WorldWideScience

Sample records for autonomic skin responses

  1. Autonomic skin responses in females with Fabry disease

    DEFF Research Database (Denmark)

    Møller, Anette Torvin; Bach, Flemming W.; Feldt-Rasmussen, Ulla

    2009-01-01

    Fabry disease is a genetic lysosomal disorder with dysfunction of the lysosomal enzyme alpha-galactosidase A causing accumulation of glycolipids in multiple organs including the nervous system and with neuropathy as a prominent manifestation. Neurological symptoms include pain and autonomic...... dysfunction. This study examined peripheral autonomic nerve function in 19 female patients with Fabry disease and 19 sex and age-matched controls by measuring (1) sweat production following acetylcholine challenge; (2) the sympathetically mediated vasoconstrictor responses to inspiratory gasp, stress...

  2. The sympathetic skin response in diabetic neuropathy and its relationship to autonomic symptoms

    International Nuclear Information System (INIS)

    Al-Moallem, Mansour A.; Zaidan, Radwan M.; Alkali, Nura H.

    2008-01-01

    Objective was to examine the utility of the sympathetic skin response (SSR) as a measure of impaired autonomic function among diabetic patients in Saudi Arabia. In this case-control study, baseline SSR was obtained from 18 healthy subjects, followed by nerve conduction studies and SSR testing on a consecutive cohort of 50 diabetic patients with peripheral neuropathy. The SSR in diabetic patients was compared between those with autonomic neuropathy and those without autonomic neuropathy. This study was conducted at the King Khalid University Hospital, Riyadh, Saudi Arabia, from June 2006 to June 2007. The SSR was present in all healthy subjects and in 32 diabetic patients. Among 16 patients with autonomic neuropathy, the SSR was absent in 14 and present in 2, while 4 of 34 patients lacking evidence of autonomic neuropathy had absent SSR. Using Fisher's exact test, we found a strong association between absent SSR and autonomic neuropathy (p<0.001), however, not with age or duration of diabetes mellitus. As a diagnostic test of autonomic neuropathy, the SSR had a sensitivity of 87.5%, a specificity of 88.2%, a positive predictive value of 77.8%, and a negative predictive value of 93.7%. Absence of the SSR is a reliable indicator of autonomic neuropathy among patients with diabetes mellitus in Saudi Arabia. (author)

  3. Effects of skin-to-skin contact on autonomic pain responses in preterm infants.

    Science.gov (United States)

    Cong, Xiaomei; Cusson, Regina M; Walsh, Stephen; Hussain, Naveed; Ludington-Hoe, Susan M; Zhang, Di

    2012-07-01

    The purpose of this randomized crossover trial was to determine the effects on autonomic responses in preterm infants of longer Kangaroo Care (30 minutes, KC30) and shorter KC (15 minutes, KC15) before and throughout heel stick compared with incubator care (IC). Beat-to-beat heart rate (HR) and spectral power analysis of heart rate variability, low frequency power (LF), high frequency power (HF), and LF/HF ratio were measured in 26 infants. HR changes from Baseline to Heel Stick were significantly less in KC30 and KC15 than in IC, and more infants had HR decrease in IC than in 2 KC conditions. In IC, LF and HF significantly increased from Baseline to Heel Stick and dropped from Heel Stick to Recovery; in 2 KC conditions, no changes across study phases were found. During Heel Stick, LF and HF were significantly higher in IC than in KC30. In all 3 conditions, LF/HF ratio decreased from Baseline to Heel Stick and increased to Recovery; no differences were found between IC and two KC conditions. Both longer and shorter KC before and throughout heel stick can stabilize HR response in preterm infants, and longer KC significantly affected infants' sympathetic and parasympathetic responses during heel stick compared with incubator care. This study showed that KC has a significant effect on reducing autonomic pain responses in preterm infants. The findings support that KC is a safe and effective pain intervention in the neonatal intensive care unit. Copyright © 2012 American Pain Society. Published by Elsevier Inc. All rights reserved.

  4. Developmental changes in autonomic responses are associated with future reward/punishment expectations: A study of sympathetic skin responses in the Markov decision task.

    Science.gov (United States)

    Hosaka, Hiromi; Aoyagi, Kakuro; Kaga, Yoshimi; Kanemura, Hideaki; Sugita, Kanji; Aihara, Masao

    2017-08-01

    Autonomic nervous system activity is recognized as a major component of emotional responses. Future reward/punishment expectations depend upon the process of decision making in the frontal lobe, which is considered to play an important role in executive function. The aim of this study was to investigate the relationship between autonomic responses and decision making during reinforcement tasks using sympathetic skin responses (SSR). Nine adult and 9 juvenile (mean age, 10.2years) volunteers were enrolled in this study. SSRs were measured during the Markov decision task (MDT), which is a reinforcement task. In this task, subjects must endure a small immediate loss to ultimately get a large reward. The subjects had to undergo three sets of tests and their scores in these tests were assessed and evaluated. All adults showed gradually increasing scores for the MDT from the first to third set. As the trial progressed from the first to second set in adults, SSR appearance ratios remarkably increased for both punishment and reward expectations. In comparison with adults, children showed decreasing scores from the first to second set. There were no significant inter-target differences in the SSR appearance ratio in the first and second set in children. In the third set, the SSR appearance ratio for reward expectations was higher than that in the neutral condition. In reinforcement tasks, such as MDT, autonomic responses play an important role in decision making. We assume that SSRs are elicited during efficient decision making tasks associated with future reward/punishment expectations, which demonstrates the importance of autonomic function. In contrast, in children around the age of 10years, the autonomic system does not react as an organized response specific to reward/punishment expectations. This suggests the immaturity of the future reward/punishment expectations process in children. Copyright © 2017 The Japanese Society of Child Neurology. Published by Elsevier B

  5. Autonomic responses to heat pain: Heart rate, skin conductance, and their relation to verbal ratings and stimulus intensity.

    Science.gov (United States)

    Loggia, Marco L; Juneau, Mylène; Bushnell, M Catherine

    2011-03-01

    In human pain experiments, as well as in clinical settings, subjects are often asked to assess pain using scales (eg, numeric rating scales). Although most subjects have little difficulty in using these tools, some lack the necessary basic cognitive or motor skills (eg, paralyzed patients). Thus, the identification of appropriate nonverbal measures of pain has significant clinical relevance. In this study, we assessed heart rate (HR), skin conductance (SC), and verbal ratings in 39 healthy male subjects during the application of twelve 6-s heat stimuli of different intensities on the subjects' left forearm. Both HR and SC increased with more intense painful stimulation. However, HR but not SC, significantly correlated with pain ratings at the group level, suggesting that HR may be a better predictor of between-subject differences in pain than is SC. Conversely, changes in SC better predicted variations in ratings within a given individual, suggesting that it is more sensitive to relative changes in perception. The differences in findings derived from between- and within-subject analyses may result from greater within-subject variability in HR. We conclude that at least for male subjects, HR provides a better predictor of pain perception than SC, but that data should be averaged over several stimulus presentations to achieve consistent results. Nevertheless, variability among studies, and the indication that gender of both the subject and experimenter could influence autonomic results, lead us to advise caution in using autonomic or any other surrogate measures to infer pain in individuals who cannot adequately report their perception. Skin conductance is more sensitive to detect within-subject perceptual changes, but heart rate appears to better predict pain ratings at the group level. Copyright © 2010 International Association for the Study of Pain. Published by Elsevier B.V. All rights reserved.

  6. The sensory channel of presentation alters subjective ratings and autonomic responses towards disgusting stimuli -Blood pressure, heart rate and skin conductance in response to visual, auditory, haptic and olfactory presented disgusting stimuli-

    Directory of Open Access Journals (Sweden)

    Ilona eCroy

    2013-09-01

    Full Text Available Disgust causes specific reaction patterns, observable in mimic responses and body reactions. Most research on disgust deals with visual stimuli. However, pictures may cause another disgust experience than sounds, odors or tactile stimuli. Therefore disgust experience evoked by four different sensory channels was compared.A total of 119 participants received 3 different disgusting and one control stimulus, each presented through the visual, auditory, tactile and olfactory channel. Ratings of evoked disgust as well as responses of the autonomic nervous system (heart rate, skin conductance level, systolic blood pressure were recorded and the effect of stimulus labeling and of repeated presentation was analyzed. Ratings suggested that disgust could be evoked through all senses; they were highest for visual stimuli. However, autonomic reaction towards disgusting stimuli differed according to the channel of presentation. In contrast to the other, olfactory disgust stimuli provoked a strong decrease of systolic blood pressure. Additionally, labeling enhanced disgust ratings and autonomic reaction for olfactory and tactile, but not for visual and auditory stimuli. Repeated presentation indicated that participant’s disgust rating diminishes to all but olfactory disgust stimuli. Taken together we argue that the sensory channel through which a disgust reaction is evoked matters.

  7. Autonomic nervous system response patterns specificity to basic emotions.

    Science.gov (United States)

    Collet, C; Vernet-Maury, E; Delhomme, G; Dittmar, A

    1997-01-12

    The aim of this study was to test the assumption that the autonomic nervous system responses to emotional stimuli are specific. A series of six slides was randomly presented to the subjects while six autonomic nervous system (ANS) parameters were recorded: skin conductance, skin potential, skin resistance, skin blood flow, skin temperature and instantaneous respiratory frequency. Each slide induced a basic emotion: happiness, surprise, anger, fear, sadness and disgust. Results have been first considered with reference to electrodermal responses (EDR) and secondly through thermo-vascular and respiratory variations. Classical as well as original indices were used to quantify autonomic responses. The six basic emotions were distinguished by Friedman variance analysis. Thus, ANS values corresponding to each emotion were compared two-by-two. EDR distinguished 13 emotion-pairs out of 15. 10 emotion-pairs were separated by skin resistance as well as skin conductance ohmic perturbation duration indices whereas conductance amplitude was only capable of distinguishing 7 emotion-pairs. Skin potential responses distinguished surprise and fear from sadness, and fear from disgust, according to their elementary pattern analysis in form and sign. Two-by-two comparisons of skin temperature, skin blood flow (estimated by the new non-oscillary duration index) and instantaneous respiratory frequency, enabled the distinction of 14 emotion-pairs out of 15. 9 emotion-pairs were distinguished by the non-oscillatory duration index values. Skin temperature was demonstrated to be different i.e. positive versus negative in response to anger and fear. The instantaneous respiratory frequency perturbation duration index was the only one capable of separating sadness from disgust. From the six ANS parameters study, different autonomic patterns were identified, each characterizing one of the six basic emotion used as inducing signals. No index alone, nor group of parameters (EDR and thermovascular

  8. Framing the ultimatum game: gender differences and autonomic responses.

    Science.gov (United States)

    Sarlo, Michela; Lotto, Lorella; Palomba, Daniela; Scozzari, Simona; Rumiati, Rino

    2013-01-01

    The present study aimed at investigating whether the way offers are framed in the Ultimatum Game (UG) affects behavioral and autonomic responses in men and women. The "I give you" and "I take" expressions were used as gain and loss frames, respectively. Skin conductance and heart rate were recorded as indices of autonomic activation in response to unfair, mid-value, and fair offers. Acceptance rates were higher in men than in women under the gain frame. Moreover, men showed higher acceptance rates under the gain than under the loss frame with mid-value offers, whereas women's choices were not affected by frame. On the physiological level, men produced differential autonomic response patterns during decision-making when offers were presented under gain and loss framing. The "I take" frame, by acting as a loss frame, elicited in men the characteristic defensive response pattern that is evoked by aversive stimulation, in which increases in skin conductance are coupled with increases in heart rate. On the other hand, the "I give you" frame, by acting as a gain frame, elicited in men increases in skin conductance associated with prevailing heart rate deceleratory responses, reflecting a state of enhanced attention and orienting. In contrast, women's autonomic reactivity was not affected by frame, consistent with behavioral results. Phasic changes in heart rate were crucial in revealing differential functional significance of skin conductance responses under different frames in men, thus questioning the assumption that this autonomic measure can be used as an index of negative emotional arousal in the UG.

  9. Blunted autonomic response in cluster headache patients

    DEFF Research Database (Denmark)

    Barloese, Mads; Brinth, Louise; Mehlsen, Jesper

    2015-01-01

    BACKGROUND: Cluster headache (CH) is a disabling headache disorder with chronobiological features. The posterior hypothalamus is involved in CH pathophysiology and is a hub for autonomic control. We studied autonomic response to the head-up tilt table test (HUT) including heart rate variability...... (HRV) in CH patients and compared results to healthy controls. METHODS AND MATERIALS: Twenty-seven episodic and chronic CH patients and an equal number of age-, sex- and BMI-matched controls were included. We analyzed responses to HUT in the time and frequency domain and by non-linear analysis. RESULTS......: CH patients have normal cardiovascular responses compared to controls but increased blood pressure. In the frequency analysis CH patients had a smaller change in the normalized low- (LF) (2.89 vs. 13.38, p 

  10. Motor execution detection based on autonomic nervous system responses

    International Nuclear Information System (INIS)

    Marchal-Crespo, Laura; Riener, Robert; Zimmermann, Raphael; Lambercy, Olivier; Edelmann, Janis; Fluet, Marie-Christine; Gassert, Roger; Wolf, Martin

    2013-01-01

    Triggered assistance has been shown to be a successful robotic strategy for provoking motor plasticity, probably because it requires neurologic patients’ active participation to initiate a movement involving their impaired limb. Triggered assistance, however, requires sufficient residual motor control to activate the trigger and, thus, is not applicable to individuals with severe neurologic injuries. In these situations, brain and body–computer interfaces have emerged as promising solutions to control robotic devices. In this paper, we investigate the feasibility of a body–machine interface to detect motion execution only monitoring the autonomic nervous system (ANS) response. Four physiological signals were measured (blood pressure, breathing rate, skin conductance response and heart rate) during an isometric pinching task and used to train a classifier based on hidden Markov models. We performed an experiment with six healthy subjects to test the effectiveness of the classifier to detect rest and active pinching periods. The results showed that the movement execution can be accurately classified based only on peripheral autonomic signals, with an accuracy level of 84.5%, sensitivity of 83.8% and specificity of 85.2%. These results are encouraging to perform further research on the use of the ANS response in body–machine interfaces. (paper)

  11. Impaired autonomic responses to emotional stimuli in autoimmune limbic encephalitis

    Directory of Open Access Journals (Sweden)

    Olga eSchröder

    2015-11-01

    Full Text Available Limbic encephalitis (LE is an autoimmune-mediated disorder that affects structures of the limbic system, in particular the amygdala. The amygdala constitutes a brain area substantial for processing of emotional, especially fear-related signals. The amygdala is also involved in neuroendocrine and autonomic functions, including skin conductance responses (SCRs to emotionally arousing stimuli. This study investigates behavioral and autonomic responses to discrete emotion-evoking and neutral film clips in a patient suffering from LE associated with contactin-associated protein-2 (CASPR2-antibodies as compared to a healthy control group. Results show a lack of SCRs in the patient while watching the film clips, with significant differences compared to healthy controls in the case of fear-inducing videos. There was no comparable impairment in behavioral data (emotion report, valence and arousal ratings. The results point to a defective modulation of sympathetic responses during emotional stimulation in patients with LE, probably due to impaired functioning of the amygdala.

  12. Autonomic and subjective responsivity to emotional images in people with dissociative seizures.

    Science.gov (United States)

    Pick, Susannah; Mellers, John D C; Goldstein, Laura H

    2018-06-01

    People with dissociative seizures (DS) report a range of difficulties in emotional functioning and exhibit altered responding to emotional facial expressions in experimental tasks. We extended this research by investigating subjective and autonomic reactivity (ratings of emotional valence, arousal and skin conductance responses [SCRs]) to general emotional images in 39 people with DS relative to 42 healthy control participants, whilst controlling for anxiety, depression, cognitive functioning and, where relevant, medication use. It was predicted that greater subjective negativity and arousal and increased SCRs in response to the affective pictures would be observed in the DS group. The DS group as a whole did not differ from controls in their subjective responses of valence and arousal. However, SCR amplitudes were greater in 'autonomic responders' with DS relative to 'autonomic responders' in the control group. A positive correlation was also observed between SCRs for highly arousing negative pictures and self-reported ictal autonomic arousal, in DS 'autonomic responders'. In the DS subgroup of autonomic 'non-responders', differences in subjective responses were observed for some conditions, compared to control 'non-responders'. The findings indicate unaffected subjective responses to emotional images in people with DS overall. However, within the group of people with DS, there may be subgroups characterized by differences in emotional responding. One subgroup (i.e., 'autonomic responders') exhibit heightened autonomic responses but intact subjective emotional experience, whilst another subgroup (i.e., 'autonomic non-responders') seem to experience greater subjective negativity and arousal for some emotional stimuli, despite less frequent autonomic reactions. The current results suggest that therapeutic interventions targeting awareness and regulation of physiological arousal and subjective emotional experience could be of value in some people with this disorder

  13. Brain Circuitry Supporting Multi-Organ Autonomic Outflow in Response to Nausea.

    Science.gov (United States)

    Sclocco, Roberta; Kim, Jieun; Garcia, Ronald G; Sheehan, James D; Beissner, Florian; Bianchi, Anna M; Cerutti, Sergio; Kuo, Braden; Barbieri, Riccardo; Napadow, Vitaly

    2016-02-01

    While autonomic outflow is an important co-factor of nausea physiology, central control of this outflow is poorly understood. We evaluated sympathetic (skin conductance level) and cardiovagal (high-frequency heart rate variability) modulation, collected synchronously with functional MRI (fMRI) data during nauseogenic visual stimulation aimed to induce vection in susceptible individuals. Autonomic data guided analysis of neuroimaging data, using a stimulus-based (analysis windows set by visual stimulation protocol) and percept-based (windows set by subjects' ratings) approach. Increased sympathetic and decreased parasympathetic modulation was associated with robust and anti-correlated brain activity in response to nausea. Specifically, greater autonomic response was associated with reduced fMRI signal in brain regions such as the insula, suggesting an inhibitory relationship with premotor brainstem nuclei. Interestingly, some sympathetic/parasympathetic specificity was noted. Activity in default mode network and visual motion areas was anti-correlated with parasympathetic outflow at peak nausea. In contrast, lateral prefrontal cortical activity was anti-correlated with sympathetic outflow during recovery, soon after cessation of nauseogenic stimulation. These results suggest divergent central autonomic control for sympathetic and parasympathetic response to nausea. Autonomic outflow and the central autonomic network underlying ANS response to nausea may be an important determinant of overall nausea intensity and, ultimately, a potential therapeutic target. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  14. Skin conductance response to the pain of others predicts later costly helping.

    Directory of Open Access Journals (Sweden)

    Grit Hein

    Full Text Available People show autonomic responses when they empathize with the suffering of another person. However, little is known about how these autonomic changes are related to prosocial behavior. We measured skin conductance responses (SCRs and affect ratings in participants while either receiving painful stimulation themselves, or observing pain being inflicted on another person. In a later session, they could prevent the infliction of pain in the other by choosing to endure pain themselves. Our results show that the strength of empathy-related vicarious skin conductance responses predicts later costly helping. Moreover, the higher the match between SCR magnitudes during the observation of pain in others and SCR magnitude during self pain, the more likely a person is to engage in costly helping. We conclude that prosocial motivation is fostered by the strength of the vicarious autonomic response as well as its match with first-hand autonomic experience.

  15. Theoretical foundations for the responsibility of autonomous agents

    NARCIS (Netherlands)

    Hage, Jaap

    This article argues that it is possible to hold autonomous agents themselves, and not only their makers, users or owners, responsible for the acts of these agents. In this connection autonomous systems are computer programs that interact with the outside world without human interference. They

  16. Autonomic response to exercise as measured by cardio- vascular ...

    African Journals Online (AJOL)

    estimate the involvement of the autonomic nervous system (ANS) influence and balance in ... activity in response to exercise, training and overtraining. This ..... However, a lower HR and higher values for time domain HRV indicators were ...

  17. Sympathetic skin response evoked by laser skin stimulation

    OpenAIRE

    Rossi, P.; Truini, A.; Serrao, M.; Iannetti, G. D.; Parisi, L.; Pozzessere, G.; Cruccu, G.

    2002-01-01

    The objective of this study was to evoke sympathetic skin responses (SSRs) in healthy subjects using laser stimulation and to compare these responses with those induced by conventional electrical stimuli. Twenty healthy subjects were investigated. SSRs were obtained using electrical and laser stimuli delivered to the wrist controlateral to the recording site. The sympathetic sudomotor conduction velocity (SSFCV) was measured in 8 subjects by simultaneously recording the SSR from the hand and ...

  18. Metabolic and cardiovascular responses to epinephrine in diabetic autonomic neuropathy

    DEFF Research Database (Denmark)

    Hilsted, J; Richter, E; Madsbad, S

    1987-01-01

    with autonomic neuropathy (P less than 0.01) but was unchanged in the other groups. Since cardiac output increased to a similar extent in the three groups, the decrease in blood pressure was due to a significantly larger decrease (P less than 0.01) in total peripheral vascular resistance in the patients......Norepinephrine-induced vasoconstriction, which is mediated by alpha-adrenergic receptors, is accentuated in patients with autonomic neuropathy. In contrast, responses mediated by beta-adrenergic receptors, including vasodilatation and metabolic changes, have not been evaluated in these patients....... To study these responses, we administered epinephrine in a graded intravenous infusion (0.5 to 5 micrograms per minute) to seven diabetic patients without neuropathy, seven diabetic patients with autonomic neuropathy, and seven normal subjects. Mean arterial pressure decreased significantly in the patients...

  19. Investigating the autonomic nervous system response to anxiety in children with autism spectrum disorders.

    Science.gov (United States)

    Kushki, Azadeh; Drumm, Ellen; Pla Mobarak, Michele; Tanel, Nadia; Dupuis, Annie; Chau, Tom; Anagnostou, Evdokia

    2013-01-01

    Assessment of anxiety symptoms in autism spectrum disorders (ASD) is a challenging task due to the symptom overlap between the two conditions as well as the difficulties in communication and awareness of emotions in ASD. This motivates the development of a physiological marker of anxiety in ASD that is independent of language and does not require observation of overt behaviour. In this study, we investigated the feasibility of using indicators of autonomic nervous system (ANS) activity for this purpose. Specially, the objectives of the study were to 1) examine whether or not anxiety causes significant measurable changes in indicators of ANS in an ASD population, and 2) characterize the pattern of these changes in ASD. We measured three physiological indicators of the autonomic nervous system response (heart rate, electrodermal activity, and skin temperature) during a baseline (movie watching) and anxiety condition (Stroop task) in a sample of typically developing children (n = 17) and children with ASD (n = 12). The anxiety condition caused significant changes in heart rate and electrodermal activity in both groups, however, a differential pattern of response was found between the two groups. In particular, the ASD group showed elevated heart rate during both baseline and anxiety conditions. Elevated and blunted phasic electrodermal activity were found in the ASD group during baseline and anxiety conditions, respectively. Finally, the ASD group did not show the typical decrease in skin temperature in response to anxiety. These results suggest that 1) signals of the autonomic nervous system may be used as indicators of anxiety in children with ASD, and 2) ASD may be associated with an atypical autonomic response to anxiety that is most consistent with sympathetic over-arousal and parasympathetic under-arousal.

  20. Autonomic nervous system status and responsiveness and the ...

    African Journals Online (AJOL)

    inflexibility or decreased responsiveness in the face of a challenge.1,2 In view of the ... and parasympathetic control were seen with time domain and Poincare ... autonomic shift that results in heart rate acceleration.7 The differences between ...

  1. Autonomous journaling response using data model LUTS

    Science.gov (United States)

    Jaenisch, Holger; Handley, James; Albritton, Nathaniel; Whitener, David; Burnett, Randel; Caspers, Robert; Moren, Stephen; Alexander, Thomas; Maddox, William, III; Albritton, William, Jr.

    2009-04-01

    Matching journal entries to appropriate context responses can be a daunting problem, especially when there are no salient keyword matches between the entry and the proposed library of appropriate responses. We examine a real-world application for matching interactive journaling requests for guidance to an a priori established archive of sufficient multimedia responses. We show the analysis required to enable a Data Model based algorithm to group journaling entries according to intrinsic context information and type. We demonstrate a new lookup table (LUT) classifier that exploits all available data in LUT form.

  2. Leader Style and Anxiety Level: Their Relation to Autonomic Response.

    Science.gov (United States)

    Seemann, Daniel C.

    1982-01-01

    Studied effects of leader style and a group of people classified as either high-anxious or low-anxious. Measured participants' (N=71) responses to the leader styles using Galvanic Skin Response. Results indicated similar responses of participants to both autocratic and democratic leadership styles. (RC)

  3. Responsibility for crashes of autonomous vehicles: an ethical analysis.

    Science.gov (United States)

    Hevelke, Alexander; Nida-Rümelin, Julian

    2015-06-01

    A number of companies including Google and BMW are currently working on the development of autonomous cars. But if fully autonomous cars are going to drive on our roads, it must be decided who is to be held responsible in case of accidents. This involves not only legal questions, but also moral ones. The first question discussed is whether we should try to design the tort liability for car manufacturers in a way that will help along the development and improvement of autonomous vehicles. In particular, Patrick Lin's concern that any security gain derived from the introduction of autonomous cars would constitute a trade-off in human lives will be addressed. The second question is whether it would be morally permissible to impose liability on the user based on a duty to pay attention to the road and traffic and to intervene when necessary to avoid accidents. Doubts about the moral legitimacy of such a scheme are based on the notion that it is a form of defamation if a person is held to blame for causing the death of another by his inattention if he never had a real chance to intervene. Therefore, the legitimacy of such an approach would depend on the user having an actual chance to do so. The last option discussed in this paper is a system in which a person using an autonomous vehicle has no duty (and possibly no way) of interfering, but is still held (financially, not criminally) responsible for possible accidents. Two ways of doing so are discussed, but only one is judged morally feasible.

  4. Autonomic composite hydrogels by reactive printing: materials and oscillatory response.

    Science.gov (United States)

    Kramb, R C; Buskohl, P R; Slone, C; Smith, M L; Vaia, R A

    2014-03-07

    Autonomic materials are those that automatically respond to a change in environmental conditions, such as temperature or chemical composition. While such materials hold incredible potential for a wide range of uses, their implementation is limited by the small number of fully-developed material systems. To broaden the number of available systems, we have developed a post-functionalization technique where a reactive Ru catalyst ink is printed onto a non-responsive polymer substrate. Using a succinimide-amine coupling reaction, patterns are printed onto co-polymer or biomacromolecular films containing primary amine functionality, such as polyacrylamide (PAAm) or poly-N-isopropyl acrylamide (PNIPAAm) copolymerized with poly-N-(3-Aminopropyl)methacrylamide (PAPMAAm). When the films are placed in the Belousov-Zhabotinsky (BZ) solution medium, the reaction takes place only inside the printed nodes. In comparison to alternative BZ systems, where Ru-containing monomers are copolymerized with base monomers, reactive printing provides facile tuning of a range of hydrogel compositions, as well as enabling the formation of mechanically robust composite monoliths. The autonomic response of the printed nodes is similar for all matrices in the BZ solution concentrations examined, where the period of oscillation decreases in response to increasing sodium bromate or nitric acid concentration. A temperature increase reduces the period of oscillations and temperature gradients are shown to function as pace-makers, dictating the direction of the autonomic response (chemical waves).

  5. Eye contact with neutral and smiling faces: effects on frontal EEG asymmetry and autonomic responses

    Directory of Open Access Journals (Sweden)

    Laura Maria Pönkänen

    2012-05-01

    Full Text Available In our previous studies we have shown that seeing another person live with a direct vs. averted gaze results in greater relative left-sided frontal asymmetry in the electroencephalography (EEG, associated with approach motivation, and in enhanced skin conductance responses indicating autonomic arousal. In our studies, however, the stimulus persons had a neutral expression. In real-life social interaction, eye contact is often associated with a smile, which is another signal of the sender’s approach-related motivation. A smile could therefore enhance the affective-motivational responses to eye contact. In the present study, we investigated whether the facial expression (neutral vs. smile would modulate the frontal EEG asymmetry and autonomic arousal to seeing a direct vs. an averted gaze in faces presented live through a liquid crystal shutter. The results showed that the skin conductance responses were greater for the direct than the averted gaze and that the effect of gaze direction was more pronounced for a smiling than a neutral face. However, the frontal EEG asymmetry results revealed a more complex pattern. Participants whose responses to seeing the other person were overall indicative of leftward frontal activity (indicative of approach showed greater relative left-sided asymmetry for the direct vs. averted gaze, whereas participants whose responses were overall indicative of rightward frontal activity (indicative of avoidance showed greater relative right-sided asymmetry to direct vs. averted gaze. The other person’s facial expression did not have an effect on the frontal EEG asymmetry. These findings may reflect that another’s direct gaze, as compared to their smile, has a more dominant role in regulating perceivers’ approach motivation.

  6. Heart rate responses to autonomic challenges in obstructive sleep apnea.

    Directory of Open Access Journals (Sweden)

    Paul M Macey

    Full Text Available Obstructive sleep apnea (OSA is accompanied by structural alterations and dysfunction in central autonomic regulatory regions, which may impair dynamic and static cardiovascular regulation, and contribute to other syndrome pathologies. Characterizing cardiovascular responses to autonomic challenges may provide insights into central nervous system impairments, including contributions by sex, since structural alterations are enhanced in OSA females over males. The objective was to assess heart rate responses in OSA versus healthy control subjects to autonomic challenges, and, separately, characterize female and male patterns. We studied 94 subjects, including 37 newly-diagnosed, untreated OSA patients (6 female, age mean ± std: 52.1 ± 8.1 years; 31 male aged 54.3 ± 8.4 years, and 57 healthy control subjects (20 female, 50.5 ± 8.1 years; 37 male, 45.6 ± 9.2 years. We measured instantaneous heart rate with pulse oximetry during cold pressor, hand grip, and Valsalva maneuver challenges. All challenges elicited significant heart rate differences between OSA and control groups during and after challenges (repeated measures ANOVA, p<0.05. In post-hoc analyses, OSA females showed greater impairments than OSA males, which included: for cold pressor, lower initial increase (OSA vs. control: 9.5 vs. 7.3 bpm in females, 7.6 vs. 3.7 bpm in males, OSA delay to initial peak (2.5 s females/0.9 s males, slower mid-challenge rate-of-increase (OSA vs. control: -0.11 vs. 0.09 bpm/s in females, 0.03 vs. 0.06 bpm/s in males; for hand grip, lower initial peak (OSA vs. control: 2.6 vs. 4.6 bpm in females, 5.3 vs. 6.0 bpm in males; for Valsalva maneuver, lower Valsalva ratio (OSA vs. control: 1.14 vs. 1.30 in females, 1.29 vs. 1.34 in males, and OSA delay during phase II (0.68 s females/1.31 s males. Heart rate responses showed lower amplitude, delayed onset, and slower rate changes in OSA patients over healthy controls, and impairments may be more pronounced in

  7. Skin bank development and critical incident response.

    Science.gov (United States)

    Hamilton, Kellie T; Herson, Marisa R

    2011-05-01

    The Donor Tissue Bank of Victoria (DTBV), situated in Melbourne, Australia developed a skin banking program in 1994. It remains Australia's only operational skin bank, processing cryopreserved human cadaveric skin for the treatment of burns. The demand for allograft skin in Australia has steadily increased since the development of the program. The bank has been involved in the provision of skin for a number of critical incidences or disasters both in Australia and overseas. Demand always exceeds supply, and in the absence of other local skin banks, the DTBV has needed to develop strategies to enable increased provision of allograft skin nationally.

  8. Autonomic Nervous System Responses to Hearing-Related Demand and Evaluative Threat.

    Science.gov (United States)

    Mackersie, Carol L; Kearney, Lucia

    2017-10-12

    This paper consists of 2 parts. The purpose of Part 1 was to review the potential influence of internal (person-related) factors on listening effort. The purpose of Part 2 was to present, in support of Part 1, preliminary data illustrating the interactive effects of an external factor (task demand) and an internal factor (evaluative threat) on autonomic nervous system measures. For Part 1, we provided a brief narrative review of motivation and stress as modulators of listening effort. For Part 2, we described preliminary data from a study using a repeated-measures (2 × 2) design involving manipulations of task demand (high, low) and evaluative threat (high, low). The low-demand task consisted of repetition of sentences from a narrative. The high-demand task consisted of answering questions about the narrative, requiring both comprehension and recall. During the high evaluative threat condition, participants were filmed and told that their video recordings would be evaluated by a panel of experts. During the low evaluative threat condition, no filming occurred; participants were instructed to "do your best." Skin conductance (sympathetic nervous system activity) and heart rate variability (HRV, parasympathetic activity) were measured during the listening tasks. The HRV measure was the root mean square of successive differences of adjacent interbeat intervals. Twelve adults with hearing loss participated. Skin conductance increased and HRV decreased relative to baseline (no task) for all listening conditions. Skin conductance increased significantly with an increase in evaluative threat, but only for the more demanding task. There was no significant change in HRV in response to increasing evaluative threat or task demand. Listening effort may be influenced by factors other than task difficulty, as reviewed in Part 1. This idea is supported by the preliminary data indicating that the sympathetic nervous system response to task demand is modulated by social evaluative

  9. Reliability of Autonomic Responses and Malaise Across Multiple Motion Sickness Stimulation Tests

    Science.gov (United States)

    Stout, Cynthia S.; Toscano, William B.; Cowings, Patricia S.

    1993-01-01

    There is general agreement that a high degree of variability exists between subjects in their autonomic nervous system responses to motion sickness stimulation. Additionally, a paucity of data exists that examines the variability within an individual across repeated motion sickness tests. Investigators have also examined the relationship of autonomic responses to motion sickness development. These investigations have used analyses at discrete points in time to describe this relationship. This approach fails to address the time course of autonomic responses and malaise development throughout the motion sickness test. Our objectives were to examine the reliability of autonomic responses and malaise using the final minute of the motion sickness test across five testing occasions, to examine the reliability of the change in autonomic responses and the change in malaise across five testing occasions, and to examine the relationship between changes in autonomic responses and changes in malaise level across the entire motion sickness test. Our results indicate that, based on the final minute of testing, the autonomic responses of heart rate, blood volume pulse, and respiration rate are moderately stable across multiple tests. Changes in heart rate, blood volume pulse, respiration rate, and malaise throughout the test duration were less stable across the tests. We attribute this instability to variations in individual susceptibility and the error associated with estimating a measure of autonomic gain.

  10. Radiation response of skin in young and old rats

    Energy Technology Data Exchange (ETDEWEB)

    Hamlet, R.; Hopewell, J.W. (Churchill Hospital, Oxford (UK))

    1982-11-01

    The results of this investigation clearly demonstrate the different radiation skin response in rats of differing ages. The reasons for these differences cannot be clarified until cell kinetic studies have been completed. These results obtained for rodent skin would appear to be in disagreement with the available data for human skin (Rubin and Casarett 1968) where no marked age-related changes were reported. Also, in pig skin studies (Hopewell and Young 1982) there was no evidence of an age effect in the dermal vascular response in 3-12-month-old animals. This may be related to the different tissue being investigated or it may reflect important species differences. Whatever the reasons behind these observations, the different skin response to radiation in rats of 7, 14 and 52 weeks of age has clearly been demonstrated and should be borne in mind when extrapolating data with rodent skin to the clinical situation.

  11. The radiation response of skin in young and old rats

    International Nuclear Information System (INIS)

    Hamlet, R.; Hopewell, J.W.

    1982-01-01

    The results of this investigation clearly demonstrate the different radiation skin response in rats of differing ages. The reasons for these differences cannot be clarified until cell kinetic studies have been completed. These results obtained for rodent skin would appear to be in disagreement with the available data for human skin (Rubin and Casarett 1968) where no marked age-related changes were reported. Also, in pig skin studies (Hopewell and Young 1982) there was no evidence of an age effect in the dermal vascular response in 3-12-month-old animals. This may be related to the different tissue being investigated or it may reflect important species differences. Whatever the reasons behind these observations, the different skin response to radiation in rats of 7, 14 and 52 weeks of age has clearly been demonstrated and should be borne in mind when extrapolating data with rodent skin to the clinical situation. (author)

  12. The framing effect and skin conductance responses

    Directory of Open Access Journals (Sweden)

    Patrick eRing

    2015-08-01

    Full Text Available Individuals often rely on simple heuristics when they face complex choice situations under uncertainty. Traditionally, it has been proposed that cognitive processes are the main driver to evaluate different choice options and finally to reach a decision. Growing evidence, however, highlights a strong interrelation between judgment and decision-making (JDM on the one hand, and emotional processes on the other hand. This also seems to apply to judgmental heuristics, i.e. decision-processes that are typically considered to be fast and intuitive. In this study, participants are exposed to different probabilities of receiving an unpleasant electric shock. Information about electric shock probabilities is either positively or negatively framed. Integrated skin conductance responses (ISCRs while waiting for electric shock realization are used as an indicator for participants' emotional arousal. This measure is compared to objective probabilities. I find evidence for a relation between emotional body reactions measured by ISCRs and the framing effect. Under negative frames, participants show significantly higher ISCRs while waiting for an electric shock to be delivered than under positive frames. This result might contribute to a better understanding of the psychological processes underlying JDM. Further studies are necessary to reveal the causality underlying this finding, i.e. whether emotional processes influence JDM or vice versa.

  13. The framing effect and skin conductance responses.

    Science.gov (United States)

    Ring, Patrick

    2015-01-01

    Individuals often rely on simple heuristics when they face complex choice situations under uncertainty. Traditionally, it has been proposed that cognitive processes are the main driver to evaluate different choice options and to finally reach a decision. Growing evidence, however, highlights a strong interrelation between judgment and decision-making (JDM) on the one hand, and emotional processes on the other hand. This also seems to apply to judgmental heuristics, i.e., decision processes that are typically considered to be fast and intuitive. In this study, participants are exposed to different probabilities of receiving an unpleasant electric shock. Information about electric shock probabilities is either positively or negatively framed. Integrated skin conductance responses (ISCRs) while waiting for electric shock realization are used as an indicator for participants' emotional arousal. This measure is compared to objective probabilities. I find evidence for a relation between emotional body reactions measured by ISCRs and the framing effect. Under negative frames, participants show significantly higher ISCRs while waiting for an electric shock to be delivered than under positive frames. This result might contribute to a better understanding of the psychological processes underlying JDM. Further studies are necessary to reveal the causality underlying this finding, i.e., whether emotional processes influence JDM or vice versa.

  14. Sympathetic skin responses in patients with hyperthyroidism.

    Science.gov (United States)

    Gozke, E; Ozyurt, Z; Dortcan, N; Ore, O; Kocer, A; Ozer, E

    2007-01-01

    The aim of this study was to investigate the disorders of sympathetic nervous system in patients with hyperthyroidism using sympathetic skin response (SSR). Twenty-two newly diagnosed cases with hyperthyroidism were included in the study. The results were compared with those of 20 healthy controls. SSR was recorded with the contralateral electrical stimulation of the median nerve (of the upper extremities) and tibial nerve (of the lower extremities) with active electrodes placed on palms and soles and reference electrodes attached on the dorsal aspects of hands and feet. Ages of the cases with hyperthyroidism and controls ranged between 15-65 years (mean: 46.7 +/- 15.0 years) and 24-62 years (mean: 39.6 +/- 9.8 years) respectively (p > 0.05). In all the control subjects SSR could be obtained, while from the lower extremities of 4 cases with hyperthyroidism (18.0%) SSR could not be elicited. Mean SSR latencies of lower extremities were found significantly longer than control group (p nervous system involvement in cases with hyperthyroidism.

  15. TRPM8 mechanism of autonomic nerve response to cold in respiratory airway

    Directory of Open Access Journals (Sweden)

    Wang Cong-Yi

    2008-06-01

    Full Text Available Abstract Breathing cold air without proper temperature exchange can induce strong respiratory autonomic responses including cough, airway constriction and mucosal secretion, and can exacerbate existing asthma conditions and even directly trigger an asthma attack. Vagal afferent fiber is thought to be involved in the cold-induced respiratory responses through autonomic nerve reflex. However, molecular mechanisms by which vagal afferent fibers are excited by cold remain unknown. Using retrograde labeling, immunostaining, calcium imaging, and electrophysiological recordings, here we show that a subpopulation of airway vagal afferent nerves express TRPM8 receptors and that activation of TRPM8 receptors by cold excites these airway autonomic nerves. Thus activation of TRPM8 receptors may provoke autonomic nerve reflex to increase airway resistance. This putative autonomic response may be associated with cold-induced exacerbation of asthma and other pulmonary disorders, making TRPM8 receptors a possible target for prevention of cold-associated respiratory disorders.

  16. University EFL Learners' Perceptions of Their Autonomous Learning Responsibilities and Abilities

    Science.gov (United States)

    Abdel Razeq, Anwar Ahmad

    2014-01-01

    This study investigated the readiness of university students for autonomous learning of English as a foreign language. Data was collected using questionnaires and interviews. The study assessed learners' readiness for autonomous learning across three dimensions: a) learners' perceptions of their educational responsibilities; b) learners' abilities…

  17. Differences in autonomic physiological responses between good and poor inductive reasoners

    NARCIS (Netherlands)

    Melis, C.J.; van Boxtel, A.

    2001-01-01

    We investigated individual- and task-related differences in autonomic physiological responses induced by time limited figural and verbal inductive reasoning tasks. In a group of 52 participants, the percentage of correctly responded task items was evaluated together with nine different autonomic

  18. Autonomic and Emotional Responses of Graduate Student Clinicians in Speech-Language Pathology to Stuttered Speech

    Science.gov (United States)

    Guntupalli, Vijaya K.; Nanjundeswaran, Chayadevie; Dayalu, Vikram N.; Kalinowski, Joseph

    2012-01-01

    Background: Fluent speakers and people who stutter manifest alterations in autonomic and emotional responses as they view stuttered relative to fluent speech samples. These reactions are indicative of an aroused autonomic state and are hypothesized to be triggered by the abrupt breakdown in fluency exemplified in stuttered speech. Furthermore,…

  19. [Skin cell response after jellyfish sting].

    Science.gov (United States)

    Adamicová, Katarína; Výbohová, Desanka; Fetisovová, Želmíra; Nováková, Elena; Mellová, Yvetta

    2016-01-01

    Jellyfish burning is not commonly part of the professional finding in the central Europe health care laboratory. Holiday seaside tourism includes different and unusual presentations of diseases for our worklplaces. Sea water-sports and leisure is commonly connected with jellyfish burning and changes in the skin, that are not precisely described. Authors focused their research on detection of morphological and quantitative changes of some inflammatory cells in the skin biopsy of a 59-years-old woman ten days after a jellyfish stinging. Because of a comparison of findings the biopsy was performed in the skin with lesional and nonlesional skin. Both excisions of the skin were tested by imunohistochemical methods to detect CD68, CD163, CD30, CD4, CD3, CD8, CD20 a CD1a, to detect histiocytes, as well as several clones of lymphocytes and Langerhans cells (antigen presenting cells of skin), CD 117, toluidin blue and chloracetase esterase to detect mastocytes and neutrophils. Material was tested by immunofluorescent methods to detect IgA, IgM, IgG, C3, C4, albumin and fibrinogen. Representative view-fields were documented by microscope photocamera Leica DFC 420 C. Registered photos from both samples of the skin were processed by morphometrical analysis by the Vision Assistant software. A student t-test was used for statistical analysis of reached results. Mean values of individual found cells in the sample with lesion and without lesion were as follows: CD117 -2.64/0.37, CD68-6.86/1.63, CD163-3.13/2.23, CD30-1.36/0.02, CD4-3.51/0.32, CD8-8.22/0.50, CD3-10.69/0.66, CD20-0.56/0.66, CD1a-7.97/0.47 respectively. Generally mild elevation of eosinofils in lesional skin was detected. Increased values of tested cells seen in excision from lesional skin when compared with nonlesional ones were statistically significant in eight case at the level p = 0.033 to 0.001. A not statistically significant difference was found only in the group of CD163+ histiocytes. Authors detected numbers

  20. Control of the skin scarring response

    Directory of Open Access Journals (Sweden)

    Lydia M. Ferreira

    2009-09-01

    Full Text Available There comes a time when the understanding of the cutaneous healing process becomes essential due to the need for a precocious tissue repair to reduce the physical, social, and psychological morbidity. Advances in the knowledge on the control of interaction among cells, matrix and growth factors will provide more information on the Regenerative Medicine, an emerging area of research in medical bioengineering. However, considering the dynamism and complexity of the cutaneous healing response, it is fundamental to understand the control mechanism exerted by the interaction and synergism of both systems, cutaneous nervous and central nervous, via hypothalamus hypophysis-adrenal axis, a relevant subject, but hardly ever explored. The present study reviews the neuro-immune-endocrine physiology of the skin responsible for its multiple functions and the extreme disturbances of the healing process, like the excess and deficiency of the extracellular matrix deposition.Aproxima-se uma época na qual é fundamental a compreensão do processo cicatricial cutâneo frente à necessidade da restauração tecidual precoce, visando a diminuição das morbidades física, social e psicológica. O avanço no conhecimento acerca do controle das interações entre as células, a matriz e os fatores de crescimento dará maiores informações à Medicina Regenerativa, área de pesquisa emergente da bioengenharia médica. Entretanto, diante do dinamismo e complexidade da resposta cicatricial cutânea torna-se indispensável o entendimento do mecanismo de controle exercido pela interação e sinergismo do sistema nervoso cutâneo e o sistema nervoso central, via eixo hipotálamo-hipófise-adrenal, tema relevante, porém, pouco abordado. O presente estudo revisa a fisiologia neuro-imuno-endócrina da pele, responsável por suas múltiplas funções, e os distúrbios extremos do processocicatricial, como o excesso e deficiência de deposição da matriz extracelular.

  1. Comparison of skin responses from macroscopic and microscopic UV challenges

    Science.gov (United States)

    Seo, InSeok; Bargo, Paulo R.; Chu, Melissa; Ruvolo, Eduardo; Kollias, Nikiforos

    2011-03-01

    The minimal erythema dose induced by solar-simulated radiation is a useful measure of UV sensitivity of skin. Most skin phototests have been conducted by projecting a flat field of UV radiation onto the skin in an area greater than 15 cm × 15 cm with an increment of radiation doses. In this study, we investigated the responses of human skin to solar-simulated radiation of different field sizes. Twelve human subjects of skin phototype I-IV were exposed to solar-simulated radiation (SSR) on their upper inner arm or on their lower back with a series of doses in increments of 20% in order to determine the threshold dose to induce a minimal perceptible erythema response (MED). Each dose was delivered with a liquid light guide (8 mm diameter on the back or 6 mm on the upper inner arm) and with quartz optical fibers of 200 μm diameter. The resulting skin responses were evaluated visually and investigated with a reflectance confocal microscope and imaging. The erythema response to the microscopic challenge was always diffuse with no clear boundaries extending to several times the exposed site diameter at doses greater than 2 MED. The skin returned to normal appearance from the microscopic challenge after two weeks of exposure while change in appearance for the larger areas persisted for several weeks to months. This new modality of testing provides the possibility to study skin at the microscopic level with a rapid recovery following challenge.

  2. Lower corticosteroid skin blanching response is associated with severe COPD.

    Directory of Open Access Journals (Sweden)

    Susan J M Hoonhorst

    Full Text Available Chronic obstructive pulmonary disease (COPD is characterized by chronic airflow limitation caused by ongoing inflammatory and remodeling processes of the airways and lung tissue. Inflammation can be targeted by corticosteroids. However, airway inflammation is generally less responsive to steroids in COPD than in asthma. The underlying mechanisms are yet unclear. This study aimed to assess whether skin corticosteroid insensitivity is associated with COPD and COPD severity using the corticosteroid skin blanching test.COPD patients GOLD stage I-IV (n = 27, 24, 22, and 16 respectively and healthy never-smokers and smokers (n = 28 and 56 respectively were included. Corticosteroid sensitivity was assessed by the corticosteroid skin blanching test. Budesonide was applied in 8 logarithmically increasing concentrations (0-100 μg/ml on subject's forearm. Assessment of blanching was performed after 7 hours using a 7-point scale (normal skin to intense blanching. All subjects performed spirometry and body plethysmography.Both GOLD III and GOLD IV COPD patients showed significantly lower skin blanching responses than healthy never-smokers and smokers, GOLD I, and GOLD II patients. Their area under the dose-response curve values of the skin blanching response were 586 and 243 vs. 1560, 1154, 1380, and 1309 respectively, p<0.05. Lower FEV1 levels and higher RV/TLC ratios were significantly associated with lower skin blanching responses (p = 0.001 and p = 0.004 respectively. GOLD stage I, II, III and IV patients had similar age and packyears.In this study, severe and very severe COPD patients had lower skin corticosteroid sensitivity than mild and moderate COPD patients and non-COPD controls with comparable age and packyears. Our findings together suggest that the reduced skin blanching response fits with a subgroup of COPD patients that has an early-onset COPD phenotype.

  3. Deceased donor skin allograft banking: Response and utilization

    Directory of Open Access Journals (Sweden)

    Gore Madhuri

    2010-10-01

    Full Text Available Background: In the absence of xenograft and biosynthetic skin substitutes, deceased donor skin allografts is a feasible option for saving life of patient with extensive burn injury in our country. Aims: The first deceased donor skin allograft bank in India became functional at Lokmanya Tilak Municipal (LTM medical college and hospital on 24 th April 2000. The response of Indian society to this new concept of skin donation after death and the pattern of utilization of banked allografts from 2000 to 2010 has been presented in this study. Settings and Design: This allograft skin bank was established by the department of surgery. The departments of surgery and microbiology share the responsibility of smooth functioning of the bank. Materials and Methods: The response in terms of number of donations and the profile of donors was analyzed from records. Pattern and outcome of allograft utilization was studied from specially designed forms. Results: During these ten years, 262 deceased donor skin allograft donations were received. The response showed significant improvement after counselling was extended to the community. Majority of the donors were above 70 years of age and procurement was done at home for most. Skin allografts from 249 donors were used for 165 patients in ten years. The outcome was encouraging with seven deaths in 151 recipients with burn injuries. Conclusions: Our experience shows that the Indian society is ready to accept the concept of skin donation after death. Use of skin allografts is life saving for large burns. We need to prepare guidelines for the establishment of more skin banks in the country.

  4. Response of Human Skin to Aesthetic Scarification

    Science.gov (United States)

    Gabriel, Vincent A.; McClellan, Elizabeth A.; Scheuermann, Richard H.

    2014-01-01

    This study was undertaken to investigate changes in RNA expression in previously healthy adult human skin following thermal injury induced by contact with hot metal that was undertaken as part of aesthetic scarification, a body modification practice. Subjects were recruited to have pre-injury skin and serial wound biopsies performed. 4 mm punch biopsies were taken prior to branding and 1 hour, 1 week, and 1, 2 and 3 months post injury. RNA was extracted and quality assured prior to the use of a whole-genome based bead array platform to describe expression changes in the samples using the pre-injury skin as a comparator. Analysis of the array data was performed using k-means clustering and a hypergeometric probability distribution without replacement and corrections for multiple comparisons were done. Confirmatory q-PCR was performed. Using a k of 10, several clusters of genes were shown to co-cluster together based on Gene Ontology classification with probabilities unlikely to occur by chance alone. OF particular interest were clusters relating to cell cycle, proteinaceous extracellular matrix and keratinization. Given the consistent expression changes at one week following injury in the cell cycle cluster, there is an opportunity to intervene early following burn injury to influence scar development. PMID:24582755

  5. Mechanical response of human female breast skin under uniaxial stretching.

    Science.gov (United States)

    Kumaraswamy, N; Khatam, Hamed; Reece, Gregory P; Fingeret, Michelle C; Markey, Mia K; Ravi-Chandar, Krishnaswamy

    2017-10-01

    Skin is a complex material covering the entire surface of the human body. Studying the mechanical properties of skin to calibrate a constitutive model is of great importance to many applications such as plastic or cosmetic surgery and treatment of skin-based diseases like decubitus ulcers. The main objective of the present study was to identify and calibrate an appropriate material constitutive model for skin and establish certain universal properties that are independent of patient-specific variability. We performed uniaxial tests performed on breast skin specimens freshly harvested during mastectomy. Two different constitutive models - one phenomenological and another microstructurally inspired - were used to interpret the mechanical responses observed in the experiments. Remarkably, we found that the model parameters that characterize dependence on previous maximum stretch (or preconditioning) exhibited specimen-independent universal behavior. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Characterizing human skin blood flow regulation in response to different local skin temperature perturbations

    NARCIS (Netherlands)

    Wu, Y.; Nieuwenhoff, M.D.; Huygen, Frank J.P.M.; van der Helm, F. C.T.; Niehof, S.P.; Schouten, A. C.

    2017-01-01

    Small nerve fibers regulate local skin blood flow in response to local thermal perturbations. Small nerve fiber function is difficult to assess with classical neurophysiological tests. In this study, a vasomotor response model in combination with a heating protocol was developed to quantitatively

  7. Differences in autonomic physiological responses between good and poor inductive reasoners.

    Science.gov (United States)

    Melis, C; van Boxtel, A

    2001-11-01

    We investigated individual- and task-related differences in autonomic physiological responses induced by time limited figural and verbal inductive reasoning tasks. In a group of 52 participants, the percentage of correctly responded task items was evaluated together with nine different autonomic physiological response measures and respiration rate (RR). Weighted multidimensional scaling analyses of the physiological responses revealed three underlying dimensions, primarily characterized by RR, parasympathetic, and sympathetic activity. RR and sympathetic activity appeared to be relatively more important response dimensions for poor reasoners, whereas parasympathetic responsivity was relatively more important for good reasoners. These results suggest that poor reasoners showed higher levels of cognitive processing intensity than good reasoners. Furthermore, for the good reasoners, the dimension of sympathetic activity was relatively more important during the figural than during the verbal reasoning task, which was explained in terms of hemispheric lateralization in autonomic function.

  8. Use of Portable Digital Devices to Analyze Autonomic Stress Response in Psychology Objective Structured Clinical Examination.

    Science.gov (United States)

    Beltrán-Velasco, Ana Isabel; Bellido-Esteban, Alberto; Ruisoto-Palomera, Pablo; Clemente-Suárez, Vicente Javier

    2018-01-12

    The aim of the present study was to explore changes in the autonomic stress response of Psychology students in a Psychology Objective Structured Clinical Examination (OSCE) and their relationship with OSCE performance. Variables of autonomic modulation by the analysis of heart rate variability in temporal, frequency and non-linear domains, subjective perception of distress strait and academic performance were measured before and after the two different evaluations that composed the OSCE. A psychology objective structured clinical examination composed by two different evaluation scenarios produced a large anxiety anticipatory response, a habituation response in the first of the evaluation scenarios and a in the entire evaluation, and a no habituation response in the second evaluation scenario. Autonomic modulation parameters do not correlate with academic performance of students.

  9. Order of exposure to pleasant and unpleasant odors affects autonomic nervous system response.

    Science.gov (United States)

    Horii, Yuko; Nagai, Katsuya; Nakashima, Toshihiro

    2013-04-15

    When mammals are exposed to an odor, that odor is expected to elicit a physiological response in the autonomic nervous system. An unpleasant aversive odor causes non-invasive stress, while a pleasant odor promotes healing and relaxation in mammals. We hypothesized that pleasant odors might reduce a stress response previously induced by an aversive predator odor. Rats were thus exposed to pleasant and unpleasant odors in different orders to determine whether the order of odor exposure had an effect on the physiological response in the autonomic nervous system. The first trial examined autonomic nerve activity via sympathetic and parasympathetic nerve response while the second trial examined body temperature response. Initial exposure to a pleasant odor elicited a positive response and secondary exposure to an unpleasant odor elicited a negative response, as expected. However, we found that while initial exposure to an unpleasant odor elicited a negative stress response, subsequent secondary exposure to a pleasant odor not only did not alleviate that negative response, but actually amplified it. These findings were consistent for both the autonomic nerve activity response trial and the body temperature response trial. The trial results suggest that exposure to specific odors does not necessarily result in the expected physiological response and that the specific order of exposure plays an important role. Our study should provide new insights into our understanding of the physiological response in the autonomic nervous system related to odor memory and discrimination and point to areas that require further research. Copyright © 2013 Elsevier B.V. All rights reserved.

  10. Responses to hyperthermia. Optimizing heat dissipation by convection and evaporation: Neural control of skin blood flow and sweating in humans.

    Science.gov (United States)

    Smith, Caroline J; Johnson, John M

    2016-04-01

    Under normothermic, resting conditions, humans dissipate heat from the body at a rate approximately equal to heat production. Small discrepancies between heat production and heat elimination would, over time, lead to significant changes in heat storage and body temperature. When heat production or environmental temperature is high the challenge of maintaining heat balance is much greater. This matching of heat elimination with heat production is a function of the skin circulation facilitating heat transport to the body surface and sweating, enabling evaporative heat loss. These processes are manifestations of the autonomic control of cutaneous vasomotor and sudomotor functions and form the basis of this review. We focus on these systems in the responses to hyperthermia. In particular, the cutaneous vascular responses to heat stress and the current understanding of the neurovascular mechanisms involved. The available research regarding cutaneous active vasodilation and vasoconstriction is highlighted, with emphasis on active vasodilation as a major responder to heat stress. Involvement of the vasoconstrictor and active vasodilator controls of the skin circulation in the context of heat stress and nonthermoregulatory reflexes (blood pressure, exercise) are also considered. Autonomic involvement in the cutaneous vascular responses to direct heating and cooling of the skin are also discussed. We examine the autonomic control of sweating, including cholinergic and noncholinergic mechanisms, the local control of sweating, thermoregulatory and nonthermoregulatory reflex control and the possible relationship between sudomotor and cutaneous vasodilator function. Finally, we comment on the clinical relevance of these control schemes in conditions of autonomic dysfunction. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. EEG and autonomic responses during performance of matching and non-matching to sample working memory tasks with emotional content.

    Directory of Open Access Journals (Sweden)

    Ana eGarcia

    2011-12-01

    Full Text Available Working memory (WM is a neural system responsible for the temporary storage of information and its utilization in problem solving. The central executive is theorized as the controller of storage functions that support WM. Neurophysiological data suggest that EEG theta and alpha oscillations in frontal and midline regions are involved in neural communication between the central executive and storage functions during WM performance. Emotion is known to modulate several memory systems, including WM, through central and peripheral pathways. However, the physiological correlations (electroencephalographic – EEG; autonomic nervous activity of the effect of emotion over WM are not well described. In this study we aimed to identify physiological responses related to emotional WM performance. EEG (21 channels, heart rate (HR and galvanic skin response (GSR recordings were obtained from 54 volunteers while performing delayed matching and non-matching to sample tasks (DMTS/DNMTS. Emotional and neutral pictures from the International Affective Picture System and geometric figures were used as stimuli. As expected, WM performance was accompanied by presence of theta (frontal and midline electrodes and Alpha power (parietal electrodes. Beta and gamma oscillations were concentrated in frontopolar and left temporal regions. DNMTS task was accompanied by increases in Beta power, HR and GSR compared to DMTS task. Correlation analysis showed a positive tendency for gamma in Fp2 site, ratio of LF/HF (HR low and high frequency and skin conductance in both tasks. The HR results indicate an inverse reaction related to parasympathetic and sympathetic nervous system during the performance of the tasks. Taken together, our results contribute to elucidate the complex interactions between central and autonomic nervous systems in the modulation of emotional WM tasks.

  12. A Role for the Autonomic Nervous System in Modulating the Immune Response during Mild Emotional Stimuli

    NARCIS (Netherlands)

    Croiset, Gerda; Heijnen, Cobi J.; Wal, Wim E. van der; Boer, Sietse F. de; Wied, David de

    1990-01-01

    The role of the autonomic nervous system in the modulation of the immune response to emotional stimuli, was established in rats subjected to the passive avoidance test. An increase in splenic primary antibody response directed against SRBC was found after exposure of rats to the passive avoidance

  13. Autonomic and Neuroendocrine Responses to a Psychosocial Stressor in Adults with Autistic Spectrum

    Science.gov (United States)

    Jansen, Lucres M. C.; Gispen-de Wied, Christine C.; Wiegant, Victor M.; Westenberg, Herman G. M.; Lahuis, Bertine E.; van Engeland, Herman

    2006-01-01

    Objective of the study was to replicate in adults our previous findings of decreased heart rate and normal endocrine responses to stress in autistic children and to elucidate the discrepancy between autonomic and endocrine stress responses by including epinephrine, norepinephrine, oxytocin and vasopressin measurements. Ten autistic spectrum…

  14. Depersonalization disorder: disconnection of cognitive evaluation from autonomic responses to emotional stimuli.

    Directory of Open Access Journals (Sweden)

    Matthias Michal

    Full Text Available BACKGROUND: Patients with depersonalization disorder (DPD typically complain about emotional detachment. Previous studies found reduced autonomic responsiveness to emotional stimuli for DPD patients as compared to patients with anxiety disorders. We aimed to investigate autonomic responsiveness to emotional auditory stimuli of DPD patients as compared to patient controls. Furthermore, we examined the modulatory effect of mindful breathing on these responses as well as on depersonalization intensity. METHODS: 22 DPD patients and 15 patient controls balanced for severity of depression and anxiety, age, sex and education, were compared regarding 1 electrodermal and heart rate data during a resting period, and 2 autonomic responses and cognitive appraisal of standardized acoustic affective stimuli in two conditions (normal listening and mindful breathing. RESULTS: DPD patients rated the emotional sounds as significantly more neutral as compared to patient controls and standardized norm ratings. At the same time, however, they responded more strongly to acoustic emotional stimuli and their electrodermal response pattern was more modulated by valence and arousal as compared to patient controls. Mindful breathing reduced severity of depersonalization in DPD patients and increased the arousal modulation of electrodermal responses in the whole sample. Finally, DPD patients showed an increased electrodermal lability in the rest period as compared to patient controls. CONCLUSIONS: These findings demonstrated that the cognitive evaluation of emotional sounds in DPD patients is disconnected from their autonomic responses to those emotional stimuli. The increased electrodermal lability in DPD may reflect increased introversion and cognitive control of emotional impulses. The findings have important psychotherapeutic implications.

  15. Oral warfarin intake affects skin inflammatory cytokine responses in rats.

    Science.gov (United States)

    Aleksandrov, Aleksandra Popov; Mirkov, Ivana; Zolotarevski, Lidija; Ninkov, Marina; Mileusnic, Dina; Kataranovski, Dragan; Kataranovski, Milena

    2017-09-01

    Warfarin is an anticoagulant used in prevention/prophylaxis of thromboembolism. Besides the effects on coagulation, non-hemorrhagic reactions have also been documented. Although cutaneous reactions were reported in some patients, the impact on skin immunity was not explored. In the present paper, the effect of 30-day oral warfarin intake on skin cytokine responses in rats was analyzed. Increased release of inflammatory cytokines (TNF, IL-1β and IL-10) was noted by skin explants from rats which received warfarin, but without effect on IL-6. No impact on epidermal cell cytokine secretion was seen, except a tendency of an increase of IL-6 response to stimulation with microbial product lipopolysaccharide (LPS). Topical application of contact allergen dinitrochlorobenzene (DNCB) resulted in slight (numerical solely) increase of TNF release by skin explants of warfarin-treated animals, while epidermal cells responded by increased secretion of all four cytokines examined. The data presented provide new information on the potential of oral warfarin to modulate skin innate immune activity. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Autonomic Nervous System Responses to Concussion: Arterial Pulse Contour Analysis

    Directory of Open Access Journals (Sweden)

    Michael F La Fountaine

    2016-02-01

    Full Text Available The arterial pulse wave (APW has a distinct morphology whose contours reflect dynamics in cardiac function and peripheral vascular tone as a result of sympathetic nervous system (SNS control. With a transition from rest to increased metabolic demand, the expected augmentation of SNS outflow will not only affect arterial blood pressure and heart rate, it will also induce changes to the contours of the APW. Following a sports concussion, a transient state cardiovascular autonomic dysfunction is present. How this state affects the APW, has yet to be described. A prospective, parallel-group study on cardiovascular autonomic control (i.e., digital electrocardiogram and continuous beat-to-beat blood pressure was performed in the seated upright position in ten athletes with concussion and 7 non-injured control athletes. Changes in APW were compared at rest and during the first 60 seconds (F60 of an isometric handgrip test (IHGT in concussed athletes and non-injured controls within 48 hours (48hr and 1 week (1wk of injury. The concussion group was further separated by the length of time until they were permitted to return to play (RTP>1wk; RTP≤1wk. SysSlope, an indirect measurement of stroke volume, was significantly lower in the concussion group at rest and during F60 at 48hr and 1wk; a paradoxical decline in SysSlope occurred at each visit during the transition from rest to IHGT F60. The RTP>1wk group had lower SysSlope (405±200; 420±88; 454±236 mmHg/s, respectively at rest 48hr compared to the RTP≤1wk and controls. Similarly at 48hr rest, several measurements of arterial stiffness were abnormal in RTP>1wk compared to RTP≤1wk and controls: Peak-to-Notch Latency (0.12±0.04; 0.16±0.02; 0.17±0.05, respectively, Notch Relative Amplitude (0.70±0.03; 0.71±0.04; 0.66±0.14, respectively and Stiffness Index (6.4±0.2; 5.7±0.4; 5.8±0.5, respectively. Use of APW revealed that concussed athletes have a transient increase in peripheral artery

  17. Autonomic markers of emotional processing: skin sympathetic nerve activity in humans during exposure to emotionally charged images.

    Science.gov (United States)

    Brown, Rachael; James, Cheree; Henderson, Luke A; Macefield, Vaughan G

    2012-01-01

    The sympathetic innervation of the skin primarily subserves thermoregulation, but the system has also been commandeered as a means of expressing emotion. While it is known that the level of skin sympathetic nerve activity (SSNA) is affected by anxiety, the majority of emotional studies have utilized the galvanic skin response as a means of inferring increases in SSNA. The purpose of the present study was to characterize the changes in SSNA when showing subjects neutral or emotionally charged images from the International Affective Picture System (IAPS). SSNA was recorded via tungsten microelectrodes inserted into cutaneous fascicles of the common peroneal nerve in ten subjects. Neutral images, positively charged images (erotica) or negatively charged images (mutilation) were presented in blocks of fifteen images of a specific type, each block lasting 2 min. Images of erotica or mutilation were presented in a quasi-random fashion, each block following a block of neutral images. Both images of erotica or images of mutilation caused significant increases in SSNA, but the increases in SSNA were greater for mutilation. The increases in SSNA were often coupled with sweat release and cutaneous vasoconstriction; however, these markers were not always consistent with the SSNA increases. We conclude that SSNA, comprising cutaneous vasoconstrictor and sudomotor activity, increases with both positively charged and negatively charged emotional images. Measurement of SSNA provides a more comprehensive assessment of sympathetic outflow to the skin than does the use of sweat release alone as a marker of emotional processing.

  18. Autonomous Sensory Meridian Response (ASMR) and Frisson: Mindfully Induced Sensory Phenomena That Promote Happiness

    Science.gov (United States)

    del Campo, Marisa A.; Kehle, Thomas J.

    2016-01-01

    There are many important phenomena involved in human functioning that are unnoticed, misunderstood, not applied, or do not pique the interest of the scientific community. Among these, "autonomous sensory meridian response" ("ASMR") and "frisson" are two very noteworthy instances that may prove to be therapeutically…

  19. Skin-Inspired Multifunctional Autonomic-Intrinsic Conductive Self-Healing Hydrogels with Pressure Sensitivity, Stretchability, and 3D Printability.

    Science.gov (United States)

    Darabi, Mohammad Ali; Khosrozadeh, Ali; Mbeleck, Rene; Liu, Yuqing; Chang, Qiang; Jiang, Junzi; Cai, Jun; Wang, Quan; Luo, Gaoxing; Xing, Malcolm

    2017-08-01

    The advent of conductive self-healing (CSH) hydrogels, a class of novel materials mimicking human skin, may change the trajectory of the industrial process because of their potential applications in soft robots, biomimetic prostheses, and health-monitoring systems. Here, the development of a mechanically and electrically self-healing hydrogel based on physically and chemically cross-linked networks is reported. The autonomous intrinsic self-healing of the hydrogel is attained through dynamic ionic interactions between carboxylic groups of poly(acrylic acid) and ferric ions. A covalent cross-linking is used to support the mechanical structure of the hydrogel. Establishing a fair balance between the chemical and physical cross-linking networks together with the conductive nanostructure of polypyrrole networks leads to a double network hydrogel with bulk conductivity, mechanical and electrical self-healing properties (100% mechanical recovery in 2 min), ultrastretchability (1500%), and pressure sensitivity. The practical potential of CSH hydrogels is further revealed by their application in human motion detection and their 3D-printing performance. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Thermoregulatory responses to skin wetting during prolonged treadmill running.

    Science.gov (United States)

    Bassett, D R; Nagle, F J; Mookerjee, S; Darr, K C; Ng, A V; Voss, S G; Napp, J P

    1987-02-01

    We examined the physiological responses to skin wetting during a 120-min level treadmill run to assess whether skin wetting would reduce the dehydration and the increase in core temperature associated with prolonged exercise. Testing was conducted in an environmental chamber (T = 29.5 degrees C, wind velocity = 3 m X sec-1) under two different humidity conditions (33 or 66% relative humidity). Ten male subjects performed two runs in each humidity condition; one served as a control run. The other included spraying the body with 50 ml of water (T = 29.5 degrees C) every 10 min. Spraying had no effect on rectal temperature (Tre), heart rate, oxygen consumption, perceived exertion, sweat loss, or percent change in plasma volume in both the humid and the dry conditions. Spraying produced a significant reduction in mean skin temperature (Tsk), which increased the (Tre - Tsk) gradient. At the same time, overall skin conductance (K) was decreased, presumably as a result of cutaneous vasoconstriction due to the low Tsk. Since heat transfer from the body's core to the skin is expressed by the equation: heat transfer = K X (Tre - Tsk) the spraying had no effect on heat transfer away from the core, and Tre remained unchanged.

  1. The Effect of Heart Rate on the Heart Rate Variability Response to Autonomic Interventions

    Directory of Open Access Journals (Sweden)

    George E Billman

    2013-08-01

    Full Text Available Heart rate variability (HRV, the beat-to-beat variation in either heart rate (HR or heart period (R-R interval, has become a popular clinical and investigational tool to quantify cardiac autonomic regulation. However, it is not widely appreciated that, due to the inverse curvilinear relationship between HR and R-R interval, HR per se can profoundly influence HRV. It is, therefore, critical to correct HRV for the prevailing HR particularly, as HR changes in response to autonomic neural activation or inhibition. The present study evaluated the effects of HR on the HRV response to autonomic interventions that either increased (submaximal exercise, n = 25 or baroreceptor reflex activation, n = 20 or reduced (pharmacological blockade: β-adrenergic receptor, muscarinic receptor antagonists alone and in combination, n = 25, or bilateral cervical vagotomy, n = 9 autonomic neural activity in a canine model. Both total (RR interval standard deviation, RRSD and the high frequency variability (HF, 0.2 to 1.04 Hz were determined before and in response to an autonomic intervention. All interventions that reduced or abolished cardiac parasympathetic regulation provoked large reductions in HRV even after HR correction [division by mean RRsec or (mean RRsec2 for RRSD and HF, respectively] while interventions that reduced HR yielded mixed results. β-adrenergic receptor blockade reduced HRV (RRSD but not HF while both RRSD and HF increased in response to increases in arterial blood (baroreceptor reflex activation even after HR correction. These data suggest that the physiological basis for HRV is revealed after correction for prevailing HR and, further, that cardiac parasympathetic activity is responsible for a major portion of the HRV in the dog.

  2. Head Exposure to Cold during Whole-Body Cryostimulation: Influence on Thermal Response and Autonomic Modulation

    Science.gov (United States)

    Louis, Julien; Schaal, Karine; Bieuzen, François; Le Meur, Yann; Filliard, Jean-Robert; Volondat, Marielle; Brisswalter, Jeanick; Hausswirth, Christophe

    2015-01-01

    Recent research on whole-body cryotherapy has hypothesized a major responsibility of head cooling in the physiological changes classically reported after a cryostimulation session. The aim of this experiment was to verify this hypothesis by studying the influence of exposing the head to cold during whole-body cryostimulation sessions, on the thermal response and the autonomic nervous system (ANS). Over five consecutive days, two groups of 10 participants performed one whole-body cryostimulation session daily, in one of two different systems; one exposing the whole-body to cold (whole-body cryostimulation, WBC), and the other exposing the whole-body except the head (partial-body cryostimulation, PBC).10 participants constituted a control group (CON) not receiving any cryostimulation. In order to isolate the head-cooling effect on recorded variables, it was ensured that the WBC and PBC systems induced the same decrease in skin temperature for all body regions (mean decrease over the 5 exposures: -8.6°C±1.3°C and -8.3±0.7°C for WBC and PBC, respectively), which persisted up to 20-min after the sessions (P20). The WBC sessions caused an almost certain decrease in tympanic temperature from Pre to P20 (-0.28 ±0.11°C), while it only decreased at P20 (-0.14±0.05°C) after PBC sessions. Heart rate almost certainly decreased after PBC (-8.6%) and WBC (-12.3%) sessions. Resting vagal-related heart rate variability indices (the root-mean square difference of successive normal R-R intervals, RMSSD, and high frequency band, HF) were very likely to almost certainly increased after PBC (RMSSD:+49.1%, HF: +123.3%) and WBC (RMSSD: +38.8%, HF:+70.3%). Plasma norepinephrine concentration was likely increased in similar proportions after PBC and WBC, but only after the first session. Both cryostimulation techniques stimulated the ANS with a predominance of parasympathetic tone activation from the first to the fifth session and in slightly greater proportion with WBC than PBC

  3. Dose-response relationship of autonomic nervous system responses to individualized training impulse in marathon runners.

