WorldWideScience

Sample records for background dna primers

  1. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omi...

  2. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

  3. PCR primers for metazoan mitochondrial 12S ribosomal DNA sequences.

    Directory of Open Access Journals (Sweden)

    Ryuji J Machida

    Full Text Available BACKGROUND: Assessment of the biodiversity of communities of small organisms is most readily done using PCR-based analysis of environmental samples consisting of mixtures of individuals. Known as metagenetics, this approach has transformed understanding of microbial communities and is beginning to be applied to metazoans as well. Unlike microbial studies, where analysis of the 16S ribosomal DNA sequence is standard, the best gene for metazoan metagenetics is less clear. In this study we designed a set of PCR primers for the mitochondrial 12S ribosomal DNA sequence based on 64 complete mitochondrial genomes and then tested their efficacy. METHODOLOGY/PRINCIPAL FINDINGS: A total of the 64 complete mitochondrial genome sequences representing all metazoan classes available in GenBank were downloaded using the NCBI Taxonomy Browser. Alignment of sequences was performed for the excised mitochondrial 12S ribosomal DNA sequences, and conserved regions were identified for all 64 mitochondrial genomes. These regions were used to design a primer pair that flanks a more variable region in the gene. Then all of the complete metazoan mitochondrial genomes available in NCBI's Organelle Genome Resources database were used to determine the percentage of taxa that would likely be amplified using these primers. Results suggest that these primers will amplify target sequences for many metazoans. CONCLUSIONS/SIGNIFICANCE: Newly designed 12S ribosomal DNA primers have considerable potential for metazoan metagenetic analysis because of their ability to amplify sequences from many metazoans.

  4. Universal COI primers for DNA barcoding amphibians.

    Science.gov (United States)

    Che, Jing; Chen, Hong-Man; Yang, Jun-Xiao; Jin, Jie-Qiong; Jiang, Ke; Yuan, Zhi-Yong; Murphy, Robert W; Zhang, Ya-Ping

    2012-03-01

    DNA barcoding is a proven tool for the rapid and unambiguous identification of species, which is essential for many activities including the vouchering tissue samples in the genome 10K initiative, genealogical reconstructions, forensics and biodiversity surveys, among many other applications. A large-scale effort is underway to barcode all amphibian species using the universally sequenced DNA region, a partial fragment of mitochondrial cytochrome oxidase subunit I COI. This fragment is desirable because it appears to be superior to 16S for barcoding, at least for some groups of salamanders. The barcoding of amphibians is essential in part because many species are now endangered. Unfortunately, existing primers for COI often fail to achieve this goal. Herein, we report two new pairs of primers (➀, ➁) that in combination serve to universally amplify and sequence all three orders of Chinese amphibians as represented by 36 genera. This taxonomic diversity, which includes caecilians, salamanders and frogs, suggests that the new primer pairs will universally amplify COI for the vast majority species of amphibians. © 2011 Blackwell Publishing Ltd.

  5. Mapping of randomly amplified polymorphic DNA primer (RAPD) on ...

    African Journals Online (AJOL)

    Mapping of randomly amplified polymorphic DNA primer (RAPD) on chromosome 2A of common wheat. Khamsa Parveen, Inamullah Inamullah, Habib Ahmad, Muhammad Sajjad Iqbal, Fida Muhammad Abbassi, Aziz ud-Din, Abdullah Khan, Imtiaz Ahmad Khan ...

  6. Mapping of randomly amplified polymorphic DNA primer (RAPD) on ...

    African Journals Online (AJOL)

    Genet & Botany only

    2012-08-14

    Aug 14, 2012 ... 500. Figure 1. PCR amplification profile of the two genetic stocks of common wheat,. NT2A2B and NT1D1B using RAPD primer GLC-07. M = Molecular size marker (100 bp DNA ladder, Gene Link, USA). important crops species including wheat (T. aestivum L.). Among the DNA markers, randomly amplified.

  7. RNA Primer Extension Hinders DNA Synthesis byEscherichia coliMutagenic DNA Polymerase IV.

    Science.gov (United States)

    Tashjian, Tommy F; Lin, Ida; Belt, Verena; Cafarelli, Tiziana M; Godoy, Veronica G

    2017-01-01

    In Escherichia coli the highly conserved DNA damage regulated dinB gene encodes DNA Polymerase IV (DinB), an error prone specialized DNA polymerase with a central role in stress-induced mutagenesis. Since DinB is the DNA polymerase with the highest intracellular concentrations upon induction of the SOS response, further regulation must exist to maintain genomic stability. Remarkably, we find that DinB DNA synthesis is inherently poor when using an RNA primer compared to a DNA primer, while high fidelity DNA polymerases are known to have no primer preference. Moreover, we show that the poor DNA synthesis from an RNA primer is conserved in DNA polymerase Kappa, the human DinB homolog. The activity of DinB is modulated by interactions with several other proteins, one of which is the equally evolutionarily conserved recombinase RecA. This interaction is known to positively affect DinB's fidelity on damaged templates. We find that upon interaction with RecA, DinB shows a significant reduction in DNA synthesis when using an RNA primer. Furthermore, with DinB or DinB:RecA a robust pause, sequence and lesion independent, occurs only when RNA is used as a primer. The robust pause is likely to result in abortive DNA synthesis when RNA is the primer. These data suggest a novel mechanism to prevent DinB synthesis when it is not needed despite its high concentrations, thus protecting genome stability.

  8. RNA Primer Extension Hinders DNA Synthesis by Escherichia coli Mutagenic DNA Polymerase IV

    Science.gov (United States)

    Tashjian, Tommy F.; Lin, Ida; Belt, Verena; Cafarelli, Tiziana M.; Godoy, Veronica G.

    2017-01-01

    In Escherichia coli the highly conserved DNA damage regulated dinB gene encodes DNA Polymerase IV (DinB), an error prone specialized DNA polymerase with a central role in stress-induced mutagenesis. Since DinB is the DNA polymerase with the highest intracellular concentrations upon induction of the SOS response, further regulation must exist to maintain genomic stability. Remarkably, we find that DinB DNA synthesis is inherently poor when using an RNA primer compared to a DNA primer, while high fidelity DNA polymerases are known to have no primer preference. Moreover, we show that the poor DNA synthesis from an RNA primer is conserved in DNA polymerase Kappa, the human DinB homolog. The activity of DinB is modulated by interactions with several other proteins, one of which is the equally evolutionarily conserved recombinase RecA. This interaction is known to positively affect DinB’s fidelity on damaged templates. We find that upon interaction with RecA, DinB shows a significant reduction in DNA synthesis when using an RNA primer. Furthermore, with DinB or DinB:RecA a robust pause, sequence and lesion independent, occurs only when RNA is used as a primer. The robust pause is likely to result in abortive DNA synthesis when RNA is the primer. These data suggest a novel mechanism to prevent DinB synthesis when it is not needed despite its high concentrations, thus protecting genome stability. PMID:28298904

  9. Onchocercal DNA amplification using beta actin gene primers ...

    African Journals Online (AJOL)

    Onchocercal DNA amplification using beta actin gene primers compared with first internal transcribed spacer sequences for monitoring onchocerciasis eradication strategy. ... Out of the 12 amplicons in agarose gel, there were 6 sharp and 6 faint bands of 100bp molecular weight as documented. The sharp bands included 3 ...

  10. DNA sequencing using fluorescence background electroblotting membrane

    Science.gov (United States)

    Caldwell, K.D.; Chu, T.J.; Pitt, W.G.

    1992-05-12

    A method for the multiplex sequencing on DNA is disclosed which comprises the electroblotting or specific base terminated DNA fragments, which have been resolved by gel electrophoresis, onto the surface of a neutral non-aromatic polymeric microporous membrane exhibiting low background fluorescence which has been surface modified to contain amino groups. Polypropylene membranes are preferably and the introduction of amino groups is accomplished by subjecting the membrane to radio or microwave frequency plasma discharge in the presence of an aminating agent, preferably ammonia. The membrane, containing physically adsorbed DNA fragments on its surface after the electroblotting, is then treated with crosslinking means such as UV radiation or a glutaraldehyde spray to chemically bind the DNA fragments to the membrane through amino groups contained on the surface. The DNA fragments chemically bound to the membrane are subjected to hybridization probing with a tagged probe specific to the sequence of the DNA fragments. The tagging may be by either fluorophores or radioisotopes. The tagged probes hybridized to the target DNA fragments are detected and read by laser induced fluorescence detection or autoradiograms. The use of aminated low fluorescent background membranes allows the use of fluorescent detection and reading even when the available amount of DNA to be sequenced is small. The DNA bound to the membranes may be reprobed numerous times. No Drawings

  11. DNA sequencing using fluorescence background electroblotting membrane

    Science.gov (United States)

    Caldwell, Karin D.; Chu, Tun-Jen; Pitt, William G.

    1992-01-01

    A method for the multiplex sequencing on DNA is disclosed which comprises the electroblotting or specific base terminated DNA fragments, which have been resolved by gel electrophoresis, onto the surface of a neutral non-aromatic polymeric microporous membrane exhibiting low background fluorescence which has been surface modified to contain amino groups. Polypropylene membranes are preferably and the introduction of amino groups is accomplished by subjecting the membrane to radio or microwave frequency plasma discharge in the presence of an aminating agent, preferably ammonia. The membrane, containing physically adsorbed DNA fragments on its surface after the electroblotting, is then treated with crosslinking means such as UV radiation or a glutaraldehyde spray to chemically bind the DNA fragments to the membrane through said smino groups contained on the surface thereof. The DNA fragments chemically bound to the membrane are subjected to hybridization probing with a tagged probe specific to the sequence of the DNA fragments. The tagging may be by either fluorophores or radioisotopes. The tagged probes hybridized to said target DNA fragments are detected and read by laser induced fluorescence detection or autoradiograms. The use of aminated low fluorescent background membranes allows the use of fluorescent detection and reading even when the available amount of DNA to be sequenced is small. The DNA bound to the membrances may be reprobed numerous times.

  12. Single-stranded DNA-binding protein recruits DNA polymerase V to primer termini on RecA-coated DNA.

    Science.gov (United States)

    Arad, Gali; Hendel, Ayal; Urbanke, Claus; Curth, Ute; Livneh, Zvi

    2008-03-28

    Translesion DNA synthesis (TLS) by DNA polymerase V (polV) in Escherichia coli involves accessory proteins, including RecA and single-stranded DNA-binding protein (SSB). To elucidate the role of SSB in TLS we used an in vitro exonuclease protection assay and found that SSB increases the accessibility of 3' primer termini located at abasic sites in RecA-coated gapped DNA. The mutant SSB-113 protein, which is defective in protein-protein interactions, but not in DNA binding, was as effective as wild-type SSB in increasing primer termini accessibility, but deficient in supporting polV-catalyzed TLS. Consistently, the heterologous SSB proteins gp32, encoded by phage T4, and ICP8, encoded by herpes simplex virus 1, could replace E. coli SSB in the TLS reaction, albeit with lower efficiency. Immunoprecipitation experiments indicated that polV directly interacts with SSB and that this interaction is disrupted by the SSB-113 mutation. Taken together our results suggest that SSB functions to recruit polV to primer termini on RecA-coated DNA, operating by two mechanisms: 1) increasing the accessibility of 3' primer termini caused by binding of SSB to DNA and 2) a direct SSB-polV interaction mediated by the C terminus of SSB.

  13. Primer retention owing to the absence of RNase H1 is catastrophic for mitochondrial DNA replication.

    Science.gov (United States)

    Holmes, J Bradley; Akman, Gokhan; Wood, Stuart R; Sakhuja, Kiran; Cerritelli, Susana M; Moss, Chloe; Bowmaker, Mark R; Jacobs, Howard T; Crouch, Robert J; Holt, Ian J

    2015-07-28

    Encoding ribonuclease H1 (RNase H1) degrades RNA hybridized to DNA, and its function is essential for mitochondrial DNA maintenance in the developing mouse. Here we define the role of RNase H1 in mitochondrial DNA replication. Analysis of replicating mitochondrial DNA in embryonic fibroblasts lacking RNase H1 reveals retention of three primers in the major noncoding region (NCR) and one at the prominent lagging-strand initiation site termed Ori-L. Primer retention does not lead immediately to depletion, as the persistent RNA is fully incorporated in mitochondrial DNA. However, the retained primers present an obstacle to the mitochondrial DNA polymerase γ in subsequent rounds of replication and lead to the catastrophic generation of a double-strand break at the origin when the resulting gapped molecules are copied. Hence, the essential role of RNase H1 in mitochondrial DNA replication is the removal of primers at the origin of replication.

  14. Ultra-low background DNA cloning system.

    Directory of Open Access Journals (Sweden)

    Kenta Goto

    Full Text Available Yeast-based in vivo cloning is useful for cloning DNA fragments into plasmid vectors and is based on the ability of yeast to recombine the DNA fragments by homologous recombination. Although this method is efficient, it produces some by-products. We have developed an "ultra-low background DNA cloning system" on the basis of yeast-based in vivo cloning, by almost completely eliminating the generation of by-products and applying the method to commonly used Escherichia coli vectors, particularly those lacking yeast replication origins and carrying an ampicillin resistance gene (Amp(r. First, we constructed a conversion cassette containing the DNA sequences in the following order: an Amp(r 5' UTR (untranslated region and coding region, an autonomous replication sequence and a centromere sequence from yeast, a TRP1 yeast selectable marker, and an Amp(r 3' UTR. This cassette allowed conversion of the Amp(r-containing vector into the yeast/E. coli shuttle vector through use of the Amp(r sequence by homologous recombination. Furthermore, simultaneous transformation of the desired DNA fragment into yeast allowed cloning of this DNA fragment into the same vector. We rescued the plasmid vectors from all yeast transformants, and by-products containing the E. coli replication origin disappeared. Next, the rescued vectors were transformed into E. coli and the by-products containing the yeast replication origin disappeared. Thus, our method used yeast- and E. coli-specific "origins of replication" to eliminate the generation of by-products. Finally, we successfully cloned the DNA fragment into the vector with almost 100% efficiency.

  15. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

    DEFF Research Database (Denmark)

    Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.

    2011-01-01

    settings. RESULTS: We describe a PCR method for quantification of microRNAs based on a single reverse transcription reaction for all microRNAs combined with real-time PCR with two, microRNA-specific DNA primers. Primer annealing temperatures were optimized by adding a DNA tail to the primers and could...... in microRNA quantification. CONCLUSIONS: MiR-specific quantitative RT-PCR with DNA primers is a highly specific, sensitive and accurate method for microRNA quantification...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...

  16. Characterization of RNA primers synthesized by the human breast cancer cell DNA synthesome.

    Science.gov (United States)

    Dai, Heqiao; Liu, Jianying; Malkas, Linda H; Hickey, Robert J

    2009-04-01

    We previously reported on the purification and characterization of a functional multi-protein DNA replication complex (the DNA synthesome) from human cells and tissues. The synthesome is fully competent to carry-out all phases of the DNA replication process in vitro. In this study, DNA primase, a component of the synthesome, is examined to determine its activity and processivity in the in vitro synthesis and extension of RNA primers. Our results show that primase activity in the P4 fraction of the synthesome is 30-fold higher than that of crude cell extracts. The synthesome synthesizes RNA primers that are 7-10 ribonucleotides long and DNA primers that are 20-40 deoxyribonucleotides long using a poly(dT) template of exogenous single-stranded DNA. The synthesome-catalyzed RNA primers can be elongated by E. coli DNA polymerase I to form the complementary DNA strands on the poly(dT) template. In addition, the synthesome also supports the synthesis of native RNA primers in vitro using an endogenous supercoiled double-stranded DNA template. Gel analysis demonstrates that native RNA primers are oligoribonucleotides of 10-20 nt in length and the primers are covalently link to DNA to form RNA-primed nascent DNA of 100-200 nt. Our study reveals that the synthesome model is capable of priming and continuing DNA replication. The ability of the synthesome to synthesize and extend RNA primers in vitro elucidates the organizational and functional properties of the synthesome as a potentially useful replication apparatus to study the function of primase and the interaction of primase with other replication proteins.

  17. Specific amplification of bacterial DNA by optimized so-called universal bacterial primers in samples rich of plant DNA.

    Science.gov (United States)

    Dorn-In, Samart; Bassitta, Rupert; Schwaiger, Karin; Bauer, Johann; Hölzel, Christina S

    2015-06-01

    Universal primers targeting the bacterial 16S-rRNA-gene allow quantification of the total bacterial load in variable sample types by qPCR. However, many universal primer pairs also amplify DNA of plants or even of archaea and other eukaryotic cells. By using these primers, the total bacterial load might be misevaluated, whenever samples contain high amounts of non-target DNA. Thus, this study aimed to provide primer pairs which are suitable for quantification and identification of bacterial DNA in samples such as feed, spices and sample material from digesters. For 42 primers, mismatches to the sequence of chloroplasts and mitochondria of plants were evaluated. Six primer pairs were further analyzed with regard to the question whether they anneal to DNA of archaea, animal tissue and fungi. Subsequently they were tested with sample matrix such as plants, feed, feces, soil and environmental samples. To this purpose, the target DNA in the samples was quantified by qPCR. The PCR products of plant and feed samples were further processed for the Single Strand Conformation Polymorphism method followed by sequence analysis. The sequencing results revealed that primer pair 335F/769R amplified only bacterial DNA in samples such as plants and animal feed, in which the DNA of plants prevailed. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. The fidelity of reverse transcription differs in reactions primed with RNA versus DNA primers

    NARCIS (Netherlands)

    Oude Essink, B. B.; Berkhout, B.

    1999-01-01

    Reverse transcriptase enzymes (RT) convert single-stranded retroviral RNA genomes into double-stranded DNA. The RT enzyme can use both RNA and DNA primers, the former being used exclusively during initiation of minus- and plus-strand synthesis. Initiation of minus-strand DNA synthesis occurs by

  19. Effects of single-stranded DNA binding proteins on primer extension by telomerase.

    Science.gov (United States)

    Cohen, Shlomit; Jacob, Eyal; Manor, Haim

    2004-08-12

    We present a biochemical analysis of the effects of three single-stranded DNA binding proteins on extension of oligonucleotide primers by the Tetrahymena telomerase. One of them, a human protein designated translin, which was shown to specifically bind the G-rich Tetrahymena and human telomeric repeats, slightly stimulated the primer extension reactions at molar ratios of translin/primer of primers, rather than by a direct interaction of this protein with telomerase. A second protein, the general human single-stranded DNA binding protein Replication Protein A (RPA), similarly affected the primer extension by telomerase, even though its mode of binding to DNA differs from that of translin. A third protein, the E. coli single-stranded DNA binding protein (SSB), whose binding to DNA is highly cooperative, caused more substantial stimulation and inhibition at the lower and the higher molar ratios of SSB/primer, respectively. Both telomere-specific and general single-stranded DNA binding proteins are found in living cells in telomeric complexes. Based on our data, we propose that these proteins may exert either stimulatory or inhibitory effects on intracellular telomerases, depending on their local concentrations. Copyright 2004 Elsevier B.V.

  20. Primer effect in the detection of mitochondrial DNA point heteroplasmy by automated sequencing.

    Science.gov (United States)

    Calatayud, Marta; Ramos, Amanda; Santos, Cristina; Aluja, Maria Pilar

    2013-06-01

    The correct detection of mitochondrial DNA (mtDNA) heteroplasmy by automated sequencing presents methodological constraints. The main goals of this study are to investigate the effect of sense and distance of primers in heteroplasmy detection and to test if there are differences in the accurate determination of heteroplasmy involving transitions or transversions. A gradient of the heteroplasmy levels was generated for mtDNA positions 9477 (transition G/A) and 15,452 (transversion C/A). Amplification and subsequent sequencing with forward and reverse primers, situated at 550 and 150 bp from the heteroplasmic positions, were performed. Our data provide evidence that there is a significant difference between the use of forward and reverse primers. The forward primer is the primer that seems to give a better approximation to the real proportion of the variants. No significant differences were found concerning the distance at which the sequencing primers were placed neither between the analysis of transitions and transversions. The data collected in this study are a starting point that allows to glimpse the importance of the sequencing primers in the accurate detection of point heteroplasmy, providing additional insight into the overall automated sequencing strategy.

  1. Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants

    Directory of Open Access Journals (Sweden)

    Aleksić Jelena M.

    2016-01-01

    Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005

  2. Development of SCAR primers based on a repetitive DNA fingerprint for Escherichia coli detection.

    Science.gov (United States)

    Sangdee, Aphidech; Natphosuk, Sitakan; Srisathan, Adunwit; Sangdee, Kusavadee

    2013-02-01

    The present study aimed to use enterobacterial repetitive intergenic consensus (ERIC) fingerprints to design SCAR primers for the detection of Escherichia coli. The E. coli strains were isolated from various water sources. The primary presumptive identification of E. coli was achieved using MacConkey agar. Nineteen isolates were selected and confirmed to be E. coli strains based on seven biochemical characteristics. ERIC-PCR with ERIC 1R and ERIC 2 primers were used to generate DNA fingerprints. ERIC-PCR DNA profiles showed variant DNA profiles among the tested E. coli strains and distinguished all E. coli strains from the other tested bacterial strains. A 350 bp band that predominated in five E. coli strains was used for the development of the species-specific SCAR primers EC-F1 and EC-R1. The primers showed good specificity for E. coli, with the exception of a single false positive reaction with Sh. flexneri DMST 4423. The primers were able to detect 50 pg and 10(0) CFU/ml of genomic DNA and cells of E. coli, respectively.

  3. BatchPrimer3: A high throughput web application for PCR and sequencing primer design

    Directory of Open Access Journals (Sweden)

    Ma Yaqin

    2008-05-01

    Full Text Available Abstract Background Microsatellite (simple sequence repeat – SSR and single nucleotide polymorphism (SNP markers are two types of important genetic markers useful in genetic mapping and genotyping. Often, large-scale genomic research projects require high-throughput computer-assisted primer design. Numerous such web-based or standard-alone programs for PCR primer design are available but vary in quality and functionality. In particular, most programs lack batch primer design capability. Such a high-throughput software tool for designing SSR flanking primers and SNP genotyping primers is increasingly demanded. Results A new web primer design program, BatchPrimer3, is developed based on Primer3. BatchPrimer3 adopted the Primer3 core program as a major primer design engine to choose the best primer pairs. A new score-based primer picking module is incorporated into BatchPrimer3 and used to pick position-restricted primers. BatchPrimer3 v1.0 implements several types of primer designs including generic primers, SSR primers together with SSR detection, and SNP genotyping primers (including single-base extension primers, allele-specific primers, and tetra-primers for tetra-primer ARMS PCR, as well as DNA sequencing primers. DNA sequences in FASTA format can be batch read into the program. The basic information of input sequences, as a reference of parameter setting of primer design, can be obtained by pre-analysis of sequences. The input sequences can be pre-processed and masked to exclude and/or include specific regions, or set targets for different primer design purposes as in Primer3Web and primer3Plus. A tab-delimited or Excel-formatted primer output also greatly facilitates the subsequent primer-ordering process. Thousands of primers, including wheat conserved intron-flanking primers, wheat genome-specific SNP genotyping primers, and Brachypodium SSR flanking primers in several genome projects have been designed using the program and validated

  4. Developing DNA barcoding (matK) primers for marama bean ...

    African Journals Online (AJOL)

    DNA barcoding is based on the premise that a short standardized DNA barcoding sequence can distinguish individuals of a species because the genetic variation between species exceeds that within species. Information on genetic variation of breeding materials helps to maintain genetic diversity and sustains long term ...

  5. Coupling DNA unwinding activity with primer synthesis in the bacteriophage T4 primosome

    Science.gov (United States)

    Manosas, Maria; Spiering, Michelle M.; Zhuang, Zhihao; Benkovic, Stephen J.; Croquette, Vincent

    2009-01-01

    The unwinding and priming activities of the bacteriophage T4 primosome, which consists of a hexameric helicase (gp41) translocating 5′ to 3′ and an oligomeric primase (gp61) synthesizing primers 5′ to 3′, has been investigated on DNA hairpins manipulated by a magnetic trap. We find that the T4 primosome continuously unwinds the DNA duplex while allowing for primer synthesis through a primosome disassembly mechanism or a novel DNA looping mechanism. A fused gp61-gp41 primosome unwinds and primes DNA exclusively via the DNA looping mechanism. Other proteins within the replisome control the partitioning of these two mechanisms disfavoring primosome disassembly thereby increasing primase processivity. In contrast priming in bacteriophage T7 involves discrete pausing of the primosome and in Escherichia coli appears to be associated primarily with dissociation of the primase from the helicase. Thus nature appears to use several strategies to couple the disparate helicase and primase activities within primosomes. PMID:19838204

  6. Amplification of marine methanotrophic enrichment DNA with 16S rDNA PCR primers for type II alpha proteobacteria methanotrophs.

    Science.gov (United States)

    Rockne, Karl J; Strand, Stuart E

    2003-09-01

    Type II alpha proteobacteria methanotrophs are capable of a wide range of cometabolic transformations of chlorinated solvents and polycyclic aromatic hydrocarbons (PAHs), and this activity has been exploited in many terrestrial bioremediation systems. However, at present, all known obligately marine methanotrophic isolates are Type I gamma proteobacteria which do not have this activity to the extent of Type II methanotrophs. In previous work in our laboratory, determining the presence of Type II alpha proteobacteria methanotrophs in marine enrichment cultures that co-metabolized PAHs required a more sensitive assay. 16S rDNA PCR primers were designed based on oligonucleotide probes for serine pathway methanotrophs and serine pathway methylotrophs with an approximate amplification fragment size of 870 base pairs. Comparison of the primers using double primer BLAST searches in established nucleotide databases showed potential amplification with all Methylocystis and Methylosinus spp., as well as potential amplification with Methylocella palustrus. DNA from Methylosinus trichosporium OB3b, a Type II methanotroph, amplified with the primers with a fragment size of approximately 850 base pairs, whereas DNA extracted from Methylomonas methanica, a Type I methanotroph, did not. The primers were used to amplify DNA extracted from two marine methanotrophic enrichment cultures: a low nitrogen/low copper enrichment to select for Type II methanotrophs and a high nitrogen/high copper enrichment to select for Type I methanotrophs. Although DNA from both cultures amplified with the PCR primers, amplification was stronger in cultures that were specifically enriched for Type II methanotrophs, suggesting the presence of higher numbers of Type II methanotrophs. These results provide further evidence for the existence of Type II marine methanotrophs, suggesting the possibility of exploiting cometabolic activity in marine systems.

  7. Molecular Basis for DNA Double-Strand Break Annealing and Primer Extension by an NHEJ DNA Polymerase

    Directory of Open Access Journals (Sweden)

    Nigel C. Brissett

    2013-11-01

    Full Text Available Nonhomologous end-joining (NHEJ is one of the major DNA double-strand break (DSB repair pathways. The mechanisms by which breaks are competently brought together and extended during NHEJ is poorly understood. As polymerases extend DNA in a 5′-3′ direction by nucleotide addition to a primer, it is unclear how NHEJ polymerases fill in break termini containing 3′ overhangs that lack a primer strand. Here, we describe, at the molecular level, how prokaryotic NHEJ polymerases configure a primer-template substrate by annealing the 3′ overhanging strands from opposing breaks, forming a gapped intermediate that can be extended in trans. We identify structural elements that facilitate docking of the 3′ ends in the active sites of adjacent polymerases and reveal how the termini act as primers for extension of the annealed break, thus explaining how such DSBs are extended in trans. This study clarifies how polymerases couple break-synapsis to catalysis, providing a molecular mechanism to explain how primer extension is achieved on DNA breaks.

  8. Mapping of randomly amplified polymorphic DNA primer (RAPD) on ...

    African Journals Online (AJOL)

    Genet & Botany only

    2012-08-14

    Aug 14, 2012 ... (Islam and Shepherd, 1992). But these markers were not considered suitable for large scale mapping. With the recent introduction of molecular biology, DNA based markers including polymerase chain reaction (PCR), restriction fragment length polymorphism (RFLP), single nucleotide polymorphisms ...

  9. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  10. Microflora ecology of the chicken intestine using 16S ribosomal DNA primers.

    Science.gov (United States)

    Amit-Romach, E; Sklan, D; Uni, Z

    2004-07-01

    The microflora in the gastrointestinal tract of broiler chickens influences digestion, health, and wellbeing. Analysis of chicken gut microflora has been mainly by culture-based methods. Studies using these techniques have been useful for identification and analysis of specific groups of bacteria, however, the use of enrichment medium precludes even relative quantitation of bacterial species. Recent advances in ribosomal DNA-based molecular techniques make it possible to identify different bacterial populations in environmental samples without cultivation. In this study, the intestinal microflora was examined using 16S ribosomal DNA (rDNA) targeted probes from bacterial DNA isolated from intestinal and cecal contents of chickens at 4, 14, and 25 d of age. The ribosomal gene sequence was amplified using PCR with universal primers to determine total bacterial DNA and specific primers directed at 6 bacterial species: Lactobacillus, Bifidobacterium, Salmonella, Campylobacter, Escherichia coli, and Clostridium. The use of universal primers extends these methods to allow determination of relative proportions of different bacterial species. The results indicated that in young chicks the major species present in the small intestines and ceca was Lactobacilli, with a Bifidobacteria population becoming more dominant in the ceca at older age. Clostridium was detected in some segments of the small intestine in young chicks. In older chickens, Salmonella, Campylobacter, and E. coli species were found in the ceca. This study has demonstrated the use of molecular techniques for determining relative proportions of bacterial species and monitoring pathogens in the chick gastrointestinal tract.

  11. Comparison between Mt-DNA D-Loop and Cyt B primers for porcine DNA detection in meat products

    Science.gov (United States)

    Hamzah, Azhana; Mutalib, Sahilah Abd.; Babji, Abdul Salam

    2013-11-01

    This study was conducted to detect the presence of porcine DNA in meat products in the market using conventional polymerase chain reaction (PCR) and commercial PCR-southern hybridization analysis. Porcine DNA detection in meat products was tested due to some issues associated with the adulteration of food products in Malaysia. This is an important issue especially for Halal authentication which is required for some religious practices such as in Islam and Hinduisms. Many techniques have been developed for determining the Halal status of food products. In this paper, mt-DNA D-loop primer and cytochrome (cyt) b were used to detect the presence of porcine DNA in meat products. Positive and negative controls were always present for each batch of extraction. DNA of raw pork meat was used as a positive control while nucleus free water is used as negative control. A pair of oligonucleotide primer was used namely Pork1 and Pork2 which produced amplicon of 531 base pair (bp) in size. While, PCR-southern hybridization was conducted using primers readily supplied by commercial PCR-Southern hybridization and produced amplicon with 276 bp in size. In the present study, demonstrated that none of the samples were contaminated with porcine residuals but selected samples with pork meat were positive. The species-specific PCR amplification yielded excellent results for identification of pork derivatives in food products and it is a potentially reliable and suitable technique in routine food analysis for Halal certification.

  12. Primer-Independent DNA Synthesis by a Family B DNA Polymerase from Self-Replicating Mobile Genetic Elements

    Directory of Open Access Journals (Sweden)

    Modesto Redrejo-Rodríguez

    2017-11-01

    Full Text Available Family B DNA polymerases (PolBs play a central role during replication of viral and cellular chromosomes. Here, we report the discovery of a third major group of PolBs, which we denote primer-independent PolB (piPolB, that might be a link between the previously known protein-primed and RNA/DNA-primed PolBs. PiPolBs are encoded by highly diverse mobile genetic elements, pipolins, integrated in the genomes of diverse bacteria and also present as circular plasmids in mitochondria. Biochemical characterization showed that piPolB displays efficient DNA polymerization activity that can use undamaged and damaged templates and is endowed with proofreading and strand displacement capacities. Remarkably, the protein is also capable of template-dependent de novo DNA synthesis, i.e., DNA-priming activity, thereby breaking the long-standing dogma that replicative DNA polymerases require a pre-existing primer for DNA synthesis. We suggest that piPolBs are involved in self-replication of pipolins and may also contribute to bacterial DNA damage tolerance.

  13. Plant organellar DNA primase-helicase synthesizes RNA primers for organellar DNA polymerases using a unique recognition sequence.

    Science.gov (United States)

    Peralta-Castro, Antolín; Baruch-Torres, Noe; Brieba, Luis G

    2017-10-13

    DNA primases recognize single-stranded DNA (ssDNA) sequences to synthesize RNA primers during lagging-strand replication. Arabidopsis thaliana encodes an ortholog of the DNA primase-helicase from bacteriophage T7, dubbed AtTwinkle, that localizes in chloroplasts and mitochondria. Herein, we report that AtTwinkle synthesizes RNA primers from a 5'-(G/C)GGA-3' template sequence. Within this sequence, the underlined nucleotides are cryptic, meaning that they are essential for template recognition but are not instructional during RNA synthesis. Thus, in contrast to all primases characterized to date, the sequence recognized by AtTwinkle requires two nucleotides (5'-GA-3') as a cryptic element. The divergent zinc finger binding domain (ZBD) of the primase module of AtTwinkle may be responsible for template sequence recognition. During oligoribonucleotide synthesis, AtTwinkle shows a strong preference for rCTP as its initial ribonucleotide and a moderate preference for rGMP or rCMP incorporation during elongation. RNA products synthetized by AtTwinkle are efficiently used as primers for plant organellar DNA polymerases. In sum, our data strongly suggest that AtTwinkle primes organellar DNA polymerases during lagging strand synthesis in plant mitochondria and chloroplast following a primase-mediated mechanism. This mechanism contrasts to lagging-strand DNA replication in metazoan mitochondria, in which transcripts synthesized by mitochondrial RNA polymerase prime mitochondrial DNA polymerase γ. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. Mechanism and stoichiometry of interaction of DnaG primase with DnaB helicase of Escherichia coli in RNA primer synthesis.

    Science.gov (United States)

    Mitkova, Atanaska V; Khopde, Sujata M; Biswas, Subhasis B

    2003-12-26

    Initiation and synthesis of RNA primers in the lagging strand of the replication fork in Escherichia coli requires the replicative DnaB helicase and the DNA primase, the DnaG gene product. In addition, the physical interaction between these two replication enzymes appears to play a role in the initiation of chromosomal DNA replication. In vitro, DnaB helicase stimulates primase to synthesize primers on single-stranded (ss) oligonucleotide templates. Earlier studies hypothesized that multiple primase molecules interact with each DnaB hexamer and single-stranded DNA. We have examined this hypothesis and determined the exact stoichiometry of primase to DnaB hexamer. We have also demonstrated that ssDNA binding activity of the DnaB helicase is necessary for directing the primase to the initiator trinucleotide and synthesis of 11-20-nucleotide long primers. Although, association of these two enzymes determines the extent and rate of synthesis of the RNA primers in vitro, direct evidence of the formation of primase-DnaB complex has remained elusive in E. coli due to the transient nature of their interaction. Therefore, we stabilized this complex using a chemical cross-linker and carried out a stoichiometric analysis of this complex by gel filtration. This allowed us to demonstrate that the primase-helicase complex of E. coli is comprised of three molecules of primase bound to one DnaB hexamer. Fluorescence anisotropy studies of the interaction of DnaB with primase, labeled with the fluorescent probe Ru(bipy)3, and Scatchard analysis further supported this conclusion. The addition of DnaC protein, leading to the formation of the DnaB-DnaC complex, to the simple priming system resulted in the synthesis of shorter primers. Therefore, interactions of the DnaB-primase complex with other replication factors might be critical for determining the physiological length of the RNA primers in vivo and the overall kinetics of primer synthesis.

  15. Retrieval of glycoside hydrolase family 9 cellulase genes from environmental DNA by metagenomic gene specific multi-primer PCR.

    Science.gov (United States)

    Xiong, Xiaolong; Yin, Xiaopu; Pei, Xiaolin; Jin, Peng; Zhang, Ao; Li, Yan; Gong, Weibo; Wang, Qiuyan

    2012-05-01

    A new method, termed metagenomic gene specific multi-primer PCR (MGSM-PCR), is presented that uses multiple gene specific primers derived from an isolated gene from a constructed metagenomic library rather than degenerate primers designed based on a known enzyme family. The utility of MGSM-PCR was shown by applying it to search for homologues of the glycoside hydrolase family 9 cellulase in metagenomic DNA. The success of the multiplex PCR was verified by visualizing products on an agarose gel following gel electrophoresis. A total of 127 homologous genes were amplified with combinatorial multi-primer reactions from 34 soil DNA samples. Multiple alignments revealed extensive sequence diversity among these captured sequences with sequence identity varying from 26 to 99.7%. These results indicated that significantly diverse homologous genes were indeed readily accessible when using multiple metagenomic gene specific primers.

  16. In silico assessment of primers for eDNA studies using PrimerTree and application to characterize the biodiversity surrounding the Cuyahoga River

    Science.gov (United States)

    Cannon, M. V.; Hester, J.; Shalkhauser, A.; Chan, E. R.; Logue, K.; Small, S. T.; Serre, D.

    2016-03-01

    Analysis of environmental DNA (eDNA) enables the detection of species of interest from water and soil samples, typically using species-specific PCR. Here, we describe a method to characterize the biodiversity of a given environment by amplifying eDNA using primer pairs targeting a wide range of taxa and high-throughput sequencing for species identification. We tested this approach on 91 water samples of 40 mL collected along the Cuyahoga River (Ohio, USA). We amplified eDNA using 12 primer pairs targeting mammals, fish, amphibians, birds, bryophytes, arthropods, copepods, plants and several microorganism taxa and sequenced all PCR products simultaneously by high-throughput sequencing. Overall, we identified DNA sequences from 15 species of fish, 17 species of mammals, 8 species of birds, 15 species of arthropods, one turtle and one salamander. Interestingly, in addition to aquatic and semi-aquatic animals, we identified DNA from terrestrial species that live near the Cuyahoga River. We also identified DNA from one Asian carp species invasive to the Great Lakes but that had not been previously reported in the Cuyahoga River. Our study shows that analysis of eDNA extracted from small water samples using wide-range PCR amplification combined with high-throughput sequencing can provide a broad perspective on biological diversity.

  17. PRIMEGENS-v2: genome-wide primer design for analyzing DNA methylation patterns of CpG islands.

    Science.gov (United States)

    Srivastava, Gyan P; Guo, Juyuan; Shi, Huidong; Xu, Dong

    2008-09-01

    DNA methylation plays important roles in biological processes and human diseases, especially cancers. High-throughput bisulfite genomic sequencing based on new generation of sequencers, such as the 454-sequencing system provides an efficient method for analyzing DNA methylation patterns. The successful implementation of this approach depends on the use of primer design software capable of performing genome-wide scan for optimal primers from in silico bisulfite-treated genome sequences. We have developed a method, which fulfills this requirement and conduct primer design for sequences including regions of given promoter CpG islands. The developed method has been implemented using the C and JAVA programming languages. The primer design results were tested in the PCR experiments of 96 selected human DNA sequences containing CpG islands in the promoter regions. The results indicate that this method is efficient and reliable for designing sequence-specific primers. The sequence-specific primer design for DNA meth-ylated sequences including CpG islands has been integrated into the second version of PRIMEGENS as one of the primer design features. The software is freely available for academic use at http://digbio.missouri.edu/primegens/.

  18. Optimization of primer specific filter metrics for the assessment of mitochondrial DNA sequence data

    Science.gov (United States)

    CURTIS, PAMELA C.; THOMAS, JENNIFER L.; PHILLIPS, NICOLE R.; ROBY, RHONDA K.

    2011-01-01

    Filter metrics are used as a quick assessment of sequence trace files in order to sort data into different categories, i.e. High Quality, Review, and Low Quality, without human intervention. The filter metrics consist of two numerical parameters for sequence quality assessment: trace score (TS) and contiguous read length (CRL). Primer specific settings for the TS and CRL were established using a calibration dataset of 2817 traces and validated using a concordance dataset of 5617 traces. Prior to optimization, 57% of the traces required manual review before import into a sequence analysis program, whereas after optimization only 28% of the traces required manual review. After optimization of primer specific filter metrics for mitochondrial DNA sequence data, an overall reduction of review of trace files translates into increased throughput of data analysis and decreased time required for manual review. PMID:21171863

  19. Affinity and sequence specificity of DNA binding and site selection for primer synthesis by Escherichia coli primase.

    Science.gov (United States)

    Khopde, Sujata; Biswas, Esther E; Biswas, Subhasis B

    2002-12-17

    Primase is an essential DNA replication enzyme in Escherichia coli and responsible for primer synthesis during lagging strand DNA replication. Although the interaction of primase with single-stranded DNA plays an important role in primer RNA and Okazaki fragment synthesis, the mechanism of DNA binding and site selection for primer synthesis remains unknown. We have analyzed the energetics of DNA binding and the mechanism of site selection for the initiation of primer RNA synthesis on the lagging strand of the replication fork. Quantitative analysis of DNA binding by primase was carried out using a number of oligonucleotide sequences: oligo(dT)(25) and a 30 bp oligonucleotide derived from bacteriophage G4 origin (G4ori-wt). Primase bound both sequences with moderate affinity (K(d) = 1.2-1.4 x 10(-)(7) M); however, binding was stronger for G4ori-wt. G4ori-wt contained a CTG trinucleotide, which is a preferred site for initiation of primer synthesis. Analysis of DNA binding isotherms derived from primase binding to the oligonucleotide sequences by fluorescence anisotropy indicated that primase bound to DNA as a dimer, and this finding was further substantiated by electrophoretic mobility shift assays (EMSAs) and UV cross-linking of the primase-DNA complex. Dissection of the energetics involved in the primase-DNA interaction revealed a higher affinity of primase for DNA sequences containing the CTG triplet. This sequence preference of primase may likely be responsible for the initiation of primer synthesis in the CTG triplet sites in the E. coli lagging strand as well as in the origin of replication of bacteriophage G4.

  20. ExoMeth sequencing of DNA: eliminating the need for subcloning and oligonucleotide primers.

    Science.gov (United States)

    Sorge, J A; Blinderman, L A

    1989-01-01

    A method is reported for sequencing DNA based on exonuclease III digestion and strand protection by using modified nucleoside triphosphates. Up to 10 kilobases of sequence information may be obtained from each strand of a given template without subcloning. Prior knowledge of the restriction map is not important; prior knowledge of any of the sequence is not required. Nor are oligonucleotide primers needed. Double-stranded cosmids, plasmids, lambda phage, or linear molecules (including amplified molecules) may be used as starting material. The method creates a single-stranded template from these starting molecules, thus generating high-quality sequence ladders. Most commonly used DNA polymerases may be utilized, including reverse transcriptase and T7 DNA polymerase. The approach is "ordered", so little time is wasted on redundant sequencing. Images PMID:2556705

  1. Detection of restriction enzyme-digested target DNA by PCR amplification using a stem-loop primer: application to the detection of hypomethylated fetal DNA in maternal plasma.

    Science.gov (United States)

    Tong, Yu K; Chiu, Rossa W K; Leung, Tak Y; Ding, Chunming; Lau, Tze K; Leung, Tse N; Lo, Y M Dennis

    2007-11-01

    The discovery of cell-free fetal DNA in maternal plasma has opened up new possibilities for noninvasive prenatal diagnosis and monitoring. Among the fetal markers that have been described, methylation markers are sex and polymorphism independent. Methylation-sensitive restriction endonucleases are commonly used to digest hypomethylated DNA molecules, and the hypermethylated molecules remain intact for detection. The positive detection of the cleaved hypomethylated molecules would be useful for certain targets but has not been reported. The use of a stem-loop primer in microRNA detection has previously been described. In this study, DNA assays were designed and performed on maternal plasma, which contained the hypomethylated placental serpin peptidase inhibitor, clade B (ovalbumin), member 5 (SERPINB5; maspin) gene in an excess background of hypermethylated maternal SERPINB5. Detection of the enzyme-digested placenta-derived hypomethylated SERPINB5 molecules was achieved by performing stem-loop extension followed by real-time PCR on maternal plasma. The placental origin of the stem-loop-extended SERPINB5 molecules was confirmed by genotyping. From the real-time PCR results on maternal plasma, stem-loop-extended SERPINB5 promoter sequences were detectable in all 11 enzyme-digested predelivery maternal plasma samples. Postpartum clearance was demonstrated. In 9 cases in which the fetal and maternal SERPINB5 genotypes were distinguishable, the placental-specific genotypes were detected in all predelivery maternal plasma samples. Detection of restriction enzyme-digested hypomethylated placental DNA molecules in maternal plasma by the use of a stem-loop primer represents a novel approach in fetal epigenetic marker detection. The analytical approach may also be generally applicable to the detection of restriction enzyme-digested nucleic acid fragments.

  2. A set of 100 chloroplast DNA primer pairs to study population genetics and phylogeny in monocotyledons.

    Directory of Open Access Journals (Sweden)

    Nora Scarcelli

    Full Text Available Chloroplast DNA sequences are of great interest for population genetics and phylogenetic studies. However, only a small set of markers are commonly used. Most of them have been designed for amplification in a large range of Angiosperms and are located in the Large Single Copy (LSC. Here we developed a new set of 100 primer pairs optimized for amplification in Monocotyledons. Primer pairs amplify coding (exon and non-coding regions (intron and intergenic spacer. They span the different chloroplast regions: 72 are located in the LSC, 13 in the Small Single Copy (SSC and 15 in the Inverted Repeat region (IR. Amplification and sequencing were tested in 13 species of Monocotyledons: Dioscorea abyssinica, D. praehensilis, D. rotundata, D. dumetorum, D. bulbifera, Trichopus sempervirens (Dioscoreaceae, Phoenix canariensis, P. dactylifera, Astrocaryum scopatum, A. murumuru, Ceroxylon echinulatum (Arecaceae, Digitaria excilis and Pennisetum glaucum (Poaceae. The diversity found in Dioscorea, Digitaria and Pennisetum mainly corresponded to Single Nucleotide Polymorphism (SNP while the diversity found in Arecaceae also comprises Variable Number Tandem Repeat (VNTR. We observed that the most variable loci (rps15-ycf1, rpl32-ccsA, ndhF-rpl32, ndhG-ndhI and ccsA are located in the SSC. Through the analysis of the genetic structure of a wild-cultivated species complex in Dioscorea, we demonstrated that this new set of primers is of great interest for population genetics and we anticipate that it will also be useful for phylogeny and bar-coding studies.

  3. Simple and reliable procedure for PCR amplification of genomic DNA from yeast cells using short sequencing primers

    DEFF Research Database (Denmark)

    Haaning, J; Oxvig, C; Overgaard, Michael Toft

    1997-01-01

    by means of PCR without any prior DNA purification steps. This method involves a simple boiling step of whole yeast cells in the presence of detergent, and subsequent amplification of genomic DNA using short sequencing primers in a polymerase chain reaction assay with a decreasing annealing temperature...

  4. Directional, seamless, and restriction enzyme-free construction of random-primed complementary DNA libraries using phosphorothioate-modified primers.

    Science.gov (United States)

    Howland, Shanshan W; Poh, Chek-Meng; Rénia, Laurent

    2011-09-01

    Directional cloning of complementary DNA (cDNA) primed by oligo(dT) is commonly achieved by appending a restriction site to the primer, whereas the second strand is synthesized through the combined action of RNase H and Escherichia coli DNA polymerase I (PolI). Although random primers provide more uniform and complete coverage, directional cloning with the same strategy is highly inefficient. We report that phosphorothioate linkages protect the tail sequence appended to random primers from the 5'→3' exonuclease activity of PolI. We present a simple strategy for constructing a random-primed cDNA library using the efficient, size-independent, and seamless In-Fusion cloning method instead of restriction enzymes. Copyright © 2011 Elsevier Inc. All rights reserved.

  5. Reverse transcription using random pentadecamer primers increases yield and quality of resulting cDNA

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Dufva, I.H.; Dufva, Hans Martin

    2006-01-01

    Reverse transcription of RNA is an invaluable method for gene expression analysis by real-time PCR or microarray methods. Random primers of varying lengths were compared with respect to their efficiency of priming reverse transcription reactions. The results showed that l5-nucleotide-long random...... that random pentadecamers can replace random hexamers in reverse transcription reactions on both poly(A) RNA and amplified RNA, resulting in higher cDNA yields and quality....... with cDNA generated with random hexamers. The increased efficiency of priming using random pentadecamers resulted in reverse transcription of > 80% of the template aRNA, while random hexamers induced reverse transcription of only 40% of the template aRNA. This suggests a better coverage...

  6. Obtaining long 16S rDNA sequences using multiple primers and its application on dioxin-containing samples.

    Science.gov (United States)

    Chen, Yi-Lin; Lee, Chuan-Chun; Lin, Ya-Lan; Yin, Kai-Min; Ho, Chung-Liang; Liu, Tsunglin

    2015-01-01

    Next-generation sequencing (NGS) technology has transformed metagenomics because the high-throughput data allow an in-depth exploration of a complex microbial community. However, accurate species identification with NGS data is challenging because NGS sequences are relatively short. Assembling 16S rDNA segments into longer sequences has been proposed for improving species identification. Current approaches, however, either suffer from amplification bias due to one single primer or insufficient 16S rDNA reads in whole genome sequencing data. Multiple primers were used to amplify different 16S rDNA segments for 454 sequencing, followed by 454 read classification and assembly. This permitted targeted sequencing while reducing primer bias. For test samples containing four known bacteria, accurate and near full-length 16S rDNAs of three known bacteria were obtained. For real soil and sediment samples containing dioxins in various concentrations, 16S rDNA sequences were lengthened by 50% for about half of the non-rare microbes, and 16S rDNAs of several microbes reached more than 1000 bp. In addition, reduced primer bias using multiple primers was illustrated. A new experimental and computational pipeline for obtaining long 16S rDNA sequences was proposed. The capability of the pipeline was validated on test samples and illustrated on real samples. For dioxin-containing samples, the pipeline revealed several microbes suitable for future studies of dioxin chemistry.

  7. The steric gate amino acid tyrosine 112 is required for efficient mismatched-primer extension by human DNA polymerase kappa.

    Science.gov (United States)

    Niimi, Naoko; Sassa, Akira; Katafuchi, Atsushi; Grúz, Petr; Fujimoto, Hirofumi; Bonala, Radha-Rani; Johnson, Francis; Ohta, Toshihiro; Nohmi, Takehiko

    2009-05-26

    Human DNA is continuously damaged by exogenous and endogenous genotoxic insults. To counteract DNA damage and ensure the completion of DNA replication, cells possess specialized DNA polymerases (Pols) that bypass a variety of DNA lesions. Human DNA polymerase kappa (hPolkappa) is a member of the Y-family of DNA Pols and a direct counterpart of DinB in Escherichia coli. hPolkappa is characterized by its ability to bypass several DNA adducts [e.g., benzo[a]pyrene diolepoxide-N(2)-deoxyguanine (BPDE-N(2)-dG) and thymine glycol] and efficiently extend primers with mismatches at the termini. hPolkappa is structurally distinct from E. coli DinB in that it possesses an approximately 100-amino acid extension at the N-terminus. Here, we report that tyrosine 112 (Y112), the steric gate amino acid of hPolkappa, which distinguishes dNTPs from rNTPs by sensing the 2'-hydroxy group of incoming nucleotides, plays a crucial role in extension reactions with mismatched primer termini. When Y112 was replaced with alanine, the amino acid change severely reduced the catalytic constant, i.e., k(cat), of the extending mismatched primers and lowered the efficiency, i.e., k(cat)/K(m), of this process by approximately 400-fold compared with that of the wild-type enzyme. In contrast, the amino acid replacement did not reduce the insertion efficiency of dCMP opposite BPDE-N(2)-dG in template DNA, nor did it affect the ability of hPolkappa to bind strongly to template-primer DNA with BPDE-N(2)-dG/dCMP. We conclude that the steric gate of hPolkappa is a major fidelity factor that regulates extension reactions from mismatched primer termini.

  8. Tools for Ultraspecific Probe/Primer Design

    National Research Council Canada - National Science Library

    Fofanov, Yurly

    2006-01-01

    .... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...

  9. Development of Prevotella intermedia-specific PCR primers based on the nucleotide sequences of a DNA probe Pig27.

    Science.gov (United States)

    Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki

    2011-03-01

    The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.

  10. The interplay of primer-template DNA phosphorylation status and single-stranded DNA binding proteins in directing clamp loaders to the appropriate polarity of DNA.

    Science.gov (United States)

    Hayner, Jaclyn N; Douma, Lauren G; Bloom, Linda B

    2014-01-01

    Sliding clamps are loaded onto DNA by clamp loaders to serve the critical role of coordinating various enzymes on DNA. Clamp loaders must quickly and efficiently load clamps at primer/template (p/t) junctions containing a duplex region with a free 3'OH (3'DNA), but it is unclear how clamp loaders target these sites. To measure the Escherichia coli and Saccharomyces cerevisiae clamp loader specificity toward 3'DNA, fluorescent β and PCNA clamps were used to measure clamp closing triggered by DNA substrates of differing polarity, testing the role of both the 5'phosphate (5'P) and the presence of single-stranded binding proteins (SSBs). SSBs inhibit clamp loading by both clamp loaders on the incorrect polarity of DNA (5'DNA). The 5'P groups contribute selectivity to differing degrees for the two clamp loaders, suggesting variations in the mechanism by which clamp loaders target 3'DNA. Interestingly, the χ subunit of the E. coli clamp loader is not required for SSB to inhibit clamp loading on phosphorylated 5'DNA, showing that χ·SSB interactions are dispensable. These studies highlight a common role for SSBs in directing clamp loaders to 3'DNA, as well as uncover nuances in the mechanisms by which SSBs perform this vital role. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Species specificity of human RPA in simian virus 40 DNA replication lies in T-antigen-dependent RNA primer synthesis.

    Science.gov (United States)

    Wang, M; Park, J S; Ishiai, M; Hurwitz, J; Lee, S H

    2000-12-01

    Replication protein A (RPA) is a three-subunit protein complex with multiple functions in DNA replication. Previous study indicated that human RPA (h-RPA) could not be replaced by Schizosaccharomyces pombe RPA (sp-RPA) in simian virus 40 (SV40) replication, suggesting that h-RPA may have a specific function in SV40 DNA replication. To understand the specificity of h-RPA in replication, we prepared heterologous RPAs containing the mixture of human and S.pombe subunits and compared these preparations for various enzymatic activities. Heterologous RPAs containing two human subunits supported SV40 DNA replication, whereas those containing only one human subunit poorly supported DNA replication, suggesting that RPA complex requires at least two human subunits to support its function in SV40 DNA replication. All heterologous RPAs effectively supported single-stranded (ss)DNA binding activity and an elongation of a primed DNA template catalyzed by DNA polymerase (pol) alpha and delta. A strong correlation between SV40 DNA replication activity and large tumor antigen (T-ag)-dependent RNA primer synthesis by pol alpha-primase complex was observed among the heterologous RPAs. Furthermore, T-ag showed a strong interaction with 70- and 34-kDa subunits from human, but poorly interacted with their S.pombe counterparts, indicating that the specificity of h-RPA is due to its role in RNA primer synthesis. In the SV40 replication reaction, the addition of increasing amounts of sp-RPA in the presence of fixed amount of h-RPA significantly reduced overall DNA synthesis, but increased the size of lagging strand, supporting a specific role for h-RPA in RNA primer synthesis. Together, these results suggest that the specificity of h-RPA in SV40 replication lies in T-ag-dependent RNA primer synthesis.

  12. Preliminary study on applicability of microsatellite DNA primers from parasite protozoa Trypanosoma cruzi in free-living protozoa

    Science.gov (United States)

    Zhang, Wenjing; Yu, Yuhe; Shen, Yunfen; Miao, Wei; Feng, Weisong

    2004-04-01

    In this paper, we took the lead in studying on specificity of the microsatellite DNA loci and applicability of microsatellite DNA primers in protozoa. In order to study characters of microsatellites in free-living protozoa, eight microsatellite loci primers developed from Trypanosoma cruzi (MCLE01, SCLE10, MCLE08, SCLE11, MCLF10, MCLG10, MCL03, MCL05) were employed to amplify microsatellite in four free-living protozoa, including Bodo designis, Euglena gracilis FACHB848, Paramecium bruzise and Tetrahymena thermophila BF1. In the amplification systems of P. bruzise, four loci (SCLE10, SCLE11, MCLF10, MCL03) were amplified successfully, and four amplification fragments were in proper size. In genome of E. gracilis FACHB848, five of eight primers brought five clear amplification bands. In B. designis, three (No.4, 5 and 7) of eight loci produced clear and sharp products without stutter bands, whereas no bands appeared in T. thermophila BF1. Further, eight 300 500 bp amplification fragments were cloned and sequenced. Nevertheless, all sequenced products did not contain corresponding microsatellite sequence, although Bodo is in the same order and has the nearest phylogenetic relation with Trypanosoma among these four species. Thus, the microsatellite DNA primers can not be applied among order or more far taxa, and the specificity of microsatellite DNA is very high in protozoa. The results of this study will contribute to our understanding of microsatellite DNA in protozoa.

  13. The dnaE173 mutator mutation confers on the alpha subunit of Escherichia coli DNA polymerase III a capacity for highly processive DNA synthesis and stable binding to primer/template DNA.

    Science.gov (United States)

    Yanagihara, Fusamitsu; Yoshida, Shohei; Sugaya, Yutaka; Maki, Hisaji

    2007-08-01

    The strong mutator mutation dnaE173 which causes an amino-acid substitution in the alpha subunit of DNA polymerase III is unique in its ability to induce sequence-substitution mutations. We showed previously that multiple biochemical properties of DNA polymerase III holoenzyme of Escherichia coli are simultaneously affected by the dnaE173 mutation. These effects include a severely reduced proofreading capacity, an increased resistance to replication-pausing on the template DNA, a capability to readily promote strand-displacement DNA synthesis, a reduced rate of DNA chain elongation, and an ability to catalyze highly processive DNA synthesis in the absence of the beta-clamp subunit. Here we show that, in contrast to distributive DNA synthesis exhibited by wild-type alpha subunit, the dnaE173 mutant form of alpha subunit catalyzes highly processive DNA chain elongation without the aid of the beta-clamp. More surprisingly, the dnaE173 alpha subunit appeared to form a stable complex with primer/template DNA, while no such affinity was detected with wild-type alpha subunit. We consider that the highly increased affinity of alpha subunit for primer/template DNA is the basis for the pleiotropic effects of the dnaE173 mutation on DNA polymerase III, and provides a clue to the molecular mechanisms underlying sequence substitution mutagenesis.

  14. Inhibition of non-templated nucleotide addition by DNA polymerases in primer extension using twisted intercalating nucleic acid modified templates

    Czech Academy of Sciences Publication Activity Database

    Güixens-Gallardo, Pedro; Hocek, Michal; Perlíková, Pavla

    2016-01-01

    Roč. 26, č. 2 (2016), s. 288-291 ISSN 0960-894X R&D Projects: GA ČR GBP206/12/G151 Institutional support: RVO:61388963 Keywords : DNA polymerases * nucleotide addition * primer extension * oligonucleotides * twisted intercalating nucleic acid Subject RIV: CC - Organic Chemistry Impact factor: 2.454, year: 2016

  15. Back to Basics – The Influence of DNA Extraction and Primer Choice on Phylogenetic Analysis of Activated Sludge Communities

    DEFF Research Database (Denmark)

    Albertsen, Mads; Karst, Søren Michael; Ziegler, Anja Sloth

    2015-01-01

    DNA extraction and primer choice have a large effect on the observed community structure in allmicrobial amplicon sequencing analyses. Although the biases are well known, no com- prehensive analysis has been conducted in activated sludge communities. In this study we systematically explored the i...

  16. Back to basics – the influence of DNA extraction and primer choice on phylogenetic analysis in activated sludge communities

    DEFF Research Database (Denmark)

    Albertsen, Mads; Karst, Søren Michael; Ziegler, Anja Sloth

    DNA extraction and primer choice have a large effect on the observed community structure in all phylogenetic analyses. Although the biases are well known, no comprehensive analysis have been conducted in activated sludge communities. In this study we investigated the effect of bead beating intens...

