WorldWideScience

Sample records for background dna primers

  1. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads;

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

  2. DNA sequencing by synthesis with degenerate primers

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    The degenerate primer-based sequencing Was developed by a synthesis method(DP-SBS)for high-throughput DNA sequencing,in which a set of degenerate primers are hybridized on the arrayed DNA templates and extended by DNA polymerase on microarrays.In this method,adifferent set of degenerate primers containing a give nnumber(n)of degenerate nucleotides at the 3'-ends were annealed to the sequenced templates that were immobilized on the solid surface.The nucleotides(n+1)on the template sequences were determined by detecting the incorporation of fluorescent labeled nucleotides.The fluorescent labeled nucleotide was incorporated into the primer in a base-specific manner after the enzymatic primer extension reactions and nine-base length were read out accurately.The main advanmge of the DP-SBS is that the method only uses very conventional biochemical reagents and avoids the complicated special chemical reagents for removing the labeled nucleotides and reactivating the primer for further extension.From the present study,it is found that the DP-SBS method is reliable,simple,and cost-effective for laboratory-sequencing a large amount of short DNA fragments.

  3. Streamlining DNA barcoding protocols: automated DNA extraction and a new cox1 primer in arachnid systematics.

    Directory of Open Access Journals (Sweden)

    Nina Vidergar

    Full Text Available BACKGROUND: DNA barcoding is a popular tool in taxonomic and phylogenetic studies, but for most animal lineages protocols for obtaining the barcoding sequences--mitochondrial cytochrome C oxidase subunit I (cox1 AKA CO1--are not standardized. Our aim was to explore an optimal strategy for arachnids, focusing on the species-richest lineage, spiders by (1 improving an automated DNA extraction protocol, (2 testing the performance of commonly used primer combinations, and (3 developing a new cox1 primer suitable for more efficient alignment and phylogenetic analyses. METHODOLOGY: We used exemplars of 15 species from all major spider clades, processed a range of spider tissues of varying size and quality, optimized genomic DNA extraction using the MagMAX Express magnetic particle processor-an automated high throughput DNA extraction system-and tested cox1 amplification protocols emphasizing the standard barcoding region using ten routinely employed primer pairs. RESULTS: The best results were obtained with the commonly used Folmer primers (LCO1490/HCO2198 that capture the standard barcode region, and with the C1-J-2183/C1-N-2776 primer pair that amplifies its extension. However, C1-J-2183 is designed too close to HCO2198 for well-interpreted, continuous sequence data, and in practice the resulting sequences from the two primer pairs rarely overlap. We therefore designed a new forward primer C1-J-2123 60 base pairs upstream of the C1-J-2183 binding site. The success rate of this new primer (93% matched that of C1-J-2183. CONCLUSIONS: The use of C1-J-2123 allows full, indel-free overlap of sequences obtained with the standard Folmer primers and with C1-J-2123 primer pair. Our preliminary tests suggest that in addition to spiders, C1-J-2123 will also perform in other arachnids and several other invertebrates. We provide optimal PCR protocols for these primer sets, and recommend using them for systematic efforts beyond DNA barcoding.

  4. Environmental DNA sequencing primers for eutardigrades and bdelloid rotifers

    Directory of Open Access Journals (Sweden)

    Martin Andrew P

    2009-12-01

    Full Text Available Abstract Background The time it takes to isolate individuals from environmental samples and then extract DNA from each individual is one of the problems with generating molecular data from meiofauna such as eutardigrades and bdelloid rotifers. The lack of consistent morphological information and the extreme abundance of these classes makes morphological identification of rare, or even common cryptic taxa a large and unwieldy task. This limits the ability to perform large-scale surveys of the diversity of these organisms. Here we demonstrate a culture-independent molecular survey approach that enables the generation of large amounts of eutardigrade and bdelloid rotifer sequence data directly from soil. Our PCR primers, specific to the 18s small-subunit rRNA gene, were developed for both eutardigrades and bdelloid rotifers. Results The developed primers successfully amplified DNA of their target organism from various soil DNA extracts. This was confirmed by both the BLAST similarity searches and phylogenetic analyses. Tardigrades showed much better phylogenetic resolution than bdelloids. Both groups of organisms exhibited varying levels of endemism. Conclusion The development of clade-specific primers for characterizing eutardigrades and bdelloid rotifers from environmental samples should greatly increase our ability to characterize the composition of these taxa in environmental samples. Environmental sequencing as shown here differs from other molecular survey methods in that there is no need to pre-isolate the organisms of interest from soil in order to amplify their DNA. The DNA sequences obtained from methods that do not require culturing can be identified post-hoc and placed phylogenetically as additional closely related sequences are obtained from morphologically identified conspecifics. Our non-cultured environmental sequence based approach will be able to provide a rapid and large-scale screening of the presence, absence and diversity of

  5. Human DNA polymerase α in binary complex with a DNA:DNA template-primer

    OpenAIRE

    Javier Coloma; Johnson, Robert E.; Louise Prakash; Satya Prakash; Aggarwal, Aneel K.

    2016-01-01

    The Polα/primase complex assembles the short RNA-DNA fragments for priming of lagging and leading strand DNA replication in eukaryotes. As such, the Polα polymerase subunit encounters two types of substrates during primer synthesis: an RNA:DNA helix and a DNA:DNA helix. The engagement of the polymerase subunit with the DNA:DNA helix has been suggested as the of basis for primer termination in eukaryotes. However, there is no structural information on how the Polα polymerase subunit actually e...

  6. Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

    Directory of Open Access Journals (Sweden)

    Zuiter Afnan

    2012-08-01

    Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

  7. New universal matK primers for DNA barcoding angiosperms

    Institute of Scientific and Technical Information of China (English)

    Jing YU; Jian-Hua XUE; Shi-Liang ZHOU

    2011-01-01

    The chloroplast maturase K gene (matK) is one of the most variable coding genes of angiosperms and has been suggested to be a "barcode" for land plants. However, matK exhibits low amplification and sequencing rates due to low universality of currently available primers and mononucleotide repeats. To resolve these technical problems, we evaluated the entire matK region to find a region of 600-800 bp that is highly variable, represents the best of all matK regions with priming sites conservative enough to design universal primers, and avoids the mononucleotide repeats. After careful evaluation, a region in the middle was chosen and a pair of primers named natK472F and matK1248R was designed to amplify and sequence the matK fragment of approximately 776 bp. This region encompasses the most variable sites, represents the entire matK region best, and also exhibits high amplification rates and quality of sequences. The universality of this primer pair was tested using 58 species from 47 families of angiosperm plants. The primers showed a strong amplification (93.1%) and sequencing (92.6%)successes in the species tested. We propose that the new primers will solve, in part, the problems encountered when using matK and promote the adoption of matK as a DNA barcode for angiosperms.

  8. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

    DEFF Research Database (Denmark)

    Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.

    2011-01-01

    settings. RESULTS: We describe a PCR method for quantification of microRNAs based on a single reverse transcription reaction for all microRNAs combined with real-time PCR with two, microRNA-specific DNA primers. Primer annealing temperatures were optimized by adding a DNA tail to the primers and could be...... designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision in...

  9. BARCRAWL and BARTAB: software tools for the design and implementation of barcoded primers for highly multiplexed DNA sequencing

    Science.gov (United States)

    Frank, Daniel N

    2009-01-01

    Background Advances in automated DNA sequencing technology have greatly increased the scale of genomic and metagenomic studies. An increasingly popular means of increasing project throughput is by multiplexing samples during the sequencing phase. This can be achieved by covalently linking short, unique "barcode" DNA segments to genomic DNA samples, for instance through incorporation of barcode sequences in PCR primers. Although several strategies have been described to insure that barcode sequences are unique and robust to sequencing errors, these have not been integrated into the overall primer design process, thus potentially introducing bias into PCR amplification and/or sequencing steps. Results Barcrawl is a software program that facilitates the design of barcoded primers, for multiplexed high-throughput sequencing. The program bartab can be used to deconvolute DNA sequence datasets produced by the use of multiple barcoded primers. This paper describes the functions implemented by barcrawl and bartab and presents a proof-of-concept case study of both programs in which barcoded rRNA primers were designed and validated by high-throughput sequencing. Conclusion Barcrawl and bartab can benefit researchers who are engaged in metagenomic projects that employ multiplexed specimen processing. The source code is released under the GNU general public license and can be accessed at . PMID:19874596

  10. BARCRAWL and BARTAB: software tools for the design and implementation of barcoded primers for highly multiplexed DNA sequencing

    Directory of Open Access Journals (Sweden)

    Frank Daniel N

    2009-10-01

    Full Text Available Abstract Background Advances in automated DNA sequencing technology have greatly increased the scale of genomic and metagenomic studies. An increasingly popular means of increasing project throughput is by multiplexing samples during the sequencing phase. This can be achieved by covalently linking short, unique "barcode" DNA segments to genomic DNA samples, for instance through incorporation of barcode sequences in PCR primers. Although several strategies have been described to insure that barcode sequences are unique and robust to sequencing errors, these have not been integrated into the overall primer design process, thus potentially introducing bias into PCR amplification and/or sequencing steps. Results Barcrawl is a software program that facilitates the design of barcoded primers, for multiplexed high-throughput sequencing. The program bartab can be used to deconvolute DNA sequence datasets produced by the use of multiple barcoded primers. This paper describes the functions implemented by barcrawl and bartab and presents a proof-of-concept case study of both programs in which barcoded rRNA primers were designed and validated by high-throughput sequencing. Conclusion Barcrawl and bartab can benefit researchers who are engaged in metagenomic projects that employ multiplexed specimen processing. The source code is released under the GNU general public license and can be accessed at http://www.phyloware.com.

  11. Ultra-Low Background DNA Cloning System

    OpenAIRE

    Goto, Kenta; Nagano, Yukio

    2013-01-01

    Yeast-based in vivo cloning is useful for cloning DNA fragments into plasmid vectors and is based on the ability of yeast to recombine the DNA fragments by homologous recombination. Although this method is efficient, it produces some by-products. We have developed an “ultra-low background DNA cloning system” on the basis of yeast-based in vivo cloning, by almost completely eliminating the generation of by-products and applying the method to commonly used Escherichia coli vectors, particularly...

  12. Mechanism of Concerted RNA-DNA Primer Synthesis by the Human Primosome.

    Science.gov (United States)

    Baranovskiy, Andrey G; Babayeva, Nigar D; Zhang, Yinbo; Gu, Jianyou; Suwa, Yoshiaki; Pavlov, Youri I; Tahirov, Tahir H

    2016-05-01

    The human primosome, a 340-kilodalton complex of primase and DNA polymerase α (Polα), synthesizes chimeric RNA-DNA primers to be extended by replicative DNA polymerases δ and ϵ. The intricate mechanism of concerted primer synthesis by two catalytic centers was an enigma for over three decades. Here we report the crystal structures of two key complexes, the human primosome and the C-terminal domain of the primase large subunit (p58C) with bound DNA/RNA duplex. These structures, along with analysis of primase/polymerase activities, provide a plausible mechanism for all transactions of the primosome including initiation, elongation, accurate counting of RNA primer length, primer transfer to Polα, and concerted autoregulation of alternate activation/inhibition of the catalytic centers. Our findings reveal a central role of p58C in the coordinated actions of two catalytic domains in the primosome and ultimately could impact the design of anticancer drugs. PMID:26975377

  13. Applicability of random primer R143 for determination of Aspergillus fumigatus DNA

    NARCIS (Netherlands)

    Erjavec, Z; Brinker, M; Apperloo-Renkema, HZ; Arends, Jan P; De Vries-Hospers, HG; Ruiters, MHJ

    1997-01-01

    The specificity of random primer R143 for Aspergillus fumigatus DNA was determined in order to test its usefulness in establishing the presence of A. fumigatus DNA in fungal cultures. When PCR reaction products of these cultures were compared with those of 21 other bacterial and fungal DNA samples,

  14. Ultra-low background DNA cloning system.

    Directory of Open Access Journals (Sweden)

    Kenta Goto

    Full Text Available Yeast-based in vivo cloning is useful for cloning DNA fragments into plasmid vectors and is based on the ability of yeast to recombine the DNA fragments by homologous recombination. Although this method is efficient, it produces some by-products. We have developed an "ultra-low background DNA cloning system" on the basis of yeast-based in vivo cloning, by almost completely eliminating the generation of by-products and applying the method to commonly used Escherichia coli vectors, particularly those lacking yeast replication origins and carrying an ampicillin resistance gene (Amp(r. First, we constructed a conversion cassette containing the DNA sequences in the following order: an Amp(r 5' UTR (untranslated region and coding region, an autonomous replication sequence and a centromere sequence from yeast, a TRP1 yeast selectable marker, and an Amp(r 3' UTR. This cassette allowed conversion of the Amp(r-containing vector into the yeast/E. coli shuttle vector through use of the Amp(r sequence by homologous recombination. Furthermore, simultaneous transformation of the desired DNA fragment into yeast allowed cloning of this DNA fragment into the same vector. We rescued the plasmid vectors from all yeast transformants, and by-products containing the E. coli replication origin disappeared. Next, the rescued vectors were transformed into E. coli and the by-products containing the yeast replication origin disappeared. Thus, our method used yeast- and E. coli-specific "origins of replication" to eliminate the generation of by-products. Finally, we successfully cloned the DNA fragment into the vector with almost 100% efficiency.

  15. Molecular Detection of Toxoplasmosis Using Specific Primers P30, B1, and rDNA

    Directory of Open Access Journals (Sweden)

    Wisnu Nurcahyo

    2014-04-01

    Full Text Available Study in order to develop molecular techniques using specific primers for the early diagnosis oftoxoplasmosis have been conducted. Detection of Toxoplasma gondii genome was performed usingpolymerase chain reaction (PCR technique. The primers used in this study were rDNA, P30, and B1. ThePCR products were further run using gel electrophoresis (gel 1.5% – 2.0% and the band was documented.Toxoplasma was detected at 500 bp and 600 bp using primer P30 and B1, respectively. Whereas usingprimer rDNA no band was observed. It was assumed that primer rDNA was not sensitive since the targetamplification was 88 bp.

  16. Specific primers for PCR amplification of the ITS1 (ribosomal DNA) of Trypanosoma lewisi.

    Science.gov (United States)

    Desquesnes, Marc; Marc, Desquesnes; Kamyingkird, Ketsarin; Ketsarin, Kamyingkird; Yangtara, Sarawut; Sarawut, Yangtara; Milocco, Cristina; Cristina, Milocco; Ravel, Sophie; Sophie, Ravel; Wang, Ming-Hui; Ming-Hui, Wang; Lun, Zhao-Rong; Zhao-Rong, Lun; Morand, Serge; Serge, Morand; Jittapalapong, Sathaporn; Sathaporn, Jittapalapong

    2011-08-01

    Trypanosoma lewisi is a mild or non-pathogenic parasite of the sub-genus Herpetosoma transmitted by fleas to rats. In a previous study we described pan-trypanosome specific primers TRYP1 which amplify the ITS1 of ribosomal DNA by hybridizing in highly conserved regions of 18S and 5.8S genes. These primers proved to be useful for detecting T. lewisi DNA in laboratory rats, but a recent large scale survey in wild rodents demonstrated a lack of specificity. In the present study, we designed and evaluated mono-specific primers LEW1S and LEW1R, for the detection and identification of T. lewisi by a single-step PCR. These primers were designed inside the highly variable region of the ITS1 sequence of T. lewisi ribosomal DNA. The product size of 220 bp is specific to T. lewisi. The sensitivity limit was estimated between 0.055 and 0.55 pg of DNA per reaction, equivalent to 1-10 organisms per reaction. All the PCR products obtained from 6 different T. lewisi isolates were more than 98% similar with each other and similar to the sequences of T. lewisi already published in Genbank. All DNA of 7 T. lewisi stocks from China gave the specific 220 bp product. We showed that LEW1S and LEW1R primers enabled sensitive detection and identification of T. lewisi infection in laboratory and wild rats. This assay is recommended for monitoring T. lewisi infections in rat colonies or for studying infections in the wild fauna. An absence of cross reaction with human DNA means that these primers can be used to investigate atypical trypanosome infections in humans. Given the risk of T. lewisi infection in human, we believe that these primers will be beneficial for public health diagnosis and rodents investigation programmes. PMID:21570489

  17. A Set of 100 Chloroplast DNA Primer Pairs to Study Population Genetics and Phylogeny in Monocotyledons

    OpenAIRE

    Scarcelli, Nora; Barnaud, Adeline; Eiserhardt, Wolf; Treier, Urs A.; Seveno, Marie; d'Anfray, Amélie; Vigouroux, Yves; Pintaud, Jean-Christophe

    2011-01-01

    Chloroplast DNA sequences are of great interest for population genetics and phylogenetic studies. However, only a small set of markers are commonly used. Most of them have been designed for amplification in a large range of Angiosperms and are located in the Large Single Copy (LSC). Here we developed a new set of 100 primer pairs optimized for amplification in Monocotyledons. Primer pairs amplify coding (exon) and non-coding regions (intron and intergenic spacer). They span the different chlo...

  18. Detection of Hepatitis B Virus DNA by Duplex Scorpion Primer-based PCR Assay

    Institute of Scientific and Technical Information of China (English)

    KONG De-Ming孔德明; SHEN Han-Xi沈含熙; MI Huai-Feng宓怀风

    2004-01-01

    The application of a new fiuorogenic probe-based PCR assay (PCR duplex scorpion primer assay) to the detection of Hepatitis B virus (HBV) DNA in human sera was described. Duplex scorpion primer is a modified variant of duplex Amplifluor, and the incorporation of a PCR stopper between probe and primer sequences improve the detection specificity and sensitivity. Combined with PCR amplification, this probe can give unambiguous positive results for the reactions initiated with more than 20 HBV molecules. In addition, the particular unimolecular probing mechanism of this probe makes the use of short target-specific probe sequence possible, which will render this probe applicable in some specific systems.

  19. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  20. Multiple primer extension by DNA polymerase on a novel plastic DNA array coated with a biocompatible polymer.

    Science.gov (United States)

    Kinoshita, Kenji; Fujimoto, Kentaro; Yakabe, Toru; Saito, Shin; Hamaguchi, Yuzo; Kikuchi, Takayuki; Nonaka, Ken; Murata, Shigenori; Masuda, Daisuke; Takada, Wataru; Funaoka, Sohei; Arai, Susumu; Nakanishi, Hisao; Yokoyama, Kanehisa; Fujiwara, Kazuhiko; Matsubara, Kenichi

    2007-01-01

    DNA microarrays are routinely used to monitor gene expression profiling and single nucleotide polymorphisms (SNPs). However, for practically useful high performance, the detection sensitivity is still not adequate, leaving low expression genes undetected. To resolve this issue, we have developed a new plastic S-BIO PrimeSurface with a biocompatible polymer; its surface chemistry offers an extraordinarily stable thermal property for a lack of pre-activated glass slide surface. The oligonucleotides immobilized on this substrate are robust in boiling water and show no significant loss of hybridization activity during dissociation treatment. This allowed us to hybridize the templates, extend the 3' end of the immobilized DNA primers on the S-Bio by DNA polymerase using deoxynucleotidyl triphosphates (dNTP) as extender units, release the templates by denaturalization and use the same templates for a second round of reactions similar to that of the PCR method. By repeating this cycle, the picomolar concentration range of the template oligonucleotide can be detected as stable signals via the incorporation of labeled dUTP into primers. This method of Multiple Primer EXtension (MPEX) could be further extended as an alternative route for producing DNA microarrays for SNP analyses via simple template preparation such as reverse transcript cDNA or restriction enzyme treatment of genome DNA. PMID:17135189

  1. Comparison between Mt-DNA D-Loop and Cyt B primers for porcine DNA detection in meat products

    Science.gov (United States)

    Hamzah, Azhana; Mutalib, Sahilah Abd.; Babji, Abdul Salam

    2013-11-01

    This study was conducted to detect the presence of porcine DNA in meat products in the market using conventional polymerase chain reaction (PCR) and commercial PCR-southern hybridization analysis. Porcine DNA detection in meat products was tested due to some issues associated with the adulteration of food products in Malaysia. This is an important issue especially for Halal authentication which is required for some religious practices such as in Islam and Hinduisms. Many techniques have been developed for determining the Halal status of food products. In this paper, mt-DNA D-loop primer and cytochrome (cyt) b were used to detect the presence of porcine DNA in meat products. Positive and negative controls were always present for each batch of extraction. DNA of raw pork meat was used as a positive control while nucleus free water is used as negative control. A pair of oligonucleotide primer was used namely Pork1 and Pork2 which produced amplicon of 531 base pair (bp) in size. While, PCR-southern hybridization was conducted using primers readily supplied by commercial PCR-Southern hybridization and produced amplicon with 276 bp in size. In the present study, demonstrated that none of the samples were contaminated with porcine residuals but selected samples with pork meat were positive. The species-specific PCR amplification yielded excellent results for identification of pork derivatives in food products and it is a potentially reliable and suitable technique in routine food analysis for Halal certification.

  2. Primer effect in the detection of mtDNA heteroplasmy: insights from horse Cytochrome b gene.

    Science.gov (United States)

    Zhao, Qianjun; Kang, Ye; Pu, Yabin; Niu, Lili; Guan, Weijun; He, Xiaohong; Zhang, Hongping; Lim, Hyuntae; Ma, Yuehui; Zhong, Tao

    2015-04-01

    Heteroplasmy, the presence of bi-allelic mtDNA types within an individual, has been previously detected in the D-loop region and Cytochrome b gene (Cytb) of mitochondrial DNA using PCR-RFLP. However, heteroplasmy was absent in thousands of equine mtDNA sequences deposited in GenBank. To address whether heteroplasmy widely exists in mitochondria of Chinese indigenous horses, we generated the data set of the target sites in Cytb region with Sanger sequencing and PCR-RFLP method as well. In this study, 23 heteroplasmic individuals were detected in 430 Chinese local horses. Both site and length heteroplasmy were identified in horse Cytb, especially in Xinihe and Ujumqin breeds. Our data provide evidence that the forward and reverse primers seem to produce a similar approximation to the proportion of mutation base call. However, locations of primers affected the proper detection of mtDNA heteroplasmy. The data obtained in this study highlight the importance of the primers in the accurate detection of heteroplasmy. PMID:24409928

  3. Characterizing contrasting soils and sediments with semispecific actinomycete r-DNA PCR primers

    Czech Academy of Sciences Publication Activity Database

    Hill, P.; Krištůfek, Václav; Caballero, S.; Kroetsch, D. J.; Rauch, Ota

    České Budějovice: Institute of Soil Biology AS CR, 2004, s. 88-92. ISBN 80-86525-03-1. [Present methods for investigation of microbial community biodiversity in soils and substrates. Methodological workshop /9./. České Budějovice (CZ), 02.03.2004-03.03.2004] Institutional research plan: CEZ:AV0Z6066911 Keywords : contrasting soils * sediments * semispecific actinomycete r-DNA PCR primers Subject RIV: EH - Ecology, Behaviour

  4. In silico assessment of primers for eDNA studies using PrimerTree and application to characterize the biodiversity surrounding the Cuyahoga River

    Science.gov (United States)

    Cannon, M. V.; Hester, J.; Shalkhauser, A.; Chan, E. R.; Logue, K.; Small, S. T.; Serre, D.

    2016-03-01

    Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity.

  5. MPprimer: a program for reliable multiplex PCR primer design

    OpenAIRE

    Wang Xiaolei; Hang Xingyi; Li Zhifeng; Wu Yonghong; Lu Yiming; Wang Wen; Qu Wubin; Shen Zhiyong; Zhao Dongsheng; Zhang Chenggang

    2010-01-01

    Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer) in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nons...

  6. The development of miniplex primer sets for the analysis of degraded DNA

    Science.gov (United States)

    McCord, Bruce; Opel, Kerry; Chung, Denise; Drabek, Jiri; Tatarek, Nancy; Meadows Jantz, Lee; Butler, John

    2005-05-01

    In this project, a new set of multiplexed PCR reactions has been developed for the analysis of degraded DNA. These DNA markers, known as Miniplexes, utilize primers that have shorter amplicons for use in short tandem repeat (STR) analysis of degraded DNA. In our work we have defined six of these new STR multiplexes, each of which consists of 3 to 4 reduced size STR loci, and each labeled with a different fluorescent dye. When compared to commercially available STR systems, reductions in size of up to 300 basepairs are possible. In addition, these newly designed amplicons consist of loci that are fully compatible with the the national computer DNA database known as CODIS. To demonstrate compatibility with commercial STR kits, a concordance study of 532 DNA samples of Caucasian, African American, and Hispanic origin was undertaken There was 99.77% concordance between allele calls with the two methods. Of these 532 samples, only 15 samples showed discrepancies at one of 12 loci. These occurred predominantly at 2 loci, vWA and D13S317. DNA sequencing revealed that these locations had deletions between the two primer binding sites. Uncommon deletions like these can be expected in certain samples and will not affect the utility of the Miniplexes as tools for degraded DNA analysis. The Miniplexes were also applied to enzymatically digested DNA to assess their potential in degraded DNA analysis. The results demonstrated a greatly improved efficiency in the analysis of degraded DNA when compared to commercial STR genotyping kits. A series of human skeletal remains that had been exposed to a variety of environmental conditions were also examined. Sixty-four percent of the samples generated full profiles when amplified with the Miniplexes, while only sixteen percent of the samples tested generated full profiles with a commercial kit. In addition, complete profiles were obtained for eleven of the twelve Miniplex loci which had amplicon size ranges less than 200 base pairs

  7. DNA TYPING FOR HLA - DR ALLELES BY PCR - AMPLIFICATION WITH SEQUENCE- SPECIFIC PRIMERS

    Institute of Scientific and Technical Information of China (English)

    谭建明; 谢桐; 徐琴君

    1999-01-01

    Ohjective To establish a rapid genetyping for HLA- DR alleles by polymerase chain reaction wiht sequence - specifie primers (PCR - SSP) for clinical application. Material and Methods The subjects of study included 69 recipients, 43 unrelated donors and 5 cell lines, Genomic DNA was prepared from peripheral blood leukoeytes by a salting- out method, Thirty primers designed according to the HLA- DRB nucleotide sequences, and synthesized on a 391 DNN synthesizer,Twenty separate PCR reactions were perfomed for each sample, The amplification was accomplished by 34 cycles consisting of denaturation at 94℃ for 30 seconds, annealing at 60℃ for 50 seconds and extension at 72℃ for 40 seconds The specificity of matching was determined by standard DNAs and Southem hybeidization using DIG labeling probes. Results All 112 samples and 5 cell lines were able to be typed by PCR-SSP,No false positive or false negative typing results were obtained. The reproducibility was 100 %,The size of the .specific product was in cnoccrdance with the size of the designed primers. The overall time for genotyping was 4 bours. The typing results were confirned by Southem hybridization.Conelusions Genotyping for HLA- DR by PCR- SSP is a rapid and accurate matching technique suited for clinical application.

  8. A set of 100 chloroplast DNA primer pairs to study population genetics and phylogeny in monocotyledons.

    Science.gov (United States)

    Scarcelli, Nora; Barnaud, Adeline; Eiserhardt, Wolf; Treier, Urs A; Seveno, Marie; d'Anfray, Amélie; Vigouroux, Yves; Pintaud, Jean-Christophe

    2011-01-01

    Chloroplast DNA sequences are of great interest for population genetics and phylogenetic studies. However, only a small set of markers are commonly used. Most of them have been designed for amplification in a large range of Angiosperms and are located in the Large Single Copy (LSC). Here we developed a new set of 100 primer pairs optimized for amplification in Monocotyledons. Primer pairs amplify coding (exon) and non-coding regions (intron and intergenic spacer). They span the different chloroplast regions: 72 are located in the LSC, 13 in the Small Single Copy (SSC) and 15 in the Inverted Repeat region (IR). Amplification and sequencing were tested in 13 species of Monocotyledons: Dioscorea abyssinica, D. praehensilis, D. rotundata, D. dumetorum, D. bulbifera, Trichopus sempervirens (Dioscoreaceae), Phoenix canariensis, P. dactylifera, Astrocaryum scopatum, A. murumuru, Ceroxylon echinulatum (Arecaceae), Digitaria excilis and Pennisetum glaucum (Poaceae). The diversity found in Dioscorea, Digitaria and Pennisetum mainly corresponded to Single Nucleotide Polymorphism (SNP) while the diversity found in Arecaceae also comprises Variable Number Tandem Repeat (VNTR). We observed that the most variable loci (rps15-ycf1, rpl32-ccsA, ndhF-rpl32, ndhG-ndhI and ccsA) are located in the SSC. Through the analysis of the genetic structure of a wild-cultivated species complex in Dioscorea, we demonstrated that this new set of primers is of great interest for population genetics and we anticipate that it will also be useful for phylogeny and bar-coding studies. PMID:21637837

  9. A novel three primers PCR (TP-PCR) method to obtain recombinant DNA molecule independent of restriction enzyme

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    In this note, we report a novel and efficient three primers PCR (TP-PCR) method to rapidly generate recombinant DNA molecule at precise junction between two arbitrary DNA fragments. TP-PCR method is characterized by its reaction system with two templates and three primers, which can produce a recombinant DNA molecule in one PCR reaction. The main advantages of this method are the independence of sequences at the recombination site, the rapidness, and the easy establishment of adequate conditions. This method has been successfully applied to constructing a fusion protein gene, sck gene.

  10. Back to basics – the influence of DNA extraction and primer choice on phylogenetic analysis in activated sludge communities

    DEFF Research Database (Denmark)

    Albertsen, Mads; Karst, Søren Michael; Ziegler, Anja Sloth;

    DNA extraction and primer choice have a large effect on the observed community structure in all phylogenetic analyses. Although the biases are well known, no comprehensive analysis have been conducted in activated sludge communities. In this study we investigated the effect of bead beating...... intensity and primer choice on the observed community using 16S rDNA amplicon sequencing. Quantitative fluorescence in situ hybridization (qFISH) was used as a DNA extraction independent method to evaluate the results. The bead beating intensity correlated with cell-wall strength and showed that the...... manufacture recommended settings were insufficient to retrieve a large part of the community. In addition, the in silico “best” primer set was found to greatly underestimate a number of important phyla when compared to qFISH results. The findings underline the need for sample specific and DNA extraction...

  11. Simple and reliable procedure for PCR amplification of genomic DNA from yeast cells using short sequencing primers

    DEFF Research Database (Denmark)

    Haaning, J; Oxvig, C; Overgaard, Michael Toft;

    1997-01-01

    means of PCR without any prior DNA purification steps. This method involves a simple boiling step of whole yeast cells in the presence of detergent, and subsequent amplification of genomic DNA using short sequencing primers in a polymerase chain reaction assay with a decreasing annealing temperature...

  12. Application of Single—labelled Probe—primer in PCR Amplification to the Detection of Hepatitis B Virus DNA

    Institute of Scientific and Technical Information of China (English)

    KONG,De-Ming; SHEN,Han-Xi

    2003-01-01

    A new method based on the incorporation of a single-lablled probe-primer into polymerase chain reaction(PCR) for the detection of PCR-amplified DNA in a closed system is reported.The probeprimerc consists of a specific probe sequence on the 5''''''''-end and a primer sequence on the 3''''''''-end.A flurophore is located at the 5''''''''end.The primeR-quencher is an oligonucleotide,which is complementary to the probe sequence of probe-primer and labelled with a quencher at the 3''''''''-end.In the duplex formed by probe-primer and primer-quencher.the fluorophore and quencher are kept in close proximity to each other.Therefore the fluorescence is quenched.During PCR amplificatio,the specific probe sequence of probeprimer binds to its complement within the same strand of DNA,and is cleaved by Taq DNA polymerase,resulting in the restoration of fluorescence.This system has the same energy transfer mechanism as molecular beacons,and a good quenching effciency can be ensured.Following optimization of PCR conditions,this method was used to detect hepatitis b virus(HBV) dna in patient sera.This technology eliminates the risk of carry-over contamination,simplifies the amplification assay and opens up new possibilities for the real-time detection of the amplified DNA.

  13. High-coverage ITS primers for the DNA-based identification of ascomycetes and basidiomycetes in environmental samples.

    Directory of Open Access Journals (Sweden)

    Hirokazu Toju

    Full Text Available The kingdom Fungi is estimated to include 1.5 million or more species, playing key roles as decomposers, mutualists, and parasites in every biome on the earth. To comprehensively understand the diversity and ecology of this huge kingdom, DNA barcoding targeting the internal transcribed spacer (ITS region of the nuclear ribosomal repeat has been regarded as a prerequisite procedure. By extensively surveying ITS sequences in public databases, we designed new ITS primers with improved coverage across diverse taxonomic groups of fungi compared to existing primers. An in silico analysis based on public sequence databases indicated that the newly designed primers matched 99% of ascomycete and basidiomycete ITS taxa (species, subspecies or varieties, causing little taxonomic bias toward either fungal group. Two of the newly designed primers could inhibit the amplification of plant sequences and would enable the selective investigation of fungal communities in mycorrhizal associations, soil, and other types of environmental samples. Optimal PCR conditions for the primers were explored in an in vitro investigation. The new primers developed in this study will provide a basis for ecological studies on the diversity and community structures of fungi in the era of massive DNA sequencing.

  14. Preliminary Study on Applicability of Microsatellite DNA Primers from Parasite Protozoa Trypanosoma cruzi in Free-living Protozoa

    Institute of Scientific and Technical Information of China (English)

    ZHANG Wenjing; YU Yuhe; SHEN Yunfen; MIAO Wei; FENG Weisong

    2004-01-01

    In this paper, we took the lead in studying on specificity of the microsatellite DNA loci and applicability of microsatellite DNA primers in protozoa. In order to study characters of microsatellites in free-living protozoa, eight microsatellite loci primers developed from Trypanosoma cruzi (MCLE01, SCLE10, MCLE08, SCLE11, MCLF10, MCLG10,MCL03, MCL05) were employed to amplify microsatellite in four free-living protozoa, including Bodo designis, Euglena gracilis FACHB848, Paramecium bruzise and Tetrahymena thermophila BF1. In the amplification systems of P. bruzise, four loci (SCLE10, SCLE1 1, MCLF10, MCL03) were amplified successfully, and four amplification fragments were in proper size. In genome of E. gracilis FACHB848, five of eight primers brought five clear amplification bands. In B. designis, three (No.4, 5 and 7) of eight loci produced clear and sharp products without stutter bands, whereas no bands appeared in T.thermophila BF1. Further, eight 300-500bp amplification fragments were cloned and sequenced. Nevertheless, all sequenced products did not contain corresponding microsatellite sequence, although Bodo is in the same order and has the nearest phylogenetic relation with Trypanosoma among these four species. Thus, the microsatellite DNA primers can not be applied among order or more far taxa, and the specificity of microsatellite DNA is very high in protozoa. The results of this study will contribute to our understanding of microsatellite DNA in protozoa.

  15. Inhibition of non-templated nucleotide addition by DNA polymerases in primer extension using twisted intercalating nucleic acid modified templates

    Czech Academy of Sciences Publication Activity Database

    Güixens Gallardo, Pedro; Hocek, Michal; Perlíková, Pavla

    2016-01-01

    Roč. 26, č. 2 (2016), s. 288-291. ISSN 0960-894X R&D Projects: GA ČR GBP206/12/G151 Institutional support: RVO:61388963 Keywords : DNA polymerases * nucleotide addition * primer extension * oligonucleotides * twisted intercalating nucleic acid Subject RIV: CC - Organic Chemistry Impact factor: 2.420, year: 2014

  16. Back to Basics – The Influence of DNA Extraction and Primer Choice on Phylogenetic Analysis of Activated Sludge Communities

    DEFF Research Database (Denmark)

    Albertsen, Mads; Karst, Søren Michael; Ziegler, Anja Sloth;

    2015-01-01

    DNA extraction and primer choice have a large effect on the observed community structure in allmicrobial amplicon sequencing analyses. Although the biases are well known, no com- prehensive analysis has been conducted in activated sludge communities. In this study we systematically explored the i...

  17. TREHALOSE-BASED ADDITIVE IMPROVED INTER-PRIMER BINDING SITE REACTIONS FOR DNA ISOLATED FROM RECALCITRANT PLANTS

    OpenAIRE

    Veronika Lancíková; Jana Žiarovská; Milan Bežo; Katarína Ražná; Rashydov, Namik M.; Martin Hajduch

    2014-01-01

    Trehalose-based (TBT-PAR) additive was tested in order to optimize PCR amplification for DNA isolated from recalcitrant plants. Retrotransposon-based inter-primer binding site reactions were significantly improved with TBT-PAR solution using genomic DNA isolated from flax (Linum usitatissimum L., genotypes Kyivskyi, Bethune) grown in radio-contaminated and non-radioactive remediated Chernobyl experimental fields. Additionally, similar improvements were observed using 19 recalcitrant genotypes...

  18. Incomplete primer extension during in vitro DNA amplification catalyzed by Taq polymerase; exploitation for DNA sequencing.

    OpenAIRE

    Olsen, D. B.; Eckstein, F.

    1989-01-01

    Polyacrylamide gel electrophoresis of DNA fragments obtained by the polymerase chain reaction using Taq polymerase revealed the presence of multiple fragments shorter than the expected product. These abortive extension products were observed even when analysis by agarose gel electrophoresis showed only a single band. The production of prematurely terminated fragments can be exploited for the sequencing of PCR products if phosphorothioate groups are incorporated base specifically during the re...

  19. Rapid plant identification using species- and group-specific primers targeting chloroplast DNA.

    Directory of Open Access Journals (Sweden)

    Corinna Wallinger

    Full Text Available Plant identification is challenging when no morphologically assignable parts are available. There is a lack of broadly applicable methods for identifying plants in this situation, for example when roots grow in mixture and for decayed or semi-digested plant material. These difficulties have also impeded the progress made in ecological disciplines such as soil- and trophic ecology. Here, a PCR-based approach is presented which allows identifying a variety of plant taxa commonly occurring in Central European agricultural land. Based on the trnT-F cpDNA region, PCR assays were developed to identify two plant families (Poaceae and Apiaceae, the genera Trifolium and Plantago, and nine plant species: Achillea millefolium, Fagopyrum esculentum, Lolium perenne, Lupinus angustifolius, Phaseolus coccineus, Sinapis alba, Taraxacum officinale, Triticum aestivum, and Zea mays. These assays allowed identification of plants based on size-specific amplicons ranging from 116 bp to 381 bp. Their specificity and sensitivity was consistently high, enabling the detection of small amounts of plant DNA, for example, in decaying plant material and in the intestine or faeces of herbivores. To increase the efficacy of identifying plant species from large number of samples, specific primers were combined in multiplex PCRs, allowing screening for multiple species within a single reaction. The molecular assays outlined here will be applicable manifold, such as for root- and leaf litter identification, botanical trace evidence, and the analysis of herbivory.

  20. Performance of 16s rDNA Primer Pairs in the Study of Rhizosphere and Endosphere Bacterial Microbiomes in Metabarcoding Studies.

    Science.gov (United States)

    Beckers, Bram; Op De Beeck, Michiel; Thijs, Sofie; Truyens, Sascha; Weyens, Nele; Boerjan, Wout; Vangronsveld, Jaco

    2016-01-01

    Next-generation sequencing technologies have revolutionized the methods for studying microbial ecology by enabling high-resolution community profiling. However, the use of these technologies in unraveling the plant microbiome remains challenging. Many bacterial 16S rDNA primer pairs also exhibit high affinity for non-target DNA such as plastid (mostly chloroplast) DNA and mitochondrial DNA. Therefore, we experimentally tested a series of commonly used primers for the analysis of plant-associated bacterial communities using 454 pyrosequencing. We evaluated the performance of all selected primer pairs in the study of the bacterial microbiomes present in the rhizosphere soil, root, stem and leaf endosphere of field-grown poplar trees (Populus tremula × Populus alba) based on (a) co-amplification of non-target DNA, (b) low amplification efficiency for pure chloroplast DNA (real-time PCR), (c) high retrieval of bacterial 16S rDNA, (d) high operational taxonomic unit (OTU) richness and Inverse Simpson diversity and (e) taxonomic assignment of reads. Results indicate that experimental evaluation of primers provide valuable information that could contribute in the selection of suitable primer pairs for 16S rDNA metabarcoding studies in plant-microbiota research. Furthermore, we show that primer pair 799F-1391R outperforms all other primer pairs in our study in the elimination of non-target DNA and retrieval of bacterial OTUs. PMID:27242686

  1. Performance of 16s rDNA Primer Pairs in the Study of Rhizosphere and Endosphere Bacterial Microbiomes in Metabarcoding Studies

    Science.gov (United States)

    Beckers, Bram; Op De Beeck, Michiel; Thijs, Sofie; Truyens, Sascha; Weyens, Nele; Boerjan, Wout; Vangronsveld, Jaco

    2016-01-01

    Next-generation sequencing technologies have revolutionized the methods for studying microbial ecology by enabling high-resolution community profiling. However, the use of these technologies in unraveling the plant microbiome remains challenging. Many bacterial 16S rDNA primer pairs also exhibit high affinity for non-target DNA such as plastid (mostly chloroplast) DNA and mitochondrial DNA. Therefore, we experimentally tested a series of commonly used primers for the analysis of plant-associated bacterial communities using 454 pyrosequencing. We evaluated the performance of all selected primer pairs in the study of the bacterial microbiomes present in the rhizosphere soil, root, stem and leaf endosphere of field-grown poplar trees (Populus tremula × Populus alba) based on (a) co-amplification of non-target DNA, (b) low amplification efficiency for pure chloroplast DNA (real-time PCR), (c) high retrieval of bacterial 16S rDNA, (d) high operational taxonomic unit (OTU) richness and Inverse Simpson diversity and (e) taxonomic assignment of reads. Results indicate that experimental evaluation of primers provide valuable information that could contribute in the selection of suitable primer pairs for 16S rDNA metabarcoding studies in plant-microbiota research. Furthermore, we show that primer pair 799F-1391R outperforms all other primer pairs in our study in the elimination of non-target DNA and retrieval of bacterial OTUs. PMID:27242686

  2. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong

    2009-10-09

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

  3. Enzymatic Primer-Extension with Glycerol-Nucleoside Triphosphates on DNA Templates

    OpenAIRE

    Chen, Jesse J.; Tsai, Ching-Hsuan; Xin CAI; Horhota, Allen T.; McLaughlin, Larry W.; Szostak, Jack W.

    2009-01-01

    Background Glycerol nucleic acid (GNA) has an acyclic phosphoglycerol backbone repeat-unit, but forms stable duplexes based on Watson-Crick base-pairing. Because of its structural simplicity, GNA is of particular interest with respect to the possibility of evolving functional polymers by in vitro selection. Template-dependent GNA synthesis is essential to any GNA-based selection system. Principal Findings In this study, we investigated the ability of various DNA polymerases to use glycerol-nu...

  4. High-Coverage ITS Primers for the DNA-Based Identification of Ascomycetes and Basidiomycetes in Environmental Samples

    OpenAIRE

    Toju, Hirokazu; Tanabe, Akifumi S; Yamamoto, Satoshi; Sato, Hirotoshi

    2012-01-01

    The kingdom Fungi is estimated to include 1.5 million or more species, playing key roles as decomposers, mutualists, and parasites in every biome on the earth. To comprehensively understand the diversity and ecology of this huge kingdom, DNA barcoding targeting the internal transcribed spacer (ITS) region of the nuclear ribosomal repeat has been regarded as a prerequisite procedure. By extensively surveying ITS sequences in public databases, we designed new ITS primers with improved coverage ...

  5. TREHALOSE-BASED ADDITIVE IMPROVED INTER-PRIMER BINDING SITE REACTIONS FOR DNA ISOLATED FROM RECALCITRANT PLANTS

    Directory of Open Access Journals (Sweden)

    Veronika Lancíková

    2014-02-01

    Full Text Available Trehalose-based (TBT-PAR additive was tested in order to optimize PCR amplification for DNA isolated from recalcitrant plants. Retrotransposon-based inter-primer binding site reactions were significantly improved with TBT-PAR solution using genomic DNA isolated from flax (Linum usitatissimum L., genotypes Kyivskyi, Bethune grown in radio-contaminated and non-radioactive remediated Chernobyl experimental fields. Additionally, similar improvements were observed using 19 recalcitrant genotypes of maize (Zea mays L. and three genotypes of yacon (Smallanthus sonchifolius, Poepp. et Endl., genotypes PER05, ECU45, BOL22 grown in standard field conditions.

  6. Hybridization probes for conventional DNA fingerprinting used as single primers in the polymerase chain reaction to distinguish strains of Cryptococcus neoformans.

    OpenAIRE

    Meyer, W.; Mitchell, T G; Freedman, E Z; Vilgalys, R

    1993-01-01

    In conventional DNA fingerprinting, hypervariable and repetitive sequences (minisatellite or microsatellite DNA) are detected with hybridization probes. As demonstrated here, these probes can be used as single primers in the polymerase chain reaction (PCR) to generate individual fingerprints. Several conventional DNA fingerprinting probes were used to prime the PCR, yielding distinctive, hypervariable multifragment profiles for different strains of Cryptococcus neoformans. PCR fingerprinting ...

  7. MPprimer: a program for reliable multiplex PCR primer design

    Directory of Open Access Journals (Sweden)

    Wang Xiaolei

    2010-03-01

    Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  8. Primer Screening for Dyera costulata (Miq Hook.f Random Amplified Polymorphic DNA Analyses

    Directory of Open Access Journals (Sweden)

    YUYU SURYASARI POERBA

    2009-01-01

    Full Text Available Dyera costulata (Miq. Hook.f (Apocynaceae is a large tree of the lowland tropical rain forest of Southeast Asia, Thailand, Malay Peninsula and Indonesia, especially in Sumatra and Kalimantan (Borneo islands. Its economic value was in its copious latex, used as gum in the manufacture of chewing gum. Today the timber of this species is much sought after for the manufacture of pencils and picture frames. Information on genetic diversity of the species is very limited. Hence studies were initiated to screen primers for RAPD analyses of Dyera costulata for use in genetic variation studies. Seventy one Operon primers (10 mer were used to generate a total of 864 consistent and ambiguous amplification products ranging from 200 bp to 2.0 kb. Rare and genotype specific bands were identified which could be effectively used to distinguish the genotypes. 34 highly polymorphic primers (100% are recorded from 71 primers used. Three primers (OPA-04, OPU-06, and OPU-07 produced highest variable RAPD profiles. The dendrogram separated the 8 genotypes into 2 groups. Genetic dissimilarity ranged from 0.07 to 0.71 %.

  9. Simultaneous identification and DNA barcoding of six Eimeria species infecting turkeys using PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus.

    Science.gov (United States)

    Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R

    2015-05-01

    Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics. PMID:25678350

  10. A set of 100 chloroplast DNA primer pairs to study population genetics and phylogeny in monocotylenons

    DEFF Research Database (Denmark)

    Scarcelli, Nora; Bernaud, Adeline; Eiserhardt, Wolf L.;

    2011-01-01

    developed a new set of 100 primer pairs optimized for amplification in Monocotyledons. Primer pairs amplify coding (exon) and non-coding regions (intron and intergenic spacer). They span the different chloroplast regions: 72 are located in the LSC, 13 in the Small Single Copy (SSC) and 15 in the Inverted...... most variable loci (rps15-ycf1, rpl32-ccsA, ndhF-rpl32, ndhG-ndhI and ccsA) are located in the SSC. Through the analysis of the genetic structure of a wild-cultivated species complex in Dioscorea, we demonstrated that this new set of primers is of great interest for population genetics and we...

  11. Single primer-mediated circular polymerase chain reaction for hairpin DNA cloning and plasmid editing.

    Science.gov (United States)

    Huang, Jiansheng; Khan, Inamullah; Liu, Rui; Yang, Yan; Zhu, Naishuo

    2016-05-01

    We developed and validated a universal polymerase chain reaction (PCR) method, single primer circular (SPC)-PCR, using single primer to simultaneously insert and amplify a short hairpin sequence into a vector with a high success rate. In this method, the hairpin structure is divided into two parts and fused into a vector by PCR. Then, a single primer is used to cyclize the chimera into a mature short hairpin RNA (shRNA) expression vector. It is not biased by loop length or palindromic structures. Six hairpin DNAs with short 4-nucleotide loops were successfully cloned. Moreover, SPC-PCR was also applied to plasmid editing within 3 h with a success rate higher than 95%. PMID:26792375

  12. Reverse transcription using random pentadecamer primers increases yield and quality of resulting cDNA

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Dufva, I.H.; Dufva, Hans Martin

    2006-01-01

    Reverse transcription of RNA is an invaluable method for gene expression analysis by real-time PCR or microarray methods. Random primers of varying lengths were compared with respect to their efficiency of priming reverse transcription reactions. The results showed that l5-nucleotide-long random...

  13. Development and validation of an rDNA operon based primer walking strategy applicable to de novo bacterial genome finishing.

    Science.gov (United States)

    Eastman, Alexander W; Yuan, Ze-Chun

    2014-01-01

    Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing projects. PMID

  14. IMP PCR primers detect single nucleotide polymorphisms for Anopheles gambiae species identification, Mopti and Savanna rDNA types, and resistance to dieldrin in Anopheles arabiensis

    Directory of Open Access Journals (Sweden)

    Howell Paul I

    2006-12-01

    Full Text Available Abstract Background Polymerase chain reactions to distinguish single-nucleotide polymorphisms are commonly used for mosquito identification and identifying insecticide resistance alleles. However, the existing methods used for primer design often result in analyses that are not robust or require additional steps. Methods Utilizing oligonucleotides that are unique in having an intentional mismatch to both templates three bases from the SNP at the 3-prime end, three new PCR assays that distinguish SNP targets using standard gel electrophoresis of undigested DNA fragments were developed and tested. These were applied to: (1 an alternative ribosomal DNA PCR assay to distinguish five members of the Anopheles gambiae complex; (2 detection of the Mopti and Savanna rDNA types; and (3 an assay to distinguish resistance to dieldrin (Rdl alleles in Anopheles arabiensis. Results Reproducible specific amplification of the target alleles was observed in all three assays. The results were consistent with existing analyses but proved simpler and the results more distinct in our hands. Conclusion The simplicity and effectiveness of the method should be utilized in these and other PCR analyses to increase their specificity and simplicity. These results have the potential to be extended not only to mosquito analyses but also to parasite and human polymorphisms.

  15. Sensitive SERS detection of DNA methyltransferase by target triggering primer generation-based multiple signal amplification strategy.

    Science.gov (United States)

    Li, Ying; Yu, Chuanfeng; Han, Huixia; Zhao, Caisheng; Zhang, Xiaoru

    2016-07-15

    A novel and sensitive surface-enhanced Raman scattering (SERS) method is proposed for the assay of DNA methyltransferase (MTase) activity and evaluation of inhibitors by developing a target triggering primer generation-based multiple signal amplification strategy. By using of a duplex substrate for Dam MTase, two hairpin templates and a Raman probe, multiple signal amplification mode is achieved. Once recognized by Dam MTase, the duplex substrate can be cleaved by Dpn I endonuclease and two primers are released for triggering the multiple signal amplification reaction. Consequently, a wide dynamic range and remarkably high sensitivity are obtained under isothermal conditions. The detection limit is 2.57×10(-4)UmL(-1). This assay exhibits an excellent selectivity and is successfully applied in the screening of inhibitors for Dam MTase. In addition, this novel sensing system is potentially universal as the recognition element can be conveniently designed for other target analytes by changing the substrate of DNA MTase. PMID:26926592

  16. Development and characterization of DNA microsatellite primers for buriti (Mauritia flexuosa L.f.).

    Science.gov (United States)

    Menezes, E V; Souto, W F S; Ciampi, A Y; Azevedo, V C R; Valério, H M; Pimenta, M A S

    2012-01-01

    Mauritia flexuosa L. (Arecaceae) is a palm tree species known as buriti that occurs in the Cerrado biome. It is characteristic of the vereda, a typical ecosystem of central Brazil. In this phytophysiognomy, M. flexuosa and other groups of arboreal-herbaceous species develop in open fields with very humid soils. M. flexuosa can be found in forest borders and is a palm tree with a wide distribution in South America (Brazil, Colombia, Venezuela, French Guyana Ecuador, Peru, and Bolivia). The main objectives of this study were to develop simple sequence repeat marker-enriched libraries and to characterize these loci in buriti palm to facilitate future population studies. A total of 40 sequences derived from the microsatellite-enriched libraries were selected for primer design. The optimization results showed that 9 primer pairs could successfully amplify polymorphic target fragments of the expected sizes. The data also show that the described primers can be used in population genetic studies in M. flexuosa to obtain information that will inform conservation and management strategies. PMID:23079977

  17. DNA barcode based wildlife forensics for resolving the origin of claw samples using a novel primer cocktail.

    Science.gov (United States)

    Khedkar, Gulab D; Abhayankar, Shil Bapurao; Nalage, Dinesh; Ahmed, Shaikh Nadeem; Khedkar, Chandraprakash D

    2014-12-10

    Abstract Excessive wildlife hunting for commercial purposes can have negative impacts on biodiversity and may result in species extinction. To ensure compliance with legal statutes, forensic identification approaches relying on molecular markers may be used to identify the species of origin of animal material from hairs, claw, blood, bone, or meat. Using this approach, DNA sequences from the COI "barcoding" gene have been used to identify material from a number of domesticated animal species. However, many wild species of carnivores still present great challenges in generating COI barcodes using standard "universal" primer pairs. In the work presented here, the mitochondrial COI gene was successfully amplified using a novel primer cocktail, and the products were sequenced to determine the species of twenty one unknown samples of claw material collected as part of forensic wildlife case investigations. Sixteen of the unknown samples were recognized to have originated from either Panthera leo or P. pardus individuals. The remaining five samples could be identified only to the family level due to the absence of reference animal sequences. This is the first report on the use of COI sequences for the identification of P. pardus and P. leo from claw samples as part of forensic investigations in India. The study also highlights the need for adequate reference material to aid in the resolution of suspected cases of illegal wildlife harvesting. PMID:25492536

  18. Fast solid support detection of PCR amplified viral DNA sequences using radioiodinated or hapten labelled primers.

    OpenAIRE

    Sauvaigo, S; Fouqué, B; Roget, A; Livache, T; BAZIN, H.; Chypre, C; Téoule, R

    1990-01-01

    Oligonucleotides with novel modifications have been synthesized and incorporated into enzymatically amplified DNA sequences. They allow the fast detection of viral DNA sequences after two rounds of amplification. The hybrids formed are immobilized by affinity on coated tubes and detected by direct beta (32P) or gamma (125I) counting or by colorimetric revelation. The effect of a dilution step between the two amplifications is studied to obtain optimal sensitivity and specificity. This test is...

  19. An Undergraduate Laboratory Experiment for Upper-Level Forensic Science, Biochemistry, or Molecular Biology Courses: Human DNA Amplification Using STR Single Locus Primers by Real-Time PCR with SYBR Green Detection

    Science.gov (United States)

    Elkins, Kelly M.; Kadunc, Raelynn E.

    2012-01-01

    In this laboratory experiment, real-time polymerase chain reaction (real-time PCR) was conducted using published human TPOX single-locus DNA primers for validation and various student-designed short tandem repeat (STR) primers for Combined DNA Index System (CODIS) loci. SYBR Green was used to detect the amplification of the expected amplicons. The…

  20. Designing of the specific DNA primers for detection of the exoA, oprL and algD pathogenicity genes for rapid diagnosis of Pseudomonas aeruginosa

    Directory of Open Access Journals (Sweden)

    Mohammad Najafimosleh

    2013-11-01

    Full Text Available Background: The aim of this study was compared the efficacy of  the designed primers and already published primers for detection of the exoA, oprL and algD genes by PCR assay  for finding a rapid, accurate and highly sensitive and specific procedure to detect the Pseudomonas aeruginosa in the serious and fatal infections such as cystic fibrosis disease, burned individual.Methods: A total of 150 clinical specimens were inoculated in to routine and selective culture media for Pseudomonas aeruginosa isolation. Specific primers were designed by bioinformatics analysis for detection of the virulence genes exoA, oprL and algD. The available sequences of these three genes were obtained from NCBI and multiple alignments were performed to find the conserved sequences of each gene for primer designing. Both multiple alignment and primer designing steps were carried out by AlleleID software, version 7.0.Results: Microbiological culture methods were showed that 70 Pseudomonas aeruginosa strains isolated from the 150 clinical specimens. PCR assay performed by using the designed primers shown 68, 70 and 69 positive results from 70 direct specimens for exoA, oprL and algD respectively that shown 97.2%, 100% and 98.6% sensitivity for above genes. PCR assay performed by using the already published primers shown 57, 49 and 28 positive results for above genes respectively that shown 81.5%, 70% and 40% sensitivity.Conclusion: The present study shows that by using the high specific primers for detection of the mentioned genes of the Pseudomonas aeruginosa. The conventional PCR assay detected the early colonization of the organism in Cystic Fibrosis patients with more sensitivity and specificity before several mounts to obtain positive culture. Indeed PCR assay with high specific primers has more sensitivity and specificity as a rapid and accurate diagnosis of the organism in other deadly infections by using the direct clinical specimens.

  1. DNA TYPING SYSTEM FOR HLA-A2 ALLELES BY POLYMERASE CHAIN REACTION WITH SEQUENCE-SPECIFIC PRIMERS

    Institute of Scientific and Technical Information of China (English)

    张庆瑞; 翟宁; 耿龙; 宋芳吉

    2001-01-01

    Objectivs. To establish a PCR-SSP method for discriminating as many HLA-A+02 alleles, which could easilybe introduced into a routine laboratory. Methods. In this study we typed HLA-A+02 polymorphisms by a sequence-specific primer (SSP) method,which involved round 1 and round 2 PCR reactions to detect 17 HLA-A+02 alleles (they are HLA-A+0201- 0217 alleles) covering exon 2 and exon 3. Results. We have fmmd that DNA sample concentration and purity were the most important variables in determin-ing the quality of the results. For identiffing correct band size, the size marker used was important. We noticed that different PCR machines pedormed differently. By this method, we detected 20 HLA-A+02 positive genomic DNA samples and found 4 kinds of HLA-A +02 alleles. They were HLA-A +0201, 0203, 0206 and 0210. Condusion. The HLA-A +02 PCR-SSP method was proven to be a reliable and easily applicable typing method. Our results suggest that the SSP described here provides an optimal HLA-A +02 typing technique that may be useful in selecting donor-recipient pairs in bone marrow transplantation between unrelated individuals.

  2. DNA TYPING SYSTEM FOR HLA-A2 ALLELES BY POLYMERASE CHAIN REACTION WITH SEQUENCE-SPECIFIC PRIMERS

    Institute of Scientific and Technical Information of China (English)

    张庆瑞; 翟宁; 耿龙; 宋芳吉

    2001-01-01

    Objective. To establish a PCR-SSP method for discriminating as many HLA-A* 02 alleles, which could easily be introduced into a rourine laboratory.``Methods. In this study we typed HLA-A*02 polymorphisms by a sequence-specific primer (SSP) method,which involved round 1 and round 2 PCR reactions to detect 17 HLA-A*02 alleles (they are HLA-A*0201- 0217alleles) covering exon 2 and exon 3.``Results. We have found that DNA sample concentration and purity were the most important variables in determining the quality of the results. For identifying correct band size, the size marker used was important. We noticed that different PCR machines performed differently. By this method, we detected 20 HLA-A* 02 positive genomic DNA samples and found 4 kinds of HLA-A*02 alleles. They were HLA-A*0201, 0203, 0206 and 0210.``Conclusior. The HLA-A* 02 PCR-SSP method was proven to be a reliable and easily applicable typing method. Our results suggest that the SSP described here provides an optimal HLA-A* 02 typing technique that may be useful in selecting donor-recipient pairs in bone marrow transplantation between unrelated individuals.

  3. Wet-lab tested microRNA assays for qPCR studies with SYBR®Green and DNA primers in pig tissues

    DEFF Research Database (Denmark)

    Mentzel, Caroline M. Junker; Skovgaard, Kerstin; Córdoba, Sarai;

    2014-01-01

    . We have previously developed two useful tools in the field of microRNA quantitative real time PCR (qPCR): 1) a very specific, sensitive and simple qPCR method based on DNA primers, MiR-specific qPCR; and 2) the free primer-design software miRprimer. The present study integrates in a publicly...... who are working on microRNAs and want to use readily tested qPCR assays in a simple and cost-effective manner....