    Science.gov (United States)

    Manzi, Vincenzo; Castagna, Carlo; Padua, Elvira; Lombardo, Mauro; D'Ottavio, Stefano; Massaro, Michele; Volterrani, Maurizio; Iellamo, Ferdinando

    2009-06-01

    In athletes, exercise training induces autonomic nervous system (ANS) adaptations that could be used to monitor training status. However, the relationship between training and ANS in athletes has been investigated without regard for individual training loads. We tested the hypothesis that in long-distance athletes, changes in ANS parameters are dose-response related to individual volume/intensity training load and could predict athletic performance. A spectral analysis of heart rate (HR), systolic arterial pressure variability, and baroreflex sensitivity by the sequences technique was investigated in eight recreational athletes during a 6-mo training period culminating with a marathon. Individualized training load responses were monitored by a modified training impulse (TRIMP(i)) method, which was determined in each athlete using the individual HR and lactate profiling determined during a treadmill test. Monthly TRIMP(i) steadily increased during the training period. All the ANS parameters were significantly and very highly correlated to the dose of exercise with a second-order regression model (r(2) ranged from 0.90 to 0.99; P marathon. These results suggest that in recreational athletes, ANS adaptations to exercise training are dose related on an individual basis, showing a progressive shift toward a sympathetic predominance, and that LF oscillations in HRV at peak training load could predict athletic achievement in this athlete population.

  4. Autonomous Sensory Meridian Response (ASMR): a flow-like mental state

    OpenAIRE

    Emma L. Barratt; Nick J. Davis

    2015-01-01

    Autonomous Sensory Meridian Response (ASMR) is a previously unstudied sensory phenomenon, in which individuals experience a tingling, static-like sensation across the scalp, back of the neck and at times further areas in response to specific triggering audio and visual stimuli. This sensation is widely reported to be accompanied by feelings of relaxation and well-being. The current study identifies several common triggers used to achieve ASMR, including whispering, personal attention, crisp s...

  5. Sensory determinants of the autonomous sensory meridian response (ASMR): Understanding the triggers

    OpenAIRE

    Barratt, EL; Spence, CJ; Davis, NJ

    2017-01-01

    The autonomous sensory meridian response (ASMR) is an atypical sensory phenomenon involving electrostatic-like tingling sensations in response to certain sensory, primarily audio-visual, stimuli. The current study used an online questionnaire, completed by 130 people who self-reported experiencing ASMR. We aimed to extend preliminary investigations into the experience, and establish key multisensory factors contributing to the successful induction of ASMR through online media. Aspects such as...

  6. Cardiovascular, hormonal and metabolic responses to graded exercise in juvenile diabetics with and without autonomic neuropathy

    DEFF Research Database (Denmark)

    Hilsted, J; Galbo, H; Christensen, N J

    1980-01-01

    Thirteen juvenile diabetics were studied in order to determine if decreased beat-to-beat variation during deep respiration, indicating abnormal autonomic nerve function, imply that cardiovascular, hormonal and metabolic responses are impaired. Patients with decreased beat-to-beat variation had to...... to be more heavily stressed during exercise to reach a certain heart rate or catecholamine level. The relation between other metabolic and hormonal response is discussed....

  7. Heart rate variability response to mental arithmetic stress in patients with schizophrenia Autonomic response to stress in schizophrenia

    NARCIS (Netherlands)

    Castro, Mariana N.; Vigo, Daniel E.; Weidema, Hylke; Fahrer, Rodolfo D.; Chu, Elvina M.; De Achaval, Delfina; Nogues, Martin; Leiguarda, Ramon C.; Cardinali, Daniel P.; Guinjoan, Salvador N.

    Background: The vulnerability-stress hypothesis is an established model of schizophrenia symptom formation. We sought to characterise the pattern of the cardiac autonomic response to mental arithmetic stress in patients with stable schizophrenia. Methods: We performed heart rate variability (HRV)

  8. Sympathetic skin response and R-R interval variation in cases with rheumatoid arthritis.

    Science.gov (United States)

    Gozke, E; Erdogan, N; Akyuz, G; Turan, B; Akyuz, E; Us, O

    2003-03-01

    To investigate the autonomic nervus system involvement in cases with rheumatoid arthritis (RA) by assesing sympathetic skin response (SSR) and R-R interval variation (RRIV), 14 healthy women and 10 women with RA, all of them without clinic dysautonomies were examined. SSR's were recorded palmar surface of both hands and soles of both feet, after stimulating median and tibial nerves individually. RRIV's were assessed at rest and during six deep breathing in one minute with electrodes placed on dorsal surfaces of both hands. SSR could not be obtained from lower extremities of one case with RA. We could not find any significant difference between two groups in terms of SSR latencies. RRIV values obtained during deep breathing to those recorded at rest (D%/R%) was found to be significantly lower in RA cases than healthy controls. RRIV values increased with deep breathing in healthy subjects, while they decreased in 50% of the RA cases. We conclude that assessment of SSR and RRIV are valuble methods for revelation of subclinical autonomic involvement in cases with RA.

  9. Investigation research on autonomous responsive materials; Jiritsu oto zairyo ni kansuru chosa kenkyu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1996-03-01

    A survey was made on autonomous responsive materials as a new material which reversibly change molecular structures and the aggregation state according to external stimuli. Autonomous responsive materials imitate environmental responsibility in the living organism system and have sensing, control and active functions for external stimuli. The materials are highly efficient and environmentally friendly. In biomimetic materials for soft actuators, drastic changes by temperature of elastic modulus of water-swollen hydrogel are used to the motion. In order to molecularly design stimulus-responsible polymer gel, studied are the relation between the micro structure and stimulus responsibility, dynamic correlation between the micro structure and the macro structure, etc. In the biomedical field, new cure and diagnosis using innovative materials are expected, and the application of autonomous responsive materials to the field is studied. For example, using hydrogel responding the temperature and the surface and controlling by temperature the interaction with components of the organism such as protein and cells, drug delivery in the organism is optimized. Also studied is the application of hydrophilic/hydrophobic changes by temperature to the chromatography. 215 refs., 47 figs., 11 tabs.

  10. Anxiety and autonomic response to social-affective stimuli in individuals with Williams syndrome.

    Science.gov (United States)

    Ng, Rowena; Bellugi, Ursula; Järvinen, Anna

    2016-12-01

    Williams syndrome (WS) is a genetic condition characterized by an unusual "hypersocial" personality juxtaposed by high anxiety. Recent evidence suggests that autonomic reactivity to affective face stimuli is disorganised in WS, which may contribute to emotion dysregulation and/or social disinhibition. Electrodermal activity (EDA) and mean interbeat interval (IBI) of 25 participants with WS (19 - 57 years old) and 16 typically developing (TD; 17-43 years old) adults were measured during a passive presentation of affective face and voice stimuli. The Beck Anxiety Inventory was administered to examine associations between autonomic reactivity to social-affective stimuli and anxiety symptomatology. The WS group was characterized by higher overall anxiety symptomatology, and poorer anger recognition in social visual and aural stimuli relative to the TD group. No between-group differences emerged in autonomic response patterns. Notably, for participants with WS, increased anxiety was uniquely associated with diminished arousal to angry faces and voices. In contrast, for the TD group, no associations emerged between anxiety and physiological responsivity to social-emotional stimuli. The anxiety associated with WS appears to be intimately related to reduced autonomic arousal to angry social stimuli, which may also be linked to the characteristic social disinhibition. Copyright © 2016. Published by Elsevier Ltd.

  11. Response of pig skin to fractionated radiation doses

    International Nuclear Information System (INIS)

    Wiernik, G.; Hopewell, J.W.; Patterson, T.J.S.; Young, C.M.A.; Foster, J.L.

    1977-01-01

    The individual components of a fractionated course of irradiation treatment have been considered separately. Methods of accurate measurement of individual parameters has brought to light different interpretations of the observations. Reasons are given for the necessity of having a radiobiological model which has a direct relevance to the clinical situation. Results are reported for fractionated regimes of irradiation in which the dose has been varied above and below normal tissue tolerance which has been equated with clinical skin necrosis. The components of the acute skin reaction, erythema, pigmentation and desquamation have been analysed separately and their contribution as a method of measurement assessed. Initially, the range of numerical scores attributed to erythema did not reach the scores attributed to necrosis but we now believe that radiation damage expressed as erythema can move directly into necrosis without passing through desquamation. Desquamation, on the other hand, only became a useful parameter at higher dose levels; it has also been shown to be a component associated with skin breakdown. Pigmentation showed no dose response at the dose levels employed in our experiments and it is our belief that this is due to this system being fully saturated under these circumstances. Measurement of the late radiation reaction in the skin has been considered in detail and our results have been expressed by comparing the relative lengths of irradiated and control fields in the same pig. From these findings iso-effect graphs have been constructed and time and fractionation factors have been derived. (author)

  12. Response of Autonomic Nervous System to Body Positions:

    Science.gov (United States)

    Xu, Aiguo; Gonnella, G.; Federici, A.; Stramaglia, S.; Simone, F.; Zenzola, A.; Santostasi, R.

    Two mathematical methods, the Fourier and wavelet transforms, were used to study the short term cardiovascular control system. Time series, picked from electrocardiogram and arterial blood pressure lasting 6 minutes, were analyzed in supine position (SUP), during the first (HD1) and the second parts (HD2) of 90° head down tilt, and during recovery (REC). The wavelet transform was performed using the Haar function of period T=2j (j=1,2,...,6) to obtain wavelet coefficients. Power spectra components were analyzed within three bands, VLF (0.003-0.04), LF (0.04-0.15) and HF (0.15-0.4) with the frequency unit cycle/interval. Wavelet transform demonstrated a higher discrimination among all analyzed periods than the Fourier transform. For the Fourier analysis, the LF of R-R intervals and VLF of systolic blood pressure show more evident difference for different body positions. For the wavelet analysis, the systolic blood pressures show much more evident differences than the R-R intervals. This study suggests a difference in the response of the vessels and the heart to different body positions. The partial dissociation between VLF and LF results is a physiologically relevant finding of this work.

  13. Cardiovascular autonomic responses to head-up tilt in gestational hypertension and normal pregnancy.

    Science.gov (United States)

    Heiskanen, Nonna; Saarelainen, Heli; Kärkkäinen, Henna; Valtonen, Pirjo; Lyyra-Laitinen, Tiina; Laitinen, Tomi; Vanninen, Esko; Heinonen, Seppo

    2011-04-01

    The aim of the present study was to evaluate the influence of gestational hypertension on hemodynamics and cardiovascular autonomic regulation at rest and their responses to head-up tilt (HUT). We prospectively studied 56 pregnant women (28 with gestational hypertension and 28 healthy pregnant women) during the third trimester of pregnancy and 3 months after pregnancy. In women with pregnancy-induced hypertension, compared with control women, there were significant differences in hemodynamics and in markers of cardiovascular regulation (p Postural change from the supine to the upright position was associated with significant changes in hemodynamic responses in both groups during pregnancy (from p pregnancies (p changes in autonomic nervous function in hypertensive women appeared to be a feature of gestational-induced hypertension.

  14. Cardiac autonomic responses induced by mental tasks and the influence of musical auditory stimulation.

    Science.gov (United States)

    Barbosa, Juliana Cristina; Guida, Heraldo L; Fontes, Anne M G; Antonio, Ana M S; de Abreu, Luiz Carlos; Barnabé, Viviani; Marcomini, Renata S; Vanderlei, Luiz Carlos M; da Silva, Meire L; Valenti, Vitor E

    2014-08-01

    We investigated the acute effects of musical auditory stimulation on cardiac autonomic responses to a mental task in 28 healthy men (18-22 years old). In the control protocol (no music), the volunteers remained at seated rest for 10 min and the test was applied for five minutes. After the end of test the subjects remained seated for five more minutes. In the music protocol, the volunteers remained at seated rest for 10 min, then were exposed to music for 10 min; the test was then applied over five minutes, and the subjects remained seated for five more minutes after the test. In the control and music protocols the time domain and frequency domain indices of heart rate variability remained unchanged before, during and after the test. We found that musical auditory stimulation with baroque music did not influence cardiac autonomic responses to the mental task. Copyright © 2014 Elsevier Ltd. All rights reserved.

  15. Secure, Autonomous, Intelligent Controller for Integrating Distributed Emergency Response Satellite Operations

    Science.gov (United States)

    Ivancic, William D.; Paulsen, Phillip E.; Miller, Eric M.; Sage, Steen P.

    2013-01-01

    This report describes a Secure, Autonomous, and Intelligent Controller for Integrating Distributed Emergency Response Satellite Operations. It includes a description of current improvements to existing Virtual Mission Operations Center technology being used by US Department of Defense and originally developed under NASA funding. The report also highlights a technology demonstration performed in partnership with the United States Geological Service for Earth Resources Observation and Science using DigitalGlobe(Registered TradeMark) satellites to obtain space-based sensor data.

  16. An Examination of Personality Traits Associated with Autonomous Sensory Meridian Response (ASMR)

    OpenAIRE

    Fredborg, Beverley; Clark, Jim; Smith, Stephen D.

    2017-01-01

    Autonomous Sensory Meridian Response (ASMR) is a perceptual condition in which the presentation of particular audio-visual stimuli triggers intense, pleasurable tingling sensations in the head and neck regions, which may spread to the periphery of the body. These triggering stimuli are often socially intimate in nature, and usually involve repetition of movements and/or sounds (e.g., hearing whispering, watching someone brush her hair). Reports of ASMR experiences first appeared in online com...

  17. Autonomous Meridian Sensory Response – from Internet subculture to audiovisual therapy

    OpenAIRE

    Garro, D

    2017-01-01

    ASMR (Autonomous Sensory Meridian Response) is the name given to a pleasant sensation that can be felt most commonly on the scalp and can be triggered by various gentle sounds (like whispers, crinkles or tapping), smooth and repetitive visual stimuli, personal attention (like the touch of a hairdresser or a masseur) or other events. ASMR is often associated with a general feeling of relaxation and peace. Whilst academic research on the sociological, artistic, sensory and cognitive dimensions ...

  18. Abnormal autonomic cardiac response to transient hypoxia in sickle cell anemia

    International Nuclear Information System (INIS)

    Sangkatumvong, S; Khoo, M C K; Coates, T D

    2008-01-01

    The objective of this study was to non-invasively assess cardiac autonomic control in subjects with sickle cell anemia (SCA) by tracking the changes in heart rate variability (HRV) that occur following brief exposure to a hypoxic stimulus. Five African–American SCA patients and seven healthy control subjects were recruited to participate in this study. Each subject was exposed to a controlled hypoxic stimulus consisting of five breaths of nitrogen. Time-varying spectral analysis of HRV was applied to estimate the cardiac autonomic response to the transient episode of hypoxia. The confounding effects of changes in respiration on the HRV spectral indices were reduced by using a computational model. A significant decrease in the parameters related to parasympathetic control was detected in the post-hypoxic responses of the SCA subjects relative to normal controls. The spectral index related to sympathetic activity, on the other hand, showed a tendency to increase the following hypoxic stimulation, but the change was not significant. This study suggests that there is some degree of cardiovascular autonomic dysfunction in SCA that is revealed by the response to transient hypoxia

  19. Influence of chemical peeling on the skin stress response system.

    Science.gov (United States)

    Kimura, Ayako; Kanazawa, Nobuo; Li, Hong-Jin; Yonei, Nozomi; Yamamoto, Yuki; Furukawa, Fukumi

    2012-07-01

    Skin stress response system (SSRS) involves corticotropin-releasing hormone (CRH) and proopiomelanocortin (POMC)-derived peptides, such as adrenocorticotropic hormone (ACTH), a-melanocyte-stimulating hormone (MSH) and b-endorphin that are locally generated in response to locally provided stressors or proinflammatory cytokines. This system would restrict tissue damage and restore local homoeostasis. Trichloroacetic acid (TCA) is one of the most widely used peeling agents and applied for cosmetic treatment of photodamaged skin. However, the biological mechanism responsible for TCA peeling has yet to be fully determined. While our investigation focused on the inflammation and wound healing pathways, in the recent study, we have examined involvement of the SSRS as the third pathway. Mostly depending on our findings that TCA peeling activates the SSRS by inducing the POMC expression of keratinocytes in the CRH-independent manner, together with the results reported by other researchers, we can say that the biological effect of POMC seems to be responsible for the TCA-induced epidermal SSRS activation. © 2012 John Wiley & Sons A/S.

  20. Response of Human Skin Equivalents to Sarcoptes scabiei

    Science.gov (United States)

    MORGAN, MARJORIE S.; ARLIAN, LARRY G.

    2010-01-01

    Studies have shown that molecules in an extract made from bodies of the ectoparasitic mite, Sarcoptes scabiei De Geer, modulate cytokine secretion from cultured human keratinocytes and fibroblasts. In vivo, in the parasitized skin, these cells interact with each other by contact and cytokine mediators and with the matrix in which they reside. Therefore, these cell types may function differently together than they do separately. In this study, we used a human skin equivalent (HSE) model to investigate the influence of cellular interactions between keratinocytes and fibroblasts when the cells were exposed to active/burrowing scabies mites, mite products, and mite extracts. The HSE consisted of an epidermis of stratified stratum corneum, living keratinocytes, and basal cells above a dermis of fibroblasts in a collagen matrix. HSEs were inoculated on the surface or in the culture medium, and their cytokine secretions on the skin surface and into the culture medium were determined by enzyme-linked immunosorbent assay. Active mites on the surface of the HSE induced secretion of cutaneous T cell-attracting chemokine, thymic stromal lymphopoietin, interleukin (IL)-1α, IL-1β, IL-1 receptor antagonist (IL-1ra), IL-6, IL-8, monocyte chemoattractant protein-1, granulocyte/macrophage colony-stimulating factor, and macrophage colony-stimulating factor. The main difference between HSEs and monocultured cells was that the HSEs produced the proinflammatory cytokines IL-1α and IL-1β and their competitive inhibitor IL-1ra, whereas very little of these mediators was previously found for cultured keratinocytes and fibroblasts. It is not clear how the balance between these cytokines influences the overall host response. However, IL-1ra may contribute to the depression of an early cutaneous inflammatory response to scabies in humans. These contrasting results illustrate that cell interactions are important in the host’s response to burrowing scabies mites. PMID:20939384

  1. Relationship between serum TSH and the responsiveness of toxic solitary autonomous thyroid nodules to radioiodine therapy

    DEFF Research Database (Denmark)

    Pedersen-Bjergaard, U; Kirkegaard, B C

    1998-01-01

    hypothyroidism both had detectable serum TSH at the time of 131I treatment. No other clinical parameter seemed to influence the outcome. CONCLUSION: There is no clinically significant effect of circulating TSH on the response of toxic solitary autonomous thyroid nodules to 131I therapy. However, keeping...... the patients subclinically hyperthyroid when receiving 131I treatment may possibly result in a reduced frequency of hypothyroidism.......) were euthyroid, three (8%) had responded insufficiently and required further antithyroid therapy, and two (5%) had developed hypothyroidism. No significant difference in the response pattern between patients with suppressed or detectable serum TSH could be demonstrated. The two patients who developed...

  2. A study on the frictional response of reptilian shed skin

    International Nuclear Information System (INIS)

    Abdel-Aal, H A; Vargiolu, R; Zahouani, H; Mansori, M El

    2011-01-01

    Deterministic surfaces are constructs of which profile, topography and textures are integral to the function of the system they enclose. They are designed to yield a predetermined tribological response. Developing such entities relies on controlling the structure of the rubbing interface so that, not only the surface is of optimized topography, but also is able to self-adjust its tribological behaviour according to the evolution of sliding conditions. In seeking inspirations for such designs, many engineers are turning toward the biological world to study the construction and behaviour of bio-analogues, and to probe the role surface topography assumes in conditioning of frictional response. That is how a bio-analogue can self-adjust its tribological response to adapt to habitat constraints. From a tribological point of view, Squamate Reptiles, offer diverse examples where surface texturing, submicron and nano-scale features, achieves frictional regulation. In this paper, we study the frictional response of shed skin obtained from a snake (Python regius). The study employed a specially designed tribo-acoustic probe capable of measuring the coefficient of friction and detecting the acoustical behavior of the skin in vivo. The results confirm the anisotropy of the frictional response of snakes. The coefficient of friction depends on the direction of sliding: the value in forward motion is lower than that in the backward direction. Diagonal and side winding motion induces a different value of the friction coefficient. We discuss the origin of such a phenomenon in relation to surface texturing and study the energy constraints, implied by anisotropic friction, on the motion of the reptile.

  3. A study on the frictional response of reptilian shed skin

    Energy Technology Data Exchange (ETDEWEB)

    Abdel-Aal, H A [Arts et Metier ParisTech, Rue Saint Dominique BP 508, 51006 Chalons-en-Champagne (France); Vargiolu, R; Zahouani, H [Laboratoire de Tribology et Dynamique des Systemes, UMR CNRS 5513, ENI Saint Etienne - Ecole Centrale de Lyon -36 Avenue Guy de Collongue, 69131 Ecully cedex. France (France); Mansori, M El, E-mail: Hisham.abdel-aal@ensam.eu [Ecole Nationale Superieure d' Arts et Metiers, 2, cours des Arts et Metiers - 13617 Aix en Provence cedex 1 (France)

    2011-08-19

    Deterministic surfaces are constructs of which profile, topography and textures are integral to the function of the system they enclose. They are designed to yield a predetermined tribological response. Developing such entities relies on controlling the structure of the rubbing interface so that, not only the surface is of optimized topography, but also is able to self-adjust its tribological behaviour according to the evolution of sliding conditions. In seeking inspirations for such designs, many engineers are turning toward the biological world to study the construction and behaviour of bio-analogues, and to probe the role surface topography assumes in conditioning of frictional response. That is how a bio-analogue can self-adjust its tribological response to adapt to habitat constraints. From a tribological point of view, Squamate Reptiles, offer diverse examples where surface texturing, submicron and nano-scale features, achieves frictional regulation. In this paper, we study the frictional response of shed skin obtained from a snake (Python regius). The study employed a specially designed tribo-acoustic probe capable of measuring the coefficient of friction and detecting the acoustical behavior of the skin in vivo. The results confirm the anisotropy of the frictional response of snakes. The coefficient of friction depends on the direction of sliding: the value in forward motion is lower than that in the backward direction. Diagonal and side winding motion induces a different value of the friction coefficient. We discuss the origin of such a phenomenon in relation to surface texturing and study the energy constraints, implied by anisotropic friction, on the motion of the reptile.

  4. Does transcutaneous nerve stimulation have effect on sympathetic skin response?

    Science.gov (United States)

    Okuyucu, E Esra; Turhanoğlu, Ayşe Dicle; Guntel, Murat; Yılmazer, Serkan; Savaş, Nazan; Mansuroğlu, Ayhan

    2018-01-01

    This study examined the effects of transcutaneous electrical nerve stimulation (TENS) on the sympathetic nerve system by sympathetic skin response test. Fifty-five healthy volunteers received either: (i) 30minutes TENS (25 participants) (ii) 30minutes sham TENS (30 participants) and SSR test was performed pre- and post-TENS. The mean values of latency and peak-to-peak amplitude of five consecutive SSRs were calculated. A significant amplitude difference was found between TENS and sham TENS group both in right and left hand (p=0.04, p=0.01, respectively). However there was no significant latancy difference between two groups (p>0.05 ). TENS has an inhibitory effect on elicited SNS responses when compared with sham TENS control group. Copyright © 2017 Elsevier Ltd. All rights reserved.

  5. [Features of Autonomic Response in Children with Bronchial Asthma in the Period of Exacerbation].

    Science.gov (United States)

    Lebedenko, A A; Semernik, O E

    2015-01-01

    Asthma is one of the urgent problems of modern pediatrics, but neuroregulation mechanisms underlying this disease have not been fully disclosed so far. The autonomic interaction assessment in patients with bronchial asthma is important to understand the pathogenesis and prognosis of the disease. The aim of this study was to investigate features of autonomic response in children with asthma in the period of exacerbation. The autonomic nervous system ANS) of 82 children aged 6 to 18 years old with asthma in the period of exacerbation were investigated. The spectral analysis of the heart rate variability and the correlation rhythmography method (skaterography) were used to assess the ANS state. Investigations were carried out at rest and after clinoorthostatic test. Non-respiratory (slow) waves reflecting (be degree of activity of humoral and neural canals of heart rate central regulation were dominated at the spectrogram of 72 (87.80%) children experiencing asthma attack; more than half of patients (58.53%) had predominantly very low-frequency component (VLF%) in the range of fluctuation rate that indicated (the influence of neurohumoral regulation. A significant increase in vagosympathetic balance coefficient (LE/HF) was recorded after clinoorthostatic test indicating the activation of the sympathetic nervous system. According to the correlation rhytlimnography data, a considerable scattering of scattergraphy points was detected in patients in (the baseline state that indicated the predominant influence of parasympathetic nervous system. After the clinoorthostatic test, on the contrary, we observed the of the scattergraphy cloud that could indicate sympathicotonia. The imbalance of the autonomic nervous system in the form of activation of the sympathetic amid neurohumoral regulation department was found in children with asthma.

  6. Dramatic response to nivolumab in xeroderma pigmentosum skin tumor.

    Science.gov (United States)

    Chambon, Fanny; Osdoit, Sophie; Bagny, Kelly; Moro, Anne; Nguyen, Jacqueline; Réguerre, Yves

    2018-02-01

    We report the case of a 6-year-old female with xeroderma pigmentosum (XP) who developed a nonoperable scalp tumor, treated with anti-programmed cell death protein 1 (anti-PD-1) therapy (nivolumab). She presented with a sarcomatoid carcinoma of the scalp with bone lysis as well as vascular and meningeal contact. Nivolumab was initiated because it has emerged as a promising immunotherapy. We observed a dramatic tumor response with excellent tolerance. However, while on nivolumab therapy she developed two large skin melanomas and several squamous cell carcinomas, which have been resected. These results demonstrate that cancer immunotherapy in patients with XP can be impressive but complex and warrants further investigation. © 2017 Wiley Periodicals, Inc.

  7. Enhanced pain and autonomic responses to ambiguous visual stimuli in chronic Complex Regional Pain Syndrome (CRPS) type I.

    Science.gov (United States)

    Cohen, H E; Hall, J; Harris, N; McCabe, C S; Blake, D R; Jänig, W

    2012-02-01

    Cortical reorganisation of sensory, motor and autonomic systems can lead to dysfunctional central integrative control. This may contribute to signs and symptoms of Complex Regional Pain Syndrome (CRPS), including pain. It has been hypothesised that central neuroplastic changes may cause afferent sensory feedback conflicts and produce pain. We investigated autonomic responses produced by ambiguous visual stimuli (AVS) in CRPS, and their relationship to pain. Thirty CRPS patients with upper limb involvement and 30 age and sex matched healthy controls had sympathetic autonomic function assessed using laser Doppler flowmetry of the finger pulp at baseline and while viewing a control figure or AVS. Compared to controls, there were diminished vasoconstrictor responses and a significant difference in the ratio of response between affected and unaffected limbs (symmetry ratio) to a deep breath and viewing AVS. While viewing visual stimuli, 33.5% of patients had asymmetric vasomotor responses and all healthy controls had a homologous symmetric pattern of response. Nineteen (61%) CRPS patients had enhanced pain within seconds of viewing the AVS. All the asymmetric vasomotor responses were in this group, and were not predictable from baseline autonomic function. Ten patients had accompanying dystonic reactions in their affected limb: 50% were in the asymmetric sub-group. In conclusion, there is a group of CRPS patients that demonstrate abnormal pain networks interacting with central somatomotor and autonomic integrational pathways. © 2011 European Federation of International Association for the Study of Pain Chapters.

  8. The choice of sensitive skin layer responsible for aftereffects of daily irradiation of the skin

    International Nuclear Information System (INIS)

    Keirim-Markus, I.B.

    1992-01-01

    The choice of sensitive human skin layer manifesting in delayed period after daily irradiation of the human skin (stochastic and determined effects) was evaluated. It was established that delayed aftereffects of daily radiation of the skin manifested as epidem damages. This layer of papilla derma of 10-15 mg/cm 2 thick situated at the great part of body surface, 15 mg/cm 2 on dorsal side of hands and 40 mg/cm 2 on palms and pillows of the fingers. Sensitive layer of skin dosimeter for a control of daily irradiation of people must have the same geometry

  9. Role of the autonomic nervous system and baroreflex in stress-evoked cardiovascular responses in rats.

    Science.gov (United States)

    Dos Reis, Daniel Gustavo; Fortaleza, Eduardo Albino Trindade; Tavares, Rodrigo Fiacadori; Corrêa, Fernando Morgan Aguiar

    2014-07-01

    Restraint stress (RS) is an experimental model to study stress-related cardiovascular responses, characterized by sustained pressor and tachycardiac responses. We used pharmacologic and surgical procedures to investigate the role played by sympathetic nervous system (SNS) and parasympathetic nervous system (PSNS) in the mediation of stress-evoked cardiovascular responses. Ganglionic blockade with pentolinium significantly reduced RS-evoked pressor and tachycardiac responses. Intravenous treatment with homatropine methyl bromide did not affect the pressor response but increased tachycardia. Pretreatment with prazosin reduced the pressor and increased the tachycardiac response. Pretreatment with atenolol did not affect the pressor response but reduced tachycardia. The combined treatment with atenolol and prazosin reduced both pressor and tachycardiac responses. Adrenal demedullation reduced the pressor response without affecting tachycardia. Sinoaortic denervation increased pressor and tachycardiac responses. The results indicate that: (1) the RS-evoked cardiovascular response is mediated by the autonomic nervous system without an important involvement of humoral factors; (2) hypertension results primarily from sympathovascular and sympathoadrenal activation, without a significant involvement of the cardiac sympathetic component (CSNS); (3) the abrupt initial peak in the hypertensive response to restraint is sympathovascular-mediated, whereas the less intense but sustained hypertensive response observed throughout the remaining restraint session is mainly mediated by sympathoadrenal activation and epinephrine release; (4) tachycardia results from CSNS activation, and not from PSNS inhibition; (5) RS evokes simultaneous CSNS and PSNS activation, and heart rate changes are a vector of both influences; (6) the baroreflex is functional during restraint, and modulates both the vascular and cardiac responses to restraint.

  10. Sinoatrial tissue of crucian carp heart has only negative contractile responses to autonomic agonists

    Directory of Open Access Journals (Sweden)

    Hälinen Mervi

    2010-06-01

    Full Text Available Abstract Background In the anoxia-tolerant crucian carp (Carassius carassius cardiac activity varies according to the seasons. To clarify the role of autonomic nervous control in modulation of cardiac activity, responses of atrial contraction and heart rate (HR to carbacholine (CCh and isoprenaline (Iso were determined in fish acclimatized to winter (4°C, cold-acclimated, CA and summer (18°C, warm-acclimated, WA temperatures. Results Inhibitory action of CCh was much stronger on atrial contractility than HR. CCh reduced force of atrial contraction at an order of magnitude lower concentrations (EC50 2.75-3.5·10-8 M in comparison to its depressive effect on HR (EC50 1.23-2.02·10-7 M (P -8 M and 10-7 M CCh, respectively (P + current, IK,CCh, with an EC50 value of 3-4.5·10-7 M and inhibited Ca2+ current (ICa by 28 ± 8% and 51 ± 6% at 10-7 M and 10-6 M, respectively. These currents can explain the shortening of AP. Iso did not elicit any responses in crucian carp sinoatrial preparations nor did it have any effect on atrial ICa, probably due to the saturation of the β-adrenergic cascade in the basal state. Conclusion In the crucian carp, HR and force of atrial contraction show cardio-depressive responses to the cholinergic agonist, but do not have any responses to the β-adrenergic agonist. The scope of inhibitory regulation by CCh is increased by the high basal tone of the adenylate cyclase-cAMP cascade. Higher concentrations of CCh were required to induce IK,CCh and inhibit ICa than was needed for CCh's negative inotropic effect on atrial muscle suggesting that neither IK,CCh nor ICa alone can mediate CCh's actions but they might synergistically reduce AP duration and atrial force production. Autonomic responses were similar in CA winter fish and WA summer fish indicating that cardiac sensitivity to external modulation by the autonomic nervous system is not involved in seasonal acclimatization of the crucian carp heart to cold and anoxic

  11. Autonomous Sensory Meridian Response (ASMR: a flow-like mental state

    Directory of Open Access Journals (Sweden)

    Emma L. Barratt

    2015-03-01

    Full Text Available Autonomous Sensory Meridian Response (ASMR is a previously unstudied sensory phenomenon, in which individuals experience a tingling, static-like sensation across the scalp, back of the neck and at times further areas in response to specific triggering audio and visual stimuli. This sensation is widely reported to be accompanied by feelings of relaxation and well-being. The current study identifies several common triggers used to achieve ASMR, including whispering, personal attention, crisp sounds and slow movements. Data obtained also illustrates temporary improvements in symptoms of depression and chronic pain in those who engage in ASMR. A high prevalence of synaesthesia (5.9% within the sample suggests a possible link between ASMR and synaesthesia, similar to that of misophonia. Links between number of effective triggers and heightened flow state suggest that flow may be necessary to achieve sensations associated with ASMR.

  12. Sensory determinants of the autonomous sensory meridian response (ASMR): understanding the triggers.

    Science.gov (United States)

    Barratt, Emma L; Spence, Charles; Davis, Nick J

    2017-01-01

    The autonomous sensory meridian response (ASMR) is an atypical sensory phenomenon involving electrostatic-like tingling sensations in response to certain sensory, primarily audio-visual, stimuli. The current study used an online questionnaire, completed by 130 people who self-reported experiencing ASMR. We aimed to extend preliminary investigations into the experience, and establish key multisensory factors contributing to the successful induction of ASMR through online media. Aspects such as timing and trigger load, atmosphere, and characteristics of ASMR content, ideal spatial distance from various types of stimuli, visual characteristics, context and use of ASMR triggers, and audio preferences are explored. Lower-pitched, complex sounds were found to be especially effective triggers, as were slow-paced, detail-focused videos. Conversely, background music inhibited the sensation for many respondents. These results will help in designing media for ASMR induction.

  13. Sensory determinants of the autonomous sensory meridian response (ASMR: understanding the triggers

    Directory of Open Access Journals (Sweden)

    Emma L. Barratt

    2017-10-01

    Full Text Available The autonomous sensory meridian response (ASMR is an atypical sensory phenomenon involving electrostatic-like tingling sensations in response to certain sensory, primarily audio-visual, stimuli. The current study used an online questionnaire, completed by 130 people who self-reported experiencing ASMR. We aimed to extend preliminary investigations into the experience, and establish key multisensory factors contributing to the successful induction of ASMR through online media. Aspects such as timing and trigger load, atmosphere, and characteristics of ASMR content, ideal spatial distance from various types of stimuli, visual characteristics, context and use of ASMR triggers, and audio preferences are explored. Lower-pitched, complex sounds were found to be especially effective triggers, as were slow-paced, detail-focused videos. Conversely, background music inhibited the sensation for many respondents. These results will help in designing media for ASMR induction.

  14. Modifications of Control Loop to Improve the Depth Response of Autonomous Underwater Vehicles

    Directory of Open Access Journals (Sweden)

    Sheng-Ping Hsu

    2014-01-01

    Full Text Available During a constant depth maneuver of an autonomous underwater vehicle (AUV, its pitch attitude and stern plane deflections create forces and moments to achieve equilibrium in the vertical plane. If an AUV has a proportional controller only in its depth control loop, then different weights or centers of gravity will cause different steady-state depth errors at trimmed conditions. In general, a steady-state depth error can be eliminated by adding an integral controller in the depth control loop. However, an improper integrator may lead to a bad transient response, even though the steady-state depth error can finally be eliminated. To remove the steady-state depth error, this study proposes methods that adjust the depth command and add a switching integral controller in the depth control loop. Simulation results demonstrate that the steady-state depth error can be eliminated and the transient response can be improved.

  15. Autonomous Sensory Meridian Response (ASMR): a flow-like mental state.

    Science.gov (United States)

    Barratt, Emma L; Davis, Nick J

    2015-01-01

    Autonomous Sensory Meridian Response (ASMR) is a previously unstudied sensory phenomenon, in which individuals experience a tingling, static-like sensation across the scalp, back of the neck and at times further areas in response to specific triggering audio and visual stimuli. This sensation is widely reported to be accompanied by feelings of relaxation and well-being. The current study identifies several common triggers used to achieve ASMR, including whispering, personal attention, crisp sounds and slow movements. Data obtained also illustrates temporary improvements in symptoms of depression and chronic pain in those who engage in ASMR. A high prevalence of synaesthesia (5.9%) within the sample suggests a possible link between ASMR and synaesthesia, similar to that of misophonia. Links between number of effective triggers and heightened flow state suggest that flow may be necessary to achieve sensations associated with ASMR.

  16. Calibration of thermoluminescence skin dosemeter response to beta emitters found in Ontario Hydro nuclear power stations

    International Nuclear Information System (INIS)

    Walsh, M.L.; Agnew, D.A.; Donnelly, K.E.

    1984-01-01

    The response of the Ontario Hydro Thermoluminescence Dosimetry System to beta radiation in nuclear power station environments was evaluated. Synthetic beta spectra were constructed, based on activity samples from heat transport systems and fuelling machine contamination smears at nuclear power stations. Using these spectra and dosemeter energy response functions, an overall response factor for the skin dosemeter relative to skin dose at 7 mg.cm -2 was calculated. This calculation was done assuming three specific geometries: (1) an infinite uniformly contaminated plane source at a distance of 33 cm (50 mg.cm -2 total shielding) from the receptor; (2) an infinite cloud surrounding the receptor; (3) a point source at 33 cm. Based on these calculations, a conservative response factor of 0.7 has been chosen. This provides an equation for skin dose assignment, i.e. Skin Dose = 1.4 x Skin Dosemeter Reading when the skin dosemeter is directly calibrated in mGy(gamma). (author)

  17. Regular physical exercise improves cardiac autonomic and muscle vasodilatory responses to isometric exercise in healthy elderly

    Science.gov (United States)

    Sarmento, Adriana de Oliveira; Santos, Amilton da Cruz; Trombetta, Ivani Credidio; Dantas, Marciano Moacir; Oliveira Marques, Ana Cristina; do Nascimento, Leone Severino; Barbosa, Bruno Teixeira; Dos Santos, Marcelo Rodrigues; Andrade, Maria do Amparo; Jaguaribe-Lima, Anna Myrna; Brasileiro-Santos, Maria do Socorro

    2017-01-01

    The objective of this study was to evaluate cardiac autonomic control and muscle vasodilation response during isometric exercise in sedentary and physically active older adults. Twenty healthy participants, 10 sedentary and 10 physically active older adults, were evaluated and paired by gender, age, and body mass index. Sympathetic and parasympathetic cardiac activity (spectral and symbolic heart rate analysis) and muscle blood flow (venous occlusion plethysmography) were measured for 10 minutes at rest (baseline) and during 3 minutes of isometric handgrip exercise at 30% of the maximum voluntary contraction (sympathetic excitatory maneuver). Variables were analyzed at baseline and during 3 minutes of isometric exercise. Cardiac autonomic parameters were analyzed by Wilcoxon and Mann–Whitney tests. Muscle vasodilatory response was analyzed by repeated-measures analysis of variance followed by Tukey’s post hoc test. Sedentary older adults had higher cardiac sympathetic activity compared to physically active older adult subjects at baseline (63.13±3.31 vs 50.45±3.55 nu, P=0.02). The variance (heart rate variability index) was increased in active older adults (1,438.64±448.90 vs 1,402.92±385.14 ms, P=0.02), and cardiac sympathetic activity (symbolic analysis) was increased in sedentary older adults (5,660.91±1,626.72 vs 4,381.35±1,852.87, P=0.03) during isometric handgrip exercise. Sedentary older adults showed higher cardiac sympathetic activity (spectral analysis) (71.29±4.40 vs 58.30±3.50 nu, P=0.03) and lower parasympathetic modulation (28.79±4.37 vs 41.77±3.47 nu, P=0.03) compared to physically active older adult subjects during isometric handgrip exercise. Regarding muscle vasodilation response, there was an increase in the skeletal muscle blood flow in the second (4.1±0.5 vs 3.7±0.4 mL/min per 100 mL, P=0.01) and third minute (4.4±0.4 vs 3.9±0.3 mL/min per 100 mL, P=0.03) of handgrip exercise in active older adults. The results indicate that

  18. Autonomic responses during acute myocardial infarction in the rat model: implications for arrhythmogenesis.

    Science.gov (United States)

    Kolettis, Theofilos M; Kontonika, Marianthi; Lekkas, Panagiotis; Vlahos, Antonios P; Baltogiannis, Giannis G; Gatzoulis, Konstantinos A; Chrousos, George P

    2018-04-10

    Autonomic responses participate in the pathophysiology of acute myocardial infarction, but their precise time course remains unclear. Here, we investigated the autonomic activity and ventricular tachyarrhythmias in conscious, unrestrained rats post-infarction. The left coronary artery was ligated in 12 Wistar rats, and six rats were sham operated, followed by 24-h electrocardiographic recording via implanted telemetry transmitters. Sympathetic activity was assessed by detrended fluctuation analysis and vagal activity by time- and frequency-domain analysis of heart rate variability. The duration of the ventricular tachyarrhythmias was measured, and voluntary motion served as a marker of heart failure. In sham-operated rats, heart rate and sympathetic activity remained low, whereas vagal activity rose progressively after the fourth hour. Post-ligation, medium-sized antero-septal necrosis was observed, reaching ~20% of the left ventricular volume; tachyarrhythmias were frequent, displaying a bimodal curve, and motion counts were low. Vagal activity decreased early post-ligation, coinciding with a high incidence of tachyarrhythmias, but tended to rise subsequently in rats with higher motion counts. Sympathetic activity increased after the third hour, along with a second tachyarrhythmia peak, and remained elevated throughout the 24-h period. Vagal withdrawal, followed by gradual sympathetic activation, may participate in arrhythmogenesis during acute myocardial infarction.

  19. Skin Blood Perfusion and Cellular Response to Insertion of Insulin Pen Needles With Different Diameters

    DEFF Research Database (Denmark)

    Præstmark, Kezia Ann; Stallknecht, Bente Merete; Bo Jensen, Casper

    2014-01-01

    skin blood perfusion response around needle insertion sites. Three common sized pen needles of 28G, 30G, and 32G as well as hooked 32G needles, were inserted into the neck skin of pigs and then removed. Laser Speckle Contrast Analysis was used to measure skin blood perfusion for 20 minutes after...... blood perfusion recording and grouped according to needle type, skin blood perfusion response relates to needle diameter. The response was significantly higher after insertions with 28G and hooked 32G needles than with 30G (P ..., but there was a trend of an increased response with increasing needle diameter. Skin blood perfusion response to pen needle insertions rank according to needle diameter, and the tissue response caused by hooked 32G needles corresponds to that of 28G needles. The relation between needle diameter and trauma when...

  20. The Effect of Tracheal Intubation-Induced Autonomic Response on Photoplethysmography

    Directory of Open Access Journals (Sweden)

    Pekka Talke

    2017-01-01

    Full Text Available Introduction. Intraoperative stress responses and postoperative pain can be monitored using photoplethysmography (PPG. PPG signal has two components, AC and DC. Effects of noxious stimuli-induced stress responses have not been studied on the DC component of PPG. The aim of this study was to investigate the effect of a known noxious stimulus (endotracheal intubation on both the AC and DC components of PPG. Methods. 15 surgical patients having general anesthesia were enrolled into this clinical study. PPG was recorded electronically from a pulse oximeter. Maximum changes in the AC and DC components of the PPG and pulse rate were determined in response to endotracheal intubation from high frequency (62.5 Hz PPG recordings. Results. Endotracheal intubation-induced autonomic stress response resulted in a significant decrease in the AC component of the PPG and an increase in pulse rate in every subject (p<0.05 for all. The decrease in the AC component of the PPG was 50±12% (p<0.05 and the increase in pulse rate was 26±10 bpm (p<0.05. The response of the DC component was variable (p = NS. Conclusion. Endotracheal intubation-induced stress response resulted in a significant and consistent change in the AC, but not the DC component of the PPG. This trial is registered with ClinicalTrials.gov Identifier NCT03032939.

  1. Appreciating the image of God in all humanity: Towards a pastoral response to skin lightening as image enhancement to exit dark skin

    Directory of Open Access Journals (Sweden)

    Noah K. Tenai

    2016-05-01

    Full Text Available The practice of skin lightening is prevalent amongst dark-skinned people globally. Various current studies that map this practice and that seek motivations behind the practice are examined. It is observed that through shrewd marketing, dark-skinned people are offered a promise of a better quality of life, obtained by a lighter skin, through the use of skin lighteners. In spite of the severe health risks involved, the promise is ostensibly irresistible to some dark-skinned persons. A pastoral response is offered that affirms the full personhood and complete humanity of dark-skinned people as fully human and whole in their dark skins. Keywords: Skin lightening, Dark skin, Image of God

  2. Rapid-onset obesity with hypothalamic dysfunction, hypoventilation, and autonomic dysregulation (ROHHAD): Response to ventilatory challenges.

    Science.gov (United States)

    Carroll, Michael S; Patwari, Pallavi P; Kenny, Anna S; Brogadir, Cindy D; Stewart, Tracey M; Weese-Mayer, Debra E

    2015-12-01

    Hypoventilation is a defining feature of Rapid-onset Obesity with Hypothalamic dysfunction, Hypoventilation and Autonomic Dysregulation (ROHHAD), a rare respiratory and autonomic disorder. This chronic hypoventilation has been explained as the result of dysfunctional chemosensory control circuits, possibly affecting peripheral afferent input, central integration, or efferent motor control. However, chemosensory function has never been quantified in a cohort of ROHHAD patients. Therefore, the purpose of this study was to assess the response to awake ventilatory challenge testing in children and adolescents with ROHHAD. The ventilatory, cardiovascular and cerebrovascular responses in 25 distinct comprehensive physiological recordings from seven unique ROHHAD patients to three different gas mixtures were analyzed at breath-to-breath and beat-to-beat resolution as absolute measures, as change from baseline, or with derived metrics. Physiologic measures were recorded during a 3-min baseline period of room air, a 3-min gas exposure (of 100% O2; 95% O2, 5% CO2; or 14% O2, 7% CO2 balanced with N2), and a 3-min recovery period. An additional hypoxic challenge was conducted which consisted of either five or seven tidal breaths of 100% N2. While ROHHAD cases showed a diminished VT and inspiratory drive response to hypoxic hypercapnia and absent behavioral awareness of the physiologic compromise, most ventilatory, cardiovascular, and cerebrovascular measures were similar to those of previously published controls using an identical protocol, suggesting a mild chemosensory deficit. Nonetheless, the high mortality rate, comorbidity and physiological fragility of patients with ROHHAD demand continued clinical vigilance. © 2015 Wiley Periodicals, Inc.

  3. Dose-response relationships and threshold levels in skin and respiratory allergy

    NARCIS (Netherlands)

    Arts, J.H.E.; Mommers, C.; Heer, C.de

    2006-01-01

    A literature study was performed to evaluate dose-response relationships and no-effect levels for sensitization and elicitation in skin- and respiratory allergy. With respect to the skin, dose-response relationships and no-effect levels were found for both intradermal and topical induction, as well

  4. Tryptophan depletion affects the autonomic stress response in generalized social anxiety disorder.

    Science.gov (United States)

    van Veen, J Frederieke; van Vliet, Irene M; de Rijk, Roel H; van Pelt, Johannes; Mertens, Bart; Fekkes, Durk; Zitman, Frans G

    2009-11-01

    In generalized social anxiety disorder (gSAD), serotonergic dysfunctions are found, as well as abnormalities of the autonomic nervous system (ANS) in basal conditions and of the hypothalamic pituitary adrenal (HPA) axis in response to psychological challenges. These findings raise the question whether these phenomena are interrelated. Therefore we designed a study in which two groups with nine pair wise age and gender matched gSAD patients (total of 10 men and 8 women), who were successfully treated with a selective serotonin reuptake inhibitor (SSRI), underwent a tryptophan depletion challenge (TD) or a placebo condition. A TD procedure temporarily decreases serotonergic neurotransmission. In order to activate the stress system the TD/placebo challenge was combined with a public speaking task. We assessed ANS responses, as measured with the promising new marker salivary alpha-amylase (sAA), and HPA-axis responses, as measured with salivary cortisol. The most important result was that the TD group showed a significant larger sAA response to the public speaking task as compared to the placebo group, reflecting hyperresponsivity of the ANS in this group, whereas no differences were seen in cortisol responses. This suggests that in gSAD there is a vulnerability of the ANS more than the HPA-axis.

  5. Considerations on command and response language features for a network of heterogeneous autonomous computers

    Science.gov (United States)

    Engelberg, N.; Shaw, C., III

    1984-01-01

    The design of a uniform command language to be used in a local area network of heterogeneous, autonomous nodes is considered. After examining the major characteristics of such a network, and after considering the profile of a scientist using the computers on the net as an investigative aid, a set of reasonable requirements for the command language are derived. Taking into account the possible inefficiencies in implementing a guest-layered network operating system and command language on a heterogeneous net, the authors examine command language naming, process/procedure invocation, parameter acquisition, help and response facilities, and other features found in single-node command languages, and conclude that some features may extend simply to the network case, others extend after some restrictions are imposed, and still others require modifications. In addition, it is noted that some requirements considered reasonable (user accounting reports, for example) demand further study before they can be efficiently implemented on a network of the sort described.

  6. Blood pressure responses to dietary sodium: Association with autonomic cardiovascular function in normotensive adults.

    Science.gov (United States)

    Matthews, Evan L; Brian, Michael S; Edwards, David G; Stocker, Sean D; Wenner, Megan M; Farquhar, William B

    2017-12-01

    Blood pressure responses to dietary sodium vary widely person-to-person. Salt sensitive rodent models display altered autonomic function, a trait thought to contribute to poor cardiovascular health. Thus, we hypothesized that increased salt sensitivity (SS) in normotensive humans would be associated with increased muscle sympathetic nerve activity (MSNA), decreased high frequency heart rate variability (HF-HRV), and decreased baroreflex sensitivity. Healthy normotensive men and women completed 1week of high (300mmol·day -1 ) and 1week of low (20mmol·day -1 ) dietary sodium (random order) with 24h mean arterial pressure (MAP) assessed on the last day of each diet to assess SS. Participants returned to the lab under habitual sodium conditions for testing. Forty-two participants are presented in this analysis, 19 of which successful MSNA recordings were obtained (n=42: age 39±2yrs., BMI 24.3±0.5kg·(m 2 ) -1 , MAP 83±1mmHg, habitual urine sodium 93±7mmol·24h -1 ; n=19: MSNA burst frequency 20±2 bursts·min -1 ). The variables of interest were linearly regressed over the magnitude of SS. Higher SS was associated with increased MSNA (burst frequency: r=0.469, p=0.041), decreased HF-HRV (r=-0.349, p=0.046), and increased LF/HF-HRV (r=0.363, p=0.034). SS was not associated with sympathetic or cardiac baroreflex sensitivity (p>0.05). Multiple regression analysis accounting for age found that age, not SS, independently predicted HF-HRV (age adjusted no longer significant; p=0.369) and LF/HF-HRV (age adjusted p=0.273). These data suggest that age-related salt sensitivity of blood pressure in response to dietary sodium is associated with altered resting autonomic cardiovascular function. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Cardiac Autonomic and Blood Pressure Responses to an Acute Bout of Kettlebell Exercise.

    Science.gov (United States)

    Wong, Alexei; Nordvall, Michael; Walters-Edwards, Michelle; Lastova, Kevin; Francavillo, Gwendolyn; Summerfield, Liane; Sanchez-Gonzalez, Marcos

    2017-10-07

    Kettlebell (KB) training has become an extremely popular exercise program for improving both muscle strength and aerobic fitness. However, the cardiac autonomic modulation and blood pressure (BP) responses induced by an acute KB exercise session are currently unknown. Understanding the impact of this exercise modality on the post-exercise autonomic modulation and BP would facilitate appropriate exercise prescription in susceptible populations. The present study evaluated the effects of an acute session of KB exercise on heart rate variability (HRV) and BP responses in healthy individuals. Seventeen (M=10, F=7) healthy subjects completed either a KB or non-exercise control trial in randomized order. HRV and BP measurements were collected at baseline, 3, 10 and 30 min after each trial. There were significant increases (P < 0.01) in heart rate, markers of sympathetic activity (nLF) and sympathovagal balance (nLF/nHF) for 30 min after the trial KB trial, while no changes from baseline were observed after the control trial. There were also significant decreases (P < 0.01) in markers of vagal tone (RMMSD, nHF) for 30 min as well as (P < 0.01) systolic BP and diastolic BP at 10 and 30 min after the trial KB trial while no changes from baseline were observed after the control trial. Our findings indicate that KB exercise increases sympathovagal balance for 30 min post-intervention which is concurrent with an important hypotensive effect. Further research is warranted to evaluate the potential clinical application of KB training in populations that might benefit from post-exercise hypotension, such as hypertensives.

  8. Reduced lymphoid response to skin allotransplants in cows with hepatic lipidosis.

    Science.gov (United States)

    Wentink, G H; van den Ingh, T S; Rutten, V P; Müller, K E; Wensing, T

    1999-04-01

    The immune responsiveness of cows with hepatic lipidosis (fatty liver) in comparison to control cows with a normal liver fat content was tested by applying skin allotransplants to the skin of the back of cows on day 3 after parturition. Immunoreactivity was determined by semiquantitative counting of the number of infiltrating lymphocytes in the recipient skin adjacent to the allotransplants during a period of 21 days. There were more invading lymphocytes in samples from control cows than there were in samples from cows with hepatic lipidosis. It was concluded that cows with hepatic lipidosis have a reduced lymphoid response to skin allotransplants.

  9. Skin

    International Nuclear Information System (INIS)

    Hunter, R.D.

    1985-01-01

    Malignant disease involving the skin represents a significant work load to the general radiotherapist and can involve interesting diagnostic and therapeutic decisions. Primary skin cancer is also relatively common and there is a need to provide an efficient service in which the first treatment is successful in the majority of patients. The reward for careful attention to technique is very considerable both in terms of clinical cancer control and functional results. Squamous cell carcinoma, basal cell carcinoma, and intra-epidermal carcinoma constitute the majority of the lesions dealt with clinically, but metastatic disease, lymphomas, and malignant melanomas are also referred regularly for opinions and may require radiotherapy. The general principle of the techniques of assessment and radiotherapeutic management to be described are equally applicable to any malignant skin tumour once the decision has been made to accept it for radiotherapy. Dosage and fractionation may have to be adjusted to allow for the nature of the disease process and the intent of the treatment

  10. Distribution of T Cells in Rainbow Trout (Oncorhynchus mykiss) Skin and Responsiveness to Viral Infection

    Science.gov (United States)

    Leal, Esther; Granja, Aitor G.; Zarza, Carlos; Tafalla, Carolina

    2016-01-01

    Although the skin constitutes the first line of defense against waterborne pathogens, there is a great lack of information regarding the skin associated lymphoid tissue (SALT) and whether immune components of the skin are homogeneously distributed through the surface of the fish is still unknown. In the current work, we have analyzed the transcription of several immune genes throughout different rainbow trout (Oncorhynchus mykiss) skin areas. We found that immunoglobulin and chemokine gene transcription levels were higher in a skin area close to the gills. Furthermore, this skin area as well as other anterior sections also transcribed significantly higher levels of many different immune genes related to T cell immunity such as T cell receptor α (TCRα), TCRγ, CD3, CD4, CD8, perforin, GATA3, Tbet, FoxP3, interferon γ (IFNγ), CD40L and Eomes in comparison to posterior skin sections. In agreement with these results, immunohistochemical analysis revealed that anterior skin areas had a higher concentration of CD3+ T cells and flow cytometry analysis confirmed that the percentage of CD8+ T lymphocytes was also higher in anterior skin sections. These results demonstrate for the first time that T cells are not homogeneously distributed throughout the teleost skin. Additionally, we studied the transcriptional regulation of these and additional T cell markers in response to a bath infection with viral hemorrhagic septicemia virus (VHSV). We found that VHSV regulated the transcription of several of these T cell markers in both the skin and the spleen; with some differences between anterior and posterior skin sections. Altogether, our results point to skin T cells as major players of teleost skin immunity in response to waterborne viral infections. PMID:26808410

  11. Characterization of the early local immune response to Ixodes ricinus tick bites in human skin.

    Science.gov (United States)

    Glatz, Martin; Means, Terry; Haas, Josef; Steere, Allen C; Müllegger, Robert R

    2017-03-01

    Little is known about the immunomodulation by tick saliva during a natural tick bite in human skin, the site of the tick-host interaction. We examined the expression of chemokines, cytokines and leucocyte markers on the mRNA levels and histopathologic changes in human skin biopsies of tick bites (n=37) compared to unaffected skin (n=9). Early tick-bite skin lesions (skin. With longer tick attachment (>24 hours), the numbers of innate immune cells and mediators (not significantly) declined, whereas the numbers of lymphocytes (not significantly) increased. Natural tick bites by Ixodes ricinus ticks initially elicit a strong local innate immune response in human skin. Beyond 24 hours of tick attachment, this response usually becomes less, perhaps because of immunomodulation by tick saliva. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  12. The influence of concentration/meditation on autonomic nervous system activity and the innate immune response: a case study.

    NARCIS (Netherlands)

    Kox, M.; Stoffels, M.; Smeekens, S.P.; Alfen, N. van; Gomes, M.E.R.; Eijsvogels, T.M.H.; Hopman, M.T.E.; Hoeven, J.G. van der; Netea, M.G.; Pickkers, P.

    2012-01-01

    OBJECTIVE: In this case study, we describe the effects of a particular individual's concentration/meditation technique on autonomic nervous system activity and the innate immune response. The study participant holds several world records with regard to tolerating extreme cold and claims that he can

  13. Effect of skin temperature on cutaneous vasodilator response to the β-adrenergic agonist isoproterenol

    OpenAIRE

    Hodges, Gary J.; Kellogg, Dean L.; Johnson, John M.

    2015-01-01

    The vascular response to local skin cooling is dependent in part on a cold-induced translocation of α2C-receptors and an increased α-adrenoreceptor function. To discover whether β-adrenergic function might contribute, we examined whether β-receptor sensitivity to the β-agonist isoproterenol was affected by local skin temperature. In seven healthy volunteers, skin blood flow was measured from the forearm by laser-Doppler flowmetry and blood pressure was measured by finger photoplethysmography....

  14. Acupuncture Affects Autonomic and Endocrine but Not Behavioural Responses Induced by Startle in Horses

    Directory of Open Access Journals (Sweden)

    Julia Dias Villas-Boas

    2015-01-01

    Full Text Available Startle is a fast response elicited by sudden acoustic, tactile, or visual stimuli in a variety of animals and in humans. As the magnitude of startle response can be modulated by external and internal variables, it can be a useful tool to study reaction to stress. Our study evaluated whether acupuncture can change cardiac autonomic modulation (heart rate variability; and behavioural (reactivity and endocrine (cortisol levels parameters in response to startle. Brazilian Sport horses (n=6 were subjected to a model of startle in which an umbrella was abruptly opened near the horse. Before startle, the horses were subjected to a 20-minute session of acupuncture in acupoints GV1, HT7, GV20, and BL52 (ACUP and in nonpoints (NP or left undisturbed (CTL. For analysis of the heart rate variability, ultrashort-term (64 s heart rate series were interpolated (4 Hz and divided into 256-point segments and the spectra integrated into low (LF; 0.01–0.07 Hz; index of sympathetic modulation and high (HF; 0.07–0.50 Hz; index of parasympathetic modulation frequency bands. Acupuncture (ACUP changed the sympathovagal balance with a shift towards parasympathetic modulation, reducing the prompt startle-induced increase in LF/HF and reducing cortisol levels 30 min after startle. However, acupuncture elicited no changes in behavioural parameters.

  15. The medial prefrontal cortex: coordinator of autonomic, neuroendocrine and behavioural responses to stress.

    Science.gov (United States)

    McKlveen, J M; Myers, B; Herman, J P

    2015-06-01

    Responding to real or potential threats in the environment requires the coordination of autonomic, neuroendocrine and behavioural processes to promote adaptation and survival. These diverging systems necessitate input from the limbic forebrain to integrate and modulate functional output in accordance with contextual demand. In the present review, we discuss the potential role of the medial prefrontal cortex (mPFC) as a coordinator of behavioural and physiological stress responses across multiple temporal and contextual domains. Furthermore, we highlight converging evidence from rodent and human research indicating the necessity of the mPFC for modulating physiological energetic systems to mobilise or limit energetic resources as needed to ultimately promote behavioural adaptation in the face of stress. We review the literature indicating that glucocorticoids act as one of the primary messengers in the reallocation of energetic resources having profound effects locally within the mPFC, as well as shaping how the mPFC acts within a network of brain structures to modulate responses to stress. Finally, we discuss how both rodent and human studies point toward a critical role of the mPFC in the coordination of anticipatory responses to stress and why this distinction is an important one to make in stress neurobiology. © 2015 British Society for Neuroendocrinology.

  16. Is Baseline Cardiac Autonomic Modulation Related to Performance and Physiological Responses Following a Supramaximal Judo Test?

    Science.gov (United States)

    Blasco-Lafarga, Cristina; Martínez-Navarro, Ignacio; Mateo-March, Manuel

    2013-01-01

    Little research exists concerning Heart Rate (HR) Variability (HRV) following supramaximal efforts focused on upper-body explosive strength-endurance. Since they may be very demanding, it seems of interest to analyse the relationship among performance, lactate and HR dynamics (i.e. HR, HRV and complexity) following them; as well as to know how baseline cardiac autonomic modulation mediates these relationships. The present study aimed to analyse associations between baseline and post-exercise HR dynamics following a supramaximal Judo test, and their relationship with lactate, in a sample of 22 highly-trained male judoists (20.70±4.56 years). A large association between the increase in HR from resting to exercise condition and performance suggests that individuals exerted a greater sympathetic response to achieve a better performance (Rating of Perceived Exertion: 20; post-exercise peak lactate: 11.57±2.24 mmol/L; 95.76±4.13 % of age-predicted HRmax). Athletes with higher vagal modulation and lower sympathetic modulation at rest achieved both a significant larger ∆HR and a faster post-exercise lactate removal. A enhanced resting parasympathetic modulation might be therefore related to a further usage of autonomic resources and a better immediate metabolic recovery during supramaximal exertions. Furthermore, analyses of variance displayed a persistent increase in α1 and a decrease in lnRMSSD along the 15 min of recovery, which are indicative of a diminished vagal modulation together with a sympathovagal balance leaning to sympathetic domination. Eventually, time-domain indices (lnRMSSD) showed no lactate correlations, while nonlinear indices (α1 and lnSaEn) appeared to be moderate to strongly correlated with it, thus pointing to shared mechanisms between neuroautonomic and metabolic regulation. PMID:24205273

  17. Impaired Memory Retrieval Correlates with Individual Differences in Cortisol Response but Not Autonomic Response

    Science.gov (United States)

    Tranel, Daniel; Adolphs, Ralph; Buchanan, Tony W.

    2006-01-01

    Stress can enhance or impair memory performance. Both cortisol release and sympathetic nervous system responses have been implicated in these differential effects. Here we investigated how memory retrieval might be affected by stress-induced cortisol release, independently of sympathetic nervous system stress responses. Thirty-two healthy…

  18. Short separation regression improves statistical significance and better localizes the hemodynamic response obtained by near-infrared spectroscopy for tasks with differing autonomic responses.

    Science.gov (United States)

    Yücel, Meryem A; Selb, Juliette; Aasted, Christopher M; Petkov, Mike P; Becerra, Lino; Borsook, David; Boas, David A

    2015-07-01

    Autonomic nervous system response is known to be highly task-dependent. The sensitivity of near-infrared spectroscopy (NIRS) measurements to superficial layers, particularly to the scalp, makes it highly susceptible to systemic physiological changes. Thus, one critical step in NIRS data processing is to remove the contribution of superficial layers to the NIRS signal and to obtain the actual brain response. This can be achieved using short separation channels that are sensitive only to the hemodynamics in the scalp. We investigated the contribution of hemodynamic fluctuations due to autonomous nervous system activation during various tasks. Our results provide clear demonstrations of the critical role of using short separation channels in NIRS measurements to disentangle differing autonomic responses from the brain activation signal of interest.

  19. Regular physical exercise improves cardiac autonomic and muscle vasodilatory responses to isometric exercise in healthy elderly

    Directory of Open Access Journals (Sweden)

    Sarmento AO

    2017-06-01

    Full Text Available Adriana de Oliveira Sarmento,1–3 Amilton da Cruz Santos,1,4 Ivani Credidio Trombetta,2,5 Marciano Moacir Dantas,1 Ana Cristina Oliveira Marques,1,4 Leone Severino do Nascimento,1,4 Bruno Teixeira Barbosa,1,2 Marcelo Rodrigues Dos Santos,2 Maria do Amparo Andrade,3 Anna Myrna Jaguaribe-Lima,3,6 Maria do Socorro Brasileiro-Santos1,3,4 1Laboratory of Physical Training Studies Applied to Health, Department of Physical Education, Federal University of Paraiba, João Pessoa, Brazil; 2Unit of Cardiovascular Rehabilitation and Exercise Physiology – Heart Institute (InCor/HC-FMUSP, University of São Paulo, São Paulo, Brazil; 3Graduate Program in Physiotherapy, Federal University of Pernambuco, Recife, Brazil; 4Associate Graduate Program in Physical Education UPE/UFPB, João Pessoa, Brazil; 5Graduate Program in Medicine, Universidade Nove de Julho (UNINOVE, São Paulo, Brazil; 6Department of Morphology and Animal Physiology, Federal Rural University of Pernambuco, Recife, Brazil Abstract: The objective of this study was to evaluate cardiac autonomic control and muscle vasodilation response during isometric exercise in sedentary and physically active older adults. Twenty healthy participants, 10 sedentary and 10 physically active older adults, were evaluated and paired by gender, age, and body mass index. Sympathetic and parasympathetic cardiac activity (spectral and symbolic heart rate analysis and muscle blood flow (venous occlusion plethysmography were measured for 10 minutes at rest (baseline and during 3 minutes of isometric handgrip exercise at 30% of the maximum voluntary contraction (sympathetic excitatory maneuver. Variables were analyzed at baseline and during 3 minutes of isometric exercise. Cardiac autonomic parameters were analyzed by Wilcoxon and Mann–Whitney tests. Muscle vasodilatory response was analyzed by repeated-measures analysis of variance followed by Tukey’s post hoc test. Sedentary older adults had higher cardiac

  20. An Examination of Personality Traits Associated with Autonomous Sensory Meridian Response (ASMR).

    Science.gov (United States)

    Fredborg, Beverley; Clark, Jim; Smith, Stephen D

    2017-01-01

    Autonomous Sensory Meridian Response (ASMR) is a perceptual condition in which the presentation of particular audio-visual stimuli triggers intense, pleasurable tingling sensations in the head and neck regions, which may spread to the periphery of the body. These triggering stimuli are often socially intimate in nature, and usually involve repetition of movements and/or sounds (e.g., hearing whispering, watching someone brush her hair). Reports of ASMR experiences first appeared in online communities in 2010; since this time, these communities have expanded, with some groups consisting of over 100,000 members. However, despite the apparent prevalence of ASMR, there is currently no research on the personality characteristics that co-occur with this condition. In the current study, 290 individuals with ASMR and 290 matched controls completed the Big Five Personality Inventory (BFI; John et al., 1991); participants with ASMR also completed a questionnaire related to their ASMR phenomenology. Individuals with ASMR demonstrated significantly higher scores on Openness-to-Experience and Neuroticism, and significantly lower levels of Conscientiousness, Extraversion, and Agreeableness compared to matched controls. Further, ratings of subjective ASMR intensity in response to 14 common ASMR stimuli were positively correlated with the Openness-to-Experience and Neuroticism dimensions of the BFI. These results provide preliminary evidence that ASMR is associated with specific personality traits and suggest avenues for further investigation.

  1. Cardiac Autonomic and Blood Pressure Responses to an Acute Foam Rolling Session.

    Science.gov (United States)

    Lastova, Kevin; Nordvall, Michael; Walters-Edwards, Michelle; Allnutt, Amy; Wong, Alexei

    2018-03-22

    Foam Rolling (FR) is a self-myofascial release method that has become extremely popular among athletes and fitness enthusiasts for its ability to improve flexibility and range of motion and alleviate delayed onset muscle soreness. However, the cardiac autonomic modulation and blood pressure (BP) responses induced by an acute FR session are currently unknown. The present study evaluated the effects of an acute session of FR exercise on heart rate variability (HRV) and BP responses in healthy individuals. Fifteen (M=8, F=7) healthy subjects completed either a FR or non-exercise control trial in randomized order. HRV and BP measurements were collected at baseline, 10 and 30 min after each trial. There were significant increases (P < 0.01) in markers of vagal tone (nHF) for 30 min after the FR trial, while no changes from baseline were observed following control. There were also significant decreases (P < 0.05) in markers of sympathetic activity (nLF), sympathovagal balance (nLF/nHF), systolic BP and diastolic BP at 10 and 30 min after the trial KB trial while no changes from baseline were observed after the control trial. Our findings indicate that FR decreases sympathovagal balance for 30 min post-intervention which is concurrent with an important hypotensive effect. Further research is warranted to evaluate the potential cardiovascular protective effects of FR in diverse populations.

  2. Cardiac autonomic response following high-intensity running work-to-rest interval manipulation.

    Science.gov (United States)

    Cipryan, Lukas; Laursen, Paul B; Plews, Daniel J

    2016-10-01

    The cardiorespiratory, cardiac autonomic (via heart rate variability (HRV)) and plasma volume responses to varying sequences of high-intensity interval training (HIT) of consistent external work were investigated. Twelve moderately trained males underwent three HIT bouts and one control session. The HIT trials consisted of warm-up, followed by 12 min of 15 s, 30 s or 60 s work:relief HIT sequences at an exercise intensity of 100% of the individual velocity at [Formula: see text]O2max (v[Formula: see text]O2max), interspersed by relief intervals at 60% [Formula: see text]O2max (work/relief ratio = 1). HRV was evaluated via the square root of the mean sum of the squared differences between R-R intervals (rMSSD) before, 1 h, 3 h and 24 h after the exercise. Plasma volume was assessed before, immediately after, and 3 h and 24 h after. There were no substantial between-trial differences in acute cardiorespiratory responses. The rMSSD values remained decreased 1 h after the exercise cessation in all exercise groups. The rMSSD subsequently increased between 1 h and 3 h after exercise, with the most pronounced change in the 15/15 group. There were no relationships between HRV and plasma volume. All HIT protocols resulted in similar cardiorespiratory responses with slightly varying post-exercise HRV responses, with the 30/30 protocol eliciting the least disruption to post-exercise HRV. These post-exercise HRV findings suggest that the 30/30 sequence may be the preferable HIT prescription when the between-training period is limited.

  3. Effect of skin temperature on cutaneous vasodilator response to the β-adrenergic agonist isoproterenol.

    Science.gov (United States)

    Hodges, Gary J; Kellogg, Dean L; Johnson, John M

    2015-04-01

    The vascular response to local skin cooling is dependent in part on a cold-induced translocation of α2C-receptors and an increased α-adrenoreceptor function. To discover whether β-adrenergic function might contribute, we examined whether β-receptor sensitivity to the β-agonist isoproterenol was affected by local skin temperature. In seven healthy volunteers, skin blood flow was measured from the forearm by laser-Doppler flowmetry and blood pressure was measured by finger photoplethysmography. Data were expressed as cutaneous vascular conductance (CVC; laser-Doppler flux/mean arterial blood pressure). Pharmacological agents were administered via intradermal microdialysis. We prepared four skin sites: one site was maintained at a thermoneutral temperature of 34°C (32 ± 10%CVCmax) one site was heated to 39°C (38 ± 11%CVCmax); and two sites were cooled, one to 29°C (22 ± 7%CVCmax) and the other 24°C (16 ± 4%CVCmax). After 20 min at these temperatures to allow stabilization of skin blood flow, isoproterenol was perfused in concentrations of 10, 30, 100, and 300 μM. Each concentration was perfused for 15 min. Relative to the CVC responses to isoproterenol at the thermoneutral skin temperature (34°C) (+21 ± 10%max), low skin temperatures reduced (at 29°C) (+17 ± 6%max) or abolished (at 24°C) (+1 ± 5%max) the vasodilator response, and warm (39°C) skin temperatures enhanced the vasodilator response (+40 ± 9%max) to isoproterenol. These data indicate that β-adrenergic function was influenced by local skin temperature. This finding raises the possibility that a part of the vasoconstrictor response to direct skin cooling could include reduced background β-receptor mediated vasodilation. Copyright © 2015 the American Physiological Society.

  4. p120-catenin mediates inflammatory responses in the skin

    DEFF Research Database (Denmark)

    Perez-Moreno, Mirna; Davis, Michael A; Wong, Ellen

    2006-01-01

    but no overt disruption in barrier function or intercellular adhesion. As the mice age, however, they display epidermal hyperplasia and chronic inflammation, typified by hair degeneration and loss of body fat. Using skin engraftments and anti-inflammatory drugs, we show that these features are not attributable...

  5. An examination of the default mode network in individuals with autonomous sensory meridian response (ASMR).

    Science.gov (United States)

    Smith, Stephen D; Katherine Fredborg, Beverley; Kornelsen, Jennifer

    2017-08-01

    Autonomous Sensory Meridian Response (ASMR) is a perceptual condition in which specific visual and auditory stimuli consistently trigger tingling sensations on the scalp and neck, sometimes spreading to the back and limbs. These triggering stimuli are often social, almost intimate, in nature (e.g., hearing whispering, or watching someone brush her hair), and often elicit a calm and positive emotional state. Surprisingly, despite its prevalence in the general population, no published study has examined the neural underpinnings of ASMR. In the current study, the default mode network (DMN) of 11 individuals with ASMR was contrasted to that of 11 matched controls. The results indicated that the DMN of individuals with ASMR showed significantly less functional connectivity than that of controls. The DMN of individuals with ASMR also demonstrated increased connectivity between regions in the occipital, frontal, and temporal cortices, suggesting that ASMR was associated with a blending of multiple resting-state networks. This atypical functional connectivity likely influences the unique sensory-emotional experiences associated with ASMR.

