WorldWideScience

Sample records for autonomic skin responses

  1. Autonomic skin responses in females with Fabry disease

    DEFF Research Database (Denmark)

    Møller, Anette Torvin; Bach, Flemming W.; Feldt-Rasmussen, Ulla;

    2009-01-01

    Fabry disease is a genetic lysosomal disorder with dysfunction of the lysosomal enzyme alpha-galactosidase A causing accumulation of glycolipids in multiple organs including the nervous system and with neuropathy as a prominent manifestation. Neurological symptoms include pain and autonomic dysfu...... response to iontophoresis of acetylcholine (p = 0.04) and a smaller capsaicin-induced flare compared to controls. These findings suggest that female patients both have an impaired C-fiber function and local abnormalities in blood vessels and sweat glands......., and the cold pressor test; and (3) cutaneous blood flow following capsaicin. The vasoconstrictor response to inspiratory gasp was increased in Fabry patients compared to controls (p = 0.03), while the response to cold and mental stress did not change. Female patients with Fabry disease had a reduced sweat...... dysfunction. This study examined peripheral autonomic nerve function in 19 female patients with Fabry disease and 19 sex and age-matched controls by measuring (1) sweat production following acetylcholine challenge; (2) the sympathetically mediated vasoconstrictor responses to inspiratory gasp, stress...

  2. Sympathetic skin response: simple test for evaluation of autonomic function in patients with diabetes mellitus?

    Institute of Scientific and Technical Information of China (English)

    Srinivasa Jayachandra; Maxim Pinto; Urban J. A. D'Souza

    2005-01-01

    @@ To the Editor: We read with interest the excellent article by Huang YN et al.1 This important and carefully conducted study illustrates the sympathetic skin response (SSR) test can detect early dysfunction of the small sympathetic fibers in people affected by diabetes mellitus.

  3. The sensory channel of presentation alters subjective ratings and autonomic responses towards disgusting stimuli -Blood pressure, heart rate and skin conductance in response to visual, auditory, haptic and olfactory presented disgusting stimuli-

    Directory of Open Access Journals (Sweden)

    Ilona eCroy

    2013-09-01

    Full Text Available Disgust causes specific reaction patterns, observable in mimic responses and body reactions. Most research on disgust deals with visual stimuli. However, pictures may cause another disgust experience than sounds, odors or tactile stimuli. Therefore disgust experience evoked by four different sensory channels was compared.A total of 119 participants received 3 different disgusting and one control stimulus, each presented through the visual, auditory, tactile and olfactory channel. Ratings of evoked disgust as well as responses of the autonomic nervous system (heart rate, skin conductance level, systolic blood pressure were recorded and the effect of stimulus labeling and of repeated presentation was analyzed. Ratings suggested that disgust could be evoked through all senses; they were highest for visual stimuli. However, autonomic reaction towards disgusting stimuli differed according to the channel of presentation. In contrast to the other, olfactory disgust stimuli provoked a strong decrease of systolic blood pressure. Additionally, labeling enhanced disgust ratings and autonomic reaction for olfactory and tactile, but not for visual and auditory stimuli. Repeated presentation indicated that participant’s disgust rating diminishes to all but olfactory disgust stimuli. Taken together we argue that the sensory channel through which a disgust reaction is evoked matters.

  4. Autonomic responses to suggestions for cold and warmth in hypnosis.

    Science.gov (United States)

    Kistler, A; Mariauzouls, C; Wyler, F; Bircher, A J; Wyler-Harper, J

    1999-02-01

    The goal of the present study was to investigate whether suggestions for cold or warmth during hypnosis affect fingertip skin temperature. Hypnosis without specific suggestions for cold or warmth ('neutral hypnosis') caused a drop in respiration frequency, however, pulse rate, fingertip skin temperature, and electrodermal activity were not affected. The cold and warmth suggestions decreased and increased fingertip skin temperature, respectively. Compared with the neutral trance phase, the other three autonomic variables measured were also affected by suggestions for cold. However, there was no association between the changes in autonomic variables induced by suggestions and hypnotizability scores measured by the 'Stanford Hypnotic Clinical Scale for Adults'. Fingertip skin temperature was mostly affected when the images used for the cold and warmth suggestions during hypnosis included experiences of physical temperature and psychological stress or relaxation, indicating that the psychological content of the imagery amplified the autonomic response.

  5. Human Skin Hypoxia Modulates Cerebrovascular and Autonomic Functions

    OpenAIRE

    Olivia Pucci; Clifford Qualls; Anne Battisti-Charbonney; Balaban, Dahlia Y.; Fisher, Joe A.; Jim Duffin; Otto Appenzeller

    2012-01-01

    Because the skin is an oxygen sensor in amphibians and mice, we thought to confirm this function also in humans. The human upright posture, however, introduces additional functional demands for the maintenance of oxygen homeostasis in which cerebral blood flow and autonomic nervous system (ANS) function may also be involved. We examined nine males and three females. While subjects were breathing ambient air, at sea level, we changed gases in a plastic body-bag during two conditions of the exp...

  6. Framing the ultimatum game: gender differences and autonomic responses.

    Science.gov (United States)

    Sarlo, Michela; Lotto, Lorella; Palomba, Daniela; Scozzari, Simona; Rumiati, Rino

    2013-01-01

    The present study aimed at investigating whether the way offers are framed in the Ultimatum Game (UG) affects behavioral and autonomic responses in men and women. The "I give you" and "I take" expressions were used as gain and loss frames, respectively. Skin conductance and heart rate were recorded as indices of autonomic activation in response to unfair, mid-value, and fair offers. Acceptance rates were higher in men than in women under the gain frame. Moreover, men showed higher acceptance rates under the gain than under the loss frame with mid-value offers, whereas women's choices were not affected by frame. On the physiological level, men produced differential autonomic response patterns during decision-making when offers were presented under gain and loss framing. The "I take" frame, by acting as a loss frame, elicited in men the characteristic defensive response pattern that is evoked by aversive stimulation, in which increases in skin conductance are coupled with increases in heart rate. On the other hand, the "I give you" frame, by acting as a gain frame, elicited in men increases in skin conductance associated with prevailing heart rate deceleratory responses, reflecting a state of enhanced attention and orienting. In contrast, women's autonomic reactivity was not affected by frame, consistent with behavioral results. Phasic changes in heart rate were crucial in revealing differential functional significance of skin conductance responses under different frames in men, thus questioning the assumption that this autonomic measure can be used as an index of negative emotional arousal in the UG. PMID:22494303

  7. Human skin hypoxia modulates cerebrovascular and autonomic functions.

    Directory of Open Access Journals (Sweden)

    Olivia Pucci

    Full Text Available Because the skin is an oxygen sensor in amphibians and mice, we thought to confirm this function also in humans. The human upright posture, however, introduces additional functional demands for the maintenance of oxygen homeostasis in which cerebral blood flow and autonomic nervous system (ANS function may also be involved. We examined nine males and three females. While subjects were breathing ambient air, at sea level, we changed gases in a plastic body-bag during two conditions of the experiment such as to induce skin hypoxia (with pure nitrogen or skin normoxia (with air. The subjects performed a test of hypoxic ventilatory drive during each condition of the experiment. We found no differences in the hypoxic ventilatory drive tests. However, ANS function and cerebral blood flow velocities were modulated by skin hypoxia and the effect was significantly greater on the left than right middle cerebral arteries. We conclude that skin hypoxia modulates ANS function and cerebral blood flow velocities and this might impact life styles and tolerance to ambient hypoxia at altitude. Thus the skin in normal humans, in addition to its numerous other functions, is also an oxygen sensor.

  8. Human skin hypoxia modulates cerebrovascular and autonomic functions.

    Science.gov (United States)

    Pucci, Olivia; Qualls, Clifford; Battisti-Charbonney, Anne; Balaban, Dahlia Y; Fisher, Joe A; Duffin, Jim; Appenzeller, Otto

    2012-01-01

    Because the skin is an oxygen sensor in amphibians and mice, we thought to confirm this function also in humans. The human upright posture, however, introduces additional functional demands for the maintenance of oxygen homeostasis in which cerebral blood flow and autonomic nervous system (ANS) function may also be involved. We examined nine males and three females. While subjects were breathing ambient air, at sea level, we changed gases in a plastic body-bag during two conditions of the experiment such as to induce skin hypoxia (with pure nitrogen) or skin normoxia (with air). The subjects performed a test of hypoxic ventilatory drive during each condition of the experiment. We found no differences in the hypoxic ventilatory drive tests. However, ANS function and cerebral blood flow velocities were modulated by skin hypoxia and the effect was significantly greater on the left than right middle cerebral arteries. We conclude that skin hypoxia modulates ANS function and cerebral blood flow velocities and this might impact life styles and tolerance to ambient hypoxia at altitude. Thus the skin in normal humans, in addition to its numerous other functions, is also an oxygen sensor. PMID:23056597

  9. Autonomous Demand Response for Primary Frequency Regulation

    Energy Technology Data Exchange (ETDEWEB)

    Donnelly, Matt; Trudnowski, Daniel J.; Mattix, S.; Dagle, Jeffery E.

    2012-02-28

    The research documented within this report examines the use of autonomous demand response to provide primary frequency response in an interconnected power grid. The work builds on previous studies in several key areas: it uses a large realistic model (i.e., the interconnection of the western United States and Canada); it establishes a set of metrics that can be used to assess the effectiveness of autonomous demand response; and it independently adjusts various parameters associated with using autonomous demand response to assess effectiveness and to examine possible threats or vulnerabilities associated with the technology.

  10. Blunted autonomic response in cluster headache patients

    DEFF Research Database (Denmark)

    Barloese, Mads; Brinth, Louise; Mehlsen, Jesper;

    2015-01-01

    BACKGROUND: Cluster headache (CH) is a disabling headache disorder with chronobiological features. The posterior hypothalamus is involved in CH pathophysiology and is a hub for autonomic control. We studied autonomic response to the head-up tilt table test (HUT) including heart rate variability...... (HRV) in CH patients and compared results to healthy controls. METHODS AND MATERIALS: Twenty-seven episodic and chronic CH patients and an equal number of age-, sex- and BMI-matched controls were included. We analyzed responses to HUT in the time and frequency domain and by non-linear analysis. RESULTS...

  11. Autonomic fiber sprouting in the skin in chronic inflammation

    Directory of Open Access Journals (Sweden)

    Longo Geraldine

    2008-11-01

    Full Text Available Abstract Pain is a major symptom associated with chronic inflammation. In previous work from our laboratory, we have shown that in animal models of neuropathic pain there is a sprouting of sympathetic fibers into the upper dermis, a territory normally devoid of them. However, it is not known whether such sympathetic spouting, which is likely trophic factor mediated, also occurs in chronic inflammation and arthritis. In the present study, we used a rat model of chronic inflammation in which a small single dose of complete Freund's adjuvant (CFA was injected subcutaneously, unilaterally, into the plantar surface of the hindpaw. This led to a localized long-term skin inflammation and arthritis in all joints of the hindpaw. Animals were perfused with histological fixatives at 1, 2, 3 or 4 weeks after the injection. Experimental animals treated with CFA were compared to saline-injected animals. We then investigated the changes in the pattern of peripheral innervation of the peptidergic nociceptors and sympathetic fibers in rat glabrous hindpaw skin. Antibodies directed towards calcitonin gene-related peptide (CGRP and dopamine beta-hydroxylase (DBH were used for the staining of peptidergic and sympathetic fibers, respectively. Immunofluorescence was then used to analyze the different nerve fiber populations of the upper dermis. At 4 weeks following CFA treatment, DBH-immunoreactive (IR fibers were found to sprout into the upper dermis, in a pattern similar to the one we had observed in animals with a chronic constriction injury of the sciatic nerve in a previous publication. There was also a significant increase in the density of CGRP-IR fibers in the upper dermis in CFA treated animals at 2, 3 and 4 weeks post-injection. The increased peptidergic fiber innervation and the ectopic autonomic fibers found in the upper dermis may have a role in the pain-related behavior displayed by these animals.

  12. SYMPATHETIC SKIN RESPONSE AND GALVANIC SKIN RESISTANCE IN MALES WITH TYPE 2 DIABETES MELLITUS

    Directory of Open Access Journals (Sweden)

    Saravanan Mohanraj

    2016-06-01

    Full Text Available BACKGROUND Diabetes mellitus, a metabolic disorder affects the nervous system due to alteration in various metabolic pathways. As neuropathy manifests in longstanding diabetes mellitus, autonomic nervous system also gets affected. The study was started based on the hypothesis that the sweat glands innervated by autonomic nervous system will be affected in patients with type 2 diabetes mellitus patients with clinical features of neuropathy. This study was undertaken to compare the sympathetic skin response (SSR and galvanic skin resistance (GSR in males with type 2 diabetes mellitus and in controls. METHODS Thirty males in the age group of 45-55 years, known to have diabetes mellitus and having a history of neuropathic symptoms served as subjects and thirty males in the same age group with no history of diabetes mellitus and neuropathy served as controls. SSR and GSR were recorded using Recorders and Medicare Systems 4 channel polygraph in the noise and light reduced research laboratory, Department of Physiology. All the recordings were done between 10-12 noon at ambient temperature. SSR was measured by deep inspiration and the GSR was measured in the supine and standing response. Comparison of latency and amplitude of the sympathetic skin response and the percentage of decrease in galvanic skin resistance was done. RESULT A statistically significant delay in the latency and a reduction in the amplitude of sympathetic skin response was observed in the diabetes patients. There was a lesser percentage of decrease in GSR in the diabetic patients. CONCLUSION This study shows that the SSR and GSR responses are significantly reduced in diabetic individuals and can be used as a diagnostic tool in the detection of diabetic autonomic neuropathy.

  13. Impaired autonomic responses to emotional stimuli in autoimmune limbic encephalitis

    Directory of Open Access Journals (Sweden)

    Olga eSchröder

    2015-11-01

    Full Text Available Limbic encephalitis (LE is an autoimmune-mediated disorder that affects structures of the limbic system, in particular the amygdala. The amygdala constitutes a brain area substantial for processing of emotional, especially fear-related signals. The amygdala is also involved in neuroendocrine and autonomic functions, including skin conductance responses (SCRs to emotionally arousing stimuli. This study investigates behavioral and autonomic responses to discrete emotion-evoking and neutral film clips in a patient suffering from LE associated with contactin-associated protein-2 (CASPR2-antibodies as compared to a healthy control group. Results show a lack of SCRs in the patient while watching the film clips, with significant differences compared to healthy controls in the case of fear-inducing videos. There was no comparable impairment in behavioral data (emotion report, valence and arousal ratings. The results point to a defective modulation of sympathetic responses during emotional stimulation in patients with LE, probably due to impaired functioning of the amygdala.

  14. Motor execution detection based on autonomic nervous system responses

    International Nuclear Information System (INIS)

    Triggered assistance has been shown to be a successful robotic strategy for provoking motor plasticity, probably because it requires neurologic patients’ active participation to initiate a movement involving their impaired limb. Triggered assistance, however, requires sufficient residual motor control to activate the trigger and, thus, is not applicable to individuals with severe neurologic injuries. In these situations, brain and body–computer interfaces have emerged as promising solutions to control robotic devices. In this paper, we investigate the feasibility of a body–machine interface to detect motion execution only monitoring the autonomic nervous system (ANS) response. Four physiological signals were measured (blood pressure, breathing rate, skin conductance response and heart rate) during an isometric pinching task and used to train a classifier based on hidden Markov models. We performed an experiment with six healthy subjects to test the effectiveness of the classifier to detect rest and active pinching periods. The results showed that the movement execution can be accurately classified based only on peripheral autonomic signals, with an accuracy level of 84.5%, sensitivity of 83.8% and specificity of 85.2%. These results are encouraging to perform further research on the use of the ANS response in body–machine interfaces. (paper)

  15. Microvascular inflammatory response in the skin

    OpenAIRE

    Evilevitch, Vladimir

    2005-01-01

    This thesis examines the microvascular inflammatory response in the skin. The microvascular response includes vasodilatation and plasma exudation. In the first three studies, the combined response was measured in guinea pig skin with a technique based on detection of radiolabelled protein. Transferrin was labelled in vivo by injection of 113mIn and the conversion electrons detected over the skin using a plastic scintillator. The duration of the microvascular response after histamine an...

  16. Autonomic and cardiovascular responses of preschool children to television programs.

    Science.gov (United States)

    Gröer, M; Howell, M

    1990-01-01

    This exploratory study examined the heart rates (HR) and skin temperatures (ST) of 18 preschool children while they viewed two clips of everyday children's television (TV) programming. The measurements were made in a day care setting, in a naturalistic environment designed to mimic the real world of children's TV viewing. The purpose of the study was to determine whether cardiovascular and autonomic arousal to TV programming might occur in some children. Since a large body of psychosocial literature addresses the affects of TV violence on children, HR and ST were examined during exposure to scenes from Mr. Roger's Neighborhood and G.I. Joe cartoons. The Mr. Roger's clip was slow, rhythmic, prosocial, and nonviolent, while the G.I. Joe clip was fast-paced, staccato, colorful, and full of verbal and action violence. The study found a significant effect of exposure to the cartoon violence on HR, with HR increasing. ST decreased, but not significantly, and there was a significant effect of time on the ST, due possibly to habituation. This finding has relevance to nursing assessment, intervention, and education of parents and children, since TV viewing is a pervasive cultural phenomenon. The possibility of excessive or inappropriate autonomic and cardiovascular responsiveness in some children to TV must be considered. PMID:2213521

  17. Skin conductance response to the pain of others predicts later costly helping.

    Directory of Open Access Journals (Sweden)

    Grit Hein

    Full Text Available People show autonomic responses when they empathize with the suffering of another person. However, little is known about how these autonomic changes are related to prosocial behavior. We measured skin conductance responses (SCRs and affect ratings in participants while either receiving painful stimulation themselves, or observing pain being inflicted on another person. In a later session, they could prevent the infliction of pain in the other by choosing to endure pain themselves. Our results show that the strength of empathy-related vicarious skin conductance responses predicts later costly helping. Moreover, the higher the match between SCR magnitudes during the observation of pain in others and SCR magnitude during self pain, the more likely a person is to engage in costly helping. We conclude that prosocial motivation is fostered by the strength of the vicarious autonomic response as well as its match with first-hand autonomic experience.

  18. Brain Circuitry Supporting Multi-Organ Autonomic Outflow in Response to Nausea.

    Science.gov (United States)

    Sclocco, Roberta; Kim, Jieun; Garcia, Ronald G; Sheehan, James D; Beissner, Florian; Bianchi, Anna M; Cerutti, Sergio; Kuo, Braden; Barbieri, Riccardo; Napadow, Vitaly

    2016-02-01

    While autonomic outflow is an important co-factor of nausea physiology, central control of this outflow is poorly understood. We evaluated sympathetic (skin conductance level) and cardiovagal (high-frequency heart rate variability) modulation, collected synchronously with functional MRI (fMRI) data during nauseogenic visual stimulation aimed to induce vection in susceptible individuals. Autonomic data guided analysis of neuroimaging data, using a stimulus-based (analysis windows set by visual stimulation protocol) and percept-based (windows set by subjects' ratings) approach. Increased sympathetic and decreased parasympathetic modulation was associated with robust and anti-correlated brain activity in response to nausea. Specifically, greater autonomic response was associated with reduced fMRI signal in brain regions such as the insula, suggesting an inhibitory relationship with premotor brainstem nuclei. Interestingly, some sympathetic/parasympathetic specificity was noted. Activity in default mode network and visual motion areas was anti-correlated with parasympathetic outflow at peak nausea. In contrast, lateral prefrontal cortical activity was anti-correlated with sympathetic outflow during recovery, soon after cessation of nauseogenic stimulation. These results suggest divergent central autonomic control for sympathetic and parasympathetic response to nausea. Autonomic outflow and the central autonomic network underlying ANS response to nausea may be an important determinant of overall nausea intensity and, ultimately, a potential therapeutic target.

  19. Autonomous Aerobraking Using Thermal Response Surface Analysis

    Science.gov (United States)

    Prince, Jill L.; Dec, John A.; Tolson, Robert H.

    2007-01-01

    Aerobraking is a proven method of significantly increasing the science payload that can be placed into low Mars orbits when compared to an all propulsive capture. However, the aerobraking phase is long and has mission cost and risk implications. The main cost benefit is that aerobraking permits the use of a smaller and cheaper launch vehicle, but additional operational costs are incurred during the long aerobraking phase. Risk is increased due to the repeated thermal loading of spacecraft components and the multiple attitude and propulsive maneuvers required for successful aerobraking. Both the cost and risk burdens can be significantly reduced by automating the aerobraking operations phase. All of the previous Mars orbiter missions that have utilized aerobraking have increasingly relied on onboard calculations during aerobraking. Even though the temperature of spacecraft components has been the limiting factor, operational methods have relied on using a surrogate variable for mission control. This paper describes several methods, based directly on spacecraft component maximum temperature, for autonomously predicting the subsequent aerobraking orbits and prescribing apoapsis propulsive maneuvers to maintain the spacecraft within specified temperature limits. Specifically, this paper describes the use of thermal response surface analysis in predicting the temperature of the spacecraft components and the corresponding uncertainty in this temperature prediction.

