susceptible water users include ingestion of contaminated water, body contact with polluted recreational waters and consumption of salad crops irrigated by polluted freshwaters. Major contributors to the spread of various water-borne pathogens are sewage, polluted surface waters and stormwater runoff. All of these contributions are intensified during periods of major floods. Several water-borne case histories are cited as examples of breakdowns in public health protection related to water supply, recreational waters and the consumption of contaminated salad crops. In the long term, water resource management must focus on pollution prevention from point sources of waste discharges and the spread of pathogens in watershed stormwater runoff.
Schütte, Conny; Gols, Rieta; Kleespies, Regina G; Poitevin, Olivier; Dicke, Marcel
2008-06-01
were not observed in control predators that were exposed to sterile water. The present data prove that A. phytoseiuli can infect the predatory mite P. persimilis and induce the NR-syndrome and characteristic histopathological changes in adult female P. persimilis. This is the first record of a bacterial pathogen in a phytoseiid mite and the first description of pathogenic effects of a bacterial species in the genus Acaricomes.
Bustamante, C I; Drusano, G L; Wharton, R C; Wade, J C
1987-01-01
The combinations of imipenem plus ciprofloxacin and imipenem plus amikacin were investigated for their activity against Pseudomonas aeruginosa and other bacterial pathogens. For imipenem-susceptible P. aeruginosa, synergy of imipenem plus ciprofloxacin and imipenem plus amikacin was observed against 36 and 45% of the strains, respectively. The incidence of synergy against imipenem-resistant isolates of P. aeruginosa was 10% for both combinations. Antagonism was not observed with either combin...
Reyna-Fabián, Miriam E.; Zermeño, Valeria; Ximénez, Cecilia; Flores, Janin; Romero, Miguel F.; Diaz, Daniel; Argueta, Jesús; Moran, Patricia; Valadez, Alicia; Cerritos, René
2016-01-01
Several recent studies have demonstrated that virulence in Entamoeba histolytica is triggered in the presence of both pathogenic and nonpathogenic bacteria species using in vitro and in vivo experimental animal models. In this study, we examined samples aspirated from abscess material obtained from patients who were clinically diagnosed with amebic liver abscess (ALA) or pyogenic liver abscess (PLA). To determine the diversity of bacterial species in the abscesses, we performed partial 16S rRNA gene sequencing. In addition, the E. histolytica and Entamoeba dispar species were genotyped using tRNA-linked short tandem repeats as specific molecular markers. The association between clinical data and bacterial and parasite genotypes were examined through a correspondence analysis. The results showed the presence of numerous bacterial groups. These taxonomic groups constitute common members of the gut microbiota, although all of the detected bacterial species have a close phylogenetic relationship with bacterial pathogens. Furthermore, some patients clinically diagnosed with PLA and ALA were coinfected with E. dispar or E. histolytica, which suggests that the virulence of these parasites increased in the presence of bacteria. However, no specific bacterial groups were associated with this effect. Together, our results suggest a nonspecific mechanism of virulence modulation by bacteria in Entamoeba. PMID:26572872
Díaz-López, A; Cantú-Ramírez, R C; Garza-González, E; Ruiz-Tolentino, L; Tellez-Luis, S J; Rivera, G; Bocanegra-García, V
2011-08-01
We analyzed a total of 70 grilled chicken samples bought randomly from street vendors and retail outlets in the city of Reynosa, Mexico, to determine the prevalence of Escherichia coli (Shiga toxin producing and enterotoxin producing), Salmonella spp., Staphylococcus aureus, Listeria spp., and Campylobacter spp. using microbiological methods and PCR detection of bacterial sequences. Of the 70 samples, 27 (38.5%) were from retail outlets and 43 (61.4%) from street vendors. All specimens were negative by both microbiological and molecular methods for Listeria monocytogenes, Shiga toxin 2 of Shiga toxin-producing E. coli, lt of enterotoxin-producing E. coli, and st enterotoxin, and all were negative for Salmonella spp. and Campylobacter jejuni by PCR. Of the samples studied, 49 (70%) had undetectable levels of the foodborne pathogens studied with the methods used. In the remaining 21 (30%) specimens, at least one pathogen was isolated or detected, with E. coli being the pathogen most frequently isolated and with two samples bearing the hlyA gene. We found no statistical difference in bacterial prevalence between retail and street vendor samples. The presence of pathogens in grilled chicken is an important public health risk because of the great demand for and daily consumption of this product in this region.