  4. Effects of DNA extraction and universal primers on 16S rRNA gene-based DGGE analysis of a bacterial community from fish farming water

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Among many reports investigating microbial diversity from environmental samples with denaturing gradient gel electrophoresis (DGGE), limited attention has been given to the effects of universal primers and DNA extraction on the outcome of DGGE analysis. In this study, these effects were tested with 16S rRNA gene-based DGGE on a bacterial community from farming water samples. The results indicate that the number of discernable bands in the DGGE fingerprint differed with the primer pairs used; the bands produced by 63f/518r, 341f/926r and 933f/1387r primer pairs were obviously fewer than those by 968f/1401r. Also, we found that each DNA extraction method resulted in different community profiles, reflected by the number and intensity of bands in the DGGE fingerprint. Furthermore,the main bands (theoretically representing dominant bacteria) differed with the extraction methods applied.It is therefore believed that the effects of universal primers and DNA extraction should be given more attention and carefully chosen before performing an investigation into a new environment with DGGE.

  5. Evaluation of different primers and DNA preparations for molecular diagnosis of human African Trypanosomosis

    International Nuclear Information System (INIS)

    This study was aimed at improving the diagnosis of Human African Trypanosomosis (HAT or sleeping sickness). We used the PCR on blood samples to compare two different methods of extraction/purification of DNA (chelex and DNA easy), and several PCR techniques (TBR 1-2, TgsGP, ESAG 6-7). The comparisons related to subjects taken at the time of medical surveillance in the mid-west of Ivory Coast and Benin: patients (Trypanosomes seen by parasitological tests), subjects with positive serologic tests but negative with parasitological tests (called sero-positives), negative subjects in serology and parasitology, and healthy volunteers living in Europe. The best combination was TBR used with Chelex. Under these conditions, the PCR test is simple, easily usable in a tropical laboratory, more sensitive than the parasitological examinations, and could help with the early detection of the cases, the decision to treat a patient, and with the post-therapeutic follow-up to detect cases of relapse. However, the limits of specificity and its high cost still restrict its use at the research laboratories

  6. OPA1-related dominant optic atrophy is not strongly influenced by mitochondrial DNA background.

    OpenAIRE

    Amati-Bonneau Patrizia; Thoraval Didier; Murail Pascal; Chevrollier Arnaud; Rocher Christophe; Ferré Marc; Pierron Denis; Reynier Pascal; Letellier Thierry

    2009-01-01

    Abstract Background Leber's hereditary optic neuropathy (LHON) and autosomal dominant optic atrophy (ADOA) are the most frequent forms of hereditary optic neuropathies. LHON is associated with mitochondrial DNA (mtDNA) mutations whereas ADOA is mainly due to mutations in the OPA1 gene that encodes a mitochondrial protein involved in the mitochondrial inner membrane remodeling. A striking influence of mtDNA haplogroup J on LHON expression has been demonstrated and it has been recently suggeste...

  7. Algorithms and Software for PCR Primer Design

    OpenAIRE

    Huang, Yu-ting

    2015-01-01

    Polymerase Chain Reaction (PCR) is a widely used technology in molecular bi-ology for DNA amplification. To generate multiple copies of a DNA molecule, a pair ofprimers (two synthesized DNA sequences with a total length of 15-30 bases) are annealedto the boundaries of the targeted DNA molecule. Then, the new replicated DNA fragmentelongates from one primer to the other.Though primers always hybridize to their respective complements within DNAsequences, primer pairs for targeted DNA sequences ...

  8. Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

    OpenAIRE

    Zuiter Afnan; Sawwan Jammal; Al Abdallat Ayed

    2012-01-01

    Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs) and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis...

  9. Mitochondrial DNA Haplogroup Background Affects LHON, but Not Suspected LHON, in Chinese Patients

    OpenAIRE

    Zhang, A-Mei; Jia, Xiaoyun; Bi, Rui; Salas, Antonio; Li, Shiqiang; Xiao, Xueshan; Wang, Panfeng; Guo, Xiangming; Kong, Qing-Peng; Zhang, Qingjiong; Yao, Yong-Gang

    2011-01-01

    Recent studies have shown that mtDNA background could affect the clinical expression of Leber hereditary optic neuropathy (LHON). We analyzed the mitochondrial DNA (mtDNA) variation of 304 Chinese patients with m.11778G>A (sample #1) and of 843 suspected LHON patients who lack the three primary mutations (sample #2) to discern mtDNA haplogroup effect on disease onset. Haplogroup frequencies in the patient group was compared to frequencies in the general Han Chinese population (n = 1,689; samp...

  10. Background Adjustment for DNA Microarrays Using a Database of Microarray Experiments

    OpenAIRE

    Sui, Yunxia; Zhao, Xiaoyue; Speed, Terence P.; Wu, Zhijin

    2009-01-01

    DNA microarrays have become an indispensable technique in biomedical research. The raw measurements from microarrays undergo a number of preprocessing steps before the data are converted to the genomic level for further analysis. Background adjustment is an important step in preprocessing. Estimating background noise has been challenging because background levels vary a lot from probe to probe, yet there are limited observations on each probe. Most current methods have used the empirical Baye...

  11. Recovery of the mitochondrial COI barcode region in diverse Hexapoda through tRNA-based primers

    Directory of Open Access Journals (Sweden)

    Oh Hyun-Woo

    2010-07-01

    Full Text Available Abstract Background DNA barcoding uses a 650 bp segment of the mitochondrial cytochrome c oxidase I (COI gene as the basis for an identification system for members of the animal kingdom and some other groups of eukaryotes. PCR amplification of the barcode region is a key step in the analytical chain, but it sometimes fails because of a lack of homology between the standard primer sets and target DNA. Results Two forward PCR primers were developed following analysis of all known arthropod mitochondrial genome arrangements and sequence alignment of the tRNA-W gene which was usually located within 200 bp upstream of the COI gene. These two primers were combined with a standard reverse primer (LepR1 to produce a cocktail which generated a barcode amplicon from 125 of 141 species that included representatives of 121 different families of Hexapoda. High quality sequences were recovered from 79% of the species including groups, such as scale insects, that invariably fail to amplify with standard primers. Conclusions A cocktail of two tRNA-W forward primers coupled with a standard reverse primer amplifies COI for most hexapods, allowing characterization of the standard barcode primer binding region in COI 5' as well as the barcode segment. The current results show that primers designed to bind to highly conserved gene regions upstream of COI will aid the amplification of this gene region in species where standard primers fail and provide valuable information to design a primer for problem groups.

  12. Extended minus-strand DNA as template for R-U5-mediated second-strand transfer in recombinational rescue of primer binding site-modified retroviral vectors

    DEFF Research Database (Denmark)

    Mikkelsen, J G; Lund, Anders Henrik; Dybkaer, K;

    1998-01-01

    We have previously demonstrated recombinational rescue of primer binding site (PBS)-impaired Akv murine leukemia virus-based vectors involving initial priming on endogenous viral sequences and template switching during cDNA synthesis to obtain PBS complementarity in second-strand transfer of...... mutated PBS during minus-strand synthesis, and subsequent second-strand transfer mediated by the R-U5 complementarity of the plus strand and the extended minus-strand DNA acceptor template. Mechanisms for R-U5-mediated second-strand transfer and its possible role in retrovirus replication and evolution...

  13. Adaptation of the interspersed repetitive sequence polymerase chain reaction to the isolation of mouse DNA probes from somatic cell hybrids on a hamster background

    International Nuclear Information System (INIS)

    A strategy for the rapid isolation of DNA probes from radiation-fusion Chinese hamster cell hybrids containing overlapping portions of the murine X chromosome based on the interspersed repetitive sequence polymerase chain reaction (IRS-PCR) previously used with human somatic cell hybrids has been developed. This specific amplification of mouse DNA on a hamster background depends on the use of primers directed to the B2 short interspersed repeat element family and the R repeat, from the long interspersed repeat element family, L1. Two sets of amplification conditions, which gave specific amplification of mouse DNA from either a mouse X-monochromosomal hybrid or irradiation-fusion hybrids having reduced X content, were defined. The mouse X-only chromosome hybrid yielded approximately 20 discrete reproducible bands, while the irradiation-fusion hybrids yielded between 1 and 10 discrete products. Comparison of different irradiation-fusion hybrids has allowed the definition of both specific and shared products corresponding to different regions within the overlapping X-chromosome fragments present within these hybrids. Use of such hybrids and the IRS-PCR technique has allowed the isolation of probes corresponding to the central region of the mouse X chromosome that contains the X-inactivation center. The method should be widely applicable to the isolation of mouse DNA sequences from mouse hybrid cell lines on either human or Chinese hamster backgrounds

  14. Detection of herpes simplex virus DNA by polymerase chain reaction in the cerebrospinal fluid of patients with vial meningoencephalitis using primers for the glycoprotein D gene

    International Nuclear Information System (INIS)

    A novel set of primers for polymerase chain reaction (PCR) which amplified the portion of US6 sequence coding for the main type-common neutralizing epitope of glycoprotein D was used for detection of herpes simplex virus (HSV) DNA in 44 cerebrospinal fluid (CSF) samples from 29 patients with clinical symptoms of viral meningitis or meningoencephalitis. The primers in question amplified the DNA of 9 out of 10 low-passage HSV-1 isolates and of 5 out of 10 HSV-2 low passage isolates as well as the DNA of ail laboratory strains examined when tested in the supernatant fluid of infected cells cultures. The PCR was positive in 5 CSF samples (taken on days 2, 4, 8, 10 and 56 after the onset of symptoms, but not later than day 8 after starting acyclovir (ACV) therapy) obtained from 4 patients with intrathecal antibody response. The PCR was repeatedly negative in CSF of 15 patients who had antibodies to HSV in serum and CSF, but did not show intrathecal antibody production. It was also negative in 10 patients who had no HSV antibodies in CSF. Our results confirmed that positive PCR for HSV DNA in the CSF is an indication for starting and/or continuing ACV therapy even in the absence of classical symptoms of HSV encephalitis. (author)

  15. Oxidative DNA damage background estimated by a system model of base excision repair

    Energy Technology Data Exchange (ETDEWEB)

    Sokhansanj, B A; Wilson, III, D M

    2004-05-13

    Human DNA can be damaged by natural metabolism through free radical production. It has been suggested that the equilibrium between innate damage and cellular DNA repair results in an oxidative DNA damage background that potentially contributes to disease and aging. Efforts to quantitatively characterize the human oxidative DNA damage background level based on measuring 8-oxoguanine lesions as a biomarker have led to estimates varying over 3-4 orders of magnitude, depending on the method of measurement. We applied a previously developed and validated quantitative pathway model of human DNA base excision repair, integrating experimentally determined endogenous damage rates and model parameters from multiple sources. Our estimates of at most 100 8-oxoguanine lesions per cell are consistent with the low end of data from biochemical and cell biology experiments, a result robust to model limitations and parameter variation. Our results show the power of quantitative system modeling to interpret composite experimental data and make biologically and physiologically relevant predictions for complex human DNA repair pathway mechanisms and capacity.

  16. Can DNA-Based Ecosystem Assessments Quantify Species Abundance? Testing Primer Bias and Biomass--Sequence Relationships with an Innovative Metabarcoding Protocol.

    Directory of Open Access Journals (Sweden)

    Vasco Elbrecht

    Full Text Available Metabarcoding is an emerging genetic tool to rapidly assess biodiversity in ecosystems. It involves high-throughput sequencing of a standard gene from an environmental sample and comparison to a reference database. However, no consensus has emerged regarding laboratory pipelines to screen species diversity and infer species abundances from environmental samples. In particular, the effect of primer bias and the detection limit for specimens with a low biomass has not been systematically examined, when processing samples in bulk. We developed and tested a DNA metabarcoding protocol that utilises the standard cytochrome c oxidase subunit I (COI barcoding fragment to detect freshwater macroinvertebrate taxa. DNA was extracted in bulk, amplified in a single PCR step, and purified, and the libraries were directly sequenced in two independent MiSeq runs (300-bp paired-end reads. Specifically, we assessed the influence of specimen biomass on sequence read abundance by sequencing 31 specimens of a stonefly species with known haplotypes spanning three orders of magnitude in biomass (experiment I. Then, we tested the recovery of 52 different freshwater invertebrate taxa of similar biomass using the same standard barcoding primers (experiment II. Each experiment was replicated ten times to maximise statistical power. The results of both experiments were consistent across replicates. We found a distinct positive correlation between species biomass and resulting numbers of MiSeq reads. Furthermore, we reliably recovered 83% of the 52 taxa used to test primer bias. However, sequence abundance varied by four orders of magnitudes between taxa despite the use of similar amounts of biomass. Our metabarcoding approach yielded reliable results for high-throughput assessments. However, the results indicated that primer efficiency is highly species-specific, which would prevent straightforward assessments of species abundance and biomass in a sample. Thus, PCR

  17. Development of detection/analysis for radiation induced mutations using new DNA analyzing techniques. Construction of effective probe and primer, and their detection method

    International Nuclear Information System (INIS)

    An investigation was made on the genome structure of 28 S rDNA in the respect of radiation-induced double strand cleavages in DNA. It has been reported that there is an insertion of retro-transposon in some rDNA. There is a possibility that rDNA may have a specific structure composed of several regions of different sensitivities to radiation exposure. Hence, the structure and the functions of such regions were investigated. This region was as long as 2.5 Mb in length and divided into inserted type and un-inserted one. FISH showed that the inserted regions are composed of mini-clusters and the structure was high-ordered. A new primer was constructed so as to provide PCR products of about 5 Kb in length. When the DNA was exposed to γ-ray (60Co and 137Cs), the amount of PCR products was dose-dependently increased up to 10 Gy and the increase was 15-20 % at the dose. Therefore, it was suggested that PCR amplification was enhanced because of the destruction of higher-ordered structure caused by radiation exposure. The sensitivity of some DNA region to 60Co or 137Cs exposure was different from that of other regions in respect of the formation of double strand cleavage. Therefore, it was thought that such high-ordered genome region could be distinguishable from other regions with the differences in radiation sensitivity of genome DNA. (M.N.)

  18. The eukaryotic leading and lagging strand DNA polymerases are loaded onto primer-ends via separate mechanisms but have comparable processivity in the presence of PCNA

    Science.gov (United States)

    Chilkova, Olga; Stenlund, Peter; Isoz, Isabelle; Stith, Carrie M.; Grabowski, Pawel; Lundström, Else-Britt; Burgers, Peter M.; Johansson, Erik

    2007-01-01

    Saccharomyces cerevisiae DNA polymerase δ (Pol δ) and DNA polymerase ε (Pol ε) are replicative DNA polymerases at the replication fork. Both enzymes are stimulated by PCNA, although to different levels. To understand why and to explore the interaction with PCNA, we compared Pol δ and Pol ε in physical interactions with PCNA and nucleic acids (with or without RPA), and in functional assays measuring activity and processivity. Using surface plasmon resonance technique, we show that Pol ε has a high affinity for DNA, but a low affinity for PCNA. In contrast, Pol δ has a low affinity for DNA and a high affinity for PCNA. The true processivity of Pol δ and Pol ε was measured for the first time in the presence of RPA, PCNA and RFC on single-stranded DNA. Remarkably, in the presence of PCNA, the processivity of Pol δ and Pol ε on RPA-coated DNA is comparable. Finally, more PCNA molecules were found on the template after it was replicated by Pol ε when compared to Pol δ. We conclude that Pol ε and Pol δ exhibit comparable processivity, but are loaded on the primer-end via different mechanisms. PMID:17905813

  19. Use of cadA-Specific Primers and DNA Probes as Tools to Select Cadmium Biosorbents with Potential in Remediation Strategies.

    Science.gov (United States)

    Icgen, Bulent; Yilmaz, Fadime

    2016-05-01

    Biosorption, using cadmium-resistant bacterial isolates, is often regarded as a relatively inexpensive and efficient way of cleaning up wastes, sediments, or soils polluted with cadmium. Therefore, many efforts have been devoted to the isolation of cadmium-resistant isolates for the efficient management of cadmium remediation processes. However, isolation, identification and in situ screening of efficient cadmium-resistant isolates are primary challenges. To overcome these challanges, in this study, cadA, cadmium resistance coding gene, specific primers and DNA probes were used to identify and screen cadmium-resistant bacteria in the cadmium-polluted river waters through polymerase chain reaction (PCR) and fluorescein in situ hybridization (FISH). PCR amplification of the cadA amplicon coupled with 16S rRNA sequencing revealed various gram-positive and -negative bacterial isolates harboring cadA. Accordingly, a cadA-mediated DNA probe was prepared and used for in situ screening of cadmium-resistant isolates from water samples collected from cadmium-polluted river waters. The FISH analyses of cadA probe showed highly specific and efficient hybridization with cadA harboring isolates. The use of primers and DNA probes specific for cadA gene seems to be very helpful tools for the selection and screening of cadmium biosorbents with potential to be used in the remediation of cadmium-polluted sites. PMID:26969609

  20. Mitochondrial DNA haplogroup background affects LHON, but not suspected LHON, in Chinese patients.

    Directory of Open Access Journals (Sweden)

    A-Mei Zhang

    Full Text Available Recent studies have shown that mtDNA background could affect the clinical expression of Leber hereditary optic neuropathy (LHON. We analyzed the mitochondrial DNA (mtDNA variation of 304 Chinese patients with m.11778G>A (sample #1 and of 843 suspected LHON patients who lack the three primary mutations (sample #2 to discern mtDNA haplogroup effect on disease onset. Haplogroup frequencies in the patient group was compared to frequencies in the general Han Chinese population (n = 1,689; sample #3. The overall matrilineal composition of the suspected LHON population resembles that of the general Han Chinese population, suggesting no association with mtDNA haplogroup. In contrast, analysis of these LHON patients confirms mtDNA haplogroup effect on LHON. Specifically, the LHON sample significantly differs from the general Han Chinese and suspected LHON populations by harboring an extremely lower frequency of haplogroup R9, in particular of its main sub-haplogroup F (#1 vs. #3, P-value = 1.46×10(-17, OR = 0.051, 95% CI: 0.016-0.162; #1 vs. #2, P-value = 4.44×10(-17, OR = 0.049, 95% CI: 0.015-0.154; in both cases, adjusted P-value A but not suspected LHON. Haplogroup F has a protective effect against LHON, while M7b is a risk factor.

  1. Evaluation of the Prototype Roche DNA Amplification Kit Incorporating the New SSK145 and SKCC1B Primers in Detection of Human Immunodeficiency Virus Type 1 DNA in Zimbabwe

    OpenAIRE

    Zijenah, Lynn S.; Humphrey, Jean; Nathoo, Kussum; Malaba, Lucie; Zvandasara, Parteson; Mahomva, Agnes; Iliff, Peter; Mbizvo, Michael T.

    1999-01-01

    We assessed the sensitivity and specificity of a newly developed DNA PCR kit (Roche Diagnostic Corporation, Indianapolis, Ind.) that incorporates primers for all the group M viruses for the detection of human immunodeficiency virus (HIV) type 1 (HIV-1) infection in Zimbabwe. A total of 202 whole-blood samples from adults whose HIV status was known were studied. This included 100 HIV-1-positive and 102 HIV-1-negative samples selected on the basis of concordant results obtained with two enzyme-...

  2. DNA Microarray Based on Arrayed-Primer Extension Technique for Identification of Pathogenic Fungi Responsible for Invasive and Superficial Mycoses▿

    OpenAIRE

    Campa, Daniele; Tavanti, Arianna; Gemignani, Federica; Mogavero, Crocifissa S.; Bellini, Ilaria; Bottari, Fabio; Barale, Roberto; Landi, Stefano; Senesi, Sonia

    2007-01-01

    An oligonucleotide microarray based on the arrayed-primer extension (APEX) technique has been developed to simultaneously identify pathogenic fungi frequently isolated from invasive and superficial infections. Species-specific oligonucleotide probes complementary to the internal transcribed spacer 1 and 2 (ITS1 and ITS2) region were designed for 24 species belonging to 10 genera, including Candida species (Candida albicans, Candida dubliniensis, Candida famata, Candida glabrata, Candida tropi...

  3. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Directory of Open Access Journals (Sweden)

    Wang Xiaowei

    2008-12-01

    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  4. Phonics Primer

    Science.gov (United States)

    Elam, Sandra

    2007-01-01

    This primer lists the 44 sounds in the English language and then gives steps for teaching those 44 sounds and their most common spelling patterns. In addition to learning sounds and spellings, each day the student must read lists of phonetically related words and spell these words from dictation. Phonics instruction must be reinforced by having…

  5. Single primer-based DNA amplification as a suitable and low-cost tool for assessing genetic diversity in mangrove crabs.

    Science.gov (United States)

    Britto, F B; Mendes, D S F; Ogawa, M; Cintra, I H A; Diniz, F M

    2011-01-01

    We used single primer-based DNA markers to assess genetic variability of the mangrove crab, Ucides cordatus, collected from four different localities from Pará to Santa Catarina States in Brazil (almost 5000 km distant). Five primers were chosen based on the consistency of the amplified bands and the polymorphism of each locus. A total of 78 loci were amplified in 76 samples; high polymorphism rates were detected in the entire sample (80.8%) and within each locality (73.5-79.5%). Analysis of molecular variance demonstrates significant differences between localities (P < 0.001); however, the Φ(ST) value (0.078) indicates a low level of genetic differentiation, which suggests that U. cordatus larvae can spread over large distances. The variation was distributed among the samples, and most of it was attributed to differences among individuals within localities. Cluster analysis, based on the Jaccard similarity coefficient, and the Mantel test gave similar results to the analysis of molecular variance data. Despite the low level of population structuring, these markers could be used for studying U. cordatus diversity, due to the high level of polymorphism. PMID:22095479

  6. Primer on molecular genetics

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  7. Use of arbitrary DNA primers, polyacrylamide gel electrophoresis and silver staining for identity testing, gene discovery and analysis of gene expression

    International Nuclear Information System (INIS)

    To understand chemically-induced genomic differences in soybean mutants differing in their ability to enter the nitrogen-fixing symbiosis involving Bradyrhizobium japonicum, molecular techniques were developed to aid the map-based, or positional, cloning. DNA marker technology involving single arbitrary primers was used to enrich regional RFLP linkage data. Molecular techniques, including two-dimensional pulse field gel electrophoresis, were developed to ascertain the first physical mapping in soybean, leading to the conclusion that in the region of marker pA-36 on linkage group H, 1 cM equals about 500 cM. High molecular weight DNA was isolated and cloned into yeast or bacterial artificial chromosomes (YACs/ BACs). YACs were used to analyze soybean genome structure, revealing that over half of the genome contains repetitive DNA. Genetic and molecular tools are now available to facilitate the isolation of plant genes directly involved in symbiosis. The further characterization of these genes, along with the determination of the mechanisms that lead to the mutation, will be of value to other plants and induced mutation research. (author)

  8. Integrated Molecular Analysis Indicates Undetectable Change in DNA Damage in Mice after Continuous Irradiation at ~ 400-fold Natural Background Radiation

    OpenAIRE

    Olipitz, Werner; Wiktor-Brown, Dominika; Shuga, Joe; Pang, Bo; McFaline, Jose; Lonkar, Pallavi; Thomas, Aline; Mutamba, James T; Greenberger, Joel S.; Samson, Leona D.; Dedon, Peter C; Yanch, Jacquelyn C.; Engelward, Bevin P.

    2012-01-01

    Background: In the event of a nuclear accident, people are exposed to elevated levels of continuous low dose-rate radiation. Nevertheless, most of the literature describes the biological effects of acute radiation. Objectives: DNA damage and mutations are well established for their carcinogenic effects. We assessed several key markers of DNA damage and DNA damage responses in mice exposed to low dose-rate radiation to reveal potential genotoxic effects associated with low dose-rate radiation....

  9. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    Directory of Open Access Journals (Sweden)

    Nomin Batnyam

    2012-01-01

    Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

  10. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes.

    Science.gov (United States)

    Batnyam, Nomin; Lee, Jimin; Lee, Jungnam; Hong, Seung Bok; Oh, Sejong; Han, Kyudong

    2012-01-01

    Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR) assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque) and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors. PMID:22693428

  11. [G3T]5/Tb(3+) based DNA biosensor with target DNA-triggered autocatalytic multi-cycle-amplification and magnetic nanoparticles assisted-background-lowered.

    Science.gov (United States)

    Jiang, Hong; Zhang, Xiaojun; Wang, Guangfeng

    2015-12-15

    Due to terbium's unique photophysical properties, nucleic-acid-sensitized terbium (DNA/Tb(3+)) bioluminescent system becomes a potential candidate for the fabrication of DNA biosensors. However, the low sensitivity of DNA/Tb(3+) bioluminescent system limits its development. In this paper, a strategy combining autocatalytic multi-cycle-amplification (including exonuclease III (exo III)-aided and Zn(2+)-requiring DNAzyme-assisted target recycling amplifications) and magnetic nanoparticles assisted-background-lowering to improve the sensitivity of DNA/Tb(3+) bioluminescent system is presented for sensitive detection of target DNA (tDNA). The DNA/Tb(3+) bioluminescent system was investigated by ultraviolet-visible (UV-vis) absorption and luminescence spectra. The possible conjugation mechanism and mode of DNA with Tb(3+) were discussed. The autocatalytic multi-cycle-amplification effect was investigated by the comparison of the luminescence. The carboxylation-functionalized Fe3O4-magnetic nanoparticles (MNPs) were characterized and its role in background lowering was proved. As a result, with the designed protocol, the detection limit for the tDNA detection reached a low level to aM, which is especially exciting for the DNA/Tb(3+) bioluminescent system. In the process, due to the separation effect of MNPs, the assay solution was purified to avoid the nonspecific luminescence of DNA/Tb(3+), not only lowering the background signal greatly (about five times lower than that without the use of MNPs but also improving the reproducibility and stability. We hope that our attempt in this field will not only extend the application of DNA/Tb(3+) luminescent system in biosensing areas but also open the road to adaptation of the protocols to other related analytes. PMID:26257185

  12. Evidence of sibling species in brown planthopper, Nilaparvata lugens complex, detected from long primer random amplified polymorphic DNA (LP-RAPD) fingerprints

    International Nuclear Information System (INIS)

    The brown planthopper, N. lugens (Staal), has become a serious threat to rice production throughout tropical and sub-tropical Asia with the spread of high yielding rice varieties and intensive culture practices since about 1970. It causes 'hopperburn' and complete wilting and drying of rice plants. Another N. lugens population was found to infest a weed grass, Leersia hexandra that grows abundantly in canals near irrigated rice fields in southeastern Asia. The Leersia infesting N. lugens population fails to survive on rice plants. Conversely, rice infesting N. lugens does not thrive on Leersia. Two sympatric populations of N. lugens, one from rice and other from L. hexandra were collected from five locations in Malaysia. The locations were University Putra Malaysia (UPM), Tanjung Karang (TK), Melaka (MK), Perak (PK) and Sabah (SB). An out group, N. bakeri was also collected from Cameron Highlands (CH). The insects used for long primer RAPD analysis were tested for esterase activity on a simple filter paper using the method reported by Pasteur and Georghiou. DNA extraction and PCR protocols were followed as described by Gillings and Holley. Four Long RAPD primers were used in this study. The primer, pehA no.6, 5'ATCGCACTTGATGCGCAGGCCGTT was diagnostic and the other three yielded the strongest bands and showed polymorphisms in rice and Leersia populations of N. lugens. Cluster analysis based on genetic distance revealed that the 10 brown planthopper populations and an out group, N. bakeri were divided into three major clusters. N. bakeri formed the most isolated cluster from populations of either rice or Leersia infesting populations of N. lugens. The rice infesting populations of five localities clustered together as a group. On the other hand Leersia infesting populations of the same localities formed another distinct cluster. An analysis of molecular variance was also performed and confirmed the differentiation into two groups. One RAPD band that was obtained

  13. Identification of signature and primers specific to genus Pseudomonas using mismatched patterns of 16S rDNA sequences

    OpenAIRE

    Kapley A; Raje DV; Purohit HJ

    2003-01-01

    Abstract Background Pseudomonas, a soil bacterium, has been observed as a dominant genus that survives in different habitats with wide hostile conditions. We had a basic assumption that the species level variation in 16S rDNA sequences of a bacterial genus is mainly due to substitutions rather than insertion or deletion of bases. Keeping this in view, the aim was to identify a region of 16S rDNA sequence and within that focus on substitution prone stretches indicating species level variation ...

  14. Primers for the Amplification of the Circular Chloroplast DNA from the A-genome Group of Cultivated Cotton

    Institute of Scientific and Technical Information of China (English)

    IBRAHIM Rashid Ismael Hag; AZUMA Jun-Ichi; SAKAMOTO Masahiro

    2008-01-01

    @@ The availability of the plastid genome sequences is one of the bases for comparative,functional,and structural genomic studies of plastid-containing living organisms,in addition to the application of plastid genetic engineering technology.The past efforts to sequence plastid genomes involve complicated preparation protocols.One procedure starts with the isolation of plastids,which was tiresome and time wasting that followed by a second step to extract plastid DNA from the isolated plastids,then finally the build up of plasmid or bacterial artificial chromosome (BAC) library.

  15. The role of the immunological background of mice in the genetic variability of Schistosoma mansoni as detected by random amplification of polymorphic DNA.

    Science.gov (United States)

    Cossa-Moiane, I L; Mendes, T; Ferreira, T M; Mauricio, I; Calado, M; Afonso, A; Belo, S

    2015-11-01

    Schistosomiasis is a parasitic disease caused by flatworms of the genus Schistosoma. Among the Schistosoma species known to infect humans, S. mansoni is the most frequent cause of intestinal schistosomiasis in sub-Saharan Africa and South America: the World Health Organization estimates that about 200,000 deaths per year result from schistosomiasis in sub-Saharan Africa alone. The Schistosoma life cycle requires two different hosts: a snail as intermediate host and a mammal as definitive host. People become infected when they come into contact with water contaminated with free-living larvae (e.g. when swimming, fishing, washing). Although S. mansoni has mechanisms for escaping the host immune system, only a minority of infecting larvae develop into adults, suggesting that strain selection occurs at the host level. To test this hypothesis, we compared the Belo Horizonte (BH) strain of S. mansoni recovered from definitive hosts with different immunological backgrounds using random amplification of polymorphic DNA-polymerase chain reaction (RAPD-PCR). Schistosoma mansoni DNA profiles of worms obtained from wild-type (CD1 and C57BL/6J) and mutant (Jα18- / - and TGFβRIIdn) mice were analysed. Four primers produced polymorphic profiles, which can therefore potentially be used as reference biomarkers. All male worms were genetically distinct from females isolated from the same host, with female worms showing more specific fragments than males. Of the four host-derived schistosome populations, female and male adults recovered from TGFβRIIdn mice showed RAPD-PCR profiles that were most similar to each other. Altogether, these data indicate that host immunological backgrounds can influence the genetic diversity of parasite populations. PMID:24991919

  16. Constructing a DNA ladder Range for Lambda Phage by multiplex PCR

    OpenAIRE

    Joseph, S; Gopalakrishnan, R; Sellappa, S

    2010-01-01

    Background and Objectives: DNA ladder contains DNA fragments of different length but with known size, used to determine the size of unknown DNA molecules. Different DNA ladders are available for expected DNA length. Conserved sequences were selected for design of primers to generate DNA fragments of known specific size."nMaterials and Methods: In this study, we describe a method by which DNA ladder was prepared based on multiplex PCR technique. Different lengths of DNA fragments were amplifie...

  17. Constructing a DNA ladder Range for Lambda Phage by multiplex PCR

    Directory of Open Access Journals (Sweden)

    S Joseph

    2010-12-01

    Full Text Available Background and Objectives: DNA ladder contains DNA fragments of different length but with known size, used to determine the size of unknown DNA molecules. Different DNA ladders are available for expected DNA length. Conserved sequences were selected for design of primers to generate DNA fragments of known specific size."nMaterials and Methods: In this study, we describe a method by which DNA ladder was prepared based on multiplex PCR technique. Different lengths of DNA fragments were amplified using the primers designed according to the 1216-2136 sequence extent of lambda phage DNA. Target DNA fragments were amplified using multiplex PCR and extracted."nResults: The results showed an amplified lambda phage DNA at particular target sites by using 1 forward and 6 different reverse primers (for 100, 200, 400, 600, 800, 1000bp for the successful amplification."nConclusion: This method would be more cost effective than commercial DNA molecular weight markers.

  18. Mitochondrial DNA Backgrounds Might Modulate Diabetes Complications Rather than T2DM as a Whole

    OpenAIRE

    Achilli, Alessandro; OLIVIERI, ANNA; Pala, Maria; Hooshiar Kashani, Baharak; Carossa, Valeria; Perego, Ugo A.; Gandini, Francesca; Santoro, Aurelia; Battaglia, Vincenza; Grugni, Viola; Lancioni, Hovirag; Sirolla, Cristina; Bonfigli, Anna Rita; Cormio, Antonella; Boemi, Massimo

    2011-01-01

    Mitochondrial dysfunction has been implicated in rare and common forms of type 2 diabetes (T2DM). Additionally, rare mitochondrial DNA (mtDNA) mutations have been shown to be causal for T2DM pathogenesis. So far, many studies have investigated the possibility that mtDNA variation might affect the risk of T2DM, however, when found, haplogroup association has been rarely replicated, even in related populations, possibly due to an inadequate level of haplogroup resolution. Effects of mtDNA varia...

  19. Clinical expression of Leber hereditary optic neuropathy is affected by the mitochondrial DNA-haplogroup background.

    NARCIS (Netherlands)

    Hudson, G.; Carelli, V.; Spruijt, L.; Gerards, M.; Mowbray, C.; Achilli, A.; Pyle, A.; Elson, J.; Howell, N.; Morgia, C. La; Valentino, M.L.; Huoponen, K.; Savontaus, M.L.; Nikoskelainen, E.; Sadun, A.A.; Salomao, S.R.; Belfort Jr, R.; Griffiths, P.; Man, P.Y.; Coo, R.F. de; Horvath, R.; Zeviani, M.; Smeets, H.J.M.; Torroni, A.; Chinnery, P.F.

    2007-01-01

    Leber hereditary optic neuropathy (LHON) is due primarily to one of three common point mutations of mitochondrial DNA (mtDNA), but the incomplete penetrance implicates additional genetic or environmental factors in the pathophysiology of the disorder. Both the 11778G-->A and 14484T-->C LHON mutation

  20. PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection.

    Science.gov (United States)

    O'Halloran, Damien M

    2016-01-01

    Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction. PMID:26853558

  1. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads;

    2011-01-01

    are individually analysed in terms of GC content, presence of GC clamp at 3'-end, the risk of primer dimer formation, the risk of intra-primer complementarity (secondary structures) and the presence of polyN stretches. Furthermore, PHUSER offers the option to insert linkers between DNA fragments, as well as highly......Uracil-Specific Exision Reagent (USER) fusion is a recently developed technique that allows for assembly of multiple DNA fragments in a few simple steps. However, designing primers for USER fusion is both tedious and time consuming. Here, we present the Primer Help for USER (PHUSER) software......, a novel tool for designing primers specifically for USER fusion and USER cloning applications. We also present proof-of-concept experimental validation of its functionality. PHUSER offers quick and easy design of PCR optimized primers ensuring directionally correct fusion of fragments into a plasmid...

  2. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    OpenAIRE

    Nomin Batnyam; Jimin Lee; Jungnam Lee; Seung Bok Hong; Sejong Oh; Kyudong Han

    2012-01-01

    Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR) assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR-...

  3. Variation in extragenic repetitive DNA sequences in Pseudomonas syringae and potential use of modified REP primers in the identification of closely related isolates

    Directory of Open Access Journals (Sweden)

    Elif Çepni

    2012-01-01

    Full Text Available In this study, Pseudomonas syringe pathovars isolated from olive, tomato and bean were identified by species-specific PCR and their genetic diversity was assessed by repetitive extragenic palindromic (REP-PCR. Reverse universal primers for REP-PCR were designed by using the bases of A, T, G or C at the positions of 1, 4 and 11 to identify additional polymorphism in the banding patterns. Binding of the primers to different annealing sites in the genome revealed additional fingerprint patterns in eight isolates of P. savastanoi pv. savastanoi and two isolates of P. syringae pv. tomato. The use of four different bases in the primer sequences did not affect the PCR reproducibility and was very efficient in revealing intra-pathovar diversity, particularly in P. savastanoi pv. savastanoi. At the pathovar level, the primer BOX1AR yielded shared fragments, in addition to five bands that discriminated among the pathovars P. syringae pv. phaseolicola, P. savastanoi pv. savastanoi and P. syringae pv. tomato. REP-PCR with a modified primer containing C produced identical bands among the isolates in a pathovar but separated three pathovars more distinctly than four other primers. Although REP-and BOX-PCRs have been successfully used in the molecular identification of Pseudomonas isolates from Turkish flora, a PCR based on inter-enterobacterial repetitive intergenic concensus (ERIC sequences failed to produce clear banding patterns in this study.

  4. Background Levels of Salivary-α-amylase Plus Foreign DNA in Cases of Oral Intercourse: a Female Perspective.

    Science.gov (United States)

    Breathnach, Michelle; Moore, Elizabeth

    2015-11-01

    Saliva plus DNA from a suspect is commonly encountered in sexual assault cases on bodily swabs. However, without background knowledge, the weight of this evidence is unknown. It may indicate the presence of saliva resulting from cunnilingus, or it may represent indirect transfer. In this study, females who refrained from cunnilingus donated 43 items of underwear and 19 vaginal swabs. The samples were subjected to Phadebas(®) , RSID(™) -Saliva and mRNA profiling and were subsequently DNA-profiled to determine the prevalence of background saliva in the female population. The results report that 15.8% of females who refrained from cunnilingus were positive for saliva and a further 10.5% also had DNA from unknown source(s). These findings of the rate of indirect transfer were evaluated with the Bayesian approach, and it was found that the evidence of saliva plus a high foreign DNA source adds moderately strong support to the allegation of cunnilingus. PMID:26212904

  5. SBE primer : multiplexing minisequencing-based genotyping

    Energy Technology Data Exchange (ETDEWEB)

    Kaderali, L. (Lars); Deshpande, A. (Alina); Uribe-Romeo, F. J. (Francisco J.); Schliep, A.; Torney, D. C. (David C.)

    2002-01-01

    Single-nucleotide polymorphism (SNP) analysis is a powerful tool for mapping and diagnosing disease-related alleles. Most of the known genetic diseases are caused by point mutations, and a growing number of SNPs will be routinely analyzed to diagnose genetic disorders. Mutation analysis by polymerase mediated single-base primer extension (minisequencing) can be massively parallelized using for example DNA microchips or flow cytometry with microspheres as solid support. By adding a unique oligonucleotide tag to the 5-inch end of the minisequencing primer and attaching the complementary anti-tag to the array or bead surface, the assay can be 'demultiplexed'. However, such high-throughput scoring of SNPs requires a high level of primer multiplexing in order to analyze multiple loci in one assay, thus enabling inexpensive and fast polymorphism scoring. Primers can be chosen from either the plus or the minus strand, and primers used in the same experiment must not bind to one another. To genotype a given number of polymorphic sites, the question is which primer to use for each SNP, and which primers to group into the same experiment. Furthermore, a crosshybridization-free tag/anti-tag code is required in order to sort the extended primers to the corresponding microspheres or chip spots. These problems pose challenging algorithmic questions. We present a computer program lo automate the design process for the assay. Oligonucleotide primers for the reaction are automatically selected by the software, a unique DNA tag/anti-tag system is generated, and the pairing of primers and DNA-Tags is automatically done in a way to avoid any crossreactivity. We report first results on a 45-plex genotyping assay, indicating that minisequencing can be adapted to be a powerful tool for high-throughput, massively parallel genotyping.

  6. LOMA: A fast method to generate efficient tagged-random primers despite amplification bias of random PCR on pathogens

    Directory of Open Access Journals (Sweden)

    Lee Wah

    2008-09-01

    Full Text Available Abstract Background Pathogen detection using DNA microarrays has the potential to become a fast and comprehensive diagnostics tool. However, since pathogen detection chips currently utilize random primers rather than specific primers for the RT-PCR step, bias inherent in random PCR amplification becomes a serious problem that causes large inaccuracies in hybridization signals. Results In this paper, we study how the efficiency of random PCR amplification affects hybridization signals. We describe a model that predicts the amplification efficiency of a given random primer on a target viral genome. The prediction allows us to filter false-negative probes of the genome that lie in regions of poor random PCR amplification and improves the accuracy of pathogen detection. Subsequently, we propose LOMA, an algorithm to generate random primers that have good amplification efficiency. Wet-lab validation showed that the generated random primers improve the amplification efficiency significantly. Conclusion The blind use of a random primer with attached universal tag (random-tagged primer in a PCR reaction on a pathogen sample may not lead to a successful amplification. Thus, the design of random-tagged primers is an important consideration when performing PCR.

  7. Development of SCAR marker specific to non-toxic Jatropha curcas L. and designing a novel multiplexing PCR along with nrDNA ITS primers to circumvent the false negative detection

    KAUST Repository

    Mastan, Shaik G.

    2011-05-10

    Jatropha curcas L., a multipurpose shrub, has acquired significant economic importance for its seed oil which can be converted to biodiesel an emerging alternative to petro-diesel. In addition to the commercial value, it is also having medicinal and even high nutritional value to use as animal fodder which is limited due to the toxicity. Development of molecular marker will enable to differentiate non-toxic from toxic variety of J. curcas in a mixed population and also for quality control since the toxic components of J. curcas has deleterious effect on animals. In the present study, the efforts were made to generate the specific SCAR marker for toxic and/or non-toxic J. curcas from RAPD markers. Among the markers specific for toxic and non-toxic varieties, four were selected, purified, cloned, sequenced, and designed primers out of which one set of primers NT-JC/SCAR I/OPQ15-F and R could able to discriminate the non-toxic with toxic Jatropha by giving expected 430 bp size amplification in non-toxic variety. Furthermore, novel multiplex PCR was designed using the nrDNA ITS primers to overcome the false negatives. Present work also demonstrates utility of the conserved regions of nrDNA coding genes in ruling out the artifacts in PCR-like false negatives frequently occur in SCAR due to various reasons. The specific SCAR markers generated in the present investigation will help to distinguish non-toxic from toxic varieties of J. curcas or vice versa, and isolated marker along with designed multiplex protocol has applications in quality control for selective cultivation of non-toxic variety and will also assist in breeding and molecular mapping studies. © 2011 Springer Science+Business Media, LLC.

  8. Evidence of sibling species in the brown planthopper complex (Nilaparvata lugens) detected from short and long primer random amplified polymorphic DNA fingerprints.

    Science.gov (United States)

    Latif, M A; Soon Guan, Tan; Mohd Yusoh, Omar; Siraj, Siti Shapor

    2008-08-01

    The inheritance of 31 amplicons from short and long primer RAPD was tested for segregating ratios in two families of the brown planthopper, Nilaparvata lugens, and they were found to be inherited in a simple Mendelian fashion. These markers could now be used in population genetics studies of N. lugens. Ten populations of N. lugens were collected from five locations in Malaysia. Each location had two sympatric populations. Cluster and principal coordinate analyses based on genetic distance along with AMOVA revealed that the rice-infesting populations (with high esterase activity) at five localities clustered together as a group, and Leersia-infesting populations (with low esterase activity) at the same localities formed another distinct cluster. Two amplicons from primers OPD03 (0.65 kb) and peh#6 (1.0 kb) could be considered diagnostic bands, which were fixed in the Leersia-infesting populations. These results represent evidence of a sibling species in the N. lugens complex. PMID:18504649

  9. Whole genome amplification using a degenerate oligonucleotide primer allows hundreds of genotypes to be performed on less than one nanogram of genomic DNA

    OpenAIRE

    Cheung, Vivian G.; Nelson, Stanley F.

    1996-01-01

    Genetic analysis of limiting quantities of genomic DNA play an important role in DNA forensics, paleoarcheology, genetic disease diagnosis, genetic linkage analysis, and genetic diversity studies. We have tested the ability of degenerate oligonucleotide primed polymerase chain reaction (DOP-PCR) to amplify picogram quantities of human genomic DNA for the purpose of increasing the amount of template for genotyping with microsatellite repeat markers. DNA was uniformly ...

  10. URPD: a specific product primer design tool

    Directory of Open Access Journals (Sweden)

    Chuang Li-Yeh

    2012-06-01

    Full Text Available Abstract Background Polymerase chain reaction (PCR plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design, a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq, UCSC In-Silico PCR, memetic algorithm (MA and genetic algorithm (GA primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/.

  11. URPD: a specific product primer design tool

    Science.gov (United States)

    2012-01-01

    Background Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/. PMID:22713312

  12. 油梨基因组DNA提取、SSR-PCR反应体系优化及引物筛选%DNA Extraction,Optimization of SSR-PCR Reaction System and Primer Screening of Persea americana

    Institute of Scientific and Technical Information of China (English)

    周海兰; 李绍鹏; 李卫亮; 贺军虎; 包冬红; 李茂富

    2016-01-01

    旨在建立稳定可靠的油梨(Persea americana Mill)叶片DNA的提取方法和SSR-PCR反应体系及筛选出稳定的油梨SSR多态性引物,为开展油梨种质SSR分子标记提供遗传研究的基础。以油梨叶片为试材,比较3种油梨叶片DNA提取方法;利用L16(45)正交实验设计对油梨SSR-PCR反应体系进行优化;利用优化的反应体系筛选引物;同时,选取5对多态性引物对45份油梨种质进行PCR扩增,进一步检测该优化体系的稳定性。结果表明,常规2×CTAB法、改良2×CTAB法和植物DNA提取试剂盒法等3种DNA提取方法中,改良2×CTAB法对油梨基因组DNA的提取效果最佳;获得最优反应体系为:20μL总反应体系中,含约40 ng DNA模板、1.5 mmol/L Mg2+、0.15 mmol/L dNTPs、0.5 U Taq DNA聚合酶、0.5μmol/L引物;以此体系为基础进行引物筛选,从73对油梨SSR引物中筛选出了30对扩增条带清晰的多态性引物,说明该反应体系可用于油梨SSR标记的进一步研究;稳定性检测获得的谱带清晰,表明该优化反应体系是稳定可靠的。由此可见,改良的2×CTAB法可用于油梨叶片DNA的大量样本提取,优化后的SSR-PCR反应体系及筛选出的30对多态性引物可用于油梨SSR标记的进一步研究。%This study is to establish a stable and reliable DNA extraction method,optimize the SSR-PCR reaction system,and screen the stable polymorphism primers for avocado(Persea americana Mill)SSR for providing the genetic foundation to conduct the SSR molecular marker of germplasm in avocados. Taking avocado’leaves as the study material,3 avocado DNA extraction methods were compared,based on the L16(45)orthogonal experiment design,the SSR-PCR reaction system in avocados was optimized,and then by optimized reaction system the SSR primers were screened. To further test the stability of the optimized SSR-PCR system,the germplasms in 45 pieces of avocados were amplified by

  13. The Background of Mitochondrial DNA Haplogroup J Increases the Sensitivity of Leber's Hereditary Optic Neuropathy Cells to 2,5-Hexanedione Toxicity

    OpenAIRE

    Ghelli, Anna; Porcelli, Anna Maria; Zanna, Claudia; Vidoni, Sara; Mattioli, Stefano; Barbieri, Anna; Iommarini, Luisa; Pala, Maria; Achilli, Alessandro; Torroni, Antonio; Rugolo, Michela; Carelli, Valerio

    2009-01-01

    Leber's hereditary optic neuropathy (LHON) is a maternally inherited blinding disease due to mitochondrial DNA (mtDNA) point mutations in complex I subunit genes, whose incomplete penetrance has been attributed to both genetic and environmental factors. Indeed, the mtDNA background defined as haplogroup J is known to increase the penetrance of the 11778/ND4 and 14484/ND6 mutations. Recently it was also documented that the professional exposure to n-hexane might act as an exogenous trigger for...

  14. Real-time PCR (qPCR) primer design using free online software.

    Science.gov (United States)

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. PMID:21445907

  15. Primer-mediated enzymatic amplification of cytomegalovirus (CMV) DNA. Application to the early diagnosis of CMV infection in marrow transplant recipients.

    OpenAIRE

    Cassol, S A; Poon, M.C.; Pal, R.; Naylor, M J; Culver-James, J; Bowen, T.J.; Russell, J A; Krawetz, S A; Pon, R T; Hoar, D I

    1989-01-01

    A nucleic acid amplification procedure, the polymerase chain reaction (PCR), has been used to establish a diagnostic assay for the identification of cytomegalovirus (CMV) immediate-early sequences in clinical specimens. Preliminary testing against virus-infected cell cultures indicated that the PCR assay was highly CMV-specific, recognizing both wild-type and laboratory strains of CMV. There was no cross-reactivity with human DNA or with DNA from other herpes viruses. The sensitivity of the a...

  16. Virus detection and identification using random multiplex (RT-PCR with 3'-locked random primers

    Directory of Open Access Journals (Sweden)

    Eaton John W

    2007-06-01

    Full Text Available Abstract Background PCR-based detection and identification of viruses assumes a known, relatively stable genome. Unfortunately, high mutation rates may lead to extensive changes in viral nucleic acid sequences making dedicated PCR primer use problematic. Furthermore, in bioterrorism, viral consensus sequences can be genetically modified as a countermeasure to RT-PCR and DNA chip detection. Accordingly, there is a great need for the development of rapid and universal virus detection and identification technologies. Results We report herein that viral genomic DNA or RNA can be separated from host nucleic acids in plasma by filtration and nuclease digestion, and randomly amplified in a single PCR using a mixture of primers designed to be resistant to primer-dimer amplification (5'-VVVVVVVVAA-3', V = A, G or C; 38 or 6561 primers. We have termed this novel PCR method Random Multiplex (RT-PCR since hundreds of overlapping PCR amplifications occur simultaneously. Using this method, we have successfullydetected and partially sequenced 3 separate viruses in human plasma without using virus-specific reagents (i.e., Adenovirus Type 17, Coxsackievirus A7, and Respiratory Syncytial Virus B. The method is sensitive to ~1000 genome equivalents/ml and may represent the fastest means of detection of unknown viruses. Conclusion These studies suggest that the further development of random multiplex (RT-PCR may lead to a diagnostic assay that can universally detect viruses in donated blood products as well as in patients suffering with idiopathic disease states of possible viral etiology.

  17. UniFrag and GenomePrimer : selection of primers for genome-wide production of unique amplicons

    NARCIS (Netherlands)

    van Hijum, SAFT; de Jong, A; Buist, G; Kok, J; Kuipers, OP

    2003-01-01

    The complementary programs UniFrag and GenomePrimer were developed to provide a reliable high-throughput method to select the most unique regions within genomic DNA sequence(s) and design primers therein, involving minimal user intervention and maximum flexibility.

  18. Development of techniques using DNA analysis method for detection/analysis of radiation-induced mutation. Development of an useful probe/primer and improvement of detection efficacy

    International Nuclear Information System (INIS)

    Previously, it was demonstrated that detection of centromere became easy and reliable through fluorescent staining by FISH method using a probe of the sequence preserved in α-satelite DNA. Since it was, however, found inappropriate to detect dicentrics based on the relative amount of DNA probe on each chromosome. A prove which allows homogeneous detection of α-satelite DNA for each chromosome was constructed. A presumed sequence specific to kinetochore, CENP-B box was amplified by PCR method and the product DNA was used as a probe. However, the variation in amounts of probe DNA among chromosomes was decreased by only about 20%. Then, a program for image processing of the results obtained from FISH using α-satelite DNA was constructed to use as a marker for centromere. When compared with detection of abnormal chromosomes stained by the conventional method, calculation efficacy for only detection of centromere was improved by the use of this program. Calculation to discriminate the normal or not was still complicated and the detection efficacy was little improved. Chromosomal abnormalities in lymphocytes were used to detect the effects of radiation. In this method, it is needed to shift the phase of cells into metaphase. The mutation induced by radiation might be often repaired during shifting. To exclude this possibility, DNA extraction was conducted at a low temperature and immediately after exposure to 137Cs, and a rapid genome detection method was established using the genome DNA. As the model genomes, the following three were used: 1) long chain repeated sequences widely dispersed over chromosome, 2) cluster genes, 3) single copy genes. The effects of radiation were detectable at 1-2 Gy for the long repeated sequences and at 7 Gy for the cluster genes, respectively, whereas no significant effects were observed at any Gy tested for the single copy genes. Amplification was marked in the cells exposed at 1-10 Gy (peak at 4 Gy), suggesting that these regions had

  19. High universality of matK primers for barcoding gymnosperms

    Institute of Scientific and Technical Information of China (English)

    Yan LI; Lian-Ming GAO; RAM C.POUDEL; De-Zhu Li; Alan FORREST

    2011-01-01

    DNA barcoding is a tool to provide rapid and accurate taxonomic identification using a standard DNA region. A two-marker combination of rnatK+rbcL was formally proposed as the core barcode for land plants by the Consortium for the Barcode of Life Plant Working Group. However, there are currently no barcoding primers for matK showing high universality in gymnosperms. We used 57 gymnosperm species representing 40 genera, 11families and four subclasses to evaluate the universality of nine candidate matK primers and one rbcL primer in this study. Primer (1F/724R) of rbcL is proposed here as a universal primer for gymnosperms due to high universality. One of the nine candidate matK primers (Gym_F1A/Gym_R1A) is proposed as the best "universal" matK primer for gynnosperms because of high polymerase chain reaction success and routine generation of high quality bidirectional sequences. A specific matK primer for Ephedra was newly designed in this study, which performed well on the sampled species. The primers proposed here for rbcL and matK can be easily and successfully amplified for most gymnosperms.

  20. An efficient method for the construction of functionalized DNA bearing amino acid groups through cross-coupling reactions of nucleoside triphosphates followed by primer extension or PCR

    Czech Academy of Sciences Publication Activity Database

    Čapek, Petr; Cahová, Hana; Pohl, Radek; Hocek, Michal; Gloeckner, Ch.; Marx, A.

    2007-01-01

    Roč. 13, č. 21 (2007), s. 6196-6203. ISSN 0947-6539 R&D Projects: GA MŠk LC512; GA ČR GA203/05/0043 Institutional research plan: CEZ:AV0Z40550506 Keywords : nucleoside triphosphates * cross-coupling * DNA Subject RIV: CC - Organic Chemistry Impact factor: 5.330, year: 2007

  1. Polymerase chain reaction of Au nanoparticle-bound primers

    Institute of Scientific and Technical Information of China (English)

    SHEN Hebai; HU Min; YANG Zhongnan; WANG Chen; ZHU Longzhang

    2005-01-01

    Polymerase chain reaction (PCR) is a useful technique for in vitro amplification of a DNA fragment. In this paper, a PCR procedure using Au nanoparticle (AuNP) -bound primers was systemically studied. The 5′-SH- (CH2)6-modified primers were covalently attached to the AuNP surface via Au-S bonds, and plasmid pBluescript SK was used as a template. The effects of the concentration of AuNP-bound primers, annealing temperature and PCR cycles were evaluated, respectively. The results indicate that PCR can proceed successfully under optimized condition, with either forward or reverse primers bound to the AuNP surface or with both the two primers bound to the AuNP surface. Development of PCR procedure based on AuNPs not only makes the isolation of PCR products very convenient, but also provides novel methods to prepare AuNP-bound ssDNA and nanostructured material.

  2. Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

    Directory of Open Access Journals (Sweden)

    Alexandre R. Zuntini

    2013-08-01

    Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  3. Bisprimer-A program for the design of primers for bisulfite-based genomic sequencing of both plant and mammalian DNA samples

    Czech Academy of Sciences Publication Activity Database

    Kováčová, Viera; Janoušek, Bohuslav

    2012-01-01

    Roč. 103, č. 2 (2012), s. 308-312. ISSN 0022-1503 R&D Projects: GA ČR(CZ) GA521/08/0932; GA ČR(CZ) GD204/09/H002 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : bisulfite * cytosine methylation * DNA methylation Subject RIV: BO - Biophysics Impact factor: 1.995, year: 2012

  4. Contribution of Partial Charge Interactions and Base Stacking to the Efficiency of Primer Extension at and beyond Abasic Sites in DNA

    Energy Technology Data Exchange (ETDEWEB)

    Xia, Shuangluo; Vashishtha, Ashwani; Bulkley, David; Eom, Soo Hyun; Wang, Jimin; Konigsberg, William H. (Yale); (Gwangju)

    2012-08-31

    During DNA synthesis, base stacking and Watson-Crick (WC) hydrogen bonding increase the stability of nascent base pairs when they are in a ternary complex. To evaluate the contribution of base stacking to the incorporation efficiency of dNTPs when a DNA polymerase encounters an abasic site, we varied the penultimate base pairs (PBs) adjacent to the abasic site using all 16 possible combinations. We then determined pre-steady-state kinetic parameters with an RB69 DNA polymerase variant and solved nine structures of the corresponding ternary complexes. The efficiency of incorporation for incoming dNTPs opposite an abasic site varied between 2- and 210-fold depending on the identity of the PB. We propose that the A rule can be extended to encompass the fact that DNA polymerase can bypass dA/abasic sites more efficiently than other dN/abasic sites. Crystal structures of the ternary complexes show that the surface of the incoming base was stacked against the PB's interface and that the kinetic parameters for dNMP incorporation were consistent with specific features of base stacking, such as surface area and partial charge-charge interactions between the incoming base and the PB. Without a templating nucleotide residue, an incoming dNTP has no base with which it can hydrogen bond and cannot be desolvated, so that these surrounding water molecules become ordered and remain on the PB's surface in the ternary complex. When these water molecules are on top of a hydrophobic patch on the PB, they destabilize the ternary complex, and the incorporation efficiency of incoming dNTPs is reduced.

  5. Mitochondrial DNA background modulates the assembly kinetics of OXPHOS complexes in a cellular model of mitochondrial disease.

    NARCIS (Netherlands)

    Pello, R.; Martin, M.A.; Carelli, V.; Nijtmans, L.G.J.; Achilli, A.; Pala, M.; Torroni, A.; Gomez-Duran, A.; Ruiz-Pesini, E.; Martinuzzi, A.; Smeitink, J.A.M.; Arenas, J.; Ugalde, C.

    2008-01-01

    Leber's hereditary optic neuropathy (LHON), the most frequent mitochondrial disorder, is mostly due to three mitochondrial DNA (mtDNA) mutations in respiratory chain complex I subunit genes: 3460/ND1, 11778/ND4 and 14484/ND6. Despite considerable clinical evidences, a genetic modifying role of the m

  6. China Energy Primer

    Energy Technology Data Exchange (ETDEWEB)

    Ni, Chun Chun

    2009-11-16

    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  7. An SAT® Validity Primer

    Science.gov (United States)

    Shaw, Emily J.

    2015-01-01

    This primer should provide the reader with a deeper understanding of the concept of test validity and will present the recent available validity evidence on the relationship between SAT® scores and important college outcomes. In addition, the content examined on the SAT will be discussed as well as the fundamental attention paid to the fairness of…

  8. Primer on Social Economics.

    Science.gov (United States)

    Darcy, Robert L.