  6. Cardiorespiratory and cardiac autonomic responses to 30-15 intermittent fitness test in team sport players.

    Science.gov (United States)

    Buchheit, Martin; Al Haddad, Hani; Millet, Grégoire Paul; Lepretre, Pierre Marie; Newton, Michael; Ahmaidi, Said

    2009-01-01

    The 30-15 Intermittent Fitness Test (30-15IFT) is an attractive alternative to classic continuous incremental field tests for defining a reference velocity for interval training prescription in team sport athletes. The aim of the present study was to compare cardiorespiratory and autonomic responses to 30-15IFT with those observed during a standard continuous test (CT). In 20 team sport players (20.9 +/- 2.2 years), cardiopulmonary parameters were measured during exercise and for 10 minutes after both tests. Final running velocity, peak lactate ([La]peak), and rating of perceived exertion (RPE) were also measured. Parasympathetic function was assessed during the postexercise recovery phase via heart rate (HR) recovery time constant (HRR[tau]) and HR variability (HRV) vagal-related indices. At exhaustion, no difference was observed in peak oxygen uptake VO2peak), respiratory exchange ratio, HR, or RPE between 30-15IFT and CT. In contrast, 30-15IFT led to significantly higher minute ventilation, [La]peak, and final velocity than CT (p HRV vagal-related indices (i.e., the root mean square of successive R-R intervals differences [rMSSD]: 4.1 +/- 2.4 and 7.0 +/- 4.9 milliseconds, p < 0.05). In conclusion, the 30-15IFT is accurate for assessing VThs and VO2peak, but it alters postexercise parasympathetic function more than a continuous incremental protocol.

  7. Autonomously responsive pumping by a bacterial flagellar forest: A mean-field approach

    Science.gov (United States)

    Martindale, James D.; Fu, Henry C.

    2017-09-01

    This study is motivated by a microfluidic device that imparts a magnetic torque on an array of bacterial flagella. Bacterial flagella can transform their helical geometry autonomously in response to properties of the background fluid, which provides an intriguing mechanism allowing their use as an engineered element for the regulation or transport of chemicals in microscale applications. The synchronization of flagellar phase has been widely studied in biological contexts, but here we examine the synchronization of flagellar tilt, which is necessary for effective pumping. We first examine the effects of helical geometry and tilt on the pumping flows generated by a single rotating flagellum. Next, we explore a mean-field model for an array of helical flagella to understand how collective tilt arises and influences pumping. The mean-field methodology allows us to take into account possible phase differences through a time-averaging procedure and to model an infinite array of flagella. We find array separation distances, magnetic field strengths, and rotation frequencies that produce nontrivial self-consistent pumping solutions. For individual flagella, pumping is reversed when helicity or rotation is reversed; in contrast, when collective effects are included, self-consistent tilted pumping solutions become untilted nonpumping solutions when helicity or rotation is reversed.

  8. Autonomous Information Fading and Provision to Achieve High Response Time in Distributed Information Systems

    Science.gov (United States)

    Lu, Xiaodong; Arfaoui, Helene; Mori, Kinji

    In highly dynamic electronic commerce environment, the need for adaptability and rapid response time to information service systems has become increasingly important. In order to cope with the continuously changing conditions of service provision and utilization, Faded Information Field (FIF) has been proposed. FIF is a distributed information service system architecture, sustained by push/pull mobile agents to bring high-assurance of services through a recursive demand-oriented provision of the most popular information closer to the users to make a tradeoff between the cost of information service allocation and access. In this paper, based on the analysis of the relationship that exists among the users distribution, information provision and access time, we propose the technology for FIF design to resolve the competing requirements of users and providers to improve users' access time. In addition, to achieve dynamic load balancing with changing users preference, the autonomous information reallocation technology is proposed. We proved the effectiveness of the proposed technology through the simulation and comparison with the conventional system.

  9. Fractionated laser resurfacing corrects the inappropriate UVB response in geriatric skin.

    Science.gov (United States)

    Spandau, Dan F; Lewis, Davina A; Somani, Ally-Khan; Travers, Jeffrey B

    2012-06-01

    Non-melanoma skin cancer is a disease primarily afflicting geriatric patients as evidenced by the fact that 80% of all non-melanoma skin cancers are diagnosed in patients over the age of 60 years. As such, geriatric skin responds to cancer-inducing UVB irradiation in a manner that allows the establishment of tumor cells. Currently, the only effective treatment for non-melanoma skin cancer is the removal of the tumors after they appear, indicating the need for a more cost-effective prophylactic therapy. Geriatric volunteers were treated with fractionated laser resurfacing therapy on either sun-protected (upper buttocks) or chronically sun-exposed (dorsal forearm) skin. Fractionated laser resurfacing therapy was shown to decrease the occurrence of senescent fibroblasts in geriatric dermis, increase the dermal expression of IGF-1, and correct the inappropriate UVB response observed in untreated geriatric skin. These responses to fractionated laser resurfacing were equal to the effects seen previously using the more aggressive wounding following dermabrasion. Furthermore, fractionated laser resurfacing was equally effective in both sun-protected and sun-exposed skin. The ability of fractionated laser resurfacing treatment to protect against the occurrence of UVB-damaged proliferating keratinocytes indicates the potential of fractionated laser resurfacing to reduce or prevent aging-associated non-melanoma skin cancer.

  10. Central nervous system involvement in the autonomic responses to psychological distress

    NARCIS (Netherlands)

    de Morree, H.M.; Szabó, B.M.; Rutten, G.J.; Kop, W.J.

    2013-01-01

    Psychological distress can trigger acute coronary syndromes and sudden cardiac death in vulnerable patients. The primary pathophysiological mechanism that plays a role in stress-induced cardiac events involves the autonomic nervous system, particularly disproportional sympathetic activation and

  11. Attention to eye contact in the West and East: autonomic responses and evaluative ratings.

    Science.gov (United States)

    Akechi, Hironori; Senju, Atsushi; Uibo, Helen; Kikuchi, Yukiko; Hasegawa, Toshikazu; Hietanen, Jari K

    2013-01-01

    Eye contact has a fundamental role in human social interaction. The special appearance of the human eye (i.e., white sclera contrasted with a coloured iris) implies the importance of detecting another person's face through eye contact. Empirical studies have demonstrated that faces making eye contact are detected quickly and processed preferentially (i.e., the eye contact effect). Such sensitivity to eye contact seems to be innate and universal among humans; however, several studies suggest that cultural norms affect eye contact behaviours. For example, Japanese individuals exhibit less eye contact than do individuals from Western European or North American cultures. However, how culture modulates eye contact behaviour is unclear. The present study investigated cultural differences in autonomic correlates of attentional orienting (i.e., heart rate) and looking time. Additionally, we examined evaluative ratings of eye contact with another real person, displaying an emotionally neutral expression, between participants from Western European (Finnish) and East Asian (Japanese) cultures. Our results showed that eye contact elicited stronger heart rate deceleration responses (i.e., attentional orienting), shorter looking times, and higher ratings of subjective feelings of arousal as compared to averted gaze in both cultures. Instead, cultural differences in the eye contact effect were observed in various evaluative responses regarding the stimulus faces (e.g., facial emotion, approachability etc.). The rating results suggest that individuals from an East Asian culture perceive another's face as being angrier, unapproachable, and unpleasant when making eye contact as compared to individuals from a Western European culture. The rating results also revealed that gaze direction (direct vs. averted) could influence perceptions about another person's facial affect and disposition. These results suggest that cultural differences in eye contact behaviour emerge from differential

  12. Attention to eye contact in the West and East: autonomic responses and evaluative ratings.

    Directory of Open Access Journals (Sweden)

    Hironori Akechi

    Full Text Available Eye contact has a fundamental role in human social interaction. The special appearance of the human eye (i.e., white sclera contrasted with a coloured iris implies the importance of detecting another person's face through eye contact. Empirical studies have demonstrated that faces making eye contact are detected quickly and processed preferentially (i.e., the eye contact effect. Such sensitivity to eye contact seems to be innate and universal among humans; however, several studies suggest that cultural norms affect eye contact behaviours. For example, Japanese individuals exhibit less eye contact than do individuals from Western European or North American cultures. However, how culture modulates eye contact behaviour is unclear. The present study investigated cultural differences in autonomic correlates of attentional orienting (i.e., heart rate and looking time. Additionally, we examined evaluative ratings of eye contact with another real person, displaying an emotionally neutral expression, between participants from Western European (Finnish and East Asian (Japanese cultures. Our results showed that eye contact elicited stronger heart rate deceleration responses (i.e., attentional orienting, shorter looking times, and higher ratings of subjective feelings of arousal as compared to averted gaze in both cultures. Instead, cultural differences in the eye contact effect were observed in various evaluative responses regarding the stimulus faces (e.g., facial emotion, approachability etc.. The rating results suggest that individuals from an East Asian culture perceive another's face as being angrier, unapproachable, and unpleasant when making eye contact as compared to individuals from a Western European culture. The rating results also revealed that gaze direction (direct vs. averted could influence perceptions about another person's facial affect and disposition. These results suggest that cultural differences in eye contact behaviour emerge from

  13. The Autonomous Development Strategies of Micro and Small Entrepreneurs Through Coorporate Social Responsibility in Bogor District of West Java

    Directory of Open Access Journals (Sweden)

    Faizal Maad

    2014-05-01

    Full Text Available The objective  of this  reseach were to: (1 analyze the level of autonomous of mikro and small entreprise (SMEs entrepreneurs are empowered through Coorporate Social Responsibility (CSR; (2 analyze the dominant factors that influence autonomous of MSEs entrepreneurs  are empowered through CSR;  and (3 formulate an appropriate  a strategy  in developing autonomy of MSEs entrepreneurs through CSR. The reseach  was conduct  in the village built two companies running CSR in Bogor district involved 212  (SMEs entrepreneurs which determined from population (450 SMEs entrepreneurs by Solvin formula with level of error 5 % and drawn by cluster random sampling. Data collection was conducted from July to November 2013, and consisted  the primary and secondary data. Data analysis was simulated by using structural equation model (SEM . The results showed that the degree  of autonomous MSEs entrepreneurs is low, its core was 36.89 out of 100.00. There are three strategies that must be done to develop of  autonomous MSEs entrepreneurs through  CSR, such as; (a an increase the empowerment sustainable of MSEs entrepereneurs (b improve the quality of  the environment  supporting MSEs and (c an increase in intensity of  empowerment for MSEs entrepreneurs.

  14. Electroencephalographic, Heart Rate, and Galvanic Skin Response Assessment for an Advertising Perception Study: Application to Antismoking Public Service Announcements.

    Science.gov (United States)

    Cartocci, Giulia; Caratù, Myriam; Modica, Enrica; Maglione, Anton Giulio; Rossi, Dario; Cherubino, Patrizia; Babiloni, Fabio

    2017-08-28

    The evaluation of advertising, products, and packaging is traditionally performed through methods based on self-reports and focus groups, but these approaches often appear poorly accurate in scientific terms. Neuroscience is increasingly applied to the investigation of the neurophysiological bases of the perception of and reaction to commercial stimuli to support traditional marketing methods. In this context, a particular sector or marketing is represented by public service announcements (PSAs). The objective of this protocol is to apply electroencephalography (EEG) and autonomic signal analysis to study responses to selected antismoking PSAs. Two EEG indices were employed: the frontal alpha band EEG asymmetry (the Approach Withdrawal (AW) index) and the frontal theta (effort index). Furthermore, the autonomic Emotional Index (EI) was calculated, as derived from the Galvanic Skin Response (GSR) and Heart Rate (HR) signals. The present protocol describes a series of operational and computational steps required to properly estimate, through the aforementioned indices, the emotional and cerebral reaction of a group of subjects towards a selected number of antismoking PSAs. In particular, a campaign characterized by a symbolic communication style (classified as "awarded" on the basis of the prizes received by specialized committees) obtained the highest approach values, as estimated by the AW index. A spot and an image belonging to the same PSA campaign based on the "fear arousing appeal" and with a narrative/experiential communication style (classified as "effective" on the basis of the economical/health-related improvements promoted) reported the lowest and highest effort values, respectively. This is probably due to the complexity of the storytelling (spot) and to the immediateness of the image (a lady who underwent a tracheotomy). Finally, the same "effective" campaign showed the highest EI values, possibly because of the empathy induced by the testimonial and the

  15. Problem gamblers are hyposensitive to wins: an analysis of skin conductance responses during actual gambling on electronic gaming machines.

    Science.gov (United States)

    Lole, Lisa; Gonsalvez, Craig J; Barry, Robert J; Blaszczynski, Alex

    2014-06-01

    Physiological arousal is purportedly a key determinant in the development and maintenance of gambling behaviors, with problem gambling conceptualized in terms of abnormal autonomic responses. Theoretical conceptualizations of problem gambling are discordant regarding the nature of deficit in this disorder; some accounts posit that problem gamblers are hypersensitive to reward, and others that they are hyposensitive to reward and/or punishment. Previous research examining phasic electrodermal responses in gamblers has been limited to laboratory settings, and reactions to real gaming situations need to be examined. Skin conductance responses (SCRs) to losses, wins, and losses disguised as wins (LDWs) were recorded from 15 problem gamblers (PGs) and 15 nonproblem gamblers (NPGs) while they wagered their own money during electronic gaming machine play. PGs demonstrated significantly reduced SCRs to reward. SCRs to losses and LDWs did not differ for either PGs or NPGs. This hyposensitivity to wins may reflect abnormalities in incentive processing, and may represent a potential biological marker for problem gambling. Copyright © 2014 Society for Psychophysiological Research.

  16. Affective and Autonomic Responses to Erotic Images: Evidence of Disgust-Based Mechanisms in Female Sexual Interest/Arousal Disorder.

    Science.gov (United States)

    DePesa, Natasha S; Cassisi, Jeffrey E

    2017-09-01

    Disgust has recently been implicated in the development and maintenance of female sexual dysfunction, yet most empirical studies have been conducted with a sexually healthy sample. The current study contributes to the literature by expanding the application of a disgust model of sexual functioning to a clinically relevant sample of women with low sexual desire/arousal and accompanying sexual distress. Young women (mean age = 19.12 years) with psychometrically defined sexual dysfunction (i.e., female sexual interest/arousal disorder [FSIAD] group) and a healthy control group were compared in their affective (i.e., facial electromyography [EMG] and self-report) and autonomic (i.e., heart rate and electrodermal activity) responses to disgusting, erotic, positive, and neutral images. Significant differences were predicted in responses to erotic images only. Specifically, it was hypothesized that the FSIAD group would display affective and autonomic responses consistent with a disgust response, while responses from the control group would align with a general appetitive response. Results largely supported study hypotheses. The FSIAD group displayed significantly greater negative facial affect, reported more subjective disgust, and recorded greater heart rate deceleration than the control group in response to erotic stimuli. Greater subjective disgust response corresponded with more sexual avoidance behavior. Planned follow-up analyses explored correlates of subjective disgust responses.

  17. Skin response to cobalt 60 irradiation and the consequences for matching the color of facial prostheses

    International Nuclear Information System (INIS)

    van Oort, R.P.; Vermey, J.; Ten Bosch, J.J.

    1984-01-01

    A radiotherapy treatment ( 60 Co) of cancer in the head and neck region causes side effects in the skin that postpone the facial prosthetic treatment. The increasing and fading erythema and pigmentation of the skin was investigated with the use of a subtractive colorimeter. This method was verified with photographs scored according to the Oxford scoring system. Fourteen patients were investigated during a period of 24 weeks. The mean colorimetric skin response showed a peak 6 weeks after the onset of irradiation. Six to 7 weeks later, there was no significant difference between the skin color before and after irradiation. At this time the dry desquamation of the skin is healed. From this viewpoint, the color matching procedure for a facial prosthesis may start not earlier than 15 weeks from the onset of irradiation. If a nonirradiated control field in the facial region is present, a color match for the facial prosthesis can be started just after the irradiation period

  18. Global brain blood-oxygen level responses to autonomic challenges in obstructive sleep apnea.

    Directory of Open Access Journals (Sweden)

    Paul M Macey

    Full Text Available Obstructive sleep apnea (OSA is accompanied by brain injury, perhaps resulting from apnea-related hypoxia or periods of impaired cerebral perfusion. Perfusion changes can be determined indirectly by evaluation of cerebral blood volume and oxygenation alterations, which can be measured rapidly and non-invasively with the global blood oxygen level dependent (BOLD signal, a magnetic resonance imaging procedure. We assessed acute BOLD responses in OSA subjects to pressor challenges that elicit cerebral blood flow changes, using a two-group comparative design with healthy subjects as a reference. We separately assessed female and male patterns, since OSA characteristics and brain injury differ between sexes. We studied 94 subjects, 37 with newly-diagnosed, untreated OSA (6 female (age mean ± std: 52.1±8.1 yrs; apnea/hypopnea index [AHI]: 27.7±15.6 events/hr and 31 male 54.3±8.4 yrs; AHI: 37.4±19.6 events/hr, and 20 female (age 50.5±8.1 yrs and 37 male (age 45.6±9.2 yrs healthy control subjects. We measured brain BOLD responses every 2 s while subjects underwent cold pressor, hand grip, and Valsalva maneuver challenges. The global BOLD signal rapidly changed after the first 2 s of each challenge, and differed in magnitude between groups to two challenges (cold pressor, hand grip, but not to the Valsalva maneuver (repeated measures ANOVA, p<0.05. OSA females showed greater differences from males in response magnitude and pattern, relative to healthy counterparts. Cold pressor BOLD signal increases (mean ± adjusted standard error at the 8 s peak were: OSA 0.14±0.08% vs. Control 0.31±0.06%, and hand grip at 6 s were: OSA 0.08±0.03% vs. Control at 0.30±0.02%. These findings, indicative of reduced cerebral blood flow changes to autonomic challenges in OSA, complement earlier reports of altered resting blood flow and reduced cerebral artery responsiveness. Females are more affected than males, an outcome which may contribute to the sex

  19. The effect of surface wave propagation on neural responses to vibration in primate glabrous skin.

    Directory of Open Access Journals (Sweden)

    Louise R Manfredi

    Full Text Available Because tactile perception relies on the response of large populations of receptors distributed across the skin, we seek to characterize how a mechanical deformation of the skin at one location affects the skin at another. To this end, we introduce a novel non-contact method to characterize the surface waves produced in the skin under a variety of stimulation conditions. Specifically, we deliver vibrations to the fingertip using a vibratory actuator and measure, using a laser Doppler vibrometer, the surface waves at different distances from the locus of stimulation. First, we show that a vibration applied to the fingertip travels at least the length of the finger and that the rate at which it decays is dependent on stimulus frequency. Furthermore, the resonant frequency of the skin matches the frequency at which a subpopulation of afferents, namely Pacinian afferents, is most sensitive. We show that this skin resonance can lead to a two-fold increase in the strength of the response of a simulated afferent population. Second, the rate at which vibrations propagate across the skin is dependent on the stimulus frequency and plateaus at 7 m/s. The resulting delay in neural activation across locations does not substantially blur the temporal patterning in simulated populations of afferents for frequencies less than 200 Hz, which has important implications about how vibratory frequency is encoded in the responses of somatosensory neurons. Third, we show that, despite the dependence of decay rate and propagation speed on frequency, the waveform of a complex vibration is well preserved as it travels across the skin. Our results suggest, then, that the propagation of surface waves promotes the encoding of spectrally complex vibrations as the entire neural population is exposed to essentially the same stimulus. We also discuss the implications of our results for biomechanical models of the skin.

  20. [Response of pancreatic polypeptide to a protein rich meal in insulin non dependent diabetes melitus and autonomic neuropathy].

    Science.gov (United States)

    Kostić, N; Zamaklar, M; Novaković, R; Stajić, S

    1994-01-01

    Parasympathetic function and plasma hPP response to a protein rich meal were evaluated in 105 insulin non-dependent diabetic patients: 20 with autonomic neuropathy (group A), diagnosed by Clonidin test; 35 patients with neurophysiological evidence of polyneuropath (group B); 30 patients with autonomic neuropathy and polineuropathy (group C), and 20 patients without any sign of neuropathy (group D). Plasma hPP levels were determined by RIA using an anti-hPP antiserum, kindly provided by Prof. S. R. Bloom (Hammersmith Hospital, London). Blood was taken at 0. 45 and 60 minutes after the beginning of the meal. In groups A and C, the meal induced hPP increase was significantly lower than in group D (p 0.001). All group B patients had a marked increase in the peptide, similar to that in diabetics without neuropathy. These result ssuggest that diabetic autonomic neuropathy is associated with dysfunction of hPP secretion, and that the evaluation of hPP response to test meal may be a sensitive and simple method for the assessment of paraympathetic impairment in diabetes.

  1. Autonomic Neuropathy

    Science.gov (United States)

    ... risk of autonomic neuropathy. Other diseases. Amyloidosis, porphyria, hypothyroidism and cancer (usually due to side effects from treatment) may also increase the risk of autonomic neuropathy. ...

  2. Effect of adjuvants on responses to skin immunization by microneedles coated with influenza subunit vaccine.

    Directory of Open Access Journals (Sweden)

    William C Weldon

    Full Text Available Recent studies have demonstrated the effectiveness of vaccine delivery to the skin by vaccine-coated microneedles; however there is little information on the effects of adjuvants using this approach for vaccination. Here we investigate the use of TLR ligands as adjuvants with skin-based delivery of influenza subunit vaccine. BALB/c mice received 1 µg of monovalent H1N1 subunit vaccine alone or with 1 µg of imiquimod or poly(I:C individually or in combination via coated microneedle patches inserted into the skin. Poly(I:C adjuvanted subunit influenza vaccine induced similar antigen-specific immune responses compared to vaccine alone when delivered to the skin by microneedles. However, imiquimod-adjuvanted vaccine elicited higher levels of serum IgG2a antibodies and increased hemagglutination inhibition titers compared to vaccine alone, suggesting enhanced induction of functional antibodies. In addition, imiquimod-adjuvanted vaccine induced a robust IFN-γ cellular response. These responses correlated with improved protection compared to influenza subunit vaccine alone, as well as reduced viral replication and production of pro-inflammatory cytokines in the lungs. The finding that microneedle delivery of imiquimod with influenza subunit vaccine induces improved immune responses compared to vaccine alone supports the use of TLR7 ligands as adjuvants for skin-based influenza vaccines.

  3. Impact of Diabetes Type 1 in Children on Autonomic Modulation at Rest and in Response to the Active Orthostatic Test.

    Science.gov (United States)

    Giacon, Thais Roque; Vanderlei, Franciele Marques; Christofaro, Diego Giulliano Destro; Vanderlei, Luiz Carlos Marques

    2016-01-01

    Cardiovascular autonomic neuropathy is one of the most common complications of diabetes mellitus type 1 (DM1), of which one of the first subclinical manifestations is changes in heart rate variability (HRV). Thus, analysis of HRV associated with the autonomic active orthostatic test is important in this population. To analyze the autonomic modulation responses induced by the implementation of the active orthostatic test, in children with DM1, and study the autonomic modulation by means of HRV indices. Data of 35 children were analyzed, of both sexes, aged between 7 and 15 years, who were divided into two groups: Diabetic (n = 16) and Control (n = 19). The following variables were collected initially: weight, height, body fat percentage, heart rate, blood pressure and casual blood glucose. Subsequently, for analysis of autonomic modulation, the beat-to-beat heart rate was captured by a heart rate monitor in the supine position for 30 minutes and after 10 minutes standing during performance of the active orthostatic test. HRV indices were calculated in the time and frequency domains. For data analysis, covariance analysis was used to compare groups and ANOVA for repeated measures to compare the effects of the active orthostatic test. These data were adjusted for age, sex, ethnicity, body fat percentage and casual blood glucose, with a 5% significance level. The results suggested that diabetic children at rest present a decrease in SDNN (50.4 vs. 75.2), rMSSD (38.7 vs 57.6) and LF [ms2] (693.6 vs 1874.6). During the active orthostatic test the children in both groups demonstrated a reduction in SDNN, RMSSD and LF [ms2] compared to the resting position, and this response was less pronounced in the diabetic group. We conclude that regardless of age, sex, ethnicity, body fat percentage and casual blood glucose, performing the active orthostatic test promoted increased sympathetic modulation and reduced parasympathetic modulation in both groups, and this response was less

  4. Impact of Diabetes Type 1 in Children on Autonomic Modulation at Rest and in Response to the Active Orthostatic Test.

    Directory of Open Access Journals (Sweden)

    Thais Roque Giacon

    Full Text Available Cardiovascular autonomic neuropathy is one of the most common complications of diabetes mellitus type 1 (DM1, of which one of the first subclinical manifestations is changes in heart rate variability (HRV. Thus, analysis of HRV associated with the autonomic active orthostatic test is important in this population.To analyze the autonomic modulation responses induced by the implementation of the active orthostatic test, in children with DM1, and study the autonomic modulation by means of HRV indices.Data of 35 children were analyzed, of both sexes, aged between 7 and 15 years, who were divided into two groups: Diabetic (n = 16 and Control (n = 19. The following variables were collected initially: weight, height, body fat percentage, heart rate, blood pressure and casual blood glucose. Subsequently, for analysis of autonomic modulation, the beat-to-beat heart rate was captured by a heart rate monitor in the supine position for 30 minutes and after 10 minutes standing during performance of the active orthostatic test. HRV indices were calculated in the time and frequency domains. For data analysis, covariance analysis was used to compare groups and ANOVA for repeated measures to compare the effects of the active orthostatic test. These data were adjusted for age, sex, ethnicity, body fat percentage and casual blood glucose, with a 5% significance level.The results suggested that diabetic children at rest present a decrease in SDNN (50.4 vs. 75.2, rMSSD (38.7 vs 57.6 and LF [ms2] (693.6 vs 1874.6. During the active orthostatic test the children in both groups demonstrated a reduction in SDNN, RMSSD and LF [ms2] compared to the resting position, and this response was less pronounced in the diabetic group.We conclude that regardless of age, sex, ethnicity, body fat percentage and casual blood glucose, performing the active orthostatic test promoted increased sympathetic modulation and reduced parasympathetic modulation in both groups, and this response

  5. The relation between constitutional skin color and photosensitivity estimated from UV-induced erythema and pigmentation dose-response curves

    NARCIS (Netherlands)

    Westerhof, W.; Estevez-Uscanga, O.; Meens, J.; Kammeyer, A.; Durocq, M.; Cario, I.

    1990-01-01

    In 54 healthy volunteers we assessed predictors of sensitivity to ultraviolet (UV) light, including Fitzpatrick's sun reactive skin types and constitutional skin color, and compared these with one another and with responses of the skin to UV irradiation, as determined experimentally by a minimal

  6. Exposure to 4100K fluorescent light elicits sex specific transcriptional responses in Xiphophorus maculatus skin.

    Science.gov (United States)

    Boswell, William T; Boswell, Mikki; Walter, Dylan J; Navarro, Kaela L; Chang, Jordan; Lu, Yuan; Savage, Markita G; Shen, Jianjun; Walter, Ronald B

    2018-06-01

    It has been reported that exposure to artificial light may affect oxygen intake, heart rate, absorption of vitamins and minerals, and behavioral responses in humans. We have reported specific gene expression responses in the skin of Xiphophorus fish after exposure to ultraviolet light (UV), as well as, both broad spectrum and narrow waveband visible light. In regard to fluorescent light (FL), we have shown that male X. maculatus exposed to 4100K FL (i.e. "cool white") rapidly suppress transcription of many genes involved with DNA replication and repair, chromosomal segregation, and cell cycle progression in skin. We have also detailed sex specific transcriptional responses of Xiphophorus skin after exposure to UVB. However, investigation of gender differences in global gene expression response after exposure to 4100K FL has not been reported, despite common use of this FL source for residential, commercial, and animal facility illumination. Here, we compare RNA-Seq results analyzed to assess changes in the global transcription profiles of female and male X. maculatus skin in response to 4100K FL exposure. Our results suggest 4100K FL exposure incites a sex-biased genetic response including up-modulation of inflammation in females and down modulation of DNA repair/replication in males. In addition, we identify clusters of genes that become oppositely modulated in males and females after FL exposure that are principally involved in cell death and cell proliferation. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Modulation of the androgenetic response in diverse skin cell types: the pilosebaceous unit

    International Nuclear Information System (INIS)

    Zurvarra, F.; Kerner, N.; Hagelin, K.

    2009-01-01

    Androgens play a central role in diverse morphogenetic processes of the skin. Hair growth and follicular cycle are regulated in part by androgens. Androgens also play a key function, together with other receptors such as the PPARs receptors family, on the proliferation and differentiation of the sebaceous gland that forms part of the pilosebaceous unit and influences hair growth and skin well-being. UV radiation may affect androgens regulation of skin homeostasis. Objectives: to study the modulation of androgenetic response related to UV radiation on the pilosebaceous unit, in two skin conditions: androgenetic alopecia and acne, both affecting skin and constituting major concerns for affected individuals. Methods: primary cultures of cells and established cell lines from the pilosebaceous unit: dermal papillae cells, keratinocytes and sebocytes. Analysis of lipid content, inflammatory response and proliferation of cells under the influence of androgens, PPARs ligands and UVR. Results: sebocytes primary cultures were obtained from human sebaceous glands. Proliferation and differentiation, as well as the expression of proinflammatory molecules (IL-1, TNF alpha, iNOs) and lipogenic enzymes (FASN) under androgens and UV treatment were assessed. The response to androgens under UV exposure was also analyzed in dermal papillae cells in culture. (authors)

  8. Effects of niacin restriction on sirtuin and PARP responses to photodamage in human skin.

    Directory of Open Access Journals (Sweden)

    Claudia A Benavente

    Full Text Available Sirtuins (SIRTs and poly(ADP-ribose polymerases (PARPs, NAD(+-dependent enzymes, link cellular energy status with responses to environmental stresses. Skin is frequently exposed to the DNA damaging effects of UV irradiation, a known etiology in skin cancer. Thus, understanding the defense mechanisms in response to UV, including the role of SIRTs and PARPs, may be important in developing skin cancer prevention strategies. Here, we report expression of the seven SIRT family members in human skin. SIRTs gene expressions are progressively upregulated in A431 epidermoid carcinoma cells (SIRTs1 and 3, actinic keratoses (SIRTs 2, 3, 5, 6, and 7 and squamous cell carcinoma (SIRTs 1-7. Photodamage induces dynamic changes in SIRT expression with upregulation of both SIRT1 and SIRT4 mRNAs. Specific losses of SIRT proteins occur early after photodamage followed by accumulation later, especially for SIRT4. Niacin restriction, which decreases NAD(+, the sirtuin substrate, results in an increase in acetylated proteins, upregulation of SIRTs 2 and 4, increased inherent DNA damage, alterations in SIRT responses to photodamage, abrogation of PARP activation following photodamage, and increased sensitivity to photodamage that is completely reversed by repleting niacin. These data support the hypothesis that SIRTs and PARPs play important roles in resistance to photodamage and identify specific SIRTs that respond to photodamage and may be targets for skin cancer prevention.

  9. Direct skin-to-skin vs. indirect touch modulates neural responses to stroking vs. tapping

    Science.gov (United States)

    Kress, Inge U; Minati, Ludovico; Ferraro, Stefania; Critchley, Hugo D

    2011-01-01

    It remains unclear whether direct inter-personal contact is processed differently from similar soft touch applied through inanimate objects. We performed a functional MRI (fMRI) experiment in healthy volunteers, whereby activity during gentle stroking or tapping was compared between stimuli delivered using the experimenter’s hand or a velvet stick. Stroking with a hand elicited larger responses than the other three conditions in the contralateral primary and secondary somatosensory areas and posterior insula. The observed effects likely originate from a combination of perceptual differences and cognitive and emotional correlates of contact with another person. This empirical observation indicates that to ensure ecological validity studies of affective touch processing should be performed with stimuli delivered with direct inter-personal contact rather than inanimate objects. PMID:21817928

  10. When Age Matters: Differences in Facial Mimicry and Autonomic Responses to Peers' Emotions in Teenagers and Adults

    Science.gov (United States)

    Ardizzi, Martina; Sestito, Mariateresa; Martini, Francesca; Umiltà, Maria Alessandra; Ravera, Roberto; Gallese, Vittorio

    2014-01-01

    Age-group membership effects on explicit emotional facial expressions recognition have been widely demonstrated. In this study we investigated whether Age-group membership could also affect implicit physiological responses, as facial mimicry and autonomic regulation, to observation of emotional facial expressions. To this aim, facial Electromyography (EMG) and Respiratory Sinus Arrhythmia (RSA) were recorded from teenager and adult participants during the observation of facial expressions performed by teenager and adult models. Results highlighted that teenagers exhibited greater facial EMG responses to peers' facial expressions, whereas adults showed higher RSA-responses to adult facial expressions. The different physiological modalities through which young and adults respond to peers' emotional expressions are likely to reflect two different ways to engage in social interactions with coetaneous. Findings confirmed that age is an important and powerful social feature that modulates interpersonal interactions by influencing low-level physiological responses. PMID:25337916

  11. Ethnic differences in objective and subjective skin irritation response: an international study.

    Science.gov (United States)

    Lee, E; Kim, S; Lee, J; Cho, S-A; Shin, K

    2014-08-01

    Due to global marketing in the cosmetics industry, it is important to assess ethnic population susceptibility when evaluating the safety of cosmetic products or chemicals. To investigate ethnic variations in skin irritation response to positive irritants. Clinical testing was performed in four countries on two ethnic groups - Asian and Caucasian. We performed patch tests on the subjects' back with 0.5% aqueous sodium lauryl sulfate (SLS) and 0.15% retinol prepared in 1,3-butylene glycol. Stinging tests were performed using 5% aqueous lactic acid and 0.001% (w/v) capsaicin prepared in 10% ethanol solution separately. The incidence of self-perceived skin sensitivity was similar in the two ethnic groups. However, the incidence of adverse skin reaction to cosmetics appeared significantly higher in Asian (33.0%) than in Caucasian subjects (11.3%). For standard positive irritants such as 0.5% aqueous SLS solution, Asian subjects showed significantly higher scores than Caucasian subjects. The incidence of positive reaction to the 0.15% retinol patch test tended to be higher in Asian than in Caucasian subjects. Our data also showed that neurosensitivity to 5% lactic acid and 0.001% capsaicin was higher in Asian than in Caucasian subjects. Although self-reported skin sensitivity does not appear to differ according to ethnicity, there are ethnic differences in objective and subjective skin irritation responses to several standard positive materials. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  12. Thermal Response of In Vivo Human Skin to Fractional Radiofrequency Microneedle Device

    Directory of Open Access Journals (Sweden)

    Woraphong Manuskiatti

    2016-01-01

    Full Text Available Background. Fractional radiofrequency microneedle system (FRMS is a novel fractional skin resurfacing system. Data on thermal response to this fractional resurfacing technique is limited. Objectives. To investigate histologic response of in vivo human skin to varying energy settings and pulse stacking of a FRMS in dark-skinned subjects. Methods. Two female volunteers who were scheduled for abdominoplasty received treatment with a FRMS with varying energy settings at 6 time periods including 3 months, 1 month, 1 week, 3 days, 1 day, and the time immediately before abdominoplasty. Biopsy specimens were analyzed using hematoxylin and eosin (H&E, Verhoeff-Van Gieson (VVG, colloidal iron, and Fontana-Masson stain. Immunohistochemical study was performed by using Heat Shock Protein 70 (HSP70 antibody and collagen III monoclonal antibody. Results. The average depth of radiofrequency thermal zone (RFTZ ranged from 100 to 300 μm, correlating with energy levels. Columns of cell necrosis and collagen denaturation followed by inflammatory response were initially demonstrated, with subsequent increasing of mucin at 1 and 3 months after treatment. Immunohistochemical study showed positive stain with HSP70. Conclusion. A single treatment with a FRMS using appropriate energy setting induces neocollagenesis. This wound healing response may serve as a mean to improve the appearance of photodamaged skin and atrophic scars.

  13. Media Research with a Galvanic Skin Response Biosensor: Some Kids Work Up a Sweat!

    Science.gov (United States)

    Clariana, Roy B.

    This study considers the galvanic skin response (GSR) of sixth-grade students (n=20) using print, video, and microcomputer segments. Subjects received all three media treatments, in randomized order. Data for analysis consisted of standardized test scores and GSR measures; a moderate positive relationship was shown between cumulative GSR and…

  14. Expectancy, False Galvanic Skin Response Feedback, and Systematic Desensitization in the Modification of Phobic Behavior

    Science.gov (United States)

    Lick, John

    1975-01-01

    This study compared systematic desensitization and two pseudotherapy manipulations with and without false galvanic skin response feedback after every session suggesting improvement in the modification of intense snake and spider fear. The results indicated no consistent differences between the three treatment groups. (Author)

  15. A synthetic peptide blocking TRPV1 activation inhibits UV-induced skin responses.

    Science.gov (United States)

    Kang, So Min; Han, Sangbum; Oh, Jang-Hee; Lee, Young Mee; Park, Chi-Hyun; Shin, Chang-Yup; Lee, Dong Hun; Chung, Jin Ho

    2017-10-01

    Transient receptor potential type 1 (TRPV1) can be activated by ultraviolet (UV) irradiation, and mediates UV-induced matrix metalloproteinase (MMP)-1 and proinflammatory cytokines in keratinocytes. Various chemicals and compounds targeting TRPV1 activation have been developed, but are not in clinical use mostly due to their safety issues. We aimed to develop a novel TRPV1-targeting peptide to inhibit UV-induced responses in human skin. We designed and generated a novel TRPV1 inhibitory peptide (TIP) which mimics the specific site in TRPV1 (aa 701-709: Gln-Arg-Ala-Ile-Thr-Ile-Leu-Asp-Thr, QRAITILDT), Thr 705 , and tested its efficacy of blocking UV-induced responses in HaCaT, mouse, and human skin. TIP effectively inhibited capsaicin-induced calcium influx and TRPV1 activation. Treatment of HaCaT with TIP prevented UV-induced increases of MMP-1 and pro-inflammatory cytokines such as interleukin (IL)-6 and tumor necrosis factor-α. In mouse skin in vivo, TIP inhibited UV-induced skin thickening and prevented UV-induced expression of MMP-13 and MMP-9. Moreover, TIP attenuated UV-induced erythema and the expression of MMP-1, MMP-2, IL-6, and IL-8 in human skin in vivo. The novel synthetic peptide targeting TRPV1 can ameliorate UV-induced skin responses in vitro and in vivo, providing a promising therapeutic approach against UV-induced inflammation and photoaging. Copyright © 2017 Japanese Society for Investigative Dermatology. Published by Elsevier B.V. All rights reserved.

  16. Measurement of erythema and tanning responses in human skin using a tri-stimulus colorimeter.

    Science.gov (United States)

    Seitz, J C; Whitmore, C G

    1988-01-01

    A 'Minolta Tri-Stimulus Colorimeter II' was evaluated for obtaining objective measurements of early changes in erythema and tanning. The meter showed a subtle, continuous transition between the primary erythematous response and the delayed tanning of skin which was below the visual threshold for detection. Thereafter, the a* (redness) value of the meter showed a significant linear correlation with the dermatologist's perception of erythema while the b* (yellow) value showed a significant correlation with the perception of tanning. This capability of the tri-stimulus colorimeter to simultaneously evaluate the hue and saturation of skin color affords an improved opportunity to quantitate the transition from erythema to tanning without subjective bias.

  17. Mood and autonomic responses to repeated exposure to the Trier Social Stress Test for Groups (TSST-G).

    Science.gov (United States)

    Boesch, Maria; Sefidan, Sandra; Ehlert, Ulrike; Annen, Hubert; Wyss, Thomas; Steptoe, Andrew; La Marca, Roberto

    2014-05-01

    A group version of the Trier Social Stress Test (TSST-G) was introduced as a standardized, economic and efficient tool to induce a psychobiological stress response simultaneously in a group of subjects. The aim of the present study was to examine the efficacy of the TSST-G to repeatedly induce an affective and autonomic stress response while comparing two alternative protocols for the second examination. Healthy young male recruits participated twice in the TSST-G 10 weeks apart. In the first examination, the TSST-G consisted of a combination of mental arithmetic and a fake job interview (TSST-G-1st; n=294). For the second examination, mental arithmetic was combined with either (a) a defensive speech in response to a false shoplifting accusation (TSST-G-2nd-defence; n=105), or (b) a speech on a more neutral topic selected by the investigators (TSST-G-2nd-presentation; n=100). Affect ratings and salivary alpha-amylase (sAA) were determined immediately before and after the stress test, while heart rate (HR) and heart rate variability (HRV) were measured continuously. TSST-G-1st resulted in a significant increase of negative affect, HR, and sAA, and a significant decrease in positive affect and HRV. TSST-G-2nd, overall, resulted in a significant increase of HR and sAA (the latter only in response to TSST-G-2nd-defence) and a decrease in HRV, while no significant affect alterations were found. When comparing both, TSST-G-2nd-defence and -2nd-presentation, the former resulted in a stronger stress response with regard to HR and HRV. The findings reveal that the TSST-G is a useful protocol to repeatedly evoke an affective and autonomic stress response, while repetition leads to affective but not necessarily autonomic habituation. When interested in examining repeated psychosocial stress reactivity, a task that requires an ego-involving effort, such as a defensive speech, seems to be significantly superior to a task using an impersonal speech. Copyright © 2014 Elsevier

  18. Effects of psychological stress test on the cardiac response of public safety workers: alternative parameters to autonomic balance

    Science.gov (United States)

    Huerta-Franco, M. R.; Vargas-Luna, F. M.; Delgadillo-Holtfort, I.

    2015-01-01

    It is well known that public safety workers (PSW) face many stressful situations that yield them as high-risk population for suffering chronic stress diseases. In this multidisciplinary research the cardiac response to induced psychological stress by a short duration Stroop test was evaluated in 20 female and 19 male PSW, in order to compare traditionally used cardiac response parameters with alternative ones. Electrocardiograms have been recorded using the Eindhoven electrodes configuration for 1 min before, 3 min during and 1 min after the test. Signals analysis has been performed for the heart rate and the power spectra of its variability and of the variability of the amplitude of the R-wave, i.e. the highest peak of the electrocardiographic signal periodic sequence. The results demonstrated that the traditional autonomic balance index shows no significant differences between stages. In contrast, the median of the area of the power spectrum of the R-wave amplitude variability in the frequency region dominated by the autonomous nervous system (0.04-to-0.4 Hz) is the more sensitive parameter. Moreover, this parameter allows to identify gender differences consistent with those encountered in other studies.

  19. Effects of psychological stress test on the cardiac response of public safety workers: alternative parameters to autonomic balance

    International Nuclear Information System (INIS)

    Huerta-Franco, M R; Vargas-Luna, F M; Delgadillo-Holtfort, I

    2015-01-01

    It is well known that public safety workers (PSW) face many stressful situations that yield them as high-risk population for suffering chronic stress diseases. In this multidisciplinary research the cardiac response to induced psychological stress by a short duration Stroop test was evaluated in 20 female and 19 male PSW, in order to compare traditionally used cardiac response parameters with alternative ones. Electrocardiograms have been recorded using the Eindhoven electrodes configuration for 1 min before, 3 min during and 1 min after the test. Signals analysis has been performed for the heart rate and the power spectra of its variability and of the variability of the amplitude of the R-wave, i.e. the highest peak of the electrocardiographic signal periodic sequence. The results demonstrated that the traditional autonomic balance index shows no significant differences between stages. In contrast, the median of the area of the power spectrum of the R-wave amplitude variability in the frequency region dominated by the autonomous nervous system (0.04-to-0.4 Hz) is the more sensitive parameter. Moreover, this parameter allows to identify gender differences consistent with those encountered in other studies

  20. Influence of hydration and experimental length scale on themechanical response of human skin in vivo, using optical coherence tomography

    NARCIS (Netherlands)

    Hendriks, F.M.; Brokken, D.; Oomens, C.W.J.; Baaijens, F.P.T.

    2004-01-01

    Human skin is a complex tissue consisting of different layers. To gain better insight into the mechanical behaviour of different skin layers, the mechanical response was studied with experiments of various length scales. Also, the influence of (superficial) hydration on the mechanical response is

  1. Altered Behavioral and Autonomic Pain Responses in Alzheimer’s Disease Are Associated with Dysfunctional Affective, Self-Reflective and Salience Network Resting-State Connectivity

    Directory of Open Access Journals (Sweden)

    Paul A. Beach

    2017-09-01

    Full Text Available While pain behaviors are increased in Alzheimer’s disease (AD patients compared to healthy seniors (HS across multiple disease stages, autonomic responses are reduced with advancing AD. To better understand the neural mechanisms underlying these phenomena, we undertook a controlled cross-sectional study examining behavioral (Pain Assessment in Advanced Dementia, PAINAD scores and autonomic (heart rate, HR pain responses in 24 HS and 20 AD subjects using acute pressure stimuli. Resting-state fMRI was utilized to investigate how group connectivity differences were related to altered pain responses. Pain behaviors (slope of PAINAD score change and mean PAINAD score were increased in patients vs. controls. Autonomic measures (HR change intercept and mean HR change were reduced in severe vs. mildly affected AD patients. Group functional connectivity differences associated with greater pain behavior reactivity in patients included: connectivity within a temporal limbic network (TLN and between the TLN and ventromedial prefrontal cortex (vmPFC; between default mode network (DMN subcomponents; between the DMN and ventral salience network (vSN. Reduced HR responses within the AD group were associated with connectivity changes within the DMN and vSN—specifically the precuneus and vmPFC. Discriminant classification indicated HR-related connectivity within the vSN to the vmPFC best distinguished AD severity. Thus, altered behavioral and autonomic pain responses in AD reflects dysfunction of networks and structures subserving affective, self-reflective, salience and autonomic regulation.

  2. Caffeine ameliorates radiation-induced skin reactions in mice but does not influence tumour radiation response

    Energy Technology Data Exchange (ETDEWEB)

    Hebbar, S.A.; Mitra, A.K.; George, K.C.; Verma, N.C. [Radiation Biology Division, Bhabha Atomic Research Centre, Trombay, Mumbai (India)]. E-mail: ncverma@apsara.barc.ernet.in

    2002-03-01

    Intramuscular administration of caffeine at a dose of 80 mg kg{sup -1} body weight to the gastrocnemius muscles of Swiss mice 5 min prior to local irradiation (35 Gy) of the leg delayed the progression of radiation-induced skin reactions in such animals. While 90% epilation with reddening of the skin was noted in animals treated with radiation alone, animals pretreated with caffeine suffered only partial hair loss with slight reddening of the skin on the 16th and 20th days post-irradiation. Beyond the 28th day, damage scores in irradiated feet for both the groups were similar (score 3) and remained unchanged until the 32nd day and then decreased and disappeared completely in both treatment groups by the 40th day after irradiation. In addition, the effect of caffeine on the radiation response of a mouse fibrosarcoma was investigated. Results showed that intratumoral administration of caffeine at a dose of 80 mg kg{sup -1} body weight 5 min prior to local exposure of tumours to 10 Gy of {sup 60}Co {gamma}-rays did not influence the response of tumours to radiation. The present study thus showed that although caffeine ameliorated radiation-induced skin reactions in the mouse leg, it did not affect the tumour radiation response, indicating its potential application in cancer radiotherapy. (author)

  3. Enhanced immune responses by skin vaccination with influenza subunit vaccine in young hosts.

    Science.gov (United States)

    Koutsonanos, Dimitrios G; Esser, E Stein; McMaster, Sean R; Kalluri, Priya; Lee, Jeong-Woo; Prausnitz, Mark R; Skountzou, Ioanna; Denning, Timothy L; Kohlmeier, Jacob E; Compans, Richard W

    2015-09-08

    Skin has gained substantial attention as a vaccine target organ due to its immunological properties, which include a high density of professional antigen presenting cells (APCs). Previous studies have demonstrated the effectiveness of this vaccination route not only in animal models but also in adults. Young children represent a population group that is at high risk from influenza infection. As a result, this group could benefit significantly from influenza vaccine delivery approaches through the skin and the improved immune response it can induce. In this study, we compared the immune responses in young BALB/c mice upon skin delivery of influenza vaccine with vaccination by the conventional intramuscular route. Young mice that received 5 μg of H1N1 A/Ca/07/09 influenza subunit vaccine using MN demonstrated an improved serum antibody response (IgG1 and IgG2a) when compared to the young IM group, accompanied by higher numbers of influenza-specific antibody secreting cells (ASCs) in the bone marrow. In addition, we observed increased activation of follicular helper T cells and formation of germinal centers in the regional lymph nodes in the MN immunized group, rapid clearance of the virus from their lungs as well as complete survival, compared with partial protection observed in the IM-vaccinated group. Our results support the hypothesis that influenza vaccine delivery through the skin would be beneficial for protecting the high-risk young population from influenza infection. Copyright © 2015. Published by Elsevier Ltd.

  4. Dose-response models for the radiation-induction of skin tumours in mice

    International Nuclear Information System (INIS)

    Papworth, D.G.; Hulse, E.V.

    1983-01-01

    Extensive data on radiation-induced skin tumours in mice were examined using 8 models, all based on the concept that incidences of radiation-induced tumours depend on a combination of two radiation effects: a tumour induction process and the loss of reproductive integrity by the potential tumour cells. Models with and without a threshold were used, in spite of theoretical objections to threshold models. No model fitted well both the epidermal and the dermal tumour data and models which proved to be statistically satisfactory for some of the data were rejected for biological reasons. It is concluded that, for skin tumours, dose-response curves depending on a combination of cancer induction and loss of cellular reproductive integrity are distorted by some special, relatively radio-resistant, factor which we have previously postulated as being involved in radiation skin carcinogenesis. (author)

  5. Effects of methylglyoxal bis(guanylhydrazone) on tumour and skin responses to hyperthermia in mice

    International Nuclear Information System (INIS)

    Miyakoshi, J.; Oda, W.; Inagaki, C.; Hiraoka, M.; Takahashi, M.; Abe, M.

    1984-01-01

    Effects of methylglyoxal bis(guanylhydrazone) (MGBG) on tumour and skin responses to hyperthermia (42degC) were examined in C3H mice. MGBG (50 mg/kg) was administered intraperitoneally to mice 4 hours before hyperthermic treatment. The tumour (FM3A) growth time was elongated by an amount dependent on the exposure time of treatment at 42degC (60, 90 and 120 min). Pre-treatment of mice with MGBG (50 mg/kg, i.p.) apparently further lengthened the tumour growth time after treatment at 42degC. No significant damage of foot skin was caused by 42degC hyperthermia. Pre-treatment with MGBG did not make the foot skin susceptible to the heating. From these findings, it can be considered that MGBG or related less-toxic compounds may have a clinical advantage for the mild (42degC) hyperthermic treatment in cancer therapy. (author)

  6. Effects of methylglyoxal bis(guanylhydrazone) on tumour and skin responses to hyperthermia in mice

    Energy Technology Data Exchange (ETDEWEB)

    Miyakoshi, J.; Oda, W.; Inagaki, C. (Kyoto Coll. of Pharmacy (Japan)); Hiraoka, M.; Takahashi, M.; Abe, M. (Kyoto Univ. (Japan). Faculty of Medicine)

    1984-09-01

    Effects of methylglyoxal bis(guanylhydrazone) (MGBG) on tumour and skin responses to hyperthermia (42degC) were examined in C3H mice. MGBG (50 mg/kg) was administered intraperitoneally to mice 4 hours before hyperthermic treatment. The tumour (FM3A) growth time was elongated by an amount dependent on the exposure time of treatment at 42degC (60, 90 and 120 min). Pre-treatment of mice with MGBG (50 mg/kg, i.p.) apparently further lengthened the tumour growth time after treatment at 42degC. No significant damage of foot skin was caused by 42degC hyperthermia. Pre-treatment with MGBG did not make the foot skin susceptible to the heating. From these findings, it can be considered that MGBG or related less-toxic compounds may have a clinical advantage for the mild (42degC) hyperthermic treatment in cancer therapy.

  7. Tissue responses to fractional transient heating with sinusoidal heat flux condition on skin surface.

    Science.gov (United States)

    Ezzat, Magdy A; El-Bary, Alaa A; Al-Sowayan, Noorah S

    2016-10-01

    A fractional model of Bioheat equation for describing quantitatively the thermal responses of skin tissue under sinusoidal heat flux conditions on skin surface is given. Laplace transform technique is used to obtain the solution in a closed form. The resulting formulation is applied to one-dimensional application to investigate the temperature distribution in skin with instantaneous surface heating for different cases. According to the numerical results and its graphs, conclusion about the fractional bioheat transfer equation has been constructed. Sensitivity analysis is performed to explore the thermal effects of various control parameters on tissue temperature. The comparisons are made with the results obtained in the case of the absence of time-fractional order. © 2016 Japanese Society of Animal Science. © 2016 Japanese Society of Animal Science.

  8. Musical Auditory Stimulation Influences Heart Rate Autonomic Responses to Endodontic Treatment

    Directory of Open Access Journals (Sweden)

    Milana Drumond Ramos Santana

    2017-01-01

    Full Text Available We aimed to evaluate the acute effect of musical auditory stimulation on heart rate autonomic regulation during endodontic treatment. The study included 50 subjects from either gender between 18 and 40 years old, diagnosed with irreversible pulpitis or pulp necrosis of the upper front teeth and endodontic treatment indication. HRV was recorded 10 minutes before (T1, during (T2, and immediately (T3 and T4 after endodontic treatment. The volunteers were randomly divided into two equal groups: exposed to music (during T2, T3, and T4 or not. We found no difference regarding salivary cortisol and anxiety score. In the group with musical stimulation heart rate decreased in T3 compared to T1 and mean RR interval increased in T2 and T3 compared to T1. SDNN and TINN indices decreased in T3 compared to T4, the RMSSD and SD1 increased in T4 compared to T1, the SD2 increased compared to T3, and LF (low frequency band increased in T4 compared to T1 and T3. In the control group, only RMSSD and SD1 increased in T3 compared to T1. Musical auditory stimulation enhanced heart rate autonomic modulation during endodontic treatment.

  9. A 41-year-old man with polyarthritis and severe autonomic neuropathy

    Directory of Open Access Journals (Sweden)

    Matthew E Bourcier

    2008-09-01

    Full Text Available Matthew E Bourcier, Aaron I VinikEastern Virginia Medical School, Norfolk, VA, USAAbstract: Orthostasis due to autonomic neuropathy can cause severe debilitation and prove refractory to treatment. This report describes a case of severe sympathetic and parasympathetic autonomic dysfunction as a consequence of acetylcholine receptor antibodies and Sjogren’s syndrome. Symptomatic management, plasma fluid expanders, and IVIG therapy failed to offer a salutary response to the condition. Etanercept therapy provided improvement of the orthostasis and autonomic function measured as high and low frequency respiratory effects on heart rate variability as well as enhancement of skin blood flow using Laser Doppler. It would be of considerable interest to determine the effectiveness of etanercept in other autoimmune neuropathies.Keywords: autonomic neuropathy, etanercept, IntraEpidermal Nerve Fibers (IENF, acetylcholine receptor antibodies, laser doppler skin blood flow, orthostasis

  10. Person perception and autonomic nervous system response: the costs and benefits of possessing a high social status.

    Science.gov (United States)

    Cloutier, J; Norman, G J; Li, T; Berntson, G G

    2013-02-01

    This research was designed to investigate the relationship between sympathetic and parasympathetic autonomic nervous system (ANS) responses to the perception of social targets varying in social status. Participants varying in subjective financial status were presented with faces assigned with either a low, average, or high financial status. Electrocardiographic and impedance cardiography signals were recorded and measures of sympathetic (pre-ejection period; PEP) and parasympathetic (high frequency heart rate variability; HF HRV) cardiac control were derived. These measures associated with the presentation of each face condition were examined in relation to the subjective status of the perceivers. Participants with high subjective financial status showed reduced sympathetic activity when viewing low- and medium-status targets as compared to high-status targets, and lower parasympathetic response when viewing high- and medium-status targets relative to low-status targets. Copyright © 2012. Published by Elsevier B.V.

  11. Optimization of gelatine extraction from grass carp (Catenopharyngodon idella) fish skin by response surface methodology.

    Science.gov (United States)

    Kasankala, Ladislaus M; Xue, Yan; Weilong, Yao; Hong, Sun D; He, Qian

    2007-12-01

    To establish the optimum gelatine extraction conditions from grass carp fish skin, response surface methodology (RSM) was adopted in this study. The effects of concentration of HCl (%, A), pre-treatment time (h, B), extraction temperature ( degrees C, C) and extraction time (h, D) were studied. The responses were yield (%) and gel strength (g). A=1.19%, B=24 h, C=52.61 degrees C and D=5.12h were determined as the optimum conditions while the predicted responses were 19.83% yield and 267 g gel strength. Gelling and melting points were 19.5 degrees C and 26.8 degrees C, respectively. Moreover, grass carp gelatine showed high contents of imino acids (proline and hydroxyproline) 19.47%. RSM provided a powerful tool to optimize the extraction parameters and the results may be adapted for industrial extraction of gelatine from grass carp fish skins.

  12. Hypothalamic-pituitary-adrenal and cardiac autonomic responses to transrectal examination differ with behavioral reactivity in dairy cows.

    Science.gov (United States)

    Kovács, L; Kézér, F L; Kulcsár-Huszenicza, M; Ruff, F; Szenci, O; Jurkovich, V

    2016-09-01

    Behavior, hypothalamic-pituitary-adrenal axis, and cardiac autonomic nervous system (ANS) activity were evaluated in response to transrectal examination in nonlactating Holstein-Friesian cows with different behavioral reactivity. According to behavioral reactions shown to the procedure of fixing the heart rate (HR) monitors, the 20 cows with the highest and the 20 cows with the lowest behavioral reactivity were involved in the study (high responder, n=20; and low responder, n=20, respectively). Activity of the ANS was assessed by HR and HR variability parameters. Blood and saliva were collected at 5 min before (baseline) and 0, 5 10, 15, 20, 30, 40, 60, and 120 min after the examination to determine cortisol concentrations. The examination lasted for 5 min. Cardiac parameters included HR, the root mean square of successive differences between the consecutive interbeat intervals, the high frequency (HF) component of heart rate variability, and the ratio between the low frequency (LF) and HF parameter (LF/HF). Following the examination, peak plasma and saliva cortisol levels and the amplitude of the plasma and saliva cortisol response were higher in high responder cows than in low responders. Areas under the plasma and saliva cortisol response curves were greater in high responder cows. Plasma and salivary cortisol levels correlated significantly at baseline (r=0.91), right after examination (r=0.98), and at peak levels (r=0.96). Area under the HR response curve was higher in low responder cows; however, maximum HR and the amplitude of the HR response showed no differences between groups. Minimum values of both parameters calculated for the examination were higher in high responders. Following the examination, response parameters of root mean square of successive differences and HF did not differ between groups. The maximum and the amplitude of LF/HF response and area under the LF/HF response curve were lower in low responder cows, suggesting a lower sympathetic

  13. Heart rate and skin conductance responses to taste, taste novelty, and the (dis)confirmation of expectations

    NARCIS (Netherlands)

    Verastegui-Tena, Luz; Trijp, van Hans; Piqueras-Fiszman, Betina

    2018-01-01

    It is unclear whether the responses of the autonomic nervous system (ANS) can measure how people respond to food. Results focused on emotional responses are contradictory; therefore, the focus has shifted to other components of emotion, such as appraisals. The aim of this study was, therefore, to

  14. Oral Contraceptives Attenuate Cardiac Autonomic Responses to Musical Auditory Stimulation: Pilot Study.

    Science.gov (United States)

    Milan, Réveni Carmem; Plassa, Bruna Oliveira; Guida, Heraldo Lorena; de Abreu, Luiz Carlos; Gomes, Rayana L; Garner, David M; Valenti, Vitor E

    2015-01-01

    The literature presents contradictory results regarding the effects of contraceptives on cardiac autonomic regulation. The research team aimed to evaluate the effects of musical auditory stimulation on cardiac autonomic regulation in women who use oral contraceptives. The research team designed a transversal observational pilot study. The setting was the Centro de Estudos do Sistema Nervoso Autônomo (CESNA) in the Departamento de Fonoaudiologia at the Universidade Estadual Paulista (UNESP) in Marília, SP, Brazil. Participants were 22 healthy nonathletic and nonsedentary females, all nonsmokers and aged between 18 and 27 y. Participants were divided into 2 groups: (1) 12 women who were not taking oral contraceptives, the control group; and (2) 10 women who were taking oral contraceptives, the oral contraceptive group. In the first stage, a rest control, the women sat with their earphones turned off for 20 min. After that period, the participants were exposed to 20 min of classical baroque music (ie, "Canon in D Major," Johann Pachelbel), at 63-84 dB. Measurements of the equivalent sound levels were conducted in a soundproof room, and the intervals between consecutive heartbeats (R-R intervals) were recorded, with a sampling rate of 1000 Hz. For calculation of the linear indices, the research team used software to perform an analysis of heart rate variability (HRV). Linear indices of HRV were analyzed in the time domain: (1) the standard deviation of normal-to-normal R-R intervals (SDNN), (2) the root-mean square of differences between adjacent normal R-R intervals in a time interval (RMSSD), and (3) the percentage of adjacent R-R intervals with a difference of duration greater than 50 ms (pNN50). The study also analyzed the frequency domain-low frequency (LF), high frequency (HF), and LF/HF ratio. For the control group, the musical auditory stimulation reduced (1) the SDNN from 52.2 ± 10 ms to 48.4 ± 16 ms (P = .0034); (2) the RMSSD from 45.8 ± 22 ms to 41.2

  15. Catecholamines and diabetic autonomic neuropathy

    DEFF Research Database (Denmark)

    Hilsted, J

    1995-01-01

    In diabetic patients with autonomic neuropathy plasma noradrenaline concentration, used as an index of sympathetic nervous activity, is low. This decrease is, however, only found in patients with a long duration of diabetes with clinically severe autonomic neuropathy. This apparent insensitivity...... of plasma catecholamine measurements is not due to changes in the clearance of catecholamines in diabetic autonomic neuropathy. The physiological responses to infused adrenaline and to noradrenaline are enhanced, for noradrenaline mainly cardiovascular responses. Adrenoceptors (alpha and beta adrenoceptors......) are not altered in circulating blood cells in diabetic autonomic neuropathy. Thus, a generalized up-regulation of adrenoceptors does not occur in diabetic autonomic neuropathy....

  16. Influence of trichloroacetic acid peeling on the skin stress response system.

    Science.gov (United States)

    Kimura, Ayako; Kanazawa, Nobuo; Li, Hong-Jin; Yonei, Nozomi; Yamamoto, Yuki; Furukawa, Fukumi

    2011-08-01

    Although trichloroacetic acid (TCA) peeling is widely applied for cosmetic treatment of photodamaged skin, the entire biological mechanisms have yet to be determined. The skin stress response system (SSRS) involves corticotropin-releasing hormone (CRH) and proopiomelanocortin (POMC) products that are locally-generated in response to locally-provided stressors or pro-inflammatory cytokines. This system would restrict tissue damage and restore local homeostasis. To determine the influence of TCA peeling on the SSRS in vitro and in vivo, expressions of POMC, melanocortin receptor 1 (MC1R), CRH and CRH receptor 1 (CRHR1) mRNA were examined by reverse transcription polymerase chain reaction in Pam212 murine keratinocytes, murine plantar and healthy human abdominal skin specimens after TCA treatment. In addition, their protein expressions as well as those of POMC-derived peptides were examined immunohistochemically. After TCA treatment, transient upregulation of POMC and MC1R mRNA expressions was observed in both murine and human skin, as well as in Pam212. Enhanced POMC protein, recovery of once-impaired MC1R protein, and no enhancement of POMC-derived peptide productions were revealed immunohistochemically in both murine and human epidermis. In contrast, neither expression levels of CRH and CRHR1 mRNA nor epidermal protein were enhanced after TCA application in murine and human skin, except for induction of human CRH mRNA expression. These results suggest that TCA activates the SSRS by inducing POMC and MC1R productions of keratinocytes in the CRH-independent manner, and that the biological effects of POMC itself are responsible for the TCA-induced epidermal SSRS activation. © 2010 Japanese Dermatological Association.

  17. Effect of skin barrier disruption on immune responses to topically applied cross-reacting material, CRM(197), of diphtheria toxin.

    Science.gov (United States)

    Godefroy, S; Peyre, M; Garcia, N; Muller, S; Sesardic, D; Partidos, C D

    2005-08-01

    The high accessibility of the skin and the presence of immunocompetent cells in the epidermis makes this surface an attractive route for needle-free administration of vaccines. However, the lining of the skin by the stratum corneum is a major obstacle to vaccine delivery. In this study we examined the effect of skin barrier disruption on the immune responses to the cross-reacting material CRM(197), a nontoxic mutant of diphtheria toxin (DTx) that is considered as a vaccine candidate. Application of CRM(197), together with cholera toxin (CT), onto the tape-stripped skin of mice elicited antibody responses that had anti-DTx neutralizing activity. Vaccine delivery onto mildly ablated skin or intact skin did not elicit any detectable anti-CRM(197) antibodies. Mice immunized with CRM(197) alone onto the tape-stripped skin mounted a vigorous antigen-specific proliferative response. In contrast, the induction of cellular immunity after CRM(197) deposition onto mildly ablated or intact skin was adjuvant dependent. Furthermore, epidermal cells were activated and underwent apoptosis that was more pronounced when the stratum corneum was removed by tape stripping. Overall, these findings highlight the potential for transcutaneous delivery of CRM(197) and establish a correlation between the degree of barrier disruption and levels of antigen-specific immune responses. Moreover, these results provide the first evidence that the development of a transcutaneous immunization strategy for diphtheria, based on simple and practical methods to disrupt the skin barrier, is feasible.

  18. Autonomic substrates of the response to pups in male prairie voles.

    Directory of Open Access Journals (Sweden)

    William M Kenkel

    Full Text Available Caregiving by nonparents (alloparenting and fathers is a defining aspect of human social behavior, yet this phenomenon is rare among mammals. Male prairie voles (Microtus ochrogaster spontaneously exhibit high levels of alloparental care, even in the absence of reproductive experience. In previous studies, exposure to a pup was selectively associated with increased activity in oxytocin and vasopressin neurons along with decreased plasma corticosterone. In the present study, physiological, pharmacological and neuroanatomical methods were used to explore the autonomic and behavioral consequences of exposing male prairie voles to a pup. Reproductively naïve, adult male prairie voles were implanted with radiotransmitters used for recording ECG, temperature and activity. Males responded with a sustained increase in heart-rate during pup exposure. This prolonged increase in heart rate was not explained by novelty, locomotion or thermoregulation. Although heart rate was elevated during pup exposure, respiratory sinus arrhythmia (RSA did not differ between these males and males exposed to control stimuli indicating that vagal inhibition of the heart was maintained. Blockade of beta-adrenergic receptors with atenolol abolished the pup-induced heart rate increase, implicating sympathetic activity in the pup-induced increase in heart rate. Blockade of vagal input to the heart delayed the males' approach to the pup. Increased activity in brainstem autonomic regulatory nuclei was also observed in males exposed to pups. Together, these findings suggest that exposure to a pup activates both vagal and sympathetic systems. This unique physiological state (i.e. increased sympathetic excitation of the heart, while maintaining some vagal cardiac tone associated with male caregiving behavior may allow males to both nurture and protect infants.

  19. Immune sensitization to methylene diphenyl diisocyanate (MDI resulting from skin exposure: albumin as a carrier protein connecting skin exposure to subsequent respiratory responses

    Directory of Open Access Journals (Sweden)

    Redlich Carrie A

    2011-03-01

    Full Text Available Abstract Background Methylene diphenyl diisocyanate (MDI, a reactive chemical used for commercial polyurethane production, is a well-recognized cause of occupational asthma. The major focus of disease prevention efforts to date has been respiratory tract exposure; however, skin exposure may also be an important route for inducing immune sensitization, which may promote subsequent airway inflammatory responses. We developed a murine model to investigate pathogenic mechanisms by which MDI skin exposure might promote subsequent immune responses, including respiratory tract inflammation. Methods Mice exposed via the skin to varying doses (0.1-10% w/v of MDI diluted in acetone/olive oil were subsequently evaluated for MDI immune sensitization. Serum levels of MDI-specific IgG and IgE were measured by enzyme-linked immunosorbant assay (ELISA, while respiratory tract inflammation, induced by intranasal delivery of MDI-mouse albumin conjugates, was evaluated based on bronchoalveolar lavage (BAL. Autologous serum IgG from "skin only" exposed mice was used to detect and guide the purification/identification of skin proteins antigenically modified by MDI exposure in vivo. Results Skin exposure to MDI resulted in specific antibody production and promoted subsequent respiratory tract inflammation in animals challenged intranasally with MDI-mouse albumin conjugates. The degree of (secondary respiratory tract inflammation and eosinophilia depended upon the (primary skin exposure dose, and was maximal in mice exposed to 1% MDI, but paradoxically limited in mice receiving 10-fold higher doses (e.g. 10% MDI. The major antigenically-modified protein at the local MDI skin exposure site was identified as albumin, and demonstrated biophysical changes consistent with MDI conjugation. Conclusions MDI skin exposure can induce MDI-specific immune sensitivity and promote subsequent respiratory tract inflammatory responses and thus, may play an important role in MDI asthma

  20. Autonomous Star Tracker Algorithms

    DEFF Research Database (Denmark)

    Betto, Maurizio; Jørgensen, John Leif; Kilsgaard, Søren

    1998-01-01

    Proposal, in response to an ESA R.f.P., to design algorithms for autonomous star tracker operations.The proposal also included the development of a star tracker breadboard to test the algorithms performances.......Proposal, in response to an ESA R.f.P., to design algorithms for autonomous star tracker operations.The proposal also included the development of a star tracker breadboard to test the algorithms performances....

  1. Inflammatory Murine Skin Responses to UV-B Light Are Partially Dependent on Endothelin-1 and Mast Cells

    OpenAIRE

    Metz, Martin; Lammel, Verena; Gibbs, Bernhard F.; Maurer, Marcus

    2006-01-01

    Endothelin (ET-1) has been shown to crucially contribute to UV-induced skin responses such as tanning. To test whether ET-1 is also involved in early cutaneous reactions to UV, we assessed ET-1 skin levels in UV-irradiated mice. In correlation with the levels of UV-induced skin inflammation, ET-1 concentrations increased substantially and continually. Moreover, blocking of ET-1 receptors (ETA) resulted in significantly decreased cutaneous inflammation following UV irradiation. When we assesse...

  2. OPTIMIZATION AND CHARACTERIZATION OF 5-FLUOROURACIL TRANSETHOSOMES FOR SKIN CANCER THERAPY USING RESPONSE SURFACE METHODOLOGY.

    OpenAIRE

    Jessy Shaji; Rinki Bajaj.

    2018-01-01

    The purpose of the present study was to develop, optimize and characterize 5-Fluorouracil transethosomes for skin cancer targeting. 5- Fluorouracil transethosomes were prepared by cold method using phospholipon 90G as the lipid and sodium cholate as edge activator. The size reduction was done by probe sonication. Central composite design was used for optimization procedure with different concentration of phospholipon 90G and sodium cholate as independent variables. The response variables sele...

  3. Evaluation of Reliability in Risk-Constrained Scheduling of Autonomous Microgrids with Demand Response and Renewable Resources

    DEFF Research Database (Denmark)

    Vahedipour-Dahraie, Mostafa; Anvari-Moghaddam, Amjad; Guerrero, Josep M.

    2018-01-01

    of microgrid. Moreover, the impacts of different VOLL and risk aversion parameter are illustrated on the system reliability. Extensive simulation results are also presented to illustrate the impact of risk aversion on system security issues with and without DR. Numerical results demonstrate the advantages......Uncertain natures of the renewable energy resources and consumers’ participation in demand response (DR) programs have introduced new challenges to the energy and reserve scheduling of microgrids, particularly in the autonomous mode. In this paper, a risk-constrained stochastic framework...... is presented to maximize the expected profit of a microgrid operator under uncertainties of renewable resources, demand load and electricity price. In the proposed model, the trade-off between maximizing the operator’s expected profit and the risk of getting low profits in undesired scenarios is modeled...

  4. Autonomic nervous system activation mediates the increase in whole-body glucose uptake in response to electroacupuncture

    DEFF Research Database (Denmark)

    Benrick, Anna; Kokosar, Milana; Hu, Min

    2017-01-01

    was higher after EA in controls and women with PCOS. Plasma serotonin levels and homovanillic acid, markers of vagal activity, decreased in both controls and patients with PCOS. Adipose tissue expression of pro-nerve growth factor (proNGF) decreased, and the mature NGF/proNGF ratio increased after EA in PCOS...... of EA increases whole-body glucose uptake by activation of the sympathetic and partly the parasympathetic nervous systems, which could have important clinical implications for the treatment of insulin resistance.-Benrick, A., Kokosar, M., Hu, M., Larsson, M., Maliqueo, M., Marcondes, R. R., Soligo, M......., Protto, V., Jerlhag, E., Sazonova, A., Behre, C. J., Højlund, K., Thorén, P., Stener-Victorin, E. Autonomic nervous system activation mediates the increase in whole-body glucose uptake in response to electroacupuncture....

  5. When avoiding unpleasant emotions might not be such a bad thing: verbal-autonomic response dissociation and midlife conjugal bereavement.