Moriyama, Hiromitsu; Fukuhara, Toshiyuki
2012-01-01
Kasugamycin (KSM), a unique aminoglycoside antibiotic, has been used in agriculture for many years to control not only rice blast caused by the fungus Magnaporthe grisea but also rice bacterial grain and seedling rot or rice bacterial brown stripe caused by Burkholderia glumae or Acidovorax avenae subsp. avenae, respectively. Since both bacterial pathogens are seed-borne and cause serious injury to rice seedlings, the emergence of KSM-resistant B. glumae and A. avenae isolates highlights the urgent need to understand the mechanism of resistance to KSM. Here, we identified a novel gene, aac(2′)-IIa, encoding a KSM 2′-N-acetyltransferase from both KSM-resistant pathogens but not from KSM-sensitive bacteria. AAC(2′)-IIa inactivates KSM, although it reveals no cross-resistance to other aminoglycosides. The aac(2′)-IIa gene from B. glumae strain 5091 was identified within the IncP genomic island inserted into the bacterial chromosome, indicating the acquisition of this gene by horizontal gene transfer. Although excision activity of the IncP island and conjugational gene transfer was not detected under the conditions tested, circular intermediates containing the aac(2′)-IIa gene were detected. These results indicate that the aac(2′)-IIa gene had been integrated into the IncP island of a donor bacterial species. Molecular detection of the aac(2′)-IIa gene could distinguish whether isolates are resistant or susceptible to KSM. This may contribute to the production of uninfected rice seeds and lead to the effective control of these pathogens by KSM. PMID:22660700
Bacterial Genome Engineering and Synthetic Biology: Combating Pathogens
2016-11-04
extremely high genome sequence similarity between non-pathogenic and pathogenic strains by targeting small sequence variations present in the...Microbiol 2011, 14(5):524-531. 46. Bikard D, Euler CW, Jiang W, Nussenzweig PM, Goldberg GW, Duportet X, Fischetti VA, Marraffini LA: Exploiting
Cao, Jing; Feng, Chao; Liu, Yan; Wang, Shouyu; Liu, Fei
2014-07-15
Since many diseases are caused by pathogenic bacterial infections, accurate and rapid detection of pathogenic bacteria is in urgent need to timely apply appropriate treatments and to reduce economic costs. To end this, we designed molecular beacon-Au nanoparticle hybrid nanoprobes to improve the bacterial detection efficiency and sensitivity. Here, we show that the designed molecular beacon modified Au nanoparticles could specifically recognize synthetic DNAs targets and can readily detect targets in clinical samples. Moreover, the hybrid nanoprobes can recognize Escherichia coli within an hour at a concentration of 10(2) cfu/ml, which is 1000-folds sensitive than using molecular beacon directly. Our results show that the molecular beacon-Au nanoparticle hybrid nanoprobes have great potential in medical and biological applications. Copyright © 2014 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Soumitra Paul Chowdhury
Full Text Available The soil-borne pathogen Rhizoctonia solani is responsible for crop losses on a wide range of important crops worldwide. The lack of effective control strategies and the increasing demand for organically grown food has stimulated research on biological control. The aim of the present study was to evaluate the rhizosphere competence of the commercially available inoculant Bacillus amyloliquefaciens FZB42 on lettuce growth and health together with its impact on the indigenous rhizosphere bacterial community in field and pot experiments. Results of both experiments demonstrated that FZB42 is able to effectively colonize the rhizosphere (7.45 to 6.61 Log 10 CFU g(-1 root dry mass within the growth period of lettuce in the field. The disease severity (DS of bottom rot on lettuce was significantly reduced from severe symptoms with DS category 5 to slight symptom expression with DS category 3 on average through treatment of young plants with FZB42 before and after planting. The 16S rRNA gene based fingerprinting method terminal restriction fragment length polymorphism (T-RFLP showed that the treatment with FZB42 did not have a major impact on the indigenous rhizosphere bacterial community. However, the bacterial community showed a clear temporal shift. The results also indicated that the pathogen R. solani AG1-IB affects the rhizosphere microbial community after inoculation. Thus, we revealed that the inoculant FZB42 could establish itself successfully in the rhizosphere without showing any durable effect on the rhizosphere bacterial community.
Comparative analysis of glutaredoxin domains from bacterial opportunistic pathogens
International Nuclear Information System (INIS)
Leeper, Thomas; Zhang, Suxin; Van Voorhis, Wesley C.; Myler, Peter J.; Varani, Gabriele
2011-01-01
NMR structures of the glutaredoxin (GLXR) domains from Br. melitensis and Ba. henselae have been determined as part of the SSGCID initiative. Comparison of the domains with known structures reveals overall structural similarity between these proteins and previously determined E. coli GLXR structures, with minor changes associated with the position of helix 1 and with regions that diverge from similar structures found in the closest related human homolog. Glutaredoxin proteins (GLXRs) are essential components of the glutathione system that reductively detoxify substances such as arsenic and peroxides and are important in the synthesis of DNA via ribonucleotide reductases. NMR solution structures of glutaredoxin domains from two Gram-negative opportunistic pathogens, Brucella melitensis and Bartonella henselae, are presented. These domains lack the N-terminal helix that is frequently present in eukaryotic GLXRs. The conserved active-site cysteines adopt canonical proline/tyrosine-stabilized geometries. A difference in the angle of α-helix 2 relative to the β-sheet surface and the presence of an extended loop in the human sequence suggests potential regulatory regions and/or protein–protein interaction motifs. This observation is consistent with mutations in this region that suppress defects in GLXR–ribonucleotide reductase interactions. These differences between the human and bacterial forms are adjacent to the dithiol active site and may permit species-selective drug design
[Polyvalence of bacteriophages isolated from fruit trees, affected by bacterial fire blight].