  17. Rapid plant identification using species- and group-specific primers targeting chloroplast DNA.

    Directory of Open Access Journals (Sweden)

    Corinna Wallinger

    Full Text Available Plant identification is challenging when no morphologically assignable parts are available. There is a lack of broadly applicable methods for identifying plants in this situation, for example when roots grow in mixture and for decayed or semi-digested plant material. These difficulties have also impeded the progress made in ecological disciplines such as soil- and trophic ecology. Here, a PCR-based approach is presented which allows identifying a variety of plant taxa commonly occurring in Central European agricultural land. Based on the trnT-F cpDNA region, PCR assays were developed to identify two plant families (Poaceae and Apiaceae, the genera Trifolium and Plantago, and nine plant species: Achillea millefolium, Fagopyrum esculentum, Lolium perenne, Lupinus angustifolius, Phaseolus coccineus, Sinapis alba, Taraxacum officinale, Triticum aestivum, and Zea mays. These assays allowed identification of plants based on size-specific amplicons ranging from 116 bp to 381 bp. Their specificity and sensitivity was consistently high, enabling the detection of small amounts of plant DNA, for example, in decaying plant material and in the intestine or faeces of herbivores. To increase the efficacy of identifying plant species from large number of samples, specific primers were combined in multiplex PCRs, allowing screening for multiple species within a single reaction. The molecular assays outlined here will be applicable manifold, such as for root- and leaf litter identification, botanical trace evidence, and the analysis of herbivory.

  18. Comprehensive study of several general and type-specific primer pairs for detection of human papillomavirus DNA by PCR in paraffin-embedded cervical carcinomas.

    Science.gov (United States)

    Baay, M F; Quint, W G; Koudstaal, J; Hollema, H; Duk, J M; Burger, M P; Stolz, E; Herbrink, P

    1996-03-01

    We have compared the efficacies of three general primer pairs for the detection of human papillomavirus (HPV) DNA in formaldehyde-fixed paraffin-embedded carcinomas. The use of these primer pairs leads to underestimates of the HPV prevalence (GP5/6, 61.1%; CPI/IIG, 57.4%; MY09/11, 46.9%; combined, 72.8%). The efficacy of each primer pair seemed to be inversely correlated to the length of the amplimer produced. By using newly developed type-specific primer pairs (amplimer length, approximately 100 bp), an increase in HPV DNA detection (87.6%) was found.

  19. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies.

    Directory of Open Access Journals (Sweden)

    Yong Wang

    Full Text Available Bacterial 16S ribosomal DNA (rDNA amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90% were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969-983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies.

  20. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong

    2009-10-09

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

  1. PCR-Based Diagnosis of Neoscytalidium dimidiatum Infection Using Internal Transcribed Spacer 1 Region of Ribosomal DNA Primers

    Directory of Open Access Journals (Sweden)

    Charussri Leeyaphan, M.D.

    2018-01-01

    Full Text Available Objective: To develop N. dimidiatum-specific single PCR-based identification with DNA sequences of nuclear ribosomal internal transcribed spacer (ITS 1 region primers to facilitate the rapid and accurate detection of N. dimidiatum. Methods: N. dimidiatum-specific PCR primers were designed based on the sequence of the internal transcribed spacer 1 region, which is located between 18S and 5.8S nuclear rDNA. Fungal DNA extracted from common causative species for superficial fungal infection including: 2 strains of N. dimidiatum, 9 species of dermatophyte (DMP and 25 species of non-dermatophyte (NDM colonies grown on culture plates were used for PCR analysis. Also, 30 clinical specimens collected from 30 patients clinically diagnosed with fungal nail and feet infection who attended Dermatology clinic Siriraj Hospital during October 2015 to November 2015 were used for PCR assay. Results: Using N. dimidiatum-specific PCR primers, the PCR product was amplified from two standard strains of N. dimidiatum, and there was no amplification from other DMP or NDM species. Regarding sensitivity as lower limit of detection, this PCR method was able to detect 10 pg of N. dimidiatum DNA with ethidium bromide staining and could detect N. dimidiatum in clinical samples. Conclusion: This newly developed N. dimidiatum-specific PCR identification system is rapid, sensitive, and specific. This diagnostic method will facilitate early and accurate diagnosis and accelerate appropriate treatment in patients with N. dimidiatum infection.

  2. Laboratory Protocol for Genetic Gut Content Analyses of Aquatic Macroinvertebrates Using Group-specific rDNA Primers.

    Science.gov (United States)

    Koester, Meike; Gergs, René

    2017-10-05

    Analyzing food webs is essential for a better understanding of ecosystems. For example, food web interactions can undergo severe changes caused by the invasion of non-indigenous species. However, an exact identification of field predator-prey interactions is difficult in many cases. These analyses are often based on a visual evaluation of gut content or the analysis of stable isotope ratios (δ 15 N and δ 13 C). Such methods require comprehensive knowledge about, respectively, morphologic diversity or isotopic signature from individual prey organisms, leading to obstacles in the exact identification of prey organisms. Visual gut content analyses especially underestimate soft bodied prey organisms, because maceration, ingestion and digestion of prey organisms make identification of specific species difficult. Hence, polymerase chain reaction (PCR) based strategies, for example the use of group-specific primer sets, provide a powerful tool for the investigation of food web interactions. Here, we describe detailed protocols to investigate the gut contents of macroinvertebrate consumers from the field using group-specific primer sets for nuclear ribosomal deoxyribonucleic acid (rDNA). DNA can be extracted either from whole specimens (in the case of small taxa) or out of gut contents of specimens collected in the field. Presence and functional efficiency of the DNA templates need to be confirmed directly from the tested individual using universal primer sets targeting the respective subunit of DNA. We also demonstrate that consumed prey can be determined further down to species level via PCR with unmodified group-specific primers combined with subsequent single strand conformation polymorphism (SSCP) analyses using polyacrylamide gels. Furthermore, we show that the use of different fluorescent dyes as labels enables parallel screening for DNA fragments of different prey groups from multiple gut content samples via automated fragment analysis.

  3. Universal and blocking primer mismatches limit the use of high-throughput DNA sequencing for the quantitative metabarcoding of arthropods.

    Science.gov (United States)

    Piñol, J; Mir, G; Gomez-Polo, P; Agustí, N

    2015-07-01

    The quantification of the biological diversity in environmental samples using high-throughput DNA sequencing is hindered by the PCR bias caused by variable primer-template mismatches of the individual species. In some dietary studies, there is the added problem that samples are enriched with predator DNA, so often a predator-specific blocking oligonucleotide is used to alleviate the problem. However, specific blocking oligonucleotides could coblock nontarget species to some degree. Here, we accurately estimate the extent of the PCR biases induced by universal and blocking primers on a mock community prepared with DNA of twelve species of terrestrial arthropods. We also compare universal and blocking primer biases with those induced by variable annealing temperature and number of PCR cycles. The results show that reads of all species were recovered after PCR enrichment at our control conditions (no blocking oligonucleotide, 45 °C annealing temperature and 40 cycles) and high-throughput sequencing. They also show that the four factors considered biased the final proportions of the species to some degree. Among these factors, the number of primer-template mismatches of each species had a disproportionate effect (up to five orders of magnitude) on the amplification efficiency. In particular, the number of primer-template mismatches explained most of the variation (~3/4) in the amplification efficiency of the species. The effect of blocking oligonucleotide concentration on nontarget species relative abundance was also significant, but less important (below one order of magnitude). Considering the results reported here, the quantitative potential of the technique is limited, and only qualitative results (the species list) are reliable, at least when targeting the barcoding COI region. © 2014 John Wiley & Sons Ltd.

  4. Comprehensive study of several general and type-specific primer pairs for detection of human papillomavirus DNA by PCR in paraffin-embedded cervical carcinomas

    NARCIS (Netherlands)

    Baay, M. F.; Quint, W. G.; Koudstaal, J.; Hollema, H.; Duk, J. M.; Burger, M. P.; Stolz, E.; Herbrink, P.

    1996-01-01

    We have compared the efficacies of three general primer pairs for the detection of human papillomavirus (HPV) DNA in formaldehyde-fixed paraffin-embedded carcinomas. The use of these primer pairs leads to underestimates of the HPV prevalence (GP5/6, 61.1%; CPI/IIG, 57.4%; MY09/11, 46.9%; combined,

  5. Comprehensive study of several general and type-specific primer pairs for detection of human papillomavirus DNA by PCR in paraffin-embedded cervical carcinomas

    NARCIS (Netherlands)

    M.F.D. Baay (Marc); W.G.V. Quint (Wim); J. Koudstaal; H. Hollema; J.M. Duk; M.P.M. Burger; E. Stolz (Ernst); P. Herbrink (Paul)

    1996-01-01

    textabstractWe have compared the efficacies of three general primer pairs for the detection of human papillomavirus (HPV) DNA in formaldehyde-fixed paraffin-embedded carcinomas. The use of these primer pairs leads to underestimates of the HPV prevalence (GP5/6, 61.1%;

  6. Comprehensive study of several general and type-specific primer pairs for detection of human papillomavirus DNA by PCR in paraffin-embedded cervical carcinomas

    NARCIS (Netherlands)

    Baay, MFD; Quint, WGV; Koudstaal, J; Hollema, H; Duk, JM; Burger, MPM; Stolz, E; Herbrink, P

    We have compared the efficacies of three general primer pairs for the detection of human papillomavirus (HPV) DNA in formaldehyde-fixed paraffin-embedded carcinomas. The use of these primer pairs leads to underestimates of the HPV prevalence (BP5/6, 61.1%; CPI/IIG, 57.4%; MY09/11, 46.9%; combined,

  7. TREHALOSE-BASED ADDITIVE IMPROVED INTER-PRIMER BINDING SITE REACTIONS FOR DNA ISOLATED FROM RECALCITRANT PLANTS

    Directory of Open Access Journals (Sweden)

    Veronika Lancíková

    2014-02-01

    Full Text Available Trehalose-based (TBT-PAR additive was tested in order to optimize PCR amplification for DNA isolated from recalcitrant plants. Retrotransposon-based inter-primer binding site reactions were significantly improved with TBT-PAR solution using genomic DNA isolated from flax (Linum usitatissimum L., genotypes Kyivskyi, Bethune grown in radio-contaminated and non-radioactive remediated Chernobyl experimental fields. Additionally, similar improvements were observed using 19 recalcitrant genotypes of maize (Zea mays L. and three genotypes of yacon (Smallanthus sonchifolius, Poepp. et Endl., genotypes PER05, ECU45, BOL22 grown in standard field conditions.

  8. Factors that affect large subunit ribosomal DNA amplicon sequencing studies of fungal communities: classification method, primer choice, and error.

    Directory of Open Access Journals (Sweden)

    Teresita M Porter

    Full Text Available Nuclear large subunit ribosomal DNA is widely used in fungal phylogenetics and to an increasing extent also amplicon-based environmental sequencing. The relatively short reads produced by next-generation sequencing, however, makes primer choice and sequence error important variables for obtaining accurate taxonomic classifications. In this simulation study we tested the performance of three classification methods: 1 a similarity-based method (BLAST + Metagenomic Analyzer, MEGAN; 2 a composition-based method (Ribosomal Database Project naïve bayesian classifier, NBC; and, 3 a phylogeny-based method (Statistical Assignment Package, SAP. We also tested the effects of sequence length, primer choice, and sequence error on classification accuracy and perceived community composition. Using a leave-one-out cross validation approach, results for classifications to the genus rank were as follows: BLAST + MEGAN had the lowest error rate and was particularly robust to sequence error; SAP accuracy was highest when long LSU query sequences were classified; and, NBC runs significantly faster than the other tested methods. All methods performed poorly with the shortest 50-100 bp sequences. Increasing simulated sequence error reduced classification accuracy. Community shifts were detected due to sequence error and primer selection even though there was no change in the underlying community composition. Short read datasets from individual primers, as well as pooled datasets, appear to only approximate the true community composition. We hope this work informs investigators of some of the factors that affect the quality and interpretation of their environmental gene surveys.

  9. Novel intein-containing DNA specific primers for rapid identification of Candida glabrata using Real-Time PCR assays.

    Science.gov (United States)

    Kumar, R Satish; Ramesh, S

    2014-12-01

    Candida glabrata is an opportunistic human pathogen known to cause systemic and vaginal candidiasis. Rapid detection of Candida glabrata is indispensable for appropriate selection of antifungal drugs for chemotherapy. The study describes a unique intein-containing DNA fragment for specific detection of C. glabrata. The designed oligonucleotides detected C. glabrata (Ct mean: 24.75 ± 1.1 and Tm: 70.08 ± 0.23°C) in Real-Time PCR assays. The fluorescent signals were negative when the primers were tested for cross-species and cross-genera amplifications. In conclusion, our study recommends a novel primer set for developing a quick identification system which does not require laborious and time-consuming experimentations. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  10. Molecular medicine: a primer for clinicians--Part VIII: Forensic DNA testing.

    Science.gov (United States)

    1995-02-01

    Forensic DNA analysis or "DNA fingerprinting" represents a specific application of DNA testing methods. Previously, we have discussed DNA testing to determine carrier status or to provide confirmatory or presymptomatic diagnosis. Forensic DNA testing seeks to determine the identity of an individual to the exclusion of all others. The most common application of forensic DNA testing is in criminalistics and establishing parentage. In this paper we discuss the application of molecular biology methods to the analysis of DNA for forensic purposes. We also consider some of the controversial issues that surround such uses of DNA testing.

  11. MPprimer: a program for reliable multiplex PCR primer design

    Directory of Open Access Journals (Sweden)

    Wang Xiaolei

    2010-03-01

    Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  12. Optimized mtDNA Control Region Primer Extension Capture Analysis for Forensically Relevant Samples and Highly Compromised mtDNA of Different Age and Origin

    Directory of Open Access Journals (Sweden)

    Mayra Eduardoff

    2017-09-01

    Full Text Available The analysis of mitochondrial DNA (mtDNA has proven useful in forensic genetics and ancient DNA (aDNA studies, where specimens are often highly compromised and DNA quality and quantity are low. In forensic genetics, the mtDNA control region (CR is commonly sequenced using established Sanger-type Sequencing (STS protocols involving fragment sizes down to approximately 150 base pairs (bp. Recent developments include Massively Parallel Sequencing (MPS of (multiplex PCR-generated libraries using the same amplicon sizes. Molecular genetic studies on archaeological remains that harbor more degraded aDNA have pioneered alternative approaches to target mtDNA, such as capture hybridization and primer extension capture (PEC methods followed by MPS. These assays target smaller mtDNA fragment sizes (down to 50 bp or less, and have proven to be substantially more successful in obtaining useful mtDNA sequences from these samples compared to electrophoretic methods. Here, we present the modification and optimization of a PEC method, earlier developed for sequencing the Neanderthal mitochondrial genome, with forensic applications in mind. Our approach was designed for a more sensitive enrichment of the mtDNA CR in a single tube assay and short laboratory turnaround times, thus complying with forensic practices. We characterized the method using sheared, high quantity mtDNA (six samples, and tested challenging forensic samples (n = 2 as well as compromised solid tissue samples (n = 15 up to 8 kyrs of age. The PEC MPS method produced reliable and plausible mtDNA haplotypes that were useful in the forensic context. It yielded plausible data in samples that did not provide results with STS and other MPS techniques. We addressed the issue of contamination by including four generations of negative controls, and discuss the results in the forensic context. We finally offer perspectives for future research to enable the validation and accreditation of the PEC MPS

  13. 16S rRNA gene sequencing of mock microbial populations- impact of DNA extraction method, primer choice and sequencing platform.

    Science.gov (United States)

    Fouhy, Fiona; Clooney, Adam G; Stanton, Catherine; Claesson, Marcus J; Cotter, Paul D

    2016-06-24

    Next-generation sequencing platforms have revolutionised our ability to investigate the microbiota composition of complex environments, frequently through 16S rRNA gene sequencing of the bacterial component of the community. Numerous factors, including DNA extraction method, primer sequences and sequencing platform employed, can affect the accuracy of the results achieved. The aim of this study was to determine the impact of these three factors on 16S rRNA gene sequencing results, using mock communities and mock community DNA. The use of different primer sequences (V4-V5, V1-V2 and V1-V2 degenerate primers) resulted in differences in the genera and species detected. The V4-V5 primers gave the most comparable results across platforms. The three Ion PGM primer sets detected more of the 20 mock community species than the equivalent MiSeq primer sets. Data generated from DNA extracted using the 2 extraction methods were very similar. Microbiota compositional data differed depending on the primers and sequencing platform that were used. The results demonstrate the risks in comparing data generated using different sequencing approaches and highlight the merits of choosing a standardised approach for sequencing in situations where a comparison across multiple sequencing runs is required.

  14. A need for standardization in drinking water analysis – an investigation of DNA extraction procedure, primer choice and detection limit of 16S rRNA amplicon sequencing

    DEFF Research Database (Denmark)

    Brandt, Jakob; Nielsen, Per Halkjær; Albertsen, Mads

    have been made to illuminate the effects specifically related to bacterial communities in drinking water. In this study, we investigated the impact of the DNA extraction and primer choice on the observed community structure, and we also estimated the detection limit of the 16S rRNA amplicon sequencing....... The PowerWater DNA Isolation Kit resulted in significantly higher amounts of isolated DNA compared to the FastDNA SPIN Kit for Soil. Furthermore, extraction with the PowerWater kit lead to detection of a significantly higher number of OTUs. Likewise, the primer experiment revealed great discrepancies in OTU....... coli could be detected in all samples. However, samples with 101 cells/mL had several contaminating OTUs, constituting approximately 8% of the read abundances. For 16S rRNA gene analysis in drinking water samples, we recommend using the PowerWater DNA Isolation Kit for DNA extraction in combination...

  15. Structure of HIV-1 reverse transcriptase bound to a novel 38-mer hairpin template-primer DNA aptamer.

    Science.gov (United States)

    Miller, Matthew T; Tuske, Steve; Das, Kalyan; DeStefano, Jeffrey J; Arnold, Eddy

    2016-01-01

    The development of a modified DNA aptamer that binds HIV-1 reverse transcriptase (RT) with ultra-high affinity has enabled the X-ray structure determination of an HIV-1 RT-DNA complex to 2.3 Å resolution without the need for an antibody Fab fragment or RT-DNA cross-linking. The 38-mer hairpin-DNA aptamer has a 15 base-pair duplex, a three-deoxythymidine hairpin loop, and a five-nucleotide 5'-overhang. The aptamer binds RT in a template-primer configuration with the 3'-end positioned at the polymerase active site and has 2'-O-methyl modifications at the second and fourth duplex template nucleotides that interact with the p66 fingers and palm subdomains. This structure represents the highest resolution RT-nucleic acid structure to date. The RT-aptamer complex is catalytically active and can serve as a platform for studying fundamental RT mechanisms and for development of anti-HIV inhibitors through fragment screening and other approaches. Additionally, the structure allows for a detailed look at a unique aptamer design and provides the molecular basis for its remarkably high affinity for RT. © 2015 The Protein Society.

  16. Electrospun manganese (III) oxide nanofiber based electrochemical DNA-nanobiosensor for zeptomolar detection of dengue consensus primer.

    Science.gov (United States)

    Tripathy, Suryasnata; Krishna Vanjari, Siva Rama; Singh, Vikrant; Swaminathan, S; Singh, Shiv Govind

    2017-04-15

    Nanoscale biosensors, owing to their high-sensitivity and extremely low limits-of-detection, have enabled the realization of highly complex and sophisticated miniaturized platforms for several important healthcare applications, the most predominant one being disease diagnosis. In particular, nanomaterial facilitated electrochemical detection of DNA hybridization has had an exceptional impact on fields such as genetics and cancerous mutation detection Here we report an ultrasensitive electrochemical platform using electrospun semi-conducting Manganese (III) Oxide (Mn 2 O 3 ) nanofibers for DNA Hybridization detection. The proposed platform coalesces the inherent advantages of metal-oxide nanofibers and electrochemical transduction techniques, resulting in label-free zeptomolar detection of DNA hybridization. As proof of concept, we demonstrate zeptomolar detection of Dengue consensus primer (limit of detection: 120×10 -21 M) both in control as well as spiked serum samples. Our reported detection limit is superior in comparison with previously reported electrochemical DNA hybridization sensors for Dengue virus detection, spanning both labeled and label-free transductions. This ultra-sensitivity, we believe, is a result of synthesizing a low bandgap electrospun metal-oxide nanomaterial corresponding to a specific oxidation state of Manganese. This methodology can be extended for detection of any hybridization of interest by simply adapting an appropriate functionalization protocol and thus is very generic in nature. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. Direct Visualization of RNA-DNA Primer Removal from Okazaki Fragments Provides Support for Flap Cleavage and Exonucleolytic Pathways in Eukaryotic Cells.

    Science.gov (United States)

    Liu, Bochao; Hu, Jiazhi; Wang, Jingna; Kong, Daochun

    2017-03-24

    During DNA replication in eukaryotic cells, short single-stranded DNA segments known as Okazaki fragments are first synthesized on the lagging strand. The Okazaki fragments originate from ∼35-nucleotide-long RNA-DNA primers. After Okazaki fragment synthesis, these primers must be removed to allow fragment joining into a continuous lagging strand. To date, the models of enzymatic machinery that removes the RNA-DNA primers have come almost exclusively from biochemical reconstitution studies and some genetic interaction assays, and there is little direct evidence to confirm these models. One obstacle to elucidating Okazaki fragment processing has been the lack of methods that can directly examine primer removal in vivo In this study, we developed an electron microscopy assay that can visualize nucleotide flap structures on DNA replication forks in fission yeast ( Schizosaccharomyces pombe ). With this assay, we first demonstrated the generation of flap structures during Okazaki fragment processing in vivo The mean and median lengths of the flaps in wild-type cells were ∼51 and ∼41 nucleotides, respectively. We also used yeast mutants to investigate the impact of deleting key DNA replication nucleases on these flap structures. Our results provided direct in vivo evidence for a previously proposed flap cleavage pathway and the critical function of Dna2 and Fen1 in cleaving these flaps. In addition, we found evidence for another previously proposed exonucleolytic pathway involving RNA-DNA primer digestion by exonucleases RNase H2 and Exo1. Taken together, our observations suggest a dual mechanism for Okazaki fragment maturation in lagging strand synthesis and establish a new strategy for interrogation of this fascinating process. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. Sensitive fluorescent detection of DNA methyltransferase using nicking endonuclease-mediated multiple primers-like rolling circle amplification.

    Science.gov (United States)

    Huang, Juan; Li, Xiao-Yu; Du, Yi-Chen; Zhang, Li-Na; Liu, Ke-Ke; Zhu, Li-Na; Kong, De-Ming

    2017-05-15

    Sensitive and reliable detection of DNA methyltransferase (MTase) is of great significance for both early tumor diagnosis and therapy. In this study, a simple, label-free and sensitive DNA MTase-sensing method was developed on the basis of a nicking endonuclease-mediated multiple primers-like rolling circle amplification (RCA) strategy. In this method, a dumbbell RCA template was prepared by blunt-end ligation of two molecules of hairpin DNA. In addition to the primer-binding sequence, the dumbbell template contained another three important parts: 5'-CCGG-3' sequences in double-stranded stems, nicking endonuclease recognition sites and C-rich sequences in single-stranded loops. The introduction of 5'-CCGG-3' sequences allows the dumbbell template to be destroyed by the restriction endonuclease, HpaII, but is not destroyed in the presence of the target MTase-M.SssI MTase. The introduction of nicking endonuclease recognition sites makes the M.SssI MTase-protected dumbbell template-mediated RCA proceed in a multiple primers-like exponential mode, thus providing the RCA with high amplification efficiency. The introduction of C-rich sequences may promote the folding of amplification products into a G-quadruplex structure, which is specifically recognized by the commercially available fluorescent probe thioflavin T. Improved RCA amplification efficiency and specific fluorescent recognition of RCA products provide the M.SssI MTase-sensing platform with high sensitivity. When a dumbbell template containing four nicking endonuclease sites is used, highly specific M.SssI MTase activity detection can be achieved in the range of 0.008-50U/mL with a detection limit as low as 0.0011U/mL. Simple experimental operation and mix-and-detection fluorescent sensing mode ensures that M.SssI MTase quantitation works well in a real-time RCA mode, thus further simplifying the sensing performance and making high throughput detection possible. The proposed MTase-sensing strategy was also

  19. Species specificity of human RPA in simian virus 40 DNA replication lies in T-antigen-dependent RNA primer synthesis

    Science.gov (United States)

    Wang, Mu; Park, Jang-Su; Ishiai, Masamichi; Hurwitz, Jerard; Lee, Suk-Hee

    2000-01-01

    Replication protein A (RPA) is a three-subunit protein complex with multiple functions in DNA replication. Previous study indicated that human RPA (h-RPA) could not be replaced by Schizosaccharomyces pombe RPA (sp-RPA) in simian virus 40 (SV40) replication, suggesting that h-RPA may have a specific function in SV40 DNA replication. To understand the specificity of h-RPA in replication, we prepared heterologous RPAs containing the mixture of human and S.pombe subunits and compared these preparations for various enzymatic activities. Heterologous RPAs containing two human subunits supported SV40 DNA replication, whereas those containing only one human subunit poorly supported DNA replication, suggesting that RPA complex requires at least two human subunits to support its function in SV40 DNA replication. All heterologous RPAs effectively supported single-stranded (ss)DNA binding activity and an elongation of a primed DNA template catalyzed by DNA polymerase (pol) α and δ. A strong correlation between SV40 DNA replication activity and large tumor antigen (T-ag)-dependent RNA primer synthesis by pol α–primase complex was observed among the heterologous RPAs. Furthermore, T-ag showed a strong interaction with 70- and 34-kDa subunits from human, but poorly interacted with their S.pombe counterparts, indicating that the specificity of h-RPA is due to its role in RNA primer synthesis. In the SV40 replication reaction, the addition of increasing amounts of sp-RPA in the presence of fixed amount of h-RPA significantly reduced overall DNA synthesis, but increased the size of lagging strand, supporting a specific role for h-RPA in RNA primer synthesis. Together, these results suggest that the specificity of h-RPA in SV40 replication lies in T-ag-dependent RNA primer synthesis. PMID:11095685

  20. An Undergraduate Laboratory Experiment for Upper-Level Forensic Science, Biochemistry, or Molecular Biology Courses: Human DNA Amplification Using STR Single Locus Primers by Real-Time PCR with SYBR Green Detection

    Science.gov (United States)

    Elkins, Kelly M.; Kadunc, Raelynn E.

    2012-01-01

    In this laboratory experiment, real-time polymerase chain reaction (real-time PCR) was conducted using published human TPOX single-locus DNA primers for validation and various student-designed short tandem repeat (STR) primers for Combined DNA Index System (CODIS) loci. SYBR Green was used to detect the amplification of the expected amplicons. The…

  1. Development and evaluation of specific PCR primers targeting the ribosomal DNA-internal transcribed spacer (ITS) region of peritrich ciliates in environmental samples

    Science.gov (United States)

    Su, Lei; Zhang, Qianqian; Gong, Jun

    2017-07-01

    Peritrich ciliates are highly diverse and can be important bacterial grazers in aquatic ecosystems. Morphological identifications of peritrich species and assemblages in the environment are time-consuming and expertise-demanding. In this study, two peritrich-specific PCR primers were newly designed to amplify a fragment including the internal transcribed spacer (ITS) region of ribosomal rDNA from environmental samples. The primers showed high specificity in silico, and in tests with peritrich isolates and environmental DNA. Application of these primers in clone library construction and sequencing yielded exclusively sequences of peritrichs for water and sediment samples. We also found the ITS1, ITS2, ITS, D1 region of 28S rDNA, and ITS+D1 region co-varied with, and generally more variable than, the V9 region of 18S rDNA in peritrichs. The newly designed specific primers thus provide additional tools to study the molecular diversity, community composition, and phylogeography of these ecologically important protists in different systems.

  2. Designing of the specific DNA primers for detection of the exoA, oprL and algD pathogenicity genes for rapid diagnosis of Pseudomonas aeruginosa

    Directory of Open Access Journals (Sweden)

    Mohammad Najafimosleh

    2013-11-01

    Full Text Available Background: The aim of this study was compared the efficacy of  the designed primers and already published primers for detection of the exoA, oprL and algD genes by PCR assay  for finding a rapid, accurate and highly sensitive and specific procedure to detect the Pseudomonas aeruginosa in the serious and fatal infections such as cystic fibrosis disease, burned individual.Methods: A total of 150 clinical specimens were inoculated in to routine and selective culture media for Pseudomonas aeruginosa isolation. Specific primers were designed by bioinformatics analysis for detection of the virulence genes exoA, oprL and algD. The available sequences of these three genes were obtained from NCBI and multiple alignments were performed to find the conserved sequences of each gene for primer designing. Both multiple alignment and primer designing steps were carried out by AlleleID software, version 7.0.Results: Microbiological culture methods were showed that 70 Pseudomonas aeruginosa strains isolated from the 150 clinical specimens. PCR assay performed by using the designed primers shown 68, 70 and 69 positive results from 70 direct specimens for exoA, oprL and algD respectively that shown 97.2%, 100% and 98.6% sensitivity for above genes. PCR assay performed by using the already published primers shown 57, 49 and 28 positive results for above genes respectively that shown 81.5%, 70% and 40% sensitivity.Conclusion: The present study shows that by using the high specific primers for detection of the mentioned genes of the Pseudomonas aeruginosa. The conventional PCR assay detected the early colonization of the organism in Cystic Fibrosis patients with more sensitivity and specificity before several mounts to obtain positive culture. Indeed PCR assay with high specific primers has more sensitivity and specificity as a rapid and accurate diagnosis of the organism in other deadly infections by using the direct clinical specimens.

  3. Development of oligonucleotide primers for the specific PCR-based detection of the most frequent Enterobacteriaceae species DNA using wec gene templates.

    Science.gov (United States)

    Bayardelle, Paul; Zafarullah, Muhammad

    2002-02-01

    Oligonucleotide primers were designed for the PCR-based detection of the wec gene cluster involved in the biosynthetic pathway leading to the production of enterobacterial common antigen (ECA). Escherichia coli DNA was detected using wec A, wec E, and wec F gene primers. The wec A primers were specific for E. coli. The wec E and wec F primers enabled the detection of the most frequent species of the Enterobacteriaceae found in blood and urine specimens as well as in water. The sensitivity of the assay was approximately 1.2 x 102 bacteria/mL of water. Thus, these primers represent an important step in the molecular diagnosis of major Enterobacteriaceae infections. Their role in the routine testing of contamination in drinking water and food may prove to be very useful. The DNA of Enterobacteriaceae species is detected in a first step PCR, followed by specific identification of important pathogens like E. coli O157, Shigella spp., Salmonella spp., and Yersinia spp.

  4. Mechanism of loading the Escherichia coli DNA polymerase III beta sliding clamp on DNA. Bona fide primer/templates preferentially trigger the gamma complex to hydrolyze ATP and load the clamp.

    Science.gov (United States)

    Ason, Brandon; Handayani, Renita; Williams, Christopher R; Bertram, Jeffrey G; Hingorani, Manju M; O'Donnell, Mike; Goodman, Myron F; Bloom, Linda B

    2003-03-21

    The Escherichia coli DNA polymerase III gamma complex clamp loader assembles the ring-shaped beta sliding clamp onto DNA. The core polymerase is tethered to the template by beta, enabling processive replication of the genome. Here we investigate the DNA substrate specificity of the clamp-loading reaction by measuring the pre-steady-state kinetics of DNA binding and ATP hydrolysis using elongation-proficient and deficient primer/template DNA. The ATP-bound clamp loader binds both elongation-proficient and deficient DNA substrates either in the presence or absence of beta. However, elongation-proficient DNA preferentially triggers gamma complex to release beta onto DNA with concomitant hydrolysis of ATP. Binding to elongation-proficient DNA converts the gamma complex from a high affinity ATP-bound state to an ADP-bound state having a 10(5)-fold lower affinity for DNA. Steady-state binding assays are misleading, suggesting that gamma complex binds much more avidly to non-extendable primer/template DNA because recycling to the high affinity binding state is rate-limiting. Pre-steady-state rotational anisotropy data reveal a dynamic association-dissociation of gamma complex with extendable primer/templates leading to the diametrically opposite conclusion. The strongly favored dynamic recognition of extendable DNA does not require the presence of beta. Thus, the gamma complex uses ATP binding and hydrolysis as a mechanism for modulating its interaction with DNA in which the ATP-bound form binds with high affinity to DNA but elongation-proficient DNA substrates preferentially trigger hydrolysis of ATP and conversion to a low affinity state.

  5. Conserved residues in the delta subunit help the E. coli clamp loader, gamma complex, target primer-template DNA for clamp assembly.

    Science.gov (United States)

    Chen, Siying; Coman, Maria Magdalena; Sakato, Miho; O'Donnell, Michael; Hingorani, Manju M

    2008-06-01

    The Escherichia coli clamp loader, gamma complex (gamma(3)deltadelta'lambdapsi), catalyzes ATP-driven assembly of beta clamps onto primer-template DNA (p/tDNA), enabling processive replication. The mechanism by which gamma complex targets p/tDNA for clamp assembly is not resolved. According to previous studies, charged/polar amino acids inside the clamp loader chamber interact with the double-stranded (ds) portion of p/tDNA. We find that dsDNA, not ssDNA, can trigger a burst of ATP hydrolysis by gamma complex and clamp assembly, but only at far higher concentrations than p/tDNA. Thus, contact between gamma complex and dsDNA is necessary and sufficient, but not optimal, for the reaction, and additional contacts with p/tDNA likely facilitate its selection as the optimal substrate for clamp assembly. We investigated whether a conserved sequence-HRVW(279)QNRR--in delta subunit contributes to such interactions, since Tryptophan-279 specifically cross-links to the primer-template junction. Mutation of delta-W279 weakens gamma complex binding to p/tDNA, hampering its ability to load clamps and promote proccessive DNA replication, and additional mutations in the sequence (delta-R277, delta-R283) worsen the interaction. These data reveal a novel location in the C-terminal domain of the E. coli clamp loader that contributes to DNA binding and helps define p/tDNA as the preferred substrate for the reaction.

  6. Fast, Background-Free DNA-PAINT Imaging Using FRET-Based Probes.

    Science.gov (United States)

    Auer, Alexander; Strauss, Maximilian T; Schlichthaerle, Thomas; Jungmann, Ralf

    2017-10-11

    DNA point accumulation in nanoscale topography (DNA-PAINT) enables super-resolution microscopy by harnessing the predictable, transient hybridization between short dye-labeled "imager" and complementary target-bound "docking" strands. DNA-PAINT microscopy allows sub-5 nm spatial resolution, spectrally unlimited multiplexing, and quantitative image analysis. However, these abilities come at the cost of nonfluorogenic imager strands, also emitting fluorescence when not bound to their docking strands. This has thus far prevented rapid image acquisition with DNA-PAINT, as the blinking rate of probes is limited by an upper-bound of imager strand concentrations, which in turn is dictated by the necessity to facilitate the detection of single-molecule binding events over the background of unbound, freely diffusing probes. To overcome this limitation and enable fast, background-free DNA-PAINT microscopy, we here introduce FRET-based imaging probes, alleviating the concentration-limit of imager strands and speeding up image acquisition by several orders of magnitude. We assay two approaches for FRET-based DNA-PAINT (or FRET-PAINT) using either fixed or transient acceptor dyes in combination with transiently binding donor-labeled DNA strands and achieve high-quality super-resolution imaging on DNA origami structures in a few tens of seconds. Finally, we also demonstrate the applicability of FRET-PAINT in a cellular environment by performing super-resolution imaging of microtubules in under 30 s. FRET-PAINT combines the advantages of conventional DNA-PAINT with fast image acquisition times, facilitating the potential study of dynamic processes.

  7. Salinas primer.

    Energy Technology Data Exchange (ETDEWEB)

    Walsh, Timothy Francis; Reese, Garth M.; Bhardwaj, Manoj Kumar

    2004-08-01

    Salinas provides a massively parallel implementation of structural dynamics finite element analysis. This capability is required for high fidelity, validated models used in modal, vibration, static and shock analysis of weapons systems. General capabilities for modal, statics and transient dynamics are provided. Salinas is similar to commercial codes like Nastran or Abaqus. It has some nonlinear capability, but excels in linear computation. It is different than the above commercial codes in that it is designed to operate efficiently in a massively parallel environment. Even for an experienced analyst, running a new finite element package can be a challenge. This little primer is intended to make part of this task easier by presenting the basic steps in a simple way. The analyst is referred to the theory manual for details of the mathematics behind the work. The User's Notes should be used for more complex inputs, and will have more details about the process (as well as many more examples). More information can be found on our web pages, 3 or 4. Finite element analysis can be deceptive. Any software can give the wrong answers if used improperly, and occasionally even when used properly. Certainly a solid background in structural mechanics is necessary to build an adequate finite element model and interpret the results. This primer should provide a quick start in answering some of the more common questions that come up in using Salinas.

  8. Monitoring the Retention of Human Proliferating Cell Nuclear Antigen at Primer/Template Junctions by Proteins That Bind Single-Stranded DNA.

    Science.gov (United States)

    Hedglin, Mark; Aitha, Mahesh; Benkovic, Stephen J

    2017-07-11

    In humans, proliferating cell nuclear antigen (PCNA) sliding clamps encircling DNA coordinate various aspects of DNA metabolism throughout the cell cycle. A critical aspect of this is restricting PCNA to the vicinity of its DNA target site. For example, PCNA must be maintained at or near primer/template (P/T) junctions during DNA synthesis. With a diverse array of cellular factors implicated, many of which interact with PCNA, DNA, or both, it is unknown how this critical feat is achieved. Furthermore, current biochemical assays that examine the retention of PCNA near P/T junctions are inefficient, discontinuous, and qualitative and significantly deviate from physiologically relevant conditions. To overcome these challenges and limitations, we recently developed a novel and convenient Förster resonance energy transfer (FRET) assay that directly and continuously monitors the retention of human PCNA at a P/T junction. Here we describe in detail the design, methodology, interpretation, and limitations of this quantitative FRET assay using the single-stranded DNA-binding protein, SSB, from Escherichia coli as an example. This powerful tool is broadly applicable to any single-stranded DNA-binding protein and may be utilized and/or expanded upon to dissect DNA metabolic pathways that are dependent upon PCNA.

  9. Wet-lab tested microRNA assays for qPCR studies with SYBR®Green and DNA primers in pig tissues

    DEFF Research Database (Denmark)

    Mentzel, Caroline M. Junker; Skovgaard, Kerstin; Córdoba, Sarai

    2014-01-01

    MicroRNAs are key post-transcriptional regulators of gene expression that are involved in several biological processes including those that mediate disease pathophysiology. Hence, quantifying microRNA expression levels can provide important and novel insights into disease biology. In recent years...... have previously developed two useful tools in the field of microRNA quantitative real time PCR (qPCR): 1) a very specific, sensitive and simple qPCR method based on DNA primers, MiR-specific qPCR; and 2) the free primer-design software miRprimer. The present study integrates in a publicly accessible...... database all available information on validated porcine microRNA qPCR assays that have utilized these tools. Due to the high phylogenetic conservation in microRNA sequence between pig, humans and other domestic species this database is a very valuable resource for the broader scientist community who...

  10. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.

  11. [Isolation of DNA from museum exhibits of butterflies (Lepidoptera, Papilionidae) and PCR analysis with random and universal genes-specific primers].

    Science.gov (United States)

    Zakharov, E V; Chelomina, G N; Zhuravlev, Iu N

    2000-09-01

    The effect of the duration of storage of entomological material on DNA preservation was estimated. The results of the optimization of conditions for the analysis of random amplified polymorphic DNA in a polymerase chain reaction (RAPD-PCR) are presented as applied to the DNA of lepidopterans of the family Papilionidae. RAPD patterns are shown for the first time in Atrophaneura alcinous and four species of the genus Parnassius (sensu lata). The applicability of museum specimens of butterflies for RAPD analysis was demonstrated. The results of PCR analysis using DNA obtained from different collection specimens stored for up to five years were compared. The authenticity of DNA obtained from collection specimens was proved using PCR with universal primers, which are specific to the COI and COII cytochrome genes of mitochondrial DNA (mt DNA). The lengths of individuals gene fragments obtained by the amplification of both museum and live specimens were 800 and 1600 bp. The conservative regions of mitochondrial genome were shown to be slightly different in two A. alcinous subspecies.

  12. First large-scale DNA barcoding assessment of reptiles in the biodiversity hotspot of Madagascar, based on newly designed COI primers.

    Science.gov (United States)

    Nagy, Zoltán T; Sonet, Gontran; Glaw, Frank; Vences, Miguel

    2012-01-01

    DNA barcoding of non-avian reptiles based on the cytochrome oxidase subunit I (COI) gene is still in a very early stage, mainly due to technical problems. Using a newly developed set of reptile-specific primers for COI we present the first comprehensive study targeting the entire reptile fauna of the fourth-largest island in the world, the biodiversity hotspot of Madagascar. Representatives of the majority of Madagascan non-avian reptile species (including Squamata and Testudines) were sampled and successfully DNA barcoded. The new primer pair achieved a constantly high success rate (72.7-100%) for most squamates. More than 250 species of reptiles (out of the 393 described ones; representing around 64% of the known diversity of species) were barcoded. The average interspecific genetic distance within families ranged from a low of 13.4% in the Boidae to a high of 29.8% in the Gekkonidae. Using the average genetic divergence between sister species as a threshold, 41-48 new candidate (undescribed) species were identified. Simulations were used to evaluate the performance of DNA barcoding as a function of completeness of taxon sampling and fragment length. Compared with available multi-gene phylogenies, DNA barcoding correctly assigned most samples to species, genus and family with high confidence and the analysis of fewer taxa resulted in an increased number of well supported lineages. Shorter marker-lengths generally decreased the number of well supported nodes, but even mini-barcodes of 100 bp correctly assigned many samples to genus and family. The new protocols might help to promote DNA barcoding of reptiles and the established library of reference DNA barcodes will facilitate the molecular identification of Madagascan reptiles. Our results might be useful to easily recognize undescribed diversity (i.e. novel taxa), to resolve taxonomic problems, and to monitor the international pet trade without specialized expert knowledge.

  13. RecJ-like protein from Pyrococcus furiosus has 3′–5′ exonuclease activity on RNA: implications for proofreading of 3′-mismatched RNA primers in DNA replication

    Science.gov (United States)

    Yuan, Hui; Liu, Xi-Peng; Han, Zhong; Allers, Thorsten; Hou, Jing-Li; Liu, Jian-Hua

    2013-01-01

    Replicative DNA polymerases require an RNA primer for leading and lagging strand DNA synthesis, and primase is responsible for the de novo synthesis of this RNA primer. However, the archaeal primase from Pyrococcus furiosus (Pfu) frequently incorporates mismatched nucleoside monophosphate, which stops RNA synthesis. Pfu DNA polymerase (PolB) cannot elongate the resulting 3′-mismatched RNA primer because it cannot remove the 3′-mismatched ribonucleotide. This study demonstrates the potential role of a RecJ-like protein from P. furiosus (PfRecJ) in proofreading 3′-mismatched ribonucleotides. PfRecJ hydrolyzes single-stranded RNA and the RNA strand of RNA/DNA hybrids in the 3′–5′ direction, and the kinetic parameters (Km and Kcat) of PfRecJ during RNA strand digestion are consistent with a role in proofreading 3′-mismatched RNA primers. Replication protein A, the single-stranded DNA–binding protein, stimulates the removal of 3′-mismatched ribonucleotides of the RNA strand in RNA/DNA hybrids, and Pfu DNA polymerase can extend the 3′-mismatched RNA primer after the 3′-mismatched ribonucleotide is removed by PfRecJ. Finally, we reconstituted the primer-proofreading reaction of a 3′-mismatched ribonucleotide RNA/DNA hybrid using PfRecJ, replication protein A, Proliferating cell nuclear antigen (PCNA) and PolB. Given that PfRecJ is associated with the GINS complex, a central nexus in archaeal DNA replication fork, we speculate that PfRecJ proofreads the RNA primer in vivo. PMID:23605041

  14. Comparative assessment of fungal cellobiohydrolase I richness and composition in cDNA generated using oligo(dT) primers or random hexamers.

    Science.gov (United States)

    Weber, Carolyn F; Kuske, Cheryl R

    2012-02-01

    Understanding soil fungal distribution and activities, particularly at the level of gene expression, is important in unveiling mechanisms regulating their activities in situ. Recent identification of fungal genes involved in carbon cycling has provided the foundation for developing reverse-transcriptase PCR assays to monitor spatiotemporal gene expression patterns in soils and other complex microbial systems. The polyadenylated 3' ends of eukaryotic mRNA transcripts enables the use of oligo(dT) primers for cDNA synthesis, but this can result in the overrepresentation of the 3' end of transcripts in cDNA pools. In an effort to increase the uniformity of transcripts represented in cDNA pools, random hexamers have been used. The use of both priming methods is abundant in the literature, but we do not know how these methods perform relative to each other. We performed comparative richness and compositional analyses of the fungal glycosyl hydrolase family 7 cellobiohydrolase I gene cbhI amplified from soil cDNAs that had been generated using either oligo(dT) primers or random hexamers. Our results demonstrate that similar cbhI richness and composition were recovered using both approaches. Richness estimates and compositional profiles of cbhI sequence libraries generated from random hexamer-primed cDNA were more variable than from libraries generated from oligo(dT) primed cDNA. However, our overall results indicate that, on average, comparable richness and composition were recovered from soil cDNAs when either priming method was used. Published by Elsevier B.V.

  15. Connector inversion probe technology: a powerful one-primer multiplex DNA amplification system for numerous scientific applications.

    Directory of Open Access Journals (Sweden)

    Michael S Akhras

    2007-09-01

    Full Text Available We combined components of a previous assay referred to as Molecular Inversion Probe (MIP with a complete gap filling strategy, creating a versatile powerful one-primer multiplex amplification system. As a proof-of-concept, this novel method, which employs a Connector Inversion Probe (CIPer, was tested as a genetic tool for pathogen diagnosis, typing, and antibiotic resistance screening with two distinct systems: i a conserved sequence primer system for genotyping Human Papillomavirus (HPV, a cancer-associated viral agent and ii screening for antibiotic resistance mutations in the bacterial pathogen Neisseria gonorrhoeae. We also discuss future applications and advances of the CIPer technology such as integration with digital amplification and next-generation sequencing methods. Furthermore, we introduce the concept of two-dimension informational barcodes, i.e. "multiplex multiplexing padlocks" (MMPs. For the readers' convenience, we also provide an on-line tutorial with user-interface software application CIP creator 1.0.1, for custom probe generation from virtually any new or established primer-pairs.

  16. Use of reiterative primer extension methodology to map UV-induced photoproducts at the nucleotide level in the laci gene from genomic DNA

    International Nuclear Information System (INIS)

    Chandrasekhar, D.; Houten, B. Van

    1994-01-01

    A newly developed reiterative primer extension assay has been employed to examine photoproduct formation and repair at the nucleotide level. Analysis of UV-induced DNA photoproduct hotspots in the first 184 base pairs of the laci genes of genomic E. coli DNA has revealed that photoproducts are formed linearly with dose and display a sequence-dependent increase. Generally, pyrimdine dimers were twice as frequent as all other UV-induced photoproducts. However, specific sites showed differing distributions. A post-irradiation recovery period revealed differences in the repair efficiency at individual nucleotides. Repair of photoproducts on the transcribed strand was generally twice as efficient as repair of photoproducts on the nontranscribed strand, indicating that strand-specific DNA repair occurs in the constitutively transcribed laci gene of E. coli. The UV-induced DNA photoproduct distribution following repair was well correlated with an established UV-induced mutation spectrum for wild-type E. coli cells. This analysis revealed that photoproduct hotspots on the efficiently repaired transcribed strand did not correlate with mutagenic hotspots. These data strongly support the hypothesis that mutations arise at inefficiently repaired sites on the nontranscribed strand

  17. Teste de DNA para verificação de parentesco em cães: avaliação do método não automatizado com o auxílio do primer CMR S DNA test for parentage verification in dogs: evaluation of the non-automatized method with assistance of the primer CMR S

    Directory of Open Access Journals (Sweden)

    P.F. Oliveira

    2002-10-01

    Full Text Available To evaluate the precision of the DNA tests using the non-automatized technique for individual identification and parentage tests, 105 Rottweiler dogs were studied using the primer CMR S. The sample was composed of 39 animals belonging to 11 complete families and their progenies, and 66 non related individuals until the second generation, derived from kennels located in the states of Minas Gerais and São Paulo. The CMR S primer was used for the Polimerase Chain Reaction (PCR. The results showed the inefficiency of the technique, even when analyzed through the automated gel analysis system. Also showed the impossibility of its commercial use due to the fact of does not permit the storage of data for subsequent use.

  18. Use of arbitrary DNA primers, polyacrylamide gel electrophoresis and silver staining for identity testing, gene discovery and analysis of gene expression

    International Nuclear Information System (INIS)

    Gresshoff, P.

    1998-01-01

    To understand chemically-induced genomic differences in soybean mutants differing in their ability to enter the nitrogen-fixing symbiosis involving Bradyrhizobium japonicum, molecular techniques were developed to aid the map-based, or positional, cloning. DNA marker technology involving single arbitrary primers was used to enrich regional RFLP linkage data. Molecular techniques, including two-dimensional pulse field gel electrophoresis, were developed to ascertain the first physical mapping in soybean, leading to the conclusion that in the region of marker pA-36 on linkage group H, 1 cM equals about 500 cM. High molecular weight DNA was isolated and cloned into yeast or bacterial artificial chromosomes (YACs/ BACs). YACs were used to analyze soybean genome structure, revealing that over half of the genome contains repetitive DNA. Genetic and molecular tools are now available to facilitate the isolation of plant genes directly involved in symbiosis. The further characterization of these genes, along with the determination of the mechanisms that lead to the mutation, will be of value to other plants and induced mutation research. (author)

  19. Primer on molecular genetics

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  20. Label-free fluorescence strategy for sensitive detection of adenosine triphosphate using a loop DNA probe with low background noise.

    Science.gov (United States)

    Lin, Chunshui; Cai, Zhixiong; Wang, Yiru; Zhu, Zhi; Yang, Chaoyong James; Chen, Xi

    2014-07-15

    A simple, rapid, label-free, and ultrasensitive fluorescence strategy for adenosine triphosphate (ATP) detection was developed using a loop DNA probe with low background noise. In this strategy, a loop DNA probe, which is the substrate for both ligation and digestion enzyme reaction, was designed. SYBR green I (SG I), a double-stranded specific dye, was applied for the readout fluorescence signal. Exonuclease I (Exo I) and exonuclease III (Exo III), sequence-independent nucleases, were selected to digest the loop DNA probe in order to minimize the background fluorescence signal. As a result, in the absence of ATP, the loop DNA was completely digested by Exo I and Exo III, leading to low background fluorescence owing to the weak electrostatic interaction between SG I and mononucleotides. On the other hand, ATP induced the ligation of the nicking site, and the sealed loop DNA resisted the digestion of Exo I and ExoIII, resulting in a remarkable increase of fluorescence response. Upon background noise reduction, the sensitivity of the ATP determination was improved significantly, and the detection limitation was found to be 1.2 pM, which is much lower than that in almost all the previously reported methods. This strategy has promise for wide application in the determination of ATP.

  1. A database of PCR primers for the chloroplast genomes of higher plants

    Science.gov (United States)

    Heinze, Berthold

    2007-01-01

    Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny) or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species). The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata). Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution. PMID:17326828

  2. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    Directory of Open Access Journals (Sweden)

    Nomin Batnyam

    2012-01-01

    Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

  3. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads

    2011-01-01

    Uracil-Specific Exision Reagent (USER) fusion is a recently developed technique that allows for assembly of multiple DNA fragments in a few simple steps. However, designing primers for USER fusion is both tedious and time consuming. Here, we present the Primer Help for USER (PHUSER) software...... containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...

  4. Human Genome Sequencing at the Population Scale: A Primer on High-Throughput DNA Sequencing and Analysis.

    Science.gov (United States)

    Goldfeder, Rachel L; Wall, Dennis P; Khoury, Muin J; Ioannidis, John P A; Ashley, Euan A

    2017-10-15

    Most human diseases have underlying genetic causes. To better understand the impact of genes on disease and its implications for medicine and public health, researchers have pursued methods for determining the sequences of individual genes, then all genes, and now complete human genomes. Massively parallel high-throughput sequencing technology, where DNA is sheared into smaller pieces, sequenced, and then computationally reordered and analyzed, enables fast and affordable sequencing of full human genomes. As the price of sequencing continues to decline, more and more individuals are having their genomes sequenced. This may facilitate better population-level disease subtyping and characterization, as well as individual-level diagnosis and personalized treatment and prevention plans. In this review, we describe several massively parallel high-throughput DNA sequencing technologies and their associated strengths, limitations, and error modes, with a focus on applications in epidemiologic research and precision medicine. We detail the methods used to computationally process and interpret sequence data to inform medical or preventative action. © The Author(s) 2017. Published by Oxford University Press on behalf of the Johns Hopkins Bloomberg School of Public Health. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  5. Design factors that influence PCR amplification success of cross-species primers among 1147 mammalian primer pairs

    Directory of Open Access Journals (Sweden)

    Beckett Stephanie E

    2006-10-01

    Full Text Available Abstract Background Cross-species primers have been used with moderate success to address a variety of questions concerning genome structure, evolution, and gene function. However, the factors affecting their success have never been adequately addressed, particularly with respect to producing a consistent method to achieve high throughput. Using 1,147 mammalian cross-species primer pairs (1089 not previously reported, we tested several factors to determine their influence on the probability that a given target will amplify in a given species under a single amplification condition. These factors included: number of mismatches between the two species (the index species used to identify conserved regions to which the primers were designed, GC-content of the gene and amplified region, CpG dinucleotides in the primer region, degree of encoded protein conservation, length of the primers, and the degree of evolutionary distance between the target species and the two index species. Results The amplification success rate for the cross-species primers was significantly influenced by the number of mismatches between the two index species (6–8% decrease per mismatch in a primer pair, the GC-content within the amplified region (for the dog, GC ≥ 50%, 56.9% amplified; GC2 = 0.14 and the relatedness of the target species to the index species. For the dog, 598 products of 930 primer pairs (64.3% (excluding primers in which dog was an index species were sequenced and shown to be the expected product, with an additional three percent producing the incorrect sequence. When hamster DNA was used with the single amplification condition in a microtiter plate-based format, 510 of 1087 primer pairs (46.9% produced amplified products. The primer pairs are spaced at an average distance of 2.3 Mb in the human genome and may be used to produce up to several hundred thousand bp of species-specific sequence. Conclusion The most important factors influencing the proportion

  6. Typing of multiple single-nucleotide polymorphisms using ribonuclease cleavage of DNA/RNA chimeric single-base extension primers and detection by MALDI-TOF mass spectrometry

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus

    2005-01-01

    of only deoxyribonucleotides (hereafter denoted standard primers). Biotin-labeled ddNTPs were used in the SBE reaction, and the SBE products were purified using the monomeric avidin triethylamine purification protocol, ensuring that only primers extended with a biotin-ddNTP in the 3'-end were isolated...

  7. Variation in extragenic repetitive DNA sequences in Pseudomonas syringae and potential use of modified REP primers in the identification of closely related isolates

    Directory of Open Access Journals (Sweden)

    Elif Çepni

    2012-01-01

    Full Text Available In this study, Pseudomonas syringe pathovars isolated from olive, tomato and bean were identified by species-specific PCR and their genetic diversity was assessed by repetitive extragenic palindromic (REP-PCR. Reverse universal primers for REP-PCR were designed by using the bases of A, T, G or C at the positions of 1, 4 and 11 to identify additional polymorphism in the banding patterns. Binding of the primers to different annealing sites in the genome revealed additional fingerprint patterns in eight isolates of P. savastanoi pv. savastanoi and two isolates of P. syringae pv. tomato. The use of four different bases in the primer sequences did not affect the PCR reproducibility and was very efficient in revealing intra-pathovar diversity, particularly in P. savastanoi pv. savastanoi. At the pathovar level, the primer BOX1AR yielded shared fragments, in addition to five bands that discriminated among the pathovars P. syringae pv. phaseolicola, P. savastanoi pv. savastanoi and P. syringae pv. tomato. REP-PCR with a modified primer containing C produced identical bands among the isolates in a pathovar but separated three pathovars more distinctly than four other primers. Although REP-and BOX-PCRs have been successfully used in the molecular identification of Pseudomonas isolates from Turkish flora, a PCR based on inter-enterobacterial repetitive intergenic concensus (ERIC sequences failed to produce clear banding patterns in this study.

  8. Simple and efficient site-directed mutagenesis using two single-primer reactions in parallel to generate mutants for protein structure-function studies

    Directory of Open Access Journals (Sweden)

    Edelheit Oded

    2009-06-01

    Full Text Available Abstract Background In protein engineering, site-directed mutagenesis methods are used to generate DNA sequences with mutated codons, insertions or deletions. In a widely used method, mutations are generated by PCR using a pair of oligonucleotide primers designed with mismatching nucleotides at the center of the primers. In this method, primer-primer annealing may prevent cloning of mutant cDNAs. To circumvent this problem we developed an alternative procedure that does not use forward-reverse primer pair in the same reaction. Results In initial studies we used a double-primer PCR mutagenesis protocol, but sequencing of products showed tandem repeats of primer in cloned DNA. We developed an alternative method that starts with two Single-Primer Reactions IN Parallel using high-fidelity Pwo DNA polymerase. Thus, we call the method with the acronym SPRINP. The SPRINP reactions are then combined, denatured at 95°C, and slowly cooled, promoting random annealing of the parental DNA and the newly synthesized strands. The products are digested with DpnI that digests methylated parental strands, and then transformed into E. coli. Using this method we generated >40 mutants in cDNAs coding for human Epithelial Na+ Channel (ENaC subunits. The method has been tested for 1–3 bp codon mutation and insertion of a 27 bp epitope tag into cDNAs. Conclusion The SPRINP mutagenesis protocol yields mutants reliably and with high fidelity. The use of a single primer in each amplification reaction increases the probability of success of primers relative to previous methods employing a forward and reverse primer pair in the same reaction.

  9. Influence of primer sequences and DNA extraction method on detection of non-O157 Shiga toxin-producing Escherichia coli in ground beef by real-time PCR targeting the eae, stx, and serogroup-specific genes.

    Science.gov (United States)

    Wasilenko, Jamie L; Fratamico, Pina M; Narang, Neelam; Tillman, Glenn E; Ladely, Scott; Simmons, Mustafa; Cray, William C

    2012-11-01

    Non-O157 Shiga toxin-producing Escherichia coli (STEC) infections, particularly those caused by the "big six" or "top six" non-O157 serogroups (O26, O45, O103, O111, O121, and O145) can result in severe illness and complications. Because of their significant public health impact and the notable prevalence of STEC in cattle, methods for detection of the big six non-O157 STEC in ground beef have been established. Currently, the U.S. Department of Agriculture, Food Safety and Inspection Service detection methods for screening beef samples for non-O157 STEC target the stx(1), stx(2), and eae virulence genes, with the 16S rRNA gene as an internal control, in a real-time PCR multiplex assay. Further, the serogroup is determined by PCR targeting genes in the E. coli O-antigen gene clusters of the big six non-O157 serogroups. The method that we previously reported was improved so that additional stx variants, stx(1d), stx(2e), and stx(2g), are detected. Additionally, alignments of the primers targeting the eae gene were used to improve the detection assay so that eae subtypes that could potentially be of clinical significance would also be detected. Therefore, evaluation of alternative real-time PCR assay primers and probes for the stx and eae reactions was carried out in order to increase the stx and eae subtypes detected. Furthermore, a Tris-EDTA DNA extraction method was compared with a previously used procedure that was based on a commercially available reagent. The Tris-EDTA DNA extraction method significantly decreased the cycle threshold values for the stx assay (P primers and probes increased the subtypes detected to include stx(1d), stx(2e), and stx(2g), and sequence data showed that modification of the eae primer should allow the known eae subtypes to be detected.

  10. Genetic background and embryonic temperature affect DNA methylation and expression of myogenin and muscle development in Atlantic salmon (Salmo salar.