    Science.gov (United States)

    Bonanno, G A; Keltner, D; Holen, A; Horowitz, M J

    1995-11-01

    It has been widely assumed that emotional avoidance during bereavement leads to either prolonged grief, delayed grief, or delayed somatic symptoms. To test this view, as well as a contrasting adaptive hypothesis, emotional avoidance was measured 6 months after a conjugal loss as negative verbal-autonomic response dissociation (low self-rated negative emotion coupled with heightened cardiovascular activity) and compared with grief measured at 6 and 14 months. The negative dissociation score evidenced reliability and validity but did not evidence the assumed link to severe grief. Rather, consistent with the adaptive hypothesis, negative dissociation at 6 months was associated with minimal grief symptoms across 14 months. Negative dissociation scores were also linked to initially high levels of somatic symptoms, which dropped to a low level by 14 months. Possible explanations for the initial cost and long-term adaptive quality of emotional avoidance during bereavement, as well as implications and limitations of the findings, are discussed.

  6. Stratum corneum cytokines and skin irritation response to sodium lauryl sulfate.

    Science.gov (United States)

    De Jongh, Cindy M; Verberk, Maarten M; Withagen, Carien E T; Jacobs, John J L; Rustemeyer, Thomas; Kezic, Sanja

    2006-06-01

    Little is known about cytokines involved in chronic irritant contact dermatitis. Individual cytokine profiles might explain at least part of the differences in the individual response to irritation. Our objective was to investigate the relation between baseline stratum corneum (SC) cytokine levels and the skin response to a single and a repeated irritation test. This study also aimed to determine changes in SC cytokine levels after repeated irritation. Transepidermal water loss (TEWL) and erythema were measured in 20 volunteers after single 24-hr exposure to 1% sodium lauryl sulfate (SLS), and during and after repeated exposure to 0.1% SLS over a 3-week period. SC cytokine levels were measured from an unexposed skin site and from the repeatedly exposed site. Interleukin (IL)-1alpha decreased by 30% after repeated exposure, while IL-1RA increased 10-fold and IL-8 increased fourfold. Baseline IL-1RA and IL-8 values were predictors of TEWL and erythema after single exposure (r = 0.55-0.61). 6 subjects showed barrier recovery during repeated exposure. Baseline IL-1RA and IL-8 levels are likely to be indicators of higher skin irritability after single exposure to SLS. Barrier repair in some of the subjects might explain the lack of agreement between the TEWL response after single and repeated irritation.

  7. Posterior superior temporal sulcus responses predict perceived pleasantness of skin stroking

    Directory of Open Access Journals (Sweden)

    Monika Davidovic

    2016-09-01

    Full Text Available Love and affection is expressed through a range of physically intimate gestures, including caresses. Recent studies suggest that posterior temporal lobe areas typically associated with visual processing of social cues also respond to interpersonal touch. Here, we asked whether these areas are selective to caress-like skin stroking. We collected functional magnetic resonance imaging (fMRI data from 23 healthy participants and compared brain responses to skin stroking and vibration. We did not find any significant differences between stroking and vibration in the posterior temporal lobe; however, right posterior superior temporal sulcus (pSTS responses predicted healthy participant's perceived pleasantness of skin stroking, but not vibration. These findings link right pSTS responses to individual variability in perceived pleasantness of caress-like tactile stimuli. We speculate that the right pSTS may play a role in the translation of tactile stimuli into positively valenced, socially relevant interpersonal touch and that this system may be affected in disorders associated with impaired attachment.

  8. Skin response to X-irradiation in the guinea-pig

    Energy Technology Data Exchange (ETDEWEB)

    Berry, R J; Mole, R H; Barnes, D W.H. [Medical Research Council, Harwell (UK). Radiobiological Research Unit

    1976-12-01

    Skin reaction to X-irradiation has been studied in the albino quinea-pig; early response in limited-field irradiations of the flank was comparable to that commonly seen in rodents, swine and man, and was dose-dependent with a dynamic range from mild erythema to moist desquamation. The peak early skin reaction was seen between 14 and 21 days after irradiation, and declined before 30 days except at the highest doses used. Fractionation of the X-ray dose at 24 hours resulted in a 'sparing' of about 340 rad. Permanent partial epilation was detectable at doses in excess of 1400 rad, and complete epilation at 1 year occurred in 50 per cent of irradiated fields at 1740 rad. Twenty-four hour two-dose fractionation resulted in a 'sparing' of about 500 rad for epilation. Palpable dermal 'fibrosis' was detectable at 3 months after irradiation in fields given more than 2070 rad, and at 1 year after irradiation in fields given more than 1800 rad; 50 per cent of fields showed palpable 'fibrosis' at 1 year at 1930 rad. Unlike domestic swine and man, skin fields in the quinea-pig showed no dimensional contraction after X-ray doses which produced gross early skin damage.

  9. An integrated stochastic multi-regional long-term energy planning model incorporating autonomous power systems and demand response

    International Nuclear Information System (INIS)

    Koltsaklis, Nikolaos E.; Liu, Pei; Georgiadis, Michael C.

    2015-01-01

    The power sector faces a rapid transformation worldwide from a dominant fossil-fueled towards a low carbon electricity generation mix. Renewable energy technologies (RES) are steadily becoming a greater part of the global energy mix, in particular in regions that have put in place policies and measures to promote their utilization. This paper presents an optimization-based approach to address the generation expansion planning (GEP) problem of a large-scale, central power system in a highly uncertain and volatile electricity industry environment. A multi-regional, multi-period linear mixed-integer linear programming (MILP) model is presented, combining optimization techniques with a Monte Carlo (MCA) method and demand response concepts. The optimization goal concerns the minimization of the total discounted cost by determining optimal power capacity additions per time interval and region, and the power generation mix per technology and time period. The model is evaluated on the Greek power system (GPS), taking also into consideration the scheduled interconnection of the mainland power system with those of selected autonomous islands (Cyclades and Crete), and aims at providing full insight into the composition of the long-term energy roadmap at a national level. - Highlights: • A spatial, multi-period, long-term generation expansion planning model is presented. • A Monte-Carlo method along with a demand response mechanism are incorporated. • Autonomous power systems interconnection is considered. • Electricity and CO 2 emission trade are taken into account. • Lignite, natural gas and wind power comprise the dominant power technologies

  10. Autonomous Preference-Aware Information Services Integration for High Response in Integrated Faded Information Field Systems

    Science.gov (United States)

    Lu, Xiaodong; Mori, Kinji

    The market and users' requirements have been rapidly changing and diversified. Under these heterogeneous and dynamic situations, not only the system structure itself, but also the accessible information services would be changed constantly. To cope with the continuously changing conditions of service provision and utilization, Faded Information Field (FIF) has been proposed, which is a agent-based distributed information service system architecture. In the case of a mono-service request, the system is designed to improve users' access time and preserve load balancing through the information structure. However, with interdependent requests of multi-service increasing, adaptability and timeliness have to be assured by the system. In this paper, the relationship that exists among the correlated services and the users' preferences for separate and integrated services is clarified. Based on these factors, the autonomous preference-aware information services integration technology to provide one-stop service for users multi-service requests is proposed. As compared to the conventional system, we show that proposed technology is able to reduce the total access time.

  11. Bioimpedance-Based Wearable Measurement Instrumentation for Studying the Autonomic Nerve System Response to Stressful Working Conditions

    Science.gov (United States)

    Ferreira, J.; Álvarez, L.; Buendía, R.; Ayllón, D.; Llerena, C.; Gil-Pita, R.; Seoane, F.

    2013-04-01

    The assessment of mental stress on workers under hard and stressful conditions is critical to identify which workers are not ready to undertake a mission that might put in risk their own life and the life of others. The ATREC project aims to enable Real Time Assessment of Mental Stress of the Spanish Armed Forces during military activities. Integrating sensors with garments and using wearable measurement devices, the following physiological measurements were recorded: heart and respiration rate, skin galvanic response as well as peripheral temperature. The measuring garments are the following: a sensorized glove, an upper-arm strap and a repositionable textrode chest strap system with 6 textrodes. The implemented textile-enabled instrumentation contains: one skin galvanometer, two temperature sensors, for skin and environmental, and an Impedance Cardiographer/Pneumographer containing a 1 channel ECG amplifier to record cardiogenic biopotentials. The implemented wearable systems operated accordingly to the specifications and are ready to be used for the mental stress experiments that will be executed in the coming phases of the project in healthy volunteers.

  12. Bioimpedance-Based Wearable Measurement Instrumentation for Studying the Autonomic Nerve System Response to Stressful Working Conditions

    International Nuclear Information System (INIS)

    Ferreira, J; Buendía, R; Seoane, F; Álvarez, L; Ayllón, D; Llerena, C; Gil-Pita, R

    2013-01-01

    The assessment of mental stress on workers under hard and stressful conditions is critical to identify which workers are not ready to undertake a mission that might put in risk their own life and the life of others. The ATREC project aims to enable Real Time Assessment of Mental Stress of the Spanish Armed Forces during military activities. Integrating sensors with garments and using wearable measurement devices, the following physiological measurements were recorded: heart and respiration rate, skin galvanic response as well as peripheral temperature. The measuring garments are the following: a sensorized glove, an upper-arm strap and a repositionable textrode chest strap system with 6 textrodes. The implemented textile-enabled instrumentation contains: one skin galvanometer, two temperature sensors, for skin and environmental, and an Impedance Cardiographer/Pneumographer containing a 1 channel ECG amplifier to record cardiogenic biopotentials. The implemented wearable systems operated accordingly to the specifications and are ready to be used for the mental stress experiments that will be executed in the coming phases of the project in healthy volunteers.

  13. Child maltreatment under the skin : basal activity and stress reactivity of the autonomic nervous system and attachment representations in maltreating parents

    NARCIS (Netherlands)

    Reijman, Sophie

    2015-01-01

    This dissertation comprises an empirical study and a meta-analytical study on autonomic nervous system (ANS) functioning and attachment representations in maltreating parents. For the empirical study we recruited a sample of 45 mothers with substantiated abuse and neglect and 45 non-maltreating

  14. Skin Carotenoid Response to a High-Carotenoid Juice in Children: A Randomized Clinical Trial.

    Science.gov (United States)

    Aguilar, Sheryl S; Wengreen, Heidi J; Dew, Jeffrey

    2015-11-01

    Previous studies have shown an increase in serum carotenoid status among children when fed carotenoids. This study looked at the effect and dose-response of a known amount of carotenoid consumption on change in skin carotenoid status among children. Participants were children aged 5 to 17 years from Cache County, UT (n=58). Children were randomly assigned to one of three groups: high (n=18) or low (n=18) dose of a carotenoid-rich juice (2.75 mg carotenoids/30 mL juice), or placebo juice (n=22). Children were asked to drink an assigned dose of the juice (30 to 120 mL/day) based on the weight of the child and group assignment, every day for 8 weeks. Skin carotenoids were measured every 2 weeks by resonance Raman spectroscopy. Participants were asked to maintain their usual diet throughout the study. Usual diet was assessed using three averaged 24-hour recalls; diet constancy was measured using food frequency questionnaires administered at baseline, Week 4, and Week 8. Repeated measures analysis of variance was used to assess the group differences in skin carotenoid status over time. The high-dose and low-dose groups had mean±standard deviation increases in skin carotenoid status of 11,515±1,134 and 10,009±1,439 Raman intensity counts, respectively (both P values juice significantly increased skin carotenoid status over an 8-week period among children aged 5 to 17 years. The amount of carotenoids found in this amount of juice is equal to the amount found in approximately 23 to 92 g cooked carrots per day. Copyright © 2015 Academy of Nutrition and Dietetics. Published by Elsevier Inc. All rights reserved.

  15. Response of the skin of hamsters to fractionated irradiation with X rays or accelerated carbon ions

    International Nuclear Information System (INIS)

    Leith, J.T.; Powers-Risius, P.; Woodruff, K.H.; McDonald, M.; Howard, J.

    1981-01-01

    The ventral thoracic skin of hamsters was irradiated with either single, split (two fractions given in 24 hr), or multiple (five fractions given daily) exposures of X rays or accelerated carbon ions using a 4-cm spread Bragg peak. Animals were positioned in the heavy-ion beam so that the ventral thoracic skin surface was 1 cm distal to the proximal peak of the modified beam. Early skin reactions from 6 to 30 days postirradiation were assessed. Using the average skin reactions produced in this period, it was found that the relative biological effect (RBE) for single doses of carbon ions was about 1.6 (5-17 Gy per fraction), for two fractions about 1.8 (5-17 Gy perfraction), and for five fractions about 1.9 (2.4-7.2 Gy per fraction). The fractional amount of sublethal damage repaired after carbon ion irradiation was about 0.3 (at dose levels of 2.4-8.0 Gy per fraction) compared to a value of about 0.45 (at dose levels of 60-13.0 Gy per fraction) found for the fractionated X irradiations, indicting about a 33% decrease in the relative amount of sublethal damage repaired after carbon ion irradiation in this position in the spread Bragg curve. Also, data were interpreted using plots of the reciprocal total dose needed to produce a given level of skin damage versus the dose per fraction used in the multifraction experiments, and of the RBE versus dose per fraction obtained from a nonparametric analysis of the responses. These approaches allow estimation of RBE at dose levels relevant to the clinical situation. Also, estimation may be made of the maximum permissible RBE by using the zero dose intercept value from the linear reciprocal dose plot. With this approach, the RBE at a dose level of 2 Gy is about 2.5 and the maximum RBE value is about 2.7

  16. The Effects of Low Dose Irradiation on Inflammatory Response Proteins in a 3D Reconstituted Human Skin Tissue Model

    Energy Technology Data Exchange (ETDEWEB)

    Varnum, Susan M.; Springer, David L.; Chaffee, Mary E.; Lien, Katie A.; Webb-Robertson, Bobbie-Jo M.; Waters, Katrina M.; Sacksteder, Colette A.

    2012-12-01

    Skin responses to moderate and high doses of ionizing radiation include the induction of DNA repair, apoptosis, and stress response pathways. Additionally, numerous studies indicate that radiation exposure leads to inflammatory responses in skin cells and tissue. However, the inflammatory response of skin tissue to low dose radiation (<10 cGy) is poorly understood. In order to address this, we have utilized a reconstituted human skin tissue model (MatTek EpiDerm FT) and assessed changes in 23 cytokines twenty-four and forty eight hours following treatment of skin with either 3 or 10 cGy low-dose of radiation. Three cytokines, IFN-γ, IL-2, MIP-1α, were significantly altered in response to low dose radiation. In contrast, seven cytokines were significantly altered in response to a high radiation dose of 200 cGy (IL-2, IL-10, IL-13, IFN-γ, MIP-1α, TNF α, and VEGF) or the tumor promoter 12-O-tetradecanoylphorbol 13-acetate (G-CSF, GM-CSF, IL-1α, IL-8, MIP-1α, MIP-1β, RANTES). Additionally, radiation induced inflammation appears to have a distinct cytokine response relative to the non-radiation induced stressor, TPA. Overall, these results indicate that there are subtle changes in the inflammatory protein levels following exposure to low dose radiation and this response is a sub-set of what is seen following a high dose in a human skin tissue model.

  17. Responsiveness of the Spanish Version of the “Skin Cancer Index”

    Directory of Open Access Journals (Sweden)

    M. de Troya-Martín

    2016-01-01

    Full Text Available Background. Skin Cancer Index (SCI is a specific questionnaire measuring health related quality of life (HRQL in patients with cervicofacial non-melanoma skin cancer (CFNMSC. The original scale has recently been adapted and validated into Spanish. Objectives. Evaluate the responsiveness of the Spanish version of SCI. Methods. Patients with CFNMSC candidate for surgical treatment were administered the questionnaire at time of diagnostic (t0, 7 days after surgery (t1, and 5 months after surgery (t2. The scale and subscales scores (C1: social/appearance, C2: emotional were then evaluated. Differences between t0-t1, t1-t2, and t0-t2 were determined and a gender-and-age segmented analysis was performed. Results. 88 patients, 54.8% male, mean age 62.5 years, completed the study. Differences between t0-t1 and t1-t2 scores were statistically significant (p<0.05. The lowest values were found at time of diagnosis and postsurgery. Women and patients under 65 years showed the lowest values at the three times. Limitations. Concrete geographic and cultural area. Clinical and histological variables are not analysed. Conclusions. Our results confirm responsiveness of the Spanish version of the SCI. Further development of the instrument in Spanish-speaking countries and populations will make it possible to extend worldwide research and knowledge horizons on skin cancer.

  18. The effect of the moisture content of a local heat source on the blood flow response of the skin.

    Science.gov (United States)

    Petrofsky, Jerrold Scott; Bains, Gurinder; Raju, Chinna; Lohman, Everett; Berk, Lee; Prowse, Michelle; Gunda, Shashi; Madani, Piyush; Batt, Jennifer

    2009-09-01

    Numerous studies have examined the effect of local and global heating of the body on skin blood flow. However, the effect of the moisture content of the heat source on the skin blood flow response has not been examined. Thirty-three subjects, without diabetes or cardiovascular disease, between the ages of 22 and 32 were examined to determine the relationship between the effects of dry vs. moist heat applied for the same length of time and with the skin clamped at the same skin temperature on the blood flow response of the skin. The skin, heated with an infrared heat lamp (skin temperature monitored with a thermocouple) to 40 degrees C for 15 min, was either kept moist with wet towels or, in a separate experiment, kept dry with Drierite (a desiccant) between the towels to remove any moisture. Before and after heat exposure of the forearm, blood pressure, heart rate, skin moisture content, skin temperature, and skin blood flow were recorded. The results of the experiment showed that there was no change in skin moisture after 15 min exposure to dry heat at 40 degrees C. However, with moist heat, skin moisture increased by 43.7%, a significant increase (P heat, blood flow increased from the resting value by 282.3% whereas with moist heat, blood flow increased by 386% over rest, a significant increase over dry heat (P heat was a better heating modality than dry heat. The reason may be linked to moisture sensitivity in calcium channels in the vascular endothelial cell.

  19. Blood Pressure Responses to Endovascular Stimulation: A Potential Therapy for Autonomic Disorders With Vasodilatation.

    Science.gov (United States)

    Naksuk, Niyada; Killu, Ammar M; Yogeswaran, Vidhushei; Desimone, Christopher V; Suddendorf, Scott H; Ladewig, Dorothy J; Powers, Joanne M; Weber, Sarah; Madhavan, Malini; Cha, Yong-Mei; Kapa, Suraj; Asirvatham, Samuel J

    2016-09-01

    We have previously shown that sympathetic ganglia stimulation via the renal vein rapidly increases blood pressure. This study further investigated the optimal target sites and effective energy levels for stimulation of the renal vasculatures and nearby sympathetic ganglia for rapid increase in blood pressure. The pre-study protocol for endovascular stimulations included 2 minutes of stimulation (1-150 V and 10 pulses per second) and at least 2 minutes of rest during poststimulation. If blood pressure and/or heart rate were changed during the stimulation, time to return to baseline was allowed prior to the next stimulation. In 11 acute canine studies, we performed 85 renal artery, 30 renal vein, and 8 hepatic vasculature stimulations. The mean arterial pressure (MAP) rapidly increased during stimulation of renal artery (95 ± 18 mmHg vs. 103 ± 15 mmHg; P vein (90 ± 16 mmHg vs. 102 ± 20 mmHg; P = 0.001), and hepatic vasculatures (74 ± 8 mmHg vs. 82 ± 11 mmHg; P = 0.04). Predictors of a significant increase in MAP were energy >10 V focused on the left renal artery, bilateral renal arteries, and bilateral renal veins (especially the mid segment). Overall, heart rate was unchanged, but muscle fasciculation was observed in 22.0% with an output >10 V (range 15-150 V). Analysis after excluding the stimulations that resulted in fasciculation yielded similar results to the main findings. Stimulation of intra-abdominal vasculatures promptly increased the MAP and thus may be a potential treatment option for hypotension in autonomic disorders. Predictors of optimal stimulation include energy delivery and the site of stimulation (for the renal vasculatures), which informs the design of subsequent research. © 2016 Wiley Periodicals, Inc.

  20. Behavioural and Autonomic Regulation of Response to Sensory Stimuli among Children: A Systematic Review of Relationship and Methodology.

    Science.gov (United States)

    Gomez, Ivan Neil; Lai, Cynthia Y Y; Morato-Espino, Paulin Grace; Chan, Chetwyn C H; Tsang, Hector W H

    2017-01-01

    Previous studies have explored the correlates of behavioural and autonomic regulation of response to sensory stimuli in children; however, a comprehensive review of such relationship is lacking. This systematic review was performed to critically appraise the current evidence on such relationship and describe the methods used in these studies. Online databases were systematically searched for peer-reviewed, full-text articles in the English language between 1999 and 2016, initially screened by title and abstract, and appraised and synthesized by two independent review authors. Fourteen Level III-3 cross-sectional studies were included for systematic review, among which six studies explored the relationship between behaviour and physiological regulation of responses to sensory stimuli. Three studies reported significant positive weak correlations among ASD children; however, no correlations were found in typically developing children. Methodological differences related to individual differences among participants, measures used, and varied laboratory experimental setting were noted. This review suggests inconclusive evidence supporting the relationship between behavioural and physiological regulation of responses to sensory stimuli among children. Methodological differences may likely have confounded the results of the current evidence. We present methodological recommendations to address this matter for future researches. This trial is registered with PROSPERO registration number CRD42016043887.

  1. Behavioural and Autonomic Regulation of Response to Sensory Stimuli among Children: A Systematic Review of Relationship and Methodology

    Directory of Open Access Journals (Sweden)

    Ivan Neil Gomez

    2017-01-01

    Full Text Available Background. Previous studies have explored the correlates of behavioural and autonomic regulation of response to sensory stimuli in children; however, a comprehensive review of such relationship is lacking. This systematic review was performed to critically appraise the current evidence on such relationship and describe the methods used in these studies. Methods. Online databases were systematically searched for peer-reviewed, full-text articles in the English language between 1999 and 2016, initially screened by title and abstract, and appraised and synthesized by two independent review authors. Results. Fourteen Level III-3 cross-sectional studies were included for systematic review, among which six studies explored the relationship between behaviour and physiological regulation of responses to sensory stimuli. Three studies reported significant positive weak correlations among ASD children; however, no correlations were found in typically developing children. Methodological differences related to individual differences among participants, measures used, and varied laboratory experimental setting were noted. Conclusion. This review suggests inconclusive evidence supporting the relationship between behavioural and physiological regulation of responses to sensory stimuli among children. Methodological differences may likely have confounded the results of the current evidence. We present methodological recommendations to address this matter for future researches. This trial is registered with PROSPERO registration number CRD42016043887.

  2. Attend or defend? Sex differences in behavioral, autonomic, and respiratory response patterns to emotion-eliciting films.

    Science.gov (United States)

    Wilhelm, Frank H; Rattel, Julina A; Wegerer, Melanie; Liedlgruber, Michael; Schweighofer, Simon; Kreibig, Sylvia D; Kolodyazhniy, Vitaliy; Blechert, Jens

    2017-12-01

    Sex differences in emotional reactivity have been studied primarily for negative but less so for positive stimuli; likewise, sex differences in the psychophysiological response-patterning during such stimuli are poorly understood. Thus, the present study examined sex differences in response to negative/positive and high/low arousing films (classified as threat-, loss-, achievement-, and recreation-related, vs. neutral films), while measuring 18 muscular, autonomic, and respiratory parameters. Sex differences emerged for all films, but were most prominent for threat-related films: Despite equivalent valence and arousal ratings, women displayed more facial-muscular and respiratory responding than men and pronounced sympathetic activation (preejection period, other cardiovascular and electrodermal measures), while men showed coactivated sympathetic/parasympathetic responding (including increased respiratory sinus arrhythmia). This indicates a prototypical threat-related defense response in women, while men showed a pattern of sustained orienting, which can be understood as a shift toward less threat proximity in the defense cascade model. Clinical implications are discussed within a socio-evolutionary framework. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Autonomous houses. Autonomous house

    Energy Technology Data Exchange (ETDEWEB)

    Tanaka, S. (Tokai University, Tokyo (Japan). Faculty of Engineering)

    1991-09-30

    Self-sufficiency type houses are outlined. On condition that people gain a certain amount of income in relation with the society, they self-suffice under the given environment, allowing themselves to accept a minimum of industrial products with small environmental load. Ordinary supply from outside of fossil energy and materials which depend on it is minimized. Types are classified into three: energy, energy materials and perfect self-sufficiency. A study project for environment symbiotic houses is progressing which is planned by the Ministry of Construction and Institute of Building Energy Conservation and is invested by a private company. Its target is making a house for halving an environmental load by CO{sub 2}, for the purpose of creating the environment symbiotic house which is nice to and in harmony with the global environment and human beings. As a part of the studies on energy-saving and resource conservation on houses, introduced is a plan of an autonomous house at Izu-Atagawa. The passive method and high thermal-insulation are used for air conditioning, and hot spring water for hot water supply. Electric power is generated by hydroelectric power generation using mountain streams and by solar cells. Staple food is purchased, while subsidiary food is sufficed. 17 refs., 4 figs., 1 tab.

  4. Multi-Source Autonomous Response for Targeting and Monitoring of Volcanic Activity

    Science.gov (United States)

    Davies, Ashley G.; Doubleday, Joshua R.; Tran, Daniel Q.

    2014-01-01

    ' inputs. The software framework uses multiple source languages and is a general framework for combining inputs and incrementally submitting observation requests/reconfigurations, accounting for prior requests. The autonomous aspect of operations is unique, especially in the context of the wide range of inputs that includes manually inputted electronic reports (such as the Air Force Weather Advisories), automated satellite-based detection methods (such as MODVOLC and GOESVOLC), and in situ sensor networks.

  5. Personality change at the intersection of autonomic arousal and stress.

    Science.gov (United States)

    Hart, Daniel; Eisenberg, Nancy; Valiente, Carlos

    2007-06-01

    We hypothesized that personality change in children can be predicted by the interaction of family risk with susceptibility to autonomic arousal and that children characterized by both high-risk families and highly reactive autonomic nervous systems tend to show maladaptive change. This hypothesis was tested in a 6-year longitudinal study in which personality-type prototypicality, problem behavior, and negative emotional intensity were measured at 2-year intervals. The results indicated that children who both had exaggerated skin conductance responses (a measure of autonomic reactivity) and were living in families with multiple risk factors were most likely to develop an undercontrolled personality type and to exhibit increases in problem behavior and negative emotional intensity. The implications of the results for understanding personality change are discussed.

  6. Responsive Boronic Acid-Decorated (Co)polymers: From Glucose Sensors to Autonomous Drug Delivery.

    Science.gov (United States)

    Vancoillie, Gertjan; Hoogenboom, Richard

    2016-10-19

    Boronic acid-containing (co)polymers have fascinated researchers for decades, garnering attention for their unique responsiveness toward 1,2- and 1,3-diols, including saccharides and nucleotides. The applications of materials that exert this property are manifold including sensing, but also self-regulated drug delivery systems through responsive membranes or micelles. In this review, some of the main applications of boronic acid containing (co)polymers are discussed focusing on the role of the boronic acid group in the response mechanism. We hope that this summary, which highlights the importance and potential of boronic acid-decorated polymeric materials, will inspire further research within this interesting field of responsive polymers and polymeric materials.

  7. Responsive Boronic Acid-Decorated (Copolymers: From Glucose Sensors to Autonomous Drug Delivery

    Directory of Open Access Journals (Sweden)

    Gertjan Vancoillie

    2016-10-01

    Full Text Available Boronic acid-containing (copolymers have fascinated researchers for decades, garnering attention for their unique responsiveness toward 1,2- and 1,3-diols, including saccharides and nucleotides. The applications of materials that exert this property are manifold including sensing, but also self-regulated drug delivery systems through responsive membranes or micelles. In this review, some of the main applications of boronic acid containing (copolymers are discussed focusing on the role of the boronic acid group in the response mechanism. We hope that this summary, which highlights the importance and potential of boronic acid-decorated polymeric materials, will inspire further research within this interesting field of responsive polymers and polymeric materials.

  8. Chemical signals of fish skin for the attachment response of Acanthostomum brauni cercariae.

    Science.gov (United States)

    Haas, W; de Nuñez, M O

    1988-01-01

    The chemical signals of the skin surface of fish, which stimulate the attachment responses of Acanthostomum brauni cercariae, were identified by offering chemicals and fish-skin extracts in agarose substrates to the cercariae. Smaller molecules such as amino acids, fatty acids, monosaccharides, electrolytes, urea, and carbonate solutions did not stimulate attachments, but hyaluronic acid had some effects. Bovine submaxillary glycoproteins had a strong stimulating activity that disappeared after neuraminidase digestion. The stimulating components of the skin surface of fish were hydrophilic substances with molecular weights of more than 10,000. They were sensitive to neuraminidase digestion but not to hyaluronidase digestion and thus can be identified as glycoproteins. A. brauni cercariae respond only to the complete glycoprotein molecules and not to their monosaccharide components. The known attachment triggers of other cercariae are small molecules. Large glycoproteins as host signals for A. brauni cercariae may be an adaptation to muddy habitats, where various substances with low molecular weights may interfere with the host identification.

  9. Raman spectroscopy: in vivo quick response code of skin physiological status

    Science.gov (United States)

    Vyumvuhore, Raoul; Tfayli, Ali; Piot, Olivier; Le Guillou, Maud; Guichard, Nathalie; Manfait, Michel; Baillet-Guffroy, Arlette

    2014-11-01

    Dermatologists need to combine different clinically relevant characteristics for a better understanding of skin health. These characteristics are usually measured by different techniques, and some of them are highly time consuming. Therefore, a predicting model based on Raman spectroscopy and partial least square (PLS) regression was developed as a rapid multiparametric method. The Raman spectra collected from the five uppermost micrometers of 11 healthy volunteers were fitted to different skin characteristics measured by independent appropriate methods (transepidermal water loss, hydration, pH, relative amount of ceramides, fatty acids, and cholesterol). For each parameter, the obtained PLS model presented correlation coefficients higher than R2=0.9. This model enables us to obtain all the aforementioned parameters directly from the unique Raman signature. In addition to that, in-depth Raman analyses down to 20 μm showed different balances between partially bound water and unbound water with depth. In parallel, the increase of depth was followed by an unfolding process of the proteins. The combinations of all these information led to a multiparametric investigation, which better characterizes the skin status. Raman signal can thus be used as a quick response code (QR code). This could help dermatologic diagnosis of physiological variations and presents a possible extension to pathological characterization.

  10. The nonlinear flexural response of a whole teleost fish: Contribution of scales and skin.

    Science.gov (United States)

    Szewciw, Lawrence; Zhu, Deju; Barthelat, Francois

    2017-12-01

    The scaled skin of fish is an intricate system that provides mechanical protection against hard and sharp puncture, while maintaining the high flexural compliance required for unhindered locomotion. This unusual combination of local hardness and global compliance makes fish skin an interesting model for bioinspired protective systems. In this work we investigate the flexural response of whole teleost fish, and how scales may affect global flexural stiffness. A bending moment is imposed on the entire body of a striped bass (Morone saxatilis). Imaging is used to measure local curvature, to generate moment-curvature curves as function of position along the entire axis of the fish. We find that the flexural stiffness is the highest in the thick middle portion of the fish, and lowest in the caudal and rostral ends. The flexural response is nonlinear, with an initial soft response followed by significant stiffening at larger flexural deformations. Low flexural stiffness at low curvatures promotes efficient swimming, while higher stiffness at high curvatures enables a possible tendon effect, where the mechanical energy at the end of a stroke is stored in the form of strain energy in the fish skin. To assess the contribution of the scales to stiffening we performed flexural tests with and without scales, following a careful protocol to take in account tissue degradation and the effects of temperature. Our findings suggest that scales do not substantially increase the whole body flexural stiffness of teleost fish over ranges of deformations which are typical of swimming and maneuvering. Teleost scales are thin and relatively flexible, so they can accommodate large flexural deformations. This finding is in contrast to the bulkier ganoid scales which were shown in previous reports to have a profound impact of global flexural deformations and swimming in fish like gar or Polypterus. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Differences in finger skin contact cooling response between an arterial occlusion and a vasodilated condition.

    Science.gov (United States)

    Jay, Ollie; Havenith, George

    2006-05-01

    To assess the presence and magnitude of the effect of skin blood flow on finger skin cooling on contact with cold objects against the background of circulatory disorder risks in occupational exposures, this study investigates the effect of zero vs. close-to-maximal hand blood flow on short-term (cooling response at a contact pressure that allows capillary perfusion of the distal pulp of the fingertip. Six male volunteers touched a block of aluminium with a finger contact force of 0.5 N at a temperature of -2 degrees C under a vasodilated and an occluded condition. Before both conditions, participants were required to exercise in a hot room for > or = 30 min for cutaneous vasodilation to occur (increase in rectal temperature of 1 degrees C). Under the vasodilated condition, forearm blood flow rate rose as high as 16.8 ml.100 ml(-1).min(-1). Under the occluded condition, the arm was exsanguinated, after which a blood pressure cuff was secured on the wrist inducing arterial occlusion. Contact temperature of the finger pad during the subsequent cold contact exposure was measured. No significant difference was found between the starting skin temperatures for the two blood flow conditions, but a distinct difference in shape of the contact cooling curve was apparent between the two blood flow conditions, with Newtonian cooling observed under the occluded condition, whereas a rewarming of the finger skin toward the end of the exposure occurred for the vasodilated condition. Blood flow was found to significantly increase contact temperature from 40 s onward (P cooling during a vasodilated state.

  12. Staphylococcus aureus α-toxin modulates skin host response to viral infection.

    Science.gov (United States)

    Bin, Lianghua; Kim, Byung Eui; Brauweiler, Anne; Goleva, Elena; Streib, Joanne; Ji, Yinduo; Schlievert, Patrick M; Leung, Donald Y M

    2012-09-01

    Patients with atopic dermatitis (AD) with a history of eczema herpeticum have increased staphylococcal colonization and infections. However, whether Staphylococcus aureus alters the outcome of skin viral infection has not been determined. We investigated whether S aureus toxins modulated host response to herpes simplex virus (HSV) 1 and vaccinia virus (VV) infections in normal human keratinocytes (NHKs) and in murine infection models. NHKs were treated with S aureus toxins before incubation of viruses. BALB/c mice were inoculated with S aureus 2 days before VV scarification. Viral loads of HSV-1 and VV were evaluated by using real-time PCR, a viral plaque-forming assay, and immunofluorescence staining. Small interfering RNA duplexes were used to knockdown the gene expression of the cellular receptor of α-toxin, a disintegrin and metalloprotease 10 (ADAM10). ADAM10 protein and α-toxin heptamers were detected by using Western blot assays. We demonstrate that sublytic staphylococcal α-toxin increases viral loads of HSV-1 and VV in NHKs. Furthermore, we demonstrate in vivo that the VV load is significantly greater (P skin inoculated with an α-toxin-producing S aureus strain compared with murine skin inoculated with the isogenic α-toxin-deleted strain. The viral enhancing effect of α-toxin is mediated by ADAM10 and is associated with its pore-forming property. Moreover, we demonstrate that α-toxin promotes viral entry in NHKs. The current study introduces the novel concept that staphylococcal α-toxin promotes viral skin infection and provides a mechanism by which S aureus infection might predispose the host toward disseminated viral infections. Copyright © 2012 American Academy of Allergy, Asthma & Immunology. Published by Mosby, Inc. All rights reserved.

  13. Differential Gene Expression in Primary Human Skin Keratinocytes and Fibroblasts in Response to Ionizing Radiation

    Science.gov (United States)

    Warters, Raymond L.; Packard, Ann T.; Kramer, Gwen F.; Gaffney, David K.; Moos, Philip J.

    2009-01-01

    Although skin is usually exposed during human exposures to ionizing radiation, there have been no thorough examinations of the transcriptional response of skin fibroblasts and keratinocytes to radiation. The transcriptional response of quiescent primary fibroblasts and keratinocytes exposed to from 10 cGy to 5 Gy and collected 4 h after treatment was examined. RNA was isolated and examined by microarray analysis for changes in the levels of gene expression. Exposure to ionizing radiation altered the expression of 279 genes across both cell types. Changes in RNA expression could be arranged into three main categories: (1) changes in keratinocytes but not in fibroblasts, (2) changes in fibroblasts but not in keratinocytes, and (3) changes in both. All of these changes were primarily of p53 target genes. Similar radiation-induced changes were induced in immortalized fibroblasts or keratinocytes. In separate experiments, protein was collected and analyzed by Western blotting for expression of proteins observed in microarray experiments to be overexpressed at the mRNA level. Both Q-PCR and Western blot analysis experiments validated these transcription changes. Our results are consistent with changes in the expression of p53 target genes as indicating the magnitude of cell responses to ionizing radiation. PMID:19580510

  14. Postural vascular response in human skin: passive and active reactions to alteration of transmural pressure.

    Science.gov (United States)

    Jepsen, H; Gaehtgens, P

    1993-09-01

    Laser-Doppler (LD) fluxmetry was performed in the palmar finger skin of healthy subjects to study the mechanisms contributing to the postural vascular response. Local transmural pressure in the skin blood vessels of the region studied was altered for 1 min in two experimental series either by passive movement of the arm to different vertical hand positions relative to heart level or by application of external pressure (-120-180 mmHg) to the finger. Heart and respiratory rate, arterial blood pressure, and LD flux in the contralateral finger (kept at heart level) were measured. The measurements suggest a compound reaction of local (myogenic) and systemic (neurogenic) mechanisms: the local regulatory component appears as a graded active vascular response elicited by passive vessel distension or compression. A systemic component, associated with a single deep inspiration, is frequently observed during the actual movement of the arm. In addition, prolonged holding of the test hand in a given vertical position also elicits a delayed vascular response in the control hand at heart level, which may be generated by volume receptors in the intrathoracic low-pressure system.

  15. Seronegative and seropositive autoimmune autonomic ganglionopathy (AAG): Same clinical picture, same response to immunotherapy.

    Science.gov (United States)

    Tijero, Beatriz; Del Pino, Rocio; Pérez-Concha, Tomás; Acera, Maria Angeles; Gabilondo, Iñigo; Berganzo, Koldo; Graus, Frances; Martinez-Alday, Jesus Daniel; Barcena, Joseba; Gómez-Esteban, Juan Carlos

    2018-06-15

    Two patients with a syndrome of pandisautonomia with clinical criteria of AAG are provided. Both patients present a similar clinical picture and response to immunosuppressive treatment. One of them has positive antibodies against the ganglionic nicotinic acetylcholine (gAChr) and the other does not. This brief article serves to reflect the spectrum of AAG, at a clinical level, in laboratory tests and in the response to immunotherapy, independently of the presence of positive gAChr antibodies. Copyright © 2018 Elsevier B.V. All rights reserved.

  16. Autonomic cardiac regulation and morpho-physiological responses to eight week training preparation in junior soccer players

    Directory of Open Access Journals (Sweden)

    Michal Botek

    2014-09-01

    Full Text Available Background: Training preparation in soccer is thought to improve body composition and performance level, especially the maximal aerobic capacity (VO2max. However, an enhancement in performance may be attenuated by the increase of fatigue. Heart rate variability (HRV as a non-invasive index of autonomic nervous system (ANS activity has been considered to be a sensitive tool in fatigue assessment. Objective: This study was focused to evaluate the response of ANS activity and morpho-physiological parameters to eight week training preparation. Methods: Study included 12 trained soccer players aged 17.2 ± 1.2 years. Athletes underwent pre- and post-preparation testing that included the ANS activity assessment by spectral analysis of HRV in supine and upright position. Further, body composition was analyzed via electrical bio-impedance method and physiological parameters were assessed during maximal stress tests. ANS activity and subjective feeling of fatigue was assessed continuously within subsequent weeks of preparation. Results: No significant differences in all HRV variables within weeks were found. Pre vs. post analyses revealed a significant (p < .05 increase in body weight, fat free mass, body mass index, and peak power. A significant decline in mean maximal heart rate (HR and resting HR at standing was identified at the end of preparation. Since no significant changes between pre- post-preparation in the mean VO2max occurred, the positive correlation between the individual change in VO2max and the vagally related HRV [supine LnHF (r = .78, Ln rMSSD (r = .63, and the standing LnHF (r = .73, p < .05] was found. Conclusions: This study showed that an 8 week training program modified particularly fat free mass and short-term endurance, whereas both the autonomic cardiac regulation and the feeling of fatigue remained almost unaffected. Standing position seems to be more sensitive in terms of the HR response in relation to fatigue

  17. Skin-Resident T Cells Drive Dermal Dendritic Cell Migration in Response to Tissue Self-Antigen.

    Science.gov (United States)

    Ali, Niwa; Zirak, Bahar; Truong, Hong-An; Maurano, Megan M; Gratz, Iris K; Abbas, Abul K; Rosenblum, Michael D

    2018-05-01

    Migratory dendritic cell (DC) subsets deliver tissue Ags to draining lymph nodes (DLNs) to either initiate or inhibit T cell-mediated immune responses. The signals mediating DC migration in response to tissue self-antigen are largely unknown. Using a mouse model of inducible skin-specific self-antigen expression, we demonstrate that CD103 + dermal DCs (DDCs) rapidly migrate from skin to skin DLN (SDLNs) within the first 48 h after Ag expression. This window of time was characterized by the preferential activation of tissue-resident Ag-specific effector T cells (Teffs), with no concurrent activation of Ag-specific Teffs in SDLNs. Using genetic deletion and adoptive transfer approaches, we show that activation of skin-resident Teffs is required to drive CD103 + DDC migration in response to tissue self-antigen and this Batf3-dependent DC population is necessary to mount a fulminant autoimmune response in skin. Conversely, activation of Ag-specific Teffs in SDLNs played no role in DDC migration. Our studies reveal a crucial role for skin-resident T cell-derived signals, originating at the site of self-antigen expression, to drive DDC migration during the elicitation phase of an autoimmune response. Copyright © 2018 by The American Association of Immunologists, Inc.

  18. Transcranial Doppler and cardiovascular responses during cardiovascular autonomic tests in migraineurs during and outside attacks

    DEFF Research Database (Denmark)

    Thomsen, L L; Iversen, Helle Klingenberg; Boesen, F

    1995-01-01

    during unilateral attacks of migraine without aura. Transcranial Doppler examinations of middle cerebral artery (MCA) blood velocity showed no differences between migraineurs and healthy subjects and no difference between migraineurs experiencing an attack and outside an attack when examined in response...

  19. Fibroblast radiosensitivity versus acute and late normal skin responses in patients treated for breast cancer

    International Nuclear Information System (INIS)

    Brock, William A.; Tucker, Susan L.; Geara, Fady B.; Wike, Jennifer; Peters, Lester J.; Turesson, Ingela; Nyman, Jan

    1995-01-01

    Purpose/Objective: To determine if the radiosensitivity of normal human skin fibroblasts, measured in early passage cultures, is significantly correlated with the degree of acute or late normal skin damage in patients treated for breast cancer with radiotherapy. Methods and Materials: In the 1970s, a series of breast cancer patients was treated at the Department of Oncology in Gothenburg, Sweden with postoperative irradiation to the parasternal region. Patients were treated bilaterally using different fractionation schedules and doses to the right and left fields. Peak acute reactions were scored on a six-point scale, and skin erythema was measured by reflectance spectrophotometry. Telangiectasia was graded over time on a six-point scale. In April 1992, two small skin biopsies were obtained from 22 patients in two treatment groups (i.e., four dose-fractionation schedules) and, using either delayed or immediate plating, fibroblast radiosensitivity was measured in early passage cultures by clonogenic survival, after high and low dose-rate irradiations. Survival at 2.0 Gy (SF2) was calculated from complete survival curves. Results: To test assay reproducibility, SF2 values derived from paired biopsies of the same patient (12 cases) were compared. A reasonably good correlation (p = 0.075) was obtained for SF2s determined by high dose-rate irradiations with immediate plating, but not for delayed plating or low dose-rate treatments. The median coefficient of variation in the replicate SF2s after high dose-rate treatment and immediate plating was 13%, suggesting that the poor correlation in paired SF2 values is due to the magnitude of the uncertainty in SF2 relative to the overall spread in SF2 values between patients (CV = 28%). Individual SF2 values and averaged values from patients with data from two biopsies were compared with the acute and late clinical reactions. A significant negative correlation was found between SF2 and relative clinical response, but only when

  20. 575 Photoaging Attenuates Skin Test Response to Histamine More Than Natural Aging

    OpenAIRE

    King, Monroe James; Fitzhugh, David; Lockey, Richard F.

    2012-01-01

    Background Clinical experience suggests that skin test reactivity is often decreased in photo-exposed skin versus sun-protected skin in older individuals. The current study was designed to address whether photoaging or natural aging of skin causes a greater diminution in skin test reponse. Methods Prick-puncture skin tests to histamine were performed on sun-exposed and sun-protected areas in younger (n = 61, age 20–50) and older (n = 63, age 60–87) adult volunteers who were recruited for skin...

  1. Heart rate variability reveals that a decrease in parasympathetic ('rest-and-digest') activity dominates autonomic stress responses in a free-living seabird.

    Science.gov (United States)

    Müller, Martina S; Vyssotski, Alexei L; Yamamoto, Maki; Yoda, Ken

    2017-10-01

    The autonomic stress response, often referred to as the 'fight-or-flight' response, is a highly conserved physiological reaction to stress in vertebrates that occurs via a decrease in parasympathetic (PNS) activity, which promotes self-maintenance 'rest and digest' processes, and an increase in sympathetic (SNS) activity, which prepares an animal for danger ('fight-or-flight'). Though the PNS and SNS both innervate most organs, they often control different tissues and functions within those organs (though the pacemaker of the heart is controlled by both). Moreover the PNS and SNS are regulated independently. Yet until now, most studies of autonomic stress responses in non-model species focused only on the SNS response. We used external electrocardiogram loggers to measure heart rate and heart rate variability indexes that reflect PNS and SNS activity in a seabird, the Streaked Shearwater (Calonectris leucomelas), during the stress of handling, and during recovery in the nest burrow or during restraint in a cloth bag. We show for the first time in a free-living animal that the autonomic stress response is mediated primarily by a rapid decrease in PNS activity: handling stress induced a large and long-lasting depression of PNS 'rest-and-digest' activity that required two hours to recover. We also found evidence for a substantially smaller and shorter-lasting SNS 'fight-or-flight' response. Confinement in a cloth bag was less stressful for birds than handling, but more stressful than recovering in nest burrows. We show that quantifying autonomic activity from heart rate variability is effective for non-invasively studying stress physiology in free-living animals. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Ensuring 3es and Responsiveness in the Delivery of Educational Services in the Autonomous Region in Muslim Mindanao, Philippines

    Directory of Open Access Journals (Sweden)

    Sapia Moalam Abdulrachman

    2013-08-01

    Full Text Available The Autonomous Region in Muslim Mindanao (ARMM is a public organization in the Philippines located in between the national government and the local governments. It performs unique functions quite distinct from other public organizations in the coun-try, as it performs both political and administrative functions. Using unobtrusive research design, as it relies on mostly secondary data, this paper analyzes the educational system in the region and proposes strategies in attaining administrative efficiency, economy, effectiveness and responsiveness. The paper starts with the introduction which consist of the background and statement of the problem. It is followed by a review of theoretical perspective and then by the research methodology. The fourth part portrays the findings of the study which include: DepEd ARMM resources; the management of DepEd ARMM, and the management outputs such as: net enrollment ratio, achievement rate and literacy rate. The fifth part of the paper deals with the analyses and conclusion. The paper concludes that in addition to certain structural innovation, inculcation of appropriate work ethics in accordance with the Ethi-cal Standards Act, the Anti-Corruption Law, the Civil Service Rules and Regulations as well as the Islamic Practices on Employment must be enshrined in the reform agenda. Finally, among other things that could facilitate the attainment of 3Es and R in the delivery of educational services is a strategy that requires the joint collaboration and teamwork between the civil society, non-government organizations and government organizations in the region.

  3. Sex-specific effects of intranasal oxytocin on autonomic nervous system and emotional responses to couple conflict

    Science.gov (United States)

    Nater, Urs M.; Schaer, Marcel; La Marca, Roberto; Bodenmann, Guy; Ehlert, Ulrike; Heinrichs, Markus

    2013-01-01

    Unhappy couple relationships are associated with impaired individual health, an effect thought to be mediated through ongoing couple conflicts. Little is known, however, about the underlying mechanisms regulating psychobiological stress, and particularly autonomic nervous system (ANS) reactivity, during negative couple interaction. In this study, we tested the effects of the neuropeptide oxytocin on ANS reactivity during couple conflict in a standardized laboratory paradigm. In a double-blind, placebo-controlled design, 47 heterosexual couples (total n = 94) received oxytocin or placebo intranasally prior to instructed couple conflict. Participants’ behavior was videotaped and salivary alpha-amylase (sAA), a measure of sympathetic activity, and emotional arousal were repeatedly measured during the experiment. Oxytocin significantly reduced sAA during couple conflict in women, whereas men showed increases in sAA levels (sex × group interaction: B = −49.36, t = −2.68, P = 0.009). In men, these increases were related to augmented emotional arousal (r = 0.286, P = 0.028) and more positive behavior (r = 0.291, P = 0.026), whereas there was no such association in women. Our results imply sex-specific effects of oxytocin on sympathetic activity, to negative couple interaction, with the neuropeptide reducing sAA responses and emotional arousal in women while increasing them in men. PMID:22842905

  4. Evaluating Autonomic Parameters: The Role of ‎Sleep ‎Duration in Emotional Responses to Music ‎

    Directory of Open Access Journals (Sweden)

    Atefeh Goshvarpour

    2016-02-01

    Full Text Available Objective: It has been recognized that sleep has an important effect on emotion processing. The aim ‎of this study was to investigate the effect of previous night sleep duration on autonomicresponses to musical stimuli in different emotional contexts.‎Method: A frequency based measure of GSR, PR and ECG signals were examined in 35 healthy ‎students in three groups of oversleeping, lack of sleep and normal sleep. ‎Results: The results of this study revealed that regardless of the emotional context of the musical ‎stimuli (happy, relax, fear, and sadness, there was an increase in the maximum power of ‎GSR, ECG and PR during the music time compared to the rest time in all the three ‎groups. In addition, the higher value of these measures was achieved while the ‎participants listened to relaxing music. Statistical analysis of the extracted features ‎between each pair of emotional states revealed that the most significant differences ‎were attained for ECG signals. These differences were more obvious in the participants ‎with normal sleeping (p<10-18. The higher value of the indices has been shown, ‎comparing long sleep duration with the normal one.‎Conclusion: There was a strong relation between emotion and sleep duration, and this association can ‎be observed by means of the ECG signals.‎ 

  5. Cooling reduces the cutaneous afferent firing response to vibratory stimuli in glabrous skin of the human foot sole.

    Science.gov (United States)

    Lowrey, Catherine R; Strzalkowski, Nicholas D J; Bent, Leah R

    2013-02-01

    Skin on the foot sole plays an important role in postural control. Cooling the skin of the foot is often used to induce anesthesia to determine the role of skin in motor and balance control. The effect of cooling on the four classes of mechanoreceptor in the skin is largely unknown, and thus the aim of the present study was to characterize the effects of cooling on individual skin receptors in the foot sole. Such insight will better isolate individual receptor contributions to balance control. Using microneurography, we recorded 39 single nerve afferents innervating mechanoreceptors in the skin of the foot sole in humans. Afferents were identified as fast-adapting (FA) or slowly adapting (SA) type I or II (FA I n = 16, FA II n = 7, SA I n = 6, SA II n = 11). Receptor response to vibration was compared before and after cooling of the receptive field (2-20 min). Overall, firing response was abolished in 30% of all receptors, and this was equally distributed across receptor type (P = 0.69). Longer cooling times were more likely to reduce firing response below 50% of baseline; however, some afferent responses were abolished with shorter cooling times (2-5 min). Skin temperature was not a reliable indicator of the level of receptor activation and often became uncoupled from receptor response levels, suggesting caution in the use of this parameter as an indicator of anesthesia. When cooled, receptors preferentially coded lower frequencies in response to vibration. In response to a sustained indentation, SA receptors responded more like FA receptors, primarily coding "on-off" events.

  6. Syk/Src Pathway-Targeted Inhibition of Skin Inflammatory Responses by Carnosic Acid

    Directory of Open Access Journals (Sweden)

    Jueun Oh

    2012-01-01

    Full Text Available Carnosic acid (CA is a diterpene compound exhibiting antioxidative, anticancer, anti-angiogenic, anti-inflammatory, anti-metabolic disorder, and hepatoprotective and neuroprotective activities. In this study, the effect of CA on various skin inflammatory responses and its inhibitory mechanism were examined. CA strongly suppressed the production of IL-6, IL-8, and MCP-1 from keratinocyte HaCaT cells stimulated with sodium lauryl sulfate (SLS and retinoic acid (RA. In addition, CA blocked the release of nitric oxide (NO, tumor necrosis factor (TNF-α, and prostaglandin E2 (PGE2 from RAW264.7 cells activated by the toll-like receptor (TLR-2 ligands, Gram-positive bacterium-derived peptidoglycan (PGN and pam3CSK, and the TLR4 ligand, Gram-negative bacterium-derived lipopolysaccharide (LPS. CA arrested the growth of dermatitis-inducing Gram-positive and Gram-negative microorganisms such Propionibacterium acnes, Pseudomonas aeruginosa, and Staphylococcus aureus. CA also blocked the nuclear translocation of nuclear factor (NF-κB and its upstream signaling including Syk/Src, phosphoinositide 3-kinase (PI3K, Akt, inhibitor of κBα (IκBα kinase (IKK, and IκBα for NF-κB activation. Kinase assays revealed that Syk could be direct enzymatic target of CA in its anti-inflammatory action. Therefore, our data strongly suggest the potential of CA as an anti-inflammatory drug against skin inflammatory responses with Src/NF-κB inhibitory properties.

  7. Optimisation of gelatin extraction from Unicorn leatherjacket (Aluterus monoceros) skin waste: response surface approach.

    Science.gov (United States)

    Hanjabam, Mandakini Devi; Kannaiyan, Sathish Kumar; Kamei, Gaihiamngam; Jakhar, Jitender Kumar; Chouksey, Mithlesh Kumar; Gudipati, Venkateshwarlu

    2015-02-01

    Physical properties of gelatin extracted from Unicorn leatherjacket (Aluterus monoceros) skin, which is generated as a waste from fish processing industries, were optimised using Response Surface Methodology (RSM). A Box-Behnken design was used to study the combined effects of three independent variables, namely phosphoric acid (H3PO4) concentration (0.15-0.25 M), extraction temperature (40-50 °C) and extraction time (4-12 h) on different responses like yield, gel strength and melting point of gelatin. The optimum conditions derived by RSM for the yield (10.58%) were 0.2 M H3PO4 for 9.01 h of extraction time and hot water extraction of 45.83 °C. The maximum achieved gel strength and melting point was 138.54 g and 22.61 °C respectively. Extraction time was found to be most influencing variable and had a positive coefficient on yield and negative coefficient on gel strength and melting point. The results indicated that Unicorn leatherjacket skins can be a source of gelatin having mild gel strength and melting point.

  8. Laser speckle contrast imaging of skin blood perfusion responses induced by laser coagulation

    Energy Technology Data Exchange (ETDEWEB)

    Ogami, M; Kulkarni, R; Wang, H; Reif, R; Wang, R K [University of Washington, Department of Bioengineering, Seattle, Washington 98195 (United States)

    2014-08-31

    We report application of laser speckle contrast imaging (LSCI), i.e., a fast imaging technique utilising backscattered light to distinguish such moving objects as red blood cells from such stationary objects as surrounding tissue, to localise skin injury. This imaging technique provides detailed information about the acute perfusion response after a blood vessel is occluded. In this study, a mouse ear model is used and pulsed laser coagulation serves as the method of occlusion. We have found that the downstream blood vessels lacked blood flow due to occlusion at the target site immediately after injury. Relative flow changes in nearby collaterals and anastomotic vessels have been approximated based on differences in intensity in the nearby collaterals and anastomoses. We have also estimated the density of the affected downstream vessels. Laser speckle contrast imaging is shown to be used for highresolution and fast-speed imaging for the skin microvasculature. It also allows direct visualisation of the blood perfusion response to injury, which may provide novel insights to the field of cutaneous wound healing. (laser biophotonics)

  9. Laser speckle contrast imaging of skin blood perfusion responses induced by laser coagulation

    Science.gov (United States)

    Ogami, M.; Kulkarni, R.; Wang, H.; Reif, R.; Wang, R. K.

    2014-08-01

    We report application of laser speckle contrast imaging (LSCI), i.e., a fast imaging technique utilising backscattered light to distinguish such moving objects as red blood cells from such stationary objects as surrounding tissue, to localise skin injury. This imaging technique provides detailed information about the acute perfusion response after a blood vessel is occluded. In this study, a mouse ear model is used and pulsed laser coagulation serves as the method of occlusion. We have found that the downstream blood vessels lacked blood flow due to occlusion at the target site immediately after injury. Relative flow changes in nearby collaterals and anastomotic vessels have been approximated based on differences in intensity in the nearby collaterals and anastomoses. We have also estimated the density of the affected downstream vessels. Laser speckle contrast imaging is shown to be used for highresolution and fast-speed imaging for the skin microvasculature. It also allows direct visualisation of the blood perfusion response to injury, which may provide novel insights to the field of cutaneous wound healing.

  10. Impact of Age and Insulin-Like Growth Factor-1 on DNA Damage Responses in UV-Irradiated Human Skin.

    Science.gov (United States)

    Kemp, Michael G; Spandau, Dan F; Travers, Jeffrey B

    2017-02-26

    The growing incidence of non-melanoma skin cancer (NMSC) necessitates a thorough understanding of its primary risk factors, which include exposure to ultraviolet (UV) wavelengths of sunlight and age. Whereas UV radiation (UVR) has long been known to generate photoproducts in genomic DNA that promote genetic mutations that drive skin carcinogenesis, the mechanism by which age contributes to disease pathogenesis is less understood and has not been sufficiently studied. In this review, we highlight studies that have considered age as a variable in examining DNA damage responses in UV-irradiated skin and then discuss emerging evidence that the reduced production of insulin-like growth factor-1 (IGF-1) by senescent fibroblasts in the dermis of geriatric skin creates an environment that negatively impacts how epidermal keratinocytes respond to UVR-induced DNA damage. In particular, recent data suggest that two principle components of the cellular response to DNA damage, including nucleotide excision repair and DNA damage checkpoint signaling, are both partially defective in keratinocytes with inactive IGF-1 receptors. Overcoming these tumor-promoting conditions in aged skin may therefore provide a way to lower aging-associated skin cancer risk, and thus we will consider how dermal wounding and related clinical interventions may work to rejuvenate the skin, re-activate IGF-1 signaling, and prevent the initiation of NMSC.

  11. Impact of Age and Insulin-Like Growth Factor-1 on DNA Damage Responses in UV-Irradiated Human Skin

    Directory of Open Access Journals (Sweden)

    Michael G. Kemp

    2017-02-01

    Full Text Available The growing incidence of non-melanoma skin cancer (NMSC necessitates a thorough understanding of its primary risk factors, which include exposure to ultraviolet (UV wavelengths of sunlight and age. Whereas UV radiation (UVR has long been known to generate photoproducts in genomic DNA that promote genetic mutations that drive skin carcinogenesis, the mechanism by which age contributes to disease pathogenesis is less understood and has not been sufficiently studied. In this review, we highlight studies that have considered age as a variable in examining DNA damage responses in UV-irradiated skin and then discuss emerging evidence that the reduced production of insulin-like growth factor-1 (IGF-1 by senescent fibroblasts in the dermis of geriatric skin creates an environment that negatively impacts how epidermal keratinocytes respond to UVR-induced DNA damage. In particular, recent data suggest that two principle components of the cellular response to DNA damage, including nucleotide excision repair and DNA damage checkpoint signaling, are both partially defective in keratinocytes with inactive IGF-1 receptors. Overcoming these tumor-promoting conditions in aged skin may therefore provide a way to lower aging-associated skin cancer risk, and thus we will consider how dermal wounding and related clinical interventions may work to rejuvenate the skin, re-activate IGF-1 signaling, and prevent the initiation of NMSC.

  12. Cardiovascular and autonomic responses to physiological stressors before and after six hours of water immersion.

    Science.gov (United States)

    Florian, John P; Simmons, Erin E; Chon, Ki H; Faes, Luca; Shykoff, Barbara E

    2013-11-01

    The physiological responses to water immersion (WI) are known; however, the responses to stress following WI are poorly characterized. Ten healthy men were exposed to three physiological stressors before and after a 6-h resting WI (32-33°C): 1) a 2-min cold pressor test, 2) a static handgrip test to fatigue at 40% of maximum strength followed by postexercise muscle ischemia in the exercising forearm, and 3) a 15-min 70° head-up-tilt (HUT) test. Heart rate (HR), systolic and diastolic blood pressure (SBP and DBP), cardiac output (Q), limb blood flow (BF), stroke volume (SV), systemic and calf or forearm vascular resistance (SVR and CVR or FVR), baroreflex sensitivity (BRS), and HR variability (HRV) frequency-domain variables [low-frequency (LF), high-frequency (HF), and normalized (n)] were measured. Cold pressor test showed lower HR, SBP, SV, Q, calf BF, LFnHRV, and LF/HFHRV and higher CVR and HFnHRV after than before WI (P lower HR, SBP, SV, Q, and calf BF and higher SVR and CVR after than before WI (P lower after than before WI (P lower SBP, DBP, SV, forearm BF, and BRS and higher HR, FVR, LF/HFHRV, and LFnHRV after than before WI (P < 0.05). The changes suggest differential activation/depression during cold pressor and handgrip (reduced sympathetic/elevated parasympathetic) and HUT (elevated sympathetic/reduced parasympathetic) following 6 h of WI.

  13. Cardiac autonomic regulation in response to a mixed meal is impaired in obese children and adolescents: the role played by insulin resistance.

    Science.gov (United States)

    Cozzolino, Domenico; Esposito, Katherine; Palmiero, Giuseppe; De Bellis, Annamaria; Furlan, Raffaello; Perrotta, Silverio; Perrone, Laura; Torella, Daniele; Miraglia del Giudice, Emanuele

    2014-09-01

    Obesity in children/adolescents has been associated with subtle cardiac abnormalities, including myocardial dysfunction and cardiac autonomic dysregulation at rest, both likely responsible for a higher mortality in adulthood. Food intake induces remarkable adjustments of cardiovascular autonomic activity in healthy subjects. The objective of the study was to evaluate in obese children/adolescents meal-induced cardiac autonomic response and the role played by insulin resistance. Sixty-eight obese and 30 matched normal-weight children/adolescents underwent blood sampling and cardiovascular autonomic analysis while recumbent and 20 minutes after a mixed meal ingestion. Spectrum analysis of the R-R interval and systolic blood pressure (SBP) variability provided the indices of sympathetic [low frequency (LFRR)] and vagal [high frequency (HFRR)] modulation of the sinoatrial node and the low frequency component of SBP. The homeostasis model assessment of insulin resistance served to separate insulin resistant (n = 35) from non insulin resistant (n = 33) obese children/adolescents. At baseline, C-reactive protein, the LFRR to HFRR ratio, SBP, and low frequency oscillatory component of SBP variability in obese children/adolescents were significantly (P meal-induced increase in the LFRR to HFRR ratio was significantly less than in controls and exaggeratedly scanty (or opposite) among insulin resistant subjects. The homeostasis model assessment of insulin resistance index strongly and inversely correlated (r = -0.871; P meal-induced changes in the LFRR to HFRR ratio among obese subjects. Autonomic modulation of the heart was impaired after eating in obese children/adolescents. This abnormality was exaggerated among insulin resistant subjects and strongly correlated with the degree of insulin resistance.

  14. GENDER DIFFERENCES IN THE CARDIOVASCULAR AUTONOMIC RESPONSE DURING ISOMETRIC HANDGRIP EXERCISE

    Directory of Open Access Journals (Sweden)

    Rajasekhar

    2015-09-01

    Full Text Available Physical exercise can be regarded as a period of increased sympathetic activity with simultaneous parasympathetic withdrawal. Many circulatory changes occur during exercise due to mass sympathetic discharge. The exercise cap acity among gender may differ due to substantial anatomical, physiological, and morphological differences. AIMS & OBJECTIVES: To evaluate the gender difference in the cardiovascular response during isometric hand grip exercise. MATERIALS AND METHOD S: 30 healthy young adult male & 30 female students aged between 18 - 24 years who had no prior endurance training were asked to perform Isometric handgrip contractions using an isometric handgrip apparatus. The heart rate was calculated using BIOPAC MP30. Blood p ressure measurements were obtained using a sphygmomanometer. RESULTS & CONCLUSION: The results of the present study showed significant increase in the blood pressure values in men during isometric exercise compared to women which may be because of increase d catecholamine release to acute stress among men

  15. Illusory ownership of an invisible body reduces autonomic and subjective social anxiety responses

    Science.gov (United States)

    Guterstam, Arvid; Abdulkarim, Zakaryah; Ehrsson, H. Henrik

    2015-01-01

    What is it like to be invisible? This question has long fascinated man and has been the central theme of many classic literary works. Recent advances in materials science suggest that invisibility cloaking of the human body may be possible in the not-so-distant future. However, it remains unknown how invisibility affects body perception and embodied cognition. To address these questions, we developed a perceptual illusion of having an entire invisible body. Through a series of experiments, we characterized the multisensory rules that govern the elicitation of the illusion and show that the experience of having an invisible body reduces the social anxiety response to standing in front of an audience. This study provides an experimental model of what it is like to be invisible and shows that this experience affects bodily self-perception and social cognition. PMID:25906330

  16. Illusory ownership of an invisible body reduces autonomic and subjective social anxiety responses.

    Science.gov (United States)

    Guterstam, Arvid; Abdulkarim, Zakaryah; Ehrsson, H Henrik

    2015-04-23

    What is it like to be invisible? This question has long fascinated man and has been the central theme of many classic literary works. Recent advances in materials science suggest that invisibility cloaking of the human body may be possible in the not-so-distant future. However, it remains unknown how invisibility affects body perception and embodied cognition. To address these questions, we developed a perceptual illusion of having an entire invisible body. Through a series of experiments, we characterized the multisensory rules that govern the elicitation of the illusion and show that the experience of having an invisible body reduces the social anxiety response to standing in front of an audience. This study provides an experimental model of what it is like to be invisible and shows that this experience affects bodily self-perception and social cognition.

  17. Autonomous search

    CERN Document Server

    Hamadi, Youssef; Saubion, Frédéric

    2012-01-01

    Autonomous combinatorial search (AS) represents a new field in combinatorial problem solving. Its major standpoint and originality is that it considers that problem solvers must be capable of self-improvement operations. This is the first book dedicated to AS.

  18. Epidermal Rac1 regulates the DNA damage response and protects from UV-light-induced keratinocyte apoptosis and skin carcinogenesis

    Science.gov (United States)

    Deshmukh, Jayesh; Pofahl, Ruth; Haase, Ingo

    2017-01-01

    Non-melanoma skin cancer (NMSC) is the most common type of cancer. Increased expression and activity of Rac1, a small Rho GTPase, has been shown previously in NMSC and other human cancers; suggesting that Rac1 may function as an oncogene in skin. DMBA/TPA skin carcinogenesis studies in mice have shown that Rac1 is required for chemically induced skin papilloma formation. However, UVB radiation by the sun, which causes DNA damage, is the most relevant cause for NMSC. A potential role of Rac1 in UV-light-induced skin carcinogenesis has not been investigated so far. To investigate this, we irradiated mice with epidermal Rac1 deficiency (Rac1-EKO) and their controls using a well-established protocol for long-term UV-irradiation. Most of the Rac1-EKO mice developed severe skin erosions upon long-term UV-irradiation, unlike their controls. These skin erosions in Rac1-EKO mice healed subsequently. Surprisingly, we observed development of squamous cell carcinomas (SCCs) within the UV-irradiation fields. This shows that the presence of Rac1 in the epidermis protects from UV-light-induced skin carcinogenesis. Short-term UV-irradiation experiments revealed increased UV-light-induced apoptosis of Rac1-deficient epidermal keratinocytes in vitro as well as in vivo. Further investigations using cyclobutane pyrimidine dimer photolyase transgenic mice revealed that the observed increase in UV-light-induced keratinocyte apoptosis in Rac1-EKO mice is DNA damage dependent and correlates with caspase-8 activation. Furthermore, Rac1-deficient keratinocytes showed reduced levels of p53, γ-H2AX and p-Chk1 suggesting an attenuated DNA damage response upon UV-irradiation. Taken together, our data provide direct evidence for a protective role of Rac1 in UV-light-induced skin carcinogenesis and keratinocyte apoptosis probably through regulating mechanisms of the DNA damage response and repair pathways. PMID:28277539

  19. Epidermal Rac1 regulates the DNA damage response and protects from UV-light-induced keratinocyte apoptosis and skin carcinogenesis.

    Science.gov (United States)

    Deshmukh, Jayesh; Pofahl, Ruth; Haase, Ingo

    2017-03-09

    Non-melanoma skin cancer (NMSC) is the most common type of cancer. Increased expression and activity of Rac1, a small Rho GTPase, has been shown previously in NMSC and other human cancers; suggesting that Rac1 may function as an oncogene in skin. DMBA/TPA skin carcinogenesis studies in mice have shown that Rac1 is required for chemically induced skin papilloma formation. However, UVB radiation by the sun, which causes DNA damage, is the most relevant cause for NMSC. A potential role of Rac1 in UV-light-induced skin carcinogenesis has not been investigated so far. To investigate this, we irradiated mice with epidermal Rac1 deficiency (Rac1-EKO) and their controls using a well-established protocol for long-term UV-irradiation. Most of the Rac1-EKO mice developed severe skin erosions upon long-term UV-irradiation, unlike their controls. These skin erosions in Rac1-EKO mice healed subsequently. Surprisingly, we observed development of squamous cell carcinomas (SCCs) within the UV-irradiation fields. This shows that the presence of Rac1 in the epidermis protects from UV-light-induced skin carcinogenesis. Short-term UV-irradiation experiments revealed increased UV-light-induced apoptosis of Rac1-deficient epidermal keratinocytes in vitro as well as in vivo. Further investigations using cyclobutane pyrimidine dimer photolyase transgenic mice revealed that the observed increase in UV-light-induced keratinocyte apoptosis in Rac1-EKO mice is DNA damage dependent and correlates with caspase-8 activation. Furthermore, Rac1-deficient keratinocytes showed reduced levels of p53, γ-H2AX and p-Chk1 suggesting an attenuated DNA damage response upon UV-irradiation. Taken together, our data provide direct evidence for a protective role of Rac1 in UV-light-induced skin carcinogenesis and keratinocyte apoptosis probably through regulating mechanisms of the DNA damage response and repair pathways.

  20. Behavioral and autonomic responses to real and digital reproductions of works of art.

    Science.gov (United States)

    Siri, Francesca; Ferroni, Francesca; Ardizzi, Martina; Kolesnikova, Anna; Beccaria, Marcella; Rocci, Barbara; Christov-Bakargiev, Carolyn; Gallese, Vittorio

    2018-01-01

    Nowadays, works of art can be enjoyed in both their original and reproduced format. The aim of this study was to investigate whether the format of a work of art could influence physiological and cognitive responses in beholders. Two abstract works of art and their digital reproductions were selected as experimental stimuli and displayed for 2min to 60 participants in a museum. HRV, HR, and RMSSD were recorded, while participants observed the works of art. Subsequently, participants provided behavioral ratings of color intensity, emotional intensity, aesthetic evaluation, perceived movement, and desire to touch the works of art. Results demonstrated that the faithful high-quality digital reproduction of works of art could be as arousing as the original works of art, but at the same time, they cannot replace the experience of standing in front of an authentic work of art in terms of explicit hedonic attributed values. Furthermore, specific interactions between individual inclinations to identify with fictional characters and acquired art competences in the context of aesthetic experience were found. © 2018 Elsevier B.V. All rights reserved.

  1. A method for continuously assessing the autonomic response to music-induced emotions through HRV analysis.

    Science.gov (United States)

    Orini, Michele; Bailón, Raquel; Enk, Ronny; Koelsch, Stefan; Mainardi, Luca; Laguna, Pablo

    2010-05-01

    Interest in therapeutic applications of music has recently increased, as well as the effort to understand the relationship between music features and physiological patterns. In this study, we present a methodology for characterizing music-induced effects on the dynamics of the heart rate modulation. It consists of three steps: (i) the smoothed pseudo Wigner-Ville distribution is performed to obtain a time-frequency representation of HRV; (ii) a parametric decomposition is used to robustly estimate the time-course of spectral parameters; and (iii) statistical population analysis is used to continuously assess whether different acoustic stimuli provoke different dynamic responses. Seventy-five healthy subjects were repetitively exposed to pleasant music, sequences of Shepard tones with the same tempo as the pleasant music and unpleasant sounds overlaid with the same sequences of Shepard tones. Results show that the modification of HRV parameters are characterized by an early fast transient phase (15-20 s), followed by an almost stationary period. All kinds of stimuli provoked significant changes compared to the resting condition, while during listening to pleasant music the heart and respiratory rates were higher (for more than 80% of the duration of the stimuli, p < 10(-5)) and the power of the HF modulation was lower (for more than 70% of the duration of the stimuli, p < 0.05) than during listening to unpleasant stimuli.

  2. Stress effects on mood, HPA axis, and autonomic response: comparison of three psychosocial stress paradigms.

    Directory of Open Access Journals (Sweden)

    Grace E Giles

    Full Text Available Extensive experimental psychology research has attempted to parse the complex relationship between psychosocial stress, mood, cognitive performance, and physiological changes. To do so, it is necessary to have effective, validated methods to experimentally induce psychosocial stress. The Trier Social Stress Test (TSST is the most commonly used method of experimentally inducing psychosocial stress, but it is resource intensive. Less resource intense psychosocial stress tasks include the Socially Evaluative Cold Pressor Task (SECPT and a computerized mental arithmetic task (MAT. These tasks effectively produce a physiological and psychological stress response and have the benefits of requiring fewer experimenters and affording data collection from multiple participants simultaneously. The objective of this study was to compare the magnitude and duration of these three experimental psychosocial stress induction paradigms. On each of four separate days, participants completed either a control non-stressful task or one of the three experimental stressors: the TSST, SECPT, or MAT. We measured mood, working memory performance, salivary cortisol and alpha-amylase (AA, and heart rate. The TSST and SECPT exerted the most robust effects on mood and physiological measures. TSST effects were generally evident immediately post-stress as well as 10- and 20-minutes after stress cessation, whereas SECPT effects were generally limited to the duration of the stressor. The stress duration is a key determinant when planning a study that utilizes an experimental stressor, as researchers may be interested in collecting dependent measures prior to stress cessation. In this way, the TSST would allow the investigator a longer window to administer tasks of interest.