Tovkach, F I; Moroz, S N; Korol', N A; Faĭdiuk, Iu V; Kushkina, A I
2013-01-01
Phage populations appearing as a result of a pathogenic process caused by Erwinia amylovora have been discovered and described. They accompany bacterial fire blight development in the process of quince, pear and apple trees vegetation in Zakarpattya region of Ukraine. Phage isolates of the affected pear and quince include polyvalent virulent phages able to develop on bacterial strains associated with plants--E. amylovora. E. "horticola" and Pantoea agglomerans. E. amylovora isolated from the plant tissues affected by the fire blight and detected at the same time as phages proved to be resistant to the viral infection. It is hard to explain now this characteristic however it was noticed that resistance to phages can change drastically in case of dissociation, lysogenization and mutagenesis of erwinia in laboratory conditions. Phage population study shows that they are heterogeneous and can obviously include not only polyvalent but also specific viruses. Further studies of biology and molecular genetics of pure lines of isolated phages will help to get closer to understanding the place and role of bacteriophages in the complicated network of relations between bacterial pathogens and plants.
Nagel, Raimund; Turrini, Paula C G; Nett, Ryan S; Leach, Jan E; Verdier, Valérie; Van Sluys, Marie-Anne; Peters, Reuben J
2017-05-01
Phytopathogens have developed elaborate mechanisms to attenuate the defense response of their host plants, including convergent evolution of complex pathways for production of the GA phytohormones, which were actually first isolated from the rice fungal pathogen Gibberella fujikuroi. The rice bacterial pathogen Xanthomonas oryzae pv. oryzicola (Xoc) has been demonstrated to contain a biosynthetic operon with cyclases capable of producing the universal GA precursor ent-kaurene. Genetic (knock-out) studies indicate that the derived diterpenoid serves as a virulence factor for this rice leaf streak pathogen, serving to reduce the jasmonic acid-mediated defense response. Here the functions of the remaining genes in the Xoc operon are elucidated and the distribution of the operon in X. oryzae is investigated in over 100 isolates. The Xoc operon leads to production of the bioactive GA 4 , an additional step beyond production of the penultimate precursor GA 9 mediated by the homologous operons recently characterized from rhizobia. Moreover, this GA biosynthetic operon was found to be widespread in Xoc (> 90%), but absent in the other major X. oryzae pathovar. These results indicate selective pressure for production of GA 4 in the distinct lifestyle of Xoc, and the importance of GA to both fungal and bacterial pathogens of rice. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.
Maximizing the chances of detecting pathogenic leptospires in mammals
DEFF Research Database (Denmark)
Tulsiani, Suhella; Graham, G C; Dohnt, M F
2011-01-01
. In the earlier field investigation, serum, renal tissue and urine were collected from wild mammals, for the detection of pathogenic leptospires by culture, the microscopic agglutination test (MAT), real-time PCR and silver impregnation of smears. Although 27.6% of the rodents investigated were found leptospire....../ml, did not affect the viability or the detection of leptospires in culture, and is therefore unlikely to reduce the chances of isolating leptospires from an animal that has been euthanized with the compound. It appears that collecting multiple samples from each mammal being checked will improve...
Adenoid Reservoir for Pathogenic Biofilm Bacteria▿
Nistico, L.; Kreft, R.; Gieseke, A.; Coticchia, J. M.; Burrows, A.; Khampang, P.; Liu, Y.; Kerschner, J. E.; Post, J. C.; Lonergan, S.; Sampath, R.; Hu, F. Z.; Ehrlich, G. D.; Stoodley, P.; Hall-Stoodley, L.