    Directory of Open Access Journals (Sweden)

    Erik Burgerhout

    Full Text Available The development of ectothermic embryos is strongly affected by incubation temperature, and thermal imprinting of body growth and muscle phenotype has been reported in various teleost fishes. The complex epigenetic regulation of muscle development in vertebrates involves DNA methylation of the myogenin promoter. Body growth is a heritable and highly variable trait among fish populations that allows for local adaptations, but also for selective breeding. Here we studied the epigenetic effects of embryonic temperature and genetic background on body growth, muscle cellularity and myogenin expression in farmed Atlantic salmon (Salmo salar. Eggs from salmon families with either high or low estimated breeding values for body growth, referred to as Fast and Slow genotypes, were incubated at 8°C or 4°C until the embryonic 'eyed-stage' followed by rearing at the production temperature of 8°C. Rearing temperature strongly affected the growth rates, and the 8°C fish were about twice as heavy as the 4°C fish in the order Fast8>Slow8>Fast4>Slow4 prior to seawater transfer. Fast8 was the largest fish also at harvest despite strong growth compensation in the low temperature groups. Larval myogenin expression was approximately 4-6 fold higher in the Fast8 group than in the other groups and was associated with relative low DNA methylation levels, but was positively correlated with the expression levels of the DNA methyltransferase genes dnmt1, dnmt3a and dnmt3b. Juvenile Fast8 fish displayed thicker white muscle fibres than Fast4 fish, while Slow 8 and Slow 4 showed no difference in muscle cellularity. The impact of genetic background on the thermal imprinting of body growth and muscle development in Atlantic salmon suggests that epigenetic variation might play a significant role in the local adaptation to fluctuating temperatures over short evolutionary time.

  11. Genetic background and embryonic temperature affect DNA methylation and expression of myogenin and muscle development in Atlantic salmon (Salmo salar).

    Science.gov (United States)

    Burgerhout, Erik; Mommens, Maren; Johnsen, Hanne; Aunsmo, Arnfinn; Santi, Nina; Andersen, Øivind

    2017-01-01

    The development of ectothermic embryos is strongly affected by incubation temperature, and thermal imprinting of body growth and muscle phenotype has been reported in various teleost fishes. The complex epigenetic regulation of muscle development in vertebrates involves DNA methylation of the myogenin promoter. Body growth is a heritable and highly variable trait among fish populations that allows for local adaptations, but also for selective breeding. Here we studied the epigenetic effects of embryonic temperature and genetic background on body growth, muscle cellularity and myogenin expression in farmed Atlantic salmon (Salmo salar). Eggs from salmon families with either high or low estimated breeding values for body growth, referred to as Fast and Slow genotypes, were incubated at 8°C or 4°C until the embryonic 'eyed-stage' followed by rearing at the production temperature of 8°C. Rearing temperature strongly affected the growth rates, and the 8°C fish were about twice as heavy as the 4°C fish in the order Fast8>Slow8>Fast4>Slow4 prior to seawater transfer. Fast8 was the largest fish also at harvest despite strong growth compensation in the low temperature groups. Larval myogenin expression was approximately 4-6 fold higher in the Fast8 group than in the other groups and was associated with relative low DNA methylation levels, but was positively correlated with the expression levels of the DNA methyltransferase genes dnmt1, dnmt3a and dnmt3b. Juvenile Fast8 fish displayed thicker white muscle fibres than Fast4 fish, while Slow 8 and Slow 4 showed no difference in muscle cellularity. The impact of genetic background on the thermal imprinting of body growth and muscle development in Atlantic salmon suggests that epigenetic variation might play a significant role in the local adaptation to fluctuating temperatures over short evolutionary time.

  12. Microsatellite primers in the native perennial cycad Cycas taitungensis (Cycadaceae).

    Science.gov (United States)

    Ju, Li-Ping; Kuo, Chia-Chi; Chao, Yi-Shan; Cheng, Yu-Pin; Gong, Xun; Chiang, Yu-Chung

    2011-04-01

    Microsatellite primers were developed for the native perennial cycad Cycas taitungensis to evaluate the genetic variation of this endangered insular species. Using a magnetic bead enrichment method and EST data, 16 primer sets were developed and identified for the native Taiwan cycad C. taitungensis. The primers amplified dinucleotide, trinucleotide, and complex repeats with 1-9 alleles per locus. Most primers also amplified DNA from C. revoluta and C. debaoensis. These results indicate the utility of primers for future studies of the genetic structure of C. taitungensis. In addition, the primers are useful for further phylogeographic studies between C. taitungensis and C. revoluta, which is a closely related species.

  13. PCR primers for an aldolase-B intron in acanthopterygian fishes

    Directory of Open Access Journals (Sweden)

    Jones William J

    2001-11-01

    Full Text Available Abstract Background Nuclear DNA sequences provide genetic information that complements studies using mitochondrial DNA. Some 'universal' primer sets have been developed that target introns within protein-coding loci, but many simultaneously amplify introns from paralogous loci. Refining existing primer sets to target a single locus could circumvent this problem. Results Aldolase intron 'G' was amplified from four fish species using previously described primer sets that target several loci indiscriminately. Phylogenetic analyses were used to group these fragments and other full-length aldolase proteins from teleost fishes into orthologous clades and a primer set was designed to target specifically an intron within the aldolase-B locus in acanthopterygian fishes. DNA amplifications were tried in a variety of acanthopterygian fishes and amplification products, identifiable as aldolase-B intron 'G', were observed in all atherinomorph and percomorph taxa examined. Sequence variation within this locus was found within and among several species examined. Conclusions Using 'universal' primer sets coupled with phylogenetic analyses it was possible to develop a genetic assay to target a specific locus in a variety of fish taxa. Sequence variation was observed within and among species suggesting that this targeted assay might facilitate interspecific and intraspecific comparisons.

  14. Primer3_masker: integrating masking of template sequence with primer design software.

    Science.gov (United States)

    Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido

    2018-01-19

    Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/(integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online. © The Author(s) 2018. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

  15. LOMA: A fast method to generate efficient tagged-random primers despite amplification bias of random PCR on pathogens

    Directory of Open Access Journals (Sweden)

    Lee Wah

    2008-09-01

    Full Text Available Abstract Background Pathogen detection using DNA microarrays has the potential to become a fast and comprehensive diagnostics tool. However, since pathogen detection chips currently utilize random primers rather than specific primers for the RT-PCR step, bias inherent in random PCR amplification becomes a serious problem that causes large inaccuracies in hybridization signals. Results In this paper, we study how the efficiency of random PCR amplification affects hybridization signals. We describe a model that predicts the amplification efficiency of a given random primer on a target viral genome. The prediction allows us to filter false-negative probes of the genome that lie in regions of poor random PCR amplification and improves the accuracy of pathogen detection. Subsequently, we propose LOMA, an algorithm to generate random primers that have good amplification efficiency. Wet-lab validation showed that the generated random primers improve the amplification efficiency significantly. Conclusion The blind use of a random primer with attached universal tag (random-tagged primer in a PCR reaction on a pathogen sample may not lead to a successful amplification. Thus, the design of random-tagged primers is an important consideration when performing PCR.

  16. Development of PCR primers based on a fragment from randomly amplified polymorphic DNA for the detection of Escherichia coli O157:H7/NM.

    Science.gov (United States)

    Lin, Chien-Ku; Lin, Jia-Chi

    2007-06-01

    Serotype O157:H7 of EHEC is by far the most prevalent serotype associated with haemorrhagic colitis (HC) and haemolytic uremic syndrome (HUS). Although PCR methods aimed on the detection of genes associated with the pathogenicity of Escherichia coli O157:H7 have been reported, tests allowing the direct identification of this serotype are rare. In this study, we used RAPD-PCR tests to analyze strains of E. coli O157:H7 serotype, strains of non-pathogenic E. coli, and strains of other pathotypes, including enterotoxigenic E. coli (ETEC), enteropathogenic E. coli (EPEC), enteroinvasive E. coli (EIEC), and enteroaggregation E. coli (EAggEC). One RAPD fragment co-shared by serotype O157:H7 strains was observed when 10-mer primer termed as OPQ3 was used. After sequencing this fragment, three primers were designed and combined to form two PCR primer pairs. These two primer pairs were highly specific to the strains belonging to E. coli O157:H7/NM (non-motile).

  17. Development of SCAR marker specific to non-toxic Jatropha curcas L. and designing a novel multiplexing PCR along with nrDNA ITS primers to circumvent the false negative detection

    KAUST Repository

    Mastan, Shaik G.

    2011-05-10

    Jatropha curcas L., a multipurpose shrub, has acquired significant economic importance for its seed oil which can be converted to biodiesel an emerging alternative to petro-diesel. In addition to the commercial value, it is also having medicinal and even high nutritional value to use as animal fodder which is limited due to the toxicity. Development of molecular marker will enable to differentiate non-toxic from toxic variety of J. curcas in a mixed population and also for quality control since the toxic components of J. curcas has deleterious effect on animals. In the present study, the efforts were made to generate the specific SCAR marker for toxic and/or non-toxic J. curcas from RAPD markers. Among the markers specific for toxic and non-toxic varieties, four were selected, purified, cloned, sequenced, and designed primers out of which one set of primers NT-JC/SCAR I/OPQ15-F and R could able to discriminate the non-toxic with toxic Jatropha by giving expected 430 bp size amplification in non-toxic variety. Furthermore, novel multiplex PCR was designed using the nrDNA ITS primers to overcome the false negatives. Present work also demonstrates utility of the conserved regions of nrDNA coding genes in ruling out the artifacts in PCR-like false negatives frequently occur in SCAR due to various reasons. The specific SCAR markers generated in the present investigation will help to distinguish non-toxic from toxic varieties of J. curcas or vice versa, and isolated marker along with designed multiplex protocol has applications in quality control for selective cultivation of non-toxic variety and will also assist in breeding and molecular mapping studies. © 2011 Springer Science+Business Media, LLC.

  18. Microsatellite DNA primers for the candy darter, Etheostoma osburni and variegate darter, Etheostoma variatum, and cross-species amplification in other darters (Percidae)

    Science.gov (United States)

    Switzer, J.F.; Welsh, S.A.; King, T.L.

    2008-01-01

    In order to investigate a potential hybrid zone between the candy darter, Etheostoma osburni, and variegate darter, Etheostoma variatum, and examine population variation within E. osburni, a suite of primers for 15 polymorphic microsatellite loci were developed. The average number of alleles per locus was 5.5 in E. osburni and 7.6 in E. variatum, and the average observed heterozygosities were 62.5% and 71.4%, respectively. There were no deviations from Hardy-Weinberg equilibrium and no observed linkage disequilibrium after Bonferroni correction. The utility of these primers was also tested in 11 species of darters representing all four genera of darters. Success of cross-species amplification was largely consistent with phylogenetic relationships of darters. ?? 2007 The Authors.

  19. LAVA: An Open-Source Approach To Designing LAMP (Loop-Mediated Isothermal Amplification DNA Signatures

    Directory of Open Access Journals (Sweden)

    Gardner Shea N

    2011-06-01

    Full Text Available Abstract Background We developed an extendable open-source Loop-mediated isothermal AMPlification (LAMP signature design program called LAVA (LAMP Assay Versatile Analysis. LAVA was created in response to limitations of existing LAMP signature programs. Results LAVA identifies combinations of six primer regions for basic LAMP signatures, or combinations of eight primer regions for LAMP signatures with loop primers, which can be used as LAMP signatures. The identified primers are conserved among target organism sequences. Primer combinations are optimized based on lengths, melting temperatures, and spacing among primer sites. We compare LAMP signature candidates for Staphylococcus aureus created both by LAVA and by PrimerExplorer. We also include signatures from a sample run targeting all strains of Mycobacterium tuberculosis. Conclusions We have designed and demonstrated new software for identifying signature candidates appropriate for LAMP assays. The software is available for download at http://lava-dna.googlecode.com/.

  20. Coupling of background reduction with rolling circle amplification for highly sensitive protein detection via terminal protection of small molecule-linked DNA.

    Science.gov (United States)

    Wang, Qiong; Jiang, Bingying; Xie, Jiaqing; Xiang, Yun; Yuan, Ruo; Chai, Yaqin

    2013-10-07

    In this work, by coupling background current reduction with rolling circle amplification (RCA), we describe the development of an ultrasensitive electrochemical sensing method for protein detection based on a small molecule-linked DNA terminal protection strategy. Our detection platform employs a typical streptavidin (STV)-biotin interaction system. Biotin-linked single-stranded DNA (SH-ssDNA-biotin) is self-assembled on a gold electrode to capture the target protein, STV. The binding of STV with the biotin small molecule recognition element protects the SH-ssDNA-biotin against hydrolysis by exonuclease I (Exo I), while the unbound SH-ssDNA-biotin is effectively hydrolyzed and removed from the electrode surface. The bound STV further interacts with long, RCA-amplified biotin DNAs to facilitate the adsorption of numerous electroactive reporters, hexaammineruthenium(III) chloride (RuHex) via electrostatic interactions, which results in significantly amplified signals for the quantitative determination of STV. Moreover, the removal of the unbound SH-ssDNA-biotin probes from the sensing electrode obviates the accumulation of RuHex and leads to a highly minimized background current. The simultaneous RCA signal amplification and background current reduction is expected to significantly enhance the signal-to-noise ratio and to achieve ultrahigh sensitivity. The results reveal that the developed strategy provides a low detection limit of 0.4 pM with high selectivity.

  1. URPD: a specific product primer design tool

    Directory of Open Access Journals (Sweden)

    Chuang Li-Yeh

    2012-06-01

    Full Text Available Abstract Background Polymerase chain reaction (PCR plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design, a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq, UCSC In-Silico PCR, memetic algorithm (MA and genetic algorithm (GA primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/.

  2. Development of techniques using DNA analysis method for detection/analysis of radiation-induced mutation. Development of an useful probe/primer and improvement of detection efficacy

    International Nuclear Information System (INIS)

    Maekawa, Hideaki; Tsuchida, Kozo; Hashido, Kazuo; Takada, Naoko; Kameoka, Yosuke; Hirata, Makoto

    1999-01-01

    Previously, it was demonstrated that detection of centromere became easy and reliable through fluorescent staining by FISH method using a probe of the sequence preserved in α-satelite DNA. Since it was, however, found inappropriate to detect dicentrics based on the relative amount of DNA probe on each chromosome. A prove which allows homogeneous detection of α-satelite DNA for each chromosome was constructed. A presumed sequence specific to kinetochore, CENP-B box was amplified by PCR method and the product DNA was used as a probe. However, the variation in amounts of probe DNA among chromosomes was decreased by only about 20%. Then, a program for image processing of the results obtained from FISH using α-satelite DNA was constructed to use as a marker for centromere. When compared with detection of abnormal chromosomes stained by the conventional method, calculation efficacy for only detection of centromere was improved by the use of this program. Calculation to discriminate the normal or not was still complicated and the detection efficacy was little improved. Chromosomal abnormalities in lymphocytes were used to detect the effects of radiation. In this method, it is needed to shift the phase of cells into metaphase. The mutation induced by radiation might be often repaired during shifting. To exclude this possibility, DNA extraction was conducted at a low temperature and immediately after exposure to 137 Cs, and a rapid genome detection method was established using the genome DNA. As the model genomes, the following three were used: 1) long chain repeated sequences widely dispersed over chromosome, 2) cluster genes, 3) single copy genes. The effects of radiation were detectable at 1-2 Gy for the long repeated sequences and at 7 Gy for the cluster genes, respectively, whereas no significant effects were observed at any Gy tested for the single copy genes. Amplification was marked in the cells exposed at 1-10 Gy (peak at 4 Gy), suggesting that these regions had

  3. Dna Sequencing

    Science.gov (United States)

    Tabor, Stanley; Richardson, Charles C.

    1995-04-25

    A method for sequencing a strand of DNA, including the steps off: providing the strand of DNA; annealing the strand with a primer able to hybridize to the strand to give an annealed mixture; incubating the mixture with four deoxyribonucleoside triphosphates, a DNA polymerase, and at least three deoxyribonucleoside triphosphates in different amounts, under conditions in favoring primer extension to form nucleic acid fragments complementory to the DNA to be sequenced; labelling the nucleic and fragments; separating them and determining the position of the deoxyribonucleoside triphosphates by differences in the intensity of the labels, thereby to determine the DNA sequence.

  4. Real-time PCR (qPCR) primer design using free online software.

    Science.gov (United States)

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

  5. Storage conditions of blood samples and primer selection affect the yield of cDNA polymerase chain reaction products of hepatitis C virus

    NARCIS (Netherlands)

    Cuypers, H. T.; Bresters, D.; Winkel, I. N.; Reesink, H. W.; Weiner, A. J.; Houghton, M.; van der Poel, C. L.; Lelie, P. N.

    1992-01-01

    We have noticed that suboptimal specimen processing and storage conditions may cause false-negative results in the detection of hepatitis C virus (HCV) RNA in plasma or serum. To establish the influence of specimen handling in a serological laboratory on the rate of detection of HCV RNA by the cDNA

  6. An efficient method for the construction of functionalized DNA bearing amino acid groups through cross-coupling reactions of nucleoside triphosphates followed by primer extension or PCR

    Czech Academy of Sciences Publication Activity Database

    Čapek, Petr; Cahová, Hana; Pohl, Radek; Hocek, Michal; Gloeckner, Ch.; Marx, A.

    2007-01-01

    Roč. 13, č. 21 (2007), s. 6196-6203 ISSN 0947-6539 R&D Projects: GA MŠk LC512; GA ČR GA203/05/0043 Institutional research plan: CEZ:AV0Z40550506 Keywords : nucleoside triphosphates * cross-coupling * DNA Subject RIV: CC - Organic Chemistry Impact factor: 5.330, year: 2007

  7. Bisprimer-A program for the design of primers for bisulfite-based genomic sequencing of both plant and mammalian DNA samples

    Czech Academy of Sciences Publication Activity Database

    Kováčová, Viera; Janoušek, Bohuslav

    2012-01-01

    Roč. 103, č. 2 (2012), s. 308-312 ISSN 0022-1503 R&D Projects: GA ČR(CZ) GA521/08/0932; GA ČR(CZ) GD204/09/H002 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : bisulfite * cytosine methylation * DNA methylation Subject RIV: BO - Biophysics Impact factor: 1.995, year: 2012

  8. Evaluation of DNA damage in the root cells of Allium cepa seeds growing in soil of high background radiation areas of Ramsar - Iran

    Energy Technology Data Exchange (ETDEWEB)

    Saghirzadeh, M. [Department of Basic Science, Gonabad University of Medical Sciences, Gonabad (Iran, Islamic Republic of); Gharaati, M.R. [Faculty of Science, Tarbiat Modares University, Tehran (Iran, Islamic Republic of); Mohammadi, Sh. [Nuclear Science and Technology Research Institute (NSTRI), Radiation Applications Research School, Tehran 11365-3486 (Iran, Islamic Republic of)], E-mail: smohammadi@aeoi.org.ir; Ghiassi-Nejad, M. [Faculty of Science, Tarbiat Modares University, Tehran (Iran, Islamic Republic of)

    2008-10-15

    Plants are unique in their ability to serve as in situ monitors for environmental genotoxins. We have used the alkaline comet assay for detecting induced DNA damage in Allium cepa to estimate the impact of high levels of natural radiation in the soils of inhabited zones of Ramsar. The average specific activity of natural radionuclides measured in the soil samples for {sup 226}Ra was 12,766 Bq kg{sup -1} whereas in the control soils was in the range of 34-60 Bq kg{sup -1}. A positive strong significant correlation of the DNA damage in nuclei of the root cells of A. cepa seeds germinated in the soil of high background radiation areas with {sup 226}Ra specific activity of the soil samples was observed. The results showed high genotoxicity of radioactively contaminated soils. Also the linear increase in the DNA damage indicates that activation of repair enzymes is not triggered by exposure to radiation in HBRA.

  9. Effects of chronic low level natural background radiation on the induction and rejoining of DNA strand breaks in human Go lymphocytes

    International Nuclear Information System (INIS)

    Vivek Kumar, P.R.; Cheriyan, V.D.; Seshadri, M.

    2010-01-01

    Thirty three inhabitants of the coastal areas of Kerala, from Chavara-Neendakara belt in Karunagappally taluk, were selected, as the population living here receives high level natural background radiation primarily due to the presence of thorium ( 232 Th) in the monazite containing beach sand. Eighteen individuals from a nearby normal background radiation area were included as control in this study. Participants in both groups were male, non- smokers and with comparable age (P=0.96, Student's t-test). Blood samples were collected with informed consent. Lymphocytes from these individuals were subjected to alkaline single cell gel electrophoresis (comet) assay to estimate DNA strand breaks. A challenge assay procedure is followed, in which lymphocytes from these individuals were exposed to 2Gy or 4Gy of 60 Co gamma radiation at a dose-rate of 1.4Gy/minute (Low dose irradiator 2000, BRIT, India) on ice and were investigated immediately (induction) or assayed after short durations (7, 14 and 30 minutes), that allowed repair of DNA damage (rejoining). In addition, comet assay coupled with endonuclease III (ENDO III) was used to assess oxidized pyrimidine bases. Results were expressed as 'DNA strand breaks per million base pairs' (SB/10 6 bp) calculated with the mean of 'percentage of DNA in comet tail' (%T) obtained from each sample, using a calibration curve. In this study data from the two groups were compared by the non-parametric Mann-Whitney U-test, otherwise indicated. This pilot study suggest a possible adaptive process in individuals exposed to chronic low level natural background radiation, indicated by an increase in repair of DNA strand breaks. Results might also suggest an elevated level of reactive oxygen species (ROS) scavenging mechanism in HBRA subjects compared to the controls. However, our findings need to be validated in a larger study population

  10. Asset management primer

    Science.gov (United States)

    1999-12-01

    According to this primer, asset management is a systematic process of maintaining, upgrading, and operating physical assets cost-effectively. It combines engineering principles with sound business practices and economic theory, and it provides tools ...

  11. Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

    Directory of Open Access Journals (Sweden)

    Alexandre R. Zuntini

    2013-08-01

    Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  12. Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples.

    Science.gov (United States)

    Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G

    2013-09-01

    New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  13. The background of mitochondrial DNA haplogroup J increases the sensitivity of Leber's hereditary optic neuropathy cells to 2,5-hexanedione toxicity.

    Directory of Open Access Journals (Sweden)

    Anna Ghelli

    Full Text Available Leber's hereditary optic neuropathy (LHON is a maternally inherited blinding disease due to mitochondrial DNA (mtDNA point mutations in complex I subunit genes, whose incomplete penetrance has been attributed to both genetic and environmental factors. Indeed, the mtDNA background defined as haplogroup J is known to increase the penetrance of the 11778/ND4 and 14484/ND6 mutations. Recently it was also documented that the professional exposure to n-hexane might act as an exogenous trigger for LHON. Therefore, we here investigate the effect of the n-hexane neurotoxic metabolite 2,5-hexanedione (2,5-HD on cell viability and mitochondrial function of different cell models (cybrids and fibroblasts carrying the LHON mutations on different mtDNA haplogroups. The viability of control and LHON cybrids and fibroblasts, whose mtDNAs were completely sequenced, was assessed using the MTT assay. Mitochondrial ATP synthesis rate driven by complex I substrates was determined with the luciferine/luciferase method. Incubation with 2,5-HD caused the maximal loss of viability in control and LHON cells. The toxic effect of this compound was similar in control cells irrespective of the mtDNA background. On the contrary, sensitivity to 2,5-HD induced cell death was greatly increased in LHON cells carrying the 11778/ND4 or the 14484/ND6 mutation on haplogroup J, whereas the 11778/ND4 mutation in association with haplogroups U and H significantly improved cell survival. The 11778/ND4 mutation on haplogroup U was also more resistant to inhibition of complex I dependent ATP synthesis by 2,5-HD. In conclusion, this study shows that mtDNA haplogroups modulate the response of LHON cells to 2,5-HD. In particular, haplogroup J makes cells more sensitive to its toxic effect. This is the first evidence that an mtDNA background plays a role by interacting with an environmental factor and that 2,5-HD may be a risk element for visual loss in LHON. This proof of principle has broad

  14. Exquisite allele discrimination by toehold hairpin primers

    Science.gov (United States)

    Byrom, Michelle; Bhadra, Sanchita; Jiang, Yu Sherry; Ellington, Andrew D.

    2014-01-01

    The ability to detect and monitor single nucleotide polymorphisms (SNPs) in biological samples is an enabling research and clinical tool. We have developed a surprising, inexpensive primer design method that provides exquisite discrimination between SNPs. The field of DNA computation is largely reliant on using so-called toeholds to initiate strand displacement reactions, leading to the execution of kinetically trapped circuits. We have now similarly found that the short toehold sequence to a target of interest can initiate both strand displacement within the hairpin and extension of the primer by a polymerase, both of which will further stabilize the primer:template complex. However, if the short toehold does not bind, neither of these events can readily occur and thus amplification should not occur. Toehold hairpin primers were used to detect drug resistance alleles in two genes, rpoB and katG, in the Mycobacterium tuberculosis genome, and ten alleles in the Escherichia coli genome. During real-time PCR, the primers discriminate between mismatched templates with Cq delays that are frequently so large that the presence or absence of mismatches is essentially a ‘yes/no’ answer. PMID:24990378

  15. The Los Alamos primer

    CERN Document Server

    Serber, Robert

    2018-01-01

    Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.

  16. China Energy Primer

    Energy Technology Data Exchange (ETDEWEB)

    Ni, Chun Chun

    2009-11-16

    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  17. Comparison of primers for the detection of pathogenic Escherichia coli using real-time PCR.

    Science.gov (United States)

    Barak, J D; Sananikone, K; Delwiche, M J

    2005-01-01

    To evaluate PCR primers for the detection of pathogenic Escherichia coli in a real-time PCR assay and determine their utility in produce irrigation water testing. Three previously published PCR primer sets and one set designed for this study were tested for their ability to produce amplification products for several pathogenic E. coli serotypes from whole cells as template. Two of the previously published primer sets were chosen for real-time PCR detection limit determination. The coneaeA and PEH detection limit of E. coli O157:H7 was 10(0) and 10(1) CFU rxn(-1) in sterile water respectively. To detect E. coli O157:H7 in sprout irrigation water, the water required dilution due to PCR inhibitors. The detection limit of the coneaeA and PEH was 10(1) and between 10(2) and 10(3) CFU rxn(-1) in diluted sprout irrigation water respectively. The primer set coneaeA was able to produce an amplification product from each E. coli serotype, except O128:H7 and most sensitive for real-time PCR detection of pathogenic E. coli in diluted sprout irrigation water. The necessity of a dissociation analysis to distinguish positive samples from those with fluorescence of random dsDNA generation for real-time PCR in a complex background was established.

  18. Primer on Water Quality

    Science.gov (United States)

    ... fs-027-01.pdf--665KB A Primer on Water Quality What is in the water? Is it safe for drinking? Can fish and ... affect water quality. What do we mean by "water quality"? Water quality can be thought of as ...

  19. An SAT® Validity Primer

    Science.gov (United States)

    Shaw, Emily J.

    2015-01-01

    This primer should provide the reader with a deeper understanding of the concept of test validity and will present the recent available validity evidence on the relationship between SAT® scores and important college outcomes. In addition, the content examined on the SAT will be discussed as well as the fundamental attention paid to the fairness of…

  20. A physicists guide to The Los Alamos Primer

    International Nuclear Information System (INIS)

    Reed, B Cameron

    2016-01-01

    In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)

  1. MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

    Directory of Open Access Journals (Sweden)

    Kitchen James L

    2012-11-01

    Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  2. Analysis of the effects of sex hormone background on the rat choroid plexus transcriptome by cDNA microarrays.

    Directory of Open Access Journals (Sweden)

    Telma Quintela

    Full Text Available The choroid plexus (CP are highly vascularized branched structures that protrude into the ventricles of the brain, and form a unique interface between the blood and the cerebrospinal fluid (CSF, the blood-CSF barrier, that are the main site of production and secretion of CSF. Sex hormones are widely recognized as neuroprotective agents against several neurodegenerative diseases, and the presence of sex hormones cognate receptors suggest that it may be a target for these hormones. In an effort to provide further insight into the neuroprotective mechanisms triggered by sex hormones we analyzed gene expression differences in the CP of female and male rats subjected to gonadectomy, using microarray technology. In gonadectomized female and male animals, 3045 genes were differentially expressed by 1.5-fold change, compared to sham controls. Analysis of the CP transcriptome showed that the top-five pathways significantly regulated by the sex hormone background are olfactory transduction, taste transduction, metabolism, steroid hormone biosynthesis and circadian rhythm pathways. These results represent the first overview of global expression changes in CP of female and male rats induced by gonadectomy and suggest that sex hormones are implicated in pathways with central roles in CP functions and CSF homeostasis.

  3. HPV 9G DNA Chip: 100% Clinical Sensitivity and Specificity

    OpenAIRE

    An, Heejung; Song, Keum-Soo; Nimse, Satish Balasaheb; Kim, Junghoon; Nguyen, Van-Thuan; Ta, Van-Thao; Sayyed, Danishmalik Rafiq; Kim, Taisun

    2012-01-01

    We describe a novel HPV 9G DNA chip test for the accurate and reliable genotyping of human papillomavirus (HPV). The HPV 9G DNA chip test established its efficiency in terms of a signal-to-background ratio (SBR) of 200, which is 50 times superior to commercial HPV DNA chips, and 100% target-specific hybridization at 25°C. We compared the genotyping results for the 439 clinical samples by the HPV 9G DNA chip test with the sequencing results for the MY11/GP6+ (M2) primer set-mediated PCR produc...

  4. Coal Bed Methane Primer

    Energy Technology Data Exchange (ETDEWEB)

    Dan Arthur; Bruce Langhus; Jon Seekins

    2005-05-25

    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  5. Predictive maintenance primer

    International Nuclear Information System (INIS)

    Flude, J.W.; Nicholas, J.R.

    1991-04-01

    This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs

  6. A method for automatically extracting infectious disease-related primers and probes from the literature

    Directory of Open Access Journals (Sweden)

    Pérez-Rey David

    2010-08-01

    Full Text Available Abstract Background Primer and probe sequences are the main components of nucleic acid-based detection systems. Biologists use primers and probes for different tasks, some related to the diagnosis and prescription of infectious diseases. The biological literature is the main information source for empirically validated primer and probe sequences. Therefore, it is becoming increasingly important for researchers to navigate this important information. In this paper, we present a four-phase method for extracting and annotating primer/probe sequences from the literature. These phases are: (1 convert each document into a tree of paper sections, (2 detect the candidate sequences using a set of finite state machine-based recognizers, (3 refine problem sequences using a rule-based expert system, and (4 annotate the extracted sequences with their related organism/gene information. Results We tested our approach using a test set composed of 297 manuscripts. The extracted sequences and their organism/gene annotations were manually evaluated by a panel of molecular biologists. The results of the evaluation show that our approach is suitable for automatically extracting DNA sequences, achieving precision/recall rates of 97.98% and 95.77%, respectively. In addition, 76.66% of the detected sequences were correctly annotated with their organism name. The system also provided correct gene-related information for 46.18% of the sequences assigned a correct organism name. Conclusions We believe that the proposed method can facilitate routine tasks for biomedical researchers using molecular methods to diagnose and prescribe different infectious diseases. In addition, the proposed method can be expanded to detect and extract other biological sequences from the literature. The extracted information can also be used to readily update available primer/probe databases or to create new databases from scratch.

  7. Math primer for engineers

    CERN Document Server

    Cryer, CW

    2014-01-01

    Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

  8. The R primer

    CERN Document Server

    Ekstrom, Claus Thorn

    2011-01-01

    Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

  9. El primer virreinato americano

    Directory of Open Access Journals (Sweden)

    Cassá, Roberto

    2006-12-01

    Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.

    El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.

  10. Encapsulated Multifunction Corrosion Inhibitive Primer.

    Science.gov (United States)

    1983-11-01

    with the environment of the primer formu- lation. Thus, prior to spray application, the microcapsules would be combined with the epoxy- polyamide primer...loading was not possible. Problems were encountered when the toluene suspensions of microcapsules were blended 302 into the polyamide component. The low...the primer is an epoxy- polyamide , which is applied under the polyurethane top- coat. The polyurea microcapsules are more similar in their chemical pro

  11. Universal PCR primers for ribosomal protein gene introns of fish

    Directory of Open Access Journals (Sweden)

    Seinen Chow

    2016-01-01

    Full Text Available Abstract Human ribosomal protein (RP gene sequences with respect to intron/exon structures and corresponding cDNA or genomic data of fish species were obtained from the GenBank database. Based on conserved exon sequences, 128 primer pairs for 41 genes were designed for exon-primed intron-crossing (EPIC polymerase chain reaction (PCR. In reference to the draft genome sequences of the Pacific bluefin tuna (Thunnus orientalis, 12 primer pairs expected to amplify introns of the bluefin tuna with lengths of 500–1000 bp were selected and applied to six distantly related fish species belonging to the Orders Clupeiformes, Tetraodontiformes, Pleuronectiformes, Perciformes, Scorpaeniformes, and Anguilliformes. PCR amplification was observed for at least four species in each primer pair, and all fragments were larger than those expected for intronless amplification. Single fragment amplification was observed for at least seven primer pairs per species. Fragment sizes of the bluefin tuna for nine primer pairs corresponded to those expected from the genomic data. Thus, our primer pairs are potentially applicable to a wide variety of fish species and serve as an initial step for isolating single-copy nuclear DNA sequences.

  12. A primer on water

    Science.gov (United States)

    Leopold, Luna Bergere; Langbein, Walter Basil

    1960-01-01

    When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to

  13. Note: Primer Amysat 001; Fragment size is 211bp

    Indian Academy of Sciences (India)

    Renuka

    Bhandara : Lanes 1–14 represent different strains of Bhandara Ecorace. Note: Primer Amysat 001; Fragment size is 211bp. Fig. 1. SSR profiles generated from genomic DNA of 16 strains from different individuals of (A.L, D. TV, D. BV, Modal, Sukinda, Raily, Bhandara) ecoraces of tasar silk worm, Antheraea mylitta using the.

  14. Novel primers for detection of genetically diverse virulent Agrobacterium tumefaciens bv1 strains

    Science.gov (United States)

    Novel primers were developed to amplify a 243 bp fragment of an intergenic region between gene5 and tms2 on the T-DNA of Agrobacterium tumefaciens. These primers exhibit 100% positive correlation with strain virulence, 100% negative correlation with avirulence and did not generate extraneous bands,...

  15. Radiation protection primer

    International Nuclear Information System (INIS)

    Aigner, R.; Melzer, E.; Seissler, H.

    1986-01-01

    This 'radiation protection primer' does not pretend to give absolute, final answers to the many questions that have been arising after the Chernobyl accident. What it is intended to supply, as a schematic overview of problems resulting from nuclear accidents, and a likewise systematic outline of possible solutions and sensible reactions to such an event. The book takes up questions such as: What has happened to the soil. Will future harvests be 'clean' again. What does radioactivity to our drinking water and other waters. What are the effects of a radioactive fallout on food. What may we eat or drink. What happens to the human body after intake of radioactive air, or - even only slightly - contaminated food or water. What can we do to protect our health, and the health of our children. Is there anything else we can do in order to avoid such a disaster in future, except from shutting-off all reactors. The book itself presents some answers and advice, along with a list of terms and explanations, and addresses to apply to for further advice and information. (orig./HP) [de

  16. PCR primers that amplify fungal rRNA genes from environmental samples.

    Science.gov (United States)

    Borneman, J; Hartin, R J

    2000-10-01

    Two PCR primer pairs were designed to amplify rRNA genes (rDNA) from all four major phyla of fungi: Ascomycota, Basidiomycota, Chytridomycota, and Zygomycota. PCRs performed with these primers showed that both pairs amplify DNA from organisms representing the major taxonomic groups of fungi but not from nonfungal sources. To test the ability of the primers to amplify fungal rDNA from environment samples, clone libraries from two avocado grove soils were constructed and analyzed. These soils possess different abilities to inhibit avocado root rot caused by Phythophthora cinnamomi. Analysis of the two rDNA clone libraries revealed differences in the two fungal communities. It also revealed a markedly different depiction of the soil fungal community than that generated by a culture-based analysis, confirming the value of rDNA-based approaches for identifying organisms that may not readily grow on agar media. Additional evidence of the usefulness of the primers was obtained by identifying fungi associated with avocado leaves. In both the soil and leaf analyses, no nonfungal rDNA sequences were identified, illustrating the selectivity of these PCR primers. This work demonstrates the ability of two newly developed PCR primer sets to amplify fungal rDNA from soil and plant tissue, thereby providing unique tools to examine this vast and mostly undescribed community of organisms.

  17. Development of Species-Specific Primers for Plasmodiophora brassicae, Clubroot Pathogen of Kimchi Cabbage

    Directory of Open Access Journals (Sweden)

    Jin Su Choi

    2014-03-01

    Full Text Available Clubroot caused by the obligate biotrophic protist Plasmodiophora brassicae Woronin is one of the most damaging diseases of Brassicaceae family. In this study, we developed species-specific primer sets for rapid and accurate detection of P. brassicae. The primer sets developed amplified a specific fragment only from P. brassicae DNA while they did not amplify a band from 10 other soilborne pathogens or from Kimchi cabbage. In sensitivity test, the species-specific primer set ITS1-1/ITS1-2 could work for approximately 10 spores/ml of genomic DNA showing more sensitivity and accuracy than previous methods. With quantitative real-time PCR test, the primer set detected less spores of P. brassicae than before, confirming that the species-specific primer set could be useful for rapid and accurate detection of P. brassicae.

  18. Study of HIV-2 primer-template initiation complex using antisense oligonucleotides

    DEFF Research Database (Denmark)

    Boulmé, F; Freund, F; Gryaznov, S

    2000-01-01

    HIV-2 reverse transcription is initiated by the retroviral DNA polymerase (reverse transcriptase) from a cellular tRNALys3 partially annealed to the primer binding site in the 5'-region of viral RNA. The HIV-2 genome has two A-rich regions upstream of the primer binding site. In contrast to HIV-1...... RNA, no direct evidence of interactions with the U-rich anticodon loop of tRNALys3 has been described to date. Here we address the question of the potential role of the interactions between these highly structured regions in the initiation of viral DNA synthesis. To evaluate this we used an antisense...... approach, first validated in our in vitro HIV-1 reverse transcription system. Annealing of the antisense oligonucleotides to the pre-primer binding site (the upstream region contiguous to the HIV-2 primer binding site) was determined in the presence of native tRNALys3 or synthetic primers. Using natural...

  19. Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

    Science.gov (United States)

    Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

    2018-01-01

    Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

  20. Improved Efficiency and Robustness in qPCR and Multiplex End-Point PCR by Twisted Intercalating Nucleic Acid Modified Primers

    Science.gov (United States)

    Schneider, Uffe Vest; Mikkelsen, Nikolaj Dam; Lindqvist, Anja; Okkels, Limei Meng; Jøhnk, Nina; Lisby, Gorm

    2012-01-01

    We introduce quantitative polymerase chain reaction (qPCR) primers and multiplex end-point PCR primers modified by the addition of a single ortho-Twisted Intercalating Nucleic Acid (o-TINA) molecule at the 5′-end. In qPCR, the 5′-o-TINA modified primers allow for a qPCR efficiency of 100% at significantly stressed reaction conditions, increasing the robustness of qPCR assays compared to unmodified primers. In samples spiked with genomic DNA, 5′-o-TINA modified primers improve the robustness by increased sensitivity and specificity compared to unmodified DNA primers. In unspiked samples, replacement of unmodified DNA primers with 5′-o-TINA modified primers permits an increased qPCR stringency. Compared to unmodified DNA primers, this allows for a qPCR efficiency of 100% at lowered primer concentrations and at increased annealing temperatures with unaltered cross-reactivity for primers with single nucleobase mismatches. In a previously published octaplex end-point PCR targeting diarrheagenic Escherichia coli, application of 5′-o-TINA modified primers allows for a further reduction (>45% or approximately one hour) in overall PCR program length, while sustaining the amplification and analytical sensitivity for all targets in crude bacterial lysates. For all crude bacterial lysates, 5′-o-TINA modified primers permit a substantial increase in PCR stringency in terms of lower primer concentrations and higher annealing temperatures for all eight targets. Additionally, crude bacterial lysates spiked with human genomic DNA show lesser formation of non-target amplicons implying increased robustness. Thus, 5′-o-TINA modified primers are advantageous in PCR assays, where one or more primer pairs are required to perform at stressed reaction conditions. PMID:22701644

  1. Improved efficiency and robustness in qPCR and multiplex end-point PCR by twisted intercalating nucleic acid modified primers.

    Directory of Open Access Journals (Sweden)

    Uffe Vest Schneider

    Full Text Available We introduce quantitative polymerase chain reaction (qPCR primers and multiplex end-point PCR primers modified by the addition of a single ortho-Twisted Intercalating Nucleic Acid (o-TINA molecule at the 5'-end. In qPCR, the 5'-o-TINA modified primers allow for a qPCR efficiency of 100% at significantly stressed reaction conditions, increasing the robustness of qPCR assays compared to unmodified primers. In samples spiked with genomic DNA, 5'-o-TINA modified primers improve the robustness by increased sensitivity and specificity compared to unmodified DNA primers. In unspiked samples, replacement of unmodified DNA primers with 5'-o-TINA modified primers permits an increased qPCR stringency. Compared to unmodified DNA primers, this allows for a qPCR efficiency of 100% at lowered primer concentrations and at increased annealing temperatures with unaltered cross-reactivity for primers with single nucleobase mismatches. In a previously published octaplex end-point PCR targeting diarrheagenic Escherichia coli, application of 5'-o-TINA modified primers allows for a further reduction (>45% or approximately one hour in overall PCR program length, while sustaining the amplification and analytical sensitivity for all targets in crude bacterial lysates. For all crude bacterial lysates, 5'-o-TINA modified primers permit a substantial increase in PCR stringency in terms of lower primer concentrations and higher annealing temperatures for all eight targets. Additionally, crude bacterial lysates spiked with human genomic DNA show lesser formation of non-target amplicons implying increased robustness. Thus, 5'-o-TINA modified primers are advantageous in PCR assays, where one or more primer pairs are required to perform at stressed reaction conditions.

  2. Mitochondrial DNA.

    Science.gov (United States)

    Wright, Russell G.; Bottino, Paul J.

    1986-01-01

    Provides background information for teachers on mitochondrial DNA, pointing out that it may have once been a free-living organism. Includes a ready-to-duplicate exercise titled "Using Microchondrial DNA to Measure Evolutionary Distance." (JN)

  3. Mechanisms of DNA binding and regulation of Bacillus anthracis DNA primase.

    Science.gov (United States)

    Biswas, Subhasis B; Wydra, Eric; Biswas, Esther E

    2009-08-11

    DNA primases are pivotal enzymes in chromosomal DNA replication in all organisms. In this article, we report unique mechanistic characteristics of recombinant DNA primase from Bacillus anthracis. The mechanism of action of B. anthracis DNA primase (DnaG(BA)) may be described in several distinct steps as follows. Its mechanism of action is initiated when it binds to single-stranded DNA (ssDNA) in the form of a trimer. Although DnaG(BA) binds to different DNA sequences with moderate affinity (as expected of a mobile DNA binding protein), we found that DnaG(BA) bound to the origin of bacteriophage G4 (G4ori) with approximately 8-fold higher affinity. DnaG(BA) was strongly stimulated (>or=75-fold) by its cognate helicase, DnaB(BA), during RNA primer synthesis. With the G4ori ssDNA template, DnaG(BA) formed short (primers in the absence of DnaB(BA). The presence of DnaB(BA) increased the rate of primer synthesis. The observed stimulation of primer synthesis by cognate DnaB(BA) is thus indicative of a positive effector role for DnaB(BA). By contrast, Escherichia coli DnaB helicase (DnaB(EC)) did not stimulate DnaG(BA) and inhibited primer synthesis to near completion. This observed effect of E. coli DnaB(EC) is indicative of a strong negative effector role for heterologous DnaB(EC). We conclude that DnaG(BA) is capable of interacting with DnaB proteins from both B. anthracis and E. coli; however, between DnaB proteins derived from these two organisms, only the homologous DNA helicase (DnaB(BA)) acted as a positive effector of primer synthesis.

  4. Target-cell-derived tRNA-like primers for reverse transcription support retroviral infection at low efficiency

    DEFF Research Database (Denmark)

    Schmitz, Alexander; Lund, Anders H; Hansen, Anette C

    2002-01-01

    Reverse transcription of a retroviral genome takes place in the cytoplasm of an infected cell by a process primed by a producer-cell-derived tRNA annealed to an 18-nucleotide primer-binding site (PBS). By an assay involving primer complementation of PBS-mutated vectors we analyzed whether tRNA...... primers derived from the target cell can sustain reverse transcription during murine leukemia virus (MLV) infection. Transduction efficiencies were 4-5 orders of magnitude below those of comparable producer-cell complementations. However, successful usage of a target-cell-derived tRNA primer was proven...... by cases of correction of single mismatches between Akv-MLV vectors and complementary tRNA primers toward the primer sequence in the integrated vector. Thus, target-cell-derived tRNA-like primers are able to initiate first-strand cDNA synthesis and plus-strand transfer leading to a complete provirus...

  5. Strikingly different penetrance of LHON in two Chinese families with primary mutation G11778A is independent of mtDNA haplogroup background and secondary mutation G13708A

    International Nuclear Information System (INIS)

    Wang Huawei; Jia Xiaoyun; Ji Yanli; Kong Qingpeng; Zhang Qingjiong; Yao Yonggang; Zhang Yaping

    2008-01-01

    The penetrance of Leber's hereditary optic neuropathy (LHON) in families with primary mitochondrial DNA (mtDNA) mutations is very complex. Matrilineal and nuclear genetic background, as well as environmental factors, have been reported to be involved in different affected pedigrees. Here we describe two large Chinese families that show a striking difference in the penetrance of LHON, in which 53.3% and 15.0% of members were affected (P < 0.02), respectively. Analysis of the complete mtDNA genome of the two families revealed the presence of the primary mutation G11778A and several other variants suggesting the same haplogroup status G2a. The family with higher penetrance contained a previously described secondary mutation G13708A, which presents a polymorphism in normal Chinese samples and does not affect in vivo mitochondrial oxidative metabolism as described in a previous study. Evolutionary analysis failed to indicate any putatively pathogenic mutation that cosegregated with G11778A in these two pedigrees. Our results suggest that the variable penetrance of LHON in the two Chinese families is independent of both their mtDNA haplotype background and a secondary mutation G13708A. As a result, it is likely that unknown nuclear gene involvement and/or other factors contribute to the strikingly different penetrance of LHON

  6. Freshwater Wetlands: A Citizen's Primer.

    Science.gov (United States)

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

  7. A Hearing Aid Primer 1

    Science.gov (United States)

    Yetter, Carol J.

    2009-01-01

    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  8. Background Material

    DEFF Research Database (Denmark)

    Zandersen, Marianne; Hyytiäinen, Kari; Saraiva, Sofia

    This document serves as a background material to the BONUS Pilot Scenario Workshop, which aims to develop harmonised regional storylines of socio-ecological futures in the Baltic Sea region in a collaborative effort together with other BONUS projects and stakeholders.......This document serves as a background material to the BONUS Pilot Scenario Workshop, which aims to develop harmonised regional storylines of socio-ecological futures in the Baltic Sea region in a collaborative effort together with other BONUS projects and stakeholders....

  9. Primer on molecular genetics. DOE Human Genome Program

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  10. Analytical comparison of nine PCR primer sets designed to detect the presence of Escherichia coli/Shigella in water samples.

    Science.gov (United States)

    Maheux, Andrée F; Picard, François J; Boissinot, Maurice; Bissonnette, Luc; Paradis, Sonia; Bergeron, Michel G

    2009-07-01

    The analytical performance of 9 different PCR primer sets designed to detect Escherichia coli and Shigella in water has been evaluated in terms of ubiquity, specificity, and analytical detection limit. Of the 9 PCR primer sets tested, only 3 of the 5 primer sets targeting uidA gene and the primer set targeting tuf gene amplified DNA from all E. coli strains tested. However, of those 4 primer sets, only the primer set targeting the tuf gene also amplified DNA from all Shigella strains tested. For the specificity, only the primer sets targeting the uidA gene were 100% specific although the primer sets targeting 16S rRNA, phoE, and tuf genes only amplified Escherichia fergusonii as non-specific target. Finally, the primer set targeting the 16S-ITS-23S gene region, was not specific as it amplified DNA from many other Enterobacteriaceae species. In summary, only the assay targeting the tuf gene detected all E. coli/Shigella strains tested in this study. However, if it becomes important to discriminate between E. coli and E. fergusonii, assays targeting the uidA gene would represent a good choice although none of them were totally ubiquitous to detect of the presence of Shigella strains.

  11. Asymmetric PCR for good quality ssDNA generation towards DNA aptamer production

    Directory of Open Access Journals (Sweden)

    Junji Tominaga4

    2012-04-01

    Full Text Available Aptamers are ssDNA or RNA that binds to wide variety of target molecules with high affinity and specificity producedby systematic evolution of ligands by exponential enrichment (SELEX. Compared to RNA aptamer, DNA aptamer is muchmore stable, favourable to be used in many applications. The most critical step in DNA SELEX experiment is the conversion ofdsDNA to ssDNA. The purpose of this study was to develop an economic and efficient approach of generating ssDNA byusing asymmetric PCR. Our results showed that primer ratio (sense primer:antisense primer of 20:1 and sense primer amountof 10 to 100 pmol, up to 20 PCR cycles using 20 ng of initial template, in combination with polyacrylamide gel electrophoresis,were the optimal conditions for generating good quality and quantity of ssDNA. The generation of ssDNA via this approachcan greatly enhance the success rate of DNA aptamer generation.

  12. 1,3-Butadiene-Induced Adenine DNA Adducts Are Genotoxic but Only Weakly Mutagenic When Replicated in Escherichia coli of Various Repair and Replication Backgrounds.

    Science.gov (United States)

    Chang, Shiou-Chi; Seneviratne, Uthpala I; Wu, Jie; Tretyakova, Natalia; Essigmann, John M

    2017-05-15

    The adverse effects of the human carcinogen 1,3-butadiene (BD) are believed to be mediated by its DNA-reactive metabolites such as 3,4-epoxybut-1-ene (EB) and 1,2,3,4-diepoxybutane (DEB). The specific DNA adducts responsible for toxic and mutagenic effects of BD, however, have yet to be identified. Recent in vitro polymerase bypass studies of BD-induced adenine (BD-dA) adducts show that DEB-induced N 6 ,N 6 -DHB-dA (DHB = 2,3-dihydroxybutan-1,4-diyl) and 1,N 6 -γ-HMHP-dA (HMHP = 2-hydroxy-3-hydroxymethylpropan-1,3-diyl) adducts block replicative DNA polymerases but are bypassed by human polymerases η and κ, leading to point mutations and deletions. In contrast, EB-induced N 6 -HB-dA (HB = 2-hydroxy-3-buten-1-yl) does not block DNA synthesis and is nonmutagenic. In the present study, we employed a newly established in vivo lesion-induced mutagenesis/genotoxicity assay via next-generation sequencing to evaluate the in vivo biological consequences of S-N 6 -HB-dA, R,R-N 6 ,N 6 -DHB-dA, S,S-N 6 ,N 6 -DHB-dA, and R,S-1,N 6 -γ-HMHP-dA. In addition, the effects of AlkB-mediated direct reversal repair, MutM and MutY catalyzed base excision repair, and DinB translesion synthesis on the BD-dA adducts in bacterial cells were investigated. BD-dA adducts showed the expected inhibition of DNA replication in vivo but were not substantively mutagenic in any of the genetic environments investigated. This result is in contrast with previous in vitro observations and opens the possibility that E. coli repair and bypass systems other than the ones studied here are able to minimize the mutagenic properties of BD-dA adducts.

  13. ex vivo DNA assembly

    Directory of Open Access Journals (Sweden)

    Adam B Fisher

    2013-10-01

    Full Text Available Even with decreasing DNA synthesis costs there remains a need for inexpensive, rapid and reliable methods for assembling synthetic DNA into larger constructs or combinatorial libraries. Advances in cloning techniques have resulted in powerful in vitro and in vivo assembly of DNA. However, monetary and time costs have limited these approaches. Here, we report an ex vivo DNA assembly method that uses cellular lysates derived from a commonly used laboratory strain of Escherichia coli for joining double-stranded DNA with short end homologies embedded within inexpensive primers. This method concurrently shortens the time and decreases costs associated with current DNA assembly methods.

  14. Background radiation

    International Nuclear Information System (INIS)

    Arnott, D.

    1985-01-01

    The effects of background radiation, whether natural or caused by man's activities, are discussed. The known biological effects of radiation in causing cancers or genetic mutations are explained. The statement that there is a threshold below which there is no risk is examined critically. (U.K.)

  15. Rapid Detection of Pseudomonas Aeruginosa by PCR Method Using Specific Primers of Quorum Sensing LasI gene

    Directory of Open Access Journals (Sweden)

    H Aghamollaei

    2013-12-01

    Full Text Available Abstract Background & aim: Pseudomonas aeruginosa is an opportunistic nosocomial pathogen that due to having intrinsic and acquired resistance to common antibiotics, mortality due to infections is very common. Therefore, early and accurate identification of bacteria could be effective in controlling infections and deaths. The aim of this study was to evaluate the use of a rapid method with high sensitivity and specificity based on polymerase chain reaction using gene-specific primers quorum sensing LasI system for detection of bacteria. Methods: In this study, the comparison between the results of culture and PCR for the diagnosis of Pseudomonas aeruginosa in clinical samples and other bacterial species were carried out. 40 strains of Pseudomonas aeruginosa from isolated clinical specimens were identified and confirmed by biochemical tests. LasI gene specific primers were designed using bioinformatics analysis. Sequence of this gene was amplified techniques after extraction of bacterial genome. The specificity of PCR tests with DNA from of different species, Staphylococcus aureus, Klebsiella pneumonia, Escherichia coli and Vibrio cholerae were evaluated. A different dilution of the bacterial genome of Pseudomonas aeruginosa was used in PCR to evaluate the sensitivity of primer. Data were analyzed by t-test Results: The results indicated that the PCR test result was positive for all strains of P. aeruginosa isolates however, PCR test results were negative for the four other bacteria. Even at 10-5 Pseudomonas aeruginosa genome concentration, PCR test was positive for all isolated strains Conclusion: This study showed that the primers designed for detection of Pseudomonas aeruginosa using PCR, had higher sensitivity and specificity compared to previous methods. Keywords: Pseudomonas aeruginosa, PCR, Quorum sensing, LasI

  16. Improved coverage of cDNA-AFLP by sequential digestion of immobilized cDNA

    Directory of Open Access Journals (Sweden)

    Karlovsky Petr

    2008-10-01

    Full Text Available Abstract Background cDNA-AFLP is a transcriptomics technique which does not require prior sequence information and can therefore be used as a gene discovery tool. The method is based on selective amplification of cDNA fragments generated by restriction endonucleases, electrophoretic separation of the products and comparison of the band patterns between treated samples and controls. Unequal distribution of restriction sites used to generate cDNA fragments negatively affects the performance of cDNA-AFLP. Some transcripts are represented by more than one fragment while other escape detection, causing redundancy and reducing the coverage of the analysis, respectively. Results With the goal of improving the coverage of cDNA-AFLP without increasing its redundancy, we designed a modified cDNA-AFLP protocol. Immobilized cDNA is sequentially digested with several restriction endonucleases and the released DNA fragments are collected in mutually exclusive pools. To investigate the performance of the protocol, software tool MECS (Multiple Enzyme cDNA-AFLP Simulation was written in Perl. cDNA-AFLP protocols described in the literatur and the new sequential digestion protocol were simulated on sets of cDNA sequences from mouse, human and Arabidopsis thaliana. The redundancy and coverage, the total number of PCR reactions, and the average fragment length were calculated for each protocol and cDNA set. Conclusion Simulation revealed that sequential digestion of immobilized cDNA followed by the partitioning of released fragments into mutually exclusive pools outperformed other cDNA-AFLP protocols in terms of coverage, redundancy, fragment length, and the total number of PCRs. Primers generating 30 to 70 amplicons per PCR provided the highest fraction of electrophoretically distinguishable fragments suitable for normalization. For A. thaliana, human and mice transcriptome, the use of two marking enzymes and three sequentially applied releasing enzymes for each

  17. Specific in situ hepatitis B viral double mutation (HBVDM) detection in urine with 60 copies ml(-1) analytical sensitivity in a background of 250-fold wild type without DNA isolation and amplification.

    Science.gov (United States)

    Kirimli, Ceyhun E; Shih, Wei-Heng; Shih, Wan Y

    2015-03-07

    We have examined in situ detection of hepatitis B virus 1762T/1764A double mutation (HBVDM) in urine using a (Pb(Mg(1/3)Nb(2/3))O3)(0.65)(PbTiO3)(0.35) (PMN-PT) piezoelectric plate sensor (PEPS) coated with a 16-nucleotide (nt) probe DNA (pDNA) complementary to the HBVDM. The in situ mutation (MT) detection was carried out in a flow with the PEPS vertically situated at the center of the flow in a background of wild type (WT). For validation, this detection was followed by detection in the mixture of MT fluorescent reporter microspheres (FRMs) (MT FRMs) and WT FRMs that emitted different fluorescence colours and were designed to specifically bind to MT and WT, respectively. At 30 °C and 4 ml min(-1), a PEPS was shown to specifically detect HBVDM in situ with 60 copies ml(-1) analytical sensitivity in a background of clinically-relevant 250-fold more WT in 30 min without DNA isolation, amplification, or labelling as validated by the visualization of the captured MT FRMs and WT FRMs following FRM detection where the captured MT FRMs outnumbered the WT FRMs by a factor of 5 to 1.

  18. Construction of Specific Primers for Rapid Detection of South African Exportable Vegetable Macergens

    Directory of Open Access Journals (Sweden)

    Bukola Rhoda Aremu

    2015-09-01

    Full Text Available Macergens are bacteria causing great damages to the parenchymatous tissues of vegetable both on the field and in transit. To effectively and rapidly investigate the diversity and distribution of these macergens, four specific primers were designed by retrieving 16S rDNA sequences of pectolytic bacteria from GenBank through the National Center for Biotechnology Information (NCBI. These were aligned using ClusterW via BioEdit and primers were designed using Primer3Plus platform. The size and primer location of each species and PCR product size were accurately defined. For specificity enhancement, DNA template of known macergens (Pectobacterium chrysanthermi and fresh healthy vegetable were used. These primers yielded expected size of approximately 1100 bp product only when tested with known macergens and no amplicon with fresh healthy vegetable was detected. Rapid detection of macergens in rotten vegetable samples was then carried out using these primers. Nucleotide sequences of macergens identified were deposited into the GenBank and were assigned accession numbers. Hence, with these specific primers, macergens can be identified with minimal quantities of the vegetable tissues using molecular techniques, for future use of the quarantine section of the Agricultural Department of the country for quick and rapid detection of macergens before exportation.

  19. El Primer Ferrocarril En Colombia

    Directory of Open Access Journals (Sweden)

    Gabriel Poveda

    2002-01-01

    Full Text Available Se presenta la historia de los preparativos, la construcción y el funcionamiento del primer ferrocarril que existió en el territorio de la actual Colombia (sin incluir a Panamá que unió a Barranquilla con el mar Caribe. Se muestra la importancia tecnológica y económica que esta obra tuvo para el país mientras existió (de 1869 a 1941

  20. Molecular discrimination of Perna (Mollusca: Bivalvia) species using the polymerase chain reaction and species-specific mitochondrial primers

    DEFF Research Database (Denmark)

    Blair, D.; Waycott, M.; Byrne, L.

    2006-01-01

    This work was prompted by the need to be able to identify the invasive mussel species, Perna viridis, in tropical Australian seas using techniques that do not rely solely on morphology. DNA-based molecular methods utilizing a polymerase chain reaction (PCR) approach were developed to distinguish...... designed that can act as a forward primer in PCRs for any Perna species. Four reverse primers have also been designed, based on nad4 and intergenic spacer sequences, which yield species-specific products of different lengths when paired with the conserved forward primer. A further pair of primers has been...