  3. Fibroblast radiosensitivity versus acute and late normal skin responses in patients treated for breast cancer

    International Nuclear Information System (INIS)

    Brock, W.A.; Wike, J.; Tucker, S.L.

    1995-01-01

    To determine if the radiosensitivity of normal human skin fibroblasts, measured in early passage cultures, is significantly correlated with the degree of acute or late normal skin damage in patients treated for breast cancer with radiotherapy. To test assay reproducibility, SF2 values derived from paired biopsies of the same patient (12 cases) were compared. A reasonably good correlation (p = 0.075) was obtained for SF2s determined by high dose-rate irradiations with immediated plating, but not for delayed plating or low dose-rate treatments. The median coefficient of variation in the replicate SF2s after high dose-rate treatment and immediate plating was 13%, suggesting that the poor correlation in paired SF2 values is due to the magnitude of the uncertainty in SF2 relative to the overall spread in SF2 values between patients (CV = 28%). Individual SF2 values and averaged values from patients with data from two biopsies were compared with the acute and late clinical reactions. A significant negative correlation was found between SF2 and relative clinical response, but only when averaged high dose-rate SF2 values and telangiectasia scores were compared. There was no significant correlation between average SF2 values and acute responses or between individual SF2 measurements and either the acute or late clinical response. The results of this study suggest that the degree of late telangiectasia is at least partially dependent upon the intrinsic cellular radiosensitivity of normal fibroblasts, but the relationship is not clear cut. Multiple replicate assays are necessary to obtain reliable estimates of fibroblast SF2 values using current techniques. 20 refs., 3 figs., 3 tabs

  4. Modeling the Mechanical Response of In Vivo Human Skin Under a Rich Set of Deformations

    KAUST Repository

    Flynn, Cormac

    2011-03-11

    Determining the mechanical properties of an individual\\'s skin is important in the fields of pathology, biomedical device design, and plastic surgery. To address this need, we present a finite element model that simulates the skin of the anterior forearm and posterior upper arm under a rich set of three-dimensional deformations. We investigated the suitability of the Ogden and Tong and Fung strain energy functions along with a quasi-linear viscoelastic law. Using non-linear optimization techniques, we found material parameters and in vivo pre-stresses for different volunteers. The model simulated the experiments with errors-of-fit ranging from 13.7 to 21.5%. Pre-stresses ranging from 28 to 92 kPa were estimated. We show that using only in-plane experimental data in the parameter optimization results in a poor prediction of the out-of-plane response. The identifiability of the model parameters, which are evaluated using different determinability criteria, improves by increasing the number of deformation orientations in the experiments. © 2011 Biomedical Engineering Society.

  5. Assessing the sensitivity of human skin hyperspectral responses to increasing anemia severity levels

    Science.gov (United States)

    Baranoski, Gladimir V. G.; Dey, Ankita; Chen, Tenn F.

    2015-09-01

    Anemia is a prevalent medical condition that seriously affects millions of people all over the world. In many regions, not only its initial detection but also its monitoring are hindered by limited access to laboratory facilities. This situation has motivated the development of a wide range of optical devices and procedures to assist physicians in these tasks. Although noticeable progress has been achieved in this area, the search for reliable, low-cost, and risk-free solutions still continues, and the strengthening of the knowledge base about this disorder and its effects is essential for the success of these initiatives. We contribute to these efforts by closely examining the sensitivity of human skin hyperspectral responses (within and outside the visible region of the light spectrum) to reduced hemoglobin concentrations associated with increasing anemia severity levels. This investigation, which involves skin specimens with distinct biophysical and morphological characteristics, is supported by controlled in silico experiments performed using a predictive light transport model and measured data reported in the biomedical literature. We also propose a noninvasive procedure to be employed in the monitoring of this condition at the point-of-care.

  6. Imaging immune response of skin mast cells in vivo with two-photon microscopy

    Science.gov (United States)

    Li, Chunqiang; Pastila, Riikka K.; Lin, Charles P.

    2012-02-01

    Intravital multiphoton microscopy has provided insightful information of the dynamic process of immune cells in vivo. However, the use of exogenous labeling agents limits its applications. There is no method to perform functional imaging of mast cells, a population of innate tissue-resident immune cells. Mast cells are widely recognized as the effector cells in allergy. Recently their roles as immunoregulatory cells in certain innate and adaptive immune responses are being actively investigated. Here we report in vivo mouse skin mast cells imaging with two-photon microscopy using endogenous tryptophan as the fluorophore. We studied the following processes. 1) Mast cells degranulation, the first step in the mast cell activation process in which the granules are released into peripheral tissue to trigger downstream reactions. 2) Mast cell reconstitution, a procedure commonly used to study mast cells functioning by comparing the data from wild type mice, mast cell-deficient mice, and mast-cell deficient mice reconstituted with bone marrow-derived mast cells (BMMCs). Imaging the BMMCs engraftment in tissue reveals the mast cells development and the efficiency of BMMCs reconstitution. We observed the reconstitution process for 6 weeks in the ear skin of mast cell-deficient Kit wsh/ w-sh mice by two-photon imaging. Our finding is the first instance of imaging mast cells in vivo with endogenous contrast.

  7. Modeling the Mechanical Response of In Vivo Human Skin Under a Rich Set of Deformations

    KAUST Repository

    Flynn, Cormac; Taberner, Andrew; Nielsen, Poul

    2011-01-01

    Determining the mechanical properties of an individual's skin is important in the fields of pathology, biomedical device design, and plastic surgery. To address this need, we present a finite element model that simulates the skin of the anterior

  8. A rare subset of skin-tropic regulatory T cells expressing Il10/Gzmb inhibits the cutaneous immune response.

    Science.gov (United States)

    Ikebuchi, Ryoyo; Teraguchi, Shunsuke; Vandenbon, Alexis; Honda, Tetsuya; Shand, Francis H W; Nakanishi, Yasutaka; Watanabe, Takeshi; Tomura, Michio

    2016-10-19

    Foxp3 + regulatory T cells (Tregs) migrating from the skin to the draining lymph node (dLN) have a strong immunosuppressive effect on the cutaneous immune response. However, the subpopulations responsible for their inhibitory function remain unclear. We investigated single-cell gene expression heterogeneity in Tregs from the dLN of inflamed skin in a contact hypersensitivity model. The immunosuppressive genes Ctla4 and Tgfb1 were expressed in the majority of Tregs. Although Il10-expressing Tregs were rare, unexpectedly, the majority of Il10-expressing Tregs co-expressed Gzmb and displayed Th1-skewing. Single-cell profiling revealed that CD43 + CCR5 + Tregs represented the main subset within the Il10/Gzmb-expressing cell population in the dLN. Moreover, CD43 + CCR5 + CXCR3 - Tregs expressed skin-tropic chemokine receptors, were preferentially retained in inflamed skin and downregulated the cutaneous immune response. The identification of a rare Treg subset co-expressing multiple immunosuppressive molecules and having tissue-remaining capacity offers a novel strategy for the control of skin inflammatory responses.

  9. Are We Afraid of Different Categories of Stimuli in Identical Ways? Evidence from Skin Conductance Responses

    Science.gov (United States)

    Yang, Jiongjiong

    2013-01-01

    Studies have shown that emotional pictures attract more attention than neutral pictures, and pictures of living stimuli have similar advantage in driving attention (vs. nonliving). However, factors of emotion, category and picture context are usually mixed so that whether living and nonliving categories elicit different skin conductance (SC) responses, in both conscious and unconscious conditions, remains to be clarified. In this study, participants were presented with negative and neutral pictures denoting different living and nonliving concepts in conscious (Experiments 1 and 2) and unconscious conditions (40ms, Experiment 3) when their SC responses were measured. The picture context was manipulated in Experiments 2 and 3 as half including human-related information. In three experiments, the emotional levels of different categories were matched in different and identical cohorts of participants. The results showed that living pictures in a negative, high-arousing dimension elicited stronger SC responses than nonliving pictures. When nonhuman animals and inanimate objects were compared, the increased SC responses to animals was obtained only for negative pictures without human contexts in the conscious condition, but regardless of human context in the unconscious condition. These results suggested that contextual information and level of conscious awareness are important to modulate the animate advantage in emotional processing. PMID:24039879

  10. Histamine response and local cooling in the human skin: involvement of H1- and H2-receptors.

    Science.gov (United States)

    Grossmann, M; Jamieson, M J; Kirch, W

    1999-08-01

    Histamine may contribute locally to cutaneous blood flow control under normal and pathologic conditions. The objective of this study was to observe the influence of skin temperature on histamine vasodilation, and the roles of H1-and H2-receptors using novel noninvasive methods. Eleven healthy subjects received, double-blind, single doses of the H1-receptor antagonist cetirizine (10 mg), cetirizine (10 mg) plus the H2-receptor antagonist cimetidine (400 mg), or placebo on separate occasions. Histamine was dosed cumulatively by iontophoresis to the forearm skin at 34 degrees C and 14 degrees C. Laser-Doppler flux (LDF) was measured at the same sites using customised probeholder/iontophoretic chambers with Peltier cooling elements. Finger mean arterial pressure (MAP) was measured and cutaneous vascular conductance calculated as LDF/MAP. Histamine vasodilation was reduced in cold skin. Cetirizine shifted the histamine dose-response at both temperatures: statistically significantly at 14 degrees C only. Combined H1- and H2-receptor antagonism shifted the response significantly at both temperatures. H1- and H2-receptors mediate histamine-induced skin vasodilation. The sensitivity of these receptors, particularly the H1- receptor, is attenuated at low skin temperature. Whether the reduced effect in cold skin represents specific receptor or postreceptor desensitization, or nonspecific attenuation of cutaneous vasodilation remains to be elucidated.

  11. The response of previously irradiated mouse skin to heat alone or combined with irradiation: influence of thermotolerance

    International Nuclear Information System (INIS)

    Wondergem, J.; Haveman, J.

    1983-01-01

    The effect of previous x-irradiation on the response to hyperthermia (44 0 C), x-irradiation, and irradiation combined with hyperthermia (43 0 C or 44 0 C) was studied in mouse foot skin. Irradiation of mice feet 90 days before, with 20 Gy, increased the subsequent response to heat alone, or combined with irradiation, as well as to irradiation alone. It had little effect on the thermal enhancement ratios for both acute and late skin reactions. Memory of the previous irradiation treatment could be masked when the temperature of the subsequent heat treatment alone, or combined with irradiation, was 44 0 C. Priming heat treatment induced resistance to a subsequent heat treatment and to a subsequent combined irradiation-heat treatment in normal as well as previously irradiated skin. When late skin reaction was considered, a larger 'memory' of the previous irradiation treatment was always evident, compared to acute skin reaction: the 'remembered' dose in the late skin reaction was about twice the 'remembered' dose in the acute reaction. (U.K.)

  12. Detecting electroporation by assessing the time constants in the exponential response of human skin to voltage controlled impulse electrical stimulation.

    Science.gov (United States)

    Bîrlea, Sinziana I; Corley, Gavin J; Bîrlea, Nicolae M; Breen, Paul P; Quondamatteo, Fabio; OLaighin, Gearóid

    2009-01-01

    We propose a new method for extracting the electrical properties of human skin based on the time constant analysis of its exponential response to impulse stimulation. As a result of this analysis an adjacent finding has arisen. We have found that stratum corneum electroporation can be detected using this analysis method. We have observed that a one time-constant model is appropriate for describing the electrical properties of human skin at low amplitude applied voltages (30V). Higher voltage amplitudes (>30V) have been proven to create pores in the skin's stratum corneum which offer a new, lower resistance, pathway for the passage of current through the skin. Our data shows that when pores are formed in the stratum corneum they can be detected, in-vivo, due to the fact that a second time constant describes current flow through them.

  13. Analysis of skin conductance response during evaluation of preferences for cosmetic products

    Science.gov (United States)

    Ohira, Hideki; Hirao, Naoyasu

    2015-01-01

    We analyzed skin conductance response (SCR) as a psychophysiological index to evaluate affective aspects of consumer preferences for cosmetic products. To examine the test-retest reliability of association between preferences and SCR, we asked 33 female volunteers to complete two experimental sessions approximately 1 year apart. The participants indicated their preferences in a typical paired comparison task by choosing the better option from a combination of two products among four products. We measured anticipatory SCR prior to expressions of the preferences. We found that the mean amplitude of the SCR elicited by the preferred products was significantly larger than that elicited by the non-preferred products. The participants' preferences and corresponding SCR patterns were well preserved at the second session 1 year later. Our results supported cumulating findings that SCR is a useful index of consumer preferences that has future potential, both in laboratory and marketing settings. PMID:25709593

  14. The response of mouse skin to multiple small doses of radiation

    International Nuclear Information System (INIS)

    Denekamp, J.; Harris, S.R.

    1975-01-01

    The response of mouse skin has been tested by irradiating the foot of albino mice and scoring erythema and desquamation during the following month. Multiple small doses of 150, 250 and 350 rad have been given 'daily', and the test dose necessary to achieve a given reaction has been determined one day after the last small fraction. This test dose has been compared with the single dose necessary to produce the same reaction level in previously untreated mice, in order to determine the ratio of the slopes of the dose-response curve at low and high doses: Slope ratio = (single dose - test dose)/total fractionated priming dose. In three separate experiments the slope ratio decreased as the dose per fraction was reduced from 350 to 150 rad. This conflicts with the data of Dutreix et al, who found a constant slope ratio over this dose range. The present data are compared with those obtained by Denekamp using 4, 9 and 14 fractions of 300 rad and by Douglas et al, using the same experimental technique, over the dose range 45 to 200 rad/fraction. In addition, the results from multifraction experiments in which equal dose increments were administered until the requisite skin reaction was achieved are also analysed in terms of their slope ratio (Fowler et al. Douglas et al). When all these results are plotted it is impossible to be sure whether the slope ratio is decreasing over the range 300 to 45 rad per fraction, although it seems likely. Most of the values at low doses lie in the range 0.15 to 0.25, indicating that at low doses the radiation is only 15 to 25% as effective per rad in causing cell death as at higher doses. (author)

  15. Comparison of blood volume pulse and skin conductance responses to mental and affective stimuli at different anatomical sites

    International Nuclear Information System (INIS)

    Kushki, Azadeh; Fairley, Jillian; Merja, Satyam; King, Gillian; Chau, Tom

    2011-01-01

    Measurements of blood volume pulse (BVP) and skin conductance are commonly used as indications of psychological arousal in affective computing and human–machine interfaces. To date, palmar surfaces remain the primary site for these measurements. Placement of sensors on palmar surfaces, however, is undesirable when recordings are fraught with motion and pressure artifacts. These artifacts are frequent when the human participant has involuntary movements as in hyperkinetic cerebral palsy. This motivates the use of alternative measurement sites. The present study examined the correlation between measurements of blood volume pulse and skin conductance obtained from three different sites on the body (fingers, toes and ear for BVP; fingers, toes and arch of the foot for skin conductance) in response to cognitive and affective stimuli. The results of this pilot study indicated significant inter-site correlation among signal features derived from different sites, with the exception of BVP amplitude, the number of electrodermal reactions and the slope of the electrodermal activity response. We attribute these differences in part to inter-site discrepancies in local skin conditions, such as skin temperature. Despite these differences, significant changes from baseline were present in the responses to the cognitive and affective stimuli at non-palmar sites, suggesting that these sites may provide viable signal measurements for use in affective computing and human–machine interface applications

  16. A DESIGN FRAMEWORK FOR HUMAN EMOTION RECOGNITION USING ELECTROCARDIOGRAM AND SKIN CONDUCTANCE RESPONSE SIGNALS

    Directory of Open Access Journals (Sweden)

    KHAIRUN NISA’ MINHAD

    2017-11-01

    Full Text Available Identification of human emotional state while driving a vehicle can help in understanding the human behaviour. Based on this identification, a response system can be developed in order to mitigate the impact that may be resulted from the behavioural changes. However, the adaptation of emotions to the environment at most scenarios is subjective to an individual’s perspective. Many factors, mainly cultural and geography, gender, age, life style and history, level of education and professional status, can affect the detection of human emotional affective states. This work investigated sympathetic responses toward human emotions defined by using electrocardiography (ECG and skin conductance response (SCR signals recorded simultaneously. This work aimed to recognize ECG and SCR patterns of the investigated emotions measured using selected sensor. A pilot study was conducted to evaluate the proposed framework. Initial results demonstrated the importance of suitability of the stimuli used to evoke the emotions and high opportunity for the ECG and SCR signals to be used in the automotive real-time emotion recognition systems.

  17. Callous-unemotional, impulsive-irresponsible, and grandiose-manipulative traits: Distinct associations with heart rate, skin conductance, and startle responses to violent and erotic scenes.

    Science.gov (United States)

    Fanti, Kostas A; Kyranides, Melina N; Georgiou, Giorgos; Petridou, Maria; Colins, Olivier F; Tuvblad, Catherine; Andershed, Henrik

    2017-05-01

    The present study aimed to examine whether callous-unemotional, grandiose-manipulative, and impulsive-irresponsible dimensions of psychopathy are differentially related to various affective and physiological measures, assessed at baseline and in response to violent and erotic movie scenes. Data were collected from young adults (N = 101) at differential risk for psychopathic traits. Findings from regression analyses revealed a unique predictive contribution of grandiose-manipulative traits in particular to higher ratings of positive valence for violent scenes. Callous-unemotional traits were uniquely associated with lower levels of sympathy toward victims and lower ratings of fear and sadness during violent scenes. All three psychopathy dimensions and the total psychopathy scale showed negative zero-order correlations with heart rate at baseline, but regression analyses revealed that only grandiose manipulation was uniquely predictive of lower baseline heart rate. Grandiose manipulation was also significantly associated with lower baseline skin conductance. Regarding autonomic activity, findings resulted in a unique negative association between grandiose manipulation and heart rate activity in response to violent scenes. In contrast, the impulsive-irresponsible dimension was positively related with heart rate activity to violent scenes. Finally, findings revealed that only callous-unemotional traits were negatively associated with startle potentiation in response to violent scenes. No associations during erotic scenes were identified. These findings point to unique associations between the three assessed dimensions of psychopathy with physiological measures, indicating that grandiose manipulation is associated with hypoarousal, impulsive irresponsibility with hyperarousal, and callous-unemotional traits with low emotional and fear responses to violent scenes. © 2017 Society for Psychophysiological Research.

  18. Measurement of the force–displacement response of in vivo human skin under a rich set of deformations

    KAUST Repository

    Flynn, Cormac

    2011-06-01

    The non-linear, anisotropic, and viscoelastic properties of human skin vary according to location on the body, age, and individual. The measurement of skin\\'s mechanical properties is important in several fields including medicine, cosmetics, and forensics. In this study, a novel force-sensitive micro-robot applied a rich set of three-dimensional deformations to the skin surface of different areas of the arms of 20 volunteers. The force-displacement response of each area in different directions was measured. All tested areas exhibited a non-linear, viscoelastic, and anisotropic force-displacement response. There was a wide quantitative variation in the stiffness of the response. For the right anterior forearm, the ratio of the maximum probe reaction force to maximum probe displacement ranged from 0.44Nmm-1 to 1.45Nmm-1. All volunteers exhibited similar qualitative anisotropic characteristics. For the anterior right forearm, the stiffest force-displacement response was when the probe displaced along the longitudinal axis of the forearm. The response of the anterior left forearm was stiffest in a direction 20° to the longitudinal axis of the forearm. The posterior upper arm was stiffest in a direction 90° to the longitudinal axis of the arm. The averaged posterior upper arm response was less stiff than the averaged anterior forearm response. The maximum probe force at 1.3mm probe displacement was 0.69N for the posterior upper arm and 1.1N for the right anterior forearm. The average energy loss during the loading-unloading cycle ranged from 11.9% to 34.2%. This data will be very useful for studying the non-linear, anisotropic, and viscoelastic behaviour of skin and also for generating material parameters for appropriate constitutive models. © 2011 IPEM.

  19. Skin Conductance Responses and Neural Activations During Fear Conditioning and Extinction Recall Across Anxiety Disorders.

    Science.gov (United States)

    Marin, Marie-France; Zsido, Rachel G; Song, Huijin; Lasko, Natasha B; Killgore, William D S; Rauch, Scott L; Simon, Naomi M; Milad, Mohammed R

    2017-06-01

    The fear conditioning and extinction neurocircuitry has been extensively studied in healthy and clinical populations, with a particular focus on posttraumatic stress disorder. Despite significant overlap of symptoms between posttraumatic stress disorder and anxiety disorders, the latter has received less attention. Given that dysregulated fear levels characterize anxiety disorders, examining the neural correlates of fear and extinction learning may shed light on the pathogenesis of underlying anxiety disorders. To investigate the psychophysiological and neural correlates of fear conditioning and extinction recall in anxiety disorders and to document how these features differ as a function of multiple diagnoses or anxiety severity. This investigation was a cross-sectional, case-control, functional magnetic resonance imaging study at an academic medical center. Participants were healthy controls and individuals with at least 1 of the following anxiety disorders: generalized anxiety disorder, social anxiety disorder, specific phobia, and panic disorder. The study dates were between March 2013 and May 2015. Two-day fear conditioning and extinction paradigm. Skin conductance responses, blood oxygenation level-dependent responses, trait anxiety scores from the State Trait Anxiety Inventory-Trait Form, and functional connectivity. This study included 21 healthy controls (10 women) and 61 individuals with anxiety disorders (36 women). P values reported for the neuroimaging results are all familywise error corrected. Skin conductance responses during extinction recall did not differ between individuals with anxiety disorders and healthy controls (ηp2 = 0.001, P = .79), where ηp2 is partial eta squared. The anxiety group had lower activation of the ventromedial prefrontal cortex (vmPFC) during extinction recall (ηp2 = 0.178, P = .02). A similar hypoactive pattern was found during early conditioning (ηp2 = 0.106, P = .009). The vmPFC hypoactivation

  20. Rate dependency and role of nitric oxide in the vascular response to direct cooling in human skin.

    Science.gov (United States)

    Yamazaki, Fumio; Sone, Ryoko; Zhao, Kun; Alvarez, Guy E; Kosiba, Wojciech A; Johnson, John M

    2006-01-01

    Local cooling of nonglabrous skin without functional sympathetic nerves causes an initial vasodilation followed by vasoconstriction. To further characterize these responses to local cooling, we examined the importance of the rate of local cooling and the effect of nitric oxide synthase (NOS) inhibition in intact skin and in skin with vasoconstrictor function inhibited. Release of norepinephrine was blocked locally (iontophoresis) with bretylium tosylate (BT). Skin blood flow was monitored from the forearm by laser-Doppler flowmetry (LDF). Cutaneous vascular conductance (CVC) was calculated as the ratio of LDF to blood pressure. Local temperature was controlled over 6.3 cm2 around the sites of LDF measurement. Local cooling was applied at -0.33 or -4 degrees C/min. At -4 degrees C/min, CVC increased (P cooling (-4 degrees C/min) to 24 degrees C decreased (P cooling, CVC decreased at BT + saline sites relative to the precooling levels (P cooling, but not functional NOS, is an important determinant of the early non-adrenergic vasodilator response to local cooling and that functional NOS, adrenergic nerves, as well as other mechanisms play roles in vasoconstriction during prolonged local cooling of skin.

  1. Loss of Snail2 favors skin tumor progression by promoting the recruitment of myeloid progenitors

    DEFF Research Database (Denmark)

    Villarejo, Ana; Molina-Ortiz, Patricia; Montenegro, Yenny

    2015-01-01

    showed that loss of Snail2 leads to a decrease in proliferation indicating a non-cell autonomous role for Snail2 in the skin carcinogenic response observed in vivo. Bone marrow (BM) cross-reconstitution assays between Snail2 wild-type and null mice showed that Snail2 absence in the hematopoietic system...

  2. Associations between Language Development and Skin Conductance Responses to Faces and Eye Gaze in Children with Autism Spectrum Disorder

    Science.gov (United States)

    Stagg, Steven D.; Davis, Robert; Heaton, Pamela

    2013-01-01

    Attention to social stimuli is associated with language development, and arousal is associated with the increased viewing of stimuli. We investigated whether skin conductance responses (SCRs) are associated with language development in autism spectrum disorder (ASD): a population that shows abnormalities in both attention to others and language…

  3. The response of previously irradiated mouse skin to heat alone or combined with irradiation: influence of thermotolerance

    NARCIS (Netherlands)

    Wondergem, J.; Haveman, J.

    1983-01-01

    The skin of the mouse foot was used to study the effects of previous irradiation on the response to hyperthermia (44 degrees C), to irradiation, or to irradiation combined with hyperthermia (43 degrees C or 44 degrees C). Hyperthermia was applied by immersing the mouse foot into a hot waterbath and

  4. Spitting Image: Tick Saliva Assists the Causative Agent of Lyme Disease in Evading Host Skin's Innate Immune Response

    NARCIS (Netherlands)

    Hovius, Joppe W. R.

    2009-01-01

    Lyme disease is caused by the spirochete Borrelia burgdorferi and is transmitted through ticks. Inhibition of host skin's innate immune response might be instrumental to both tick feeding and B. burgdorferi transmission. The article by Marchal et al. describes how tick saliva suppresses B.

  5. Characterization of guinea pig T cell responses elicited after EP-assisted delivery of DNA vaccines to the skin.

    Science.gov (United States)

    Schultheis, Katherine; Schaefer, Hubert; Yung, Bryan S; Oh, Janet; Muthumani, Karuppiah; Humeau, Laurent; Broderick, Kate E; Smith, Trevor R F

    2017-01-03

    The skin is an ideal target tissue for vaccine delivery for a number of reasons. It is highly accessible, and most importantly, enriched in professional antigen presenting cells. Possessing strong similarities to human skin physiology and displaying a defined epidermis, the guinea pig is an appropriate model to study epidermal delivery of vaccine. However, whilst we have characterized the humoral responses in the guinea pig associated with skin vaccine protocols we have yet to investigate the T cell responses. In response to this inadequacy, we developed an IFN-γ ELISpot assay to characterize the cellular immune response in the peripheral blood of guinea pigs. Using a nucleoprotein (NP) influenza pDNA vaccination regimen, we characterized host T cell responses. After delivery of the DNA vaccine to the guinea pig epidermis we detected robust and rapid T cell responses. The levels of IFN-γ spot-forming units averaged approximately 5000 per million cells after two immunizations. These responses were broad in that multiple regions across the NP antigen elicited a T cell response. Interestingly, we identified a number of NP immunodominant T cell epitopes to be conserved across an outbred guinea pig population, a phenomenon which was also observed after immunization with a RSV DNA vaccine. We believe this data enhances our understanding of the cellular immune response elicited to a vaccine in guinea pigs, and globally, will advance the use of this model for vaccine development, especially those targeting skin as a delivery site. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  6. Fractionated laser resurfacing corrects the inappropriate UVB response in geriatric skin

    OpenAIRE

    Spandau, Dan F; Lewis, Davina A.; Somani, Ally-Khan; Travers, Jeffrey B.

    2012-01-01

    Non-melanoma skin cancer is a disease primarily afflicting geriatric patients as evidenced by the fact that 80% of all non-melanoma skin cancers are diagnosed in patients over the age of 60 years. As such, geriatric skin responds to cancer-inducing UVB irradiation in a manner that allows the establishment of tumor cells. Currently, the only effective treatment for non-melanoma skin cancer is the removal of the tumors after they appear, indicating the need for a more cost-effective prophylacti...

  7. The effect of salmeterol and salbutamol on mediator release and skin responses in immediate and late phase allergic cutaneous reactions

    DEFF Research Database (Denmark)

    Petersen, Lars Jelstrup; Skov, P S

    1999-01-01

    on clinical and biochemical EAR and LPR in human skin. METHODS: Measurement of wheal and flare reactions to allergen, codeine, and histamine, and LPR (induration) to allergen. Assessment of histamine and prostaglandin D2 (PGD2) release by microdialysis technique in EAR, and measurement of mediators in LPR......, myeloperoxidase, or eosinophil cationic protein in LPR. CONCLUSIONS: Salmeterol and salbutamol inhibited allergen-induced skin responses, and reduced mediator release in EAR but not LPR. In general, the anti-inflammatory effects of salmeterol did not differ from those induced by salbutamol....

  8. Safety and skin delayed-type hypersensitivity response in vervet monkeys immunized with Leishmania donovani sonicate antigen delivered with adjuvants

    OpenAIRE

    Mutiso,Joshua M.; Macharia,John C.; Taracha,Evans; Wafula,Kellern; Rikoi,Hitler; Gicheru,Michael M.

    2012-01-01

    In this study, we report on the safety and skin delayed-type hypersensitivity (DTH), responses of the Leishmania donovani whole cell sonicate antigen delivered in conjunction with alum-BCG (AlBCG), Montanide ISA 720 (MISA) or Monophosphoryl lipid A (MPLA) in groups of vervet monkeys. Following three intradermal injections of the inoculums on days 0, 28 and 42, safety and DTH responses were assessed. Preliminary tumor necrosis factor alpha (TNF-α) and interferon gamma (IFN-γ) levels ...

  9. Protein Kinases and Transcription Factors Activation in Response to UV-Radiation of Skin: Implications for Carcinogenesis

    OpenAIRE

    Laurence A. Marchat; Elena Aréchaga Ocampo; Mavil López Casamichana; Carlos Pérez-Plasencia; César López-Camarillo; Elizbeth Álvarez-Sánchez

    2011-01-01

    Solar ultraviolet (UV) radiation is an important environmental factor that leads to immune suppression, inflammation, photoaging, and skin carcinogenesis. Here, we reviewed the specific signal transduction pathways and transcription factors involved in the cellular response to UV-irradiation. Increasing experimental data supporting a role for p38, MAPK, JNK, ERK1/2, and ATM kinases in the response network to UV exposure is discussed. We also reviewed the participation of NF-?B, AP-1, and NRF2...

  10. Temporal aspects of tumorigenic response to individual and mixed carcinogens. Comprehensive progress report, June 1, 1975--May 31, 1978. [Mouse skin, rats, hamsters

    Energy Technology Data Exchange (ETDEWEB)

    Albert, R.E.; Burns, F.J.; Altshuler, B.

    1978-02-01

    The research proposed here is designed to obtain a better understanding of the temporal kinetics of tumor induction when one or more carcinogens are present simultaneously or sequentially for prolonged periods of time. Studies done to date under this contract have shown that carcinogenesis in mouse skin by polycyclic aromatic hydrocarbon carcinogens is consistent with the induction of dependent and autonomous cell transformations by the carcinogen followed by the conversion of autonomous tumor cells into malignancies at a rate which is determined by the level of carcinogen exposure. Dependent cell transformations remain latent in the skin unless expressed by a promoting agent. Dependent neoplasia appears to follow one-hit kinetics while malignancy is a multihit endpoint. Dose-related and time-related aspects of tumor induction are separable in the initiation-promotion system of mouse skin which along with rat skin and hamster lung is being used as a model for testing hypotheses. Results to date provide the basis for a new interpretation of the linear non-threshold extrapolation model. The broad aim of the study is to provide a basis or rationale for estimating risks associated with prolonged exposures to carcinogens found in the environment and to predict how different tissues and species respond to the same carcinogens.

  11. Autonomic nervous system responses during perception of masked speech may reflect constructs other than subjective listening effort

    Directory of Open Access Journals (Sweden)

    Alexander L. Francis

    2016-03-01

    Full Text Available Typically, understanding speech seems effortless and automatic. However, a variety of factors may, independently or interactively, make listening more effortful. Physiological measures may help to distinguish between the application of different cognitive mechanisms whose operation is perceived as effortful. In the present study, physiological and behavioral measures associated with task demand were collected along with behavioral measures of performance while participants listened to and repeated sentences. The goal was to measure psychophysiological reactivity associated with three degraded listening conditions, each of which differed in terms of the source of the difficulty (distortion, energetic masking, and informational masking, and therefore were expected to engage different cognitive mechanisms. These conditions were chosen to be matched for overall performance (keywords correct, and were compared to listening to unmasked speech produced by a natural voice. The three degraded conditions were: (1 Unmasked speech produced by a computer speech synthesizer, (2 Speech produced by a natural voice and masked by speech-shaped noise and (3 Speech produced by a natural voice and masked by two-talker babble. Masked conditions were both presented at a -8 dB signal to noise ratio (SNR, a level shown in previous research to result in comparable levels of performance for these stimuli and maskers. Performance was measured in terms of proportion of key words identified correctly, and task demand or effort was quantified subjectively by self-report. Measures of psychophysiological reactivity included electrodermal (skin conductance response frequency and amplitude, blood pulse amplitude and pulse rate. Results suggest that the two masked conditions evoked stronger psychophysiological reactivity than did the two unmasked conditions even when behavioral measures of listening performance and listeners’ subjective perception of task demand were comparable

  12. The effects of reward and punishment on reaction times and autonomic activity in hyperactive and normal children.

    Science.gov (United States)

    Firestone, P; Douglas, V

    1975-01-01

    The performance of hyperactive and control children was compared on a delayed reaction time task under three reinforcement conditions: reward, punishment, and reward plus punishment. Hyperactives had slower and more variable reaction times, suggesting an attentional deficit. Although each of the three reinforcement conditons was successful in improving reaction times for both subject groups, reward led to a significant increase in impulsive responses in the hyperactive children. Autonomic data revealed that reward also increased arousal to a greater extent than punishment or reward plus punishment. Although resting skin conductance was not different in the two groups of subjects, hyperactives produced fewer specific autonomic responses to signal stimuli.

  13. Synergistic skin heat shock protein expression in response to combined laser treatment with a diode laser and ablative fractional lasers.

    Science.gov (United States)

    Paasch, Uwe; Sonja, Grunewald; Haedersdal, Merete

    2014-06-01

    Diode laser-based skin heating has been shown to minimise scars by interfering with wound healing responses through the induction of heat shock proteins (HSP). HSP are also induced after ablative fractional laser (AFXL) wound healing. AFXL itself is highly recommended for scar treatment. Therefore, the sequential combination of both modalities may produce superior outcomes. The aim of this study was to examine the pretreatment effects of a diode laser before AFXL on wound healing responses in terms of HSP up-regulation in an in vitro model. Immediate responses and responses on days 1, 3 or 6 post-procedure were studied in an in vitro porcine skin model (n = 240). Untreated samples served as control. Immunohistochemical investigation (Hsp70) was performed in all untreated controls, diode laser-, AFXL-, and in diode laser + AFXL-treated samples. Hsp70 was shown to be up-regulated by all interventions between days 1 and 6 after interventions. The largest effect was caused by the combination of a diode laser and an AFXL procedure. Diode laser exposure induces a skin HSP response that can be further enhanced by sequential AFXL treatment. Clinical studies are necessary to investigate the dose response of HSP on scar formation and refine suitable laser exposure settings.

  14. Dermal damage promoted by repeated low-level UV-A1 exposure despite tanning response in human skin.

    Science.gov (United States)

    Wang, Frank; Smith, Noah R; Tran, Bao Anh Patrick; Kang, Sewon; Voorhees, John J; Fisher, Gary J

    2014-04-01

    exposures did not suppress type I procollagen expression. A limited number of low-dose UV-A1 exposures, as commonly experienced in daily life, potentially promotes photoaging by affecting breakdown, rather than synthesis, of collagen. Progressive skin darkening in response to repeated low-dose UV-A1 exposures in lightly pigmented individuals does not prevent UV-A1-induced collagenolytic changes. Therefore, for optimal protection against skin damage, sunscreen formulations should filter all UV wavelengths, including UV-A1 irradiation.

  15. Effects of husbandry conditions on the skin colour and stress response of red porgy, Pagrus pagrus

    NARCIS (Netherlands)

    Salm, A.L. van der; Martinez, M.; Flik, G.; Wendelaar Bonga, S.E.

    2004-01-01

    Red porgy, Pagrus pagrus, is a potential candidate for aquaculture. However, darkening of the body occurs after capture of wild fish and during fanning of cultured animals. In fish, skin pigmentation is hormonally controlled and the main hormone involved in skin darkening,

  16. Inhibition of ultraviolet irradiation response of human skin by topical phlogostatic compounds

    International Nuclear Information System (INIS)

    Weirich, E.G.; Lutz, U.C.

    1977-01-01

    By adaption of the model of UV dermatitis in human skin a test procedure has been developed which facilitates realistic assessment of topical contra-inflammatory activity of steroidal as well as non-steroidal compounds. Sixt typical skin drug agents were tested according to their reaction inhibition effect. (orig./MG) [de

  17. Measurement of the force–displacement response of in vivo human skin under a rich set of deformations

    KAUST Repository

    Flynn, Cormac; Taberner, Andrew; Nielsen, Poul

    2011-01-01

    The non-linear, anisotropic, and viscoelastic properties of human skin vary according to location on the body, age, and individual. The measurement of skin's mechanical properties is important in several fields including medicine, cosmetics, and forensics. In this study, a novel force-sensitive micro-robot applied a rich set of three-dimensional deformations to the skin surface of different areas of the arms of 20 volunteers. The force-displacement response of each area in different directions was measured. All tested areas exhibited a non-linear, viscoelastic, and anisotropic force-displacement response. There was a wide quantitative variation in the stiffness of the response. For the right anterior forearm, the ratio of the maximum probe reaction force to maximum probe displacement ranged from 0.44Nmm-1 to 1.45Nmm-1. All volunteers exhibited similar qualitative anisotropic characteristics. For the anterior right forearm, the stiffest force-displacement response was when the probe displaced along the longitudinal axis of the forearm. The response of the anterior left forearm was stiffest in a direction 20° to the longitudinal axis of the forearm. The posterior upper arm was stiffest in a direction 90° to the longitudinal axis of the arm. The averaged posterior upper arm response was less stiff than the averaged anterior forearm response. The maximum probe force at 1.3mm probe displacement was 0.69N for the posterior upper arm and 1.1N for the right anterior forearm. The average energy loss during the loading-unloading cycle ranged from 11.9% to 34.2%. This data will be very useful for studying the non-linear, anisotropic, and viscoelastic behaviour of skin and also for generating material parameters for appropriate constitutive models. © 2011 IPEM.

  18. Facial skin blood flow responses during exposures to emotionally charged movies.

    Science.gov (United States)

    Matsukawa, Kanji; Endo, Kana; Ishii, Kei; Ito, Momoka; Liang, Nan

    2018-03-01

    The changes in regional facial skin blood flow and vascular conductance have been assessed for the first time with noninvasive two-dimensional laser speckle flowmetry during audiovisually elicited emotional challenges for 2 min (comedy, landscape, and horror movie) in 12 subjects. Limb skin blood flow and vascular conductance and systemic cardiovascular variables were simultaneously measured. The extents of pleasantness and consciousness for each emotional stimulus were estimated by the subjective rating from -5 (the most unpleasant; the most unconscious) to +5 (the most pleasant; the most conscious). Facial skin blood flow and vascular conductance, especially in the lips, decreased during viewing of comedy and horror movies, whereas they did not change during viewing of a landscape movie. The decreases in facial skin blood flow and vascular conductance were the greatest with the comedy movie. The changes in lip, cheek, and chin skin blood flow negatively correlated (P < 0.05) with the subjective ratings of pleasantness and consciousness. The changes in lip skin vascular conductance negatively correlated (P < 0.05) with the subjective rating of pleasantness, while the changes in infraorbital, subnasal, and chin skin vascular conductance negatively correlated (P < 0.05) with the subjective rating of consciousness. However, none of the changes in limb skin blood flow and vascular conductance and systemic hemodynamics correlated with the subjective ratings. The mental arithmetic task did not alter facial and limb skin blood flows, although the task influenced systemic cardiovascular variables. These findings suggest that the more emotional status becomes pleasant or conscious, the more neurally mediated vasoconstriction may occur in facial skin blood vessels.

  19. Clinical features, fungal load, coinfections, histological skin changes, and itraconazole treatment response of cats with sporotrichosis caused by Sporothrix brasiliensis.

    Science.gov (United States)

    de Souza, Elaine Waite; Borba, Cintia de Moraes; Pereira, Sandro Antonio; Gremião, Isabella Dib Ferreira; Langohr, Ingeborg Maria; Oliveira, Manoel Marques Evangelista; de Oliveira, Raquel de Vasconcellos Carvalhaes; da Cunha, Camila Rocha; Zancopé-Oliveira, Rosely Maria; de Miranda, Luisa Helena Monteiro; Menezes, Rodrigo Caldas

    2018-06-13

    Zoonotic sporotrichosis caused by the fungus Sporothrix brasiliensis is usually severe in cats. This study investigated the associations between clinical features, fungal load, coinfections, histological skin changes, and response to itraconazole in cats with sporotrichosis caused by S. brasiliensis. Fifty-two cats with skin lesions and a definitive diagnosis of sporotrichosis were treated with itraconazole for a maximum period of 36 weeks. The animals were submitted to clinical examination and two subsequent collections of samples from the same skin lesion for fungal diagnosis and histopathology, as well as serology for feline immunodeficiency (FIV) and leukaemia (FeLV) viruses. Thirty-seven (71%) cats were clinically cured. Nasal mucosa lesions and respiratory signs were associated with treatment failure. Cats coinfected with FIV/FeLV (n = 12) had a lower neutrophil count in the lesion. A high fungal load in skin lesions was linked to young age and treatment failure, as well as to a longer time of wound healing, poorly formed granulomas and fewer neutrophils, macrophages and lymphocytes in these lesions. These results indicate that itraconazole is effective, but nasal mucosal involvement, respiratory signs and high fungal loads in skin lesions are predictors of treatment failure that will assist in the development of better treatment protocols for cats.

  20. The Response of the Ocean Thermal Skin Layer to Variations in Incident Infrared Radiation

    Science.gov (United States)

    Wong, Elizabeth W.; Minnett, Peter J.

    2018-04-01

    Ocean warming trends are observed and coincide with the increase in concentrations of greenhouse gases in the atmosphere resulting from human activities. At the ocean surface, most of the incoming infrared (IR) radiation is absorbed within the top micrometers of the ocean's surface where the thermal skin layer (TSL) exists. Thus, the incident IR radiation does not directly heat the upper few meters of the ocean. This paper investigates the physical mechanism between the absorption of IR radiation and its effect on heat transfer at the air-sea boundary. The hypothesis is that given the heat lost through the air-sea interface is controlled by the TSL, the TSL adjusts in response to variations in incident IR radiation to maintain the surface heat loss. This modulates the flow of heat from below and hence controls upper ocean heat content. This hypothesis is tested using the increase in incoming longwave radiation from clouds and analyzing vertical temperature profiles in the TSL retrieved from sea-surface emission spectra. The additional energy from the absorption of increasing IR radiation adjusts the curvature of the TSL such that the upward conduction of heat from the bulk of the ocean into the TSL is reduced. The additional energy absorbed within the TSL supports more of the surface heat loss. Thus, more heat beneath the TSL is retained leading to the observed increase in upper ocean heat content.

  1. Isolation of fish skin and bone gelatin from tilapia (Oreochromis niloticus): Response surface approach

    Science.gov (United States)

    Arpi, N.; Fahrizal; Novita, M.

    2018-03-01

    In this study, gelatin from fish collagen, as one of halal sources, was extracted from tilapia (Oreochromis niloticus) skin and bone, by using Response Surface Methodology to optimize gelatin extraction conditions. Concentrations of alkaline NaOH and acid HCl, in the pretreatment process, and temperatures in extraction process were chosen as independent variables, while dependent variables were yield, gel strength, and emulsion activity index (EAI). The result of investigation showed that lower NaOH pretreatment concentrations provided proper pH extraction conditions which combine with higher extraction temperatures resulted in high gelatin yield. However, gelatin emulsion activity index increased proportionally to the decreased in NaOH concentrations and extraction temperatures. No significant effect of the three independent variables on the gelatin gel strength. RSM optimization process resulted in optimum gelatin extraction process conditions using alkaline NaOH concentration of 0.77 N, acid HCl of 0.59 N, and extraction temperature of 66.80 °C. The optimal solution formula had optimization targets of 94.38%.

  2. Skin microvascular and metabolic response to pressure relief maneuvers in people with spinal cord injury

    Science.gov (United States)

    Ramella-Roman, Jessica C.; Le, Du V. N.; Ghassemi, Pejhman; Nguyen, Thu A.; Lichy, Alison; Groah, Suzanne

    2013-02-01

    Clinician's recommendations on wheelchair pressure reliefs in the context of the high prevalence of pressure ulcers that occur in people with spinal cord injury is not supported by strong experimental evidence. Some data indicates that altered tissue perfusion and oxygenation occurring under pressure loads, such as during sitting, induce various pathophysiologic changes that may lead to pressure ulcers. Pressure causes a cascade of responses, including initial tissue hypoxia, which leads to ischemia, vascular leakage, tissue acidification, compensatory angiogenesis, thrombosis, and hyperemia, all of which may lead to tissue damage. We have developed an advanced skin sensor that allows measurement of oxygenation in addition to perfusion, and can be safely used during sitting. The sensor consists of a set of fiber optics probes, spectroscopic and Laser Doppler techniques that are used to obtain parameters of interest. The overriding goal of this project is to develop the evidence base for clinical recommendations on pressure reliefs. In this paper we will illustrate the experimental apparatus as well as some preliminary results of a small clinical trial conducted at the National Rehabilitation Hospital.

  3. Testing a linear time invariant model for skin conductance responses by intraneural recording and stimulation.

    Science.gov (United States)

    Gerster, Samuel; Namer, Barbara; Elam, Mikael; Bach, Dominik R

    2018-02-01

    Skin conductance responses (SCR) are increasingly analyzed with model-based approaches that assume a linear and time-invariant (LTI) mapping from sudomotor nerve (SN) activity to observed SCR. These LTI assumptions have previously been validated indirectly, by quantifying how much variance in SCR elicited by sensory stimulation is explained under an LTI model. This approach, however, collapses sources of variability in the nervous and effector organ systems. Here, we directly focus on the SN/SCR mapping by harnessing two invasive methods. In an intraneural recording experiment, we simultaneously track SN activity and SCR. This allows assessing the SN/SCR relationship but possibly suffers from interfering activity of non-SN sympathetic fibers. In an intraneural stimulation experiment under regional anesthesia, such influences are removed. In this stimulation experiment, about 95% of SCR variance is explained under LTI assumptions when stimulation frequency is below 0.6 Hz. At higher frequencies, nonlinearities occur. In the intraneural recording experiment, explained SCR variance is lower, possibly indicating interference from non-SN fibers, but higher than in our previous indirect tests. We conclude that LTI systems may not only be a useful approximation but in fact a rather accurate description of biophysical reality in the SN/SCR system, under conditions of low baseline activity and sporadic external stimuli. Intraneural stimulation under regional anesthesia is the most sensitive method to address this question. © 2017 The Authors. Psychophysiology published by Wiley Periodicals, Inc. on behalf of Society for Psychophysiological Research.

  4. Optical spectroscopy of radiotherapy and photodynamic therapy responses in normal rat skin shows vascular breakdown products

    Science.gov (United States)

    Teles de Andrade, Cintia; Nogueira, Marcelo S.; Kanick, Stephen C.; Marra, Kayla; Gunn, Jason; Andreozzi, Jacqueline; Samkoe, Kimberley S.; Kurachi, Cristina; Pogue, Brian W.

    2016-03-01

    Photodynamic therapy (PDT) and radiotherapy are non-systemic cancer treatment options with different mechanisms of damage. So combining these techniques has been shown to have some synergy, and can mitigate their limitations such as low PDT light penetration or radiotherapy side effects. The present study monitored the induced tissue changes after PDT, radiotherapy, and a combination protocol in normal rat skin, using an optical spectroscopy system to track the observed biophysical changes. The Wistar rats were treated with one of the protocols: PDT followed by radiotherapy, PDT, radiotherapy and radiotherapy followed by PDT. Reflectance spectra were collected in order to observe the effects of these combined therapies, especially targeting vascular response. From the reflectance, information about oxygen saturation, met-hemoglobin and bilirubin concentration, blood volume fraction (BVF) and vessel radius were extracted from model fitting of the spectra. The rats were monitored for 24 hours after treatment. Results showed that there was no significant variation in the vessel size or BVF after the treatments. However, the PDT caused a significant increase in the met-hemoglobin and bilirubin concentrations, indicating an important blood breakdown. These results may provide an important clue on how the damage establishment takes place, helping to understand the effect of the combination of those techniques in order to verify the existence of a known synergistic effect.

  5. Affective Synchrony and Autonomic Coupling during Cooperation: A Hyperscanning Study

    Directory of Open Access Journals (Sweden)

    Maria Elide Vanutelli

    2017-01-01

    Full Text Available Previous research highlighted that during social interactions people shape each other’s emotional states by resonance mechanisms and synchronized autonomic patterns. Starting from the idea that joint actions create shared emotional experiences, in the present study a social bond was experimentally induced by making subjects cooperate with each other. Participants’ autonomic system activity (electrodermal: skin conductance level and response: SCL, SCR; cardiovascular indices: heart rate: HR was continuously monitored during an attentional couple game. The cooperative motivation was induced by presenting feedback which reinforced the positive outcomes of the intersubjective exchange. 24 participants coupled in 12 dyads were recruited. Intrasubject analyses revealed higher HR in the first part of the task, connoted by increased cognitive demand and arousing social dynamic, while intersubject analysis showed increased synchrony in electrodermal activity after the feedback. Such results encourage the use of hyperscanning techniques to assess emotional coupling in ecological and real-time paradigms.

  6. Assessment of Skin Pathological Responses in the Yellowfin Seabream (Acanthopagrus latus under the Aeromonas hydrophila Exposure

    Directory of Open Access Journals (Sweden)

    Fatemeh Azadbakht

    2018-01-01

    Full Text Available Background: Bacterial diseases in cultured fish are considered the main problem to aquaculture system. Skin is the structure that covers the body in fish. Skin histopatological alterations were used to assess the effects of Aeromonas hydrophila exposure on the yellowfin seabream Acanthopagrus latus(. Methods: In this regard, 90 A. latus were exposed to sublethal concentrations of A. hydrophila (103,106 CFU/ml for 3 weeks. Results: Some more severe alternations found in the skin of fish exposed. The most frequent histopathological changes detected in the skin including hyperplasia of epidermis, hypertrophy and hyperplasia of the mucosal cells and dermis edema. Some more severe alternations found in the skin of fish exposed to higher level of A. hydrophila (106 CFU/ml included telangiectasia of dermis layer. In addition, according to the results of histometrical studies in treated fish compared to control group showed that thickness of epidermis and dermis layers were increased significantly (P<0.05. Conclusion: A. hydrophila can cause major histophatological changes in the skin of A. latus. In addition, histopathological changes of the skin provide helpful information about the environmental conditions and as particular biomarkers may provide imminent into evaluating the general health and stress status of fish.

  7. Direct quantitative comparison of molecular responses in photodamaged human skin to fractionated and fully ablative carbon dioxide laser resurfacing.

    Science.gov (United States)

    Orringer, Jeffrey S; Sachs, Dana L; Shao, Yuan; Hammerberg, Craig; Cui, Yilei; Voorhees, John J; Fisher, Gary J

    2012-10-01

    Fractionated ablative laser resurfacing has become a widely used treatment modality. Its clinical results are often found to approach those of traditional fully ablative laser resurfacing. To directly compare the molecular changes that result from fractionated and fully ablative carbon dioxide (CO(2)) laser resurfacing in photodamaged human skin. Photodamaged skin of 34 adult volunteers was focally treated at distinct sites with a fully ablative CO(2) laser and a fractionated CO(2) laser. Serial skin samples were obtained at baseline and several time points after treatment. Real-time reverse transcriptase polymerase chain reaction technology and immunohistochemistry were used to quantify molecular responses to each type of laser treatment. Fully ablative and fractionated CO(2) laser resurfacing induced significant dermal remodeling and collagen induction. After a single treatment, fractionated ablative laser resurfacing resulted in collagen induction that was approximately 40% to 50% as pronounced as that induced by fully ablative laser resurfacing. The fundamental cutaneous responses that result from fully ablative and fractionated carbon dioxide laser resurfacing are similar but differ in magnitude and duration, with the fully ablative procedure inducing relatively greater changes including more pronounced collagen induction. However, the molecular data reported here provide substantial support for fractionated ablative resurfacing as an effective treatment modality for improving skin texture. © 2012 by the American Society for Dermatologic Surgery, Inc. Published by Wiley Periodicals, Inc.

  8. Response-surface models for deterministic effects of localized irradiation of the skin by discrete β/γ -emitting sources

    International Nuclear Information System (INIS)

    Scott, B.R.

    1995-01-01

    Individuals who work at nuclear reactor facilities can be at risk for deterministic effects in the skin from exposure to discrete Β- and γ-emitting (ΒγE) sources (e.g., ΒγE hot particles) on the skin or clothing. Deterministic effects are non-cancer effects that have a threshold and increase in severity as dose increases (e.g., ulcer in skin). Hot ΒγE particles are 60 Co- or nuclear fuel-derived particles with diameters > 10 μm and < 3 mm and contain at least 3.7 kBq (0.1 μCi) of radioactivity. For such ΒγE sources on the skin, it is the beta component of the dose that is most important. To develop exposure limitation systems that adequately control exposure of workers to discrete ΒγE sources, models are needed for systems that adequately control exposure of workers to discrete ΒγE sources, models are needed for evaluating the risk of deterministic effects of localized Β irradiation of the skin. The purpose of this study was to develop dose-rate and irradiated-area dependent, response-surface models for evaluating risks of significant deterministic effects of localized irradiation of the skin by discrete ΒγE sources and to use modeling results to recommend approaches to limiting occupational exposure to such sources. The significance of the research results as follows: (1) response-surface models are now available for evaluating the risk of specific deterministic effects of localized irradiation of the skin; (2) modeling results have been used to recommend approaches to limiting occupational exposure of workers to Β radiation from ΒγE sources on the skin or on clothing; and (3) the generic irradiated-volume, weighting-factor approach to limiting exposure can be applied to other organs including the eye, the ear, and organs of the respiratory or gastrointestinal tract and can be used for both deterministic and stochastic effects

  9. Response-surface models for deterministic effects of localized irradiation of the skin by discrete {beta}/{gamma} -emitting sources

    Energy Technology Data Exchange (ETDEWEB)

    Scott, B.R.

    1995-12-01

    Individuals who work at nuclear reactor facilities can be at risk for deterministic effects in the skin from exposure to discrete {Beta}- and {gamma}-emitting ({Beta}{gamma}E) sources (e.g., {Beta}{gamma}E hot particles) on the skin or clothing. Deterministic effects are non-cancer effects that have a threshold and increase in severity as dose increases (e.g., ulcer in skin). Hot {Beta}{gamma}E particles are {sup 60}Co- or nuclear fuel-derived particles with diameters > 10 {mu}m and < 3 mm and contain at least 3.7 kBq (0.1 {mu}Ci) of radioactivity. For such {Beta}{gamma}E sources on the skin, it is the beta component of the dose that is most important. To develop exposure limitation systems that adequately control exposure of workers to discrete {Beta}{gamma}E sources, models are needed for systems that adequately control exposure of workers to discrete {Beta}{gamma}E sources, models are needed for evaluating the risk of deterministic effects of localized {Beta} irradiation of the skin. The purpose of this study was to develop dose-rate and irradiated-area dependent, response-surface models for evaluating risks of significant deterministic effects of localized irradiation of the skin by discrete {Beta}{gamma}E sources and to use modeling results to recommend approaches to limiting occupational exposure to such sources. The significance of the research results as follows: (1) response-surface models are now available for evaluating the risk of specific deterministic effects of localized irradiation of the skin; (2) modeling results have been used to recommend approaches to limiting occupational exposure of workers to {Beta} radiation from {Beta}{gamma}E sources on the skin or on clothing; and (3) the generic irradiated-volume, weighting-factor approach to limiting exposure can be applied to other organs including the eye, the ear, and organs of the respiratory or gastrointestinal tract and can be used for both deterministic and stochastic effects.

  10. Estrogens and aging skin

    OpenAIRE

    Thornton, M. Julie

    2013-01-01

    Estrogen deficiency following menopause results in atrophic skin changes and acceleration of skin aging. Estrogens significantly modulate skin physiology, targeting keratinocytes, fibroblasts, melanocytes, hair follicles and sebaceous glands, and improve angiogenesis, wound healing and immune responses. Estrogen insufficiency decreases defense against oxidative stress; skin becomes thinner with less collagen, decreased elasticity, increased wrinkling, increased dryness and reduced vascularity...

  11. Skin barrier response to occlusion of healthy and irritated skin: differences in trans-epidermal water loss, erythema and stratum corneum lipids

    DEFF Research Database (Denmark)

    Jungersted, Jakob Mutanu; Høgh, Julie Kaae; Hellgren, Lars

    2010-01-01

    Occlusion of the skin is a risk factor for development of irritant contact dermatitis. Occlusion may, however, have a positive effect on skin healing. No consensus on the effect of occlusion has been reached.......Occlusion of the skin is a risk factor for development of irritant contact dermatitis. Occlusion may, however, have a positive effect on skin healing. No consensus on the effect of occlusion has been reached....

  12. Comparison of human skin opto-thermal response to near-infrared and visible laser irradiations: a theoretical investigation

    Energy Technology Data Exchange (ETDEWEB)

    Dai Tianhong [Department of Bioengineering, Rice University, Houston, TX 77251 (United States); Pikkula, Brian M [Department of Bioengineering, Rice University, Houston, TX 77251 (United States); Wang, Lihong V [Department of Biomedical Engineering, Texas A and M University, College Station, TX 77843 (United States); Anvari, Bahman [Department of Bioengineering, Rice University, Houston, TX 77251 (United States)

    2004-11-07

    Near-infrared wavelengths are absorbed less by epidermal melanin, and penetrate deeper into human skin dermis and blood than visible wavelengths. Therefore, laser irradiation using near-infrared wavelengths may improve the therapeutic outcome of cutaneous hyper-vascular malformations in moderately to heavily pigmented skin patients and those with large-sized blood vessels or blood vessels extending deeply into the skin. A mathematical model composed of a Monte Carlo algorithm to estimate the distribution of absorbed light, numerical solution of a bio-heat diffusion equation to calculate the transient temperature distribution, and a damage integral based on an empirical Arrhenius relationship to quantify the tissue damage was utilized to investigate the opto-thermal response of human skin to near-infrared and visible laser irradiations in conjunction with cryogen spray cooling. In addition, the thermal effects of a single continuous laser pulse and micropulse-composed laser pulse profiles were compared. Simulation results indicated that a 940 nm wavelength induces improved therapeutic outcome compared with a 585 and 595 nm wavelengths for the treatment of patients with large-sized blood vessels and moderately to heavily pigmented skin. On the other hand, a 585 nm wavelength shows the best efficacy in treating small-sized blood vessels, as characterized by the largest laser-induced blood vessel damage depth compared with 595 and 940 nm wavelengths. Dermal blood content has a considerable effect on the threshold incident dosage for epidermal damage, while the effect of blood vessel size is minimal. For the same macropulse duration and incident dosage, a micropulse-composed pulse profile results in higher peak temperature at the basal layer of skin epidermis than an ideal single continuous pulse profile.

  13. Effects of 2-day calorie restriction on cardiovascular autonomic response, mood, and cognitive and motor functions in obese young adult women.

    Science.gov (United States)

    Solianik, Rima; Sujeta, Artūras; Čekanauskaitė, Agnė

    2018-06-02

    Although long-term energy restriction has been widely investigated and has consistently induced improvements in health and cognitive and motor functions, the responses to short-duration calorie restriction are not completely understood. The purpose of this study was to investigate the effects of a 2-day very low-calorie diet on evoked stress, mood, and cognitive and motor functions in obese women. Nine obese women (body fatness > 32%) aged 22-31 years were tested under two randomly allocated conditions: 2-day very low-calorie diet (511 kcal) and 2-day usual diet. The perceived stressfulness of the diet, cardiovascular autonomic response, and cognitive and motor performances were evaluated before and after each diet. The subjective stress rating of the calorie-restricted diet was 41.5 ± 23.3. Calorie restriction had no detectable effects on the heart rate variability indices, mood, grip strength, or psychomotor functions. By contrast, calorie restriction increased (p restriction evoked moderate stress in obese women, cardiovascular autonomic function was not affected. Calorie restriction had complex effects on cognition: it declined cognitive flexibility, and improved spatial processing and visuospatial working memory, but did not affect mood or motor behavior.

  14. Visible Light Induces Melanogenesis in Human Skin through a Photoadaptive Response

    Science.gov (United States)

    Randhawa, Manpreet; Seo, InSeok; Liebel, Frank; Southall, Michael D.; Kollias, Nikiforos; Ruvolo, Eduardo

    2015-01-01

    Visible light (400–700 nm) lies outside of the spectral range of what photobiologists define as deleterious radiation and as a result few studies have studied the effects of visible light range of wavelengths on skin. This oversight is important considering that during outdoors activities skin is exposed to the full solar spectrum, including visible light, and to multiple exposures at different times and doses. Although the contribution of the UV component of sunlight to skin damage has been established, few studies have examined the effects of non-UV solar radiation on skin physiology in terms of inflammation, and limited information is available regarding the role of visible light on pigmentation. The purpose of this study was to determine the effect of visible light on the pro-pigmentation pathways and melanin formation in skin. Exposure to visible light in ex-vivo and clinical studies demonstrated an induction of pigmentation in skin by visible light. Results showed that a single exposure to visible light induced very little pigmentation whereas multiple exposures with visible light resulted in darker and sustained pigmentation. These findings have potential implications on the management of photo-aggravated pigmentary disorders, the proper use of sunscreens, and the treatment of depigmented lesions. PMID:26121474

  15. Visible Light Induces Melanogenesis in Human Skin through a Photoadaptive Response.

    Science.gov (United States)

    Randhawa, Manpreet; Seo, InSeok; Liebel, Frank; Southall, Michael D; Kollias, Nikiforos; Ruvolo, Eduardo

    2015-01-01

    Visible light (400-700 nm) lies outside of the spectral range of what photobiologists define as deleterious radiation and as a result few studies have studied the effects of visible light range of wavelengths on skin. This oversight is important considering that during outdoors activities skin is exposed to the full solar spectrum, including visible light, and to multiple exposures at different times and doses. Although the contribution of the UV component of sunlight to skin damage has been established, few studies have examined the effects of non-UV solar radiation on skin physiology in terms of inflammation, and limited information is available regarding the role of visible light on pigmentation. The purpose of this study was to determine the effect of visible light on the pro-pigmentation pathways and melanin formation in skin. Exposure to visible light in ex-vivo and clinical studies demonstrated an induction of pigmentation in skin by visible light. Results showed that a single exposure to visible light induced very little pigmentation whereas multiple exposures with visible light resulted in darker and sustained pigmentation. These findings have potential implications on the management of photo-aggravated pigmentary disorders, the proper use of sunscreens, and the treatment of depigmented lesions.

  16. Visible Light Induces Melanogenesis in Human Skin through a Photoadaptive Response.

    Directory of Open Access Journals (Sweden)

    Manpreet Randhawa

    Full Text Available Visible light (400-700 nm lies outside of the spectral range of what photobiologists define as deleterious radiation and as a result few studies have studied the effects of visible light range of wavelengths on skin. This oversight is important considering that during outdoors activities skin is exposed to the full solar spectrum, including visible light, and to multiple exposures at different times and doses. Although the contribution of the UV component of sunlight to skin damage has been established, few studies have examined the effects of non-UV solar radiation on skin physiology in terms of inflammation, and limited information is available regarding the role of visible light on pigmentation. The purpose of this study was to determine the effect of visible light on the pro-pigmentation pathways and melanin formation in skin. Exposure to visible light in ex-vivo and clinical studies demonstrated an induction of pigmentation in skin by visible light. Results showed that a single exposure to visible light induced very little pigmentation whereas multiple exposures with visible light resulted in darker and sustained pigmentation. These findings have potential implications on the management of photo-aggravated pigmentary disorders, the proper use of sunscreens, and the treatment of depigmented lesions.

  17. Sympathetic skin response in multiple sclerosis: a meta-analysis of case-control studies.

    Science.gov (United States)

    Margaritella, Nicolò; Mendozzi, Laura; Garegnani, Massimo; Gilardi, Elisabetta; Nemni, Raffaello; Pugnetti, Luigi

    2018-01-01

    The usefulness of sympathetic skin responses (SSR) in multiple sclerosis (MS) has been advocated by several studies in the last 20 years; however, due to a great heterogeneity of findings, a comprehensive meta-analysis of case-control studies is in order to pinpoint consistencies and investigate the causes of discrepancies. We searched MEDLINE, EMBASE and Cochrane databases for case-control studies comparing SSR absence frequency and latency between patients with MS and healthy controls. Thirteen eligible studies including 415 MS patients and 331 healthy controls were identified. The pooled analysis showed that SSR can be always obtained in healthy controls while 34% of patients had absent SSRs in at least one limb (95% CI 22-47%; p studies (I 2  = 90.3%). Patients' age explained 22% of the overall variability and positive correlations were found with Expanded Disability Status Scale and disease duration. The pooled mean difference of SSR latency showed a significant increase in patients on both upper (193 ms; 95% CI 120-270 ms) and lower (350 ms; 95% CI 190-510 ms) extremities. We tested the discriminatory value of SSR latency thresholds defined as the 95% confidence interval (CI) upper bound of the healthy controls, and validated the results on a new dataset. The lower limb threshold of 1.964 s produces the best results in terms of sensitivity 0.86, specificity 0.67, positive predicted value 0.75 and negative predicted value 0.80. Despite a considerable heterogeneity of findings, there is evidence that SSR is a useful tool in MS.

  18. Modifications of the sympathetic skin response in workers chronically exposed to lead

    Directory of Open Access Journals (Sweden)

    D.B. Nora

    2007-01-01

    Full Text Available The long-term effects of low-level lead intoxication are not known. The sympathetic skin response (SSR was evaluated in a group of 60 former workers of a primary lead smelter, located in Santo Amaro, BA, Brazil. The individuals participating in the study were submitted to a clinical-epidemiological evaluation including questions related to potential risk factors for intoxication, complaints related to peripheral nervous system (PNS involvement, neurological clinical examination, and also to electromyography and nerve conduction studies and SSR evaluation. The sample consisted of 57 men and 3 women aged 34 to 69 years (mean ± SD: 46.8 ± 6.9. The neurophysiologic evaluation showed the presence of lumbosacral radiculopathy in one of the individuals (1.7%, axonal sensorimotor polyneuropathy in 2 (3.3%, and carpal tunnel syndrome in 6 (10%. SSR was abnormal or absent in 12 cases, representing 20% of the sample. More than half of the subjects (53.3% reported a history of acute abdominal pain requiring hospitalization during the period of work at the plant. A history of acute palsy of radial and peroneal nerves was reported by about 16.7 and 8.3% of the individuals, respectively. Mean SSR amplitude did not differ significantly between patients presenting or not the various characteristics in the current neurological situation, except for diaphoresis. The results suggest that chronic lead intoxication induces PNS damage, particularly affecting unmyelinated small fibers. Further systematic study is needed to more precisely define the role of lead in inducing PNS injury.

  19. Political accountability and autonomous weapons

    Directory of Open Access Journals (Sweden)

    James Igoe Walsh

    2015-09-01

    Full Text Available Autonomous weapons would have the capacity to select and attack targets without direct human input. One important objection to the introduction of such weapons is that they will make it more difficult to identify and hold accountable those responsible for undesirable outcomes such as mission failures and civilian casualties. I hypothesize that individuals can modify their attribution of responsibility in predicable ways to accommodate this new technology. The results of a survey experiment are consistent with this; subjects continue to find responsible and hold accountable political and military leaders when autonomous weapons are used, but also attribute responsibility to the designers and programmers of such weapons.

  20. Autonomic functioning in mothers with interpersonal violence-related posttraumatic stress disorder in response to separation-reunion.

    Science.gov (United States)

    Schechter, Daniel S; Moser, Dominik A; McCaw, Jaime E; Myers, Michael M

    2014-05-01

    This study characterizes autonomic nervous system activity reactive to separation-reunion among mothers with Interpersonal Violence-Related Posttraumatic Stress Disorder (IPV-PTSD). Heart-rate (HR) and high frequency heart-rate-variability (HF-HRV) were measured in 17 IPV-PTSD-mothers, 22 sub-threshold-mothers, and 15 non-PTSD mother-controls while interacting with their toddlers (12-48 months). Analyses showed IPV-PTSD-mothers having generally lower HR than other groups. All groups showed negative correlations between changes in HR and HF-HRV from sitting- to standing-baseline. During initial separation, controls no longer showed a negative relationship between HR and HF-HRV. But by the second reunion, the negative relationship reappeared. IPV-PTSD- and sub-threshold-mothers retained negative HR/HF-HRV correlations during the initial separation, but stopped showing them by the second reunion. Results support that mother-controls showed a pattern of autonomic regulation suggestive of hypervigilance during initial separation that resolved by the time of re-exposure. PTSD-mothers showed delayed onset of this pattern only upon re-exposure, and were perhaps exhibiting defensive avoidance or numbing during the initial separation/reunion. © 2013 Wiley Periodicals, Inc.

  1. Cardiac Autonomic Responses during Exercise and Post-exercise Recovery Using Heart Rate Variability and Systolic Time Intervals—A Review

    Science.gov (United States)

    Michael, Scott; Graham, Kenneth S.; Davis, Glen M.

    2017-01-01

    Cardiac parasympathetic activity may be non-invasively investigated using heart rate variability (HRV), although HRV is not widely accepted to reflect sympathetic activity. Instead, cardiac sympathetic activity may be investigated using systolic time intervals (STI), such as the pre-ejection period. Although these autonomic indices are typically measured during rest, the “reactivity hypothesis” suggests that investigating responses to a stressor (e.g., exercise) may be a valuable monitoring approach in clinical and high-performance settings. However, when interpreting these indices it is important to consider how the exercise dose itself (i.e., intensity, duration, and modality) may influence the response. Therefore, the purpose of this investigation was to review the literature regarding how the exercise dosage influences these autonomic indices during exercise and acute post-exercise recovery. There are substantial methodological variations throughout the literature regarding HRV responses to exercise, in terms of exercise protocols and HRV analysis techniques. Exercise intensity is the primary factor influencing HRV, with a greater intensity eliciting a lower HRV during exercise up to moderate-high intensity, with minimal change observed as intensity is increased further. Post-exercise, a greater preceding intensity is associated with a slower HRV recovery, although the dose-response remains unclear. A longer exercise duration has been reported to elicit a lower HRV only during low-moderate intensity and when accompanied by cardiovascular drift, while a small number of studies have reported conflicting results regarding whether a longer duration delays HRV recovery. “Modality” has been defined multiple ways, with limited evidence suggesting exercise of a greater muscle mass and/or energy expenditure may delay HRV recovery. STI responses during exercise and recovery have seldom been reported, although limited data suggests that intensity is a key

  2. Skin graft

    Science.gov (United States)

    Skin transplant; Skin autografting; FTSG; STSG; Split thickness skin graft; Full thickness skin graft ... donor site. Most people who are having a skin graft have a split-thickness skin graft. This takes ...

  3. Force sensor in simulated skin and neural model mimic tactile SAI afferent spiking response to ramp and hold stimuli.

    Science.gov (United States)

    Kim, Elmer K; Wellnitz, Scott A; Bourdon, Sarah M; Lumpkin, Ellen A; Gerling, Gregory J

    2012-07-23

    The next generation of prosthetic limbs will restore sensory feedback to the nervous system by mimicking how skin mechanoreceptors, innervated by afferents, produce trains of action potentials in response to compressive stimuli. Prior work has addressed building sensors within skin substitutes for robotics, modeling skin mechanics and neural dynamics of mechanotransduction, and predicting response timing of action potentials for vibration. The effort here is unique because it accounts for skin elasticity by measuring force within simulated skin, utilizes few free model parameters for parsimony, and separates parameter fitting and model validation. Additionally, the ramp-and-hold, sustained stimuli used in this work capture the essential features of the everyday task of contacting and holding an object. This systems integration effort computationally replicates the neural firing behavior for a slowly adapting type I (SAI) afferent in its temporally varying response to both intensity and rate of indentation force by combining a physical force sensor, housed in a skin-like substrate, with a mathematical model of neuronal spiking, the leaky integrate-and-fire. Comparison experiments were then conducted using ramp-and-hold stimuli on both the spiking-sensor model and mouse SAI afferents. The model parameters were iteratively fit against recorded SAI interspike intervals (ISI) before validating the model to assess its performance. Model-predicted spike firing compares favorably with that observed for single SAI afferents. As indentation magnitude increases (1.2, 1.3, to 1.4 mm), mean ISI decreases from 98.81 ± 24.73, 54.52 ± 6.94, to 41.11 ± 6.11 ms. Moreover, as rate of ramp-up increases, ISI during ramp-up decreases from 21.85 ± 5.33, 19.98 ± 3.10, to 15.42 ± 2.41 ms. Considering first spikes, the predicted latencies exhibited a decreasing trend as stimulus rate increased, as is observed in afferent recordings. Finally, the SAI afferent's characteristic response

  4. The effect of starting or stopping skin cooling on the thermoregulatory responses during leg exercise in humans.

    Science.gov (United States)

    Demachi, K; Yoshida, T; Kume, M; Tsuneoka, H

    2012-07-01

    To assess the effects of starting or stopping leg cooling on the thermoregulatory responses during exercise, 60 min of cycling exercise at 30% of maximal oxygen uptake was performed under 4 conditions using tube trouser perfused with water at 10 °C; no leg cooling (NC), starting of leg cooling after 30 min of exercise (delayed cooling, DC), continuous leg cooling (CC), and stopping of continuous leg cooling after 30 min of exercise (SC) at an environmental temperature of 28.5 °C. During exercise under the DC conditions, an instantaneous increase in the esophageal temperature (Tes), a suppression of the cutaneous vascular conductance at the forearm (%CVC), and a decrease in the mean skin temperature (Tsk) were observed after leg cooling. The total sweat loss (Δm sw,tot) was lower under the DC than the NC condition. In the SC study, however, the Tes remained constant, while the %CVC increased gradually after leg cooling was stopped, and the Δm sw,tot was greater than that under the CC condition. These results suggest that during exercise, rapid skin cooling of the leg may cause an increase in core temperature, while also enhancing thermal stress. However, stopping skin cooling did not significantly affect the core temperature long-term, because the skin blood flow and sweat rate subsequently increased. © Georg Thieme Verlag KG Stuttgart · New York.