2011-01-01
Biofilms of pathogenic bacteria are present on the middle ear mucosa of children with chronic otitis media (COM) and may contribute to the persistence of pathogens and the recalcitrance of COM to antibiotic treatment. Controlled studies indicate that adenoidectomy is effective in the treatment of COM, suggesting that the adenoids may act as a reservoir for COM pathogens. To investigate the bacterial community in the adenoid, samples were obtained from 35 children undergoing adenoidectomy for chronic OM or obstructive sleep apnea. We used a novel, culture-independent molecular diagnostic methodology, followed by confocal microscopy, to investigate the in situ distribution and organization of pathogens in the adenoids to determine whether pathogenic bacteria exhibited criteria characteristic of biofilms. The Ibis T5000 Universal Biosensor System was used to interrogate the extent of the microbial diversity within adenoid biopsy specimens. Using a suite of 16 broad-range bacterial primers, we demonstrated that adenoids from both diagnostic groups were colonized with polymicrobial biofilms. Haemophilus influenzae was present in more adenoids from the COM group (P = 0.005), but there was no significant difference between the two patient groups for Streptococcus pneumoniae or Staphylococcus aureus. Fluorescence in situ hybridization, lectin binding, and the use of antibodies specific for host epithelial cells demonstrated that pathogens were aggregated, surrounded by a carbohydrate matrix, and localized on and within the epithelial cell surface, which is consistent with criteria for bacterial biofilms. PMID:21307211
Screening for Sexually Transmitted Infection Pathogens in Semen Samples
Directory of Open Access Journals (Sweden)
RW Peeling
2005-01-01
Full Text Available The transmission of sexually transmitted infection (STI pathogens from an infected donor to the recipient of a semen donation in assisted conception may result not only in acute infection but also in long-term reproductive complications or adverse outcomes of pregnancy, including infection of the offspring. Screening for bacterial STI pathogens, Chlamydia trachomatis and Neisseria gonorrhoeae is strongly recommended because these pathogens can cause serious reproductive complications in the recipients of semen donations and infection in their offspring. Screening for these pathogens should be performed using the most sensitive methods, such as nucleic acid amplified tests. False-negative results due to inhibitory substances in the semen sample should be monitored using amplification controls. Where specimen transport is not a problem and culture facilities are available, N gonorrhoeae can also be detected by culture. Laboratories performing screening should subscribe to proficiency programs and have strict quality controls. Although Trichomonas vaginalis, group B streptococcus and genital mycoplasmas have been associated with adverse outcomes of pregnancy, the frequent finding of these organisms in healthy individuals brings into question the validity of mandatory inclusion of these organisms in the screening panel. Although viral STI pathogens and Treponema pallidum -- the causative agent of syphilis -- may be detected in semen, their presence may be more sensitively detected through antibody testing of the donor. Screening donors for HIV, hepatitis B and syphilis by serology is uniformly recommended in all of the guidelines, but the value of screening either donors or semen samples for cytomegalovirus, herpes simplex viruses and human papilloma viruses is less clear.
Bacterial and parasitic diseases of parrots.
Doneley, Robert J T
2009-09-01
As wild-caught birds become increasingly rare in aviculture, there is a corresponding decline in the incidence of bacterial and parasitic problems and an increase in the recognition of the importance of maintaining health through better nutrition and husbandry. Nevertheless, the relatively close confines of captivity mean an increased pathogen load in the environment in which companion and aviary parrots live. This increased pathogen load leads to greater exposure of these birds to bacteria and parasites, and consequently a greater risk of infection and disease. This article discusses bacterial and parasitic infections in companion and aviary parrots. It includes the origins, pathogens, diagnosis, treatment, and some of the associated risk factors.
Jaeger, S; Virchow, F; Torgerson, P R; Bischoff, M; Biner, B; Hartnack, S; Rüegg, S R
2017-09-01
Bovine mastitis is an important disease in the dairy industry, causing economic losses as a result of withheld milk and treatment costs. Several studies have suggested milk amyloid A (MAA) as a promising biomarker in the diagnosis of mastitis. In the absence of a gold standard for diagnosis of subclinical mastitis, we estimated the diagnostic test accuracy of a commercial MAA-ELISA, somatic cell count (SCC), and bacteriological culture using Bayesian latent class modeling. We divided intramammary infections into 2 classes: those caused by major pathogens (e.g., Escherichia coli, Staphylococcus aureus, streptococci, and lacto-/enterococci) and those caused by all pathogens (major pathogens plus Corynebacterium bovis, coagulase-negative staphylococci, Bacillus spp., Streptomyces spp.). We applied the 3 diagnostic tests to all samples. Of 433 composite milk samples included in this study, 275 (63.5%) contained at least 1 colony of any bacterial species; of those, 56 contained major pathogens and 219 contained minor pathogens. The remaining 158 samples (36.5%) were sterile. We determined 2 different thresholds for the MAA-ELISA using Bayesian latent class modeling: 3.9 µg/mL to detect mastitis caused by major pathogens and 1.6 µg/mL to detect mastitis caused by all pathogens. The optimal SCC threshold for identification of subclinical mastitis was 150,000 cells/mL; this threshold led to higher specificity (Sp) than 100,000 cells/mL. Test accuracy for major-pathogen intramammary infections was as follows: SCC, sensitivity (Se) 92.6% and Sp 72.9%; MAA-ELISA, Se 81.4% and Sp 93.4%; bacteriological culture, Se 23.8% and Sp 95.2%. Test accuracy for all-pathogen intramammary infections was as follows: SCC, sensitivity 90.3% and Sp 71.8%; MAA-ELISA, Se 88.0% and Sp 65.2%; bacteriological culture, Se 83.8% and Sp 54.8%. We suggest the use of SCC and MAA-ELISA as a combined screening procedure for situations such as a Staphylococcus aureus control program. With Bayesian
Pathogenic and genetic diversity of Xanthomonas translucens pv. undulosa in North Dakota.