    An elaboration of the author's booklet entitled "First Steps Toward Economic Understanding," this primer is designed to help the reader develop a functional understanding of the economic process so that he can make wiser decisions on issues of social policy and on matters affecting his economic well-being. The document is not "economics in one…

  9. Cytotoxic and genotoxic evaluation of orthodontic adhesives with primer and without primer exposed to electron beam irradiation - an in-vitro study

    International Nuclear Information System (INIS)

    To evaluate the in vitro genotoxicity and cytotoxicity of two visible light-cured adhesives. The materials tested were 1. orthodontic adhesive with primer (Transbond XT3M) and 2. Orthodontic adhesive without primer (Heliosit, Ivoclar Vivadent AG), Cured sterile individual masses were exposed to 2 kGy electron beam radiation, both irradiated and non irradiated materials were immersed in Phosphate buffer saline and left at 370℃ for 24 hr. Then a volume of 200 μL of the extract medium was mixed with human peripheral blood lymphocyte tested for comet assay by single cell DNA Damage assay and Apoptosis by DNA diffusion agar assay. Evaluation of cytotoxicity was carried out by Hemolysis assay method. Haemolytic activity of orthodontic adhesive without primer (53.34±3.12) was slightly more than that of orthodontic adhesive with primer (52.9±.88). In case of Apoptosis, adhesive with primer (188.92±55.05) and adhesives without primer (186.75±101.83) showed increased diffusion of DNA compared to normal lymphocyte (111.22±8.78). However the level of DNA diffusion was not significantly different between the two adhesives. Both adhesives were cytotoxic and induced apoptosis. Adhesives without primer were found to be slightly toxic than that of adhesive with primer. Both the adhesives had no significant effect on the percentage of DNA tail and olive tail moment of DNA exposed to electron beam radiation. (author)

  10. Evaluation of DNA damage in the root cells of Allium cepa seeds growing in soil of high background radiation areas of Ramsar - Iran

    Energy Technology Data Exchange (ETDEWEB)

    Saghirzadeh, M. [Department of Basic Science, Gonabad University of Medical Sciences, Gonabad (Iran, Islamic Republic of); Gharaati, M.R. [Faculty of Science, Tarbiat Modares University, Tehran (Iran, Islamic Republic of); Mohammadi, Sh. [Nuclear Science and Technology Research Institute (NSTRI), Radiation Applications Research School, Tehran 11365-3486 (Iran, Islamic Republic of)], E-mail: smohammadi@aeoi.org.ir; Ghiassi-Nejad, M. [Faculty of Science, Tarbiat Modares University, Tehran (Iran, Islamic Republic of)

    2008-10-15

    Plants are unique in their ability to serve as in situ monitors for environmental genotoxins. We have used the alkaline comet assay for detecting induced DNA damage in Allium cepa to estimate the impact of high levels of natural radiation in the soils of inhabited zones of Ramsar. The average specific activity of natural radionuclides measured in the soil samples for {sup 226}Ra was 12,766 Bq kg{sup -1} whereas in the control soils was in the range of 34-60 Bq kg{sup -1}. A positive strong significant correlation of the DNA damage in nuclei of the root cells of A. cepa seeds germinated in the soil of high background radiation areas with {sup 226}Ra specific activity of the soil samples was observed. The results showed high genotoxicity of radioactively contaminated soils. Also the linear increase in the DNA damage indicates that activation of repair enzymes is not triggered by exposure to radiation in HBRA.

  11. Coal Bed Methane Primer

    Energy Technology Data Exchange (ETDEWEB)

    Dan Arthur; Bruce Langhus; Jon Seekins

    2005-05-25

    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  12. The background of mitochondrial DNA haplogroup J increases the sensitivity of Leber's hereditary optic neuropathy cells to 2,5-hexanedione toxicity.

    Directory of Open Access Journals (Sweden)

    Anna Ghelli

    Full Text Available Leber's hereditary optic neuropathy (LHON is a maternally inherited blinding disease due to mitochondrial DNA (mtDNA point mutations in complex I subunit genes, whose incomplete penetrance has been attributed to both genetic and environmental factors. Indeed, the mtDNA background defined as haplogroup J is known to increase the penetrance of the 11778/ND4 and 14484/ND6 mutations. Recently it was also documented that the professional exposure to n-hexane might act as an exogenous trigger for LHON. Therefore, we here investigate the effect of the n-hexane neurotoxic metabolite 2,5-hexanedione (2,5-HD on cell viability and mitochondrial function of different cell models (cybrids and fibroblasts carrying the LHON mutations on different mtDNA haplogroups. The viability of control and LHON cybrids and fibroblasts, whose mtDNAs were completely sequenced, was assessed using the MTT assay. Mitochondrial ATP synthesis rate driven by complex I substrates was determined with the luciferine/luciferase method. Incubation with 2,5-HD caused the maximal loss of viability in control and LHON cells. The toxic effect of this compound was similar in control cells irrespective of the mtDNA background. On the contrary, sensitivity to 2,5-HD induced cell death was greatly increased in LHON cells carrying the 11778/ND4 or the 14484/ND6 mutation on haplogroup J, whereas the 11778/ND4 mutation in association with haplogroups U and H significantly improved cell survival. The 11778/ND4 mutation on haplogroup U was also more resistant to inhibition of complex I dependent ATP synthesis by 2,5-HD. In conclusion, this study shows that mtDNA haplogroups modulate the response of LHON cells to 2,5-HD. In particular, haplogroup J makes cells more sensitive to its toxic effect. This is the first evidence that an mtDNA background plays a role by interacting with an environmental factor and that 2,5-HD may be a risk element for visual loss in LHON. This proof of principle has broad

  13. A universal DNA mini-barcode for biodiversity analysis

    OpenAIRE

    Hebert Paul DN; Hickey Donal A; Landry Jean-François; Singer Gregory AC; Meusnier Isabelle; Hajibabaei Mehrdad

    2008-01-01

    Abstract Background The goal of DNA barcoding is to develop a species-specific sequence library for all eukaryotes. A 650 bp fragment of the cytochrome c oxidase 1 (CO1) gene has been used successfully for species-level identification in several animal groups. It may be difficult in practice, however, to retrieve a 650 bp fragment from archival specimens, (because of DNA degradation) or from environmental samples (where universal primers are needed). Results We used a bioinformatics analysis ...

  14. A method for automatically extracting infectious disease-related primers and probes from the literature

    Directory of Open Access Journals (Sweden)

    Pérez-Rey David

    2010-08-01

    Full Text Available Abstract Background Primer and probe sequences are the main components of nucleic acid-based detection systems. Biologists use primers and probes for different tasks, some related to the diagnosis and prescription of infectious diseases. The biological literature is the main information source for empirically validated primer and probe sequences. Therefore, it is becoming increasingly important for researchers to navigate this important information. In this paper, we present a four-phase method for extracting and annotating primer/probe sequences from the literature. These phases are: (1 convert each document into a tree of paper sections, (2 detect the candidate sequences using a set of finite state machine-based recognizers, (3 refine problem sequences using a rule-based expert system, and (4 annotate the extracted sequences with their related organism/gene information. Results We tested our approach using a test set composed of 297 manuscripts. The extracted sequences and their organism/gene annotations were manually evaluated by a panel of molecular biologists. The results of the evaluation show that our approach is suitable for automatically extracting DNA sequences, achieving precision/recall rates of 97.98% and 95.77%, respectively. In addition, 76.66% of the detected sequences were correctly annotated with their organism name. The system also provided correct gene-related information for 46.18% of the sequences assigned a correct organism name. Conclusions We believe that the proposed method can facilitate routine tasks for biomedical researchers using molecular methods to diagnose and prescribe different infectious diseases. In addition, the proposed method can be expanded to detect and extract other biological sequences from the literature. The extracted information can also be used to readily update available primer/probe databases or to create new databases from scratch.

  15. Coverage evaluation of universal bacterial primers using the metagenomic datasets

    Directory of Open Access Journals (Sweden)

    Mao Dan-Ping

    2012-05-01

    Full Text Available Abstract Background The coverage of universal primers for the bacterial 16S rRNA gene plays a crucial role in the correct understanding of microbial community structure. However, existing studies on primer coverage are limited by the lack of appropriate databases and are restricted to the domain level. Additionally, most studies do not account for the positional effect of single primer-template mismatches. In this study, we used 7 metagenomic datasets as well as the Ribosomal Database Project (RDP to assess the coverage of 8 widely used bacterial primers. Results The coverage rates for bacterial primers were found to be overestimated by previous studies that only investigated the RDP because of PCR amplification bias in the sequence composition of the dataset. In the RDP, the non-coverage rates for all primers except 27F were ≪6%, while in the metagenomic datasets, most were ≫10%. If one considers that a single mismatch near the 3′ end of the primer might greatly reduce PCR efficiency, then some phylum non-coverage rates would change by more than 20%. Primer binding-site sequence variants that could not pair with their corresponding primers are discussed. Conclusions Our study revealed the potential bias introduced by the use of universal bacterial primers in the assessment of microbial communities. With the development of high-throughput, next-generation sequencing techniques, it will become feasible to sequence more of the hypervariable regions of the bacterial 16S rRNA gene. This, in turn, will lead to the more frequent use of the primers discussed here.

  16. A Quantum Groups Primer

    Science.gov (United States)

    Majid, Shahn

    2002-05-01

    Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.

  17. Math primer for engineers

    CERN Document Server

    Cryer, CW

    2014-01-01

    Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

  18. The R primer

    CERN Document Server

    Ekstrom, Claus Thorn

    2011-01-01

    Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

  19. Solarium primer. [Monograph

    Energy Technology Data Exchange (ETDEWEB)

    1981-01-01

    Solaria can be used to collect solar energy for space heating and provide an open environment. This primer introduces the basic concepts of an energy-efficient solarium and provides information on the practical aspects of siting, design, and construction. The horticultural use of a solarium as a greenhouse is not dealt with except in explaining the influence this may have on its design and operation. The book shows the characteristics of different types of solaria, their advantages as well as their limitations. It also explains the prerequisite of a successful addition to an existing home. Design and construction details accompany the text. 73 references, 2 tables.

  20. Analysis of DNA methylation variation in wheat genetic background after alien chromatin introduction based on methylation-sensitive amplification polymorphism

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    During the process of alien germplasm introduced into wheat genome by chromosome engineering,extensive genetic variations of genome structure and gene expression in recipient could be induced.In this study,we performed GISH(genome in situ hybridization)and AFLP(amplified fragment length polymorphism) on wheat-rye chromosome transIocation lines and their parents to detect the identity in genomic structure of different translocation lines.The results showed that the genome primary structure variations were not obviously detected in different translocation lines except the same 1RS chromosome translocation.Methylation sensitive amplification polymorphism(MSAP)analyses on genomic DNA showed that the ratios of fully-methylated sites were significantly increased in translocation lines(CN12,20.15%;CN17,20.91%;CN18,22.42%),but the ratios of hemimethylated sites were significantly lowered(CN12,21.41%;CN17,23.43%;CN18,22.42%),whereas 16.37%were fully-methylated and 25.44%were hemimethylated in case of their wheat parent.Twenty-nine classes of methylation patterns were identified in a comparative assay of cytosine methylation patterns between wheat-rye translocation lines and their wheat parent,including 13 hypermethylation patterns(33.74%),9 demethylation patterns(22.76%)and 7 uncertain patterns(4.07%).In further sequence analysis,the alterations of methylation pattern affected both repetitive DNA sequences,such as retrotransposons and tandem repetitive sequences,and low-copy DNA.

  1. Designing PCR Primers from 16S-23S rDNA Intergenic Spacer Region for the Identification of Pasteurella multocida%以 16S-23S rDNA 间区序列为目的基因设计 PCR 引物鉴定多杀巴斯德氏菌

    Institute of Scientific and Technical Information of China (English)

    周浩; 刘寅; 陈一军; 郑泽军; 黄熙泰

    2008-01-01

    多杀巴斯德氏菌是养殖动物(鸡,猪,牛等)的重要致病菌.本研究以16S-23S rDNA间区序列为目的基因设计PCR引物鉴定多杀巴斯德氏菌.通过对多杀巴斯德氏菌ITS-IA(含有tDNA-Ile和tDNA-Ala的16S-23S rDNA间区序列)的测序和与GenBank中序列的BLAST,设计筛选了一对特异引物PS-F/PS-R.对引物的特异性和有效性,用PCR方法进行了验证.结果表明:所有的多杀巴斯德氏菌标准菌株和分离菌株都能被检出,而全部39株非多杀巴斯德氏菌都没有扩增出特异性条带.其检测灵敏度能达到102CFU/mL.研究结果表明,发展了的PCR鉴定方法是省时的和可靠的,整个过程只需要20 h,而传统的鉴定方法需要至少5 d的时间.%Pasteurella multocida is an important pathogen that infects many kinds of animals. In present study, a polymerase chain reaction (PCR) assay using primers derived from the 16S-23S rRNA intergenic spacer (ITS) of P. multocida was developed. One pairs of specific PCR primers were designed by sequencing the ITS-IA (ITS containing tDNA-Ile and tDNA-Ala) of P. multocida and BLAST of GenBank. The specificity and efficiency of the PCR methods were tested against a panel of numerous strains from 39 different bacterial strains. All of the P. multocida strains generated positive signal, and no cross-reaction was observed with non-P, multocida strains in the PCR detection. Sensitivity of the detection is 102 CFU/mL cultures. The newly developed PCR array procedures take only 20 hours for each time, whereas the conventional methods required at least five days. This study demonstrated that the PCR detection for P. multocida is time-saved and reliable.

  2. HPV 9G DNA Chip: 100% Clinical Sensitivity and Specificity

    OpenAIRE

    An, Heejung; Song, Keum-Soo; Nimse, Satish Balasaheb; Kim, Junghoon; Nguyen, Van-Thuan; Ta, Van-Thao; Sayyed, Danishmalik Rafiq; Kim, Taisun

    2012-01-01

    We describe a novel HPV 9G DNA chip test for the accurate and reliable genotyping of human papillomavirus (HPV). The HPV 9G DNA chip test established its efficiency in terms of a signal-to-background ratio (SBR) of 200, which is 50 times superior to commercial HPV DNA chips, and 100% target-specific hybridization at 25°C. We compared the genotyping results for the 439 clinical samples by the HPV 9G DNA chip test with the sequencing results for the MY11/GP6+ (M2) primer set-mediated PCR produc...

  3. POT1–TPP1 enhances telomerase processivity by slowing primer dissociation and aiding translocation

    OpenAIRE

    Latrick, Chrysa M; Cech, Thomas R.

    2010-01-01

    Telomerase contributes to chromosome end replication by synthesizing repeats of telomeric DNA, and the telomeric DNA-binding proteins protection of telomeres (POT1) and TPP1 synergistically increase its repeat addition processivity. To understand the mechanism of increased processivity, we measured the effect of POT1–TPP1 on individual steps in the telomerase reaction cycle. Under conditions where telomerase was actively synthesizing DNA, POT1–TPP1 bound to the primer decreased primer dissoci...

  4. Teste de DNA para verificação de parentesco em cães: avaliação do método não automatizado com o auxílio do primer CMR S

    Directory of Open Access Journals (Sweden)

    Oliveira P.F.

    2002-01-01

    Full Text Available To evaluate the precision of the DNA tests using the non-automatized technique for individual identification and parentage tests, 105 Rottweiler dogs were studied using the primer CMR S. The sample was composed of 39 animals belonging to 11 complete families and their progenies, and 66 non related individuals until the second generation, derived from kennels located in the states of Minas Gerais and São Paulo. The CMR S primer was used for the Polimerase Chain Reaction (PCR. The results showed the inefficiency of the technique, even when analyzed through the automated gel analysis system. Also showed the impossibility of its commercial use due to the fact of does not permit the storage of data for subsequent use.

  5. PD5: A General Purpose Library for Primer Design Software

    OpenAIRE

    Riley, Michael C.; Aubrey, Wayne; Young, Michael; Clare, Amanda

    2013-01-01

    Background Complex PCR applications for large genome-scale projects require fast, reliable and often highly sophisticated primer design software applications. Presently, such applications use pipelining methods to utilise many third party applications and this involves file parsing, interfacing and data conversion, which is slow and prone to error. A fully integrated suite of software tools for primer design would considerably improve the development time, the processing speed, and the reliab...

  6. New cyt b gene universal primer set for forensic analysis.

    Science.gov (United States)

    Lopez-Oceja, A; Gamarra, D; Borragan, S; Jiménez-Moreno, S; de Pancorbo, M M

    2016-07-01

    Analysis of mitochondrial DNA, and in particular the cytochrome b gene (cyt b), has become an essential tool for species identification in routine forensic practice. In cases of degraded samples, where the DNA is fractionated, universal primers that are highly efficient for the amplification of the target region are necessary. Therefore, in the present study a new universal cyt b primer set with high species identification capabilities, even in samples with highly degraded DNA, has been developed. In order to achieve this objective, the primers were designed following the alignment of complete sequences of the cyt b from 751 species from the Class of Mammalia listed in GenBank. A highly variable region of 148bp flanked by highly conserved sequences was chosen for placing the primers. The effectiveness of the new pair of primers was examined in 63 animal species belonging to 38 Families from 14 Orders and 5 Classes (Mammalia, Aves, Reptilia, Actinopterygii, and Malacostraca). Species determination was possible in all cases, which shows that the fragment analyzed provided a high capability for species identification. Furthermore, to ensure the efficiency of the 148bp fragment, the intraspecific variability was analyzed by calculating the concordance between individuals with the BLAST tool from the NCBI (National Center for Biotechnological Information). The intraspecific concordance levels were superior to 97% in all species. Likewise, the phylogenetic information from the selected fragment was confirmed by obtaining the phylogenetic tree from the sequences of the species analyzed. Evidence of the high power of phylogenetic discrimination of the analyzed fragment of the cyt b was obtained, as 93.75% of the species were grouped within their corresponding Orders. Finally, the analysis of 40 degraded samples with small-size DNA fragments showed that the new pair of primers permits identifying the species, even when the DNA is highly degraded as it is very common in

  7. Study of HIV-2 primer-template initiation complex using antisense oligonucleotides

    DEFF Research Database (Denmark)

    Boulmé, F; Freund, F; Gryaznov, S;

    2000-01-01

    HIV-2 reverse transcription is initiated by the retroviral DNA polymerase (reverse transcriptase) from a cellular tRNALys3 partially annealed to the primer binding site in the 5'-region of viral RNA. The HIV-2 genome has two A-rich regions upstream of the primer binding site. In contrast to HIV-1...... approach, first validated in our in vitro HIV-1 reverse transcription system. Annealing of the antisense oligonucleotides to the pre-primer binding site (the upstream region contiguous to the HIV-2 primer binding site) was determined in the presence of native tRNALys3 or synthetic primers. Using natural...... and chemically modified antisense oligonucleotides we found that interactions between the anticodon of tRNALys3 and an A-rich loop of viral RNA led to an important destabilization of the pre-primer binding site; this region became accessible to anti-pre-primer binding site oligonucleotides in a...

  8. φ29 DNA polymerase

    OpenAIRE

    Blanco, Luis; Bernad, Antonio; Salas, Margarita

    1996-01-01

    An improved method for determining the nucleotide base sequence of a DNA molecule employs a φ-29 type DNA polymerase modified to have reduced or no exonuclease activity. The method includes annealing the DNA molecule with a primer molecule able to hybridize to the DNA molecule; incubating the annealed mixture in a vessel containing four different deoxynucleoside triphosphates, a DNA polymerase, and one or more DNA synthesis terminating agents which terminate DNA synthesis at a specific nucleo...

  9. SDM-Assist software to design site-directed mutagenesis primers introducing “silent” restriction sites

    Science.gov (United States)

    2013-01-01

    Background Over the past decades site-directed mutagenesis (SDM) has become an indispensable tool for biological structure-function studies. In principle, SDM uses modified primer pairs in a PCR reaction to introduce a mutation in a cDNA insert. DpnI digestion of the reaction mixture is used to eliminate template copies before amplification in E. coli; however, this process is inefficient resulting in un-mutated clones which can only be distinguished from mutant clones by sequencing. Results We have developed a program – ‘SDM-Assist’ which creates SDM primers adding a specific identifier: through additional silent mutations a restriction site is included or a previous one removed which allows for highly efficient identification of ‘mutated clones’ by a simple restriction digest. Conclusions The direct identification of SDM clones will save time and money for researchers. SDM-Assist also scores the primers based on factors such as Tm, GC content and secondary structure allowing for simplified selection of optimal primer pairs. PMID:23522286

  10. Analysis of the effects of sex hormone background on the rat choroid plexus transcriptome by cDNA microarrays.

    Directory of Open Access Journals (Sweden)

    Telma Quintela

    Full Text Available The choroid plexus (CP are highly vascularized branched structures that protrude into the ventricles of the brain, and form a unique interface between the blood and the cerebrospinal fluid (CSF, the blood-CSF barrier, that are the main site of production and secretion of CSF. Sex hormones are widely recognized as neuroprotective agents against several neurodegenerative diseases, and the presence of sex hormones cognate receptors suggest that it may be a target for these hormones. In an effort to provide further insight into the neuroprotective mechanisms triggered by sex hormones we analyzed gene expression differences in the CP of female and male rats subjected to gonadectomy, using microarray technology. In gonadectomized female and male animals, 3045 genes were differentially expressed by 1.5-fold change, compared to sham controls. Analysis of the CP transcriptome showed that the top-five pathways significantly regulated by the sex hormone background are olfactory transduction, taste transduction, metabolism, steroid hormone biosynthesis and circadian rhythm pathways. These results represent the first overview of global expression changes in CP of female and male rats induced by gonadectomy and suggest that sex hormones are implicated in pathways with central roles in CP functions and CSF homeostasis.

  11. Gold nanoparticle-assisted primer walking for closing the human chromosomal gap

    DEFF Research Database (Denmark)

    Li, H; Shi, B; Li, X;

    2013-01-01

    NPs) to improve the efficiency in primer walking amplification. We used this strategy to close a gap in human chromosome 5 containing a DNA stretch composed of the 12SAT repeat. The obtained gap sequence is highly conserved among several mammalian genomes. The demonstrated AuNP-assisted primer walking strategy...

  12. Sequence-related amplified polymorphism primer screening on Chinese fir (Cunninghamia lanceolata (Lamb.) Hook)

    Institute of Scientific and Technical Information of China (English)

    Huiquan Zheng; Hongjing Duan; Dehuo Hu; Ruping Wei; Yun Li

    2015-01-01

    Chinese fir (Cunninghamia lanceolata (Lamb.) Hook) is one of the most important coniferous tree species used for timber production in China. Here, we conducted a sequence-related amplified polymorphism (SRAP) primer screening assay with a total of 594 primer combinations, using 22 forward and 27 reverse primers on four repre-sentative Chinese fir genotypes. The obtained results indicated that Chinese fir genomic DNA has a notable amplification bias on the employed forward or reverse primer nucleotides (3' selection bases). Out of the tested primer sets, 35 primer combinations with clearly distin-guished bands, stable amplification, and rich polymorphism were selected and identified as optimal primer sets. These optimal primer pairs gave a total of 379 scorable bands, including 265 polymorphic bands, with an average of 10.8 bands and 7.6 polymorphic bands per primer combination. The produced band number for each optimal primer set ranged from 7 to 14 with a percentage of polymorphic bands spanning from 33.3 to 100.0%. These primer combinations could facilitate the next SRAP analysis assays in Chinese fir.

  13. ITS as an environmental DNA barcode for fungi: an in silico approach reveals potential PCR biases

    Directory of Open Access Journals (Sweden)

    Taberlet Pierre

    2010-07-01

    Full Text Available Abstract Background During the last 15 years the internal transcribed spacer (ITS of nuclear DNA has been used as a target for analyzing fungal diversity in environmental samples, and has recently been selected as the standard marker for fungal DNA barcoding. In this study we explored the potential amplification biases that various commonly utilized ITS primers might introduce during amplification of different parts of the ITS region in samples containing mixed templates ('environmental barcoding'. We performed in silico PCR analyses with commonly used primer combinations using various ITS datasets obtained from public databases as templates. Results Some of the ITS primers, such as ITS1-F, were hampered with a high proportion of mismatches relative to the target sequences, and most of them appeared to introduce taxonomic biases during PCR. Some primers, e.g. ITS1-F, ITS1 and ITS5, were biased towards amplification of basidiomycetes, whereas others, e.g. ITS2, ITS3 and ITS4, were biased towards ascomycetes. The assumed basidiomycete-specific primer ITS4-B only amplified a minor proportion of basidiomycete ITS sequences, even under relaxed PCR conditions. Due to systematic length differences in the ITS2 region as well as the entire ITS, we found that ascomycetes will more easily amplify than basidiomycetes using these regions as targets. This bias can be avoided by using primers amplifying ITS1 only, but this would imply preferential amplification of 'non-dikarya' fungi. Conclusions We conclude that ITS primers have to be selected carefully, especially when used for high-throughput sequencing of environmental samples. We suggest that different primer combinations or different parts of the ITS region should be analyzed in parallel, or that alternative ITS primers should be searched for.

  14. Immune monitoring technology primer

    OpenAIRE

    Dobbin, Kevin K.

    2015-01-01

    Background Recent biotechnological developments have resulted in increasing interest in immunology biomarkers. These biomarkers have potential clinical utility in the near future as predictors of treatment response. Hence, clinical validation of these predictive markers is critical. Findings The process of clinically validating a predictive biomarker is reviewed. Validation of a predictive biomarker requires quantifying the strength of a statistical interaction between marker and a treatment....

  15. Blood Donation and Transfusion: A Primer for Health Educators.

    Science.gov (United States)

    Felts, W. Michael; Glascoff, Mary A.

    1991-01-01

    Presents a primer for health educators about blood donation and transfusion, examining the nature of human blood, the background of blood transfusion, blood donation criteria, risks related to homologous blood transfusion, directed blood donation, potential alternatives to homologous transfusion, and resources for education on the subject. (SM)

  16. Characterization of polybacterial clinical samples using a set of group-specific broad-range primers targeting the 16S rRNA gene followed by DNA sequencing and RipSeq analysis

    OpenAIRE

    Kommedal, Øyvind; Lekang, Katrine; Langeland, Nina; Wiker, Harald G.

    2011-01-01

    The standard use of a single universal broad-range PCR in direct 16S rDNA sequencing from polybacterial samples leaves the minor constituents at risk of remaining undetected because all bacterial DNA will be competing for the same reagents. In this article we introduce a set of three broad-range group-specific 16S rDNA PCRs that together cover the clinically relevant bacteria and apply them in the investigation of 25 polybacterial clinical samples. Mixed DNA chromatograms from samples contain...

  17. Vygotsky on Education Primer. Peter Lang Primer. Volume 30

    Science.gov (United States)

    Lake, Robert

    2012-01-01

    The "Vygotsky on Education Primer" serves as an introduction to the life and work of the Russian psychologist Lev Vygotsky. Even though he died almost eighty years ago, his life's work remains both relevant and significant to the field of education today. This book examines Vygotsky's emphasis on the role of cultural and historical context in…

  18. Changes of 5' Terminal Nucleotides of PCR Primers Causing Variable T-A Cloning Efficiency

    Institute of Scientific and Technical Information of China (English)

    Mei-Qin Liu; Xin Shen; Wei-Lun Yin; Cun-Fu Lu

    2007-01-01

    T-A cloning takes advantage of the unpaired adenosyl residue added to the 3' terminus of amplified DNAs by Taq and other thermostable DNA polymerase and uses a linearized plasmid vector with a protruding 3' thymidylate residue at each of its 3' termini to clone polymerase chain reaction (PCR)-derived DNA fragments. It is a simple,reliable, and efficient ligation-dependent cloning method for PCR products, but the drawback of variable cloning efficiency occurs during application. In the present work, the relationship between variable T-A cloning efficiency and the different 5' end nucleotide base of primers used in PCR amplification was studied. The results showed that different cloning efficiency was obtained with different primer pairs containing A, T, C and G at the 5' terminus respectively. The data shows that when the 5' end base of primer pair was adenosyl, more white colonies could be obtained in cloning the corresponding PCR product in comparison with other bases. And the least white colonies were formed when using the primer pair with 5' cytidylate end. The gluanylate end primers resulted in almost the same cloning efficiency in the white colonies amount as the thymidylate end primer did, and this efficiency was much lower than that of adenosyl end primers. This presumably is a consequence of variability in 3'dA addition to PCR products mediated by Taq polymerase. Our results offer instructions for primer design for researchers who choose T-A cloning to clone PCR products.

  19. Target-cell-derived tRNA-like primers for reverse transcription support retroviral infection at low efficiency

    DEFF Research Database (Denmark)

    Schmitz, Alexander; Lund, Anders H; Hansen, Anette C;

    2002-01-01

    Reverse transcription of a retroviral genome takes place in the cytoplasm of an infected cell by a process primed by a producer-cell-derived tRNA annealed to an 18-nucleotide primer-binding site (PBS). By an assay involving primer complementation of PBS-mutated vectors we analyzed whether t......RNA primers derived from the target cell can sustain reverse transcription during murine leukemia virus (MLV) infection. Transduction efficiencies were 4-5 orders of magnitude below those of comparable producer-cell complementations. However, successful usage of a target-cell-derived tRNA primer was proven by...... cases of correction of single mismatches between Akv-MLV vectors and complementary tRNA primers toward the primer sequence in the integrated vector. Thus, target-cell-derived tRNA-like primers are able to initiate first-strand cDNA synthesis and plus-strand transfer leading to a complete provirus...

  20. Guidelines for the tetra-primer ARMS-PCR technique development.

    Science.gov (United States)

    Medrano, Ruan Felipe Vieira; de Oliveira, Camila Andréa

    2014-07-01

    The tetra-primer amplification refractory mutation system-polymerase chain (ARMS-PCR) reaction is a simple and economical method to genotype single-nucleotide polymorphisms (SNPs). It uses four primers in a single PCR and is followed just by gel electrophoresis. However, the optimization step can be very hardworking and time-consuming. Hence, we propose to demonstrate and discuss critical steps for its development, in a way to provide useful information. Two SNPs that provided different amplification conditions were selected. DNA extraction methods, annealing temperatures, PCR cycles protocols, reagents, and primers concentration were also analyzed. The use of tetra-primer ARMS-PCR could be impaired for SNPs in DNA regions rich in cytosine and guanine and for samples with DNA not purified. The melting temperature was considered the factor of greater interference. However, small changes in the reagents concentration significantly affect the PCR, especially MgCl2. Balancing the inner primers band is also a key step. So, in order to balance the inner primers band, intensity is important to observe which one has the weakest band and promote its band by increasing its concentration. The use of tetra-primer ARMS-PCR attends the expectations of modern genomic research and allows the study of SNPs in a fast, reliable, and low-cost way. PMID:24519268

  1. A Primer on Multilevel Modeling

    Science.gov (United States)

    Hayes, Andrew F.

    2006-01-01

    Multilevel modeling (MLM) is growing in use throughout the social sciences. Although daunting from a mathematical perspective, MLM is relatively easy to employ once some basic concepts are understood. In this article, I present a primer on MLM, describing some of these principles and applying them to the analysis of a multilevel data set on…

  2. Freshwater Wetlands: A Citizen's Primer.

    Science.gov (United States)

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of wetland…

  3. A classical primer for QCD

    International Nuclear Information System (INIS)

    A basic primer for QCD is presented using a semiclassical approach to the colour Maxwell equations. The non-Abelian nature of colour symmetry and the violation of superposition by colour fields is compared with QED. A simple discussion of asymptotic freedom is also presented. (author)

  4. A Hearing Aid Primer 1

    Science.gov (United States)

    Yetter, Carol J.

    2009-01-01

    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  5. Primer on Molecular Genetics; DOE Human Genome Program

    Science.gov (United States)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  6. Primer on molecular genetics. DOE Human Genome Program

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  7. Fundamentals of statistical evidence—a primer for legal professionals

    OpenAIRE

    Aitken, Colin; TARONI, FRANCO

    2008-01-01

    Criminal courts are today frequently confronted with statistical evidence, notably in relation to DNA profiling. Recent experience tends to confirm both widespread perceptions and more systematic research indicating that probability and statistics are not handled confidently, or always competently, by lawyers, judges, jurors or even by forensic scientists. Conceived as a primer for legal professionals, this article reviews basic statistical terminology and its forensic applications, and explo...

  8. Degenerative primer design and gene sequencing validation for select turkey genes.

    Science.gov (United States)

    Hutsko, Stephanie L; Lilburn, Michael S; Wick, Macdonald

    2016-06-01

    We successfully designed and validated degenerative primers for turkey genes MUC2, RPS13, TBP and TFF2 based on chicken sequences in order to use gene transcription analysis to evaluate (quantify) the mucin transcription to probiotic supplementation in turkeys. Primers were designed for the genes MUC2, TFF2, RPS13 and TBP using a degenerative primer design method based on the available Gallus gallus sequences. All primer sets, which produced a single PCR amplicon of the expected sizes, were cloned into the TOPO(®) vector and then transformed into TOP 10(®) competent cells. Plasmid DNA isolation was performed on the TOP10(®) cell culture and sent for sequencing. Sequences were analyzed using NCBI BLAST. All genes sequenced had over 90% homology with both the chicken and predicted turkey sequences. The sequences were used to design new 100% homologous primer sets for the genes of interest. PMID:27053625

  9. Evaluation of conservation programs: a primer

    Energy Technology Data Exchange (ETDEWEB)

    Soderstrom, E.J.; Berry, L.G.; Hirst, E.; Bronfman, B.H.

    1981-07-01

    This primer is an introduction to the field of program evaluation. A considerable amount of information is included about the actual conduct of an evaluation. No specific activity is addressed, but rather an idea is provided of the issues and constraints characteristic of each phase and activity of an evaluation. Examples of how these issues arise and potential solutions are presented. Chapter 1 provides background on the origins and evolution of evaluation, focusing especially on why evaluation is currently receiving increased emphasis. Chapter 2 is an overview of the field of evaluation, especially as it relates to energy conservation. Chapter 3 is a consideration of the steps involved in conducting an evaluation from the planning stage to data analysis. Chapter 4 discusses managerial considerations in conducting an evaluation. Chapter 5 discusses evaluators as people; both in terms of organizational obstacles likely to be encountered by, and personal characteristics found in, good evaluators. An appendix includes suggested further readings.

  10. Construction of Specific Primers for Rapid Detection of South African Exportable Vegetable Macergens

    Directory of Open Access Journals (Sweden)

    Bukola Rhoda Aremu

    2015-09-01

    Full Text Available Macergens are bacteria causing great damages to the parenchymatous tissues of vegetable both on the field and in transit. To effectively and rapidly investigate the diversity and distribution of these macergens, four specific primers were designed by retrieving 16S rDNA sequences of pectolytic bacteria from GenBank through the National Center for Biotechnology Information (NCBI. These were aligned using ClusterW via BioEdit and primers were designed using Primer3Plus platform. The size and primer location of each species and PCR product size were accurately defined. For specificity enhancement, DNA template of known macergens (Pectobacterium chrysanthermi and fresh healthy vegetable were used. These primers yielded expected size of approximately 1100 bp product only when tested with known macergens and no amplicon with fresh healthy vegetable was detected. Rapid detection of macergens in rotten vegetable samples was then carried out using these primers. Nucleotide sequences of macergens identified were deposited into the GenBank and were assigned accession numbers. Hence, with these specific primers, macergens can be identified with minimal quantities of the vegetable tissues using molecular techniques, for future use of the quarantine section of the Agricultural Department of the country for quick and rapid detection of macergens before exportation.

  11. Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples 1

    OpenAIRE

    Alexandre R. Zuntini; Fonseca, Luiz Henrique M.; Lúcia G. Lohmann

    2013-01-01

    Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The sta...

  12. Detecting Lesch-Nyhan syndrome by solid phase primer extension

    Energy Technology Data Exchange (ETDEWEB)

    Shumaker, J.M.; Caskey, C.T. [Baylor College of Medicine, Houston, TX (United States); Metspalu, A.

    1994-09-01

    A mutation detection method based upon the wild type human HPRT sequence is presented for identification of Lesch Nyhan syndrome. The technique consists of performing a biotinlyated PCR amplification of the region of interest, followed by isolation and purification of single stranded template using magnetic separation. Allele-specific primers are annealed adjacent to the potential mutation site on the template. A terminal fluorescent deoxynucleotide addition is performed with a DNA template-dependent polymerase to distinguish between the mutant and wild-type sequence. The products are purified from unincorporated ddNTPs, eluted and finally analyzed on an ABI 373 to identify the mutation. The length of an extension primer is used as a position signature for mutations. The fidelity of nucleotide incorporation provides an excellent signal-to-noise ratio for the detection of nine HPRT mutations within eight cell lines. This method should detect all types of mutations except for repeated sequences that are longer than the primers. Moreover, the method is being extended to a solid support assay, whereby the extension primers are attached to a two-dimensional glass surface. Following extension, the solid support is analyzed for radioactive incorporation. We have shown the sequence determination of a five base region of a wild-type sequence and two different HPRT mutations. As more dense oligonucleotide arrays are produced, this method could be extended to sequence the complete coding region of HPRT.

  13. Somatic point mutations in mtDNA control region are influenced by genetic background and associated with healthy aging: a GEHA study

    DEFF Research Database (Denmark)

    Rose, Giuseppina; Romeo, Giuseppe; Dato, Serena;

    2010-01-01

    Tissue specific somatic mutations occurring in the mtDNA control region have been proposed to provide a survival advantage. Data on twins and on relatives of long-lived subjects suggested that the occurrence/accumulation of these mutations may be genetically influenced. To further investigate....... We found a significant correlation of the mtDNA control region heteroplasmy between sibs, confirming a genetic influence on this phenomenon. Furthermore, many subjects showed heteroplasmy due to mutations different from the C150T transition. In these cases heteroplasmy was correlated within sibpairs...... performance and of mortality risk in the elderly. Our study provides new evidence on the relevance of mtDNA somatic mutations in aging and longevity and confirms that the occurrence of specific point mutations in the mtDNA control region may represent a strategy for the age-related remodelling of organismal...

  14. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    Directory of Open Access Journals (Sweden)

    Dunn Sade N

    2008-06-01

    Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

  15. Design and Evaluation of PCR Primers for Analysis of Bacterial Populations in Wine by Denaturing Gradient Gel Electrophoresis

    OpenAIRE

    Lopez, Isabel; Ruiz-Larrea, Fernanda; Cocolin, Luca; Orr, Erica; Phister, Trevor; Marshall, Megan; VanderGheynst, Jean; Mills, David A.

    2003-01-01

    Denaturing gradient gel electrophoresis (DGGE) of PCR-amplified ribosomal DNA (rDNA) is routinely used to compare levels of diversity of microbial communities and to monitor population dynamics. While using PCR-DGGE to examine the bacteria in wine fermentations, we noted that several commonly used PCR primers for amplifying bacterial 16S rDNA also coamplified yeast, fungal, or plant DNA present in samples. Unfortunately, amplification of nonbacterial DNA can result in a masking of bacterial p...

  16. Detection of Helicobacter pylori DNA in Fecal Samples from Infected Individuals

    OpenAIRE

    Gramley, William A.; Asghar, Ali; Frierson, Henry F; Powell, Steven M

    1999-01-01

    Stool, gastric biopsy, and serum samples were collected from 22 subjects. DNA from stool was extracted, amplified, and hybridized with primers specific for the 16S rRNA gene of Helicobacter pylori. DNA from gastric biopsy specimens was analyzed similarly for comparison. Universal primers were used to confirm successful extraction of DNA from samples. Histologic, serologic, and DNA analyses were scored in a blinded fashion. Universal primer amplification verified successful DNA extraction from...

  17. Primers with 5' flaps improve the efficiency and sensitivity of multiplex PCR assays for the detection of Salmonella and Escherichia coli O157:H7.

    Science.gov (United States)

    Timmons, Chris; Dobhal, Shefali; Fletcher, Jacqueline; Ma, Li Maria

    2013-04-01

    Foodborne illnesses caused by Salmonella enterica and Escherichia coli O157:H7 are worldwide health concerns. Rapid, sensitive, and robust detection of these pathogens in foods and in clinical and environmental samples is essential for routine food quality testing, effective surveillance, and outbreak investigations. The aim of this study was to evaluate the effect on PCR sensitivity of adding a short, AT-rich overhanging nucleotide sequence (flap) to the 5' end of PCR primers specific for the detection of Salmonella and E. coli O157:H7. Primers targeting the invA gene of Salmonella and the rfbE gene of E. coli O157:H7 were synthesized with or without a 12-bp, AT-rich 5' flap (5'-AATAAATCATAA-3'). Singleplex PCR, multiplex PCR, and real-time PCR sensitivity assays were conducted using purified bacterial genomic DNA and crude cell lysates of bacterial cells. The effect of background flora on detection was evaluated by spiking tomato and jalapeno pepper surface washes with E. coli O157:H7 and Salmonella Saintpaul. When targeting individual pathogens, end-point PCR assays using flap-amended primers were more efficient than nonamended primers, with 20.4 and 23.5% increases in amplicon yield for Salmonella and E. coli O157:H7, respectively. In multiplex PCR assays, a 10- to 100-fold increase in detection sensitivity was observed when the primer flap sequence was incorporated. This improvement in both singleplex and multiplex PCR efficiency and sensitivity can lead to improved Salmonella and E. coli O157:H7 detection. PMID:23575131

  18. PriFi - Using a Multiple Alignment of Related Sequences to Find Primers for  Amplification of Homologs

    DEFF Research Database (Denmark)

    Fredslund, Jakob; Schauser, Leif; Madsen, Lene Heegaard;

    2005-01-01

    Using a comparative approach, the web program PriFi (http://cgi-www.daimi.au.dk/cgi-chili/PriFi/main) designs pairs of primers useful for PCR amplification of genomic DNA in species where prior sequence information is not available. The program works with an alignment of DNA sequences from...... phylogenetically related species and outputs a list of possibly degenerate primer pairs fulfilling a number of criteria, such that the primers have a maximal probability of amplifying orthologous sequences in other phylogenetically related species. Operating on a genome-wide scale, PriFi automates the first steps...

  19. Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

    Directory of Open Access Journals (Sweden)

    Li Kelvin

    2012-11-01

    Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

  20. Loop Quantum Geometry: A primer

    CERN Document Server

    Corichi, A

    2005-01-01

    This is the written version of a lecture given at the ``VI Mexican School of Gravitation and Mathematical Physics" (Nov 21-27, 2004, Playa del Carmen, Mexico), introducing the basics of Loop Quantum Geometry. The purpose of the written contribution is to provide a Primer version, that is, a first entry into Loop Quantum Gravity and to present at the same time a friendly guide to the existing pedagogical literature on the subject. This account is geared towards graduate students and non-experts interested in learning the basics of the subject.

  1. Sample Return Primer and Handbook

    Science.gov (United States)

    Barrow, Kirk; Cheuvront, Allan; Faris, Grant; Hirst, Edward; Mainland, Nora; McGee, Michael; Szalai, Christine; Vellinga, Joseph; Wahl, Thomas; Williams, Kenneth; Lee, Gentry; Duxbury, Thomas

    2007-01-01

    This three-part Sample Return Primer and Handbook provides a road map for conducting the terminal phase of a sample return mission. The main chapters describe element-by-element analyses and trade studies, as well as required operations plans, procedures, contingencies, interfaces, and corresponding documentation. Based on the experiences of the lead Stardust engineers, the topics include systems engineering (in particular range safety compliance), mission design and navigation, spacecraft hardware and entry, descent, and landing certification, flight and recovery operations, mission assurance and system safety, test and training, and the very important interactions with external support organizations (non-NASA tracking assets, landing site support, and science curation).

  2. A primer of special relativity

    CERN Document Server

    Sardesai, PL

    2004-01-01

    A Primer of Special Relativity1 is an unusually lucid introduction to the subject specifically written for Indian students. It is intended to give the beginner a firm grounding for a more advanced course in relativity. An entire chapter is devoted to applications of the theory to elucidate a large number of topics the students (B.Sc. Physics) come across in Modern Physics. Detailed and well-selected examples are used to illuminate aspects of the theory as well as to show techniques of application. A large number of Illustrative Examples enables the students to gain confidence to solve any problem in relativity normally expected of B.Sc. students.

  3. A primer of multivariate statistics

    CERN Document Server

    Harris, Richard J

    2014-01-01

    Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

  4. Loop Quantum Geometry: A primer

    OpenAIRE

    Corichi, Alejandro

    2005-01-01

    This is the written version of a lecture given at the ``VI Mexican School of Gravitation and Mathematical Physics" (Nov 21-27, 2004, Playa del Carmen, Mexico), introducing the basics of Loop Quantum Geometry. The purpose of the written contribution is to provide a Primer version, that is, a first entry into Loop Quantum Gravity and to present at the same time a friendly guide to the existing pedagogical literature on the subject. This account is geared towards graduate students and non-expert...

  5. A primer of Lebesgue integration

    CERN Document Server

    Bear, H S

    2001-01-01

    The Lebesgue integral is now standard for both applications and advanced mathematics. This books starts with a review of the familiar calculus integral and then constructs the Lebesgue integral from the ground up using the same ideas. A Primer of Lebesgue Integration has been used successfully both in the classroom and for individual study.Bear presents a clear and simple introduction for those intent on further study in higher mathematics. Additionally, this book serves as a refresher providing new insight for those in the field. The author writes with an engaging, commonsense style that appeals to readers at all levels.

  6. Small Commercial Building Re-tuning: A Primer

    Energy Technology Data Exchange (ETDEWEB)

    Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas

    2013-09-30

    To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.

  7. Determination of the species specificity of the primers for the detection of chicken and turkey meat by realtime PCR method

    Directory of Open Access Journals (Sweden)

    Lenka Maršálková

    2014-07-01

    Full Text Available The aim of this work was to use TaqMan Real-Time PCR for quantitative authentication of chicken and turkey meat. To meet this purpose, a specific pair of primers and TaqMan probe was used. The test was aimed at identifying the reaction cycle of turkey and chicken meat using by two sets of primers. With first set of primer designed for chicken we obtained the following results: Cp = 16.18 for 100% chicken DNA Cp = 29, 18 100% turkey DNA It was also amplified DNA of pig that exceeded the detection threshold fluorescence intensities in the 31.07 cycle (Cp = 31.07. Using primers designed for turkey we obtained the following results Cp = 31.16 for 100% CHDNA, Cp =16.18 100% TDNA. It was also amplified the 100% DNA of rabbit in 31.63 cycle (Cp = 31.63 and deer in cycle 32 (Cp = 32. The DNA of all other animal species was amplificated after more than 35 cycles (Cp >35. It follows that the second detection primer pair is specific enough to unrelated species of animals by 30 cycles of the reaction. Species authentication based on DNA analysis from this perspective overcomes all the shortcomings of proteins. At present, DNA analysis use different types of PCR. Is the most progressive Real-time PCR, which is suitable for the specific use of detection (primers and TaqMan probe. The TaqMan Real-time PCR is within the sensitivity and specificity, clearly one of the best methods for identifying the species of chicken and turkey meat. The specificity of this method, however, depends primarily on the specificity of the primers and TaqMan probe. The 30 cycle reaction was chosen by us as the threshold for specificity using primers for authentication chicken and turkey meat.

  8. Strikingly different penetrance of LHON in two Chinese families with primary mutation G11778A is independent of mtDNA haplogroup background and secondary mutation G13708A

    International Nuclear Information System (INIS)

    The penetrance of Leber's hereditary optic neuropathy (LHON) in families with primary mitochondrial DNA (mtDNA) mutations is very complex. Matrilineal and nuclear genetic background, as well as environmental factors, have been reported to be involved in different affected pedigrees. Here we describe two large Chinese families that show a striking difference in the penetrance of LHON, in which 53.3% and 15.0% of members were affected (P < 0.02), respectively. Analysis of the complete mtDNA genome of the two families revealed the presence of the primary mutation G11778A and several other variants suggesting the same haplogroup status G2a. The family with higher penetrance contained a previously described secondary mutation G13708A, which presents a polymorphism in normal Chinese samples and does not affect in vivo mitochondrial oxidative metabolism as described in a previous study. Evolutionary analysis failed to indicate any putatively pathogenic mutation that cosegregated with G11778A in these two pedigrees. Our results suggest that the variable penetrance of LHON in the two Chinese families is independent of both their mtDNA haplotype background and a secondary mutation G13708A. As a result, it is likely that unknown nuclear gene involvement and/or other factors contribute to the strikingly different penetrance of LHON

  9. Strikingly different penetrance of LHON in two Chinese families with primary mutation G11778A is independent of mtDNA haplogroup background and secondary mutation G13708A

    Energy Technology Data Exchange (ETDEWEB)

    Wang Huawei [Key Laboratory of Animal Models and Human Disease Mechanisms, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming 650223 (China)]|[Laboratory for Conservation and Utilization of Bio-resource, Yunnan University, Kunming 650091 (China); Jia Xiaoyun; Ji Yanli [State Key Laboratory of Ophthalmology, Zhongshan Ophthalmic Center, Sun Yat-sen University, Guangzhou 510060 (China); Kong Qingpeng [State Key Laboratory of Genetic Resources and Evolution, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223 (China); Zhang Qingjiong [State Key Laboratory of Ophthalmology, Zhongshan Ophthalmic Center, Sun Yat-sen University, Guangzhou 510060 (China)], E-mail: qingjiongzhang@yahoo.com; Yao Yonggang [Key Laboratory of Animal Models and Human Disease Mechanisms, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming 650223 (China)]|[State Key Laboratory of Genetic Resources and Evolution, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223 (China)], E-mail: ygyaozh@yahoo.com; Zhang Yaping [Laboratory for Conservation and Utilization of Bio-resource, Yunnan University, Kunming 650091 (China)]|[State Key Laboratory of Genetic Resources and Evolution, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, Yunnan 650223 (China)

    2008-08-25

    The penetrance of Leber's hereditary optic neuropathy (LHON) in families with primary mitochondrial DNA (mtDNA) mutations is very complex. Matrilineal and nuclear genetic background, as well as environmental factors, have been reported to be involved in different affected pedigrees. Here we describe two large Chinese families that show a striking difference in the penetrance of LHON, in which 53.3% and 15.0% of members were affected (P < 0.02), respectively. Analysis of the complete mtDNA genome of the two families revealed the presence of the primary mutation G11778A and several other variants suggesting the same haplogroup status G2a. The family with higher penetrance contained a previously described secondary mutation G13708A, which presents a polymorphism in normal Chinese samples and does not affect in vivo mitochondrial oxidative metabolism as described in a previous study. Evolutionary analysis failed to indicate any putatively pathogenic mutation that cosegregated with G11778A in these two pedigrees. Our results suggest that the variable penetrance of LHON in the two Chinese families is independent of both their mtDNA haplotype background and a secondary mutation G13708A. As a result, it is likely that unknown nuclear gene involvement and/or other factors contribute to the strikingly different penetrance of LHON.

  10. Background Material

    DEFF Research Database (Denmark)

    Zandersen, Marianne; Hyytiäinen, Kari; Saraiva, Sofia;

    2016-01-01

    This document serves as a background material to the BONUS Pilot Scenario Workshop, which aims to develop harmonised regional storylines of socio-ecological futures in the Baltic Sea region in a collaborative effort together with other BONUS projects and stakeholders.......This document serves as a background material to the BONUS Pilot Scenario Workshop, which aims to develop harmonised regional storylines of socio-ecological futures in the Baltic Sea region in a collaborative effort together with other BONUS projects and stakeholders....

  11. Blocking human contaminant DNA during PCR allows amplification of rare mammal species from sedimentary ancient DNA

    DEFF Research Database (Denmark)

    Boessenkool, Sanne; Epp, Laura S.; Haile, James Seymour;

    2012-01-01

    bias, during the PCR. In this study, we test the utility of human-specific blocking primers in mammal diversity analyses of ancient permafrost samples from Siberia. Using quantitative PCR (qPCR) on human and mammoth DNA, we first optimized the design and concentration of blocking primer in the PCR......Analyses of degraded DNA are typically hampered by contamination, especially when employing universal primers such as commonly used in environmental DNA studies. In addition to false-positive results, the amplification of contaminant DNA may cause false-negative results because of competition, or....... Subsequently, 454 pyrosequencing of ancient permafrost samples amplified with and without the addition of blocking primer revealed that DNA sequences from a diversity of mammalian representatives of the Beringian megafauna were retrieved only when the blocking primer was added to the PCR. Notably, we observe...

  12. Screening for the familial defective apolipoprotein B-100 R3500W by mutagenic primers PCR

    Institute of Scientific and Technical Information of China (English)

    冯纪安; 冯铮

    2002-01-01

    Objective A method combining the mutagenic primers PCR and restriction enzyme digestion was designed to facilitate the detection of gene mutation in familial defective apolipoprotein B-1O0 R3500W. Methods A pair of primer was designed and a mismatch nucleotide was introduced in its upstream primer. A segment of target DNA including the possibly mutated nucleotide was amplified by PCR and the products were digested by restriction enzyme Nco 1. To overcome the potential false negative results due to improper digestion conditions, a segment of DNA with Ncol cut size was added as reference.Results The target sequence was successfully amplified by PCR, producing a 144 bp DNA fragment as expected. When incubated with Ncol, the enzyme could digest the DNA, producing a 114 bp segment,only if it was amplified from the mutated gene, but not from the normal allele. This difference in length of DNA could be separated by electrophoresis on a 2 %agarose gel. Thus we successfully detected two carriers of heterozygous FDB R3500W in 162 hypercholesterolemic patients. Conclusions Mutagenic primers PCR can be used to detect the gene mutation of apo B-100 R3500W, two cases were detected among 162patients with hypercholesterolemia. It suggests that this mutation is not rare in mainland China.

  13. Relativistic Astrophysics and Cosmology: A Primer

    International Nuclear Information System (INIS)

    'Relativistic Astrophysics and Cosmology: A Primer' by Peter Hoyng, was published last year by Springer. The book is based on lectures given by the author at University of Utrecht to advanced undergraduates. This is a short and scholarly book. In about 300 pages, the author has covered the most interesting and important applications of Albert Einstein's general relativity in present-day astrophysics and cosmology: black holes, neutron stars, gravitational waves, and the cosmic microwave background. The book stresses theory, but also discusses several experimental and observational topics, such as the Gravity Probe B mission, interferometer detectors of gravitational waves and the power spectrum of the cosmic microwave background. The coverage is not uniform. Some topics are discussed in depth, others are only briefly mentioned. The book obviously reflects the author's own research interests and his preferences for specific mathematical methods, and the choice of the original artwork that illustrates the book (and appears on its cover) is a very personal one. I consider this personal touch an advantage, even if I do not always agree with the author's choices. For example, I employ Killing vectors as a very useful mathematical tool not only in my research on black holes, but also in my classes. I find that my students prefer it when discussions of particle, photon and fluid motion in the Schwarzschild and Kerr spacetimes are based explicitly and directly on the Killing vectors rather than on coordinate calculations. The latter approach is, of course, the traditional one, and is used in Peter Hoyng's book. Reading the book is a stimulating experience, because the reader can almost feel the author's presence. The author's opinions, his mathematical taste, his research pleasures, and his pedagogical passion are apparent everywhere. Lecturers contemplating a new course on relativistic astrophysics could adopt Hoyng's book as the text. Their students will be in the author

  14. A Practical Primer on Geostatistics

    Science.gov (United States)

    Olea, Ricardo A.

    2009-01-01

    significant methodological implications. HISTORICAL REMARKS As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields. PIONEERS Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorology CALCULATIONS Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations. SOFTWARE For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics. ORGANIZATION OF THE PRIMER The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of th

  15. A primer on quantum fluids

    CERN Document Server

    Barenghi, Carlo

    2016-01-01

    The aim of this primer is to cover the essential theoretical information, quickly and concisely, in order to enable senior undergraduate and beginning graduate students to tackle projects in topical research areas of quantum fluids, for example, solitons, vortices and collective modes. The selection of the material, both regarding the content and level of presentation, draws on the authors analysis of the success of relevant research projects with newcomers to the field, as well as of the students feedback from many taught and self-study courses on the subject matter. Starting with a brief historical overview, this text covers particle statistics, weakly interacting condensates and their dynamics and finally superfluid helium and quantum turbulence. At the end of each chapter (apart from the first) there will be some exercises. Detailed solutions can be made available to instructors upon request to the authors. .

  16. An integrated web medicinal materials DNA database: MMDBD (Medicinal Materials DNA Barcode Database

    Directory of Open Access Journals (Sweden)

    But Paul

    2010-06-01

    Full Text Available Abstract Background Thousands of plants and animals possess pharmacological properties and there is an increased interest in using these materials for therapy and health maintenance. Efficacies of the application is critically dependent on the use of genuine materials. For time to time, life-threatening poisoning is found because toxic adulterant or substitute is administered. DNA barcoding provides a definitive means of authentication and for conducting molecular systematics studies. Owing to the reduced cost in DNA authentication, the volume of the DNA barcodes produced for medicinal materials is on the rise and necessitates the development of an integrated DNA database. Description We have developed an integrated DNA barcode multimedia information platform- Medicinal Materials DNA Barcode Database (MMDBD for data retrieval and similarity search. MMDBD contains over 1000 species of medicinal materials listed in the Chinese Pharmacopoeia and American Herbal Pharmacopoeia. MMDBD also contains useful information of the medicinal material, including resources, adulterant information, medical parts, photographs, primers used for obtaining the barcodes and key references. MMDBD can be accessed at http://www.cuhk.edu.hk/icm/mmdbd.htm. Conclusions This work provides a centralized medicinal materials DNA barcode database and bioinformatics tools for data storage, analysis and exchange for promoting the identification of medicinal materials. MMDBD has the largest collection of DNA barcodes of medicinal materials and is a useful resource for researchers in conservation, systematic study, forensic and herbal industry.

  17. Yeast tRNAPhe expressed in human cells can be selected by HIV-1 for use as a reverse transcription primer

    International Nuclear Information System (INIS)

    All naturally occurring human immune deficiency viruses (HIV-1) select and use tRNALys,3 as the primer for reverse transcription. Studies to elucidate the mechanism of tRNA selection from the intracellular milieu have been hampered due to the difficulties in manipulating the endogenous levels of tRNALys,3. We have previously described a mutant HIV-1 with a primer binding site (PBS) complementary to yeast tRNAPhe (psHIV-Phe) that relies on transfection of yeast tRNAPhe for infectivity. To more accurately recapitulate the selection process, a cDNA was designed for the intracellular expression of the yeast tRNAPhe. Increasing amounts of the plasmid encoding tRNAPhe resulted in a corresponding increase in levels of yeast tRNAPhe in the cell. The yeast tRNAPhe isolated from cells transfected with the cDNA for yeast tRNAPhe, or in the cell lines expressing yeast tRNAPhe, were aminoacylated, indicating that the expressed yeast tRNAPhe was incorporated into tRNA biogenesis pathways and translation. Increasing the cytoplasmic levels of tRNAPhe resulted in increased encapsidation of tRNAPhe in viruses with a PBS complementary to tRNAPhe (psHIV-Phe) or tRNALys,3 (wild-type HIV-1). Production of infectious psHIV-Phe was dependent on the amount of cotransfected tRNAPhe cDNA. Increasing amounts of plasmids encoding yeast tRNAPhe produced an increase of infectious psHIV-Phe that plateaued at a level lower than that from the transfection of the wild-type genome, which uses tRNALys,3 as the primer for reverse transcription. Cell lines were generated that expressed yeast tRNAPhe at levels approximately 0.1% of that for tRNALys,3. Even with this reduced level of yeast tRNAPhe, the cell lines complemented psHIV-Phe over background levels. The results of these studies demonstrate that intracellular levels of primer tRNA can have a direct effect on HIV-1 infectivity and further support the role for PBS-tRNA complementarity in the primer selection process

  18. PCR and real-time PCR primers developed for detection and identification of Bifidobacterium thermophilum in faeces

    Directory of Open Access Journals (Sweden)

    Mini Raffaella

    2008-10-01

    Full Text Available Abstract Background Culture-independent methods based on the 16S ribosomal RNA molecule are nowadays widely used for assessment of the composition of the intestinal microbiota, in relation to host health or probiotic efficacy. Because Bifidobacterium thermophilum was only recently isolated from human faeces until now, no specific real-time PCR (qPCR assay has been developed for detection of this species as component of the bifidobacterial community of the human intestinal flora. Results Design of specific primers and probe was achieved based on comparison of 108 published bifidobacterial 16S rDNA sequences with the recently published sequence of the human faecal isolate B. thermophilum RBL67. Specificity of the primer was tested in silico by similarity search against the sequence database and confirmed experimentally by PCR amplification on 17 Bifidobacterium strains, representing 12 different species, and two Lactobacillus strains. The qPCR assay developed was linear for B. thermophilum RBL67 DNA quantities ranging from 0.02 ng/μl to 200 ng/μl and showed a detection limit of 105 cells per gram faeces. The application of this new qPCR assay allowed to detect the presence of B. thermophilum in one sample from a 6-month old breast-fed baby among 17 human faecal samples tested. Additionally, the specific qPCR primers in combination with selective plating experiments led to the isolation of F9K9, a faecal isolate from a 4-month old breast-fed baby. The 16S rDNA sequence of this isolate is 99.93% similar to that of B. thermophilum RBL67 and confirmed the applicability of the new qPCR assay in faecal samples. Conclusion A new B. thermophilum-specific qPCR assay was developed based on species-specific target nucleotides in the 16S rDNA. It can be used to further characterize the composition of the bifidobacterial community in the human gastrointestinal tract. Until recently, B. thermophilum was considered as a species of animal origin, but here we

  19. Development and Validation of LNA-Based Quantitative Real-Time PCR Assays for Detection and Identification of the Root-Knot Nematode Meloidogyne enterolobii in Complex DNA Backgrounds.