  1. An integrated web medicinal materials DNA database: MMDBD (Medicinal Materials DNA Barcode Database

    Directory of Open Access Journals (Sweden)

    But Paul

    2010-06-01

    Full Text Available Abstract Background Thousands of plants and animals possess pharmacological properties and there is an increased interest in using these materials for therapy and health maintenance. Efficacies of the application is critically dependent on the use of genuine materials. For time to time, life-threatening poisoning is found because toxic adulterant or substitute is administered. DNA barcoding provides a definitive means of authentication and for conducting molecular systematics studies. Owing to the reduced cost in DNA authentication, the volume of the DNA barcodes produced for medicinal materials is on the rise and necessitates the development of an integrated DNA database. Description We have developed an integrated DNA barcode multimedia information platform- Medicinal Materials DNA Barcode Database (MMDBD for data retrieval and similarity search. MMDBD contains over 1000 species of medicinal materials listed in the Chinese Pharmacopoeia and American Herbal Pharmacopoeia. MMDBD also contains useful information of the medicinal material, including resources, adulterant information, medical parts, photographs, primers used for obtaining the barcodes and key references. MMDBD can be accessed at http://www.cuhk.edu.hk/icm/mmdbd.htm. Conclusions This work provides a centralized medicinal materials DNA barcode database and bioinformatics tools for data storage, analysis and exchange for promoting the identification of medicinal materials. MMDBD has the largest collection of DNA barcodes of medicinal materials and is a useful resource for researchers in conservation, systematic study, forensic and herbal industry.

  2. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    Directory of Open Access Journals (Sweden)

    Dunn Sade N

    2008-06-01

    Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

  3. Primers with 5' flaps improve the efficiency and sensitivity of multiplex PCR assays for the detection of Salmonella and Escherichia coli O157:H7.

    Science.gov (United States)

    Timmons, Chris; Dobhal, Shefali; Fletcher, Jacqueline; Ma, Li Maria

    2013-04-01

    Foodborne illnesses caused by Salmonella enterica and Escherichia coli O157:H7 are worldwide health concerns. Rapid, sensitive, and robust detection of these pathogens in foods and in clinical and environmental samples is essential for routine food quality testing, effective surveillance, and outbreak investigations. The aim of this study was to evaluate the effect on PCR sensitivity of adding a short, AT-rich overhanging nucleotide sequence (flap) to the 5' end of PCR primers specific for the detection of Salmonella and E. coli O157:H7. Primers targeting the invA gene of Salmonella and the rfbE gene of E. coli O157:H7 were synthesized with or without a 12-bp, AT-rich 5' flap (5'-AATAAATCATAA-3'). Singleplex PCR, multiplex PCR, and real-time PCR sensitivity assays were conducted using purified bacterial genomic DNA and crude cell lysates of bacterial cells. The effect of background flora on detection was evaluated by spiking tomato and jalapeno pepper surface washes with E. coli O157:H7 and Salmonella Saintpaul. When targeting individual pathogens, end-point PCR assays using flap-amended primers were more efficient than nonamended primers, with 20.4 and 23.5% increases in amplicon yield for Salmonella and E. coli O157:H7, respectively. In multiplex PCR assays, a 10- to 100-fold increase in detection sensitivity was observed when the primer flap sequence was incorporated. This improvement in both singleplex and multiplex PCR efficiency and sensitivity can lead to improved Salmonella and E. coli O157:H7 detection.

  4. Blocking human contaminant DNA during PCR allows amplification of rare mammal species from sedimentary ancient DNA

    DEFF Research Database (Denmark)

    Boessenkool, Sanne; Epp, Laura S.; Haile, James Seymour

    2012-01-01

    , or bias, during the PCR. In this study, we test the utility of human-specific blocking primers in mammal diversity analyses of ancient permafrost samples from Siberia. Using quantitative PCR (qPCR) on human and mammoth DNA, we first optimized the design and concentration of blocking primer in the PCR......Analyses of degraded DNA are typically hampered by contamination, especially when employing universal primers such as commonly used in environmental DNA studies. In addition to false-positive results, the amplification of contaminant DNA may cause false-negative results because of competition....... Subsequently, 454 pyrosequencing of ancient permafrost samples amplified with and without the addition of blocking primer revealed that DNA sequences from a diversity of mammalian representatives of the Beringian megafauna were retrieved only when the blocking primer was added to the PCR. Notably, we observe...

  5. Cell-free cloning using multiply-primed rolling circle amplification with modified RNA primers.

    Science.gov (United States)

    Takahashi, Hirokazu; Yamamoto, Kimiko; Ohtani, Toshio; Sugiyama, Shigeru

    2009-07-01

    The predominant method for DNA cloning is by propagation in biological hosts, but this method has limitations because certain sequences are difficult to clone using any combination of available hosts or vectors. Recently, multiply-primed rolling circle amplification (MPRCA) has been applied to overcome the problems of the DNA cloning via host cells. However, when MPRCA is used to amplify from minute quantities of DNA template, the products are mostly by-product DNA molecules generated by false priming and primer dimer formation. This study demonstrates that MPRCA using random RNA primers[#x02014]instead of DNA primers[#x02014]blocked the synthesis of by-products and succeeded in amplifying one copy of a circular DNA molecule more than 1012-fold to give microgram quantities of amplification product without using submicroliter reaction volumes. Furthermore, a ligation strategy was elaborated to circularize only the desired DNA sequence and eliminate undesired ligation-products. A combination of these methods was able to amplify and ligate a large construct without undesired DNA sequences and at microgram quantities within one day. Therefore, these methods have the possibility to improve DNA cloning techniques that have been restricted by the limitations of PCR methods or by the host cell.

  6. Design and Evaluation of PCR Primers for Analysis of Bacterial Populations in Wine by Denaturing Gradient Gel Electrophoresis

    Science.gov (United States)

    Lopez, Isabel; Ruiz-Larrea, Fernanda; Cocolin, Luca; Orr, Erica; Phister, Trevor; Marshall, Megan; VanderGheynst, Jean; Mills, David A.

    2003-01-01

    Denaturing gradient gel electrophoresis (DGGE) of PCR-amplified ribosomal DNA (rDNA) is routinely used to compare levels of diversity of microbial communities and to monitor population dynamics. While using PCR-DGGE to examine the bacteria in wine fermentations, we noted that several commonly used PCR primers for amplifying bacterial 16S rDNA also coamplified yeast, fungal, or plant DNA present in samples. Unfortunately, amplification of nonbacterial DNA can result in a masking of bacterial populations in DGGE profiles. To surmount this problem, we developed two new primer sets for specific amplification of bacterial 16S rDNA in wine fermentation samples without amplification of eukaryotic DNA. One primer set, termed WLAB1 and WLAB2, amplified lactic acid bacteria, while another, termed WBAC1 and WBAC2, amplified both lactic acid bacterial and acetic acid bacterial populations found in wine. Primer specificity and efficacy were examined with DNA isolated from numerous bacterial, yeast, and fungal species commonly found in wine and must samples. Importantly, both primer sets effectively distinguished bacterial species in wine containing mixtures of yeast and bacteria. PMID:14602643

  7. A fresh method of DNA transformation to the seeds irradiated by Co ...

    African Journals Online (AJOL)

    Jane

    2011-06-29

    Jun 29, 2011 ... Figure 1. Origin of the linear DNA transformed into seeds. The linear DNA were from the PCR amplification products, in which the templates were the cricoid plasmids, and the primers were the up- stream primer P1 (its sequence: 5'-GTT GGC GGT AAC AAG AAA GGG AT-3') and down-stream primer P2 (its ...

  8. Small Commercial Building Re-tuning: A Primer

    Energy Technology Data Exchange (ETDEWEB)

    Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas

    2013-09-30

    To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.

  9. DNA Sequencing apparatus

    Science.gov (United States)

    Tabor, Stanley; Richardson, Charles C.

    1992-01-01

    An automated DNA sequencing apparatus having a reactor for providing at least two series of DNA products formed from a single primer and a DNA strand, each DNA product of a series differing in molecular weight and having a chain terminating agent at one end; separating means for separating the DNA products to form a series bands, the intensity of substantially all nearby bands in a different series being different, band reading means for determining the position an This invention was made with government support including a grant from the U.S. Public Health Service, contract number AI-06045. The U.S. government has certain rights in the invention.

  10. A primer of special relativity

    CERN Document Server

    Sardesai, PL

    2004-01-01

    A Primer of Special Relativity1 is an unusually lucid introduction to the subject specifically written for Indian students. It is intended to give the beginner a firm grounding for a more advanced course in relativity. An entire chapter is devoted to applications of the theory to elucidate a large number of topics the students (B.Sc. Physics) come across in Modern Physics. Detailed and well-selected examples are used to illuminate aspects of the theory as well as to show techniques of application. A large number of Illustrative Examples enables the students to gain confidence to solve any problem in relativity normally expected of B.Sc. students.

  11. A primer of multivariate statistics

    CERN Document Server

    Harris, Richard J

    2014-01-01

    Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

  12. A primer of Lebesgue integration

    CERN Document Server

    Bear, H S

    2001-01-01

    The Lebesgue integral is now standard for both applications and advanced mathematics. This books starts with a review of the familiar calculus integral and then constructs the Lebesgue integral from the ground up using the same ideas. A Primer of Lebesgue Integration has been used successfully both in the classroom and for individual study.Bear presents a clear and simple introduction for those intent on further study in higher mathematics. Additionally, this book serves as a refresher providing new insight for those in the field. The author writes with an engaging, commonsense style that appeals to readers at all levels.

  13. Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

    Directory of Open Access Journals (Sweden)

    Li Kelvin

    2012-11-01

    Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

  14. CODEHOP PCR and CODEHOP PCR primer design.

    Science.gov (United States)

    Staheli, Jeannette P; Boyce, Richard; Kovarik, Dina; Rose, Timothy M

    2011-01-01

    While PCR primer design for the amplification of known sequences is usually quite straightforward, the design, and successful application of primers aimed at the detection of as yet unknown genes is often not. The search for genes that are presumed to be distantly related to a known gene sequence, such as homologous genes in different species, paralogs in the same genome, or novel pathogens in diverse hosts, often turns into the proverbial search for the needle in the haystack. PCR-based methods commonly used to address this issue involve the use of either consensus primers or degenerate primers, both of which have significant shortcomings regarding sensitivity and specificity. We have developed a novel primer design approach that diminishes these shortcomings and instead takes advantage of the strengths of both consensus and degenerate primer designs, by combining the two concepts into a Consensus-Degenerate Hybrid Oligonucleotide Primer (CODEHOP) approach. CODEHOP PCR primers contain a relatively short degenerate 3' core and a 5' nondegenerate clamp. The 3' degenerate core consists of a pool of primers containing all possible codons for a 3-4 aminoacid motif that is highly conserved in multiply aligned sequences from known members of a protein family. Each primer in the pool also contains a single 5' nondegenerate nucleotide sequence derived from a codon consensus across the aligned aminoacid sequences flanking the conserved motif. During the initial PCR amplification cycles, the degenerate core is responsible for specific binding to sequences encoding the conserved aminoacid motif. The longer consensus clamp region serves to stabilize the primer and allows the participation of all primers in the pool in the efficient amplification of products during later PCR cycles. We have developed an interactive web site and algorithm (iCODEHOP) for designing CODEHOP PCR primers from multiply aligned protein sequences, which is freely available online. Here, we describe the

  15. Comparing the Accuracy Rate of Two Different Universal Primers in Enteric Pathogen Diagnosis From Blood

    Directory of Open Access Journals (Sweden)

    Esmaeil Soleimani

    2014-02-01

    Full Text Available Background: Detecting enteric bacteria in blood by culture is a slow assay with low accuracy rate. PCR might be a suitable alternative assay but as several species can cause bacteremia, it is necessary to use universal primers. Objectives: In this study we evaluated and compared two pairs of universal primers in detecting four enteric bacteria in blood, which are common causes of bacteremia in human. Materials and Methods: Standard strains of E. faecalis, S. typhi, E. coli, and S. Aeruginosa, were used in this study. A serially diluted bacterial suspension of all strains was made for inoculation to four sets of defibrinated sheep blood which were used to prepare blood specimens with different bacterial contents for performing routine assay and PCR. PCR was performed using two different universal primers designed from two ribosomal genes, 16sr RNA and 23sr RNA. Results: PCR with 16sr RNA universal primer showed more accuracy rate than both blood culture and PCR with 23sr RNA universal primer. Mean time for performing PCR assay and blood culture was eight and 48 hours, respectively. Conclusions: Both PCR with 16sr RNA and 23sr RNA universal primers have more accuracy rate than blood culture and are faster in detection of bacteremia. PCR with 16sr RNA universal primer is more accurate than both PCR with 16sr RNA universal primer and blood culture for diagnosis of bacteremia.

  16. Barcoding the kingdom Plantae: new PCR primers for ITS regions of plants with improved universality and specificity.

    Science.gov (United States)

    Cheng, Tao; Xu, Chao; Lei, Li; Li, Changhao; Zhang, Yu; Zhou, Shiliang

    2016-01-01

    The internal transcribed spacer (ITS) of nuclear ribosomal DNA is one of the most commonly used DNA markers in plant phylogenetic and DNA barcoding analyses, and it has been recommended as a core plant DNA barcode. Despite this popularity, the universality and specificity of PCR primers for the ITS region are not satisfactory, resulting in amplification and sequencing difficulties. By thoroughly surveying and analysing the 18S, 5.8S and 26S sequences of Plantae and Fungi from GenBank, we designed new universal and plant-specific PCR primers for amplifying the whole ITS region and a part of it (ITS1 or ITS2) of plants. In silico analyses of the new and the existing ITS primers based on these highly representative data sets indicated that (i) the newly designed universal primers are suitable for over 95% of plants in most groups; and (ii) the plant-specific primers are suitable for over 85% of plants in most groups without amplification of fungi. A total of 335 samples from 219 angiosperm families, 11 gymnosperm families, 24 fern and lycophyte families, 16 moss families and 17 fungus families were used to test the performances of these primers. In vitro PCR produced similar results to those from the in silico analyses. Our new primer pairs gave PCR improvements up to 30% compared with common-used ones. The new universal ITS primers will find wide application in both plant and fungal biology, and the new plant-specific ITS primers will, by eliminating PCR amplification of nonplant templates, significantly improve the quality of ITS sequence information collections in plant molecular systematics and DNA barcoding. © 2015 John Wiley & Sons Ltd.

  17. EGNAS: an exhaustive DNA sequence design algorithm

    Directory of Open Access Journals (Sweden)

    Kick Alfred

    2012-06-01

    Full Text Available Abstract Background The molecular recognition based on the complementary base pairing of deoxyribonucleic acid (DNA is the fundamental principle in the fields of genetics, DNA nanotechnology and DNA computing. We present an exhaustive DNA sequence design algorithm that allows to generate sets containing a maximum number of sequences with defined properties. EGNAS (Exhaustive Generation of Nucleic Acid Sequences offers the possibility of controlling both interstrand and intrastrand properties. The guanine-cytosine content can be adjusted. Sequences can be forced to start and end with guanine or cytosine. This option reduces the risk of “fraying” of DNA strands. It is possible to limit cross hybridizations of a defined length, and to adjust the uniqueness of sequences. Self-complementarity and hairpin structures of certain length can be avoided. Sequences and subsequences can optionally be forbidden. Furthermore, sequences can be designed to have minimum interactions with predefined strands and neighboring sequences. Results The algorithm is realized in a C++ program. TAG sequences can be generated and combined with primers for single-base extension reactions, which were described for multiplexed genotyping of single nucleotide polymorphisms. Thereby, possible foldback through intrastrand interaction of TAG-primer pairs can be limited. The design of sequences for specific attachment of molecular constructs to DNA origami is presented. Conclusions We developed a new software tool called EGNAS for the design of unique nucleic acid sequences. The presented exhaustive algorithm allows to generate greater sets of sequences than with previous software and equal constraints. EGNAS is freely available for noncommercial use at http://www.chm.tu-dresden.de/pc6/EGNAS.

  18. Using long ssDNA polynucleotides to amplify STRs loci in degraded DNA samples

    Science.gov (United States)

    Pérez Santángelo, Agustín; Corti Bielsa, Rodrigo M.; Sala, Andrea; Ginart, Santiago; Corach, Daniel

    2017-01-01

    Obtaining informative short tandem repeat (STR) profiles from degraded DNA samples is a challenging task usually undermined by locus or allele dropouts and peak-high imbalances observed in capillary electrophoresis (CE) electropherograms, especially for those markers with large amplicon sizes. We hereby show that the current STR assays may be greatly improved for the detection of genetic markers in degraded DNA samples by using long single stranded DNA polynucleotides (ssDNA polynucleotides) as surrogates for PCR primers. These long primers allow a closer annealing to the repeat sequences, thereby reducing the length of the template required for the amplification in fragmented DNA samples, while at the same time rendering amplicons of larger sizes suitable for multiplex assays. We also demonstrate that the annealing of long ssDNA polynucleotides does not need to be fully complementary in the 5’ region of the primers, thus allowing for the design of practically any long primer sequence for developing new multiplex assays. Furthermore, genotyping of intact DNA samples could also benefit from utilizing long primers since their close annealing to the target STR sequences may overcome wrong profiling generated by insertions/deletions present between the STR region and the annealing site of the primers. Additionally, long ssDNA polynucleotides might be utilized in multiplex PCR assays for other types of degraded or fragmented DNA, e.g. circulating, cell-free DNA (ccfDNA). PMID:29099837

  19. Non-destructive sampling of ancient insect DNA.

    Directory of Open Access Journals (Sweden)

    Philip Francis Thomsen

    Full Text Available BACKGROUND: A major challenge for ancient DNA (aDNA studies on insect remains is that sampling procedures involve at least partial destruction of the specimens. A recent extraction protocol reveals the possibility of obtaining DNA from past insect remains without causing visual morphological damage. We test the applicability of this protocol on historic museum beetle specimens dating back to AD 1820 and on ancient beetle chitin remains from permafrost (permanently frozen soil dating back more than 47,000 years. Finally, we test the possibility of obtaining ancient insect DNA directly from non-frozen sediments deposited 3280-1800 years ago -- an alternative approach that also does not involve destruction of valuable material. METHODOLOGY/PRINCIPAL FINDINGS: The success of the methodological approaches are tested by PCR and sequencing of COI and 16S mitochondrial DNA (mtDNA fragments of 77-204 base pairs (-bp in size using species-specific and general insect primers. CONCLUSION/SIGNIFICANCE: The applied non-destructive DNA extraction method shows promising potential on insect museum specimens of historical age as far back as AD 1820, but less so on the ancient permafrost-preserved insect fossil remains tested, where DNA was obtained from samples up to ca. 26,000 years old. The non-frozen sediment DNA approach appears to have great potential for recording the former presence of insect taxa not normally preserved as macrofossils and opens new frontiers in research on ancient biodiversity.

  20. UNIVERSAL PRIMERS FOR THE AMPLIFICATION AND SEQUENCE ANALYSIS OF ACTIN-1 FROM DIVERSE MOSQUITO SPECIES

    Science.gov (United States)

    STALEY, MOLLY; DORMAN, KARIN S.; BARTHOLOMAY, LYRIC C.; FERNÁNDEZ-SALAS, ILDEFONSO; FARFAN-ALE, JOSE A.; LOROÑO-PINO, MARIA A.; GARCIA-REJON, JULIAN E.; IBARRA-JUAREZ, LUIS

    2010-01-01

    We report the development of universal primers for the reverse-transcription polymerase chain reaction (RT-PCR) amplification and nucleotide sequence analysis of actin cDNAs from taxonomically diverse mosquito species. Primers specific to conserved regions of the invertebrate actin-1 gene were designed after actin cDNA sequences of Anopheles gambiae, Bombyx mori, Drosophila melanogaster, and Caenorhabditis elegans. The efficacy of these primers was determined by RT-PCR with the use of total RNA from mosquitoes belonging to 30 species and 8 genera (Aedes, Anopheles, Culex, Deinocerites, Mansonia, Psorophora, Toxorhynchites, and Wyeomyia). The RT-PCR products were sequenced, and sequence data were used to design additional primers. One primer pair, denoted as Act-2F (5′-ATGGTCGGYATGGGNCAGAAGGACTC-3′) and Act-8R (5′-GATTCCATACCCAGGAAG-GADGG-3′), successfully amplified an RT-PCR product of the expected size (683-nt) in all mosquito spp. tested. We propose that this primer pair can be used as an internal control to test the quality of RNA from mosquitoes collected in vector surveillance studies. These primers can also be used in molecular experiments in which the detection, amplification or silencing of a ubiquitously expressed mosquito housekeeping gene is necessary. Sequence and phylogenetic data are also presented in this report. PMID:20649132

  1. Application of nonsense-mediated primer exclusion (NOPE) for preparation of unique molecular barcoded libraries.

    Science.gov (United States)

    Shagin, Dmitriy A; Turchaninova, Maria A; Shagina, Irina A; Shugay, Mikhail; Zaretsky, Andrew R; Zueva, Olga I; Bolotin, Dmitriy A; Lukyanov, Sergey; Chudakov, Dmitriy M

    2017-06-05

    Recently we proposed efficient method to exclude undesirable primers at any stage of amplification reaction, here termed NOPE (NOnsense-mediated Primer Exclusion). According to this method, added oligonucleotide overlapping with the 3'-end of unwanted amplification primer (NOPE oligo) simultaneously provides a template for its elongation. This elongation disrupts specificity of unwanted primer, preventing its further participation in PCR. The suggested approach allows to rationally manage the course of PCR reactions in order to facilitate analysis of complex DNA mixtures as well as to perform multistage PCR bypassing intermediate purification steps. Here we apply NOPE method to DNA library preparation for the high-throughput sequencing (HTS) with the PCR-based introduction of unique molecular identifiers (UMI). We show that NOPE oligo efficiently neutralizes UMI-containing oligonucleotides after introduction of UMI into sample DNA molecules, thus allowing to proceed with further amplification steps without purification and associated loss of starting material. At the same time, NOPE oligo does not affect the efficiency of target PCR amplification. We describe a simple, robust and cheap modification of UMI-labeled HTS libraries preparation procedure, that allows to bypass purification step and thus to preserve starting material which may be limited, e.g. circulating tumor DNA, circulating fetal DNA, or small amounts of isolated cells of interest. Furthermore, demonstrated simplicity and robustness of NOPE method should make it popular in various PCR protocols.

  2. Relativistic Astrophysics and Cosmology: A Primer

    International Nuclear Information System (INIS)

    Abramowicz, Marek A

    2007-01-01

    'Relativistic Astrophysics and Cosmology: A Primer' by Peter Hoyng, was published last year by Springer. The book is based on lectures given by the author at University of Utrecht to advanced undergraduates. This is a short and scholarly book. In about 300 pages, the author has covered the most interesting and important applications of Albert Einstein's general relativity in present-day astrophysics and cosmology: black holes, neutron stars, gravitational waves, and the cosmic microwave background. The book stresses theory, but also discusses several experimental and observational topics, such as the Gravity Probe B mission, interferometer detectors of gravitational waves and the power spectrum of the cosmic microwave background. The coverage is not uniform. Some topics are discussed in depth, others are only briefly mentioned. The book obviously reflects the author's own research interests and his preferences for specific mathematical methods, and the choice of the original artwork that illustrates the book (and appears on its cover) is a very personal one. I consider this personal touch an advantage, even if I do not always agree with the author's choices. For example, I employ Killing vectors as a very useful mathematical tool not only in my research on black holes, but also in my classes. I find that my students prefer it when discussions of particle, photon and fluid motion in the Schwarzschild and Kerr spacetimes are based explicitly and directly on the Killing vectors rather than on coordinate calculations. The latter approach is, of course, the traditional one, and is used in Peter Hoyng's book. Reading the book is a stimulating experience, because the reader can almost feel the author's presence. The author's opinions, his mathematical taste, his research pleasures, and his pedagogical passion are apparent everywhere. Lecturers contemplating a new course on relativistic astrophysics could adopt Hoyng's book as the text. Their students will be in the author

  3. PCR and real-time PCR primers developed for detection and identification of Bifidobacterium thermophilum in faeces

    Science.gov (United States)

    Mathys, Sophie; Lacroix, Christophe; Mini, Raffaella; Meile, Leo

    2008-01-01

    Background Culture-independent methods based on the 16S ribosomal RNA molecule are nowadays widely used for assessment of the composition of the intestinal microbiota, in relation to host health or probiotic efficacy. Because Bifidobacterium thermophilum was only recently isolated from human faeces until now, no specific real-time PCR (qPCR) assay has been developed for detection of this species as component of the bifidobacterial community of the human intestinal flora. Results Design of specific primers and probe was achieved based on comparison of 108 published bifidobacterial 16S rDNA sequences with the recently published sequence of the human faecal isolate B. thermophilum RBL67. Specificity of the primer was tested in silico by similarity search against the sequence database and confirmed experimentally by PCR amplification on 17 Bifidobacterium strains, representing 12 different species, and two Lactobacillus strains. The qPCR assay developed was linear for B. thermophilum RBL67 DNA quantities ranging from 0.02 ng/μl to 200 ng/μl and showed a detection limit of 105 cells per gram faeces. The application of this new qPCR assay allowed to detect the presence of B. thermophilum in one sample from a 6-month old breast-fed baby among 17 human faecal samples tested. Additionally, the specific qPCR primers in combination with selective plating experiments led to the isolation of F9K9, a faecal isolate from a 4-month old breast-fed baby. The 16S rDNA sequence of this isolate is 99.93% similar to that of B. thermophilum RBL67 and confirmed the applicability of the new qPCR assay in faecal samples. Conclusion A new B. thermophilum-specific qPCR assay was developed based on species-specific target nucleotides in the 16S rDNA. It can be used to further characterize the composition of the bifidobacterial community in the human gastrointestinal tract. Until recently, B. thermophilum was considered as a species of animal origin, but here we confirm with the application

  4. Rapid identification of Zygosaccharomyces with genus-specific primers.

    Science.gov (United States)

    Hulin, Michelle; Wheals, Alan

    2014-03-03

    There has been a recent and rapid increase in the number of species of the genus Zygosaccharomyces which now comprises Z. bailii, Z. bisporus, Z. gambellarensis, Z. kombuchaensis, Z. lentus, Z. machadoi, Z. mellis, Z. parabaillii, Z. pseudobailii, Z. pseudorouxii, Z. rouxii, Z. sapae, and Z. siamensis. Z. pseudorouxii is an unofficial name given to isolates closely related to the newly-described species Z. sapae. The Zygosaccharomyces genus contains species that are important as food and beverage spoilage organisms and others are associated with fermentations and sweet foodstuffs, such as honey. Their economic significance means that the ability to identify them rapidly is of significant importance. Although Z. rouxii and Z. bailii have been genome-sequenced the extent of sequence data for the others, especially the newly-discovered species, is sometimes extremely limited which makes identification slow. However, parts of the ITS1/5.8S/ITS2 rDNA region contain sequences of sufficient similarity within the genus and of sufficient difference with outgroups, to be potential regions for the design of genus-wide specific primers. We report here the development of genus-specific primers that can detect all the major Zygosaccharomyces species including all those associated with foods; the rare and localised species Z. machadoi and Z. gambellarensis are not detected. The size of the single amplicon produced varies between species and in some cases is sufficiently different to assign provisional species identification. Sequence data from rDNA regions are available for virtually all described yeast species in all genera, thus, prior to having sufficient sequence data from structural genes, rDNA regions may provide more generally suitable candidates for both genus-specific and species-specific primer design. Copyright © 2013 Elsevier B.V. All rights reserved.

  5. A primer on quantum fluids

    CERN Document Server

    Barenghi, Carlo

    2016-01-01

    The aim of this primer is to cover the essential theoretical information, quickly and concisely, in order to enable senior undergraduate and beginning graduate students to tackle projects in topical research areas of quantum fluids, for example, solitons, vortices and collective modes. The selection of the material, both regarding the content and level of presentation, draws on the authors analysis of the success of relevant research projects with newcomers to the field, as well as of the students feedback from many taught and self-study courses on the subject matter. Starting with a brief historical overview, this text covers particle statistics, weakly interacting condensates and their dynamics and finally superfluid helium and quantum turbulence. At the end of each chapter (apart from the first) there will be some exercises. Detailed solutions can be made available to instructors upon request to the authors. .

  6. A Primer on Observational Measurement.

    Science.gov (United States)

    Girard, Jeffrey M; Cohn, Jeffrey F

    2016-08-01

    Observational measurement plays an integral role in a variety of scientific endeavors within biology, psychology, sociology, education, medicine, and marketing. The current article provides an interdisciplinary primer on observational measurement; in particular, it highlights recent advances in observational methodology and the challenges that accompany such growth. First, we detail the various types of instrument that can be used to standardize measurements across observers. Second, we argue for the importance of validity in observational measurement and provide several approaches to validation based on contemporary validity theory. Third, we outline the challenges currently faced by observational researchers pertaining to measurement drift, observer reactivity, reliability analysis, and time/expense. Fourth, we describe recent advances in computer-assisted measurement, fully automated measurement, and statistical data analysis. Finally, we identify several key directions for future observational research to explore.

  7. A quest to find good primers for gene expression analysis of Candida albicans from clinical samples.

    Science.gov (United States)

    Alonso, Gabriela C; Pavarina, Ana C; Sousa, Tábata V; Klein, Marlise I

    2018-04-01

    Biofilm production contributes to several human diseases, including oral candidiasis. Among the Candida species, Candida albicans is the most prevalent. The expression of virulence genes is implicated in the pathogenic potential of Candida biofilms. However, the evaluation of microbial gene expression from in vivo biofilm samples is not trivial, specifically, assessment via quantitative PCR (qPCR) can be a challenge because of several species present in clinical samples. Hence, the necessity of primers specificity. The aim of this study was to evaluate through in silico and in vitro analyses the specificity of published primers and newly designed primers for C. albicans virulence genes: ALS1, CAP1, CAT1, EFG1, HWP1, LIP3, PLB1, SAP1, SAP4, SOD1, SOD5 and ACT1 (normalizing gene). In silico analysis was performed through a PubMed search of articles with primer sequences that evaluated gene expression of C. albicans. Then, the sequence similarity of twenty-eight primers was checked through BLASTn and ClustalW2. The analysis of secondary structures was performed using mfold. When the primers did not present satisfactory characteristics (absence of secondary structures, not discrepant Tm of forward and reverse sequences and specificity) following in vitro analysis (i.e., end point PCR), new primers were designed using Beacon Designer™ and sequences obtained from the "Candida Genome Database". The selected primers were tested in vitro by end point PCR using a panel of genomic DNA from five different Candida species (C. albicans, Candida glabrata, Candida dubliniensis, Candida krusei, and Candida tropicalis). The resulting PCR products were visualized on agarose gel. qPCR reactions were performed to determine primers' optimal concentration and PCR efficiency. End point PCR demonstrated that published primers for the SAP1 and HWP1 were specific for C. albicans and the one for SOD1 reacted with C. albicans and C. dubliniensis. The sequence of primers designed for ACT1

  8. Use of 65kDa mannoprotein gene primers in PCR methods for the identification of five medically important Candida species.

    Science.gov (United States)

    Arancia, S; Sandini, S; Cassone, A; De Bernardis, F

    2009-10-01

    We have developed PCR and Multiplex PCR assays for the detection of medically important Candida spp. using different species and genus-specific PCR primers selected within the MP65 gene, a recently cloned gene encoding a mannoprotein adhesin. The genus-specific PCR primers were able to amplify Candida species DNA (100% positivity) whereas DNA from all other isolates tested, belonging to other fungal genera, was not amplified. The species-specific PCR primers allowed differentiation of each of five Candida species by the amplicon length produced. No amplicons were detected using species- or genus-specific primers in several bacterial or human DNA templates. The methods described in this study are reproducible, simple and specific. The total time required for each PCR method was less than 4 h from the extraction to the visualized amplicons after PCR. In conclusion, we developed PCR methods to differentiate the five most medically important Candida species using primers directed to the MP65 gene.

  9. Table 1. Primers sequences information. Primer name Sequence ...

    Indian Academy of Sciences (India)

    Administrator

    Figure 5. Selected microsatellite markers indicated maternal mosaicism was not caused by DNA contamination. We did not find any of the proband's paternal microsatellite markers mixed with the mother's (A). The positive control was generated by mixing 10% proband's sample with 90% his mother's sample (B).

  10. Portable microsatellite primers for Ficus (Moraceae).

    Science.gov (United States)

    Garcia, Marjorie; Bain, Anthony; Tzeng, Hsy-Yu; Peng, Yan-Qiong; Chou, Lien-Siang; Kjellberg, Finn

    2012-05-01

    Highly portable microsatellite primers were developed for Ficus to facilitate investigation of genetic structure of complete regional floras using a single set of markers. Pyrosequencing of five species of Ficus produced a library of 5723 potential primers. Potential primers found in at least two species and presenting identical annealing temperatures were tested on a set of five additional Ficus species. A set of 20 primer pairs producing well-defined and easily readable peaks was retained and tests showed their potential utility for analyzing population genetic structure of 24 Ficus species from Taiwan. Numbers of alleles per locus ranged from one to six in the least variable species and from one to 17 in the most variable species. The results indicate that our set of primers can be used to analyze polymorphism and compare levels of polymorphism among Ficus species.

  11. A Phylogenetic Index for Cichlid Microsatellite Primers

    Directory of Open Access Journals (Sweden)

    Robert D. Kunkle

    2010-01-01

    Full Text Available Microsatellites abound in most organisms and have proven useful for a range of genetic and genomic studies. Once primers have been created, they can be applied to populations or taxa that have diverged from the source taxon. We use PCR amplification, in a 96-well format, to determine the presence and absence of 46 microsatellite loci in 13 cichlid species. At least one primer set amplified a product in each species tested, and some products were present in nearly all species. These results are compared to the known phylogenetic relationships among cichlids. While we do not address intraspecies variation, our results present a phylogenetic index for the success of microsatellite PCR primer product amplification, thus providing information regarding a collection of primers that are applicable to wide range of species. Through the use of such a uniform primer panel, the potential impact for cross species would be increased.

  12. Electrostatic Discharge testing of propellants and primers

    Energy Technology Data Exchange (ETDEWEB)

    Berry, R.B.

    1994-02-01

    This report presents the results of testing of selected propellants and primers to Electrostatic Discharge (ESD) characteristic of the human body. It describes the tests and the fixturing built to accommodate loose material (propellants) and the packed energetic material of the primer. The results indicate that all powders passed and some primers, especially the electric primers, failed to pass established requirements which delineate insensitive energetic components. This report details the testing of components and materials to four ESD environments (Standard ESD, Severe ESD, Modified Standard ESD, and Modified Severe ESD). The purpose of this study was to collect data based on the customer requirements as defined in the Sandia Environmental Safety & Health (ES&H) Manual, Chapter 9, and to define static sensitive and insensitive propellants and primers.

  13. Description of a PCR-based technique for DNA splicing and mutagenesis by producing 5' overhangs with run through stop DNA synthesis utilizing Ara-C

    Directory of Open Access Journals (Sweden)

    Silverman Mel

    2005-09-01

    Full Text Available Abstract Background Splicing of DNA molecules is an important task in molecular biology that facilitates cloning, mutagenesis and creation of chimeric genes. Mutagenesis and DNA splicing techniques exist, some requiring restriction enzymes, and others utilize staggered reannealing approaches. Results A method for DNA splicing and mutagenesis without restriction enzymes is described. The method is based on mild template-dependent polymerization arrest with two molecules of cytosine arabinose (Ara-C incorporated into PCR primers. Two rounds of PCR are employed: the first PCR produces 5' overhangs that are utilized for DNA splicing. The second PCR is based on polymerization running through the Ara-C molecules to produce the desired final product. To illustrate application of the run through stop mutagenesis and DNA splicing technique, we have carried out splicing of two segments of the human cofilin 1 gene and introduced a mutational deletion into the product. Conclusion We have demonstrated the utility of a new PCR-based method for carrying out DNA splicing and mutagenesis by incorporating Ara-C into the PCR primers.

  14. Selective control of primer usage in multiplex one-step reverse transcription PCR

    Directory of Open Access Journals (Sweden)

    Paul Natasha

    2009-12-01

    Full Text Available Abstract Background Multiplex RT-PCR is a valuable technique used for pathogen identification, disease detection and relative quantification of gene expression. The simplification of this protocol into a one-step procedure saves time and reagents. However, intensive PCR optimization is often required to overcome competing undesired PCR primer extension during the RT step. Results Herein, we report multiplex one-step RT-PCR experiments in which the PCR primers contain thermolabile phosphotriester modification groups. The presence of these groups minimizes PCR primer extension during the RT step and allows for control of PCR primer extension until the more stringent, elevated temperatures of PCR are reached. Results reveal that the use of primers whose extension can be controlled in a temperature-mediated way provides improved one-step RT-PCR specificity in both singleplex and multiplex reaction formats. Conclusions The need for an accurate and sensitive technique to quantify mRNA expression levels makes the described modified primer technology a promising tool for use in multiplex one-step RT-PCR. A more accurate representation of the abundances in initial template sample is feasible with modified primers, as artifacts of biased PCR are reduced because of greater improvements in reaction specificity.

  15. Primique: automatic design of specific PCR primers for each sequence in a family

    Directory of Open Access Journals (Sweden)

    Lange Mette

    2007-10-01

    Full Text Available Abstract Background In many contexts, researchers need specific primers for all sequences in a family such that each primer set amplifies only its target sequence and none of the others, e.g. to detect which transcription factor out of a family of very similar proteins that is present in a sample, or to design diagnostic assays for the identification of pathogen strains. Results This paper presents primique, a new graphical, user-friendly, fast, web-based tool which solves the problem: It designs specific primers for each sequence in an uploaded set. Further, a secondary set of sequences not to be amplified by any primer pair may be uploaded. Primers with high sequence similarity to non-target sequences are selected against. Lastly, the suggested primers may be checked against the National Center for Biotechnology Information databases for possible mis-priming. Conclusion Results are presented in interactive tables, and various primer properties are listed and displayed graphically. Any close match alignments can be displayed. Given 30 sequences, the running time of primique is about 20 seconds. primique can be reached via this web address: http://cgi-www.daimi.au.dk/cgi-chili/primique/front.py

  16. Novel primers for complete mitochondrial cytochrome b genesequencing in mammals

    Science.gov (United States)

    Naidu, Ashwin; Fitak, Robert R.; Munguia-Vega, Adrian; Culver, Melanie

    2011-01-01

    Sequence-based species identification relies on the extent and integrity of sequence data available in online databases such as GenBank. When identifying species from a sample of unknown origin, partial DNA sequences obtained from the sample are aligned against existing sequences in databases. When the sequence from the matching species is not present in the database, high-scoring alignments with closely related sequences might produce unreliable results on species identity. For species identification in mammals, the cytochrome b (cyt b) gene has been identified to be highly informative; thus, large amounts of reference sequence data from the cyt b gene are much needed. To enhance availability of cyt b gene sequence data on a large number of mammalian species in GenBank and other such publicly accessible online databases, we identified a primer pair for complete cyt b gene sequencing in mammals. Using this primer pair, we successfully PCR amplified and sequenced the complete cyt b gene from 40 of 44 mammalian species representing 10 orders of mammals. We submitted 40 complete, correctly annotated, cyt b protein coding sequences to GenBank. To our knowledge, this is the first single primer pair to amplify the complete cyt b gene in a broad range of mammalian species. This primer pair can be used for the addition of new cyt b gene sequences and to enhance data available on species represented in GenBank. The availability of novel and complete gene sequences as high-quality reference data can improve the reliability of sequence-based species identification.

  17. A new set of validated SSR primers for application in mulberry ...

    Indian Academy of Sciences (India)

    user

    2018-01-11

    Jan 11, 2018 ... A set of ten diverse mulberry accessions was used for screening the primers and standardizing PCR conditions. The PCR amplifications were carried out in 10 µl reaction volume, containing 10 ng template DNA, 1X DreamTaqTM Green Buffer (ThermoFisher. Scientific, Lithuania), 0.1 mM of each dNTPs, ...

  18. Evaluation of genetic diversity in open pollinated guava by iPBS primers

    International Nuclear Information System (INIS)

    Mehmood, A.; Jaskani, M.J.; Ahmad, S.; Ahmad, R.

    2013-01-01

    DNA markers are important tools for assessing genetic diversity and relationships among species, cultivars and breeding materials. Many horticultural species are lacking genomic information. DNA markers that do not require prior knowledge of DNA sequences are therefore appealing for horticultural research. A retrotransposon-based DNA marker system, iPBS (inter primer binding sites) developed from conserved primer binding sites within retrotransposons, was used to study the genetic variation and relationships in ornamental guava. PCR from 6 iPBS primers (dominant markers) produced a total of 113 bands (52.38-100% polymorphic) ranging from 150 bp to 3000 bp, and the mean PIC value for each primer ranging from 0.1245 to 0.3698. Molecular information generated from both iPBS was separately scored in a matrix for phylogenetic dendrogram construction. The phylogenetic dendrogram based on iPBS markers reflected morphologic classifications of the accessions that were studied. The iPBS PCR-based genome fingerprinting technology in this study is low-cost and provides another effective alternative in differentiation of accessions in guava (Psidium guajava Linn.) and related species or genera. (author)

  19. KULTUR PRIMER FIBROBLAS: PENELITIAN PENDAHULUAN

    Directory of Open Access Journals (Sweden)

    Yuli Kurniawati

    2015-05-01

    Full Text Available AbstrakKultur sel fibroblas banyak digunakan untuk penelitian proses penyembuhan luka dan penuaankulit. Metode ini digunakan untuk melihat perkembangan sel, proliferasi kinetik seluler, sertabiosintesis komponen matriks ekstraseluler. Penelitian pendahuluan ini dilakukan untuk optimasiteknik laboratorium serta berbagai kendala yang didapatkan saat kultur fibroblas. Kultur primerfibroblas dibagi menjadi 2 jenis sampel yaitu sampel yang berasal dari embrio mencit usia 7,5–9,5 hari, dan kulit pasien keloid. Sampel dari embrio mencit dilakukan kultur primer denganmetode dissociated fibroblast. Sampel jaringan keloid dan kulit normal dikultur dengan metodeskin explant. Fibroblas yang berasal dari kultur primer embrio mencit tumbuh baik sehinggadapat dilakukan subkultur dan disimpan di dalam nitrogen cair suhu -198°C. Fibroblas yangberasal dari sampel keloid pertama tumbuh sesuai pola pertumbuhan fibroblas, namun padasampel kedua terdapat kontaminasi Paecilomyces sp. yang merupakan salah satu jenis jamurkontaminan. Sel fibroblas mudah untuk dikultur karena memiliki kemampuan tumbuh danmelekat yang tinggi serta regenerasi cepat, namun penelitian lebih lanjut untuk optimasi teknikkultur dan pencegahan kontaminasi masih dibutuhkan sehingga sel dapat tumbuh baik.AbstractFibroblast cell culture method has been used for wound healing and skin aging studies. Thismethod was used for cell development imaging study, celullar kinetic proliferation andextracelullar matrix component biosynthesis. This preeliminary study was done for laboratoricaltechnic optimation as well as problems appeared in fibroblast culture. Fibroblasts primary culturewas divided into 2 type of samples, from 7.5-9.5-day-mice embryo and keloid-patient skin.Primary culture with dissociated fibroblast method was done for mice embryo sample. Keloidtissue sample and normal skin were cultured with skin explant method. Fibroblasts that weretaken from mice embryo primary culture grew well

  20. Thinking in systems a primer

    CERN Document Server

    Meadows, Donella H

    2008-01-01

    In the years following her role as the lead author of the international bestseller, "Limits to Growth"-the first book to show the consequences of unchecked growth on a finite planet- Donella Meadows remained a pioneer of environmental and social analysis until her untimely death in 2001. Meadows' newly released manuscript, "Thinking in Systems", is a concise and crucial book offering insight for problem solving on scales ranging from the personal to the global. Edited by the Sustainability Institute's Diana Wright, this essential primer brings systems thinking out of the realm of computers and equations and into the tangible world, showing readers how to develop the systems-thinking skills that thought leaders across the globe consider critical for 21st-century life. Some of the biggest problems facing the world-war, hunger, poverty, and environmental degradation-are essentially system failures. They cannot be solved by fixing one piece in isolation from the others, because even seemingly minor details have e...

  1. Identification and DNA fingerprinting of Legionella strains by randomly amplified polymorphic DNA analysis.

    OpenAIRE

    Bansal, N S; McDonell, F

    1997-01-01

    The randomly amplified polymorphic DNA (RAPD) technique was used in the development of a fingerprinting (typing) and identification protocol for Legionella strains. Twenty decamer random oligonucleotide primers were screened for their discriminatory abilities. Two candidate primers were selected. By using a combination of these primers, RAPD analysis allowed for the differentiation between all different species, between the serogroups, and further differentiation between subtypes of the same ...

  2. Simple and efficient site-directed mutagenesis using two single-primer reactions in parallel to generate mutants for protein structure-function studies.

    Science.gov (United States)

    Edelheit, Oded; Hanukoglu, Aaron; Hanukoglu, Israel

    2009-06-30

    In protein engineering, site-directed mutagenesis methods are used to generate DNA sequences with mutated codons, insertions or deletions. In a widely used method, mutations are generated by PCR using a pair of oligonucleotide primers designed with mismatching nucleotides at the center of the primers. In this method, primer-primer annealing may prevent cloning of mutant cDNAs. To circumvent this problem we developed an alternative procedure that does not use forward-reverse primer pair in the same reaction. In initial studies we used a double-primer PCR mutagenesis protocol, but sequencing of products showed tandem repeats of primer in cloned DNA. We developed an alternative method that starts with two Single-Primer Reactions IN Parallel using high-fidelity Pwo DNA polymerase. Thus, we call the method with the acronym SPRINP. The SPRINP reactions are then combined, denatured at 95 degrees C, and slowly cooled, promoting random annealing of the parental DNA and the newly synthesized strands. The products are digested with DpnI that digests methylated parental strands, and then transformed into E. coli. Using this method we generated >40 mutants in cDNAs coding for human Epithelial Na+ Channel (ENaC) subunits. The method has been tested for 1-3 bp codon mutation and insertion of a 27 bp epitope tag into cDNAs. The SPRINP mutagenesis protocol yields mutants reliably and with high fidelity. The use of a single primer in each amplification reaction increases the probability of success of primers relative to previous methods employing a forward and reverse primer pair in the same reaction.

  3. Complementary DNA-amplified fragment length polymorphism ...

    African Journals Online (AJOL)

    owner

    2011-05-09

    May 9, 2011 ... Complementary DNA-amplified fragment length polymorphism (cDNA-AFLP) technology was used to analyze ... that 9 of the studied expressed sequence tags (ESTs) are related to protein modification, 12 ESTs are involved in the .... primers were used during the first strand synthesis of our cDNA synthesis ...

  4. Detection of Mycobacterium ulcerans by real-time PCR with improved primers.

    Science.gov (United States)

    Shinoda, Noriko; Nakamura, Hajime; Watanabe, Mineo

    2016-01-01

    Buruli ulcer is a severe skin disease caused by Mycobacterium ulcerans. Real-time PCR targeting the IS2404 sequence has been used as a reliable and rapid method for the diagnosis of Buruli ulcer and detection of M. ulcerans in the environment. The genome of M. ulcerans contains hundreds of IS2404 copies, which have variability in certain sequences. Therefore, the design of new primers specific to conserved IS2404 regions may potentially improve the sensitivity of M. ulcerans detection and, consequently, the diagnosis of Buruli ulcer, thus ensuring timely treatment of the disease. In silico analysis indicates that DNA sequences of the IS2404 elements are highly variable within a single strain. As the binding sites of conventional IS2404-specific primers used for M. ulcerans detection contain polymorphic sequences, we designed new primers, which enabled the detection of M. ulcerans by real-time PCR with higher sensitivity and similar specificity with respect to that of conventional primers. However, the increase in sensitivity with the new primers depended on the M. ulcerans strain. The results suggest that real-time PCR based on the new primers could improve Buruli ulcer diagnosis and M. ulcerans detection in environmental samples.

  5. Primer on spontaneous heating and pyrophoricity

    Energy Technology Data Exchange (ETDEWEB)

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  6. A simple method of DNA extraction from coffee seeds suitable for ...

    African Journals Online (AJOL)

    Quality of DNA was confirmed by digestion using EcoRI, HindIII and PstI restriction endonucleases and complete digestion was observed. PCR with random decamer primers and consensus primers of mitochondria and chloroplast DNA and PCR-RFLP revealed the suitability of the DNA for PCR based marker techniques ...

  7. Effect of oligonucleotide primers in determining viral variability within hosts

    Directory of Open Access Journals (Sweden)

    Moya Andrés

    2004-12-01

    Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  8. Application of a new PCR primer for terminal restriction fragment length polymorphism analysis of the bacterial communities in plant roots.

    Science.gov (United States)

    Sakai, Masao; Matsuka, Akira; Komura, Taichi; Kanazawa, Shinjiro

    2004-10-01

    Contamination with plastid small subunit (SSU) rDNA is a major drawback when analyzing the bacterial communities of plant roots using culture-independent methods. In this study, a polymerase chain reaction (PCR) primer, 783r, was designed and tested to specifically amplify the SSU rDNA of various bacterial species without amplifying the SSU rDNA of plant plastids. To confirm how useful the community analysis of rhizobacteria is using 783r, the terminal restriction fragment length polymorphism (T-RFLP) method was performed with wheat (Triticum aestivum) and spinach (Spinacea oleracea) root samples. Using the standard T-RFLP method, a large T-RF peak of plant plastid SSU rDNA interfered with the bacterial community analysis. In contrast, the T-RFLP method using the 783r primer was able to detect the bacterial DNA while directly eliminating the influence of the plant-derived DNA extracted from the plant roots. Primer 783r might, therefore, be a useful PCR primer for the culture-independent analysis of bacterial communities in plant roots using SSU rDNA.

  9. A practical primer on geostatistics

    Science.gov (United States)

    Olea, Ricardo A.

    2009-01-01

    has significant methodological implications.Historical Remarks—As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields.Pioneers—Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorologyCalculations—Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations.Software—For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics.Organization of the Primer—The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of these main

  10. A primer on physical-layer network coding

    CERN Document Server

    Liew, Soung Chang; Zhang, Shengli

    2015-01-01

    The concept of physical-layer network coding (PNC) was proposed in 2006 for application in wireless networks. Since then it has developed into a subfield of communications and networking with a wide following. This book is a primer on PNC. It is the outcome of a set of lecture notes for a course for beginning graduate students at The Chinese University of Hong Kong. The target audience is expected to have some prior background knowledge in communication theory and wireless communications, but not working knowledge at the research level. Indeed, a goal of this book/course is to allow the reader

  11. Primer on transportation and climate change

    Science.gov (United States)

    2008-04-01

    This primer is an introduction to the issue of climate change and its implications for transportation policy in the United States. Its purpose is to outline the current thinking of governmental agencies, researchers, and advocacy groups on the issue ...

  12. Hexavalent Chromium IV-Free Primer Development

    Science.gov (United States)

    Alldredge, Michael J.; Buck, Amy L.

    2015-01-01

    Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.

  13. Menopause 101: A Primer for the Perimenopausal

    Science.gov (United States)

    ... Abstracts Media Award Recipients Media Policy Media Requests Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...

  14. Multiplexing Short Primers for Viral Family PCR

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  15. PCR-based cDNA library construction: general cDNA libraries at the level of a few cells.

    OpenAIRE

    Belyavsky, A; Vinogradova, T; Rajewsky, K

    1989-01-01

    A procedure for the construction of general cDNA libraries is described which is based on the amplification of total cDNA in vitro. The first cDNA strand is synthesized from total RNA using an oligo(dT)-containing primer. After oligo(dG) tailing the total cDNA is amplified by PCR using two primers complementary to oligo(dA) and oligo(dG) ends of the cDNA. For insertion of the cDNA into a vector a controlled trimming of the 3' ends of the cDNA by Klenow enzyme was used. Starting from 10 J558L ...

  16. Eukaryotic DNA Replicases

    KAUST Repository

    Zaher, Manal S.

    2014-11-21

    The current model of the eukaryotic DNA replication fork includes three replicative DNA polymerases, polymerase α/primase complex (Pol α), polymerase δ (Pol δ), and polymerase ε (Pol ε). The primase synthesizes 8–12 nucleotide RNA primers that are extended by the DNA polymerization activity of Pol α into 30–35 nucleotide RNA-DNA primers. Replication factor C (RFC) opens the polymerase clamp-like processivity factor, proliferating cell nuclear antigen (PCNA), and loads it onto the primer-template. Pol δ utilizes PCNA to mediate highly processive DNA synthesis, while Pol ε has intrinsic high processivity that is modestly stimulated by PCNA. Pol ε replicates the leading strand and Pol δ replicates the lagging strand in a division of labor that is not strict. The three polymerases are comprised of multiple subunits and share unifying features in their large catalytic and B subunits. The remaining subunits are evolutionarily not related and perform diverse functions. The catalytic subunits are members of family B, which are distinguished by their larger sizes due to inserts in their N- and C-terminal regions. The sizes of these inserts vary among the three polymerases, and their functions remain largely unknown. Strikingly, the quaternary structures of Pol α, Pol δ, and Pol ε are arranged similarly. The catalytic subunits adopt a globular structure that is linked via its conserved C-terminal region to the B subunit. The remaining subunits are linked to the catalytic and B subunits in a highly flexible manner.

  17. Bioelectronic DNA detection of human papillomaviruses using eSensor™: a model system for detection of multiple pathogens

    Directory of Open Access Journals (Sweden)

    Miller Donna L

    2003-06-01

    Full Text Available Abstract Background We used human papillomaviruses (HPV as a model system to evaluate the utility of a nucleic acid, hybridization-based bioelectronic DNA detection platform (eSensor™ in identifying multiple pathogens. Methods Two chips were spotted with capture probes consisting of DNA oligonucleotide sequences specific for HPV types. Electrically conductive signal probes were synthesized to be complementary to a distinct region of the amplified HPV target DNA. A portion of the HPV L1 region that was amplified by using consensus primers served as target DNA. The amplified target was mixed with a cocktail of signal probes and added to a cartridge containing a DNA chip to allow for hybridization with complementary capture probes. Results Two bioelectric chips were designed and successfully detected 86% of the HPV types contained in clinical samples. Conclusions This model system demonstrates the potential of the eSensor platform for rapid and integrated detection of multiple pathogens.

  18. Relativistic Astrophysics and Cosmology: A Primer

    Energy Technology Data Exchange (ETDEWEB)

    Abramowicz, Marek A [Department of Astronomy and Astrophysics, Chalmers University of Technology, 41296 Goeteborg (Sweden)

    2007-10-21

    'Relativistic Astrophysics and Cosmology: A Primer' by Peter Hoyng, was published last year by Springer. The book is based on lectures given by the author at University of Utrecht to advanced undergraduates. This is a short and scholarly book. In about 300 pages, the author has covered the most interesting and important applications of Albert Einstein's general relativity in present-day astrophysics and cosmology: black holes, neutron stars, gravitational waves, and the cosmic microwave background. The book stresses theory, but also discusses several experimental and observational topics, such as the Gravity Probe B mission, interferometer detectors of gravitational waves and the power spectrum of the cosmic microwave background. The coverage is not uniform. Some topics are discussed in depth, others are only briefly mentioned. The book obviously reflects the author's own research interests and his preferences for specific mathematical methods, and the choice of the original artwork that illustrates the book (and appears on its cover) is a very personal one. I consider this personal touch an advantage, even if I do not always agree with the author's choices. For example, I employ Killing vectors as a very useful mathematical tool not only in my research on black holes, but also in my classes. I find that my students prefer it when discussions of particle, photon and fluid motion in the Schwarzschild and Kerr spacetimes are based explicitly and directly on the Killing vectors rather than on coordinate calculations. The latter approach is, of course, the traditional one, and is used in Peter Hoyng's book. Reading the book is a stimulating experience, because the reader can almost feel the author's presence. The author's opinions, his mathematical taste, his research pleasures, and his pedagogical passion are apparent everywhere. Lecturers contemplating a new course on relativistic astrophysics could adopt Hoyng's book as

  19. Lateral Flow Loop-Mediated Isothermal Amplification Test with Stem Primers: Detection of Cryptosporidium Species in Kenyan Children Presenting with Diarrhea

    Directory of Open Access Journals (Sweden)

    Timothy S. Mamba

    2018-01-01

    Full Text Available Background. Cryptosporidium is a protozoan parasite and a major cause of diarrhea in children and immunocompromised patients. Current diagnostic methods for cryptosporidiosis such as microscopy have low sensitivity while techniques such as PCR indicate higher sensitivity levels but are seldom used in developing countries due to their associated cost. A loop-mediated isothermal amplification (LAMP technique, a method with shorter time to result and with equal or higher sensitivity compared to PCR, has been developed and applied in the detection of Cryptosporidium species. The test has a detection limit of 10 pg/µl (~100 oocysts/ml indicating a need for more sensitive diagnostic tools. This study developed a more sensitive lateral flow dipstick (LFD LAMP test based on SAM-1 gene and with the addition of a second set of reaction accelerating primers (stem primers. Results. The stem LFD LAMP test showed analytical sensitivity of 10 oocysts/ml compared to 100 oocysts/ml (10 pg/ul for each of the SAM-1 LAMP test and nested PCR. The stem LFD LAMP and nested PCR detected 29/39 and 25/39 positive samples of previously identified C. parvum and C. hominis DNA, respectively. The SAM-1 LAMP detected 27/39. On detection of Cryptosporidium DNA in 67 clinical samples, the stem LFD LAMP detected 16 samples and SAM-2 LAMP 14 and nested PCR identified 11. Preheating the templates increased detection by stem LFD LAMP to 19 samples. Time to results from master mix preparation step took ~80 minutes. The test was specific, and no cross-amplification was recorded with nontarget DNA. Conclusion. The developed stem LFD LAMP test is an appropriate method for the detection of C. hominis, C. parvum, and C. meleagridis DNA in human stool samples. It can be used in algorithm with other diagnostic tests and may offer promise as an effective diagnostic tool in the control of cryptosporidiosis.

  20. An In Vitro Single-Primer Site-Directed Mutagenesis Method for Use in Biotechnology.

    Science.gov (United States)

    Huang, Yanchao; Zhang, Likui

    2017-01-01

    Site-directed mutagenesis is a powerful method to introduce mutation(s) into DNA sequences. A number of methods have been developed over the years with a main goal being to create a high number of mutant genes. The single-mutagenic primer method for site-directed mutagenesis is the most direct method that yields mutant genes in about 25-50 % of transformants in a robust, low-cost reaction. The supercompetent XL10-Gold bacteria used in the Stratagene protocol carry a phage, which may be a problem for some applications; however, in our single-mutagenic primer method the supercompetent bacteria are not needed. A thermostable DNA polymerase with high fidelity and processivity, such as Phusion DNA polymerase, is required for our optimized procedure to avoid extra mutation(s) and enhance mutagenic efficiency.

  1. VizPrimer: a web server for visualized PCR primer design based on known gene structure.

    Science.gov (United States)

    Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

    2011-12-15

    The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

  2. A high-throughput method for detection of DNA in chloroplasts using flow cytometry

    Directory of Open Access Journals (Sweden)

    Oldenburg Delene J

    2007-03-01

    Full Text Available Abstract Background The amount of DNA in the chloroplasts of some plant species has been shown recently to decline dramatically during leaf development. A high-throughput method of DNA detection in chloroplasts is now needed in order to facilitate the further investigation of this process using large numbers of tissue samples. Results The DNA-binding fluorophores 4',6-diamidino-2-phenylindole (DAPI, SYBR Green I (SG, SYTO 42, and SYTO 45 were assessed for their utility in flow cytometric analysis of DNA in Arabidopsis chloroplasts. Fluorescence microscopy and real-time quantitative PCR (qPCR were used to validate flow cytometry data. We found neither DAPI nor SYTO 45 suitable for flow cytometric analysis of chloroplast DNA (cpDNA content, but did find changes in cpDNA content during development by flow cytometry using SG and SYTO 42. The latter dye provided more sensitive detection, and the results were similar to those from the fluorescence microscopic analysis. Differences in SYTO 42 fluorescence were found to correlate with differences in cpDNA content as determined by qPCR using three primer sets widely spaced across the chloroplast genome, suggesting that the whole genome undergoes copy number reduction during development, rather than selective reduction/degradation of subgenomic regions. Conclusion Flow cytometric analysis of chloroplasts stained with SYTO 42 is a high-throughput method suitable for determining changes in cpDNA content during development and for sorting chloroplasts on the basis of DNA content.

  3. Canadian municipal carbon trading primer

    International Nuclear Information System (INIS)

    Seskus, A.