Adhikari, Tika B; Gurung, Suraj; Hansen, Jana M; Bonman, J Michael
2012-04-01
Bacterial leaf streak (BLS), caused by Xanthomonas translucens pv. undulosa, has become more prevalent recently in North Dakota and neighboring states. From five locations in North Dakota, 226 strains of X. translucens pv. undulosa were collected and evaluated for pathogenicity and then selected strains were inoculated on a set of 12 wheat cultivars and other cereal hosts. The genetic diversity of all strains was determined using repetitive sequence-based polymerase chain reaction (rep-PCR) and insertion sequence-based (IS)-PCR. Bacterial strains were pathogenic on wheat and barley but symptom severity was greatest on wheat. Strains varied greatly in aggressiveness, and wheat cultivars also showed differential responses to several strains. The 16S ribosomal DNA sequences of the strains were identical, and distinct from those of the other Xanthomonas pathovars. Combined rep-PCR and IS-PCR data produced 213 haplotypes. Similar haplotypes were detected in more than one location. Although diversity was greatest (≈92%) among individuals within a location, statistically significant (P ≤ 0.001 or 0.05) genetic differentiation among locations was estimated, indicating geographic differentiation between pathogen populations. The results of this study provide information on the pathogen diversity in North Dakota, which will be useful to better identify and characterize resistant germplasm.
[Spontaneous bacterial peritonitis].
Velkey, Bálint; Vitális, Eszter; Vitális, Zsuzsanna
2017-01-01
Spontaneous bacterial peritonitis occurs most commonly in cirrhotic patients with ascites. Pathogens get into the circulation by intestinal translocation and colonize in peritoneal fluid. Diagnosis of spontaneous bacterial peritonitis is based on elevated polymorphonuclear leukocyte count in the ascites (>0,25 G/L). Ascites culture is often negative but aids to get information about antibiotic sensitivity in positive cases. Treatment in stable patient can be intravenous then orally administrated ciprofloxacin or amoxicillin/clavulanic acid, while in severe cases intravenous III. generation cephalosporin. Nosocomial spontaneous bacterial peritonitis often caused by Gram-positive bacteria and multi-resistant pathogens can also be expected thus carbapenem should be the choice of the empiric treatment. Antibiotic prophylaxis should be considered. Norfloxacin is used most commonly, but changes are expected due to increase in quinolone resistance. As a primary prophylaxis, a short-term antibiotic treatment is recommended after gastrointestinal bleeding for 5 days, while long-term prophylaxis is for patients with low ascites protein, and advanced disease (400 mg/day). Secondary prophylaxis is recommended for all patients recovered from spontaneous bacterial peritonitis. Due to increasing antibiotic use of antibiotics prophylaxis is debated to some degree. Orv. Hetil., 2017, 158(2), 50-57.
Molecular mimicry modulates plant host responses to pathogens.
Ronald, Pamela; Joe, Anna
2018-01-25
Pathogens often secrete molecules that mimic those present in the plant host. Recent studies indicate that some of these molecules mimic plant hormones required for development and immunity. This Viewpoint reviews the literature on microbial molecules produced by plant pathogens that functionally mimic molecules present in the plant host. This article includes examples from nematodes, bacteria and fungi with emphasis on RaxX, a microbial protein produced by the bacterial pathogen Xanthomonas oryzae pv. oryzae. RaxX mimics a plant peptide hormone, PSY (plant peptide containing sulphated tyrosine). The rice immune receptor XA21 detects sulphated RaxX but not the endogenous peptide PSY. Studies of the RaxX/XA21 system have provided insight into both host and pathogen biology and offered a framework for future work directed at understanding how XA21 and the PSY receptor(s) can be differentially activated by RaxX and endogenous PSY peptides. © The Author 2017. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Campylobacter jejuni & Inflammation : Grilling the pathogen
Bouwman, L.I.
2016-01-01
Campylobacter jejuni is the most common cause of bacterial foodborne disease. Yet, little is known about how this pathogen causes intestinal inflammation. The clinical pathology during human infection points to invasive bacterial behavior accompanied by the induction of potent pro-inflammatory
RecA: a universal drug target in pathogenic bacteria.