  20. Metabolic and cardiovascular responses to epinephrine in diabetic autonomic neuropathy

    DEFF Research Database (Denmark)

    Hilsted, J; Richter, E; Madsbad, S;

    1987-01-01

    Norepinephrine-induced vasoconstriction, which is mediated by alpha-adrenergic receptors, is accentuated in patients with autonomic neuropathy. In contrast, responses mediated by beta-adrenergic receptors, including vasodilatation and metabolic changes, have not been evaluated in these patients. ...

  1. Intact electrodermal skin conductance responses after bilateral amygdala damage.

    Science.gov (United States)

    Tranel, D; Damasio, H

    1989-01-01

    Several lines of evidence have suggested that the amygdala is a crucial component of the anatomical network that mediates the skin conductance orienting response (SCOR). In this study, the electrodermal activity of a patient whose entire amygdaloid complex had been destroyed bilaterally, and of 7 age- and gender-matched controls, was recorded under the same experimental conditions. The results indicate unequivocally that the subject could generate normal skin conductance and SCORs, in response to stimuli of different sensory modalities and configurations. This suggests that the amygdala is not a necessary component of the neural network underlying SCORs and that there are alternate neural units and pathways that link sensory cortices to autonomic effectors.

  2. The sensory channel of presentation alters subjective ratings and autonomic responses towards disgusting stimuli -Blood pressure, heart rate and skin conductance in response to visual, auditory, haptic and olfactory presented disgusting stimuli-

    OpenAIRE

    Ilona eCroy; Kerstin eLaqua; Frank eSuess; Peter eJoraschky; Tjalf eZiemssen; Thomas eHummel

    2013-01-01

    Disgust causes specific reaction patterns, observable in mimic responses and body reactions. Most research on disgust deals with visual stimuli. However, pictures may cause another disgust experience than sounds, odors or tactile stimuli. Therefore disgust experience evoked by four different sensory channels was compared.A total of 119 participants received 3 different disgusting and one control stimulus, each presented through the visual, auditory, tactile and olfactory channel. Ratings of e...

  3. The sensory channel of presentation alters subjective ratings and autonomic responses toward disgusting stimuli—Blood pressure, heart rate and skin conductance in response to visual, auditory, haptic and olfactory presented disgusting stimuli

    OpenAIRE

    Croy, Ilona; Laqua, Kerstin; Süß, Frank; Joraschky, Peter; Ziemssen, Tjalf; Hummel, Thomas

    2013-01-01

    Disgust causes specific reaction patterns, observable in mimic responses and body reactions. Most research on disgust deals with visual stimuli. However, pictures may cause another disgust experience than sounds, odors, or tactile stimuli. Therefore, disgust experience evoked by four different sensory channels was compared. A total of 119 participants received 3 different disgusting and one control stimulus, each presented through the visual, auditory, tactile, and olfactory channel. Ratings ...

  4. Differentiation of Internet addiction risk level based on autonomic nervous responses: the Internet-addiction hypothesis of autonomic activity.

    Science.gov (United States)

    Lu, Dong Wei; Wang, Jenn Wu; Huang, Andrew Chih Wei

    2010-08-01

    How high-risk Internet addiction (IA) abusers respond to different autonomic nervous activities compared with low-risk subjects may be a critical research goal with prevention and treatment implications. The aim of the present study was to address this issue by observing differences between high- and low-risk IA abusers in four physiological assessments when surfing the Internet: blood volume pulse (BVP), skin conductance (SC), peripheral temperature (PTEMP), and respiratory response (RESPR). Forty-two male and ten female participants aged 18-24 years were screened with the Chen Internet Addiction Scale (CIAS, 2003), and then separated into high- and low-risk IA groups. Using psychophysiology equipment, participants encountered a 3-minute adaptation period followed by a 6-minute testing period for surfing the Internet on baseline and testing phases. The present results indicate that: (a) the CIAS scores were positively and negatively correlated with the RESPR and the PTEMP; (b) the PTEMP and RESPR of high-risk IA abusers were respectively weaker and stronger than those of low-risk IA abusers; the BVP and SC of high-risk IA abusers were respectively augmented and decreased relative to low-risk IA abusers. Thus we suggest that four autonomic responses may be differentially sensitive to abusers' potency in terms of the IA hypothesis of autonomic activity. The stronger BVP and RESPR responses and the weaker PTEMP reactions of the high-risk IA abusers indicate the sympathetic nervous system was heavily activated in these individuals. However, SC activates parasympathetic responses at the same time in the high-risk IA abusers. The paradoxical responses between the sympathetic and parasympathetic actions are addressed in the discussion.

  5. Responsibility for Crashes of Autonomous Vehicles: An Ethical Analysis

    OpenAIRE

    Hevelke, Alexander; Nida-Rümelin, Julian

    2014-01-01

    A number of companies including Google and BMW are currently working on the development of autonomous cars. But if fully autonomous cars are going to drive on our roads, it must be decided who is to be held responsible in case of accidents. This involves not only legal questions, but also moral ones. The first question discussed is whether we should try to design the tort liability for car manufacturers in a way that will help along the development and improvement of autonomous vehicles. In p...

  6. Autonomous Aerobraking: Thermal Analysis and Response Surface Development

    Science.gov (United States)

    Dec, John A.; Thornblom, Mark N.

    2011-01-01

    A high-fidelity thermal model of the Mars Reconnaissance Orbiter was developed for use in an autonomous aerobraking simulation study. Response surface equations were derived from the high-fidelity thermal model and integrated into the autonomous aerobraking simulation software. The high-fidelity thermal model was developed using the Thermal Desktop software and used in all phases of the analysis. The use of Thermal Desktop exclusively, represented a change from previously developed aerobraking thermal analysis methodologies. Comparisons were made between the Thermal Desktop solutions and those developed for the previous aerobraking thermal analyses performed on the Mars Reconnaissance Orbiter during aerobraking operations. A variable sensitivity screening study was performed to reduce the number of variables carried in the response surface equations. Thermal analysis and response surface equation development were performed for autonomous aerobraking missions at Mars and Venus.

  7. Some relationships between punishment, stuttering, and galvanic skin responses.

    Science.gov (United States)

    Reed, C G; Lingwall, J B

    1976-06-01

    The simultaneous effects of response-contingent punishment on stuttering behaviors and the frequency of galvanic skin response (GSR) deflections for 10 subjects were investigated. GSR's and stuttering responses were recorded during base rate, treatment, and extinction conditions. The subjects demonstrated a 50% or greater decrease in stuttering frequency during the treatment condition. Combined data for all subjects indicated that the mean frequency of GSR deflections remained stable or declined across conditions of the study. Analysis of individual data revealed that GSR deflections during treatment as compared with base rate increased for four subjects, remained essentially the same in two subjects, and decreased for four subjects. These results suggest that experimental procedures which result in functional punishment effects on stuttering frequency may not be associated with any predictable pattern on concomitant autonomic arousal. PMID:979195

  8. Investigating the autonomic nervous system response to anxiety in children with autism spectrum disorders.

    Directory of Open Access Journals (Sweden)

    Azadeh Kushki

    Full Text Available Assessment of anxiety symptoms in autism spectrum disorders (ASD is a challenging task due to the symptom overlap between the two conditions as well as the difficulties in communication and awareness of emotions in ASD. This motivates the development of a physiological marker of anxiety in ASD that is independent of language and does not require observation of overt behaviour. In this study, we investigated the feasibility of using indicators of autonomic nervous system (ANS activity for this purpose. Specially, the objectives of the study were to 1 examine whether or not anxiety causes significant measurable changes in indicators of ANS in an ASD population, and 2 characterize the pattern of these changes in ASD. We measured three physiological indicators of the autonomic nervous system response (heart rate, electrodermal activity, and skin temperature during a baseline (movie watching and anxiety condition (Stroop task in a sample of typically developing children (n = 17 and children with ASD (n = 12. The anxiety condition caused significant changes in heart rate and electrodermal activity in both groups, however, a differential pattern of response was found between the two groups. In particular, the ASD group showed elevated heart rate during both baseline and anxiety conditions. Elevated and blunted phasic electrodermal activity were found in the ASD group during baseline and anxiety conditions, respectively. Finally, the ASD group did not show the typical decrease in skin temperature in response to anxiety. These results suggest that 1 signals of the autonomic nervous system may be used as indicators of anxiety in children with ASD, and 2 ASD may be associated with an atypical autonomic response to anxiety that is most consistent with sympathetic over-arousal and parasympathetic under-arousal.

  9. Investigating the autonomic nervous system response to anxiety in children with autism spectrum disorders.

    Science.gov (United States)

    Kushki, Azadeh; Drumm, Ellen; Pla Mobarak, Michele; Tanel, Nadia; Dupuis, Annie; Chau, Tom; Anagnostou, Evdokia

    2013-01-01

    Assessment of anxiety symptoms in autism spectrum disorders (ASD) is a challenging task due to the symptom overlap between the two conditions as well as the difficulties in communication and awareness of emotions in ASD. This motivates the development of a physiological marker of anxiety in ASD that is independent of language and does not require observation of overt behaviour. In this study, we investigated the feasibility of using indicators of autonomic nervous system (ANS) activity for this purpose. Specially, the objectives of the study were to 1) examine whether or not anxiety causes significant measurable changes in indicators of ANS in an ASD population, and 2) characterize the pattern of these changes in ASD. We measured three physiological indicators of the autonomic nervous system response (heart rate, electrodermal activity, and skin temperature) during a baseline (movie watching) and anxiety condition (Stroop task) in a sample of typically developing children (n = 17) and children with ASD (n = 12). The anxiety condition caused significant changes in heart rate and electrodermal activity in both groups, however, a differential pattern of response was found between the two groups. In particular, the ASD group showed elevated heart rate during both baseline and anxiety conditions. Elevated and blunted phasic electrodermal activity were found in the ASD group during baseline and anxiety conditions, respectively. Finally, the ASD group did not show the typical decrease in skin temperature in response to anxiety. These results suggest that 1) signals of the autonomic nervous system may be used as indicators of anxiety in children with ASD, and 2) ASD may be associated with an atypical autonomic response to anxiety that is most consistent with sympathetic over-arousal and parasympathetic under-arousal.

  10. Facial feedback and autonomic responsiveness reflect impaired emotional processing in Parkinson's Disease.

    Science.gov (United States)

    Balconi, Michela; Pala, Francesca; Manenti, Rosa; Brambilla, Michela; Cobelli, Chiara; Rosini, Sandra; Benussi, Alberto; Padovani, Alessandro; Borroni, Barbara; Cotelli, Maria

    2016-01-01

    Emotional deficits are part of the non-motor features of Parkinson's disease but few attention has been paid to specific aspects such as subjective emotional experience and autonomic responses. This study aimed to investigate the mechanisms of emotional recognition in Parkinson's Disease (PD) using the following levels: explicit evaluation of emotions (Self-Assessment Manikin) and implicit reactivity (Skin Conductance Response; electromyographic measure of facial feedback of the zygomaticus and corrugator muscles). 20 PD Patients and 34 healthy controls were required to observe and evaluate affective pictures during physiological parameters recording. In PD, the appraisal process on both valence and arousal features of emotional cues were preserved, but we found significant impairment in autonomic responses. Specifically, in comparison to healthy controls, PD patients revealed lower Skin Conductance Response values to negative and high arousing emotional stimuli. In addition, the electromyographic measures showed defective responses exclusively limited to negative and high arousing emotional category: PD did not show increasing of corrugator activity in response to negative emotions as happened in heathy controls. PD subjects inadequately respond to the emotional categories which were considered more "salient": they had preserved appraisal process, but impaired automatic ability to distinguish between different emotional contexts. PMID:27509848

  11. Facial feedback and autonomic responsiveness reflect impaired emotional processing in Parkinson’s Disease

    Science.gov (United States)

    Balconi, Michela; Pala, Francesca; Manenti, Rosa; Brambilla, Michela; Cobelli, Chiara; Rosini, Sandra; Benussi, Alberto; Padovani, Alessandro; Borroni, Barbara; Cotelli, Maria

    2016-01-01

    Emotional deficits are part of the non-motor features of Parkinson’s disease but few attention has been paid to specific aspects such as subjective emotional experience and autonomic responses. This study aimed to investigate the mechanisms of emotional recognition in Parkinson’s Disease (PD) using the following levels: explicit evaluation of emotions (Self-Assessment Manikin) and implicit reactivity (Skin Conductance Response; electromyographic measure of facial feedback of the zygomaticus and corrugator muscles). 20 PD Patients and 34 healthy controls were required to observe and evaluate affective pictures during physiological parameters recording. In PD, the appraisal process on both valence and arousal features of emotional cues were preserved, but we found significant impairment in autonomic responses. Specifically, in comparison to healthy controls, PD patients revealed lower Skin Conductance Response values to negative and high arousing emotional stimuli. In addition, the electromyographic measures showed defective responses exclusively limited to negative and high arousing emotional category: PD did not show increasing of corrugator activity in response to negative emotions as happened in heathy controls. PD subjects inadequately respond to the emotional categories which were considered more “salient”: they had preserved appraisal process, but impaired automatic ability to distinguish between different emotional contexts. PMID:27509848

  12. Leader Style and Anxiety Level: Their Relation to Autonomic Response.

    Science.gov (United States)

    Seemann, Daniel C.

    1982-01-01

    Studied effects of leader style and a group of people classified as either high-anxious or low-anxious. Measured participants' (N=71) responses to the leader styles using Galvanic Skin Response. Results indicated similar responses of participants to both autocratic and democratic leadership styles. (RC)

  13. Cognitive modulation of psychophysical, respiratory and autonomic responses to cold pressor test.

    Directory of Open Access Journals (Sweden)

    Enrica L Santarcangelo

    Full Text Available In healthy subjects with high hypnotisability (highs under hypnosis, subjectively effective suggestions for analgesia abolish the increases in blood pressure associated with cold pressor test (cpt by reducing the peripheral vascular resistance. The aim of the present study was to investigate the effects of the suggestions of analgesia on the responses to cpt in healthy highs (n = 22 and in low hypnotisable participants (lows, n = 22 out of hypnosis. Cpt was administered without (CPT and with suggestions for analgesia (CPT+AN. Psychophysical (pain intensity, pain threshold, cpt duration (time of immersion and pain tolerance, defined as the difference between cpt duration and pain threshold, respiratory (amplitude and frequency and autonomic variables (tonic skin conductance, mean RR interval (RR = 1/heart rate, blood pressure, skin blood flow were studied. The suggestions for analgesia increased cpt duration and RR in both groups, but decreased pain intensity and enhanced pain threshold only in highs; in both groups they did not modulate systolic blood pressure, tonic skin conductance and skin blood flow; thus, increased parasympathetic activity appears responsible for the heart rate reduction induced by suggestions in both groups. In conclusion, our findings show that suggestions modulate pain experience differentially in highs and lows, and are partially effective also in lows. We hypothesize that the mechanisms responsible for the efficacy of suggestions in healthy lows may be involved also in their efficacy in chronic pain patients with low hypnotisability.

  14. Responsibility for crashes of autonomous vehicles: an ethical analysis.

    Science.gov (United States)

    Hevelke, Alexander; Nida-Rümelin, Julian

    2015-06-01

    A number of companies including Google and BMW are currently working on the development of autonomous cars. But if fully autonomous cars are going to drive on our roads, it must be decided who is to be held responsible in case of accidents. This involves not only legal questions, but also moral ones. The first question discussed is whether we should try to design the tort liability for car manufacturers in a way that will help along the development and improvement of autonomous vehicles. In particular, Patrick Lin's concern that any security gain derived from the introduction of autonomous cars would constitute a trade-off in human lives will be addressed. The second question is whether it would be morally permissible to impose liability on the user based on a duty to pay attention to the road and traffic and to intervene when necessary to avoid accidents. Doubts about the moral legitimacy of such a scheme are based on the notion that it is a form of defamation if a person is held to blame for causing the death of another by his inattention if he never had a real chance to intervene. Therefore, the legitimacy of such an approach would depend on the user having an actual chance to do so. The last option discussed in this paper is a system in which a person using an autonomous vehicle has no duty (and possibly no way) of interfering, but is still held (financially, not criminally) responsible for possible accidents. Two ways of doing so are discussed, but only one is judged morally feasible. PMID:25027859

  15. Responsibility for crashes of autonomous vehicles: an ethical analysis.

    Science.gov (United States)

    Hevelke, Alexander; Nida-Rümelin, Julian

    2015-06-01

    A number of companies including Google and BMW are currently working on the development of autonomous cars. But if fully autonomous cars are going to drive on our roads, it must be decided who is to be held responsible in case of accidents. This involves not only legal questions, but also moral ones. The first question discussed is whether we should try to design the tort liability for car manufacturers in a way that will help along the development and improvement of autonomous vehicles. In particular, Patrick Lin's concern that any security gain derived from the introduction of autonomous cars would constitute a trade-off in human lives will be addressed. The second question is whether it would be morally permissible to impose liability on the user based on a duty to pay attention to the road and traffic and to intervene when necessary to avoid accidents. Doubts about the moral legitimacy of such a scheme are based on the notion that it is a form of defamation if a person is held to blame for causing the death of another by his inattention if he never had a real chance to intervene. Therefore, the legitimacy of such an approach would depend on the user having an actual chance to do so. The last option discussed in this paper is a system in which a person using an autonomous vehicle has no duty (and possibly no way) of interfering, but is still held (financially, not criminally) responsible for possible accidents. Two ways of doing so are discussed, but only one is judged morally feasible.

  16. Cognitive load and autonomic response patterns under negative priming demand in depersonalization-derealization disorder.

    Science.gov (United States)

    Lemche, Erwin; Sierra-Siegert, Mauricio; David, Anthony S; Phillips, Mary L; Gasston, David; Williams, Steven C R; Giampietro, Vincent P

    2016-04-01

    Previous studies have yielded evidence for cognitive processing abnormalities and alterations of autonomic functioning in depersonalization-derealization disorder (DPRD). However, multimodal neuroimaging and psychophysiology studies have not yet been conducted to test for functional and effective connectivity under cognitive stress in patients with DPRD. DPRD and non-referred control subjects underwent a combined Stroop/negative priming task, and the neural correlates of Stroop interference effect, negative priming effect, error rates, cognitive load span and average amplitude of skin conductance responses were ascertained for both groups. Evoked haemodynamic responses for basic Stroop/negative priming activations were compared. For basic Stroop to neutral contrast, patients with DPRD differed in the location (inferior vs. superior lobule) of the parietal region involved, but showed similar activations in the left frontal region. In addition, patients with DPRD also co-activated the dorsomedial prefrontal cortex (BA9) and posterior cingulate cortex (BA31), which were also found to be the main between-group difference regions. These regions furthermore showed connectivity with frequency of depersonalization states. Evoked haemodynamic responses drawn from regions of interest indicated significant between-group differences in 30-40% of time points. Brain-behaviour correlations differed mainly in laterality, yet only slightly in regions. A reversal of autonomic patterning became evident in patients with DPRD for cognitive load spans, indicating less effective arousal suppression under cognitive stress - patients with DPRD showed positive associations of cognitive load with autonomic responses, whereas controls exhibit respective inverse association. Overall, the results of the present study show only minor executive cognitive peculiarities, but further support the notion of abnormalities in autonomic functioning in patients with DPRD.