    2002-01-01

    The trading of greenhouse gas (GHG) emissions is being suggested as an effective economic way to meet Canada's Kyoto target. Emissions trading is a market-based instrument that can help achieve environmental improvements while using the market to absorb the economical and effective measures to achieve emissions reductions. Placing a value on emissions means that in order to minimize costs, companies will be motivated to apply the lowest-cost emission reductions possible for regulatory approval. The two main types of emissions trading that exist in Canada are the trading of emissions that lead to the formation of smog or acid rain, and the trading of greenhouse gas emissions that lead to climate change. Since carbon dioxide is the most prevalent GHG, making up approximately 75 per cent of Canadian GHG emissions, the trading of units of GHGs is often referred to as carbon trading. The impact that emissions trading will have on municipal operations was the focus of this primer. The trading of GHG involves buying and selling of allowances of GHGs between contracting parties, usually between one party that is short of GHG credits and another that has excess credits. The 3 common approaches to emissions trading include allowance trading (cap and trade), credit trading (baseline and credit), and a hybrid system which combines both credit and allowance trading systems. The issues that impact municipalities include the debate regarding who owns the credits from landfills, particularly if power is generated using landfill gas and the power is sold as green power. Other viable questions were also addressed, including who can claim emission reduction credits if a city implements energy efficiency projects, or fuel substitution programs. Also, will municipalities be allowed to trade internationally, for example, with municipalities in the United States, and how should they spend their money earned from selling credits. This report also presents highlights from 3 emissions

  4. Avoiding cross hybridization by choosing nonredundant targets on cDNA arrays

    DEFF Research Database (Denmark)

    Nielsen, Henrik Bjørn; Knudsen, Steen

    2002-01-01

    PROBEWIZ designs PCR primers for amplifying probes for cDNA arrays. The probes are designed to have minimal homology to other expressed sequences from a given organism. The primer selection is based on user-defined penalties for homology, primer quality, and proximity to the 3' end....

  5. RExPrimer: an integrated primer designing tool increases PCR effectiveness by avoiding 3' SNP-in-primer and mis-priming from structural variation.

    Science.gov (United States)

    Piriyapongsa, Jittima; Ngamphiw, Chumpol; Assawamakin, Anunchai; Wangkumhang, Pongsakorn; Suwannasri, Payiarat; Ruangrit, Uttapong; Agavatpanitch, Gallissara; Tongsima, Sissades

    2009-12-03

    Polymerase chain reaction (PCR) is very useful in many areas of molecular biology research. It is commonly observed that PCR success is critically dependent on design of an effective primer pair. Current tools for primer design do not adequately address the problem of PCR failure due to mis-priming on target-related sequences and structural variations in the genome. We have developed an integrated graphical web-based application for primer design, called RExPrimer, which was written in Python language. The software uses Primer3 as the primer designing core algorithm. Locally stored sequence information and genomic variant information were hosted on MySQLv5.0 and were incorporated into RExPrimer. RExPrimer provides many functionalities for improved PCR primer design. Several databases, namely annotated human SNP databases, insertion/deletion (indel) polymorphisms database, pseudogene database, and structural genomic variation databases were integrated into RExPrimer, enabling an effective without-leaving-the-website validation of the resulting primers. By incorporating these databases, the primers reported by RExPrimer avoid mis-priming to related sequences (e.g. pseudogene, segmental duplication) as well as possible PCR failure because of structural polymorphisms (SNP, indel, and copy number variation (CNV)). To prevent mismatching caused by unexpected SNPs in the designed primers, in particular the 3' end (SNP-in-Primer), several SNP databases covering the broad range of population-specific SNP information are utilized to report SNPs present in the primer sequences. Population-specific SNP information also helps customize primer design for a specific population. Furthermore, RExPrimer offers a graphical user-friendly interface through the use of scalable vector graphic image that intuitively presents resulting primers along with the corresponding gene structure. In this study, we demonstrated the program effectiveness in successfully generating primers for strong

  6. Identification of a premature termination of DNA polymerization in ...

    Indian Academy of Sciences (India)

    2013-04-25

    Apr 25, 2013 ... DNA polymerases have been widely used as sophisticated powerful tools in molecular biology for DNA cloning and genetic diagnosis (Raymond et al. 2010). Using parental single-stranded DNA as template and oligonucleo- tide as primer, these DNA polymerases can extend daughter strands to the 5′ ...

  7. Enhanced peptide nucleic acid binding to supercoiled DNA: possible implications for DNA "breathing" dynamics

    DEFF Research Database (Denmark)

    Bentin, T; Nielsen, Peter E.

    1996-01-01

    The influence of DNA topology on peptide nucleic acid (PNA) binding was studied. Formation of sequence-specific PNA2/dsDNA (double-stranded DNA) complexes was monitored by a potassium permanganate probing/primer extension assay. At low ionic strengths, the binding of PNA was 2-3 times more effici...

  8. Effectiveness of annealing blocking primers versus restriction enzymes for characterization of generalist diets: unexpected prey revealed in the gut contents of two coral reef fish species.

    Science.gov (United States)

    Leray, Matthieu; Agudelo, Natalia; Mills, Suzanne C; Meyer, Christopher P

    2013-01-01

    Characterization of predator-prey interactions is challenging as researchers have to rely on indirect methods that can be costly, biased and too imprecise to elucidate the complexity of food webs. DNA amplification and sequencing techniques of gut and fecal contents are promising approaches, but their success largely depends on the ability to amplify the taxonomic array of prey consumed and then match prey amplicons with reference sequences. When little a priori information on diet is available or a generalist predator is targeted, versatile primer sets (also referred to as universal or general primers) as opposed to group- or species-specific primer sets are the most powerful to unveil the full range of prey consumed. However, versatile primers are likely to preferentially amplify the predominant, less degraded predator DNA if no manipulation is performed to exclude this confounding DNA template. In this study we compare two approaches that eliminate the confounding predator template: restriction digestion and the use of annealing blocking primers. First, we use a preliminary DNA barcode library provided by the Moorea BIOCODE project to 1) evaluate the cutting frequency of commercially available restriction enzymes and 2) design predator specific annealing blocking primers. We then compare the performance of the two predator removal strategies for the detection of prey templates using two versatile primer sets from the gut contents of two generalist coral reef fish species sampled in Moorea. Our study demonstrates that blocking primers should be preferentially used over restriction digestion for predator DNA removal as they recover greater prey diversity. We also emphasize that a combination of versatile primers may be required to best represent the breadth of a generalist's diet.

  9. Effectiveness of Annealing Blocking Primers versus Restriction Enzymes for Characterization of Generalist Diets: Unexpected Prey Revealed in the Gut Contents of Two Coral Reef Fish Species

    Science.gov (United States)

    Leray, Matthieu; Agudelo, Natalia; Mills, Suzanne C.; Meyer, Christopher P.

    2013-01-01

    Characterization of predator-prey interactions is challenging as researchers have to rely on indirect methods that can be costly, biased and too imprecise to elucidate the complexity of food webs. DNA amplification and sequencing techniques of gut and fecal contents are promising approaches, but their success largely depends on the ability to amplify the taxonomic array of prey consumed and then match prey amplicons with reference sequences. When little a priori information on diet is available or a generalist predator is targeted, versatile primer sets (also referred to as universal or general primers) as opposed to group- or species-specific primer sets are the most powerful to unveil the full range of prey consumed. However, versatile primers are likely to preferentially amplify the predominant, less degraded predator DNA if no manipulation is performed to exclude this confounding DNA template. In this study we compare two approaches that eliminate the confounding predator template: restriction digestion and the use of annealing blocking primers. First, we use a preliminary DNA barcode library provided by the Moorea BIOCODE project to 1) evaluate the cutting frequency of commercially available restriction enzymes and 2) design predator specific annealing blocking primers. We then compare the performance of the two predator removal strategies for the detection of prey templates using two versatile primer sets from the gut contents of two generalist coral reef fish species sampled in Moorea. Our study demonstrates that blocking primers should be preferentially used over restriction digestion for predator DNA removal as they recover greater prey diversity. We also emphasize that a combination of versatile primers may be required to best represent the breadth of a generalist's diet. PMID:23579925

  10. Serovar distribution of a DNA sequence involved in the antigenic relationship between Leptospira and equine cornea

    Directory of Open Access Journals (Sweden)

    Arroyo Guillermo H

    2002-02-01

    Full Text Available Abstract Background Horses infected with Leptospira present several clinical disorders, one of them being recurrent uveitis. A common endpoint of equine recurrent uveitis is blindness. Serovar pomona has often been incriminated, although others have also been reported. An antigenic relationship between this bacterium and equine cornea has been described in previous studies. A leptospiral DNA fragment that encodes cross-reacting epitopes was previously cloned and expressed in Escherichia coli. Results A region of that DNA fragment was subcloned and sequenced. Samples of leptospiral DNA from several sources were analysed by PCR with two primer pairs designed to amplify that region. Reference strains from serovars canicola, icterohaemorrhagiae, pomona, pyrogenes, wolffi, bataviae, sentot, hebdomadis and hardjo rendered products of the expected sizes with both pairs of primers. The specific DNA region was also amplified from isolates from Argentina belonging to serogroups Canicola and Pomona. Both L. biflexa serovar patoc and L. borgpetersenii serovar tarassovi rendered a negative result. Conclusions The DNA sequence related to the antigen mimicry with equine cornea was not exclusively found in serovar pomona as it was also detected in several strains of Leptospira belonging to different serovars. The results obtained with L. biflexa serovar patoc strain Patoc I and L. borgpetersenii serovar tarassovi strain Perepelicin suggest that this sequence is not present in these strains, which belong to different genomospecies than those which gave positive results. This is an interesting finding since L. biflexa comprises nonpathogenic strains and serovar tarassovi has not been associated clinically with equine uveitis.

  11. DNA Amplification of Meat Tenderness Gene of Bali Cattle

    Directory of Open Access Journals (Sweden)

    Agus Susilo

    2012-02-01

    Full Text Available The aim of this study was to find out DNA band pattern as a result of amplification using DNA primer from meat tenderness gene of Bali cattle. Sample used in this study was DNA isolated from blood Bali cattle. Blood samples was collected in heparin tubes from jugular vein. Leucocyte cells were isolated using RBCs (Red Blood Cells lysis buffer. To get DNA fragmen, marbling and meat tenderness gene were amplified by using DNA primer for for meat tenderness (forward: 5’–CTACCGGGACGTCAACCT-3’; reverse: 5’-GGTTGTCGGGGTAGCTCA-3’. The size of DNA fragment were 210 bp. Key words: Bali cattle, meat tenderness gene

  12. DNA Amplification of Meat Tenderness Gene of Bali Cattle

    Directory of Open Access Journals (Sweden)

    Agus Susilo

    2012-03-01

    Full Text Available The aim of this study was to know DNA band pattern as a result of amplification using DNA primer from meat tenderness gene of Bali cattle. Sample used in this study was DNA isolated from blood Bali cattle. Blood samples was collected in heparin tubes from jugular vein. Leucocyte cells were isolated using RBCs (Red Blood Cells lysis buffer. To get DNA fragmen, marbling and meat tenderness gene were amplified by using DNA primer for for meat tenderness (forward: 5’–CTACCGGGACGTCAACCT-3’; reverse: 5’-GGTTGTCGGGGTAGCTCA-3’. The size of DNA fragment were 210 bp, respectively. Key words: Bali cattle, meat tenderness gene

  13. Detection of genital human papillomaviruses by polymerase chain reaction amplification with degenerate nested primers.

    Science.gov (United States)

    Williamson, A L; Rybicki, E P

    1991-03-01

    Degenerate oligonucleotide primers were designed for in vitro amplification by polymerase chain reaction (PCR) of a relatively well-conserved portion of the L1 capsid protein gene of genital human papillomaviruses. A specific 441bp fragment was amplified by PCR from genomic clones and clinical biopsy specimens containing DNA from HPV types 6, 11, 16, 18, 31, and 33, as well as from a number of other clinical specimens known to contain unclassified HPV isolates. As some HPV non-specific DNA was also often amplified, another set of degenerate primers was designed which amplified a 335 bp sequence contained within the 441 bp sequence. These nested primers could be used in a two-stage PCR reaction to obtain distinct HPV-specific DNA fragments suitable for direct sequencing. Two-stage PCR was used to demonstrate the presence of HPV DNA in 13 out of 16 biopsies, which had been classified histologically as cervical intraepithelial neoplasia (CIN), but which were negative for HPV on Southern blot hybridization. Seven of these amplification products were sequenced, and one proved to be a previously unsequenced HPV type. The results have important implications for the routine detection and typing of genital and other HPV types in clinical samples.

  14. Reliable allele detection using SNP-based PCR primers containing Locked Nucleic Acid: application in genetic mapping

    Directory of Open Access Journals (Sweden)

    Trognitz Friederike

    2007-02-01

    Full Text Available Abstract Background The diploid, Solanum caripense, a wild relative of potato and tomato, possesses valuable resistance to potato late blight and we are interested in the genetic base of this resistance. Due to extremely low levels of genetic variation within the S. caripense genome it proved impossible to generate a dense genetic map and to assign individual Solanum chromosomes through the use of conventional chromosome-specific SSR, RFLP, AFLP, as well as gene- or locus-specific markers. The ease of detection of DNA polymorphisms depends on both frequency and form of sequence variation. The narrow genetic background of close relatives and inbreds complicates the detection of persisting, reduced polymorphism and is a challenge to the development of reliable molecular markers. Nonetheless, monomorphic DNA fragments representing not directly usable conventional markers can contain considerable variation at the level of single nucleotide polymorphisms (SNPs. This can be used for the design of allele-specific molecular markers. The reproducible detection of allele-specific markers based on SNPs has been a technical challenge. Results We present a fast and cost-effective protocol for the detection of allele-specific SNPs by applying Sequence Polymorphism-Derived (SPD markers. These markers proved highly efficient for fingerprinting of individuals possessing a homogeneous genetic background. SPD markers are obtained from within non-informative, conventional molecular marker fragments that are screened for SNPs to design allele-specific PCR primers. The method makes use of primers containing a single, 3'-terminal Locked Nucleic Acid (LNA base. We demonstrate the applicability of the technique by successful genetic mapping of allele-specific SNP markers derived from monomorphic Conserved Ortholog Set II (COSII markers mapped to Solanum chromosomes, in S. caripense. By using SPD markers it was possible for the first time to map the S. caripense alleles

  15. A Novel Universal Primer-Multiplex-PCR Method with Sequencing Gel Electrophoresis Analysis

    Science.gov (United States)

    Huang, Kunlun; Zhang, Nan; Yuan, Yanfang; Shang, Ying; Luo, Yunbo

    2012-01-01

    In this study, a novel universal primer-multiplex-PCR (UP-M-PCR) method adding a universal primer (UP) in the multiplex PCR reaction system was described. A universal adapter was designed in the 5′-end of each specific primer pairs which matched with the specific DNA sequences for each template and also used as the universal primer (UP). PCR products were analyzed on sequencing gel electrophoresis (SGE) which had the advantage of exhibiting extraordinary resolution. This method overcame the disadvantages rooted deeply in conventional multiplex PCR such as complex manipulation, lower sensitivity, self-inhibition and amplification disparity resulting from different primers, and it got a high specificity and had a low detection limit of 0.1 ng for single kind of crops when screening the presence of genetically modified (GM) crops in mixture samples. The novel developed multiplex PCR assay with sequencing gel electrophoresis analysis will be useful in many fields, such as verifying the GM status of a sample irrespective of the crop and GM trait and so on. PMID:22272223

  16. Polyadenylated Sequencing Primers Enable Complete Readability of PCR Amplicons Analyzed by Dideoxynucleotide Sequencing

    Directory of Open Access Journals (Sweden)

    Martin Beránek

    2012-01-01

    Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.

  17. Hypervariable region polymorphism of mtDNA of recurrent oral ulceration in Chinese.

    Directory of Open Access Journals (Sweden)

    Mao Sun

    Full Text Available BACKGROUND: MtDNA haplogroups could have important implication for understanding of the relationship between the mutations of the mitochondrial genome and diseases. Distribution of a variety of diseases among these haplogroups showed that some of the mitochondrial haplogroups are predisposed to disease. To examine the susceptibility of mtDNA haplogroups to ROU, we sequenced the mtDNA HV1, HV2 and HV3 in Chinese ROU. METHODOLOGY/PRINCIPAL FINDINGS: MtDNA haplogroups were analyzed in the 249 cases of ROU patients and the 237 cases of healthy controls respectively by means of primer extension analysis and DNA sequencing. Haplogroups G1 and H were found significantly more abundant in ROU patients than in healthy persons, while haplogroups D5 and R showed a trend toward a higher frequency in control as compared to those in patients. The distribution of C-stretch sequences polymorphism in mtDNA HV1, HV2 and HV3 regions was found in diversity. CONCLUSIONS/SIGNIFICANCE: For the first time, the relationship of mtDNA haplogroups and ROU in Chinese was investigated. Our results indicated that mtDNA haplogroups G1 and H might constitute a risk factor for ROU, which possibly increasing the susceptibility of ROU. Meanwhile, haplogroups D5 and R were indicated as protective factors for ROU. The polymorphisms of C-stretch sequences might being unstable and influence the mtDNA replication fidelity.

  18. Climate Change, Health, and Communication: A Primer.

    Science.gov (United States)

    Chadwick, Amy E

    2016-01-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

  19. Multiplex real-time PCR using temperature sensitive primer-supplying hydrogel particles and its application for malaria species identification.

    Directory of Open Access Journals (Sweden)

    Junsun Kim

    Full Text Available Real-time PCR, also called quantitative PCR (qPCR, has been powerful analytical tool for detection of nucleic acids since it developed. Not only for biological research but also for diagnostic needs, qPCR technique requires capacity to detect multiple genes in recent years. Solid phase PCR (SP-PCR where one or two directional primers are immobilized on solid substrates could analyze multiplex genetic targets. However, conventional SP-PCR was subjected to restriction of application for lack of PCR efficiency and quantitative resolution. Here we introduce an advanced qPCR with primer-incorporated network (PIN. One directional primers are immobilized in the porous hydrogel particle by covalent bond and the other direction of primers are temporarily immobilized at so-called 'Supplimers'. Supplimers released the primers to aqueous phase in the hydrogel at the thermal cycling of PCR. It induced the high PCR efficiency over 92% with high reliability. It reduced the formation of primer dimers and improved the selectivity of qPCR thanks to the strategy of 'right primers supplied to right place only'. By conducting a six-plex qPCR of 30 minutes, we analyzed DNA samples originated from malaria patients and successfully identified malaria species in a single reaction.

  20. Microsatellites as DNA markers in cultivated peanut (Arachis hypogaea L.

    Directory of Open Access Journals (Sweden)

    Gao Guoqing

    2003-04-01

    Full Text Available Abstract Background Genomic research of cultivated peanut has lagged behind other crop species because of the paucity of polymorphic DNA markers found in this crop. It is necessary to identify additional DNA markers for further genetic research in peanut. Results Microsatellite markers in cultivated peanut were developed using the SSR enrichment procedure. The results showed that the GA/CT repeat was the most frequently dispersed microsatellite in peanut. The primer pairs were designed for fifty-six different microsatellites, 19 of which showed a polymorphism among the genotypes studied. The average number of alleles per locus was 4.25, and up to 14 alleles were found at one locus. This suggests that microsatellite DNA markers produce a higher level of DNA polymorphism than other DNA markers in cultivated peanut. Conclusions It is desirable to isolate and characterize more DNA markers in cultivated peanut for more productive genomic studies, such as genetic mapping, marker-assisted selection, and gene discovery. The development of microsatellite markers holds a promise for such studies.

  1. Digital quantification of gene methylation in stool DNA by emulsion-PCR coupled with hydrogel immobilized bead-array.

    Science.gov (United States)

    Liu, Yunlong; Wu, Haiping; Zhou, Qiang; Song, Qinxin; Rui, Jianzhong; Zou, Bingjie; Zhou, Guohua

    2017-06-15

    Aberrations of gene methylation in stool DNA (sDNA) is an effective biomarker for non-invasive colorectal cancer diagnosis. However, it is challenging to accurately quantitate the gene methylation levels in sDNA due to the low abundance and degradation of sDNA. In this study, a digital quantification strategy was proposed by combining emulsion PCR (emPCR) with hydrogel immobilized bead-array. The assay includes following steps: bisulfite conversion of sDNA, pre-amplification by PCR with specific primers containing 5' universal sequences, emPCR of pre-amplicons with beaded primers to achieve single-molecular amplification and identification of hydrogel embedding beads coated with amplicons. The sensitivity and the specificity of the method are high enough to pick up 0.05% methylated targets from unmethylated DNA background. The successful detection of hypermethylated vimentin gene in clinical stool samples suggests that the proposed method should be a potential tool for non-invasive colorectal cancer screening. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Species-specific PCR primers for the rapid identification of yeasts of the genus Zygosaccharomyces.

    Science.gov (United States)

    Harrison, Elizabeth; Muir, Alastair; Stratford, Malcolm; Wheals, Alan

    2011-06-01

    Species-specific primer pairs that produce a single band of known product size have been developed for members of the Zygosaccharomyces clade including Zygosaccharomyces bailii, Zygosaccharomyces bisporus, Zygosaccharomyces kombuchaensis, Zygosaccharomyces lentus, Zygosaccharomyces machadoi, Zygosaccharomyces mellis and Zygosaccharomyces rouxii. An existing primer pair for the provisional new species Zygosaccharomyces pseudorouxii has been confirmed as specific. The HIS3 gene, encoding imidazole-glycerolphosphate dehydratase, was used as the target gene. This housekeeping gene evolves slowly and is thus well conserved among different isolates, but shows a significant number of base pair changes between even closely related species, sufficient for species-specific primer design. The primers were tested on type and wild strains of the genus Zygosaccharomyces and on members of the Saccharomycetaceae. Sequencing of the D1/D2 region of rDNA was used to confirm the identification of all nonculture collection isolates. This approach used extracted genomic DNA, but in practice, it can be used efficiently with a rapid colony PCR protocol. The method also successfully detected known and new hybrid strains of Z. rouxii and Z. pseudorouxii. The method is rapid, robust and inexpensive. It requires little expertise by the user and is thus useful for preliminary, large-scale screens. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  3. Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers

    Science.gov (United States)

    Liu, Yang; Wang, Xiao-yue; Gao, Zi-tong; Han, Jian-ping; Xiang, Li

    2017-01-01

    Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata) that are processed into one of the most valued traditional Chinese medicines (TCM). The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS) region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations. PMID:28680424

  4. Multiply-primed rolling circle amplification of human papillomavirus using sequence-specific primers.

    Science.gov (United States)

    Marincevic-Zuniga, Yanara; Gustavsson, Inger; Gyllensten, Ulf

    2012-10-10

    Multiply-primed rolling circle amplification (RCA) is a suitable technique for amplification of circular templates and has been used to identify novel human papillomaviruses (HPV). In this study we develop an efficient RCA for whole genome amplification of HPV using HPV-specific primers in clinical samples and establish a protocol for whole genome sequencing using the Sanger method. Amplification of cloned HPV-genomes by RCA was compared using specific primers against random hexamers. Using HPV-specific primers increased the effectiveness on average 15.2 times and the enrichment of HPV relative to human gDNA on average 62.2 times, as compared to using random hexamer. RCA products were sequenced without need for cloning, even when using low-input amounts. The technique was successfully used on 4 patient samples from FTA cards, to generate whole HPV-genome sequences. Degenerated HPV-specific primers for RCA produce DNA of sufficient quality and quantity suitable for sequencing and other potential downstream analyses. Copyright © 2012. Published by Elsevier Inc.

  5. Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers

    Directory of Open Access Journals (Sweden)

    Yang Liu

    2017-06-01

    Full Text Available Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata that are processed into one of the most valued traditional Chinese medicines (TCM. The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations.

  6. Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Esther Lantero

    2017-07-01

    Full Text Available Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L. trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control

  7. Microsatellite Primers for Fungus-Growing Ants

    DEFF Research Database (Denmark)

    Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  8. Microsatellite primers for fungus-growing ants

    DEFF Research Database (Denmark)

    Villesen, Palle; Gertsch, P J; Boomsma, JJ

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  9. Decreased mitochondrial DNA content in blood samples of patients with stage I breast cancer

    Directory of Open Access Journals (Sweden)

    Fokas Emmanouil

    2009-12-01

    Full Text Available Abstract Background Alterations of mitochondrial DNA (mtDNA have been implicated in carcinogenesis. We developed an accurate multiplex quantitative real-time PCR for synchronized determination of mtDNA and nuclear DNA (nDNA. We sought to investigate whether mtDNA content in the peripheral blood of breast cancer patients is associated with clinical and pathological parameters. Methods Peripheral blood samples were collected from 60 patients with breast cancer and 51 age-matched healthy individuals as control. DNA was extracted from peripheral blood for the quantification of mtDNA and nDNA, using a one-step multiplex real-time PCR. A FAM labeled MGB probe and primers were used to amplify the mtDNA sequence of the ATP 8 gene, and a VIC labeled MGB probe and primers were employed to amplify the glyceraldehyde-3-phosphate-dehydrogenase gene. mtDNA content was correlated with tumor stage, menstruation status, and age of patients as well as lymph node status and the expression of estrogen receptor (ER, progesterone receptor (PR and Her-2/neu protein. Results The content of mtDNA in stage I breast cancer patients was significantly lower than in other stages (overall P = 0.023. Reduced mtDNA was found often in post menopausal cancer group (P = 0.024. No difference in mtDNA content, in regards to age (p = 0.564, lymph node involvement (p = 0.673, ER (p = 0.877, PR (p = 0.763, and Her-2/neu expression (p = 0.335, was observed. Conclusion Early detection of breast cancer has proved difficult and current detection methods are inadequate. In the present study, decreased mtDNA content in the peripheral blood of patients with breast cancer was strongly associated with stage I. The use of mtDNA may have diagnostic value and further studies are required to validate it as a potential biomarker for early detection of breast cancer.

  10. Oral bacterial DNA findings in pericardial fluid

    Directory of Open Access Journals (Sweden)

    Anne-Mari Louhelainen

    2014-11-01

    Full Text Available Background: We recently reported that large amounts of oral bacterial DNA can be found in thrombus aspirates of myocardial infarction patients. Some case reports describe bacterial findings in pericardial fluid, mostly done with conventional culturing and a few with PCR; in purulent pericarditis, nevertheless, bacterial PCR has not been used as a diagnostic method before. Objective: To find out whether bacterial DNA can be measured in the pericardial fluid and if it correlates with pathologic–anatomic findings linked to cardiovascular diseases. Methods: Twenty-two pericardial aspirates were collected aseptically prior to forensic autopsy at Tampere University Hospital during 2009–2010. Of the autopsies, 10 (45.5% were free of coronary artery disease (CAD, 7 (31.8% had mild and 5 (22.7% had severe CAD. Bacterial DNA amounts were determined using real-time quantitative PCR with specific primers and probes for all bacterial strains associated with endodontic disease (Streptococcus mitis group, Streptococcus anginosus group, Staphylococcus aureus/Staphylococcus epidermidis, Prevotella intermedia, Parvimonas micra and periodontal disease (Aggregatibacter actinomycetemcomitans, Porphyromonas gingivalis, Treponema denticola, Fusobacterium nucleatus, and Dialister pneumosintes. Results: Of 22 cases, 14 (63.6% were positive for endodontic and 8 (36.4% for periodontal-disease-associated bacteria. Only one case was positive for bacterial culturing. There was a statistically significant association between the relative amount of bacterial DNA in the pericardial fluid and the severity of CAD (p=0.035. Conclusions: Oral bacterial DNA was detectable in pericardial fluid and an association between the severity of CAD and the total amount of bacterial DNA in pericardial fluid was found, suggesting that this kind of measurement might be useful for clinical purposes.

  11. Defense Primer: A Guide for New Members

    Science.gov (United States)

    2017-03-03

    2 Regular Military Compensation ...Military Compensation CRS In Focus IF10532, Defense Primer: Regular Military Compensation , by Lawrence Kapp Military Pay Raise CRS In Focus...Specialist on Congress and the Legislative Process vheitshusen@crs.loc.gov, 7-8635 Kristy N. Kamarck Analyst in Military Manpower kkamarck@crs.loc.gov

  12. A Primer on Basic Effect Size Concepts.

    Science.gov (United States)

    Elmore, Patricia B.; Rotou, Ourania

    The increased interest in reporting effect sizes means that it is necessary to consider what should be included in a primer on effect sizes. A review of papers on effect sizes and commonly repeated statistical analyses suggests that it is important to discuss effect sizes relative to bivariate correlation, t-tests, analysis of variance/covariance,…

  13. A primer on motor vehicle air pollution.

    Science.gov (United States)

    1973-01-01

    This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...

  14. Scrimer: designing primers from transcriptome data

    Czech Academy of Sciences Publication Activity Database

    Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.

    2015-01-01

    Roč. 15, č. 6 (2015), s. 1415-1420 ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.298, year: 2015

  15. PlasmaDNA: a free, cross-platform plasmid manipulation program for molecular biology laboratories

    Directory of Open Access Journals (Sweden)

    Rainy Jeffrey

    2007-09-01

    Full Text Available Abstract Background Most molecular biology experiments, and the techniques associated with this field of study, involve a great deal of engineering in the form of molecular cloning. Like all forms of engineering, perfect information about the starting material is crucial for successful completion of design and strategies. Results We have generated a program that allows complete in silico simulation of the cloning experiment. Starting with a primary DNA sequence, PlasmaDNA looks for restriction sites, open reading frames, primer annealing sequences, and various common domains. The databases are easily expandable by the user to fit his most common cloning needs. PlasmaDNA can manage and graphically represent multiple sequences at the same time, and keeps in memory the overhangs at the end of the sequences if any. This means that it is possible to virtually digest fragments, to add the digestion products to the project, and to ligate together fragments with compatible ends to generate the new sequences. Polymerase Chain Reaction (PCR fragments can also be virtually generated using the primer database, automatically adding to the fragments any 5' extra sequences present in the primers. Conclusion PlasmaDNA is a program available both on Windows and Apple operating systems, designed to facilitate molecular cloning experiments by building a visual map of the DNA. It then allows the complete planning and simulation of the cloning experiment. It also automatically updates the new sequences generated in the process, which is an important help in practice. The capacity to maintain multiple sequences in the same file can also be used to archive the various steps and strategies involved in the cloning of each construct. The program is freely available for download without charge or restriction.

  16. Rust transformation/rust compatible primers

    Science.gov (United States)

    Emeric, Dario A.; Miller, Christopher E.

    1993-01-01

    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  17. Criticality calculations with MCNP trademark: A primer

    International Nuclear Information System (INIS)

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

    1994-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand

  18. Analysis of the role of PCNA-DNA contacts during clamp loading

    Directory of Open Access Journals (Sweden)

    Goedken Eric R

    2010-01-01

    Full Text Available Abstract Background Sliding clamps, such as Proliferating Cell Nuclear Antigen (PCNA in eukaryotes, are ring-shaped protein complexes that encircle DNA and enable highly processive DNA replication by serving as docking sites for DNA polymerases. In an ATP-dependent reaction, clamp loader complexes, such as the Replication Factor-C (RFC complex in eukaryotes, open the clamp and load it around primer-template DNA. Results We built a model of RFC bound to PCNA and DNA based on existing crystal structures of clamp loaders. This model suggests that DNA would enter the clamp at an angle during clamp loading, thereby interacting with positively charged residues in the center of PCNA. We show that simultaneous mutation of Lys 20, Lys 77, Arg 80, and Arg 149, which interact with DNA in the RFC-PCNA-DNA model, compromises the ability of yeast PCNA to stimulate the DNA-dependent ATPase activity of RFC when the DNA is long enough to extend through the clamp. Fluorescence anisotropy binding experiments show that the inability of the mutant clamp proteins to stimulate RFC ATPase activity is likely caused by reduction in the affinity of the RFC-PCNA complex for DNA. We obtained several crystal forms of yeast PCNA-DNA complexes, measuring X-ray diffraction data to 3.0 Å resolution for one such complex. The resulting electron density maps show that DNA is bound in a tilted orientation relative to PCNA, but makes different contacts than those implicated in clamp loading. Because of apparent partial disorder in the DNA, we restricted refinement of the DNA to a rigid body model. This result contrasts with previous analysis of a bacterial clamp bound to DNA, where the DNA was well resolved. Conclusion Mutational analysis of PCNA suggests that positively charged residues in the center of the clamp create a binding surface that makes contact with DNA. Disruption of this positive surface, which had not previously been implicated in clamp loading function, reduces RFC

  19. Randomly amplified polymorphic DNA-polymerase chain reaction ...

    Indian Academy of Sciences (India)

    Unknown

    The polymorphic DNA markers that were shown to genetically link to a trait of interest could be used for .... 2.3 Primers, markers and amplification conditions. Out of 20 decamer primers (Operon Technologies, ..... and stock structure of school mackerel and spotted mackerel in northern Australian waters; J. Fish Biol. 53 543– ...

  20. SSR marker based DNA fingerprinting and diversity study in rice ...

    African Journals Online (AJOL)

    The genetic diversity and DNA fingerprinting of 15 elite rice genotypes using 30 SSR primers on chromosome numbers 7-12 was investigated. The results revealed that all the primers showed distinct polymorphism among the cultivars studied indicating the robust nature of microsatellites in revealing polymorphism. Cluster ...

  1. Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: xingda@scnu.edu.cn [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)

    2013-01-25

    Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs-TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: Black-Right-Pointing-Pointer A novel method for detection of rotavirus has been developed. Black-Right-Pointing-Pointer In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. Black-Right-Pointing-Pointer To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. Black-Right-Pointing-Pointer The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2 Prime -bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection

  2. Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

    International Nuclear Information System (INIS)

    Zhan Fangfang; Zhou Xiaoming; Xing Da

    2013-01-01

    Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs–TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: ► A novel method for detection of rotavirus has been developed. ► In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. ► To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. ► The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2′-bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs–TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection. In this study, rotavirus in fecal specimens was successfully detected within 1.5 h. Experimental

  3. RAPD analysis of alfalfa DNA mutation via N+ implantation

    International Nuclear Information System (INIS)

    Li Yufeng; Huang Qunce; Yu Zengliang; Liang Yunzhang

    2003-01-01

    Germination capacity of alfalfa seeds under low energy N + implantation manifests oscillations going down with dose strength. From analyzing alfalfa genome DNA under low energy N + implantation by RAPD (Random Amplified Polymorphous DNA), it is recommended that 30 polymorphic DNA fragments be amplified with 8 primers in total 100 primers, and fluorescence intensity of the identical DNA fragment amplified by RAPD is different between CK and treatments. Number of different polymorphic DNA fragments between treatment and CK via N + implantation manifests going up with dose strength

  4. Primer on consumer marketing research : procedures, methods, and tools

    Science.gov (United States)

    1994-03-01

    The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...

  5. Economics : pricing, demand, and economic efficiency : a primer.

    Science.gov (United States)

    2008-11-01

    The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...

  6. Detection of Mycosphaerella graminicola in Wheat Leaves by a Microsatellite Dinucleotide Specific-Primer

    Directory of Open Access Journals (Sweden)

    Joseph-Alexander Verreet

    2011-01-01

    Full Text Available Early detection of infection is very important for efficient management of Mycosphaerella graminicola leaf blotch. To monitor and quantify the occurrence of this fungus during the growing season, a diagnostic method based on real-time PCR was developed. Standard and real-time PCR assays were developed using SYBR Green chemistry to quantify M. graminicola in vitro or in wheat samples. Microsatellite dinucleotide specific-primers were designed based on microsatellite repeats of sequences present in the genome of M. graminicola. Specificity was checked by analyzing DNA of 55 M. graminicola isolates obtained from different geographical origins. The method appears to be highly specific for detecting M. graminicola; no fluorescent signals were observed from 14 other closely related taxa. Primer (CT 7 G amplified a specific amplicon of 570 bp from all M. graminicola isolates. The primers did not amplify DNA extracted from 14 other fungal species. The approximate melting temperature (Tm of the (CT 7 G primer was 84.2 °C. The detection limit of the real-time PCR assay with the primer sets (CT 7 G is 10 fg/25 µL, as compared to 10 pg/25 µL using conventional PCR technology. From symptomless leaves, a PCR fragment could be generated two days after inoculation. Both conventional and real-time PCR could successfully detect the fungus from artificially inoculated wheat leaves. However, real-time PCR appeared much more sensitive than conventional PCR. The developed quantitative real-time PCR method proved to be rapid, sensitive, specific, cost-effective and reliable for the identification and quantification of M. graminicola in wheat.

  7. Identification of Streptococcus parasanguinis DNA contamination in human buccal DNA samples.

    Science.gov (United States)

    Mahfuz, Istiak; Cheng, Wei; White, Stefan J

    2013-11-22

    The use of buccal swabs in clinical and scientific studies is a very popular method of collecting DNA, due to its non-invasive nature of collection. However, contamination of the DNA sample may interfere with analysis. Here we report the finding of Streptococcus parasanguinis bacterial DNA contamination in human buccal DNA samples, which led to preferential amplification of bacterial sequence with PCR primers designed against human sequence. Contamination of buccal-derived DNA with bacterial DNA can be significant, and may influence downstream genetic analysis. One needs to be aware of possible bacterial contamination when interpreting abnormal findings following PCR amplification of buccal swab DNA samples.

  8. Tighter binding of HIV reverse transcriptase to RNA-DNA vs. DNA-DNA results mostly from interactions in the polymerase domain and requires just a small stretch of RNA-DNA*

    OpenAIRE

    Bohlayer, William P.; DeStefano, Jeffrey J.

    2006-01-01

    Binding of HIV reverse transcriptase (RT) to unique substrates that positioned RNA-DNA or DNA-DNA near the polymerase or RNase H domains was measured. The substrates consisted of a 50 nucleotide template and DNA primers ranging from 23–43 nucleotides. Five different types of template strands were used: homogeneous (1) RNA or (2) DNA, (3) first 20 5′ nucleotides DNA and last 30 RNA, (4) first 20 RNA and last 30 DNA, (5) 15 nucleotides DNA followed by 5 RNA then 30 DNA. The different length pri...

  9. A combined HM-PCR/SNuPE method for high sensitive detection of rare DNA methylation

    Directory of Open Access Journals (Sweden)

    Tierling Sascha

    2010-06-01

    Full Text Available Abstract Background DNA methylation changes are widely used as early molecular markers in cancer detection. Sensitive detection and classification of rare methylation changes in DNA extracted from circulating body fluids or complex tissue samples is crucial for the understanding of tumor etiology, clinical diagnosis and treatment. In this paper, we describe a combined method to monitor the presence of methylated tumor DNA in an excess of unmethylated background DNA of non-tumorous cells. The method combines heavy methyl-PCR, which favors preferential amplification of methylated marker sequence from bisulfite-treated DNA with a methylation-specific single nucleotide primer extension monitored by ion-pair, reversed-phase, high-performance liquid chromatography separation. Results This combined method allows detection of 14 pg (that is, four to five genomic copies of methylated chromosomal DNA in a 2000-fold excess (that is, 50 ng of unmethylated chromosomal background, with an analytical sensitivity of > 90%. We outline a detailed protocol for the combined assay on two examples of known cancer markers (SEPT9 and TMEFF2 and discuss general aspects of assay design and data interpretation. Finally, we provide an application example for rapid testing on tumor methylation in plasma DNA derived from a small cohort of patients with colorectal cancer. Conclusion The method allows unambiguous detection of rare DNA methylation, for example in body fluid or DNA isolates from cells or tissues, with very high sensitivity and accuracy. The application combines standard technologies and can easily be adapted to any target region of interest. It does not require costly reagents and can be used for routine screening of many samples.

  10. DNA Barcoding: Amplification and sequence analysis of rbcl and matK genome regions in three divergent plant species

    Directory of Open Access Journals (Sweden)

    Javed Iqbal Wattoo

    2016-11-01

    Full Text Available Background: DNA barcoding is a novel method of species identification based on nucleotide diversity of conserved sequences. The establishment and refining of plant DNA barcoding systems is more challenging due to high genetic diversity among different species. Therefore, targeting the conserved nuclear transcribed regions would be more reliable for plant scientists to reveal genetic diversity, species discrimination and phylogeny. Methods: In this study, we amplified and sequenced the chloroplast DNA regions (matk+rbcl of Solanum nigrum, Euphorbia helioscopia and Dalbergia sissoo to study the functional annotation, homology modeling and sequence analysis to allow a more efficient utilization of these sequences among different plant species. These three species represent three families; Solanaceae, Euphorbiaceae and Fabaceae respectively. Biological sequence homology and divergence of amplified sequences was studied using Basic Local Alignment Tool (BLAST. Results: Both primers (matk+rbcl showed good amplification in three species. The sequenced regions reveled conserved genome information for future identification of different medicinal plants belonging to these species. The amplified conserved barcodes revealed different levels of biological homology after sequence analysis. The results clearly showed that the use of these conserved DNA sequences as barcode primers would be an accurate way for species identification and discrimination. Conclusion: The amplification and sequencing of conserved genome regions identified a novel sequence of matK in native species of Solanum nigrum. The findings of the study would be applicable in medicinal industry to establish DNA based identification of different medicinal plant species to monitor adulteration.

  11. Demystifying eResearch a primer for librarians

    CERN Document Server

    Martin, Victoria

    2014-01-01

    Today's librarians need to be technology-savvy information experts who understand how to manage datasets. Demystifying eResearch: A Primer for Librarians prepares librarians for careers that involve eResearch, clearly defining what it is and how it impacts library services and collections, explaining key terms and concepts, and explaining the importance of the field. You will come to understand exactly how the use of networked computing technologies enhances and supports collaboration and innovative methods particularly in scientific research, learn about eResearch library initiatives and best practices, and recognize the professional development opportunities that eResearch offers. This book takes the broad approach to the complex topic of eResearch and how it pertains to the library community, providing an introduction that will be accessible to readers without a background in electronic research. The author presents a conceptual overview of eResearch with real-world examples of electronic research activit...

  12. Removal of PCR error products and unincorporated primers by metal-chelate affinity chromatography.

    Directory of Open Access Journals (Sweden)

    Indhu Kanakaraj

    Full Text Available Immobilized Metal Affinity Chromatography (IMAC has been used for decades to purify proteins on the basis of amino acid content, especially surface-exposed histidines and "histidine tags" genetically added to recombinant proteins. We and others have extended the use of IMAC to purification of nucleic acids via interactions with the nucleotide bases, especially purines, of single-stranded RNA and DNA. We also have demonstrated the purification of plasmid DNA from contaminating genomic DNA by IMAC capture of selectively-denatured genomic DNA. Here we describe an efficient method of purifying PCR products by specifically removing error products, excess primers, and unincorporated dNTPs from PCR product mixtures using flow-through metal-chelate affinity adsorption. By flowing a PCR product mixture through a Cu(2+-iminodiacetic acid (IDA agarose spin column, 94-99% of the dNTPs and nearly all the primers can be removed. Many of the error products commonly formed by Taq polymerase also are removed. Sequencing of the IMAC-processed PCR product gave base-calling accuracy comparable to that obtained with a commercial PCR product purification method. The results show that IMAC matrices (specifically Cu(2+-IDA agarose can be used for the purification of PCR products. Due to the generality of the base-specific mechanism of adsorption, IMAC matrices may also be used in the purification of oligonucleotides, cDNA, mRNA and micro RNAs.

  13. Bioinformatic tools and guideline for PCR primer design | Abd ...

    African Journals Online (AJOL)

    Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...

  14. Dimerization of the Klenow fragment of Escherichia coli DNA polymerase I is linked to its mode of DNA binding.

    Science.gov (United States)

    Bailey, Michael F; Van der Schans, Edwin J C; Millar, David P

    2007-07-10

    Upon associating with a proofreading polymerase, the nascent 3' end of a DNA primer/template has two possible fates. Depending upon its suitability as a substrate for template-directed extension or postsynthetic repair, it will bind either to the 5'-3' polymerase active site, yielding a polymerizing complex, or to the 3'-5' exonuclease site, yielding an editing complex. In this investigation, we use a combination of biochemical and biophysical techniques to probe the stoichiometry, thermodynamic, and kinetic stability of the polymerizing and editing complexes. We use the Klenow fragment of Escherichia coli DNA polymerase I (KF) as a model proofreading polymerase and oligodeoxyribonucleotide primer/templates as model DNA substrates. Polymerizing complexes are produced by mixing KF with correctly base paired (matched) primer/templates, whereas editing complexes are produced by mixing KF with multiply mismatched primer/templates. Electrophoretic mobility shift titrations carried out with matched and multiply mismatched primer/templates give rise to markedly different electrophoretic patterns. In the case of the matched primer/template, the KF.DNA complex is represented by a slow moving band. However, in the case of the multiply mismatched primer/template, the complex is predominantly represented by a fast moving band. Analytical ultracentrifugation measurements indicate that the fast and slow moving bands correspond to 1:1 and 2:1 KF.DNA complexes, respectively. Fluorescence anisotropy titrations reveal that KF binds with a higher degree of cooperativity to the matched primer/template. Taken together, these results indicate that KF is able to dimerize on a DNA primer/template and that dimerization is favored when the first molecule is bound in the polymerizing mode, but disfavored when it is bound in the editing mode. We suggest that self-association of the polymerase may play an important and as yet unexplored role in coordinating high-fidelity DNA replication.

  15. DNA fusion gene vaccines

    DEFF Research Database (Denmark)

    Holst, Peter Johannes; Bassi, Maria Rosaria; Thomsen, Allan Randrup

    2010-01-01

    DNA vaccines are versatile and safe, but limited immunogenicity has prevented their use in the clinical setting. Experimentally, immunogenicity may be enhanced by the use of new delivery technologies, by coadministration of cytokines and pathogen-associated molecular patterns, or by fusion...... of antigens into molecular domains that enhance antigen presentation. More specifically, the immunogenicity of DNA vaccines may benefit from increased protein synthesis, increased T-cell help and MHC class I presentation, and the addition of a range of specific cytokines and pathogen-associated molecular...... with these modifications, it is likely that the primary use of DNA vaccines may be as primers for viral-vectored vaccines, rather than as single agents. This review discusses the approaches used to enhance DNA vaccine immunogenicity, with a primary focus on fusion strategies that enhance antigen presentation....

  16. Method for priming and DNA sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Mugasimangalam, R.C.; Ulanovsky, L.E.

    1997-12-01

    A method is presented for improving the priming specificity of an oligonucleotide primer that is non-unique in a nucleic acid template which includes selecting a continuous stretch of several nucleotides in the template DNA where one of the four bases does not occur in the stretch. This also includes bringing the template DNA in contract with a non-unique primer partially or fully complimentary to the sequence immediately upstream of the selected sequence stretch. This results in polymerase-mediated differential extension of the primer in the presence of a subset of deoxyribonucleotide triphosphates that does not contain the base complementary to the base absent in the selected sequence stretch. These reactions occur at a temperature sufficiently low for allowing the extension of the non-unique primer. The method causes polymerase-mediated extension reactions in the presence of all four natural deoxyribonucleotide triphosphates or modifications. At this high temperature discrimination occurs against priming sites of the non-unique primer where the differential extension has not made the primer sufficiently stable to prime. However, the primer extended at the selected stretch is sufficiently stable to prime.

  17. Molecular cloning and characterization of a cDNA encoding ...

    African Journals Online (AJOL)

    enoh

    2012-03-29

    Nanjing) co., Ltd. The nucleotide sequences of these primers are as follows: ..... Ebizuka Y (2000). Molecular cloning and characterization of a cDNA for Glycyrrhiza glabra cycloartenol synthase. Biol. Pharm. Bull. 23(2):231-234.

  18. Cloning, sequencing and expression of cDNA encoding growth ...

    Indian Academy of Sciences (India)

    Using polymerase chain reaction (PCR) primers representing the conserved regions of fish GH sequences the 3′ region of catfish GH cDNA (540 bp) was cloned by random amplification of cDNA ends and the clone was used as a probe to isolate recombinant phages carrying the full-length cDNA sequence. The full-length ...

  19. Molecular architecture and function of adenovirus DNA polymerase

    NARCIS (Netherlands)

    Brenkman, A.B. (Arjan Bernard)

    2002-01-01

    Central to this thesis is the role of adenovirus DNA polymerase (Ad pol) in adenovirus DNA replication. Ad pol is a member of the family B DNA polymerases but belongs to a distinct subclass of polymerases that use a protein as primer. As Ad pol catalyses both the initiation and elongation phases and

  20. Improved detection of small deletions in complex pools of DNA

    Science.gov (United States)

    Edgley, Mark; D’Souza, Anil; Moulder, Gary; McKay, Sheldon; Shen, Bin; Gilchrist, Erin; Moerman, Donald; Barstead, Robert

    2002-01-01

    About 40% of the genes in the nematode Caenorhabditis elegans have homologs in humans. Based on the history of this model system, it is clear that the application of genetic methods to the study of this set of genes would provide important clues to their function in humans. To facilitate such genetic studies, we are engaged in a project to derive deletion alleles in every gene in this set. Our standard methods make use of nested PCR to hunt for animals in mutagenized populations that carry deletions at a given locus. The deletion bearing animals exist initially in mixed populations where the majority of the animals are wild type at the target. Therefore, the production of the PCR fragment representing the deletion allele competes with the production of the wild type fragment. The size of the deletion fragment relative to wild type determines whether it can compete to a level where it can be detected above the background. Using our standard conditions, we have found that when the deletion is 600 bp, they do not work well to detect mutants with smaller deletions. Here we report a new strategy to detect small deletion alleles in complex DNA pools. Our new strategy is a modification of our standard PCR based screens. In the first round of the nested PCR, we include a third PCR primer between the two external primers. The presence of this third primer leads to the production of three fragments from wild type DNA. We configure the system so that two of these three fragments cannot serve as a template in the second round of the nested PCR. The addition of this third primer, therefore, handicaps the amplification from wild type template. On the other hand, the amplification of mutant fragments where the binding site for the third primer is deleted is unabated. Overall, we see at least a 500-fold increase in the sensitivity for small deletion fragments using our new method. Using this new method, we report the recovery of new deletion alleles within 12 C.elegans genes. PMID

  1. Status of NC Primer Demonstration & Transition

    Science.gov (United States)

    2014-11-20

    skid coating – Navy facilities- plan to assess as alternative to zinc-rich primers – General: internal funding in place through at least 2019 to...Strippability 5. Dry Time (-23377) 6. Fluid Resistance (Skydrol) 7. Solvent Resistance 8. Thickness Tolerance 9. Application Method 10. Packaging (1K... Resistance (Skydrol) 7. Color Matching 8. Solvent Resistance 9. Thickness Tolerance 10. Application Method 11. Packaging 31 Questions?

  2. Single-nucleotide polymorphisms may cause erroneous results in primer-introduced restriction enzyme analyses: a case of molecular misdiagnosis of homozygous vs heterozygous familial hypercholesterolemia.

    Science.gov (United States)

    Vuorio, A F; Paulin, L; Saltevo, J; Kontula, K

    1999-12-01

    PCR amplification followed by a primer introduced restriction analysis PCR (PIRA-PCR) is a widely used method to detect point mutations. Usually the artificial RFLP is created by siting one nucleotide mismatch near the 3; end of the primer. This does not alter the hybrization of the primer to the target DNA sequence. Unfortunately, unexpected single nucleotide polymorphisms (SNPs) may lead to additional mismatches and result in no amplification of the allele having unexpected SNP. We describe a warning example in which heterozygous familial hypercholesterolemia patient had an unexpected SNP and this led to his misdiagnosis. Copyright 1999 Academic Press.

  3. Optimization Of ISSR Markers For DNA Fingerprinting In Stevia Rebaudiana Bertoni

    International Nuclear Information System (INIS)

    Lyena Watty Zuraine Ahmad; Lyena Watty Zuraine Ahmad; Azhar Mohamad; Mohamad Osman; Zarina Zainuddin; Fatin Izzati Mohd Khari

    2014-01-01

    ISSR or inter-simple sequence repeat is PCR based markers which required no prior DNA sequence knowledge of the studied organism. It has been proved to overcome limitations in other genetic marker techniques. In this study, 100 ISSR primers which comprised of 80 specific primers and 20 degenerate primers were used. All of the primers were tested on gradient temperatures from 45-55 degree Celsius. For positive amplification, 62 specific primers (77.5 %) and 18 degenerate primers (90.0 %) were recorded as working primers. The most efficient temperature for 25 primers was 55 degree Celsius. Marker derived from ISSR profiling is a powerful approach for identification and molecular classification of Stevia rebaudiana bertoni. (author)

  4. SDM-Assist software to design site-directed mutagenesis primers introducing "silent" restriction sites.

    Science.gov (United States)

    Karnik, Abhijit; Karnik, Rucha; Grefen, Christopher

    2013-03-22

    Over the past decades site-directed mutagenesis (SDM) has become an indispensable tool for biological structure-function studies. In principle, SDM uses modified primer pairs in a PCR reaction to introduce a mutation in a cDNA insert. DpnI digestion of the reaction mixture is used to eliminate template copies before amplification in E. coli; however, this process is inefficient resulting in un-mutated clones which can only be distinguished from mutant clones by sequencing. We have developed a program - 'SDM-Assist' which creates SDM primers adding a specific identifier: through additional silent mutations a restriction site is included or a previous one removed which allows for highly efficient identification of 'mutated clones' by a simple restriction digest. The direct identification of SDM clones will save time and money for researchers. SDM-Assist also scores the primers based on factors such as Tm, GC content and secondary structure allowing for simplified selection of optimal primer pairs.

  5. Development of strain-specific PCR primers for the identification of Fusobacterium nucleatum subsp. fusiforme ATCC 51190(T) and subsp. vincentii ATCC 49256(T).

    Science.gov (United States)

    Shin, Hwan Seon; Kim, Min-Jung; Kim, Hwa-Sook; Park, Soon-Nang; Kim, Do Kyung; Baek, Dong-Heon; Kim, Chan; Kook, Joong-Ki

    2010-02-01

    The objective of this study was to develop the strain-specific PCR primers for Fusobacterium nucleatum subsp. fusiforme ATCC 51190(T) and F. nucleatum subsp. vincentii ATCC 49256(T) based on the nucleotide sequence of the Fs17 and Fv35 DNA probes, respectively. The strain specificity was tested against 10 type strains of Fusobacterium spp. or subsp., 21 clinical isolates of F. nucleatum from Koreans, and five type strains of distinct Fusobacterium species. Primer sensitivity was determined by testing serial dilutions (4 ng-4 fg) of the purified genomic DNA from each of the type strains. PCR showed that two pairs of PCR primers, Fs17-F14/Fs17-R14 and Fv35-F1/Fv35-R1 primers, could produce strain-specific amplicons from F. nucleatum subsp. fusiforme ATCC 51190(T) and F. nucleatum subsp. vincentii ATCC 49256(T), respectively. The two PCR primer sets could detect as little as 0.4 pg or 4 pg of the genomic DNA of each target strain. These results suggest that the two sets of PCR primers could be used to identify F. nucleatum subsp. fusiforme ATCC 51190(T) and F. nucleatum subsp. vincentii ATCC 49256(T), particularly for ascertaining the authenticity of the strain. 2009 Elsevier Ltd. All rights reserved.

  6. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

    Science.gov (United States)

    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

    2015-07-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

  7. Impact of DNA3'pp5'G capping on repair reactions at DNA 3' ends.

    Science.gov (United States)

    Das, Ushati; Chauleau, Mathieu; Ordonez, Heather; Shuman, Stewart

    2014-08-05

    Many biological scenarios generate "dirty" DNA 3'-PO4 ends that cannot be sealed by classic DNA ligases or extended by DNA polymerases. The noncanonical ligase RtcB can "cap" these ends via a unique chemical mechanism entailing transfer of GMP from a covalent RtcB-GMP intermediate to a DNA 3'-PO4 to form DNA3'pp5'G. Here, we show that capping protects DNA 3' ends from resection by Escherichia coli exonucleases I and III and from end-healing by T4 polynucleotide 3' phosphatase. By contrast, the cap is an effective primer for DNA synthesis. E. coli DNA polymerase I and Mycobacterium DinB1 extend the DNAppG primer to form an alkali-labile DNApp(rG)pDNA product. The addition of dNTP depends on pairing of the cap guanine with an opposing cytosine in the template strand. Aprataxin, an enzyme implicated in repair of A5'pp5'DNA ends formed during abortive ligation by classic ligases, is highly effective as a DNA 3' decapping enzyme, converting DNAppG to DNA3'p and GMP. We conclude that the biochemical impact of DNA capping is to prevent resection and healing of a 3'-PO4 end, while permitting DNA synthesis, at the price of embedding a ribonucleotide and a pyrophosphate linkage in the repaired strand. Aprataxin affords a means to counter the impact of DNA capping.

  8. Detection of cutaneous and genital HPV types in clinical samples by PCR using consensus primers

    NARCIS (Netherlands)

    Tieben, L. M.; ter Schegget, J.; Minnaar, R. P.; Bouwes Bavinck, J. N.; Berkhout, R. J.; Vermeer, B. J.; Jebbink, M. F.; Smits, H. L.

    1993-01-01

    Two sets of consensus PCR primers consisting of a common 3' primer CP-I and two 5'-primers, CP-IIG (primer set A) and CP-IIS (primer set B), in the E1 open reading frame of the human papillomavirus (HPV) genome are presented. These two primer sets enabled the detection of a 188 base pair (bp)

  9. Shotgun metagenomes and multiple primer pair-barcode combinations of amplicons reveal biases in metabarcoding analyses of fungi

    Directory of Open Access Journals (Sweden)

    Leho Tedersoo

    2015-05-01

    Full Text Available Rapid development of high-throughput (HTS molecular identification methods has revolutionized our knowledge about taxonomic diversity and ecology of fungi. However, PCR-based methods exhibit multiple technical shortcomings that may bias our understanding of the fungal kingdom. This study was initiated to quantify potential biases in fungal community ecology by comparing the relative performance of amplicon-free shotgun metagenomics and amplicons of nine primer pairs over seven nuclear ribosomal DNA (rDNA regions often used in metabarcoding analyses. The internal transcribed spacer (ITS barcodes ITS1 and ITS2 provided greater taxonomic and functional resolution and richness of operational taxonomic units (OTUs at the 97% similarity threshold compared to barcodes located within the ribosomal small subunit (SSU and large subunit (LSU genes. All barcode-primer pair combinations provided consistent results in ranking taxonomic richness and recovering the importance of floristic variables in driving fungal community composition in soils of Papua New Guinea. The choice of forward primer explained up to 2.0% of the variation in OTU-level analysis of the ITS1 and ITS2 barcode data sets. Across the whole data set, barcode-primer pair combination explained 37.6–38.1% of the variation, which surpassed any environmental signal. Overall, the metagenomics data set recovered a similar taxonomic overview, but resulted in much lower fungal rDNA sequencing depth, inability to infer OTUs, and high uncertainty in identification. We recommend the use of ITS2 or the whole ITS region for metabarcoding and we advocate careful choice of primer pairs in consideration of the relative proportion of fungal DNA and expected dominant groups.

  10. Modified Proofreading PCR for Detection of Point Mutations, Insertions and Deletions Using a ddNTP-Blocked Primer

    Science.gov (United States)

    Chen, Qianqian; Chen, Xiaoxiang; Zhang, Sichao; Lan, Ke; Lu, Jian; Zhang, Chiyu

    2015-01-01

    The development of simple, accurate, rapid and cost-effective technologies for mutation detection is crucial to the early diagnosis and prevention of numerous genetic diseases, pharmacogenetics, and drug resistance. Proofreading PCR (PR-PCR) was developed for mutation detection in 1998 but is rarely applied due to its low efficiency in allele discrimination. Here we developed a modified PR-PCR method using a ddNTP-blocked primer and a mixture of DNA polymerases with and without the 3'-5' proofreading function. The ddNTP-blocked primer exhibited the best blocking efficiency to avoid nonspecific primer extension while the mixture of a tiny amount of high-fidelity DNA polymerase with a routine amount of Taq DNA polymerase provided the best discrimination and amplification effects. The modified PR-PCR method is quite capable of detecting various mutation types, including point mutations and insertions/deletions (indels), and allows discrimination amplification when the mismatch is located within the last eight nucleotides from the 3'-end of the ddNTP-blocked primer. The modified PR-PCR has a sensitivity of 1-5 × 102 copies and a selectivity of 5 × 10-5 mutant among 107 copies of wild-type DNA. It showed a 100% accuracy rate in the detection of P72R germ-line mutation in the TP53 gene among 60 clinical blood samples, and a high potential to detect rifampin-resistant mutations at low frequency in Mycobacterium tuberculosis using an adaptor and a fusion-blocked primer. These results suggest that the modified PR-PCR technique is effective in detection of various mutations or polymorphisms as a simple, sensitive and promising approach. PMID:25915410

  11. Applied Ecosystem Analysis - - a Primer : EDT the Ecosystem Diagnosis and Treatment Method.

    Energy Technology Data Exchange (ETDEWEB)

    Lestelle, Lawrence C.; Mobrand, Lars E.