Pavlopoulou, Athanasia
2018-01-01
The spread of bacterial infectious diseases due to the development of resistance to antibiotic drugs in pathogenic bacteria is an emerging global concern. Therefore, the efficacious management and prevention of bacterial infections are major public health challenges. RecA is a pleiotropic recombinase protein that has been demonstrated to be implicated strongly in the bacterial drug resistance, survival and pathogenicity. In this minireview, RecA's role in the development of antibiotic resistance and its potential as an antimicrobial drug target are discussed.
Spittel, Susanne; Hoedemaker, Martina
2012-01-01
In the following field study, the commercial PathoProof Mastitis PCR Assay, a real-time PCR for identifying eleven mastitis pathogens and the staphylococcal beta-lactamase gene, was compared with conventional bacterial culture. For this purpose, 681 udder quarter samples from 173 clinically healthy cows with varying somatic cell count from four dairy herds in the region of Osnabrück, Lower Saxony, Germany, were collected between July 2010 and February 2011 and subjected to PCR and bacterial culture. The frequency of positive pathogen signals was markedly higher with PCR compared with culture (70.6% vs. 32.2%). This was accompanied by a substantial higher percentage of multiple pathogen identifications and a lower percentage of single identifications in the PCR compared with bacterial culture. Using bacterial culture as gold standard, moderate to high sensitivities (76.9-100%) and specificities (63.3-98.7%) were calculated for six out of seven pathogens with sufficient detection numbers. For Enterococcus spp, the sensitivity was only 9.1%. When the PCR results of pooled udder quarter samples of the 173 cows were compared with the single udder quarter samples, in 72% of the cases, major pathogen DNA was either not found in both types of samples, or in the case of a positive pool sample, the respective pathogens were found in at least one udder quarter sample. With both methods, the most frequently detected mastitis pathogens were coryneform bacteria (PCR: Corynebacterium bovis), coagulase-negative staphylococci (CNS) and Staphylococcus (S.) aureus, followed by Arcanobacterium pyogenes/Peptoniphilus indolicus with PCR, and then with both methods, Streptococcus uberis. The staphylococcal beta-lactamase gene was found in 27.7% of the S. aureus and in 37.0% of the CNS identifications.
Molecular and Genomic Characterization of Enteric Pathogens Circulating during Hajj
Alsomali, Mona
2016-05-01
Hajj, the annual Muslim pilgrimage to Mecca, Saudi Arabia is a unique mass gathering event that attracts approximately 3 million pilgrims from around the globe. This diverse pilgrim population coupled with the nature of the performed activities raise major public health concerns in the host country with potential global implications. Although gastroenteritis and diarrhea are common among the pilgrims performing Hajj, the microbial etiologies of these infections are still unknown. We used molecular and antigenic approaches to identify the main pathogens associated with Hajj diarrhea. 544 fecal samples from pilgrims suffering from diarrhea whilst performing Hajj during three consecutive seasons (2011-2013) and 99 control samples from 2011 were screened for 16 pathogens that include bacterial, parasitic and viral etiologies that are commonly associated with diarrheal infections. At least one of the screened pathogens could be detected in 42% (n=228) of the samples from the diarrheal cases. Bacteria were the main agents detected in 83% (n=189) of the positive samples, followed by viral and parasitic agents detected in 6% (n=14) and 5% (n=12) respectively. We have also standardized a 16S-based metagenomic approach to identify the gut microbiome in diarrheal cases and non-diarrheal controls in 76 samples. Also, we have standardized a shotgun metagenomics protocol for the direct characterization (diagnosis) of enteric pathogens without cultivation. This approach was used successfully to identify viral (adenovirus) and bacterial causes of Enterotoxigenic E. coli diarrhea from Hajj samples. The findings in this study fill in clear gaps in our knowledge of the etiologies associated with diarrheal infections during Hajj. Foodborne bacteria were the major contributors to Hajj-diarrheal infections. This was coupled with the increased incidences of antimicrobial resistance loci associated with the identified bacteria. These findings would help the public health policy makers to
Bulgari, Daniela; Casati, Paola; Quaglino, Fabio; Bianco, Piero A
2014-07-21
Endophytic bacteria benefit host plant directly or indirectly, e.g. by biocontrol of the pathogens. Up to now, their interactions with the host and with other microorganisms are poorly understood. Consequently, a crucial step for improving the knowledge of those relationships is to determine if pathogens or plant growing season influence endophytic bacterial diversity and dynamic. Four healthy, four phytoplasma diseased and four recovered (symptomatic plants that spontaneously regain a healthy condition) grapevine plants were sampled monthly from June to October 2010 in a vineyard in north-western Italy. Metagenomic DNA was extracted from sterilized leaves and the endophytic bacterial community dynamic and diversity were analyzed by taxon specific real-time PCR, Length-Heterogeneity PCR and genus-specific PCR. These analyses revealed that both sampling date and phytoplasma infection influenced the endophytic bacterial composition. Interestingly, in June, when the plants are symptomless and the pathogen is undetectable (i) the endophytic bacterial community associated with diseased grapevines was different from those in the other sampling dates, when the phytoplasmas are detectable inside samples; (ii) the microbial community associated with recovered plants differs from that living inside healthy and diseased plants. Interestingly, LH-PCR database identified bacteria previously reported as biocontrol agents in the examined grapevines. Of these, Burkholderia, Methylobacterium and Pantoea dynamic was influenced by the phytoplasma infection process and seasonality. Results indicated that endophytic bacterial community composition in grapevine is correlated to both phytoplasma infection and sampling date. For the first time, data underlined that, in diseased plants, the pathogen infection process can decrease the impact of seasonality on community dynamic. Moreover, based on experimental evidences, it was reasonable to hypothesize that after recovery the restructured
Antimicrobial susceptibility in community-acquired bacterial ...