  17. Basic emotions evoked by odorants: comparison between autonomic responses and self-evaluation.

    Science.gov (United States)

    Alaoui-Ismaïli, O; Robin, O; Rada, H; Dittmar, A; Vernet-Maury, E

    1997-10-01

    The present study was designed to analyze the relationship between self-report and physiological expression of basic emotions (happiness, surprise, fear, sadness, disgust and anger) in response to odorants. 44 subjects inhaled five odorants: vanillin, menthol, eugenol, methyl methacrylate, and propionic acid. Six autonomic nervous systems (ANS) parameters were simultaneously recorded in real time and without interference: Skin Potential (SP), Skin Resistance (SR), Skin Temperature (ST), Skin Blood Flow (SBF), Instantaneous Respiratory Frequency (IRF) and Instantaneous Heart Rate (IHR). At the end of the recording, subjects were instructed i) to identify the odorants roughly II) to situate them on an 11-point hedonic scale from highly pleasant (0) to highly unpleasant (10); and iii) to define what type of basic emotion was evoked by each odorant. In this study, the expected affects were aroused in the subjects. Vanillin and menthol were rated pleasant, while methyl methacrylate and propionic acid were judged unpleasant. Eugenol was median in hedonic estimation. ANS evaluation (each autonomic pattern induced by an odorant was transcripted into a basic emotion) shows that pleasantly connoted odorants evoked mainly happiness and surprise, but that unpleasant ones induced mainly disgust and anger. Eugenol was associated with positive and negative affects. Comparison between conscious (verbal) and unconscious (ANS) emotions, reveals that these two estimations 1) were not significantly different as far as the two pleasant odorants were concerned, 2) showed a tendency to be significantly different for eugenol odorant which was variably scored on the hedonic axis, and 3) exhibited a significant difference for the two unpleasant odorants, for which the corresponding "verbal emotion" was mainly "disgust", while the most frequent ANS emotion was "anger". In conclusion, these results show quite a good correlation between verbal and ANS estimated basic emotions. The main

  18. Immune response associated with nonmelanoma skin cancer.

    Science.gov (United States)

    Strickland, F M; Kripke, M L

    1997-10-01

    It is now clear that UV radiation causes nonmelanoma skin cancer in at least two ways: by causing permanent changes in the genetic code and by preventing immunologic recognition of mutant cells. These are interacting rather than separate mechanisms. Damage to DNA results in disregulation of cellular proliferation and initiates immune suppression by stimulating the production of suppressive cytokines. These cytokines contribute to the loss of immunosurveillance. Ultraviolet radiation has both local and systemic immunosuppressive effects. Locally, it depletes and alters antigen-presenting LC at the site of UV irradiation. Systemic suppression results when Ts cells are induced, by altered LC, by inflammatory macrophages that enter the skin following UV irradiation, or by the action of cytokines. Damage to DNA appears to be one of the triggering events in inducing systemic immunosuppression via the release of immunosuppressive cytokines and mediators. Immunologic approaches to treating skin cancers so far have concentrated on nonspecifically stimulating immune cells that infiltrate these tumors, but induction of specific immune responses against these tumors with antitumor vaccines has received little attention as yet. Preventive measures include sun avoidance and the use of sunscreens to prevent DNA damage by UV light. Future strategies may employ means to reverse UV-induced immunosuppression by using anti-inflammatory agents, biologicals that accelerate DNA repair or prevent the generation of immunosuppressive cytokines, and specific immunotherapy with tumor antigens. New approaches for studying the immunology of human skin cancers are needed to accelerate progress in this field.

  19. Self-report, personality and autonomic system modulation in response to empathic conflictual versus non conflictual situation.

    Science.gov (United States)

    Balconi, Michela; Bortolotti, Adriana

    2014-01-01

    The present study integrated three different measures of emotional empathic behaviour in a social context: verbal self-report measures (empathic response, emotional involvement, emotional significance, and valence), autonomic response (skin conductance, SCR, and heart rate, HR), and personal response to empathic scale (BEES). Thirty-five younger adults were presented with different interpersonal scene types (co-operation, non-co-operation, conflict, neutral). Different empathic sensitivity to these interpersonal situations was tested, since we hypothesised self-report on empathy, emotional involvement and valence varied as a function of interpersonal context. As supposed, self-report measures of empathy and autonomic measures were found to be related: SCR and HR increased in response to conflictual and non-co-operative situations. Moreover, high empathic subjects were more responsive (on both self-report and autonomic response) to empathy-related situations than low empathic subjects. The convergence of these multidimensional measures are discussed: emotional components of empathy are elucidated in relation to self-report, autonomic modulation, and personality trait variation.

  20. Olfactory ensheathing cell transplantation improves sympathetic skin responses in chronic spinal cord injury

    Institute of Scientific and Technical Information of China (English)

    Zuncheng Zheng; Guifeng Liu; Yuexia Chen; Shugang Wei

    2013-01-01

    Forty-three patients with chronic spinal cord injury for over 6 months were transplanted with bryonic olfactory ensheathing cells, 2-4 × 106, into multiple sites in the injured area under the sur-gical microscope. The sympathetic skin response in patients was measured with an electromyo-graphy/evoked potential instrument 1 day before transplantation and 3-8 weeks after trans-tion. Spinal nerve function of patients was assessed using the American Spinal Injury Association impairment scale. The sympathetic skin response was elicited in 32 cases before olfactory en-sheathing celltransplantation, while it was observed in 34 cases after transplantation. tantly, sympathetic skin response latency decreased significantly and amplitude increased cantly after transplantation. Transplantation of olfactory ensheathing cells also improved American Spinal Injury Association scores for movement, pain and light touch. Our findings indicate that factory ensheathing celltransplantation improves motor, sensory and autonomic nerve functions in patients with chronic spinal cord injury.

  1. Physiological correlates of the big 5: autonomic responses to video presentations.

    Science.gov (United States)

    Brumbaugh, Claudia Chloe; Kothuri, Ravi; Marci, Carl; Siefert, Caleb; Pfaff, Donald D

    2013-12-01

    Personality's link to emotional experience has been demonstrated, but specific biological responses to emotion as a function of personality have not been well-established. Here, the association between personality and physiological responses (heart rate, skin conductance, and respiration) to emotional videos was assessed. One-hundred sixty-nine participants self-reported on their Big 5 personality traits and underwent ambulatory monitoring as they watched four brief video clips from primetime television content showing scenes containing violence, fear, sadness, and tension. Generally, the negatively-toned emotional scenes provoked increases in skin conductance response and declines in heart rate. We found that physiological outcomes depended on the particular emotional scene and on personality, most notably Extraversion and Neuroticism. Extraversion, and to a lesser degree, Neuroticism, were associated with increases in autonomic arousal responses to the scenes. Gender also interacted with personality to predict responses, such that women who scored higher on measures of Extraversion, Neuroticism, and Conscientious tended to show more physiological arousal than men. Overall, the emotional scenes evoked increases in arousal and more controlled attention. The findings are discussed in context of the limited capacity model and shed light on how personality and gender affect physiological reactions to emotional experiences in everyday life. PMID:24129901

  2. Anticipatory autonomic response to a public speaking task in women: the role of trait anxiety.

    Science.gov (United States)

    Gonzalez-Bono, Esperanza; Moya-Albiol, Luis; Salvador, Alicia; Carrillo, Eduvigis; Ricarte, Jorge; Gomez-Amor, Jesus

    2002-01-01

    The aim of this research was to study anticipatory autonomic responses their relationship to trait anxiety. Twenty-three women prepared an evaluated speech (S-condition) and 22 women an evaluated essay (W-condition). Heart rate (HR), finger pulse volume (FPV) and skin conductance were recorded before, during and after preparation of the task and during task performance; state-anxiety was evaluated before and after the task. In the total sample, state-anxiety was higher in the S- than in W-condition and this anxiety increase was accompanied by FPV reductions. However, when the sample was split according to trait anxiety scores, HR during preparation and increases of state-anxiety were greater in S- than W-condition in only in high-anxious women. Results suggest that specificity of anticipatory HR response to a public speaking task in women is moderated by cognitive anxiety. PMID:12100844

  3. Heart rate responses to autonomic challenges in obstructive sleep apnea.

    Directory of Open Access Journals (Sweden)

    Paul M Macey

    Full Text Available Obstructive sleep apnea (OSA is accompanied by structural alterations and dysfunction in central autonomic regulatory regions, which may impair dynamic and static cardiovascular regulation, and contribute to other syndrome pathologies. Characterizing cardiovascular responses to autonomic challenges may provide insights into central nervous system impairments, including contributions by sex, since structural alterations are enhanced in OSA females over males. The objective was to assess heart rate responses in OSA versus healthy control subjects to autonomic challenges, and, separately, characterize female and male patterns. We studied 94 subjects, including 37 newly-diagnosed, untreated OSA patients (6 female, age mean ± std: 52.1 ± 8.1 years; 31 male aged 54.3 ± 8.4 years, and 57 healthy control subjects (20 female, 50.5 ± 8.1 years; 37 male, 45.6 ± 9.2 years. We measured instantaneous heart rate with pulse oximetry during cold pressor, hand grip, and Valsalva maneuver challenges. All challenges elicited significant heart rate differences between OSA and control groups during and after challenges (repeated measures ANOVA, p<0.05. In post-hoc analyses, OSA females showed greater impairments than OSA males, which included: for cold pressor, lower initial increase (OSA vs. control: 9.5 vs. 7.3 bpm in females, 7.6 vs. 3.7 bpm in males, OSA delay to initial peak (2.5 s females/0.9 s males, slower mid-challenge rate-of-increase (OSA vs. control: -0.11 vs. 0.09 bpm/s in females, 0.03 vs. 0.06 bpm/s in males; for hand grip, lower initial peak (OSA vs. control: 2.6 vs. 4.6 bpm in females, 5.3 vs. 6.0 bpm in males; for Valsalva maneuver, lower Valsalva ratio (OSA vs. control: 1.14 vs. 1.30 in females, 1.29 vs. 1.34 in males, and OSA delay during phase II (0.68 s females/1.31 s males. Heart rate responses showed lower amplitude, delayed onset, and slower rate changes in OSA patients over healthy controls, and impairments may be more pronounced in

  4. Autonomously-triggered microfluidic cooling using thermo-responsive hydrogels.

    Science.gov (United States)

    Agarwal, Abhishek K; Dong, Liang; Beebe, David J; Jiang, Hongrui

    2007-03-01

    We present autonomously-triggered on-chip microfluidic cooling devices that utilize thermo-responsive hydrogels to adapt to local environmental temperatures. An external rotating magnetic stirrer couples with an in situ fabricated nickel impeller in these centrifugal-based microfluidic cooling devices to recirculate cooler water. Temperature-responsive hydrogels, which exhibit volumetric expansion and contraction, are integrated at the axle of the impeller. In this design, the hydrogels behave similar to an automotive clutch, to autonomously control the impeller's rotation as a function of the local environmental temperature. Therefore, the hydrogels act as both sensors and actuators and help take away the necessity for additional temperature sensing, feedback, and/or control units here. Cooling devices capable of on-chip thermal management at multiple predetermined onset operation points are realized by changes to the composition of hydrogel to alter its lowest critical solution temperature (LCST). Furthermore, the effect of magnetic stirrer frequency on the fluid cooling and flowrates for different two-blade nickel impeller designs are presented. PMID:17330161

  5. Active skin perfusion and thermoregulatory response in the hand following nerve injury and repair in human upper extremities.

    Science.gov (United States)

    Deng, Aidong; Liu, Dan; Gu, Chen; Gu, Xiaosong; Gu, Jianhui; Hu, Wen

    2016-01-01

    Cutaneous vasoconstriction/vasodilatation occurs in response to whole body and local cooling/heating, and the vasomotor activities play a pivotal role in thermal control of the human body. The mechanisms underlying regulation of skin blood flow involve both neurogenic and humeral/local chemical influence, contributing to the initial response to thermal stimuli and the prolonged phase of response, respectively. Previous studies have suggested the impairment of cutaneous thermal regulation after nerve injury. However, the evidence regarding how the skin perfusion and thermoregulatory response evolve after nerve injury and repair remains limited. Here we observed, by utilizing laser-Doppler perfusion imaging, baseline skin perfusion and perfusion change in response to thermal stimuli after median and ulnar nerve injury, and the results showed that baseline perfusion in autonomous skin area profoundly decreased and active rewarming after clod stress dramatically diminished before sensory recovery of the skin became detectable. In addition, baseline cutaneous perfusion was recovered as the skin regained touch sensation, and exhibited positive correlation to touch sensibility of the skin. These data indicate that both active perfusion and thermoregulatory response of the skin are markedly compromised during skin denervation and can be recovered by re-innervation. This suggests the importance of timely repair of injured nerve, especially in the practice of replantation.

  6. Sympathetic skin response in patients with myasthenia gravis A comparative analysis

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    BACKGROUND: The examination of sympathetic skin response is an important index for assessing the autonomic nerve function, and patients with myasthenia gravis are always accompanied by dysautonomia.Therefore, it will be important to know whether sympathetic skin response can be used as the index for the clinical evaluation of myasthenia gravis.OBJECTIVE: To investigate the diagnostic value of sympathetic skin response in the damage of autonomic nerve function of patients with myasthenia gravis.DESIGN: A case-controlled comparative observation.SETTING: Department of Neurology and Room of Nerve Electromyogram, the Affiliated Hospital of North Sichuan Medical College.PARTICIPANTS: Thirty outpatients or inpatients with myasthenia gravis were selected from the Department of Neurology, the Affiliated Hospital of North Sichuan Medical College from May 2006 to May 2007, including 9 males and 21 females, aged 8 - 72 years with a mean age of (28±5) years old. They were all accorded with the diagnostic standards of myasthenia gravis, accompanied by different severity of autonomic nerve symptoms, including poor skin nutrition, sweating of hands and feet, pyknocardia,persistent hypotension, abdominal pain, constipation, etc. They all had not taken any drug affecting the autonomic nerve function before the examination. Informed consents were obtained from all the patients.Meanwhile, 30 healthy physical examinees were enrolled as the normal control group, including 10 males and 20 females, aged 10 - 75 years with a mean age of (31±5) years old. Approval was obtained from the hospital ethic committee.METHODS: After admission, the patients were examined with sympathetic skin response using DANTEC keypoint 2.0 electromyography evoked potential apparatus (Danmark). The changes of the latency and wave amplitude of sympathetic skin response were observed. The subjects in the normal control group were examined with the same methods at physical examination. Abnormality was judged by

  7. Skin conductance orienting response in unmedicated RDC schizophrenic, schizoaffective, depressed, and control subjects.

    Science.gov (United States)

    Levinson, D F

    1991-10-01

    In an evaluation of the skin conductance orienting response (SCOR) as a marker for schizophrenia, skin conductance (SC) activity was studied in 36 Research Diagnostic Criteria (RDC) schizophrenic (SCZ), 17 schizoaffective--mainly schizophrenic (SA), 24 depressed (DEP), and 25 psychiatrically well control (CONT) subjects. All subjects were unmedicated. Data are presented from four paradigms: a series of 1 s 70 dB tones in a no-task habituation paradigm; a similar series of 103 dB tones; a series of tones with a button-press (reaction time) task; and a loud white noise stimulus (without task). The proportion of SCOR nonresponse to the first 70 dB tone was 39% for SCZ, 82% for SA, 46% for DEP, and 36% for CONT subjects; the response rate for SA subjects was significantly lower than for all other groups. The CONT group was less responsive than in most previous studies. SCZ subjects did not show increased responsivity to more intense and to task-relevant stimuli, although SA subjects did show such increases. DEP subjects showed some evidence of autonomic hyperarousal (higher tonic SC level, trend toward more spontaneous SC responses). The overall pattern of results does not support SCOR to neutral, moderate-intensity tones as a specific marker for schizophrenia, although there was some evidence for a generalized decrease in autonomic responsivity to stimuli.

  8. Mind-body relationships in elite apnea divers during breath holding: a study of autonomic responses to acute hypoxemia

    Directory of Open Access Journals (Sweden)

    Marco eLaurino

    2012-03-01

    Full Text Available The mental control of ventilation with all associated phenomena,from relaxation to modulation of emotions, from cardiovascular tometabolic adaptations, constitutes a psychophysiological conditioncharacterizing voluntary breath holding (BH. BH induces severalautonomic responses, involving both autonomic cardiovascular andcutaneous pathways, whose characterization is the main aim ofthis study. Electrocardiogram and skin conductance (SC recordingswere collected from 14 elite divers during three conditions: freebreathing (FB, normoxic phase of BH (NPBH and hypoxic phaseof BH (HPBH. Thus, we compared a set of features describing signaldynamics between the three experimental conditions: from heart ratevariability features (in time and frequency domains and by usingnonlinear methods to rate and shape of spontaneous SC responses.The main result of the study rises by applying a Factor Analysis tothe subset of features significantly changed in the two BH phases.Indeed, the Factor Analysis allowed to uncover the structure of latentfactors which modeled the autonomic response: a factor describingthe autonomic balance, one the information increase rate, and alatter the central nervous system driver. The BH did not disrupt theFB factorial structure, and only few features moved among factors.Factor Analysis indicates that during BH i only the SC described theemotional output, ii the sympathetic tone on heart did not change, iiithe dynamics of interbeats intervals showed an increase of long rangecorrelation that anticipates the HPBH, followed by a drop to a randombehavior. In conclusion, data show that the autonomic control onheart rate and skin conductance are differentially modulated duringBH, which could be related to a more pronounced effect on emotionalcontrol induced by the mental training to BH.

  9. Responsive corneosurfametry following in vivo skin preconditioning.

    Science.gov (United States)

    Uhoda, E; Goffin, V; Pierard, G E

    2003-12-01

    Skin is subjected to many environmental threats, some of which altering the structure and function of the stratum corneum. Among them, surfactants are recognized factors that may influence irritant contact dermatitis. The present study was conducted to compare the variations in skin capacitance and corneosurfametry (CSM) reactivity before and after skin exposure to repeated subclinical injuries by 2 hand dishwashing liquids. A forearm immersion test was performed on 30 healthy volunteers. 2 daily soak sessions were performed for 5 days. At inclusion and the day following the last soak session, skin capacitance was measured and cyanoacrylate skin-surface strippings were harvested. The latter specimens were used for the ex vivo microwave CSM. Both types of assessments clearly differentiated the 2 hand dishwashing liquids. The forearm immersion test allowed the discriminant sensitivity of CSM to increase. Intact skin capacitance did not predict CSM data. By contrast, a significant correlation was found between the post-test conductance and the corresponding CSM data. In conclusion, a forearm immersion test under realistic conditions can discriminate the irritation potential between surfactant-based products by measuring skin conductance and performing CSM. In vivo skin preconditioning by surfactants increases CSM sensitivity to the same surfactants.

  10. The framing effect and skin conductance responses

    Directory of Open Access Journals (Sweden)

    Patrick eRing

    2015-08-01

    Full Text Available Individuals often rely on simple heuristics when they face complex choice situations under uncertainty. Traditionally, it has been proposed that cognitive processes are the main driver to evaluate different choice options and finally to reach a decision. Growing evidence, however, highlights a strong interrelation between judgment and decision-making (JDM on the one hand, and emotional processes on the other hand. This also seems to apply to judgmental heuristics, i.e. decision-processes that are typically considered to be fast and intuitive. In this study, participants are exposed to different probabilities of receiving an unpleasant electric shock. Information about electric shock probabilities is either positively or negatively framed. Integrated skin conductance responses (ISCRs while waiting for electric shock realization are used as an indicator for participants' emotional arousal. This measure is compared to objective probabilities. I find evidence for a relation between emotional body reactions measured by ISCRs and the framing effect. Under negative frames, participants show significantly higher ISCRs while waiting for an electric shock to be delivered than under positive frames. This result might contribute to a better understanding of the psychological processes underlying JDM. Further studies are necessary to reveal the causality underlying this finding, i.e. whether emotional processes influence JDM or vice versa.

  11. TRPM8 mechanism of autonomic nerve response to cold in respiratory airway

    Directory of Open Access Journals (Sweden)

    Wang Cong-Yi

    2008-06-01

    Full Text Available Abstract Breathing cold air without proper temperature exchange can induce strong respiratory autonomic responses including cough, airway constriction and mucosal secretion, and can exacerbate existing asthma conditions and even directly trigger an asthma attack. Vagal afferent fiber is thought to be involved in the cold-induced respiratory responses through autonomic nerve reflex. However, molecular mechanisms by which vagal afferent fibers are excited by cold remain unknown. Using retrograde labeling, immunostaining, calcium imaging, and electrophysiological recordings, here we show that a subpopulation of airway vagal afferent nerves express TRPM8 receptors and that activation of TRPM8 receptors by cold excites these airway autonomic nerves. Thus activation of TRPM8 receptors may provoke autonomic nerve reflex to increase airway resistance. This putative autonomic response may be associated with cold-induced exacerbation of asthma and other pulmonary disorders, making TRPM8 receptors a possible target for prevention of cold-associated respiratory disorders.