    Science.gov (United States)

    Kiewnick, Sebastian; Frey, Jürg E; Braun-Kiewnick, Andrea

    2015-09-01

    Meloidogyne enterolobii is a quarantine root-knot nematode posing a major threat to agricultural production systems worldwide. It attacks many host plants, including important agricultural crops, ornamentals, and trees. M. enterolobii is a highly virulent and pathogenic root-knot nematode species, able to reproduce on plants resistant to other Meloidogyne spp. Significant crop damage has been reported in Asia, South America, Africa, the United States, France, and greenhouses in Switzerland. To identify potential introduction pathways and ensure appropriate phytosanitary measures and management strategies, accurate detection and identification tools are needed. Therefore, two real-time quantitative polymerase chain reaction (PCR) assays based on the second intergenic spacer region of the ribosomal DNA cistron and the cytochrome oxidase c subunit I (COI) gene using locked nucleic acid probes were developed and validated for fast and reliable detection and identification of M. enterolobii. Analytical specificity was confirmed with 16 M. enterolobii populations, 16 populations of eight closely related Meloidogyne spp., and four species from other nematode genera. Optimizing and testing the assays on two real-time PCR platforms revealed an analytical sensitivity of one juvenile in a background of 1,000 nematodes and the intended limit of detection of one juvenile per 100 ml of soil. Both assays performed equally well, with the COI-based assay showing a slightly better performance concerning detection of M. enterolobii target DNA in complex DNA backgrounds. PMID:25775103

  20. Specific in situ hepatitis B viral double mutation (HBVDM) detection in urine with 60 copies ml(-1) analytical sensitivity in a background of 250-fold wild type without DNA isolation and amplification.

    Science.gov (United States)

    Kirimli, Ceyhun E; Shih, Wei-Heng; Shih, Wan Y

    2015-03-01

    We have examined in situ detection of hepatitis B virus 1762T/1764A double mutation (HBVDM) in urine using a (Pb(Mg(1/3)Nb(2/3))O3)(0.65)(PbTiO3)(0.35) (PMN-PT) piezoelectric plate sensor (PEPS) coated with a 16-nucleotide (nt) probe DNA (pDNA) complementary to the HBVDM. The in situ mutation (MT) detection was carried out in a flow with the PEPS vertically situated at the center of the flow in a background of wild type (WT). For validation, this detection was followed by detection in the mixture of MT fluorescent reporter microspheres (FRMs) (MT FRMs) and WT FRMs that emitted different fluorescence colours and were designed to specifically bind to MT and WT, respectively. At 30 °C and 4 ml min(-1), a PEPS was shown to specifically detect HBVDM in situ with 60 copies ml(-1) analytical sensitivity in a background of clinically-relevant 250-fold more WT in 30 min without DNA isolation, amplification, or labelling as validated by the visualization of the captured MT FRMs and WT FRMs following FRM detection where the captured MT FRMs outnumbered the WT FRMs by a factor of 5 to 1. PMID:25599103

  1. Electrostatic Discharge testing of propellants and primers

    Energy Technology Data Exchange (ETDEWEB)

    Berry, R.B.

    1994-02-01

    This report presents the results of testing of selected propellants and primers to Electrostatic Discharge (ESD) characteristic of the human body. It describes the tests and the fixturing built to accommodate loose material (propellants) and the packed energetic material of the primer. The results indicate that all powders passed and some primers, especially the electric primers, failed to pass established requirements which delineate insensitive energetic components. This report details the testing of components and materials to four ESD environments (Standard ESD, Severe ESD, Modified Standard ESD, and Modified Severe ESD). The purpose of this study was to collect data based on the customer requirements as defined in the Sandia Environmental Safety & Health (ES&H) Manual, Chapter 9, and to define static sensitive and insensitive propellants and primers.

  2. EGNAS: an exhaustive DNA sequence design algorithm

    Directory of Open Access Journals (Sweden)

    Kick Alfred

    2012-06-01

    Full Text Available Abstract Background The molecular recognition based on the complementary base pairing of deoxyribonucleic acid (DNA is the fundamental principle in the fields of genetics, DNA nanotechnology and DNA computing. We present an exhaustive DNA sequence design algorithm that allows to generate sets containing a maximum number of sequences with defined properties. EGNAS (Exhaustive Generation of Nucleic Acid Sequences offers the possibility of controlling both interstrand and intrastrand properties. The guanine-cytosine content can be adjusted. Sequences can be forced to start and end with guanine or cytosine. This option reduces the risk of “fraying” of DNA strands. It is possible to limit cross hybridizations of a defined length, and to adjust the uniqueness of sequences. Self-complementarity and hairpin structures of certain length can be avoided. Sequences and subsequences can optionally be forbidden. Furthermore, sequences can be designed to have minimum interactions with predefined strands and neighboring sequences. Results The algorithm is realized in a C++ program. TAG sequences can be generated and combined with primers for single-base extension reactions, which were described for multiplexed genotyping of single nucleotide polymorphisms. Thereby, possible foldback through intrastrand interaction of TAG-primer pairs can be limited. The design of sequences for specific attachment of molecular constructs to DNA origami is presented. Conclusions We developed a new software tool called EGNAS for the design of unique nucleic acid sequences. The presented exhaustive algorithm allows to generate greater sets of sequences than with previous software and equal constraints. EGNAS is freely available for noncommercial use at http://www.chm.tu-dresden.de/pc6/EGNAS.

  3. Optimization of PCR conditions to amplify microsatellite loci in the bunchgrass lizard (Sceloporus slevini genomic DNA

    Directory of Open Access Journals (Sweden)

    d'Orgeix Christian A

    2011-01-01

    Full Text Available Abstract Background Microsatellites, also called Simple Sequence Repeats (SSRs, repetitions of nucleotide motifs of 1-5 bases, are currently the markers of choice due to their abundant distribution in the genomes, and suitability for high-throughput analysis. A total of five different primer pairs were optimized for polymerase chain reaction (PCR to amplify microsatellite loci in total genomic DNA of bunchgrass lizards (Sceloporus slevini collected from three sites in southeastern Arizona; the Sonoita Plain, Chiricahua Mountains and Huachuca Mountains. Findings The primers used for current investigation were originally designed for the Eastern Fence Lizard (Sceloporus undulatus. Five primer pairs were selected based on annealing temperatures for optimizing the PCR conditions to amplify with bunchgrass lizards. Different concentrations of DNA and annealing temperature were optimized. While keeping other reagents constant, a DNA concentration, 37.5 ng in the final reaction volume and PCR conditions of an initial denaturation of 94°C for five minutes, an annealing temperature of 55°C and final extension of 72°C for four minutes gave the best amplification for all the primer pairs. Conclusions Modifying the standard protocol for annealing temperatures and final extension time increases the success of cross amplification of specific microsatellite loci in the bunchgrass lizard. A loading volume of 5 ul DNA at a concentration of 10 ng/ul and a 2% agarose for gel electrophoresis were observed the best for cross amplification of selected five primer pairs on bunch grass lizard. Trial Registration The research was conducted with Arizona Game and Fish Department scientific collecting permits SP565256, SP657407 & SP749119 to Dr. Christian A d'Orgeix.

  4. Assessment of fungal diversity in deep-sea sediments by multiple primer approach

    Digital Repository Service at National Institute of Oceanography (India)

    Singh, P.; Raghukumar, C.; Verma, P.; Shouche, Y.

    Increasing evidence of the fungal diversity in deep-sea sediments has come from amplification of environmental DNA with fungal specific or eukaryote primer sets. In order to assess the fungal diversity in deep-sea sediments of the Central Indian...

  5. Evaluation of genetic diversity in open pollinated guava by iPBS primers

    International Nuclear Information System (INIS)

    DNA markers are important tools for assessing genetic diversity and relationships among species, cultivars and breeding materials. Many horticultural species are lacking genomic information. DNA markers that do not require prior knowledge of DNA sequences are therefore appealing for horticultural research. A retrotransposon-based DNA marker system, iPBS (inter primer binding sites) developed from conserved primer binding sites within retrotransposons, was used to study the genetic variation and relationships in ornamental guava. PCR from 6 iPBS primers (dominant markers) produced a total of 113 bands (52.38-100% polymorphic) ranging from 150 bp to 3000 bp, and the mean PIC value for each primer ranging from 0.1245 to 0.3698. Molecular information generated from both iPBS was separately scored in a matrix for phylogenetic dendrogram construction. The phylogenetic dendrogram based on iPBS markers reflected morphologic classifications of the accessions that were studied. The iPBS PCR-based genome fingerprinting technology in this study is low-cost and provides another effective alternative in differentiation of accessions in guava (Psidium guajava Linn.) and related species or genera. (author)

  6. Sensitive and low-background electrochemical assay of corin activity via supramolecular recognition and rolling circle amplification.

    Science.gov (United States)

    Yin, Tingting; Li, Hao; Zhang, Yuanyuan; Yang, Nana; Sun, Lizhou; Cao, Ya; Xiang, Yang

    2016-05-01

    Corin is an important member of type II transmembrane serine proteases that is involved in a variety of cardiovascular and pregnancy-related diseases. Herein, a sensitive and low-background electrochemical method is proposed to assay the activity of corin. In principle, a peptide comprising both the substrate motif of corin and binding site of cucurbit[8]uril (CB[8]) is first designed and immobilized on the electrode surface. Thereafter, via CB[8]-mediated supramolecular recognition, a DNA-primer is recruited, subsequently triggering the rolling circle amplification (RCA) reaction. In this way, a succeeding propagation of DNA strands is achieved on the electrode surface, which would produce remarkable repelling effect against the electrochemical species [Fe(CN)6](3-/4-), and thereby yield a highly minimized background signal. However, in the presence of activated corin, the peptide is specifically recognized and cleaved, breaching the recruitment of DNA primer as well as the RCA reaction, which decreases the repulsion to [Fe(CN)6](3-/4-), leading to a remarkable electrochemical response. As a result, the proposed assay method can sensitively determine the activity of corin with a detection limit of 0.92 pM, and can further be directly used in maternal plasma samples. Therefore, this method may provide a promising tool for pathological research and clinical diagnosis of corin-related diseases. PMID:27086096

  7. The use of coded PCR primers enables high-throughput sequencing of multiple homolog amplification products by 454 parallel sequencing

    DEFF Research Database (Denmark)

    Binladen, Jonas; Gilbert, M Thomas P; Bollback, Jonathan P;

    2007-01-01

    template DNA from multiple individuals, as homologous sequences cannot be subsequently assigned to their original sources. METHODOLOGY: We use conventional PCR with 5'-nucleotide tagged primers to generate homologous DNA amplification products from multiple specimens, followed by sequencing through the...... differently tagged primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the...... distribution of the sequences as sorted by the second nucleotide of the dinucleotide tags. As the results are based on a single GS20 run, the general applicability of the approach requires confirmation. However, our experiments demonstrate that 5'primer tagging is a useful method in which the sequencing power...

  8. Primer on spontaneous heating and pyrophoricity

    Energy Technology Data Exchange (ETDEWEB)

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  9. Detection of Luminous Vibrio harveyi in Penaeid Shrimp Through Nested PCR Using Haemolysin Gene Primer

    Directory of Open Access Journals (Sweden)

    Wawan Abdullah Setiawan

    2015-04-01

    Full Text Available Whiteleg shrimp (Litopenaeus vannamei is one of the most important aquaculture commodity in Indonesia. However, the luminous disease primarily caused by Vibrio harveyi bacteria still becomes an obstacle in penaeid shrimp farming, especially in shrimp hatchery. This study was aimed to identify the presence of V. harveyi in L. vannamei through nested PCR using haemolysin gene primer. First, initial primers were designed using V. harveyi VIB 391 haemolysin gene sequence (accession number: DQ640264, flanking the position 133 to 756. This primer pairs were used to identify haemolysin gene in both V. harveyi MR5339 and V. harveyi 275 strain. Sequencing results from each sample showed 99% similarity with haemolysin gene sequence in Genebank. Furthermore, the sequence of V. harveyi MR5339 haemolysin gene was used to design the nested PCR primers. The first primer pairs of nested PCR have successfully amplified the haemolysin gene fragment of all V. harveyi strains samples from position 52 to 405. The second primer pairs of nested PCR have amplified position 204 to 405 where it can detect all of V. harveyi strains used as sample sources in this study. The application of nested PCR technique in this study was able to identify V. harveyi strains at serial dilution of cells density as low as 100 cfu/mL, which is equal to a single cell or at DNA concentration up to 101 fg/µL.

  10. Sexing birds using random amplified polymorphic DNA (RAPD) markers

    NARCIS (Netherlands)

    Lessells, C.M.; Mateman, A.C.

    1998-01-01

    We used random amplified polymorphic DNA (RAPD) markers to sex birds from small tissue (usually blood) samples. Arbitrarily chosen 10-mer PCR primers were screened with DNA from known-sex individuals for the production of a bright female-specific band. Suitable primers were found for seven bird spec

  11. Multiplexing Short Primers for Viral Family PCR

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  12. Establishment of Quantitative Analysis Method for Genetically Modified Maize Using a Reference Plasmid and Novel Primers

    Science.gov (United States)

    Moon, Gi-Seong; Shin, Weon-Sun

    2012-01-01

    For the quantitative analysis of genetically modified (GM) maize in processed foods, primer sets and probes based on the 35S promoter (p35S), nopaline synthase terminator (tNOS), p35S-hsp70 intron, and zSSIIb gene encoding starch synthase II for intrinsic control were designed. Polymerase chain reaction (PCR) products (80~101 bp) were specifically amplified and the primer sets targeting the smaller regions (80 or 81 bp) were more sensitive than those targeting the larger regions (94 or 101 bp). Particularly, the primer set 35F1-R1 for p35S targeting 81 bp of sequence was even more sensitive than that targeting 101 bp of sequence by a 3-log scale. The target DNA fragments were also specifically amplified from all GM labeled food samples except for one item we tested when 35F1-R1 primer set was applied. A reference plasmid pGMmaize (3 kb) including the smaller PCR products for p35S, tNOS, p35S-hsp70 intron, and the zSSIIb gene was constructed for real-time PCR (RT-PCR). The linearity of standard curves was confirmed by using diluents ranging from 2×101~105 copies of pGMmaize and the R2 values ranged from 0.999~1.000. In the RT-PCR, the detection limit using the novel primer/probe sets was 5 pg of genomic DNA from MON810 line indicating that the primer sets targeting the smaller regions (80 or 81 bp) could be used for highly sensitive detection of foreign DNA fragments from GM maize in processed foods. PMID:24471096

  13. "YFlag"--a single-base extension primer based method for gender determination.

    Science.gov (United States)

    Allwood, Julia S; Harbison, Sally Ann

    2015-01-01

    Assigning the gender of a DNA contributor in forensic analysis is typically achieved using the amelogenin test. Occasionally, this test produces false-positive results due to deletions occurring on the Y chromosome. Here, a four-marker "YFlag" method is presented to infer gender using single-base extension primers to flag the presence (or absence) of Y-chromosome DNA within a sample to supplement forensic STR profiling. This method offers built-in redundancy, with a single marker being sufficient to detect the presence of male DNA. In a study using 30 male and 30 female individuals, detection of male DNA was achieved with c. 0.03 ng of male DNA. All four markers were present in male/female mixture samples despite the presence of excessive female DNA. In summary, the YFlag system offers a method that is reproducible, specific, and sensitive, making it suitable for forensic use to detect male DNA. PMID:25354446

  14. A primer on physical-layer network coding

    CERN Document Server

    Liew, Soung Chang; Zhang, Shengli

    2015-01-01

    The concept of physical-layer network coding (PNC) was proposed in 2006 for application in wireless networks. Since then it has developed into a subfield of communications and networking with a wide following. This book is a primer on PNC. It is the outcome of a set of lecture notes for a course for beginning graduate students at The Chinese University of Hong Kong. The target audience is expected to have some prior background knowledge in communication theory and wireless communications, but not working knowledge at the research level. Indeed, a goal of this book/course is to allow the reader

  15. PCR primers for 30 novel gene regions in the nuclear genomes of Lepidoptera

    OpenAIRE

    Wahlberg, Niklas; Peña, Carlos; Ahola,Milla; Wheat, Christopher W; Rota, Jadranka

    2016-01-01

    We report primer pairs for 30 new gene regions in the nuclear genomes of Lepidoptera that can be amplified using a standard PCR protocol. The new primers were tested across diverse Lepidoptera, including nonditrysians and a wide selection of ditrysians. These new gene regions give a total of 11,043 bp of DNA sequence data and they show similar variability to traditionally used nuclear gene regions in studies of Lepidoptera. We feel that a PCR-based approach still has its place in molecular sy...

  16. Canadian municipal carbon trading primer

    International Nuclear Information System (INIS)

    The trading of greenhouse gas (GHG) emissions is being suggested as an effective economic way to meet Canada's Kyoto target. Emissions trading is a market-based instrument that can help achieve environmental improvements while using the market to absorb the economical and effective measures to achieve emissions reductions. Placing a value on emissions means that in order to minimize costs, companies will be motivated to apply the lowest-cost emission reductions possible for regulatory approval. The two main types of emissions trading that exist in Canada are the trading of emissions that lead to the formation of smog or acid rain, and the trading of greenhouse gas emissions that lead to climate change. Since carbon dioxide is the most prevalent GHG, making up approximately 75 per cent of Canadian GHG emissions, the trading of units of GHGs is often referred to as carbon trading. The impact that emissions trading will have on municipal operations was the focus of this primer. The trading of GHG involves buying and selling of allowances of GHGs between contracting parties, usually between one party that is short of GHG credits and another that has excess credits. The 3 common approaches to emissions trading include allowance trading (cap and trade), credit trading (baseline and credit), and a hybrid system which combines both credit and allowance trading systems. The issues that impact municipalities include the debate regarding who owns the credits from landfills, particularly if power is generated using landfill gas and the power is sold as green power. Other viable questions were also addressed, including who can claim emission reduction credits if a city implements energy efficiency projects, or fuel substitution programs. Also, will municipalities be allowed to trade internationally, for example, with municipalities in the United States, and how should they spend their money earned from selling credits. This report also presents highlights from 3 emissions

  17. Diamondoid-modified DNA

    OpenAIRE

    Wang, Yan; Tkachenko, Boryslav A.; Schreiner, Peter R.; Marx, Andreas

    2011-01-01

    We prepared novel C5-modified triphosphates and phosphoramidites with a diamondoid functionally linked to the nucleobase. Using primer extension experiments with different length templates we investigated whether the modified triphosphates were enzymatically incorporated into DNA and whether they were further extended. We found that all three modified nucleotides can be incorporated into DNA using a single-nucleotide incorporation experiment, but only partially using two templates that demand...

  18. Identification and DNA fingerprinting of Legionella strains by randomly amplified polymorphic DNA analysis.

    OpenAIRE

    Bansal, N S; McDonell, F

    1997-01-01

    The randomly amplified polymorphic DNA (RAPD) technique was used in the development of a fingerprinting (typing) and identification protocol for Legionella strains. Twenty decamer random oligonucleotide primers were screened for their discriminatory abilities. Two candidate primers were selected. By using a combination of these primers, RAPD analysis allowed for the differentiation between all different species, between the serogroups, and further differentiation between subtypes of the same ...

  19. Beam shaping for laser initiated optical primers

    Science.gov (United States)

    Lizotte, Todd E.

    2008-08-01

    Remington was one of the first firearm manufacturing companies to file a patent for laser initiated firearms, in 1969. Nearly 40 years later, the development of laser initiated firearms has not become a mainstream technology in the civilian market. Requiring a battery is definitely a short coming, so it is easy to see how such a concept would be problematic. Having a firearm operate reliably and the delivery of laser energy in an efficient manner to ignite the shock-sensitive explosive primer mixtures is a tall task indeed. There has been considerable research on optical element based methods of transferring or compressing laser energy to ignite primer charges, including windows, laser chip primers and various lens shaped windows to focus the laser energy. The focusing of laser light needs to achieve igniting temperatures upwards of >400°C. Many of the patent filings covering this type of technology discuss simple approaches where a single point of light might be sufficient to perform this task. Alternatively a multi-point method might provide better performance, especially for mission critical applications, such as precision military firearms. This paper covers initial design and performance test of the laser beam shaping optics to create simultaneous multiple point ignition locations and a circumferential intense ring for igniting primer charge compounds. A simple initial test of the ring beam shaping technique was evaluated on a standard large caliber primer to determine its effectiveness on igniting the primer material. Several tests were conducted to gauge the feasibility of laser beam shaping, including optic fabrication and mounting on a cartridge, optic durability and functional ignition performance. Initial data will be presented, including testing of optically elements and empirical primer ignition / burn analysis.

  20. New primers for detecting and quantifying denitrifying anaerobic methane oxidation archaea in different ecological niches.

    Science.gov (United States)

    Ding, Jing; Ding, Zhao-Wei; Fu, Liang; Lu, Yong-Ze; Cheng, Shuk H; Zeng, Raymond J

    2015-11-01

    The significance of ANME-2d in methane sink in the environment has been overlooked, and there was no any study evaluating the distribution of ANME-2d in the environment. New primers were thus needed to be designed for following research. In this paper, a pair of primers (DP397F and DP569R) was designed to quantify ANME-2d. The specificity and amplification efficiency of this primer pair were acceptable. PCR amplification of another pair of primers (DP142F and DP779R) generated a single, bright targeted band from the enrichment sample, but yielded faint, multiple bands from the environmental samples. Nested PCR was conducted using the primers DP142F/DP779R in the first round and DP142F/DP569R in the second round, which generated a bright targeted band. Further phylogenetic analysis showed that these targeted bands were ANME-2d-related sequences. Real-time PCR showed that the copies of the 16s ribosomal RNA gene of ANME-2d in these samples ranged from 3.72 × 10(4) to 2.30 × 10(5) copies μg(-1) DNA, indicating that the percentage of ANME-2d was greatest in a polluted river sample and least in a rice paddy sample. These results demonstrate that the newly developed real-time PCR primers could sufficiently quantify ANME-2d and that nested PCR with an appropriate combination of the new primers could successfully detect ANME-2d in environmental samples; the latter finding suggests that ANME-2d may spread in environments. PMID:26300291

  1. Climate Change, Health, and Communication: A Primer.

    Science.gov (United States)

    Chadwick, Amy E

    2016-06-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects. PMID:26580230

  2. Bioelectronic DNA detection of human papillomaviruses using eSensor™: a model system for detection of multiple pathogens

    Directory of Open Access Journals (Sweden)

    Miller Donna L

    2003-06-01

    Full Text Available Abstract Background We used human papillomaviruses (HPV as a model system to evaluate the utility of a nucleic acid, hybridization-based bioelectronic DNA detection platform (eSensor™ in identifying multiple pathogens. Methods Two chips were spotted with capture probes consisting of DNA oligonucleotide sequences specific for HPV types. Electrically conductive signal probes were synthesized to be complementary to a distinct region of the amplified HPV target DNA. A portion of the HPV L1 region that was amplified by using consensus primers served as target DNA. The amplified target was mixed with a cocktail of signal probes and added to a cartridge containing a DNA chip to allow for hybridization with complementary capture probes. Results Two bioelectric chips were designed and successfully detected 86% of the HPV types contained in clinical samples. Conclusions This model system demonstrates the potential of the eSensor platform for rapid and integrated detection of multiple pathogens.

  3. Enzymes involved in organellar DNA replication in photosynthetic eukaryotes

    OpenAIRE

    Moriyama, Takashi; Sato, Naoki

    2014-01-01

    Plastids and mitochondria possess their own genomes. Although the replication mechanisms of these organellar genomes remain unclear in photosynthetic eukaryotes, several organelle-localized enzymes related to genome replication, including DNA polymerase, DNA primase, DNA helicase, DNA topoisomerase, single-stranded DNA maintenance protein, DNA ligase, primer removal enzyme, and several DNA recombination-related enzymes, have been identified. In the reference Eudicot plant Arabidopsis thaliana...

  4. Development of Specific Primer for Tricholoma matsutake

    OpenAIRE

    Kim, Jang-Han; Han, Yeong-Hwan

    2009-01-01

    In this study, in an effort to develop a method for the molecular detection of Tricholoma matsutake in Korea from other closely related Tricholomataceae, a species-specific PCR primer pair, TmF and TmR, was designed using nuclear ribosomal intertranscribed spacer (ITS) sequences. The DTmF and DTmR sequences were 5'-CCTGACGCCAATCTTTTCA-3' and 5'-GGAGAGCAGACTTGTGAGCA-3', respectively. The PCR primers reliably amplified only the ITS sequences of T. matsutake, and not those of other species used ...

  5. Microsatellite primers for fungus-growing ants

    DEFF Research Database (Denmark)

    Villesen, Palle; Gertsch, P J; Boomsma, JJ

    2002-01-01

    developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants.......We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...

  6. Microsatellite Primers for Fungus-Growing Ants

    DEFF Research Database (Denmark)

    Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

    2002-01-01

    developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants.......We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...

  7. Single-Copy Nuclear Gene Primers for Streptanthus and Other Brassicaceae from Genomic Scans, Published Data, and ESTs

    Directory of Open Access Journals (Sweden)

    N. Ivalú Cacho

    2013-07-01

    Full Text Available Premise of the study: We report 11 primer sets for nine single-copy nuclear genes in Streptanthus and other Thelypodieae (Brassicaceae and their utility at tribal-level and species-level phylogenetics in this poorly resolved group. Methods and Results: We selected regions based on a cross-referenced matrix of previous studies and public Brassica expressed sequence tags. To design primers, we used alignments of low-depth-coverage Illumina sequencing of genomic DNA for two species of Brassica mapped onto Arabidopsis thaliana. We report several primer combinations for five regions that consistently amplified a single band and yielded high-quality sequences for at least 70% of the species assayed, and for four additional regions whose utility might be clade specific. Conclusions: Our primers will be useful in improving resolution at shallow depths across the Thelypodieae, and likely in other Brassicaceae.

  8. Document image analysis: A primer

    Indian Academy of Sciences (India)

    Rangachar Kasturi; Lawrence O’Gorman; Venu Govindaraju

    2002-02-01

    Document image analysis refers to algorithms and techniques that are applied to images of documents to obtain a computer-readable description from pixel data. A well-known document image analysis product is the Optical Character Recognition (OCR) software that recognizes characters in a scanned document. OCR makes it possible for the user to edit or search the document’s contents. In this paper we briefly describe various components of a document analysis system. Many of these basic building blocks are found in most document analysis systems, irrespective of the particular domain or language to which they are applied. We hope that this paper will help the reader by providing the background necessary to understand the detailed descriptions of specific techniques presented in other papers in this issue.

  9. Geothermal district piping - A primer

    Energy Technology Data Exchange (ETDEWEB)

    Rafferty, K.

    1989-11-01

    Transmission and distribution piping constitutes approximately 40 -60% of the capital costs of typical geothermal district heating systems. Selections of economical piping suitable for the fluid chemistry is critical. Presently, most piping (56%) in geothermal systems is of asbestos cement construction. Some fiberglass (19%) and steel (19%) is also in use. Identification of an economical material to replace asbestos cement is important to future project development. By providing information on relative costs, purchase considerations, existing material performance and new products, this report seeks to provide a background of information to the potential pipe purchaser. A brief discussion of the use of uninsulated piping in geothermal district heating systems is also provided. 5 refs., 19 figs., 1 tab.

  10. Simple method for production of internal control DNA for Mycobacterium tuberculosis polymerase chain reaction assays.

    OpenAIRE

    Dewit, D.; Wootton, M.; Allan, B; Steyn, L

    1993-01-01

    A simple method for the production of internal control DNA for two well-established Mycobacterium tuberculosis polymerase chain reaction assays is described. The internal controls were produced from Mycobacterium kansasii DNA with the same primers but at a lower annealing temperature than that used in the standard assays. In both assays, therefore, the internal control DNA has the same primer-binding sequences at the target DNA. One-microgram quantities of internal control DNA which was not c...

  11. Reliable allele detection using SNP-based PCR primers containing Locked Nucleic Acid: application in genetic mapping

    Directory of Open Access Journals (Sweden)

    Trognitz Friederike

    2007-02-01

    Full Text Available Abstract Background The diploid, Solanum caripense, a wild relative of potato and tomato, possesses valuable resistance to potato late blight and we are interested in the genetic base of this resistance. Due to extremely low levels of genetic variation within the S. caripense genome it proved impossible to generate a dense genetic map and to assign individual Solanum chromosomes through the use of conventional chromosome-specific SSR, RFLP, AFLP, as well as gene- or locus-specific markers. The ease of detection of DNA polymorphisms depends on both frequency and form of sequence variation. The narrow genetic background of close relatives and inbreds complicates the detection of persisting, reduced polymorphism and is a challenge to the development of reliable molecular markers. Nonetheless, monomorphic DNA fragments representing not directly usable conventional markers can contain considerable variation at the level of single nucleotide polymorphisms (SNPs. This can be used for the design of allele-specific molecular markers. The reproducible detection of allele-specific markers based on SNPs has been a technical challenge. Results We present a fast and cost-effective protocol for the detection of allele-specific SNPs by applying Sequence Polymorphism-Derived (SPD markers. These markers proved highly efficient for fingerprinting of individuals possessing a homogeneous genetic background. SPD markers are obtained from within non-informative, conventional molecular marker fragments that are screened for SNPs to design allele-specific PCR primers. The method makes use of primers containing a single, 3'-terminal Locked Nucleic Acid (LNA base. We demonstrate the applicability of the technique by successful genetic mapping of allele-specific SNP markers derived from monomorphic Conserved Ortholog Set II (COSII markers mapped to Solanum chromosomes, in S. caripense. By using SPD markers it was possible for the first time to map the S. caripense alleles

  12. A high-throughput method for detection of DNA in chloroplasts using flow cytometry

    Directory of Open Access Journals (Sweden)

    Oldenburg Delene J

    2007-03-01

    Full Text Available Abstract Background The amount of DNA in the chloroplasts of some plant species has been shown recently to decline dramatically during leaf development. A high-throughput method of DNA detection in chloroplasts is now needed in order to facilitate the further investigation of this process using large numbers of tissue samples. Results The DNA-binding fluorophores 4',6-diamidino-2-phenylindole (DAPI, SYBR Green I (SG, SYTO 42, and SYTO 45 were assessed for their utility in flow cytometric analysis of DNA in Arabidopsis chloroplasts. Fluorescence microscopy and real-time quantitative PCR (qPCR were used to validate flow cytometry data. We found neither DAPI nor SYTO 45 suitable for flow cytometric analysis of chloroplast DNA (cpDNA content, but did find changes in cpDNA content during development by flow cytometry using SG and SYTO 42. The latter dye provided more sensitive detection, and the results were similar to those from the fluorescence microscopic analysis. Differences in SYTO 42 fluorescence were found to correlate with differences in cpDNA content as determined by qPCR using three primer sets widely spaced across the chloroplast genome, suggesting that the whole genome undergoes copy number reduction during development, rather than selective reduction/degradation of subgenomic regions. Conclusion Flow cytometric analysis of chloroplasts stained with SYTO 42 is a high-throughput method suitable for determining changes in cpDNA content during development and for sorting chloroplasts on the basis of DNA content.

  13. The effect of multiple primer-template mismatches on quantitative PCR accuracy and development of a multi-primer set assay for accurate quantification of pcrA gene sequence variants.

    Science.gov (United States)

    Ledeker, Brett M; De Long, Susan K

    2013-09-01

    Quantitative PCR (qPCR) is a critical tool for quantifying the abundance of specific organisms and the level or expression of target genes in medically and environmentally relevant systems. However, often the power of this tool has been limited because primer-template mismatches, due to sequence variations of targeted genes, can lead to inaccuracies in measured gene quantities, detection failures, and spurious conclusions. Currently available primer design guidelines for qPCR were developed for pure culture applications, and available primer design strategies for mixed cultures were developed for detection rather than accurate quantification. Furthermore, past studies examining the impact of mismatches have focused only on single mismatches while instances of multiple mismatches are common. There are currently no appropriate solutions to overcome the challenges posed by sequence variations. Here, we report results that provide a comprehensive, quantitative understanding of the impact of multiple primer-template mismatches on qPCR accuracy and demonstrate a multi-primer set approach to accurately quantify a model gene pcrA (encoding perchlorate reductase) that has substantial sequence variation. Results showed that for multiple mismatches (up to 3 mismatches) in primer regions where mismatches were previously considered tolerable (middle and 5' end), quantification accuracies could be as low as ~0.1%. Furthermore, tests were run using a published pcrA primer set with mixtures of genomic DNA from strains known to harbor the target gene, and for some mixtures quantification accuracy was as low as ~0.8% or was non-detect. To overcome these limitations, a multiple primer set assay including minimal degeneracies was developed for pcrA genes. This assay resulted in nearly 100% accurate detection for all mixed microbial communities tested. The multi-primer set approach demonstrated herein can be broadly applied to other genes with known sequences. PMID:23806694

  14. Primer Design Assistant (PDA): a web-based primer design tool

    OpenAIRE

    Chen, S. H.; Lin, C. Y.; Cho, C.S.; Lo, C.Z.; Hsiung, C. A.

    2003-01-01

    Primer Design Assistant (PDA) is a web interface primer design service combined with thermodynamic theory to evaluate the fitness of primers. It runs in a Linux–Apache–MySQL–PHP structure on a PC equipped with dual CPU (Intel Pentium III 1.4 GHz) and 512 Mb of RAM. A succinct user interface of PDA is accomplished by built-in parameters setting. Advanced options on 5′ GC content, 3′ GC content, dimer check and hairpin check are available. The option of covered region constrains the PCR product...

  15. DNA fusion gene vaccines

    DEFF Research Database (Denmark)

    Holst, Peter Johannes; Bassi, Maria Rosaria; Thomsen, Allan Randrup;

    2010-01-01

    DNA vaccines are versatile and safe, but limited immunogenicity has prevented their use in the clinical setting. Experimentally, immunogenicity may be enhanced by the use of new delivery technologies, by coadministration of cytokines and pathogen-associated molecular patterns, or by fusion...... with these modifications, it is likely that the primary use of DNA vaccines may be as primers for viral-vectored vaccines, rather than as single agents. This review discusses the approaches used to enhance DNA vaccine immunogenicity, with a primary focus on fusion strategies that enhance antigen presentation....

  16. Forest Interpreter's Primer on Fire Management.

    Science.gov (United States)

    Zelker, Thomas M.

    Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

  17. Scrimer: designing primers from transcriptome data

    Czech Academy of Sciences Publication Activity Database

    Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.

    2015-01-01

    Roč. 15, č. 6 (2015), s. 1415-1420. ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.712, year: 2014

  18. Loop-Mediated Amplification Accelerated by Stem Primers

    Directory of Open Access Journals (Sweden)

    Laurence Tisi

    2011-12-01

    Full Text Available Isothermal nucleic acid amplifications (iNAATs have become an important alternative to PCR for in vitro molecular diagnostics in all fields. Amongst iNAATs Loop-mediated amplification (LAMP has gained much attention over the last decade because of the simplicity of hardware requirements. LAMP demonstrates performance equivalent to that of PCR, but its application has been limited by the challenging primer design. The design of six primers in LAMP requires a selection of eight priming sites with significant restrictions imposed on their respective positioning and orientation. In order to relieve primer design constraints we propose an alternative approach which uses Stem primers instead of Loop primers and demonstrate the application of STEM-LAMP in assaying for Clostridium difficile, Listeria monocytogenes and HIV. Stem primers used in LAMP in combination with loop-generating and displacement primers gave significant benefits in speed and sensitivity, similar to those offered by Loop primers, while offering additional options of forward and reverse orientations, multiplexing, use in conjunction with Loop primers or even omission of one or two displacement primers, where necessary. Stem primers represent a valuable alternative to Loop primers and an additional tool for IVD assay development by offering more choices for primer design at the same time increasing assay speed, sensitivity, and reproducibility.

  19. Loop-mediated amplification accelerated by stem primers.

    Science.gov (United States)

    Gandelman, Olga; Jackson, Rebecca; Kiddle, Guy; Tisi, Laurence

    2011-01-01

    Isothermal nucleic acid amplifications (iNAATs) have become an important alternative to PCR for in vitro molecular diagnostics in all fields. Amongst iNAATs Loop-mediated amplification (LAMP) has gained much attention over the last decade because of the simplicity of hardware requirements. LAMP demonstrates performance equivalent to that of PCR, but its application has been limited by the challenging primer design. The design of six primers in LAMP requires a selection of eight priming sites with significant restrictions imposed on their respective positioning and orientation. In order to relieve primer design constraints we propose an alternative approach which uses Stem primers instead of Loop primers and demonstrate the application of STEM-LAMP in assaying for Clostridium difficile, Listeria monocytogenes and HIV. Stem primers used in LAMP in combination with loop-generating and displacement primers gave significant benefits in speed and sensitivity, similar to those offered by Loop primers, while offering additional options of forward and reverse orientations, multiplexing, use in conjunction with Loop primers or even omission of one or two displacement primers, where necessary. Stem primers represent a valuable alternative to Loop primers and an additional tool for IVD assay development by offering more choices for primer design at the same time increasing assay speed, sensitivity, and reproducibility. PMID:22272122

  20. Criticality calculations with MCNP trademark: A primer

    International Nuclear Information System (INIS)

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand

  1. Rust transformation/rust compatible primers

    Science.gov (United States)

    Emeric, Dario A.; Miller, Christopher E.

    1993-01-01

    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  2. Caries inhibition by fluoride-releasing primers.

    Science.gov (United States)

    Kerber, L J; Donly, K J

    1993-10-01

    This study evaluated the caries inhibition of dentin primers with the addition of fluoride. Two standardized Class V preparations were placed in 20 molars, the gingival margin placed below the cementoenamel junction and the occlusal margin placed in enamel. Two dentin primers (Syntac and ScotchPrep) were placed in equal numbers of 20 preparations, according to manufacturer's instructions. Ammonium fluoride (10% by weight) was then added to these primers and they were placed in the remaining 20 preparations, opposing the non-fluoridated primer of the same system. All teeth were then restored with a non-fluoridated resin composite. All teeth were subjected to an artificial caries challenge (pH 4.2) for 5 days. Sections of 100 microns were obtained, photographed under polarized light microscopy, then demineralized areas were quantitated by digitization. Results demonstrated the mean areas (mm2 +/- S.D.) demineralization at 0.25 mm, 0.5 mm and 1.0 mm from the restoration margin to be: Syntac/fluoride (1.44 +/- 0.49, 1.68 +/- 0.54, 3.72 +/- 0.74); Syntac (1.99 +/- 0.58, 1.50 +/- 0.35, 2.98 +/- 1.26); ScotchPrep/fluoride (1.23 +/- 0.68, 1.55 +/- 0.64, 3.08 +/- 1.16); ScotchPrep (1.90 +/- 0.83, 1.71 +/- .038, 3.36 +/- 0.62). A paired t-test indicated primers with fluoride to demonstrate significantly less demineralization 0.25 mm from the restoration margin (P < 0.07). PMID:7880460

  3. Hot Start PCR with heat-activatable primers: a novel approach for improved PCR performance

    OpenAIRE

    Lebedev, Alexandre V.; Paul, Natasha; Yee, Joyclyn; Timoshchuk, Victor A.; Shum, Jonathan; Miyagi, Kei; Kellum, Jack; Hogrefe, Richard I.; Zon, Gerald

    2008-01-01

    The polymerase chain reaction (PCR) is widely used for applications which require a high level of specificity and reliability, such as genetic testing, clinical diagnostics, blood screening, forensics and biodefense. Great improvements to PCR performance have been achieved by the use of Hot Start activation strategies that aim to prevent DNA polymerase extension until more stringent, higher temperatures are reached. Herein we present a novel Hot Start activation approach in PCR where primers ...

  4. Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: xingda@scnu.edu.cn [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)

    2013-01-25

    Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs-TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: Black-Right-Pointing-Pointer A novel method for detection of rotavirus has been developed. Black-Right-Pointing-Pointer In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. Black-Right-Pointing-Pointer To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. Black-Right-Pointing-Pointer The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2 Prime -bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection

  5. Influence of commonly used primer systems on automated ribosomal intergenic spacer analysis of bacterial communities in environmental samples.

    Science.gov (United States)

    Purahong, Witoon; Stempfhuber, Barbara; Lentendu, Guillaume; Francioli, Davide; Reitz, Thomas; Buscot, François; Schloter, Michael; Krüger, Dirk

    2015-01-01

    Due to the high diversity of bacteria in many ecosystems, their slow generation times, specific but mostly unknown nutrient requirements and syntrophic interactions, isolation based approaches in microbial ecology mostly fail to describe microbial community structure. Thus, cultivation independent techniques, which rely on directly extracted nucleic acids from the environment, are a well-used alternative. For example, bacterial automated ribosomal intergenic spacer analysis (B-ARISA) is one of the widely used methods for fingerprinting bacterial communities after PCR-based amplification of selected regions of the operon coding for rRNA genes using community DNA. However, B-ARISA alone does not provide any taxonomic information and the results may be severely biased in relation to the primer set selection. Furthermore, amplified DNA stemming from mitochondrial or chloroplast templates might strongly bias the obtained fingerprints. In this study, we determined the applicability of three different B-ARISA primer sets to the study of bacterial communities. The results from in silico analysis harnessing publicly available sequence databases showed that all three primer sets tested are specific to bacteria but only two primers sets assure high bacterial taxa coverage (1406f/23Sr and ITSF/ITSReub). Considering the study of bacteria in a plant interface, the primer set ITSF/ITSReub was found to amplify (in silico) sequences of some important crop species such as Sorghum bicolor and Zea mays. Bacterial genera and plant species potentially amplified by different primer sets are given. These data were confirmed when DNA extracted from soil and plant samples were analyzed. The presented information could be useful when interpreting existing B-ARISA results and planning B-ARISA experiments, especially when plant DNA can be expected. PMID:25749323

  6. Influence of commonly used primer systems on automated ribosomal intergenic spacer analysis of bacterial communities in environmental samples.

    Directory of Open Access Journals (Sweden)

    Witoon Purahong

    Full Text Available Due to the high diversity of bacteria in many ecosystems, their slow generation times, specific but mostly unknown nutrient requirements and syntrophic interactions, isolation based approaches in microbial ecology mostly fail to describe microbial community structure. Thus, cultivation independent techniques, which rely on directly extracted nucleic acids from the environment, are a well-used alternative. For example, bacterial automated ribosomal intergenic spacer analysis (B-ARISA is one of the widely used methods for fingerprinting bacterial communities after PCR-based amplification of selected regions of the operon coding for rRNA genes using community DNA. However, B-ARISA alone does not provide any taxonomic information and the results may be severely biased in relation to the primer set selection. Furthermore, amplified DNA stemming from mitochondrial or chloroplast templates might strongly bias the obtained fingerprints. In this study, we determined the applicability of three different B-ARISA primer sets to the study of bacterial communities. The results from in silico analysis harnessing publicly available sequence databases showed that all three primer sets tested are specific to bacteria but only two primers sets assure high bacterial taxa coverage (1406f/23Sr and ITSF/ITSReub. Considering the study of bacteria in a plant interface, the primer set ITSF/ITSReub was found to amplify (in silico sequences of some important crop species such as Sorghum bicolor and Zea mays. Bacterial genera and plant species potentially amplified by different primer sets are given. These data were confirmed when DNA extracted from soil and plant samples were analyzed. The presented information could be useful when interpreting existing B-ARISA results and planning B-ARISA experiments, especially when plant DNA can be expected.

  7. Application of PCR amplicon sequencing using a single primer pair in PCR amplification to assess variations in Helicobacter pylori CagA EPIYA tyrosine phosphorylation motifs

    Directory of Open Access Journals (Sweden)

    Karlsson Anneli

    2010-02-01

    Full Text Available Abstract Background The presence of various EPIYA tyrosine phosphorylation motifs in the CagA protein of Helicobacter pylori has been suggested to contribute to pathogenesis in adults. In this study, a unique PCR assay and sequencing strategy was developed to establish the number and variation of cagA EPIYA motifs. Findings MDA-DNA derived from gastric biopsy specimens from eleven subjects with gastritis was used with M13- and T7-sequence-tagged primers for amplification of the cagA EPIYA motif region. Automated capillary electrophoresis using a high resolution kit and amplicon sequencing confirmed variations in the cagA EPIYA motif region. In nine cases, sequencing revealed the presence of AB, ABC, or ABCC (Western type cagA EPIYA motif, respectively. In two cases, double cagA EPIYA motifs were detected (ABC/ABCC or ABC/AB, indicating the presence of two H. pylori strains in the same biopsy. Conclusion Automated capillary electrophoresis and Amplicon sequencing using a single, M13- and T7-sequence-tagged primer pair in PCR amplification enabled a rapid molecular typing of cagA EPIYA motifs. Moreover, the techniques described allowed for a rapid detection of mixed H. pylori strains present in the same biopsy specimen.

  8. DNA fingerprinting of safflower irradiation induced mutants by RAPD markers

    International Nuclear Information System (INIS)

    RAPD markers were utilized to identify the genetic differences and the genetic relationship between 8 safflower genotypes i.e. seven induced mutants namely Mut 1 H, Mut 2 H2 , Mut3, Mut4, Mut 5 , Mut6, Mut 7 and the parental variety Giza 1. Ten arbitrary primers were used; different primers generated polymorphic RAPD profiles. The number of amplified DNA amplicons across the ten primers ranged from seven amplicons for the primer OBC-18 to 17 amplicons for the primersOPA-03 and OPA-04. However the number of polymorphic amplicons ranged from 1 for the primer OPB-3 to 14 amplicons for the primers OPA-03 and OPA-17. The percentage of polymorphism ranged from 9.09 % for the primer OPB- 03 to 100% for the primer OPC-17.The highest genetic similarity (94%) was found between Mut 4 and Mut 7 and the lowest (79.0%) was found between Mut 1 and Giza 1. Seventeen positive and four negative unique RAPD markers were identified across the 8 safflower genotypes. The parent Giza 1 was characterized by one positive unique marker amplified by OPA-03 primer at the molecular weight of 2000 bp as well as, two negative unique markers generated by the OPB-6 and OPB-5 primers at the molecular weights of 1150 and 800 bp., respectively. The mutant 1 showed highest number of positive unique markers (8) generated by OPA-3 primer at the molecular weights of 1400, 800 ,700 and 600 bp, OPB-04 at the molecular weight 2000 bp., OPB-06 primers at the molecular weight of 900 bp., OPB-05 primer at the molecular weight of 500 bp., and OPA-04 primer at the molecular weight of 600 bp. Mut 2 was identified by two positive unique markers generated by the OPB-05 and OPA-03 primers at the molecular weights of 1500 and 500 bp respectively, However the Mut 3 was characterized by one positive unique marker amplified by OPC-17 primer at the molecular weight 550 bp., there is no unique number was found to characterize the mutant 4. The Mut 5 identified by one positive uniquemarker generated by OPA-04 Primer at the

  9. Demystifying eResearch a primer for librarians

    CERN Document Server

    Martin, Victoria

    2014-01-01

    Today's librarians need to be technology-savvy information experts who understand how to manage datasets. Demystifying eResearch: A Primer for Librarians prepares librarians for careers that involve eResearch, clearly defining what it is and how it impacts library services and collections, explaining key terms and concepts, and explaining the importance of the field. You will come to understand exactly how the use of networked computing technologies enhances and supports collaboration and innovative methods particularly in scientific research, learn about eResearch library initiatives and best practices, and recognize the professional development opportunities that eResearch offers. This book takes the broad approach to the complex topic of eResearch and how it pertains to the library community, providing an introduction that will be accessible to readers without a background in electronic research. The author presents a conceptual overview of eResearch with real-world examples of electronic research activit...

  10. Monte Carlo primer for health physicists

    International Nuclear Information System (INIS)

    The basic ideas and principles of Monte Carlo calculations are presented in the form of a primer for health physicists. A simple integral with a known answer is evaluated by two different Monte Carlo approaches. Random number, which underlie Monte Carlo work, are discussed, and a sample table of random numbers generated by a hand calculator is presented. Monte Carlo calculations of dose and linear energy transfer (LET) from 100-keV neutrons incident on a tissue slab are discussed. The random-number table is used in a hand calculation of the initial sequence of events for a 100-keV neutron entering the slab. Some pitfalls in Monte Carlo work are described. While this primer addresses mainly the bare bones of Monte Carlo, a final section briefly describes some of the more sophisticated techniques used in practice to reduce variance and computing time

  11. Rapid Amplification of Plasmid and Phage DNA Using Phi29 DNA Polymerase and Multiply-Primed Rolling Circle Amplification

    OpenAIRE

    Dean, Frank B.; Nelson, John R.; Giesler, Theresa L.; Lasken, Roger S.

    2001-01-01

    We describe a simple method of using rolling circle amplification to amplify vector DNA such as M13 or plasmid DNA from single colonies or plaques. Using random primers and φ29 DNA polymerase, circular DNA templates can be amplified 10,000-fold in a few hours. This procedure removes the need for lengthy growth periods and traditional DNA isolation methods. Reaction products can be used directly for DNA sequencing after phosphatase treatment to inactivate unincorporated nucleotides. Amplified ...

  12. A primer for criticality calculations with DANTSYS

    Energy Technology Data Exchange (ETDEWEB)

    Busch, R.D. [Univ. of New Mexico, Albuquerque, NM (United States). Nuclear Criticality Safety Group

    1997-08-01

    With the closure of many experimental facilities, the nuclear safety analyst has to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. Although deterministic methods often do not provide exact models of a system, a substantial amount of reliable information on nuclear systems can be obtained using these methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico (UNM) in cooperation with the Radiation Transport Group at Los Alamos National Laboratory (LANL) has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. DANTSYS is the new name of the group of codes formerly known as: ONEDANT, TWODANT, TWOHEX, TWOGQ, and THREEDANT. The primer is designed to teach bu example, with each example illustrating two or three DANTSYS features useful in criticality analyses. Starting with a Quickstart chapter, the primer gives an overview of the basic requirements for DANTSYS input and allows the user to quickly run a simple criticality problem with DANTSYS. Each chapter has a list of basic objectives at the beginning identifying the goal of the chapter and the individual DANTSYS features covered in detail in the chapter example problems. On completion of the primer, it is expected that the user will be comfortable doing criticality calculations with DANTSYS and can handle 60--80% of the situations that normally arise in a facility. The primary provides a set of input files that can be selective modified by the user to fit each particular problem.

  13. A primer for criticality calculations with DANTSYS

    International Nuclear Information System (INIS)

    With the closure of many experimental facilities, the nuclear safety analyst has to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. Although deterministic methods often do not provide exact models of a system, a substantial amount of reliable information on nuclear systems can be obtained using these methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico (UNM) in cooperation with the Radiation Transport Group at Los Alamos National Laboratory (LANL) has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. DANTSYS is the new name of the group of codes formerly known as: ONEDANT, TWODANT, TWOHEX, TWOGQ, and THREEDANT. The primer is designed to teach bu example, with each example illustrating two or three DANTSYS features useful in criticality analyses. Starting with a Quickstart chapter, the primer gives an overview of the basic requirements for DANTSYS input and allows the user to quickly run a simple criticality problem with DANTSYS. Each chapter has a list of basic objectives at the beginning identifying the goal of the chapter and the individual DANTSYS features covered in detail in the chapter example problems. On completion of the primer, it is expected that the user will be comfortable doing criticality calculations with DANTSYS and can handle 60--80% of the situations that normally arise in a facility. The primary provides a set of input files that can be selective modified by the user to fit each particular problem

  14. Book review: feminist research practice: a primer

    OpenAIRE

    Smith, Emma

    2013-01-01

    The fully revised and updated Second Edition of Feminist Research Practice: A Primer, edited by Sharlene Nagy Hesse-Biber, draws on the expertise of a wide group of interdisciplinary scholars who aim to cover cutting-edge research methods and explore research questions related to the complex and diverse issues that deeply impact women’s lives. Emma Smith finds that it will be valuable for academics already working from or looking to develop their understanding and use of feminist research pra...

  15. Primer for the algebraic geometry of sandpiles

    OpenAIRE

    Perkinson, David; Perlman, Jacob; Wilmes, John

    2011-01-01

    The Abelian Sandpile Model (ASM) is a game played on a graph realizing the dynamics implicit in the discrete Laplacian matrix of the graph. The purpose of this primer is to apply the theory of lattice ideals from algebraic geometry to the Laplacian matrix, drawing out connections with the ASM. An extended summary of the ASM and of the required algebraic geometry is provided. New results include a characterization of graphs whose Laplacian lattice ideals are complete intersection ideals; a new...

  16. Weathered Hydrocarbon Wastes: A Risk Management Primer

    OpenAIRE

    Brassington, Kirsty J.; Hough, Rupert L.; Paton, Graeme I.; Semple, Kirk T.; Risdon, Graeme C.; Crossley, Jane; Hay, I; Askari, K.; Pollard, Simon J. T.

    2007-01-01

    We provide a primer and critical review of the characterization, risk assessment, and bioremediation of weathered hydrocarbons. Historically the remediation of soil contaminated with petroleum hydrocarbons has been expressed in terms of reductions in total petroleum hydrocarbon (TPH) load rather than reductions in risk. There are several techniques by which petroleum hydrocarbons in soils can be characterized. Method development is often driven by the objectives of published...

  17. Removal of PCR error products and unincorporated primers by metal-chelate affinity chromatography.

    Directory of Open Access Journals (Sweden)

    Indhu Kanakaraj

    Full Text Available Immobilized Metal Affinity Chromatography (IMAC has been used for decades to purify proteins on the basis of amino acid content, especially surface-exposed histidines and "histidine tags" genetically added to recombinant proteins. We and others have extended the use of IMAC to purification of nucleic acids via interactions with the nucleotide bases, especially purines, of single-stranded RNA and DNA. We also have demonstrated the purification of plasmid DNA from contaminating genomic DNA by IMAC capture of selectively-denatured genomic DNA. Here we describe an efficient method of purifying PCR products by specifically removing error products, excess primers, and unincorporated dNTPs from PCR product mixtures using flow-through metal-chelate affinity adsorption. By flowing a PCR product mixture through a Cu(2+-iminodiacetic acid (IDA agarose spin column, 94-99% of the dNTPs and nearly all the primers can be removed. Many of the error products commonly formed by Taq polymerase also are removed. Sequencing of the IMAC-processed PCR product gave base-calling accuracy comparable to that obtained with a commercial PCR product purification method. The results show that IMAC matrices (specifically Cu(2+-IDA agarose can be used for the purification of PCR products. Due to the generality of the base-specific mechanism of adsorption, IMAC matrices may also be used in the purification of oligonucleotides, cDNA, mRNA and micro RNAs.

  18. Decreased mitochondrial DNA content in blood samples of patients with stage I breast cancer

    Directory of Open Access Journals (Sweden)

    Fokas Emmanouil

    2009-12-01

    Full Text Available Abstract Background Alterations of mitochondrial DNA (mtDNA have been implicated in carcinogenesis. We developed an accurate multiplex quantitative real-time PCR for synchronized determination of mtDNA and nuclear DNA (nDNA. We sought to investigate whether mtDNA content in the peripheral blood of breast cancer patients is associated with clinical and pathological parameters. Methods Peripheral blood samples were collected from 60 patients with breast cancer and 51 age-matched healthy individuals as control. DNA was extracted from peripheral blood for the quantification of mtDNA and nDNA, using a one-step multiplex real-time PCR. A FAM labeled MGB probe and primers were used to amplify the mtDNA sequence of the ATP 8 gene, and a VIC labeled MGB probe and primers were employed to amplify the glyceraldehyde-3-phosphate-dehydrogenase gene. mtDNA content was correlated with tumor stage, menstruation status, and age of patients as well as lymph node status and the expression of estrogen receptor (ER, progesterone receptor (PR and Her-2/neu protein. Results The content of mtDNA in stage I breast cancer patients was significantly lower than in other stages (overall P = 0.023. Reduced mtDNA was found often in post menopausal cancer group (P = 0.024. No difference in mtDNA content, in regards to age (p = 0.564, lymph node involvement (p = 0.673, ER (p = 0.877, PR (p = 0.763, and Her-2/neu expression (p = 0.335, was observed. Conclusion Early detection of breast cancer has proved difficult and current detection methods are inadequate. In the present study, decreased mtDNA content in the peripheral blood of patients with breast cancer was strongly associated with stage I. The use of mtDNA may have diagnostic value and further studies are required to validate it as a potential biomarker for early detection of breast cancer.

  19. Novel oligonucleotide primers reveal a high diversity of microbes which drive phosphorous turnover in soil.

    Science.gov (United States)

    Bergkemper, Fabian; Kublik, Susanne; Lang, Friederike; Krüger, Jaane; Vestergaard, Gisle; Schloter, Michael; Schulz, Stefanie

    2016-06-01

    Phosphorus (P) is of central importance for cellular life but likewise a limiting macronutrient in numerous environments. Certainly microorganisms have proven their ability to increase the phosphorus bioavailability by mineralization of organic-P and solubilization of inorganic-P. On the other hand they efficiently take up P and compete with other biota for phosphorus. However the actual microbial community that is associated to the turnover of this crucial macronutrient in different ecosystems remains largely anonymous especially taking effects of seasonality and spatial heterogeneity into account. In this study seven oligonucleotide primers are presented which target genes coding for microbial acid and alkaline phosphatases (phoN, phoD), phytases (appA), phosphonatases (phnX) as well as the quinoprotein glucose dehydrogenase (gcd) and different P transporters (pitA, pstS). Illumina amplicon sequencing of soil genomic DNA underlined the high rate of primer specificity towards the respective target gene which usually ranged between 98% and 100% (phoN: 87%). As expected the primers amplified genes from a broad diversity of distinct microorganisms. Using DNA from a beech dominated forest soil, the highest microbial diversity was detected for the alkaline phosphatase (phoD) gene which was amplified from 15 distinct phyla respectively 81 families. Noteworthy the primers also allowed amplification of phoD from 6 fungal orders. The genes coding for acid phosphatase (phoN) and the quinoprotein glucose dehydrogenase (gcd) were amplified from 20 respectively 17 different microbial orders. In comparison the phytase and phosphonatase (appA, phnX) primers covered 13 bacterial orders from 2 different phyla respectively. Although the amplified microbial diversity was apparently limited both primers reliably detected all orders that contributed to the P turnover in the investigated soil as revealed by a previous metagenomic approach. Genes that code for microbial P transporter

  20. PlasmaDNA: a free, cross-platform plasmid manipulation program for molecular biology laboratories

    Directory of Open Access Journals (Sweden)

    Rainy Jeffrey

    2007-09-01

    Full Text Available Abstract Background Most molecular biology experiments, and the techniques associated with this field of study, involve a great deal of engineering in the form of molecular cloning. Like all forms of engineering, perfect information about the starting material is crucial for successful completion of design and strategies. Results We have generated a program that allows complete in silico simulation of the cloning experiment. Starting with a primary DNA sequence, PlasmaDNA looks for restriction sites, open reading frames, primer annealing sequences, and various common domains. The databases are easily expandable by the user to fit his most common cloning needs. PlasmaDNA can manage and graphically represent multiple sequences at the same time, and keeps in memory the overhangs at the end of the sequences if any. This means that it is possible to virtually digest fragments, to add the digestion products to the project, and to ligate together fragments with compatible ends to generate the new sequences. Polymerase Chain Reaction (PCR fragments can also be virtually generated using the primer database, automatically adding to the fragments any 5' extra sequences present in the primers. Conclusion PlasmaDNA is a program available both on Windows and Apple operating systems, designed to facilitate molecular cloning experiments by building a visual map of the DNA. It then allows the complete planning and simulation of the cloning experiment. It also automatically updates the new sequences generated in the process, which is an important help in practice. The capacity to maintain multiple sequences in the same file can also be used to archive the various steps and strategies involved in the cloning of each construct. The program is freely available for download without charge or restriction.