African Journals Online (AJOL)
Objectives: To determine the antimicrobial susceptibility patterns of Streptococcus pneumoniae and Haemophilus influenzae, two bacterial pathogens commonly associated with communityacquired pneumonia. Design: Cross-sectional study. Setting: Bacterial isolates were obtained from adults suspected to have ...
Development of genetic methods for detection of pathogenic microorganisms in irradiated food
International Nuclear Information System (INIS)
2010-01-01
The existence of injured microorganisms in food and their recovery during culturing procedures is critical. Injured microorganisms present a potential threat in food safety since they may repair themselves under suitable conditions. This study provides development of recovery methods for detection of injured foodborne microorganisms, after irradiation treatment at different doses. For this purpose, iniatially the methods of recovery were compared at different irradiation doses. At the second step, antibiotic resistance of foodborne pathogens was determined. After determination of antibiotic resistance, recovery methods were modified for reversibly injured foodborne pathogens at different doses after irradiation treatment . Finally, damages of DNA were detected by a spectrophotometric method after 1.0 kGy irradiation treatment
Bacterial decontamination using ambient pressure nonthermal discharges
Energy Technology Data Exchange (ETDEWEB)
Birmingham, J.G.; Hammerstrom, D.J.
2000-02-01
Atmospheric pressure nonthermal plasmas can efficiently deactivate bacteria in gases, liquids, and on surfaces, as well as can decompose hazardous chemicals. This paper focuses on the changes to bacterial spores and toxic biochemical compounds, such as mycotoxins, after their treatment in ambient pressure discharges. The ability of nonthermal plasmas to decompose toxic chemicals and deactivate hazardous biological materials has been applied to sterilizing medical instruments, ozonating water, and purifying air. In addition, the fast lysis of bacterial spores and other cells has led us to include plasma devices within pathogen detection instruments, where nucleic acids must be accessed. Decontaminating chemical and biological warfare materials from large, high value targets such as building surfaces, after a terrorist attack, are especially challenging. A large area plasma decontamination technology is described.
Bacterial fatty acid metabolism in modern antibiotic discovery.
Yao, Jiangwei; Rock, Charles O
2017-11-01
Bacterial fatty acid synthesis is essential for many pathogens and different from the mammalian counterpart. These features make bacterial fatty acid synthesis a desirable target for antibiotic discovery. The structural divergence of the conserved enzymes and the presence of different isozymes catalyzing the same reactions in the pathway make bacterial fatty acid synthesis a narrow spectrum target rather than the traditional broad spectrum target. Furthermore, bacterial fatty acid synthesis inhibitors are single-targeting, rather than multi-targeting like traditional monotherapeutic, broad-spectrum antibiotics. The single-targeting nature of bacterial fatty acid synthesis inhibitors makes overcoming fast-developing, target-based resistance a necessary consideration for antibiotic development. Target-based resistance can be overcome through multi-targeting inhibitors, a cocktail of single-targeting inhibitors, or by making the single targeting inhibitor sufficiently high affinity through a pathogen selective approach such that target-based mutants are still susceptible to therapeutic concentrations of drug. Many of the pathogens requiring new antibiotic treatment options encode for essential bacterial fatty acid synthesis enzymes. This review will evaluate the most promising targets in bacterial fatty acid metabolism for antibiotic therapeutics development and review the potential and challenges in advancing each of these targets to the clinic and circumventing target-based resistance. This article is part of a Special Issue entitled: Bacterial Lipids edited by Russell E. Bishop. Copyright © 2016 Elsevier B.V. All rights reserved.
Human pathogens in plant biofilms: Formation, physiology, and detection.