  12. Autonomic and Emotional Responses of Graduate Student Clinicians in Speech-Language Pathology to Stuttered Speech

    Science.gov (United States)

    Guntupalli, Vijaya K.; Nanjundeswaran, Chayadevie; Dayalu, Vikram N.; Kalinowski, Joseph

    2012-01-01

    Background: Fluent speakers and people who stutter manifest alterations in autonomic and emotional responses as they view stuttered relative to fluent speech samples. These reactions are indicative of an aroused autonomic state and are hypothesized to be triggered by the abrupt breakdown in fluency exemplified in stuttered speech. Furthermore,…

  13. University EFL Learners' Perceptions of Their Autonomous Learning Responsibilities and Abilities

    Science.gov (United States)

    Abdel Razeq, Anwar Ahmad

    2014-01-01

    This study investigated the readiness of university students for autonomous learning of English as a foreign language. Data was collected using questionnaires and interviews. The study assessed learners' readiness for autonomous learning across three dimensions: a) learners' perceptions of their educational responsibilities; b)…

  14. Control of the skin scarring response

    Directory of Open Access Journals (Sweden)

    Lydia M. Ferreira

    2009-09-01

    Full Text Available There comes a time when the understanding of the cutaneous healing process becomes essential due to the need for a precocious tissue repair to reduce the physical, social, and psychological morbidity. Advances in the knowledge on the control of interaction among cells, matrix and growth factors will provide more information on the Regenerative Medicine, an emerging area of research in medical bioengineering. However, considering the dynamism and complexity of the cutaneous healing response, it is fundamental to understand the control mechanism exerted by the interaction and synergism of both systems, cutaneous nervous and central nervous, via hypothalamus hypophysis-adrenal axis, a relevant subject, but hardly ever explored. The present study reviews the neuro-immune-endocrine physiology of the skin responsible for its multiple functions and the extreme disturbances of the healing process, like the excess and deficiency of the extracellular matrix deposition.Aproxima-se uma época na qual é fundamental a compreensão do processo cicatricial cutâneo frente à necessidade da restauração tecidual precoce, visando a diminuição das morbidades física, social e psicológica. O avanço no conhecimento acerca do controle das interações entre as células, a matriz e os fatores de crescimento dará maiores informações à Medicina Regenerativa, área de pesquisa emergente da bioengenharia médica. Entretanto, diante do dinamismo e complexidade da resposta cicatricial cutânea torna-se indispensável o entendimento do mecanismo de controle exercido pela interação e sinergismo do sistema nervoso cutâneo e o sistema nervoso central, via eixo hipotálamo-hipófise-adrenal, tema relevante, porém, pouco abordado. O presente estudo revisa a fisiologia neuro-imuno-endócrina da pele, responsável por suas múltiplas funções, e os distúrbios extremos do processocicatricial, como o excesso e deficiência de deposição da matriz extracelular.

  15. Superficial Immunity: Antimicrobial Responses Are More Than Skin Deep.

    Science.gov (United States)

    Mack, Madison R; Kim, Brian S

    2016-07-19

    The skin barrier is essential for host defense, but how the skin provides protection when the barrier is breached is not well understood. In this issue of Immunity, Gallo and colleagues report that keratinocytes integrate signals from antimicrobial peptides via MAVS signaling to amplify their antiviral immune response. PMID:27438760

  16. Maternal Sensitivity and Infant Autonomic and Endocrine Stress Responses

    Science.gov (United States)

    Enlow, Michelle Bosquet; King, Lucy; Schreier, Hannah; Howard, Jamie M.; Rosenfield, David; Ritz, Thomas; Wright, Rosalind J.

    2014-01-01

    Background Early environmental exposures may help shape the development of the autonomic nervous system (ANS) and hypothalamic-pituitary-adrenal (HPA) axis, influencing vulnerability for health problems across the lifespan. Little is known about the role of maternal sensitivity in influencing the development of the ANS in early life. Aims To examine associations among maternal sensitivity and infant behavioral distress and ANS and HPA axis reactivity to the Repeated Still-Face Paradigm (SFP-R), a dyadic stress task. Study Design Observational repeated measures study. Subjects Thirty-five urban, sociodemographically diverse mothers and their 6-month-old infants. Outcome Measures Changes in infant affective distress, heart rate, respiratory sinus arrhythmia (RSA), and T-wave amplitude (TWA) across episodes of the SFP-R were assessed. A measure of cortisol output (area under the curve) in the hour following cessation of the SFP-R was also obtained. Results Greater maternal insensitivity was associated with greater infant sympathetic activation (TWA) during periods of stress and tended to be associated with greater cortisol output following the SFP-R. There was also evidence for greater affective distress and less parasympathetic activation (RSA) during the SFP-R among infants of predominantly insensitive mothers. Conclusions Caregiving quality in early life may influence the responsiveness of the sympathetic and parasympathetic branches of the ANS as well as the HPA axis. Consideration of the ANS and HPA axis systems together provides a fuller representation of adaptive versus maladaptive stress responses. The findings highlight the importance of supporting high quality caregiving in the early years of life, which is likely to promote later health. PMID:24794304

  17. Lower corticosteroid skin blanching response is associated with severe COPD.

    Directory of Open Access Journals (Sweden)

    Susan J M Hoonhorst

    Full Text Available BACKGROUND: Chronic obstructive pulmonary disease (COPD is characterized by chronic airflow limitation caused by ongoing inflammatory and remodeling processes of the airways and lung tissue. Inflammation can be targeted by corticosteroids. However, airway inflammation is generally less responsive to steroids in COPD than in asthma. The underlying mechanisms are yet unclear. This study aimed to assess whether skin corticosteroid insensitivity is associated with COPD and COPD severity using the corticosteroid skin blanching test. METHODS: COPD patients GOLD stage I-IV (n = 27, 24, 22, and 16 respectively and healthy never-smokers and smokers (n = 28 and 56 respectively were included. Corticosteroid sensitivity was assessed by the corticosteroid skin blanching test. Budesonide was applied in 8 logarithmically increasing concentrations (0-100 μg/ml on subject's forearm. Assessment of blanching was performed after 7 hours using a 7-point scale (normal skin to intense blanching. All subjects performed spirometry and body plethysmography. RESULTS: Both GOLD III and GOLD IV COPD patients showed significantly lower skin blanching responses than healthy never-smokers and smokers, GOLD I, and GOLD II patients. Their area under the dose-response curve values of the skin blanching response were 586 and 243 vs. 1560, 1154, 1380, and 1309 respectively, p<0.05. Lower FEV1 levels and higher RV/TLC ratios were significantly associated with lower skin blanching responses (p = 0.001 and p = 0.004 respectively. GOLD stage I, II, III and IV patients had similar age and packyears. CONCLUSIONS: In this study, severe and very severe COPD patients had lower skin corticosteroid sensitivity than mild and moderate COPD patients and non-COPD controls with comparable age and packyears. Our findings together suggest that the reduced skin blanching response fits with a subgroup of COPD patients that has an early-onset COPD phenotype.

  18. Deceased donor skin allograft banking: Response and utilization

    Directory of Open Access Journals (Sweden)

    Gore Madhuri

    2010-10-01

    Full Text Available Background: In the absence of xenograft and biosynthetic skin substitutes, deceased donor skin allografts is a feasible option for saving life of patient with extensive burn injury in our country. Aims: The first deceased donor skin allograft bank in India became functional at Lokmanya Tilak Municipal (LTM medical college and hospital on 24 th April 2000. The response of Indian society to this new concept of skin donation after death and the pattern of utilization of banked allografts from 2000 to 2010 has been presented in this study. Settings and Design: This allograft skin bank was established by the department of surgery. The departments of surgery and microbiology share the responsibility of smooth functioning of the bank. Materials and Methods: The response in terms of number of donations and the profile of donors was analyzed from records. Pattern and outcome of allograft utilization was studied from specially designed forms. Results: During these ten years, 262 deceased donor skin allograft donations were received. The response showed significant improvement after counselling was extended to the community. Majority of the donors were above 70 years of age and procurement was done at home for most. Skin allografts from 249 donors were used for 165 patients in ten years. The outcome was encouraging with seven deaths in 151 recipients with burn injuries. Conclusions: Our experience shows that the Indian society is ready to accept the concept of skin donation after death. Use of skin allografts is life saving for large burns. We need to prepare guidelines for the establishment of more skin banks in the country.

  19. Responses of the autonomic nervous system in altitude adapted and high altitude pulmonary oedema subjects

    Science.gov (United States)

    Mathew, Lazar; Purkayastha, S. S.; Jayashankar, A.; Radhakrishnan, U.; Sen Gupta, J.; Nayar, H. S.

    1985-06-01

    Studies were carried out to ascertain the role of sympatho-parasympathetic responses in the process of adaptation to altitude. The assessment of status of autonomic balance was carried out in a group of 20 young male subjects by recording their resting heart rate, blood pressure, oral temperature, mean skin temperature, extremity temperatures, pupillary diameter, cold pressor response, oxygen consumption, cardioacceleration during orthostasis and urinary excretion of catecholamines; in a thermoneutral laboratory. The same parameters were repeated on day 3 and at weekly intervals for a period of 3 weeks, after exposing them to 3,500 m; and also after return to sea level. At altitude, similar studies were carried out in a group of 10 acclimatized lowlanders, 10 high altitude natives and 6 patients who had recently recovered from high altitude pulmonary oedema. In another phase, similar studies were done in two groups of subjects, one representing 15 subjects who had stayed at altitude (3,500 4,000 m) without any ill effects and the other comprising of 10 subjects who had either suffered from high altitude pulmonary oedema (HAPO) or acute mountain sickness (AMS). The results revealed sympathetic overactivity on acute induction to altitude which showed gradual recovery on prolonged stay, the high altitude natives had preponderance to parasympathetic system. Sympathetic preponderance may not be an essential etiological factor for the causation of maladaptation syndromes.

  20. Activation of Molecular Signatures for Antimicrobial and Innate Defense Responses in Skin with Transglutaminase 1 Deficiency.

    Science.gov (United States)

    Haneda, Takashi; Imai, Yasutomo; Uchiyama, Ryosuke; Jitsukawa, Orie; Yamanishi, Kiyofumi

    2016-01-01

    Mutations of the transglutaminase 1 gene (TGM1) are a major cause of autosomal recessive congenital ichthyoses (ARCIs) that are associated with defects in skin barrier structure and function. However, the molecular processes induced by the transglutaminase 1 deficiency are not fully understood. The aim of the present study was to uncover those processes by analysis of cutaneous molecular signatures. Gene expression profiles of wild-type and Tgm1-/-epidermis were assessed using microarrays. Gene ontology analysis of the data showed that genes for innate defense responses were up-regulated in Tgm1-/-epidermis. Based on that result, the induction of Il1b and antimicrobial peptide genes, S100a8, S100a9, Defb14, Camp, Slpi, Lcn2, Ccl20 and Wfdc12, was confirmed by quantitative real-time PCR. A protein array revealed that levels of IL-1β, G-CSF, GM-CSF, CXCL1, CXCL2, CXCL9 and CCL2 were increased in Tgm1-/-skin. Epidermal growth factor receptor (EGFR) ligand genes, Hbegf, Areg and Ereg, were activated in Tgm1-/-epidermis. Furthermore, the antimicrobial activity of an epidermal extract from Tgm1-/-mice was significantly increased against both Escherichia coli and Staphylococcus aureus. In the epidermis of ichthyosiform skins from patients with TGM1 mutations, S100A8/9 was strongly positive. The expression of those antimicrobial and defense response genes was also increased in the lesional skin of an ARCI patient with TGM1 mutations. These results suggest that the up-regulation of molecular signatures for antimicrobial and innate defense responses is characteristic of skin with a transglutaminase 1 deficiency, and this autonomous process might be induced to reinforce the defective barrier function of the skin. PMID:27442430

  1. TRPM8 mechanism of autonomic nerve response to cold in respiratory airway

    OpenAIRE

    Wang Cong-Yi; Tominaga Makoto; Johnson Richard D; Chen Meng; Ling Jennifer X; Xing Hong; Gu Jianguo

    2008-01-01

    Abstract Breathing cold air without proper temperature exchange can induce strong respiratory autonomic responses including cough, airway constriction and mucosal secretion, and can exacerbate existing asthma conditions and even directly trigger an asthma attack. Vagal afferent fiber is thought to be involved in the cold-induced respiratory responses through autonomic nerve reflex. However, molecular mechanisms by which vagal afferent fibers are excited by cold remain unknown. Using retrograd...

  2. The thyroid hormone receptors modulate the skin response to retinoids.

    Directory of Open Access Journals (Sweden)

    Laura García-Serrano

    Full Text Available BACKGROUND: Retinoids play an important role in skin homeostasis and when administered topically cause skin hyperplasia, abnormal epidermal differentiation and inflammation. Thyroidal status in humans also influences skin morphology and function and we have recently shown that the thyroid hormone receptors (TRs are required for a normal proliferative response to 12-O-tetradecanolyphorbol-13-acetate (TPA in mice. METHODOLOGY/PRINCIPAL FINDINGS: We have compared the epidermal response of mice lacking the thyroid hormone receptor binding isoforms TRα1 and TRβ to retinoids and TPA. Reduced hyperplasia and a decreased number of proliferating cells in the basal layer in response to 9-cis-RA and TPA were found in the epidermis of TR-deficient mice. Nuclear levels of proteins important for cell proliferation were altered, and expression of keratins 5 and 6 was also reduced, concomitantly with the decreased number of epidermal cell layers. In control mice the retinoid (but not TPA induced parakeratosis and diminished expression of keratin 10 and loricrin, markers of early and terminal epidermal differentiation, respectively. This reduction was more accentuated in the TR deficient animals, whereas they did not present parakeratosis. Therefore, TRs modulate both the proliferative response to retinoids and their inhibitory effects on skin differentiation. Reduced proliferation, which was reversed upon thyroxine treatment, was also found in hypothyroid mice, demonstrating that thyroid hormone binding to TRs is required for the normal response to retinoids. In addition, the mRNA levels of the pro-inflammatory cytokines TNFα and IL-6 and the chemotactic proteins S1008A and S1008B were significantly elevated in the skin of TR knock-out mice after TPA or 9-cis-RA treatment and immune cell infiltration was also enhanced. CONCLUSIONS/SIGNIFICANCE: Since retinoids are commonly used for the treatment of skin disorders, these results demonstrating that TRs

  3. No response of pancreatic hormones to hypoglycemia in diabetic autonomic neuropathy

    DEFF Research Database (Denmark)

    Hilsted, J; Madsbad, S; Krarup, T;

    1982-01-01

    The responses of pancreatic hormones (i.e. glucagon, pancreatic polypeptide, and somatostatin) to insulin-induced hypoglycemia were investigated in 18 insulin-dependent diabetics without residual beta-cell function and in 6 normal subjects. Nine of the diabetics had autonomic neuropathy, and 9 had...... no neuropathy. After hypoglycemia, no significant increase in any of the 3 pancreatic hormones was found in the diabetics with autonomic neuropathy, whereas significant increments were found in the diabetics without neuropathy and in the normal subjects. These results suggest that autonomic nervous activity...

  4. EEG and autonomic responses during performance of matching and non-matching to sample working memory tasks with emotional content.

    Directory of Open Access Journals (Sweden)

    Ana eGarcia

    2011-12-01

    Full Text Available Working memory (WM is a neural system responsible for the temporary storage of information and its utilization in problem solving. The central executive is theorized as the controller of storage functions that support WM. Neurophysiological data suggest that EEG theta and alpha oscillations in frontal and midline regions are involved in neural communication between the central executive and storage functions during WM performance. Emotion is known to modulate several memory systems, including WM, through central and peripheral pathways. However, the physiological correlations (electroencephalographic – EEG; autonomic nervous activity of the effect of emotion over WM are not well described. In this study we aimed to identify physiological responses related to emotional WM performance. EEG (21 channels, heart rate (HR and galvanic skin response (GSR recordings were obtained from 54 volunteers while performing delayed matching and non-matching to sample tasks (DMTS/DNMTS. Emotional and neutral pictures from the International Affective Picture System and geometric figures were used as stimuli. As expected, WM performance was accompanied by presence of theta (frontal and midline electrodes and Alpha power (parietal electrodes. Beta and gamma oscillations were concentrated in frontopolar and left temporal regions. DNMTS task was accompanied by increases in Beta power, HR and GSR compared to DMTS task. Correlation analysis showed a positive tendency for gamma in Fp2 site, ratio of LF/HF (HR low and high frequency and skin conductance in both tasks. The HR results indicate an inverse reaction related to parasympathetic and sympathetic nervous system during the performance of the tasks. Taken together, our results contribute to elucidate the complex interactions between central and autonomic nervous systems in the modulation of emotional WM tasks.

  5. Autonomic and Neuroendocrine Responses to a Psychosocial Stressor in Adults with Autistic Spectrum

    Science.gov (United States)

    Jansen, Lucres M. C.; Gispen-de Wied, Christine C.; Wiegant, Victor M.; Westenberg, Herman G. M.; Lahuis, Bertine E.; van Engeland, Herman

    2006-01-01

    Objective of the study was to replicate in adults our previous findings of decreased heart rate and normal endocrine responses to stress in autistic children and to elucidate the discrepancy between autonomic and endocrine stress responses by including epinephrine, norepinephrine, oxytocin and vasopressin measurements. Ten autistic spectrum…

  6. Control of the skin scarring response

    OpenAIRE

    Ferreira, Lydia M; Alfredo Gragnani; Fabianne Furtado; Bernardo Hochman

    2009-01-01

    There comes a time when the understanding of the cutaneous healing process becomes essential due to the need for a precocious tissue repair to reduce the physical, social, and psychological morbidity. Advances in the knowledge on the control of interaction among cells, matrix and growth factors will provide more information on the Regenerative Medicine, an emerging area of research in medical bioengineering. However, considering the dynamism and complexity of the cutaneous healing response, i...

  7. Behavioral and autonomic responses to acute restraint stress are segregated within the lateral septal area of rats.

    Directory of Open Access Journals (Sweden)

    Daniel G Reis

    Full Text Available BACKGROUND: The Lateral Septal Area (LSA is involved with autonomic and behavior responses associated to stress. In rats, acute restraint (RS is an unavoidable stress situation that causes autonomic (body temperature, mean arterial pressure (MAP and heart rate (HR increases and behavioral (increased anxiety-like behavior changes in rats. The LSA is one of several brain regions that have been involved in stress responses. The aim of the present study was to investigate if the neurotransmission blockade in the LSA would interfere in the autonomic and behavioral changes induced by RS. METHODOLOGY/PRINCIPAL FINDINGS: Male Wistar rats with bilateral cannulae aimed at the LSA, an intra-abdominal datalogger (for recording internal body temperature, and an implanted catheter into the femoral artery (for recording and cardiovascular parameters were used. They received bilateral microinjections of the non-selective synapse blocker cobalt chloride (CoCl(2, 1 mM/ 100 nL or vehicle 10 min before RS session. The tail temperature was measured by an infrared thermal imager during the session. Twenty-four h after the RS session the rats were tested in the elevated plus maze (EPM. CONCLUSIONS/SIGNIFICANCE: Inhibition of LSA neurotransmission reduced the MAP and HR increases observed during RS. However, no changes were observed in the decrease in skin temperature and increase in internal body temperature observed during this period. Also, LSA inhibition did not change the anxiogenic effect induced by RS observed 24 h later in the EPM. The present results suggest that LSA neurotransmission is involved in the cardiovascular but not the temperature and behavioral changes induced by restraint stress.

  8. Multifractal and nonlinear assessment of autonomous nervous system response during transient myocardial ischaemia

    International Nuclear Information System (INIS)

    We assess autonomic nervous system response during prolonged percutaneous transluminal coronary angioplasty (PTCA) using heart rate variability analysis with multifractal indices. These indices are used to evaluate the effects of the PTCA procedures at different arteries and locations. A total of 55 patients from the Staff3 database, with no prior history of myocardial infarction, were included in the study. The indices increased significantly during the transient ischaemia and reperfusion periods, indicating an increase in nonlinear multifractal characteristics and a change in temporal correlations in heartbeat fluctuations. This indicates that significant multifractal and nonlinear complex reactions in the autonomic control of the heart rate occurred during coronary artery occlusions and suggests that the multifractal indices may be a promising nonlinear technique for evaluating autonomic nervous system response in the presence of transient myocardial ischaemia

  9. Characterization of the Frictional Response of Squamata Shed Skin in Comparison to Human skin

    CERN Document Server

    Abdel-Aal, H A

    2010-01-01

    Deterministic surfaces are constructs of which profile, topography and textures are integral to the function of the system they enclose. They are designed to yield a predetermined rubbing response. Developing such entities relies on controlling the structure of the rubbing interface so that, not only the surface is of optimized topography, but also is able to self-adjust its behavior according to the evolution of sliding conditions. Inspirations for such designs are frequently encountered in natural species. In particular, and from a tribological point of view, Squamate Reptiles, offer diverse examples where surface texturing, submicron and nano-scale features, achieves frictional regulation. In this paper, we study the frictional response of shed skin obtained from a Python regius snake. The study employed a specially designed tribo-acoustic probe capable of measuring the coefficient of friction and detecting the acoustical behavior of the skin in vivo. The results confirm the anisotropy of the frictional re...

  10. Autonomous Sensory Meridian Response (ASMR) and Frisson: Mindfully Induced Sensory Phenomena That Promote Happiness

    Science.gov (United States)

    del Campo, Marisa A.; Kehle, Thomas J.

    2016-01-01

    There are many important phenomena involved in human functioning that are unnoticed, misunderstood, not applied, or do not pique the interest of the scientific community. Among these, "autonomous sensory meridian response" ("ASMR") and "frisson" are two very noteworthy instances that may prove to be therapeutically…

  11. Blunted autonomic response to volume expansion in formerly preeclamptic women with low plasma volume.

    NARCIS (Netherlands)

    Krabbendam, I.; Courtar, D.A.; Janssen, B.J.; Aardenburg, R.; Peeters, L.L.; Spaanderman, M.E.A.