    1996-05-01

    The aim of this document is to inform and instruct the reader about an approach to ecosystem management that is based upon salmon as an indicator species. It is intended to provide natural resource management professionals with the background information needed to answer questions about why and how to apply the approach. The methods and tools the authors describe are continually updated and refined, so this primer should be treated as a first iteration of a sequentially revised manual.

  12. Applied ecosystem analysis - a primer; the ecosystem diagnosis and treatment method

    International Nuclear Information System (INIS)

    Lestelle, L.C.; Mobrand, L.E.; Lichatowich, J.A.; Vogel, T.S.

    1996-05-01

    The aim of this document is to inform and instruct the reader about an approach to ecosystem management that is based upon salmon as an indicator species. It is intended to provide natural resource management professionals with the background information needed to answer questions about why and how to apply the approach. The methods and tools the authors describe are continually updated and refined, so this primer should be treated as a first iteration of a sequentially revised manual

  13. Background sources at PEP

    International Nuclear Information System (INIS)

    Lynch, H.; Schwitters, R.F.; Toner, W.T.

    1988-01-01

    Important sources of background for PEP experiments are studied. Background particles originate from high-energy electrons and positrons which have been lost from stable orbits, γ-rays emitted by the primary beams through bremsstrahlung in the residual gas, and synchrotron radiation x-rays. The effect of these processes on the beam lifetime are calculated and estimates of background rates at the interaction region are given. Recommendations for the PEP design, aimed at minimizing background are presented. 7 figs., 4 tabs

  14. Alu polymerase chain reaction: A method for rapid isolation of human-specific sequences from complex DNA sources

    International Nuclear Information System (INIS)

    Nelson, D.L.; Ledbetter, S.A.; Corbo, L.; Victoria, M.F.; Ramirez-Solis, R.; Webster, T.D.; Ledbetter, D.H.; Caskey, C.T.

    1989-01-01

    Current efforts to map the human genome are focused on individual chromosomes or smaller regions and frequently rely on the use of somatic cell hybrids. The authors report the application of the polymerase chain reaction to direct amplification of human DNA from hybrid cells containing regions of the human genome in rodent cell backgrounds using primers directed to the human Alu repeat element. They demonstrate Alu-directed amplification of a fragment of the human HPRT gene from both hybrid cell and cloned DNA and identify through sequence analysis the Alu repeats involved in this amplification. They also demonstrate the application of this technique to identify the chromosomal locations of large fragments of the human X chromosome cloned in a yeast artificial chromosome and the general applicability of the method to the preparation of DNA probes from cloned human sequences. The technique allows rapid gene mapping and provides a simple method for the isolation and analysis of specific chromosomal regions

  15. Signals and systems primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2006-01-01

    Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,

  16. Primer Concilio Provincial del Nuevo Reino

    Directory of Open Access Journals (Sweden)

    Manuel Lucena Salmoral

    1963-01-01

    Full Text Available El acontecimiento más sobresaliente del patriarcado de don Fernando Arias de Ugarte, en el que hubo muchos notables, fue el Primer Concilio Provincial del Nuevo Reino de Granada, celebrado en el año 1623. Cumplió así una vieja aspiración de los arzobispos santafereños y la obligación impuesta en el Concilio de Trento, por lo que resulta incomprensible lo historiado por don José Antonio Plaza quien, al referirse a este hecho, dice lo siguiente...

  17. Bayesian models a statistical primer for ecologists

    CERN Document Server

    Hobbs, N Thompson

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods-in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach. Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probabili

  18. Ancient DNA

    DEFF Research Database (Denmark)

    Willerslev, Eske; Cooper, Alan

    2004-01-01

    ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair......ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair...

  19. An Introduction to DNA Fingerprinting.

    Science.gov (United States)

    Hepfer, Carol Ely; And Others

    1993-01-01

    Provides background information on DNA fingerprinting, and describes exercises for introducing general biology students at the high school or college level to the methodology and applications of DNA fingerprinting. (PR)

  20. Identification of Acinetobacter baumannii via amplified ribosomal DNA restriction analysis

    Directory of Open Access Journals (Sweden)

    Delsuz Rezaei

    2014-02-01

    Full Text Available Background: Acinetobacter baumannii is a multi-resistant opportunistic nosocomial pathogen responsible for hospital outbreaks worldwide. In addition to common microscopic and biochemical methods, the Amplified Ribosomal DNA Restriction Analysis (ARDRA was tested to identify Acinetobacter genomic species (DNA groups. Methods: In this study, standard biochemical tests were used for identification of isolates. The genomic species of Acinetobacter spp. was confirmed by Amplified Ribosomal DNA Restriction Analysis (ARDRA. PCR products of 16S rRNA were digested with AluI, MboI and HhaI restriction enzymes. Results: ARDRA proved to be a rapid and reliable method for identification of Acinetobacter baumannii (genome species 2 of the Acinetobacter genomic species, including the closely related genomic species (genomic species 1 (A. calcoaceticus, 2 (A. baumannii, 3, and TU13. Conclusion: The results of this study suggested that ARDRA with AluI, MboI and HhaI restriction enzymes can be used for identificationof A. baumannii which may help to elucidate the ecology and clinical significance of different species of this genus. Since ARDRA is performed by universal primers of 16S rDNA gene, it is expected to be applicable to identifying most bacterial species.

  1. Primer on CDM programme of activities

    Energy Technology Data Exchange (ETDEWEB)

    Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

    2009-07-01

    As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

  2. Bayesian models: A statistical primer for ecologists

    Science.gov (United States)

    Hobbs, N. Thompson; Hooten, Mevin B.

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods—in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach.Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probability and develops a step-by-step sequence of connected ideas, including basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and inference from single and multiple models. This unique book places less emphasis on computer coding, favoring instead a concise presentation of the mathematical statistics needed to understand how and why Bayesian analysis works. It also explains how to write out properly formulated hierarchical Bayesian models and use them in computing, research papers, and proposals.This primer enables ecologists to understand the statistical principles behind Bayesian modeling and apply them to research, teaching, policy, and management.Presents the mathematical and statistical foundations of Bayesian modeling in language accessible to non-statisticiansCovers basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and moreDeemphasizes computer coding in favor of basic principlesExplains how to write out properly factored statistical expressions representing Bayesian models

  3. Single primer amplification reaction (SPAR) methods reveal subsequent increase in genetic variations in micropropagated plants of Nepenthes khasiana Hook. f. maintained for three consecutive regenerations.

    Science.gov (United States)

    Devi, Soibam Purnima; Kumaria, Suman; Rao, Satyawada Rama; Tandon, Pramod

    2014-03-15

    The genetic fidelity of in vitro-raised plants of three successive regenerations of Nepenthes khasiana Hook. f. was assessed using three different single primer amplification reaction (SPAR) methods, viz., random amplified polymorphic DNA (RAPD), inter-simple sequence repeat (ISSR) and direct amplification of minisatellite DNA region (DAMD) markers. Out of 80 RAPD primers screened, 14 primers reflected a genetic variation of 4.1% in the first regeneration which was increased to 9.4% in the third regeneration. In the case of ISSR, out of 36 primers screened for assessment of genetic homogeneity of the regenerated plantlets, 12 primers showed an increase of genetic variation from 4.3% to 10% from the first to the third regenerations. In DAMD profiling, 15 primers were used for the evaluation of genetic fidelity where 8.47% of polymorphism was observed in the first regeneration which was increased to 13.33% in the third regeneration. The cumulative analysis reflected a genetic variation of 5.65% in the first regeneration which increased subsequently to 7.77% in the second regeneration and 10.87% in the third regeneration. The present study demonstrates SPAR technique to be an efficient tool for the assessment of clonal fidelity of in vitro-raised plants. Copyright © 2014 Elsevier B.V. All rights reserved.

  4. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    Energy Technology Data Exchange (ETDEWEB)

    Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.

    2013-06-28

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

  5. Comparison of pectin-degrading fungal communities in temperate forests using glycosyl hydrolase family 28 pectinase primers targeting Ascomycete fungi.

    Science.gov (United States)

    Gacura, Matthew D; Sprockett, Daniel D; Heidenreich, Bess; Blackwood, Christopher B

    2016-04-01

    Fungi have developed a wide assortment of enzymes to break down pectin, a prevalent polymer in plant cell walls that is important in plant defense and structure. One enzyme family used to degrade pectin is the glycosyl hydrolase family 28 (GH28). In this study we developed primers for the amplification of GH28 coding genes from a database of 293 GH28 sequences from 40 fungal genomes. The primers were used to successfully amplify GH28 pectinases from all Ascomycota cultures tested, but only three out of seven Basidiomycota cultures. In addition, we further tested the primers in PCRs on metagenomic DNA extracted from senesced tree leaves from different forest ecosystems, followed by cloning and sequencing. Taxonomic specificity for Ascomycota GH28 genes was tested by comparing GH28 composition in leaves to internal transcribed spacer (ITS) amplicon composition using pyrosequencing. All sequences obtained from GH28 primers were classified as Ascomycota; in contrast, ITS sequences indicated that fungal communities were up to 39% Basidiomycetes. Analysis of leaf samples indicated that both forest stand and ecosystem type were important in structuring fungal communities. However, site played the prominent role in explaining GH28 composition, whereas ecosystem type was more important for ITS composition, indicating possible genetic drift between populations of fungi. Overall, these primers will have utility in understanding relationships between fungal community composition and ecosystem processes, as well as detection of potentially pathogenic Ascomycetes. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Molecular diagnosis of cryptococcal meningitis in cerebrospinal fluid: comparison of primer sets for Cryptococcus neoformans and Cryptococcus gattii species complex.

    Science.gov (United States)

    Martins, Marilena dos Anjos; Brighente, Kate Bastos Santos; Matos, Terezinha Aparecida de; Vidal, Jose Ernesto; Hipólito, Daise Damaris Carnietto de; Pereira-Chioccola, Vera Lucia

    2015-01-01

    This study evaluated the use of polymerase chain reaction for cryptococcal meningitis diagnosis in clinical samples. The sensitivity and specificity of the methodology were evaluated using eight Cryptococcus neoformans/C. gattii species complex reference strains and 165 cerebrospinal fluid samples from patients with neurological diseases divided into two groups: 96 patients with cryptococcal meningitis and AIDS; and 69 patients with other neurological opportunistic diseases (CRL/AIDS). Two primer sets were tested (CN4-CN5 and the multiplex CNa70S-CNa70A/CNb49S-CNb-49A that amplify a specific product for C. neoformans and another for C. gattii). CN4-CN5 primer set was positive in all Cryptococcus standard strains and in 94.8% in DNA samples from cryptococcal meningitis and AIDS group. With the multiplex, no 448-bp product of C. gattii was observed in the clinical samples of either group. The 695bp products of C. neoformans were observed only in 64.6% of the cryptococcal meningitis and AIDS group. This primer set was negative for two standard strains. The specificity based on the negative samples from the CTL/AIDS group was 98.5% in both primer sets. These data suggest that the CN4/CN5 primer set was highly sensitive for the identification of C. neoformans/C. gattii species complex in cerebrospinal fluid samples from patients with clinical suspicion of cryptococcal meningitis. Copyright © 2014 Elsevier Editora Ltda. All rights reserved.

  7. Selection of a set of specific primers for the identification of Tuber rufum: a truffle species with high genetic variability.

    Science.gov (United States)

    Iotti, Mirco; Amicucci, Antonella; Bonito, Gregory; Bonuso, Enrico; Stocchi, Vilberto; Zambonelli, Alessandra

    2007-12-01

    Tuber rufum is a truffle widely distributed throughout Europe, which forms mycorrhizal associations with numerous species of broadleaf and coniferous trees. The possibility of T. rufum contamination in commercial truffle-infected plants makes its detection important. To facilitate the identification of T. rufum from mycorrhiza and fruitbodies, species-specific primers were designed and tested. To overcome the high intraspecific genetic variability within the internal transcribed spacer (ITS) regions of T. rufum, as demonstrated by phylogenetic analysis, two forward primers, Ru1f and Ru2f, located on the ITS1 region were designed to be used in concert with the reverse primer ITS4. Only T. rufum was amplified with this primer combination, while DNA of Tuber magnatum, Tuber brumale, Tuber maculatum, Tuber borchii, Tuber excavatum and Tuber melanosporum was not. These primers give a specific amplicon ranging between 566 and 572 bp and are able to discriminate between T. rufum, T. borchii and T. magnatum in multiplex PCR. In addition, T. rufum-specific amplicons were obtained from both spore suspensions and mycorrhiza by direct PCR. Tuber rufum mycorrhiza obtained in the greenhouse using mycelial inoculation techniques had morphological features similar to those of other species of Tuber, stressing the importance of molecular tools for their identification.

  8. Great Lakes rivermouths: a primer for managers

    Science.gov (United States)

    Pebbles, Victoria; Larson, James; Seelbach, Paul; Pebbles, Victoria; Larson, James; Seelbach, Paul

    2013-01-01

    Between the North American Great Lakes and their tributaries are the places where the confluence of river and lake waters creates a distinct ecosystem: the rivermouth ecosystem. Human development has often centered around these rivermouths, in part, because they provide a rich array of ecosystem services. Not surprisingly, centuries of intense human activity have led to substantial pressures on, and alterations to, these ecosystems, often diminishing or degrading their ecological functions and associated ecological services. Many Great Lakes rivermouths are the focus of intense restoration efforts. For example, 36 of the active Great Lakes Areas of Concern (AOCs) are rivermouths or areas that include one or more rivermouths. Historically, research of rivermouth ecosystems has been piecemeal, focused on the Great Lakes proper or on the upper reaches of tributaries, with little direct study of the rivermouth itself. Researchers have been divided among disciplines, agencies and institutions; and they often work independently and use disparate venues to communicate their work. Management has also been fragmented with a focus on smaller, localized, sub-habitat units and socio-political or economic elements, rather than system-level consideration. This Primer presents the case for a more holistic approach to rivermouth science and management that can enable restoration of ecosystem services with multiple benefits to humans and the Great Lakes ecosystem. A conceptual model is presented with supporting text that describes the structures and processes common to all rivermouths, substantiating the case for treating these ecosystems as an identifiable class.1 Ecological services provided by rivermouths and changes in how humans value those services over time are illustrated through case studies of two Great Lakes rivermouths—the St. Louis River and the Maumee River. Specific ecosystem services are identified in italics throughout this Primer and follow definitions described

  9. Estimating intraspecific genetic diversity from community DNA metabarcoding data

    Directory of Open Access Journals (Sweden)

    Vasco Elbrecht

    2018-04-01

    Full Text Available Background DNA metabarcoding is used to generate species composition data for entire communities. However, sequencing errors in high-throughput sequencing instruments are fairly common, usually requiring reads to be clustered into operational taxonomic units (OTUs, losing information on intraspecific diversity in the process. While Cytochrome c oxidase subunit I (COI haplotype information is limited in resolving intraspecific diversity it is nevertheless often useful e.g. in a phylogeographic context, helping to formulate hypotheses on taxon distribution and dispersal. Methods This study combines sequence denoising strategies, normally applied in microbial research, with additional abundance-based filtering to extract haplotype information from freshwater macroinvertebrate metabarcoding datasets. This novel approach was added to the R package “JAMP” and can be applied to COI amplicon datasets. We tested our haplotyping method by sequencing (i a single-species mock community composed of 31 individuals with 15 different haplotypes spanning three orders of magnitude in biomass and (ii 18 monitoring samples each amplified with four different primer sets and two PCR replicates. Results We detected all 15 haplotypes of the single specimens in the mock community with relaxed filtering and denoising settings. However, up to 480 additional unexpected haplotypes remained in both replicates. Rigorous filtering removes most unexpected haplotypes, but also can discard expected haplotypes mainly from the small specimens. In the monitoring samples, the different primer sets detected 177–200 OTUs, each containing an average of 2.40–3.30 haplotypes per OTU. The derived intraspecific diversity data showed population structures that were consistent between replicates and similar between primer pairs but resolution depended on the primer length. A closer look at abundant taxa in the dataset revealed various population genetic patterns, e.g. the stonefly

  10. Comparison of ten different DNA extraction procedures with respect to their suitability for environmental samples.

    Science.gov (United States)

    Kuhn, Ramona; Böllmann, Jörg; Krahl, Kathrin; Bryant, Isaac Mbir; Martienssen, Marion

    2017-12-01

    DNA extraction for molecular biological applications usually requires target optimized extraction procedures depending on the origin of the samples. For environmental samples, a range of different procedures has been developed. We compared the applicability and efficiency of ten selected DNA extraction methods published in recent literature using four different environmental samples namely: activated sludge from a domestic wastewater treatment plant, river sediment, anaerobic digestion sludge and nitrifying enrichment culture. We assessed the suitability of the extraction procedures based on both DNA yield and quality. DNA quantification was performed by both ultra violet (UV) spectrophotometry and fluorescence spectrophotometry after staining with PicoGreen. In our study, DNA yields based on UV measurement were overestimated in most cases while DNA yields from fluorescence measurements correlated well with the sample load on agarose gels of crude DNA. The quality of the DNA extracts was determined by gel electrophoresis of crude DNA and PCR products from 16S rDNA with the universal primer set 27f/1525r. It was observed that gel electrophoresis of crude DNA was not always suitable to evaluate DNA integrity and purity since interfering background substances (e.g. humic substances) were not visible. Therefore, we strongly recommend examining the DNA quality of both crude DNA and 16S rDNA PCR products by gel electrophoresis when a new extraction method is established. Summarizing, we found four out of ten extraction procedures being applicable to all tested samples without noticeable restrictions. The procedure G (according to the standard method 432_10401 of the Lower Saxony State Office for Consumer Protection and Food Safety) had the broadest application range over procedure J (published by Wilson, 2001). These were followed by procedures F (Singka et al., 2012) and A (Bourrain et al., 1999). All four extraction procedures delivered reliable and reproducible crude

  11. Complex and Adaptive Dynamical Systems A Primer

    CERN Document Server

    Gros, Claudius

    2011-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  12. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2007-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  13. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2013-01-01

    Complex system theory is rapidly developing and gaining importance, providing tools and concepts central to our modern understanding of emergent phenomena. This primer offers an introduction to this area together with detailed coverage of the mathematics involved. All calculations are presented step by step and are straightforward to follow. This new third edition comes with new material, figures and exercises. Network theory, dynamical systems and information theory, the core of modern complex system sciences, are developed in the first three chapters, covering basic concepts and phenomena like small-world networks, bifurcation theory and information entropy. Further chapters use a modular approach to address the most important concepts in complex system sciences, with the emergence and self-organization playing a central role. Prominent examples are self-organized criticality in adaptive systems, life at the edge of chaos, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase...

  14. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2015-01-01

    This primer offers readers an introduction to the central concepts that form our modern understanding of complex and emergent behavior, together with detailed coverage of accompanying mathematical methods. All calculations are presented step by step and are easy to follow. This new fourth edition has been fully reorganized and includes new chapters, figures and exercises. The core aspects of modern complex system sciences are presented in the first chapters, covering network theory, dynamical systems, bifurcation and catastrophe theory, chaos and adaptive processes, together with the principle of self-organization in reaction-diffusion systems and social animals. Modern information theoretical principles are treated in further chapters, together with the concept of self-organized criticality, gene regulation networks, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase transitions and the cognitive system approach to the brain. Technical course prerequisites are the standard ...

  15. A Practical Primer on Prion Pathology.

    Science.gov (United States)

    Appleby, Brian S; Rhoads, Daniel D; Mente, Karin; Cohen, Mark L

    2018-03-28

    Prion diseases comprise a group of transmissible degenerative encephalopathies resulting from propagation of a misfolded cellular protein of uncertain function. As is generally the case with rare diseases, lack of institutional experience compromises individual familiarity with the varying, and apparently protean, manifestations of prion diseases, both clinically and pathologically. Coupled with the documented transmissibility of these diseases both within and between species, the Centers for Disease Control and Prevention (CDC) has established the National Prion Disease Pathology Surveillance Center to both aid with diagnosis of prion disease and to survey the United States for evidence of zoonotic transmission. We have assembled this primer with the hope that our accumulated experience will enable the neuropathological community to help the CDC "save lives and protect people."

  16. Primer on tritium safe handling practices

    Energy Technology Data Exchange (ETDEWEB)

    1994-12-01

    This Primer is designed for use by operations and maintenance personnel to improve their knowledge of tritium safe handling practices. It is applicable to many job classifications and can be used as a reference for classroom work or for self-study. It is presented in general terms for use throughout the DOE Complex. After reading it, one should be able to: describe methods of measuring airborne tritium concentration; list types of protective clothing effective against tritium uptake from surface and airborne contamination; name two methods of reducing the body dose after a tritium uptake; describe the most common method for determining amount of tritium uptake in the body; describe steps to take following an accidental release of airborne tritium; describe the damage to metals that results from absorption of tritium; explain how washing hands or showering in cold water helps reduce tritium uptake; and describe how tritium exchanges with normal hydrogen in water and hydrocarbons.

  17. Primer for criticality calculations with DANTSYS

    International Nuclear Information System (INIS)

    Busch, R.D.

    1996-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his or her facility. Typically, two types of codes are available: deterministic codes such as ANISN or DANTSYS that solve an approximate model exactly and Monte Carlo Codes such as KENO or MCNP that solve an exact model approximately. Often, the analyst feels that the deterministic codes are too simple and will not provide the necessary information, so most modeling uses Monte Carlo methods. This sometimes means that hours of effort are expended to produce results available in minutes from deterministic codes. A substantial amount of reliable information on nuclear systems can be obtained using deterministic methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico in cooperation with the Radiation Transport Group at Los Alamos National Laboratory has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. (DANTSYS is the name of a suite of codes that users more commonly know as ONEDANT, TWODANT, TWOHEX, and THREEDANT.) It assumes a college education in a technical field, but there is no assumption of familiarity with neutronics codes in general or with DANTSYS in particular. The primer is designed to teach by example, with each example illustrating two or three DANTSYS features useful in criticality analyses

  18. MCNPTM criticality primer and training experiences

    International Nuclear Information System (INIS)

    Briesmeister, J.; Forster, R.A.; Busch, R.

    1995-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (k eff ). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple k eff calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP

  19. Detection of EGFR Gene Mutations in 100 Non-small Cell Lung Cancer Clinical Samples by a Real-time Polymerase Chain Reaction Method Using Amplification Refractory Mutation System Specific Primers and Taqman Fluorescence Probes

    Directory of Open Access Journals (Sweden)

    Jing ZHAO

    2013-01-01

    Full Text Available Background and objective Epidermal growth factor receptor (EGFR gene mutation is the most important predictor of the efficiency of EGFR-tyrosine kinase inhibitors in the treatment of non-small cell lung cancer (NSCLC. The detection of EGFR gene mutations can guide individual therapies for NSCLC. Numerous methods are used to detect EGFR gene mutation and each method has different features. This study aims to establish a real-time polymerase chain reaction (PCR method for the detection of EGFR gene mutations using amplification refractory mutation system (ARMS specific primers and Taqman fluorescence probes. Methods ARMS specific primers for the two EGFR gene mutations (E746_A750 and L858R and Taqman fluorescence probes for the detection of the target sequence were carefully designed by the Primer Premier 5.0 software. Then, using the recombinants containing E746_A750 and L858R mutations as the study objects, we further analyzed the sensitivity and lower limit of this method, and then determined the cutoff ΔCt value to evaluate specific or non-specific amplification. A total of 100 clinical samples were collected and used to detect the EGFR gene mutations using this method. Results The lower limit of this method for the detection of EGFR gene mutation was 10 copies if no interference of wild-type EGFR gene or background DNA existed. Regarding the method sensitivity, the detection resolution was as high as 1% and 0.1%-0.5% in the background of 500 and 5,000 copies/μL wild-type EGFR gene, respectively. Regarding the method specificity, non-specific amplifications were found when it was used to detect 21 L858R mutations in leukocyte DNA samples from healthy volunteers. However, the minimal ΔCt value was 14.48. Non-specific amplifications were not found when detecting 19 Del mutations. Among the 100 clinical samples, 39 mutations were detected (19 Del and 21 L858R were 21 and 18, respectively using this method. The total mutation rate was 39

  20. Quantitative Single-letter Sequencing: a method for simultaneously monitoring numerous known allelic variants in single DNA samples

    Directory of Open Access Journals (Sweden)

    Duborjal Hervé

    2008-02-01

    Full Text Available Abstract Background Pathogens such as fungi, bacteria and especially viruses, are highly variable even within an individual host, intensifying the difficulty of distinguishing and accurately quantifying numerous allelic variants co-existing in a single nucleic acid sample. The majority of currently available techniques are based on real-time PCR or primer extension and often require multiplexing adjustments that impose a practical limitation of the number of alleles that can be monitored simultaneously at a single locus. Results Here, we describe a novel method that allows the simultaneous quantification of numerous allelic variants in a single reaction tube and without multiplexing. Quantitative Single-letter Sequencing (QSS begins with a single PCR amplification step using a pair of primers flanking the polymorphic region of interest. Next, PCR products are submitted to single-letter sequencing with a fluorescently-labelled primer located upstream of the polymorphic region. The resulting monochromatic electropherogram shows numerous specific diagnostic peaks, attributable to specific variants, signifying their presence/absence in the DNA sample. Moreover, peak fluorescence can be quantified and used to estimate the frequency of the corresponding variant in the DNA population. Using engineered allelic markers in the genome of Cauliflower mosaic virus, we reliably monitored six different viral genotypes in DNA extracted from infected plants. Evaluation of the intrinsic variance of this method, as applied to both artificial plasmid DNA mixes and viral genome populations, demonstrates that QSS is a robust and reliable method of detection and quantification for variants with a relative frequency of between 0.05 and 1. Conclusion This simple method is easily transferable to many other biological systems and questions, including those involving high throughput analysis, and can be performed in any laboratory since it does not require specialized

  1. MITOCHONDRIAL DNA- REVOLUTIONARY EVOLUTION

    Directory of Open Access Journals (Sweden)

    Vaidhehi Narayan Nayak

    2017-07-01

    Full Text Available BACKGROUND Mitochondrion, the sausage-shaped organelle residing in the cytoplasm of all eukaryotic cells, apart from being the power house, represents endosymbiotic evolution of a free living organism to intracellular structure. Anthropologically, mitochondrial DNA is the fossilised source to trace the human ancestry particularly of maternal lineage. This article attempts to highlight the various biological functions of mitochondrial DNA (mtDNA with a note on its forensic application.

  2. The construction and use of bacterial DNA microarrays based on an optimized two-stage PCR strategy

    Directory of Open Access Journals (Sweden)

    Pesta David

    2003-06-01

    Full Text Available Abstract Background DNA microarrays are a powerful tool with important applications such as global gene expression profiling. Construction of bacterial DNA microarrays from genomic sequence data using a two-stage PCR amplification approach for the production of arrayed DNA is attractive because it allows, in principal, the continued re-amplification of DNA fragments and facilitates further utilization of the DNA fragments for additional uses (e.g. over-expression of protein. We describe the successful construction and use of DNA microarrays by the two-stage amplification approach and discuss the technical challenges that were met and resolved during the project. Results Chimeric primers that contained both gene-specific and shared, universal sequence allowed the two-stage amplification of the 3,168 genes identified on the genome of Synechocystis sp. PCC6803, an important prokaryotic model organism for the study of oxygenic photosynthesis. The gene-specific component of the primer was of variable length to maintain uniform annealing temperatures during the 1st round of PCR synthesis, and situated to preserve full-length ORFs. Genes were truncated at 2 kb for efficient amplification, so that about 92% of the PCR fragments were full-length genes. The two-stage amplification had the additional advantage of normalizing the yield of PCR products and this improved the uniformity of DNA features robotically deposited onto the microarray surface. We also describe the techniques utilized to optimize hybridization conditions and signal-to-noise ratio of the transcription profile. The inter-lab transportability was demonstrated by the virtual error-free amplification of the entire genome complement of 3,168 genes using the universal primers in partner labs. The printed slides have been successfully used to identify differentially expressed genes in response to a number of environmental conditions, including salt stress. Conclusions The technique detailed

  3. Specific primers for the detection of the black-yeast fungus associated with lethargic crab disease (LCD).

    Science.gov (United States)

    Pie, Marcio R; Boeger, Walter A; Patella, Luciana; Vicente, Vânia A; Ribeiro, Raphael O; Ostrensky, Antonio

    2011-03-16

    Lethargic crab disease (LCD) is an emerging infirmity that has been causing extensive mortalities in populations of the mangrove land crab Ucides cordatus (Ocypodidae) along the Atlantic coast of Brazil. Previous studies have indicated that LCD is associated with a dematiaceous fungus, Exophiala cancerae de Hoog et al. In the present study, we sequenced the internal transcribed spacer (ITS) of the rDNA region of this black yeast species and developed species-specific PCR primers. Sensitivity tests indicated that the developed protocol is capable of detecting very small amounts of target DNA. Also, the application of the protocol to a variety of other dematiaceous fungi did not generate any false positives. The specific primers provided in the present study represent an important tool for rapidly surveying a large number of crab individuals, as well as environmental samples. Such knowledge will be instrumental in understanding the epidemiological dynamics of LCD.

  4. Comparative evaluation of the GP5+/6+, MY09/11 and PGMY09/11 primer sets for HPV detection by PCR in oral squamous cell carcinomas.

    Science.gov (United States)

    Erhart, Sibele Morais Miyata; Rivero, Elena Riet Correa; Bazzo, Maria Luiza; Onofre, Alexandre Sherlley Casimiro

    2016-02-01

    The aim of this study was to evaluate the use of GP5+/6+, MY09/11 and PGMY09/11 primer sets for the detection of human papillomavirus (HPV) DNA by single step polymerase chain reaction (PCR) and nested PCR in formalin-fixed and paraffin-embedded (FFPE) tissues from oral squamous cell carcinomas (OSCCs). DNA extracted from FFPE tissues were tested for amplification of the human beta globin gene with PCO3/4 primers. Positive samples for this gene were tested for HPV DNA using single step PCR with GP5+/6+, MY09/11 and PGMY09/11 primer sets. All negative samples at single step PCR with MY09/11 and PGMY09/11 were subjected to a further PCR with GP5+/6+ primers using the non-amplified product in the previously reactions (nested PCR) as samples. Among 26 samples, 23 were positive for the human beta globin gene and were considered viable for HPV DNA detection by PCR. Single step PCR with GP5+/6+ and MY09/11 primers and MY/GP+ nested PCR did not amplify HPV DNA in any samples. PGMY09/11 primers detected HPV DNA in 13.0% of OSCC cases and this rate was raise to 17.4% with the use of PGMY/GP+ nested PCR. According to our results the PGMY/GP+ nested PCR is the most appropriate primer set for the detection of HPV DNA using FFPE samples from OSCC. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. Improved Bacterial 16S rRNA Gene (V4 and V4-5) and Fungal Internal Transcribed Spacer Marker Gene Primers for Microbial Community Surveys

    Energy Technology Data Exchange (ETDEWEB)

    Walters, William; Hyde, Embriette R.; Berg-Lyons, Donna; Ackermann, Gail; Humphrey, Greg; Parada, Alma; Gilbert, Jack A.; Jansson, Janet K.; Caporaso, J. Gregory; Fuhrman, Jed A.; Apprill, Amy; Knight, Rob; Bik, Holly

    2015-12-22

    ABSTRACT

    Designing primers for PCR-based taxonomic surveys that amplify a broad range of phylotypes in varied community samples is a difficult challenge, and the comparability of data sets amplified with varied primers requires attention. Here, we examined the performance of modified 16S rRNA gene and internal transcribed spacer (ITS) primers for archaea/bacteria and fungi, respectively, with nonaquatic samples. We moved primer bar codes to the 5′ end, allowing for a range of different 3′ primer pairings, such as the 515f/926r primer pair, which amplifies variable regions 4 and 5 of the 16S rRNA gene. We additionally demonstrated that modifications to the 515f/806r (variable region 4) 16S primer pair, which improves detection ofThaumarchaeotaand clade SAR11 in marine samples, do not degrade performance on taxa already amplified effectively by the original primer set. Alterations to the fungal ITS primers did result in differential but overall improved performance compared to the original primers. In both cases, the improved primers should be widely adopted for amplicon studies.

    ImportanceWe continue to uncover a wealth of information connecting microbes in important ways to human and environmental ecology. As our scientific knowledge and technical abilities improve, the tools used for microbiome surveys can be modified to improve the accuracy of our techniques, ensuring that we can continue to identify groundbreaking connections between microbes and the ecosystems they populate, from ice caps to the human body. It is important to confirm that modifications to these tools do not cause new, detrimental biases that would inhibit the field rather than continue to move it forward. We therefore demonstrated that two recently modified primer pairs that target taxonomically discriminatory regions of bacterial and fungal genomic DNA do not introduce new biases when used on a variety of sample types, from soil to

  6. Krait: an ultrafast tool for genome-wide survey of microsatellites and primer design.

    Science.gov (United States)

    Du, Lianming; Zhang, Chi; Liu, Qin; Zhang, Xiuyue; Yue, Bisong; Hancock, John

    2018-02-15

    Microsatellites are found to be related with various diseases and widely used in population genetics as genetic markers. However, it remains a challenge to identify microsatellite from large genome and screen microsatellites for primer design from a huge result dataset. Here, we present Krait, a robust and flexible tool for fast investigation of microsatellites in DNA sequences. Krait is designed to identify all types of perfect or imperfect microsatellites on a whole genomic sequence, and is also applicable to identification of compound microsatellites. Primer3 was seamlessly integrated into Krait so that users can design primer for microsatellite amplification in an efficient way. Additionally, Krait can export microsatellite results in FASTA or GFF3 format for further analysis and generate statistical report as well as plotting. Krait is freely available at https://github.com/lmdu/krait under GPL2 License, implemented in C and Python, and supported on Windows, Linux and Mac operating systems. chizhang_swmu@126.com. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  7. Marketing Information Products and Services : A Primer for ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    ... and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Editor(s):. Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Publisher(s):. Tata McGraw-Hill, CRDI.

  8. Kentucky State Primer. A Primer on Developing Kentucky's Landfill Gas-to-Energy Potential

    Science.gov (United States)

    2000-05-01

    Throughout the country, the number of landfill gas-to-energy (LFGTE) projects is growing. Recovering methane gas at solid waste landfills provides significant environmental and economic benefits by eliminating methane emissions while capturing the emissions energy value. The methane captured from landfills can be transformed into a cost-effective fuel source for generating electricity and heat, firing boilers, or even powering vehicles. Permits, incentive programs, and policies for LFGTE project development vary greatly from state to state. To guide LFGTE project developers through the state permitting process and to help them to take advantage of state incentive programs, the U.S. Environmental Protection Agencys (EPAs) Landfill Methane Outreach Program (LMOP) has worked with state agencies to develop individual primers for states participating in the State Ally Program. By presenting the latest information on federal and state regulations and incentives affecting LFGTE projects in this primer, the LMOP and Kentucky state officials hope to facilitate development of many of the landfills listed in Table A. To develop this primer, the Commonwealth of Kentucky identified all the permits and funding programs that could apply to LFGTE projects developed in Kentucky. It should be noted, however, that the regulations, agencies, and policies described are subject to change. Changes are likely to occur whenever a state legislature meets, or when the federal government imposes new directions on state and local governments. LFGTE project developers should verify and continuously monitor the status of laws and rules that might affect their plans or the operations of their projects.

  9. RUCS: Rapid identification of PCR primers for unique core sequences

    DEFF Research Database (Denmark)

    Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

    2017-01-01

    Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

  10. An asymmetric PCR-based, reliable and rapid single-tube native DNA engineering strategy

    Science.gov (United States)

    2012-01-01

    Background Widely used restriction-dependent cloning methods are labour-intensive and time-consuming, while several types of ligase-independent cloning approaches have inherent limitations. A rapid and reliable method of cloning native DNA sequences into desired plasmids are highly desired. Results This paper introduces ABI-REC, a novel strategy combining asymmetric bridge PCR with intramolecular homologous recombination in bacteria for native DNA cloning. ABI-REC was developed to precisely clone inserts into defined location in a directional manner within recipient plasmids. It featured an asymmetric 3-primer PCR performed in a single tube that could robustly amplify a chimeric insert-plasmid DNA sequence with homologous arms at both ends. Intramolecular homologous recombination occurred to the chimera when it was transformed into E.coli and produced the desired recombinant plasmids with high efficiency and fidelity. It is rapid, and does not involve any operational nucleotides. We proved the reliability of ABI-REC using a double-resistance reporter assay, and investigated the effects of homology and insert length upon its efficiency. We found that 15 bp homology was sufficient to initiate recombination, while 25 bp homology had the highest cloning efficiency. Inserts up to 4 kb in size could be cloned by this method. The utility and advantages of ABI-REC were demonstrated through a series of pig myostatin (MSTN) promoter and terminator reporter plasmids, whose transcriptional activity was assessed in mammalian cells. We finally used ABI-REC to construct a pig MSTN promoter-terminator cassette reporter and showed that it could work coordinately to express EGFP. Conclusions ABI-REC has the following advantages: (i) rapid and highly efficient; (ii) native DNA cloning without introduction of extra bases; (iii) restriction-free; (iv) easy positioning of directional and site-specific recombination owing to formulated primer design. ABI-REC is a novel approach to

  11. An asymmetric PCR-based, reliable and rapid single-tube native DNA engineering strategy

    Directory of Open Access Journals (Sweden)

    Bi Yanzhen

    2012-07-01

    Full Text Available Abstract Background Widely used restriction-dependent cloning methods are labour-intensive and time-consuming, while several types of ligase-independent cloning approaches have inherent limitations. A rapid and reliable method of cloning native DNA sequences into desired plasmids are highly desired. Results This paper introduces ABI-REC, a novel strategy combining asymmetric bridge PCR with intramolecular homologous recombination in bacteria for native DNA cloning. ABI-REC was developed to precisely clone inserts into defined location in a directional manner within recipient plasmids. It featured an asymmetric 3-primer PCR performed in a single tube that could robustly amplify a chimeric insert-plasmid DNA sequence with homologous arms at both ends. Intramolecular homologous recombination occurred to the chimera when it was transformed into E.coli and produced the desired recombinant plasmids with high efficiency and fidelity. It is rapid, and does not involve any operational nucleotides. We proved the reliability of ABI-REC using a double-resistance reporter assay, and investigated the effects of homology and insert length upon its efficiency. We found that 15 bp homology was sufficient to initiate recombination, while 25 bp homology had the highest cloning efficiency. Inserts up to 4 kb in size could be cloned by this method. The utility and advantages of ABI-REC were demonstrated through a series of pig myostatin (MSTN promoter and terminator reporter plasmids, whose transcriptional activity was assessed in mammalian cells. We finally used ABI-REC to construct a pig MSTN promoter-terminator cassette reporter and showed that it could work coordinately to express EGFP. Conclusions ABI-REC has the following advantages: (i rapid and highly efficient; (ii native DNA cloning without introduction of extra bases; (iii restriction-free; (iv easy positioning of directional and site-specific recombination owing to formulated primer design. ABI

  12. DNA Sequences of RAPD Fragments in the Egyptian cotton ...

    African Journals Online (AJOL)

    Random Amplified Polymorphic DNAs (RAPDs) is a DNA polymorphism assay based on the amplification of random DNA segments with single primers of arbitrary nucleotide sequence. Despite the fact that the RAPD technique has become a very powerful tool and has found use in numerous applications, yet, the nature of ...

  13. The internal transcribed spacer rDNA specific markers for ...

    African Journals Online (AJOL)

    ... schinifolium. These primers are useful to study the structure of Rutaceae family. Such identifications will be helpful for phylogenetic analysis in intraspecies population of the genus Zanthoxylum. Key words: Zanthoxylum piperitum, rDNA Int-sp markers, phylogenetic relationship, ribosomal DNA, internal transcribed spacer.

  14. Circulating nucleic acids damage DNA of healthy cells by integrating ...

    Indian Academy of Sciences (India)

    2015-02-04

    Feb 4, 2015 ... ... High Sensitivity Bioanalyzer Chip (Agilent) to check for quality and size distribution. DNA library frag- ments were diluted, denatured and hybridized to a lawn of oligonucleotides immobilized on the flow-cell surface. Hy- bridized DNA template was amplified using immobilized oligonucleotides as primers.

  15. Zambia Country Background Report

    DEFF Research Database (Denmark)

    Hampwaye, Godfrey; Jeppesen, Søren; Kragelund, Peter

    This paper provides background data and general information for the Zambia studies focusing on local food processing sub­‐sector; and the local suppliers to the mines as part of the SAFIC project (Successful African Firms and Institutional Change).......This paper provides background data and general information for the Zambia studies focusing on local food processing sub­‐sector; and the local suppliers to the mines as part of the SAFIC project (Successful African Firms and Institutional Change)....

  16. DNA Methylation Alterations in Breast Cancer

    National Research Council Canada - National Science Library

    Yamamoto, Fumiichiro

    2000-01-01

    .... We performed NotI-MseI MS-AFLP using clinical specimens of normal and tumor breast DNA. We used both combinations of four NotI and four MseI primers with an additional selective residue at the 3' end (4x4 format...

  17. A Real Time PCR Platform for the Simultaneous Quantification of Total and Extrachromosomal HIV DNA Forms in Blood of HIV-1 Infected Patients

    Science.gov (United States)

    Canovari, Benedetta; Scotti, Maddalena; Acetoso, Marcello; Valentini, Massimo; Petrelli, Enzo; Magnani, Mauro

    2014-01-01

    Background The quantitative measurement of various HIV-1 DNA forms including total, unintegrated and integrated provirus play an increasingly important role in HIV-1 infection monitoring and treatment-related research. We report the development and validation of a SYBR Green real time PCR (TotUFsys platform) for the simultaneous quantification of total and extrachromosomal HIV-1 DNA forms in patients. This innovative technique makes it possible to obtain both measurements in a single PCR run starting from frozen blood employing the same primers and standard curve. Moreover, due to identical amplification efficiency, it allows indirect estimation of integrated level. To specifically detect 2-LTR a qPCR method was also developed. Methodology/Findings Primers used for total HIV-1 DNA quantification spanning a highly conserved region were selected and found to detect all HIV-1 clades of group M and the unintegrated forms of the same. A total of 195 samples from HIV-1 patients in a wide range of clinical conditions were analyzed with a 100% success rate, even in patients with suppressed plasma viremia, regardless of CD4+ or therapy. No significant correlation was observed between the two current prognostic markers, CD4+ and plasma viremia, while a moderate or high inverse correlation was found between CD4+ and total HIV DNA, with strong values for unintegrated HIV DNA. Conclusions/Significance Taken together, the results support the use of HIV DNA as another tool, in addition to traditional assays, which can be used to estimate the state of viral infection, the risk of disease progression and to monitor the effects of ART. The TotUFsys platform allowed us to obtain a final result, expressed as the total and unintegrated HIV DNA copy number per microgram of DNA or 104 CD4+, for 12 patients within two working days. PMID:25364909

  18. Development of a novel quantitative real-time assay using duplex mutation primers for rapid detection of Candida species.

    Science.gov (United States)

    Xia, Qian-Feng; Liu, Jin-Bo; Liu, Ping; Qin, Xi; Qian, Shi-Yun; Tu, Zhi-Guang

    2012-01-01

    We developed a novel quantitative real-time PCR for quantitating Candida DNA based on the duplex mutation primer principle, in which a signal is generated by melting a duplex mutation primer during renaturation. The duplex mutation primers are much more specific than double-stranded DNA dyes such as SYBR-Green I and, unlike other probes, do not require the double-labeled synthesis of fluorophore and a quencher on the same molecule. A total of 176 clinical blood specimens were obtained from patients hospitalized in our hospital with clinically proven or suspected systemic Candida infection. The presence of DNA from pathogens in the Candida species was detected using real-time PCR targeting of an internal transcribed spacer region of a fungal gene. The assay exhibited a low limit of detection (10 CFU/ml of blood), an excellent reproducibility and specificity. Twenty-eight positive samples exhibited a wide range of Candida species loads, extending from 13 to 90,528 CFU/ml of blood. The sensitivity and specificity of the present assay were 100 and 97.4%, respectively, compared with the results of blood culture. Our data suggest that this assay may be appropriate for use in clinical laboratories as a simple, low-cost and rapid screening test for the most frequently encountered Candida species.

  19. High accuracy genotyping directly from genomic DNA using a rolling circle amplification based assay

    Directory of Open Access Journals (Sweden)

    Du Yuefen

    2003-05-01

    Full Text Available Abstract Background Rolling circle amplification of ligated probes is a simple and sensitive means for genotyping directly from genomic DNA. SNPs and mutations are interrogated with open circle probes (OCP that can be circularized by DNA ligase when the probe matches the genotype. An amplified detection signal is generated by exponential rolling circle amplification (ERCA of the circularized probe. The low cost and scalability of ligation/ERCA genotyping makes it ideally suited for automated, high throughput methods. Results A retrospective study using human genomic DNA samples of known genotype was performed for four different clinically relevant mutations: Factor V Leiden, Factor II prothrombin, and two hemochromatosis mutations, C282Y and H63D. Greater than 99% accuracy was obtained genotyping genomic DNA samples from hundreds of different individuals. The combined process of ligation/ERCA was performed in a single tube and produced fluorescent signal directly from genomic DNA in less than an hour. In each assay, the probes for both normal and mutant alleles were combined in a single reaction. Multiple ERCA primers combined with a quenched-peptide nucleic acid (Q-PNA fluorescent detection system greatly accellerated the appearance of signal. Probes designed with hairpin structures reduced misamplification. Genotyping accuracy was identical from either purified genomic DNA or genomic DNA generated using whole genome amplification (WGA. Fluorescent signal output was measured in real time and as an end point. Conclusions Combining the optimal elements for ligation/ERCA genotyping has resulted in a highly accurate single tube assay for genotyping directly from genomic DNA samples. Accuracy exceeded 99 % for four probe sets targeting clinically relevant mutations. No genotypes were called incorrectly using either genomic DNA or whole genome amplified sample.

  20. Improved primer sequences for the mitochondrial ND1, ND3/4 and ND5/6 segments in salmonid fishes : application to RFLP analysis of Atlantic salmon

    DEFF Research Database (Denmark)

    Eg Nielsen, Einar; Hansen, Michael Møller; Mensberg, Karen-Lise Dons

    1998-01-01

    New specific primers for the mtDNA segments ND1, ND3/4 and ND5/6 designed from the rainbow trout sequence, improved PCR amplification for salmonid fishes. RFLP analysis revealed restriction site variation for all three segments in Atlantic salmon. Eleven haplotypes were detected in a screening...

  1. VNTR fingerprinting of Kluyveromyces marxianus strains WT, 7-1, and 8-1 by using different primer types to give best results in PCR and on electrophorese gel in order to find differentiation of the DNA of the yeast strains.

    Science.gov (United States)

    Using mutagenized Kluyveromyces marxianus strains (WT, 7-1, 8-1) we wish to find out the variable numbered tandem repeats (VNTR) of each of the DNA strains from the different mutagenized K. marxianus strains. To do this we used Phusion HF Buffer Pack to try and give a clear picture of the VNTR by u...

  2. DNA barcoding Bromeliaceae: achievements and pitfalls.

    Directory of Open Access Journals (Sweden)

    Vitor Hugo Maia

    Full Text Available BACKGROUND: DNA barcoding has been successfully established in animals as a tool for organismal identification and taxonomic clarification. Slower nucleotide substitution rates in plant genomes have made the selection of a DNA barcode for land plants a much more difficult task. The Plant Working Group of the Consortium for the Barcode of Life (CBOL recommended the two-marker combination rbcL/matK as a pragmatic solution to a complex trade-off between universality, sequence quality, discrimination, and cost. METHODOLOGY/PRINCIPAL FINDINGS: It is expected that a system based on any one, or a small number of plastid genes will fail within certain taxonomic groups with low amounts of plastid variation, while performing well in others. We tested the effectiveness of the proposed CBOL Plant Working Group barcoding markers for land plants in identifying 46 bromeliad species, a group rich in endemic species from the endangered Brazilian Atlantic Rainforest. Although we obtained high quality sequences with the suggested primers, species discrimination in our data set was only 43.48%. Addition of a third marker, trnH-psbA, did not show significant improvement. This species identification failure in Bromeliaceaecould also be seen in the analysis of the GenBank's matK data set. Bromeliaceae's sequence divergence was almost three times lower than the observed for Asteraceae and Orchidaceae. This low variation rate also resulted in poorly resolved tree topologies. Among the three Bromeliaceae subfamilies sampled, Tillandsioideae was the only one recovered as a monophyletic group with high bootstrap value (98.6%. Species paraphyly was a common feature in our sampling. CONCLUSIONS/SIGNIFICANCE: Our results show that although DNA barcoding is an important tool for biodiversity assessment, it tends to fail in taxonomy complicated and recently diverged plant groups, such as Bromeliaceae. Additional research might be needed to develop markers capable to

  3. A DNA Barcode-Based RPA Assay (BAR-RPA) for Rapid Identification of the Dry Root of Ficus hirta (Wuzhimaotao).

    Science.gov (United States)

    Tian, Enwei; Liu, Qianqian; Ye, Haoting; Li, Fang; Chao, Zhi

    2017-12-18

    Background: Wuzhimaotao (the dry root of Ficus hirta ) is used as both medicine and food ingredient by the locals in areas around Nanling Mountains of China. Due to its very similar external morphologies with Duanchangcao (the root of Gelsemium elegans , which contains gelsemine that is extremely neurotoxic) and the associated growth of these two plants, incidents of food poisoning and even death frequently occur, resulting from the misuse of Duanchangcao as Wuzhimaotao. The aim of this study is to develop a fast, even, on-spot approach to identification of Wuzhimaotao. Methods: We used DNA barcode-based recombinase polymerase amplification (BAR-RPA) with species-specific primers targeting the internal transcribed spacer (ITS) region of the rDNA of F. hirta. BAR-RPA reaction time and temperature were optimized and the specificity and sensitivity of BAR-RPA species-specific primers were assessed. Results: This technique showed a high specificity and sensitivity to amplify the genomic DNA of F. hirta and allowed for rapid amplification (within 15 min) of the ITS region under a constant and mild temperature range of 37-42 °C without using thermocyclers. Conclusions: The BAR-RPA assay with a fast DNA extraction protocol provides a simple, energy-saving, and rapid method for identification of Wuzhimaotao in both laboratory and field settings.

  4. Value for money assessment for public-private partnerships : a primer.

    Science.gov (United States)

    2015-01-01

    This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.

  5. Composite Overwrapped Pressure Vessels, A Primer

    Science.gov (United States)

    McLaughlan, Pat B.; Forth, Scott C.; Grimes-Ledesma, Lorie R.

    2011-01-01

    Due to the extensive amount of detailed information that has been published on composite overwrapped pressure vessels (COPVs), this document has been written to serve as a primer for those who desire an elementary knowledge of COPVs and the factors affecting composite safety. In this application, the word "composite" simply refers to a matrix of continuous fibers contained within a resin and wrapped over a pressure barrier to form a vessel for gas or liquid containment. COPVs are currently used at NASA to contain high pressure fluids in propulsion, science experiments, and life support applications. They have a significant weight advantage over all metal vessels but require unique design, manufacturing, and test requirements. COPVs also involve a much more complex mechanical understanding due to the interplay between the composite overwrap and the inner liner. A metallic liner is typically used in a COPV as a fluid permeation barrier. The liner design concepts and requirements have been borrowed from all-metal vessels. However, application of metallic vessel design standards to a very thin liner is not straightforward. Different failure modes exist for COPVs than for all-metal vessels, and understanding of these failure modes is at a much more rudimentary level than for metal vessels.

  6. Transforming practices: a primer on action research.

    Science.gov (United States)

    Acosta, Sandra; Goltz, Heather Honoré

    2014-07-01

    Action research (AR) is a powerful tool for health education and promotion practitioners who want to focus on improving the quality of their programs and services. In this Tool, we describe the characteristics and controversial aspects of AR, differentiate between traditional and action research, present the benefits of applying AR methods/techniques for investigating problems related to professional practice, and offer a four-phase methodological framework for conducting AR studies. Unlike traditional research, AR is a methodology that links theory, research, and practice; advances new knowledge and understandings via iterative action cycles; employs frontline health practitioners as researchers; and promotes collaborative practitioner-community partnerships. Egalitarian in its approach, AR offers an "insider's perspective" centered on context-specific problems and issues related to health promotion. AR falls into two categories: large-scale community-based research and small-scale practice-based research. Each cycle of the AR framework includes four phases: (a) preplanning/needs assessment, (b) planning/study organization, (c) action and observation/study implementation, and (d) reflection and planning/data analysis and interpretation. Using the AR primer in this Tool has the potential to empower health education/promotion practitioners, encourage collaborative partnerships, enhance practitioners' knowledge base, and promote social change. © 2014 Society for Public Health Education.

  7. Primer on electricity futures and other derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.

  8. Primer on electricity futures and other derivatives

    International Nuclear Information System (INIS)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area

  9. Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J

    1997-01-01

    , but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....

  10. The Cosmic Background Explorer

    Science.gov (United States)

    Gulkis, Samuel; Lubin, Philip M.; Meyer, Stephan S.; Silverberg, Robert F.

    1990-01-01

    The Cosmic Background Explorer (CBE), NASA's cosmological satellite which will observe a radiative relic of the big bang, is discussed. The major questions connected to the big bang theory which may be clarified using the CBE are reviewed. The satellite instruments and experiments are described, including the Differential Microwave Radiometer, which measures the difference between microwave radiation emitted from two points on the sky, the Far-Infrared Absolute Spectrophotometer, which compares the spectrum of radiation from the sky at wavelengths from 100 microns to one cm with that from an internal blackbody, and the Diffuse Infrared Background Experiment, which searches for the radiation from the earliest generation of stars.

  11. The natural radiation background

    International Nuclear Information System (INIS)

    Duggleby, J.C.

    1982-01-01

    The components of the natural background radiation and their variations are described. Cosmic radiation is a major contributor to the external dose to the human body whilst naturally-occurring radionuclides of primordial and cosmogenic origin contribute to both the external and internal doses, with the primordial radionuclides being the major contributor in both cases. Man has continually modified the radiation dose to which he has been subjected. The two traditional methods of measuring background radiation, ionisation chamber measurements and scintillation counting, are looked at and the prospect of using thermoluminescent dosimetry is considered

  12. Cosmic Tachyon Background Radiation

    CERN Document Server

    Tomaschitz, R

    1999-01-01

    The equilibrium statistical mechanics of a background radiation of superluminal particles is investigated, based on a vectorial wave equation for tachyons of the Proca type. The partition function, the spectral energy density, and the various thermodynamic variables of an ideal Bose gas of tachyons in an open Robertson-Walker cosmology are derived. The negative mass square in the wave equation changes the frequency scaling in the Rayleigh-Jeans law, and there are also significant changes in the low temperature regime as compared to the microwave background, in particular in the caloric and thermal equations of state.

  13. In Silico PCR Tools for a Fast Primer, Probe, and Advanced Searching.

    Science.gov (United States)

    Kalendar, Ruslan; Muterko, Alexandr; Shamekova, Malika; Zhambakin, Kabyl

    2017-01-01

    The polymerase chain reaction (PCR) is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. The principle of this technique has been further used and applied in plenty of other simple or complex nucleic acid amplification technologies (NAAT). In parallel to laboratory "wet bench" experiments for nucleic acid amplification technologies, in silico or virtual (bioinformatics) approaches have been developed, among which in silico PCR analysis. In silico NAAT analysis is a useful and efficient complementary method to ensure the specificity of primers or probes for an extensive range of PCR applications from homology gene discovery, molecular diagnosis, DNA fingerprinting, and repeat searching. Predicting sensitivity and specificity of primers and probes requires a search to determine whether they match a database with an optimal number of mismatches, similarity, and stability. In the development of in silico bioinformatics tools for nucleic acid amplification technologies, the prospects for the development of new NAAT or similar approaches should be taken into account, including forward-looking and comprehensive analysis that is not limited to only one PCR technique variant. The software FastPCR and the online Java web tool are integrated tools for in silico PCR of linear and circular DNA, multiple primer or probe searches in large or small databases and for advanced search. These tools are suitable for processing of batch files that are essential for automation when working with large amounts of data. The FastPCR software is available for download at http://primerdigital.com/fastpcr.html and the online Java version at http://primerdigital.com/tools/pcr.html .

  14. cDNA cloning, structural analysis, SNP detection and tissue ...

    Indian Academy of Sciences (India)

    THOMAS NAICY

    E-mail: naicy@kvasu.ac.in. and conception rate ... transformed into DH5α strain of Escherichia coli and the clones harbouring ... Primer pairs for caprine IGF1 and GAPDH were designed using Primer3 software (table 1). RTq-PCR was conducted in a 25 μL reaction volume containing 50 ng of cDNA and 2× Max- ima SYBR ...

  15. Simultaneous Profiling of DNA Mutation and Methylation by Melting Analysis Using Magnetoresistive Biosensor Array

    DEFF Research Database (Denmark)

    Rizzi, Giovanni; Lee, Jung-Rok; Dahl, Christina

    2017-01-01

    specificity. Genomic (mutation) or bisulphite-treated (methylation) DNA is amplified using nondiscriminatory primers, and the amplicons are then hybridized to a giant magnetoresistive (GMR) biosensor array followed by melting curve measurements. The GMR biosensor platform offers scalable multiplexed detection...

  16. cDNA cloning and characterization of a mannose-binding lectin from ...

    Indian Academy of Sciences (India)

    Using RNA extracted from Zingiber officinale rhizomes and primers designed according to the conservative regions of monocot mannose-binding lectins, the full-length cDNA of Z. officinale agglutinin (ZOA) was cloned by rapid amplification of cDNA ends (RACE). The full-length cDNA of zoa was 746 bp and contained a ...

  17. Polymerase chain reaction-mediated DNA fingerprinting for epidemiological studies on Campylobacter spp

    NARCIS (Netherlands)

    Giesendorf, B A; Goossens, H; Niesters, H G; Van Belkum, A; Koeken, A; Endtz, H P; Stegeman, H; Quint, W G

    The applicability of polymerase chain reaction (PCR)-mediated DNA typing, with primers complementary to dispersed repetitive DNA sequences and arbitrarily chosen DNA motifs, to study the epidemiology of campylobacter infection was evaluated. With a single PCR reaction and simple gel electrophoresis,

  18. cDNA cloning and characterization of a mannose-binding lectin

    Indian Academy of Sciences (India)

    Using RNA extracted from Zingiber officinale rhizomes and primers designed according to the conservative regions of monocot mannose-binding lectins, the full-length cDNA of Z. officinale agglutinin (ZOA) was cloned by rapid amplification of cDNA ends (RACE). The full-length cDNA of zoa was 746 bp and contained a ...

  19. Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae

    Directory of Open Access Journals (Sweden)

    Francesco Dal Grande

    2013-03-01

    Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.

  20. Nonthermal cosmic neutrino background

    Science.gov (United States)

    Chen, Mu-Chun; Ratz, Michael; Trautner, Andreas

    2015-12-01

    We point out that, for Dirac neutrinos, in addition to the standard thermal cosmic neutrino background (C ν B ), there could also exist a nonthermal neutrino background with comparable number density. As the right-handed components are essentially decoupled from the thermal bath of standard model particles, relic neutrinos with a nonthermal distribution may exist until today. The relic density of the nonthermal (nt) background can be constrained by the usual observational bounds on the effective number of massless degrees of freedom Neff and can be as large as nν nt≲0.5 nγ. In particular, Neff can be larger than 3.046 in the absence of any exotic states. Nonthermal relic neutrinos constitute an irreducible contribution to the detection of the C ν B and, hence, may be discovered by future experiments such as PTOLEMY. We also present a scenario of chaotic inflation in which a nonthermal background can naturally be generated by inflationary preheating. The nonthermal relic neutrinos, thus, may constitute a novel window into the very early Universe.