  1. CRISPR Primer Designer:Design primers for knockout and chromosome imaging CRISPR-Cas system

    Institute of Scientific and Technical Information of China (English)

    Meng Yan; Shi-Rong Zhou; Hong-Wei Xue

    2015-01-01

    The clustered regularly interspaced short palin-dromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especial y the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran local y and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were stil no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs local y and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system.

  2. PlantID – DNA-based identification of multiple medicinal plants in complex mixtures

    Directory of Open Access Journals (Sweden)

    Howard Caroline

    2012-07-01

    Full Text Available Abstract Background An efficient method for the identification of medicinal plant products is now a priority as the global demand increases. This study aims to develop a DNA-based method for the identification and authentication of plant species that can be implemented in the industry to aid compliance with regulations, based upon the economically important Hypericum perforatum L. (St John’s Wort or Guan ye Lian Qiao. Methods The ITS regions of several Hypericum species were analysed to identify the most divergent regions and PCR primers were designed to anneal specifically to these regions in the different Hypericum species. Candidate primers were selected such that the amplicon produced by each species-specific reaction differed in size. The use of fluorescently labelled primers enabled these products to be resolved by capillary electrophoresis. Results Four closely related Hypericum species were detected simultaneously and independently in one reaction. Each species could be identified individually and in any combination. The introduction of three more closely related species to the test had no effect on the results. Highly processed commercial plant material was identified, despite the potential complications of DNA degradation in such samples. Conclusion This technique can detect the presence of an expected plant material and adulterant materials in one reaction. The method could be simply applied to other medicinal plants and their problem adulterants.

  3. Bactome, I: Python in DNA Fingerprinting

    Directory of Open Access Journals (Sweden)

    2010-09-01

    Full Text Available Bactome is a collection of Python functions to find primers suitable for DNA fingerprinting, determine restriction digestion profile, and analyse the resulting DNA fingerprint features as migration distance of the bands in gel electrophoresis. An actual use case will be presented as a case study. These codes are licensed under Lesser General Public Licence version 3.

  4. Oligonucleotide primers for targeted amplification of single-copy nuclear genes in apocritan Hymenoptera.

    Directory of Open Access Journals (Sweden)

    Gerrit Hartig

    Full Text Available BACKGROUND: Published nucleotide sequence data from the mega-diverse insect order Hymenoptera (sawflies, bees, wasps, and ants are taxonomically scattered and still inadequate for reconstructing a well-supported phylogenetic tree for the order. The analysis of comprehensive multiple gene data sets obtained via targeted PCR could provide a cost-effective solution to this problem. However, oligonucleotide primers for PCR amplification of nuclear genes across a wide range of hymenopteran species are still scarce. FINDINGS: Here we present a suite of degenerate oligonucleotide primer pairs for PCR amplification of 154 single-copy nuclear protein-coding genes from Hymenoptera. These primers were inferred from genome sequence data from nine Hymenoptera (seven species of ants, the honeybee, and the parasitoid wasp Nasonia vitripennis. We empirically tested a randomly chosen subset of these primer pairs for amplifying target genes from six Hymenoptera, representing the families Chrysididae, Crabronidae, Gasteruptiidae, Leucospidae, Pompilidae, and Stephanidae. Based on our results, we estimate that these primers are suitable for studying a large number of nuclear genes across a wide range of apocritan Hymenoptera (i.e., all hymenopterans with a wasp-waist and of aculeate Hymenoptera in particular (i.e., apocritan wasps with stingers. CONCLUSIONS: The amplified nucleotide sequences are (a with high probability from single-copy genes, (b easily generated at low financial costs, especially when compared to phylogenomic approaches, (c easily sequenced by means of an additionally provided set of sequencing primers, and (d suitable to address a wide range of phylogenetic questions and to aid rapid species identification via barcoding, as many amplicons contain both exonic and fast-evolving intronic nucleotides.

  5. RAPD analysis of alfalfa DNA mutation via N+ implantation

    International Nuclear Information System (INIS)

    Germination capacity of alfalfa seeds under low energy N+ implantation manifests oscillations going down with dose strength. From analyzing alfalfa genome DNA under low energy N+ implantation by RAPD (Random Amplified Polymorphous DNA), it is recommended that 30 polymorphic DNA fragments be amplified with 8 primers in total 100 primers, and fluorescence intensity of the identical DNA fragment amplified by RAPD is different between CK and treatments. Number of different polymorphic DNA fragments between treatment and CK via N+ implantation manifests going up with dose strength

  6. Hypervariable spacer regions are good sites for developing specific PCR-RFLP markers and PCR primers for screening actinorhizal symbionts

    Indian Academy of Sciences (India)

    Rajani Varghese; Vineeta S Chauhan; Arvind K Misra

    2003-06-01

    While the ribosomal RNA like highly conserved genes are good molecular chronometers for establishing phylogenetic relationships, they can also be useful in securing the amplification of adjoining hyper-variable regions. These regions can then be used for developing specific PCR primers or PCR-RFL profiles to be used as molecular markers. We report here the use of ITS region of rrn operon of Frankia for developing PCR-RFL profiles capable of discriminating between closely related frankiae. We have also made use of the ITS1 region of the nuclear rrn operon of Alnus nepalensis (D Don) for designing a PCR primer for specific amplification of nuclear DNA of this tree.

  7. Optimization Of ISSR Markers For DNA Fingerprinting In Stevia Rebaudiana Bertoni

    International Nuclear Information System (INIS)

    ISSR or inter-simple sequence repeat is PCR based markers which required no prior DNA sequence knowledge of the studied organism. It has been proved to overcome limitations in other genetic marker techniques. In this study, 100 ISSR primers which comprised of 80 specific primers and 20 degenerate primers were used. All of the primers were tested on gradient temperatures from 45-55 degree Celsius. For positive amplification, 62 specific primers (77.5 %) and 18 degenerate primers (90.0 %) were recorded as working primers. The most efficient temperature for 25 primers was 55 degree Celsius. Marker derived from ISSR profiling is a powerful approach for identification and molecular classification of Stevia rebaudiana bertoni. (author)

  8. Analysis of the role of PCNA-DNA contacts during clamp loading

    Directory of Open Access Journals (Sweden)

    Goedken Eric R

    2010-01-01

    Full Text Available Abstract Background Sliding clamps, such as Proliferating Cell Nuclear Antigen (PCNA in eukaryotes, are ring-shaped protein complexes that encircle DNA and enable highly processive DNA replication by serving as docking sites for DNA polymerases. In an ATP-dependent reaction, clamp loader complexes, such as the Replication Factor-C (RFC complex in eukaryotes, open the clamp and load it around primer-template DNA. Results We built a model of RFC bound to PCNA and DNA based on existing crystal structures of clamp loaders. This model suggests that DNA would enter the clamp at an angle during clamp loading, thereby interacting with positively charged residues in the center of PCNA. We show that simultaneous mutation of Lys 20, Lys 77, Arg 80, and Arg 149, which interact with DNA in the RFC-PCNA-DNA model, compromises the ability of yeast PCNA to stimulate the DNA-dependent ATPase activity of RFC when the DNA is long enough to extend through the clamp. Fluorescence anisotropy binding experiments show that the inability of the mutant clamp proteins to stimulate RFC ATPase activity is likely caused by reduction in the affinity of the RFC-PCNA complex for DNA. We obtained several crystal forms of yeast PCNA-DNA complexes, measuring X-ray diffraction data to 3.0 Å resolution for one such complex. The resulting electron density maps show that DNA is bound in a tilted orientation relative to PCNA, but makes different contacts than those implicated in clamp loading. Because of apparent partial disorder in the DNA, we restricted refinement of the DNA to a rigid body model. This result contrasts with previous analysis of a bacterial clamp bound to DNA, where the DNA was well resolved. Conclusion Mutational analysis of PCNA suggests that positively charged residues in the center of the clamp create a binding surface that makes contact with DNA. Disruption of this positive surface, which had not previously been implicated in clamp loading function, reduces RFC

  9. Method for priming and DNA sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Mugasimangalam, R.C.; Ulanovsky, L.E.

    1997-12-01

    A method is presented for improving the priming specificity of an oligonucleotide primer that is non-unique in a nucleic acid template which includes selecting a continuous stretch of several nucleotides in the template DNA where one of the four bases does not occur in the stretch. This also includes bringing the template DNA in contract with a non-unique primer partially or fully complimentary to the sequence immediately upstream of the selected sequence stretch. This results in polymerase-mediated differential extension of the primer in the presence of a subset of deoxyribonucleotide triphosphates that does not contain the base complementary to the base absent in the selected sequence stretch. These reactions occur at a temperature sufficiently low for allowing the extension of the non-unique primer. The method causes polymerase-mediated extension reactions in the presence of all four natural deoxyribonucleotide triphosphates or modifications. At this high temperature discrimination occurs against priming sites of the non-unique primer where the differential extension has not made the primer sufficiently stable to prime. However, the primer extended at the selected stretch is sufficiently stable to prime.

  10. Methods for Precise Molecular Detection of Probiotic Microflora: Using Adjusted Molecular Biology Protocols, Primer Sets and PCR Assays

    Directory of Open Access Journals (Sweden)

    F. Abu Bakar

    2010-01-01

    Full Text Available Lactobacillus sp. is probiotic bacteria for which many detection methods were envisaged. However, culture-based methods failed to achieve specific detection of this bacterium due to its presence in mixed bacterial complex communities. The PCR assay was optimized to detect and quantify Lactobacillus sp. specifically in complex microbial community of mixed bacteria. Four DNA extraction methods, DNA integrity, primers specificity and optimized PCR procedure were all tested. It was shown that extracted genomic DNA using Wizard® Genomic DNA Purification Kit showed the highest yield, quality and performance in gel electrophoresis. Moreover, the specificity of the primer set, Lacto-16S-F /Lacto-16S-R, specific for Lactobacillus sp. was checked and found highly specific. In conclusion, the best DNA extraction protocol, working specific primer set and working PCR assay were achieved for achieving efficient, specific and reliable molecular-based, culture-independent, method of detection of lactobacillus sp. in PCR-suppressor highly protein-complex environment of mixed bacteria community.

  11. Oxidation by DNA Charge Transport Damages Conserved Sequence Block II, a Regulatory Element in Mitochondrial DNA

    OpenAIRE

    Merino, Edward J.; Barton, Jacqueline K.

    2007-01-01

    Sites of oxidative damage in mitochondrial DNA have been identified on the basis of DNA-mediated charge transport. Our goal is to understand which sites in mitochondrial DNA are prone to oxidation at long range and whether such oxidative damage correlates with cancerous transformation. Here we show that a primer extension reaction can be used to monitor directly oxidative damage to authentic mitochondrial DNA through photoreactions with a rhodium intercalator. The complex [Rh(phi)_2bpy]Cl_3 (...

  12. Shotgun metagenomes and multiple primer pair-barcode combinations of amplicons reveal biases in metabarcoding analyses of fungi

    Directory of Open Access Journals (Sweden)

    Leho Tedersoo

    2015-05-01

    Full Text Available Rapid development of high-throughput (HTS molecular identification methods has revolutionized our knowledge about taxonomic diversity and ecology of fungi. However, PCR-based methods exhibit multiple technical shortcomings that may bias our understanding of the fungal kingdom. This study was initiated to quantify potential biases in fungal community ecology by comparing the relative performance of amplicon-free shotgun metagenomics and amplicons of nine primer pairs over seven nuclear ribosomal DNA (rDNA regions often used in metabarcoding analyses. The internal transcribed spacer (ITS barcodes ITS1 and ITS2 provided greater taxonomic and functional resolution and richness of operational taxonomic units (OTUs at the 97% similarity threshold compared to barcodes located within the ribosomal small subunit (SSU and large subunit (LSU genes. All barcode-primer pair combinations provided consistent results in ranking taxonomic richness and recovering the importance of floristic variables in driving fungal community composition in soils of Papua New Guinea. The choice of forward primer explained up to 2.0% of the variation in OTU-level analysis of the ITS1 and ITS2 barcode data sets. Across the whole data set, barcode-primer pair combination explained 37.6–38.1% of the variation, which surpassed any environmental signal. Overall, the metagenomics data set recovered a similar taxonomic overview, but resulted in much lower fungal rDNA sequencing depth, inability to infer OTUs, and high uncertainty in identification. We recommend the use of ITS2 or the whole ITS region for metabarcoding and we advocate careful choice of primer pairs in consideration of the relative proportion of fungal DNA and expected dominant groups.

  13. Validation of a primer optimisation matrix to improve the performance of reverse transcription – quantitative real-time PCR assays

    Directory of Open Access Journals (Sweden)

    Dobrovic Alexander

    2009-06-01

    Full Text Available Abstract Background The development of reverse transcription – quantitative real-time PCR (RT-qPCR platforms that can simultaneously measure the expression of multiple genes is dependent on robust assays that function under identical thermal cycling conditions. The use of a primer optimisation matrix to improve the performance of RT-qPCR assays is often recommended in technical bulletins and manuals. Despite this recommendation, a comprehensive introduction to and evaluation of this approach has been absent from the literature. Therefore, we investigated the impact of varying the primer concentration, leaving all the other reaction conditions unchanged, on a large number of RT-qPCR assays which in this case were designed to be monitored using hydrolysis probes from the Universal Probe Library (UPL library. Findings Optimal RT-qPCR conditions were determined for 60 newly designed assays. The calculated Cq (Quantification Cycle difference, non-specific amplification, and primer dimer formation for a given assay was often dependent on primer concentration. The chosen conditions were further optimised by testing two different probe concentrations. Varying the primer concentrations had a greater effect on the performance of a RT-qPCR assay than varying the probe concentrations. Conclusion Primer optimisation is important for improving the performance of RT-qPCR assays monitored by UPL probes. This approach would also be beneficial to the performance of other RT-qPCR assays such as those using other types of probes or fluorescent intercalating dyes.

  14. Adventitious match probability for autosomal profiles when primer binding site mutation is possible.

    Science.gov (United States)

    Pope, Susan; Evett, Ian; Puch-Solis, Roberto

    2016-09-01

    This paper considers the situation where two DNA systems with differing primers have been used to produce DNA profiles for loading and searching of a DNA Database. With any profiling system there exists the possibility of a "primer binding site mutation" (PBSM). When such a mutation occurs at one of the loci in a profile, it has the effect that the associated allele is not visible in the profile. In the case where a person has two different alleles at a given locus (heterozygous) the effect of a PBSM would be that the profile would appear to be that of an individual with only one allele at that locus (homozygous). The paper investigates the potential for an adventitious match as a result of a PBSM when, for example, a crime profile and person profile that have originated from two different individuals are found to be the same as a result of a PBSM in one of the profiles. It is demonstrated, both by theory and using simulations, that the effect of PBSMs is to slightly decrease the adventitious match probability from what it would had the same DNA system been used. PMID:27420391

  15. Signals and systems primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2006-01-01

    Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,

  16. Bayesian models a statistical primer for ecologists

    CERN Document Server

    Hobbs, N Thompson

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods-in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach. Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probabili

  17. Primer izpeljave analize besedila v kvalitativni raziskavi

    OpenAIRE

    Roblek, Vasja

    2013-01-01

    V članku na podlagi kvalitativne raziskave prikazujemo primer načina analize in razlage besedila. V prvem delu se osredotočimo na teoretično opredelitev analitičnega orodja ter značilnosti analize in interpretacije besedil znotraj kvalitativne raziskave. V nadaljevanju na podlagi izsledkov (polstrukturiranih intervjujev in osebnih zapisov, opazovanja delovanja dveh mrež) prikažemo možnost analize in interpretacije dobljenih podatkov z uporabo analitičnega orodja tematske mreže.

  18. Primer izpeljave analize besedila v kvalitativni raziskavi:

    OpenAIRE

    Roblek, Vasja

    2009-01-01

    V članku na podlagi kvalitativne raziskave prikazujemo primer načina analize in razlage besedila. V prvem delu se osredotočimo na teoretično opredelitev analitičnega orodja ter značilnosti analize in interpretacije besedil znotraj kvalitativne raziskave. V nadaljevanju na podlagi izsledkov (polstrukturiranih intervjujev in osebnih zapisov, opazovanja delovanja dveh mrež) prikažemo možnost analize in interpretacije dobljenih podatkov z uporabo analitičnega orodja tematske mreže.

  19. Applied Ecosystem Analysis - - a Primer : EDT the Ecosystem Diagnosis and Treatment Method.

    Energy Technology Data Exchange (ETDEWEB)

    Lestelle, Lawrence C.; Mobrand, Lars E.

    1996-05-01

    The aim of this document is to inform and instruct the reader about an approach to ecosystem management that is based upon salmon as an indicator species. It is intended to provide natural resource management professionals with the background information needed to answer questions about why and how to apply the approach. The methods and tools the authors describe are continually updated and refined, so this primer should be treated as a first iteration of a sequentially revised manual.

  20. An improved allele-specific PCR primer design method for SNP marker analysis and its application

    OpenAIRE

    Liu Jing; Huang Shunmou; Sun Meiyu; Liu Shengyi; Liu Yumei; Wang Wanxing; Zhang Xiurong; Wang Hanzhong; Hua Wei

    2012-01-01

    Abstract Background Although Single Nucleotide Polymorphism (SNP) marker is an invaluable tool for positional cloning, association study and evolutionary analysis, low SNP detection efficiency by Allele-Specific PCR (AS-PCR) still restricts its application as molecular marker like other markers such as Simple Sequence Repeat (SSR). To overcome this problem, primers with a single nucleotide artificial mismatch introduced within the three bases closest to the 3’end (SNP site) have been used in ...

  1. Applied ecosystem analysis - a primer; the ecosystem diagnosis and treatment method

    International Nuclear Information System (INIS)

    The aim of this document is to inform and instruct the reader about an approach to ecosystem management that is based upon salmon as an indicator species. It is intended to provide natural resource management professionals with the background information needed to answer questions about why and how to apply the approach. The methods and tools the authors describe are continually updated and refined, so this primer should be treated as a first iteration of a sequentially revised manual

  2. Detection of genetic variability in Chrysanthemum (Dendranthema grandiflora T. using ISSR primers

    Directory of Open Access Journals (Sweden)

    P. Lalitha Kameswari, Hameedunnisabegum, M. Pratap, and G.Anuradha

    2015-03-01

    Full Text Available The genetic diversity of 37 genotypes of Chrysanthemum was characterized using inter simple sequence repeats (ISSR technique. A total of 46 primers were screened, of which 10 polymorphic and informative patterns were selected to determine genetic relationships. Among 114 amplified DNA fragments obtained, 107 bands were polymorphic, accounting for 93.86% polymorphism. The percentage of polymorphism exhibited by different ISSR primers ranged from 71.43% (ISSR-825 to 100% (ISSR-808, 810, 812, 840 and 842. The similarity coefficient values ranged from 0.275 to 0.775 with a mean similarity matrix of 0.525. Among the 37 genotypes studied, the closest relationship was scored between Geetanjali and Red Stone with similarity level of 77.5% while, the most distantly related genotypes were Autumn Joy and Flirtation with the lowest similarity index of 0.275. The UPGMA dendrogram revealed that the chrysanthemum genotypes were grouped into ten clusters.

  3. Differentiation of five tuna species by a multiplex primer-extension assay.

    Science.gov (United States)

    Bottero, Maria Teresa; Dalmasso, Alessandra; Cappelletti, Marco; Secchi, Camillo; Civera, Tiziana

    2007-05-01

    A novel methodology based on analysis of mtDNA-cytb diagnostic sites was performed to discriminate four closely related species of Thunnus (Thunnus alalunga, Thunnus albacares, Thunnus obesus and Thunnus thynnus) and one species of Euthynnus (Katsuwonus pelamis) genus in raw and canned tuna. The primers used in the preliminary PCR designed in well conserved region upstream and downstream of the diagnosis sites successfully amplified a 132bp region from the cytb gene of all the species taken into consideration. The sites of diagnosis have been interrogate simultaneously using a multiplex primer-extension assay (PER) and the results were confirmed by fragment sequencing. The applicability of the multiplex PER assay to commercial canned tuna samples was also demonstrated. The proposed test could be useful for detection of fraud and for seafood traceability. PMID:17353060

  4. DNA amplification polymorphisms of the cultivated mushroom Agaricus bisporus.

    OpenAIRE

    Khush, R S; Becker, E; Wach, M.

    1992-01-01

    Single 10-bp primers were used to generate random amplified polymorphic DNA (RAPD) markers from commercial and wild strains of the cultivated mushroom Agaricus bisporus via the polymerase chain reaction. Of 20 primers tested, 19 amplified A. bisporus DNA, each producing 5 to 15 scorable markers ranging from 0.5 to 3.0 kbp. RAPD markers identified seven distinct genotypes among eight heterokaryotic strains; two of the commercial strains were shown to be related to each other through single-spo...

  5. A combined HM-PCR/SNuPE method for high sensitive detection of rare DNA methylation

    Directory of Open Access Journals (Sweden)

    Tierling Sascha

    2010-06-01

    Full Text Available Abstract Background DNA methylation changes are widely used as early molecular markers in cancer detection. Sensitive detection and classification of rare methylation changes in DNA extracted from circulating body fluids or complex tissue samples is crucial for the understanding of tumor etiology, clinical diagnosis and treatment. In this paper, we describe a combined method to monitor the presence of methylated tumor DNA in an excess of unmethylated background DNA of non-tumorous cells. The method combines heavy methyl-PCR, which favors preferential amplification of methylated marker sequence from bisulfite-treated DNA with a methylation-specific single nucleotide primer extension monitored by ion-pair, reversed-phase, high-performance liquid chromatography separation. Results This combined method allows detection of 14 pg (that is, four to five genomic copies of methylated chromosomal DNA in a 2000-fold excess (that is, 50 ng of unmethylated chromosomal background, with an analytical sensitivity of > 90%. We outline a detailed protocol for the combined assay on two examples of known cancer markers (SEPT9 and TMEFF2 and discuss general aspects of assay design and data interpretation. Finally, we provide an application example for rapid testing on tumor methylation in plasma DNA derived from a small cohort of patients with colorectal cancer. Conclusion The method allows unambiguous detection of rare DNA methylation, for example in body fluid or DNA isolates from cells or tissues, with very high sensitivity and accuracy. The application combines standard technologies and can easily be adapted to any target region of interest. It does not require costly reagents and can be used for routine screening of many samples.

  6. Single primer amplification reaction methods reveal exotic and indigenous mulberry varieties are similarly diverse

    Indian Academy of Sciences (India)

    Esha Bhattacharya; S B Dandin; Shirish Anand Ranade

    2005-12-01

    Mulberry is the sole food source for mulberry silkworm and a number of indigenous and exotic varieties are used in sericulture. Studies on assessment of genetic diversity have been done amongst a few mulberry varieties using one or at the most two methods. However, no comprehensive study on a large number of varieties has been carried out. In present study, single primer amplification reaction (SPAR) methods have been used for determination of diversity in 27 mulberry varieties (exotic as well as indigenous), using four minisatellite core sequence primers for directed amplification of minisatellite DNA (DAMD), three simple sequence repeat (SSR) motifs as primers for inter simple sequence repeat (ISSR) and 20 arbitrary sequence decamer primers for random amplified polymorphic DNA (RAPD) reactions. The Jaccard coefficients were determined for the DAMD, ISSR and RAPD band data (total of 58, 39 and 235 bands respectively). All three methods revealed wide range of distances supporting a wide range of mulberry genetic diversity. A cumulative analysis of the data generated by three methods resulted in a neighbour-joining (NJ) tree that gave a better reflection of the relatedness and affinities of the varieties to each other. Comparison of the three methods by marker indices and the Mantel test of correlation indicated that though all methods were useful for the assessment of diversity in mulberry, the DAMD method was better. When considered as two groups (10 exotic and 17 indigenous varieties), the mulberry varieties in the exotic group were found to have slightly greater diversity than the indigenous ones. These results support the concept of naturalization of mulberry varieties at locales distant from their origins.

  7. Primer on CDM programme of activities

    Energy Technology Data Exchange (ETDEWEB)

    Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

    2009-07-01

    As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

  8. Hanford Site background: Part 3, Groundwater background

    International Nuclear Information System (INIS)

    This report presents and interprets groundwater background data collected from the unconfined aquifer beneath the Hanford Site, a U.S. Department of Energy complex located near Richland, Washington. Characterization of background composition is an important component of environmental characterization activities and serves as a basis for distinguishing the presence and significance of contamination. Background data can also be used to assess the levels of baseline risk to which humans or other receptors are typically exposed and to establish remediation goals. Evaluating background on a sitewide basis provides a consistent, technically defensible definition of background as opposed to determining area-specific background compositions for each waste management unit being considered for remediation across the Hanford Site

  9. Cytoplasmic inheritance of somatic hybrids and development of primers for cpSSR in Citrus%柑橘体细胞胞质遗传及叶绿体SSR引物开发

    Institute of Scientific and Technical Information of China (English)

    程运江

    2011-01-01

    以38个组合的柑橘体细胞杂种(或胞质杂种)为试验材料,综合应用RFLP、CAPS和cpSSR分子标记技术,对这些杂种的线粒体和叶绿体遗传组成进行了分析;同时对试验技术体系进行了完善与拓展,开发了柑橘叶绿体SSR标记;并对柑橘愈伤组织长期继代保存过程中胞质基因组遗传变异进行了分析,主要结果如下.%In the present study,cytoplasmic inheritance of Citrus somatic hybrids and cybrids from 38 interge-neric and interspecific fusion combinations was analyzed with restriction fragment length polymorphisms (RFLPs), cleaved amplified polymorphic sequence (CAPS) and chloroplast simple sequence repeat (cpSSR) markers. The experimental procedures were modified and optimized. A novel marker, cpSSR, was developed in Citrus and other tropical fruit crops. Meanwhile,genetic variations of organelle from 23 Citrus calli were analyzed. The main results were as follows:1. A simple and efficient method for genomic DNA extraction from woody fruit crops containing high level of polysaccharides was developed. This method involves a modified CTAB or SDS procedure employing a purification step to remove polysaccharides by using water saturated ether at the presence of 1. 25-1. 30 mol/L NaCl. The quality of DNA samples extracted with this method was suitable for PCR and RFLPs analysis and for long-term storage. In addition, this procedure was successfully applied in DNA isolation from the freezed or withered or senile leaves of Citrus and more than 20 kinds of tropical and subtropical fruit crops.2. Five universal pairs of chloroplast DNA (cpDNA) primer and 3 universal pairs of mitochondrial DNA (mtDNA) primers amplified monomorphic fragments among 4 intergeneric hybrids and 3 inter-spefic fusion combinations. After digested by restriction endonuclease, polymorphic mitochondrial CAPS markers were displayed in the 4 intergeneric combinations, while polymorphic chloroplast CAPS markers were found in 3

  10. pmoA Primers for Detection of Anaerobic Methanotrophs▿

    OpenAIRE

    Luesken, F.A.; Zhu, B.; Alen, T.A. van; Butler, M.K.; Diaz, M. R.; Song, B.; Op den Camp, H.J.M.; M. S. M. Jetten; Ettwig, K.F.

    2011-01-01

    Published pmoA primers do not match the pmoA sequence of “Candidatus Methylomirabilis oxyfera,” a bacterium that performs nitrite-dependent anaerobic methane oxidation. Therefore, new pmoA primers for the detection of “Ca. Methylomirabilis oxyfera”-like methanotrophs were developed and successfully tested on freshwater samples from different habitats. These primers expand existing molecular tools for the study of methanotrophs in the environment.

  11. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    International Nuclear Information System (INIS)

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

  12. High-speed measurement of firearm primer blast waves

    OpenAIRE

    Courtney, Michael; Daviscourt, Joshua; Eng, Jonathan; Courtney, Amy

    2012-01-01

    This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast p...

  13. Single primer amplification reaction (SPAR) methods reveal subsequent increase in genetic variations in micropropagated plants of Nepenthes khasiana Hook. f. maintained for three consecutive regenerations.

    Science.gov (United States)

    Devi, Soibam Purnima; Kumaria, Suman; Rao, Satyawada Rama; Tandon, Pramod

    2014-03-15

    The genetic fidelity of in vitro-raised plants of three successive regenerations of Nepenthes khasiana Hook. f. was assessed using three different single primer amplification reaction (SPAR) methods, viz., random amplified polymorphic DNA (RAPD), inter-simple sequence repeat (ISSR) and direct amplification of minisatellite DNA region (DAMD) markers. Out of 80 RAPD primers screened, 14 primers reflected a genetic variation of 4.1% in the first regeneration which was increased to 9.4% in the third regeneration. In the case of ISSR, out of 36 primers screened for assessment of genetic homogeneity of the regenerated plantlets, 12 primers showed an increase of genetic variation from 4.3% to 10% from the first to the third regenerations. In DAMD profiling, 15 primers were used for the evaluation of genetic fidelity where 8.47% of polymorphism was observed in the first regeneration which was increased to 13.33% in the third regeneration. The cumulative analysis reflected a genetic variation of 5.65% in the first regeneration which increased subsequently to 7.77% in the second regeneration and 10.87% in the third regeneration. The present study demonstrates SPAR technique to be an efficient tool for the assessment of clonal fidelity of in vitro-raised plants. PMID:24440289

  14. Comparison of pectin-degrading fungal communities in temperate forests using glycosyl hydrolase family 28 pectinase primers targeting Ascomycete fungi.

    Science.gov (United States)

    Gacura, Matthew D; Sprockett, Daniel D; Heidenreich, Bess; Blackwood, Christopher B

    2016-04-01

    Fungi have developed a wide assortment of enzymes to break down pectin, a prevalent polymer in plant cell walls that is important in plant defense and structure. One enzyme family used to degrade pectin is the glycosyl hydrolase family 28 (GH28). In this study we developed primers for the amplification of GH28 coding genes from a database of 293 GH28 sequences from 40 fungal genomes. The primers were used to successfully amplify GH28 pectinases from all Ascomycota cultures tested, but only three out of seven Basidiomycota cultures. In addition, we further tested the primers in PCRs on metagenomic DNA extracted from senesced tree leaves from different forest ecosystems, followed by cloning and sequencing. Taxonomic specificity for Ascomycota GH28 genes was tested by comparing GH28 composition in leaves to internal transcribed spacer (ITS) amplicon composition using pyrosequencing. All sequences obtained from GH28 primers were classified as Ascomycota; in contrast, ITS sequences indicated that fungal communities were up to 39% Basidiomycetes. Analysis of leaf samples indicated that both forest stand and ecosystem type were important in structuring fungal communities. However, site played the prominent role in explaining GH28 composition, whereas ecosystem type was more important for ITS composition, indicating possible genetic drift between populations of fungi. Overall, these primers will have utility in understanding relationships between fungal community composition and ecosystem processes, as well as detection of potentially pathogenic Ascomycetes. PMID:26899925

  15. SVARAP and aSVARAP: simple tools for quantitative analysis of nucleotide and amino acid variability and primer selection for clinical microbiology

    OpenAIRE

    Tamalet Catherine; Colson Philippe; Raoult Didier

    2006-01-01

    Abstract Background Simple computerized methods that analyse variability along alignments of nucleotide or amino acid sequences can be very useful in a clinical microbiology laboratory for two main purposes. First, to optimize primer selection, which is critical for the identification of infectious pathogens based on gene sequencing: primers must target conserved nucleotide regions bordering highly variable areas to ensure discrimination of species. Second, it can be of interest to reveal mut...

  16. Use of Repetitive DNA Sequences and the PCR To Differentiate Escherichia coli Isolates from Human and Animal Sources

    OpenAIRE

    Dombek, Priscilla E.; Johnson, LeeAnn K.; Zimmerley, Sara T.; Michael J Sadowsky

    2000-01-01

    The rep-PCR DNA fingerprint technique, which uses repetitive intergenic DNA sequences, was investigated as a way to differentiate between human and animal sources of fecal pollution. BOX and REP primers were used to generate DNA fingerprints from Escherichia coli strains isolated from human and animal sources (geese, ducks, cows, pigs, chickens, and sheep). Our initial studies revealed that the DNA fingerprints obtained with the BOX primer were more effective for grouping E. coli strains than...

  17. Methodology: simplified preparation of a DNA ladder using PCR.

    Science.gov (United States)

    Wang, T-Y; Wang, L; Wang, F

    2011-01-01

    Serving as a DNA molecular weight standard, the DNA ladder has been widely used in molecular biology applications. We developed a simple method for the preparation of a DNA marker, which involves designing primers to amplify 100- to 1000-bp DNA fragments using lambda DNA as a template for polymerase chain reaction, followed by extraction with phenol/chloroform, precipitation with ethanol and mixing. Fragments of 100- to 1000-bp DNA were successfully amplified; the sequences showed 100% identity with lambda DNA. This prepared DNA marker displayed clear bands, indicating that it can be used for molecular studies. PMID:21863555

  18. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2013-01-01

    Complex system theory is rapidly developing and gaining importance, providing tools and concepts central to our modern understanding of emergent phenomena. This primer offers an introduction to this area together with detailed coverage of the mathematics involved. All calculations are presented step by step and are straightforward to follow. This new third edition comes with new material, figures and exercises. Network theory, dynamical systems and information theory, the core of modern complex system sciences, are developed in the first three chapters, covering basic concepts and phenomena like small-world networks, bifurcation theory and information entropy. Further chapters use a modular approach to address the most important concepts in complex system sciences, with the emergence and self-organization playing a central role. Prominent examples are self-organized criticality in adaptive systems, life at the edge of chaos, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase...

  19. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2007-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  20. Complex and Adaptive Dynamical Systems A Primer

    CERN Document Server

    Gros, Claudius

    2011-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  1. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2015-01-01

    This primer offers readers an introduction to the central concepts that form our modern understanding of complex and emergent behavior, together with detailed coverage of accompanying mathematical methods. All calculations are presented step by step and are easy to follow. This new fourth edition has been fully reorganized and includes new chapters, figures and exercises. The core aspects of modern complex system sciences are presented in the first chapters, covering network theory, dynamical systems, bifurcation and catastrophe theory, chaos and adaptive processes, together with the principle of self-organization in reaction-diffusion systems and social animals. Modern information theoretical principles are treated in further chapters, together with the concept of self-organized criticality, gene regulation networks, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase transitions and the cognitive system approach to the brain. Technical course prerequisites are the standard ...

  2. Primer for criticality calculations with DANTSYS

    International Nuclear Information System (INIS)

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his or her facility. Typically, two types of codes are available: deterministic codes such as ANISN or DANTSYS that solve an approximate model exactly and Monte Carlo Codes such as KENO or MCNP that solve an exact model approximately. Often, the analyst feels that the deterministic codes are too simple and will not provide the necessary information, so most modeling uses Monte Carlo methods. This sometimes means that hours of effort are expended to produce results available in minutes from deterministic codes. A substantial amount of reliable information on nuclear systems can be obtained using deterministic methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico in cooperation with the Radiation Transport Group at Los Alamos National Laboratory has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. (DANTSYS is the name of a suite of codes that users more commonly know as ONEDANT, TWODANT, TWOHEX, and THREEDANT.) It assumes a college education in a technical field, but there is no assumption of familiarity with neutronics codes in general or with DANTSYS in particular. The primer is designed to teach by example, with each example illustrating two or three DANTSYS features useful in criticality analyses

  3. Formaldehyde as hypothetical primer of biohomochirality

    Energy Technology Data Exchange (ETDEWEB)

    Goldanskii, V.I. [N. N. Semenov Institute of Chemical Physics of the Russian Academy of Sciences, Kosygin Street 4, Moscow, 117334 (Russia)

    1996-07-01

    One of the most intriguing and crucial problems of the prebiotic evolution and the origin of life is the explanation of the origin of biohomochirality. A scheme of conversions originated by formaldehyde (FA) as hypothetical primer of biohomochirality is proposed. The merit of FA as executor of this function is based -inter alia - on the distinguished role of FA as one of the earliest and simplest molecules in both warm, terrestrial and cold, extraterrestrial scenarios of the origin of life. The confirmation of the role of FA as primer of biohomochirality would support the option of an RNA world as an alternative to the protein world. The suggested hypothesis puts forward for the first time a concrete sequence of chemical reactions which can lead to biohomochirality. The spontaneous breaking of the mirror symmetry is secured by the application of the well-known Frank scheme (combination of autocatalysis and {open_quote}{open_quote}annihilation{close_quote}{close_quote} of L and D enantiomers) to the series of interactions of FA {open_quote}{open_quote}trimers{close_quote}{close_quote} (i.e. C{sub 3}H{sub 6}O{sub 3} compounds) of (aaa), (apa) and (app) types, where the monomeric groups (a) means {open_quote}{open_quote}achirons{close_quote}{close_quote} (a=CH{sub n}, n{ge}2 and C=M, M=C,O) and (p) mean {open_quote}{open_quote}prochirons{close_quote}{close_quote} (p=HC{asterisk}OM, M=H,C). {copyright} {ital 1996 American Institute of Physics.}

  4. MCNPTM criticality primer and training experiences

    International Nuclear Information System (INIS)

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (keff). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple keff calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP

  5. TESTING THE SPECIFICITY OF PRIMERS TO ENVIRONMENTAL AMMONIA MONOOXYGENASE (AMOA) GENES IN GROUNDWATER TREATED WITH UREA TO PROMOTE CALCITE PRECIPITATION

    Energy Technology Data Exchange (ETDEWEB)

    Stephanie Freeman; David Reed; Yoshiko Fujita

    2006-12-01

    The diversity of bacterial ammonia monooxygenase (amoA) genes in DNA isolated from microorganisms in groundwater was characterized by amplification of amoA DNA using polymerase chain reaction (PCR), Restriction Fragment Length Polymorphism (RFLP) analysis, and sequencing. The amoA gene is characteristic of ammonia oxidizing bacteria (AOB). The DNA extracts were acquired from an experiment where dilute molasses and urea were sequentially introduced into a well in the Eastern Snake River Plain Aquifer (ESRPA) in Idaho to examine whether such amendments could stimulate enhanced ureolytic activity. The hydrolysis of urea into ammonium and carbonate serves as the basis for a potential remediation technique for trace metals and radionuclide contaminants that co-precipitate in calcite. The ammonium ion resulting from ureolysis can promote the growth of AOB. The goal of this work was to investigate the effectiveness of primers designed for quantitative PCR of environmental amoA genes and to evaluate the effect of the molasses and urea amendments upon the population diversity of groundwater AOB. PCR primers designed to target a portion of the amoA gene were used to amplify amoA gene sequences in the groundwater DNA extracts. Following PCR, amplified gene products were cloned and the clones were characterized by RFLP, a DNA restriction technique that can distinguish different DNA sequences, to gauge the initial diversity. Clones exhibiting unique RFLP patterns were subjected to DNA sequencing. Initial sequencing results suggest that the primers were successful at specific detection of amoA sequences and the RFLP analyses indicated that the diversity of detected amoA sequences in the ESRPA decreased with the additions of molasses and urea.

  6. Modified primers for the identification of nonpathogenic Fusarium oxysporum isolates that have biological control potential against Fusarium wilt of cucumber in Taiwan.

    Directory of Open Access Journals (Sweden)

    Chaojen Wang

    Full Text Available Previous investigations demonstrated that Fusarium oxysporum (Fo, which is not pathogenic to cucumbers, could serve as a biological control agent for managing Fusarium wilt of cucumber caused by Fo f. sp. cucumerinum (Foc in Taiwan. However, thus far it has not been possible to separate the populations of pathogenic Fo from the nonpathogenic isolates that have biological control potential through their morphological characteristics. Although these two populations can be distinguished from one another using a bioassay, the work is laborious and time-consuming. In this study, a fragment of the intergenic spacer (IGS region of ribosomal DNA from an Fo biological control agent, Fo366, was PCR-amplified with published general primers, FIGS11/FIGS12 and sequenced. A new primer, NPIGS-R, which was designed based on the IGS sequence, was paired with the FIGS11 primer. These primers were then evaluated for their specificity to amplify DNA from nonpathogenic Fo isolates that have biological control potential. The results showed that the modified primer pair, FIGS11/NPIGS-R, amplified a 500-bp DNA fragment from five of seven nonpathogenic Fo isolates. These five Fo isolates delayed symptom development of cucumber Fusarium wilt in greenhouse bioassay tests. Seventy-seven Fo isolates were obtained from the soil and plant tissues and then subjected to amplification using the modified primer pair; six samples showed positive amplification. These six isolates did not cause symptoms on cucumber seedlings when grown in peat moss infested with the isolates and delayed disease development when the same plants were subsequently inoculated with a virulent isolate of Foc. Therefore, the modified primer pair may prove useful for the identification of Fo isolates that are nonpathogenic to cucumber which can potentially act as biocontrol agents for Fusarium wilt of cucumber.

  7. AMPLIFICATION OF AZOSPIRILLUM SP. JG3 GLPD GENE FRAGMENT USING DEGENERATE PRIMERS GENERATED BY WEB-BASED TOOLS

    Directory of Open Access Journals (Sweden)

    Stalis Norma Ethica

    2013-12-01

    Full Text Available Primaclade and In Silico web-based tools were used as a strategy to obtain the correct-size PCR amplicon targeting a fragment of gene encoding glycerol-3-phosphate dehydrogenase (glpD of Azospirillum sp. JG3. The bacterial strains are soil, Gram-negative PGPR (Plant-Growth Promoting Rhizobacteria isolated from an agricultural land in Purwokerto, Central Java, Indonesia, which have ability to produce several commercial enzymes. The aim is to obtain a pair of reliable degenerate primers from a limited number of glpD sequences from other Azospirilla retrieved in GenBank using bioinformatics approach. We demonstrated degenerate primer design that led to successful PCR amplification corresponding to the targeted DNA fragment. Homology analysis showed that the obtained DNA fragment is 61% and 99% similar to sn-glycerol-3-phosphate dehydrogenase genes of Azospirillum brasilense and Stenotrophomonas maltophili respectively.

  8. New primers for sex identification in the Chinese egret and other ardeid species.

    Science.gov (United States)

    Wang, Zeng; Zhou, Xiaoping; Lin, Qingxian; Fang, Wenzhen; Chen, Xiaolin

    2011-01-01

    Using the universal P2/P8 primers, we were able to obtain the gene segments of chromo-helicase-DNA binding protein (CHD)-Z and CHD-W from ten species of ardeid birds including Chinese egret (Egretta eulophotes), little egret (E. garzetta), eastern reef egret (E. sacra), great egret (Ardea alba), grey heron (A. cinerea), Chinese pond-heron (Ardeola bacchus), cattle egret (Bubulcus ibis), black-crowned night-heron (Nycticorax nycticorax), cinnamon bittern (Ixobrychus cinnamomeus) and yellow bittern (I. sinensis). Based on conserved regions inside the P2/P8-derived sequences, we designed new PCR primers for sex identification in these ardeid species. Using agarose gel electrophoresis, the PCR products showed two bands for females (140 bp derived from CHD-W and the other 250 bp from CHD-ZW), whereas the males showed only the 250 bp band. The results indicated that our new primers could be used for accurate and convenient sex identification in ardeid species. PMID:21429119

  9. Uncoupling primer and releaser responses to pheromone in honey bees

    Science.gov (United States)

    Grozinger, Christina M.; Fischer, Patrick; Hampton, Jacob E.

    2007-05-01

    Pheromones produce dramatic behavioral and physiological responses in a wide variety of species. Releaser pheromones elicit rapid responses within seconds or minutes, while primer pheromones produce long-term changes which may take days to manifest. Honeybee queen mandibular pheromone (QMP) elicits multiple distinct behavioral and physiological responses in worker bees, as both a releaser and primer, and thus produces responses on vastly different time scales. In this study, we demonstrate that releaser and primer responses to QMP can be uncoupled. First, treatment with the juvenile hormone analog methoprene leaves a releaser response (attraction to QMP) intact, but modulates QMP’s primer effects on sucrose responsiveness. Secondly, two components of QMP (9-ODA and 9-HDA) do not elicit a releaser response (attraction) but are as effective as QMP at modulating a primer response, downregulation of foraging-related brain gene expression. These results suggest that different responses to a single pheromone may be produced via distinct pathways.

  10. PrimerSeq:Design and Visualization of RT-PCR Primers for Alternative Splicing Using RNA-seq Data

    Institute of Scientific and Technical Information of China (English)

    Collin Tokheim; Juw Won Park; Yi Xing

    2014-01-01

    The vast majority of multi-exon genes in higher eukaryotes are alternatively spliced and changes in alternative splicing (AS) can impact gene function or cause disease. High-throughput RNA sequencing (RNA-seq) has become a powerful technology for transcriptome-wide analysis of AS, but RT-PCR still remains the gold-standard approach for quantifying and validating exon splicing levels. We have developed PrimerSeq, a user-friendly software for systematic design and visualization of RT-PCR primers using RNA-seq data. PrimerSeq incorporates user-provided tran-scriptome profiles (i.e., RNA-seq data) in the design process, and is particularly useful for large-scale quantitative analysis of AS events discovered from RNA-seq experiments. PrimerSeq features a graphical user interface (GUI) that displays the RNA-seq data juxtaposed with the expected RT-PCR results. To enable primer design and visualization on user-provided RNA-seq data and transcript annotations, we have developed PrimerSeq as a stand-alone software that runs on local computers. PrimerSeq is freely available for Windows and Mac OS X along with source code at http://primerseq.sourceforge.net/. With the growing popularity of RNA-seq for transcriptome stud-ies, we expect PrimerSeq to help bridge the gap between high-throughput RNA-seq discovery of AS events and molecular analysis of candidate events by RT-PCR.

  11. Fast, reliable sexing of prosimian DNA

    DEFF Research Database (Denmark)

    Fredsted, Tina; Villesen, Palle

    2004-01-01

    Molecular sexing of mammals is normally done by PCR amplification of Y chromosomal fragments, or coamplification of homologous fragments from both sex chromosomes. Existing primers are often unreliable for distantly related species due to mutations in primer regions. Currently there are no...... published primers for the sexing of prosimian DNA. We show that an existing method (using the zinc finger protein) based on a size difference between the X and Y homologs does not work in prosimians. Multiple alignments of distantly related mammalian species from Genbank and genome databases enabled us to...... identify conserved regions in the amelogenin gene. Using these conserved regions, we can target species that have no sequence information. We designed a single, conserved primer pair that is useful for fast and reliable molecular sexing of prosimian primates. A single PCR yields two fragments in males and...

  12. Guanine-rich sequences inhibit proofreading DNA polymerases

    Science.gov (United States)

    Zhu, Xiao-Jing; Sun, Shuhui; Xie, Binghua; Hu, Xuemei; Zhang, Zunyi; Qiu, Mengsheng; Dai, Zhong-Min

    2016-01-01

    DNA polymerases with proofreading activity are important for accurate amplification of target DNA. Despite numerous efforts have been made to improve the proofreading DNA polymerases, they are more susceptible to be failed in PCR than non-proofreading DNA polymerases. Here we showed that proofreading DNA polymerases can be inhibited by certain primers. Further analysis showed that G-rich sequences such as GGGGG and GGGGHGG can cause PCR failure using proofreading DNA polymerases but not Taq DNA polymerase. The inhibitory effect of these G-rich sequences is caused by G-quadruplex and is dose dependent. G-rich inhibitory sequence-containing primers can be used in PCR at a lower concentration to amplify its target DNA fragment. PMID:27349576

  13. Coordinated DNA dynamics during the human telomerase catalytic cycle

    Science.gov (United States)

    Parks, Joseph W.; Stone, Michael D.

    2014-06-01

    The human telomerase reverse transcriptase (hTERT) utilizes a template within the integral RNA subunit (hTR) to direct extension of telomeres. Telomerase exhibits repeat addition processivity (RAP) and must therefore translocate the nascent DNA product into a new RNA:DNA hybrid register to prime each round of telomere repeat synthesis. Here, we use single-molecule FRET and nuclease protection assays to monitor telomere DNA structure and dynamics during the telomerase catalytic cycle. DNA translocation during RAP proceeds through a previously uncharacterized kinetic substep during which the 3‧-end of the DNA substrate base pairs downstream within the hTR template. The rate constant for DNA primer realignment reveals this step is not rate limiting for RAP, suggesting a second slow conformational change repositions the RNA:DNA hybrid into the telomerase active site and drives the extrusion of the 5‧-end of the DNA primer out of the enzyme complex.

  14. A primer on climate relevant technology transfer

    International Nuclear Information System (INIS)

    The aim of this primer is to support technology transfer initiatives related to mitigation of emissions of greenhouse gases and adaptation to climate change in developing countries and economies in transition. It is meant to provide guidance to all parties involved in the transfer of climate relevant technologies, micluding government, business organisations and other non-governmental organizations representing all sectors relevant for climate change. The emphasis in this primer is on strategic and organisational issues related to the transfer of climate relevant technologies, in particular with a view to utilise climate-relevant technologies in the development process of developing countries and countries in economic transition. It builds upon insight gained in National Needs Assessments regarding the Transfer of Enviromentally Sound Technologies to developing countries. Chapter 2 deals with the technology transfer process for climate relevant technologies. It provides a framework for co-ordinated action of the stakeholders involved in the technology transfer process, with a view to improve the utilisation of climate relevant technologies in the development process of developing countries. It therefore proposes three main 'pillars' for climate relevant technology transfer, i.e. creating an enabling environment for stakeholders' participation, assessing mitigation and adaptation needs and opportunities, and implementing and evaluating mitigation and adaptation actions. Chapter 3 elaborates on creating an enabling environment for stakeholders' participation. It deals in particular with the selection of priority sectors and obtaining involvement of stakeholders representing these prioritised sectors, in order to start a roundtable process for the preparation of mitigation and adaptation actions. Chapter 4 covers the second pillar 'assessing mitigation and adaptation needs and opportunities'. This encompasses several assessment tasks including: identification and

  15. Asymmetric PCR method in generation of HBV ssDNA for pyrosequencing

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    Objective To explore the optimal primer ratio and concentration of asymmetric polymerase chain reaction (A-PCR) in producing hepatitis B virus (HBV) single-stranded DNA (ssDNA) for pyrosequencing. Methods A-PCR was carried out to generate HBV ssDNA with forward to reverse primers of different ratios (50∶1, 100∶1) and concentrations (13.0 pmol/25μL and 0.14 pmol/25μL, 19.5 pmol/25μL and 0.21 pmol/25μL), and the product yield and quality were compared respectively. Results The forward to reverse primer ratio ...

  16. PCR primers to study the diversity of expressed fungal genes encoding lignocellulolytic enzymes in soils using high-throughput sequencing.

    Science.gov (United States)

    Barbi, Florian; Bragalini, Claudia; Vallon, Laurent; Prudent, Elsa; Dubost, Audrey; Fraissinet-Tachet, Laurence; Marmeisse, Roland; Luis, Patricia

    2014-01-01

    Plant biomass degradation in soil is one of the key steps of carbon cycling in terrestrial ecosystems. Fungal saprotrophic communities play an essential role in this process by producing hydrolytic enzymes active on the main components of plant organic matter. Open questions in this field regard the diversity of the species involved, the major biochemical pathways implicated and how these are affected by external factors such as litter quality or climate changes. This can be tackled by environmental genomic approaches involving the systematic sequencing of key enzyme-coding gene families using soil-extracted RNA as material. Such an approach necessitates the design and evaluation of gene family-specific PCR primers producing sequence fragments compatible with high-throughput sequencing approaches. In the present study, we developed and evaluated PCR primers for the specific amplification of fungal CAZy Glycoside Hydrolase gene families GH5 (subfamily 5) and GH11 encoding endo-β-1,4-glucanases and endo-β-1,4-xylanases respectively as well as Basidiomycota class II peroxidases, corresponding to the CAZy Auxiliary Activity family 2 (AA2), active on lignin. These primers were experimentally validated using DNA extracted from a wide range of Ascomycota and Basidiomycota species including 27 with sequenced genomes. Along with the published primers for Glycoside Hydrolase GH7 encoding enzymes active on cellulose, the newly design primers were shown to be compatible with the Illumina MiSeq sequencing technology. Sequences obtained from RNA extracted from beech or spruce forest soils showed a high diversity and were uniformly distributed in gene trees featuring the global diversity of these gene families. This high-throughput sequencing approach using several degenerate primers constitutes a robust method, which allows the simultaneous characterization of the diversity of different fungal transcripts involved in plant organic matter degradation and may lead to the

  17. PCR primers to study the diversity of expressed fungal genes encoding lignocellulolytic enzymes in soils using high-throughput sequencing.

    Directory of Open Access Journals (Sweden)

    Florian Barbi

    Full Text Available Plant biomass degradation in soil is one of the key steps of carbon cycling in terrestrial ecosystems. Fungal saprotrophic communities play an essential role in this process by producing hydrolytic enzymes active on the main components of plant organic matter. Open questions in this field regard the diversity of the species involved, the major biochemical pathways implicated and how these are affected by external factors such as litter quality or climate changes. This can be tackled by environmental genomic approaches involving the systematic sequencing of key enzyme-coding gene families using soil-extracted RNA as material. Such an approach necessitates the design and evaluation of gene family-specific PCR primers producing sequence fragments compatible with high-throughput sequencing approaches. In the present study, we developed and evaluated PCR primers for the specific amplification of fungal CAZy Glycoside Hydrolase gene families GH5 (subfamily 5 and GH11 encoding endo-β-1,4-glucanases and endo-β-1,4-xylanases respectively as well as Basidiomycota class II peroxidases, corresponding to the CAZy Auxiliary Activity family 2 (AA2, active on lignin. These primers were experimentally validated using DNA extracted from a wide range of Ascomycota and Basidiomycota species including 27 with sequenced genomes. Along with the published primers for Glycoside Hydrolase GH7 encoding enzymes active on cellulose, the newly design primers were shown to be compatible with the Illumina MiSeq sequencing technology. Sequences obtained from RNA extracted from beech or spruce forest soils showed a high diversity and were uniformly distributed in gene trees featuring the global diversity of these gene families. This high-throughput sequencing approach using several degenerate primers constitutes a robust method, which allows the simultaneous characterization of the diversity of different fungal transcripts involved in plant organic matter degradation and may

  18. Development of genome-specific primers for homoeologous genes in allopolyploid species: the waxy and starch synthase II genes in allohexaploid wheat (Triticum aestivum L. as examples

    Directory of Open Access Journals (Sweden)

    Brûlé-Babel Anita

    2010-05-01

    Full Text Available Abstract Background In allopolypoid crops, homoeologous genes in different genomes exhibit a very high sequence similarity, especially in the coding regions of genes. This makes it difficult to design genome-specific primers to amplify individual genes from different genomes. Development of genome-specific primers for agronomically important genes in allopolypoid crops is very important and useful not only for the study of sequence diversity and association mapping of genes in natural populations, but also for the development of gene-based functional markers for marker-assisted breeding. Here we report on a useful approach for the development of genome-specific primers in allohexaploid wheat. Findings In the present study, three genome-specific primer sets for the waxy (Wx genes and four genome-specific primer sets for the starch synthase II (SSII genes were developed mainly from single nucleotide polymorphisms (SNPs and/or insertions or deletions (Indels in introns and intron-exon junctions. The size of a single PCR product ranged from 750 bp to 1657 bp. The total length of amplified PCR products by these genome-specific primer sets accounted for 72.6%-87.0% of the Wx genes and 59.5%-61.6% of the SSII genes. Five genome-specific primer sets for the Wx genes (one for Wx-7A, three for Wx-4A and one for Wx-7D could distinguish the wild type wheat and partial waxy wheat lines. These genome-specific primer sets for the Wx and SSII genes produced amplifications in hexaploid wheat, cultivated durum wheat, and Aegilops tauschii accessions, but failed to generate amplification in the majority of wild diploid and tetraploid accessions. Conclusions For the first time, we report on the development of genome-specific primers from three homoeologous Wx and SSII genes covering the majority of the genes in allohexaploid wheat. These genome-specific primers are being used for the study of sequence diversity and association mapping of the three homoeologous Wx

  19. Genetic diversity analysis of Penicillium marneffei isolated from AIDS patients in Guangdong, China using randomly amplified polymorphic DNA

    Institute of Scientific and Technical Information of China (English)

    LI Ling-hua; HU Feng-yu; CHEN Wan-shan; CAI Wei-ping; SONG Wei-nan; KUANG Yan-ling; TANG Xiao-ping

    2012-01-01

    Background Penicillium mameffei (P.mameffei) is an emerging pathogenic fungus that can cause invasive mycosis in patients with AIDS.The epidemiological features of P.mameffei infection in AIDS patients in Guangdong province remain unclear so far.This study aimed to investigate the genetic diversity within a population of 163 P.mameffei isolates obtained from AIDS patients and search for the dominant clinical strains in Guangdong province.Methods One hundred and sixty-three P.marneffeiisolates obtained from AIDS patients in Guangdong province during January 2004 and December 2009 were studied by randomly amplified polymorphic DNA (RAPD) using two random primers (H2 and H22).The degree of similarity between samples was calculated through similarity coefficients from RAPD fragment data and the dendrogram was assessed using the unweighted pair group method with arithmetic mean (UPGMA).Results Two primers showed a high degree of discrimination and good stability.Primer H2 yielded eight different patterns (H2-1 to H2-8) among 163 isolates with the discriminatory power being 0.413.Primer H22 identified seven types (H22-1 to H22-7) among 163 isolates with the discriminatory power being 0.467.Genetic similarity coefficients based on RAPD data among 163 P.marneffei isolates ranged from 0.681 to 0.957,61.96% of which were no less than 0.83.The discriminatory power of the two primers was 0.524.One hundred and sixty-three P.marneffei isolates were clustered into nine distinct groups (groups I to IX) at the similarity coefficient value of 0.83 and group Ⅰ was the most common,including 101 strains (61.96%).Conclusion The RAPD analyses could provide important information as to the degree of genetic diversity and the relationship among clinical P.mameffei isolates,revealing genetic polymorphism and dominant strains.

  20. Primer on electricity futures and other derivatives

    International Nuclear Information System (INIS)

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area

  1. Primer on electricity futures and other derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.

  2. Ancient DNA

    DEFF Research Database (Denmark)

    Willerslev, Eske; Cooper, Alan

    2004-01-01

    ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair......ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair...

  3. Quantitative Single-letter Sequencing: a method for simultaneously monitoring numerous known allelic variants in single DNA samples

    Directory of Open Access Journals (Sweden)

    Duborjal Hervé

    2008-02-01

    Full Text Available Abstract Background Pathogens such as fungi, bacteria and especially viruses, are highly variable even within an individual host, intensifying the difficulty of distinguishing and accurately quantifying numerous allelic variants co-existing in a single nucleic acid sample. The majority of currently available techniques are based on real-time PCR or primer extension and often require multiplexing adjustments that impose a practical limitation of the number of alleles that can be monitored simultaneously at a single locus. Results Here, we describe a novel method that allows the simultaneous quantification of numerous allelic variants in a single reaction tube and without multiplexing. Quantitative Single-letter Sequencing (QSS begins with a single PCR amplification step using a pair of primers flanking the polymorphic region of interest. Next, PCR products are submitted to single-letter sequencing with a fluorescently-labelled primer located upstream of the polymorphic region. The resulting monochromatic electropherogram shows numerous specific diagnostic peaks, attributable to specific variants, signifying their presence/absence in the DNA sample. Moreover, peak fluorescence can be quantified and used to estimate the frequency of the corresponding variant in the DNA population. Using engineered allelic markers in the genome of Cauliflower mosaic virus, we reliably monitored six different viral genotypes in DNA extracted from infected plants. Evaluation of the intrinsic variance of this method, as applied to both artificial plasmid DNA mixes and viral genome populations, demonstrates that QSS is a robust and reliable method of detection and quantification for variants with a relative frequency of between 0.05 and 1. Conclusion This simple method is easily transferable to many other biological systems and questions, including those involving high throughput analysis, and can be performed in any laboratory since it does not require specialized

  4. An Introduction to DNA Fingerprinting.

    Science.gov (United States)

    Hepfer, Carol Ely; And Others

    1993-01-01

    Provides background information on DNA fingerprinting, and describes exercises for introducing general biology students at the high school or college level to the methodology and applications of DNA fingerprinting. (PR)

  5. Building Background Knowledge

    Science.gov (United States)

    Neuman, Susan B.; Kaefer, Tanya; Pinkham, Ashley

    2014-01-01

    This article make a case for the importance of background knowledge in children's comprehension. It suggests that differences in background knowledge may account for differences in understanding text for low- and middle-income children. It then describes strategies for building background knowledge in the age of common core standards.