    2009-01-01

    OBJECTIVE: We hypothesize that low plasma volume in normotensive formerly preeclamptic women reflects reduced venous storage capacity. To test this hypothesis, we compared circulatory and autonomic responses to acute volume loading between women with low and those with normal plasma volume. METHODS:

  12. Cardiovascular, hormonal and metabolic responses to graded exercise in juvenile diabetics with and without autonomic neuropathy

    DEFF Research Database (Denmark)

    Hilsted, J; Galbo, H; Christensen, N J

    1980-01-01

    Thirteen juvenile diabetics were studied in order to determine if decreased beat-to-beat variation during deep respiration, indicating abnormal autonomic nerve function, imply that cardiovascular, hormonal and metabolic responses are impaired. Patients with decreased beat-to-beat variation had to...

  13. Predicting Performance Under Stressful Conditions Using Galvanic Skin Response

    OpenAIRE

    Mundell, Carter; Vielma, Juan Pablo; Zaman, Tauhid

    2016-01-01

    The rapid growth of the availability of wearable biosensors has created the opportunity for using biological signals to measure worker performance. An important question is how to use such signals to not just measure, but actually predict worker performance on a task under stressful and potentially high risk conditions. Here we show that the biological signal known as galvanic skin response (GSR) allows such a prediction. We conduct an experiment where subjects answer arithmetic questions und...

  14. The autonomic and rate pressure product responses of Tai Chi practitioners

    Directory of Open Access Journals (Sweden)

    Michael A Figueroa

    2012-01-01

    Full Text Available Background: Spectral analysis of autonomic nervous system activity can provide insight into cardiovascular function. Rate pressure product is the parameter often targeted pharmacologically to decrease the incidence of myocardial events. Aim: The purpose of this study was to investigate whether or not Tai Chi Chuan practitioners would demonstrate autonomic responses that would be more cardioprotective when compared to non-trained controls. Materials and Methods: This was a cross-sectional study that measured the autonomic responses and rate pressure product of 2 groups of subjects; a Tai Chi Chuan trained (n = 13 and non-trained sedentary controls (n = 13 at rest and during 2 stressor phases that simulated functional activities of daily living. Results: The Tai Chi group maintained a greater parasympathetic outflow at rest and during the isometric grip stressor phase (P<0.05. Sympathetic outflow, systolic blood pressure and rate pressure product were significantly lower in the Tai Chi group at rest, during the isometric grip and standing stressor phases (P<0.05. Conclusion: Although a cause-and-effect relationship cannot be concluded in this study, the Tai Chi group was able to demonstrate efficiency of the myocardium with suppressed rate pressure product values and autonomic responses that favored parasympathetic outflow. This type of training may complement non-pharmacological anti-hypertensive therapy.

  15. Response of pig skin to fractionated radiation doses

    International Nuclear Information System (INIS)

    The individual components of a fractionated course of irradiation treatment have been considered separately. Methods of accurate measurement of individual parameters has brought to light different interpretations of the observations. Reasons are given for the necessity of having a radiobiological model which has a direct relevance to the clinical situation. Results are reported for fractionated regimes of irradiation in which the dose has been varied above and below normal tissue tolerance which has been equated with clinical skin necrosis. The components of the acute skin reaction, erythema, pigmentation and desquamation have been analysed separately and their contribution as a method of measurement assessed. Initially, the range of numerical scores attributed to erythema did not reach the scores attributed to necrosis but we now believe that radiation damage expressed as erythema can move directly into necrosis without passing through desquamation. Desquamation, on the other hand, only became a useful parameter at higher dose levels; it has also been shown to be a component associated with skin breakdown. Pigmentation showed no dose response at the dose levels employed in our experiments and it is our belief that this is due to this system being fully saturated under these circumstances. Measurement of the late radiation reaction in the skin has been considered in detail and our results have been expressed by comparing the relative lengths of irradiated and control fields in the same pig. From these findings iso-effect graphs have been constructed and time and fractionation factors have been derived. (author)

  16. Investigation research on autonomous responsive materials; Jiritsu oto zairyo ni kansuru chosa kenkyu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1996-03-01

    A survey was made on autonomous responsive materials as a new material which reversibly change molecular structures and the aggregation state according to external stimuli. Autonomous responsive materials imitate environmental responsibility in the living organism system and have sensing, control and active functions for external stimuli. The materials are highly efficient and environmentally friendly. In biomimetic materials for soft actuators, drastic changes by temperature of elastic modulus of water-swollen hydrogel are used to the motion. In order to molecularly design stimulus-responsible polymer gel, studied are the relation between the micro structure and stimulus responsibility, dynamic correlation between the micro structure and the macro structure, etc. In the biomedical field, new cure and diagnosis using innovative materials are expected, and the application of autonomous responsive materials to the field is studied. For example, using hydrogel responding the temperature and the surface and controlling by temperature the interaction with components of the organism such as protein and cells, drug delivery in the organism is optimized. Also studied is the application of hydrophilic/hydrophobic changes by temperature to the chromatography. 215 refs., 47 figs., 11 tabs.

  17. Cardiac autonomic responses induced by mental tasks and the influence of musical auditory stimulation.

    Science.gov (United States)

    Barbosa, Juliana Cristina; Guida, Heraldo L; Fontes, Anne M G; Antonio, Ana M S; de Abreu, Luiz Carlos; Barnabé, Viviani; Marcomini, Renata S; Vanderlei, Luiz Carlos M; da Silva, Meire L; Valenti, Vitor E

    2014-08-01

    We investigated the acute effects of musical auditory stimulation on cardiac autonomic responses to a mental task in 28 healthy men (18-22 years old). In the control protocol (no music), the volunteers remained at seated rest for 10 min and the test was applied for five minutes. After the end of test the subjects remained seated for five more minutes. In the music protocol, the volunteers remained at seated rest for 10 min, then were exposed to music for 10 min; the test was then applied over five minutes, and the subjects remained seated for five more minutes after the test. In the control and music protocols the time domain and frequency domain indices of heart rate variability remained unchanged before, during and after the test. We found that musical auditory stimulation with baroque music did not influence cardiac autonomic responses to the mental task. PMID:25129880

  18. Analysis of Individual Variations in Autonomic Responses to Urban and Forest Environments.

    Science.gov (United States)

    Kobayashi, Hiromitsu; Song, Chorong; Ikei, Harumi; Kagawa, Takahide; Miyazaki, Yoshifumi

    2015-01-01

    Autonomic responses to urban and forest environments were studied in 625 young male subjects. The experimental sites were 57 forests and 57 urban areas across Japan. The subjects viewed the landscape (forest or urban environment) for a period of 15 min while sitting on a chair. During this period, heart rate variability (HRV) was monitored continuously. The results were presented as histograms and analyzed with special reference to individual variations. Approximately 80% of the subjects showed an increase in the parasympathetic indicator of HRV (lnHF), whereas the remaining subjects showed a decrease in the parasympathetic activity. Similarly, 64.0% of the subjects exhibited decreases in the sympathetic indicator of HRV (ln[LF/HF]), whereas the remaining subjects showed opposite responses. Analysis of the distribution of HRV indices (lnHF and ln[LF/HF]) demonstrated the effect of forest environments on autonomic activity more specifically than the conventional analysis based on the difference in mean values.

  19. Kissing reduces allergic skin wheal responses and plasma neurotrophin levels.

    Science.gov (United States)

    Kimata, Hajime

    2003-11-01

    The effect of kissing on allergen-induced skin wheal responses and plasma neurotrophin levels were studied in 30 normal subjects, 30 patients with allergic rhinitis (AR), and 30 patients with atopic dermatitis (AD). All of the patients with AR or AD are allergic to house dust mite (HDM) and Japanese cedar pollen (JCP). They are all Japanese and they do not kiss habitually. The subject kissed freely during 30 min with their lover or spouse alone in a room with closed doors while listening to soft music. Before and after kissing, skin prick tests were performed using commercial HDM allergen, JCP allergen, as well as histamine and control solution, and wheal responses were measured. Simultaneously, plasma levels of neurotrophin, including nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), neurotrophin-3 (NT-3) and -4 (NT-4) were measured. Kissing significantly reduced wheal responses induced by HDM and JCP, but not by histamine, and decreased plasma levels of NGF, BDNF, NT-3, and NT-4 in patients with AR or AD, while it failed to do so in normal subjects. These finding indicate that kissing have some implication in the study of neuroimmunology in allergic patients. PMID:14637240

  20. Autonomic neuropathy

    DEFF Research Database (Denmark)

    Hilsted, J

    1980-01-01

    In order to elucidate the physiological significance of autonomic neuropathy in juvenile diabetics, cardiovascular, hormonal and metabolic functions have been investigated in three groups of juvenile diabetics: One group had no signs of neuropathy, one group had presumably slight autonomic...... neuropathy (reduced beat-to-beat variation in heart rate during hyperventilation) and one group had clinically severe autonomic neuropathy, defined by presence of orthostatic hypotension. In all three experimental situations we found sympathetic dysfunction causing cardiovascular and/or hormonal...... maladjustments in patients with autonomic neuropathy. Regarding metabolic functions we found normal responses to graded exercise and insulin-induced hypoglycemia in patients with autonomic neuropathy in spite of blunted catecholamine responses, suggesting increased sensitivity of glycogen stores and adipose...

  1. How Can Music Influence the Autonomic Nervous System Response in Patients with Severe Disorder of Consciousness?

    Science.gov (United States)

    Riganello, Francesco; Cortese, Maria D; Arcuri, Francesco; Quintieri, Maria; Dolce, Giuliano

    2015-01-01

    Activations to pleasant and unpleasant musical stimuli were observed within an extensive neuronal network and different brain structures, as well as in the processing of the syntactic and semantic aspects of the music. Previous studies evidenced a correlation between autonomic activity and emotion evoked by music listening in patients with Disorders of Consciousness (DoC). In this study, we analyzed retrospectively the autonomic response to musical stimuli by mean of normalized units of Low Frequency (nuLF) and Sample Entropy (SampEn) of Heart Rate Variability (HRV) parameters, and their possible correlation to the different complexity of four musical samples (i.e., Mussorgsky, Tchaikovsky, Grieg, and Boccherini) in Healthy subjects and Vegetative State/Unresponsive Wakefulness Syndrome (VS/UWS) patients. The complexity of musical sample was based on Formal Complexity and General Dynamics parameters defined by Imberty's semiology studies. The results showed a significant difference between the two groups for SampEn during the listening of Mussorgsky's music and for nuLF during the listening of Boccherini and Mussorgsky's music. Moreover, the VS/UWS group showed a reduction of nuLF as well as SampEn comparing music of increasing Formal Complexity and General Dynamics. These results put in evidence how the internal structure of the music can change the autonomic response in patients with DoC. Further investigations are required to better comprehend how musical stimulation can modify the autonomic response in DoC patients, in order to administer the stimuli in a more effective way.

  2. How can music influence the Autonomic Nervous System response in patients with severe Disorder of Consciousness?

    Directory of Open Access Journals (Sweden)

    Francesco eRiganello

    2015-12-01

    Full Text Available Activations to pleasant and unpleasant musical stimuli were observed within an extensive neuronal network and different brain structures, as well as in the processing of the syntactic and semantic aspects of the music. Previous studies evidenced a correlation between autonomic activity and emotion evoked by music listening in patients with Disorders of Consciousness (DoC. In this study, we analyzed retrospectively the autonomic response to musical stimuli by mean of normalized units of Low Frequency (nuLF and Sample Entropy (SampEn of Heart Rate Variability (HRV parameters, and their possible correlation to the different complexity of four musical samples (i.e. Mussorgsky, Tchaikovsky, Grieg and Boccherini in Healthy subjects and Vegetative State/Unresponsive Wakefulness Syndrome (VS/UWS patients.The complexity of musical sample was based on Formal Complexity and General Dynamics parameters defined by Imberty’s semiology studies.The results showed a significant difference between the two groups for SampEn during the listening of Mussorgsky’s music and for nuLF during the listening of Boccherini and Mussorgsky’s music.Moreover, the VS/UWS group showed a reduction of nuLF as well as SampEn comparing music of increasing Formal Complexity and General Dynamics.These results put in evidence how the internal structure of the music can change the autonomic response in patients with DoC. Further investigations are required to better comprehend how musical stimulation can modify the autonomic response in DoC patients, in order to administer the stimuli in a more effective way.

  3. How Can Music Influence the Autonomic Nervous System Response in Patients with Severe Disorder of Consciousness?

    Science.gov (United States)

    Riganello, Francesco; Cortese, Maria D; Arcuri, Francesco; Quintieri, Maria; Dolce, Giuliano

    2015-01-01

    Activations to pleasant and unpleasant musical stimuli were observed within an extensive neuronal network and different brain structures, as well as in the processing of the syntactic and semantic aspects of the music. Previous studies evidenced a correlation between autonomic activity and emotion evoked by music listening in patients with Disorders of Consciousness (DoC). In this study, we analyzed retrospectively the autonomic response to musical stimuli by mean of normalized units of Low Frequency (nuLF) and Sample Entropy (SampEn) of Heart Rate Variability (HRV) parameters, and their possible correlation to the different complexity of four musical samples (i.e., Mussorgsky, Tchaikovsky, Grieg, and Boccherini) in Healthy subjects and Vegetative State/Unresponsive Wakefulness Syndrome (VS/UWS) patients. The complexity of musical sample was based on Formal Complexity and General Dynamics parameters defined by Imberty's semiology studies. The results showed a significant difference between the two groups for SampEn during the listening of Mussorgsky's music and for nuLF during the listening of Boccherini and Mussorgsky's music. Moreover, the VS/UWS group showed a reduction of nuLF as well as SampEn comparing music of increasing Formal Complexity and General Dynamics. These results put in evidence how the internal structure of the music can change the autonomic response in patients with DoC. Further investigations are required to better comprehend how musical stimulation can modify the autonomic response in DoC patients, in order to administer the stimuli in a more effective way. PMID:26696818

  4. Palmar skin blood flow and temperature responses throughout endoscopic sympathectomy.

    Science.gov (United States)

    Crandall, Craig G; Meyer, Dan M; Davis, Scott L; Dellaria, Suzanne M

    2005-01-01

    Thoracic surgical sympathectomy is often performed to treat primary palmar and axillary hyperhidrosis. An increase in palmar skin temperature is frequently used to identify the success of the procedure. Because changes in palmar skin temperature occur secondary to changes in skin blood flow, the objective of this study was to test the hypothesis that monitoring palmar skin blood flow would provide greater temporal resolution relative to monitoring palmar skin temperature. In 11 patients with palmar and/or axillary hyperhidrosis, we measured palmar skin temperature and blood flow (via laser Doppler flowmetry) throughout the sympathectomy procedure. Five minutes after the initial cautery, skin blood flow increased from 48 +/- 7 perfusion units to 121 +/- 17 perfusion units (P 0.05). The time required to reach peak skin blood flow (22 +/- 3 min) was significantly less than the time required to reach peak skin temperature (34 +/- 0.3 min; P <0.001). Finally at 5, 10, and 15 min after the initial cautery, skin blood flow increased to a larger percentage of the total increase in skin blood flow relative skin temperature (all P <0.006). These data suggest that monitoring skin blood flow provides greater temporal resolution when compared with monitoring skin temperature during thoracic sympathectomy. However, the initial cautery of the parietal pleura over the ganglion may result in increases in skin blood flow before physical disruption of the ganglion. This occurrence may limit the utility of skin blood-flow measurements in identifying the success of the procedure. PMID:15616091

  5. A study on the frictional response of reptilian shed skin

    International Nuclear Information System (INIS)

    Deterministic surfaces are constructs of which profile, topography and textures are integral to the function of the system they enclose. They are designed to yield a predetermined tribological response. Developing such entities relies on controlling the structure of the rubbing interface so that, not only the surface is of optimized topography, but also is able to self-adjust its tribological behaviour according to the evolution of sliding conditions. In seeking inspirations for such designs, many engineers are turning toward the biological world to study the construction and behaviour of bio-analogues, and to probe the role surface topography assumes in conditioning of frictional response. That is how a bio-analogue can self-adjust its tribological response to adapt to habitat constraints. From a tribological point of view, Squamate Reptiles, offer diverse examples where surface texturing, submicron and nano-scale features, achieves frictional regulation. In this paper, we study the frictional response of shed skin obtained from a snake (Python regius). The study employed a specially designed tribo-acoustic probe capable of measuring the coefficient of friction and detecting the acoustical behavior of the skin in vivo. The results confirm the anisotropy of the frictional response of snakes. The coefficient of friction depends on the direction of sliding: the value in forward motion is lower than that in the backward direction. Diagonal and side winding motion induces a different value of the friction coefficient. We discuss the origin of such a phenomenon in relation to surface texturing and study the energy constraints, implied by anisotropic friction, on the motion of the reptile.

  6. Diabetic autonomic neuropathy.

    Science.gov (United States)

    Freeman, Roy

    2014-01-01

    Diabetes mellitus is the commonest cause of an autonomic neuropathy in the developed world. Diabetic autonomic neuropathy causes a constellation of symptoms and signs affecting cardiovascular, urogenital, gastrointestinal, pupillomotor, thermoregulatory, and sudomotor systems. Several discrete syndromes associated with diabetes cause autonomic dysfunction. The most prevalent of these are: generalized diabetic autonomic neuropathy, autonomic neuropathy associated with the prediabetic state, treatment-induced painful and autonomic neuropathy, and transient hypoglycemia-associated autonomic neuropathy. These autonomic manifestations of diabetes are responsible for the most troublesome and disabling features of diabetic peripheral neuropathy and result in a significant proportion of the mortality and morbidity associated with the disease.

  7. Sympathetic skin response: a new test to diagnose erectile dysfunction

    Institute of Scientific and Technical Information of China (English)

    Guang-You ZHU; Yan SHEN

    2001-01-01

    Electrophysiological monitoring of the activity of the penile sympathetic skin responses (PSSR) in healthy men and patients with erectile dysfunction (ED). Methods: PSSR were recorded from the skin of penis with disk electrodes at the time of electric stimulation of left median nerves. Results: PSSR were recorded from all the healthy men and almost all the patients. In healthy men the latency of P0, the latency of N1, the duration of N1 and the amplitude of N1 were 1249 ± 111 ms, 2239 ± 286 ms, 1832 ± 505 ms and 470 μV (median), respectively. In ED patients the latency of P0, the latency of N1, the duration of N1 and the amplitude of N1 were 1467 ± 183 ms ( P < 0.01), 2561±453 ms (P <0.05), 2560±861 ms (P <0.01) and 91 μV (P <0.01), respectively. The normal latency of P0 was less than 1471 ms. The normal amplitude of N1 was more than 235 μV. According to this normal value, of 20 patients 11 showed longer latency of P0, and 14 showed lower amplitude of N1 as compared with those of normal subjects.Conclusion: PSSR can be used as an electrophysiological method in assisting the diagnosis of ED.

  8. Novel phenotype in beagle dogs characterized by skin response to compound 48/80 focusing on skin mast cell degranulation.

    Science.gov (United States)

    Uchida, Mitsuhiro; Ito, Fumi; Tsuchiya, Toshiyuki; Shoji, Yoko; Kurosawa, Toru

    2015-01-01

    Beagle dogs have long been employed in toxicology studies and as skin disease models. Compared with other experimental animal species, they are known to be susceptible to skin responses, such as rashes, from exposure to various chemical compounds. Here, a unique dog phenotype was identified that showed no skin response to compound 48/80, a mast cell degranulating agent. Although the skin responses to intradermal injection of polyoxyethylene castor oil derivative (HCO-60, a nonionic detergent), histamine dihydrochloride, concanavalin A (IgE receptor-mediated stimuli), or calcium ionophore A23187 were comparable in wild-type (WT) dogs and these nonresponder (NR) dogs, only the response to compound 48/80 was entirely absent from NR dogs. The skin mast cell density and histamine content per mast cell were histologically comparable between WT and NR dogs. By checking for skin responses to compound 48/80, NR dogs were found to exist at the proportion of 17-20% among four animal breeders. From retrospective analysis of in-house breeding histories, the NR phenotype appears to conform to the Mendelian pattern of recessive inheritance. The standard skin response in WT dogs developed at 2-4 months of age. In conclusion, this unique phenotype, typified by insensitivity in the compound 48/80-induced degranulation pathway in mast cells, has been widely retained by recessive inheritance in beagle dogs among general experimental animal breeders. The knowledge concerning this phenotype could lead to better utilization of dogs in studies and aid in model development. PMID:26062768

  9. Comparison of skin stripping, in vitro release, and skin blanching response methods to measure dose response and similarity of triamcinolone acetonide cream strengths from two manufactured sources.