  1. Fluorescent-increase kinetics of different fluorescent reporters used for qPCR depend on monitoring chemistry, targeted sequence, type of DNA input and PCR efficiency

    International Nuclear Information System (INIS)

    Ruijter, Jan M.; Hoff, Maurice J. B. van den; Lorenz, Peter; Tuomi, Jari M.; Hecker, Michael

    2014-01-01

    The analysis of quantitative PCR data usually does not take into account the fact that the increase in fluorescence depends on the monitoring chemistry, the input of ds-DNA or ss-cDNA, and the directionality of the targeting of probes or primers. The monitoring chemistries currently available can be categorized into six groups: (A) DNA-binding dyes; (B) hybridization probes; (C) hydrolysis probes; (D) LUX primers; (E) hairpin primers; and (F) the QZyme system. We have determined the kinetics of the increase in fluorescence for each of these groups with respect to the input of both ds-DNA and ss-cDNA. For the latter, we also evaluated mRNA and cDNA targeting probes or primers. This analysis revealed three situations. Hydrolysis probes and LUX primers, compared to DNA-binding dyes, do not require a correction of the observed quantification cycle. Hybridization probes and hairpin primers require a correction of −1 cycle (dubbed C-lag), while the QZyme system requires the C-lag correction and an efficiency-dependent C-shift correction. A PCR efficiency value can be derived from the relative increase in fluorescence in the exponential phase of the amplification curve for all monitoring chemistries. In case of hydrolysis probes, LUX primers and hairpin primers, however, this should be performed after cycle 12, and for the QZyme system after cycle 19, to keep the overestimation of the PCR efficiency below 0.5 %. (author)

  2. Detection and Identification of Bursaphelenchus Species with DNA Fingerprinting and Polymerase Chain Reaction

    OpenAIRE

    Harmey, Judith H.; Harmey, Matthew A.

    1993-01-01

    We have evaluated the potential of DNA-based methods to identify and differentiate Bursaphelenchus spp. and isolates. The isolation of a DNA probe, designated X14, and development of a DNA fingerprinting method for the identification and differentiation of Bursaphelenchus species and strains is described. Polymerase chain reaction (PCR) amplification of DNA isolated from Bursaphelenchus species using two primers derived from the sequence of the cloned repetitive DNA fragment X14 resulted in m...

  3. In vitro expansion of mammalian telomere repeats by DNA polymerase α-primase

    Science.gov (United States)

    Nozawa, Katsura; Suzuki, Motoshi; Takemura, Masaharu; Yoshida, Shonen

    2000-01-01

    Among the polymerases, DNA polymerase α-primase is involved in lagging strand DNA synthesis. A previous report indicated that DNA polymerase α-primase initiates primer RNA synthesis with purine bases on a single-stranded G-rich telomere repeat. In this study, we found that DNA polymerase α-primase precisely initiated with adenosine opposite the 3′-side thymidine in the G-rich telomere repeat 5′-(TTAGGG)n-3′ under rATP-rich conditions. Then, DNA polymerase α-primase synthesized the nascent DNA fragments by extending the primer. It was remarkable that DNA polymerase α-primase further expanded the product DNA far beyond the length of the template DNA, as ladders of multiple hexanucleotides on polyacrylamide gel electrophoresis. Using an oligomer duplex 5′-A(GGGTTA)5-3′/5′-(TAACCC)5T-3′ as a template–primer, we show that both the Klenow fragment of Escherichia coli DNA polymerase I and HIV reverse transcriptase could expand telomere DNA sequences as well, giving products greater than the size of the template DNA. The maximum product lengths with these polymerases were ∼40–90 nt longer than the template length. Our data imply that DNA polymerases have an intrinsic activity to expand the hexanucleotide repeats of the telomere sequence by a slippage mechanism and that DNA polymerase α uses both the repeat DNA primers and the de novo RNA primers for expansion. On the other hand, a plasmid harboring a eukaryotic telomere repeat showed remarkable genetic instability in E.coli. The telomere repeats exhibited either expansions or deletions by multiple hexanucleotide repeats during culture for a number of generations, suggesting involvement of the slippage mechanism in the instability of telomeric DNA in vivo. PMID:10931927

  4. Directed PCR-free engineering of highly repetitive DNA sequences

    Directory of Open Access Journals (Sweden)

    Preissler Steffen

    2011-09-01

    Full Text Available Abstract Background Highly repetitive nucleotide sequences are commonly found in nature e.g. in telomeres, microsatellite DNA, polyadenine (poly(A tails of eukaryotic messenger RNA as well as in several inherited human disorders linked to trinucleotide repeat expansions in the genome. Therefore, studying repetitive sequences is of biological, biotechnological and medical relevance. However, cloning of such repetitive DNA sequences is challenging because specific PCR-based amplification is hampered by the lack of unique primer binding sites resulting in unspecific products. Results For the PCR-free generation of repetitive DNA sequences we used antiparallel oligonucleotides flanked by restriction sites of Type IIS endonucleases. The arrangement of recognition sites allowed for stepwise and seamless elongation of repetitive sequences. This facilitated the assembly of repetitive DNA segments and open reading frames encoding polypeptides with periodic amino acid sequences of any desired length. By this strategy we cloned a series of polyglutamine encoding sequences as well as highly repetitive polyadenine tracts. Such repetitive sequences can be used for diverse biotechnological applications. As an example, the polyglutamine sequences were expressed as His6-SUMO fusion proteins in Escherichia coli cells to study their aggregation behavior in vitro. The His6-SUMO moiety enabled affinity purification of the polyglutamine proteins, increased their solubility, and allowed controlled induction of the aggregation process. We successfully purified the fusions proteins and provide an example for their applicability in filter retardation assays. Conclusion Our seamless cloning strategy is PCR-free and allows the directed and efficient generation of highly repetitive DNA sequences of defined lengths by simple standard cloning procedures.

  5. propósito del primer centenario

    Directory of Open Access Journals (Sweden)

    René Martínez Lemoine

    2007-01-01

    Full Text Available Este trabajo, trata de las apreciaciones públicas y urbanas que se dieron en la ciudad de Santiago a instancias de la celebración del primer Centenario de la República, en el año 1910. Es una rememoranza de aquellas visiones que la ciudad sustrajo a los medios periodísticos, personajes y liderazgos de una sociedad autosatisfecha por el progreso notable alcanzado por el país en las últimas décadas del siglo XIX y los primeros años del siglo XX, pero que ignoró los movimientos obreros y expresiones de disconformidad social que ya comenzaban a ebullir en esos años. La ciudad, como una vasta, compleja y heterogénea construcción en el espacio, erigida a través de las edades por innumerables y, la más de las veces, anónimos constructores, representa la mayor suma de obra humana acumulada en el tiempo, en la que cada generación va dejando una muestra de su aporte en vivienda, espacios, instalaciones y monumentos, vale decir, de su particular cultura y modo de vida en su propio tiempo. Ciertamente, cada ciudad es historia y memoria de sí misma, testimonio permanente de la continuidad del hombre y de la sociedad humana con su propio pasado. En ese sentido, como somos herederos de nuestra historia y de los hombres y mujeres que construyeron y legaron las ciudades en las que vivimos, es importante rescatar esos valores culturales, sociales, arquitectónicos y urbanísticos de modo de visualizar el paso del tiempo, que se materializa, se hace objeto y se torna visible en la ciudad, en la medida que nos “cuenta” algo.

  6. Heterologous primer transferability and access to microsatellite loci polymorphism in ‘somnus’ passion fruit tree (Passiflora setacea DC

    Directory of Open Access Journals (Sweden)

    Douglas de Almeida Pereira

    2015-09-01

    Full Text Available Primer pairs that access microsatellite loci, initially constructed through the genome of Passiflora edulis Sims flavicarpa and P. alata, were tested concerning their ability to access microsatellite loci in ‘somnus’ passion fruit tree (P. setacea individuals. Seven out of the thirty one primer pairs tested were able to access DNA polymorphism in the genome of this wild Passiflora species, by evaluating six natural populations, located in a transition area between the biomes Caatinga and Cerrado, in the state of Bahia, Brazil. The number of alleles/loci was small, oscillating from 1 to 4. The average heterozygosity observed per locus in all populations ranged from 0.13 to 0.40. There was transference of heterologous microsatellite primer pairs from the Passiflora genus to ‘somnus’ passion fruit tree, constituting a new set of primers that access random co-dominant locus in this species, useful for conservationist purposes and pre-improvement of ‘somnus’ passion fruit tree.

  7. Detection of bacterial soft-rot of crown imperial caused by Pectobacterium carotovorum subsp. carotovorum using specific PCR primers

    Directory of Open Access Journals (Sweden)

    E. Mahmoudi

    2007-08-01

    Full Text Available Pectobacterium is one of the major destructive causal agent in most crop plants throughout the world. During a survey in spring of 2005 in the rangeland of Kermanshah and Isfahan, provinces of Iran, samples of bulbs and stems of crown imperial with brown spot and soft rot were collected. Eight strains of pectolytic Erwinia were isolated and purified from these samples. Phenotypic tests indicated that the strains were gram-negative, facultative anaerobic, rod shaped, motile with peritrichous flagella. They were oxidase negative, catalase positive and also able to macerate potato slices. Pathogenicity of all the strains were confirmed on corn, philodendron and crown imperial by inoculation of these crops with a bacterial suspension and reisolation of the strain from symptomatic tissues. A pair of specific PCR primers was used to detect these bacterial strains. The primer set (EXPCCF/EXPCCR amplified a single fragment of the expected size (0.55 kb from genomic DNA of all strains used in this study. In nested PCR, the primer set (INPCCR/INPCCF amplified the expected single fragment (0.4 kb from the PCR product of first PCR amplification. On the basis of the biochemical and phenotypic characteristics and PCR amplification by the specific PCR primers, these strains were identified as Pectobacterium carotovorum subsp. carotovorum. This is the first report of occurrence of crown imperial bacterial soft-rot in Iran.

  8. Development of Primers to O-Antigen Biosynthesis Genes for Specific Detection of Escherichia coli O157 by PCR

    Science.gov (United States)

    Maurer, John J.; Schmidt, Denise; Petrosko, Patricia; Sanchez, Susan; Bolton, Lance; Lee, Margie D.

    1999-01-01

    The chemical composition of each O-antigen subunit in gram-negative bacteria is a reflection of the unique DNA sequences within each rfb operon. By characterizing DNA sequences contained with each rfb operon, a diagnostic serotype-specific probe to Escherichia coli O serotypes that are commonly associated with bacterial infections can be generated. Recently, from an E. coli O157:H7 cosmid library, O-antigen-positive cosmids were identified with O157-specific antisera. By using the cosmid DNAs as probes, several DNA fragments which were unique to E. coli O157 serotypes were identified by Southern analysis. Several of these DNA fragments were subcloned from O157-antigen-positive cosmids and served as DNA probes in Southern analysis. One DNA fragment within plasmid pDS306 which was specific for E. coli O157 serotypes was identified by Southern analysis. The DNA sequence for this plasmid revealed homology to two rfb genes, the first of which encodes a GDP-mannose dehydratase. These rfb genes were similar to O-antigen biosynthesis genes in Vibrio cholerae and Yersinia enterocolitica serotype O:8. An oligonucleotide primer pair was designed to amplify a 420-bp DNA fragment from E. coli O157 serotypes. The PCR test was specific for E. coli O157 serotypes. PCR detected as few as 10 cells with the O157-specific rfb oligonucleotide primers. Coupled with current enrichment protocols, O157 serotyping by PCR will provide a rapid, specific, and sensitive method for identifying E. coli O157. PMID:10388689

  9. RT-qPCR with chimeric dU stem-loop primer is efficient for the detection of bacterial small RNAs.

    Science.gov (United States)

    Wu, Yangfan; Xing, Xuejiao; You, Ting; Liang, Rubing; Liu, Jianhua

    2017-06-01

    Small non-coding RNAs are considered be involved in the regulation of multiple cellular processes. Quantitative reverse transcription PCR (RT-qPCR) is widely used in the detection of eukaryotic microRNA, and the stem-loop primers can improve the specificity and efficiency of reverse transcription. However, the loop structure of primers probably influence the next quantitative amplification due to the base stacking and steric hindrance. Here, we designed a chimeric stem-loop primer with a deoxyuracil (dU) base located near the RNA matching part. After the reverse transcription, uracil-DNA glycosylase (UDG) treatment was used to remove the dU base and destroy the stem-loop structure of RT product. Enzymatic assay confirmed that the recombinant UDG could efficiently eliminate the dU base in the oligonucleotide. Transcriptions of two small RNAs (TFF and ryeA) in Escherichia coli were detected by RT-qPCR with different primers. Results showed that the use of the chimeric dU stem-loop primer and UDG treatment could enhance the detection specificity and sensitivity about 1.1- to 3.4-fold, compared to those with traditional stem-loop primer and linear primer. Total RNA of 1-10 pg was enough for efficient detection with the chimeric stem-loop primers. In a word, this strategy could promote the RT-qPCR detection efficiency on the transcription of bacterial small RNAs even in trace samples and can facilitate the detection of exiguous change in cellular metabolism.

  10. FONZIE: An optimized pipeline for minisatellite marker discovery and primer design from large sequence data sets

    Directory of Open Access Journals (Sweden)

    Balesdent Marie-Hélène

    2010-11-01

    Full Text Available Abstract Background Micro-and minisatellites are among the most powerful genetic markers known to date. They have been used as tools for a large number of applications ranging from gene mapping to phylogenetic studies and isolate typing. However, identifying micro-and minisatellite markers on large sequence data sets is often a laborious process. Results FONZIE was designed to successively 1 perform a search for markers via the external software Tandem Repeat Finder, 2 exclude user-defined specific genomic regions, 3 screen for the size and the percent matches of each relevant marker found by Tandem Repeat Finder, 4 evaluate marker specificity (i.e., occurrence of the marker as a single copy in the genome using BLAST2.0, 5 design minisatellite primer pairs via the external software Primer3, and 6 check the specificity of each final PCR product by BLAST. A final file returns to users all the results required to amplify markers. A biological validation of the approach was performed using the whole genome sequence of the phytopathogenic fungus Leptosphaeria maculans, showing that more than 90% of the minisatellite primer pairs generated by the pipeline amplified a PCR product, 44.8% of which showed agarose-gel resolvable polymorphism between isolates. Segregation analyses confirmed that the polymorphic minisatellites corresponded to single-locus markers. Conclusion FONZIE is a stand-alone and user-friendly application developed to minimize tedious manual operations, reduce errors, and speed up the search for efficient minisatellite and microsatellite markers departing from whole-genome sequence data. This pipeline facilitates the integration of data and provides a set of specific primer sequences for PCR amplification of single-locus markers. FONZIE is freely downloadable at: http://www.versailles-grignon.inra.fr/bioger/equipes/leptosphaeria_maculans/outils_d_analyses/fonzie

  11. The Cosmic Microwave Background

    Directory of Open Access Journals (Sweden)

    Jones Aled

    1998-01-01

    Full Text Available We present a brief review of current theory and observations of the cosmic microwave background (CMB. New predictions for cosmological defect theories and an overview of the inflationary theory are discussed. Recent results from various observations of the anisotropies of the microwave background are described and a summary of the proposed experiments is presented. A new analysis technique based on Bayesian statistics that can be used to reconstruct the underlying sky fluctuations is summarised. Current CMB data is used to set some preliminary constraints on the values of fundamental cosmological parameters $Omega$ and $H_circ$ using the maximum likelihood technique. In addition, secondary anisotropies due to the Sunyaev-Zel'dovich effect are described.

  12. Sri Lanka; Background Papers

    OpenAIRE

    International Monetary Fund

    1995-01-01

    This Background Paper on Sri Lanka provides information on the economic developments during 1992–95. Developments in the domestic and external sectors are discussed. The deficiencies of the official consumer price index that resulted in a substantial understatement of inflation performance in 1994 and alternative estimates of underlying inflation are described. The structural rigidities in the labor market that perpetuate high unemployment and limit job growth are also described. The paper al...

  13. Designing for transportation management and operations : a primer.

    Science.gov (United States)

    2013-02-01

    This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...

  14. A Primer of Easy Pieces: Teaching through Typical Narrative.

    Science.gov (United States)

    Waldman, Peter

    1982-01-01

    A "Form Primer," developed for and used in an introductory architectural design course at Princeton University, is explained and illustrated. The concept holds that architecture is made up of a typology of pieces that are composed into a whole. (MSE)

  15. Preparation and Characterization of Acrylic Primer for Concrete Substrate Application

    Directory of Open Access Journals (Sweden)

    El-Sayed Negim

    2016-01-01

    Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.

  16. Medium Caliber Lead-Free Electric Primer. Version 2

    Science.gov (United States)

    2012-09-01

    additive since it was not commercially available. A replacement was needed. 2) Kel-F, a Polychorotrifluoro ethylene (PCTFE) polymer , which was...primer mixes where scraps fall onto wet floors and by the chemical production of the primer mix. In addition, workers clothing can be easily...preparation of the LFEP are recyclable without re-purification. A second general advantage is the ease of de-militarization of ENC based LFEP. These

  17. Sensitivitas dan Spesifisitas Nested Polymerase Chain Reaction untuk Mendeteksi DNA Coxiella burnetii (SENSITIVITY AND SPECIFICITY OF NESTED POLYMERASE CHAIN REACTION FOR DETECTION OF COXIELLA BURNETII DNA

    Directory of Open Access Journals (Sweden)

    Trioso Purnawarman

    2014-04-01

    Full Text Available Sensitivity and specificity of nested polymerase chain reaction (nested PCR to detect Coxiella burnetii(C. burnetii DNA were studied. The primer system which consists of external primers (OMP1 and OMP2and internal primers (OMP3 and OMP4, was designed from the nucleotide sequence of the com I geneencoding for 27 kDa outer membrane protein and used to specifically amplify a 501 bp and 438 bp fragment.This nested PCR assay was 50 fold more sensitive than that of using PCR external primer only. TheNested PCR has a detection limit as low as 300 pg/?l. Specificity studies showed that nested PCR onlydetected C. burnetii DNA and did not happened Brucella abortus, Escherichia coli, Pseudomonas aeruginosaand Campylobacter Jejuni DNA. Nested PCR has high senstively and specificaly diagnostic method of C.burnetii as agent of Q fever disease.

  18. A preferred region for recombinational patch repair in the 5' untranslated region of primer binding site-impaired murine leukemia virus vectors

    DEFF Research Database (Denmark)

    Mikkelsen, J G; Lund, Anders Henrik; Kristensen, K D

    1996-01-01

    Transduction of primer binding site-impaired Akv murine leukemia virus-based retroviral vectors from the murine packaging cell lines psi-2 and omega E was studied. The efficiency of transduction of the neo marker of all mutated constructs was found to decrease by 5 to 6 orders of magnitude compared......, suggesting the involvement of a specific endogenous virus-like sequence in patch repair rescue of the primer binding site mutants. The putative recombination partner RNA was found in virions from psi-2 cells as detected by analysis of glutamine tRNA-initiated cDNA and by sequence analysis of regions...

  19. Assessment of SCAR markers to design real-time PCR primers for rhizosphere quantification of Azospirillum brasilense phytostimulatory inoculants of maize.

    Science.gov (United States)

    Couillerot, O; Poirier, M-A; Prigent-Combaret, C; Mavingui, P; Caballero-Mellado, J; Moënne-Loccoz, Y

    2010-08-01

    To assess the applicability of sequence characterized amplified region (SCAR) markers obtained from BOX, ERIC and RAPD fragments to design primers for real-time PCR quantification of the phytostimulatory maize inoculants Azospirillum brasilense UAP-154 and CFN-535 in the rhizosphere. Primers were designed based on strain-specific SCAR markers and were screened for successful amplification of target strain and absence of cross-reaction with other Azospirillum strains. The specificity of primers thus selected was verified under real-time PCR conditions using genomic DNA from strain collection and DNA from rhizosphere samples. The detection limit was 60 fg DNA with pure cultures and 4 x 10(3) (for UAP-154) and 4 x 10(4) CFU g(-1) (for CFN-535) in the maize rhizosphere. Inoculant quantification was effective from 10(4) to 10(8) CFU g(-1) soil. BOX-based SCAR markers were useful to find primers for strain-specific real-time PCR quantification of each A. brasilense inoculant in the maize rhizosphere. Effective root colonization is a prerequisite for successful Azospirillum phytostimulation, but cultivation-independent monitoring methods were lacking. The real-time PCR methods developed here will help understand the effect of environmental conditions on root colonization and phytostimulation by A. brasilense UAP-154 and CFN-535.

  20. Design and evaluation of PCR primers which differentiate Escherichia coli O157:H7 and related serotypes.

    Science.gov (United States)

    Rice, W C

    2009-01-01

    To develop methods to differentiate Escherichia coli O157:H7 and related serotypes by the use of amplicon length polymorphism (ALP) analysis based on identifying DNA sequence deletions within highly homologous regions of three sequenced E. coli strains. Potential primer locations along the ancestral genomic backbone were identified and evaluated against three sequenced genomes and then applied to a reference set of pathogenic E. coli strains. All 16 primer combinations generated the expected diagnostic fragments as predicted for the E. coli K12 MG1655, O157:H7 EDL933, and O157:H7B Sakai genomes. This study defines a collection of primers distributed along the length of the E. coli genome that were applied to ALP analysis methods to successfully differentiate between serotypes of E. coli O157:H7 and other E. coli serotypes. ALP-PCR analysis method was validated as an independent method of classification when compared with that of rep-PCR. The principles underlying ALP analysis can be readily applied for the detection and differentiation of other closely related microbial species because of the abundance of complete DNA sequence data for a large number of microbial genomes.

  1. Family Background and Entrepreneurship

    DEFF Research Database (Denmark)

    Lindquist, Matthew J.; Sol, Joeri; Van Praag, Mirjam

    Vast amounts of money are currently being spent on policies aimed at promoting entrepreneurship. The success of such policies, however, rests in part on the assumption that individuals are not ‘born entrepreneurs’. In this paper, we assess the importance of family background and neighborhood...... effects as determinants of entrepreneurship. We start by estimating sibling correlations in entrepreneurship. We find that between 20 and 50 percent of the variance in different entrepreneurial outcomes is explained by factors that siblings share. The average is 28 percent. Allowing for differential...... entrepreneurship does play a large role, as do shared genes....

  2. Background and introduction

    DEFF Research Database (Denmark)

    Jensen, Per Anker; van der Voordt, Theo; Coenen, Christian

    2012-01-01

    in scope between FM and CREM is that CREM has its focus on real estate as physical and economical assets utilized by an organisation, while FM has a wider service focus. The difference in scope between FM and CREM on one side and B2B marketing on the other is that FM and CREM are related to organisations...... background information to understand the following chapters in this book. Research limitations: The chapter is mainly based on the experience and knowledge of the editors. It does not include original research but provides an introductory overview of the book. Originality/value: This chapter takes a look...

  3. Malaysia; Background Paper

    OpenAIRE

    International Monetary Fund

    1996-01-01

    This Background Paper on Malaysia examines developments and trends in the labor market since the mid-1980s. The paper describes the changes in the employment structure and the labor force. It reviews wages and productivity trends and their effects on unit labor cost. The paper highlights that Malaysia’s rapid growth, sustained since 1987, has had a major impact on the labor market. The paper outlines the major policy measures to address the labor constraints. It also analyzes Malaysia’s recen...

  4. Genome-Wide Epigenetic Studies in Human Disease: A Primer on -Omic Technologies.

    Science.gov (United States)

    Yan, Huihuang; Tian, Shulan; Slager, Susan L; Sun, Zhifu; Ordog, Tamas

    2016-01-15

    Epigenetic information encoded in covalent modifications of DNA and histone proteins regulates fundamental biological processes through the action of chromatin regulators, transcription factors, and noncoding RNA species. Epigenetic plasticity enables an organism to respond to developmental and environmental signals without genetic changes. However, aberrant epigenetic control plays a key role in pathogenesis of disease. Normal epigenetic states could be disrupted by detrimental mutations and expression alteration of chromatin regulators or by environmental factors. In this primer, we briefly review the epigenetic basis of human disease and discuss how recent discoveries in this field could be translated into clinical diagnosis, prevention, and treatment. We introduce platforms for mapping genome-wide chromatin accessibility, nucleosome occupancy, DNA-binding proteins, and DNA methylation, primarily focusing on the integration of DNA methylation and chromatin immunoprecipitation-sequencing technologies into disease association studies. We highlight practical considerations in applying high-throughput epigenetic assays and formulating analytical strategies. Finally, we summarize current challenges in sample acquisition, experimental procedures, data analysis, and interpretation and make recommendations on further refinement in these areas. Incorporating epigenomic testing into the clinical research arsenal will greatly facilitate our understanding of the epigenetic basis of disease and help identify novel therapeutic targets. © The Author 2015. Published by Oxford University Press on behalf of the Johns Hopkins Bloomberg School of Public Health. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  5. A Novel Terminator Primer and Enhancer Reagents for Direct Expression of PCR-Amplified Genes in Mammalian Cells.

    Science.gov (United States)

    Nakamura, Mikiko; Suzuki, Ayako; Akada, Junko; Yarimizu, Tohru; Iwakiri, Ryo; Hoshida, Hisashi; Akada, Rinji

    2015-08-01

    Escherichia coli plasmids are commonly used for gene expression experiments in mammalian cells, while PCR-amplified DNAs are rarely used even though PCR is a much faster and easier method to construct recombinant DNAs. One difficulty may be the limited amount of DNA produced by PCR. For direct utilization of PCR-amplified DNA in transfection experiments, efficient transfection with a smaller amount of DNA should be attained. For this purpose, we investigated two enhancer reagents, polyethylene glycol and tRNA, for a chemical transfection method. The addition of the enhancers to a commercial transfection reagent individually and synergistically exhibited higher transfection efficiency applicable for several mammalian cell culture lines in a 96-well plate. By taking advantage of a simple transfection procedure using PCR-amplified DNA, SV40 and rabbit β-globin terminator lengths were minimized. The terminator length is short enough to design in oligonucleotides; thus, terminator primers can be used for the construction and analysis of numerous mutations, deletions, insertions, and tag-fusions at the 3'-terminus of any gene. The PCR-mediated gene manipulation with the terminator primers will transform gene expression by allowing for extremely simple and high-throughput experiments with small-scale, multi-well, and mammalian cell cultures.

  6. Study in mutation of alfalfa genome DNA due to low energy N+ implantation using RAPD

    International Nuclear Information System (INIS)

    Chen Roulei; Song Daojun; Yu Zengliang; Li Yufeng; Liang Yunzhang

    2001-01-01

    After implanted by various dosage N + beams, germination rate of alfalfa seeds appears to be saddle line with dosage increasing. The authors have studied in mutation of genome DNA due to low energy N + implantation, and concluded that 30 differential DNA fragments have been amplified by 8 primers (S 41 , S 42 , S 45 , S 46 , S 50 , S 52 , S 56 , S 58 ) in 100 primers, moreover, number of differential DNA fragments between CK and treatments increases with dosage. Consequently, low energy ion implantation can cause mutation of alfalfa genome DNA. The more dosage it is, the more mutation alfalfa will be

  7. Genome instabilities arising from ribonucleotides in DNA.

    Science.gov (United States)

    Klein, Hannah L

    2017-08-01

    Genomic DNA is transiently contaminated with ribonucleotide residues during the process of DNA replication through misincorporation by the replicative DNA polymerases α, δ and ε, and by the normal replication process on the lagging strand, which uses RNA primers. These ribonucleotides are efficiently removed during replication by RNase H enzymes and the lagging strand synthesis machinery. However, when ribonucleotides remain in DNA they can distort the DNA helix, affect machineries for DNA replication, transcription and repair, and can stimulate genomic instabilities which are manifest as increased mutation, recombination and chromosome alterations. The genomic instabilities associated with embedded ribonucleotides are considered here, along with a discussion of the origin of the lesions that stimulate particular classes of instabilities. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Using a commercially available DNA extraction kit to obtain high quality human genomic DNA suitable for PCR and genotyping from 11-year-old saliva saturated cotton spit wads

    Directory of Open Access Journals (Sweden)

    Hudziak James J

    2008-12-01

    Full Text Available Abstract Background We sought to describe the integrity of human genomic DNA extracted from saliva saturated cotton spit wads stored at -20°C for approximately 11 years. 783 spit wad samples were collected from an ADHD sample population (Vermont Family Study during 1996–2000. Human genomic DNA was extracted from the spit wads using a commercially available kit; QIAamp DNA Blood Midi Kit (Qiagen, Inc., Valencia, CA. with a few modifications. Results The resulting DNA yield was more than adequate for genetic analysis and ranged from approximately 1 μg to a total of 80 μg (mean 17.3 μgs ± 11.9 μgs. A260/A280 ratios for the human genomic DNA extracted from the spit wads was consistently within the generally acceptable values of 1.7–2.0, with the lowest purity being 1.70, and a mean value of 1.937 ± 0.226 for the 783 samples. The DNA also was suitable for PCR reactions as evidenced by the amplification of the serotonin-transporter-linked polymorphic region, 5HTTLPR. 5HTTLPR is a functional polymorphism in the promoter region of the serotonin transporter gene (HTT, SLC6A4, or SERT, consisting of two intensively studied alleles. 770 of the 783 samples (98.3% produced fragments after PCR of the expected size with primers specific for 5HTTLPR. Conclusion High quality and abundant genomic DNA can be successfully retrieved from saliva saturated cotton spit wads using the commercially available kit, QIAamp DNA Blood Midi Kit from Qiagen, Inc. Furthermore, the DNA can be extracted in less than 3 hours and multiple samples can be processed simultaneously thus reducing processing time.

  9. Application of a double-enrichment procedure for microsatellite isolation and the use of tailed primers for high throughput genotyping

    Directory of Open Access Journals (Sweden)

    Fábio Mendonça Diniz

    2007-03-01

    Full Text Available The number of microsatellite loci and their allelic diversity contribute to increase accuracy and informativity of genetic estimates, however, the isolation of microsatellite loci is not only laborious but also quite expensive. We used (GATAn and (GACAn tetranucleotide probes and single- and double-enrichment hybridization to construct and screen a genomic library with an increased proportion of DNA fragments containing repeat motifs. Repeats were found using both types of hybridization but the double-enrichment procedure recovered sequences of which 100% contained (GATAn and (GACAn motifs. Microsatellite loci primers were then designed with an M13R-tail or CAG-tag to produce scorable PCR products with minimal stutter. The approach used in this study suggests that double-enrichment is a worthwhile strategy when isolating repeat motifs from eukaryotic genomes. Moreover, the use of tailed microsatellite primers provides increased resolution for compound microsatellite loci, with a significant decrease in costs.

  10. A genome editing primer for the hematologist

    Science.gov (United States)

    Hoban, Megan D.

    2016-01-01

    Gene editing enables the site-specific modification of the genome. These technologies have rapidly advanced such that they have entered common use in experimental hematology to investigate genetic function. In addition, genome editing is becoming increasingly plausible as a treatment modality to rectify genetic blood disorders and improve cellular therapies. Genome modification typically ensues from site-specific double-strand breaks and may result in a myriad of outcomes. Even single-strand nicks and targeted biochemical modifications that do not permanently alter the DNA sequence (epigenome editing) may be powerful instruments. In this review, we examine the various technologies, describe their advantages and shortcomings for engendering useful genetic alterations, and consider future prospects for genome editing to impact hematology. PMID:27053532

  11. Pump cavitation background noise

    International Nuclear Information System (INIS)

    Cha, Y.S.

    1976-01-01

    Cavitation is defined as the growth and collapse of cavities associated with the change in pressure in contrast to the case of boiling where change in temperature is the dominating factor. It is commonly accepted that cavitation inception occurs when the minimum pressure in a system reaches the vapor pressure corresponding to the local temperatures of the liquid. The foregoing statement is, in fact, another way of defining incipient boiling which is usually defined as the condition where the temperature reaches the saturation temperature corresponding to the system pressure. Therefore, there is no difference between cavitation and boiling since both are associated with the growth and collapse of bubbles in a liquid. Cavitation noise may not be avoidable for an LMFBR primary pump under normal operating conditions, and will be present as background during boiling detection by acoustic methods

  12. Sensitive and selective amplification of methylated DNA sequences using helper-dependent chain reaction in combination with a methylation-dependent restriction enzymes.

    Science.gov (United States)

    Rand, Keith N; Young, Graeme P; Ho, Thu; Molloy, Peter L

    2013-01-07

    We have developed a novel technique for specific amplification of rare methylated DNA fragments in a high background of unmethylated sequences that avoids the need of bisulphite conversion. The methylation-dependent restriction enzyme GlaI is used to selectively cut methylated DNA. Then targeted fragments are tagged using specially designed 'helper' oligonucleotides that are also used to maintain selection in subsequent amplification cycles in a process called 'helper-dependent chain reaction'. The process uses disabled primers called 'drivers' that can only prime on each cycle if the helpers recognize specific sequences within the target amplicon. In this way, selection for the sequence of interest is maintained throughout the amplification, preventing amplification of unwanted sequences. Here we show how the method can be applied to methylated Septin 9, a promising biomarker for early diagnosis of colorectal cancer. The GlaI digestion and subsequent amplification can all be done in a single tube. A detection sensitivity of 0.1% methylated DNA in a background of unmethylated DNA was achieved, which was similar to the well-established Heavy Methyl method that requires bisulphite-treated DNA.

  13. Detection of Balamuthia mandrillaris DNA by real-time PCR targeting the RNase P gene

    Directory of Open Access Journals (Sweden)

    Lewin Astrid

    2008-12-01

    Full Text Available Abstract Background The free-living amoeba Balamuthia mandrillaris may cause fatal encephalitis both in immunocompromised and in – apparently – immunocompetent humans and other mammalian species. Rapid, specific, sensitive, and reliable detection requiring little pathogen-specific expertise is an absolute prerequisite for a successful therapy and a welcome tool for both experimental and epidemiological research. Results A real-time polymerase chain reaction assay using TaqMan® probes (real-time PCR was established specifically targeting the RNase P gene of B. mandrillaris amoebae. The assay detected at least 2 (down to 0.5 genomes of B. mandrillaris grown in axenic culture. It did not react with DNA from closely related Acanthamoeba (3 species, nor with DNA from Toxoplasma gondii, Leishmania major, Pneumocystis murina, Mycobacterium bovis (BCG, human brain, various mouse organs, or from human and murine cell lines. The assay efficiently detected B. mandrillaris DNA in spiked cell cultures, spiked murine organ homogenates, B. mandrillaris-infected mice, and CNS tissue-DNA preparations from 2 patients with proven cerebral balamuthiasis. This novel primer set was successfully combined with a published set that targets the B. mandrillaris 18S rRNA gene in a duplex real-time PCR assay to ensure maximum specificity and as a precaution against false negative results. Conclusion A real-time PCR assay for B. mandrillaris amoebae is presented, that is highly specific, sensitive, and reliable and thus suited both for diagnosis and for research.

  14. Mutated primer binding sites interacting with different tRNAs allow efficient murine leukemia virus replication

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J

    1993-01-01

    Two Akv murine leukemia virus-based retroviral vectors with primer binding sites matching tRNA(Gln-1) and tRNA(Lys-3) were constructed. The transduction efficiency of these mutated vectors was found to be comparable to that of a vector carrying the wild-type primer binding site matching t......RNA(Pro). Polymerase chain reaction amplification and sequence analysis of transduced proviruses confirmed the transfer of vectors with mutated primer binding sites and further showed that tRNA(Gln-2) may act efficiently in conjunction with the tRNA(Gln-1) primer binding site. We conclude that murine leukemia virus...... can replicate by using various tRNA molecules as primers and propose primer binding site-tRNA primer interactions to be of major importance for tRNA primer selection. However, efficient primer selection does not require perfect Watson-Crick base pairing at all 18 positions of the primer binding site....

  15. Use of conserved genomic regions and degenerate primers in a PCR-based assay for the detection of members of the genus Caulimovirus.

    Science.gov (United States)

    Pappu, H R; Druffel, K L

    2009-04-01

    The genus Caulimovirus consists of several distinct virus species with a double-stranded DNA genome that infect diverse plant species. A comparative analysis of the sequences of known Caulimovirus species revealed two regions that are conserved in all Caulimovirus species with the exception of Strawberry vein banding virus. Degenerate primers based on these two regions were designed and tested in a polymerase chain reaction-based assay for broad spectrum detection of members of this genus. Cauliflower mosaic virus, Figwort mosaic virus and three distinct caulimoviruses associated with dahlia (Dahlia variabilis) were used to show the utility of this test in detecting diverse caulimoviruses. The primer pair gave an amplicon of expected size (840bp). Amplicons from each virus were cloned and sequenced to verify their identity. The primer pair and the PCR assay provide approach for the broad spectrum detection of several members of the genus Caulimovirus.

  16. The novel primers for mammal species identification-based mitochondrial cytochrome b sequence: implication for reserved wild animals in Thailand and endangered mammal species in Southeast Asia.

    Science.gov (United States)

    Muangkram, Yuttamol; Wajjwalku, Worawidh; Amano, Akira; Sukmak, Manakorn

    2018-01-01

    We presented the powerful techniques for species identification using the short amplicon of mitochondrial cytochrome b gene sequence. Two faecal samples and one single hair sample of the Asian tapir were tested using the new cytochrome b primers. The results showed a high sequence similarity with the mainland Asian tapir group. The comparative sequence analysis of the reserved wild mammals in Thailand and the other endangered mammal species from Southeast Asia comprehensibly verified the potential of our novel primers. The forward and reverse primers were 94.2 and 93.2%, respectively, by the average value of the sequence identity among 77 species sequences, and the overall mean distance was 35.9%. This development technique could provide rapid, simple, and reliable tools for species confirmation. Especially, it could recognize the problematic biological specimens contained less DNA material from illegal products and assist with wildlife crime investigation of threatened species and related forensic casework.

  17. DNA Polymerase e - More Than a Polymerase

    Directory of Open Access Journals (Sweden)

    Helmut Pospiech

    2003-01-01

    Full Text Available This paper presents a comprehensive review of the structure and function of DNA polymerase e. Together with DNA polymerases a and d, this enzyme replicates the nuclear DNA in the eukaryotic cell. During this process, DNA polymerase a lays down RNA-DNA primers that are utilized by DNA polymerases d and e for the bulk DNA synthesis. Attempts have been made to assign these two enzymes specifically to the synthesis of the leading and the lagging strand. Alternatively, the two DNA polymerases may be needed to replicate distinct regions depending on chromatin structure. Surprisingly, the essential function of DNA polymerase e does not depend on its catalytic activity, but resides in the nonenzymatic carboxy-terminal domain. This domain not only mediates the interaction of the catalytic subunit with the three smaller regulatory subunits, but also links the replication machinery to the S phase checkpoint. In addition to its role in DNA replication, DNA polymerase e fulfils roles in the DNA synthesis step of nucleotide excision and base excision repair, and has been implicated in recombinational processes in the cell.

  18. cDNA library preparation.

    Science.gov (United States)

    Kooiker, Maarten; Xue, Gang-Ping

    2014-01-01

    The construction of full-length cDNA libraries allows researchers to study gene expression and protein interactions and undertake gene discovery. Recent improvements allow the construction of high-quality cDNA libraries, with small amounts of mRNA. In parallel, these improvements allow for the incorporation of adapters into the cDNA, both at the 5' and 3' end of the cDNA. The 3' adapter is attached to the oligo-dT primer that is used by the reverse transcriptase, whereas the 5' adapter is incorporated by the template switching properties of the MMLV reverse transcriptase. This allows directional cloning and eliminates inefficient steps like adapter ligation, phosphorylation, and methylation. Another important step in the construction of high-quality cDNA libraries is the normalization. The difference in the levels of expression between genes might be several orders of magnitude. Therefore, it is essential that the cDNA library is normalized. With a recently discovered enzyme, duplex-specific nuclease, it is possible to normalize the cDNA library, based on the fact that more abundant molecules are more likely to reanneal after denaturation compared to rare molecules.

  19. Software-Supported USER Cloning Strategies for Site-Directed Mutagenesis and DNA Assembly

    DEFF Research Database (Denmark)

    Genee, Hans Jasper; Bonde, Mads Tvillinggaard; Bagger, Frederik Otzen

    2015-01-01

    USER cloning is a fast and versatile method for engineering of plasmid DNA. We have developed a user friendly Web server tool that automates the design of optimal PCR primers for several distinct USER cloning-based applications. Our Web server, named AMUSER (Automated DNA Modifications with USER...... cloning), facilitates DNA assembly and introduction of virtually any type of site-directed mutagenesis by designing optimal PCR primers for the desired genetic changes. To demonstrate the utility, we designed primers for a simultaneous two-position site-directed mutagenesis of green fluorescent protein...... (GFP) to yellow fluorescent protein (YFP), which in a single step reaction resulted in a 94% cloning efficiency. AMUSER also supports degenerate nucleotide primers, single insert combinatorial assembly, and flexible parameters for PCR amplification. AMUSER is freely available online at ....

  20. MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

    Science.gov (United States)

    Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

    2012-11-05

    Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  1. Mitochondrial DNA haplogroup T is associated with coronary artery disease and diabetic retinopathy: a case control study

    Directory of Open Access Journals (Sweden)

    Kofler Barbara

    2009-04-01

    Full Text Available Abstract Background There is strong and consistent evidence that oxidative stress is crucially involved in the development of atherosclerotic vascular disease. Overproduction of reactive oxygen species (ROS in mitochondria is an unifying mechanism that underlies micro- and macrovascular atherosclerotic disease. Given the central role of mitochondria in energy and ROS production, mitochondrial DNA (mtDNA is an obvious candidate for genetic susceptibility studies on atherosclerotic processes. We therefore examined the association between mtDNA haplogroups and coronary artery disease (CAD as well as diabetic retinopathy. Methods This study of Middle European Caucasians included patients with angiographically documented CAD (n = 487, subjects with type 2 diabetes mellitus with (n = 149 or without (n = 78 diabetic retinopathy and control subjects without clinical manifestations of atherosclerotic disease (n = 1527. MtDNA haplotyping was performed using multiplex PCR and subsequent multiplex primer extension analysis for determination of the major European haplogroups. Haplogroup frequencies of patients were compared to those of control subjects without clinical manifestations of atherosclerotic disease. Results Haplogroup T was significantly more prevalent among patients with CAD than among control subjects (14.8% vs 8.3%; p = 0.002. In patients with type 2 diabetes, the presence of diabetic retinopathy was also significantly associated with a higher prevalence of haplogroup T (12.1% vs 5.1%; p = 0.046. Conclusion Our data indicate that the mtDNA haplogroup T is associated with CAD and diabetic retinopathy in Middle European Caucasian populations.

  2. HPV Genotyping of Modified General Primer-Amplicons Is More Analytically Sensitive and Specific by Sequencing than by Hybridization.

    Science.gov (United States)

    Meisal, Roger; Rounge, Trine Ballestad; Christiansen, Irene Kraus; Eieland, Alexander Kirkeby; Worren, Merete Molton; Molden, Tor Faksvaag; Kommedal, Øyvind; Hovig, Eivind; Leegaard, Truls Michael; Ambur, Ole Herman

    2017-01-01

    Sensitive and specific genotyping of human papillomaviruses (HPVs) is important for population-based surveillance of carcinogenic HPV types and for monitoring vaccine effectiveness. Here we compare HPV genotyping by Next Generation Sequencing (NGS) to an established DNA hybridization method. In DNA isolated from urine, the overall analytical sensitivity of NGS was found to be 22% higher than that of hybridization. NGS was also found to be the most specific method and expanded the detection repertoire beyond the 37 types of the DNA hybridization assay. Furthermore, NGS provided an increased resolution by identifying genetic variants of individual HPV types. The same Modified General Primers (MGP)-amplicon was used in both methods. The NGS method is described in detail to facilitate implementation in the clinical microbiology laboratory and includes suggestions for new standards for detection and calling of types and variants with improved resolution.

  3. HPV Genotyping of Modified General Primer-Amplicons Is More Analytically Sensitive and Specific by Sequencing than by Hybridization.

    Directory of Open Access Journals (Sweden)

    Roger Meisal

    Full Text Available Sensitive and specific genotyping of human papillomaviruses (HPVs is important for population-based surveillance of carcinogenic HPV types and for monitoring vaccine effectiveness. Here we compare HPV genotyping by Next Generation Sequencing (NGS to an established DNA hybridization method. In DNA isolated from urine, the overall analytical sensitivity of NGS was found to be 22% higher than that of hybridization. NGS was also found to be the most specific method and expanded the detection repertoire beyond the 37 types of the DNA hybridization assay. Furthermore, NGS provided an increased resolution by identifying genetic variants of individual HPV types. The same Modified General Primers (MGP-amplicon was used in both methods. The NGS method is described in detail to facilitate implementation in the clinical microbiology laboratory and includes suggestions for new standards for detection and calling of types and variants with improved resolution.

  4. An efficient method for DNA extraction from Cladosporioid fungi.

    Science.gov (United States)

    Moslem, M A; Bahkali, A H; Abd-Elsalam, K A; Wit, P J G M

    2010-11-23

    We developed an efficient method for DNA extraction from Cladosporioid fungi, which are important fungal plant pathogens. The cell wall of Cladosporioid fungi is often melanized, which makes it difficult to extract DNA from their cells. In order to overcome this we grew these fungi for three days on agar plates and extracted DNA from mycelium mats after manual or electric homogenization. High-quality DNA was isolated, with an A(260)/A(280) ratio ranging between 1.6 and 2.0. Isolated genomic DNA was efficiently digested with restriction enzymes and produced distinct banding patterns on agarose gels for the different Cladosporium species. Clear DNA fragments from the isolated DNA were amplified by PCR using small and large subunit rDNA primers, demonstrating that this method provides DNA of sufficiently high quality for molecular analyses.

  5. Mechanism of sequence-specific template binding by the DNA primase of bacteriophage T7

    KAUST Repository

    Lee, Seung-Joo

    2010-03-28

    DNA primases catalyze the synthesis of the oligoribonucleotides required for the initiation of lagging strand DNA synthesis. Biochemical studies have elucidated the mechanism for the sequence-specific synthesis of primers. However, the physical interactions of the primase with the DNA template to explain the basis of specificity have not been demonstrated. Using a combination of surface plasmon resonance and biochemical assays, we show that T7 DNA primase has only a slightly higher affinity for DNA containing the primase recognition sequence (5\\'-TGGTC-3\\') than for DNA lacking the recognition site. However, this binding is drastically enhanced by the presence of the cognate Nucleoside triphosphates (NTPs), Adenosine triphosphate (ATP) and Cytosine triphosphate (CTP) that are incorporated into the primer, pppACCA. Formation of the dimer, pppAC, the initial step of sequence-specific primer synthesis, is not sufficient for the stable binding. Preformed primers exhibit significantly less selective binding than that observed with ATP and CTP. Alterations in subdomains of the primase result in loss of selective DNA binding. We present a model in which conformational changes induced during primer synthesis facilitate contact between the zinc-binding domain and the polymerase domain. The Author(s) 2010. Published by Oxford University Press.

  6. Firearm laws: a primer for psychiatrists.

    Science.gov (United States)

    Price, Marilyn; Norris, Donna Marie

    2010-01-01

    Persons with mental illness or substance abuse have been perceived by the public to pose an increased risk of violence to themselves and others. As a result, federal and state laws have restricted the right of certain categories of persons with mental illness or substance abuse to possess, register, license, retain, or carry a firearm. Clinicians should be familiar with the specific firearm statutes of their own states, which describe the disqualifying mental health/substance abuse history and the role and responsibility of the psychiatrist in the process. State statutes vary widely in terms of the definitions of, and reporting requirements relating to, prohibited persons with mental illness or substance abuse. States also vary in the duration of the prohibition and in the timing of the appeals process. Some of the statutes have specific provisions for the removal of a firearm when a prohibited person is identified. States may maintain a mental health database that is used to determine firearm eligibility and may forward information to the National Instant Criminal Background Check System. The National Instant Criminal Background Check System Improvement Amendments Act of 2007 will likely increase the number of persons identified as belonging to the prohibited class.

  7. Komparasi Metode Isolasi DNA Patogen Antraknosa dan Bulai untuk Deteksi PCR

    Directory of Open Access Journals (Sweden)

    Ade Syahputra

    2016-11-01

    Full Text Available Polymerase chain reaction (PCR is an important tool for detection, identification and monitoring of quarantine pests in Indonesia. DNA isolation method from target organism is an important step to provide adequate DNA template for performing PCR. Objective of the research was to compare conventional, commercial kit, FTA-card and its modification methods of DNA isolation to be used in PCR detection for Colletotrichum acutatum and Peronosclerospora sorghi from chili and maize, respectively. DNA obtained from various isolation methods were measured using UV-vis nanodrop-spectrophotometry.  DNA amplification was performed using DNA concentration of 15 ng µL-1 from each isolation method with gradual primer concentrations of 0.4; 0.6; 0.8; and 1.0 mM. The highest concentration of DNA was achieved with conventional methods for C. acutatum from pure culture and P. sorghi from maize leaf. Best DNA purity was obtained from isolation method using commercial kit for C. acutatum from infected fruit (1.94 and from conventional method for C. acutatum from pure culture (1.91. The highest total yield of isolated DNA was achieved by modified FTA-card for C. acutatum from pure culture. In general DNA amplification using various primer concentration gave positive results although DNA bands intensity was varied from faint to very bright.  Furthermore PCR optimization using the best primer concentration from previous reaction showed that all DNA templates resulted in thick and bright DNA bands.

  8. Low background infrared (LBIR) facility

    Data.gov (United States)

    Federal Laboratory Consortium — The Low background infrared (LBIR) facility was originally designed to calibrate user supplied blackbody sources and to characterize low-background IR detectors and...

  9. Hanford Site background: Part 1, Soil background for nonradioactive analytes

    International Nuclear Information System (INIS)

    1993-04-01

    Volume two contains the following appendices: Description of soil sampling sites; sampling narrative; raw data soil background; background data analysis; sitewide background soil sampling plan; and use of soil background data for the detection of contamination at waste management unit on the Hanford Site

  10. Exploration of Deinococcus-Thermus molecular diversity by novel group-specific PCR primers

    Science.gov (United States)

    Theodorakopoulos, Nicolas; Bachar, Dipankar; Christen, Richard; Alain, Karine; Chapon, Virginie

    2013-01-01

    The deeply branching Deinococcus-Thermus lineage is recognized as one of the most extremophilic phylum of bacteria. In previous studies, the presence of Deinococcus-related bacteria in the hot arid Tunisian desert of Tataouine was demonstrated through combined molecular and culture-based approaches. Similarly, Thermus-related bacteria have been detected in Tunisian geothermal springs. The present work was conducted to explore the molecular diversity within the Deinococcus-Thermus phylum in these extreme environments. A set of specific primers was designed in silico on the basis of 16S rRNA gene sequences, validated for the specific detection of reference strains, and used for the polymerase chain reaction (PCR) amplification of metagenomic DNA retrieved from the Tataouine desert sand and Tunisian hot spring water samples. These analyses have revealed the presence of previously undescribed Deinococcus-Thermus bacterial sequences within these extreme environments. The primers designed in this study thus represent a powerful tool for the rapid detection of Deinococcus-Thermus in environmental samples and could also be applicable to clarify the biogeography of the Deinococcus-Thermus phylum. PMID:23996915

  11. Development of DNA marker for Fusarium resistance in Pisang Berangan

    International Nuclear Information System (INIS)

    Affrida Abu Hassan; Mohd Nazir Basiran; Rosmawati Shaharuddin

    2000-01-01

    Fusarium wilt (Panama disease), a disease caused by a soil-bome fungus Fusarium oxysporum f. sp. cubense, is regarded as one of the most significant threats to banana (Musa spp.) production worldwide. In Malaysia, it is affecting the Cavendish as well as Pisang Berangan which are widely planted for export as well as for local consumption. Pisang Berangan mutant line (MB96) which was obtained through induced mutation by gamma irradiation has showed certain degree of tolerance towards the disease. Attempts were made to utilise Polymerase Chain Reaction (PCR) based techniques i.e. RAPD (Random Amplified Polymorphic DNA) to screen for unique DNA sequences that are associated or closely linked to these tolerance characteristics. Four single 1 Obp primers and five duplex 1 Obp primers combinations were used to detect polymorphism between the DNA of control and 4 mutant lines micropropagated from MB96. As further control, DNA of Pisang Mas was included. Duplex arbitrary primer combinations 11-89 and single primer OPA-3 have produced DNA fragments that are polymorphic between cultivar, Pisang Berangan and Pisang Mas. However the RAPD analysis failed to show any polymorphism between the control and the mutant lines or in between the mutant lines

  12. Characterization of highly informative cross-species microsatellite panels for the Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) including five novel primers.

    Science.gov (United States)

    Hunter, Margaret Kellogg; Broderick, Damien; Ovenden, Jennifer R; Tucker, Kimberly Pause; Bonde, Robert K; McGuire, Peter M; Lanyon, Janet M

    2010-03-01

    The Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) are threatened species of aquatic mammals in the order Sirenia. Sirenian conservation and management actions would benefit from a more complete understanding of genetic diversity and population structure. Generally, species-specific microsatellite markers are employed in conservation genetic studies; however, robust markers can be difficult and costly to isolate. To increase the number of available markers, dugong and manatee microsatellite primers were evaluated for cross-species amplification. Furthermore, one manatee and four dugong novel primers are reported. After polymerase chain reaction optimization, 23 (92%) manatee primers successfully amplified dugong DNA, of which 11 (48%) were polymorphic. Of the 32 dugong primers tested, 27 (84%) yielded product in the manatee, of which 17 (63%) were polymorphic. Dugong and manatee primers were compared and the most informative markers were selected to create robust and informative marker-panels for each species. These cross-species microsatellite marker-panels can be employed to assess other sirenian populations and can provide beneficial information for the protection and management of these unique mammals. Published 2009. This article is a US Government work and is in the public domain in the USA.

  13. Characterization of highly informative cross-species microsatellite panels for the Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) including five novel primers

    Science.gov (United States)

    Hunter, Margaret Kellogg; Broderick, Damien; Ovenden, Jennifer R.; Tucker, Kimberly Pause; Bonde, Robert K.; McGuire, Peter M.; Lanyon, Janet M.

    2010-01-01

    The Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) are threatened species of aquatic mammals in the order Sirenia. Sirenian conservation and management actions would benefit from a more complete understanding of genetic diversity and population structure. Generally, species-specific microsatellite markers are employed in conservation genetic studies; however, robust markers can be difficult and costly to isolate. To increase the number of available markers, dugong and manatee microsatellite primers were evaluated for cross-species amplification. Furthermore, one manatee and four dugong novel primers are reported. After polymerase chain reaction optimization, 23 (92%) manatee primers successfully amplified dugong DNA, of which 11 (48%) were polymorphic. Of the 32 dugong primers tested, 27 (84%) yielded product in the manatee, of which 17 (63%) were polymorphic. Dugong and manatee primers were compared and the most informative markers were selected to create robust and informative marker-panels for each species. These crossspecies microsatellite marker-panels can be employed to assess other sirenian populations and can provide beneficial information for the protection and management of these unique mammals.

  14. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    Energy Technology Data Exchange (ETDEWEB)

    Bowman, Stephen M [ORNL

    2008-09-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

  15. Translesion Synthesis Past Acrolein-derived DNA Adducts by Human Mitochondrial DNA Polymerase γ*

    Science.gov (United States)

    Kasiviswanathan, Rajesh; Minko, Irina G.; Lloyd, R. Stephen; Copeland, William C.

    2013-01-01

    Acrolein, a mutagenic aldehyde, is produced endogenously by lipid peroxidation and exogenously by combustion of organic materials, including tobacco products. Acrolein reacts with DNA bases forming exocyclic DNA adducts, such as γ-hydroxy-1,N2-propano-2′-deoxyguanosine (γ-HOPdG) and γ-hydroxy-1,N6-propano-2′-deoxyadenosine (γ-HOPdA). The bulky γ-HOPdG adduct blocks DNA synthesis by replicative polymerases but can be bypassed by translesion synthesis polymerases in the nucleus. Although acrolein-induced adducts are likely to be formed and persist in mitochondrial DNA, animal cell mitochondria lack specialized translesion DNA synthesis polymerases to tolerate these lesions. Thus, it is important to understand how pol γ, the sole mitochondrial DNA polymerase in human cells, acts on acrolein-adducted DNA. To address this question, we investigated the ability of pol γ to bypass the minor groove γ-HOPdG and major groove γ-HOPdA adducts using single nucleotide incorporation and primer extension analyses. The efficiency of pol γ-catalyzed bypass of γ-HOPdG was low, and surprisingly, pol γ preferred to incorporate purine nucleotides opposite the adduct. Pol γ also exhibited ∼2-fold lower rates of excision of the misincorporated purine nucleotides opposite γ-HOPdG compared with the corresponding nucleotides opposite dG. Extension of primers from the termini opposite γ-HOPdG was accomplished only following error-prone purine nucleotide incorporation. However, pol γ preferentially incorporated dT opposite the γ-HOPdA adduct and efficiently extended primers from the correctly paired terminus, indicating that γ-HOPdA is probably nonmutagenic. In summary, our data suggest that acrolein-induced exocyclic DNA lesions can be bypassed by mitochondrial DNA polymerase but, in the case of the minor groove γ-HOPdG adduct, at the cost of unprecedented high mutation rates. PMID:23543747

  16. Fungal DNA barcoding.

    Science.gov (United States)

    Xu, Jianping

    2016-11-01

    Fungi are ubiquitous in both natural and human-made environments. They play important roles in the health of plants, animals, and humans, and in broad ecosystem functions. Thus, having an efficient species-level identification system could significantly enhance our ability to treat fungal diseases and to monitor the spatial and temporal patterns of fungal distributions and migrations. DNA barcoding is a potent approach for rapid identification of fungal specimens, generating novel species hypothesis, and guiding biodiversity and ecological studies. In this mini-review, I briefly summarize (i) the history of DNA sequence-based fungal identification; (ii) the emergence of the ITS region as the consensus primary fungal barcode; (iii) the use of the ITS barcodes to address a variety of issues on fungal diversity from local to global scales, including generating a large number of species hypothesis; and (iv) the problems with the ITS barcode region and the approaches to overcome these problems. Similar to DNA barcoding research on plants and animals, significant progress has been achieved over the last few years in terms of both the questions being addressed and the foundations being laid for future research endeavors. However, significant challenges remain. I suggest three broad areas of research to enhance the usefulness of fungal DNA barcoding to meet the current and future challenges: (i) develop a common set of primers and technologies that allow the amplification and sequencing of all fungi at both the primary and secondary barcode loci; (ii) compile a centralized reference database that includes all recognized fungal species as well as species hypothesis, and allows regular updates from the research community; and (iii) establish a consensus set of new species recognition criteria based on barcode DNA sequences that can be applied across the fungal kingdom.

  17. A mathematical primer on quantum mechanics

    CERN Document Server

    Teta, Alessandro

    2018-01-01

    This book offers a rigorous yet elementary approach to quantum mechanics that will meet the needs of Master’s-level Mathematics students and is equally suitable for Physics students who are interested in gaining a deeper understanding of the mathematical structure of the theory. Throughout the coverage, which is limited to single-particle quantum mechanics, the focus is on formulating theory and developing applications in a mathematically precise manner. Following a review of selected key concepts in classical physics and the historical background, the basic elements of the theory of operators in Hilbert spaces are presented and used to formulate the rules of quantum mechanics. The discussion then turns to free particles, harmonic oscillators, delta potential, and hydrogen atoms, providing rigorous proofs of the corresponding dynamical properties. Starting from an analysis of these applications, readers are subsequently introduced to more advanced topics such as the classical limit, scattering theory, and s...

  18. A primer on scientific programming with Python

    CERN Document Server

    Langtangen, Hans Petter

    2014-01-01

    The book serves as a first introduction to computer programming of scientific applications, using the high-level Python language. The exposition is example and problem-oriented, where the applications are taken from mathematics, numerical calculus, statistics, physics, biology and finance. The book teaches "Matlab-style" and procedural programming as well as object-oriented programming. High school mathematics is a required background and it is advantageous to study classical and numerical one-variable calculus in parallel with reading this book. Besides learning how to program computers, the reader will also learn how to solve mathematical problems, arising in various branches of science and engineering, with the aid of numerical methods and programming. By blending programming, mathematics and scientific applications, the book lays a solid foundation for practicing computational science. From the reviews: Langtangen … does an excellent job of introducing programming as a set of skills in problem solving. ...