  5. Histologic analyses on the response of the skin to 1,927-nm fractional thulium fiber laser treatment.

    Science.gov (United States)

    Kwon, In Ho; Bae, Youin; Yeo, Un-Cheol; Lee, Jin Yong; Kwon, Hyuck Hoon; Choi, Young Hee; Park, Gyeong-Hun

    2018-02-01

    The histologic responses to varied parameters of 1,927-nm fractional thulium fiber laser treatment have not yet been sufficiently elucidated. This study sought to evaluate histologic changes immediately after 1,927-nm fractional thulium fiber laser session at various parameters. The dorsal skin of Yucatan mini-pig was treated with 1,927-nm fractional thulium fiber laser at varied parameters, with or without skin drying. The immediate histologic changes were evaluated to determine the effects of varying laser parameters on the width and the depth of treated zones. The increase in the level of pulse energy widened the area of epidermal changes in the low power level, but increased the dermal penetration depth in the high power level. As the pulse energy level increased, the increase in the power level under the given pulse energy level more evidently made dermal penetration deeper and the treatment area smaller. Skin drying did not show significant effects on epidermal changes, but evidently increased the depth of dermal denaturation under both high and low levels of pulse energy. These results may provide important information to establish treatment parameters of the 1,927-nm fractional thulium fiber laser for various skin conditions.

  6. Dose requirements of alfentanil to eliminate autonomic responses during rapid-sequence induction with thiopental 4 mg/kg and rocuronium 0.6 mg/kg.

    Science.gov (United States)

    Abou-Arab, Mohammad H; Rostrup, Morten; Heier, Tom

    2016-12-01

    Opioids are integral part of anesthesia induction, but information on optimal dosing is limited. We aimed to determine doses of alfentanil needed to eliminate increases in 5 autonomic response variables (plasma concentrations of epinephrine, norepinephrine and vasopressin, arterial blood pressure [ABP], and heart rate) during rapid-sequence induction of anesthesia with thiopental 4 mg/kg and rocuronium 0.6 mg/kg. Prospective, randomized, observer-blinded, interventional clinical study. Large academic institution. Eighty-four healthy patients, aged 18 to 55 years, received 1 of 7 assessor-blinded doses of alfentanil (0, 10, 20, 30, 40, 50, and 60 μg/kg) together with thiopental 4 mg/kg and rocuronium 0.6 mg/kg, administered in rapid succession (15 seconds). Laryngoscopy was initiated 40 seconds after rocuronium, and tracheal intubation was concluded within 15 seconds thereafter. An indwelling radial artery catheter was used for hemodynamic monitoring and blood sampling. Relationships between alfentanil dose and response variables were tested with linear regression, and the influence of covariates (sex, body weight, and age) was determined. Alfentanil dose needed to prevent increases in ABP >10% above baseline with 95% probability was estimated with logistic regression. Significant relationships were determined between alfentanil dose and response variables. Clinically interesting influence of covariates was not found. Alfentanil 55 μg/kg was needed to prevent increases in ABP postintubation >10% above baseline with 95% probability. One individual needed a bolus of vasopressor postintubation. Optimal control of autonomic responses during rapid-sequence induction was achieved with clinically relevant doses of alfentanil in healthy patients anesthetized with thiopental 4 mg/kg and rocuronium 0.6 mg/kg. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Quantitative Methods for Measuring Repair Rates and Innate-Immune Cell Responses in Wounded Mouse Skin.

    Science.gov (United States)

    Li, Zhi; Gothard, Elizabeth; Coles, Mark C; Ambler, Carrie A

    2018-01-01

    In skin wounds, innate-immune cells clear up tissue debris and microbial contamination, and also secrete cytokines and other growth factors that impact repair process such as re-epithelialization and wound closure. After injury, there is a rapid influx and efflux of immune cells at wound sites, yet the function of each innate cell population in skin repair is still under investigation. Flow cytometry is a valuable research tool for detecting and quantifying immune cells; however, in mouse back skin, the difficulty in extracting immune cells from small area of skin due to tissue complexity has made cytometric analysis an underutilized tool. In this paper, we provide detailed methods on the digestion of lesion-specific skin without disrupting antigen expression followed by multiplex cell staining that allows for identification of seven innate-immune populations, including rare subsets such as group-3 innate lymphoid cells (ILC3s), by flow-cytometry analysis. Furthermore, when studying the functions of immune cells to tissue repair an important metric to monitor is size of the wound opening. Normal wounds close steadily albeit at non-linear rates, while slow or stalled wound closure can indicate an underlying problem with the repair process. Calliper measurements are difficult and time-consuming to obtain and can require repeated sedation of experimental animals. We provide advanced methods for measuring of wound openness; digital 3D image capture and semi-automated image processing that allows for unbiased, reliable measurements that can be taken repeatedly over time.

  8. Benefits of plasma rich in growth factors (PRGF) in skin photodamage: clinical response and histological assessment.

    Science.gov (United States)

    Díaz-Ley, B; Cuevast, J; Alonso-Castro, L; Calvo, M I; Ríos-Buceta, L; Orive, G; Anitua, E; Jaén, P

    2015-01-01

    Skin ageing is characterized by small and fine wrinkles, roughness, laxity, and pigmentation as a result of epidermal thinning, collagen degradation, dermal atrophy, and fewer fibroblasts. Plasma rich in growth factors (PRGF) is an autologous plasma preparation enriched in proteins obtained from patient's own blood aimed at accelerating tissue repair and regeneration. To evaluate the benefits of PRGF in skin photodamage, 10 healthy volunteers were treated with three consecutive intradermal injections of PRGF in the facial area. Clinical outcomes and histological analysis were performed. A statistically significant increase in the epidermis and papillary dermis thickness was seen after PRGF treatment (p PRGF treatment, a reduction of the average area fraction of solar elastosis was observed in patients with clinical and histological signs of skin photodamage (p PRGF use was 0.75 (9/12) for the group of patients with signs of skin photodamage. Intradermal PRGF infiltration appears to be an effective treatment for the photodamaged skin. © 2015 Wiley Periodicals, Inc.

  9. Immune and biochemical responses in skin differ between bovine hosts genetically susceptible and resistant to the cattle tick Rhipicephalus microplus.

    Science.gov (United States)

    Franzin, Alessandra Mara; Maruyama, Sandra Regina; Garcia, Gustavo Rocha; Oliveira, Rosane Pereira; Ribeiro, José Marcos Chaves; Bishop, Richard; Maia, Antônio Augusto Mendes; Moré, Daniela Dantas; Ferreira, Beatriz Rossetti; Santos, Isabel Kinney Ferreira de Miranda

    2017-01-31

    Ticks attach to and penetrate their hosts' skin and inactivate multiple components of host responses in order to acquire a blood meal. Infestation loads with the cattle tick, Rhipicephalus microplus, are heritable: some breeds carry high loads of reproductively successful ticks, whereas in others, few ticks feed and reproduce efficiently. In order to elucidate the mechanisms that result in the different outcomes of infestations with cattle ticks, we examined global gene expression and inflammation induced by tick bites in skins from one resistant and one susceptible breed of cattle that underwent primary infestations with larvae and nymphs of R. microplus. We also examined the expression profiles of genes encoding secreted tick proteins that mediate parasitism in larvae and nymphs feeding on these breeds. Functional analyses of differentially expressed genes in the skin suggest that allergic contact-like dermatitis develops with ensuing production of IL-6, CXCL-8 and CCL-2 and is sustained by HMGB1, ISG15 and PKR, leading to expression of pro-inflammatory chemokines and cytokines that recruit granulocytes and T lymphocytes. Importantly, this response is delayed in susceptible hosts. Histopathological analyses of infested skins showed inflammatory reactions surrounding tick cement cones that enable attachment in both breeds, but in genetically tick-resistant bovines they destabilized the cone. The transcription data provided insights into tick-mediated activation of basophils, which have previously been shown to be a key to host resistance in model systems. Skin from tick-susceptible bovines expressed more transcripts encoding enzymes that detoxify tissues. Interestingly, these enzymes also produce volatile odoriferous compounds and, accordingly, skin rubbings from tick-susceptible bovines attracted significantly more tick larvae than rubbings from resistant hosts. Moreover, transcripts encoding secreted modulatory molecules by the tick were significantly more

  10. Multiple helminth infection of the skin causes lymphocyte hypo-responsiveness mediated by Th2 conditioning of dermal myeloid cells.

    Directory of Open Access Journals (Sweden)

    Peter C Cook

    2011-03-01

    Full Text Available Infection of the mammalian host by schistosome larvae occurs via the skin, although nothing is known about the development of immune responses to multiple exposures of schistosome larvae, and/or their excretory/secretory (E/S products. Here, we show that multiple (4x exposures, prior to the onset of egg laying by adult worms, modulate the skin immune response and induce CD4(+ cell hypo-responsiveness in the draining lymph node, and even modulate the formation of hepatic egg-induced granulomas. Compared to mice exposed to a single infection (1x, dermal cells from multiply infected mice (4x, were less able to support lymph node cell proliferation. Analysis of dermal cells showed that the most abundant in 4x mice were eosinophils (F4/80(+MHC-II(-, but they did not impact the ability of antigen presenting cells (APC to support lymphocyte proliferation to parasite antigen in vitro. However, two other cell populations from the dermal site of infection appear to have a critical role. The first comprises arginase-1(+, Ym-1(+ alternatively activated macrophage-like cells, and the second are functionally compromised MHC-II(hi cells. Through the administration of exogenous IL-12 to multiply infected mice, we show that these suppressive myeloid cell phenotypes form as a consequence of events in the skin, most notably an enrichment of IL-4 and IL-13, likely resulting from an influx of RELMα-expressing eosinophils. We further illustrate that the development of these suppressive dermal cells is dependent upon IL-4Rα signalling. The development of immune hypo-responsiveness to schistosome larvae and their effect on the subsequent response to the immunopathogenic egg is important in appreciating how immune responses to helminth infections are modulated by repeated exposure to the infective early stages of development.

  11. Biochemical response of skin-coated citrus fruits irradiated for preservation

    International Nuclear Information System (INIS)

    Ahmed, E.S.

    1977-01-01

    Orange fruits (citrus Sinensis) Kind Egyptian Balady variety, were irradiated for 100, 200 and 400 Krad γ-ray doses in combination with sodium orthophenylphenate, 0.0025% incorporated in wax coatings as preirradiation treatment. The data revealed the utility of combined treatment to control postharvest decay in citrus fruits. 100 Krad extend shelflife of skin-coated fruits by 15 weeks without significant losses in Vitamin C, reducing sugars, or free amino acids and without storage disorders. Unirradiated non skin-coated and unirradiated skin-coated had a shelf-life of 7, and 10 weeks, respectively, under the same experimental storage conditions (14-20 C and R.H. 65-75%)

  12. The response of mouse skin to re-irradiation with x-rays or fast neutrons

    International Nuclear Information System (INIS)

    Tsukiyama, Iwao; Egawa, Sunao; Kumazawa, Akiyoshi; Iino, Yuu.

    1986-01-01

    Effects of neutrons and x-rays on mouse skin which had been previously irradiated with x-rays were investigated. Two tattoo marks were placed in the hairless legs of mice at intervals of 15 mm. The legs were exposed to various doses of x-ray and neutrons to determine the relative biological effectiveness (RBE) using the contraction of the skin as an index. The RBE was 0.93 - 1.73. The legs of the mice were preexposed to 25 Gy of x-ray, and exposed 4 months later. The contraction of the skin began earlier than after the first irradiation. RBE was 2.18 - 2.47. This RBE was higher than that in untreated mice. These results suggest that previously irradiated normal tissues are much more sensitive to neutrons than to x-rays. (author)

  13. The response of mouse skin and lung to fractionated x-rays

    International Nuclear Information System (INIS)

    Field, S.B.; Hornsey, S.

    1975-01-01

    The relationship between total dose and number of fractions has been investigated for damage to lung and skin in mice. Single doses and various numbers of fractions have been given and the results are analysed in two ways: (i) by comparing the fractionated treatment with a single dose. With this approach, and assuming that the observed damage to lung and skin is the result of cell killing, it is estimated that the ratio of initial to final slope of the cell survival curve is about 7:1; (ii) by measuring the additional dose required when the number of fractions is doubled. These results are roughly fitted by a single-hit times multitarget survival-curve model, with the ratio of slopes about 3:1. It is concluded from this discrepancy that the two-component model is an inadequate description of the survival curve for the cells of either skin or lung. (author)

  14. Exogenous melatonin administration modifies cutaneous vasoconstrictor response to whole body skin cooling in humans.

    Science.gov (United States)

    Aoki, Ken; Zhao, Kun; Yamazaki, Fumio; Sone, Ryoko; Alvarez, Guy E; Kosiba, Wojciech A; Johnson, John M

    2008-03-01

    Humans and other diurnal species experience a fall in internal temperature (T(int)) at night, accompanied by increased melatonin and altered thermoregulatory control of skin blood flow (SkBF). Also, exogenous melatonin induces a fall in T(int), an increase in distal skin temperatures and altered control of the cutaneous active vasodilator system, suggesting an effect of melatonin on the control of SkBF. To test whether exogenous melatonin also affects the more tonically active vasoconstrictor system in glabrous and nonglabrous skin during cooling, healthy males (n = 9) underwent afternoon sessions of whole body skin temperature (T(sk)) cooling (water-perfused suits) after oral melatonin (Mel; 3 mg) or placebo (Cont). Cutaneous vascular conductance (CVC) was calculated from SkBF (laser Doppler flowmetry) and non-invasive blood pressure. Baseline T(int) was lower in Mel than in Cont (P forearm CVC was first significantly reduced at T(sk) of 34.33 +/- 0.01 degrees C (P forearm CVC in Mel was significantly less than in Cont at T(sk) of 32.66 +/- 0.01 degrees C and lower (P < 0.05). In Mel, palmar CVC was significantly higher than in Cont above T(sk) of 33.33 +/- 0.01 degrees C, but not below. Thus exogenous melatonin blunts reflex vasoconstriction in nonglabrous skin and shifts vasoconstrictor system control to lower T(int). It provokes vasodilation in glabrous skin but does not suppress the sensitivity to falling T(sk). These findings suggest that by affecting the vasoconstrictor system, melatonin has a causal role in the nocturnal changes in body temperature and its control.

  15. Modeling slug tests in unconfined aquifers with both oscillatory and overdamped responses, and with low-K and high-K skin effects

    Science.gov (United States)

    Thoma, M. J.; Malama, B.; Barrash, W.; Bohling, G.; Butler, J. J.

    2009-12-01

    We extend the models for slug tests developed by Hyder et al. (1994) and Butler and Zhan (2004) to obtain a single general model for slug tests in unconfined aquifers in partially penetrating wells with a near-well disturbed zone (skin). The full range of responses, oscillatory to overdamped, is considered since both types of responses are common in wells in unconsolidated coarse fluvial aquifers, and others. The general semi-analytical solution allows for skin and formation storage as well as anisotropy in skin and formation hydraulic conductivity (K). The water table is treated as a fixed head boundary so the solution is applicable for wells screened below the water table. The model is validated by comparison with other models and by matching field data from unconfined fluvial aquifers at sites in Nebraska (MSEA) and Idaho (BHRS). We examine the effects of varying skin K and skin thickness to simulate the impact of a near-well disturbed zone that is lower (damage) or higher (filter pack) K than the formation. Results indicate that, for a given set of measured behavior at an example test zone, minor progressive decreases in estimated formation K occur with increases in assumed skin K, and moderate increases in estimated formation K occur with decreases in assumed skin K. Major increases (orders of magnitude) in estimated formation K occur with increased thickness of low-K skin. The importance of incorporating a finite-thickness representation of the skin, rather than the conventional infinitely thin representation, is also addressed.

  16. Basic emotions induced by odorants: a new approach based on autonomic pattern results.

    Science.gov (United States)

    Vernet-Maury, E; Alaoui-Ismaïli, O; Dittmar, A; Delhomme, G; Chanel, J

    1999-02-15

    The aim of this study was to link the effects of odorants with the emotional process, through autonomic nervous system (ANS) responses. Taking Ekman's data and our previous results into account, we tried to verify a possible evocation by odorants of some basic emotions, i.e. anger, fear, sadness, surprise, disgust and happiness. The question investigated was: would it be possible to associate any of these emotions with a pattern of autonomic responses? A total of 15 subjects inhaled five odorants: lavender, ethyl aceto acetate, camphor, acetic acid and butyric acid acting as olfactory stimuli. After inhaling the odorant, subjects were requested to fill out an 11-point hedonic scale to rate its 'pleasantness' vs. 'unpleasantness'. ANS parameters monitored were skin potential and resistance, skin blood flow and temperature, instantaneous respiratory frequency and instantaneous heart rate. Simultaneous recording of these six autonomic parameters permitted the analysis of phasic responses through specific ANS patterns. An analysis of variance made it possible to differentiate among the five odorants. Two-by-two odorant comparisons for autonomic responses using Tukey's HSD multiple comparison test only permitted differentiation between 'pleasant' and 'unpleasant' odors. Camphor was differentiated from both types. For instance, long duration responses were associated with 'unpleasant' odors whereas camphor elicited intermediate responses. Taking into account each subject's preferential channel, it was possible to associate each ANS pattern with a basic emotion by means of a decision tree. The computation of subjects' responses made it possible to associate an odorant with a basic emotion, over the whole group: lavender elicited mostly 'happiness', as did, to a lesser degree ethyl aceto acetate; camphor induced either 'happiness', 'surprise' or 'sadness' according to subjects' past histories; butyric and acetic acids mainly induced negative emotions: 'anger' and 'disgust

  17. Spatially distinct response of rice yield to autonomous adaptation under the CMIP5 multi-model projections

    Science.gov (United States)

    Shin, Yonghee; Lee, Eun-Jeong; Im, Eun-Soon; Jung, Il-Won

    2017-02-01

    Rice ( Oryza sativa L.) is a very important staple crop, as it feeds more than half of the world's population. Numerous studies have focused on the negative impacts of climate change on rice production. However, there is little debate on which region of the world is more vulnerable to climate change and how adaptation to this change can mitigate the negative impacts on rice production. We investigated the impacts of climate change on rice yield, based on simulations combining a global crop model, M-GAZE, and Coupled Model Intercomparison Project Phase 5 (CMIP5) multi-model projections. Our focus was the impact of mitigating emission forcings (representative concentration pathway RCP 4.5 vs. RCP 8.5) and autonomous adaptation (i.e., changing crop variety and planting date) on rice yield. In general, our results showed that climate change due to anthropogenic warming leads to a significant reduction in rice yield. However, autonomous adaptation provides the potential to reduce the negative impact of global warming on rice yields in a spatially distinct manner. The adaptation was less beneficial for countries located at a low latitude (e.g., Cambodia, Thailand, Brazil) compared to mid-latitude countries (e.g., USA, China, Pakistan), as regional climates at the lower latitudes are already near the upper temperature thresholds for acceptable rice growth. These findings suggest that the socioeconomic effects from rice production in lowlatitude countries can be highly vulnerable to anthropogenic global warming. Therefore, these countries need to be accountable to develop transformative adaptation strategies, such as adopting (or developing) heat-tolerant varieties, and/or improve irrigation systems and fertilizer use efficiency.

  18. Cardiovascular Autonomic Responses in the VCD Rat Model of Menopause: Effects of Short- and Long-Term Ovarian Failure.

    Science.gov (United States)

    Huber, Domitila A; Bazilio, Darlan; Lorenzon, Flaviano; Sehnem, Sibele; Pacheco, Lucas; Anselmo-Franci, Janete A; Lima, Fernanda B

    2017-01-01

    After menopause, hypertension elevates the risk of cardiac diseases, one of the major causes of women's morbidity. The gradual depletion of ovarian follicles in rats, induced by 4-vinylcyclohexene diepoxide (VCD), is a model for studying the physiology of menopause. 4-Vinylcyclohexene diepoxide treatment leads to early ovarian failure (OF) and a hormonal profile comparable to menopause in humans. We have hypothesized that OF can compromise the balance between sympathetic and parasympathetic tones of the cardiovascular system, shifting toward dominance of the former. We aimed to study the autonomic modulation of heart and blood vessels and the cardiovascular reflexes in rats presenting short-term (80 days) or long-term (180 days) OF induced by VCD. Twenty-eight-day-old Wistar rats were submitted to VCD treatment (160 mg/kg, intraperitoneally) or vehicle (control) for 15 consecutive days and experiments were conducted at 80 or 180 days after the onset of treatment. Long-term OF led to an increase in the sympathetic activity to blood vessels and an impairment in the baroreflex control of the heart, evoked by physiological changes in arterial pressure. Despite that, long-term OF did not cause hypertension during the 180 days of exposure. Short-term OF did not cause any deleterious effect on the cardiovascular parameters analyzed. These data indicate that long-term OF does not disrupt the maintenance of arterial pressure homeostasis in rats but worsens the autonomic cardiovascular control. In turn, this can lead to cardiovascular complications, especially when associated with the aging process seen during human menopause.

  19. Early and late radiation response of human skin following chronic exposure of the hands

    International Nuclear Information System (INIS)

    Lenz, U.; Arndt, D.; Thormann, T.

    1979-01-01

    Clinical examinations on 45 radiation workers with chronical low-level exposures to their hands revealed that accumulated doses in the range of 15 to 30 Sv (1500 to 3000 rem) may already produce macroscopically unconspicuous early alterations of the vessel system within the corium as well as epidermal hyperplasia. Therefore, the annual permissible dose equivalent of 0.75 Sv (75 rem) recommended by ICRP for the skin of the extremities appears unjustifiably high and should be reduced to 0.30 Sv (30 rem), the limit valid for the remaining areas of skin. (author)

  20. Dose response evaluation of gene expression profiles in the skin of K6/ODC mice exposed to sodium arsenite

    International Nuclear Information System (INIS)

    Ahlborn, Gene J.; Nelson, Gail M.; Ward, William O.; Knapp, Geremy; Allen, James W.; Ouyang Ming; Roop, Barbara C.; Chen Yan; O'Brien, Thomas; Kitchin, Kirk T.; Delker, Don A.

    2008-01-01

    Chronic drinking water exposure to inorganic arsenic and its metabolites increases tumor frequency in the skin of K6/ODC transgenic mice. To identify potential biomarkers and modes of action for this skin tumorigenicity, we characterized gene expression profiles from analysis of K6/ODC mice administered 0, 0.05, 0.25, 1.0 and 10 ppm sodium arsenite in their drinking water for 4 weeks. Following exposure, total RNA was isolated from mouse skin and processed to biotin-labeled cRNA for microarray analyses. Skin gene expression was analyzed with Affymetrix Mouse Genome 430A 2.0 GeneChips (registered) , and pathway analysis was conducted with DAVID (NIH), Ingenuity (registered) Systems and MetaCore's GeneGo. Differential expression of several key genes was verified through qPCR. Only the highest dose (10 ppm) resulted in significantly altered KEGG (Kyoto Encyclopedia of Genes and Genomes) pathways, including MAPK, regulation of actin cytoskeleton, Wnt, Jak-Stat, Tight junction, Toll-like, phosphatidylinositol and insulin signaling pathways. Approximately 20 genes exhibited a dose response, including several genes known to be associated with carcinogenesis or tumor progression including cyclin D1, CLIC4, Ephrin A1, STAT3 and DNA methyltransferase 3a. Although transcription changes in all identified genes have not previously been linked to arsenic carcinogenesis, their association with carcinogenesis in other systems suggests that these genes may play a role in the early stages of arsenic-induced skin carcinogenesis and can be considered potential biomarkers

  1. Developmental and Metabolic Plasticity of White-Skinned Grape Berries in Response to Botrytis cinerea during Noble Rot1[OPEN

    Science.gov (United States)

    Collins, Thomas S.; Vicente, Ariel R.; Doyle, Carolyn L.; Ye, Zirou; Allen, Greg; Heymann, Hildegarde

    2015-01-01

    Noble rot results from exceptional infections of ripe grape (Vitis vinifera) berries by Botrytis cinerea. Unlike bunch rot, noble rot promotes favorable changes in grape berries and the accumulation of secondary metabolites that enhance wine grape composition. Noble rot-infected berries of cv Sémillon, a white-skinned variety, were collected over 3 years from a commercial vineyard at the same time that fruit were harvested for botrytized wine production. Using an integrated transcriptomics and metabolomics approach, we demonstrate that noble rot alters the metabolism of cv Sémillon berries by inducing biotic and abiotic stress responses as well as ripening processes. During noble rot, B. cinerea induced the expression of key regulators of ripening-associated pathways, some of which are distinctive to the normal ripening of red-skinned cultivars. Enhancement of phenylpropanoid metabolism, characterized by a restricted flux in white-skinned berries, was a common outcome of noble rot and red-skinned berry ripening. Transcript and metabolite analyses together with enzymatic assays determined that the biosynthesis of anthocyanins is a consistent hallmark of noble rot in cv Sémillon berries. The biosynthesis of terpenes and fatty acid aroma precursors also increased during noble rot. We finally characterized the impact of noble rot in botrytized wines. Altogether, the results of this work demonstrated that noble rot causes a major reprogramming of berry development and metabolism. This desirable interaction between a fruit and a fungus stimulates pathways otherwise inactive in white-skinned berries, leading to a greater accumulation of compounds involved in the unique flavor and aroma of botrytized wines. PMID:26450706

  2. IN SITU IMMUNE RESPONSE EVALUATION VIA IMMUNOHISTOCHEMISTRY IN SKIN BIOPSIES FROM PATIENTS AFFECTED BY AUTOIMMUNE BLISTERING DISEASES

    Directory of Open Access Journals (Sweden)

    Ana Maria Abreu Velez

    2013-11-01

    Full Text Available Introduction: The in situ immune response in skin biopsies from patients affected by autoimmune skin blistering diseases (ABD is not well characterized. Aim: Our investigation attempts to immunophenotype cells in lesional skin in several ABD, utilizing immunohistochemistry (ICH. Methods: We tested by IHC for CD4, CD8, CD19, CD20, CD45, CD56/NCAM, PAX-5, granzyme B, myeloperoxidase, neutrophil elastase, LAT and ZAP-70 in patients affected by ABD. We tested 30 patients with endemic pemphigus foliaceus (EPF, 15 controls from the EPF endemic area, and 15 biopsies from healthy controls from the USA. We also tested archival biopsies from patients with selected ABD, including 30 patients with bullous pemphigoid, 20 with pemphigus vulgaris, 8 with pemphigus foliaceus and 14 with dermatitis herpetiformis. Results: We found a predominantly CD8 positive/CD45 positive T cell infiltrate in all ABD. Our skin biopsies demonstrated consistently positive staining for myeloperoxidase, but negative staining for neutrophil elastase. Most ABD biopsies displayed negative staining for CD4 and B cell markers; natural killer cell markers were also rarely seen. ZAP-70 and LAT were frequently detected. In El Bagre-EPF, a significant fragmentation of T cells in lesional skin was noted, as well as autoreactivity to lymph nodes. Conclusions: The documented T cell and myeloperoxidase staining are indicative of the role of T lymphocytes and neutrophils in lesional biopsies in patients with ABD, in addition to previously documented deposition of B cells, immunoglobulins and complement in situ. In El Bagre-EPF, T cells could also target lymph nodes; however, further studies are needed to confirm this possibility.

  3. The Response of the Ocean Thermal Skin Layer to Air-Sea Surface Heat Fluxes

    Science.gov (United States)

    Wong, Elizabeth Wing-See

    There is much evidence that the ocean is heating as a result of an increase in concentrations of greenhouse gases (GHGs) in the atmosphere from human activities. GHGs absorb infrared radiation and re-emit infrared radiation back to the ocean's surface which is subsequently absorbed. However, the incoming infrared radiation is absorbed within the top micrometers of the ocean's surface which is where the thermal skin layer exists. Thus the incident infrared radiation does not directly heat the upper few meters of the ocean. We are therefore motivated to investigate the physical mechanism between the absorption of infrared radiation and its effect on heat transfer at the air-sea boundary. The hypothesis is that since heat lost through the air-sea interface is controlled by the thermal skin layer, which is directly influenced by the absorption and emission of infrared radiation, the heat flow through the thermal skin layer adjusts to maintain the surface heat loss, assuming the surface heat loss does not vary, and thus modulates the upper ocean heat content. This hypothesis is investigated through utilizing clouds to represent an increase in incoming longwave radiation and analyzing retrieved thermal skin layer vertical temperature profiles from a shipboard infrared spectrometer from two research cruises. The data are limited to night-time, no precipitation and low winds of less than 2 m/s to remove effects of solar radiation, wind-driven shear and possibilities of thermal skin layer disruption. The results show independence of the turbulent fluxes and emitted radiation on the incident radiative fluxes which rules out the immediate release of heat from the absorption of the cloud infrared irradiance back into the atmosphere through processes such as evaporation and increase infrared emission. Furthermore, independence was confirmed between the incoming and outgoing radiative flux which implies the heat sink for upward flowing heat at the air-sea interface is more

  4. Hemodynamic and autonomic nervous system responses to mixed meal ingestion in healthy young and old subjects and dysautonomic patients with postprandial hypotension

    Science.gov (United States)

    Lipsitz, L. A.; Ryan, S. M.; Parker, J. A.; Freeman, R.; Wei, J. Y.; Goldberger, A. L.

    1993-01-01

    BACKGROUND. Although postprandial hypotension is a common cause of falls and syncope in elderly persons and in patients with autonomic insufficiency, the pathophysiology of this disorder remains unknown. METHODS AND RESULTS. We examined the hemodynamic, splanchnic blood pool, plasma norepinephrine (NE), and heart rate (HR) power spectra responses to a standardized 400-kcal mixed meal in 11 healthy young (age, 26 +/- 5 years) and nine healthy elderly (age, 80 +/- 5 years) subjects and 10 dysautonomic patients with symptomatic postprandial hypotension (age, 65 +/- 16 years). Cardiac and splanchnic blood pools were determined noninvasively by radionuclide scans, and forearm vascular resistance was determined using venous occlusion plethysmography. In healthy young and old subjects, splanchnic blood volume increased, but supine blood pressure remained unchanged after the meal. In both groups, HR increased and systemic vascular resistance remained stable. Forearm vascular resistance and cardiac index increased after the meal in elderly subjects, whereas these responses were highly variable and of smaller magnitude in the young. Young subjects demonstrated postprandial increases in low-frequency HR spectral power, representing cardiac sympatho-excitation, but plasma NE remained unchanged. In elderly subjects, plasma NE increased after the meal but without changes in the HR power spectrum. Patients with dysautonomia had a large postprandial decline in blood pressure associated with no change in forearm vascular resistance, a fall in systemic vascular resistance, and reduction in left ventricular end diastolic volume index. HR increased in these patients but without changes in plasma NE or the HR power spectrum. CONCLUSIONS. 1) In healthy elderly subjects, the maintenance of blood pressure homeostasis after food ingestion is associated with an increase in HR, forearm vascular resistance, cardiac index, and plasma NE. In both young and old, systemic vascular resistance is

  5. [Effects of self-foot reflexology on stress, fatigue, skin temperature and immune response in female undergraduate students].

    Science.gov (United States)

    Lee, Young-Mee

    2011-02-01

    The purpose of this study was to evaluate the effects of self-foot reflexology on stress (perceived stress, urine cortisol level, and serum cortisol level), fatigue, skin temperature and immune response in female undergraduate students. The research design was a nonequivalent control group pretest-post test design. Participants were 60 university students: 30 in the experiment group and 30 in the control group. The period of this study was from April to June 2010. The program was performed for 1 hr a session, three times a week for 6 weeks. The data were analyzed using the SPSS/WIN 17.0 program. The results showed that self-foot reflexology was effective in reducing perceived stress and fatigue, and raised skin temperature in female undergraduate students. But cortisol levels and immune response were not statistically significant different. The results of this study indicate that self-foot reflexology is an effective nursing intervention in reducing perceived stress and fatigue and, in improving skin temperature. Therefore, it is recommended that this be used in clinical practice as an effective nursing intervention for in female undergraduate students.

  6. Safety and skin delayed-type hypersensitivity response in vervet monkeys immunized with Leishmania donovani sonicate antigen delivered with adjuvants

    Directory of Open Access Journals (Sweden)

    Joshua M. Mutiso

    2012-02-01

    Full Text Available In this study, we report on the safety and skin delayed-type hypersensitivity (DTH, responses of the Leishmania donovani whole cell sonicate antigen delivered in conjunction with alum-BCG (AlBCG, Montanide ISA 720 (MISA or Monophosphoryl lipid A (MPLA in groups of vervet monkeys. Following three intradermal injections of the inoculums on days 0, 28 and 42, safety and DTH responses were assessed. Preliminary tumor necrosis factor alpha (TNF-α and interferon gamma (IFN-γ levels were also measured and these were compared with DTH. Only those animals immunized with alum-BCG reacted adversely to the inoculum by producing ulcerative erythematous skin indurations. Non-parametric analysis of variance followed by a post-test showed significantly higher DTH responses in the MISA+Ag group compared with other immunized groups (p < 0.001. The MPLA+Ag group indicated significantly lower DTH responses to the sonicate antigen compared with the AlBCG+Ag group. There was a significant correlation between the DTH and cytokine responses (p < 0.0001. Based on this study we conclude that Leishmania donovani sonicate antigen containing MISA 720 is safe and is associated with a strong DTH reaction following immunization.

  7. Extracellular Matrix Modulates Morphology, Growth, Oxidative Stress Response and Functionality of Human Skin Fibroblasts during Aging In Vitro

    DEFF Research Database (Denmark)

    Jørgensen, Peter; Rattan, Suresh

    2014-01-01

    recent observations indicate that replicative lifespan, senescence and functionality of cells in vitro can be significantly affected by the quality of the extra cellular matrix (ECM). Following up on those reports, here we show that using the ECM prepared from early passage young cells, partial...... rejuvenation of serially passaged human facial skin fibroblasts was possible in pre-senescent middle-aged cells, but not in fully senescent late passage cells. ECM from young cells improved the appearance, viability, stress tolerance and wound healing ability of skin fibroblasts. Furthermore, young ECM...... modulated the oxidative stress response transcription factor Nrf-2 and its downstream effector haem-oxygenase (HO-1), possibly through the amelioration of the environmental stress induced by the plastic surface of the culturing flasks. Therefore, it is important to consider the role of ECM in modulating...

  8. Skin Conductance Response in ICU patients with various stressors: a case series

    NARCIS (Netherlands)

    Tjan, D.H.T.; Schellaars, R.; Volders, J.; Weda, J.; Johnson, M.T.; Lubberding, M.; Dijk, E.O.; Ouwerkerk, M.; Van Zanten, A.R.H.

    2012-01-01

    Measuring stress levels in the ICU is not well defined and lacks reliable and valid methods of detection. ICU patients experience different kinds of stress like pain, dyspnoea, anxiety and general discomfort. Skin conductance has recently been shown to be a promising physiological indicator of pain

  9. Augmentation of skin response by exposure to a combination of allergens and irritants - a review

    DEFF Research Database (Denmark)

    Pedersen, Line Kynemund; Johansen, Jeanne Duus; Held, Elisabeth

    2004-01-01

    Clinical experimental studies on contact dermatitis (CD) often evaluate the effect of one allergen or one irritant at a time. In real life, the skin is often exposed to more allergens, more irritants or allergens and irritants in combination. This combined exposure may potentially influence irrit...

  10. Surface Lipids as Multifunctional Mediators of Skin Responses to Environmental Stimuli

    Directory of Open Access Journals (Sweden)

    Chiara De Luca

    2010-01-01

    Full Text Available Skin surface lipid (SSL film is a mixture of sebum and keratinocyte membrane lipids, protecting skin from environment. Its composition is unique for the high percentage of long chain fatty acids, and of the polyterpenoid squalene, absent in other human tissues, and in non-human Primates sebum. Here, the still incomplete body of information on SSL as mediators of external chemical, physical, and microbial signals and stressors is revised, focusing on the central event of the continuous oxidative modification induced by the metabolic activity of residential and pathological microbial flora, natural or iatrogenic UV irradiation, exposure to chemicals and cosmetics. Once alpha-tocopherol and ubiquinol-10 antioxidant defences of SSL are overcome, oxidation of squalene and cholesterol gives rise to reactive by-products penetrating deeper into skin layers, to mediate local defensive inflammatory, photo-protective, immune reactions or, at higher concentrations, inducing local but also systemic immune depression, ultimately implicating skin cancerogenesis. Qualitative modifications of SSL represent a pathogenetic sign of diagnostic value in dermatological disorders involving altered sebum production, like pytiriasis versicolor, acne, atopic or seborrheic dermatitis, as well as photo-aging. Achievements of nutriceutical interventions aimed at restoring normal SSL composition and homeostasis are discussed, as feasible therapeutic goals and major means of photo-protection.

  11. Skin Permeation Enhancers and their Effects on Narcotic Transdermal Drug Delivery Systems through Response Surface Experimental Design

    Directory of Open Access Journals (Sweden)

    A. Moghimi

    2014-02-01

    Full Text Available Drug delivery through skin is often obstructed by low permeability of skin towards most drugs; however, such problem would be solved by application of skin penetration enhancers in the formulations. In the present study, a drug in adhesive patch with buprenorphine as active ingredient was prepared. Drug-in-adhesive transdermal drug delivery systems with different chemical penetration enhancers were designed. For this purpose a response-surface experimental design was used. Response surface methodology based on a three-level, three-variable Box–Behnken design was used to evaluate the interactive effects of dependent variables such as: the rate of skin permeation and adhesion properties including peel strength and tack value. The parameters such as drug release and adhesion were used as independent variables. Levulinic acid, lauryl alcohol and Tween 80 were used as penetration enhancers. In order to prepare samples, buprenorphine with constant concentration was incorporated into acrylic pressure sensitive adhesive with carboxylic functionality and this mixture was added to chemical penetration enhancer with different concentrations. The results show that the cumulative amount of drug release in presence of Tween 80 is 462.9 ± 0.006 μg so it is higher than cumulative amount of drug release in presence of levulinic acid (357.9 ± 0.005 μg and lauryl alcohol (269.5 ± 0.001 μg. Results of adhesion properties such as peel strength and tack reveal that using levulinic acid and lauryl alcohol will increase peel strength while Tween 80 will decrease it. Besides, the results show that all these permeation enhancers have increased tack values.

  12. Quantitative Methods for Measuring Repair Rates and Innate-Immune Cell Responses in Wounded Mouse Skin

    Directory of Open Access Journals (Sweden)

    Zhi Li

    2018-02-01

    Full Text Available In skin wounds, innate-immune cells clear up tissue debris and microbial contamination, and also secrete cytokines and other growth factors that impact repair process such as re-epithelialization and wound closure. After injury, there is a rapid influx and efflux of immune cells at wound sites, yet the function of each innate cell population in skin repair is still under investigation. Flow cytometry is a valuable research tool for detecting and quantifying immune cells; however, in mouse back skin, the difficulty in extracting immune cells from small area of skin due to tissue complexity has made cytometric analysis an underutilized tool. In this paper, we provide detailed methods on the digestion of lesion-specific skin without disrupting antigen expression followed by multiplex cell staining that allows for identification of seven innate-immune populations, including rare subsets such as group-3 innate lymphoid cells (ILC3s, by flow-cytometry analysis. Furthermore, when studying the functions of immune cells to tissue repair an important metric to monitor is size of the wound opening. Normal wounds close steadily albeit at non-linear rates, while slow or stalled wound closure can indicate an underlying problem with the repair process. Calliper measurements are difficult and time-consuming to obtain and can require repeated sedation of experimental animals. We provide advanced methods for measuring of wound openness; digital 3D image capture and semi-automated image processing that allows for unbiased, reliable measurements that can be taken repeatedly over time.

  13. The acute effects of alpha and beta irradiation of mouse skin and the factors affecting the response

    International Nuclear Information System (INIS)

    Needham, S.G.; Coggle, J.E.

    1991-01-01

    Several problems regarding acute effects of alpha and beta irradiation were investigated in order to clarify protection problems of localised doses to the skin. A study into the acute biological effects of different energy beta emitters and the effects of energy and area on the response showed direct relationships between these criteria for a range of different acute responses with different time courses. Three different types of acute response were found and these are described as 'moist desquamation', 'acute ulceration' and 'acute epidermal necrosis'. An unexpected finding was that the lower energy beta emitter 170 Tm was as efficient at inducing scab formation as the higher energy 90 Sr sources for the same area of exposure. Experiments using 2x4 cm 2 exposures to 224 Cm alpha particles showed that the response to this poorly penetrating radiation was minimal after doses as high as 180 Gy measured at 10 μm into the skin. In comparison, large area exposure to 170 Tm produced areas of prolonged scabbing after doses up to 100 Gy. However, the intensity of the reaction varied between strains. (author)

  14. The response of human skin commensal bacteria as a reflection of UV radiation: UV-B decreases porphyrin production.

    Directory of Open Access Journals (Sweden)

    Yanhan Wang

    Full Text Available Recent global radiation fears reflect the urgent need for a new modality that can simply determine if people are in a radiation risk of developing cancer and other illnesses. Ultraviolet (UV radiation has been thought to be the major risk factor for most skin cancers. Although various biomarkers derived from the responses of human cells have been revealed, detection of these biomarkers is cumbersome, probably requires taking live human tissues, and varies significantly depending on human immune status. Here we hypothesize that the reaction of Propionibacterium acnes (P. acnes, a human resident skin commensal, to UV radiation can serve as early surrogate markers for radiation risk because the bacteria are immediately responsive to radiation. In addition, the bacteria can be readily accessible and exposed to the same field of radiation as human body. To test our hypothesis, P. acnes was exposed to UV-B radiation. The production of porphyrins in P. acnes was significantly reduced with increasing doses of UV-B. The porphyrin reduction can be detected in both P. acnes and human skin bacterial isolates. Exposure of UV-B to P. acnes- inoculated mice led to a significant decrease in porphyrin production in a single colony of P. acnes and simultaneously induced the formation of cyclobutane pyrimidine dimers (CPD in the epidermal layers of mouse skin. Mass spectrometric analysis via a linear trap quadrupole (LTQ-Orbitrap XL showed that five peptides including an internal peptide (THLPTGIVVSCQNER of a peptide chain release factor 2 (RF2 were oxidized by UV-B. Seven peptides including three internal peptides of 60 kDa chaperonin 1 were de-oxidized by UV-B. When compared to UV-B, gamma radiation also decreased the porphyrin production of P. acnes in a dose-dependent manner, but induced a different signature of protein oxidation/de-oxidation. We highlight that uncovering response of skin microbiome to radiation will facilitate the development of pre

  15. The response of human skin commensal bacteria as a reflection of UV radiation: UV-B decreases porphyrin production.

    Science.gov (United States)

    Wang, Yanhan; Zhu, Wenhong; Shu, Muya; Jiang, Yong; Gallo, Richard L; Liu, Yu-Tsueng; Huang, Chun-Ming

    2012-01-01

    Recent global radiation fears reflect the urgent need for a new modality that can simply determine if people are in a radiation risk of developing cancer and other illnesses. Ultraviolet (UV) radiation has been thought to be the major risk factor for most skin cancers. Although various biomarkers derived from the responses of human cells have been revealed, detection of these biomarkers is cumbersome, probably requires taking live human tissues, and varies significantly depending on human immune status. Here we hypothesize that the reaction of Propionibacterium acnes (P. acnes), a human resident skin commensal, to UV radiation can serve as early surrogate markers for radiation risk because the bacteria are immediately responsive to radiation. In addition, the bacteria can be readily accessible and exposed to the same field of radiation as human body. To test our hypothesis, P. acnes was exposed to UV-B radiation. The production of porphyrins in P. acnes was significantly reduced with increasing doses of UV-B. The porphyrin reduction can be detected in both P. acnes and human skin bacterial isolates. Exposure of UV-B to P. acnes- inoculated mice led to a significant decrease in porphyrin production in a single colony of P. acnes and simultaneously induced the formation of cyclobutane pyrimidine dimers (CPD) in the epidermal layers of mouse skin. Mass spectrometric analysis via a linear trap quadrupole (LTQ)-Orbitrap XL showed that five peptides including an internal peptide (THLPTGIVVSCQNER) of a peptide chain release factor 2 (RF2) were oxidized by UV-B. Seven peptides including three internal peptides of 60 kDa chaperonin 1 were de-oxidized by UV-B. When compared to UV-B, gamma radiation also decreased the porphyrin production of P. acnes in a dose-dependent manner, but induced a different signature of protein oxidation/de-oxidation. We highlight that uncovering response of skin microbiome to radiation will facilitate the development of pre-symptomatic diagnosis

  16. Skin barrier response to occlusion of healthy and irritated skin: Differences in trans-epidermal water loss, erythema and stratum corneum lipids

    DEFF Research Database (Denmark)

    Jungersted, J.M.; Høgh, Julie Kaae; Hellgren, Lars

    2010-01-01

    been damaged by either sodium lauryl sulfate (SLS) or tape stripping, respectively, was determined and compared with that of to non-occluded pre-damaged skin. Skin barrier function was assessed by measurements of trans-epidermal water loss (TEWL) and erythema. In study A, stratum corneum lipids were...

  17. Skin Diseases: Skin Health and Skin Diseases

    Science.gov (United States)

    Skip Navigation Bar Home Current Issue Past Issues Skin Diseases Skin Health and Skin Diseases Past Issues / Fall 2008 Table of Contents ... acne to wrinkles Did you know that your skin is the largest organ of your body? It ...

  18. Fluoxetine ameliorates atopic dermatitis-like skin lesions in BALB/c mice through reducing psychological stress and inflammatory response

    Directory of Open Access Journals (Sweden)

    Yanxi Li

    2016-09-01

    Full Text Available Atopic dermatitis (AD is a common chronic inflammatory skin disorder, and patients with AD suffer from severe psychological stress, which markedly increases the prevalence rate of depression and anxiety disorders in later life. Fluoxetine, a selective serotonin reuptake inhibitor, has recently been reported to exert anti-inflammatory and immunosuppressive effects. However, it is unclear whether fluoxetine is effective in the treatment of AD through reducing psychological stress and inflammatory reaction. Here, we reported that a BALB/c mouse model of AD was induced by application of 2,4‑dinitrochlorobenzene (DNCB onto hairless dorsal skin. Chronic fluoxetine treatment (10 mg/kg per day, i.p. significantly attenuated AD-like symptoms, as reflected by a dramatic decrease in scratching bouts, as well as a decrease in anxiety- and depressive-like behaviors. Furthermore, these behavioral changes were accompanied by a significant decrease in epidermal thickness, the number of mast cells in skin tissue, mRNA levels of interleukin-4 (IL-4 and IL-13 in the spleen, as well as serum immunoglobulin E (IgE in the DNCB-treated mice by treatment with fluoxetine. Taken together, these results indicate that fluoxetine may suppress psychological stress and inflammatory response during AD development, and subsequently ameliorate AD symptoms, suggesting that fluoxetine may be a potential therapeutic agent against AD in clinic.

  19. Transdermal glyceryl trinitrate (nitroglycerin in healthy persons: acute effects on skin temperature and hemodynamic orthostatic response

    Directory of Open Access Journals (Sweden)

    Eva Maria Augusta Boeckh Haebisch

    Full Text Available In order to find an explanation for individual reactions to transdermal glyceryl trinitrate (GTN we studied the skin temperature and hemodynamic reactions in 63 healthy persons. The data were obtained before and after the application of GTN and Glycerin (GL placebo patches, during one hour. The skin temperature was measured on both forearms, the local (left sided and systemic (right sided reaction on GTN was related to the skin fold and the calculated body fat content. The bilateral rise of skin temperature and its duration was higher and longer in obese than in lean persons mainly in obese women. The UV induced thermo and the later photothermoreaction (Erythema was reduced on the left forearm after the application of GTN and GL patches. The observed hemodynamic GTN effect confirmed known postural reactions, such as decreased arterial pressure (ΔmAP = -2.9%, increased heart rate (ΔHR = +7,4% and QTc prolongation (ΔQTc = +4,9% in upright position. An adverse drug effect with increased mean blood pressure (ΔmAP = +12% and increased heart rate (ΔHR = + 10.4% mainly in supine position was observed in 11 % of the participants, but only in men. Such a reaction was already described by Murell, 1879. Individual GTN effects were analyzed and related to habits and family history. In male smokers and in persons with hypertensive and diabetic close relatives, the hypotensive GTN effect was accentuated in supine position. In the upright position the group with hypertensives in the family presented a moderate hypotensive reaction without secondary tachycardia and the smokers presented only a slightly increased heart rate. Our observations suggest that individual reactions to transdermal glyceryl trinitrate (GTN with its active component nitric oxide (NO depends on physiological conditions, related to endogenous vasoactive substances, mainly the interaction with EDRF (the endogenous NO and the activity of the Renin-Angiotensin System.

  20. From membrane to skin: aqueous permeation control through light-responsive amphiphilic polymer co-networks

    Czech Academy of Sciences Publication Activity Database

    Schöller, K.; Küpfer, S.; Baumann, L.; Hoyer, P.M.; de Courten, D.; Rossi, R.M.; Vetushka, Aliaksi; Wolf, M.; Bruns, N.; Scherer, L.J.

    2014-01-01

    Roč. 24, č. 33 (2014), s. 5194-5201 ISSN 1616-301X R&D Projects: GA ČR GB14-37427G; GA MŠk(CZ) LM2011026 Institutional support: RVO:68378271 Keywords : transdermal drug-delivery * porcine ear skin * in-vitro * surface modification Subject RIV: JI - Composite Materials Impact factor: 11.805, year: 2014

  1. Comparison of thermal and hemodynamic responses in skin and muscles to heating with electric and magnetic field

    Directory of Open Access Journals (Sweden)

    Karmen Glažar

    2015-06-01

    Full Text Available 12.00 Introduction: It has been shown that sufficient amount of energy provided by electromagnetic diathermy induces the increase of skin temperature and underlying tissues. However, scarce information is available on the differences in responses initiated by various techniques of diathermy. The goal of the present study was to compare thermal and hemodynamic responses of the skin and underlying muscles of the forearm to diathermy applied with electric (EF or magnetic field (MF. Methods: Eleven healthy volunteers participated in the study. On two separate occasions, they randomly received 20-minut diathermy with EF or with MF. Skin and tympanic temperature, and heart rate were measured. Further, kinetics of muscle oxyhemoglobin and deoxyhemoglobin kinetics were obtained. Thermal perception and thermal comfort were noted through the application of EF and MF. Results: The skin temperature increased similarly during the administration of EF and MF, by ~ 8.0 ± 1.3°C on both occasions. The thermal perception was more intense during the application of EF. Accordingly, the thermal comfort during the application of EF was perceived as less comfortable as compared with MF. During MF the increase in minute muscle blood flow and oxygen consumption was for ~ 42 % higher compared to the heating with EF. Conclusion: Although the increase in skin temperature was similar between EF and MF, the application of diathermy with MF was perceived more comfortable by the participants. Furthermore, the increase in minute muscle blood flow and oxygen consumption was higher in MF compared with EF. Thus, when muscle is the target tissue for physical therapy, a diathermy with magnetic field is the technique of choice. Normal 0 21 false false false SL X-NONE X-NONE /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Navadna tabela"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso

  2. Assessment of skin barrier function and biochemical changes of ex vivo human skin in response to physical and chemical barrier disruption.

    Science.gov (United States)

    Döge, Nadine; Avetisyan, Araks; Hadam, Sabrina; Pfannes, Eva Katharina Barbosa; Rancan, Fiorenza; Blume-Peytavi, Ulrike; Vogt, Annika

    2017-07-01

    Topical dermatotherapy is intended to be used on diseased skin. Novel drug delivery systems even address differences between intact and diseased skin underlining the need for pre-clinical assessment of different states of barrier disruption. Herein, we studied how short-term incubation in culture media compared to incubation in humidified chambers affects human skin barrier function and viability. On both models we assessed different types and intensities of physical and chemical barrier disruption methods with regard to structural integrity, biophysical parameters and cytokine levels. Tissue degeneration and proliferative activity limited the use of tissue cultures to 48h. Viability is better preserved in cultured tissue. Tape-stripping (50×TS) and 4h sodium lauryl sulfate (SLS) pre-treatment were identified as highly reproducible and effective procedures for barrier disruption. Transepidermal water loss (TEWL) values reproducibly increased with the intensity of disruption while sebum content and skin surface pH were of limited value. Interleukin (IL)-6/8 and various chemokines and proteases were increased in tape-stripped skin which was more pronounced in SLS-treated skin tissue extracts. Thus, albeit limited to 48h, cultured full-thickness skin maintained several barrier characteristics and responded to different intensities of barrier disruption. Potentially, these models can be used to assess pre-clinically the efficacy and penetration of anti-inflammatory compounds. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Analysis and Modeling of the Galvanic Skin Response Spontaneous Component in the context of Intelligent Biofeedback Systems Development

    Science.gov (United States)

    Unakafov, A.

    2009-01-01

    The paper presents an approach to galvanic skin response (GSR) spontaneous component analysis and modeling. In the study a classification of biofeedback training methods is given, importance of intelligent methods development is shown. The INTENS method, which is perspective for intellectualization, is presented. An important problem of biofeedback training method intellectualization - estimation of the GSR spontaneous component - is solved in the main part of the work. Its main characteristics are described; results of GSR spontaneous component modeling are shown. Results of small research of an optimum material for GSR probes are presented.

  4. Skin denervation and its clinical significance in late-stage chronic kidney disease.

    Science.gov (United States)

    Chao, Chi-Chao; Wu, Vin-Cent; Tan, Chun-Hsiang; Wang, Yi-Mei; Tseng, Ming-Tsung; Wu, Pei-Chen; Lin, Yea-Huey; Lin, Whei-Min; Wu, Kwan-Dun; Hsieh, Sung-Tsang

    2011-02-01

    To investigate the skin innervation and its clinical significance in late-stage chronic kidney disease (CKD). Case series. National Taiwan University Hospital, Taipei, Taiwan. Forty consecutive nondiabetic patients with late-stage CKD (14 female and 26 male; mean [SD] age, 60.7 [12.3] years), including 2 cases with stage 3 CKD, 6 with stage 4 CKD, and 32 with stage 5 CKD, ie, end-stage kidney disease. Clinical evaluation of neurological deficits, nerve conduction study, autonomic function tests, and a 3-mm-diameter skin biopsy specimen taken from the distal leg. Quantitation of epidermal innervation, parameters of nerve conduction study, R-R interval variability, and sympathetic skin response. Clinically, 21 patients (52.5%) were symptomatic with paresthesia over the limbs or autonomic symptoms. The intraepidermal nerve fiber (IENF) density was markedly reduced in patients with CKD compared with age- and sex-matched controls (mean [SD], 2.8 [2.0] vs 8.6 [2.8] fibers/mm; P Skin denervation was observed in 27 patients (67.5%). Fifteen patients (37.5%) had abnormalities on nerve conduction studies, and 29 patients (72.5%) had abnormal results on autonomic function tests. By analysis with multiple regression models, the IENF density was negatively correlated with the duration of renal disease (P = .02). Additionally, the R-R interval variability at rest was linearly correlated with the IENF density (P = .02) and the absence of sympathetic skin responses at the soles was associated with reduced IENF density (P = .03). Small-fiber sensory and autonomic neuropathies constitute the major form of neuropathy in late-stage CKD. Furthermore, skin denervation was associated with the duration of renal disease.

  5. Differential immune response of congenic mice to ultraviolet-treated major histocompatibility complex class II-incompatible skin grafts

    International Nuclear Information System (INIS)

    Vermeer, B.J.; Santerse, B.; Van De Kerckhove, B.A.; Schothorst, A.A.; Claas, F.H.

    1988-01-01

    The influence of ultraviolet (UVB) irradiation on the survival of H-2 class II-disparate skin grafts was studied in congenic mouse strains. Isolated skin was UVB irradiated in vitro at a dose of 40 mJ/cm 2 from both sides to remove Ia immunogenicity. Immediately after irradiation the skin was transplanted onto the flank of allogeneic mice. When B10.AQR grafts were transplanted onto B10.T(6R) recipients, a significant prolongation of the survival time was observed, while 50% of the UVB-treated grafts were not rejected at all. However, in the opposite direction--i.e., B10.T(6R) grafts onto B10.AQR recipients, no significant prolongation of the survival was observed. To test whether this effect was due to a difference in susceptibility of the donor skin to UVB irradiation or to a different immune response in the recipients, (B10.T(6R) x B10.AQR) grafts were transplanted onto the parent strains. Similar results were obtained, in that UVB-treated grafts did not show a prolonged survival in B10.AQR recipients, whereas a significant prolongation (50% of the grafts survived more than 100 days) was observed in B10.T(6R) recipients. UVB-treated (B10.T(6R) x B10.AQR)F1 grafts were also transplanted onto (B10.T(6R) x C57B1/10)F1, (B10.AQR x C57B1/10)F1, (B10.T(6R) x Balb/c)F1 and (B10.AQR x Balb/c)F1 recipients--but in none of these combinations was a prolonged survival time observed. These data suggest that, in contrast to all in vitro experiments, the abrogation of the immune response by UVB treatment of the stimulator cells is, in vivo, not a general phenomenon. The genetic constitution of the responder mice seems to play an important role in determining whether or not an immune response takes place

  6. Infrared sensing based sensitive skin

    Institute of Scientific and Technical Information of China (English)

    CAO Zheng-cai; FU Yi-li; WANG Shu-guo; JIN Bao

    2006-01-01

    Developed robotics sensitive skin is a modularized, flexible, mini-type array of infrared sensors with data processing capabilities, which can be used to cover the body of a robot. Depending on the infrared sensors and periphery processing circuit, robotics sensitive skin can in real-time provide existence and distance information about obstacles for robots within sensory areas. The methodology of designing sensitive skin and the algorithm of a mass of IR data fusion are presented. The experimental results show that the multi-joint robot with this sensitive skin can work autonomously in an unknown environment.

  7. Implicit Recognition of Familiar and Unfamiliar Faces in Schizophrenia: A Study of the Skin Conductance Response in Familiarity Disorders

    Directory of Open Access Journals (Sweden)

    Aurely Ameller

    2017-09-01

    Full Text Available ObjectiveFamiliarity is a subjective sensation that contributes to person recognition. This process is described as an emotion-based memory-trace of previous meetings and could be disrupted in schizophrenia. Consequently, familiarity disorders could be involved in the impaired social interactions observed in patients with schizophrenia. Previous studies have primarily focused on famous people recognition. Our aim was to identify underlying features, such as emotional disturbances, that may contribute to familiarity disorders in schizophrenia. We hypothesize that patients with familiarity disorders will exhibit a lack of familiarity that could be detected by a flattened skin conductance response (SCR.MethodThe SCR was recorded to test the hypothesis that emotional reactivity disturbances occur in patients with schizophrenia during the categorization of specific familiar, famous and unknown faces as male or female. Forty-eight subjects were divided into the following 3 matched groups with 16 subjects per group: control subjects, schizophrenic people with familiarity disorder, and schizophrenic people without familiarity disorders.ResultsEmotional arousal is reflected by the skin conductance measures. The control subjects and the patients without familiarity disorders experienced a differential emotional response to the specific familiar faces compared with that to the unknown faces. Nevertheless, overall, the schizophrenic patients without familiarity disorders showed a weaker response across conditions compared with the control subjects. In contrast, the patients with familiarity disorders did not show any significant differences in their emotional response to the faces, regardless of the condition.ConclusionOnly patients with familiarity disorders fail to exhibit a difference in emotional response between familiar and non-familiar faces. These patients likely emotionally process familiar faces similarly to unknown faces. Hence, the lower

  8. In vitro assessment of skin irritation potential of surfactant-based formulations by using a 3-D skin reconstructed tissue model and cytokine response.

    Science.gov (United States)

    Walters, Russel M; Gandolfi, Lisa; Mack, M Catherine; Fevola, Michael; Martin, Katharine; Hamilton, Mathew T; Hilberer, Allison; Barnes, Nicole; Wilt, Nathan; Nash, Jennifer R; Raabe, Hans A; Costin, Gertrude-Emilia

    2016-12-01

    The personal care industry is focused on developing safe, more efficacious, and increasingly milder products, that are routinely undergoing preclinical and clinical testing before becoming available for consumer use on skin. In vitro systems based on skin reconstructed equivalents are now established for the preclinical assessment of product irritation potential and as alternative testing methods to the classic Draize rabbit skin irritation test. We have used the 3-D EpiDerm™ model system to evaluate tissue viability and primary cytokine interleukin-1α release as a way to evaluate the potential dermal irritation of 224 non-ionic, amphoteric and/or anionic surfactant-containing formulations, or individual raw materials. As part of our testing programme, two representative benchmark materials with known clinical skin irritation potential were qualified through repeated testing, for use as references for the skin irritation evaluation of formulations containing new surfactant ingredients. We have established a correlation between the in vitro screening approach and clinical testing, and are continually expanding our database to enhance this correlation. This testing programme integrates the efforts of global manufacturers of personal care products that focus on the development of increasingly milder formulations to be applied to the skin, without the use of animal testing. 2016 FRAME.

  9. Comparison of Tuberculin Skin Test result and interferon gamma response to human PPD in BCG scar positive and negative children.

    Science.gov (United States)

    Sayyahfar, Shirin; Karimi, Abdollah; Fahimzad, Alireza; Shamshiri, Ahmad Reza

    2014-03-01

    The aim of this study is to compare Tuberculin Skin Test (TST) result and interferon gamma response to human PPD (purified protein derivative), in scar positive and scar negative BCG-vaccinated children. Between August 2007 and May 2008 a total of 236 children aged 1-168 months (mean 21 months) admitted to Mofid Children's Hospital, Tehran, Iran, were enrolled in a cross-sectional study. Each patient was examined for BCG vaccine scar and tested with TST and human PPD-based Interferon Gamma Release Assay (IGRA). Two hundred and twenty one cases out of 236 (44% female, 1-168 months, mean age 21 months) were scar positive of whom 95% TST result was negative. Human PPD-based IGRA was positive in 110 (49.8%), negative in 85 (38.4 %) and indeterminate in 26 (11.8%) of scar positive patients. Fifteen children (40% female, 1-156 months; mean age 42 months) were scar negative. All the scar negative cases were TST negative. Human PPD-based IGRA was positive in 10 (66.7%), negative in 4 (26.7%) and indeterminate in 1 (6.7%) of scar negative patients. Immune responsiveness to human PPD antigens in scar positive and negative children may not correspond with results of the Tuberculin Skin Test. Copyright © 2013 Ministry of Health, Saudi Arabia. Published by Elsevier Ltd. All rights reserved.

  10. Effects of CO2 laser irradiation on the wettability and human skin fibroblast cell response of magnesia partially stabilised zirconia

    International Nuclear Information System (INIS)

    Hao, L.; Lawrence, J.

    2003-01-01

    Human skin fibroblast cells in vitro responses on the surface of a bioinert zirconia ceramic partially stabilised with magnesia partially stabilised zirconia (MgO-PSZ) bioinert ceramic before and after CO 2 laser treatment were investigated to find the interrelationship between the cell adhesion, wettability and laser parameters. Contact angle, θ, measurements of a set of test liquids were a clear indication that surface treatment of the MgO-PSZ with a CO 2 laser brought about a reduction in θ, indicating that the wettability of the MgO-PSZ had been enhanced. A relationship was found between the wettability and the microstructure of the MgO-PSZ surface and laser processing parameters. It was subsequently deduced that the factors active in causing the observed modification in the wettability of the MgO-PSZ were the increases in the surface O 2 content and the polar component of the surface energy, γ sv p , the latter resulting from surface melting and resolidification. Moreover, the investigation into the human skin fibroblast cell response revealed that the CO 2 laser treatment of the MgO-PSZ had resulted in a surface favourable for cell adhesion, as the extent of cell attachment and adhesion on the MgO-PSZ surface was enhanced depending on laser parameters. Such an improvement in cell adhesion, which could be greatly beneficial to developing enhanced bonding at the tissue and implant interface, was influenced by the surface properties of the modified MgO-PSZ, particular wettability

  11. Heterogeneous response to X-ray and ultraviolet light irradiations of cultured skin fibroblasts in two families with Gardner's Syndrome

    International Nuclear Information System (INIS)

    Kinsella, T.J.; Little, J.B.; Nove, J.; Weichselbaum, R.R.; Li, F.P.; Meyer, R.J.; Marchetto, D.J.; Patterson, W.B.

    1982-01-01

    A heterogeneous response to X-ray and far UV (254 nm) light irradiations was found in cultured skin fibroblast lines from 2 separate families with Gardner's syndrome. When compared to 2 normal control cultures and cultures from 2 patients with nonfamilial colon cancer, cultures from 4 clinically affected members of family 1 showed increased sensitivity to the lethal effects of both X-ray and UV light irradiations. These cells also showed a delayed pattern of X-ray potentially lethal damage repair (PLDR) and absent UV PLDR. In contrast, cultures from 3 members of family 2 (2 of whom were clinically affected) showed a normal response of survival and PLDR to both X-ray and UV light irradiations. Thus increased sensitivity of cultured skin fibroblasts to X-ray and UV light irradiations was not a consistent in vitro finding in patients with Gardner's syndrome. However, in families with Gardner's syndrome who demonstrate in vitro radiosensitivity, additional studies are needed to assess the usefulness of these techniques in detecting affected individuals prior to the development of colon carcinoma and other manifestations

  12. Localization of sclerotic-type chronic graft-vs-host disease to sites of skin injury: potential insight into the mechanism of isomorphic and isotopic responses.

    Science.gov (United States)

    Martires, Kathryn J; Baird, Kristin; Citrin, Deborah E; Hakim, Fran T; Pavletic, Steven Z; Cowen, Edward W

    2011-09-01

    The mechanisms responsible for the variable manifestations of chronic cutaneous graft-vs-host disease (cGVHD) are poorly understood. Localization of sclerotic-type chronic graft-vs-host disease to sites of skin injury (isomorphic and isotopic responses), a recognized phenomenon in morphea, suggests a potential common pathway between cGVHD and other sclerotic skin conditions. Four cases of sclerotic-type cGVHD developed at the site of disparate skin injuries (ionizing radiotherapy, repeated needle sticks, central catheter site, and varicella-zoster virus infection). We review the spectrum of previously reported cases of sclerotic and nonsclerotic cGVHD relating to external forces on the skin. Localization of sclerotic-type cGVHD may occur after many types of skin injury, including UV and ionizing radiotherapy, needle sticks, viral infection, and pressure or friction. Recognition of this phenomenon may be helpful for the early diagnosis of sclerotic disease. Recent insights into the immunological consequences of minor skin injury may provide important clues to the underlying pathogenesis of cGVHD-mediated skin disease.

  13. Pain Processing and Vegetative Dysfunction in Fibromyalgia: A Study by Sympathetic Skin Response and Laser Evoked Potentials

    Directory of Open Access Journals (Sweden)

    Marina de Tommaso

    2017-01-01

    Full Text Available Background. A dysfunction of pain processing at central and peripheral levels was reported in fibromyalgia (FM. We aimed to correlate laser evoked potentials (LEPs, Sympathetic Skin Response (SSR, and clinical features in FM patients. Methods. Fifty FM patients and 30 age-matched controls underwent LEPs and SSR by the right hand and foot. The clinical evaluation included FM disability (FIQ and severity scores (WPI, anxiety (SAS and depression (SDS scales, and questionnaires for neuropathic pain (DN4. Results. The LEP P2 latency and amplitude and the SSR latency were increased in FM group. This latter feature was more evident in anxious patients. The LEPs habituation was reduced in FM patients and correlated to pain severity scores. In a significant number of patients (32% with higher DN4 and FIQ scores, SSR or LEP responses were absent. Conclusions. LEPs and SSR might contribute to clarifying the peripheral and central nervous system involvement in FM patients.

  14. Transmission potential, skin inflammatory response, and parasitism of symptomatic and asymptomatic dogs with visceral leishmaniasis

    Directory of Open Access Journals (Sweden)

    Goto H

    2008-11-01

    Full Text Available Abstract Background Visceral leishmaniasis in Brazil is caused by the protozoan Leishmania (Leishmania chagasi and it is transmitted by sandfly of the genus Lutzomyia. Dogs are an important domestic reservoir, and control of the transmission of visceral leishmaniasis (VL to humans includes the elimination of infected dogs. However, though dogs are considered to be an important element in the transmission cycle of Leishmania, the identification of infected dogs representing an immediate risk for transmission has not been properly evaluated. Since it is not possible to treat infected dogs, they are sacrificed when a diagnosis of VL is established, a measure that is difficult to accomplish in highly endemic areas. In such areas, parameters that allow for easy identification of reservoirs that represents an immediate risk for transmission is of great importance for the control of VL transmission. In this study we aimed to identify clinical parameters, reinforced by pathological parameters that characterize dogs with potential to transmit the parasite to the vector. Results The major clinical manifestations of visceral leishmaniasis in dogs from an endemic area were onicogriphosis, skin lesions, conjunctivitis, lymphadenopathy, and weight loss. The transmission potential of these dogs was assessed by xenodiagnosis using Lutzomyia longipalpis. Six of nine symptomatic dogs were infective to Lutzomyia longipalpis while none of the five asymptomatic dogs were infective to the sandfly. Leishmania amastigotes were present in the skin of all clinically symptomatic dogs, but absent in asymptomatic dogs. Higher parasite loads were observed in the ear and ungueal region, and lower in abdomen. The inflammatory infiltrate was more intense in the ears and ungueal regions of both symptomatic and asymptomatic dogs. In clinically affected dogs in which few or none Leishmania amastigotes were observed, the inflammatory infiltrate was constituted mainly of lymphocytes

  15. Skin-transmitted pathogens and the heebie jeebies: evidence for a subclass of disgust stimuli that evoke a qualitatively unique emotional response.

    Science.gov (United States)

    Blake, Khandis R; Yih, Jennifer; Zhao, Kun; Sung, Billy; Harmon-Jones, Cindy

    2017-09-01

    Skin-transmitted pathogens have threatened humans since ancient times. We investigated whether skin-transmitted pathogens were a subclass of disgust stimuli that evoked an emotional response that was related to, but distinct from, disgust and fear. We labelled this response "the heebie jeebies". In Study 1, coding of 76 participants' experiences of disgust, fear, and the heebie jeebies showed that the heebie jeebies was elicited by unique stimuli which produced skin-crawling sensations and an urge to protect the skin. In Experiment 2,350 participants' responses to skin-transmitted pathogen, fear-inducing, and disgust-inducing vignettes showed that the vignettes elicited sensations and urges which loaded onto heebie jeebies, fear, and disgust factors, respectively. Experiment 3 largely replicated findings from Experiment 2 using video stimuli (178 participants). Results are consistent with the notion that skin-transmitted pathogens are a subclass of disgust stimuli which motivate behaviours that are functionally consistent with disgust yet qualitatively distinct.

  16. Effects of insula resection on autonomic nervous system activity

    NARCIS (Netherlands)

    de Morree, Helma; Rutten, Geert-Jan; Szabo, B.M.; Sitskoorn, Margriet; Kop, Wijo

    2016-01-01

    Background: The insula is an essential component of the central autonomic network and plays a critical role in autonomic regulation in response to environmental stressors. The role of the insula in human autonomic regulation has been primarily investigated following cerebrovascular accidents, but

  17. Adaptive technique for matching the spectral response in skin lesions' images

    International Nuclear Information System (INIS)

    Pavlova, P; Borisova, E; Avramov, L; Pavlova, E

    2015-01-01

    The suggested technique is a subsequent stage for data obtaining from diffuse reflectance spectra and images of diseased tissue with a final aim of skin cancer diagnostics. Our previous work allows us to extract patterns for some types of skin cancer, as a ratio between spectra, obtained from healthy and diseased tissue in the range of 380 – 780 nm region. The authenticity of the patterns depends on the tested point into the area of lesion, and the resulting diagnose could also be fixed with some probability. In this work, two adaptations are implemented to localize pixels of the image lesion, where the reflectance spectrum corresponds to pattern. First adapts the standard to the personal patient and second – translates the spectrum white point basis to the relative white point of the image. Since the reflectance spectra and the image pixels are regarding to different white points, a correction of the compared colours is needed. The latest is done using a standard method for chromatic adaptation. The technique follows the steps below: –Calculation the colorimetric XYZ parameters for the initial white point, fixed by reflectance spectrum from healthy tissue; –Calculation the XYZ parameters for the distant white point on the base of image of nondiseased tissue; –Transformation the XYZ parameters for the test-spectrum by obtained matrix; –Finding the RGB values of the XYZ parameters for the test-spectrum according sRGB; Finally, the pixels of the lesion's image, corresponding to colour from the test-spectrum and particular diagnostic pattern are marked with a specific colour

  18. Evaluation of the autonomic neuropathy function immediately after a change to upright posture using the impulse response function; Impulse oto kansu wo mochiita shisei henkan katoki ni okeru jiritsu shinkei kino hyoka

    Energy Technology Data Exchange (ETDEWEB)

    Yokoyama, K. [Nagoya City University, Nagoya (Japan); Moyoshi, M.; Takata, K. [Daido Institute of Technology, Nagoya (Japan); Watanabe, Y. [Toyota College of Technology, Aichi (Japan)

    1997-05-20

    Autonomic neuropathy function immediately after a change to upright posture has been evaluated by applying transient response function of the system to the blood regulation system. The impulse response function was determined from the change in heart rate before postural change to the upright posture, and was compared with the transient change immediately after a change to the upright posture. The time series of R-R interval of electrocardiogram was used as the time series of the change in heart rate. To determine the impulse response function, an autoregressive model was applied to the R-R interval time series. The impulse response function at the steady state is a transient reaction at the impulse stimulation added to the blood regulation system. The R-R interval decreases rapidly by the autonomic neuropathy reaction in which the blood is rapidly transferred into the legs immediately after a change to upright posture. There is a close correlation between the initial temporary decrease in R-R interval and the impulse response function derived from the change in heart rate immediately after a change to the upright posture. Accordingly, the blood regulation and autonomic neuropathy functions can be evaluated by the impulse response function without actual standing test and load of tested persons. 9 refs., 3 figs., 1 tab.