    Science.gov (United States)

    Pershing, Lynn K; Bakhtian, Shahrzad; Poncelet, Craig E; Corlett, Judy L; Shah, Vinod P

    2002-05-01

    The collective studies compare in vitro drug release, in vivo skin stripping, and skin blanching response methods for dose responsiveness and bioequivalence assessment of triamcinolone acetonide cream products, as a function of application duration, drug concentration, and manufacturer source. Commercially available triamcinolone acetonide creams (0.025%, 0.1%, and 0.5%) from two manufacturers were evaluated in vitro for rate and extent of drug release across synthetic membranes and in vivo for rate, extent, and variability of drug uptake into human stratum corneum and skin blanching response in human forearm skin. Data demonstrate that increasing triamcinolone acetonide cream concentration applied increased the rate and extent of drug released in vitro as well as the extent of drug uptake and skin blanching response in human skin in vivo. No difference (p blanching response methods. Dermatopharmacokinetic analysis of triamcinonide acetonide in vivo is therefore dose responsive to drug concentration applied and application duration and agrees with in vivo skin blanching results. Data support the use of dermatopharmacokinetic methods for bioequivalence and bioavailability assessment of topical drug products.

  10. Hyperhidrosis and sympathetic skin response in chronic alcoholic patients.

    Science.gov (United States)

    Tugnoli, V; Eleopra, R; De Grandis, D

    1999-02-01

    Palmoplantar hyperhidrosis is frequently observed in patients with a clinical history of chronic abnormal alcoholic intake. It can be related to peripheral or central mechanisms such as abnormal spontaneous activity in peripheral damaged fibres; receptor hypersensitivity; compensatory incremented activity in segmentary anhidrosis; or impairment of central sweat control. With the aim of quantifying this phenomenon and of identifying its possible origin, sympathetic skin response (SSR) analysis was performed in 20 chronic alcoholic patients with clinical diffuse acral hyperhidrosis, compared with 30 normal subjects and 2 patients affected by primary palmoplantar hyperhidrosis (PPH). SSRs were recorded by disc electrodes place on the hands and feet, simultaneously. At the hand level two recording sites were selected: palm-dorsum proximally and ventral-dorsal tip of the third finger distally. Attention was paid to the number of SSR after a single endogenous or exogenous stimulus. The alcoholic patients were divided into two groups, with and without mild polyneuropathy. Both patient groups showed synchronous SSR at recording sites, with the same pattern and the normal delay between upper and lower arms. In the control group one response was generally related to a single stimulus; if more responses were elicited an evident adaptation was shown; in the two groups of patients an increase of the waves was observed in all the recording sites without any adaptation. The SSR profile described in alcoholic patients was observed also in PPH. The pattern of SSR waves in alcoholic patients seems to suggest a possible central origin of this type of hyperhidrosis. PMID:10212744

  11. Evaluating Autonomic Parameters: The Role of Sleep ‎Duration in Emotional Responses to Music ‎

    OpenAIRE

    Atefeh Goshvarpour; Ataollah Abbasi; Ateke Goshvarpour

    2016-01-01

    Objective: It has been recognized that sleep has an important effect on emotion processing. The aim ‎of this study was to investigate the effect of previous night sleep duration on autonomicresponses to musical stimuli in different emotional contexts.‎Method: A frequency based measure of GSR, PR and ECG signals were examined in 35 healthy ‎students in three groups of oversleeping, lack of sleep and normal sleep. ‎Results: The results of this study revealed that regardless of the emotional c...

  12. Prediction of nuclear submariner adaptability from autonomic indices and Rorschach Inkblot responses. Interim report

    Energy Technology Data Exchange (ETDEWEB)

    Weybrew, B.B.; Molish, H.B.

    1986-09-09

    To identify the most valid predictors of submariner adaptability, the authors derived 23 indices from the responses of 170 nuclear submariners to the Rorschach Inkblot Test, 11 measures of Autonomic Nervous System (ANS) reactivity to contrived stress, and five adjustment criteria. Factor analysis of this 39x39 correlation matrix yielded two Rorschach Factors, one of which correlated with three criterion dimensions. Two unique factors were also discovered, one, a structured ANS factor, and the other, a complex criterion scale. Selected Rorschach scores and, to a lesser extent, certain ANS indices emanating from this study, may be usefully-valid predictors of the adaptability of nuclear submariners during long patrols.

  13. On-line identification of the speed, steering and diving response parameters of an autonomous underwater vehicle from experimental data

    OpenAIRE

    Bahrke, Fredric G.

    1992-01-01

    Approved for public release; distribution is unlimited. The experimental response data from autonomous maneuvering using the NPS AUV II vehicle has been analyzed with a view to defining Kalman filters to provide on-line estimates of system parameters and their variability. Kalman filters, designed for parameter estimation are expected to be the first step in the development of autonomous fault detection systems for underwater vehicles. Secondly, extraction of vehicle hydrodynamic coefficie...

  14. Synchronization of Sacral Skin Blood Flow Oscillations in Response to Local Heating

    OpenAIRE

    Jan, Yih-Kuen; Liao, Fuyuan

    2011-01-01

    Local heating causes an increase in skin blood flow by activating sensory axon reflex and metabolic nitric oxide controls. It has been observed that the remote skin area without temperature changes also shows a slightly increase in blood flow. The responsible mechanism of this indirect vasodilation remains unclear. We hypothesized that the remote skin area will have enhanced synchronization of blood flow oscillations (BFO), thus inducing a vasodilatory response. We studied BFO in two sites se...

  15. Sinoatrial tissue of crucian carp heart has only negative contractile responses to autonomic agonists

    Directory of Open Access Journals (Sweden)

    Hälinen Mervi

    2010-06-01

    Full Text Available Abstract Background In the anoxia-tolerant crucian carp (Carassius carassius cardiac activity varies according to the seasons. To clarify the role of autonomic nervous control in modulation of cardiac activity, responses of atrial contraction and heart rate (HR to carbacholine (CCh and isoprenaline (Iso were determined in fish acclimatized to winter (4°C, cold-acclimated, CA and summer (18°C, warm-acclimated, WA temperatures. Results Inhibitory action of CCh was much stronger on atrial contractility than HR. CCh reduced force of atrial contraction at an order of magnitude lower concentrations (EC50 2.75-3.5·10-8 M in comparison to its depressive effect on HR (EC50 1.23-2.02·10-7 M (P -8 M and 10-7 M CCh, respectively (P + current, IK,CCh, with an EC50 value of 3-4.5·10-7 M and inhibited Ca2+ current (ICa by 28 ± 8% and 51 ± 6% at 10-7 M and 10-6 M, respectively. These currents can explain the shortening of AP. Iso did not elicit any responses in crucian carp sinoatrial preparations nor did it have any effect on atrial ICa, probably due to the saturation of the β-adrenergic cascade in the basal state. Conclusion In the crucian carp, HR and force of atrial contraction show cardio-depressive responses to the cholinergic agonist, but do not have any responses to the β-adrenergic agonist. The scope of inhibitory regulation by CCh is increased by the high basal tone of the adenylate cyclase-cAMP cascade. Higher concentrations of CCh were required to induce IK,CCh and inhibit ICa than was needed for CCh's negative inotropic effect on atrial muscle suggesting that neither IK,CCh nor ICa alone can mediate CCh's actions but they might synergistically reduce AP duration and atrial force production. Autonomic responses were similar in CA winter fish and WA summer fish indicating that cardiac sensitivity to external modulation by the autonomic nervous system is not involved in seasonal acclimatization of the crucian carp heart to cold and anoxic

  16. Autonomous Sensory Meridian Response (ASMR: a flow-like mental state

    Directory of Open Access Journals (Sweden)

    Emma L. Barratt

    2015-03-01

    Full Text Available Autonomous Sensory Meridian Response (ASMR is a previously unstudied sensory phenomenon, in which individuals experience a tingling, static-like sensation across the scalp, back of the neck and at times further areas in response to specific triggering audio and visual stimuli. This sensation is widely reported to be accompanied by feelings of relaxation and well-being. The current study identifies several common triggers used to achieve ASMR, including whispering, personal attention, crisp sounds and slow movements. Data obtained also illustrates temporary improvements in symptoms of depression and chronic pain in those who engage in ASMR. A high prevalence of synaesthesia (5.9% within the sample suggests a possible link between ASMR and synaesthesia, similar to that of misophonia. Links between number of effective triggers and heightened flow state suggest that flow may be necessary to achieve sensations associated with ASMR.

  17. Autonomous Sensory Meridian Response (ASMR): a flow-like mental state.

    Science.gov (United States)

    Barratt, Emma L; Davis, Nick J

    2015-01-01

    Autonomous Sensory Meridian Response (ASMR) is a previously unstudied sensory phenomenon, in which individuals experience a tingling, static-like sensation across the scalp, back of the neck and at times further areas in response to specific triggering audio and visual stimuli. This sensation is widely reported to be accompanied by feelings of relaxation and well-being. The current study identifies several common triggers used to achieve ASMR, including whispering, personal attention, crisp sounds and slow movements. Data obtained also illustrates temporary improvements in symptoms of depression and chronic pain in those who engage in ASMR. A high prevalence of synaesthesia (5.9%) within the sample suggests a possible link between ASMR and synaesthesia, similar to that of misophonia. Links between number of effective triggers and heightened flow state suggest that flow may be necessary to achieve sensations associated with ASMR.

  18. Modifications of Control Loop to Improve the Depth Response of Autonomous Underwater Vehicles

    Directory of Open Access Journals (Sweden)

    Sheng-Ping Hsu

    2014-01-01

    Full Text Available During a constant depth maneuver of an autonomous underwater vehicle (AUV, its pitch attitude and stern plane deflections create forces and moments to achieve equilibrium in the vertical plane. If an AUV has a proportional controller only in its depth control loop, then different weights or centers of gravity will cause different steady-state depth errors at trimmed conditions. In general, a steady-state depth error can be eliminated by adding an integral controller in the depth control loop. However, an improper integrator may lead to a bad transient response, even though the steady-state depth error can finally be eliminated. To remove the steady-state depth error, this study proposes methods that adjust the depth command and add a switching integral controller in the depth control loop. Simulation results demonstrate that the steady-state depth error can be eliminated and the transient response can be improved.

  19. Skin thermal response to sapphire contact and cryogen spray cooling: a comparative study based on measurements in a skin phantom

    Science.gov (United States)

    Torres, Jorge H.; Nelson, J. Stuart; Tanenbaum, B. S.; Anvari, Bahman

    2000-05-01

    Non-specific thermal injury to the epidermis may occur as a result of laser treatment of cutaneous hypervascular malformations (e.g. port wine stains) and other dermatoses. Methods to protect the epidermis from thermal injury include sapphire contact cooling (SCC) and cryogen spray cooling (CSC). Evaluation of the skin thermal response to either cooling method and better understanding of the heat transfer process at the skin surface are essential for further optimization of cooling technique during laser therapy. We present internal temperature measurements in an epoxy resin phantom in response to both SCC and CSC, and use the results in conjunction with a mathematical model to predict the temperature distributions within human skin. Based on our results, a conductive heat transfer process at the skin interface appears to be the primary mechanism for both SCC and CSC. In the case of CSC, 'film cooling' rather than 'evaporative cooling' seems to be the dominant mode during the spurt duration. Currently, due to the lower temperature of the cryogen film and its shorter time of application, CSC produces larger temperature reductions at the skin surface and smaller temperature reductions at depths greater than 200 micrometer (i.e., higher spatial selectivity) when compared to SCC. However, SCC can potentially induce temperature reductions comparable to those produced by CSC if a sapphire temperature similar to that for a cryogen could be achieved in practice.

  20. Sympathetic skin response--a method of assessing unmyelinated axon dysfunction in peripheral neuropathies.

    OpenAIRE

    Shahani, B T; Halperin, J J; Boulu, P; Cohen, J.

    1984-01-01

    The sympathetic skin response (SSR) was measured in 33 patients with peripheral neuropathies and in 30 normal control subjects. Abnormalities of the response were correlated with clinical, pathologic, and EMG observations. The response was usually absent in axonal neuropathies, but present in demyelinating disorders. Abnormalities of the sympathetic skin response did not correlate well with clinical evidence of dysautonomia, but were a reliable indicator of disorders affecting unmyelinated ax...

  1. Redundancy analysis of autonomic and self-reported, responses to induced emotions.

    Science.gov (United States)

    Friedman, Bruce H; Stephens, Chad L; Thayer, Julian F

    2014-04-01

    The issue of concordance among the elements of emotional states has been prominent in the literature since Lang (1968) explored the topic in relation to therapy for anxiety. Since that time, a consensus has emerged that concordance among these components is relatively low. To address this issue, redundancy analysis, a technique for examining directional relationships between two sets of multivariate data, was applied to data from a previously published study (Stephens, Christie, & Friedman, 2010). Subjects in this study listened to emotion-inducing music and viewed affective films while a montage of autonomic variables, as well as self-reported affective responses, were recorded. Results indicated that approximately 27-28% of the variance in self-reported affect could be explained by autonomic variables, and vice-versa. When all of the constraints of this emotion research paradigm are considered, these levels of explained variance indicate substantial coherence between feelings and physiology during the emotion inductions. These results are considered vis-à-vis the low levels of coherence that have often been reported in the literature. PMID:24380823

  2. Human skin pigmentation: melanocytes modulate skin color in response to stress.

    Science.gov (United States)

    Costin, Gertrude-E; Hearing, Vincent J

    2007-04-01

    All organisms, from simple invertebrates to complex human beings, exist in different colors and patterns, which arise from the unique distribution of pigments throughout the body. Pigmentation is highly heritable, being regulated by genetic, environmental, and endocrine factors that modulate the amount, type, and distribution of melanins in the skin, hair, and eyes. In addition to its roles in camouflage, heat regulation, and cosmetic variation, melanin protects against UV radiation and thus is an important defense system in human skin against harmful factors. Being the largest organ of the body that is always under the influence of internal and external factors, the skin often reacts to those agents by modifying the constitutive pigmentation pattern. The focus of this review is to provide an updated overview of important physiological and biological factors that increase pigmentation and the mechanisms by which they do so. We consider endocrine factors that induce temporary (e.g., during pregnancy) or permanent (e.g., during aging) changes in skin color, environmental factors (e.g., UV), certain drugs, and chemical compounds, etc. Understanding the mechanisms by which different factors and compounds induce melanogenesis is of great interest pharmaceutically (as therapy for pigmentary diseases) and cosmeceutically (e.g., to design tanning products with potential to reduce skin cancer risk). PMID:17242160

  3. Distribution of T Cells in Rainbow Trout (Oncorhynchus mykiss) Skin and Responsiveness to Viral Infection

    Science.gov (United States)

    Leal, Esther; Granja, Aitor G.; Zarza, Carlos; Tafalla, Carolina

    2016-01-01

    Although the skin constitutes the first line of defense against waterborne pathogens, there is a great lack of information regarding the skin associated lymphoid tissue (SALT) and whether immune components of the skin are homogeneously distributed through the surface of the fish is still unknown. In the current work, we have analyzed the transcription of several immune genes throughout different rainbow trout (Oncorhynchus mykiss) skin areas. We found that immunoglobulin and chemokine gene transcription levels were higher in a skin area close to the gills. Furthermore, this skin area as well as other anterior sections also transcribed significantly higher levels of many different immune genes related to T cell immunity such as T cell receptor α (TCRα), TCRγ, CD3, CD4, CD8, perforin, GATA3, Tbet, FoxP3, interferon γ (IFNγ), CD40L and Eomes in comparison to posterior skin sections. In agreement with these results, immunohistochemical analysis revealed that anterior skin areas had a higher concentration of CD3+ T cells and flow cytometry analysis confirmed that the percentage of CD8+ T lymphocytes was also higher in anterior skin sections. These results demonstrate for the first time that T cells are not homogeneously distributed throughout the teleost skin. Additionally, we studied the transcriptional regulation of these and additional T cell markers in response to a bath infection with viral hemorrhagic septicemia virus (VHSV). We found that VHSV regulated the transcription of several of these T cell markers in both the skin and the spleen; with some differences between anterior and posterior skin sections. Altogether, our results point to skin T cells as major players of teleost skin immunity in response to waterborne viral infections. PMID:26808410

  4. Considerations on command and response language features for a network of heterogeneous autonomous computers

    Science.gov (United States)

    Engelberg, N.; Shaw, C., III

    1984-01-01

    The design of a uniform command language to be used in a local area network of heterogeneous, autonomous nodes is considered. After examining the major characteristics of such a network, and after considering the profile of a scientist using the computers on the net as an investigative aid, a set of reasonable requirements for the command language are derived. Taking into account the possible inefficiencies in implementing a guest-layered network operating system and command language on a heterogeneous net, the authors examine command language naming, process/procedure invocation, parameter acquisition, help and response facilities, and other features found in single-node command languages, and conclude that some features may extend simply to the network case, others extend after some restrictions are imposed, and still others require modifications. In addition, it is noted that some requirements considered reasonable (user accounting reports, for example) demand further study before they can be efficiently implemented on a network of the sort described.

  5. Basic taste stimuli elicit unique responses in facial skin blood flow.

    Directory of Open Access Journals (Sweden)

    Hideaki Kashima

    Full Text Available Facial expression changes characteristically with the emotions induced by basic tastes in humans. We tested the hypothesis that the five basic tastes also elicit unique responses in facial skin blood flow. Facial skin blood flow was measured using laser speckle flowgraphy in 16 healthy subjects before and during the application of basic taste stimuli in the oral cavity for 20 s. The skin blood flow in the eyelid increased in response to sweet and umami taste stimuli, while that in the nose decreased in response to a bitter stimulus. There was a significant correlation between the subjective hedonic scores accompanying these taste stimuli and the above changes in skin blood flow. These results demonstrate that sweet, umami, and bitter tastes induce unique changes in facial skin blood flow that reflect subjective hedonic scores.

  6. Skin.

    Science.gov (United States)

    Mancini, Anthony J

    2004-04-01

    Human skin provides a barrier between the host and the physical, chemical, and biological environment. It is also a potential portal of entry for hazardous or infectious agents and a potential target of environmental toxins. Cutaneous vulnerability may take on many forms in the embryo, infant, child, and adolescent. Teratogenic agents may occasionally target skin, as appreciated in the proposed association of the antithyroid medication methimazole, with the congenital malformation known as aplasia cutis congenita. Percutaneous absorption of topically applied substances and the potential for resultant drug toxicities are important considerations in the child. Many topical agents have been associated with systemic toxicity, including alcohol, hexachlorophene, iodine-containing compounds, eutectic mixture of local anesthetics, and lindane. Percutaneous toxicity is of greatest concern in the premature infant, in whom immaturity of the epidermal permeability barrier results in disproportionately increased absorption. Immature drug metabolism capabilities may further contribute to the increased risk in this population. Ultraviolet (UV) radiation exposure, which increases an individual's risk of cutaneous carcinogenesis, may be a particularly significant risk factor when it occurs during childhood. The "critical period hypothesis" suggests that UV exposure early in life increases the risk of eventual development of malignant melanoma. Other risk factors for malignant melanoma may include severe sunburns during childhood, intense intermittent UV exposure, and increased susceptibility of pediatric melanocytes to UV-induced DNA damage. Last, percutaneous exposure to environmental toxins and chemicals, such as insecticides and polychlorinated biphenyls, may differ between children and adults for several reasons, including behavioral patterns, anatomic and physiologic variations, and developmental differences of vital organs. PMID:15060207

  7. Staphylococcus pseudintermedius infection associated with nodular skin lesions and systemic inflammatory response syndrome in a dog

    OpenAIRE

    Min, Sa-Hee; Kang, Min-Hee; Sur, Jung-Hyang; Park, Hee-Myung

    2014-01-01

    A 10-year-old Pekingese dog with atopic dermatitis was referred due to pyrexia, multiple skin nodules, anorexia, and depression. The dog was diagnosed as having systemic inflammatory response syndrome (SIRS) induced by bacterial dermatitis. This case presents diagnosis and treatment of SIRS with staphylococcal skin infection in a dog that was immunosuppressed due to long-term use of corticosteroid.

  8. The impact of emotion-related autonomic nervous system responsiveness on pain sensitivity in female patients with fibromyalgia

    NARCIS (Netherlands)

    Middendorp, H. van; Lumley, M.A.; Houtveen, J.H.; Jacobs, J.W.G.; Bijlsma, J.W.J.; Geenen, R.

    2013-01-01

    OBJECTIVE: Patients with fibromyalgia have shown hyporeactive autonomic nervous system (ANS) responses to physical stressors, augmented pain to ANS changes, and heightened negative emotions, which can increase pain. This study examined ANS reactivity to negative emotions and its association with pai

  9. Coordination of cortisol response to social evaluative threat with autonomic and inflammatory responses is moderated by stress appraisals and affect.