  19. A primer on scientific programming with Python

    CERN Document Server

    Langtangen, Hans Petter

    2016-01-01

    The book serves as a first introduction to computer programming of scientific applications, using the high-level Python language. The exposition is example and problem-oriented, where the applications are taken from mathematics, numerical calculus, statistics, physics, biology and finance. The book teaches "Matlab-style" and procedural programming as well as object-oriented programming. High school mathematics is a required background and it is advantageous to study classical and numerical one-variable calculus in parallel with reading this book. Besides learning how to program computers, the reader will also learn how to solve mathematical problems, arising in various branches of science and engineering, with the aid of numerical methods and programming. By blending programming, mathematics and scientific applications, the book lays a solid foundation for practicing computational science. From the reviews: Langtangen … does an excellent job of introducing programming as a set of skills in problem solving. ...

  20. Complexity management in engineering design a primer

    CERN Document Server

    Maurer, Maik

    2017-01-01

    The treatise supports understanding the phenomena of complexity in engineering, distinguishes complexity from other challenges and presents an overview of definitions and applied approaches. The historical background of complexity management is explained by highlighting the important epochs, their key actors and their discoveries, findings and developments. Knowing about the appearance of early system awareness in ancient Greece, the creation of mechanical philosophy in the 17th century and the discovery of classic physics enables the reader to better comprehend modern system sciences and management approaches. A classification of complexity management approaches by research fields indicates current focus areas and starting points for future discussions. In a comprehensive map, the classification points out mutual overlaps between engineering disciplines in terms of similar complexity management approaches. Finally, the treatise introduces a generic complexity management framework, which is based on structura...

  1. Relativistic astrophysics and cosmology a primer

    CERN Document Server

    Hoyng, Peter

    2006-01-01

    This book offers a succinct and self-contained treatment of general relativity and its application to neutron stars, black holes, gravitational waves and cosmology, at an intermediate level. The required mathematical concepts are introduced informally, following geometrical intuition as much as possible. The approach is theoretical, but there is ample discussion of observational aspects and instrumental issues where appropriate. Topical issues such as the Gravity Probe B mission, and the physics of interferometer detectors of gravitational waves and the angular power spectrum of the Cosmic Microwave Background are included. The book is written for advanced undergraduates and beginning graduate students in (astro)physics. The reader is assumed to be familiar with linear algebra and analysis, ordinary differential equations, special relativity, and basic thermal physics, but prior knowledge of differential geometry and general relativity is not required. Containing 140 exercises with extensive hints for their s...

  2. A Primer of Middle Eastern Leadership Culture

    Directory of Open Access Journals (Sweden)

    Sheldon Greaves

    2012-01-01

    Full Text Available It is natural for someone looking in on a foreign culture from the outside to interpret what they see and frame their reactions based on their own background and assumptions. With cultures as a different as those of the Middle East and the West, the potential for blunders increases dramatically, made worse by the high political, diplomatic, military, and commercial stakes involved. Leadership culture in this region has been shaped over centuries through a variety of factors, such as reputation, family, and religion, which continue to influence decision making. The present study posits that an understanding of these factors and how they work is crucial for intelligence analysts, policy and decision makers, strategists, and scholars who must find their way through a very unfamiliar cultural landscape in the Middle East. It is hoped that this discussion will in some way assist in the creation of more effective interaction, policies, and analysis associated with the Middle East.

  3. Application of DNA as a Smart Material

    DEFF Research Database (Denmark)

    Voigt, Niels Vinther

    2011-01-01

    The scientific field of DNA nanotechnology is undergoing a tremendous development these years. This thesis presents five different projects investigating various aspects of the recent development in DNA nanotechnology. Chapter 1 is a background chapter that outlines the evolution of DNA...... nanotechnology from the small assemblies in the beginning to the large and complex DNA structures of today. After the background chapter, the thesis consists of two parts. The first part comprises three projects regarding DNA origami (chapter 2–4). In the project described in chapter 2, DNA origami was exploited...

  4. Lesion Orientation of O4-Alkylthymidine Influences Replication by Human DNA Polymerase η

    OpenAIRE

    O’Flaherty, D. K.; Patra, A.; Su, Y.; Guengerich, F. P.; Egli, M.; Wilds, C. J.

    2016-01-01

    DNA lesions that elude repair may undergo translesion synthesis catalyzed by Y-family DNA polymerases. O4-Alkylthymidines, persistent adducts that can result from carcinogenic agents, may be encountered by DNA polymerases. The influence of lesion orientation around the C4-O4 bond on processing by human DNA polymerase η (hPol η) was studied for oligonucleotides containing O4-methylthymidine, O4-ethylthymidine, and analogs restricting the O4-methylene group in an anti-orientation. Primer extens...

  5. Development, distribution and application of DNA markers for cereal research

    International Nuclear Information System (INIS)

    Qi, X.; Stephenson, P.; Devos, K.M.; Gale, M.D.

    2001-01-01

    DNA probes and primers are important resources for molecular genetic research and molecular breeding. Presently, more than 2500 wheat probes, 400 barley probes, 800 foxtail, pearl millet and finger millet probes, and approximately 150 wheat microsatellite (SSR) primer pairs have been developed and maintained in our DNA Resource Centre at the John Innes Centre (JIC). To accelerate probe and primer distribution, an 'anchor set' and a 'supplementary anchor set', containing 73 and 31 wheat RFLP probes, respectively, and a standard set of 42 primer pairs for wheat SSR markers were selected. Similarly, a set of 52 pearl millet probes has been selected for distribution. More than 8000 wheat RFLP probes, 2000 wheat SSR primer pairs, 700 millet probes and 200 barley probes have been distributed to more than 250 research groups in 40 countries. Our wheat and millet probes and other grass cDNA probes have been used for comparative genetic studies. The revealed conservation of gene content and gene order has been used to construct maps of many grass species and to predict the locations of key genes from one crop species to another. Developed SSR and AFLP markers in wheat, barley and millet are particularly suited for genetic diversity analyses and map construction. (author)

  6. A restriction site to differentiate Plasmodium and Haemoproteus infections in birds: on the inefficiency of general primers for detection of mixed infections.

    Science.gov (United States)

    Martínez, J; Martínez-DE LA Puente, J; Herrero, J; Del Cerro, S; Lobato, E; Rivero-DE Aguilar, J; Vásquez, R A; Merino, S

    2009-06-01

    Avian Plasmodium and Haemoproteus parasites are easily detected by DNA analyses of infected samples but only correctly assigned to each genus by sequencing and use of a phylogenetic approach. Here, we present a restriction site to differentiate between both parasite genera avoiding the use of those analyses. Alignments of 820 sequences currently listed in GenBank encoding a particular cytochrome B region of avian Plasmodium and Haemoproteus show a shared restriction site for both genera using the endonuclease Hpy CH4III. An additional restriction site is present in Plasmodium sequences that would initially allow differentiation of both genera by differential migration of digested products on gels. Overall 9 out of 326 sequences containing both potential restriction sites do not fit to the general rule. We used this differentiation of parasite genera based on Hpy CH4III restriction sites to evaluate the efficacy of 2 sets of general primers in detecting mixed infections. To do so, we used samples from hosts infected by parasites of both genera. The use of general primers was only able to detect 25% or less of the mixed infections. Therefore, parasite DNA amplification using general primers to determine the species composition of haemosporidian infections in individual hosts is not recommended. Specific primers for each species and study area should be designed until a new method can efficiently discriminate both parasites.

  7. Oligonucleotide indexing of DNA barcodes: identification of tuna and other scombrid species in food products

    Directory of Open Access Journals (Sweden)

    Botti Sara

    2010-08-01

    Full Text Available Abstract Background DNA barcodes are a global standard for species identification and have countless applications in the medical, forensic and alimentary fields, but few barcoding methods work efficiently in samples in which DNA is degraded, e.g. foods and archival specimens. This limits the choice of target regions harbouring a sufficient number of diagnostic polymorphisms. The method described here uses existing PCR and sequencing methodologies to detect mitochondrial DNA polymorphisms in complex matrices such as foods. The reported application allowed the discrimination among 17 fish species of the Scombridae family with high commercial interest such as mackerels, bonitos and tunas which are often present in processed seafood. The approach can be easily upgraded with the release of new genetic diversity information to increase the range of detected species. Results Cocktail of primers are designed for PCR using publicly available sequences of the target sequence. They are composed of a fixed 5' region and of variable 3' cocktail portions that allow amplification of any member of a group of species of interest. The population of short amplicons is directly sequenced and indexed using primers containing a longer 5' region and the non polymorphic portion of the cocktail portion. A 226 bp region of CytB was selected as target after collection and screening of 148 online sequences; 85 SNPs were found, of which 75 were present in at least two sequences. Primers were also designed for two shorter sub-fragments that could be amplified from highly degraded samples. The test was used on 103 samples of seafood (canned tuna and scomber, tuna salad, tuna sauce and could successfully detect the presence of different or additional species that were not identified on the labelling of canned tuna, tuna salad and sauce samples. Conclusions The described method is largely independent of the degree of degradation of DNA source and can thus be applied to

  8. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    Lucas, D.S.

    2004-10-03

    This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.

  9. Human DNA polymerase η accommodates RNA for strand extension.

    Science.gov (United States)

    Su, Yan; Egli, Martin; Guengerich, F Peter

    2017-11-03

    Ribonucleotides are the natural analogs of deoxyribonucleotides, which can be misinserted by DNA polymerases, leading to the most abundant DNA lesions in genomes. During replication, DNA polymerases tolerate patches of ribonucleotides on the parental strands to different extents. The majority of human DNA polymerases have been reported to misinsert ribonucleotides into genomes. However, only PrimPol, DNA polymerase α, telomerase, and the mitochondrial human DNA polymerase (hpol) γ have been shown to tolerate an entire RNA strand. Y-family hpol η is known for translesion synthesis opposite the UV-induced DNA lesion cyclobutane pyrimidine dimer and was recently found to incorporate ribonucleotides into DNA. Here, we report that hpol η is able to bind DNA/DNA, RNA/DNA, and DNA/RNA duplexes with similar affinities. In addition, hpol η, as well as another Y-family DNA polymerase, hpol κ, accommodates RNA as one of the two strands during primer extension, mainly by inserting dNMPs opposite unmodified templates or DNA lesions, such as 8-oxo-2'-deoxyguanosine or cyclobutane pyrimidine dimer, even in the presence of an equal amount of the DNA/DNA substrate. The discovery of this RNA-accommodating ability of hpol η redefines the traditional concept of human DNA polymerases and indicates potential new functions of hpol η in vivo . © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  10. Establishment of dna fingerprinting in clonal tea improved cultivars from yunnan of china using issr markers

    International Nuclear Information System (INIS)

    Liu, B.Y.; Zhao, C.M.; Sun, X.M.; Jiang, H.B.

    2015-01-01

    In this study, DNA fingerprints were constructed by using ISSR markers for 20 clonal improved varieties developed by two breeding institutes in Yunnan province. Seven core ISSR primers were selected from 15 primers. A total of 110 bands were generated by PAGE with seven core primers, 93 of which were polymorphic bands, the percentage of polymorphic band (PPB) was 84.54%, and the mean value of polymorphism information content (PIC) reached 0.417; the genetic similarity coefficient of the cultivars was 0.574-0.854. The two primers, UBC835 and ISSR2, had high PIC values, and could be used to distinguish all cultivars, presenting the most efficient single primers. Among the all of primer combinations from the seven core primers, the three combinations, UBC835/UBC811, UBC835/ISSR2, and UBC835/ISSR3 showed lower similar coefficients, and more efficient in identifying the 20 improved varieties than the other primer combinations. Then these three primer combinations were further scored in 15 traditional cultivars. The results showed that UBC835/ISSR2 was the optimal primer combination, which could be used to distinguish each material among the 20 clonal improved varieties and 15 traditional cultivals. Finally, the DNA fingerprints of the 20 clonal improved varieties were constructed based on country and region code, breeding institute, core primer name and ISSR marker data. The established fingerprints could provide reliable scientific base for the protection of intellectual property right for these clonal improved varieties, and the important molecular information contained in these fingerprints would be useful for the authenticity identification and genetic relationship analysis of tea varieties. (author)

  11. Testing the potential of a ribosomal 16S marker for DNA metabarcoding of insects

    Directory of Open Access Journals (Sweden)

    Vasco Elbrecht

    2016-04-01

    Full Text Available Cytochrome c oxidase I (COI is a powerful marker for DNA barcoding of animals, with good taxonomic resolution and a large reference database. However, when used for DNA metabarcoding, estimation of taxa abundances and species detection are limited due to primer bias caused by highly variable primer binding sites across the COI gene. Therefore, we explored the ability of the 16S ribosomal DNA gene as an alternative metabarcoding marker for species level assessments. Ten bulk samples, each containing equal amounts of tissue from 52 freshwater invertebrate taxa, were sequenced with the Illumina NextSeq 500 system. The 16S primers amplified three more insect species than the Folmer COI primers and amplified more equally, probably due to decreased primer bias. Estimation of biomass might be less biased with 16S than with COI, although variation in read abundances of two orders of magnitudes is still observed. According to these results, the marker choice depends on the scientific question. If the goal is to obtain a taxonomic identification at the species level, then COI is more appropriate due to established reference databases and known taxonomic resolution of this marker, knowing that a greater proportion of insects will be missed using COI Folmer primers. If the goal is to obtain a more comprehensive survey the 16S marker, which requires building a local reference database, or optimised degenerated COI primers could be more appropriate.

  12. QuantPrime – a flexible tool for reliable high-throughput primer design for quantitative PCR

    Directory of Open Access Journals (Sweden)

    Kwasniewski Miroslaw

    2008-11-01

    Full Text Available Abstract Background Medium- to large-scale expression profiling using quantitative polymerase chain reaction (qPCR assays are becoming increasingly important in genomics research. A major bottleneck in experiment preparation is the design of specific primer pairs, where researchers have to make several informed choices, often outside their area of expertise. Using currently available primer design tools, several interactive decisions have to be made, resulting in lengthy design processes with varying qualities of the assays. Results Here we present QuantPrime, an intuitive and user-friendly, fully automated tool for primer pair design in small- to large-scale qPCR analyses. QuantPrime can be used online through the internet http://www.quantprime.de/ or on a local computer after download; it offers design and specificity checking with highly customizable parameters and is ready to use with many publicly available transcriptomes of important higher eukaryotic model organisms and plant crops (currently 295 species in total, while benefiting from exon-intron border and alternative splice variant information in available genome annotations. Experimental results with the model plant Arabidopsis thaliana, the crop Hordeum vulgare and the model green alga Chlamydomonas reinhardtii show success rates of designed primer pairs exceeding 96%. Conclusion QuantPrime constitutes a flexible, fully automated web application for reliable primer design for use in larger qPCR experiments, as proven by experimental data. The flexible framework is also open for simple use in other quantification applications, such as hydrolyzation probe design for qPCR and oligonucleotide probe design for quantitative in situ hybridization. Future suggestions made by users can be easily implemented, thus allowing QuantPrime to be developed into a broad-range platform for the design of RNA expression assays.

  13. A new DNA band display technology of microsatellite DNA ...

    African Journals Online (AJOL)

    This study proposes a new DNA band display technology of microsatellite DNA called Fluorescent Imaging Technology. In comparison with Silver Stain Technology, this technology is worth popularizing in the laboratory because of its high resolution, efficiency, simplicity and clear background. Key words: Microsatellite DNA ...

  14. Analysis of Translesion DNA Synthesis by the Mitochondrial DNA Polymerase γ.

    Science.gov (United States)

    Copeland, William C; Kasiviswanathan, Rajesh; Longley, Matthew J

    2016-01-01

    Mitochondrial DNA is replicated by the nuclear-encoded DNA polymerase γ (pol γ) which is composed of a single 140 kDa catalytic subunit and a dimeric 55 kDa accessory subunit. Mitochondrial DNA is vulnerable to various forms of damage, including several types of oxidative lesions, UV-induced photoproducts, chemical adducts from environmental sources, as well as alkylation and inter-strand cross-links from chemotherapy agents. Although many of these lesions block DNA replication, pol γ can bypass some lesions by nucleotide incorporation opposite a template lesion and further extension of the DNA primer past the lesion. This process of translesion synthesis (TLS) by pol γ can occur in either an error-free or an error-prone manner. Assessment of TLS requires extensive analysis of oligonucleotide substrates and replication products by denaturing polyacrylamide sequencing gels. This chapter presents protocols for the analysis of translesion DNA synthesis.

  15. Alignment-free design of highly discriminatory diagnostic primer sets for Escherichia coli O104:H4 outbreak strains.

    Directory of Open Access Journals (Sweden)

    Leighton Pritchard

    Full Text Available BACKGROUND: An Escherichia coli O104:H4 outbreak in Germany in summer 2011 caused 53 deaths, over 4000 individual infections across Europe, and considerable economic, social and political impact. This outbreak was the first in a position to exploit rapid, benchtop high-throughput sequencing (HTS technologies and crowdsourced data analysis early in its investigation, establishing a new paradigm for rapid response to disease threats. We describe a novel strategy for design of diagnostic PCR primers that exploited this rapid draft bacterial genome sequencing to distinguish between E. coli O104:H4 outbreak isolates and other pathogenic E. coli isolates, including the historical hæmolytic uræmic syndrome (HUSEC E. coli HUSEC041 O104:H4 strain, which possesses the same serotype as the outbreak isolates. METHODOLOGY/PRINCIPAL FINDINGS: Primers were designed using a novel alignment-free strategy against eleven draft whole genome assemblies of E. coli O104:H4 German outbreak isolates from the E. coli O104:H4 Genome Analysis Crowd-Sourcing Consortium website, and a negative sequence set containing 69 E. coli chromosome and plasmid sequences from public databases. Validation in vitro against 21 'positive' E. coli O104:H4 outbreak and 32 'negative' non-outbreak EHEC isolates indicated that individual primer sets exhibited 100% sensitivity for outbreak isolates, with false positive rates of between 9% and 22%. A minimal combination of two primers discriminated between outbreak and non-outbreak E. coli isolates with 100% sensitivity and 100% specificity. CONCLUSIONS/SIGNIFICANCE: Draft genomes of isolates of disease outbreak bacteria enable high throughput primer design and enhanced diagnostic performance in comparison to traditional molecular assays. Future outbreak investigations will be able to harness HTS rapidly to generate draft genome sequences and diagnostic primer sets, greatly facilitating epidemiology and clinical diagnostics. We expect that high

  16. Allele dropout caused by a non-primer-site SNV affecting PCR amplification--a call for next-generation primer design algorithm.

    Science.gov (United States)

    Lam, Ching-wan; Mak, Chloe Miu

    2013-06-05

    PCR-based technology is indispensable for genetic diagnosis. On the other hand, allele dropout is one significant cause of genotyping errors. Most allele dropout mechanisms are related to annealing failure caused by single nucleotide variant (SNV) situated inside the primer sequences. Here, we demonstrate a novel allele dropout mechanism caused by a non-primer-binding-site SNV. We demonstrate that the apparent homozygosity of NM_000137.1(FAH):c.1035_1037del was caused by allele dropout. The non-primer-binding-site SNV causes a strong secondary hairpin structure formation of the PCR products and leads to amplification failure. SNV check of the primer sequences per se during primer design is not adequate to avoid allele dropout. The next-generation primer design software should analyze the secondary structure of primers and template sequence taking SNV in both sequences into account in order to avoid genotyping errors. Copyright © 2013 Elsevier B.V. All rights reserved.

  17. Executive Summary - Historical background

    International Nuclear Information System (INIS)

    2005-01-01

    matter physics experiments at the High Flux Reactor of The Laue Langevin Institute and the ISIS spallation source at Rutherford-Appleton. Recently, we very actively entered the ICARUS neutrino collaboration and were invited to the PIERRE AUGER collaboration which will search for the highest energies in the Universe. Having close ties with CERN we are very actively engaged in CROSS-GRID, a large computer network project. To better understand the historical background of the INP development, it is necessary to add a few comments on financing of science in Poland. During the 70's and the 80's, research was financed through the so-called Central Research Projects for Science and Technical Development. The advantage of this system was that state-allocated research funds were divided only by a few representatives of the scientific community, which allowed realistic allocation of money to a small number of projects. After 1989 we were able to purchase commercially available equipment, which led to the closure of our large and very experienced electronic workshop. We also considerably reduced our well equipped mechanical shop. During the 90's the reduced state financing of science was accompanied by a newly established Committee of Scientific Research which led to the creation of a system of small research projects. This precluded the development of more ambitious research projects and led to the dispersion of equipment among many smaller laboratories and universities. A large research establishment, such as our Institute, could not develop properly under such conditions. In all, between 1989 and 2004 we reduced our personnel from about 800 to 470 and our infrastructure became seriously undercapitalised. However, with energetic search for research funds, from European rather than national research programs, we hope to improve and modernize our laboratories and their infrastructure in the coming years

  18. Isolation of Retroelement from Plant Genomic DNA

    OpenAIRE

    sprotocols

    2014-01-01

    Author: Pat Heslop-Harrison ### Abstract: Retroelements and their derivatives are an ubiquitous and abundant component of plant genomes. From the 1990s, PCR based techniques have been developed to isolate the elements from genomic DNA of different plants, and the methods and primers used are presented here. Major classes of retroelements include the Ty1-copia, the Ty3-gypsy and the LINE (non-LTR) groups. Mixed PCR products representing the full heterogeneous pool of retrotransposo...

  19. Inaccurate DNA synthesis in cell extracts of yeast producing active human DNA polymerase iota.

    Directory of Open Access Journals (Sweden)

    Alena V Makarova

    2011-01-01

    Full Text Available Mammalian Pol ι has an unusual combination of properties: it is stimulated by Mn(2+ ions, can bypass some DNA lesions and misincorporates "G" opposite template "T" more frequently than incorporates the correct "A." We recently proposed a method of detection of Pol ι activity in animal cell extracts, based on primer extension opposite the template T with a high concentration of only two nucleotides, dGTP and dATP (incorporation of "G" versus "A" method of Gening, abbreviated as "misGvA". We provide unambiguous proof of the "misGvA" approach concept and extend the applicability of the method for the studies of variants of Pol ι in the yeast model system with different cation cofactors. We produced human Pol ι in baker's yeast, which do not have a POLI ortholog. The "misGvA" activity is absent in cell extracts containing an empty vector, or producing catalytically dead Pol ι, or Pol ι lacking exon 2, but is robust in the strain producing wild-type Pol ι or its catalytic core, or protein with the active center L62I mutant. The signature pattern of primer extension products resulting from inaccurate DNA synthesis by extracts of cells producing either Pol ι or human Pol η is different. The DNA sequence of the template is critical for the detection of the infidelity of DNA synthesis attributed to DNA Pol ι. The primer/template and composition of the exogenous DNA precursor pool can be adapted to monitor replication fidelity in cell extracts expressing various error-prone Pols or mutator variants of accurate Pols. Finally, we demonstrate that the mutation rates in yeast strains producing human DNA Pols ι and η are not elevated over the control strain, despite highly inaccurate DNA synthesis by their extracts.

  20. Mitochondrial DNA copy number and risk of oral cancer: a report from Northeast India.

    Directory of Open Access Journals (Sweden)

    Rosy Mondal

    Full Text Available BACKGROUND: Oral squamous cell carcinoma (OSCC is the sixth most common cancer globally. Tobacco consumption and HPV infection, both are the major risk factor for the development of oral cancer and causes mitochondrial dysfunction. Genetic polymorphisms in xenobiotic-metabolizing enzymes modify the effect of environmental exposures, thereby playing a significant role in gene-environment interactions and hence contributing to the individual susceptibility to cancer. Here, we have investigated the association of tobacco - betel quid chewing, HPV infection, GSTM1-GSTT1 null genotypes, and tumour stages with mitochondrial DNA (mtDNA content variation in oral cancer patients. METHODOLOGY/PRINCIPAL FINDINGS: The study comprised of 124 cases of OSCC and 140 control subjects to PCR based detection was done for high-risk HPV using a consensus primer and multiplex PCR was done for detection of GSTM1-GSTT1 polymorphism. A comparative ΔCt method was used for determination of mtDNA content. The risk of OSCC increased with the ceased mtDNA copy number (Ptrend  = 0.003. The association between mtDNA copy number and OSCC risk was evident among tobacco - betel quid chewers rather than tobacco - betel quid non chewers; the interaction between mtDNA copy number and tobacco - betel quid was significant (P = 0.0005. Significant difference was observed between GSTM1 - GSTT1 null genotypes (P = 0.04, P = 0.001 respectively and HPV infection (P<0.001 with mtDNA content variation in cases and controls. Positive correlation was found with decrease in mtDNA content with the increase in tumour stages (P<0.001. We are reporting for the first time the association of HPV infection and GSTM1-GSTT1 null genotypes with mtDNA content in OSCC. CONCLUSION: Our results indicate that the mtDNA content in tumour tissues changes with tumour stage and tobacco-betel quid chewing habits while low levels of mtDNA content suggests invasive thereby serving as a biomarker in

  1. A Primer on Concepts and Applications of Proteomics in Neuroscience

    DEFF Research Database (Denmark)

    Hosp, Fabian; Mann, Matthias

    2017-01-01

    The enormous complexity of the central nervous system has impeded its systemic exploration for decades but powerful "omic" technologies are now pushing forward the frontiers of neuroscience research at an increasing pace. This Primer reviews the most recent progress in mass spectrometry (MS...

  2. Bond strength of compomers to dentin using acidic primers.

    Science.gov (United States)

    Tate, W H; You, C; Powers, J M

    1999-10-01

    To determine the in vitro bond strengths of seven compomer/bonding agent restorative systems to human dentin. Seven compomer/bonding agents were bonded to human dentin, stored in water at 37 degrees C for 24 hours, and debonded in tension. Bonding conditions were with and without phosphoric acid etching, with and without the use of combined primer/bonding agents, and under moist and wet bond interfaces. Without phosphoric acid etching, F2000/F2000 Compomer Primer/Adhesive and F2000/Single Bond Dental Adhesive System were less sensitive to dentin wetness. With moist dentin, bond strengths of Dyract/Prime & Bond 2.1, Dyract AP/Prime & Bond 2.1, Hytac/OSB light-curing, one-component bonding agent, F2000/Single Bond, and Freedom/STAE single component light-cured dentin/enamel adhesive system, were improved with phosphoric acid etching. Also, with moist dentin, the bond strength of F2000/F2000 Compomer Primer/Adhesive in the 3M Clicker dispensing system was higher without phosphoric acid etching, whereas bonds of Compoglass/Syntac Single-component were not affected by phosphoric acid etching. Bonding did not occur without primer/bonding agent, regardless of surface condition or use of phosphoric acid etching.

  3. Development of a microsatellite primer set to investigate the genetic ...

    Indian Academy of Sciences (India)

    Development of a microsatellite primer set to investigate the genetic population structure of Armadillidium nasatum (Crustacea, Oniscidea). Séverine Masson, Cédric Faivre, Isabelle Giraud, Catherine Souty-Grosset, Richard Cordaux, Carine Delaunay,. Didier Bouchon and Nicolas Bech. J. Genet. 93, 545-549. Table 1.

  4. Controlling Air Pollution; A Primer on Stationary Source Control Techniques.

    Science.gov (United States)

    Corman, Rena

    This companion document to "Air Pollution Primer" is written for the nonexpert in air pollution; however, it does assume a familiarity with air pollution problems. This work is oriented toward providing the reader with knowledge about current and proposed air quality legislation and knowledge about available technology to meet these standards for…

  5. Development of a microsatellite primer set to investigate the genetic ...

    Indian Academy of Sciences (India)

    Development of a microsatellite primer set to investigate the genetic population structure of Armadillidium nasatum (Crustacea, Oniscidea). Séverine Masson, Cédric Faivre, Isabelle Giraud, Catherine Souty-Grosset, Richard Cordaux, Carine Delaunay,. Didier Bouchon and Nicolas Bech. J. Genet. 93, 545–549. Table 1.

  6. Characteristics of the population employed in primer sector in Turkey

    Directory of Open Access Journals (Sweden)

    Bayar Rüya

    2006-01-01

    Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.

  7. Criticality calculations with MCNP{sup TM}: A primer

    Energy Technology Data Exchange (ETDEWEB)

    Mendius, P.W. [ed.; Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

    1994-08-01

    The purpose of this Primer is to assist the nuclear criticality safety analyst to perform computer calculations using the Monte Carlo code MCNP. Because of the closure of many experimental facilities, reliance on computer simulation is increasing. Often the analyst has little experience with specific codes available at his/her facility. This Primer helps the analyst understand and use the MCNP Monte Carlo code for nuclear criticality analyses. It assumes no knowledge of or particular experience with Monte Carlo codes in general or with MCNP in particular. The document begins with a Quickstart chapter that introduces the basic concepts of using MCNP. The following chapters expand on those ideas, presenting a range of problems from simple cylinders to 3-dimensional lattices for calculating keff confidence intervals. Input files and results for all problems are included. The Primer can be used alone, but its best use is in conjunction with the MCNP4A manual. After completing the Primer, a criticality analyst should be capable of performing and understanding a majority of the calculations that will arise in the field of nuclear criticality safety.

  8. Single nucleotide primer extension to detect genetic diseases: Experimental application to hemophilia B (factor IX) and cystic fibrosis genes

    International Nuclear Information System (INIS)

    Kuppuswamy, M.N.; Hoffmann, J.W.; Spitzer, S.G.; Groce, S.L.; Bajaj, S.P.; Kasper, C.K.

    1991-01-01

    In this report, the authors describe an approach to detect the presence of abnormal alleles in those genetic diseases in which frequency of occurrence of the same mutation is high (e.g., hemophilia B). Initially, from each subject, the DNA fragment containing the putative mutation site is amplified by the polymerase chain reaction. For each fragment two reaction mixtures are then prepared. Each contains the amplified fragment, a primer (18-mer or longer) whose sequence is identical to the coding sequence of the normal gene immediately flanking the 5' end of the mutation site, and either an α- 32 P-labeled nucleotide corresponding to the normal coding sequence at the mutation site or an α- 32 P-labeled nucleotide corresponding to the mutant sequence. An essential feature of the present methodology is that the base immediately 3' to the template-bound primer is one of those altered in the mutant, since in this way an extension of the primer by a single base will give an extended molecule characteristic of either the mutant or the wild type. The method is rapid and should be useful in carrier detection and prenatal diagnosis of every genetic disease with a known sequence variation

  9. Dissecting the role of the ϕ29 terminal protein DNA binding residues in viral DNA replication.

    Science.gov (United States)

    Holguera, Isabel; Muñoz-Espín, Daniel; Salas, Margarita

    2015-03-11

    Phage ϕ29 DNA replication takes place by a protein-priming mechanism in which the viral DNA polymerase catalyses the covalent linkage of the initiating nucleotide to a specific serine residue of the terminal protein (TP). The N-terminal domain of the ϕ29 TP has been shown to bind to the host DNA in a sequence-independent manner and this binding is essential for the TP nucleoid localisation and for an efficient viral DNA replication in vivo. In the present work we have studied the involvement of the TP N-terminal domain residues responsible for DNA binding in the different stages of viral DNA replication by assaying the in vitro activity of purified TP N-terminal mutant proteins. The results show that mutation of TP residues involved in DNA binding affects the catalytic activity of the DNA polymerase in initiation, as the Km for the initiating nucleotide is increased when these mutant proteins are used as primers. Importantly, this initiation defect was relieved by using the ϕ29 double-stranded DNA binding protein p6 in the reaction, which decreased the Km of the DNA polymerase for dATP about 130-190 fold. Furthermore, the TP N-terminal domain was shown to be required both for a proper interaction with the DNA polymerase and for an efficient viral DNA amplification. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. An approach to sequence DNA without tagging

    Science.gov (United States)

    Niu, Sanjun; Saraf, Ravi F.

    2002-10-01

    Microarray technology is playing an increasingly important role in biology and medicine and its application to genomics for gene expression analysis has already reached the market with a variety of commercially available instruments. In these combinatorial analysis methods, known probe single-strand DNA (ssDNA) 'primers' are attached in clusters of typically 100 µm × 100 µm pixels. Each pixel of the array has a slightly different sequence. On exposure to 'unknown' target ssDNA, the pixels with the right complementary probe ssDNA sequence convert to double-stranded DNA (dsDNA) by a hybridization reaction. To transduct the conversion of the pixel to dsDNA, the target ssDNA is labelled with a photoluminescent tag during the polymerase chain reaction (PCR) amplification process. Due to the statistical distribution of the tags in the target ssDNA, it becomes significantly difficult to implement these methods as a diagnostic tool in a pathology laboratory. A method to sequence DNA without tagging the molecule is developed. The fabrication process is compatible with current microelectronics and (emerging) soft-material fabrication technologies, allowing the method to be integrable with micro-electromechanical systems (MEMS) and lab-on-a-chip devices. An estimated sensitivity of 10-12 g on a 1 cm2 device area is obtained.

  11. How a DNA polymerase clamp loader opens a sliding clamp

    OpenAIRE

    Kelch, Brian A.; Makino, Debora L.; O’Donnell, Mike; Kuriyan, John

    2011-01-01

    Processive chromosomal replication relies on sliding DNA clamps, which are loaded onto DNA by pentameric clamp loader complexes belonging to the AAA+ family of ATPases. We present structures for the ATP-bound state of the clamp loader complex from bacteriophage T4, bound to an open clamp and primer-template DNA. The clamp loader traps a spiral conformation of the open clamp so that both the loader and the clamp match the helical symmetry of DNA. One structure reveals that ATP has been hydroly...

  12. Stochastic gravity: a primer with applications

    International Nuclear Information System (INIS)

    Hu, B L; Verdaguer, E

    2003-01-01

    Stochastic semiclassical gravity of the 1990s is a theory naturally evolved from semiclassical gravity of the 1970s and 1980s. It improves on the semiclassical Einstein equation with source given by the expectation value of the stress-energy tensor of quantum matter fields in curved spacetime by incorporating an additional source due to their fluctuations. In stochastic semiclassical gravity the main object of interest is the noise kernel, the vacuum expectation value of the (operator-valued) stress-energy bi-tensor, and the centrepiece is the (semiclassical) Einstein-Langevin equation. We describe this new theory via two approaches: the axiomatic and the functional. The axiomatic approach is useful to see the structure of the theory from the framework of semiclassical gravity, showing the link from the mean value of the energy-momentum tensor to their correlation functions. The functional approach uses the Feynman-Vernon influence functional and the Schwinger-Keldysh closed-time-path effective action methods which are convenient for computations. It also brings out the open system concepts and the statistical and stochastic contents of the theory such as dissipation, fluctuations, noise and decoherence. We then describe the applications of stochastic gravity to the backreaction problems in cosmology and black-hole physics. In the first problem, we study the backreaction of conformally coupled quantum fields in a weakly inhomogeneous cosmology. In the second problem, we study the backreaction of a thermal field in the gravitational background of a quasi-static black hole (enclosed in a box) and its fluctuations. These examples serve to illustrate closely the ideas and techniques presented in the first part. This topical review is intended as a first introduction providing readers with some basic ideas and working knowledge. Thus, we place more emphasis here on pedagogy than completeness. (Further discussions of ideas, issues and ongoing research topics can be found

  13. Stochastic gravity: a primer with applications

    Energy Technology Data Exchange (ETDEWEB)

    Hu, B L [Department of Physics, University of Maryland, College Park, MD 20742-4111 (United States); Verdaguer, E [Departament de Fisica Fonamental and CER en Astrofisica Fisica de Particules i Cosmologia, Universitat de Barcelona, Av. Diagonal 647, 08028 Barcelona (Spain)

    2003-03-21

    Stochastic semiclassical gravity of the 1990s is a theory naturally evolved from semiclassical gravity of the 1970s and 1980s. It improves on the semiclassical Einstein equation with source given by the expectation value of the stress-energy tensor of quantum matter fields in curved spacetime by incorporating an additional source due to their fluctuations. In stochastic semiclassical gravity the main object of interest is the noise kernel, the vacuum expectation value of the (operator-valued) stress-energy bi-tensor, and the centrepiece is the (semiclassical) Einstein-Langevin equation. We describe this new theory via two approaches: the axiomatic and the functional. The axiomatic approach is useful to see the structure of the theory from the framework of semiclassical gravity, showing the link from the mean value of the energy-momentum tensor to their correlation functions. The functional approach uses the Feynman-Vernon influence functional and the Schwinger-Keldysh closed-time-path effective action methods which are convenient for computations. It also brings out the open system concepts and the statistical and stochastic contents of the theory such as dissipation, fluctuations, noise and decoherence. We then describe the applications of stochastic gravity to the backreaction problems in cosmology and black-hole physics. In the first problem, we study the backreaction of conformally coupled quantum fields in a weakly inhomogeneous cosmology. In the second problem, we study the backreaction of a thermal field in the gravitational background of a quasi-static black hole (enclosed in a box) and its fluctuations. These examples serve to illustrate closely the ideas and techniques presented in the first part. This topical review is intended as a first introduction providing readers with some basic ideas and working knowledge. Thus, we place more emphasis here on pedagogy than completeness. (Further discussions of ideas, issues and ongoing research topics can be found

  14. Criticality calculations with MCNP{trademark}: A primer

    Energy Technology Data Exchange (ETDEWEB)

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A. [New Mexico Univ., Albuquerque, NM (United States)

    1994-06-06

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand.

  15. Dual Role of φ29 DNA Polymerase Lys529 in Stabilisation of the DNA Priming-Terminus and the Terminal Protein-Priming Residue at the Polymerisation Site

    Science.gov (United States)

    del Prado, Alicia; Lázaro, José M.; Villar, Laurentino; Salas, Margarita; de Vega, Miguel

    2013-01-01

    Resolution of the crystallographic structure of φ29 DNA polymerase binary and ternary complexes showed that residue Lys529, located at the C-terminus of the palm subdomain, establishes contacts with the 3′ terminal phosphodiester bond. In this paper, site-directed mutants at this Lys residue were used to analyse its functional importance for the synthetic activities of φ29 DNA polymerase, an enzyme that starts linear φ29 DNA replication using a terminal protein (TP) as primer. Our results show that single replacement of φ29 DNA polymerase residue Lys529 by Ala or Glu decreases the stabilisation of the primer-terminus at the polymerisation active site, impairing both the insertion of the incoming nucleotide when DNA and TP are used as primers and the translocation step required for the next incoming nucleotide incorporation. In addition, combination of the DNA polymerase mutants with a TP derivative at residue Glu233, neighbour to the priming residue Ser232, leads us to infer a direct contact between Lys529 and Glu233 for initiation of TP-DNA replication. Altogether, the results are compatible with a sequential binding of φ29 DNA polymerase residue Lys529 with TP and DNA during replication of TP-DNA. PMID:24023769

  16. Cloning and sequencing of dolphinfish (Coryphaena hippurus, Coryphaenidae) growth hormone-encoding cDNA.

    Science.gov (United States)

    Peduel, A D; Elizur, A; Knibb, W

    1994-01-01

    The cDNA encoding the preprotein growth hormone from the dolphinfish (Coryphaena hippurus) has been cloned and sequenced. The cDNA was derived by reverse transcription of RNA from the pituitary of a young fish using the method known as Rapid Amplification of cDNA Ends (RACE). An oligonucleotide primer corresponding to the 5' region of Pagrus major and the universal RACE primer enabled amplification using the Polymerase Chain Reaction (PCR). The dolphinfish and yellow-tail, Seriola quineqeradiata, are both members of the sub-order Percoidei (Perciforme) and their GH sequences show a high level of homology.

  17. CRISPR Technology Reveals RAD(51)-ical Mechanisms of Repair in Roundworms: An Educational Primer for Use with "Promotion of Homologous Recombination by SWS-1 in Complex with RAD-51 Paralogs in Caenorhabditis elegans".

    Science.gov (United States)

    Turcotte, Carolyn A; Andrews, Nicolas P; Sloat, Solomon A; Checchi, Paula M

    2016-11-01

    The mechanisms cells use to maintain genetic fidelity via DNA repair and the accuracy of these processes have garnered interest from scientists engaged in basic research to clinicians seeking improved treatment for cancer patients. Despite the continued advances, many details of DNA repair are still incompletely understood. In addition, the inherent complexity of DNA repair processes, even at the most fundamental level, makes it a challenging topic. This primer is meant to assist both educators and students in using a recent paper, "Promotion of homologous recombination by SWS-1 in complex with RAD-51 paralogs in Caenorhabditis elegans," to understand mechanisms of DNA repair. The goals of this primer are to highlight and clarify several key techniques utilized, with special emphasis on the clustered, regularly interspaced, short palindromic repeats technique and the ways in which it has revolutionized genetics research, as well as to provide questions for deeper in-class discussion. Copyright © 2016 by the Genetics Society of America.

  18. Random Amplified Polymorphic DNA (RAPD) Markers Readily Distinguish Cryptic Mosquito Species (Diptera: Culicidae: Anopheles)

    Science.gov (United States)

    1993-01-01

    DNA isolation. Individual larvae or adults were ground with a strong diagnostic bands and simple patterns. Primers pro- plastic pestle in...V. (1988) Com- peninsular Malaysia and Thailand (Diptera: Culicidae). Mosq parison of DNA probe and cytogenic methods for identifying field Syst 20

  19. Detection of grey seal Halichoerus grypus DNA in attack wounds on stranded harbour porpoises Phocoena phocoena

    NARCIS (Netherlands)

    van Blijswijk, Judith; Begeman, Lineke; Witte, H.; IJsseldijk, Lonneke; Brasseur, Sophie; Gröne, Andrea; Leopold, Mardik F

    2014-01-01

    DNA was analysed from external wounds on 3 dead harbour porpoises Phocoena phocoena that were stranded in the Netherlands. Puncture wounds as well as the edges of large open wounds were sampled with sterile cotton swabs. With specific primers that target the mtDNA control region of grey seal

  20. Single-molecule studies of fork dynamics in Escherichia coli DNA replication

    NARCIS (Netherlands)

    Tanner, Nathan A.; Hamdan, Samir M.; Jergic, Slobodan; Loscha, Karin V.; Schaeffer, Patrick M.; Dixon, Nicholas E.; Oijen, Antoine M. van

    2008-01-01

    We present single-molecule studies of the Escherichia coli replication machinery. We visualize individual E. coli DNA polymerase III (Pol III) holoenzymes engaging in primer extension and leading-strand synthesis. When coupled to the replicative helicase DnaB, Pol III mediates leading-strand

  1. Supplementary data: Development of nuclear DNA markers for ...

    Indian Academy of Sciences (India)

    Supplementary data: Development of nuclear DNA markers for evolutionary studies in Plasmodium falciparum. Celia Thomas, Sneh Shalini, N. Raghavendra, Meenakshi Choudhary, Anju Verma, Hema Joshi,. A. P. Dash and Aparup Das. J. Genet. 86, 65–68. Primer sequences for amplification of putatively neutral ...

  2. DNA methylation and genetic diversity analysis of genus Cycas in ...

    African Journals Online (AJOL)

    10 Cycas species as well as one subspecies localized in Thailand were studied using the methylation sensitive amplification polymorphism (MSAP) technique. 11 MSAP primer combinations were used and 720 MSAP bands were generated. The percentages of DNA methylation estimated from MSAP fingerprints were in ...

  3. Randomly amplified polymorphic DNA-polymerase chain reaction ...

    Indian Academy of Sciences (India)

    Genetic similarity and diversity of cultured catfish Silurus asotus populations collected from two areas in western Korea were examined using randomly amplified polymorphic DNA-polymerase chain reaction (RAPD-PCR). Out of 20 random primers tested, 5 produced 1344 RAPD bands ranging from 8.2 to 13.6 polymorphic ...

  4. Efficiency of random amplified polymorphic DNA (RAPD) and inter ...

    African Journals Online (AJOL)

    Efficiency of random amplified polymorphic DNA (RAPD) and inter-simple sequence repeats (ISSR) markers for genotype fingerprinting and genetic diversity studies in canola ( ) ... The number of amplified fragments with RAPD primers ranged from 8 to 21, with the size of amplicons ranging from 162 to 3154 bp.

  5. Analysis of phage Mu DNA transposition by whole-genome ...

    Indian Academy of Sciences (India)

    labelled ChIP DNA and Cy3-labelled whole-genome DNA, both amplified by random primers. The 'ratio' value of each probe (fluorescence intensity of Cy5 over Cy3) is the relative enrichment of that probe sequence in the ChIP sample, referred to as the relative MuB binding preference, or BBP. A scatter plot of log2 BBP ...

  6. DNA barcode of coastal alga ( Chlorella sorokiniana ) from Ago ...

    African Journals Online (AJOL)

    Five different loci 18S, UPA, rbcl, ITS and tufA were tested for their use as deoxyribonucleic acid (DNA) barcode in this study. Although the UPA primers were designed to amplify all phototrophic algae and cyanobacteria, UPA and 18S did not amplified at all for the genus Chlorella while ITS1, ITS2 rDNA and rbcL markers ...

  7. Capillary gel electrophoresis for rapid, high resolution DNA sequencing.

    OpenAIRE

    Swerdlow, H; Gesteland, R

    1990-01-01

    Capillary gel electrophoresis has been demonstrated for the separation and detection of DNA sequencing samples. Enzymatic dideoxy nucleotide chain termination was employed, using fluorescently tagged oligonucleotide primers and laser based on-column detection (limit of detection is 6,000 molecules per peak). Capillary gel separations were shown to be three times faster, with better resolution (2.4 x), and higher separation efficiency (5.4 x) than a conventional automated slab gel DNA sequenci...

  8. Mapping the gravitational wave background

    OpenAIRE

    Cornish, Neil J.

    2001-01-01

    The gravitational wave sky is expected to have isolated bright sources superimposed on a diffuse gravitational wave background. The background radiation has two components: a confusion limited background from unresolved astrophysical sources; and a cosmological component formed during the birth of the universe. A map of the gravitational wave background can be made by sweeping a gravitational wave detector across the sky. The detector output is a complicated convolution of the sky luminosity ...

  9. Nonfluorescent denaturing HPLC-based primer-extension method for allele-specific expression: application to analysis of mismatch repair genes.

    Science.gov (United States)

    Aceto, Gitana M; De Lellis, Laura; Catalano, Teresa; Veschi, Serena; Radice, Paolo; Di Iorio, Angelo; Mariani-Costantini, Renato; Cama, Alessandro; Curia, Maria Cristina

    2009-09-01

    Altered germline expression of genes may represent a powerful marker of genetic or epigenetic predisposition to cancer or other diseases. We developed and validated a method of nonfluorescent primer extension that uses a single dideoxynucleotide and denaturing HPLC (DHPLC) to analyze the relative allele expression. We devised 5 independent assays for measuring allele-specific expression (ASE) to exploit different markers of mismatch repair genes MLH1 [mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli)] and MSH2 [mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli)]. We initially confirmed method reproducibility with genomic DNA (gDNA) from individuals heterozygous for a frequent single-nucleotide polymorphism in the MLH1 gene. After this preliminary validation with gDNA, we confirmed assay reproducibility with cDNA templates from control individuals. Relative allele expression was estimated by comparing the heights of the peaks corresponding to the 2 alleles. Results obtained with gDNA templates were used to normalize cDNA results. With these DHPLC-based primer-extension assays, we detected and confirmed a 5-fold imbalance in MLH1 allele expression in a mutation-negative patient with hereditary nonpolyposis colorectal cancer and in another patient with a modest degree of imbalance in MLH1 expression. Among control individuals, the relative expression of MLH1 alleles displayed a narrow range of variation. Independent DHPLC-based primer-extension assays for measuring and confirming ASE can be developed for different sequence variants of interest. This DHPLC application provides a cost-effective method for detecting ASE in cases for which conventional screening fails to detect pathogenic mutations in candidate genes and may be applicable for confirming ASE revealed by other methods, such as those used for transcriptome-wide analyses. .

  10. JEM-X background models

    DEFF Research Database (Denmark)

    Huovelin, J.; Maisala, S.; Schultz, J.

    2003-01-01

    Background and determination of its components for the JEM-X X-ray telescope on INTEGRAL are discussed. A part of the first background observations by JEM-X are analysed and results are compared to predictions. The observations are based on extensive imaging of background near the Crab Nebula...

  11. PDA: Pooled DNA analyzer

    Directory of Open Access Journals (Sweden)

    Lin Chin-Yu

    2006-04-01

    Full Text Available Abstract Background Association mapping using abundant single nucleotide polymorphisms is a powerful tool for identifying disease susceptibility genes for complex traits and exploring possible genetic diversity. Genotyping large numbers of SNPs individually is performed routinely but is cost prohibitive for large-scale genetic studies. DNA pooling is a reliable and cost-saving alternative genotyping method. However, no software has been developed for complete pooled-DNA analyses, including data standardization, allele frequency estimation, and single/multipoint DNA pooling association tests. This motivated the development of the software, 'PDA' (Pooled DNA Analyzer, to analyze pooled DNA data. Results We develop the software, PDA, for the analysis of pooled-DNA data. PDA is originally implemented with the MATLAB® language, but it can also be executed on a Windows system without installing the MATLAB®. PDA provides estimates of the coefficient of preferential amplification and allele frequency. PDA considers an extended single-point association test, which can compare allele frequencies between two DNA pools constructed under different experimental conditions. Moreover, PDA also provides novel chromosome-wide multipoint association tests based on p-value combinations and a sliding-window concept. This new multipoint testing procedure overcomes a computational bottleneck of conventional haplotype-oriented multipoint methods in DNA pooling analyses and can handle data sets having a large pool size and/or large numbers of polymorphic markers. All of the PDA functions are illustrated in the four bona fide examples. Conclusion PDA is simple to operate and does not require that users have a strong statistical background. The software is available at http://www.ibms.sinica.edu.tw/%7Ecsjfann/first%20flow/pda.htm.

  12. A Bioluminometric Method of DNA Sequencing

    Science.gov (United States)

    Ronaghi, Mostafa; Pourmand, Nader; Stolc, Viktor; Arnold, Jim (Technical Monitor)

    2001-01-01

    Pyrosequencing is a bioluminometric single-tube DNA sequencing method that takes advantage of co-operativity between four enzymes to monitor DNA synthesis. In this sequencing-by-synthesis method, a cascade of enzymatic reactions yields detectable light, which is proportional to incorporated nucleotides. Pyrosequencing has the advantages of accuracy, flexibility and parallel processing. It can be easily automated. Furthermore, the technique dispenses with the need for labeled primers, labeled nucleotides and gel-electrophoresis. In this chapter, the use of this technique for different applications is discussed.

  13. PCR approach for rapid detection of Escherichia coli in tempe using a specific primer

    Directory of Open Access Journals (Sweden)

    Siti Harnina Bintari

    2014-12-01

    Full Text Available Tempe known as a traditional fermented food originated from Indonesia. It has a unique flavour and texture. It also contains high protein and usually serves to substitute meat, fish, or egg as a complement to rice. The manufacture process of Tempe is quite complex and mostly, the traditional process has not employed the hygienic standard. In the process of Tempe making, there are two critical stages of the whole process; i.e. soaking of soybeans and solid state fermentation by Rhizopus sp. During the process, foodborne pathogen bacteria such as Escherichia coli could contaminate the product of Tempe. The bacterial contamination could be revealed through culture dependent methods which is costly, laborious, and time consuming. Therefore, the culture-independent method such as polymerase chain reaction using a specific primer could be applied to detect target microorganism to save time and labour. In this study, thirty-one Tempe samples collected from different manufacturers in Semarang, Central Java, Indonesia were analysed by PCR. In order to obtain the bacterial genomic DNA, a modified Chelex 100-Microwave method was employed. The results of DNA extraction showed that the method was an applicable method. It gave high quantity and quality of DNA; therefore, it could be applied in the PCR reaction. The DNA samples were employed in PCR for detection of Escherichia coli using Ecoli706F/R. It was found that 27 out of 31 samples were detected having Escherichia coli contamination showed by the presence of the amplified product size 706 bp. The application of this method could significantly reduce costs and time of analysis in the laboratory. Further response after E. coli were detected could be employed, including investigation of the critical factors in Tempe manufacturing process which allowed E. coli contamination.

  14. The Flp double cross system a simple efficient procedure for cloning DNA fragments

    Directory of Open Access Journals (Sweden)

    Sadowski Paul D

    2003-07-01

    Full Text Available Abstract Background While conventional cloning methods using restriction enzymes and polynucleotide ligase are adequate for most DNAs, fragments made by the polymerase chain reaction are difficult to clone because the amplifying DNA polymerase tends to add untemplated nucleotides to the 3'-termini of the amplified strands. Conservative site-specific recombinases offer an efficient alternative to conventional cloning methods. Results In this paper I describe the use of the Flp site-specific recombinase for cloning PCR-amplified fragments. A DNA fragment is amplified with primers that contain at their ends inverted target sequences for Flp. Flp readily recombines these fragments in vitro into a vector that also contains two inverted Flp target sequences surrounding the α-complementing region of the lacZ gene of E. coli. The recombinants are conveniently detected as white colonies by the familiar blue/white screening test for lacZ activity. A useful feature of the system is that both orientations of the inserted DNA are usually obtained. If the recipient vector is cut between the two inverted Flp targets, Flp "heals" the double-strand break by inserting a linear fragment flanked by Flp targets. Conclusion This system ("The Flp Double Cross System" should be useful for cloning multiple PCR fragments into many sites in several vectors. It has certain advantages over other available recombinase-based cloning procedures.

  15. Evaluation of HPV DNA positivity in colorectal cancer patients in Kerman, Southeast Iran

    Science.gov (United States)

    Malekpour Afshar, Reza; Deldar, Zeinab; Mollaei, Hamid Reza; Arabzadeh, Seyed Alimohammad; Iranpour, Maryam

    2018-01-27

    Background: The HPV virus is known to be oncogenic and associations with many cancers has been proven. Although many studies have been conducted on the possible relationship with colorectal cancer (CRC), a definitive role of the virus has yet to be identified. Method: In this cross-sectional study, the frequency of HPV positivity in CRC samples in Kerman was assessed in 84 cases with a mean age of 47.7 ± 12.5 years over two years. Qualitative real time PCR was performed using general primers for the L1 region of HPV DNA. Results: Out of 84 CRC samples, 19 (22.6%), proved positive for HPV DNA. Genotyping of positive samples showed all of these to be of high risk HPV type. Prevalence of HPV infection appears to depend geographic region, life style, diet and other factors. Conclusion: In our location frequency of CRC is low, and this limited the sample size for evaluation of HPV DNA. The most prevalent types were HPV types 51 and 56. While HPV infection may play an important role in colorectal carcinogenesis, this needs to be assessed in future studies. Creative Commons Attribution License

  16. Comparison of five protocols to extract DNA from paraffin-embedded tissues for the detection of human papillomavirus.

    Science.gov (United States)

    Alvarez-Aldana, Adalucy; Martínez, José William; Sepúlveda-Arias, Juan C

    2015-02-01

    Formalin-fixed paraffin-embedded (FFPE) tissues are a valuable source of DNA with which to perform large retrospective studies on the epidemiology of HPV infection. Five different DNA extraction protocols were carried out to evaluate the DNA obtained from FFPE samples with polymerase chain reaction (PCR) using two primer sets to amplify a constitutive human gene, β-globin, and two primer sets to detect the L1 and E6 HPV genes. From the five DNA extraction protocols evaluated, the best results were obtained with protocol A, corresponding to a crude extract from the sample. With the procedures described herein, we were able to amplify DNA extracted from archival paraffin blocks stored for six years. However, the amplification products were more efficiently obtained with primers that amplified shorter fragments. This result indicates that a major factor limiting the extraction process in these samples is DNA fragmentation, a factor that will naturally vary between the different specimens evaluated. Also, depending upon the extraction method, PCR amplification of a human gene does not necessarily guarantee the successful extraction of viral DNA. In conclusion, different DNA and HPV detection methods can significantly influence the results. Therefore, the DNA extraction methods and primers used for DNA amplification in fixed tissues need to be chosen carefully, depending on the specific requirements of the study being carried out. Copyright © 2014 Elsevier GmbH. All rights reserved.

  17. Modeling DNA

    Science.gov (United States)

    Robertson, Carol

    2016-01-01

    Deoxyribonucleic acid (DNA) is life's most amazing molecule. It carries the genetic instructions that almost every organism needs to develop and reproduce. In the human genome alone, there are some three billion DNA base pairs. The most difficult part of teaching DNA structure, however, may be getting students to visualize something as small as a…

  18. Quantitation of DNA methylation by melt curve analysis

    Directory of Open Access Journals (Sweden)

    Jones Michael E

    2009-04-01

    Full Text Available Abstract Background Methylation of DNA is a common mechanism for silencing genes, and aberrant methylation is increasingly being implicated in many diseases such as cancer. There is a need for robust, inexpensive methods to quantitate methylation across a region containing a number of CpGs. We describe and validate a rapid, in-tube method to quantitate DNA methylation using the melt data obtained following amplification of bisulfite modified DNA in a real-time thermocycler. Methods We first describe a mathematical method to normalise the raw fluorescence data generated by heating the amplified bisulfite modified DNA. From this normalised data the temperatures at which melting begins and finishes can be calculated, which reflect the less and more methylated template molecules present respectively. Also the T50, the temperature at which half the amplicons are melted, which represents the summative methylation of all the CpGs in the template mixture, can be calculated. These parameters describe the methylation characteristics of the region amplified in the original sample. Results For validation we used synthesized oligonucleotides and DNA from fresh cells and formalin fixed paraffin embedded tissue, each with known methylation. Using our quantitation we could distinguish between unmethylated, partially methylated and fully methylated oligonucleotides mixed in varying ratios. There was a linear relationship between T50 and the dilution of methylated into unmethylated DNA. We could quantitate the change in methylation over time in cell lines treated with the demethylating drug 5-aza-2'-deoxycytidine, and the differences in methylation associated with complete, clonal or no loss of MGMT expression in formalin fixed paraffin embedded tissues. Conclusion We have validated a rapid, simple in-tube method to quantify methylation which is robust and reproducible, utilizes easily designed primers and does not need proprietary algorithms or software. The

  19. Digital analysis of cDNA abundance; expression profiling by means of restriction fragment fingerprinting

    Directory of Open Access Journals (Sweden)

    Regenbogen Johannes

    2002-03-01

    Full Text Available Abstract Background Gene expression profiling among different tissues is of paramount interest in various areas of biomedical research. We have developed a novel method (DADA, Digital Analysis of cDNA Abundance, that calculates the relative abundance of genes in cDNA libraries. Results DADA is based upon multiple restriction fragment length analysis of pools of clones from cDNA libraries and the identification of gene-specific restriction fingerprints in the resulting complex fragment mixtures. A specific cDNA cloning vector had to be constructed that governed missing or incomplete cDNA inserts which would generate misleading fingerprints in standard cloning vectors. Double stranded cDNA was synthesized using an anchored oligo dT primer, uni-directionally inserted into the DADA vector and cDNA libraries were constructed in E. coli. The cDNA fingerprints were generated in a PCR-free procedure that allows for parallel plasmid preparation, labeling, restriction digest and fragment separation of pools of 96 colonies each. This multiplexing significantly enhanced the throughput in comparison to sequence-based methods (e.g. EST approach. The data of the fragment mixtures were integrated into a relational database system and queried with fingerprints experimentally produced by analyzing single colonies. Due to limited predictability of the position of DNA fragments on the polyacrylamid gels of a given size, fingerprints derived solely from cDNA sequences were not accurate enough to be used for the analysis. We applied DADA to the analysis of gene expression profiles in a model for impaired wound healing (treatment of mice with dexamethasone. Conclusions The method proved to be capable of identifying pharmacologically relevant target genes that had not been identified by other standard methods routinely used to find differentially expressed genes. Due to the above mentioned limited predictability of the fingerprints, the method was yet tested only with

  20. BACKGROUNDER

    International Development Research Centre (IDRC) Digital Library (Canada)

    Corey Piccioni

    Saharan Africa at US$4 billion per year for grains alone (World Bank, 2010). Considerable scope exists for research to find effecve ways to reduce food losses while increasing returns through product quality control, market segmentaon,.