  19. Your Skin

    Science.gov (United States)

    ... Safe Videos for Educators Search English Español Your Skin KidsHealth / For Kids / Your Skin What's in this ... body) are really dead skin cells. Bye-Bye Skin Cells These old cells are tough and strong, ...

  20. High psychosis liability is associated with altered autonomic balance during exposure to Virtual Reality social stressors.

    Science.gov (United States)

    Counotte, Jacqueline; Pot-Kolder, Roos; van Roon, Arie M; Hoskam, Olivier; van der Gaag, Mark; Veling, Wim

    2017-06-01

    Social stressors are associated with an increased risk of psychosis. Stress sensitisation is thought to be an underlying mechanism and may be reflected in an altered autonomic stress response. Using an experimental Virtual Reality design, the autonomic stress response to social stressors was examined in participants with different liability to psychosis. Fifty-five patients with recent onset psychotic disorder, 20 patients at ultra-high risk for psychosis, 42 siblings of patients with psychosis and 53 controls were exposed to social stressors (crowdedness, ethnic minority status and hostility) in a Virtual Reality environment. Heart rate variability parameters and skin conductance levels were measured at baseline and during Virtual Reality experiments. High psychosis liability groups had significantly increased heart rate and decreased heart rate variability compared to low liability groups both at baseline and during Virtual Reality experiments. Both low frequency (LF) and high frequency (HF) power were reduced, while the LF/HF ratio was similar between groups. The number of virtual social stressors significantly affected heart rate, HF, LF/HF and skin conductance level. There was no interaction between psychosis liability and amount of virtual social stress. High liability to psychosis is associated with decreased parasympathetic activity in virtual social environments, which reflects generally high levels of arousal, rather than increased autonomic reactivity to social stressors. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. The Position of Member States in (Autonomous) Institutional Decision-Making : Implications for the Establishment of Responsibility

    NARCIS (Netherlands)

    Ryngaert, Cedric; Barros, Sofia

    2014-01-01

    The international legal personality and autonomy of international organizations constitute the main vantage point from which responsibility issues in an institutional context are addressed in legal scholarship. In such an exercise, what is often missed is an explanation of how both concepts impact

  2. Morphologic Changes in Autonomic Nerves in Diabetic Autonomic Neuropathy

    Directory of Open Access Journals (Sweden)

    Heung Yong Jin

    2015-12-01

    Full Text Available Diabetic neuropathy is one of the major complications of diabetes, and it increases morbidity and mortality in patients with both type 1 diabetes mellitus (T1DM and type 2 diabetes mellitus (T2DM. Because the autonomic nervous system, for example, parasympathetic axons, has a diffuse and wide distribution, we do not know the morphological changes that occur in autonomic neural control and their exact mechanisms in diabetic patients with diabetic autonomic neuropathy (DAN. Although the prevalence of sympathetic and parasympathetic neuropathy is similar in T1DM versus T2DM patients, sympathetic nerve function correlates with parasympathetic neuropathy only in T1DM patients. The explanation for these discrepancies might be that parasympathetic nerve function was more severely affected among T2DM patients. As parasympathetic nerve damage seems to be more advanced than sympathetic nerve damage, it might be that parasympathetic neuropathy precedes sympathetic neuropathy in T2DM, which was Ewing's concept. This could be explained by the intrinsic morphologic difference. Therefore, the morphological changes in the sympathetic and parasympathetic nerves of involved organs in T1DM and T2DM patients who have DAN should be evaluated. In this review, evaluation methods for morphological changes in the epidermal nerves of skin, and the intrinsic nerves of the stomach will be discussed.

  3. Skin rash in patients treated with neoadjuvant erlotinib (Tarceva in resectable non-small cell lung cancer: Predictor for tumor response and survival?

    Directory of Open Access Journals (Sweden)

    Van Gool MH

    2017-08-01

    Full Text Available Background: Skin rash during treatment with epidermal growth factor receptor (EGFR-tyrosine kinase inhibitors (TKI has been reported to be predictive for response and survival in patients with advanced non-small cell lung cancer (NSCLC. The aim of this analysis was to evaluate whether skin rash during treatment (as a biomarker in a preoperative setting was related to response and survival. Methods: This study was designed as an open-label phase II trial (also known as M06NEL. Patients received preoperative erlotinib (Tarceva 150 mg once daily for 3 weeks. Skin toxicity during treatment was analysed in relation to metabolic and histopathological response, overall survival (OS and progression-free survival (PFS. Results: In total 59 patients (25 male, 34 female were eligible for analysis. In 39 patients (66% skin toxicity occurred. According to National Cancer Institute Common Toxicity Criteria (NCICTC, Grade 1 toxicity was seen in 15 patients (25%, Grade 2 in 19 patients (32% and Grade 3 in five patients (8%. None of the patients showed skin toxicity Grade 4 and 5. The median follow up was 74 months. Thirty-six patients (61% were alive at time of analysis. Twenty-seven patients (46% showed disease progression during follow up. Hazard ratios (HR indicated lower risk of death (HR = 0.66, 95%CI: 0.29 - 1.50 and progression (HR = 0.64, 0.30 - 1.36, although in this small group results were not significant. Skin rash did not adequately predict response. Conclusions: In this neoadjuvant setting with limited treatment time in patients with early stage NSCLC, skin rash was not associated with response and survival and cannot be used as an early biomarker.

  4. Autonomic Nervous System Disorders

    Science.gov (United States)

    Your autonomic nervous system is the part of your nervous system that controls involuntary actions, such as the beating of your heart ... breathing and swallowing Erectile dysfunction in men Autonomic nervous system disorders can occur alone or as the result ...

  5. Cultivar Diversity of Grape Skin Polyphenol Composition and Changes in Response to Drought Investigated by LC-MS Based Metabolomics

    Directory of Open Access Journals (Sweden)

    Lucie Pinasseau

    2017-10-01

    Full Text Available Phenolic compounds represent a large family of plant secondary metabolites, essential for the quality of grape and wine and playing a major role in plant defense against biotic and abiotic stresses. Phenolic composition is genetically driven and greatly affected by environmental factors, including water stress. A major challenge for breeding of grapevine cultivars adapted to climate change and with high potential for wine-making is to dissect the complex plant metabolic response involved in adaptation mechanisms. A targeted metabolomics approach based on ultra high-performance liquid chromatography coupled to triple quadrupole mass spectrometry (UHPLC-QqQ-MS analysis in the Multiple Reaction Monitoring (MRM mode has been developed for high throughput profiling of the phenolic composition of grape skins. This method enables rapid, selective, and sensitive quantification of 96 phenolic compounds (anthocyanins, phenolic acids, stilbenoids, flavonols, dihydroflavonols, flavan-3-ol monomers, and oligomers…, and of the constitutive units of proanthocyanidins (i.e., condensed tannins, giving access to detailed polyphenol composition. It was applied on the skins of mature grape berries from a core-collection of 279 Vitis vinifera cultivars grown with or without watering to assess the genetic variation for polyphenol composition and its modulation by irrigation, in two successive vintages (2014–2015. Distribution of berry weights and δ13C values showed that non irrigated vines were subjected to a marked water stress in 2014 and to a very limited one in 2015. Metabolomics analysis of the polyphenol composition and chemometrics analysis of this data demonstrated an influence of water stress on the biosynthesis of different polyphenol classes and cultivar differences in metabolic response to water deficit. Correlation networks gave insight on the relationships between the different polyphenol metabolites and related biosynthetic pathways. They also

  6. Sensitivity Analysis of Vagus Nerve Stimulation Parameters on Acute Cardiac Autonomic Responses: Chronotropic, Inotropic and Dromotropic Effects.

    Directory of Open Access Journals (Sweden)

    David Ojeda

    Full Text Available Although the therapeutic effects of Vagus Nerve Stimulation (VNS have been recognized in pre-clinical and pilot clinical studies, the effect of different stimulation configurations on the cardiovascular response is still an open question, especially in the case of VNS delivered synchronously with cardiac activity. In this paper, we propose a formal mathematical methodology to analyze the acute cardiac response to different VNS configurations, jointly considering the chronotropic, dromotropic and inotropic cardiac effects. A latin hypercube sampling method was chosen to design a uniform experimental plan, composed of 75 different VNS configurations, with different values for the main parameters (current amplitude, number of delivered pulses, pulse width, interpulse period and the delay between the detected cardiac event and VNS onset. These VNS configurations were applied to 6 healthy, anesthetized sheep, while acquiring the associated cardiovascular response. Unobserved VNS configurations were estimated using a Gaussian process regression (GPR model. In order to quantitatively analyze the effect of each parameter and their combinations on the cardiac response, the Sobol sensitivity method was applied to the obtained GPR model and inter-individual sensitivity markers were estimated using a bootstrap approach. Results highlight the dominant effect of pulse current, pulse width and number of pulses, which explain respectively 49.4%, 19.7% and 6.0% of the mean global cardiovascular variability provoked by VNS. More interestingly, results also quantify the effect of the interactions between VNS parameters. In particular, the interactions between current and pulse width provoke higher cardiac effects than the changes on the number of pulses alone (between 6 and 25% of the variability. Although the sensitivity of individual VNS parameters seems similar for chronotropic, dromotropic and inotropic responses, the interacting effects of VNS parameters

  7. Autonomic correlates at rest and during evoked attention in children with attention-deficit/hyperactivity disorder and effects of methylphenidate.

    Science.gov (United States)

    Negrao, Bianca Lee; Bipath, Priyesh; van der Westhuizen, Deborah; Viljoen, Margaretha

    2011-01-01

    The aim of this study was to assess autonomic nervous system functioning in children with attention-deficit/hyperactivity disorder (ADHD) and to examine the effects of methylphenidate and focussed attention. Children with ADHD (n = 19) were tested while they were stimulant free and during a period in which they were on stimulants. On both occasions, autonomic nervous system functioning was tested at baseline and during focussed attention. Autonomic nervous system functioning of control subjects was also tested at baseline and during focussed attention. Autonomic nervous system activity was determined by means of heart rate variability (HRV) and skin conductivity analyses. Attention was evoked by means of the BioGraph Infiniti biofeedback apparatus. HRV was determined by time domain, frequency domain and Poincaré analysis of RR interval data. Skin conductivity was determined by the BioGraph Infiniti biofeedback apparatus. The main findings of this study were (a) that stimulant-free children with ADHD showed a sympathetic underarousal and parasympathetic overarousal of the sympathovagal balance relative to control subjects; (b) methylphenidate shifted the autonomic balance of children with ADHD towards normal levels; however, a normal autonomic balance was not reached, and (c) stimulant-free children with ADHD exhibited a shift in the sympathovagal balance towards the sympathetic nervous system from baseline to focussed attention; however, methylphenidate appeared to abolish this shift. Stimulant-free children with ADHD have a parasympathetic dominance of the autonomic balance, relative to control subjects. Methylphenidate attempts to restore the normal autonomic balance in children with ADHD, but inhibits the normal autonomic nervous system response to a cognitive challenge. These results indicate that methylphenidate may have a suppressive effect on the normal stress response. Although this may be of benefit to those who interact with children who suffer from ADHD

  8. A Study on the Effects of Sympathetic Skin Response Parameters in Diagnosis of Fibromyalgia Using Artificial Neural Networks.

    Science.gov (United States)

    Ozkan, Ozhan; Yildiz, Murat; Arslan, Evren; Yildiz, Sedat; Bilgin, Suleyman; Akkus, Selami; Koyuncuoglu, Hasan R; Koklukaya, Etem

    2016-03-01

    Fibromyalgia syndrome (FMS), usually observed commonly in females over age 30, is a rheumatic disease accompanied by extensive chronic pain. In the diagnosis of the disease non-objective psychological tests and physiological tests and laboratory test results are evaluated and clinical experiences stand out. However, these tests are insufficient in differentiating FMS with similar diseases that demonstrate symptoms of extensive pain. Thus, objective tests that would help the diagnosis are needed. This study analyzes the effect of sympathetic skin response (SSR) parameters on the auxiliary tests used in FMS diagnosis, the laboratory tests and physiological tests. The study was conducted in Suleyman Demirel University, Faculty of Medicine, Physical Medicine and Rehabilitation Clinic in Turkey with 60 patients diagnosed with FMS for the first time and a control group of 30 healthy individuals. In the study all participants underwent laboratory tests (blood tests), certain physiological tests (pulsation, skin temperature, respiration) and SSR measurements. The test data and SSR parameters obtained were classified using artificial neural network (ANN). Finally, in the ANN framework, where only laboratory and physiological test results were used as input, a simulation result of 96.51 % was obtained, which demonstrated diagnostic accuracy. This data, with the addition of SSR parameter values obtained increased to 97.67 %. This result including SSR parameters - meaning a higher diagnostic accuracy - demonstrated that SSR could be a new auxillary diagnostic method that could be used in the diagnosis of FMS.

  9. OREXIN 1 AND 2 RECEPTOR INVOLVEMENT IN CO2-INDUCED PANIC-ASSOCIATED BEHAVIOR AND AUTONOMIC RESPONSES

    Science.gov (United States)

    Johnson, Philip L.; Federici, Lauren M.; Fitz, Stephanie D.; Renger, John J.; Shireman, Brock; Winrow, Christopher J.; Bonaventure, Pascal; Shekhar, Anantha

    2016-01-01

    Background The neuropeptides orexin A and B play a role in reward and feeding and are critical for arousal. However, it was not initially appreciated that most prepro-orexin synthesizing neurons are almost exclusively concentrated in the perifornical hypothalamus, which when stimulated elicits panic-associated behavior and cardiovascular responses in rodents and self-reported “panic attacks” and “fear of dying” in humans. More recent studies support a role for the orexin system in coordinating an integrative stress response. For instance, orexin neurons are highly reactive to anxiogenic stimuli, are hyperactive in anxiety pathology, and have strong projections to anxiety and panic-associated circuitry. Although the two cognate orexin receptors are colocalized in many brain regions, the orexin 2 receptor (OX2R) most robustly maps to the histaminergic wake-promoting region, while the orexin 1 receptor (OX1R) distribution is more exclusive and dense in anxiety and panic circuitry regions, such as the locus ceruleus. Overall, this suggests that OX1Rs play a critical role in mobilizing anxiety and panic responses. Methods Here, we used a CO2-panic provocation model to screen a dual OX1/2R antagonist (DORA-12) to globally inhibit orexin activity, then a highly selective OX1R antagonist (SORA1, Compound 56) or OX2R antagonist (SORA2, JnJ10397049) to assess OX1R and OX2R involvement. Results All compounds except the SORA2 attenuated CO2-induced anxiety-like behaviors, and all but the SORA2 and DORA attenuated CO2-induced cardiovascular responses. Conclusions SORA1s may represent a novel method of treating anxiety disorders, with no apparent sedative effects that were present with a benzodiazepine. PMID:26332431

  10. Autonomous parvoviruses neither stimulate nor are inhibited by the type I interferon response in human normal or cancer cells.

    Science.gov (United States)

    Paglino, Justin C; Andres, Wells; van den Pol, Anthony N

    2014-05-01

    Members of the genus Parvovirus are small, nonenveloped single-stranded DNA viruses that are nonpathogenic in humans but have potential utility as cancer therapeutics. Because the innate immune response to parvoviruses has received relatively little attention, we compared the response to parvoviruses to that of several other types of viruses in human cells. In normal human glia, fibroblasts, or melanocytes, vesicular stomatitis virus evoked robust beta interferon (IFN-β) responses. Cytomegalovirus, pseudorabies virus, and Sindbis virus all evoked a 2-log-unit or greater upregulation of IFN-β in glia; in contrast, LuIII and MVMp parvoviruses did not evoke a detectable IFN-β or interferon-stimulated gene (ISG; MX1, oligoadenylate synthetase [OAS], IFIT-1) response in the same cell types. The lack of response raised the question of whether parvoviral infection can be attenuated by IFN; interestingly, we found that IFN did not decrease parvovirus (MVMp, LuIII, and H-1) infectivity in normal human glia, fibroblasts, or melanocytes. The same was true in human cancers, including glioma, sarcoma, and melanoma. Similarly, IFN failed to attenuate transduction by the dependovirus vector adeno-associated virus type 2. Progeny production of parvoviruses was also unimpaired by IFN in both glioma and melanoma, whereas vesicular stomatitis virus replication was blocked. Sarcoma cells with upregulated IFN signaling that show high levels of resistance to other viruses showed strong infection by LuIII. Unlike many other oncolytic viruses, we found no evidence that impairment of innate immunity in cancer cells plays a role in the oncoselectivity of parvoviruses in human cells. Parvoviral resistance to the effects of IFN in cancer cells may constitute an advantage in the virotherapy of some tumors. Understanding the interactions between oncolytic viruses and the innate immune system will facilitate employing these viruses as therapeutic agents in cancer patients. The cancer

  11. Skin-safe photothermal therapy enabled by responsive release of acid-activated membrane-disruptive polymer from polydopamine nanoparticle upon very low laser irradiation.

    Science.gov (United States)

    Zhu, Rui; Gao, Feng; Piao, Ji-Gang; Yang, Lihua

    2017-07-25

    How to ablate tumor without damaging skin is a challenge for photothermal therapy. We, herein, report skin-safe photothermal cancer therapy provided by the responsive release of acid-activated hemolytic polymer (aHLP) from the photothermal polydopamine (PDA) nanoparticle upon irradiation at very low dosage. Upon skin-permissible irradiation (via an 850 nm laser irradiation at the power density of 0.4 W cm -2 ), the nanoparticle aHLP-PDA generates sufficient localized-heat to bring about mild hyperthermia treatment and consequently, responsively sheds off the aHLP polymer from its PDA nanocore; this leads to selective cytotoxicity to cancer cells under the acidic conditions of the extracellular microenvironment of tumor. As a result, our aHLP-PDA nanoparticle upon irradiation at a low dosage effectively inhibits tumor growth without damaging skin, as demonstrated using animal models. Effective in mitigating the otherwise inevitable skin damage in tumor photothermal therapy, the nanosystem reported herein offers an efficient pathway towards skin-safe photothermal therapy.

  12. Slow motion in films and video clips: Music influences perceived duration and emotion, autonomic physiological activation and pupillary responses.

    Science.gov (United States)

    Wöllner, Clemens; Hammerschmidt, David; Albrecht, Henning

    2018-01-01

    Slow motion scenes are ubiquitous in screen-based audiovisual media and are typically accompanied by emotional music. The strong effects of slow motion on observers are hypothetically related to heightened emotional states in which time seems to pass more slowly. These states are simulated in films and video clips, and seem to resemble such experiences in daily life. The current study investigated time perception and emotional response to media clips containing decelerated human motion, with or without music using psychometric and psychophysiological testing methods. Participants were presented with slow-motion scenes taken from commercial films, ballet and sports footage, as well as the same scenes converted to real-time. Results reveal that slow-motion scenes, compared to adapted real-time scenes, led to systematic underestimations of duration, lower perceived arousal but higher valence, lower respiration rates and smaller pupillary diameters. The presence of music compared to visual-only presentations strongly affected results in terms of higher accuracy in duration estimates, higher perceived arousal and valence, higher physiological activation and larger pupillary diameters, indicating higher arousal. Video genre affected responses in addition. These findings suggest that perceiving slow motion is not related to states of high arousal, but rather affects cognitive dimensions of perceived time and valence. Music influences these experiences profoundly, thus strengthening the impact of stretched time in audiovisual media.

  13. Complete Electric Dipole Response in 120Sn and 208Pb and Implications for Neutron Skin and Symmetry Energy

    Directory of Open Access Journals (Sweden)

    von Neumann-Cosel Peter

    2015-01-01

    Full Text Available Polarized proton scattering at energies of a few 100 MeV and extreme forward angles including 0° has been established as a new tool to extract the complete E1 response in nuclei up to excitation energies of about 20 MeV. A case study of 208Pb demonstrates excellent agreement with other electromagnetic probes. From the information on the B(E1 strength one can derive the electric dipole dipole polarizability, which is strongly correlated to the neutron skin and to parameters of the symmetry energy. Recently, we have extracted the polarizability of 120Sn with a comparable precision. The combination of both results further constrains the symmetry energy parameters and presents a challenge for mean-field models, since the relativistic and many Skyrme parameterizations cannot reproduce both experimental results simultaneously.

  14. Differential gene expression profiling of mouse skin after sulfur mustard exposure: Extended time response and inhibitor effect

    International Nuclear Information System (INIS)

    Gerecke, Donald R.; Chen Minjun; Isukapalli, Sastry S.; Gordon, Marion K.; Chang, Y.-C.; Tong Weida; Androulakis, Ioannis P.; Georgopoulos, Panos G.

    2009-01-01

    Sulfur mustard (HD, SM), is a chemical warfare agent that within hours causes extensive blistering at the dermal-epidermal junction of skin. To better understand the progression of SM-induced blistering, gene expression profiling for mouse skin was performed after a single high dose of SM exposure. Punch biopsies of mouse ears were collected at both early and late time periods following SM exposure (previous studies only considered early time periods). The biopsies were examined for pathological disturbances and the samples further assayed for gene expression profiling using the Affymetrix microarray analysis system. Principal component analysis and hierarchical cluster analysis of the differently expressed genes, performed with ArrayTrack showed clear separation of the various groups. Pathway analysis employing the KEGG library and Ingenuity Pathway Analysis (IPA) indicated that cytokine-cytokine receptor interaction, cell adhesion molecules (CAMs), and hematopoietic cell lineage are common pathways affected at different time points. Gene ontology analysis identified the most significantly altered biological processes as the immune response, inflammatory response, and chemotaxis; these findings are consistent with other reported results for shorter time periods. Selected genes were chosen for RT-PCR verification and showed correlations in the general trends for the microarrays. Interleukin 1 beta was checked for biological analysis to confirm the presence of protein correlated to the corresponding microarray data. The impact of a matrix metalloproteinase inhibitor, MMP-2/MMP-9 inhibitor I, against SM exposure was assessed. These results can help in understanding the molecular mechanism of SM-induced blistering, as well as to test the efficacy of different inhibitors

  15. A single bout of exercise with a flexible pole induces significant cardiac autonomic responses in healthy men

    Directory of Open Access Journals (Sweden)

    Cristiane M. Ogata

    2014-09-01

    Full Text Available OBJECTIVES: Flexible poles can provide rapid eccentric and concentric muscle contractions. Muscle vibration is associated with a "tonic vibration reflex” that is stimulated by a sequence of rapid muscle stretching, activation of the muscle spindles and stimulation of a response that is similar to the myotatic reflex. Literature studies analyzing the acute cardiovascular responses to different exercises performed with this instrument are lacking. We investigated the acute effects of exercise with flexible poles on the heart period in healthy men. METHOD: The study was performed on ten young adult males between 18 and 25 years old. We evaluated the heart rate variability in the time and frequency domains. The subjects remained at rest for 10 min. After the rest period, the volunteers performed the exercises with the flexible poles. Immediately after the exercise protocol, the volunteers remained seated at rest for 30 min and their heart rate variability was analyzed. RESULTS: The pNN50 was reduced at 5-10 and 15-20 min after exercise compared to 25-30 min after exercise (p = 0.0019, the SDNN was increased at 25-30 min after exercise compared to at rest and 0-10 min after exercise (p = 0.0073 and the RMSSD was increased at 25-30 min after exercise compared to 5-15 min after exercise (p = 0.0043. The LF in absolute units was increased at 25-30 min after exercise compared to 5-20 min after exercise (p = 0.0184. CONCLUSION: A single bout of exercise with a flexible pole reduced the heart rate variability and parasympathetic recovery was observed approximately 30 min after exercise.

  16. Selective CD28 Antagonist Blunts Memory Immune Responses and Promotes Long-Term Control of Skin Inflammation in Nonhuman Primates.

    Science.gov (United States)

    Poirier, Nicolas; Chevalier, Melanie; Mary, Caroline; Hervouet, Jeremy; Minault, David; Baker, Paul; Ville, Simon; Le Bas-Bernardet, Stephanie; Dilek, Nahzli; Belarif, Lyssia; Cassagnau, Elisabeth; Scobie, Linda; Blancho, Gilles; Vanhove, Bernard

    2016-01-01

    Novel therapies that specifically target activation and expansion of pathogenic immune cell subsets responsible for autoimmune attacks are needed to confer long-term remission. Pathogenic cells in autoimmunity include memory T lymphocytes that are long-lived and present rapid recall effector functions with reduced activation requirements. Whereas the CD28 costimulation pathway predominantly controls priming of naive T cells and hence generation of adaptive memory cells, the roles of CD28 costimulation on established memory T lymphocytes and the recall of memory responses remain controversial. In contrast to CD80/86 antagonists (CTLA4-Ig), selective CD28 antagonists blunt T cell costimulation while sparing CTLA-4 and PD-L1-dependent coinhibitory signals. Using a new selective CD28 antagonist, we showed that Ag-specific reactivation of human memory T lymphocytes was prevented. Selective CD28 blockade controlled both cellular and humoral memory recall in nonhuman primates and induced long-term Ag-specific unresponsiveness in a memory T cell-mediated inflammatory skin model. No modification of memory T lymphocytes subsets or numbers was observed in the periphery, and importantly no significant reactivation of quiescent viruses was noticed. These findings indicate that pathogenic memory T cell responses are controlled by both CD28 and CTLA-4/PD-L1 cosignals in vivo and that selectively targeting CD28 would help to promote remission of autoimmune diseases and control chronic inflammation. Copyright © 2015 by The American Association of Immunologists, Inc.

  17. Sensitivity of the Yo-Yo Intermittent Recovery Test and cardiac autonomic responses to training in futsal players.

    Science.gov (United States)

    de Freitas, Victor H; Pereira, Lucas A; de Souza, Eberton A; Leicht, Anthony S; Bertollo, Maurizio; Nakamura, Fábio Y

    2015-07-01

    This study examined the sensitivity of maximal (Yo-Yo Intermittent Recovery [IR] 1 and 2) and submaximal (5'-5') tests to identify training adaptations in futsal players along with the suitability of heart-rate (HR) and HR-variability (HRV) measures to identify these adaptations. Eleven male professional futsal players were assessed before (pretraining) and after (posttraining) a 5-wk period. Assessments included 5'-5' and Yo-Yo IR1 and IR2 performances and HR and HRV at rest and during the IR and 5'-5' tests. Magnitude-based-inference analyses examined the differences between pre- and posttraining, while relationships between changes in variables were determined via correlation. Posttraining, Yo-Yo IR1 performance likely increased while Yo-Yo IR2 performance almost certainly increased. Submaximal HR during the Yo-Yo IR1 and Yo-Yo IR2 almost certainly and likely, respectively, decreased with training. HR during the 5'-5' was very likely decreased, while HRV at rest and during the 5'-5' was likely increased after training. Changes in both Yo-Yo IR performances were negatively correlated with changes in HR during the Yo-Yo IR1 test and positively correlated with the change in HRV during the 5'-5'. The current study has identified the Yo-Yo IR2 as more responsive for monitoring training-induced changes of futsal players than the Yo-Yo IR1. Changes in submaximal HR during the Yo-Yo IR and HRV during the 5'-5' were highly sensitive to changes in maximal performance and are recommended for monitoring training. The 5'-5' was recommended as a time-efficient method to assess training adaptations for futsal players.

  18. Stratum corneum cytokines and skin irritation response to sodium lauryl sulfate

    NARCIS (Netherlands)

    de Jongh, Cindy M.; Verberk, Maarten M.; Withagen, Carien E. T.; Jacobs, John J. L.; Rustemeyer, Thomas; Kezic, Sanja

    2006-01-01

    Little is known about cytokines involved in chronic irritant contact dermatitis. Individual cytokine profiles might explain at least part of the differences in the individual response to irritation. Our objective was to investigate the relation between baseline stratum corneum (SC) cytokine levels

  19. Influence of a detergent on skin response to methyldibromo glutaronitrile in sensitized individuals

    DEFF Research Database (Denmark)

    Pedersen, Line Kynemund; Haslund, Pia; Johansen, Jeanne Duus

    2004-01-01

    The present study was undertaken to evaluate the combined effect of the preservative methyldibromo glutaronitrile (MDBGN) and sodium lauryl sulfate (SLS) on the elicitation response of allergic contact dermatitis. 20 volunteers with contact allergy to MDBGN were patch tested with 5 concentrations...

  20. Actively Perceiving and Responsive Soft Robots Enabled by Self-Powered, Highly Extensible, and Highly Sensitive Triboelectric Proximity- and Pressure-Sensing Skins.

    Science.gov (United States)

    Lai, Ying-Chih; Deng, Jianan; Liu, Ruiyuan; Hsiao, Yung-Chi; Zhang, Steven L; Peng, Wenbo; Wu, Hsing-Mei; Wang, Xingfu; Wang, Zhong Lin

    2018-06-04

    Robots that can move, feel, and respond like organisms will bring revolutionary impact to today's technologies. Soft robots with organism-like adaptive bodies have shown great potential in vast robot-human and robot-environment applications. Developing skin-like sensory devices allows them to naturally sense and interact with environment. Also, it would be better if the capabilities to feel can be active, like real skin. However, challenges in the complicated structures, incompatible moduli, poor stretchability and sensitivity, large driving voltage, and power dissipation hinder applicability of conventional technologies. Here, various actively perceivable and responsive soft robots are enabled by self-powered active triboelectric robotic skins (tribo-skins) that simultaneously possess excellent stretchability and excellent sensitivity in the low-pressure regime. The tribo-skins can actively sense proximity, contact, and pressure to external stimuli via self-generating electricity. The driving energy comes from a natural triboelectrification effect involving the cooperation of contact electrification and electrostatic induction. The perfect integration of the tribo-skins and soft actuators enables soft robots to perform various actively sensing and interactive tasks including actively perceiving their muscle motions, working states, textile's dampness, and even subtle human physiological signals. Moreover, the self-generating signals can drive optoelectronic devices for visual communication and be processed for diverse sophisticated uses. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Dissociation of sad facial expressions and autonomic nervous system responding in boys with disruptive behavior disorders

    Science.gov (United States)

    Marsh, Penny; Beauchaine, Theodore P.; Williams, Bailey

    2009-01-01

    Although deficiencies in emotional responding have been linked to externalizing behaviors in children, little is known about how discrete response systems (e.g., expressive, physiological) are coordinated during emotional challenge among these youth. We examined time-linked correspondence of sad facial expressions and autonomic reactivity during an empathy-eliciting task among boys with disruptive behavior disorders (n = 31) and controls (n = 23). For controls, sad facial expressions were associated with reduced sympathetic (lower skin conductance level, lengthened cardiac preejection period [PEP]) and increased parasympathetic (higher respiratory sinus arrhythmia [RSA]) activity. In contrast, no correspondence between facial expressions and autonomic reactivity was observed among boys with conduct problems. Furthermore, low correspondence between facial expressions and PEP predicted externalizing symptom severity, whereas low correspondence between facial expressions and RSA predicted internalizing symptom severity. PMID:17868261

  2. Response of mouse skin to tattooing: use of SKH-1 mice as a surrogate model for human tattooing

    International Nuclear Information System (INIS)

    Gopee, Neera V.; Cui, Yanyan; Olson, Greg; Warbritton, Alan R.; Miller, Barbara J.; Couch, Letha H.; Wamer, Wayne G.; Howard, Paul C.

    2005-01-01

    Tattooing is a popular cosmetic practice involving more than 45 million US citizens. Since the toxicology of tattoo inks and pigments used to formulate tattoo inks has not been reported, we studied the immunological impact of tattooing and determined recovery time from this trauma. SKH-1 hairless mice were tattooed using commercial tattoo inks or suspensions of titanium dioxide, cadmium sulfide, or iron oxide, and sacrificed at 0.5, 1, 3, 4, 7, or 14 days post-tattooing. Histological evaluation revealed dermal hemorrhage at 0.5 and 1 day. Acute inflammation and epidermal necrosis were initiated at 0.5 day decreasing in incidence by day 14. Dermal necrosis and epidermal hyperplasia were prominent by day 3, reducing in severity by day 14. Chronic active inflammation persisted in all tattooed mice from day 3 to 14 post-tattooing. Inguinal and axillary lymph nodes were pigmented, the inguinal being most reactive as evidenced by lymphoid hyperplasia and polymorphonuclear infiltration. Cutaneous nuclear protein concentrations of nuclear factor-kappa B were elevated between 0.5 and 4 days. Inflammatory and proliferative biomarkers, cyclooxygenase-1, cyclooxygenase-2, and ornithine decarboxylase protein levels were elevated between 0.5 and 4 days in the skin and decreased to control levels by day 14. Interleukin-1 beta and interleukin-10 were elevated in the lymph nodes but suppressed in the tattooed skin, with maximal suppression occurring between days 0.5 and 4. These data demonstrate that mice substantially recover from the tattooing insult by 14 days, leaving behind pigment in the dermis and the regional lymph nodes. The response seen in mice is similar to acute injury seen in humans, suggesting that the murine model might be a suitable surrogate for investigating the toxicological and phototoxicological properties of ingredients used in tattooing

  3. Possible relationships between the early inflammatory response and subsequent fibrosis in rat skin after irradiation

    International Nuclear Information System (INIS)

    Ullrich, R.L.

    1975-01-01

    The possible mechanistic relationships between the early inflammatory response and subsequent fibrosis seen after radiation exposure was studied in rats were given single x ray doses of either 2000 or 5000 rads to standardized fields of the inner thigh. The results suggest that two mechanisms are responsible for the radiation-induced increase in extravasation rate and vascular injury seen early after irradiation. First, direct cytocidal damage of the endothelium; and second, chemically mediated, possibly complement dependent mechanisms. Indirect histological evidence suggests a correlation between the PMN infiltrate and the indirect vascular damage. In addition, one may conclude from these data that both direct and indirect damage to the vasculature play a role in influencing the subsequent late radiation-induced fibrosis; and a decrease in the indirect damage may allow the maintenance of a supportive vasculature at lower doses or allow the reestablishment of a vascular bed in the case of higher doses. (U.S.)

  4. Assessment of the respiratory metabolism in the skin from transcutaneous measurements of pO2 and pCO2: potential for non-invasive monitoring of response to tuberculin skin testing.

    Science.gov (United States)

    Abbot, N C; Spence, V A; Swanson-Beck, J; Carnochan, F M; Gibbs, J H; Lowe, J G

    1990-03-01

    A method is described for non-invasive transcutaneous (tc) measurement of tissue respiratory gas tensions in the skin on the forearm for study of delayed hypersensitivity reactions in man. Steady state values for tcpO2 and tcpCO2 were measured, and the skin respiratory rate (oxygen consumption) and the tissue pH were estimated from the changes in tcpO2 and tcpCO2 observed after interruption of the arterial circulation by cuff occlusion for 4 minutes. The extent of within-experiment and between subject variation in the steady-state measurements was not great (coefficient of variation 10%): tcpCO2.ss (steady state) was higher in men and tcpO2.ss was higher in women, but the extent of these sex differences was also small. Reference ranges have been established for tc measurements and calculated indices of tissue respiration in the undisturbed forearm skin of normal volunteers, against which the changes induced by tuberculin testing can be assessed. Severe changes, indicative of profound hypoxia and acidosis, are seen in intense delayed hypersensitivity reactions. Similar, but less severe changes were seen at the site of skin tests on BCG-vaccinated subjects who were 'negative' by conventional criteria of measurement of dermal induration and they became greatly exaggerated after successful re-vaccination. Intradermal injection of saline did not induce hypoxia or local acidosis. These new methods are very sensitive indicators of the tissue response in the DHS reaction.

  5. The characteristics of autonomic nervous system disorders in burning mouth syndrome and Parkinson disease.

    Science.gov (United States)

    Koszewicz, Magdalena; Mendak, Magdalena; Konopka, Tomasz; Koziorowska-Gawron, Ewa; Budrewicz, Sławomir

    2012-01-01

    To conduct a clinical electrophysiologic evaluation of autonomic nervous system functions in patients with burning mouth syndrome and Parkinson disease and estimate the type and intensity of the autonomic dysfunction. The study involved 83 subjects-33 with burning mouth syndrome, 20 with Parkinson disease, and 30 controls. The BMS group included 27 women and 6 men (median age, 60.0 years), and the Parkinson disease group included 15 women and 5 men (median age, 66.5 years). In the control group, there were 20 women and 10 men (median age, 59.0 years). All patients were subjected to autonomic nervous system testing. In addition to the Low autonomic disorder questionnaire, heart rate variability (HRV), deep breathing (exhalation/inspiration [E/I] ratio), and sympathetic skin response (SSR) tests were performed in all cases. Parametric and nonparametric tests (ANOVA, Kruskal-Wallis, and Scheffe tests) were used in the statistical analysis. The mean values for HRV and E/I ratios were significantly lower in the burning mouth syndrome and Parkinson disease groups. Significant prolongation of SSR latency in the foot was revealed in both burning mouth syndrome and Parkinson disease patients, and lowering of the SSR amplitude occurred in only the Parkinson disease group. The autonomic questionnaire score was significantly higher in burning mouth syndrome and Parkinson disease patients than in the control subjects, with the Parkinson disease group having the highest scores. In patients with burning mouth syndrome, a significant impairment of both the sympathetic and parasympathetic nervous systems was found but sympathetic/parasympathetic balance was preserved. The incidence and intensity of autonomic nervous system dysfunction was similar in patients with burning mouth syndrome and Parkinson disease, which may suggest some similarity in their pathogeneses.

  6. Skin immunization by microneedle patch overcomes statin-induced suppression of immune responses to influenza vaccine.

    Science.gov (United States)

    Vassilieva, Elena V; Wang, Shelly; Li, Song; Prausnitz, Mark R; Compans, Richard W

    2017-12-19

    Recent studies indicated that in elderly individuals, statin therapy is associated with a reduced response to influenza vaccination. The present study was designed to determine effects on the immune response to influenza vaccination induced by statin administration in a mouse model, and investigate potential approaches to improve the outcome of vaccination on the background of statin therapy. We fed middle aged BALB/c mice a high fat "western" diet (WD) alone or supplemented with atorvastatin (AT) for 14 weeks, and control mice were fed with the regular rodent diet. Mice were immunized with a single dose of subunit A/Brisbane/59/07 (H1N1) vaccine, either systemically or with dissolving microneedle patches (MNPs). We observed that a greater age-dependent decline in the hemagglutinin inhibition titers occurred in systemically-immunized mice than in MNP- immunized mice. AT dampened the antibody response in the animals vaccinated by either route of vaccine delivery. However, the MNP-vaccinated AT-treated animals had ~20 times higher total antibody levels to the influenza vaccine than the systemically vaccinated group one month postvaccination. We propose that microneedle vaccination against influenza provides an approach to ameliorate the immunosuppressive effect of statin therapy observed with systemic immunization.

  7. Deep tissue injury in development of pressure ulcers: a decrease of inflammasome activation and changes in human skin morphology in response to aging and mechanical load.

    Directory of Open Access Journals (Sweden)

    Olivera Stojadinovic

    Full Text Available Molecular mechanisms leading to pressure ulcer development are scarce in spite of high mortality of patients. Development of pressure ulcers that is initially observed as deep tissue injury is multifactorial. We postulate that biomechanical forces and inflammasome activation, together with ischemia and aging, may play a role in pressure ulcer development. To test this we used a newly-developed bio-mechanical model in which ischemic young and aged human skin was subjected to a constant physiological compressive stress (load of 300 kPa (determined by pressure plate analyses of a person in a reclining position for 0.5-4 hours. Collagen orientation was assessed using polarized light, whereas inflammasome proteins were quantified by immunoblotting. Loaded skin showed marked changes in morphology and NLRP3 inflammasome protein expression. Sub-epidermal separations and altered orientation of collagen fibers were observed in aged skin at earlier time points. Aged skin showed significant decreases in the levels of NLRP3 inflammasome proteins. Loading did not alter NLRP3 inflammasome proteins expression in aged skin, whereas it significantly increased their levels in young skin. We conclude that aging contributes to rapid morphological changes and decrease in inflammasome proteins in response to tissue damage, suggesting that a decline in the innate inflammatory response in elderly skin could contribute to pressure ulcer pathogenesis. Observed morphological changes suggest that tissue damage upon loading may not be entirely preventable. Furthermore, newly developed model described here may be very useful in understanding the mechanisms of deep tissue injury that may lead towards development of pressure ulcers.

  8. Inflammatory response, parasite load and AgNOR expression in ear skin of symptomatic and asymptomatic Leishmania (Leishmania chagasi infected dogs

    Directory of Open Access Journals (Sweden)

    Verçosa BLA

    2011-01-01

    Full Text Available The skin has an important role in the transmission of visceral leishmaniasis (VL as the infection pathway in dogs. To better characterize the inflammatory response of intact skin in VL, sixty infected dogs (30 symptomatic and 30 asymptomatic and six non-infected controls were studied. Diagnosis of visceral leishmaniasis was confirmed by RIFI and ELISA; direct visualization of the parasite in bone marrow aspirate; imprints of popliteal lymph nodes, spleen, liver and skin; culture in NNN-phase liquid Schneider's medium; and PCR (performed only in the ear skin. Amastigote forms of the parasite in intact skin were found only in symptomatic dogs. Inflammatory infiltrates were observed in all groups, varying from intense and/or moderate in symptomatic to discrete and/or negligible in asymptomatic and control animals. Parasite load was associated with the intensity of the inflammatory response and with clinical manifestations in canine visceral leishmaniasis. AgNOr as active transcription markers were expressed in inflammatory cells and within apoptotic bodies in all groups, including controls, with no statistical difference. Therefore, cell activation and transcription do occur in both symptomatic and asymptomatic canine visceral leishmaniasis and may result in more necrosis and inflammation or in apoptosis and less symptoms, depending on the parasite load.

  9. 5-HT receptors as novel targets for optimizing pigmentary responses in dorsal skin melanophores of frog, Hoplobatrachus tigerinus

    Science.gov (United States)

    Ali, Sharique A; Salim, Saima; Sahni, Tarandeep; Peter, Jaya; Ali, Ayesha S

    2012-01-01

    BACKGROUND AND PURPOSE Biochemical identification of 5-HT has revealed similar projection patterns across vertebrates. In CNS, 5-HT regulates major physiological functions but its peripheral functions are still emerging. The pharmacology of 5-HT is mediated by a diverse range of receptors that trigger different responses. Interestingly, 5-HT receptors have been detected in pigment cells indicating their role in skin pigmentation. Hence, we investigated the role of this monoaminergic system in amphibian pigment cells, melanophores, to further our understanding of its role in pigmentation biology together with its evolutionary significance. EXPERIMENTAL APPROACH Pharmacological profiling of 5-HT receptors was achieved using potent/selective agonists and antagonists. In vitro responses of melanophores were examined by Mean Melanophores Size Index assay. The melanophores of lower vertebrates are highly sensitive to external stimuli. The immediate cellular responses to drugs were defined in terms of pigment translocation within the cells. KEY RESULTS 5-HT exerted strong concentration-dependent pigment dispersion at threshold dose of 1 × 10−6 g·mL−1. Specific 5-HT1 and 5-HT2 receptor agonists, sumatriptan and myristicin. also induced dose-dependent dispersion. Yohimbine and metergoline synergistically antagonized sumatriptan-mediated dispersion, whereas trazodone partially blocked myristicin-induced dispersion. Conversely, 5-HT3 and 5-HT4 receptor agonists, 1 (3 chlorophenyl) biguanide (1,3 CPB) and 5-methoxytryptamine (5-MT), caused a dose-dependent pigment aggregation. The aggregatory effect of 1,3 CPB was completely blocked by ondansetron, whereas L-lysine partially blocked the effect of 5-MT. CONCLUSIONS AND IMPLICATIONS The results suggest that 5-HT-induced physiological effects are mediated via distinct classes of receptors, which possibly participate in the modulation of pigmentary responses in amphibian. PMID:21880033

  10. Endogenous salivary α-amylase does not interact with skin conductance response during fear extinction in posttraumatic stress disorder.

    Science.gov (United States)

    Zuj, Daniel V; Palmer, Matthew A; Malhi, Gin S; Bryant, Richard A; Felmingham, Kim L

    2018-04-01

    Posttraumatic Stress Disorder (PTSD) is associated with elevated noradrenergic signaling, which has an impact on emotional learning and memory. Fear extinction is thought to underlie the processes of exposure therapy, however the relationship between noradrenaline and extinction in PTSD is unclear. Participants with PTSD (n = 21), trauma-exposure without PTSD (TC; n = 36), and non-trauma-exposed controls (NTC; n = 27) completed a fear conditioning and extinction paradigm, and conditioned fear was indexed by skin conductance response (SCR). Salivary α-amylase (sAA) collected at baseline and immediately post-fear acquisition was used as an index of noradrenaline, and we examined whether sAA in response to fear acquisition was a moderator between fear extinction and PTSD symptoms. While there was a significant increase in sAA from baseline to post-fear acquisition, this was not modulated by group. Compared to TC and NTC, the PTSD group displayed a slower decline in SCRs during early extinction, which generalized across stimulus type, and was not moderated by sAA. These findings suggest that the relationship between fear extinction and PTSD symptoms does not change as a function of sAA levels; however previous research suggests other processes of fear learning may be associated with noradrenergic activity in PTSD. Crown Copyright © 2018. Published by Elsevier B.V. All rights reserved.

  11. The insular cortex: relationship to skin conductance responses to facial expression of emotion in temporal lobe epilepsy.

    Science.gov (United States)

    Banks, Sarah J; Bellerose, Jenny; Douglas, Danielle; Jones-Gotman, Marilyn

    2014-03-01

    The insula plays an important role both in emotion processing and in the generation of epileptic seizures. In the current study we examined thickness of insular cortices and bilateral skin conductance responses (SCR) in healthy subjects in addition to a small number of patients with temporal lobe epilepsy. SCR measures arousal and is used to assess non-conscious responses to emotional stimuli. We used two emotion tasks, one explicitly about emotion and the other implicit. The explicit task required judgments about emotions being expressed in photographs of faces, while the implicit one required judgments about the age of the people in the photographs. Patients and healthy differed in labeling neutral faces, but not other emotions. They also differed in their SCR to emotions, though the profile depended on which hand the recordings were from. Finally, we found relationships between the thickness of the insula and SCR to each task: in the healthy group the thickness of the left insula was related to SCR to the emotion-labeling task; in the patient group it was between the thickness of the right insula and SCR in the age-labeling task. These patterns were evident only for the right hand recordings, thus underscoring the importance of bilateral recordings.

  12. Arsenic transformation predisposes human skin keratinocytes to UV-induced DNA damage yet enhances their survival apparently by diminishing oxidant response

    International Nuclear Information System (INIS)

    Sun Yang; Kojima, Chikara; Chignell, Colin; Mason, Ronald; Waalkes, Michael P.

    2011-01-01

    Inorganic arsenic and UV, both human skin carcinogens, may act together as skin co-carcinogens. We find human skin keratinocytes (HaCaT cells) are malignantly transformed by low-level arsenite (100 nM, 30 weeks; termed As-TM cells) and with transformation concurrently undergo full adaptation to arsenic toxicity involving reduced apoptosis and oxidative stress response to high arsenite concentrations. Oxidative DNA damage (ODD) is a possible mechanism in arsenic carcinogenesis and a hallmark of UV-induced skin cancer. In the current work, inorganic arsenite exposure (100 nM) did not induce ODD during the 30 weeks required for malignant transformation. Although acute UV-treatment (UVA, 25 J/cm 2 ) increased ODD in passage-matched control cells, once transformed by arsenic to As-TM cells, acute UV actually further increased ODD (> 50%). Despite enhanced ODD, As-TM cells were resistant to UV-induced apoptosis. The response of apoptotic factors and oxidative stress genes was strongly mitigated in As-TM cells after UV exposure including increased Bcl2/Bax ratio and reduced Caspase-3, Nrf2, and Keap1 expression. Several Nrf2-related genes (HO-1, GCLs, SOD) showed diminished responses in As-TM cells after UV exposure consistent with reduced oxidant stress response. UV-exposed As-TM cells showed increased expression of cyclin D1 (proliferation gene) and decreased p16 (tumor suppressor). UV exposure enhanced the malignant phenotype of As-TM cells. Thus, the co-carcinogenicity between UV and arsenic in skin cancer might involve adaptation to chronic arsenic exposure generally mitigating the oxidative stress response, allowing apoptotic by-pass after UV and enhanced cell survival even in the face of increased UV-induced oxidative stress and increased ODD. - Highlights: → Arsenic transformation adapted to UV-induced apoptosis. → Arsenic transformation diminished oxidant response. → Arsenic transformation enhanced UV-induced DNA damage.

  13. Chronic stress induces a hyporeactivity of the autonomic nervous system in response to acute mental stressor and impairs cognitive performance in business executives.

    Directory of Open Access Journals (Sweden)

    Renata Roland Teixeira

    Full Text Available The present study examined the incidence of chronic stress in business executives (109 subjects: 75 male and 34 female and its relationship with cortisol levels, cognitive performance, and autonomic nervous system (ANS reactivity after an acute mental stressor. Blood samples were collected from the subjects to measure cortisol concentration. After the sample collection, the subjects completed the Lipp Inventory of Stress Symptoms for Adults and the Stroop Color-Word Test to evaluate stress and cognitive performance levels, respectively. Saliva samples were collected prior to, immediately after, and five minutes after the test. The results revealed that 90.1% of the stressed subjects experienced stress phases that are considered chronic stress. At rest, the subjects with chronic stress showed higher cortisol levels, and no gender differences were observed. No differences were found between the stressed and non-stressed subjects regarding salivary amylase activity prior to test. Chronic stress also impaired performance on the Stroop test, which revealed higher rates of error and longer reaction times in the incongruent stimulus task independently of gender. For the congruent stimulus task of the Stroop test, the stressed males presented a higher rate of errors than the non-stressed males and a longer reaction time than the stressed females. After the acute mental stressor, the non-stressed male group showed an increase in salivary alpha-amylase activity, which returned to the initial values five minutes after the test; this ANS reactivity was not observed in the chronically stressed male subjects. The ANS responses of the non-stressed vs stressed female groups were not different prior to or after the Stroop test. This study is the first to demonstrate a blunted reactivity of the ANS when male subjects with chronic psychological stress were subjected to an acute mental stressor, and this change could contribute to impairments in cognitive

  14. Chronic stress induces a hyporeactivity of the autonomic nervous system in response to acute mental stressor and impairs cognitive performance in business executives.

    Science.gov (United States)

    Teixeira, Renata Roland; Díaz, Miguel Mauricio; Santos, Tatiane Vanessa da Silva; Bernardes, Jean Tofoles Martins; Peixoto, Leonardo Gomes; Bocanegra, Olga Lucia; Neto, Morun Bernardino; Espindola, Foued Salmen

    2015-01-01

    The present study examined the incidence of chronic stress in business executives (109 subjects: 75 male and 34 female) and its relationship with cortisol levels, cognitive performance, and autonomic nervous system (ANS) reactivity after an acute mental stressor. Blood samples were collected from the subjects to measure cortisol concentration. After the sample collection, the subjects completed the Lipp Inventory of Stress Symptoms for Adults and the Stroop Color-Word Test to evaluate stress and cognitive performance levels, respectively. Saliva samples were collected prior to, immediately after, and five minutes after the test. The results revealed that 90.1% of the stressed subjects experienced stress phases that are considered chronic stress. At rest, the subjects with chronic stress showed higher cortisol levels, and no gender differences were observed. No differences were found between the stressed and non-stressed subjects regarding salivary amylase activity prior to test. Chronic stress also impaired performance on the Stroop test, which revealed higher rates of error and longer reaction times in the incongruent stimulus task independently of gender. For the congruent stimulus task of the Stroop test, the stressed males presented a higher rate of errors than the non-stressed males and a longer reaction time than the stressed females. After the acute mental stressor, the non-stressed male group showed an increase in salivary alpha-amylase activity, which returned to the initial values five minutes after the test; this ANS reactivity was not observed in the chronically stressed male subjects. The ANS responses of the non-stressed vs stressed female groups were not different prior to or after the Stroop test. This study is the first to demonstrate a blunted reactivity of the ANS when male subjects with chronic psychological stress were subjected to an acute mental stressor, and this change could contribute to impairments in cognitive performance.

  15. Prefrontal oxygenation correlates to the responses in facial skin blood flows during exposure to pleasantly charged movie

    OpenAIRE

    Matsukawa, Kanji; Endo, Kana; Asahara, Ryota; Yoshikawa, Miho; Kusunoki, Shinya; Ishida, Tomoko

    2017-01-01

    Abstract Our laboratory reported that facial skin blood flow may serve as a sensitive tool to assess an emotional status. Cerebral neural correlates during emotional interventions should be sought in relation to the changes in facial skin blood flow. To test the hypothesis that prefrontal activity has positive relation to the changes in facial skin blood flow during emotionally charged stimulation, we examined the dynamic changes in prefrontal oxygenation (with near‐infrared spectroscopy) and...

  16. Skin Conditions

    Science.gov (United States)

    Your skin is your body's largest organ. It covers and protects your body. Your skin Holds body fluids in, preventing dehydration Keeps harmful ... it Anything that irritates, clogs, or inflames your skin can cause symptoms such as redness, swelling, burning, ...

  17. Possible relationships between the early inflammatory response and subsequent fibrosis in rat skin after irradiation

    International Nuclear Information System (INIS)

    Ullrich, R.L.

    1975-01-01

    This study was designed to examine possible mechanistic relationships between the early inflammatory response and the subsequent fibrosis seen after radiation exposure. Anesthetized Rochester ex-Wistar rats were given single x-ray doses of either 2000 or 5000 rads to standardized fields of the inner thigh. The data suggest that two mechanisms are responsible for the radiation-induced increase in extravasation rate and vascular injury seen early after irradiation. First, direct cytocidal damage of the endothelium; and second, chemically mediated, possibly complement dependent mechanisms. Indirect histological evidence suggests a correlation between the PMN infiltrate and the indirect vascular damage. In addition, one may conclude from these data that (1) both direct and indirect damage to the vasculature play a role in influencing the subsequent late radiation-induced fibrosis; and (2) a decrease in the indirect damage may allow the maintenance of a supportive vasculature at lower doses or allow the reestablishment of a vascular bed in the case of higher doses

  18. Use of Galvanic Skin Responses, Salivary Biomarkers, and Self-reports to Assess Undergraduate Student Performance During a Laboratory Exam Activity

    Science.gov (United States)

    Villanueva, Idalis; Valladares, Maria; Goodridge, Wade

    2016-01-01

    Typically, self-reports are used in educational research to assess student response and performance to a classroom activity. Yet, addition of biological and physiological measures such as salivary biomarkers and galvanic skin responses are rarely included, limiting the wealth of information that can be obtained to better understand student performance. A laboratory protocol to study undergraduate students' responses to classroom events (e.g., exams) is presented. Participants were asked to complete a representative exam for their degree. Before and after the laboratory exam session, students completed an academic achievement emotions self-report and an interview that paralleled these questions when participants wore a galvanic skin sensor and salivary biomarkers were collected. Data collected from the three methods resulted in greater depth of information about students' performance when compared to the self-report. The work can expand educational research capabilities through more comprehensive methods for obtaining nearer to real-time student responses to an examination activity. PMID:26891278

  19. Skin abscess

    Science.gov (United States)

    Abscess - skin; Cutaneous abscess; Subcutaneous abscess; MRSA - abscess; Staph infection - abscess ... Skin abscesses are common and affect people of all ages. They occur when an infection causes pus ...

  20. Testing for autonomic neuropathy

    DEFF Research Database (Denmark)

    Hilsted, J

    1984-01-01

    Autonomic neuropathy is a common complication in long-term diabetes, about 30% of the patients showing measurable signs of autonomic dysfunction after 10 years duration of disease. The diagnosis is often difficult to establish because clinical symptoms generally occur late in the course of the di......Autonomic neuropathy is a common complication in long-term diabetes, about 30% of the patients showing measurable signs of autonomic dysfunction after 10 years duration of disease. The diagnosis is often difficult to establish because clinical symptoms generally occur late in the course...

  1. Differentiating between heat pain intensities: the combined effect of multiple autonomic parameters.

    Science.gov (United States)

    Treister, Roi; Kliger, Mark; Zuckerman, Galit; Goor Aryeh, Itay; Eisenberg, Elon

    2012-09-01

    Although it is well known that pain induces changes in autonomic parameters, the extent to which these changes correlate with the experience of pain is under debate. The aim of the present study was to compare a combination of multiple autonomic parameters and each parameter alone in their ability to differentiate among 4 categories of pain intensity. Tonic heat stimuli (1minute) were individually adjusted to induce no pain, low, medium, and high pain in 45 healthy volunteers. Electrocardiogram, photoplethysmogram, and galvanic skin response were recorded, and the following parameters were calculated: heart rate; heart rate variability-high frequency (0.15 to 0.4Hz) spectral power; skin conductance level; number of skin conduction fluctuations; and photoplethysmographic pulse wave amplitude. A combination of parameters was created by fitting an ordinal cumulative logit model to the data and using linear coefficients of the model. Friedman test with post-hoc Wilcoxon test were used to compare between pain intensity categories for every parameter alone and for their linear combination. All of the parameters successfully differentiated between no pain and all other pain categories. However, none of the parameters differentiated between all 3 pain categories (i.e., low and medium; medium and high; low and high). In contrast, the linear combination of parameters significantly differentiated not only between pain and no pain, but also between all pain categories (Ppain assessment. Copyright © 2012 International Association for the Study of Pain. Published by Elsevier B.V. All rights reserved.

  2. Mobile Autonomous Reconfigurable System

    Directory of Open Access Journals (Sweden)

    Pavliuk N.A.

    2018-04-01

    Full Text Available The object of this study is a multifunctional modular robot able to assemble independently in a given configuration and responsively change it in the process of operation depending on the current task. In this work we aim at developing and examining unified modules for a modular robot, which can both perform autonomous movement and form a complex structure by connecting to other modules. The existing solutions in the field of modular robotics were reviewed and classified by power supply, the ways of interconnection, the ways of movement and the possibility of independent movement of separate modules. Basing on the analysis of the shortcomings of existing analogues, we have developed a module of mobile autonomous reconfigurable system, including a base unit, a set of magneto-mechanical connectors and two motor wheels. The basic kinematic scheme of the modular robot, the features of a single module, as well as the modular structure formed by an array of similar modules were described. Two schemes for placing sets of magneto-mechanical connectors in the basic module have been proposed. We described the principle of operation of a magneto-mechanical connector based on redirection of the magnetic flux of a permanent magnet. This solution simplifies the system for controlling a mechanism of connection with other modules, increases energy efficiency and a battery life of the module. Since the energy is required only at the moment of switching the operating modes of the connector, there is no need to power constantly the connector mechanism to maintain the coupling mode.

  3. Subcutaneous L-tyrosine elicits cutaneous analgesia in response to local skin pinprick in rats.

    Science.gov (United States)

    Hung, Ching-Hsia; Chiu, Chong-Chi; Liu, Kuo-Sheng; Chen, Yu-Wen; Wang, Jhi-Joung

    2015-10-15

    The purpose of the study was to estimate the ability of L-tyrosine to induce cutaneous analgesia and to investigate the interaction between L-tyrosine and the local anesthetic lidocaine. After subcutaneously injecting the rats with L-tyrosine and lidocaine in a dose-dependent manner, cutaneous analgesia (by blocking the cutaneous trunci muscle reflex-CTMR) was evaluated in response to the local pinprick. The drug-drug interaction was analyzed by using an isobolographic method. We showed that both L-tyrosine and lidocaine produced dose-dependent cutaneous analgesia. On the 50% effective dose (ED50) basis, the rank of drug potency was lidocaine (5.09 [4.88-5.38] μmol)>L-tyrosine (39.1 [36.5-41.8] μmol) (Ptyrosine lasted longer than that caused by lidocaine (Ptyrosine exhibited an additive effect on infiltrative cutaneous analgesia. Our pre-clinical study demonstrated that L-tyrosine elicits the local/cutaneous analgesia, and the interaction between L-tyrosine and lidocaine is additive. L-tyrosine has a lower potency but much greater duration of cutaneous analgesia than lidocaine. Adding L-tyrosine to lidocaine preparations showed greater duration of cutaneous analgesia compared with lidocaine alone. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Real-time gene expression analysis in carp (Cyprinus carpio) skin: inflammatory responses to injury mimicking infection with ectoparasites

    NARCIS (Netherlands)

    Gonzalez, S.F.; Huising, M.O.; Stakauska, R.; Forlenza, M.; Verburg-van Kemenade, B.M.L.; Buchmann, K.; Nielsen, M.E.; Wiegertjes, G.F.

    2007-01-01

    We studied a predictive model of gene expression induced by mechanical injury of fish skin, to resolve the confounding effects on the immune system induced by injury and skin parasite-specific molecules. We applied real time quantitative PCR (RQ-PCR) to measure the expression of the pro-inflammatory

  5. Real-time gene expression analysis in carp (Cyprinus carpio L.) skin: Inflammatory responses to injury mimicking infection with ectoparasites

    NARCIS (Netherlands)

    Gonzalez, S.F.; Huising, M.O.; Stakauskas, R.; Forlenza, M.; Verburg-van Kemenade, B.M.L.; Buchmann, K.; Nielsen, M.E.; Wiegertjes, G.F.

    2007-01-01

    We studied a predictive model of gene expression induced by mechanical injury of fish skin, to resolve the confounding effects on the immune system induced by injury and skin parasite-specific molecules. We applied real time quantitative PCR (RQ-PCR) to measure the expression of the pro-inflammatory

  6. Experimental research and observation of the skin response of mice with a second-degree scald during irradiation by a CO2 laser

    Science.gov (United States)

    Wang, Yunxia; Wu, Shulian; Li, Zhifang; Xu, Xiaohui; Li, Hui

    2014-05-01

    Second-degree scalding is a common dermatological injury. Inappropriate treatment methods in clinical practice always produce scarring, and can lead to skin cancer and other complications in the longer term. In this study optical coherence tomography (OCT) combined with a skin detector was used to monitor the response of second-degree scalded skin tissue irradiated by a CO2 laser. The process of treatment of second-degree scalding was systematically studied from the perspective of tissue optics. The OCT signal intensity was stronger within the whole recovery period in the experimental group undergoing CO2 laser treatment, and the attenuation coefficient (μt) returned to its original value in a shorter time. The results help us to understand tissue injury in a second-degree scald and may help improve the standard treatment.

  7. The Role of AKT/mTOR Pathway in Stress Response to UV-Irradiation: Implication in Skin Carcinogenesis by Regulation of Apoptosis, Autophagy and Senescence

    Science.gov (United States)

    Strozyk, Elwira; Kulms, Dagmar

    2013-01-01

    Induction of DNA damage by UVB and UVA radiation may generate mutations and genomic instability leading to carcinogenesis. Therefore, skin cells being repeatedly exposed to ultraviolet (UV) light have acquired multilayered protective mechanisms to avoid malignant transformation. Besides extensive DNA repair mechanisms, the damaged skin cells can be eliminated by induction of apoptosis, which is mediated through the action of tumor suppressor p53. In order to prevent the excessive loss of skin cells and to maintain the skin barrier function, apoptotic pathways are counteracted by anti-apoptotic signaling including the AKT/mTOR pathway. However, AKT/mTOR not only prevents cell death, but is also active in cell cycle transition and hyper-proliferation, thereby also counteracting p53. In turn, AKT/mTOR is tuned down by the negative regulators being controlled by the p53. This inhibition of AKT/mTOR, in combination with transactivation of damage-regulated autophagy modulators, guides the p53-mediated elimination of damaged cellular components by autophagic clearance. Alternatively, p53 irreversibly blocks cell cycle progression to prevent AKT/mTOR-driven proliferation, thereby inducing premature senescence. Conclusively, AKT/mTOR via an extensive cross talk with p53 influences the UV response in the skin with no black and white scenario deciding over death or survival. PMID:23887651

  8. Water bath hyperthermia is a simple therapy for psoriasis and also stimulates skin tanning in response to sunlight

    Energy Technology Data Exchange (ETDEWEB)

    Boreham, D.R.; Gasmann, H.C.; Mitchel, R.E.J

    1994-07-01

    An eight week trial, involving superficial hyperthermia delivered biweekly via simple water bath immersion, was tested for its ability to clear mild to moderate psoriatic lesions. Seven patients were treated and three cases rapidly improved. In the remaining patients, the treatment frequency was increased to alternate days; two cases improved significantly, one patient showed a partial response, and the fourth had no visible change (this was the only patient taking concurrent drug therapy - etretinate). In addition to resolving psoriatic lesions, water bath hyperthermia also reduced edema (swelling) and relieved pruritus (itching) in all patients, both during the treatment period and for up to several months after lesions had returned. Lesion reappearance occurred within one to three months after the last heat treatment. We retreated one patient and produced a second complete remission. These results indicate that simple repetitive water bath hyperthermia alone is effective in the treatment of psoriatic lesions in heatable locations. An unexpected side effect was enhanced melanin content (tanning) in all areas where hyperthermia treated skin was exposed to sunlight. (author)

  9. Do intensity ratings and skin conductance responses reliably discriminate between different stimulus intensities in experimentally induced pain?

    Science.gov (United States)

    Breimhorst, Markus; Sandrock, Stephan; Fechir, Marcel; Hausenblas, Nadine; Geber, Christian; Birklein, Frank

    2011-01-01

    The present study addresses the question whether pain-intensity ratings and skin conductance responses (SCRs) are able to detect different intensities of phasic painful stimuli and to determine the reliability of this discrimination. For this purpose, 42 healthy participants of both genders were assigned to either electrical, mechanical, or laser heat-pain stimulation (each n = 14). A whole range of single brief painful stimuli were delivered on the right volar forearm of the dominant hand in a randomized order. Pain-intensity ratings and SCRs were analyzed. Using generalizability theory, individual and gender differences were the main contributors to the variability of both intensity ratings and SCRs. Most importantly, we showed that pain-intensity ratings are a reliable measure for the discrimination of different pain stimulus intensities in the applied modalities. The reliability of SCR was adequate when mechanical and heat stimuli were tested but failed for the discrimination of electrical stimuli. Further studies are needed to reveal the reason for this lack of accuracy for SCRs when applying electrical pain stimuli. Our study could help researchers to better understand the relationship between pain and activation of the sympathetic nervous system. Pain researchers are furthermore encouraged to consider individual and gender differences when measuring pain intensity and the concomitant SCRs in experimental settings. Copyright © 2011 American Pain Society. Published by Elsevier Inc. All rights reserved.

  10. Optically-tracked handheld fluorescence imaging platform for monitoring skin response in the management of soft tissue sarcoma

    Science.gov (United States)

    Chamma, Emilie; Qiu, Jimmy; Lindvere-Teene, Liis; Blackmore, Kristina M.; Majeed, Safa; Weersink, Robert; Dickie, Colleen I.; Griffin, Anthony M.; Wunder, Jay S.; Ferguson, Peter C.; DaCosta, Ralph S.

    2015-07-01

    Standard clinical management of extremity soft tissue sarcomas includes surgery with radiation therapy. Wound complications (WCs) arising from treatment may occur due to bacterial infection and tissue breakdown. The ability to detect changes in these parameters during treatment may lead to earlier interventions that mitigate WCs. We describe the use of a new system composed of an autofluorescence imaging device and an optical three-dimensional tracking system to detect and coregister the presence of bacteria with radiation doses. The imaging device visualized erythema using white light and detected bacterial autofluorescence using 405-nm excitation light. Its position was tracked relative to the patient using IR reflective spheres and registration to the computed tomography coordinates. Image coregistration software was developed to spatially overlay radiation treatment plans and dose distributions on the white light and autofluorescence images of the surgical site. We describe the technology, its use in the operating room, and standard operating procedures, as well as demonstrate technical feasibility and safety intraoperatively. This new clinical tool may help identify patients at greater risk of developing WCs and investigate correlations between radiation dose, skin response, and changes in bacterial load as biomarkers associated with WCs.

  11. Electric dipole response of {sup 208}Pb from proton inelastic scattering: Constraints on neutron skin thickness and symmetry energy

    Energy Technology Data Exchange (ETDEWEB)

    Tamii, A. [Research Center for Nuclear Physics, Ibaraki (Japan); Neumann-Cosel, P. von; Poltoratska, I. [Technische Universitaet Darmstadt, Institut fuer Kernphysik, Darmstadt (Germany)

    2014-02-15

    The electric dipole (E1) response of {sup 208}Pb has been precisely determined by measuring Coulomb excitation induced by proton scattering at very forward angles. The electric dipole polarizability, defined as inverse energy-weighted sum rule of the E1 strength, has been extracted as α{sub D} = 20.1 ± 0.6 fm{sup 3}. The data can be used to constrain the neutron skin thickness of {sup 208}Pb to Δr{sub np} = 0.165 ± (0.009){sub expt} ± (0.013){sub theor} ± (0.021){sub est} fm, where the subscript ''expt'' refers to the experimental uncertainty, ''theor'' to the theoretical confidence band and ''est'' to the uncertainty associated with the estimation of the symmetry energy at the saturation density. In addition, a constraint band has been extracted in the plane of the symmetry energy (J and its slope parameter L) at the saturation density. (orig.)

  12. Skin Cancer.

    Science.gov (United States)

    Linares, Miguel A; Zakaria, Alan; Nizran, Parminder

    2015-12-01

    Skin cancer accounts for most malignancies across the globe. They are primarily divided into melanoma and nonmelanoma skin malignancies. Nonmelanoma skin cancer includes basal cell carcinoma and squamous cell carcinoma. Fair skin and chronic ultraviolet B exposure are the most important risk factors. Primary prevention is achieved by avoiding sun exposure and tanning beds. Copyright © 2015 Elsevier Inc. All rights reserved.

  13. Semi-Autonomous Systems Laboratory

    Data.gov (United States)

    Federal Laboratory Consortium — VisionThe Semi-Autonomous Systems Lab focuses on developing a comprehensive framework for semi-autonomous coordination of networked robotic systems. Semi-autonomous...

  14. Randomized placebo-controlled trial of sucrose analgesia on neonatal skin blood flow and pain response during heel lance.

    Science.gov (United States)

    Tutag Lehr, Victoria; Cortez, Josef; Grever, William; Cepeda, Eugene; Thomas, Ron; Aranda, Jacob V

    2015-05-01

    To evaluate the effect of oral sucrose on skin blood flow (SBF; perfusion units; PU) measured by Laser Doppler Imager (LDI) in term newborns and pain response (Neonatal Infant Pain Scale score; NIPS score) during heel lance; (2) determine SBF changes during heel lance; and (3) the relationship between SBF and NIPS. Term infants ≤7 days old (n=56) undergoing routine heel lance were randomized to pretreatment with 2.0 mL oral 24% sucrose (n=29) or sterile water (n=27) in a double-blinded, placebo-controlled trial. SBF was assessed by LDI scans and NIPS scores at 10 minutes before lance, immediately after lancing, and 5 minutes after blood extraction. Mean SBF and median NIPS scores were compared between groups using General Linear Model or Kruskal-Wallis. Regressions examined the relationship between SBF immediately after heel lance and NIPS score. Mean SBF and median NIPS scores immediately after heel lance were lower in sucrose-treated infants (167.9±15.5 vs. 205.4±16.0 PU, P=0.09; NIPS 1 [interquartile range 0 to 4] vs. NIPS 3 [interquartile range 0 to 6], P=0.02), although no significant difference in mean SBF. During heel lance NIPS score was predictive of SBF. An increase of 1 in NIPS score was associated with 11 PU increase in SBF (R=0.21; P=0.09) for sucrose, and 16 PU increase for placebo-treated infants (R=0.20; P=0.014). Increased SBF assessed by LDI is a pain response among term neonates after routine heel lance, which was not completely attenuated by oral sucrose administration. Increased SBF is associated with NIPS scores. Sucrose analgesic efficacy evidenced by decreased NIPS scores for the sucrose group. Association of SBF with NIPS scores suggests that LDI is potentially useful for assessing newborn procedural pain.

  15. Non-thermal near-infrared exposure photobiomodulates cellular responses to ionizing radiation in human full thickness skin models.

    Science.gov (United States)

    König, Anke; Zöller, Nadja; Kippenberger, Stefan; Bernd, August; Kaufmann, Roland; Layer, Paul G; Heselich, Anja

    2018-01-01

    Ionizing and near-infrared radiation are both part of the therapeutic spectrum in cancer treatment. During cancer therapy ionizing radiation is typically used for non-invasive reduction of malignant tissue, while near-infrared photobiomodulation is utilized in palliative medical approaches, e.g. for pain reduction or impairment of wound healing. Furthermore, near-infrared is part of the solar wavelength spectrum. A combined exposure of these two irradiation qualities - either intentionally during medical treatment or unintentionally due to solar exposure - is therefore presumable for cancer patients. Several studies in different model organisms and cell cultures show a strong impact of near-infrared pretreatment on ionizing radiation-induced stress response. To investigate the risks of non-thermal near-infrared (NIR) pretreatment in patients, a human in vitro full thickness skin models (FTSM) was evaluated for radiation research. FTSM were pretreated with therapy-relevant doses of NIR followed by X-radiation, and then examined for DNA-double-strand break (DSB) repair, cell proliferation and apoptosis. Double-treated FTSM revealed a clear influence of NIR on X-radiation-induced stress responses in cells in their typical tissue environment. Furthermore, over a 24h time period, double-treated FTSM presented a significant persistence of DSBs, as compared to samples exclusively irradiated by X-rays. In addition, NIR pretreatment inhibited apoptosis induction of integrated fibroblasts, and counteracted the radiation-induced proliferation inhibition of basal keratinocytes. Our work suggests that cancer patients treated with X-rays should be prevented from uncontrolled NIR irradiation. On the other hand, controlled double-treatment could provide an alternative therapy approach, exposing the patient to less radiation. Copyright © 2017. Published by Elsevier B.V.