    Science.gov (United States)

    Laurent, Heidemarie K; Lucas, Todd; Pierce, Jennifer; Goetz, Stefan; Granger, Douglas A

    2016-07-01

    Recent approaches to stress regulation have emphasized coordination among multiple biological systems. This study builds on evidence that hypothalamic-pituitary-adrenal (HPA) axis activity should be considered in coordination with other stress-sensitive biological systems to characterize healthy responses. Healthy African-Americans (n=115) completed the Trier Social Stress Test, and biological responses were assessed through salivary cortisol, dehydroepiandrosterone-sulfate (DHEA-S), alpha amylase (sAA), and C-reactive protein (sCRP). Multilevel modeling demonstrated that cortisol responses typically aligned with changes in DHEA-S, sAA, and sCRP across the session. At the same time, the degree of cortisol coordination with sAA and sCRP varied by participants' subjective stress following the task; participants with higher secondary stress appraisals showed greater cortisol-sAA alignment, whereas those experiencing more negative affect showed greater cortisol-sCRP alignment. Results highlight the importance of a multisystem approach to stress and suggest that positive HPA axis coordination with the autonomic response, but not with the immune/inflammatory response, may be adaptive.

  10. Area 3a Neuron Response to Skin Nociceptor Afferent Drive

    OpenAIRE

    Whitsel, Barry L.; Favorov, Oleg V; Li, Yongbiao; Quibrera, Miguel; Tommerdahl, Mark

    2008-01-01

    Area 3a neurons are identified that respond weakly or not at all to skin contact with a 25–38 °C probe, but vigorously to skin contact with the probe at ≥49 °C. Maximal rate of spike firing associated with 1- to 7-s contact at ≥49 °C occurs 1-2 s after probe removal from the skin. The activity evoked by 5-s contact with the probe at 51 °C remains above-background for ∼20 s after probe retraction. After 1-s contact at 55–56 °C activity remains above-background for ∼4 s. Magnitude of spike firi...

  11. Acupuncture Affects Autonomic and Endocrine but Not Behavioural Responses Induced by Startle in Horses

    Directory of Open Access Journals (Sweden)

    Julia Dias Villas-Boas

    2015-01-01

    Full Text Available Startle is a fast response elicited by sudden acoustic, tactile, or visual stimuli in a variety of animals and in humans. As the magnitude of startle response can be modulated by external and internal variables, it can be a useful tool to study reaction to stress. Our study evaluated whether acupuncture can change cardiac autonomic modulation (heart rate variability; and behavioural (reactivity and endocrine (cortisol levels parameters in response to startle. Brazilian Sport horses (n=6 were subjected to a model of startle in which an umbrella was abruptly opened near the horse. Before startle, the horses were subjected to a 20-minute session of acupuncture in acupoints GV1, HT7, GV20, and BL52 (ACUP and in nonpoints (NP or left undisturbed (CTL. For analysis of the heart rate variability, ultrashort-term (64 s heart rate series were interpolated (4 Hz and divided into 256-point segments and the spectra integrated into low (LF; 0.01–0.07 Hz; index of sympathetic modulation and high (HF; 0.07–0.50 Hz; index of parasympathetic modulation frequency bands. Acupuncture (ACUP changed the sympathovagal balance with a shift towards parasympathetic modulation, reducing the prompt startle-induced increase in LF/HF and reducing cortisol levels 30 min after startle. However, acupuncture elicited no changes in behavioural parameters.

  12. The Autonomous Development Strategies of Micro and Small Entrepreneurs Through Coorporate Social Responsibility in Bogor District of West Java

    OpenAIRE

    Faizal Maad; Sumardjo Sumardjo; Amiruddin Saleh; Pudji Muljono

    2014-01-01

    The objective  of this  reseach were to: (1) analyze the level of autonomous of mikro and small entreprise (SMEs) entrepreneurs are empowered through Coorporate Social Responsibility (CSR); (2) analyze the dominant factors that influence autonomous of MSEs entrepreneurs  are empowered through CSR;  and (3) formulate an appropriate  a strategy  in developing autonomy of MSEs entrepreneurs through CSR. The reseach  was conduct  in the village built two companies running CSR in Bogor district in...

  13. Stress and immune responses in skin of turbot (Scophthalmus maximus) under different stocking densities.

    Science.gov (United States)

    Jia, Rui; Liu, Bao-Liang; Feng, Wen-Rong; Han, Cen; Huang, Bin; Lei, Ji-Lin

    2016-08-01

    Fish skin and its mucus provide the first line of defense against chemical, physical and biological stressors, but little is known about the role of skin and its mucus in immune response to crowding stress. In the present study, we investigated the stress and immune responses in skin of turbot (Scophthalmus maximus) under different stocking densities. Turbot (average weight 185.4 g) were reared for 120 days under three densities: low density (LD), medium density (MD), and high density (HD). After 120 days, fish were weighed and sampled to obtain blood, mucus and skin tissues which were used for analyses of biochemical parameters and genes expression. The results showed HD treatment significantly suppressed growth and enhanced plasma cortisol and glucose levels (P turbot. Moreover, this information would help to understand the skin immunity and their relation with stress and disease in fish. PMID:27235366

  14. Effect of skin wettedness on sweat gland response

    Science.gov (United States)

    Nadel, E. R.; Stolwijk, J. A. J.

    1973-01-01

    Investigation of the effect of skin wettedness upon sweating rate. Several techniques were used to gain a better understanding of the quantitative nature of this effect. The results include the finding that the evaporative power of the environment has a profound effect on the relationship between body temperature and sweating rate.

  15. Autonomic Function Predicts Fitness Response to Short-Term High-Intensity Interval Training.

    Science.gov (United States)

    Kiviniemi, A M; Tulppo, M P; Eskelinen, J J; Savolainen, A M; Kapanen, J; Heinonen, I H A; Hautala, A J; Hannukainen, J C; Kalliokoski, K K

    2015-11-01

    We tested the hypothesis that baseline cardiac autonomic function and its acute response to all-out interval exercise explains individual fitness responses to high-intensity interval training (HIT). Healthy middle-aged sedentary men performed HIT (n=12, 4-6×30 s of all-out cycling efforts with 4-min recovery) or aerobic training (AET, n=9, 40-60 min at 60% of peak workload in exercise test [Loadpeak]), comprising 6 sessions within 2 weeks. Low (LF) and high frequency (HF) power of R-R interval oscillation were analyzed from data recorded at supine and standing position (5+5 min) every morning during the intervention. A significant training effect (ptraining*group interaction, was observed in Loadpeak and peak oxygen consumption (VO2peak). Pre-training supine LF/HF ratio, an estimate of sympathovagal balance, correlated with training outcome in Loadpeak (Spearman's rho [rs]=-0.74, p=0.006) and VO2peak (rs=- 0.59, p=0.042) in the HIT but not the AET group. Also, the mean change in the standing LF/HF ratio in the morning after an acute HIT exercise during the 1(st) week of intervention correlated with training response in Loadpeak (rs=- 0.68, p=0.014) and VO2peak (rs=-0.60, p=0.039) with HIT but not with AET. In conclusion, pre-training cardiac sympathovagal balance and its initial alterations in response to acute HIT exercise were related to fitness responses to short-term HIT.

  16. Human responses to upright tilt: a window on central autonomic integration

    Science.gov (United States)

    Cooke, W. H.; Hoag, J. B.; Crossman, A. A.; Kuusela, T. A.; Tahvanainen, K. U.; Eckberg, D. L.

    1999-01-01

    1. We examined interactions between haemodynamic and autonomic neural oscillations during passive upright tilt, to gain better insight into human autonomic regulatory mechanisms. 2. We recorded the electrocardiogram, finger photoplethysmographic arterial pressure, respiration and peroneal nerve muscle sympathetic activity in nine healthy young adults. Subjects breathed in time with a metronome at 12 breaths min-1 (0.2 Hz) for 5 min each, in supine, and 20, 40, 60, 70 and 80 deg head-up positions. We performed fast Fourier transform (and autoregressive) power spectral analyses and integrated low-frequency (0.05-0.15 Hz) and respiratory-frequency (0. 15-0.5 Hz) spectral powers. 3. Integrated areas of muscle sympathetic bursts and their low- and respiratory-frequency spectral powers increased directly and significantly with the tilt angle. The centre frequency of low-frequency sympathetic oscillations was constant before and during tilt. Sympathetic bursts occurred more commonly during expiration than inspiration at low tilt angles, but occurred equally in expiration and inspiration at high tilt angles. 4. Systolic and diastolic pressures and their low- and respiratory-frequency spectral powers increased, and R-R intervals and their respiratory-frequency spectral power decreased progressively with the tilt angle. Low-frequency R-R interval spectral power did not change. 5. The cross-spectral phase angle between systolic pressures and R-R intervals remained constant and consistently negative at the low frequency, but shifted progressively from positive to negative at the respiratory frequency during tilt. The arterial baroreflex modulus, calculated from low-frequency cross-spectra, decreased at high tilt angles. 6. Our results document changes of baroreflex responses during upright tilt, which may reflect leftward movement of subjects on their arterial pressure sympathetic and vagal response relations. The intensity, but not the centre frequency of low

  17. Skin Blood Perfusion and Cellular Response to Insertion of Insulin Pen Needles With Different Diameters

    DEFF Research Database (Denmark)

    Præstmark, Kezia Ann; Stallknecht, Bente Merete; Bo Jensen, Casper;

    2014-01-01

    skin blood perfusion response around needle insertion sites. Three common sized pen needles of 28G, 30G, and 32G as well as hooked 32G needles, were inserted into the neck skin of pigs and then removed. Laser Speckle Contrast Analysis was used to measure skin blood perfusion for 20 minutes after...... the insertions. Seven pigs were included in the study and a total of 118 randomized needle insertions were conducted. Histology was made of tissue samples inserted with 18G, 28G, and 32G needles, and stained to quantify red and white blood cell response. Based on area under curve, calculated for each individual...

  18. Motivational processes and autonomic responsivity in Asperger's disorder: evidence from the Iowa Gambling Task.

    Science.gov (United States)

    Johnson, Shannon A; Yechiam, Eldad; Murphy, Robin R; Queller, Sarah; Stout, Julie C

    2006-09-01

    Asperger's disorder (ASP), like other autism spectrum disorders, is associated with altered responsiveness to social stimuli. This study investigated learning and responsiveness to nonsocial, but motivational, stimuli in ASP. We examined choice behavior and galvanic skin conductance responses (SCRs) during the Iowa Gambling Task (IGT; Bechara et al., 1994) in 15 adolescents and young adults with ASP and 14 comparison subjects. We examined aspects of learning, attention to wins and losses, and response style with a formal cognitive model, the Expectancy-Valence Learning model (Busemeyer & Stout, 2002). The ASP group did not differ from the comparison group in proportions of selections from advantageous decks. However, ASP participants showed a distinct pattern of selection characterized by frequent shifts between the four IGT decks, whereas comparison participants developed clear deck preferences. SCR results showed some evidence of reduced responsiveness in the ASP group during the IGT. Results from the cognitive model indicated that, in contrast to the comparison group, the ASP group's selections were less consistent with the motivational significance they assigned to decks. Findings are discussed in the context of the neurobiological substrates associated with IGT performance. PMID:16961948

  19. The use of infrared thermography to detect the skin temperature response to physical activity

    Science.gov (United States)

    Tanda, G.

    2015-11-01

    Physical activity has a noticeable effect on skin blood flow and temperature. The thermal regulatory and hemodynamic processes during physical activity are controlled by two conflicting mechanisms: the skin vasoconstriction induced by the blood flow demand to active muscles and the skin vasodilation required by thermoregulation to increase warm blood flow and heat conduction to the skin. The time-evolution of skin temperature during exercise can give useful information about the adaptation of the subject as a function of specific type, intensity and duration of exercise. In this paper, infrared thermography is used to investigate the thermal response of skin temperature during running exercise on treadmill for a group of seven healthy and trained runners. Two different treadmill exercises are considered: a graded load exercise and a constant load exercise; for both exercises the duration was 30 minutes. Within the limits due to the relatively small size of the sample group, results typically indicate a fall in skin temperature during the initial stage of running exercise. As the exercise progresses, the dynamics of the skin temperature response depends on the type of exercise (graded versus constant load) and probably on the level of training of the subject.

  20. Key Role of CRF in the Skin Stress Response System

    OpenAIRE

    Slominski, Andrzej T.; Zmijewski, Michal A.; Zbytek, Blazej; Tobin, Desmond J.; Theoharides, Theoharis C.; Rivier, Jean

    2013-01-01

    The discovery of corticotropin-releasing factor (CRF) or CRH defining the upper regulatory arm of the hypothalamic-pituitary-adrenal (HPA) axis, along with the identification of the corresponding receptors (CRFRs 1 and 2), represents a milestone in our understanding of central mechanisms regulating body and local homeostasis. We focused on the CRF-led signaling systems in the skin and offer a model for regulation of peripheral homeostasis based on the interaction of CRF and the structurally r...

  1. Assessment of autonomic nervous system activity by heart rate recovery response

    Institute of Scientific and Technical Information of China (English)

    MENG Zhaohui; BAI Jing

    2004-01-01

    The assessment of autonomic nervous system (ANS) activity is a tool for diagnosing or predicting cardiovascular diseases,while heart rate recovery response (HRRR) after exercise has been promoted as a process under the regulation of ANS (sympathetic and parasympathetic nervous systems).Therefore,assessment of ANS activity was performed by HRRR in this study.Firstly,HRRR signal was extracted based on wavelet decomposition and difference curve of coarse component from heart rate signal.Then,HRRR was divided into quickly descending interval (QDI) and slowly descending interval (SDI).Finally,3 groups of indexes (Difference,Exponential and Quadratic Groups) from QDI and SDI were compared between 50 normotensive and 61 hypertensive subjects.The results showed that the indexes of Difference Group were better choices than others in analyzing the features of HRRR.Furthermore,parasympathetic activity is dominant in QDI,while sympathetic and parasympathetic activities affect SDI together.In conclusion,the proposed method was effective to assess ANS activity.

  2. Evaluating Autonomic Parameters: The Role of Sleep ‎Duration in Emotional Responses to Music ‎

    Science.gov (United States)

    Goshvarpour‎, Atefeh; Abbasi, Ataollah; Goshvarpour‎, Ateke

    2016-01-01

    Objective: It has been recognized that sleep has an important effect on emotion processing. The aim ‎of this study was to investigate the effect of previous night sleep duration on autonomicresponses to musical stimuli in different emotional contexts.‎ Method: A frequency based measure of GSR, PR and ECG signals were examined in 35 healthy ‎students in three groups of oversleeping, lack of sleep and normal sleep. ‎ Results: The results of this study revealed that regardless of the emotional context of the musical ‎stimuli (happy, relax, fear, and sadness), there was an increase in the maximum power of ‎GSR, ECG and PR during the music time compared to the rest time in all the three ‎groups. In addition, the higher value of these measures was achieved while the ‎participants listened to relaxing music. Statistical analysis of the extracted features ‎between each pair of emotional states revealed that the most significant differences ‎were attained for ECG signals. These differences were more obvious in the participants ‎with normal sleeping (p<10-18). The higher value of the indices has been shown, ‎comparing long sleep duration with the normal one.‎ Conclusion: There was a strong relation between emotion and sleep duration, and this association can ‎be observed by means of the ECG signals.‎ PMID:27252770

  3. Role of Autonomic Reflex Arcs in Cardiovascular Responses to Air Pollution Exposure

    Science.gov (United States)

    The body responds to environmental stressors by triggering autonomic reflexes in the pulmonary receptors, baroreceptors, and chemoreceptors to maintain homeostasis. Numerous studies have shown that exposure to various gases and airborne particles can alter the functional outcome ...

  4. Cardiovascular, metabolic, and hormonal responses to noradrenaline in diabetic patients with autonomic neuropathy

    DEFF Research Database (Denmark)

    Dejgaard, Anders; Andersen, P; Hvidberg, A;

    1996-01-01

    Denervation hypersensitivity is a well-known phenomenon in patients with autonomic failure. In diabetic autonomic neuropathy hypersensitivity to beta-adrenergic stimulation has been demonstrated. We infused noradrenaline, mainly an alpha-adrenoceptor agonist, in three escalating doses (0.5, 2.......5, and 5 micrograms min-1) in three age and sex matched groups of eight subjects: healthy volunteers, diabetic patients with and without autonomic neuropathy. During steady state in each infusion period we measured heart rate, blood pressure, cardiac output, hepato-splanchnic blood flow, vascular...... resistance, glucose kinetics, metabolites (beta-hydroxybuturate, glycerol, and lactate), and glucoregulatory hormones (noradrenaline, adrenaline, growth hormone, pancreatic polypeptide, cortisol, and insulin). Systolic and mean blood pressure increased in all groups but diabetic patients with autonomic...

  5. Autonomic responses to cold face stimulation in sickle cell disease: a time-varying model analysis

    OpenAIRE

    Chalacheva, Patjanaporn; Kato, Roberta M.; Sangkatumvong, Suvimol; Detterich, Jon; Bush, Adam; Wood, John C.; Meiselman, Herbert; Coates, Thomas D; Khoo, Michael C.K.

    2015-01-01

    Sickle cell disease (SCD) is characterized by sudden onset of painful vaso-occlusive crises (VOC), which occur on top of the underlying chronic blood disorder. The mechanisms that trigger VOC remain elusive, but recent work suggests that autonomic dysfunction may be an important predisposing factor. Heart-rate variability has been employed in previous studies, but the derived indices have provided only limited univariate information about autonomic cardiovascular control in SCD. To circumvent...

  6. Hypoglycemia-associated autonomic failure in insulin-dependent diabetes mellitus. Recent antecedent hypoglycemia reduces autonomic responses to, symptoms of, and defense against subsequent hypoglycemia.

    OpenAIRE

    Dagogo-Jack, S E; Craft, S; Cryer, P E

    1993-01-01

    We hypothesize that in patients with insulin-dependent diabetes mellitus (IDDM), recent antecedent iatrogenic hypoglycemia is a major cause of hypoglycemia-associated autonomic failure, a disorder distinct from classical diabetic autonomic neuropathy (CDAN), and that hypoglycemia-associated autonomic failure, by reducing both symptoms of and defense against developing hypoglycemia, results in recurrent iatrogenic hypoglycemia, thus creating a vicious cycle. We used the hyperinsulinemic (12.0 ...

  7. Sensorized Garments and Textrode-Enabled Measurement Instrumentation for Ambulatory Assessment of the Autonomic Nervous System Response in the ATREC Project

    Directory of Open Access Journals (Sweden)

    Cosme Llerena

    2013-07-01

    Full Text Available Advances in textile materials, technology and miniaturization of electronics for measurement instrumentation has boosted the development of wearable measurement systems. In several projects sensorized garments and non-invasive instrumentation have been integrated to assess on emotional, cognitive responses as well as physical arousal and status of mental stress through the study of the autonomous nervous system. Assessing the mental state of workers under stressful conditions is critical to identify which workers are in the proper state of mind and which are not ready to undertake a mission, which might consequently risk their own life and the lives of others. The project Assessment in Real Time of the Stress in Combatants (ATREC aims to enable real time assessment of mental stress of the Spanish Armed Forces during military activities using a wearable measurement system containing sensorized garments and textile-enabled non-invasive instrumentation. This work describes the multiparametric sensorized garments and measurement instrumentation implemented in the first phase of the project required to evaluate physiological indicators and recording candidates that can be useful for detection of mental stress. For such purpose different sensorized garments have been constructed: a textrode chest-strap system with six repositionable textrodes, a sensorized glove and an upper-arm strap. The implemented textile-enabled instrumentation contains one skin galvanometer, two temperature sensors for skin and environmental temperature and an impedance pneumographer containing a 1-channel ECG amplifier to record cardiogenic biopotentials. With such combinations of garments and non-invasive measurement devices, a multiparametric wearable measurement system has been implemented able to record the following physiological parameters: heart and respiration rate, skin galvanic response, environmental and peripheral temperature. To ensure the proper functioning of the

  8. Attention to eye contact in the West and East: autonomic responses and evaluative ratings.

    Directory of Open Access Journals (Sweden)

    Hironori Akechi

    Full Text Available Eye contact has a fundamental role in human social interaction. The special appearance of the human eye (i.e., white sclera contrasted with a coloured iris implies the importance of detecting another person's face through eye contact. Empirical studies have demonstrated that faces making eye contact are detected quickly and processed preferentially (i.e., the eye contact effect. Such sensitivity to eye contact seems to be innate and universal among humans; however, several studies suggest that cultural norms affect eye contact behaviours. For example, Japanese individuals exhibit less eye contact than do individuals from Western European or North American cultures. However, how culture modulates eye contact behaviour is unclear. The present study investigated cultural differences in autonomic correlates of attentional orienting (i.e., heart rate and looking time. Additionally, we examined evaluative ratings of eye contact with another real person, displaying an emotionally neutral expression, between participants from Western European (Finnish and East Asian (Japanese cultures. Our results showed that eye contact elicited stronger heart rate deceleration responses (i.e., attentional orienting, shorter looking times, and higher ratings of subjective feelings of arousal as compared to averted gaze in both cultures. Instead, cultural differences in the eye contact effect were observed in various evaluative responses regarding the stimulus faces (e.g., facial emotion, approachability etc.. The rating results suggest that individuals from an East Asian culture perceive another's face as being angrier, unapproachable, and unpleasant when making eye contact as compared to individuals from a Western European culture. The rating results also revealed that gaze direction (direct vs. averted could influence perceptions about another person's facial affect and disposition. These results suggest that cultural differences in eye contact behaviour emerge from

  9. The Autonomous Development Strategies of Micro and Small Entrepreneurs Through Coorporate Social Responsibility in Bogor District of West Java

    Directory of Open Access Journals (Sweden)

    Faizal Maad

    2014-05-01

    Full Text Available The objective  of this  reseach were to: (1 analyze the level of autonomous of mikro and small entreprise (SMEs entrepreneurs are empowered through Coorporate Social Responsibility (CSR; (2 analyze the dominant factors that influence autonomous of MSEs entrepreneurs  are empowered through CSR;  and (3 formulate an appropriate  a strategy  in developing autonomy of MSEs entrepreneurs through CSR. The reseach  was conduct  in the village built two companies running CSR in Bogor district involved 212  (SMEs entrepreneurs which determined from population (450 SMEs entrepreneurs by Solvin formula with level of error 5 % and drawn by cluster random sampling. Data collection was conducted from July to November 2013, and consisted  the primary and secondary data. Data analysis was simulated by using structural equation model (SEM . The results showed that the degree  of autonomous MSEs entrepreneurs is low, its core was 36.89 out of 100.00. There are three strategies that must be done to develop of  autonomous MSEs entrepreneurs through  CSR, such as; (a an increase the empowerment sustainable of MSEs entrepereneurs (b improve the quality of  the environment  supporting MSEs and (c an increase in intensity of  empowerment for MSEs entrepreneurs.