  6. Specific primers design based on the superoxide dismutase b gene for Trypanosoma cruzi as a screening tool:Validation method using strains from Colombia classified according to their discrete typing unit

    Institute of Scientific and Technical Information of China (English)

    Francisco Olmo; Javier Escobedo-Ortegn; Patricia Palma; Manuel Snchez-Moreno; Ana Meja-Jaramillo; Omar Triana; Clotilde Marn

    2014-01-01

    Objective:To classify 21 new isolates of Trypanosoma cruzi (T. cruzi) according to the Discrete Typing Unit (DTU) which they belong to, as well as tune up a new pair of primers designed to detect the parasite in biological samples. Methods: Strains were isolated, DNA extracted, and classified by using three Polymerase Chain Reactions (PCR). Subsequently this DNA was used along with other isolates of various biological samples, for a new PCR using primers designed. Finally, the amplified fragments were sequenced. Results: It was observed the predominance of DTU I in Colombia, as well as the specificity of our primers for detection of T. cruzi, while no band was obtained when other species were used. Conclusions:This work reveals the genetic variability of 21 new isolates of T. cruzi in Colombia.Our primers confirmed their specificity for detecting the presence of T. cruzi.

  7. Target Detection Assay (TDA): a versatile procedure to determine DNA binding sites as demonstrated on SP1 protein.

    OpenAIRE

    Thiesen, H J; Bach, C.

    1990-01-01

    We developed a rapid method designated Target Detection Assay (TDA) to determine DNA binding sites for putative DNA binding proteins. A purified, functionally active DNA binding protein and a pool of random double-stranded oligonucleotides harbouring PCR primer sites at each end are included the TDA cycle which consists of four separate steps: a DNA protein incubation step, a protein DNA complex separation step, a DNA elution step and a polymerase chain reaction (PCR) DNA amplification step. ...

  8. Genome fingerprinting of the silkworm, Bombyx mori, using random arbitrary primers.

    Science.gov (United States)

    Nagaraja, G M; Nagaraju, J

    1995-09-01

    The random amplified polymorphic DNA (RAPD) technique was used to study DNA profiling of thirteen silkworm genotypes. The genotypes included six diapausing and seven nondiapausing varieties that represent a high degree of divergence with respect to geographic origin, and morphological, qualitative, quantitative and biochemical characters. Two hundred sixteen amplified products were generated using 40 random primers. Genotype-specific amplification products were identified. Amplification products specific to diapausing genotypes were also identified. Segregation of the RAPD marker was analyzed in a backcross population and found to be inherited as dominant Mendelian traits. Based on pairwise comparison of amplified products, the genetic similarity was performed by a hierarchical clustering technique. Silkworm genotypes were clustered into two groups, one consisting of six diapausing and the other of seven nondiapausing genotypes. The results of our study suggest that the RAPD technique could be used as a powerful tool to generate genetic markers that are linked to traits of interest in the silkworm. PMID:8582347

  9. The construction and use of bacterial DNA microarrays based on an optimized two-stage PCR strategy

    Directory of Open Access Journals (Sweden)

    Pesta David

    2003-06-01

    Full Text Available Abstract Background DNA microarrays are a powerful tool with important applications such as global gene expression profiling. Construction of bacterial DNA microarrays from genomic sequence data using a two-stage PCR amplification approach for the production of arrayed DNA is attractive because it allows, in principal, the continued re-amplification of DNA fragments and facilitates further utilization of the DNA fragments for additional uses (e.g. over-expression of protein. We describe the successful construction and use of DNA microarrays by the two-stage amplification approach and discuss the technical challenges that were met and resolved during the project. Results Chimeric primers that contained both gene-specific and shared, universal sequence allowed the two-stage amplification of the 3,168 genes identified on the genome of Synechocystis sp. PCC6803, an important prokaryotic model organism for the study of oxygenic photosynthesis. The gene-specific component of the primer was of variable length to maintain uniform annealing temperatures during the 1st round of PCR synthesis, and situated to preserve full-length ORFs. Genes were truncated at 2 kb for efficient amplification, so that about 92% of the PCR fragments were full-length genes. The two-stage amplification had the additional advantage of normalizing the yield of PCR products and this improved the uniformity of DNA features robotically deposited onto the microarray surface. We also describe the techniques utilized to optimize hybridization conditions and signal-to-noise ratio of the transcription profile. The inter-lab transportability was demonstrated by the virtual error-free amplification of the entire genome complement of 3,168 genes using the universal primers in partner labs. The printed slides have been successfully used to identify differentially expressed genes in response to a number of environmental conditions, including salt stress. Conclusions The technique detailed

  10. The Geometry of Soft Materials: A Primer

    OpenAIRE

    Kamien, Randall D.

    2002-01-01

    We present an overview of the differential geometry of curves and surfaces using examples from soft matter as illustrations. The presentation requires a background only in vector calculus and is otherwise self-contained.

  11. Novel primers and PCR protocols for the specific detection and quantification of Sphingobium suberifaciens in situ.

    Science.gov (United States)

    Bull, Carolee T; Goldman, Polly H; Martin, Kendall J

    2014-01-01

    The pathogen causing corky root on lettuce, Sphingobium suberifaciens, is recalcitrant to standard epidemiological methods. Primers were developed from 16S rDNA sequences to be useful for the specific detection and quantification of S. suberifaciens. Quantitative PCR (qPCR) protocols specifically amplified DNA from the type strain of S. suberifaciens (LMG 17323) and other members of this species but not from other members of the Sphingomonadaceae. The detection limit was as little as 100 fg DNA (equivalent to 2 × 10(2) cells) in the qPCR. Detection was successful from soils inoculated with as little as 1 × 10(3) CFU/g soil. DNA isolated from naturally infested soils and diseased lettuce roots was amplified and sequenced fragments were identical or nearly identical to 16S rDNA sequences from S. suberifaciens. In growth chamber experiments, there was a positive correlation between disease severity and S. suberifaciens population levels in roots and soil, as detected by qPCR. Detection levels were below population levels of the pathogen necessary for disease development. PMID:24647265

  12. Simple, multiplexed, PCR-based barcoding of DNA enables sensitive mutation detection in liquid biopsies using sequencing.

    Science.gov (United States)

    Ståhlberg, Anders; Krzyzanowski, Paul M; Jackson, Jennifer B; Egyud, Matthew; Stein, Lincoln; Godfrey, Tony E

    2016-06-20

    Detection of cell-free DNA in liquid biopsies offers great potential for use in non-invasive prenatal testing and as a cancer biomarker. Fetal and tumor DNA fractions however can be extremely low in these samples and ultra-sensitive methods are required for their detection. Here, we report an extremely simple and fast method for introduction of barcodes into DNA libraries made from 5 ng of DNA. Barcoded adapter primers are designed with an oligonucleotide hairpin structure to protect the molecular barcodes during the first rounds of polymerase chain reaction (PCR) and prevent them from participating in mis-priming events. Our approach enables high-level multiplexing and next-generation sequencing library construction with flexible library content. We show that uniform libraries of 1-, 5-, 13- and 31-plex can be generated. Utilizing the barcodes to generate consensus reads for each original DNA molecule reduces background sequencing noise and allows detection of variant alleles below 0.1% frequency in clonal cell line DNA and in cell-free plasma DNA. Thus, our approach bridges the gap between the highly sensitive but specific capabilities of digital PCR, which only allows a limited number of variants to be analyzed, with the broad target capability of next-generation sequencing which traditionally lacks the sensitivity to detect rare variants. PMID:27060140

  13. DIFFERENT RESULTS BY DIFFERENT COMMERCIAL TAQ DNA POLYMERASE IN RAPD

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    @@ RAPD (Random Amplified Polymorphic DNA) technique has been widely used in animal, plant, human and microorganism research since it was first established by Williams in 1990[1-3]. But, because of low annealed temperature and short 10-nt primers, the resolution and repetition is low in RAPD. The stability of RAPD is influenced by many factors such as the concentration of template, primers, dNTP, Mg++,and Taq DNA polymerase[4-6]. The influence on amplified products of different commercial Taq DNA polymerase in RAPD was studied in this paper.

  14. propósito del primer centenario

    Directory of Open Access Journals (Sweden)

    René Martínez Lemoine

    2007-01-01

    Full Text Available Este trabajo, trata de las apreciaciones públicas y urbanas que se dieron en la ciudad de Santiago a instancias de la celebración del primer Centenario de la República, en el año 1910. Es una rememoranza de aquellas visiones que la ciudad sustrajo a los medios periodísticos, personajes y liderazgos de una sociedad autosatisfecha por el progreso notable alcanzado por el país en las últimas décadas del siglo XIX y los primeros años del siglo XX, pero que ignoró los movimientos obreros y expresiones de disconformidad social que ya comenzaban a ebullir en esos años. La ciudad, como una vasta, compleja y heterogénea construcción en el espacio, erigida a través de las edades por innumerables y, la más de las veces, anónimos constructores, representa la mayor suma de obra humana acumulada en el tiempo, en la que cada generación va dejando una muestra de su aporte en vivienda, espacios, instalaciones y monumentos, vale decir, de su particular cultura y modo de vida en su propio tiempo. Ciertamente, cada ciudad es historia y memoria de sí misma, testimonio permanente de la continuidad del hombre y de la sociedad humana con su propio pasado. En ese sentido, como somos herederos de nuestra historia y de los hombres y mujeres que construyeron y legaron las ciudades en las que vivimos, es importante rescatar esos valores culturales, sociales, arquitectónicos y urbanísticos de modo de visualizar el paso del tiempo, que se materializa, se hace objeto y se torna visible en la ciudad, en la medida que nos “cuenta” algo.

  15. Heterologous primer transferability and access to microsatellite loci polymorphism in ‘somnus’ passion fruit tree (Passiflora setacea DC

    Directory of Open Access Journals (Sweden)

    Douglas de Almeida Pereira

    2015-09-01

    Full Text Available Primer pairs that access microsatellite loci, initially constructed through the genome of Passiflora edulis Sims flavicarpa and P. alata, were tested concerning their ability to access microsatellite loci in ‘somnus’ passion fruit tree (P. setacea individuals. Seven out of the thirty one primer pairs tested were able to access DNA polymorphism in the genome of this wild Passiflora species, by evaluating six natural populations, located in a transition area between the biomes Caatinga and Cerrado, in the state of Bahia, Brazil. The number of alleles/loci was small, oscillating from 1 to 4. The average heterozygosity observed per locus in all populations ranged from 0.13 to 0.40. There was transference of heterologous microsatellite primer pairs from the Passiflora genus to ‘somnus’ passion fruit tree, constituting a new set of primers that access random co-dominant locus in this species, useful for conservationist purposes and pre-improvement of ‘somnus’ passion fruit tree.

  16. PRIMER FOR FINANCIAL ANALYSIS OF POLLUTION PREVENTION PROJECTS

    Science.gov (United States)

    This primer will serve as a basic guide to pollution prevention investment -- specifically, the preparation of financial comparisons and justifications for such expenditures. he emphasis is on the basic analytical techniques needed to justify pollution prevention investments. onc...

  17. An asymmetric PCR-based, reliable and rapid single-tube native DNA engineering strategy

    Directory of Open Access Journals (Sweden)

    Bi Yanzhen

    2012-07-01

    Full Text Available Abstract Background Widely used restriction-dependent cloning methods are labour-intensive and time-consuming, while several types of ligase-independent cloning approaches have inherent limitations. A rapid and reliable method of cloning native DNA sequences into desired plasmids are highly desired. Results This paper introduces ABI-REC, a novel strategy combining asymmetric bridge PCR with intramolecular homologous recombination in bacteria for native DNA cloning. ABI-REC was developed to precisely clone inserts into defined location in a directional manner within recipient plasmids. It featured an asymmetric 3-primer PCR performed in a single tube that could robustly amplify a chimeric insert-plasmid DNA sequence with homologous arms at both ends. Intramolecular homologous recombination occurred to the chimera when it was transformed into E.coli and produced the desired recombinant plasmids with high efficiency and fidelity. It is rapid, and does not involve any operational nucleotides. We proved the reliability of ABI-REC using a double-resistance reporter assay, and investigated the effects of homology and insert length upon its efficiency. We found that 15 bp homology was sufficient to initiate recombination, while 25 bp homology had the highest cloning efficiency. Inserts up to 4 kb in size could be cloned by this method. The utility and advantages of ABI-REC were demonstrated through a series of pig myostatin (MSTN promoter and terminator reporter plasmids, whose transcriptional activity was assessed in mammalian cells. We finally used ABI-REC to construct a pig MSTN promoter-terminator cassette reporter and showed that it could work coordinately to express EGFP. Conclusions ABI-REC has the following advantages: (i rapid and highly efficient; (ii native DNA cloning without introduction of extra bases; (iii restriction-free; (iv easy positioning of directional and site-specific recombination owing to formulated primer design. ABI

  18. FONZIE: An optimized pipeline for minisatellite marker discovery and primer design from large sequence data sets

    Directory of Open Access Journals (Sweden)

    Balesdent Marie-Hélène

    2010-11-01

    Full Text Available Abstract Background Micro-and minisatellites are among the most powerful genetic markers known to date. They have been used as tools for a large number of applications ranging from gene mapping to phylogenetic studies and isolate typing. However, identifying micro-and minisatellite markers on large sequence data sets is often a laborious process. Results FONZIE was designed to successively 1 perform a search for markers via the external software Tandem Repeat Finder, 2 exclude user-defined specific genomic regions, 3 screen for the size and the percent matches of each relevant marker found by Tandem Repeat Finder, 4 evaluate marker specificity (i.e., occurrence of the marker as a single copy in the genome using BLAST2.0, 5 design minisatellite primer pairs via the external software Primer3, and 6 check the specificity of each final PCR product by BLAST. A final file returns to users all the results required to amplify markers. A biological validation of the approach was performed using the whole genome sequence of the phytopathogenic fungus Leptosphaeria maculans, showing that more than 90% of the minisatellite primer pairs generated by the pipeline amplified a PCR product, 44.8% of which showed agarose-gel resolvable polymorphism between isolates. Segregation analyses confirmed that the polymorphic minisatellites corresponded to single-locus markers. Conclusion FONZIE is a stand-alone and user-friendly application developed to minimize tedious manual operations, reduce errors, and speed up the search for efficient minisatellite and microsatellite markers departing from whole-genome sequence data. This pipeline facilitates the integration of data and provides a set of specific primer sequences for PCR amplification of single-locus markers. FONZIE is freely downloadable at: http://www.versailles-grignon.inra.fr/bioger/equipes/leptosphaeria_maculans/outils_d_analyses/fonzie

  19. PEB1-LTB DNA vaccine primer-protein boost enhances the immunization against Campylobacter ;jejuni in mice%抗空肠弯曲菌 PEB1-LTB 疫苗联合应用增强免疫应答的研究

    Institute of Scientific and Technical Information of China (English)

    刘琳琳

    2014-01-01

    Objective To develop novel and effective Campylobacter jejuni vaccine, we constructed Campylobacter jejuni gene PEB1 fused LTB. In present study, we determined if the pcDNA3.1(-)-PEB1-LTB DNA vaccines boosting with PEB1-LTB protein vaccines could enhance immunization in mice. Methods We immunized mice by intramuscular injection. The mice were inoculated with DNA vaccines and DNA boosting with protein at 0, 3, 6 week. The specific humoral and cellular immune responses were detected at 5,8 week. Results In the DNA vaccine prime-boost group after 3 times, the levels of IgG in serum, (14.392±0.579)μg/ml were higher than the others. The DNA vaccine boosting protein vaccine could enhance the humoral response. But the levels of IFN-γ, (1472.34±73.99)pg/ml in PEB1-LTB DNA vaccine were the highest. Conclusions DNA vaccines can induce different immunization, specially the better cellular immune responses, compared with DNA vaccines boosting with protein vaccines. The results provide a basis for ration design and application of the Campylobacter jejuni vaccine.%目的:为研制有效的空肠弯曲菌疫苗,构建 PEB1与 LTB 融合基因的空肠弯曲菌疫苗,并初步探讨pcDNA3.1(-)-PEB1-LTB核酸疫苗与蛋白疫苗联合免疫BALB/c小鼠的免疫应答水平。方法通过腿部肌肉注射免疫小鼠的方式,在第0、3、6周采用核酸单独免疫与核酸蛋白联合免疫小鼠的免疫程序,于第5、8周末,测量小鼠体液免疫应答和细胞免疫应答水平。结果3次免疫后,核酸蛋白免疫组诱导的IgG抗体含量[(14.392±0.579)μg/ml]是核酸疫苗单独免疫的2.43倍(P<0.05),说明核酸蛋白联合免疫诱导了更高的体液免疫应答水平;3次免疫后,核酸疫苗单独免疫组诱导的IFN-γ水平[(1472.34±73.99)pg/ml]是联合免疫组[(290.323±15.46)pg/ml]的5.07倍,说明PEB1-LTB核酸疫苗单独免疫诱导较高的细胞免疫应答。结论核酸疫苗能诱导较

  20. Loop-Mediated Amplification Accelerated by Stem Primers

    OpenAIRE

    Laurence Tisi; Guy Kiddle; Olga Gandelman; Rebecca Jackson

    2011-01-01

    Isothermal nucleic acid amplifications (iNAATs) have become an important alternative to PCR for in vitro molecular diagnostics in all fields. Amongst iNAATs Loop-mediated amplification (LAMP) has gained much attention over the last decade because of the simplicity of hardware requirements. LAMP demonstrates performance equivalent to that of PCR, but its application has been limited by the challenging primer design. The design of six primers in LAMP requires a selection of eight priming sites ...

  1. EFFECTIVE METHOD TO EXTRACT DNA FROM ENVIRONMENTAL SAMPLES FOR POLYMERASE CHAIN REACTION AMPLIFICATION AND DNA FINGERPRINT ANALYSIS

    Science.gov (United States)

    A rapid direct-extraction method was used to obtain DNA from environmental soil samples. eat, enzymes, and guanidine isothiocyanate were utilized to lyse cells. he DNA was purified by agarose gel electrophoresis, amplified with 16S based primers by use of the polymerase chain rea...

  2. Fluorescent-increase kinetics of different fluorescent reporters used for qPCR depend on monitoring chemistry, targeted sequence, type of DNA input and PCR efficiency

    International Nuclear Information System (INIS)

    The analysis of quantitative PCR data usually does not take into account the fact that the increase in fluorescence depends on the monitoring chemistry, the input of ds-DNA or ss-cDNA, and the directionality of the targeting of probes or primers. The monitoring chemistries currently available can be categorized into six groups: (A) DNA-binding dyes; (B) hybridization probes; (C) hydrolysis probes; (D) LUX primers; (E) hairpin primers; and (F) the QZyme system. We have determined the kinetics of the increase in fluorescence for each of these groups with respect to the input of both ds-DNA and ss-cDNA. For the latter, we also evaluated mRNA and cDNA targeting probes or primers. This analysis revealed three situations. Hydrolysis probes and LUX primers, compared to DNA-binding dyes, do not require a correction of the observed quantification cycle. Hybridization probes and hairpin primers require a correction of −1 cycle (dubbed C-lag), while the QZyme system requires the C-lag correction and an efficiency-dependent C-shift correction. A PCR efficiency value can be derived from the relative increase in fluorescence in the exponential phase of the amplification curve for all monitoring chemistries. In case of hydrolysis probes, LUX primers and hairpin primers, however, this should be performed after cycle 12, and for the QZyme system after cycle 19, to keep the overestimation of the PCR efficiency below 0.5 %. (author)

  3. Establishment of Ecotilling for Discovery of DNA Polymorphisms in Brassica rapa Natural Population

    Institute of Scientific and Technical Information of China (English)

    WU Jian; SUN Ri-fei; ZHANG Yan-guo; WANG Xiao-wu

    2005-01-01

    Ecotilling is a new approach based on enzyme-mediated heteroduplex cleavage to discover DNA polymorphisms in natural population. We used mung bean nuclease(MBN) instead of routinely used CELI to cleave single base pair mismatches in heteroduplex DNA templates. Nested set of primers were designed to amplify targeted region to avoid the influence of the variation in quality and quantity of the genomic DNA. To reduce the costs in fluorescently labeled primers, we added M13 adapter to 5'end of gene specific primers to make IRD dye labeled M13 forward and reverse primers possibly universal for different genes. A Brassica rapa ZIP gene homologue was subjected to the analysis to practise the feasibility of the method in polymorphisms detection. Our experiment showed this method is efficient in discovering DNA polymorphisms in Brassica rapa natural population.

  4. The Cosmic Microwave Background

    OpenAIRE

    Silk, Joseph

    2001-01-01

    This set of lectures provides an overview of the basic theory and phenomenology of the cosmic microwave background. Topics include a brief historical review; the physics of temperature and polarization fluctuations; acoustic oscillations of the primordial plasma; the space of inflationary cosmological models; current and potential constraints on these models from the microwave background; and constraints on inflation.

  5. A New Multiplex-PCR for Urinary Tract Pathogen Detection Using Primer Design Based on an Evolutionary Computation Method.

    Science.gov (United States)

    García, Liliana Torcoroma; Cristancho, Laura Maritza; Vera, Erika Patricia; Begambre, Oscar

    2015-10-28

    This work describes a new strategy for optimal design of Multiplex-PCR primer sequences. The process is based on the Particle Swarm Optimization-Simplex algorithm (Mult-PSOS). Diverging from previous solutions centered on heuristic tools, the Mult-PSOS is selfconfigured because it does not require the definition of the algorithm's initial search parameters. The successful performance of this method was validated in vitro using Multiplex- PCR assays. For this validation, seven gene sequences of the most prevalent bacteria implicated in urinary tract infections were taken as DNA targets. The in vitro tests confirmed the good performance of the Mult-PSOS, with respect to infectious disease diagnosis, in the rapid and efficient selection of the optimal oligonucleotide sequences for Multiplex-PCRs. The predicted sequences allowed the adequate amplification of all amplicons in a single step (with the correct amount of DNA template and primers), reducing significantly the need for trial and error experiments. In addition, owing to its independence from the initial selection of the heuristic constants, the Mult-PSOS can be employed by non-expert users in computational techniques or in primer design problems. PMID:26059514

  6. POSA: Perl Objects for DNA Sequencing Data Analysis

    Directory of Open Access Journals (Sweden)

    Jungerius Bart J

    2004-08-01

    Full Text Available Abstract Background Capillary DNA sequencing machines allow the generation of vast amounts of data with little hands-on time. With this expansion of data generation, there is a growing need for automated data processing. Most available software solutions, however, still require user intervention or provide modules that need advanced informatics skills to allow implementation in pipelines. Results Here we present POSA, a pair of new perl objects that describe DNA sequence traces and Phrap contig assemblies in detail. Methods included in POSA include basecalling with quality scores (by Phred, contig assembly (by Phrap, generation of primer3 input and automated SNP annotation (by PolyPhred. Although easily implemented by users with only limited programming experience, these objects considerabily reduce hands-on analysis time compared to using the Staden package for extracting sequence information from raw sequencing files and for SNP discovery. Conclusions The POSA objects allow a flexible and easy design, implementation and usage of perl-based pipelines to handle and analyze DNA sequencing data, while requiring only minor programming skills.

  7. Design of Vibrio 16S rRNA Gene Specific Primers and Their Application in the Analysis of Seawater Vibrio Community

    Institute of Scientific and Technical Information of China (English)

    LIU Yong; YANG Guanpin; WANG Hualei; CHEN Jixiang; SHI Xianming; ZOU Guiwei; WEI Qiwei; SUN Xiuqin

    2006-01-01

    The pathogenic species of genus Vibrio cause vibriosis, one of the most prevalent diseases of maricultured animals and seafood consumers. Monitoring their kinetics in the chain of seafood production, processing and consumption is of great importance for food and mariculture safety. In order to enrich Vibrio-representing 16S ribosomal RNA gene (rDNA) fragments and identify these bacteria further real-timely and synchronously among bacterial flora in the chain, a pair of primers that selectively amplify Vibrio 16S rDNA fragments were designed with their specificities and coverage testified in the analysis of seawater Vibrio community. The specificities and coverage of two primers, VF169 and VR744, were determined theoretically among bacterial 16S rDNAs available in GenBank by using BLAST program and practically by amplifying Vibrio 16S rDNA fragments from seawater DNA. More than 88.3% of sequences in GenBank, which showed identical matches with VR744, belong to Vibrio genus. A total of 33 clones were randomly selected and sequenced. All of the sequences showed their highest similarities to and clustered around those of diverse known Vibrio species. The primers designed are capable of retrieving a wide range of Vibrio 16S rDNA fragments specifically among bacterial flora in seawater, the most important natural environment of seafood cultivation.

  8. Polymerase chain reaction-mediated DNA fingerprinting for epidemiological studies on Campylobacter spp

    NARCIS (Netherlands)

    Giesendorf, B A; Goossens, H; Niesters, H G; Van Belkum, A; Koeken, A; Endtz, H P; Stegeman, H; Quint, W G

    1994-01-01

    The applicability of polymerase chain reaction (PCR)-mediated DNA typing, with primers complementary to dispersed repetitive DNA sequences and arbitrarily chosen DNA motifs, to study the epidemiology of campylobacter infection was evaluated. With a single PCR reaction and simple gel electrophoresis,

  9. Bleomycin-induced DNA synthesis in a cell-free system using a permeable mouse sarcoma cell Extract.

    Directory of Open Access Journals (Sweden)

    Seki,Shuji

    1987-10-01

    Full Text Available To investigate factors involved in excision repair DNA synthesis, a soluble extract was prepared from permeable mouse sarcoma (SR-C3H/He cells by homogenization and ultracentrifugation. DNA synthesis measured by using native calf thymus DNA as the template-primer and the extract as the polymerase source showed low activity. The DNA synthesis was enhanced more than ten-fold by the addition of an appropriate concentration of bleomycin, a radiomimetic DNA-damaging drug. Using selective inhibitors of DNA polymerases, it was shown that the DNA polymerase involved in the bleomycin-induced DNA synthesis was DNA polymerase beta. In addition to DNA polymerase beta, an exonuclease which converts bleomycin-damaged DNA into suitable template-primers for repair DNA synthesis appeared to be present in the permeable cell extract.

  10. TSUNAMI Primer: A Primer for Sensitivity/Uncertainty Calculations with SCALE

    Energy Technology Data Exchange (ETDEWEB)

    Rearden, Bradley T [ORNL; Mueller, Don [ORNL; Bowman, Stephen M [ORNL; Busch, Robert D. [University of New Mexico, Albuquerque; Emerson, Scott [University of New Mexico, Albuquerque

    2009-01-01

    This primer presents examples in the application of the SCALE/TSUNAMI tools to generate k{sub eff} sensitivity data for one- and three-dimensional models using TSUNAMI-1D and -3D and to examine uncertainties in the computed k{sub eff} values due to uncertainties in the cross-section data used in their calculation. The proper use of unit cell data and need for confirming the appropriate selection of input parameters through direct perturbations are described. The uses of sensitivity and uncertainty data to identify and rank potential sources of computational bias in an application system and TSUNAMI tools for assessment of system similarity using sensitivity and uncertainty criteria are demonstrated. Uses of these criteria in trending analyses to assess computational biases, bias uncertainties, and gap analyses are also described. Additionally, an application of the data adjustment tool TSURFER is provided, including identification of specific details of sources of computational bias.

  11. "PCR- Detection of Candida albicans in Blood Using a New Primer Pair to Diagnosis of Systemic Candidiasis"

    Directory of Open Access Journals (Sweden)

    SH Mirhendi

    2003-07-01

    Full Text Available The opportunistic pathogen C.albicans is able to cause disseminated infections in immunocompromised patients. Microbiological methods for the diagnosis of invasive candidiasis have many problems including low sensitivity, requirement to invasive clinical sampling such as biopsies or multiple blood cultures and need to expertise laboratory stuff. Since PCR has proven to be a powerful tool in the early diagnosis of several infectious diseases, we applied this approach as a rapid and sensitive method in detection of C.albicans cells in blood samples, for establishment a clinically useful method in diagnosing systemic candidiasis. DNA were extracted from blood samples seeded by serially diluted C.albicans cells, by omitting WBC and RBC followed by enzymatic breaking of fungal cell wall and phenol – chlorophorm extraction and alcohol precipitation of DNA. A new primer pair was designed for PCR-amplification of a part of ribosomal RNA gene. The primer set was able to amplify all medically important Candida species. When PCR was performed for detection of purified DNA, the sensitivity of the method was about 1 picogram fungal DNA, whereas the sensitivity for detection of C.albicans blastospores inoculated in blood was as few as 10 cell per 0.1 ml of blood. This method could be sensitive and useful for early and rapid diagnosis of systemic Candida infections and to simultaneous detection and speciation of Candida species by PCR-RFLP method.

  12. Identification of the B-cell tumor-specific molecular fingerprint using non-radiolabelled PCR consensus primers

    OpenAIRE

    Paolucci, G.; Pileri, S. A.; Pession, A.; Zinzani, P L; Rodriguez-Calvillo, M. (Mercedes); Inoges, S. (Susana); Sartini, R. (R.); Turi, C. (C.); Botti, S.; R. Maffei; Tonelli, R; M. Bendandi

    2001-01-01

    Abstract BACKGROUND: The complementarity determining region 3 (CDR3) of the immunoglobulin (Ig) heavy chain variable region (VH) is the most reliable molecular fingerprint for most if not all human B cells. The nucleotide sequence encoding for any B-cell tumor-specific VH CDR3 is currently identified by PCR sequencing based on procedures involving the usage of either radioactive materials, patient/family-specific primers, or bacterial cloning. PATIENTS AND METHODS: In six consecut...

  13. Studies on the Primers Screening for AFLP Fingerprints of Rice Cultivars

    Institute of Scientific and Technical Information of China (English)

    ZHANG Chun-qing; JIA Ji-zeng

    2002-01-01

    AFLP(amplified fragment length polymorphism) is a very powerful fingerprinting technology.The key of making variety fingerprints is to select specific powerful primers for each crop. A quick and effective procedure for selecting AFLP primers for rice variety fingerprinting was established as the following: (1)Choose 3 or more group materials that have close genetic relations. (2) Select potential polymorphic primers from primer pairs that are 2 + 2 primer crosses and same at two ends. (3) Recombine the selected potential polymorphic primers and choosing more polymorphic primers. (4) Add one selecting base at one end to become 2 + 3 or 3 + 2primers and further selecting more polymorphic primers. Some primers were selected with this procedure, such as M21Ps7 and M73P17, with which the fingerprints had more polymorphism and high quality.

  14. Mutated primer binding sites interacting with different tRNAs allow efficient murine leukemia virus replication

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J;

    1993-01-01

    Two Akv murine leukemia virus-based retroviral vectors with primer binding sites matching tRNA(Gln-1) and tRNA(Lys-3) were constructed. The transduction efficiency of these mutated vectors was found to be comparable to that of a vector carrying the wild-type primer binding site matching t......RNA(Pro). Polymerase chain reaction amplification and sequence analysis of transduced proviruses confirmed the transfer of vectors with mutated primer binding sites and further showed that tRNA(Gln-2) may act efficiently in conjunction with the tRNA(Gln-1) primer binding site. We conclude that murine leukemia virus...... can replicate by using various tRNA molecules as primers and propose primer binding site-tRNA primer interactions to be of major importance for tRNA primer selection. However, efficient primer selection does not require perfect Watson-Crick base pairing at all 18 positions of the primer binding site....

  15. Amplification of human minisatellites by the polymerase chain reaction: towards DNA fingerprinting of single cells.

    OpenAIRE

    Jeffreys, A J; Wilson, V.; Neumann, R.; Keyte, J

    1988-01-01

    Hypervariable minisatellites can be amplified from human DNA by the polymerase chain reaction, using primers from DNA flanking the minisatellite to amplify the entire block of tandem repeat units. Minisatellite alleles up to 5-10 kb long can be faithfully amplified. At least six minisatellite loci can be co-amplified from the same DNA sample and simultaneously detected to provide a reproducible and highly variable DNA fingerprint which can be obtained from nanogram quantities of human DNA. Th...

  16. Detection and Identification of Bursaphelenchus Species with DNA Fingerprinting and Polymerase Chain Reaction

    OpenAIRE

    Harmey, Judith H.; Harmey, Matthew A.

    1993-01-01

    We have evaluated the potential of DNA-based methods to identify and differentiate Bursaphelenchus spp. and isolates. The isolation of a DNA probe, designated X14, and development of a DNA fingerprinting method for the identification and differentiation of Bursaphelenchus species and strains is described. Polymerase chain reaction (PCR) amplification of DNA isolated from Bursaphelenchus species using two primers derived from the sequence of the cloned repetitive DNA fragment X14 resulted in m...

  17. Damage of DNA ends induced by mechanical force during AFM nano-manipulation

    International Nuclear Information System (INIS)

    An experimental and statistical study was carried out to explore the effects of mechanical forces on the ends of linear double-stranded DNA (dsDNA) fragments. Mechanical force was applied onto individual DNA molecules during atomic force microscope (AFM)-based picking-up manipulation. By comparing the PCR efficiency of two DNA fragments with primers either at ends or at the inner regions, it was found that the ends of DNA fragments were damaged during picking-up process. (authors)

  18. Cosmogenic Backgrounds to 0{\

    CERN Document Server

    :,; Auty, D J; Barbeau, P S; Beck, D; Belov, V; Breidenbach, M; Brunner, T; Burenkov, A; Cao, G F; Chambers, C; Cleveland, B; Coon, M; Craycraft, A; Daniels, T; Danilov, M; Daugherty, S J; Davis, J; Delaquis, S; Der Mesrobian-Kabakian, A; DeVoe, R; Didberidze, T; Dilling, J; Dolgolenko, A; Dolinski, M J; Dunford, M; Fairbank, W; Farine, J; Feldmeier, W; Feyzbakhsh, S; Fierlinger, P; Fudenberg, D; Gornea, R; Graham, K; Gratta, G; Hall, C; Herrin, S; Hughes, M; Jewell, M J; Johnson, A; Johnson, T N; Johnston, S; Karelin, A; Kaufman, L J; Killick, R; Koffas, T; Kravitz, S; Krücken, R; Kuchenkov, A; Kumar, K S; Leonard, D S; Licciardi, C; Lin, Y H; Ling, J; MacLellan, R; Marino, M G; Mong, B; Moore, D; Njoya, O; Nelson, R; Odian, A; Ostrovskiy, I; Piepke, A; Pocar, A; Prescott, C Y; Retière, F; Rowson, P C; Russell, J J; Schubert, A; Sinclair, D; Smith, E; Stekhanov, V; Tarka, M; Tolba, T; Tsang, R; Twelker, K; Vuilleumier, J -L; Waite, A; Walton, J; Walton, T; Weber, M; Wen, L J; Wichoski, U; Wood, J; Yang, L; Yen, Y -R; Zeldovich, O Ya

    2015-01-01

    As neutrinoless double-beta decay experiments become more sensitive and intrinsic radioactivity in detector materials is reduced, previously minor contributions to the background must be understood and eliminated. With this in mind, cosmogenic backgrounds have been studied with the EXO-200 experiment. Using the EXO-200 TPC, the muon flux (through a flat horizontal surface) underground at the Waste Isolation Pilot Plant (WIPP) has been measured to be {\\Phi} = 4.07 $\\pm$ 0.14 (sys) $\\pm$ 0.03 (stat) $\\times$ $10^{-7}$cm$^{-2}$ s$^{-1}$, with a vertical intensity of $I_{v}$ = 2.97$^{+0.14}_{-0.13}$ (sys) $\\pm$ 0.02 (stat) $\\times$ $10^{-7}$cm$^{-2}$ s$^{-1}$ sr$^{-1}$. Simulations of muon-induced backgrounds identified several potential cosmogenic radionuclides, though only 137Xe is a significant background for the 136Xe 0{\

  19. A genome editing primer for the hematologist.

    Science.gov (United States)

    Hoban, Megan D; Bauer, Daniel E

    2016-05-26

    Gene editing enables the site-specific modification of the genome. These technologies have rapidly advanced such that they have entered common use in experimental hematology to investigate genetic function. In addition, genome editing is becoming increasingly plausible as a treatment modality to rectify genetic blood disorders and improve cellular therapies. Genome modification typically ensues from site-specific double-strand breaks and may result in a myriad of outcomes. Even single-strand nicks and targeted biochemical modifications that do not permanently alter the DNA sequence (epigenome editing) may be powerful instruments. In this review, we examine the various technologies, describe their advantages and shortcomings for engendering useful genetic alterations, and consider future prospects for genome editing to impact hematology. PMID:27053532

  20. On Background Independence

    OpenAIRE

    Anderson, Edward

    2013-01-01

    This paper concerns what Background Independence itself is (as opposed to some particular physical theory that is background independent). The notions presented mostly arose from a layer-by-layer analysis of the facets of the Problem of Time in Quantum Gravity. Part of this coincides with two relational postulates which are thus identified as classical precursors of two of the facets of the Problem of Time. These are furthemore tied to the forms of each of the GR Hamiltonian and momentum cons...

  1. Zambia Country Background Report

    DEFF Research Database (Denmark)

    Hampwaye, Godfrey; Jeppesen, Søren; Kragelund, Peter

    This paper provides background data and general information for the Zambia studies focusing on local food processing sub­‐sector; and the local suppliers to the mines as part of the SAFIC project (Successful African Firms and Institutional Change).......This paper provides background data and general information for the Zambia studies focusing on local food processing sub­‐sector; and the local suppliers to the mines as part of the SAFIC project (Successful African Firms and Institutional Change)....

  2. Sensitivitas dan Spesifisitas Nested Polymerase Chain Reaction untuk Mendeteksi DNA Coxiella burnetii (SENSITIVITY AND SPECIFICITY OF NESTED POLYMERASE CHAIN REACTION FOR DETECTION OF COXIELLA BURNETII DNA

    Directory of Open Access Journals (Sweden)

    Trioso Purnawarman

    2014-04-01

    Full Text Available Sensitivity and specificity of nested polymerase chain reaction (nested PCR to detect Coxiella burnetii(C. burnetii DNA were studied. The primer system which consists of external primers (OMP1 and OMP2and internal primers (OMP3 and OMP4, was designed from the nucleotide sequence of the com I geneencoding for 27 kDa outer membrane protein and used to specifically amplify a 501 bp and 438 bp fragment.This nested PCR assay was 50 fold more sensitive than that of using PCR external primer only. TheNested PCR has a detection limit as low as 300 pg/?l. Specificity studies showed that nested PCR onlydetected C. burnetii DNA and did not happened Brucella abortus, Escherichia coli, Pseudomonas aeruginosaand Campylobacter Jejuni DNA. Nested PCR has high senstively and specificaly diagnostic method of C.burnetii as agent of Q fever disease.

  3. Streptococcus salivarius ATCC 25975 possesses at least two genes coding for primer-independent glucosyltransferases.

    Science.gov (United States)

    Simpson, C L; Giffard, P M; Jacques, N A

    1995-01-01

    Fractionation of the culture medium showed that Streptococcus salivarius ATCC 25975 secreted a glucosyltransferase (Gtf) that was primer independent. On the basis of this observation, a gene library of S. salivarius chromosomal DNA cloned into lambda L47.1 was screened for a gene(s) coding for such an activity. As a result of this screening process, two new gtf genes, gtfL and gtfM, both of which coded for primer-independent Gtf activities, were isolated. GtfL produced an insoluble glucan that was refractory to digestion by the endo-(1-->6)-alpha-D-glucanase. of Chaetonium gracile, while GtfM produced a soluble glucan that was readily degraded by the glucanase. Comparison of the deduced amino acid sequences of gtfL and gtfM with 10 other available Gtf sequences allowed the relatedness of the conserved catalytic regions to be assessed. This analysis showed that the 12 enzymes did not form clusters based on their primer dependencies or on their product solubilities. Further analysis of the YG repeats in the C-terminal glucan-binding domains of GtfJ, GtfK, GtfL, and GtfM from S. salivarius showed that there was strong homology between a block of contiguous triplet YG repeats present in the four alleles. These blocks of YG repeats were coded for by a region of each gene that appeared to have arisen as a result of a recent duplication event(s). PMID:7822030

  4. Bridging PCR and partially overlapping primers for novel allergen gene cloning and expression insert decoration

    Institute of Scientific and Technical Information of China (English)

    Ai-Lin Tao; Shao-Heng He

    2004-01-01

    AIM: To obtain the entire gene open reading frame (ORF)and to construct the expression vectors for recombinant allergen production.METHODS: Gene fragments corresponding to the gene specific region and the cDNA ends of pollen allergens of short ragweed (Rg, Ambrosia artemisiifolia L.) were obtained by pan-degenerate primer-based PCR and rapid amplification of the cDNA ends (RACE), and the products were mixed to serve as the bridging PCR (BPCR) template. The full-length gene was then obtained. Partially overlapping primer-based PCR (POP-PCR) method was developed to overcome the other problem, i.e., the non-specific amplification of the ORF with routine long primers for expression insert decoration.Northern blot was conducted to confirm pollen sources of the gene. The full-length coding region was evaluated for its gene function by homologue search in GenBank database and Western blotting of the recombinant protein Amb a 8 (D106) expressed in Escherichia colipET-44 system.RESULTS: The full-length cDNA sequence of Amb a 8(D106)was obtained by using the above procedure and deduced to encode a 131 amino acid polypeptide. Multiple sequence alignment exhibited the gene D106sharing a homology as high as 54-89% and 79-89% to profilin from pollen and food sources, respectively. The expression vector of the allergen gene D106was successfully constructed by employing the combined method of BPCR and POP-PCR. Recombinant allergen rAmb a 8(D106) was then successfully generated.The allergenicity was hallmarked by immunoblotting with the allergic serum samples and its RNA source was confirmed by Northern blot.CONCLUSION: The combined procedure of POP-PCR and BPCR is a powerful method for full-length allergen gene retrieval and expression insert decoration, which would be useful for recombinant allergen production and subsequent diagnosis and immunotherapy of pollen and food allergy.

  5. 安徽乌菜DNA提取与InDel引物筛选%DNA Extraction and InDel Primer Screening of Wucai (Brassica campestris L.ssp.Chinese (L.)Makino var.rosularis Tsen et Lee)in Anhui

    Institute of Scientific and Technical Information of China (English)

    马福萌; 王明霞; 刘童光; 张其安; 方凌; 王本勤; 刘雪静

    2014-01-01

    利用改良的SDS法提取了153个品种的安徽乌菜DNA,并进行2次重复,均获得了较理想的DNA产物.通过试验确定了安徽乌菜InDel-PCR的10 μL最佳反应体系:l× PCR Buffer 1 μL,dNTP 0.2μL,引物1μL,TaqE 0.1 μL,DNA 1 μL,ddH2O 6.7 μL;最佳PCR扩增反应程序:94℃预变性5 min;94℃变性30 s,55℃退火40 s,72℃延伸40 s,共36个循环,最后72℃延伸10 min,10℃保存.从供试的66对InDel引物中筛选出31对适合安徽乌菜、条带清晰、重复性高、多态性好的引物,为安徽乌菜品种鉴定、遗传多样性分析等奠定了基础.

  6. Molecular characterization of the GCN4-DNA complex.

    OpenAIRE

    Gartenberg, M.R.; Ampe, C.; Steitz, T A; Crothers, D M

    1990-01-01

    We report studies of the DNA complex formed by GCN4, a transcriptional activator of eukaryotic amino acid biosynthetic operons. The DNA thermodynamic binding domain, defined by primer extension analysis, spans at least 18 base pairs, a site much larger than the 9-base-pair consensus defined by homology with naturally occurring binding sites. Chemical modification experiments reveal multiple sites of protein-DNA contact: methylation of any guanine N-7 or adenine N-3, ethylation of any phosphat...

  7. 4种PCR体系对湖北海棠DNA扩增效果的对比%The Contrast of Malus hupehensis (Pamp.)Rehd DNA with 4 PCR Systems

    Institute of Scientific and Technical Information of China (English)

    陈琳琳; 吴瑞姣; 罗思谦; 刘连芬; 钱关泽

    2013-01-01

    The experiment with four PCR systems (2 × Taq MasterMix,Forward Primer,Reverse Primer,Template DNA,RNase-free Water;,2 × PCR buffer,2 mmol/L dNTPs,Forward Primer,Reverse Primer,KOD FX,Template DNA,RNase-free Water;10 × Buffer for Blend Taq,Blend Taq,Template,Forward Primer,Reverse Primer,dNTPs,RNase-free Water; 10 × Taq PCR Buffer,dNTP Mix,Forward Primer,Reverse Primer,MgCl2,Template DNA,Taq DNA Polymerase,RNase-Free Water),were used respectively to test the different content and quality of Malus hupehensis (Pamp.)Rehd for the PCR experiments.The results showed:the DNA diluted for several times had little influence on the four PCR systems and it could amplilied a clear,bright band,but different quality DNA had a great effect on these four systems.The bad quality DNA could only amplilied a clear,bright band in the mix system and other three systems failed.%用4种PCR体系(2×Taq MasterMix,Forward Primer,Reverse Primer,Template DNA,RNase-free Water;2×PCR buffer,2 mmol/L d NTPs,Forward Primer,Reverse Primer,KOD FX,Template DNA,RNase-free Water; 10×Buffer for Blend Taq,Blend Taq,Template,Forward Primer,Reverse Primer,dNTPs,RNase-free Water; 10×Taq PCR Buffer,dNTP Mix,Forward Primer,Reverse Primer,MgCl2,Template DNA,Taq DNA Polymerase,RNase-free Water),分别对不同含量和质量的湖北海棠DNA进行PCR实验.结果表明,DNA稀释几倍后对4种PCR体系的影响不大,扩增的条带清晰;但不同质量DNA对4种PCR体系影响很大,低质量DNA只能在混合酶体系下才可以扩增出清晰、明亮的条带,而其他3个体系下的扩增产物均不清晰.

  8. ‘Shotgun DNA synthesis’ for the high-throughput construction of large DNA molecules

    OpenAIRE

    Kim, Hwangbeom; Han, Hyojun; Ahn, Jinwoo; Lee, Joongoo; Cho, Namjin; Jang, Hoon; Kim, Hyoki; Kwon, Sunghoon; Bang, Duhee

    2012-01-01

    We developed a highly scalable ‘shotgun’ DNA synthesis technology by utilizing microchip oligonucleotides, shotgun assembly and next-generation sequencing technology. A pool of microchip oligonucleotides targeting a penicillin biosynthetic gene cluster were assembled into numerous random fragments, and tagged with 20 bp degenerate barcode primer pairs. An optimal set of error-free fragments were identified by high-throughput DNA sequencing, selectively amplified using the barcode sequences, a...

  9. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    Energy Technology Data Exchange (ETDEWEB)

    Bowman, Stephen M [ORNL

    2008-09-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

  10. PRIMED: PRIMEr database for deleting and tagging all fission and budding yeast genes developed using the open-source genome retrieval script (GRS.

    Directory of Open Access Journals (Sweden)

    Michael T Cummings

    Full Text Available The fission (Schizosaccharomyces pombe and budding (Saccharomyces cerevisiae yeasts have served as excellent models for many seminal discoveries in eukaryotic biology. In these organisms, genes are deleted or tagged easily by transforming cells with PCR-generated DNA inserts, flanked by short (50-100 bp regions of gene homology. These PCR reactions use especially designed long primers, which, in addition to the priming sites, carry homology for gene targeting. Primer design follows a fixed method but is tedious and time-consuming especially when done for a large number of genes. To automate this process, we developed the Python-based Genome Retrieval Script (GRS, an easily customizable open-source script for genome analysis. Using GRS, we created PRIMED, the complete PRIMEr D atabase for deleting and C-terminal tagging genes in the main S. pombe and five of the most commonly used S. cerevisiae strains. Because of the importance of noncoding RNAs (ncRNAs in many biological processes, we also included the deletion primer set for these features in each genome. PRIMED are accurate and comprehensive and are provided as downloadable Excel files, removing the need for future primer design, especially for large-scale functional analyses. Furthermore, the open-source GRS can be used broadly to retrieve genome information from custom or other annotated genomes, thus providing a suitable platform for building other genomic tools by the yeast or other research communities.

  11. Characterization of highly informative cross-species microsatellite panels for the Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) including five novel primers

    Science.gov (United States)

    Hunter, Margaret Kellogg; Broderick, Damien; Ovenden, Jennifer R.; Tucker, Kimberly Pause; Bonde, Robert K.; McGuire, Peter M.; Lanyon, Janet M.

    2010-01-01

    The Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) are threatened species of aquatic mammals in the order Sirenia. Sirenian conservation and management actions would benefit from a more complete understanding of genetic diversity and population structure. Generally, species-specific microsatellite markers are employed in conservation genetic studies; however, robust markers can be difficult and costly to isolate. To increase the number of available markers, dugong and manatee microsatellite primers were evaluated for cross-species amplification. Furthermore, one manatee and four dugong novel primers are reported. After polymerase chain reaction optimization, 23 (92%) manatee primers successfully amplified dugong DNA, of which 11 (48%) were polymorphic. Of the 32 dugong primers tested, 27 (84%) yielded product in the manatee, of which 17 (63%) were polymorphic. Dugong and manatee primers were compared and the most informative markers were selected to create robust and informative marker-panels for each species. These crossspecies microsatellite marker-panels can be employed to assess other sirenian populations and can provide beneficial information for the protection and management of these unique mammals.

  12. Characterization of highly informative cross-species microsatellite panels for the Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) including five novel primers.

    Science.gov (United States)

    Hunter, Margaret Kellogg; Broderick, Damien; Ovenden, Jennifer R; Tucker, Kimberly Pause; Bonde, Robert K; McGuire, Peter M; Lanyon, Janet M

    2010-03-01

    The Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) are threatened species of aquatic mammals in the order Sirenia. Sirenian conservation and management actions would benefit from a more complete understanding of genetic diversity and population structure. Generally, species-specific microsatellite markers are employed in conservation genetic studies; however, robust markers can be difficult and costly to isolate. To increase the number of available markers, dugong and manatee microsatellite primers were evaluated for cross-species amplification. Furthermore, one manatee and four dugong novel primers are reported. After polymerase chain reaction optimization, 23 (92%) manatee primers successfully amplified dugong DNA, of which 11 (48%) were polymorphic. Of the 32 dugong primers tested, 27 (84%) yielded product in the manatee, of which 17 (63%) were polymorphic. Dugong and manatee primers were compared and the most informative markers were selected to create robust and informative marker-panels for each species. These cross-species microsatellite marker-panels can be employed to assess other sirenian populations and can provide beneficial information for the protection and management of these unique mammals. PMID:21565032

  13. Comparison of the Performances of Five Primer Sets for the Detection and Quantification of Plasmodium in Anopheline Vectors by Real-Time PCR

    Science.gov (United States)

    Chaumeau, V.; Andolina, C.; Fustec, B.; Tuikue Ndam, N.; Brengues, C.; Herder, S.; Cerqueira, D.; Chareonviriyaphap, T.; Nosten, F.; Corbel, V.

    2016-01-01

    Quantitative real-time polymerase chain reaction (qrtPCR) has made a significant improvement for the detection of Plasmodium in anopheline vectors. A wide variety of primers has been used in different assays, mostly adapted from molecular diagnosis of malaria in human. However, such an adaptation can impact the sensitivity of the PCR. Therefore we compared the sensitivity of five primer sets with different molecular targets on blood stages, sporozoites and oocysts standards of Plasmodium falciparum (Pf) and P. vivax (Pv). Dilution series of standard DNA were used to discriminate between methods at low concentrations of parasite and to generate standard curves suitable for the absolute quantification of Plasmodium sporozoites. Our results showed that the best primers to detect blood stages were not necessarily the best ones to detect sporozoites. Absolute detection threshold of our qrtPCR assay varied between 3.6 and 360 Pv sporozoites and between 6 and 600 Pf sporozoites per mosquito according to the primer set used in the reaction mix. In this paper, we discuss the general performance of each primer set and highlight the need to use efficient detection methods for transmission studies. PMID:27441839

  14. DNA loops and semicatenated DNA junctions

    OpenAIRE

    Strauss François; Gaillard Claire

    2000-01-01

    Abstract Background Alternative DNA conformations are of particular interest as potential signals to mark important sites on the genome. The structural variability of CA microsatellites is particularly pronounced; these are repetitive poly(CA) · poly(TG) DNA sequences spread in all eukaryotic genomes as tracts of up to 60 base pairs long. Many in vitro studies have shown that the structure of poly(CA) · poly(TG) can vary markedly from the classical right handed DNA double helix and adopt dive...

  15. Determination of background radiation

    International Nuclear Information System (INIS)

    The invention relates to a method and appartus for determining the level of background radiation in a spectral region where a Raman peak characteristic of a particular substance, in particular diamond, is expected to occur. The method includes the steps of isolating the radiation in a first spectral band, and isolating the radiation in a second spectral band which overlaps the first spectral band at least partially to form an overlapping band in the vicinity of the expected Raman Peak and a least one sideband. At least one sideband value representative of the radiation present in the one or more sidebands is then obtained, and further values, representative of the radiation isolated by any one or more of the other spectral bands, such as the first and second bands, are then used to derive a background value indicative of the level of background radiation present at the position of the expected Raman peak

  16. Exploring String Theory Backgrounds

    CERN Document Server

    Williams, B P

    2004-01-01

    This thesis examines phenomenological and theoretical questions by exploring string theoretic backgrounds. Part I focuses on cosmology. First we propose that the induced metric along a brane moving through a curved bulk may be interpreted as the cosmology of the brane universe, providing a resolution to the apparent cosmological singularity on the brane. We then look at various decay channels of the certain meta-stable de Sitter vacua and show that there exist NS5-brane meditated decays which are much faster than decays to decompactification. Part II discusses a new class of nongeometric vacua in string theory. These backgrounds may be described locally as T2 fibrations. By enlarging the monodromy group of the fiber to include perturbative stringy duality symmetries we are able to explicitly construct nongeometric backgrounds.

  17. Unitarity and singular backgrounds

    CERN Document Server

    Brouzakis, Nikos

    2013-01-01

    We compute the graviton Kaluza-Klein spectrum on a gravity-dilaton background with a naked singularity for all possible boundary conditions at the singularity which are consistent with unitary evolution. We apply methods from non-relativistic quantum mechanics with singular Schr\\"{o}dinger potentials. In general the spectrum contains a tachyon, a sign of instability. Only for a particular boundary condition at the singularity the spectrum is free of tachyons. In this case the lowest-lying graviton mode is massless. We argue that this result will also hold for other backgrounds with similar geometry near the curvature singularity. We complete our study with a brief discussion on radion perturbations and Higgs mechanism on this singular background.

  18. Nucleotide Base Variation of Blast Disease Resistance Gene Pi33 in Rice Selected Broad Genetic Background

    Directory of Open Access Journals (Sweden)

    DWINITA WIKAN UTAMI

    2011-09-01

    Full Text Available Rice is one of the most important crops for human beings, thus increasing productivity are continually persecuted. Blast disease can reduce the rate of productivity of rice cultivation. Therefore, the program of blast disease-resistant varieties needs to do effectively. One of broad-spectrum blast disease-resistant gene is Pi33. This study was aimed to identify the variation in the sequence of nucleotide bases of Pi33 gene in five interspesific lines which derived from Bio46 (IR64/Oryza rufipogon and CT13432 crossing. DNA of five rice lines were amplified using the spesific primer for Pi33, G1010. Amplification results purified through Exonuclease 1 and Shrimp Alkaline Phosphatase protocols. Labelling using fluorescent dyes done before sequencing nucleotide base using CEQ8000 instrument. The results showed that lines number 28 showed introgesion of the three control parent genome (subspecies of Indica, subspecies of Japonica, and O. rufipogon while the Lines number 79, 136, and 143 were identical to Indica genome. Strain number 195 was identical to Japonica genome. These broad genetic background lines promise as durable performance to attack the expansion of the dynamic nature of the pathogen to blast. The result of ortholog sequence analysis found conserved nucleotide base sequence (CAGCAGCC which involved in heterotrimeric G-protein group. This protein has role as plant receptor for recognizing pathogen elicitor in interaction of rice and blast pathogen.

  19. DNA-based Simultaneous Identification of Three Terminalia Species Targeting Adulteration

    Science.gov (United States)

    Sharma, Sonal; Shrivastava, Neeta

    2016-01-01

    Background: Various parts of three Terminalia species, namely, Terminalia arjuna (stem bark), Terminalia bellirica (fruit), and Terminalia chebula (fruit) are widely known for their therapeutic principles and other commercial values. However, stem bark of T. bellirica and T. chebula along with Terminalia tomentosa are reported as adulterants of T. arjuna. Correct botanical identification is very critical for safe and effective herbal drugs. DNA-based identification approaches are advancing the conventional methods and sometime proved more beneficial. Objective: The purpose of the study was to develop polymerase chain reaction (PCR) method using internal transcribed spacer (ITS) region to ascertain the identity of T. arjuna herbal material as well as detection of mixing of other three Terminalia species. Materials and Methods: DNA from stem barks samples were isolated and subjected to ITS region amplification and sequencing. Sequences were compared for polymorphic nucleotides determination to develop species-specific primers. Final primers were selected on the basis of in silico analysis and experimentally validated. PCR assays for botanical identification of Terminalia species were developed. Sensitivity testing and assay validation were also performed. Results: The PCR assays developed for Terminalia species were resulted in definite amplicons of the corresponding species. No cross-reactivity of the primers was detected. Sensitivity was found enough to amplify as low as 2 ng of DNA. Mixing of DNA in various concentrations for validation also proved the sensitivity of assay to detect original botanicals in the mixture. The developed methods proved very specific and sensitive to authenticate Arjuna bark to develop evidence-based herbal medicines. SUMMARY Internal transcribed spacer-based species-specific polymerase chain reaction.(PCR) assays were developed to authenticate Terminalia arjuna stem bark and to identify substitution/adulteration of Terminalia bellirica

  20. Cosmic Tachyon Background Radiation

    CERN Document Server

    Tomaschitz, R

    1999-01-01

    The equilibrium statistical mechanics of a background radiation of superluminal particles is investigated, based on a vectorial wave equation for tachyons of the Proca type. The partition function, the spectral energy density, and the various thermodynamic variables of an ideal Bose gas of tachyons in an open Robertson-Walker cosmology are derived. The negative mass square in the wave equation changes the frequency scaling in the Rayleigh-Jeans law, and there are also significant changes in the low temperature regime as compared to the microwave background, in particular in the caloric and thermal equations of state.