  16. Skin tightening.

    Science.gov (United States)

    Woolery-Lloyd, Heather; Kammer, Jenna N

    2011-01-01

    Skin tightening describes the treatment of skin laxity via radiofrequency (RF), ultrasound, or light-based devices. Skin laxity on the face is manifested by progressive loss of skin elasticity, loosening of the connective tissue framework, and deepening of skin folds. This results in prominence of submandibular and submental tissues. Genetic factors (chronological aging) and extrinsic factors (ultraviolet radiation) both contribute to skin laxity. There are many RF, ultrasound, and light-based devices directed at treating skin laxity. All of these devices target and heat the dermis to induce collagen contraction. Heating of the dermis causes collagen denaturation and immediate collagen contraction in addition to long-term collagen remodeling. Via RF, light, or ultrasound, these skin tightening devices deliver heat to the dermis to create new collagen and induce skin tightening. This chapter will provide an overview of the various skin tightening devices. Copyright © 2011 S. Karger AG, Basel.

  17. Genetic autonomic disorders.

    Science.gov (United States)

    Axelrod, Felicia B

    2013-03-01

    Genetic disorders affecting the autonomic nervous system can result in abnormal development of the nervous system or they can be caused by neurotransmitter imbalance, an ion-channel disturbance or by storage of deleterious material. The symptoms indicating autonomic dysfunction, however, will depend upon whether the genetic lesion has disrupted peripheral or central autonomic centers or both. Because the autonomic nervous system is pervasive and affects every organ system in the body, autonomic dysfunction will result in impaired homeostasis and symptoms will vary. The possibility of genetic confirmation by molecular testing for specific diagnosis is increasing but treatments tend to remain only supportive and directed toward particular symptoms. Copyright © 2013 Elsevier Inc. All rights reserved.

  18. Response of pig skin to single doses of irradiation from strontium-90 sources of differing surface area

    Energy Technology Data Exchange (ETDEWEB)

    Hopewell, J.W.; Hamlet, R.; Peel, D. (Churchill Hospital, Oxford (UK). Research Inst.)

    1985-08-01

    In the present investigations the effects of irradiation of pig skin with 22.5 and 40 mm diameter /sup 90/Sr plaques are compared. In addition to comparing peak epithelial reactions, comparisons were also made as to the healing times for comparable peak skin reactions for each field size. The ED/sub 50/ values (dose to produce moist desquamation in 50% of the skin fields) 26.5 +- 1.5 Gy for the 22.5 diameter field was not significantly different from that obtained for the larger 40 mm diameter source (ED/sub 50/ 29.0 +- 1.5 Gy).

  19. The response of pig skin to single doses of irradiation from strontium-90 sources of differing surface area

    International Nuclear Information System (INIS)

    Hopewell, J.W.; Hamlet, R.; Peel, D.

    1985-01-01

    In the present investigations the effects of irradiation of pig skin with 22.5 and 40 mm diameter 90 Sr plaques are compared. In addition to comparing peak epithelial reactions, comparisons were also made as to the healing times for comparable peak skin reactions for each field size. The ED 50 values (dose to produce moist desquamation in 50% of the skin fields) 26.5+-1.5 Gy for the 22.5 diameter field was not significantly different from that obtained for the larger 40 mm diameter source (ED 50 29.0+-1.5 Gy). (U.K.)

  20. Skin barrier function

    DEFF Research Database (Denmark)

    2016-01-01

    Renowned experts present the latest knowledge Although a very fragile structure, the skin barrier is probably one of the most important organs of the body. Inward/out it is responsible for body integrity and outward/in for keeping microbes, chemicals, and allergens from penetrating the skin. Since...... the role of barrier integrity in atopic dermatitis and the relationship to filaggrin mutations was discovered a decade ago, research focus has been on the skin barrier, and numerous new publications have become available. This book is an interdisciplinary update offering a wide range of information...... on the subject. It covers new basic research on skin markers, including results on filaggrin and on methods for the assessment of the barrier function. Biological variation and aspects of skin barrier function restoration are discussed as well. Further sections are dedicated to clinical implications of skin...

  1. Oral fibroblasts produce more HGF and KGF than skin fibroblasts in response to co-culture with keratinocytes

    DEFF Research Database (Denmark)

    Grøn, Birgitte; Stoltze, Kaj; Andersson, Anders

    2002-01-01

    The production of hepatocyte growth factor (HGF) and keratinocyte growth factor (KGF) in subepithelial fibroblasts from buccal mucosa, periodontal ligament, and skin was determined after co-culture with keratinocytes. The purpose was to detect differences between the fibroblast subpopulations...... days by ELISA. When cultured on polystyrene, the constitutive level of KGF and HGF in periodontal fibroblasts was higher than the level in buccal and skin fibroblasts. In the presence of keratinocytes, all three types of fibroblasts in general increased their HGF and KGF production 2-3 times. When...... cells were maintained in collagen, the level of HGF and KGF was decreased mainly in skin cultures. However, in oral fibroblasts, induction after stimulation was at a similar level in collagen compared to on polystyrene. Skin fibroblasts maintained in collagen produced almost no HGF whether...

  2. Emergence time and skin melanin spot patterns do not correlate with growth performance, social competitive ability or stress response in farmed rainbow trout

    DEFF Research Database (Denmark)

    Gesto, Manuel; Skov, Peter Vilhelm; Jokumsen, Alfred

    2017-01-01

    dissimilarities in the acute stress responses, emergence fraction displayed no correlation with growth rates, or the ability to compete for feed. Within the whole group of fish utilized in the experiments, no relationship between skinmelanin spot pattern and growth performance, stress response intensity......, or competitive ability was found. Altogether, the differences in physiological traits related to emergence time were not as strong as those found in earlier studies. It is hypothesized, that the origin and degree of domestication of the fish might be partly responsible for this. The predictive value of skin...... spots or emergence time to infer the fish stress coping style in farmed fish is also discussed...

  3. Prefrontal oxygenation correlates to the responses in facial skin blood flows during exposure to pleasantly charged movie.

    Science.gov (United States)

    Matsukawa, Kanji; Endo, Kana; Asahara, Ryota; Yoshikawa, Miho; Kusunoki, Shinya; Ishida, Tomoko

    2017-11-01

    Our laboratory reported that facial skin blood flow may serve as a sensitive tool to assess an emotional status. Cerebral neural correlates during emotional interventions should be sought in relation to the changes in facial skin blood flow. To test the hypothesis that prefrontal activity has positive relation to the changes in facial skin blood flow during emotionally charged stimulation, we examined the dynamic changes in prefrontal oxygenation (with near-infrared spectroscopy) and facial skin blood flows (with two-dimensional laser speckle and Doppler flowmetry) during emotionally charged audiovisual challenges for 2 min (by viewing comedy, landscape, and horror movie) in 14 subjects. Hand skin blood flow and systemic hemodynamics were simultaneously measured. The extents of pleasantness and consciousness for each emotional stimulus were estimated by subjective rating from -5 (the most unpleasant; the most unconscious) to +5 (the most pleasant; the most conscious). Positively charged emotional stimulation (comedy) simultaneously decreased ( P  horror) or neutral (landscape) emotional stimulation did not alter or slightly decreased them. Any of hand skin blood flow and systemic cardiovascular variables did not change significantly during positively charged emotional stimulation. The changes in prefrontal oxygenation had a highly positive correlation with the changes in facial skin blood flow without altering perfusion pressure, and they were inversely correlated with the subjective rating of pleasantness. The reduction in prefrontal oxygenation during positively charged emotional stimulation suggests a decrease in prefrontal neural activity, which may in turn elicit neurally mediated vasoconstriction of facial skin blood vessels. © 2017 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of The Physiological Society and the American Physiological Society.

  4. Effects of galvanic skin response feedback on user experience in gaze-controlled gaming: A pilot study.

    Science.gov (United States)

    Larradet, Fanny; Barresi, Giacinto; Mattos, Leonardo S

    2017-07-01

    Eye-tracking (ET) is one of the most intuitive solutions for enabling people with severe motor impairments to control devices. Nevertheless, even such an effective assistive solution can detrimentally affect user experience during demanding tasks because of, for instance, the user's mental workload - using gaze-based controls for an extensive period of time can generate fatigue and cause frustration. Thus, it is necessary to design novel solutions for ET contexts able to improve the user experience, with particular attention to its aspects related to workload. In this paper, a pilot study evaluates the effects of a relaxation biofeedback system on the user experience in the context of a gaze-controlled task that is mentally and temporally demanding: ET-based gaming. Different aspects of the subjects' experience were investigated under two conditions of a gaze-controlled game. In the Biofeedback group (BF), the user triggered a command by means of voluntary relaxation, monitored through Galvanic Skin Response (GSR) and represented by visual feedback. In the No Biofeedback group (NBF), the same feedback was timed according to the average frequency of commands in BF. After the experiment, each subject filled out a user experience questionnaire. The results showed a general appreciation for BF, with a significant between-group difference in the perceived session time duration, with the latter being shorter for subjects in BF than for the ones in NBF. This result implies a lower mental workload for BF than for NBF subjects. Other results point toward a potential role of user's engagement in the improvement of user experience in BF. Such an effect highlights the value of relaxation biofeedback for improving the user experience in a demanding gaze-controlled task.

  5. Is applying the same exercise-based inpatient program to normal and reduced left ventricular function patients the best strategy after coronary surgery? A focus on autonomic cardiac response.

    Science.gov (United States)

    Mendes, Renata Gonçalves; Simões, Rodrigo Polaquini; Costa, Fernando de Souza Melo; Pantoni, Camila Bianca Falasco; Di Thommazo-Luporini, Luciana; Luzzi, Sérgio; Amaral-Neto, Othon; Arena, Ross; Catai, Aparecida Maria; Borghi-Silva, Audrey

    2014-01-01

    To assess whether the same exercise-based inpatient program applied to patients with normal and reduced left ventricular function (LVF) evokes a similar cardiac autonomic response after coronary artery bypass graft (CABG). Forty-four patients post-CABG, subgrouped according to normal LVF [LVFN: n = 23; left ventricular ejection fraction (LVEF) ≥ 55%] and reduced LVF (LVFR: n = 21; LVEF 35-54%), were included. All initiated the exercise protocol on post-operative day 1 (PO1), following a whole progressive program until discharge. Cardiac autonomic response was assessed by the indices of heart rate variability (HRV) at rest and during exercise (extremity range of motion and ambulation). During ambulation, lower values of HRV indices were found in the LVFR group compared with the LVFN group [standard deviation of all RR (STDRR; 6.1 ± 2.7 versus 8.9 ± 4.7 ms), baseline width of the RR histogram (TINN; 30.6 ± 14.8 versus 45.8 ± 24.9 ms), SD2 (14.8 ± 8.0 versus 21.3 ± 9.0 ms), Shannon entropy (3.6 ± 0.5 versus 3.9 ± 0.4) and correlation dimension (0.08 ± 0.2 versus 0.2 ± 0.2)]. Also, when comparing the ambulation to rest change, lower values were observed in the LVFR group for linear (STDRR, TINN, RR TRI, rMSSD) and non-linear (SD2 and correlation dimension) HRV indices (p exercise (extremity range of motion), for mean intervals between heart beats and heart rate. For patients with LVFN, the same inpatient exercise protocol triggered a more attenuated autonomic response compared with patients with LVFR. These findings have implications as to how exercise should be prescribed according to LVF in the early stages following recovery from CABG. Implications for Rehabilitation Exercise-based inpatient program, performed by post-CABG patients who have normal left ventricular function, triggered a more attenuated cardiac autonomic response compared with patients with reduced left ventricular function. Volume of the inpatient exercises should be prescribed according

  6. Cardiovascular Autonomic Neuropathy in Systemic Lupus Erythematosus.

    Science.gov (United States)

    Alam, Md Mahboob; Das, Pinaki; Ghosh, Parasar; Zaman, Md Salim Uz; Boro, Madhusmita; Sadhu, Manika; Mazumdar, Ardhendu

    2015-01-01

    Objective is to evaluate cardiovascular autonomic function in SLE by simple non-invasive tests. A case control study was carried out involving 18-50 yrs old previously diagnosed SLE patients and same number of age and sex-matched controls. Parasympathetic function was assessed by heart rate (HR) response to Valsalva maneuver, deep breathing and standing. Sympathetic function was evaluated by blood pressure response to standing and sustained hand-grip test (HGT). There were 50 female SLE patients. They had significantly higher minimum resting HR and diastolic blood pressure (DBP). HR variation with deep breathing, expiratory inspiratory ratio, 30:15 ratio and DBP change in response to HGT were significantly lower inpatients compared to controls. Thirty patients (60%) had at least one abnormal or two borderline test results indicating autonomic impairment of which 27 had parasympathetic dysfunction and 7 had sympathetic dysfunction. Autonomic dysfunction is common in SLE with higher prevalence of parasympathetic impairment.

  7. Fine-Needle Aspiration Biopsy of the Lymph Node: A Novel Tool for the Monitoring of Immune Responses after Skin Antigen Delivery.

    Science.gov (United States)

    Tatovic, Danijela; Young, Philippa; Kochba, Efrat; Levin, Yotam; Wong, F Susan; Dayan, Colin M

    2015-07-01

    Assessment of immune responses in lymph nodes (LNs) is routine in animals, but rarely done in humans. We have applied minimally invasive ultrasound-guided fine-needle aspiration of the LN to a before-and-after study of the immune response to intradermally delivered Ag in healthy volunteers (n = 25). By comparison with PBMCs from the same individual, LN cells (LNCs) were characterized by reduced numbers of effector memory cells, especially CD8(+) TEMRA cells (3.37 ± 1.93 in LNCs versus 22.53 ± 7.65 in PBMCs; p = 0.01) and a marked increased in CD69 expression (27.67 ± 7.49 versus 3.49 ± 2.62%, LNCs and PBMCs, respectively; p < 0.0001). At baseline, there was a striking absence of IFN-γ ELISPOT responses to recall Ags (purified protein derivative, Tetanus toxoid, or flu/EBV/CMV viral mix) in LN, despite strong responses in the peripheral blood. However, 48 h after tuberculin purified protein derivative administration in the ipsilateral forearm resulting in a positive skin reaction, a clear increase in IFN-γ ELISPOT counts was seen in the draining LN but not in PBMCs. This response was lost by 5 d. These data suggest that the low levels of effector memory cells in the LN may explain the low background of baseline ELISPOT responses in LNs as compared with PBMCs, and the appearance of a response after 48 h is likely to represent migration of effector memory cells from the skin to the LN. Hence, it appears that the combination of intradermal Ag administration and draining LN sampling can be used as a sensitive method to probe the effector memory T cell repertoire in the skin. Copyright © 2015 by The American Association of Immunologists, Inc.

  8. Human papillomavirus types detected in skin warts and cancer differ in their transforming properties but commonly counteract UVB induced protective responses in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Shterzer, Naama; Heyman, Dariya; Shapiro, Beny; Yaniv, Abraham; Jackman, Anna [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel); Serour, Francis [Department of Pediatric Surgery, The E. Wolfson Medical Center, Holon (Israel); Chaouat, Malka [Laboratory of Experimental Surgery, Hadassah University Hospital, Ein Karem, Jerusalem (Israel); Gonen, Pinhas [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel); Tommasino, Massimo [International Agency for Research on Cancer, World Health Organization, Lyon (France); Sherman, Levana [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel)

    2014-11-15

    In the present study, E6E7 and E6 proteins of human papillomaviruses (HPVs) associated with skin warts and cancer were compared for their transforming and carcinogenic abilities in primary human keratinocytes (PHKs). We show that E6E7 of cancer associated beta HPV types, notably 49 and 24, were able to extend the life span and enhance the clonogenic efficiency of PHKs when maintained in serum free/low calcium medium. Activities of the beta HPV E6E7 were lower than those of HPV16 E6E7. In contrast, E6 proteins from HPV types detected in skin warts or cancer, notably 10, 49 and 38, attenuated UVB induced protective responses in PHKs including cell death, proliferation arrest and accumulation of the proapoptotic proteins, p53, bax or bak. Together, this investigation revealed functional differences and commonalities between HPVs associated with skin warts and cancer, and allowed the identification of specific properties of beta HPVs supporting their involvement in skin carcinogenesis. - Highlights: • Primary keratinocytes were used to evaluate transforming and carcinogenic abilities of cutaneous HPVs. • E6E7 of cancer associated β HPV types transform primary human keratinocytes. • E6 proteins of cancer and wart associated HPVs inhibit UVB induced cell death. • E6s of cancer and wart associated HPVs attenuate UVB induced proliferation arrest. • E6s of cancer and wart associated HPVs attenuate UVB induced apoptosis signaling.

  9. Human papillomavirus types detected in skin warts and cancer differ in their transforming properties but commonly counteract UVB induced protective responses in human keratinocytes

    International Nuclear Information System (INIS)

    Shterzer, Naama; Heyman, Dariya; Shapiro, Beny; Yaniv, Abraham; Jackman, Anna; Serour, Francis; Chaouat, Malka; Gonen, Pinhas; Tommasino, Massimo; Sherman, Levana

    2014-01-01

    In the present study, E6E7 and E6 proteins of human papillomaviruses (HPVs) associated with skin warts and cancer were compared for their transforming and carcinogenic abilities in primary human keratinocytes (PHKs). We show that E6E7 of cancer associated beta HPV types, notably 49 and 24, were able to extend the life span and enhance the clonogenic efficiency of PHKs when maintained in serum free/low calcium medium. Activities of the beta HPV E6E7 were lower than those of HPV16 E6E7. In contrast, E6 proteins from HPV types detected in skin warts or cancer, notably 10, 49 and 38, attenuated UVB induced protective responses in PHKs including cell death, proliferation arrest and accumulation of the proapoptotic proteins, p53, bax or bak. Together, this investigation revealed functional differences and commonalities between HPVs associated with skin warts and cancer, and allowed the identification of specific properties of beta HPVs supporting their involvement in skin carcinogenesis. - Highlights: • Primary keratinocytes were used to evaluate transforming and carcinogenic abilities of cutaneous HPVs. • E6E7 of cancer associated β HPV types transform primary human keratinocytes. • E6 proteins of cancer and wart associated HPVs inhibit UVB induced cell death. • E6s of cancer and wart associated HPVs attenuate UVB induced proliferation arrest. • E6s of cancer and wart associated HPVs attenuate UVB induced apoptosis signaling

  10. Skin Complications

    Science.gov (United States)

    ... Text Size: A A A Listen En Español Skin Complications Diabetes can affect every part of the ... lipoidica diabeticorum, diabetic blisters, and eruptive xanthomatosis. General Skin Conditions Bacterial Infections Several kinds of bacterial infections ...

  11. Cryotherapy - skin

    Science.gov (United States)

    Cryosurgery - skin; Warts - freezing; Warts - cryotherapy; Actinic keratosis - cryotherapy; Solar keratosis - cryotherapy ... may be used to: Remove warts Destroy precancerous skin lesions (actinic keratoses or solar keratoses) In rare ...

  12. Skin Cancer

    Science.gov (United States)

    Skin cancer is the most common form of cancer in the United States. The two most common types ... face, neck, hands, and arms. Another type of skin cancer, melanoma, is more dangerous but less common. Anyone ...

  13. Sagging Skin

    Science.gov (United States)

    ... turkey neck,” this occurs as skin loses its elasticity and in cases where individuals have lost a ... technique or procedure is appropriate for my skin type? Did the doctor show me before-and-after ...

  14. Skin Biopsy

    Science.gov (United States)

    ... Development Infections Diseases & Conditions Pregnancy & Baby Nutrition & Fitness Emotions & Behavior School & Family Life First Aid & Safety Doctors & ... like these: skin rashes or conditions, such as eczema or psoriasis skin infections, such as staph diseases, ...

  15. Autonomous Propellant Loading Project

    Data.gov (United States)

    National Aeronautics and Space Administration — The AES Autonomous Propellant Loading (APL) project consists of three activities. The first is to develop software that will automatically control loading of...

  16. Autonomous Systems and Operations

    Data.gov (United States)

    National Aeronautics and Space Administration — The AES Autonomous Systems and Operations (ASO) project will develop an understanding of the impacts of increasing communication time delays on mission operations,...

  17. Skin Graft

    OpenAIRE

    Shimizu, Ruka; Kishi, Kazuo

    2012-01-01

    Skin graft is one of the most indispensable techniques in plastic surgery and dermatology. Skin grafts are used in a variety of clinical situations, such as traumatic wounds, defects after oncologic resection, burn reconstruction, scar contracture release, congenital skin deficiencies, hair restoration, vitiligo, and nipple-areola reconstruction. Skin grafts are generally avoided in the management of more complex wounds. Conditions with deep spaces and exposed bones normally require the use o...

  18. Skin Aging

    Science.gov (United States)

    Your skin changes as you age. You might notice wrinkles, age spots and dryness. Your skin also becomes thinner and loses fat, making it ... heal, too. Sunlight is a major cause of skin aging. You can protect yourself by staying out ...

  19. Anti-Inflammation Activities of Mycosporine-Like Amino Acids (MAAs) in Response to UV Radiation Suggest Potential Anti-Skin Aging Activity

    Science.gov (United States)

    Suh, Sung-Suk; Hwang, Jinik; Park, Mirye; Seo, Hyo Hyun; Kim, Hyoung-Shik; Lee, Jeong Hun; Moh, Sang Hyun; Lee, Taek-Kyun

    2014-01-01

    Certain photosynthetic marine organisms have evolved mechanisms to counteract UV-radiation by synthesizing UV-absorbing compounds, such as mycosporine-like amino acids (MAAs). In this study, MAAs were separated from the extracts of marine green alga Chlamydomonas hedleyi using HPLC and were identified as porphyra-334, shinorine, and mycosporine-glycine (mycosporine-Gly), based on their retention times and maximum absorption wavelengths. Furthermore, their structures were confirmed by triple quadrupole MS/MS. Their roles as UV-absorbing compounds were investigated in the human fibroblast cell line HaCaT by analyzing the expression levels of genes associated with antioxidant activity, inflammation, and skin aging in response to UV irradiation. The mycosporine-Gly extract, but not the other MAAs, had strong antioxidant activity in the 2,2-diphenyl-1-picryhydrazyl (DPPH) assay. Furthermore, treatment with mycosporine-Gly resulted in a significant decrease in COX-2 mRNA levels, which are typically increased in response to inflammation in the skin, in a concentration-dependent manner. Additionally, in the presence of MAAs, the UV-suppressed genes, procollagen C proteinase enhancer (PCOLCE) and elastin, which are related to skin aging, had increased expression levels equal to those in UV-mock treated cells. Interestingly, the increased expression of involucrin after UV exposure was suppressed by treatment with the MAAs mycosporine-Gly and shinorine, but not porphyra-334. This is the first report investigating the biological activities of microalgae-derived MAAs in human cells. PMID:25317535

  20. Differential responses of autonomic function in sea level residents, acclimatized lowlanders at >3500 m and Himalayan high altitude natives at >3500 m: A cross-sectional study.

    Science.gov (United States)

    Dhar, Priyanka; Sharma, Vijay K; Das, Saroj K; Barhwal, Kalpana; Hota, Sunil K; Singh, Shashi B

    2018-04-09

    We studied the differential responses of autonomic function in sea level residents (SLR), acclimatized lowlanders (ALH) in high altitude (HA) and HA natives (HAN) at >3500 m. Out of 771 male volunteers included in this cross-sectional study, SLR, ALH and HAN groups were comprised of 351, 307 and 113 volunteers, respectively. Our results showed persistent sympathetic dominance with significantly reduced (p < 0.05) parasympathetic response in ALH as compared to SLR and HAN populations. This may be attributed to significantly increased (p < 0.05) concentration of coronary risk factors and plasma catecholamines in ALH as compared to SLR and HAN. The ALH also showed significantly increased (p < 0.05) level of serum homocysteine as compared to SLR. The HAN exhibited no changes in autonomic function despite significantly elevated (p < 0.05) homocysteine level as compared to SLR. Our findings may have clinical relevance for assessment of susceptibility to cardiovascular risks in HA dwellers, native highlanders and patients with hypoxemia. Copyright © 2018 Elsevier B.V. All rights reserved.

  1. Autonomous quality assurance and troubleshooting

    Science.gov (United States)

    DuPlain, Ronald F.; Radziwill, Nicole M.; Shelton, Amy L.

    2006-06-01

    To improve operational availability (the proportion of time that a telescope is able to accomplish what a visiting observer wants at the time the observation is scheduled), response time to faults must be minimized. One way this can be accomplished is by characterizing the relationships and interdependencies between components in a control system, developing algorithms to identify the root cause of a problem, and capturing expert knowledge of a system to simplify the process of troubleshooting. Results from a prototype development are explained, along with deployment issues. Implications for the future, such as effective knowledge representation and management, and learning processes which integrate autonomous and interactive components, are discussed.

  2. Blood pressure regulation in diabetic autonomic neuropathy

    DEFF Research Database (Denmark)

    Hilsted, J

    1985-01-01

    Defective blood pressure responses to standing, exercise and epinephrine infusions have been demonstrated in diabetic patients with autonomic neuropathy. The circulatory mechanisms underlying blood pressure responses to exercise and standing up in these patients are well characterized: In both...... which may contribute to exercise hypotension in these patients. During hypoglycemia, blood pressure regulation seems intact in patients with autonomic neuropathy. This is probably due to release of substantial amounts of catecholamines during these experiments. During epinephrine infusions a substantial...... blood pressure fall ensues in patients with autonomic neuropathy, probably due to excessive muscular vasodilation. It is unresolved why blood pressure regulation is intact during hypoglycemia and severely impaired--at similar catecholamine concentrations--during epinephrine infusions....

  3. Acoustic Measures of Voice and Physiologic Measures of Autonomic Arousal during Speech as a Function of Cognitive Load.

    Science.gov (United States)

    MacPherson, Megan K; Abur, Defne; Stepp, Cara E

    2017-07-01

    This study aimed to determine the relationship among cognitive load condition and measures of autonomic arousal and voice production in healthy adults. A prospective study design was conducted. Sixteen healthy young adults (eight men, eight women) produced a sentence containing an embedded Stroop task in each of two cognitive load conditions: congruent and incongruent. In both conditions, participants said the font color of the color words instead of the word text. In the incongruent condition, font color differed from the word text, creating an increase in cognitive load relative to the congruent condition in which font color and word text matched. Three physiologic measures of autonomic arousal (pulse volume amplitude, pulse period, and skin conductance response amplitude) and four acoustic measures of voice (sound pressure level, fundamental frequency, cepstral peak prominence, and low-to-high spectral energy ratio) were analyzed for eight sentence productions in each cognitive load condition per participant. A logistic regression model was constructed to predict the cognitive load condition (congruent or incongruent) using subject as a categorical predictor and the three autonomic measures and four acoustic measures as continuous predictors. It revealed that skin conductance response amplitude, cepstral peak prominence, and low-to-high spectral energy ratio were significantly associated with cognitive load condition. During speech produced under increased cognitive load, healthy young adults show changes in physiologic markers of heightened autonomic arousal and acoustic measures of voice quality. Future work is necessary to examine these measures in older adults and individuals with voice disorders. Copyright © 2017 The Voice Foundation. Published by Elsevier Inc. All rights reserved.

  4. Adaptation of the dermal collagen structure of human skin and scar tissue in response to stretch: An experimental study

    NARCIS (Netherlands)

    Verhaegen, Pauline D.; Schouten, Hennie J.; Tigchelaar-Gutter, Wikky; van Marle, Jan; van Noorden, Cornelis J.; Middelkoop, Esther; van Zuijlen, Paul P.

    2012-01-01

    Surgeons are often faced with large defects that are difficult to close. Stretching adjacent skin can facilitate wound closure. In clinical practice, intraoperative stretching is performed in a cyclical or continuous fashion. However, exact mechanisms of tissue adaptation to stretch remain unclear.

  5. The static friction response of non-glabrous skin as a function of surface energy and environmental conditions

    NARCIS (Netherlands)

    Klaassen, Michel; de Vries, Erik G.; Masen, Marc Arthur

    2017-01-01

    The (local) environmental conditions have a significant effect on the interaction between skin and products. Plasticisation of the stratum corneum occurs at high humidity, causing this layer to soften and change its surface free energy. In this work we study the effects of the micro-climate on the

  6. Learner Behaviors and Perceptions of Autonomous Language Learning

    Science.gov (United States)

    Bekleyen, Nilüfer; Selimoglu, Figen

    2016-01-01

    The purpose of the present study was to investigate the learners' behaviors and perceptions about autonomous language learning at the university level in Turkey. It attempts to reveal what type of perceptions learners held regarding teachers' and their own responsibilities in the language learning process. Their autonomous language learning…

  7. Should autonomous agents be liable for what they do?

    NARCIS (Netherlands)

    Hage, Jaap; Keirse, A.; Loos, M.

    2017-01-01

    This article argues that it may be useful to sometimes hold autonomous agents, and not only their users, responsible for their acts. In this connection autonomous systems can be computer programs that interact with the outside world without human interference, including ‘intelligent’ weapons and

  8. Autonomic cardiac innervation

    Science.gov (United States)

    Hasan, Wohaib

    2013-01-01

    Autonomic cardiac neurons have a common origin in the neural crest but undergo distinct developmental differentiation as they mature toward their adult phenotype. Progenitor cells respond to repulsive cues during migration, followed by differentiation cues from paracrine sources that promote neurochemistry and differentiation. When autonomic axons start to innervate cardiac tissue, neurotrophic factors from vascular tissue are essential for maintenance of neurons before they reach their targets, upon which target-derived trophic factors take over final maturation, synaptic strength and postnatal survival. Although target-derived neurotrophins have a central role to play in development, alternative sources of neurotrophins may also modulate innervation. Both developing and adult sympathetic neurons express proNGF, and adult parasympathetic cardiac ganglion neurons also synthesize and release NGF. The physiological function of these “non-classical” cardiac sources of neurotrophins remains to be determined, especially in relation to autocrine/paracrine sustenance during development.   Cardiac autonomic nerves are closely spatially associated in cardiac plexuses, ganglia and pacemaker regions and so are sensitive to release of neurotransmitter, neuropeptides and trophic factors from adjacent nerves. As such, in many cardiac pathologies, it is an imbalance within the two arms of the autonomic system that is critical for disease progression. Although this crosstalk between sympathetic and parasympathetic nerves has been well established for adult nerves, it is unclear whether a degree of paracrine regulation occurs across the autonomic limbs during development. Aberrant nerve remodeling is a common occurrence in many adult cardiovascular pathologies, and the mechanisms regulating outgrowth or denervation are disparate. However, autonomic neurons display considerable plasticity in this regard with neurotrophins and inflammatory cytokines having a central regulatory

  9. Effects of locus coeruleus stimulation on the responses of SI neurons of the rat to controlled natural and electrical stimulation of the skin.

    Science.gov (United States)

    Snow, P J; Andre, P; Pompeiano, O

    1999-02-01

    1. The effects of microstimulation of the locus coeruleus (LC) region on the spontaneous discharge and the response of SI neurons to natural and electrical stimulation of the skin have been investigated in 26 urethane anesthetized Sprague-Dawley rats. In particular, one or two air puffs, 5-10 msec in duration, 1-2 psi, usually separated by an interval of 40 msec, were applied on the hairy skin of the wrist or the forepaw at the presentation rate of 1/sec. For units unresponsive to air puffs, similar presentation of low intensity electrical stimuli (0.2-5.0 V, 0.2-0.4 msec pulses) were applied through two needles inserted on the most effective area of the skin. Both natural and electrical stimulations of the skin were applied under control conditions, as well as 50 msec after a 250 msec train of 0.3 msec pulses at 40 Hz. 20-30 microA applied stereotaxically to the LC complex through a tungsten microelectrode. 2. Not all cortical units exhibited spontaneous discharge. Most of the units, however, which were spontaneously active, were inhibited by electrical stimulation of the LC complex, while the remaining ones were excited. The sites of stimulation, which included either the LC proper or the locus subcoeruleus, were identified following both anatomical and physiological criteria. 3. SI neurons recorded at sites between 400 and 950 microns below the surface of the cortex, thus being most likely granule cells of layers III and IV, responded to cutaneous stimuli with spikes which occurred with a latency of 20-30 msec in response to single air puffs and a latency of 15-20 msec in response to single electrical pulses to the skin. In both instances the response to the second stimulus applied at the interstimulus interval of 40 msec was markedly reduced or abolished due to postexcitatory inhibition following the response to the first stimulus (in-field inhibition). In contrast, units particularly located at or below 1000 microns from the cortical surface, which were of

  10. Influence of laser wavelength on the thermal responses of port wine stain lesions in light, moderate and heavy pigmented skin

    International Nuclear Information System (INIS)

    Li, D.; Chen, B.; Wu, W.J.; Ying, Z.X.

    2017-01-01

    Highlights: • Laser surgery for port wine stain (PWS) was studied by local non-equilibrium theory. • Wavelength selection in laser surgery under various skin pigmentation was explored. • High pigmented skin prefers to 585 nm rather then 595 nm. • Dual-wavelength laser (585/595 + 1064 nm) has better clinic effect than single one. • Deep buried blood vessels can be damaged by 595/1064 nm dual-wavelength laser. - Abstract: Pulsed dye laser (PDL) in visible band (e.g. 585 or 595 nm) together with cryogen spray cooling has become the golden standard for treatment of vascular malformation such as port wine stain (PWS). However, due to the limited energy penetration depth of the PDL, deeply buried blood vessels are likely to survive from the laser irradiation. Nd:YAG laser in near infrared (1064 nm) has great potential in the laser treatment of PWS due to its deeper penetration depth. In this study, the influence of laser wavelength in treating PWS lesions with various melanin concentrations in epidermis was theoretically investigated by a two-temperature model following the local thermal non-equilibrium theory of porous media. The results showed that deeply buried blood vessels can be coagulated by dual-wavelength laser combing 585 or 595 nm with 1064 nm laser. Furthermore, the therapeutic results by dual-wavelength laser were highly related to the melanin concentration in epidermis. In the light and moderate pigmented skin, the 595/1064 nm dual-wavelength laser showed better treatment effect in treating PWS with deeply-buried blood vessels than of 585/1064 nm dual-wavelength laser. For a high pigmented skin, the 585/1064 nm dual-wavelength laser showed better treatment effect than 595/1064 nm dual-wavelength laser.

  11. Regulatory T Cells in Chronic Graft-Versus-Host Disease After Extracorporeal Photopheresis: Correlation With Skin and Global Organ Responses, and Ability to Taper Steroids.

    Science.gov (United States)

    Denney, Helen A; Whittle, Robert J; Lai, Jennifer; Jacques, Richard M; Taylor, Peter C

    2017-01-01

    Induction of immune tolerance by an increase in regulatory T (Treg) cells after extracorporeal photopheresis (ECP) is thought to contribute to how ECP exerts its therapeutic effect in patients with chronic graft-versus-host disease (cGvHD). We investigated whether percentages and absolute counts of Treg cells changed post-ECP, and examined correlation with response. Absolute counts and % of CD4+ T cells and Treg cells (CD4 + CD25 + FOXP3 + CD127dim/-) were evaluated using flow cytometry in 32 patients with cGvHD treated by ECP for a minimum of 3 months, and up to 12 months. CD4+ or Treg cells at baseline to 12 months post-ECP were compared with changes in skin disease scores or global organ involvement, or the ability to taper steroids, at 14, 28, and 56 weeks. Regulatory T cells % increased significantly above any overall changes in CD4+ % at 6, 9, and 12 months post-ECP. There was no statistically significant association between Treg cells and skin or steroid response, whereas a larger increase in CD4+ count from baseline to 1 to 3 months corresponded to increased odds of being able to reduce steroid dose by 50% or greater at 14 weeks. Skin and global organ responders at 28 weeks had higher median Treg cell counts 3 months post-ECP than nonresponders, as did steroid responders at 56 weeks who were 12 months post-ECP. Regulatory T cell counts and % varied greatly among cGvHD patients, and the increase post-ECP was not significant until 6 months. No clear correlation was found between Treg cells and clinical improvement, suggesting that increases in Treg cell numbers and/or proportions are not driving the mechanism leading to a response after ECP.

  12. Autonomous system for launch vehicle range safety

    Science.gov (United States)

    Ferrell, Bob; Haley, Sam

    2001-02-01

    The Autonomous Flight Safety System (AFSS) is a launch vehicle subsystem whose ultimate goal is an autonomous capability to assure range safety (people and valuable resources), flight personnel safety, flight assets safety (recovery of valuable vehicles and cargo), and global coverage with a dramatic simplification of range infrastructure. The AFSS is capable of determining current vehicle position and predicting the impact point with respect to flight restriction zones. Additionally, it is able to discern whether or not the launch vehicle is an immediate threat to public safety, and initiate the appropriate range safety response. These features provide for a dramatic cost reduction in range operations and improved reliability of mission success. .

  13. Human skin wetness perception: psychophysical and neurophysiological bases

    Science.gov (United States)

    Filingeri, Davide; Havenith, George

    2015-01-01

    The ability to perceive thermal changes in the surrounding environment is critical for survival. However, sensing temperature is not the only factor among the cutaneous sensations to contribute to thermoregulatory responses in humans. Sensing skin wetness (i.e. hygrosensation) is also critical both for behavioral and autonomic adaptations. Although much has been done to define the biophysical role of skin wetness in contributing to thermal homeostasis, little is known on the neurophysiological mechanisms underpinning the ability to sense skin wetness. Humans are not provided with skin humidity receptors (i.e., hygroreceptors) and psychophysical studies have identified potential sensory cues (i.e. thermal and mechanosensory) which could contribute to sensing wetness. Recently, a neurophysiological model of human wetness sensitivity has been developed. In helping clarifying the peripheral and central neural mechanisms involved in sensing skin wetness, this model has provided evidence for the existence of a specific human hygrosensation strategy, which is underpinned by perceptual learning via sensory experience. Remarkably, this strategy seems to be shared by other hygroreceptor-lacking animals. However, questions remain on whether these sensory mechanisms are underpinned by specific neuromolecular pathways in humans. Although the first study on human wetness perception dates back to more than 100 years, it is surprising that the neurophysiological bases of such an important sensory feature have only recently started to be unveiled. Hence, to provide an overview of the current knowledge on human hygrosensation, along with potential directions for future research, this review will examine the psychophysical and neurophysiological bases of human skin wetness perception. PMID:27227008

  14. Nonlinear dynamics of skin blood flow response to mechanical and thermal stresses in the plantar foot of diabetics with peripheral neuropathy.

    Science.gov (United States)

    Liao, Fuyuan; Jan, Yih-Kuen

    2017-01-01

    Diabetic foot ulcers (DFU) are a major complication in diabetics. Impaired microvascular reactivity is a major contributor to the development of DFU and has been traditionally quantified by time-domain or frequency-domain measures of skin blood flow (SBF). These measures, however, are unable to characterize the changes of nonlinear dynamics of SBF associated with diabetes and peripheral neuropathy. The objective of this study was to investigate altered nonlinear dynamics of skin blood flow in the plantar foot of diabetics with peripheral neuropathy. 18 type 2 diabetics with peripheral neuropathy and 8 healthy controls were recruited. SBF at the first metatarsal head in response to a loading pressure of 300 mmHg and a local heating was measured using laser Doppler flowmetry. A sample entropy approach was used to quantify the degree of regularity of SBF. Our results showed that the regularity degree of SBF in the diabetic foot underwent only small changes during post-occlusive reactive hyperemia and thermally induced biphasic response compared to non-diabetics. SBF of the diabetic foot has higher degree of irregularity during reactive hyperemia because of attenuated myogenic activity, and demonstrated higher regularity during the biphasic response largely due to significantly enhanced cardiac activities. This study suggests that the regularity degree of SBF at the first metatarsal head could be used to assess impaired microvascular reactivity and thus may be used to assess the risk for DFU in diabetics with peripheralneuropathy.

  15. The differential response of the skin in young and old rats to a combination of X-rays and 'wet' or 'dry' hyperthermia

    International Nuclear Information System (INIS)

    Hamlet, R.; Hopewell, J.W.

    1986-01-01

    Hind feet of group of female rats aged 7, 14 and 52 weeks were X-irradiated at 20, 25 or 30 Gy. Hyperthermia (42.5 0 C for 1 h) was carried out immediately following irradiation using either 'wet' or 'dry' heat, by immersion in water or fluorocarbon liquid. Results demonstrated that 'wet' heat produced a consistently greater enhancement of the irradiation damage than 'dry'. The thermal enhancement ratio for irradiation plus 'wet' heat was approximately 1.5 and for irradiation plus 'dry' heat 1.17 to 1.39. Immersion of the feet in fluorocarbon liquid at 37 0 C did not significantly modify the irradiation response of the skin. The lower thermal enhancement ratios obtained using immersion in fluorocarbon liquid at 42.5 0 C are close to those obtained in large animal studies and similar to the limited amount of data from clinical studies where microwave or ultrasound heating techniques were used. It has been demonstrated that there are large age-related differences in the response of the rat foot skin to irradiation alone. It has also been shown, using rats of the same age, that the response to irradiation plus hyperthermia was less age dependent. (author)

  16. Differential response of the skin in young and old rats to a combination of X-rays and 'wet' or 'dry' hyperthermia

    Energy Technology Data Exchange (ETDEWEB)

    Hamlet, R.; Hopewell, J.W.

    1986-11-01

    Hind feet of group of female rats aged 7, 14 and 52 weeks were X-irradiated at 20, 25 or 30 Gy. Hyperthermia (42.5/sup 0/C for 1 h) was carried out immediately following irradiation using either 'wet' or 'dry' heat, by immersion in water or fluorocarbon liquid. Results demonstrated that 'wet' heat produced a consistently greater enhancement of the irradiation damage than 'dry'. The thermal enhancement ratio for irradiation plus 'wet' heat was approximately 1.5 and for irradiation plus 'dry' heat 1.17 to 1.39. Immersion of the feet in fluorocarbon liquid at 37/sup 0/C did not significantly modify the irradiation response of the skin. The lower thermal enhancement ratios obtained using immersion in fluorocarbon liquid at 42.5/sup 0/C are close to those obtained in large animal studies and similar to the limited amount of data from clinical studies where microwave or ultrasound heating techniques were used. It has been demonstrated that there are large age-related differences in the response of the rat foot skin to irradiation alone. It has also been shown, using rats of the same age, that the response to irradiation plus hyperthermia was less age dependent.

  17. Extraction of gelatin from salmon (Salmo salar) fish skin using trypsin-aided process: optimization by Plackett-Burman and response surface methodological approaches.

    Science.gov (United States)

    Fan, HuiYin; Dumont, Marie-Josée; Simpson, Benjamin K

    2017-11-01

    Gelatin from salmon ( Salmo salar ) skin with high molecular weight protein chains ( α -chains) was extracted using trypsin-aided process. Response surface methodology was used to optimise the extraction parameters. Yield, hydroxyproline content and protein electrophoretic profile via sodium dodecyl sulfate-polyacrylamide gel electrophoresis analysis of gelatin were used as responses in the optimization study. The optimum conditions were determined as: trypsin concentration at 1.49 U/g; extraction temperature at 45 °C; and extraction time at 6 h 16 min. This response surface optimized model was significant and produced an experimental value (202.04 ± 8.64%) in good agreement with the predicted value (204.19%). Twofold higher yields of gelatin with high molecular weight protein chains were achieved in the optimized process with trypsin treatment when compared to the process without trypsin.

  18. The role of variants from the innate immune system genes in tuberculosis and skin test response in a Native American population.

    Science.gov (United States)

    Lindenau, Juliana D; Salzano, Francisco M; Hurtado, Ana M; Hill, Kim R; Hutz, Mara H

    2016-10-01

    Native American populations show higher tuberculosis (TB) mortality and infectivity rates than non-Native populations. Variants in the innate immune system seem to have an important role on TB susceptibility. The role of some innate immune system variants in TB susceptibility and/or skin test response (PPD) were investigated in the Aché, a Native American population. Complement receptor 1 and toll like receptor 9 variants were associated with anergy to PPD and protection to TB, respectively. These findings demonstrate an important role of the innate immune system variants in TB susceptibility. Copyright © 2016 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  19. An Expert System for Autonomous Spacecraft Control

    Science.gov (United States)

    Sherwood, Rob; Chien, Steve; Tran, Daniel; Cichy, Benjamin; Castano, Rebecca; Davies, Ashley; Rabideau, Gregg

    2005-01-01

    The Autonomous Sciencecraft Experiment (ASE), part of the New Millennium Space Technology 6 Project, is flying onboard the Earth Orbiter 1 (EO-1) mission. The ASE software enables EO-1 to autonomously detect and respond to science events such as: volcanic activity, flooding, and water freeze/thaw. ASE uses classification algorithms to analyze imagery onboard to detect chang-e and science events. Detection of these events is then used to trigger follow-up imagery. Onboard mission planning software then develops a response plan that accounts for target visibility and operations constraints. This plan is then executed using a task execution system that can deal with run-time anomalies. In this paper we describe the autonomy flight software and how it enables a new paradigm of autonomous science and mission operations. We will also describe the current experiment status and future plans.

  20. Dry Skin Relief

    Science.gov (United States)

    ... on a budget Skin care products Skin care secrets Skin lighteners Skin of color Summer skin problems ... condition, such as eczema. Additional related information Dermatologists' top tips for relieving dry skin FIND A DERMATOLOGIST ...

  1. Overview of the Autonomic Nervous System

    Science.gov (United States)

    ... be reversible or progressive. Anatomy of the autonomic nervous system The autonomic nervous system is the part of ... organs they connect with. Function of the autonomic nervous system The autonomic nervous system controls internal body processes ...

  2. Autonomous Forest Fire Detection

    NARCIS (Netherlands)

    Breejen, E. den; Breuers, M.; Cremer, F.; Kemp, R.A.W.; Roos, M.; Schutte, K.; Vries, J.S. de

    1998-01-01

    Forest fire detection is a very important issue in the pre-suppression process. Timely detection allows the suppression units to reach the fire in its initial stages and this will reduce the suppression costs considerably. The autonomous forest fire detection principle is based on temporal contrast

  3. Experimental Autonomous Vehicle Systems

    DEFF Research Database (Denmark)

    Ravn, Ole; Andersen, Nils Axel

    1998-01-01

    The paper describes the requirements for and a prototype configuration of a software architecture for control of an experimental autonomous vehicle. The test bed nature of the system is emphasised in the choice of architecture making re-configurability, data logging and extendability simple...

  4. Towards autonomous vehicles.

    Science.gov (United States)

    2013-11-01

    We are moving towards an age of autonomous vehicles. Cycles of innovation initiated in the public and private sectors : have led one into another since the 1990s; and out of these efforts have sprung a variety of Advanced Driver Assistance : Systems ...

  5. ADAM: ADaptive Autonomous Machine

    NARCIS (Netherlands)

    van Oosten, Daan C.; Nijenhuis, Lucas F.J.; Bakkers, André; Vervoort, Wiek

    1996-01-01

    This paper describes a part of the development of an adaptive autonomous machine that is able to move in an unknown world extract knowledge out of the perceived data, has the possibility to reason, and finally has the capability to exchange experiences and knowledge with other agents. The agent is

  6. Skin cancer

    International Nuclear Information System (INIS)

    Yamada, Michiko

    1992-01-01

    This chapter reviews the development of skin cancer associated with radiation, focusing on the knowledge of A-bomb radiation-induced skin cancer. Since the discovery of X radiation in 1895, acute and chronic radiation dermatitis has been the first matter of concern. Then, in 1902, skin cancer found among radiological personnel has posed a social problem. In earlier study determining the relationship between skin cancer and A-bomb radiation, there is no increase in the incidence of either skin cancer or precancerous condition during the first 20 years after A-bombing. More recent studies have showed that there is a significant correlation between the incidence of skin cancer and distance from the hypocenter; and the incidence of skin cancer is found to be remarkably increased since 1975 in the group exposed at ≤2,000 m. Excess relative risk is 2.2 at one Gy dose. The incidence of skin cancer is also found to be extremely increased with aging. Relative risk is high in younger A-bomb survivors at the time of exposure. Histologically, basal cell carcinoma is more senstitive to ionizing radiation than squamous cell carcinoma. (N.K.)

  7. Menstrual cycle and skin reactivity

    DEFF Research Database (Denmark)

    Agner, T; Damm, P; Skouby, S O

    1991-01-01

    The hypothesis was tested that a cyclic variation exists in skin reactivity to irritant stimuli. Twenty-nine healthy women with regular menstrual cycles were challenged with sodium lauryl sulfate as an irritant patch test at day 1 and at days 9 through 11 of the menstrual cycle. The skin response...... to the applied irritant stimulus was evaluated by visual scoring and also quantified by measurements of transepidermal water loss, edema formation, and blood flow in the skin. The skin response to challenge with sodium lauryl sulfate was found to be significantly stronger at day 1 than at days 9 through 11...

  8. Web addiction in the brain: Cortical oscillations, autonomic activity, and behavioral measures.

    Science.gov (United States)

    Balconi, Michela; Campanella, Salvatore; Finocchiaro, Roberta

    2017-09-01

    Background and aims Internet addiction (IA) was recently defined as a disorder tagging both the impulse control and the reward systems. Specifically, inhibitory deficits and reward bias were considered highly relevant in IA. This research aims to examine the electrophysiological correlates and autonomic activity [skin conductance response (SCR) and heart rate] in two groups of young subjects (N = 25), with high or low IA profile [tested by the Internet Addiction Test (IAT)], with specific reference to gambling behavior. Methods Oscillatory brain activity (delta, theta, alpha, beta, and gamma) and autonomic and behavioral measures [response times (RTs) and error rates (ERs)] were acquired during the performance of a Go/NoGo task in response to high-rewarding (online gambling videos and video games) or neutral stimuli. Results A better performance (reduced ERs and reduced RTs) was revealed for high IAT in the case of NoGo trials representing rewarding cues (inhibitory control condition), probably due to a "gain effect" induced by the rewarding condition. In addition, we also observed for NoGo trials related to gambling and video games stimuli that (a) increased low-frequency band (delta and theta) and SCR and (b) a specific lateralization effect (more left-side activity) delta and theta in high IAT. Discussion Both inhibitory control deficits and reward bias effect were considered to explain IA.

  9. Exploring relationships for visceral and somatic pain with autonomic control and personality.

    Science.gov (United States)

    Paine, Peter; Kishor, Jessin; Worthen, Sian F; Gregory, Lloyd J; Aziz, Qasim

    2009-08-01

    The autonomic nervous system (ANS) integrates afferent and motor activity for homeostatic processes including pain. The aim of the study was to compare hitherto poorly characterised relations between brainstem autonomic control and personality in response to visceral and somatic pain. Eighteen healthy subjects (16 females, mean age 34) had recordings during rest and pain of heart rate (HR), cardiac vagal tone (CVT), cardiac sensitivity to baroreflex (CSB), skin conductance level (SC), cardiac sympathetic index (CSI) and mean blood pressure (MBP). Visceral pain was induced by balloon distension in proximal (PB) and distal (DB) oesophagus and somatic pain by nail-bed pressure (NBP). Eight painful stimuli were delivered at each site and unpleasantness and intensity measured. Personality was profiled with the Big Five inventory. (1) Oesophageal intubation evoked "fight-flight" responses: HR and sympathetic (CSI, SC, MBP) elevation with parasympathetic (CVT) withdrawal (pintrovert subjects had greater positive pain-related CVT slope change (neuroticism r 0.8, p<0.05; extroversion r -0.5, p<0.05). Pain-evoked heart rate increases were mediated by parasympathetic and sympathetic co-activation - a novel finding in humans but recently described in mammals too. Visceral pain-related parasympathetic change correlated with personality. ANS defence responses are nuanced and may relate to personality type for visceral pain. Clinical relevance of these findings warrants further exploration.

  10. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  11. Anti-Inflammation Activities of Mycosporine-Like Amino Acids (MAAs in Response to UV Radiation Suggest Potential Anti-Skin Aging Activity

    Directory of Open Access Journals (Sweden)

    Sung-Suk Suh

    2014-10-01

    Full Text Available Certain photosynthetic marine organisms have evolved mechanisms to counteract UV-radiation by synthesizing UV-absorbing compounds, such as mycosporine-like amino acids (MAAs. In this study, MAAs were separated from the extracts of marine green alga Chlamydomonas hedleyi using HPLC and were identified as porphyra-334, shinorine, and mycosporine-glycine (mycosporine-Gly, based on their retention times and maximum absorption wavelengths. Furthermore, their structures were confirmed by triple quadrupole MS/MS. Their roles as UV-absorbing compounds were investigated in the human fibroblast cell line HaCaT by analyzing the expression levels of genes associated with antioxidant activity, inflammation, and skin aging in response to UV irradiation. The mycosporine-Gly extract, but not the other MAAs, had strong antioxidant activity in the 2,2-diphenyl-1-picryhydrazyl (DPPH assay. Furthermore, treatment with mycosporine-Gly resulted in a significant decrease in COX-2 mRNA levels, which are typically increased in response to inflammation in the skin, in a concentration-dependent manner. Additionally, in the presence of MAAs, the UV-suppressed genes, procollagen C proteinase enhancer (PCOLCE and elastin, which are related to skin aging, had increased expression levels equal to those in UV-mock treated cells. Interestingly, the increased expression of involucrin after UV exposure was suppressed by treatment with the MAAs mycosporine-Gly and shinorine, but not porphyra-334. This is the first report investigating the biological activities of microalgae-derived MAAs in human cells.

  12. Self-Organizing and Autonomous Learning Agents and Systems

    National Research Council Canada - National Science Library

    Shen, Wei-Min

    2004-01-01

    ...) Autonomous discovery and response to unexpected topology changes; (2) A new distributed functional language called DH2 for programming of self-reconfigurable systems using hormone-inspired computational methods...

  13. Autonomous Real Time Requirements Tracing

    Science.gov (United States)

    Plattsmier, George; Stetson, Howard

    2014-01-01

    One of the more challenging aspects of software development is the ability to verify and validate the functional software requirements dictated by the Software Requirements Specification (SRS) and the Software Detail Design (SDD). Insuring the software has achieved the intended requirements is the responsibility of the Software Quality team and the Software Test team. The utilization of Timeliner-TLX(sup TM) Auto- Procedures for relocating ground operations positions to ISS automated on-board operations has begun the transition that would be required for manned deep space missions with minimal crew requirements. This transition also moves the auto-procedures from the procedure realm into the flight software arena and as such the operational requirements and testing will be more structured and rigorous. The autoprocedures would be required to meet NASA software standards as specified in the Software Safety Standard (NASASTD- 8719), the Software Engineering Requirements (NPR 7150), the Software Assurance Standard (NASA-STD-8739) and also the Human Rating Requirements (NPR-8705). The Autonomous Fluid Transfer System (AFTS) test-bed utilizes the Timeliner-TLX(sup TM) Language for development of autonomous command and control software. The Timeliner-TLX(sup TM) system has the unique feature of providing the current line of the statement in execution during real-time execution of the software. The feature of execution line number internal reporting unlocks the capability of monitoring the execution autonomously by use of a companion Timeliner-TLX(sup TM) sequence as the line number reporting is embedded inside the Timeliner-TLX(sup TM) execution engine. This negates I/O processing of this type data as the line number status of executing sequences is built-in as a function reference. This paper will outline the design and capabilities of the AFTS Autonomous Requirements Tracker, which traces and logs SRS requirements as they are being met during real-time execution of the

  14. Delayed-type hypersensitivity skin test responses to PPD and other antigens among BCG-vaccinated HIV-1-infected and healthy children and adolescents.

    Science.gov (United States)

    Costa, Natalia Moriya Xavierda; Albuquerque, Maly de; Lins, Janaína Bacelar Acioli; Alvares-Junior, João Teixeira; Stefani, Mariane Martins de Araújo

    2011-10-01

    Among HIV-1-infected patients, CD4+ T cell counts are well-established markers of cell-mediated immunity. Delayed-type hypersensitivity (DTH) skin tests can be used to evaluate in vivo cell-mediated immunity to common antigens. DTH responses to tuberculin purified protein derivative (PPD), sporotrichin, trichophytin, candidin and streptokinase/streptodornase antigens were assessed. Thirty-six HIV-1-infected children/adolescents and 56 age- and sex-matched HIV-1/HIV-2-seronegative participants were tested. All participants had a BCG scar. Fisher's exact test was used to evaluate significant differences between groups (pPPD positivity prevailed among healthy participants (40/56, 71.4%). PPD reactivity in the HIV-1-positive group was 8.3% (pPPD induration was 2.5mm (range: 2-5mm) in the HIV-1 group and 6.0 mm among healthy participants (range: 3-15 mm). There was no correlation between PPD positivity and age. No correlation between CD4+ T cell counts and DTH reactivity was observed among HIV-1-infected patients. DTH skin test responses, including PPD reactivity, were significantly lower among HIV-1-infected participants compared to healthy controls, which likely reflects advanced disease and T cell depletion.

  15. Detection of pathogenic bacteria in skin lesions of patients with chiclero's ulcer: reluctant response to antimonial treatment

    Directory of Open Access Journals (Sweden)

    Isaac-Márquez Angélica Patricia

    2003-01-01

    Full Text Available We investigated the bacterial flora present in skin lesions of patients with chiclero's ulcer from the Yucatan peninsula of Mexico using conventional culture methods (11 patients, and an immunocolorimetric detection of pathogenic Streptococcus pyogenes (15 patients. Prevalence of bacteria isolated by culture methods was 90.9% (10/11. We cultured, from chiclero's ulcers (60%, pathogenic bacterial such as Staphylococcus aureus (20%, S. pyogenes (1.6%, Pseudomonas aeruginosa (1.6%, Morganella morganii (1.6%, and opportunist pathogenic bacteria such as Klebsiella spp. (20.0%, Enterobacter spp. (20%, and Enterococcus spp. (20%. We also cultured coagulase-negative staphylococci in 40% (4/10 of the remaining patients. Micrococcus spp. and coagulase-negative staphylococci constituted the bacterial genuses more frequently isolated in the normal skin of patients with chiclero's ulcer and healthy individuals used as controls. We also undertook another study to find out the presence of S. pyogenes by an immunocolorimetric assay. This study indicated that 60% (9/15 of the ulcerated lesions, but not normal controls, were contaminated with S. pyogenes. Importantly, individuals with purulent secretion and holding concomitant infections with S. pyogenes, S. aureus, P. aeruginosa, M. morganii, and E. durans took longer to heal Leishmania (L. mexicana infections treated with antimonial drugs. Our results suggest the need to eliminate bacterial purulent infections, by antibiotic treatment, before starting antimonial administration to patients with chiclero's ulcer.

  16. Synthetic antimicrobial and LPS-neutralising peptides suppress inflammatory and immune responses in skin cells and promote keratinocyte migration.

    Science.gov (United States)

    Pfalzgraff, Anja; Heinbockel, Lena; Su, Qi; Gutsmann, Thomas; Brandenburg, Klaus; Weindl, Günther

    2016-08-11

    The stagnation in the development of new antibiotics and the concomitant high increase of resistant bacteria emphasize the urgent need for new therapeutic options. Antimicrobial peptides are promising agents for the treatment of bacterial infections and recent studies indicate that Pep19-2.5, a synthetic anti-lipopolysaccharide (LPS) peptide (SALP), efficiently neutralises pathogenicity factors of Gram-negative (LPS) and Gram-positive (lipoprotein/-peptide, LP) bacteria and protects against sepsis. Here, we investigated the potential of Pep19-2.5 and the structurally related compound Pep19-4LF for their therapeutic application in bacterial skin infections. SALPs inhibited LP-induced phosphorylation of NF-κB p65 and p38 MAPK and reduced cytokine release and gene expression in primary human keratinocytes and dermal fibroblasts. In LPS-stimulated human monocyte-derived dendritic cells and Langerhans-like cells, the peptides blocked IL-6 secretion, downregulated expression of maturation markers and inhibited dendritic cell migration. Both SALPs showed a low cytotoxicity in all investigated cell types. Furthermore, SALPs markedly promoted cell migration via EGFR transactivation and ERK1/2 phosphorylation and accelerated artificial wound closure in keratinocytes. Peptide-induced keratinocyte migration was mediated by purinergic receptors and metalloproteases. In contrast, SALPs did not affect proliferation of keratinocytes. Conclusively, our data suggest a novel therapeutic target for the treatment of patients with acute and chronic skin infections.

  17. Biologic activities of molecular chaperones and pharmacologic chaperone imidazole-containing dipeptide-based compounds: natural skin care help and the ultimate challenge: implication for adaptive responses in the skin.

    Science.gov (United States)

    Babizhayev, Mark A; Nikolayev, Gennady M; Nikolayeva, Juliana G; Yegorov, Yegor E

    2012-03-01

    Accumulation of molecular damage and increased molecular heterogeneity are hallmarks of photoaged skin and pathogenesis of human cutaneous disease. Growing evidence demonstrates the ability of molecular chaperone proteins and of pharmacologic chaperones to decrease the environmental stress and ameliorate the oxidation stress-related and glycation disease phenotypes, suggesting that the field of chaperone therapy might hold novel treatments for skin diseases and aging. In this review, we examine the evidence suggesting a role for molecular chaperone proteins in the skin and their inducer and protecting agents: pharmacologic chaperone imidazole dipeptide-based agents (carcinine and related compounds) in cosmetics and dermatology. Furthermore, we discuss the use of chaperone therapy for the treatment of skin photoaging diseases and other skin pathologies that have a component of increased glycation and/or free radical-induced oxidation in their genesis. We examine biologic activities of molecular and pharmacologic chaperones, including strategies for identifying potential chaperone compounds and for experimentally demonstrating chaperone activity in in vitro and in vivo models of human skin disease. This allows the protein to function and traffic to the appropriate location in the skin, thereby increasing protein activity and cellular function and reducing stress on skin cells. The benefits of imidazole dipeptide antioxidants with transglycating activity (such as carcinine) in skin care are that they help protect and repair cell membrane damage and help retain youthful, younger-looking skin. All skin types will benefit from daily, topical application of pharmacologic chaperone antioxidants, anti-irritants, in combination with water-binding protein agents that work to mimic the structure and function of healthy skin. General strategies are presented addressing ground techniques to improve absorption of usually active chaperone proteins and dipeptide compounds, include

  18. Oxidative stress drives CD8+ T-cell skin trafficking in patients with vitiligo through CXCL16 upregulation by activating the unfolded protein response in keratinocytes.

    Science.gov (United States)

    Li, Shuli; Zhu, Guannan; Yang, Yuqi; Jian, Zhe; Guo, Sen; Dai, Wei; Shi, Qiong; Ge, Rui; Ma, Jingjing; Liu, Ling; Li, Kai; Luan, Qi; Wang, Gang; Gao, Tianwen; Li, Chunying

    2017-07-01

    In patients with vitiligo, an increased reactive oxygen species (ROS) level has been proved to be a key player during disease initiation and progression in melanocytes. Nevertheless, little is known about the effects of ROS on other cells involved in the aberrant microenvironment, such as keratinocytes and the following immune events. CXCL16 is constitutively expressed in keratinocytes and was recently found to mediate homing of CD8 + T cells in human skin. We sought to explicate the effect of oxidative stress on human keratinocytes and its capacity to drive CD8 + T-cell trafficking through CXCL16 regulation. We first detected putative T-cell skin-homing chemokines and ROS in serum and lesions of patients with vitiligo. The production of candidate chemokines was detected by using quantitative real-time PCR and ELISA in keratinocytes exposed to H 2 O 2 . Furthermore, the involved mediators were analyzed by using quantitative real-time PCR, Western blotting, ELISA, and immunofluorescence. Next, we tested the chemotactic migration of CD8 + T cells from patients with vitiligo mediated by the CXCL16-CXCR6 pair using the transwell assay. CXCL16 expression increased and showed a positive correlation with oxidative stress levels in serum and lesions of patients with vitiligo. The H 2 O 2 -induced CXCL16 expression was due to the activation of 2 unfolded protein response pathways: kinase RNA (PKR)-like ER kinase-eukaryotic initiation factor 2α and inositol-requiring enzyme 1α-X-box binding protein 1. CXCL16 produced by stressed keratinocytes induced migration of CXCR6 + CD8 + T cells derived from patients with vitiligo. CXCR6 + CD8 + T-cell skin infiltration is accompanied by melanocyte loss in lesions of patients with vitiligo. Our study demonstrated that CXCL16-CXCR6 mediates CD8 + T-cell skin trafficking under oxidative stress in patients with vitiligo. The CXCL16 expression in human keratinocytes induced by ROS is, at least in part, caused by unfolded protein response

  19. Pseudomonas aeruginosa biofilm aggravates skin inflammatory response in BALB/c mice in a novel chronic wound model

    DEFF Research Database (Denmark)

    Trøstrup, Hannah; Thomsen, Kim; Christophersen, Lars J

    2013-01-01

    model in C3H/HeN and BALB/c mice. The chronic wound was established by an injection of seaweed alginate-embedded P. aeruginosa PAO1 beneath a third-degree thermal lesion providing full thickness skin necrosis, as in human chronic wounds. Cultures revealed growth of PA, and both alginate with or without......Chronic wounds are presumed to persist in the inflammatory state, preventing healing. Emerging evidence indicates a clinical impact of bacterial biofilms in soft tissues, including Pseudomonas aeruginosa (PA) biofilms. To further investigate this, we developed a chronic PA biofilm wound infection...... bacteria organized in clusters, resembling biofilms, and inflammation located adjacent to the PA. The chronic wound infection showed a higher number of PAO1 in the BALB/c mice at day 4 after infection as compared to C3H/HeN mice (p

  20. Complete electric dipole response in 120Sn and 208Pb and implications for neutron skin and symmetry energy

    International Nuclear Information System (INIS)

    Von Neumann-Cosel, Peter

    2015-01-01

    Polarized proton scattering at energies of a few 100 MeV and very forward angles including 0° has been established as a new tool to extract the complete E1 strength distribution in nuclei for excitation energies between about 5 and 20 MeV. A case study of 208 Pb demonstrates excellent agreement with other electromagnetic probes. From the information on the B(E1) strength one can derive the electric dipole dipole polarizability, which is strongly correlated to the neutron skin and to parameters of the symmetry energy. Recently, we have extracted the polarizability of 120 Sn with a comparable precision. The combination of both results further constrains the symmetry energy parameters and presents a challenge for mean-field models, since relativistic and many Skyrme parameterizations cannot reproduce both experimental results simultaneously. (paper)

  1. Effect of Sleep/Wake Cycle on Autonomic Regulation

    International Nuclear Information System (INIS)

    Jabeen, S.

    2015-01-01

    Objective: To evaluate the association between irregular sleep/wake cycle in shift workers and autonomic regulation. Study Design: Cross-sectional, analytical study. Place and Duration of Study: Dow University Hospital, Karachi, from August to November 2013. Methodology: All health care providers working in rotating shifts making a total (n=104) were included. Instrument was an integrated questionnaire applied to assess autonomic regulation, taken from Kroz et al. on scoring criteria, ranging from 18 - 54, where higher rating signifies strong autonomic regulation, indicating a stable Autonomic Nervous System (ANS) and vice versa. Participants were interviewed and their response was recorded by the investigator. Influence of sleep misalignment was measured quantitatively to extract index of autonomic activity. Results: There was a reduced trend in autonomic strength amongst shift workers. The mean score obtained on the Autonomic Scale was 37.8 ± 5.9. Conclusion: Circadian misalignment has an injurious influence on ANS which might be valuable in controlling autonomic dysfunction that leads to fatal triggers in rotating shift workers. (author)

  2. Comparison of three techniques for evaluating skin erythemal response for determination of sun protection factors of sunscreens: high resolution laser Doppler imaging, colorimetry and visual scoring.

    Science.gov (United States)

    Wilhelm, K P; Kaspar, K; Funkel, O

    2001-04-01

    Sun protection factor (SPF) measurement is based on the determination of the minimal erythema dose (MED). The ratio of doses required to induce a minimal erythema between product-treated and untreated skin is defined as SPF. The aim of this study was to validate the conventionally used visual scoring with two non-invasive methods: high resolution laser Doppler imaging (HR-LDI) and colorimetry. Another goal was to check whether suberythemal reactions could be detected by means of HR-LDI measurements. Four sunscreens were selected. The measurements were made on the back of 10 subjects. A solar simulator SU 5000 (m.u.t., Wedel, Germany) served as radiation source. For the visual assessment, the erythema was defined according to COLIPA as the first perceptible, clearly defined unambiguous redness of the skin. For the colorimetric determination of the erythema, a Chromameter CR 300 (Minolta, Osaka, Japan) was used. The threshold for the colorimetry was chosen according to the COLIPA recommendation as an increase of the redness parameter delta a* = 2.5. For the non-contact perfusion measurements of skin blood flow, a two-dimensional high resolution laser Doppler imager (HR-LDI) (Lisca, Linköping, Sweden) was used. For the HR-LDI measurements, an optimal threshold perfusion needed to be established. For the HR-LDI measurements basal perfusion +1 standard deviation of all basal measurements was found to be a reliable threshold perfusion corresponding to the minimal erythema. Smaller thresholds, which would be necessary for detection of suberythemal responses, did not provide unambiguous data. All three methods, visual scoring, colorimetry and HR-LDI, produced similar SPFs for the test products with a variability of colorimetry are suitable, reliable and observer-independent methods for MED determination. However, they do not provide greater sensitivity and thus do not result in lower UV dose requirements for testing.

  3. Assessing complexity of skin blood flow oscillations in response to locally applied heating and pressure in rats: Implications for pressure ulcer risk

    Science.gov (United States)

    Liao, Fuyuan; O'Brien, William D.; Jan, Yih-Kuen

    2013-10-01

    The objective of this study was to investigate the effects of local heating on the complexity of skin blood flow oscillations (BFO) under prolonged surface pressure in rats. Eleven Sprague-Dawley rats were studied: 7 rats underwent surface pressure with local heating (△t=10 °C) and 4 rats underwent pressure without heating. A pressure of 700 mmHg was applied to the right trochanter area of rats for 3 h. Skin blood flow was measured using laser Doppler flowmetry. The loading period was divided into nonoverlapping 30 min epochs. For each epoch, multifractal detrended fluctuation analysis (MDFA) was utilized to compute DFA coefficients and complexity of endothelial related metabolic, neurogenic, and myogenic frequencies of BFO. The results showed that under surface pressure, local heating led to a significant decrease in DFA coefficients of myogenic frequency during the initial epoch of loading period, a sustained decrease in complexity of myogenic frequency, and a significantly higher degree of complexity of metabolic frequency during the later phase of loading period. Surrogate tests showed that the reduction in complexity of myogenic frequency was associated with a loss of nonlinearity whereas increased complexity of metabolic frequency was associated with enhanced nonlinearity. Our results indicate that increased metabolic activity and decreased myogenic response due to local heating manifest themselves not only in magnitudes of metabolic and myogenic frequencies but also in their structural complexity. This study demonstrates the feasibility of using complexity analysis of BFO to monitor the ischemic status of weight-bearing skin and risk of pressure ulcers.

  4. Enhanced brain responses to C-fiber input in the area of secondary hyperalgesia induced by high-frequency electrical stimulation of the skin.

    Science.gov (United States)

    van den Broeke, Emanuel N; Mouraux, André

    2014-11-01

    High-frequency electrical stimulation (HFS) of the human skin induces an increase in both mechanical and heat pain sensitivity in the surrounding unconditioned skin. The aim of this study was to investigate the effect of HFS on the intensity of perception and brain responses elicited by the selective activation of C fibers. HFS was applied to the ventral forearm of 15 healthy volunteers. Temperature-controlled CO2 laser stimulation was used to activate selectively low-threshold C-fiber afferents without concomitantly activating Aδ-fiber afferents. These stimuli were detected with reaction times compatible with the conduction velocity of C fibers. The intensity of perception and event-related brain potentials (ERPs) elicited by thermal stimuli delivered to the surrounding unconditioned skin were recorded before (T0) and after HFS (T1: 20 min after HFS; T2: 45 min after HFS). The contralateral forearm served as a control. Mechanical hyperalgesia following HFS was confirmed by measuring the change in the intensity of perception elicited by mechanical punctate stimuli. HFS resulted in increased intensity of perception to mechanical punctate stimulation and selective C-fiber thermal stimulation at both time points. In contrast, the N2 wave of the ERP elicited by C-fiber stimulation (679 ± 88 ms; means ± SD) was enhanced at T1 but not at T2. The P2 wave (808 ± 105 ms) was unaffected by HFS. Our results suggest that HFS enhances the sensitivity to thermal C-fiber input in the area of secondary hyperalgesia. However, there was no significant enhancement of the magnitude of the C-fiber ERPs at T2, suggesting that quickly adapting C fibers do not contribute to this enhancement. Copyright © 2014 the American Physiological Society.

  5. Correlation between cardiac autonomic modulation in response to orthostatic stress and indicators of quality of life, physical capacity, and physical activity in healthy individuals.

    Science.gov (United States)

    Gonçalves, Thiago R; Farinatti, Paulo de Tarso Veras; Gurgel, Jonas L; da Silva Soares, Pedro P

    2015-05-01

    Increased heart rate variability (HRV) at rest is frequently associated to maximal oxygen uptake (VO2max), physical activity, and markers of quality of life (QoL). However, the HRV has not been observed during physical exercise or orthostatic (ORT) challenge. This study investigated the associations of HRV changes (ΔHRV) from rest at supine (SUP) to ORT positions with (VO2max), physical activity level, and QoL in young a