Ximenes, Eduardo; Hoagland, Lori; Ku, Seockmo; Li, Xuan; Ladisch, Michael
2017-07-01
Fresh produce, viewed as an essential part of a healthy life style is usually consumed in the form of raw or minimally processed fruits and vegetables, and is a potentially important source of food-borne human pathogenic bacteria and viruses. These are passed on to the consumer since the bacteria can form biofilms or otherwise populate plant tissues, thereby using plants as vectors to infect animal hosts. The life cycle of the bacteria in plants differs from those in animals or humans and results in altered physiochemical and biological properties (e.g., physiology, immunity, native microflora, physical barriers, mobility, and temperature). Mechanisms by which healthy plants may become contaminated by microorganisms, develop biofilms, and then pass on their pathogenic burden to people are explored in the context of hollow fiber microfiltration by which plant-derived microorganisms may be recovered and rapidly concentrated to facilitate study of their properties. Enzymes, when added to macerated plant tissues, hydrolyze or alter macromolecules that would otherwise foul hollow-fiber microfiltration membranes. Hence, microfiltration may be used to quickly increase the concentration of microorganisms to detectable levels. This review discusses microbial colonization of vegetables, formation and properties of biofilms, and how hollow fiber microfiltration may be used to concentrate microbial targets to detectable levels. The use of added enzymes helps to disintegrate biofilms and minimize hollow fiber membrane fouling, thereby providing a new tool for more time effectively elucidating mechanisms by which biofilms develop and plant tissue becomes contaminated with human pathogens. Biotechnol. Bioeng. 2017;114: 1403-1418. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Sarah I. Bonnet
2017-06-01
Full Text Available Ticks are among the most important vectors of pathogens affecting humans and other animals worldwide. They do not only carry pathogens however, as a diverse group of commensal and symbiotic microorganisms are also present in ticks. Unlike pathogens, their biology and their effect on ticks remain largely unexplored, and are in fact often neglected. Nonetheless, they can confer multiple detrimental, neutral, or beneficial effects to their tick hosts, and can play various roles in fitness, nutritional adaptation, development, reproduction, defense against environmental stress, and immunity. Non-pathogenic microorganisms may also play a role in driving transmission of tick-borne pathogens (TBP, with many potential implications for both human and animal health. In addition, the genetic proximity of some pathogens to mutualistic symbionts hosted by ticks is evident when studying phylogenies of several bacterial genera. The best examples are found within members of the Rickettsia, Francisella, and Coxiella genera: while in medical and veterinary research these bacteria are traditionally recognized as highly virulent vertebrate pathogens, it is now clear to evolutionary ecologists that many (if not most Coxiella, Francisella, and Rickettsia bacteria are actually non-pathogenic microorganisms exhibiting alternative lifestyles as mutualistic ticks symbionts. Consequently, ticks represent a compelling yet challenging system in which to study microbiomes and microbial interactions, and to investigate the composition, functional, and ecological implications of bacterial communities. Ultimately, deciphering the relationships between tick microorganisms as well as tick symbiont interactions will garner invaluable information, which may aid in the future development of arthropod pest and vector-borne pathogen transmission control strategies.
Detection of Streptococcus iniae and Lactococcus garvieae by ...
African Journals Online (AJOL)
Streptococcosis is one of the most important bacterial diseases in farmed salmonid fishes. Streptococcus iniae and Lactococcus garvieae are known as the major pathogens of streptococcosis and lactococcosis in the rainbow trout, Oncorhynchus mykiss. The present study accomplished the detection of the two mentioned ...
Rôças, Isabela N.
2018-01-01
Introduction Acute apical abscess is caused by bacteria that leave the infected dental root canal to invade the periodontal tissues. Most species occurring in abscesses are also found in asymptomatic infections; therefore, the possibility exists that not only the presence of certain species but also their specific counts influence the appearance of symptoms. This molecular study compared the frequency and levels of several candidate endodontic pathogens in teeth with acute apical abscesses and asymptomatic apical periodontitis. Methods Samples were taken from the root canals of teeth with asymptomatic apical periodontitis (n = 73) and by aspiration of purulent exudate from acute abscesses (n = 55). DNA was extracted from samples and bacterial identifications were performed by a closed-ended semi-quantitative reverse-capture checkerboard approach targeting 40 bacterial species/phylotypes. Results Bacterial DNA was detected in all cases. In abscesses, the most prevalent taxa were Fusobacterium nucleatum (60%), Porphyromonas endodontalis (53%), Parvimonas micra (51%), and Streptococcus species (45%). The most frequently detected taxa in asymptomatic teeth were P. endodontalis (63%), Dialister invisus (58%), Olsenella uli (56%), and F. nucleatum (51%). None of the targeted taxa were significantly associated with abscesses when only mere presence was evaluated (p>0.05). However, semi-quantitative data demonstrated that P. endodontalis, Prevotella baroniae, Treponema denticola and Streptococcus species were significantly more frequent at levels >105 in abscesses than in asymptomatic cases (pabscesses in terms of frequency. However, some taxa were significantly found in higher levels in abscesses. Presence of a potentially virulent pathogen in high counts may increase the collective pathogenicity of the bacterial community and give rise to symptoms. PMID:29293651