  1. The natural radiation background

    International Nuclear Information System (INIS)

    The components of the natural background radiation and their variations are described. Cosmic radiation is a major contributor to the external dose to the human body whilst naturally-occurring radionuclides of primordial and cosmogenic origin contribute to both the external and internal doses, with the primordial radionuclides being the major contributor in both cases. Man has continually modified the radiation dose to which he has been subjected. The two traditional methods of measuring background radiation, ionisation chamber measurements and scintillation counting, are looked at and the prospect of using thermoluminescent dosimetry is considered

  2. Study in mutation of alfalfa genome DNA due to low energy N+ implantation using RAPD

    International Nuclear Information System (INIS)

    After implanted by various dosage N+ beams, germination rate of alfalfa seeds appears to be saddle line with dosage increasing. The authors have studied in mutation of genome DNA due to low energy N+ implantation, and concluded that 30 differential DNA fragments have been amplified by 8 primers (S41, S42, S45, S46, S50, S52, S56, S58) in 100 primers, moreover, number of differential DNA fragments between CK and treatments increases with dosage. Consequently, low energy ion implantation can cause mutation of alfalfa genome DNA. The more dosage it is, the more mutation alfalfa will be

  3. A primer on wavelets and their scientific applications

    CERN Document Server

    Walker, James S

    2008-01-01

    In the first edition of his seminal introduction to wavelets, James S. Walker informed us that the potential applications for wavelets were virtually unlimited. Since that time thousands of published papers have proven him true, while also necessitating the creation of a new edition of his bestselling primer. Updated and fully revised to include the latest developments, this second edition of A Primer on Wavelets and Their Scientific Applications guides readers through the main ideas of wavelet analysis in order to develop a thorough appreciation of wavelet applications. Ingeniously relying o

  4. A Primer of Middle Eastern Leadership Culture

    Directory of Open Access Journals (Sweden)

    Sheldon Greaves

    2012-01-01

    Full Text Available It is natural for someone looking in on a foreign culture from the outside to interpret what they see and frame their reactions based on their own background and assumptions. With cultures as a different as those of the Middle East and the West, the potential for blunders increases dramatically, made worse by the high political, diplomatic, military, and commercial stakes involved. Leadership culture in this region has been shaped over centuries through a variety of factors, such as reputation, family, and religion, which continue to influence decision making. The present study posits that an understanding of these factors and how they work is crucial for intelligence analysts, policy and decision makers, strategists, and scholars who must find their way through a very unfamiliar cultural landscape in the Middle East. It is hoped that this discussion will in some way assist in the creation of more effective interaction, policies, and analysis associated with the Middle East.

  5. Relativistic astrophysics and cosmology a primer

    CERN Document Server

    Hoyng, Peter

    2006-01-01

    This book offers a succinct and self-contained treatment of general relativity and its application to neutron stars, black holes, gravitational waves and cosmology, at an intermediate level. The required mathematical concepts are introduced informally, following geometrical intuition as much as possible. The approach is theoretical, but there is ample discussion of observational aspects and instrumental issues where appropriate. Topical issues such as the Gravity Probe B mission, and the physics of interferometer detectors of gravitational waves and the angular power spectrum of the Cosmic Microwave Background are included. The book is written for advanced undergraduates and beginning graduate students in (astro)physics. The reader is assumed to be familiar with linear algebra and analysis, ordinary differential equations, special relativity, and basic thermal physics, but prior knowledge of differential geometry and general relativity is not required. Containing 140 exercises with extensive hints for their s...

  6. A primer on scientific programming with Python

    CERN Document Server

    Langtangen, Hans Petter

    2014-01-01

    The book serves as a first introduction to computer programming of scientific applications, using the high-level Python language. The exposition is example and problem-oriented, where the applications are taken from mathematics, numerical calculus, statistics, physics, biology and finance. The book teaches "Matlab-style" and procedural programming as well as object-oriented programming. High school mathematics is a required background and it is advantageous to study classical and numerical one-variable calculus in parallel with reading this book. Besides learning how to program computers, the reader will also learn how to solve mathematical problems, arising in various branches of science and engineering, with the aid of numerical methods and programming. By blending programming, mathematics and scientific applications, the book lays a solid foundation for practicing computational science. From the reviews: Langtangen … does an excellent job of introducing programming as a set of skills in problem solving. ...

  7. A primer on scientific programming with Python

    CERN Document Server

    Langtangen, Hans Petter

    2016-01-01

    The book serves as a first introduction to computer programming of scientific applications, using the high-level Python language. The exposition is example and problem-oriented, where the applications are taken from mathematics, numerical calculus, statistics, physics, biology and finance. The book teaches "Matlab-style" and procedural programming as well as object-oriented programming. High school mathematics is a required background and it is advantageous to study classical and numerical one-variable calculus in parallel with reading this book. Besides learning how to program computers, the reader will also learn how to solve mathematical problems, arising in various branches of science and engineering, with the aid of numerical methods and programming. By blending programming, mathematics and scientific applications, the book lays a solid foundation for practicing computational science. From the reviews: Langtangen … does an excellent job of introducing programming as a set of skills in problem solving. ...

  8. Site-specific mutagenesis of Drosophila proliferating cell nuclear antigen enhances its effects on calf thymus DNA polymerase δ

    Directory of Open Access Journals (Sweden)

    Miller Holly

    2004-08-01

    Full Text Available Abstract Background We and others have shown four distinct and presumably related effects of mammalian proliferating cell nuclear antigen (PCNA on DNA synthesis catalyzed by mammalian DNA polymerase δ(pol δ. In the presence of homologous PCNA, pol δ exhibits 1 increased absolute activity; 2 increased processivity of DNA synthesis; 3 stable binding of synthetic oligonucleotide template-primers (t1/2 of the pol δ•PCNA•template-primer complex ≥2.5 h; and 4 enhanced synthesis of DNA opposite and beyond template base lesions. This last effect is potentially mutagenic in vivo. Biochemical studies performed in parallel with in vivo genetic analyses, would represent an extremely powerful approach to investigate further, both DNA replication and repair in eukaryotes. Results Drosophila PCNA, although highly similar in structure to mammalian PCNA (e.g., it is >70% identical to human PCNA in amino acid sequence, can only substitute poorly for either calf thymus or human PCNA (~10% as well in affecting calf thymus pol δ. However, by mutating one or only a few amino acids in the region of Drosophila PCNA thought to interact with pol δ, all four effects can be enhanced dramatically. Conclusions Our results therefore suggest that all four above effects depend at least in part on the PCNA-pol δ interaction. Moreover unlike mammals, Drosophila offers the potential for immediate in vivo genetic analyses. Although it has proven difficult to obtain sufficient amounts of homologous pol δ for parallel in vitro biochemical studies, by altering Drosophila PCNA using site-directed mutagenesis as suggested by our results, in vitro biochemical studies may now be performed using human and/or calf thymus pol δ preparations.

  9. Species-specific polymerase chain reaction primer sets for the diagnosis of Tenacibaculum maritimum infection.

    Science.gov (United States)

    Avendaño-Herrera, Rubén; Magariños, Beatriz; Toranzo, Alicia E; Beaz, Roxana; Romalde, Jesús L

    2004-11-23

    In this study the specificity and sensitivity of 2 primer pairs, MAR1-MAR2 and Mar1-Mar2, for the detection of Tenacibaculum maritimum were evaluated in parallel using 79 T. maritimum strains isolated from different fish species, as well as 53 representatives of related and unrelated bacterial species. Both primer pairs were species-specific for T. maritimum, since no amplification products were obtained from chromosomal DNA of the non-T. maritimum bacteria tested. However, whereas MAR1-MAR2 identified all the T. maritimum strains studied, producing a unique and clear PCR band of the expected 1088 bp length, the Marl-Mar2 primer pair failed to amplify the 400 bp specific band in 3 sole isolates. To verify if these strains belonged to T. maritimum species, 2 endonucleases (PvuI and SacII) were selected as the most adequate enzymes to confirm the specificity of the MAR1-MAR2 amplified fragment. The digestion patterns obtained with both endonucleases supported the assignation of all the strains to T. maritimum. The sensitivity of both PCR detection methods was also different, showing a reduction of sensitivity in at least one order of magnitude of the Marl-Mar2 primer pair in comparison with MAR1-MAR2. When the MAR-MAR2 PCR protocol was applied to different seeded turbot tissues, the detection limit was 10(2) to 10(4) T. maritimum cells per reaction. In addition, a nested PCR protocol for detection of this pathogens based on MAR1-MAR2 was developed, which increased the sensitivity by approximately 2 orders of magnitude, ranging from 1 to 250 T. maritimum cells per reaction depending on the tissue employed. The tissues that allowed the most easy detection of T. maritimum were the skin and mucus. Based on the findings reported here, we propose the nested PCR protocol as the most adequate for an accurate detection of T. maritimum in diagnostic pathology as well as in epidemiological studies of gliding bacterial disease of marine fish. PMID:15648833

  10. Berkeley Low Background Facility

    International Nuclear Information System (INIS)

    The Berkeley Low Background Facility (BLBF) at Lawrence Berkeley National Laboratory (LBNL) in Berkeley, California provides low background gamma spectroscopy services to a wide array of experiments and projects. The analysis of samples takes place within two unique facilities; locally within a carefully-constructed, low background laboratory on the surface at LBNL and at the Sanford Underground Research Facility (SURF) in Lead, SD. These facilities provide a variety of gamma spectroscopy services to low background experiments primarily in the form of passive material screening for primordial radioisotopes (U, Th, K) or common cosmogenic/anthropogenic products; active screening via neutron activation analysis for U,Th, and K as well as a variety of stable isotopes; and neutron flux/beam characterization measurements through the use of monitors. A general overview of the facilities, services, and sensitivities will be presented. Recent activities and upgrades will also be described including an overview of the recently installed counting system at SURF (recently relocated from Oroville, CA in 2014), the installation of a second underground counting station at SURF in 2015, and future plans. The BLBF is open to any users for counting services or collaboration on a wide variety of experiments and projects

  11. Local microwave background radiation

    OpenAIRE

    Soares, Domingos

    2006-01-01

    An inquiry on a possible local origin for the Microwave Background Radiation is made. Thermal MBR photons are contained in a system called {\\it magnetic bottle} which is due to Earth magnetic field and solar wind particles, mostly electrons. Observational tests are anticipated.

  12. Berkeley Low Background Facility

    Energy Technology Data Exchange (ETDEWEB)

    Thomas, K. J.; Norman, E. B. [Department of Nuclear Engineering, University of California-Berkeley, CA 94720 (United States); Nuclear Science Division, Lawrence Berkeley National Laboratory, CA 94720 (United States); Smith, A. R.; Poon, A. W. P.; Chan, Y. D. [Nuclear Science Division, Lawrence Berkeley National Laboratory, CA 94720 (United States); Lesko, K. T. [Physics Division, Lawrence Berkeley National Laboratory, CA 94720 (United States)

    2015-08-17

    The Berkeley Low Background Facility (BLBF) at Lawrence Berkeley National Laboratory (LBNL) in Berkeley, California provides low background gamma spectroscopy services to a wide array of experiments and projects. The analysis of samples takes place within two unique facilities; locally within a carefully-constructed, low background laboratory on the surface at LBNL and at the Sanford Underground Research Facility (SURF) in Lead, SD. These facilities provide a variety of gamma spectroscopy services to low background experiments primarily in the form of passive material screening for primordial radioisotopes (U, Th, K) or common cosmogenic/anthropogenic products; active screening via neutron activation analysis for U,Th, and K as well as a variety of stable isotopes; and neutron flux/beam characterization measurements through the use of monitors. A general overview of the facilities, services, and sensitivities will be presented. Recent activities and upgrades will also be described including an overview of the recently installed counting system at SURF (recently relocated from Oroville, CA in 2014), the installation of a second underground counting station at SURF in 2015, and future plans. The BLBF is open to any users for counting services or collaboration on a wide variety of experiments and projects.

  13. Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J;

    1997-01-01

    Reverse transcription of retroviral genomes is primed by a tRNA annealed to an 18-nucleotide primer binding site. Here, we present a primer complementation system to study molecular interaction of the replication machinery with the primer and primer binding site in vivo. Introduction of eight base...... substitutions into the primer binding site of a murine leukemia virus-based vector allowed efficient RNA encapsidation but resulted in severely reduced vector replication capacity. Replication was restored upon complementation with a synthetic gene designed to encode a complementary tRNA-like primer, but not...... with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather...

  14. Evaluation of shear bond strength of metal bracket to enamel after application of primers over bracket base-an in vitro study

    OpenAIRE

    Firuzbakht MM; Hedayati Z

    2011-01-01

    "nBackground and Aims: The aim of this study was to evaluate the effect of application of two types of primers over bracket bases on the shear bond strength (SBS) and mode of bond failure."nMaterials and Methods: In this study, 75 human premolar teeth were divided into three equal groups. In group 1 (control), after surface preparation of enamel by conventional method (acid etching+primer) brackets were bonded with Transbond XT composite. In group 2 (TX), brackets were bond...

  15. Analysis and validation of genome-specific DNA variations in 5' flanking conserved sequences of wheat low-molecular-weight glutenin subunit genes

    Institute of Scientific and Technical Information of China (English)

    LONG; Hai; WEI; Yuming

    2006-01-01

    The thirty-three 5' flanking conserved sequences of the known low-molecular-weight subunit (LMW-GS) genes have been divided into eight clusters, which was in agreement with the classification based on the deduced N-terminal protein sequences. The DNA polymorphism between the eight clusters was obtained by sequence alignment, and a total of 34 polymorphic positions were observed in the approximately 200 bp regions, among which 18 polymorphic positions were candidate SNPs. Seven cluster-specific primer sets were designed for seven out of eight clusters containing cluster-specific bases, with which the genomic DNA of the ditelosomic lines of group 1 chromosomes of a wheat variety 'Chinese Spring' was employed to carry out chromosome assignment. The subsequent cloning and DNA sequencing of PCR fragments validated the sequences specificity of the 5' flanking conserved sequences between LMW-GS gene groups in different genomes. These results suggested that the coding and 5' flanking regions of LMW-GS genes are likely to have evolved in a concerted fashion. The seven primer sets developed in this study could be used to isolate the complete ORFs of seven groups of LMW-GS genes, respectively, and therefore possess great value for further research in the contributions of a single LMW-GS gene to wheat quality in the complex genetic background and the efficient selections of quality-related components in breeding programs.

  16. Event extraction for DNA methylation

    OpenAIRE

    Ohta Tomoko; Pyysalo Sampo; Miwa Makoto; Tsujii Jun’ichi

    2011-01-01

    Abstract Background We consider the task of automatically extracting DNA methylation events from the biomedical domain literature. DNA methylation is a key mechanism of epigenetic control of gene expression and implicated in many cancers, but there has been little study of automatic information extraction for DNA methylation. Results We present an annotation scheme for DNA methylation following the representation of the BioNLP shared task on event extraction, select a set of 200 abstracts inc...

  17. FACTORES AMBIENTALES QUE AFECTAN LA EDAD AL PRIMER PARTO Y PRIMER INTERVALO DE PARTOS EN VACAS DEL SISTEMA DOBLE PROPOSITO

    OpenAIRE

    Caty Martínez B; Luz Botero A; Oscar Vergara G

    2009-01-01

    Objetivo. Determinar los factores que influyen en la edad al primer parto (AFC) y primer intervalo de parto (PIDP) en hembras bovinas bajo el sistema de doble propósito, en la finca “El Rodeo”, municipio de Magangué, Bolívar - Colombia. Materiales y métodos. Se analizaron 379 datos provenientes de los registros productivos entre los años 1993 hasta 2002, usando el programa estadístico GLM del Statistical Analysis System, donde se obtuvieron la media y el error estándar de cada fuente de vari...

  18. Genetic alterations of hepatocellular carcinoma by random amplified polymorphic DNA analysis and cloning sequencing of tumor differential DNA fragment

    Institute of Scientific and Technical Information of China (English)

    Zhi-Hong Xian; Wen-Ming Cong; Shu-Hui Zhang; Meng-Chao Wu

    2005-01-01

    AIM: To study the genetic alterations and their association with clinicopathological characteristics of hepatocellular carcinoma (HCC), and to find the tumor related DNA fragments.METHODS: DNA isolated from tumors and corresponding noncancerous liver tissues of 56 HCC patients was amplified by random amplified polymorphic DNA (RAPD)with 10 random 10-mer arbitrary primers. The RAPD bands showing obvious differences in tumor tissue DNA corresponding to that of normal tissue were separated,purified, cloned and sequenced. DNA sequences were analyzed and compared with GenBank data.RESULTS: A total of 56 cases of HCC were demonstrated to have genetic alterations, which were detected by at least one primer. The detestability of genetic alterations ranged from 20% to 70% in each case, and 17.9% to 50% in each primer. Serum HBV infection, tumor size,histological grade, tumor capsule, as well as tumor intrahepatic metastasis, might be correlated with genetic alterations on certain primers. A band with a higher intensity of 480 bp or so amplified fragments in tumor DNA relative to normal DNA could be seen in 27 of 56 tumor samples using primer 4. Sequence analysis of these fragments showed 91% homology with Homo sapiens double homeobox protein DUX10 gene.CONCLUSION: Genetic alterations are a frequent event in HCC, and tumor related DNA fragments have been found in this study, which may be associated with hepatocarcinogenesis. RAPD is an effective method for the identification and analysis of genetic alterations in HCC, and may provide new information for further evaluating the molecular mechanism of hepatocarcinogenesis.

  19. Application possibilities of AFLP fingerprinting technique in maize DNA profiling and plant variety protection

    Directory of Open Access Journals (Sweden)

    Galović Vladislava O.

    2004-01-01

    Full Text Available As a contribution to DUS testing within the system of protection of plant breeders' rights (PBR, the AFLP molecular system has been used in this study to produce DNA fingerprinting profiles. DNA polymorphism and genetic distance of nine agronomicaly important maize genotypes has been investigated using the AFLP technique. Two specific adapters, two preselective primers and twenty selective primers were utilized for DNA amplification. The selective primers were GC rich, each having a 3-mer selective sequence at 3' termini. Ten double stranded primer combinations were made out of the twenty primers but only five of them turned out to be reliable. Out of 253 amplified DNA fragments, 177 were polymorphic (70%. The CGA/GAG (B primer combination has proved to be the most polymorphic (44 polymorphic fragments have been recorded revealing the polymorphism rate of 81.5%. Genotypes g1 and g7 were most distinct (GD=55% and GD=79%, respectively and genotypes g1. g4 and g8 were closest (GD=55% in all cases. The paper discusses possible uses of AFLP DNA profiling technique to achieve a unique fingerprinting pattern of agronomicaly important maize genotypes.

  20. RAPD analysis of alfalfa DNA mutation via N+ implantation

    Institute of Scientific and Technical Information of China (English)

    LI Yu-Feng; HUANG Qun-Ce; LIANG Yun-Zhang; YU Zeng-Liang

    2003-01-01

    Germination capacity of alfalfa seeds under low energy N+ implantation manifests oscillations goingdown with dose strength. From analyzing alfalfa genome DNA under low energy N+ implantation by RAPD (RandomAmplified Polymorphous DNA), it is recommended that 30 polymorphic DNA fragments be amplified with 8 primersin total 100 primers, and fluorescence intensity of the identical DNA fragments amplified by RAPD is different be-tween CK and treatments. Number of different polymorphic DNA fragments between treatment and CK via N+ im-plantation manifests going up with dose strength.

  1. Application of PCR fingerprinting using (GACA 4 primer in the rapid discrimination of dermatophytes

    Directory of Open Access Journals (Sweden)

    E Elavarashi

    2014-01-01

    Full Text Available Background: Superficial fungal infections have a major impact on cosmetic health, affecting more than 20-25% of the global population, which is predominantly caused by dermatophytes. As per literature search, molecular strain typing of dermatophytes has not been investigated in India. Therefore, the present study was carried out to characterise the dermatophyte species and strains by molecular methods. Objective: To analyse the genotype variability by applying polymerase chain reaction (PCR fingerprinting using a simple sequence repetitive oligonucleotide (GACA 4 primer to identify the species and strain variations among the dermatophytes isolated from a tertiary care centre in Chennai. Materials and Methods: From January 2010 to December 2010, 81 dermatophytes were isolated and included for the present study. A simple sequence repetitive oligonucleotide (GACA 4 was used as a single primer in the amplification process. Results: The (GACA 4 -based PCR successfully amplified all the clinical isolates. Trichophyton rubrum and T. rubrum var. raubitschekii produced identical band profiles, where the latter could not be differentiated from the T. rubrum, which are being reported for the first time from south India. Epidermophyton floccosum produced species-specific band profiles. Intra-species variability was not observed among the T. rubrum and E. floccosum isolates. T. mentagrophytes produced three simple, distinct band patterns, which are surprisingly different from the earlier studies. Conclusion: The PCR-based genotype using the short primer is rapid and precise in direct identification of dermatophyte isolates by one-step PCR to the species level and strain discrimination of the T. mentagrophytes variants.

  2. Testing the Specificity of Primers to Environmental Ammonia Monooxygenase (amoA) Genes in Groundwater Treated with Urea to Promote Calcite Precipitation

    Energy Technology Data Exchange (ETDEWEB)

    Freeman, S.; Reed, D.W.; Fujita, Y.

    2006-01-01

    Bacterial ammonia monooxygenase (amoA) genes in DNA isolated from microorganisms in groundwater were characterized by amplification of amoA DNA using polymerase chain reaction (PCR), Restriction Fragment Length Polymorphism (RFLP) analysis, and sequencing. The amoA gene is characteristic of ammonia oxidizing bacteria (AOB). The DNA extracts were acquired from an experiment where dilute molasses and urea were sequentially introduced into a well in the Eastern Snake River Plain Aquifer (ESRPA) in Idaho to examine whether such amendments could stimulate enhanced ureolytic activity. The hydrolysis of urea into ammonium and carbonate serves as the basis for a potential remediation technique for trace metals and radionuclide contaminants that can co-precipitate in calcite. The ammonium ion resulting from ureolysis can promote the growth of AOB. The goal of this work was to investigate the effectiveness of primers designed for quantitative PCR of environmental amoA genes and to evaluate the effect of the molasses and urea amendments upon the population diversity of groundwater AOB. PCR primers designed to target a portion of the amoA gene were used to amplify amoA gene sequences in the groundwater DNA extracts. Following PCR, amplified gene products were cloned and the clones were characterized by RFLP, a DNA restriction technique that can distinguish different DNA sequences, to gauge the initial diversity. Clones exhibiting unique RFLP patterns were subjected to DNA sequencing. Initial sequencing results suggest that the primers were successful at specific detection of amoA sequences and the RFLP analyses indicated that the diversity of detected amoA sequences in the ESRPA decreased with the additions of molasses and urea.

  3. Mechanism of sequence-specific template binding by the DNA primase of bacteriophage T7

    KAUST Repository

    Lee, Seung-Joo

    2010-03-28

    DNA primases catalyze the synthesis of the oligoribonucleotides required for the initiation of lagging strand DNA synthesis. Biochemical studies have elucidated the mechanism for the sequence-specific synthesis of primers. However, the physical interactions of the primase with the DNA template to explain the basis of specificity have not been demonstrated. Using a combination of surface plasmon resonance and biochemical assays, we show that T7 DNA primase has only a slightly higher affinity for DNA containing the primase recognition sequence (5\\'-TGGTC-3\\') than for DNA lacking the recognition site. However, this binding is drastically enhanced by the presence of the cognate Nucleoside triphosphates (NTPs), Adenosine triphosphate (ATP) and Cytosine triphosphate (CTP) that are incorporated into the primer, pppACCA. Formation of the dimer, pppAC, the initial step of sequence-specific primer synthesis, is not sufficient for the stable binding. Preformed primers exhibit significantly less selective binding than that observed with ATP and CTP. Alterations in subdomains of the primase result in loss of selective DNA binding. We present a model in which conformational changes induced during primer synthesis facilitate contact between the zinc-binding domain and the polymerase domain. The Author(s) 2010. Published by Oxford University Press.

  4. Plasma nuclear and mitochondrial DNA levels as predictors of outcome in severe sepsis patients in the emergency room

    Directory of Open Access Journals (Sweden)

    Kung Chia-Te

    2012-06-01

    Full Text Available Abstract Background and aim The sensitivity and specificity of biomarkers and scoring systems used for predicting fatality of severe sepsis patients remain unsatisfactory. This study aimed to determine the prognostic value of circulating plasma DNA levels in severe septic patients presenting at the Emergency Department (ED. Methods Sixty-seven consecutive patients with severe sepsis and 33 controls were evaluated. Plasma DNA levels were estimated by real-time quantitative polymerase chain reaction assay using primers for the human β-hemoglobin and ND2 gene. The patients’ clinical and laboratory data on admission were analyzed. Results The median plasma nuclear and mitochondria DNA levels for severe septic patients on admission were significantly higher than those of the controls. The mean plasma nuclear DNA level on admission correlated with lactate concentration (γ = 0.36, p = 0.003 and plasma mitochondrial DNA on admission (γ = 0.708, p 0.001. Significant prognostic factors for fatality included mechanical ventilation within the first 24 hours (p = 0.013, mean sequential organ failure assessment (SOFA score on admission (p = 0.04, serum lactate (p  0.001, and both plasma nuclear and mitochondrial DNA on admission (p  0.001. Plasma mitochondrial DNA was an independent predictor of fatality by stepwise logistic regression such that an increase by one ng/mL in level would increase fatality rate by 0.7%. Conclusion Plasma DNA has potential use for predicting outcome in septic patients arriving at the emergency room. Plasma mitochondrial DNA level on admission is a more powerful predictor than lactate concentration or SOFA scores on admission.

  5. Criminal Justice in the United States: A Primer

    OpenAIRE

    James B. Jacobs

    2007-01-01

    In this primer on the U.S. criminal justice system, James B. Jacobs, Warren E. Burger Professor of Law at New York University (NYU) and Director of the Center for Research in Crime and Justice at the NYU School of Law, explains the structure and basic jurisprudence of U.S. criminal law and criminal procedure.

  6. Diversity of internal structures in inhibited epoxy primers

    Directory of Open Access Journals (Sweden)

    Anthony E. Hughes

    2015-10-01

    Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.

  7. Criticality calculations with MCNP{sup TM}: A primer

    Energy Technology Data Exchange (ETDEWEB)

    Mendius, P.W. [ed.; Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

    1994-08-01

    The purpose of this Primer is to assist the nuclear criticality safety analyst to perform computer calculations using the Monte Carlo code MCNP. Because of the closure of many experimental facilities, reliance on computer simulation is increasing. Often the analyst has little experience with specific codes available at his/her facility. This Primer helps the analyst understand and use the MCNP Monte Carlo code for nuclear criticality analyses. It assumes no knowledge of or particular experience with Monte Carlo codes in general or with MCNP in particular. The document begins with a Quickstart chapter that introduces the basic concepts of using MCNP. The following chapters expand on those ideas, presenting a range of problems from simple cylinders to 3-dimensional lattices for calculating keff confidence intervals. Input files and results for all problems are included. The Primer can be used alone, but its best use is in conjunction with the MCNP4A manual. After completing the Primer, a criticality analyst should be capable of performing and understanding a majority of the calculations that will arise in the field of nuclear criticality safety.

  8. Characteristics of the population employed in primer sector in Turkey

    Directory of Open Access Journals (Sweden)

    Bayar Rüya

    2006-01-01

    Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.

  9. The Cosmic Microwave Background

    Directory of Open Access Journals (Sweden)

    Jones Aled

    1998-01-01

    Full Text Available We present a brief review of current theory and observations of the cosmic microwave background (CMB. New predictions for cosmological defect theories and an overview of the inflationary theory are discussed. Recent results from various observations of the anisotropies of the microwave background are described and a summary of the proposed experiments is presented. A new analysis technique based on Bayesian statistics that can be used to reconstruct the underlying sky fluctuations is summarised. Current CMB data is used to set some preliminary constraints on the values of fundamental cosmological parameters $Omega$ and $H_circ$ using the maximum likelihood technique. In addition, secondary anisotropies due to the Sunyaev-Zel'dovich effect are described.

  10. DEVELOPMENT OF MULTIPLEX DNA-MARKER SET FOR IDENTIFICATION OF RICE BLAST RESISTANCE GENES Pi -40 AND Pi-b

    OpenAIRE

    Suprun I. I.; Kovalev V. S.; Shilovskiy V. N.

    2013-01-01

    Multiplex DNA-marker set for PCR identification for rice blast resistance genes Pi-40 and Pi-b was developed in this study. Optimal primers combinations and PCR conditions allows to identify both abovementioned genes in the single PCR

  11. Unitarity and singular backgrounds

    OpenAIRE

    Brouzakis, Nikos; Quiros, Mariano

    2013-01-01

    We compute the graviton Kaluza-Klein spectrum on a gravity-dilaton background with a naked singularity for all possible boundary conditions at the singularity which are consistent with unitary evolution. We apply methods from non-relativistic quantum mechanics with singular Schr\\"{o}dinger potentials. In general the spectrum contains a tachyon, a sign of instability. Only for a particular boundary condition at the singularity is the spectrum free of tachyons. In this case the lowest-lying gra...

  12. Australia; Background Material

    OpenAIRE

    International Monetary Fund

    1995-01-01

    This paper describes the developments in the Australian labor market during the 1990s. In 1994, a number of new labor market programs were launched, directed especially at the long-term unemployed, and a further step was taken in the evolutionary reform of the industrial relations system. The paper reviews developments in employment, wages, and productivity in Australia that formed the background to these policy initiatives. It also examines the conduct of fiscal policy at the Commonwealth an...

  13. Sri Lanka; Background Papers

    OpenAIRE

    International Monetary Fund

    1995-01-01

    This Background Paper on Sri Lanka provides information on the economic developments during 1992–95. Developments in the domestic and external sectors are discussed. The deficiencies of the official consumer price index that resulted in a substantial understatement of inflation performance in 1994 and alternative estimates of underlying inflation are described. The structural rigidities in the labor market that perpetuate high unemployment and limit job growth are also described. The paper ...

  14. Background, phenomenology, and motivation

    International Nuclear Information System (INIS)

    The authors discuss the background to the kinetics of adsorption and desorption after an elementary introduction to the problem of chemisorption in two limiting cases. Other topics discussed include the thermodynamics of adsorption, reaction mechanisms outside surfaces, and a case history of catalytic hydrogenation of carbon monoxide. Figures show the potential energy barrier as a function of an appropriate reaction coordinate, and bonding of carbon monoxide to platinum metal

  15. Some background about satellites

    Science.gov (United States)

    Burns, Joseph A.

    1986-01-01

    Four tables of planetary and satellite data are presented which list satellite discoveries, planetary parameters, satellite orbits, and satellite physical properties respectively. A scheme for classifying the satellites is provided and it is noted that most known moons fall into three general classes: regular satellites, collisional shards, and irregular satellites. Satellite processes are outlined with attention given to origins, dynamical and thermal evolution, surface processes, and composition and cratering. Background material is provided for each family of satellites.

  16. Detection of Balamuthia mandrillaris DNA by real-time PCR targeting the RNase P gene

    Directory of Open Access Journals (Sweden)

    Lewin Astrid

    2008-12-01

    Full Text Available Abstract Background The free-living amoeba Balamuthia mandrillaris may cause fatal encephalitis both in immunocompromised and in – apparently – immunocompetent humans and other mammalian species. Rapid, specific, sensitive, and reliable detection requiring little pathogen-specific expertise is an absolute prerequisite for a successful therapy and a welcome tool for both experimental and epidemiological research. Results A real-time polymerase chain reaction assay using TaqMan® probes (real-time PCR was established specifically targeting the RNase P gene of B. mandrillaris amoebae. The assay detected at least 2 (down to 0.5 genomes of B. mandrillaris grown in axenic culture. It did not react with DNA from closely related Acanthamoeba (3 species, nor with DNA from Toxoplasma gondii, Leishmania major, Pneumocystis murina, Mycobacterium bovis (BCG, human brain, various mouse organs, or from human and murine cell lines. The assay efficiently detected B. mandrillaris DNA in spiked cell cultures, spiked murine organ homogenates, B. mandrillaris-infected mice, and CNS tissue-DNA preparations from 2 patients with proven cerebral balamuthiasis. This novel primer set was successfully combined with a published set that targets the B. mandrillaris 18S rRNA gene in a duplex real-time PCR assay to ensure maximum specificity and as a precaution against false negative results. Conclusion A real-time PCR assay for B. mandrillaris amoebae is presented, that is highly specific, sensitive, and reliable and thus suited both for diagnosis and for research.

  17. Discrimination of mitochondrial DNA 10400 locus by SNP-operatedon/off Switch

    Institute of Scientific and Technical Information of China (English)

    Mei Hong; Enben Su; Ziqing Chen; Xiaobing Ju; Qi Chen; Rong Zhou

    2008-01-01

    Objective:To apply reformed AS-PCR, which combined phosphorothioate-modified primers with exo polymerase, in single nucle-otidepolymorphism discrimination of mitochondrial DNA 10400 locus. Methods: We used the mtDNA 10400 locus to design unmodi-fied and 3 ' phosphorothioate-modified allele-specific primers for PCR, which was performed using polymerases with and without 3, exonuclease activities. The effects of these primers on primer-extension were evaluated by agarose gel electrophoresis. Results: The unmodified primers were extended by both exo and exo+ polymerase irrespective of whether the primers were matched or mismatched with the templates. However, the 3' phosphorothioate-modified primers with a terminal mismatch triggered an "off-switch" of exo+polymerase when compared to exo'polymerase. Conclusion: The" on/off"switch constituted by the combination of 3' phosphorothioate-modified primers with exo+ polymerase is a cost-effective, high-throughput and reliable method for SNP typing, which will be of enormous application in association studies by single nucleotide polymorphism screening.

  18. Single nucleotide primer extension to detect genetic diseases: Experimental application to hemophilia B (factor IX) and cystic fibrosis genes

    International Nuclear Information System (INIS)

    In this report, the authors describe an approach to detect the presence of abnormal alleles in those genetic diseases in which frequency of occurrence of the same mutation is high (e.g., hemophilia B). Initially, from each subject, the DNA fragment containing the putative mutation site is amplified by the polymerase chain reaction. For each fragment two reaction mixtures are then prepared. Each contains the amplified fragment, a primer (18-mer or longer) whose sequence is identical to the coding sequence of the normal gene immediately flanking the 5' end of the mutation site, and either an α-32P-labeled nucleotide corresponding to the normal coding sequence at the mutation site or an α-32P-labeled nucleotide corresponding to the mutant sequence. An essential feature of the present methodology is that the base immediately 3' to the template-bound primer is one of those altered in the mutant, since in this way an extension of the primer by a single base will give an extended molecule characteristic of either the mutant or the wild type. The method is rapid and should be useful in carrier detection and prenatal diagnosis of every genetic disease with a known sequence variation

  19. Development of species-specific PCR primers and polyphasic characterization of Lactobacillus sanfranciscensis isolated from Korean sourdough.

    Science.gov (United States)

    Lee, Hyeongrho; Baek, Hyunwook; Lim, Sae Bom; Hur, Jin Soo; Shim, Sangmin; Shin, So-Yeon; Han, Nam Soo; Seo, Jin-Ho

    2015-05-01

    Lactobacillus sanfranciscensis is a bacterium used in sourdough that provides desirable properties such as better flavor and texture to the sourdough bread. Here, the intra-species diversity of L. sanfranciscensis strains isolated from Korean sourdough was studied using genotypic (multiplex-RAPD-PCR: multiplex-Randomly Amplified Polymorphic DNA-polymerase chain reaction) and phenotypic (VITEK2 Compact system) analyses. For this, a novel species-specific set of PCR primers was developed to identify L. sanfranciscensis using the recently published genome database. The primers were able to detect L. sanfranciscensis isolated from Korean sourdough with 100% accuracy. Genotyping and phenotyping analyses at the strain level demonstrated that Korean sourdough possesses various biotypes of L. sanfranciscensis strains. These strains were clustered into 5 subtypes (genotyping) or 7 subtypes (phenotyping). In summary, this strategy to construct novel primers reduced the chance of cross amplification and was able to identify the desired strain. The various strains isolated in this study can be used to develop a sourdough starter after the analysis of their fermentation characteristics. PMID:25702881

  20. Evaluation of shear bond strength of metal bracket to enamel after application of primers over bracket base-an in vitro study

    Directory of Open Access Journals (Sweden)

    Firuzbakht MM

    2011-04-01

    Full Text Available "nBackground and Aims: The aim of this study was to evaluate the effect of application of two types of primers over bracket bases on the shear bond strength (SBS and mode of bond failure."nMaterials and Methods: In this study, 75 human premolar teeth were divided into three equal groups. In group 1 (control, after surface preparation of enamel by conventional method (acid etching+primer brackets were bonded with Transbond XT composite. In group 2 (TX, brackets were bonded to enamel same as the first group but Transbond XT primer were used on bracket bases before placement of composite. In group 3 (PL, Transbond plus primer was applied on bracket bases before placement of composite. After 24 h, the SBS test was performed by universal testing machine at crosshead speed of 0.5 mm/min. Then, adhesive remnant index (ARI scores and percentage of cohesive fracture were determined using stereomicroscopy. SBS data were analyzed by one-way ANOVA and Duncan tests. Kruskal-Wallis and Mann-Whitney tests were used to analyze ARI and cohesive fracture results."nResults: There was significant difference in SBS values among the groups (P<0.001. The highest SBS was shown in TX group and the lowest was seen in PL group. There was no significant difference between control and TX groups in ARI scores (P=0.199. No significant difference was found in cohesive fracture values between the groups (P=0.093. Both the control and TX groups showed significant difference in ARI scores and cohesive fracture compared with the PL group in all of the comparisons (P<0.001."nConclusion: Application of Transbond XT primer over bracket base affects the bond strength and failure mode. Transbond XT primer increased the bond strength but Transbond plus primer decreased it.

  1. Assembling semiconductor nanocomposites using DNA replication technologies.

    Energy Technology Data Exchange (ETDEWEB)

    Heimer, Brandon W.; Crown, Kevin K.; Bachand, George David

    2005-11-01

    Deoxyribonucleic acid (DNA) molecules represent Nature's genetic database, encoding the information necessary for all cellular processes. From a materials engineering perspective, DNA represents a nanoscale scaffold with highly refined structure, stability across a wide range of environmental conditions, and the ability to interact with a range of biomolecules. The ability to mass-manufacture functionalized DNA strands with Angstrom-level resolution through DNA replication technology, however, has not been explored. The long-term goal of the work presented in this report is focused on exploiting DNA and in vitro DNA replication processes to mass-manufacture nanocomposite materials. The specific objectives of this project were to: (1) develop methods for replicating DNA strands that incorporate nucleotides with ''chemical handles'', and (2) demonstrate attachment of nanocrystal quantum dots (nQDs) to functionalized DNA strands. Polymerase chain reaction (PCR) and primer extension methodologies were used to successfully synthesize amine-, thiol-, and biotin-functionalized DNA molecules. Significant variability in the efficiency of modified nucleotide incorporation was observed, and attributed to the intrinsic properties of the modified nucleotides. Noncovalent attachment of streptavidin-coated nQDs to biotin-modified DNA synthesized using the primer extension method was observed by epifluorescence microscopy. Data regarding covalent attachment of nQDs to amine- and thiol-functionalized DNA was generally inconclusive; alternative characterization tools are necessary to fully evaluate these attachment methods. Full realization of this technology may facilitate new approaches to manufacturing materials at the nanoscale. In addition, composite nQD-DNA materials may serve as novel recognition elements in sensor devices, or be used as diagnostic tools for forensic analyses. This report summarizes the results obtained over the course of this 1-year

  2. DNA Book

    OpenAIRE

    Kawai, Jun; Hayashizaki, Yoshihide

    2003-01-01

    We propose herein a new method of DNA distribution, whereby DNA clones or PCR products are printed directly onto the pages of books and delivered to users along with relevant scientific information. DNA sheets, comprising water-soluble paper onto which DNA is spotted, can be bound into books. Readers can easily extract the DNA fragments from DNA sheets and amplify them using PCR. We show that DNA sheets can withstand various conditions that may be experienced during bookbinding and deli...

  3. Criticality calculations with MCNP{trademark}: A primer

    Energy Technology Data Exchange (ETDEWEB)

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A. [New Mexico Univ., Albuquerque, NM (United States)

    1994-06-06

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand.

  4. Cleaving DNA with DNA

    Science.gov (United States)

    Carmi, Nir; Balkhi, Shameelah R.; Breaker, Ronald R.

    1998-03-01

    A DNA structure is described that can cleave single-stranded DNA oligonucleotides in the presence of ionic copper. This ``deoxyribozyme'' can self-cleave or can operate as a bimolecular complex that simultaneously makes use of duplex and triplex interactions to bind and cleave separate DNA substrates. Bimolecular deoxyribozyme-mediated strand scission proceeds with a kobs of 0.2 min-1, whereas the corresponding uncatalyzed reaction could not be detected. The duplex and triplex recognition domains can be altered, making possible the targeted cleavage of single-stranded DNAs with different nucleotide sequences. Several small synthetic DNAs were made to function as simple ``restriction enzymes'' for the site-specific cleavage of single-stranded DNA.

  5. Establishment of dna fingerprinting in clonal tea improved cultivars from yunnan of china using issr markers

    International Nuclear Information System (INIS)

    In this study, DNA fingerprints were constructed by using ISSR markers for 20 clonal improved varieties developed by two breeding institutes in Yunnan province. Seven core ISSR primers were selected from 15 primers. A total of 110 bands were generated by PAGE with seven core primers, 93 of which were polymorphic bands, the percentage of polymorphic band (PPB) was 84.54%, and the mean value of polymorphism information content (PIC) reached 0.417; the genetic similarity coefficient of the cultivars was 0.574-0.854. The two primers, UBC835 and ISSR2, had high PIC values, and could be used to distinguish all cultivars, presenting the most efficient single primers. Among the all of primer combinations from the seven core primers, the three combinations, UBC835/UBC811, UBC835/ISSR2, and UBC835/ISSR3 showed lower similar coefficients, and more efficient in identifying the 20 improved varieties than the other primer combinations. Then these three primer combinations were further scored in 15 traditional cultivars. The results showed that UBC835/ISSR2 was the optimal primer combination, which could be used to distinguish each material among the 20 clonal improved varieties and 15 traditional cultivals. Finally, the DNA fingerprints of the 20 clonal improved varieties were constructed based on country and region code, breeding institute, core primer name and ISSR marker data. The established fingerprints could provide reliable scientific base for the protection of intellectual property right for these clonal improved varieties, and the important molecular information contained in these fingerprints would be useful for the authenticity identification and genetic relationship analysis of tea varieties. (author)

  6. Testing the potential of a ribosomal 16S marker for DNA metabarcoding of insects

    Science.gov (United States)

    Elbrecht, Vasco; Taberlet, Pierre; Dejean, Tony; Valentini, Alice; Usseglio-Polatera, Philippe; Beisel, Jean-Nicolas; Coissac, Eric; Boyer, Frederic

    2016-01-01

    Cytochrome c oxidase I (COI) is a powerful marker for DNA barcoding of animals, with good taxonomic resolution and a large reference database. However, when used for DNA metabarcoding, estimation of taxa abundances and species detection are limited due to primer bias caused by highly variable primer binding sites across the COI gene. Therefore, we explored the ability of the 16S ribosomal DNA gene as an alternative metabarcoding marker for species level assessments. Ten bulk samples, each containing equal amounts of tissue from 52 freshwater invertebrate taxa, were sequenced with the Illumina NextSeq 500 system. The 16S primers amplified three more insect species than the Folmer COI primers and amplified more equally, probably due to decreased primer bias. Estimation of biomass might be less biased with 16S than with COI, although variation in read abundances of two orders of magnitudes is still observed. According to these results, the marker choice depends on the scientific question. If the goal is to obtain a taxonomic identification at the species level, then COI is more appropriate due to established reference databases and known taxonomic resolution of this marker, knowing that a greater proportion of insects will be missed using COI Folmer primers. If the goal is to obtain a more comprehensive survey the 16S marker, which requires building a local reference database, or optimised degenerated COI primers could be more appropriate. PMID:27114891

  7. Testing the potential of a ribosomal 16S marker for DNA metabarcoding of insects.

    Science.gov (United States)

    Elbrecht, Vasco; Taberlet, Pierre; Dejean, Tony; Valentini, Alice; Usseglio-Polatera, Philippe; Beisel, Jean-Nicolas; Coissac, Eric; Boyer, Frederic; Leese, Florian

    2016-01-01

    Cytochrome c oxidase I (COI) is a powerful marker for DNA barcoding of animals, with good taxonomic resolution and a large reference database. However, when used for DNA metabarcoding, estimation of taxa abundances and species detection are limited due to primer bias caused by highly variable primer binding sites across the COI gene. Therefore, we explored the ability of the 16S ribosomal DNA gene as an alternative metabarcoding marker for species level assessments. Ten bulk samples, each containing equal amounts of tissue from 52 freshwater invertebrate taxa, were sequenced with the Illumina NextSeq 500 system. The 16S primers amplified three more insect species than the Folmer COI primers and amplified more equally, probably due to decreased primer bias. Estimation of biomass might be less biased with 16S than with COI, although variation in read abundances of two orders of magnitudes is still observed. According to these results, the marker choice depends on the scientific question. If the goal is to obtain a taxonomic identification at the species level, then COI is more appropriate due to established reference databases and known taxonomic resolution of this marker, knowing that a greater proportion of insects will be missed using COI Folmer primers. If the goal is to obtain a more comprehensive survey the 16S marker, which requires building a local reference database, or optimised degenerated COI primers could be more appropriate. PMID:27114891

  8. Stochastic gravity: a primer with applications

    International Nuclear Information System (INIS)

    Stochastic semiclassical gravity of the 1990s is a theory naturally evolved from semiclassical gravity of the 1970s and 1980s. It improves on the semiclassical Einstein equation with source given by the expectation value of the stress-energy tensor of quantum matter fields in curved spacetime by incorporating an additional source due to their fluctuations. In stochastic semiclassical gravity the main object of interest is the noise kernel, the vacuum expectation value of the (operator-valued) stress-energy bi-tensor, and the centrepiece is the (semiclassical) Einstein-Langevin equation. We describe this new theory via two approaches: the axiomatic and the functional. The axiomatic approach is useful to see the structure of the theory from the framework of semiclassical gravity, showing the link from the mean value of the energy-momentum tensor to their correlation functions. The functional approach uses the Feynman-Vernon influence functional and the Schwinger-Keldysh closed-time-path effective action methods which are convenient for computations. It also brings out the open system concepts and the statistical and stochastic contents of the theory such as dissipation, fluctuations, noise and decoherence. We then describe the applications of stochastic gravity to the backreaction problems in cosmology and black-hole physics. In the first problem, we study the backreaction of conformally coupled quantum fields in a weakly inhomogeneous cosmology. In the second problem, we study the backreaction of a thermal field in the gravitational background of a quasi-static black hole (enclosed in a box) and its fluctuations. These examples serve to illustrate closely the ideas and techniques presented in the first part. This topical review is intended as a first introduction providing readers with some basic ideas and working knowledge. Thus, we place more emphasis here on pedagogy than completeness. (Further discussions of ideas, issues and ongoing research topics can be found

  9. Stochastic gravity: a primer with applications

    Energy Technology Data Exchange (ETDEWEB)

    Hu, B L [Department of Physics, University of Maryland, College Park, MD 20742-4111 (United States); Verdaguer, E [Departament de Fisica Fonamental and CER en Astrofisica Fisica de Particules i Cosmologia, Universitat de Barcelona, Av. Diagonal 647, 08028 Barcelona (Spain)

    2003-03-21

    Stochastic semiclassical gravity of the 1990s is a theory naturally evolved from semiclassical gravity of the 1970s and 1980s. It improves on the semiclassical Einstein equation with source given by the expectation value of the stress-energy tensor of quantum matter fields in curved spacetime by incorporating an additional source due to their fluctuations. In stochastic semiclassical gravity the main object of interest is the noise kernel, the vacuum expectation value of the (operator-valued) stress-energy bi-tensor, and the centrepiece is the (semiclassical) Einstein-Langevin equation. We describe this new theory via two approaches: the axiomatic and the functional. The axiomatic approach is useful to see the structure of the theory from the framework of semiclassical gravity, showing the link from the mean value of the energy-momentum tensor to their correlation functions. The functional approach uses the Feynman-Vernon influence functional and the Schwinger-Keldysh closed-time-path effective action methods which are convenient for computations. It also brings out the open system concepts and the statistical and stochastic contents of the theory such as dissipation, fluctuations, noise and decoherence. We then describe the applications of stochastic gravity to the backreaction problems in cosmology and black-hole physics. In the first problem, we study the backreaction of conformally coupled quantum fields in a weakly inhomogeneous cosmology. In the second problem, we study the backreaction of a thermal field in the gravitational background of a quasi-static black hole (enclosed in a box) and its fluctuations. These examples serve to illustrate closely the ideas and techniques presented in the first part. This topical review is intended as a first introduction providing readers with some basic ideas and working knowledge. Thus, we place more emphasis here on pedagogy than completeness. (Further discussions of ideas, issues and ongoing research topics can be found

  10. Development of DNA marker for Fusarium resistance in Pisang Berangan

    International Nuclear Information System (INIS)

    Fusarium wilt (Panama disease), a disease caused by a soil-bome fungus Fusarium oxysporum f. sp. cubense, is regarded as one of the most significant threats to banana (Musa spp.) production worldwide. In Malaysia, it is affecting the Cavendish as well as Pisang Berangan which are widely planted for export as well as for local consumption. Pisang Berangan mutant line (MB96) which was obtained through induced mutation by gamma irradiation has showed certain degree of tolerance towards the disease. Attempts were made to utilise Polymerase Chain Reaction (PCR) based techniques i.e. RAPD (Random Amplified Polymorphic DNA) to screen for unique DNA sequences that are associated or closely linked to these tolerance characteristics. Four single 1 Obp primers and five duplex 1 Obp primers combinations were used to detect polymorphism between the DNA of control and 4 mutant lines micropropagated from MB96. As further control, DNA of Pisang Mas was included. Duplex arbitrary primer combinations 11-89 and single primer OPA-3 have produced DNA fragments that are polymorphic between cultivar, Pisang Berangan and Pisang Mas. However the RAPD analysis failed to show any polymorphism between the control and the mutant lines or in between the mutant lines

  11. ANALYSIS OF THE VARIANTS PRODUCED THROUGH TISSUE CULTURE TECHNIQUES IN WITHANIA SOMNIFERA (L) DUNAL. BY DNA FINGER PRINTING EMPLOYING RAPD METHOD

    OpenAIRE

    Devika Shetty; Nareshchandra

    2012-01-01

    Withania somnifera (L) Dunal.var.JA20 (Jawahar Asgund 20), JA134 (Jawahar Asgund134), GLV(Gujarat Local Variety) and wild plants were regenerated from callus cultures on MS medium supplemented with BAP and 2,4-D. DNA finger printing by PCR method with randomly amplified primers was carried out for mother plants and regenerated plants. Of 10 different primers from OPBE series, 3 primers namely OPBE 09-GGAAGCGTCC, OPBE 15-CTTTGCGCAC and OPBE 18-GGGAAAAGCC produced polymorphisms. Minor variati...

  12. Genetic variation in Opisthorchis viverrini (Trematoda: Opisthorchiidae) from northeast Thailand and Laos PDR based on random amplified polymorphic DNA analyses

    OpenAIRE

    Sithithaworn, Paiboon; Nuchjungreed, Chadaporn; Srisawangwong, Tuanchai; Ando, Katsuhiko; Petney, Trevor N.; Chilton, Neil B.; Andrews, Ross H.

    2006-01-01

    Genetic variation in Opisthorchis viverrini adults originating from different locations in northeast Thailand and Laos, People’s Democratic Republic (PDR), was examined using random amplified polymorphic DNA (RAPD) analyses. In an initial analysis, the genomic DNA of one fluke from each of ten localities was amplified using 15 random primers (10-mers); however, genetic variation among O. viverrini specimens was detected reliably for only four primers. A more detailed RAPD analysis using these...

  13. Backgrounded but not peripheral

    DEFF Research Database (Denmark)

    Hovmark, Henrik

    DDAs in question contribute to the socio-cultural construction of identity, i.e. that they play a rather specific role in discursive communication and socio-cultural meaning construction. On the other hand it is clear that the semantics of the DDAs in question, seen in isolation, is very abstract or...... general; furthermore, the DDAs are backgrounded in discourse. Is it reasonable to claim, rather boldly, that “the informants express their identity in the use of the directional adverb ud ‘out’ etc.”? In the course of this article, however, I suggest that the DDAs in question do contribute to the socio-cultural...

  14. The Cosmic Background Radiation

    OpenAIRE

    Smoot, George; Scott, Douglas

    1997-01-01

    We review the current status of experimental data for spectral distortions and angular anisotropies of the cosmic microwave background, as well as discussing the relevant physical processes. This is one of a number of new articles in astrophysics and cosmology which will appear in the 1996 Review of Particle Properties (Phys. Rev. D. in press). Other relevant reviews include: "Big-Bang Cosmology" by K.A. Olive; "Big-Bang Nucleosynthesis" by K.A. Olive & D.N. Schramm; "The Hubble Constant" by ...

  15. Malaysia; Background Paper

    OpenAIRE

    International Monetary Fund

    1996-01-01

    This Background Paper on Malaysia examines developments and trends in the labor market since the mid-1980s. The paper describes the changes in the employment structure and the labor force. It reviews wages and productivity trends and their effects on unit labor cost. The paper highlights that Malaysia’s rapid growth, sustained since 1987, has had a major impact on the labor market. The paper outlines the major policy measures to address the labor constraints. It also analyzes Malaysia’s r...

  16. Background and introduction

    DEFF Research Database (Denmark)

    Jensen, Per Anker; van der Voordt, Theo; Coenen, Christian

    2012-01-01

    in scope between FM and CREM is that CREM has its focus on real estate as physical and economical assets utilized by an organisation, while FM has a wider service focus. The difference in scope between FM and CREM on one side and B2B marketing on the other is that FM and CREM are related to...... chapter provides important background information to understand the following chapters in this book. Research limitations: The chapter is mainly based on the experience and knowledge of the editors. It does not include original research but provides an introductory overview of the book. Originality...

  17. Family Background and Entrepreneurship

    DEFF Research Database (Denmark)

    Lindquist, Matthew J.; Sol, Joeri; Van Praag, Mirjam;

    Vast amounts of money are currently being spent on policies aimed at promoting entrepreneurship. The success of such policies, however, rests in part on the assumption that individuals are not ‘born entrepreneurs’. In this paper, we assess the importance of family background and neighborhood...... effects as determinants of entrepreneurship. We start by estimating sibling correlations in entrepreneurship. We find that between 20 and 50 percent of the variance in different entrepreneurial outcomes is explained by factors that siblings share. The average is 28 percent. Allowing for differential...... entrepreneurship does play a large role, as do shared genes....

  18. Development, distribution and application of DNA markers for cereal research

    International Nuclear Information System (INIS)

    DNA probes and primers are important resources for molecular genetic research and molecular breeding. Presently, more than 2500 wheat probes, 400 barley probes, 800 foxtail, pearl millet and finger millet probes, and approximately 150 wheat microsatellite (SSR) primer pairs have been developed and maintained in our DNA Resource Centre at the John Innes Centre (JIC). To accelerate probe and primer distribution, an 'anchor set' and a 'supplementary anchor set', containing 73 and 31 wheat RFLP probes, respectively, and a standard set of 42 primer pairs for wheat SSR markers were selected. Similarly, a set of 52 pearl millet probes has been selected for distribution. More than 8000 wheat RFLP probes, 2000 wheat SSR primer pairs, 700 millet probes and 200 barley probes have been distributed to more than 250 research groups in 40 countries. Our wheat and millet probes and other grass cDNA probes have been used for comparative genetic studies. The revealed conservation of gene content and gene order has been used to construct maps of many grass species and to predict the locations of key genes from one crop species to another. Developed SSR and AFLP markers in wheat, barley and millet are particularly suited for genetic diversity analyses and map construction. (author)

  19. Genomic fingerprints of Staphylococcus aureus of bovine origin by polymerase chain reaction-based DNA fingerprinting.

    OpenAIRE

    Matthews, K R; Kumar, S. J.; O'Conner, S. A.; Harmon, R J; Pankey, J W; Fox, L. K.; Oliver, S P

    1994-01-01

    Staphylococcus aureus (n = 75) isolated from mammary secretions of cows with subclinical and clinical mastitis from several geographic locations in the USA were examined using polymerase chain reaction-based DNA fingerprinting. DNA fingerprints were produced using a synthetic oligonucleotide primer (5'GTAACGCC3') to produce a distinct spectrum of amplified DNA fragments facilitating a high degree of resolution for differentiating S. aureus strains. PCR-based DNA fingerprinting grouped the 75 ...

  20. Liquid Chromatography-Mass Spectrometry Analysis of DNA Polymerase Reaction Products

    OpenAIRE

    Chowdhury, Goutam; Guengerich, F. Peter

    2011-01-01

    This unit describes experimental and analytical procedures for characterizing the efficiency and fidelity of translesion DNA synthesis across various DNA damages by DNA polymerases in vitro. This procedure utilizes primer extension assays followed by LC-MS and LC-MS/MS analysis of the extension products. Detailed explanations for the analysis of the LC-MS/MS data for deciphering the nucleotide sequences of the DNA fragments are also presented. This approach provides a significant improvement ...

  1. Regulation of mitochondrial transcription and mtDNA copy number in mammals

    OpenAIRE

    Rantanen, Anja

    2003-01-01

    Functional mitochondria are essential for wellbeing of the cell and the whole organism. Gene expression from the mitochondrial genome (mtDNA) is indispensable for oxidative phosphorylation, but also for the replication of mtDNA, as the replication primers are processed from mtDNA transcripts. Mitochondrial transcription factor A (TFAM) is a key transcriptional activator that is also necessary for the maintenance of mtDNA. In this thesis we have focused on characterizing the ...

  2. Concurrent genotyping of Helicobacter pylori virulence genes and human cytokine SNP sites using whole genome amplified DNA derived from minute amounts of gastric biopsy specimen DNA

    Directory of Open Access Journals (Sweden)

    Borch Kurt

    2008-10-01

    Full Text Available Abstract Background Bacterial and cellular genotyping is becoming increasingly important in the diagnosis of infectious diseases. However, difficulties in obtaining sufficient amount of bacterial and cellular DNA extracted from the same human biopsy specimens is often a limiting factor. In this study, total DNA (host and bacterial DNA was isolated from minute amounts of gastric biopsy specimens and amplified by means of whole genome amplification using the multiple displacement amplification (MDA technique. Subsequently, MDA-DNA was used for concurrent Helicobacter pylori and human host cellular DNA genotyping analysis using PCR-based methods. Results Total DNA was isolated from gastric biopsy specimens of 12 subjects with gastritis and 16 control subjects having a normal mucosa. The DNA was amplified using a multiple displacement amplification (MDA kit. Next, concurrent genotyping was performed using H. pylori-specific virulence gene PCR amplification assays, pyrosequencing of bacterial 16S rDNA and PCR characterisation of various host genes. This includes Interleukin 1-beta (IL1B and Interferon-gamma receptor (IFNGR1 SNP analysis, and Interleukin-1 receptor antagonist (IL1RN variable tandem repeats (VNTR in intron 2. Finally, regions of the vacA-gene were PCR amplified using M13-sequence tagged primers which allowed for direct DNA sequencing, omitting cloning of PCR amplicons. H. pylori specific multiplex PCR assays revealed the presence of H. pylori cagA and vacA genotypic variations in 11 of 12 gastritis biopsy specimens. Using pyrosequencing, 16S rDNA variable V3 region signatures of H. pylori were found in 11 of 12 individuals with gastritis, but in none of the control subjects. Similarly, IL1B and IFNGR1-SNP and IL1RN-VNTR patterns could be established in all individuals. Furthermore, sequencing of M13-sequence tagged vacA-PCR amplicons revealed the presence of highly diverse H. pylori vacA-s/i/m regions. Conclusion The PCR

  3. Oligonucleotide indexing of DNA barcodes: identification of tuna and other scombrid species in food products

    Directory of Open Access Journals (Sweden)

    Botti Sara

    2010-08-01

    Full Text Available Abstract Background DNA barcodes are a global standard for species identification and have countless applications in the medical, forensic and alimentary fields, but few barcoding methods work efficiently in samples in which DNA is degraded, e.g. foods and archival specimens. This limits the choice of target regions harbouring a sufficient number of diagnostic polymorphisms. The method described here uses existing PCR and sequencing methodologies to detect mitochondrial DNA polymorphisms in complex matrices such as foods. The reported application allowed the discrimination among 17 fish species of the Scombridae family with high commercial interest such as mackerels, bonitos and tunas which are often present in processed seafood. The approach can be easily upgraded with the release of new genetic diversity information to increase the range of detected species. Results Cocktail of primers are designed for PCR using publicly available sequences of the target sequence. They are composed of a fixed 5' region and of variable 3' cocktail portions that allow amplification of any member of a group of species of interest. The population of short amplicons is directly sequenced and indexed using primers containing a longer 5' region and the non polymorphic portion of the cocktail portion. A 226 bp region of CytB was selected as target after collection and screening of 148 online sequences; 85 SNPs were found, of which 75 were present in at least two sequences. Primers were also designed for two shorter sub-fragments that could be amplified from highly degraded samples. The test was used on 103 samples of seafood (canned tuna and scomber, tuna salad, tuna sauce and could successfully detect the presence of different or additional species that were not identified on the labelling of canned tuna, tuna salad and sauce samples. Conclusions The described method is largely independent of the degree of degradation of DNA source and can thus be applied to

  4. The Backgrounds Data Center

    Science.gov (United States)

    Snyder, W. A.; Gursky, H.; Heckathorn, H. M.; Lucke, R. L.; Berg, S. L.; Dombrowski, E. G.; Kessel, R. A.

    1993-01-01

    The Strategic Defense Initiative Organization has created data centers for midcourse, plumes, and backgrounds phenomenologies. The Backgrounds Data Center (BDC) has been designated as the prime archive for data collected by SDIO programs. The BDC maintains a Summary Catalog that contains 'metadata,' that is, information about data, such as when the data were obtained, what the spectral range of the data is, and what region of the Earth or sky was observed. Queries to this catalog result in a listing of all data sets (from all experiments in the Summary Catalog) that satisfy the specified criteria. Thus, the user can identify different experiments that made similar observations and order them from the BDC for analysis. On-site users can use the Science Analysis Facility (SAFE for this purpose. For some programs, the BDC maintains a Program Catalog, which can classify data in as many ways as desired (rather than just by position, time, and spectral range as in the Summary Catalog). For example, data sets could be tagged with such diverse parameters as solar illumination angle, signal level, or the value of a particular spectral ratio, as long as these quantities can be read from the digital record or calculated from it by the ingest program. All unclassified catalogs and unclassified data will be remotely accessible.

  5. PriSM: a primer selection and matching tool for amplification and sequencing of viral genomes

    OpenAIRE

    Yu, Qing; Ryan, Elizabeth M; Allen, Todd M.; Birren, Bruce W.; Henn, Matthew R.; Lennon, Niall J.

    2010-01-01

    Summary: PriSM is a set of algorithms designed to select and match degenerate primer pairs for the amplification of viral genomes. The design of panels of hundreds of primer pairs takes just hours using this program, compared with days using a manual approach. PriSM allows for rapid in silico optimization of primers for downstream applications such as sequencing. As a validation, PriSM was used to create an amplification primer panel for human immunodeficiency virus (HIV) Clade B.

  6. Resin bonding of metal brackets to glazed zirconia with a porcelain primer

    OpenAIRE

    Lee, Jung-Hwan; Lee, Milim; Kim, Kyoung-Nam; Hwang, Chung-Ju

    2015-01-01

    Objective The aims of this study were to compare the shear bond strength between orthodontic metal brackets and glazed zirconia using different types of primer before applying resin cement and to determine which primer was more effective. Methods Zirconia blocks were milled and embedded in acrylic resin and randomly assigned to one of four groups: nonglazed zirconia with sandblasting and zirconia primer (NZ); glazed zirconia with sandblasting, etching, and zirconia primer (GZ); glazed zirconi...

  7. Holography for Schrodinger backgrounds

    CERN Document Server

    Guica, Monica; Taylor, Marika; van Rees, Balt

    2010-01-01

    We discuss holography for Schrodinger solutions of both topologically massive gravity in three dimensions and massive vector theories in (d+1) dimensions. In both cases the dual field theory can be viewed as a d-dimensional conformal field theory (two dimensional in the case of TMG) deformed by certain operators that respect the Schrodinger symmetry. These operators are irrelevant from the viewpoint of the relativistic conformal group but they are exactly marginal with respect to the non-relativistic conformal group. The spectrum of linear fluctuations around the background solutions corresponds to operators that are labeled by their scaling dimension and the lightcone momentum k_v. We set up the holographic dictionary and compute 2-point functions of these operators both holographically and in field theory using conformal perturbation theory and find agreement. The counterterms needed for holographic renormalization are non-local in the v lightcone direction.

  8. Marker-Assisted Selection Backgrounder

    OpenAIRE

    Van Eenennaam, Alison

    2004-01-01

    DNA (deoxyribonucleic acid) is a molecule that is shaped like a double helix and made up of pairs of nucleotides. DNA transmits genetic information. DNA is packaged into chromosomes which are located within the nucleus of all cells. Every cell in the body contains all of the chromosomes that collectively make up the genome of that organism. DNA codes for amino acids which are linked together to make proteins. A gene is a stretch of DNA that specifies all of the amino acids that make up a sing...

  9. Gain of DNA methylation is enhanced in the absence of CTCF at the human retinoblastoma gene promoter

    Directory of Open Access Journals (Sweden)

    Recillas-Targa Félix

    2011-06-01

    Full Text Available Abstract Background Long-term gene silencing throughout cell division is generally achieved by DNA methylation and other epigenetic processes. Aberrant DNA methylation is now widely recognized to be associated with cancer and other human diseases. Here we addressed the contribution of the multifunctional nuclear factor CTCF to the epigenetic regulation of the human retinoblastoma (Rb gene promoter in different tumoral cell lines. Methods To assess the DNA methylation status of the Rb promoter, genomic DNA from stably transfected human erythroleukemic K562 cells expressing a GFP reporter transgene was transformed with sodium bisulfite, and then PCR-amplified with modified primers and sequenced. Single- and multi-copy integrants with the CTCF binding site mutated were isolated and characterized by Southern blotting. Silenced transgenes were reactivated using 5-aza-2'-deoxycytidine and Trichostatin-A, and their expression was monitored by fluorescent cytometry. Rb gene expression and protein abundance were assessed by RT-PCR and Western blotting in three different glioma cell lines, and DNA methylation of the promoter region was determined by sodium bisulfite sequencing, together with CTCF dissociation and methyl-CpG-binding protein incorporation by chromatin immunoprecipitation assays. Results We found that the inability of CTCF to bind to the Rb promoter causes a dramatic loss of gene expression and a progressive gain of DNA methylation. Conclusions This study indicates that CTCF plays an important role in maintaining the Rb promoter in an optimal chromatin configuration. The absence of CTCF induces a rapid epigenetic silencing through a progressive gain of DNA methylation. Consequently, CTCF can now be seen as one of the epigenetic components that allows the proper configuration of tumor suppressor gene promoters. Its aberrant dissociation can then predispose key genes in cancer cells to acquire DNA methylation and epigenetic silencing.

  10. Evaluation of multiplex PCR using MPB64 and IS6110 primers for rapid diagnosis of tuberculous meningitis.

    Science.gov (United States)

    Lekhak, Sunil Prasad; Sharma, Laxmi; Rajbhandari, Reema; Rajbhandari, Pravesh; Shrestha, Resha; Pant, Basant

    2016-09-01

    Tuberculous meningitis (TBM) is one of those most serious manifestations of extra-pulmonary tuberculosis and prompt diagnosis and treatment is required for better clinical outcome. It is difficult to diagnose due to lack of rapid, sensitive, and specific tests. Newer methods, which are easy and reliable, are required to diagnose TBM at an early stage. Thus our aim was to evaluate the Multiplex polymerase chain reaction (PCR) technique, using primers directed against the insertion sequence IS6110 and MPB64 gene for the detection of Mycobacterium tuberculosis in Cerebrospinal fluid (CSF), for rapid diagnosis of TBM patients. 102 CSF samples were analyzed from patients suspected with TBM along with a control group of 10 patients having other neurological disorders. CSF sediments were analyzed individually for M. tuberculosis DNA by Multiplex PCR using two set of primers targeting insertion sequence IS6110 and gene MBp64, which is very specific for MTBC. Out of 37 patients diagnosed with TBM clinically, MPB64 PCR was positive in 22, IS6110 PCR was positive in 28, both PCR using Multiplex were positive in 34 and Microscopy was positive in one. Thus Sensitivity of MPB64 PCR, IS6110 PCR, Multiplex PCR and Microscopy were found to be 62.3%, 75.4%, 91.8% and 2.7% respectively. In non TBM group PCR was negative in all cases hence, the specificity was 100%. Multiplex PCR system using primers targeting IS6110 and MPB64, for the detection of M. tuberculosis DNA in CSF samples, has high sensitivity than any one of them alone, and could be used for the early detection of TBM in CSF samples. PMID:27553404

  11. Modelling background intensity in Affymetrix Genechips

    CERN Document Server

    Kroll, K M; Carlon, E

    2008-01-01

    DNA microarrays are devices that are able, in principle, to detect and quantify the presence of specific nucleic acid sequences in complex biological mixtures. The measurement consists in detecting fluorescence signals from several spots on the microarray surface onto which different probe sequences are grafted. One of the problems of the data analysis is that the signal contains a noisy background component due to non-specific binding. This paper presents a physical model for background estimation in Affymetrix Genechips. It combines two different approaches. The first is based on the sequence composition, specifically its sequence dependent hybridization affinity. The second is based on the strong correlation of intensities from locations which are the physical neighbors of a specific spot on the chip. Both effects are incorporated in a background functional which contains 24 free parameters, fixed by minimization on a training data set. In all data analyzed the sequence specific parameters, obtained by min...

  12. SPECT single photon emission computed tomography: A primer

    International Nuclear Information System (INIS)

    This book aims to assist nuclear medicine technologists in expanding their knowledge of nuclear medicine to include SPECT. The text of this primer is written with the assumption that the reader is proficient in most elements of nuclear medicine technology; therefore, the information is limited to data that will answer the basic questions of single-photon emission computed tomography .... The authors' goal is to bring the basics of this material together in a manner that would answer the technologist's fundamental questions. The authors have designed this primer in a generic manner to be used as an extension of the manufacturer's operating manual .... A glossary is included which contains some of the terminology relevant to the specialty, and reading lists are provided at the end of each chapter to direct the reader to more comprehensive text on specific subjects

  13. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders; FINAL

    International Nuclear Information System (INIS)

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums

  14. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Bilyard, Gordon R.; Word, Charlotte J.; Weber, James R.; Harding, Anna K.

    2000-09-27

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  15. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson

    1998-12-10

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  16. Analysis of Translesion DNA Synthesis by the Mitochondrial DNA Polymerase γ.

    Science.gov (United States)

    Copeland, William C; Kasiviswanathan, Rajesh; Longley, Matthew J

    2016-01-01

    Mitochondrial DNA is replicated by the nuclear-encoded DNA polymerase γ (pol γ) which is composed of a single 140 kDa catalytic subunit and a dimeric 55 kDa accessory subunit. Mitochondrial DNA is vulnerable to various forms of damage, including several types of oxidative lesions, UV-induced photoproducts, chemical adducts from environmental sources, as well as alkylation and inter-strand cross-links from chemotherapy agents. Although many of these lesions block DNA replication, pol γ can bypass some lesions by nucleotide incorporation opposite a template lesion and further extension of the DNA primer past the lesion. This process of translesion synthesis (TLS) by pol γ can occur in either an error-free or an error-prone manner. Assessment of TLS requires extensive analysis of oligonucleotide substrates and replication products by denaturing polyacrylamide sequencing gels. This chapter presents protocols for the analysis of translesion DNA synthesis. PMID:26530671

  17. Identification of Escherichia coli DNA helicase IV with the use of a DNA helicase activity gel.

    OpenAIRE

    Trieu, V N; McCarthy, D

    1989-01-01

    A DNA helicase activity gel was developed based on the assumption that DNA helicases could unwind double-stranded DNA in a polyacrylamide matrix. The production of single-stranded DNA was detected by staining the activity gel with acridine orange and visualizing the gel under long-wave UV light. The products of DNA helicase activities appeared as red bands within a green fluorescent background. A novel DNA helicase, called helicase IV, was detected in crude extracts of Escherichia coli with t...

  18. RT-PCR for detecting five distinct Tospovirus species using degenerate primers and dsRNA template.

    Science.gov (United States)

    Okuda, M; Hanada, K

    2001-08-01

    RT-PCR procedures for detection of multiple species of tospovirus from plant tissues were investigated. Downstream primers were designated from the 3' untranslated sequences of the S RNA. An upstream primer was designated from the degenerated sequences of the nucleocapsid protein. Approximately 450 bp DNA fragments were detected when Tomato spotted wilt virus (TSWV)- or Impatiens necrotic spot virus (INSV)- infected tissues were examined. Approximately 350 bp DNA fragments were detected when Watermelon silver mottle virus (WSMoV)- or Melon yellow spot virus (MYSV)-infected tissues were examined. Template RNA was extracted using CF 11 cellulose powder, and nonspecific amplification became unnoticeable when double-stranded RNA was used. The amplified fragments of WSMoV were differentiated from those of MYSV by AluI or TaqI digestion. The amplified fragments of TSWV were differentiated from those of INSV by DraI or HindIII digestion. An alstroemeria plant that was infected with an unidentified tospovirus was also examined, and a 350 bp fragment that was 97% identical to Iris yellow spot virus was detected. This method, therefore, detected at least five distinct Tospovirus species. PMID:11445145

  19. MERS-CoV PCR/Sequencing Primers

    OpenAIRE

    sprotocols

    2014-01-01

    Authors: Rachel Graham ### Abstract This protocol details the primers and conditions used for forward and reverse PCR amplification and sequencing of MERS-CoV genomes. ### Introduction This protocol details the steps, reagents, and conditions required to sequence MERS-CoV genomes in the forward and reverse directions. The protocol begins with the RT-PCR step, assuming that MERS-CoV RNA purified using a standard procedure (i.e., TRIzol extraction) has already been performed. ...

  20. El primer llibre de la Biblioteca de Comunicació

    OpenAIRE

    Moragas Spà, Miquel de,

    2010-01-01

    El primer llibre va ser "El espíritu del tiempo", d'Edgar Morin. Un llibre sobre la cultura de masses i els mitjans de comunicació, mal vist en aquells anys 70 per la sociologia més acadèmica i oficial, però de fet un dels fundadors dels estudis interdisciplinaris de la comunicació

  1. Introduction to Command, Control, and Communications: a primer

    OpenAIRE

    Eidson, Edward H.

    1995-01-01

    This thesis is a primer for students in the Introduction to Command, Control, and Communications Courses at the Naval Postgraduate School. This document provide students a consolidated reference that emphasizes key concepts and ideas presented by the course instructor and required readings. Its organization closely parallels the course outline used for in-class instruction. It supports course objectives by providing an executive overview of a wide variety of C2 topics. These topics include: C...

  2. The Primer for Sports Medicine Professionals on Imaging

    OpenAIRE

    Farshad-Amacker, Nadja A.; Jain Palrecha, Sapna; Farshad, Mazda

    2013-01-01

    Because of its inherent superior soft tissue contrast and lack of ionizing radiation, magnetic resonance imaging (MRI) is highly suited to study the complex anatomy of the shoulder joint, particularly when assessing the relatively high incidence of shoulder injuries in young, athletic patients. This review aims to serve as a primer for understanding shoulder MRI in an algorithmical approach, including MRI protocol and technique, normal anatomy and anatomical variations of the shoulder, pathol...

  3. Development and Validation of Corynebacterium DNA Microarrays

    OpenAIRE

    Loos, Andrea; Glanemann, Christoph; Willis, Laura B.; O'Brien, Xian M; Lessard, Philip A.; Gerstmeir, Robert; Guillouet, Stéphane; Sinskey, Anthony J.

    2001-01-01

    We have developed DNA microarray techniques for studying Corynebacterium glutamicum. A set of 52 C. glutamicum genes encoding enzymes from primary metabolism was amplified by PCR and printed in triplicate onto glass slides. Total RNA was extracted from cells harvested during the exponential-growth and lysine production phases of a C. glutamicum fermentation. Fluorescently labeled cDNAs were prepared by reverse transcription using random hexamer primers and hybridized to the microarrays. To es...

  4. Sensory reception of the primer pheromone ethyl oleate

    Science.gov (United States)

    Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

    2012-05-01

    Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

  5. Sequencing strategy of mitochondrial HV1 and HV2 DNA with length heteroplasmy

    DEFF Research Database (Denmark)

    Rasmussen, Erik Michael; Sørensen, E; Eriksen, Birthe;

    2002-01-01

    We describe a method to obtain reliable mitochondrial DNA (mtDNA) sequences downstream of the homopolymeric stretches with length heteroplasmy in the sequencing direction. The method is based on the use of junction primers that bind to a part of the homopolymeric stretch and the first 2-4 bases...... downstream of the homopolymeric region. This junction primer method gave clear and unambiguous results using samples from 21 individuals with length heteroplasmy in the hypervariable regions HV1, HV2 or both. The method is of special value for forensic casework, because sequencing of both strands of an mtDNA...

  6. Cloning and sequencing of a DNA fragment encoding N37 apoptotic peptide derived from p53

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    Objective It was reported that p53 apoptotic peptide (N37) could inhibit p73 gene through being bound with iASPP,which could induce tumor cell apoptosis. To further explore the function of N37,we constructed the cloning plasmid of DNA fragment encoding p53 (N37) apoptotic peptide by using DNA synthesis and molecular biology methods. Methods According to human p53 sequence from the GenBank database,the primer of p53(N37) gene was designed using Primer V7.0 software. The DNA fragment encoding p53 (N37) apopto...

  7. Asymmetric PCR method in generation of HBV ssDNA for pyrosequencing

    Institute of Scientific and Technical Information of China (English)

    Nian-cai Peng; Chun-lin Wang; Li-li Zhang; Mao-li Lu; Zhen-xi Zhang

    2009-01-01

    Objective To explore the optimal primer ratio and concentration of asymmetric polymerase chain reaction (A-PCR) in producing hepatitis B virus (HBV) single-stranded DNA (ssDNA) for pyrosequencing. Methods A-PCR was carried out to generate HBV ssDNA with forward to reverse primers of different ratios (50 : 1, 100 : 1) and concentrations (13. 0 pmol/25μL and 0.14 pmol/25μL, 19. 5 pmol/25μL and 0. 21 pmol/25μL), and the product yield and quality were compared respectively. Results The forward to reverse primer ratio of 50 : 1 provided better yield and concentration of 19. 5 pmol/25μL and 0. 21 pmol//25μL generated a clearer band. Conclusion A simple and feasible method to produce HBV ssDNA for pyrosequencing in batch is established.

  8. Genetical background of intelligence.

    Science.gov (United States)

    Junkiert-Czarnecka, Anna; Haus, Olga

    2016-01-01

    Intelligence as an ability to reason, think abstractly and adapt effectively to the environment is a subject of research in the field of psychology, neurobiology, and in the last twenty years genetics as well. Genetical testing of twins carried out from XX century indicated heritebility of intelligence, therefore confirmed an influence of genetic factor on cognitive processes. Studies on genetic background of intelligence focus on dopaminergic (DRD2, DRD4, COMT, SLC6A3, DAT1, CCKAR) and adrenergic system (ADRB2, CHRM2) genes as well as, neutrofins (BDNF) and oxidative stress genes (LTF, PRNP). Positive effect of investigated gene polymorphism was indicated by variation c.957C>T DRD2 gene (if in polymorphic site is thymine), polymorphism c.472G>A COMT gene (presence of adenine) and also gene ADRB2 c.46A->G (guanine), CHRM2 (thymine in place c.1890A>T) and BDNF (guanine in place c.472G>A) Obtained results indicate that intelligence is a feature dependent not only on genetic but also an environmental factor. PMID:27333929

  9. Biological aerosol background characterization

    Science.gov (United States)

    Blatny, Janet; Fountain, Augustus W., III

    2011-05-01

    To provide useful information during military operations, or as part of other security situations, a biological aerosol detector has to respond within seconds or minutes to an attack by virulent biological agents, and with low false alarms. Within this time frame, measuring virulence of a known microorganism is extremely difficult, especially if the microorganism is of unknown antigenic or nucleic acid properties. Measuring "live" characteristics of an organism directly is not generally an option, yet only viable organisms are potentially infectious. Fluorescence based instruments have been designed to optically determine if aerosol particles have viability characteristics. Still, such commercially available biological aerosol detection equipment needs to be improved for their use in military and civil applications. Air has an endogenous population of microorganisms that may interfere with alarm software technologies. To design robust algorithms, a comprehensive knowledge of the airborne biological background content is essential. For this reason, there is a need to study ambient live bacterial populations in as many locations as possible. Doing so will permit collection of data to define diverse biological characteristics that in turn can be used to fine tune alarm algorithms. To avoid false alarms, improving software technologies for biological detectors is a crucial feature requiring considerations of various parameters that can be applied to suppress alarm triggers. This NATO Task Group will aim for developing reference methods for monitoring biological aerosol characteristics to improve alarm algorithms for biological detection. Additionally, they will focus on developing reference standard methodology for monitoring biological aerosol characteristics to reduce false alarm rates.

  10. Chinese Cabbage-pak-choi Transcriptome Map Construction with cDNA-AFLP Techniques

    Institute of Scientific and Technical Information of China (English)

    FAN Shu-ying; LE Jian-gang; CHENG Guang-jie; WU Cai-jun

    2008-01-01

    Chinese cabbage-pak-choi (Brassica campestris L. ssp. chinensis Makino) transcriptome map with cDNA-APLP techniques was constructed. The inbred line Aijiaohuang 97-3-2, the inbred line Baimanjing 001-24 of turnip [B. campestris ssp. rapifera (Matzg.) Sinsk] and 183 F6 (recombinant inbred population) plants were used as experimental materials. cDNAs were synthesized from total RNA extracted from young leaves at rosette stage. 256 pairs of cDNA-AFLP primers were used to detect the polymorphisms between parents Aijiaohuang 97-3-2 and Baimanjing 001-24. 56 pairs of cDNA-AFLP primers with high polymorphisms were screened from 256 pairs of primer by DNA-AFLP techniques. The genetic diversity of parents and 183 F6 progenies was detected by 56 pairs of cDNA-AFLP primers. The segregation and distribution of cDNA-AFLPs molecular marker were analyzed to construct transcriptome map amongst parents and F6 plants. A total of 164 cDNA-AFLPs marker loci were mapped into 13 linkage groups which covered 1 401.2 cM with an average distance of 9.7 cM. It was the first transcriptome map of Chinese cabbage using cDNA-AFLP technique.

  11. Impact and mechanism of TiO2 nanoparticles on DNA synthesis in vitro

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    The impact of TiO2 nanoparticles on DNA synthesis in vitro in the dark and the molecular mechanism of such impact were studied. The impact of TiO2 nanoparticles on DNA synthesis was investigated by adding TiO2 nanoparticles in different sizes and at various concentrations into the polymerase chain reaction (PCR) system. TiO2 nanoparticles were premixed with the DNA polymerase, the primer or the template, respectively and then the supernatant and the precipitation of each mixture were added into the PCR system separately to observe the impact on DNA synthesis. Sequentially the interaction be- tween TiO2 nanoparticles and the DNA polymerase, the primer or the template was further analyzed by using UV-visible spectroscopy and polyacrylamide gel electrophoresis (PAGE). The results suggest that TiO2 nanoparticles inhibit DNA synthesis in the PCR system in the dark more severely than mi- croscale TiO2 particles at the equivalent concentration and the inhibition effect of TiO2 nanoparticles is concentration dependent. The molecular mechanism of such inhibition is that in the dark, TiO2 nanoparticles interact with the DNA polymerase through physical adsorption while TiO2 nanoparticles do with the primer or the template in a chemical adsorption manner. The disfunction levels of the bio-molecules under the impact of TiO2 nanoparticles are in the following order: the primer > the tem- plate > the DNA polymerase.

  12. DNA supercoiling inhibits DNA knotting.

    OpenAIRE

    Burnier Y.; Dorier J.; Stasiak A.

    2008-01-01

    Despite the fact that in living cells DNA molecules are long and highly crowded, they are rarely knotted. DNA knotting interferes with the normal functioning of the DNA and, therefore, molecular mechanisms evolved that maintain the knotting and catenation level below that which would be achieved if the DNA segments could pass randomly through each other. Biochemical experiments with torsionally relaxed DNA demonstrated earlier that type II DNA topoisomerases that permit inter- and intramolecu...

  13. Low background infrared (LBIR) facility

    Data.gov (United States)

    Federal Laboratory Consortium — The Low background infrared (LBIR) facility was originally designed to calibrate user supplied blackbody sources and to characterize low-background IR detectors and...

  14. Perbedaan Kadar Superokside Dismutase pada Remaja dengan Dismenore Primer dan Tanpa Dismenore Primer

    Directory of Open Access Journals (Sweden)

    Yanti .

    2016-01-01

    Full Text Available Abstrak             Dismenore didefinisikan sebagai rasa kram saat menstruasi yang menyakitkan tanpa patologi yang jelas. Kram berlangsung selama satu hari atau lebih dan disertai rasa mual, diare, sakit kepala. Masalah yang ditimbulkan oleh dismenore adalah  peningkatan ketidakhadiran di sekolah pada remaja sehingga menyebabkan rendahnya nilai akademik pada pelajar. Superokside dismutase (SOD adalah bahan bioaktif yang diketahui bersifat antioksidan. SOD melindungi sel terhadap gangguan oksidan (radikal bebas. SOD mengubah anion superoksida menjadi hidrogen peroksida dan oksigen, sering disebut juga sebagai pertahanan primer terhadap stress oksidatif. Tujuan penelitian ini adalah mengetahui  perbedaan kadar superokside dismutase pada remaja dengan dismenore dan tanpa dismenore. Penelitian ini adalah observasional desain cross sectional comparative. Data dianalisis menggunakan uji Mann-Withney  dengan nilai p<0.05 dianggap bermakna secara statistik. Rerata kadar SOD pada remaja yang mengalami dismenore yaitu 36,76 u/ml dan rerata kadar SOD pada remaja tanpa dismenore yaitu 32,24 u/ml. Dengan nilai p>0,005 (0,345. Hasil penelitian ini menyimpulkan bahwa tidak terdapat perbedaan yang bermakna  kadar SOD pada remaja dengan dismenore dan tanpa dismenore. Kata kunci: remaja, dismenore, antioksidan, superokside dismutase AbstractPrimary dysmenorrhoe is  a painful menstrual cramps without obvious pathology. Cramps is lasting for one day or more, accaompanied by nausea, diarrhea and headache. Problems cause by dysmenorrhea are an increase in school attendance in adolescents resulting in low academic grades of students. Superokside Dismeutase (SOD is a bioactive ingredient that is known as antioxidants, protecting cells against harmful SOD oxidants (free radicals SOD convert superoxide anion into hydrogen perokxide and oxygen, often call  as primary defense agains oxidative stress. Primary dysmenorrhoe increased uterine activity or

  15. Hanford Site background: Part 1, Soil background for nonradioactive analytes

    International Nuclear Information System (INIS)

    Volume two contains the following appendices: Description of soil sampling sites; sampling narrative; raw data soil background; background data analysis; sitewide background soil sampling plan; and use of soil background data for the detection of contamination at waste management unit on the Hanford Site

  16. Application of DNA as a Smart Material

    DEFF Research Database (Denmark)

    Voigt, Niels Vinther

    2011-01-01

    The scientific field of DNA nanotechnology is undergoing a tremendous development these years. This thesis presents five different projects investigating various aspects of the recent development in DNA nanotechnology. Chapter 1 is a background chapter that outlines the evolution of DNA...... nanotechnology from the small assemblies in the beginning to the large and complex DNA structures of today. After the background chapter, the thesis consists of two parts. The first part comprises three projects regarding DNA origami (chapter 2–4). In the project described in chapter 2, DNA origami was exploited...

  17. Mitochondrial DNA copy number and risk of oral cancer: a report from Northeast India.

    Directory of Open Access Journals (Sweden)

    Rosy Mondal

    Full Text Available BACKGROUND: Oral squamous cell carcinoma (OSCC is the sixth most common cancer globally. Tobacco consumption and HPV infection, both are the major risk factor for the development of oral cancer and causes mitochondrial dysfunction. Genetic polymorphisms in xenobiotic-metabolizing enzymes modify the effect of environmental exposures, thereby playing a significant role in gene-environment interactions and hence contributing to the individual susceptibility to cancer. Here, we have investigated the association of tobacco - betel quid chewing, HPV infection, GSTM1-GSTT1 null genotypes, and tumour stages with mitochondrial DNA (mtDNA content variation in oral cancer patients. METHODOLOGY/PRINCIPAL FINDINGS: The study comprised of 124 cases of OSCC and 140 control subjects to PCR based detection was done for high-risk HPV using a consensus primer and multiplex PCR was done for detection of GSTM1-GSTT1 polymorphism. A comparative ΔCt method was used for determination of mtDNA content. The risk of OSCC increased with the ceased mtDNA copy number (Ptrend  = 0.003. The association between mtDNA copy number and OSCC risk was evident among tobacco - betel quid chewers rather than tobacco - betel quid non chewers; the interaction between mtDNA copy number and tobacco - betel quid was significant (P = 0.0005. Significant difference was observed between GSTM1 - GSTT1 null genotypes (P = 0.04, P = 0.001 respectively and HPV infection (P<0.001 with mtDNA content variation in cases and controls. Positive correlation was found with decrease in mtDNA content with the increase in tumour stages (P<0.001. We are reporting for the first time the association of HPV infection and GSTM1-GSTT1 null genotypes with mtDNA content in OSCC. CONCLUSION: Our results indicate that the mtDNA content in tumour tissues changes with tumour stage and tobacco-betel quid chewing habits while low levels of mtDNA content suggests invasive thereby serving as a biomarker in

  18. The primer design of domain-specific C-terminus of the avian H5N1 NS gene from Indonesia

    Directory of Open Access Journals (Sweden)

    Kindi Adam

    2015-01-01

    Full Text Available AbstrakLatar belakang: Virus avian influenza (AI H5N1 telah menyebabkan kematian hampir 600 orang di dunia sejak tahun 2003. Virus AI H5N1 masih beredar pada unggas liar dan domestik. Salah satu sifat patogenitas virus AI  diketahui dari kemampuan protein nonstructural (NS1 dan NS2 dalam menginduksi badai sitokin. Mutasi yang terjadi pada protein NS1 dan NS2 dapat memperberat infeksi yang terjadi. Metode: Sekuens genetik gen NS yang mengkode domain C-terminus dari virus AI H5N1 didapat dengan metode sekuensing menggunakan primer khusus untuk mengamplifikasi gen NS. Desain primer dilakukan dengan menggunakan beberapa software bioinformatika yang tersedia kemudian primer diuji kembali untuk mengetahui keberhasilan dalam mengamplifikasi sekuen target. Pengujian RT-PCR dilakukan pada empat isolat virus AI H5N1, dilanjutkan dengan sekuensing untuk mengetahui urutan basa nukleotida yang dihasilkan dari primer yang dibuat dalam penelitian ini. Hasil: Primer yang didesain dapat mengamplifikasi empat isolat H5N1 ayam yang diuji yaitu dua isolat dari Bali (A/Ck/Bali-KH/2009 dan A/Ck/Bali-T/2009,serta dua isolat dari Jawa Timur (A/Ck/Jawa Timur-S/2009 dan A/Ck/Jawa Timur-D/2009.Kesimpulan: Primer yang didesain dapat digunakan dalam amplifikasi PCR dan sekuensing gen NS yang mengekspresikan bagian C terminus dari protein NS1 dan bagian ujung NS2. (Health Science Indones2014;2:83-8Kata kunci: avian influenza, H5N1, gen NS, C-terminusAbstractBackground: The avian influenza (AI H5N1 viruses have caused nearly 600 fatal cases in the world since 2003. The H5N1 AI virus is still circulating in wild birds and domestic. One of the known of AI virus pathogenicity is the ability of the nonstructural protein (NS1 and NS2 to induce cytokine storm. Mutations of the NS1 and NS2 proteins may aggravate infections.Methods: Genetic sequences of NS gene that encodes the C - terminus domain of AI H5N1 virus were obtained by sequencing method using specific primer to amplify

  19. Priming DNA Replication from Triple Helix Oligonucleotides: Possible Threestranded DNA in DNA Polymerases

    Directory of Open Access Journals (Sweden)

    Patrick P. Lestienne

    2011-01-01

    Full Text Available Triplex associate with a duplex DNA presenting the same polypurine or polypyrimidine-rich sequence in an antiparallel orientation. So far, triplex forming oligonucleotides (TFOs are known to inhibit transcription, replication, and to induce mutations. A new property of TFO is reviewed here upon analysis of DNA breakpoint yielding DNA rearrangements; the synthesized sequence of the first direct repeat displays a skewed polypurine- rich sequence. This synthesized sequence can bind the second homologous duplex sequence through the formation of a triple helix, which is able to prime further DNA replication. In these case, the d(G-rich Triple Helix Primers (THP bind the homologous strand in a parallel manner, possibly via a RecA-like mechanism. This novel property is shared by all tested DNA polymerases: phage, retrovirus, bacteria, and human. These features may account for illegitimate initiation of replication upon single-strand breakage and annealing to a homologous sequence where priming may occur. Our experiments suggest that DNA polymerases can bind three instead of two polynucleotide strands in their catalytic centre.

  20. Priming DNA replication from triple helix oligonucleotides: possible threestranded DNA in DNA polymerases.

    Science.gov (United States)

    Lestienne, Patrick P

    2011-01-01

    Triplex associate with a duplex DNA presenting the same polypurine or polypyrimidine-rich sequence in an antiparallel orientation. So far, triplex forming oligonucleotides (TFOs) are known to inhibit transcription, replication, and to induce mutations. A new property of TFO is reviewed here upon analysis of DNA breakpoint yielding DNA rearrangements; the synthesized sequence of the first direct repeat displays a skewed polypurine- rich sequence. This synthesized sequence can bind the second homologous duplex sequence through the formation of a triple helix, which is able to prime further DNA replication. In these case, the d(G)-rich Triple Helix Primers (THP) bind the homologous strand in a parallel manner, possibly via a RecA-like mechanism. This novel property is shared by all tested DNA polymerases: phage, retrovirus, bacteria, and human. These features may account for illegitimate initiation of replication upon single-strand breakage and annealing to a homologous sequence where priming may occur. Our experiments suggest that DNA polymerases can bind three instead of two polynucleotide strands in their catalytic centre. PMID:22229092

  1. A buffalo meat products certification by DNA test

    OpenAIRE

    D.A.A. Oliveira; E. Bastianetto; C.S Teixeira; L.V. Teixeira

    2010-01-01

    The Laboratory of Genetics of the Veterinary School and the Buffalo Study Group of the Federal University of Minas Gerais (UFMG) are developing analysis techniques from buffalo DNA to verify the purity of products derived from buffalo meat. Samples of 30 buffalos (Murrah) and 30 bovines (B. indicus and B. taurus) were collected at slaughter and DNA samples were extracted. The primers used amplify the cytochrome b regions, specific of mammals of the artiodactyles order. By using restriction en...

  2. Detection Tuna and Processed Products Based Protein and DNA Barcoding

    OpenAIRE

    Nuring Wulansari; Mala Nurilamala; Nurjanah

    2015-01-01

    Tuna is the second largest fishery commodity in Indonesia after the shrimp. Since the high demand and the limited stock of tuna resulted in fraudulent chance. Authentication is required to meassure consumers regarding the accuracy of its labeling and food safety. In this study, the authentication was based on protein and DNA barcoding using cytochrome-b gene (cyt-b) of the mitochondrial DNA as the target of gene. Primer of cyt b gene was designed based on the tuna species. This...

  3. Fluorescence-based DNA minisequence analysis for detection of known single-base changes in genomic DNA.

    Science.gov (United States)

    Kobayashi, M; Rappaport, E; Blasband, A; Semeraro, A; Sartore, M; Surrey, S; Fortina, P

    1995-06-01

    We describe a rapid, automated method for direct detection of known single-base changes in genomic DNA. Fluorescence-based DNA minisequence analysis is employed in a template-dependent reaction which involves a single nucleotide extension of an oligonucleotide primer by the correct fluorescently-tagged dideoxynucleotide chain terminator. Detection following electrophoresis on denaturing acrylamide gels is facilitated by alkaline phosphatase treatment of reaction products after extension followed by isopropanol precipitation of the dye-tagged, single-base-extended primer to remove unincorporated deoxynucleotides. Fluorescence analysis of the incorporated dye tag reveals the identity of the template nucleotide immediately 3' to the primer site. This technique does not require radioactivity or biotinylated PCR product, relies on the incorporation of a single dideoxynucleotide terminator to extend the primer by one nucleotide and takes advantage of the sensitivity of fluorescent terminators developed for automated DNA sequence analysis. As a demonstration, we have applied the assay to human genomic DNA for detection of the sickle mutation in the beta-globin gene, and have also examined feasibility for simultaneous delineation using a multiplex-like strategy in a single gel-lane of some of the most common beta-thalassemia mutations in the Mediterranean basin. PMID:7477010

  4. Facial primer provides immediate and long-term improvements in mild-to-moderate facial hyperpigmentation and fine lines associated with photoaging

    Science.gov (United States)

    Roberts, Wendy E; Jiang, Lily I; Herndon, James H

    2015-01-01

    Background Photoaged skin results from various environmental factors, most importantly chronic sun exposure. Dyschromia and fine lines/wrinkles are common clinical manifestations of photodamaged skin. Purpose This single-center clinical trial was conducted to assess the efficacy and tolerability of a new multifunctional facial primer (camouflage, broad-spectrum SPF 50, and a treatment for hyperpigmentation) when used by females with mild-to-moderate facial hyperpigmentation and fine lines due to photoaging over a course of 12 weeks. Patients and methods Subjects were provided test material (Even Up-Clinical Pigment Perfector) and supporting products to use on their face and neck. Products were used according to specific application instructions. Clinical grading for efficacy and tolerability assessments were performed by an expert grader at baseline, baseline (post-application primer), week 4, week 8, week 12, and week 12 (post-application primer). Standardized digital photographs were taken, and self-assessment questionnaires were conducted. Results Twenty-eight female subjects completed the 12-week trial. The facial primer improved scores for the appearance of hyperpigmentation and other photoaging parameters immediately after the first application. The treatment also showed a progressive improvement in the clinical assessment of hyperpigmentation and other photoaging parameters over the 12-week trial. These long-term benefits can be attributed to an improvement in the underlying skin condition. The facial primer was well tolerated. Subject questionnaires showed that the product was highly rated at all visits. Conclusion The facial primer was shown to be effective and well tolerated for immediate and long-term improvement in the appearance of mild-to-moderate hyperpigmentation and fine lines associated with photodamage when used over a 12-week period. PMID:26366102

  5. Facial primer provides immediate and long-term improvements in mild-to-moderate facial hyperpigmentation and fine lines associated with photoaging

    Directory of Open Access Journals (Sweden)

    Roberts WE

    2015-09-01

    Full Text Available Wendy E Roberts,1 Lily I Jiang,2 James H Herndon Jr3 1Generational and Cosmetic Dermatology, Rancho Mirage, CA, 2Thomas J Stephens and Associates, Richardson, 3Dermatology Center of Dallas, Dallas, TX, USA Background: Photoaged skin results from various environmental factors, most importantly chronic sun exposure. Dyschromia and fine lines/wrinkles are common clinical manifestations of photodamaged skin. Purpose: This single-center clinical trial was conducted to assess the efficacy and tolerability of a new multifunctional facial primer (camouflage, broad-spectrum SPF 50, and a treatment for hyperpigmentation when used by females with mild-to-moderate facial hyperpigmentation and fine lines due to photoaging over a course of 12 weeks. Patients and methods: Subjects were provided test material (Even Up-Clinical Pigment Perfector and supporting products to use on their face and neck. Products were used according to specific application instructions. Clinical grading for efficacy and tolerability assessments were performed by an expert grader at baseline, baseline (post-application primer, week 4, week 8, week 12, and week 12 (post-application primer. Standardized digital photographs were taken, and self-assessment questionnaires were conducted. Results: Twenty-eight female subjects completed the 12-week trial. The facial primer improved scores for the appearance of hyperpigmentation and other photoaging parameters immediately after the first application. The treatment also showed a progressive improvement in the clinical assessment of hyperpigmentation and other photoaging parameters over the 12-week trial. These long-term benefits can be attributed to an improvement in the underlying skin condition. The facial primer was well tolerated. Subject questionnaires showed that the product was highly rated at all visits. Conclusion: The facial primer was shown to be effective and well tolerated for immediate and long-term improvement in the appearance

  6. Evaluation of antibacterial activity of three dentin primers using an in vitro tooth model.

    Science.gov (United States)

    Ohmori, K; Maeda, N; Kohno, A

    1999-01-01

    This study compared the antibacterial activities of three dentin primers and investigated a newly designed experimental system using a bovine tooth model method for evaluating antibacterial activity by comparing this method with a conventional disk diffusion method. The antibacterial activities of SA primer in Clearfil Liner Bond, LB primer in Clearfil Liner Bond II, and ED primer in Panavia 21 were evaluated using the conventional disk diffusion method. The 50 microliters aliquot of each primer was applied to three sterilized paper disks, then placed onto Tryptic Soy agar plates already inoculated with Streptococcus mutans. After anaerobic incubation for 48 hours, the diffusion of antibacterial components was determined using the inhibition zone produced around the paper disk. The diameter of the inhibition zones was measured and the average calculated. Standardized cavities (diameter 5.0 mm, depth 3.0 mm) were prepared on the labial surfaces of bovine teeth and inoculated with S mutans (10(6) CFU/microliter) following sterilization by 60Co gamma rays (50 KGy). The teeth were divided into four groups: SA primer, LB primer, ED primer, and a control group. Except for the control teeth, the cavity preparations were treated with the respective dentin primers, and then firmly sealed with a temporary sealing material. The teeth were placed in bottles containing melted Tryptic Soy agar. Five ml of Tryptic Soy broth was then added to the surface of the hardened Tryptic Soy agar. After 1 week's incubation of the teeth in the bottles at 37 degrees C, the number of bacteria remaining in each cavity was counted, except for eight specimens, which were used for SEM observation. The ED primer showed the widest inhibition zone in the disk diffusion test, which was significantly different from the other primers. Using the bovine tooth model, all dentin primers showed antibacterial activity, with significant differences found among the four groups. The results indicated that ED

  7. DNA vaccines

    OpenAIRE

    Coban, Cevayir; Kobiyama, Kouji; Jounai, Nao; Tozuka, Miyuki; Ishii, Ken J.

    2013-01-01

    Since the introduction of DNA vaccines two decades ago, this attractive strategy has been hampered by its low immunogenicity in humans. Studies conducted to improve the immunogenicity of DNA vaccines have shown that understanding the mechanism of action of DNA vaccines might be the key to successfully improving their immunogenicity. Our current understanding is that DNA vaccines induce innate and adaptive immune responses in two ways: (1) encoded protein (or polypeptide) antigen(s) by the DNA...

  8. Enzymatic synthesis of long double-stranded DNA labeled with haloderivatives of nucleobases in a precisely pre-determined sequence

    Directory of Open Access Journals (Sweden)

    Rak Janusz

    2011-08-01

    Full Text Available Abstract Background Restriction endonucleases are widely applied in recombinant DNA technology. Among them, enzymes of class IIS, which cleave DNA beyond recognition sites, are especially useful. We use BsaI enzyme for the pinpoint introduction of halogen nucleobases into DNA. This has been done for the purpose of anticancer radio- and phototherapy that is our long-term objective. Results An enzymatic method for synthesizing long double-stranded DNA labeled with the halogen derivatives of nucleobases (Hal-NBs with 1-bp accuracy has been put forward and successfully tested on three different DNA fragments containing the 5-bromouracil (5-BrU residue. The protocol assumes enzymatic cleavage of two Polymerase-Chain-Reaction (PCR fragments containing two recognition sequences for the same or different class IIS restriction endonucleases, where each PCR fragment has a partially complementary cleavage site. These sites are introduced using synthetic DNA primers or are naturally present in the sequence used. The cleavage sites are not compatible, and therefore not susceptible to ligation until they are partially filled with a Hal-NB or original nucleobase, resulting in complementary cohesive end formation. Ligation of these fragments ultimately leads to the required Hal-NB-labeled DNA duplex. With this approach, a synthetic, extremely long DNA fragment can be obtained by means of a multiple assembly reaction (n × maximum PCR product length: n × app. 50 kb. Conclusions The long, precisely labeled DNA duplexes obtained behave in very much the same manner as natural DNA and are beyond the range of chemical synthesis. Moreover, the conditions of synthesis closely resemble the natural ones, and all the artifacts accompanying the chemical synthesis of DNA are thus eliminated. The approach proposed seems to be completely general and could be used to label DNA at multiple pre-determined sites and with halogen derivatives of any nucleobase. Access to DNAs

  9. PCR with Paracoccidioides brasiliensis specific primers: potential use in ecological studies PCR com «primers» específicos de Paracoccidioides brasiliensis: uso potencial em estudos ecológicos

    Directory of Open Access Journals (Sweden)

    S. DÍEZ

    1999-11-01

    Full Text Available The precise microenvironment of Paracoccidioides brasiliensis has not yet been discovered perhaps because the methods used are not sensitive enough. We applied to this purpose the polymerase chain reaction (PCR using three sets of specific primers corresponding to two P. brasiliensis genes. This fungus as well as several other fungi, were grown and their DNA obtained by mechanical disruption and a phenol chloroform isoamylalcohol-based purification method. The DNA served for a PCR reaction that employed specific primers from two P. brasiliensis genes that codify for antigenic proteins, namely, the 27 kDa and the 43 kDa. The lowest detection range for the 27 kDa gene was 3 pg. The amplification for both genes was positive only with DNA from P. brasiliensis; additionally, the mRNA for the 27 kDa gene was present only in P. brasiliensis, as indicated by the Northern analysis. The standardization of PCR technology permitted the amplification of P. brasiliensis DNA in artificially contaminated soils and in tissues of armadillos naturally infected with the fungus. These results indicate that PCR technology could play an important role in the search for P. brasiliensis’ habitat and could also be used in other ecological studies.O microambiente adequado do Paracoccidioides brasiliensis não foi ainda bem esclarecido, talvez porque os métodos utilizados não sejam suficientemente sensíveis. Aplicamos com este propósito, a reação em cadeia da polimerase (PCR usando três jogos de primers específicos do P. brasiliensis, correspondendo a dois dos genes do P. brasiliensis. Este fungo, assim como outros fungos, foram cultivados e seus DNAs obtidos por ruptura mecânica e purificados com mistura de fenol-clorofórmio com álcool isoamílico. Os DNAs serviram para a reação de PCR utilizando-se primers específicos para dois dos genes do P. brasiliensis que codificam para as proteínas antigênicas, denominadas, 27 kDa e 43 kDa. O limite mínimo de

  10. Non-detection of Chlamydia species in carotid atheroma using generic primers by nested PCR in a population with a high prevalence of Chlamydia pneumoniae antibody

    Directory of Open Access Journals (Sweden)

    Bamford Kathleen B

    2001-08-01

    Full Text Available Abstract Background The association of Chlamydia pneumoniae with atherosclerosis is controversial. We investigated the presence of C. pneumoniae and other Chlamydia spp. in atheromatous carotid artery tissue. Methods Forty elective carotid endarterectomy patients were recruited (27 males, mean age 65 and 13 females mean age 68, 4 had bilateral carotid endarterectomies (n= 44 endarterectomy specimens. Control specimens were taken from macroscopically normal carotid artery adjacent to the atheromatous lesions (internal controls, except in 8 cases where normal carotid arteries from post mortem (external controls were used. Three case-control pairs were excluded when the HLA DRB gene failed to amplify from the DNA. Genus specific primers to the major outer membrane protein (MOMP gene were used in a nested polymerase chain reaction (nPCR in 41 atheromatous carotid specimens and paired controls. PCR inhibition was monitored by spiking with target C. trachomatis. Atheroma severity was graded histologically. Plasma samples were tested by microimmunofluorescence (MIF for antibodies to C. pneumoniae, C. trachomatis and C. psittaci and the corresponding white cells were tested for Chlamydia spp. by nPCR. Results C. pneumoniae was not detected in any carotid specimen. Twenty-five of 38 (66% plasma specimens were positive for C. pneumoniae IgG, 2/38 (5% for C. trachomatis IgG and 1/38 (3% for C. psittaci IgG. Conclusions We were unable to show an association between the presence of Chlamydia spp. and atheroma in carotid arteries in the presence of a high seroprevalence of C. pneumoniae antibodies in Northern Ireland.

  11. Telomere length in human adults and high level natural background radiation.

    Directory of Open Access Journals (Sweden)

    Birajalaxmi Das

    Full Text Available BACKGROUND: Telomere length is considered as a biomarker of aging, stress, cancer. It has been associated with many chronic diseases such as hypertension and diabetes. Although, telomere shortening due to ionizing radiation has been reported in vitro, no in vivo data is available on natural background radiation and its effect on telomere length. METHODOLOGY/PRINCIPAL FINDINGS: The present investigation is an attempt to determine the telomere length among human adults residing in high level natural radiation areas (HLNRA and the adjacent normal level radiation areas (NLNRA of Kerala coast in Southwest India. Genomic DNA was isolated from the peripheral blood mononuclear cells of 310 individuals (HLNRA: N = 233 and NLNRA: N = 77. Telomere length was determined using real time q-PCR. Both telomere (T and single copy gene (S specific primers were used to calculate the relative T/S and expressed as the relative telomere length. The telomere length was determined to be 1.22+/-0.15, 1.12+/-0.15, 1.08+/-0.08, 1.12+/-0.11, respectively, among the four dose groups (5.00 mGy per year, which did not show any dose response. The results suggested that the high level natural chronic radiation did not have significant effect on telomere length among young adult population living in HLNRA, which is indicative of better repair of telomeric ends. No significant difference in telomere length was observed between male and female individuals. In the present investigation, although the determination of telomere length was studied among the adults with an age group between 18 to 40 years (mean maternal age: 26.10+/-4.49, a negative correlation was observed with respect to age. However, inter-individual variation was (0.81-1.68 was clearly observed. CONCLUSIONS/SIGNIFICANCE: In this preliminary investigation, we conclude that elevated level of natural background radiation has no significant effect on telomere length among the adult population residing in HLNRAs of

  12. DNA barcoding of the Lemnaceae, a family of aquatic monocots

    Directory of Open Access Journals (Sweden)

    Wang Wenqin

    2010-09-01

    Full Text Available Abstract Background Members of the aquatic monocot family Lemnaceae (commonly called duckweeds represent the smallest and fastest growing flowering plants. Their highly reduced morphology and infrequent flowering result in a dearth of characters for distinguishing between the nearly 38 species that exhibit these tiny, closely-related and often morphologically similar features within the same family of plants. Results We developed a simple and rapid DNA-based molecular identification system for the Lemnaceae based on sequence polymorphisms. We compared the barcoding potential of the seven plastid-markers proposed by the CBOL (Consortium for the Barcode of Life plant-working group to discriminate species within the land plants in 97 accessions representing 31 species from the family of Lemnaceae. A Lemnaceae-specific set of PCR and sequencing primers were designed for four plastid coding genes (rpoB, rpoC1, rbcL and matK and three noncoding spacers (atpF-atpH, psbK-psbI and trnH-psbA based on the Lemna minor chloroplast genome sequence. We assessed the ease of amplification and sequencing for these markers, examined the extent of the barcoding gap between intra- and inter-specific variation by pairwise distances, evaluated successful identifications based on direct sequence comparison of the "best close match" and the construction of a phylogenetic tree. Conclusions Based on its reliable amplification, straightforward sequence alignment, and rates of DNA variation between species and within species, we propose that the atpF-atpH noncoding spacer could serve as a universal DNA barcoding marker for species-level identification of duckweeds.

  13. Random amplified polymorphic DNA assay is less discriminant than pulsed-field gel electrophoresis for typing strains of methicillin-resistant Staphylococcus aureus.

    OpenAIRE

    Saulnier, P; Bourneix, C; Prévost, G; Andremont, A

    1993-01-01

    Twenty-six strains of methicillin-resistant Staphylococcus aureus with different pulsed-field gel electrophoresis fingerprints were tested by random amplified polymorphic DNA assay with three primers, resulting in 15 to 20 different random amplified polymorphic DNA fingerprints. By summing the results for the three primers, the number of different fingerprints increased to 25, but two strains could not be differentiated. We conclude that pulsed-field gel electrophoresis remains the best metho...

  14. Characterization of microsatellite DNA markers for the alligator snapping turtle, Macrochelys temminckii: Primer note

    Science.gov (United States)

    Hackler, J.C.; Van Den Bussche, Ronald A.; Leslie, David M., Jr.

    2007-01-01

    Two trinucleotide and seven tetranucleotide microsatellite loci were isolated from an alligator snapping turtle Macrochelys temminckii. To assess the degree of variability in these nine microsatellite loci, we genotyped 174 individuals collected from eight river drainage basins in the southeastern USA. These markers revealed a moderate degree of allelic diversity (six to 16 alleles per locus) and observed heterozygosity (0.166-0.686). These polymorphic microsatellite loci provide powerful tools for population genetic studies for a species that is afforded some level of conservation protection in every state in which it occurs. ?? 2006 The Authors.

  15. Molecular detection of bacteria in plant tissues, using universal 16S ribosomal DNA degenerated primers

    OpenAIRE

    Tsoktouridis, Georgios; Tsiamis, George; Koutinas, Nikolaos; Mantell, Sinclair

    2014-01-01

    Highly specific, sensitive and rapid tests are required for the detection and identification of covert bacterial contaminations in plant tissue cultures. Current methods available for this purpose are tedious, time consuming, highly error prone, expensive, require advanced technical expertise and are sometimes ineffective. We report here the development of a sensitive polymerase chain reaction (PCR) based method for the rapid detection and identification of bacteria occurring in plant tissue ...

  16. Automated FingerPrint Background removal: FPB

    Directory of Open Access Journals (Sweden)

    Morgante Michele

    2009-04-01

    Full Text Available Abstract Background The construction of a whole-genome physical map has been an essential component of numerous genome projects initiated since the inception of the Human Genome Project. Its usefulness has been proved for whole-genome shotgun projects as a post-assembly validation and recently it has also been used in the assembly step to constrain on BACs positions. Fingerprinting is usually the method of choice for construction of physical maps. A clone fingerprint is composed of true peaks representing real fragments and background peaks, mainly composed of E. coli genomic DNA, partial digestions, star activity by-products, and machine background. High-throughput fingerprinting leads to the production of thousands of BAC clone fingerprints per day. That is why background peaks removal has become an important issue and needs to be automatized, especially in capillary electrophoresis based fingerprints. Results At the moment, the only tools available for such a task are GenoProfiler and its descendant FPMiner. The large variation in the quality of fingerprints that is usually present in large fingerprinting projects represents a major difficulty in the correct removal of background peaks that has only been partially addressed by the methods so far adopted that all require a long manual optimization of parameters. Thus, we implemented a new data-independent tool, FPB (FingerPrint Background removal, suitable for large scale projects as well as mapping of few clones. Conclusion FPB is freely available at http://www.appliedgenomics.org/tools.php. FPB was used to remove the background from all fingerprints of three grapevine physical map projects. The first project consists of about 50,000 fingerprints, the second one consists of about 70,000 fingerprints, and the third one consists of about 45,000 fingerprints. In all cases a successful assembly was built.

  17. Quantitation of DNA methylation by melt curve analysis

    Directory of Open Access Journals (Sweden)

    Jones Michael E

    2009-04-01

    Full Text Available Abstract Background Methylation of DNA is a common mechanism for silencing genes, and aberrant methylation is increasingly being implicated in many diseases such as cancer. There is a need for robust, inexpensive methods to quantitate methylation across a region containing a number of CpGs. We describe and validate a rapid, in-tube method to quantitate DNA methylation using the melt data obtained following amplification of bisulfite modified DNA in a real-time thermocycler. Methods We first describe a mathematical method to normalise the raw fluorescence data generated by heating the amplified bisulfite modified DNA. From this normalised data the temperatures at which melting begins and finishes can be calculated, which reflect the less and more methylated template molecules present respectively. Also the T50, the temperature at which half the amplicons are melted, which represents the summative methylation of all the CpGs in the template mixture, can be calculated. These parameters describe the methylation characteristics of the region amplified in the original sample. Results For validation we used synthesized oligonucleotides and DNA from fresh cells and formalin fixed paraffin embedded tissue, each with known methylation. Using our quantitation we could distinguish between unmethylated, partially methylated and fully methylated oligonucleotides mixed in varying ratios. There was a linear relationship between T50 and the dilution of methylated into unmethylated DNA. We could quantitate the change in methylation over time in cell lines treated with the demethylating drug 5-aza-2'-deoxycytidine, and the differences in methylation associated with complete, clonal or no loss of MGMT expression in formalin fixed paraffin embedded tissues. Conclusion We have validated a rapid, simple in-tube method to quantify methylation which is robust and reproducible, utilizes easily designed primers and does not need proprietary algorithms or software. The

  18. Digital analysis of cDNA abundance; expression profiling by means of restriction fragment fingerprinting

    Directory of Open Access Journals (Sweden)

    Regenbogen Johannes

    2002-03-01

    Full Text Available Abstract Background Gene expression profiling among different tissues is of paramount interest in various areas of biomedical research. We have developed a novel method (DADA, Digital Analysis of cDNA Abundance, that calculates the relative abundance of genes in cDNA libraries. Results DADA is based upon multiple restriction fragment length analysis of pools of clones from cDNA libraries and the identification of gene-specific restriction fingerprints in the resulting complex fragment mixtures. A specific cDNA cloning vector had to be constructed that governed missing or incomplete cDNA inserts which would generate misleading fingerprints in standard cloning vectors. Double stranded cDNA was synthesized using an anchored oligo dT primer, uni-directionally inserted into the DADA vector and cDNA libraries were constructed in E. coli. The cDNA fingerprints were generated in a PCR-free procedure that allows for parallel plasmid preparation, labeling, restriction digest and fragment separation of pools of 96 colonies each. This multiplexing significantly enhanced the throughput in comparison to sequence-based methods (e.g. EST approach. The data of the fragment mixtures were integrated into a relational database system and queried with fingerprints experimentally produced by analyzing single colonies. Due to limited predictability of the position of DNA fragments on the polyacrylamid gels of a given size, fingerprints derived solely from cDNA sequences were not accurate enough to be used for the analysis. We applied DADA to the analysis of gene expression profiles in a model for impaired wound healing (treatment of mice with dexamethasone. Conclusions The method proved to be capable of identifying pharmacologically relevant target genes that had not been identified by other standard methods routinely used to find differentially expressed genes. Due to the above mentioned limited predictability of the fingerprints, the method was yet tested only with

  19. DNA detection using recombination proteins.

    Directory of Open Access Journals (Sweden)

    Olaf Piepenburg

    2006-07-01

    Full Text Available DNA amplification is essential to most nucleic acid testing strategies, but established techniques require sophisticated equipment or complex experimental procedures, and their uptake outside specialised laboratories has been limited. Our novel approach, recombinase polymerase amplification (RPA, couples isothermal recombinase-driven primer targeting of template material with strand-displacement DNA synthesis. It achieves exponential amplification with no need for pretreatment of sample DNA. Reactions are sensitive, specific, and rapid and operate at constant low temperature. We have also developed a probe-based detection system. Key aspects of the combined RPA amplification/detection process are illustrated by a test for the pathogen methicillin-resistant Staphylococcus aureus. The technology proves to be sensitive to fewer than ten copies of genomic DNA. Furthermore, products can be detected in a simple sandwich assay, thereby establishing an instrument-free DNA testing system. This unique combination of properties is a significant advance in the development of portable and widely accessible nucleic acid-based tests.

  20. Bt-CoV HKU3 PCR/Sequencing Primers

    OpenAIRE

    sprotocols

    2014-01-01

    Authors: Rachel Graham ### Abstract This protocol details the primers and conditions used for forward and reverse PCR amplification and sequencing of Bt-CoV HKU3 genomes. ### Introduction This protocol details the steps, reagents, and conditions required to sequence Bt-CoV HKU3 genomes in the forward and reverse directions. The protocol begins with the RT-PCR step, assuming that BtCoV HKU3 RNA purified using a standard procedure (i.e., TRIzol extraction) has already been perfo...