  10. Botulinum toxin type A reduces histamine-induced itch and vasomotor responses in human skin

    DEFF Research Database (Denmark)

    Gazerani, Parisa; Pedersen, N. S.; Drewes, Asbjørn Mohr;

    2009-01-01

    .001) and temperature measurements (F(1,26) = 27.6, P response to the histamine prick test in human skin...... of subcutaneous administration of BoNT/A on experimentally histamine-induced itch in human skin. METHODS: In this double-blind, placebo-controlled study, 14 healthy men (mean +/- SD age 26.3 +/- 2.6 years) received BoNT/A (Botox; Allergan, Irvine, CA, U.S.A.; 5 U) and isotonic saline on the volar surface...

  11. Global brain blood-oxygen level responses to autonomic challenges in obstructive sleep apnea.

    Directory of Open Access Journals (Sweden)

    Paul M Macey

    Full Text Available Obstructive sleep apnea (OSA is accompanied by brain injury, perhaps resulting from apnea-related hypoxia or periods of impaired cerebral perfusion. Perfusion changes can be determined indirectly by evaluation of cerebral blood volume and oxygenation alterations, which can be measured rapidly and non-invasively with the global blood oxygen level dependent (BOLD signal, a magnetic resonance imaging procedure. We assessed acute BOLD responses in OSA subjects to pressor challenges that elicit cerebral blood flow changes, using a two-group comparative design with healthy subjects as a reference. We separately assessed female and male patterns, since OSA characteristics and brain injury differ between sexes. We studied 94 subjects, 37 with newly-diagnosed, untreated OSA (6 female (age mean ± std: 52.1±8.1 yrs; apnea/hypopnea index [AHI]: 27.7±15.6 events/hr and 31 male 54.3±8.4 yrs; AHI: 37.4±19.6 events/hr, and 20 female (age 50.5±8.1 yrs and 37 male (age 45.6±9.2 yrs healthy control subjects. We measured brain BOLD responses every 2 s while subjects underwent cold pressor, hand grip, and Valsalva maneuver challenges. The global BOLD signal rapidly changed after the first 2 s of each challenge, and differed in magnitude between groups to two challenges (cold pressor, hand grip, but not to the Valsalva maneuver (repeated measures ANOVA, p<0.05. OSA females showed greater differences from males in response magnitude and pattern, relative to healthy counterparts. Cold pressor BOLD signal increases (mean ± adjusted standard error at the 8 s peak were: OSA 0.14±0.08% vs. Control 0.31±0.06%, and hand grip at 6 s were: OSA 0.08±0.03% vs. Control at 0.30±0.02%. These findings, indicative of reduced cerebral blood flow changes to autonomic challenges in OSA, complement earlier reports of altered resting blood flow and reduced cerebral artery responsiveness. Females are more affected than males, an outcome which may contribute to the sex

  12. Evaluation of the autonomic response in healthy subjects during treadmill training with assistance of a robot-driven gait orthosis.

    Science.gov (United States)

    Magagnin, Valentina; Porta, Alberto; Fusini, Laura; Licari, Vittorio; Bo, Ivano; Turiel, Maurizio; Molteni, Franco; Cerutti, Sergio; Caiani, Enrico G

    2009-04-01

    Body weight supported treadmill training assisted with a robotic driven gait orthosis is an emerging clinical tool helpful to restore gait in individuals with loss of motor skills. However, the autonomic response during this rehabilitation protocol is not known. The aim of the study was to evaluate the autonomic response during a routine protocol of motor rehabilitation through spectral and symbolic analyses of short-term heart rate variability in a group of 20 healthy subjects (11 men, mean age 25+/-3.8 years). The protocol included the following phases: (1) sitting position; (2) standing position; (3) suspension during subject instrumentation; (4 and 5) robotic-assisted treadmill locomotion at 1.5km/h and 2.5km/h respectively with partial body weight support; (6) standing recovery after exercise. Results showed a significant tachycardia associated with the reduction in variance during the suspended phase of the protocol compared to the sitting position. Spectral analysis did not demonstrate any significant autonomic response during the entire protocol, while symbolic analysis detected an increase in sympathetic modulation during body suspension and an increase of vagal modulation during walking. These results could be used to improve understanding of the cardiovascular effects of rehabilitation in subjects undergoing robotic driven gait orthosis treadmill training.

  13. A psychophysiological inquiry into the nature of the Sokolovian orienting response comparator model: skin conductance and EEG data.

    Science.gov (United States)

    Barceló, F; Hall, M; Gale, A

    1995-10-01

    The mechanisms which trigger the orienting response (OR) are still the subject of lively debate. Sokolov (1990) proposes the development of a multidimensional model of the physical parameters of stimulation. Recent OR research has shown that the skin conductance OR (SCOR) is related to task demands and controlled processing, although this is not so clear for central physiological indexes of orienting. Seventy-three subjects performed visual discriminations of stimuli within a warning-stimulus paradigm. The physical complexity of stimuli and their task relevance were manipulated within subjects, while the nonspecific effects of workload were controlled with a group factor. SCORs were measured concurrently with 1-s epochs of EEG alpha and theta power from Fz, Cz, Pz, and Oz. Neither index was reliably affected by the physical complexity of stimulation alone. However, both higher task relevance and higher workload significantly increased the magnitude of EEGORs and SCORs. Task averages of central and autonomic activity showed an overall pattern of covariation, but a second-by-second breakdown of EEG spectra suggests that the SCOR may be an aggregate of the activation of diverse brain mechanisms responsible for physiological orienting. The results are consistent with a model of orienting as a continuous dimension of resource allocation to anticipated and current task demands, rather than with the abrupt dichotomy between voluntary and involuntary orienting. Implications for the classical OR Sokolovian model are discussed.

  14. Time- and frequency-domain parameters of heart rate variability and sympathetic skin response in Parkinson's disease.

    Science.gov (United States)

    Maetzler, Walter; Karam, Marie; Berger, Monika Fruhmann; Heger, Tanja; Maetzler, Corina; Ruediger, Heinz; Bronzova, Juliana; Lobo, Patricia Pita; Ferreira, Joaquim J; Ziemssen, Tjalf; Berg, Daniela

    2015-03-01

    The autonomic nervous system (ANS) is regularly affected in Parkinson's disease (PD). Information on autonomic dysfunction can be derived from e.g. altered heart rate variability (HRV) and sympathetic skin response (SSR). Such parameters can be quantified easily and measured repeatedly which might be helpful for evaluating disease progression and therapeutic outcome. In this 2-center study, HRV and SSR of 45 PD patients and 26 controls were recorded. HRV was measured during supine metronomic breathing and analyzed in time- and frequency-domains. SSR was evoked by repetitive auditory stimulation. Various ANS parameters were compared (1) between patients and healthy controls, (2) to clinical scales (Unified Parkinson's disease rating scale, Mini-Mental State Examination, Becks Depression Inventory), and (3) to disease duration. Root mean square of successive differences (RMSSD) and low frequency/high frequency (LF/HF) ratio differed significantly between PD and controls. Both, HRV and SSR parameters showed low or no association with clinical scores. Time-domain parameters tended to be affected already at early PD stages but did not consistently change with longer disease duration. In contrast, frequency-domain parameters were not altered in early PD phases but tended to be lower (LF, LF/HF ratio), respectively higher (HF) with increasing disease duration. This report confirms previous results of altered ANS parameters in PD. In addition, it suggests that (1) these ANS parameters are not relevantly associated with motor, behavioral, and cognitive changes in PD, (2) time-domain parameters are useful for the assessment of early PD, and (3) frequency-domain parameters are more closely associated with disease duration.

  15. Muscle cells challenged with saturated fatty acids mount an autonomous inflammatory response that activates macrophages

    Directory of Open Access Journals (Sweden)

    Pillon Nicolas J

    2012-10-01

    Full Text Available Abstract Obesity is associated with chronic low-grade inflammation. Within adipose tissue of mice fed a high fat diet, resident and infiltrating macrophages assume a pro-inflammatory phenotype characterized by the production of cytokines which in turn impact on the surrounding tissue. However, inflammation is not restricted to adipose tissue and high fat-feeding is responsible for a significant increase in pro-inflammatory cytokine expression in muscle. Although skeletal muscle is the major disposer of dietary glucose and a major determinant of glycemia, the origin and consequence of muscle inflammation in the development of insulin resistance are poorly understood. We used a cell culture approach to investigate the vectorial crosstalk between muscle cells and macrophages upon exposure to physiological, low levels of saturated and unsaturated fatty acids. Inflammatory pathway activation and cytokine expression were analyzed in L6 muscle cells expressing myc-tagged GLUT4 (L6GLUT4myc exposed to 0.2 mM palmitate or palmitoleate. Conditioned media thereof, free of fatty acids, were then tested for their ability to activate RAW264.7 macrophages. Palmitate -but not palmitoleate- induced IL-6, TNFα and CCL2 expression in muscle cells, through activation of the NF-κB pathway. Palmitate (0.2 mM alone did not induce insulin resistance in muscle cells, yet conditioned media from palmitate-challenged muscle cells selectively activated macrophages towards a pro-inflammatory phenotype. These results demonstrate that low concentrations of palmitate activate autonomous inflammation in muscle cells to release factors that turn macrophages pro-inflammatory. We hypothesize that saturated fat-induced, low-grade muscle cell inflammation may trigger resident skeletal muscle macrophage polarization, possibly contributing to insulin resistance in vivo.

  16. Effects of autonomous motivational priming on motivation and affective responses towards high-intensity interval training.

    Science.gov (United States)

    Brown, Denver M Y; Teseo, Amanda J; Bray, Steven R

    2016-08-01

    This study examined the effect of autonomous motivational priming on motivation, attitudes and intentions towards high-intensity interval training (HIT). Participants (N = 42) performed a graded exercise test to determine their peak aerobic power (WPEAK). At a subsequent testing session, participants were randomised to complete either an autonomous or neutral motivational priming task followed by a 10 × 1 HIT exercise protocol, alternating 1-min bouts of hard (70% WPEAK) and light (12.5% WPEAK) exercises for 20 min. Participants primed with autonomous motivation reported greater enjoyment, P = .009, ηp(2) = .16, and perceived competence, P = .005, ηp(2) = .18, post-exercise compared to those in the neutral priming condition. Participants in the autonomous motivational priming condition also reported more positive attitudes, P = .014, ηp(2) = .14, towards HIT; however, there was no difference between the conditions for task motivation during HIT or intentions, P = .53, ηp(2) = .01, to engage in HIT. These findings highlight autonomous motivational priming as a method of enhancing affective and motivational experiences regarding HIT. PMID:26634389

  17. Effects of autonomous motivational priming on motivation and affective responses towards high-intensity interval training.

    Science.gov (United States)

    Brown, Denver M Y; Teseo, Amanda J; Bray, Steven R

    2016-08-01

    This study examined the effect of autonomous motivational priming on motivation, attitudes and intentions towards high-intensity interval training (HIT). Participants (N = 42) performed a graded exercise test to determine their peak aerobic power (WPEAK). At a subsequent testing session, participants were randomised to complete either an autonomous or neutral motivational priming task followed by a 10 × 1 HIT exercise protocol, alternating 1-min bouts of hard (70% WPEAK) and light (12.5% WPEAK) exercises for 20 min. Participants primed with autonomous motivation reported greater enjoyment, P = .009, ηp(2) = .16, and perceived competence, P = .005, ηp(2) = .18, post-exercise compared to those in the neutral priming condition. Participants in the autonomous motivational priming condition also reported more positive attitudes, P = .014, ηp(2) = .14, towards HIT; however, there was no difference between the conditions for task motivation during HIT or intentions, P = .53, ηp(2) = .01, to engage in HIT. These findings highlight autonomous motivational priming as a method of enhancing affective and motivational experiences regarding HIT.

  18. Molecular genetic response to varied wavelengths of light in Xiphophorus maculatus skin.

    Science.gov (United States)

    Chang, Jordan; Lu, Yuan; Boswell, William T; Boswell, Mikki; Caballero, Kaela L; Walter, Ronald B

    2015-12-01

    Xiphophorus fishes represent a model often utilized to study UVB induced tumorigenesis. Recently, varied genetic responses to UVB exposure have been documented in the skin of female and male Xiphophorus, as have differences in UVB response in the skin of different parental species and for interspecies hybrids produced from crossing them. Additionally, it has been shown that exposure to "cool white" fluorescent light induces a shift in the genetic profiles of Xiphophorus skin that is nearly as robust as the UVB response, but involves a fundamentally different set of genes. Given these results and the use of Xiphophorus interspecies hybrids as an experimental model for UVB inducible melanoma, it is of interest to characterize genes that may be transcriptionally modulated in a wavelength specific manner. The global molecular genetic response of skin upon exposure of the intact animal to specific wavelengths of light has not been investigated. Herein, we report results of RNA-Seq experiments from the skin of male Xiphophorus maculatus Jp 163 B following exposure to varied 50nm wavelengths of light ranging from 300-600nm. We identify two specific wavelength regions, 350-400nm (88 genes) and 500-550nm (276 genes), that exhibit transcriptional modulation of a significantly greater number of transcripts than any of the other 50nm regions in the 300-600nm range. Observed functional sets of genes modulated within these two transcriptionally active light regions suggest different mechanisms of gene modulation.

  19. Classical conditioning of autonomic fear responses is independent of contingency awareness.

    Science.gov (United States)

    Schultz, Douglas H; Helmstetter, Fred J

    2010-10-01

    The role of contingency awareness in classical conditioning experiments using human subjects is currently under debate. This study took a novel approach to manipulating contingency awareness in a differential Pavlovian conditioning paradigm. Complex sine wave gratings were used as visual conditional stimuli (CS). By manipulating the fundamental spatial frequency of the displays, we were able to construct pairs of stimuli that varied in discriminability. One group of subjects was given an "easy" discrimination, and another was exposed to a "difficult" CS+ and CS-. A 3rd group was exposed to a stimulus that was paired with the unconditional stimulus (UCS) 50% of the time and served as a control. Skin conductance response (SCR) and continuous UCS expectancy data were measured concurrently throughout the experiment. Differential UCS expectancy was found only in the easy discrimination group. Differential SCRs were found in the easy discrimination group as well as in the difficult discrimination group, but not in the 50% contingency control. The difficult discrimination group did not exhibit differential UCS expectancy but did show clear differential SCR. These observations support a dual process interpretation of classical conditioning whereby conditioning on an implicit level can occur without explicit knowledge about the contingencies. The role of contingency awareness in classical conditioning experiments using human subjects is currently under debate. This study took a novel approach to manipulating contingency awareness in a differential Pavlovian conditioning paradigm. Complex sine wave gratings were used as visual conditional stimuli (CS). By manipulating the fundamental spatial frequency of the displays, we were able to construct pairs of stimuli that varied in discriminability. One group of subjects was given an "easy" discrimination, and another was exposed to a "difficult" CS+ and CS-. A 3rd group was exposed to a stimulus that was paired with the

  20. Regulating Response Time in an Autonomic Computing System: A Comparison of Proportional Control and Fuzzy Control Approaches

    Directory of Open Access Journals (Sweden)

    Harish S. Venkatarama

    2010-10-01

    Full Text Available Ecommerce is an area where an Autonomic Computing system could be very effectively deployed. Ecommerce has created demand for high quality information technology services and businesses are seeking quality of service guarantees from their service providers. These guarantees are expressed as part of service level agreements. Properly adjusting tuning parameters for enforcement of the service level agreement is time-consuming and skills-intensive. Moreover, in case of changes to the workload, the setting of the parameters may no longer be optimum. In an ecommerce system, where the workload changes frequently, there is a need to update the parameters at regular intervals. This paper describes two approaches, one, using a proportional controller and two, using a fuzzy controller, to automate the tuning of MaxClients parameter of Apache web server based on the required response time and the current workload. This is an illustration of the self-optimizing characteristic of an autonomic computing system.

  1. Regulating Response Time in an Autonomic Computing System: A Comparison of Proportional Control and Fuzzy Control Approaches

    Directory of Open Access Journals (Sweden)

    Harish S. Venkatarama

    2010-10-01

    Full Text Available Ecommerce is an area where an Autonomic Computing system could be very effectively deployed.Ecommerce has created demand for high quality information technology services and businesses areseeking quality of service guarantees from their service providers. These guarantees are expressed aspart of service level agreements. Properly adjusting tuning parameters for enforcement of the servicelevel agreement is time-consuming and skills-intensive. Moreover, in case of changes to the workload, thesetting of the parameters may no longer be optimum. In an ecommerce system, where the workloadchanges frequently, there is a need to update the parameters at regular intervals. This paper describestwo approaches, one, using a proportional controller and two, using a fuzzy controller, to automate thetuning of MaxClients parameter of Apache web server based on the required response time and thecurrent workload. This is an illustration of the self-optimizing characteristic of an autonomic computingsystem.

  2. Lower Corticosteroid Skin Blanching Response Is Associated with Severe COPD

    NARCIS (Netherlands)

    Hoonhorst, Susan J. M.; ten Hacken, Nicolaas; Loi, Adele T. Lo Tam; Koenderman, Leo; Lammers, Jan Willem J.; Telenga, Eef D.; Boezen, Hendrika; van den Berge, Maarten; Postma, Dirkje S.

    2014-01-01

    Background: Chronic obstructive pulmonary disease (COPD) is characterized by chronic airflow limitation caused by ongoing inflammatory and remodeling processes of the airways and lung tissue. Inflammation can be targeted by corticosteroids. However, airway inflammation is generally less responsive t

  3. Sympathetic Responses to Noxious Stimulation of Muscle and Skin.

    Science.gov (United States)

    Burton, Alexander R; Fazalbhoy, Azharuddin; Macefield, Vaughan G

    2016-01-01

    Acute pain triggers adaptive physiological responses that serve as protective mechanisms that prevent continuing damage to tissues and cause the individual to react to remove or escape the painful stimulus. However, an extension of the pain response beyond signaling tissue damage and healing, such as in chronic pain states, serves no particular biological function; it is maladaptive. The increasing number of chronic pain sufferers is concerning, and the associated disease burden is putting healthcare systems around the world under significant pressure. The incapacitating effects of long-lasting pain are not just psychological - reflexes driven by nociceptors during the establishment of chronic pain may cause serious physiological consequences on regulation of other body systems. The sympathetic nervous system is inherently involved in a host of physiological responses evoked by noxious stimulation. Experimental animal and human models demonstrate a diverse array of heterogeneous reactions to nociception. The purpose of this review is to understand how pain affects the sympathetic nervous system by investigating the reflex cardiovascular and neural responses to acute pain and the long-lasting physiological responses to prolonged (tonic) pain. By observing the sympathetic responses to long-lasting pain, we can begin to understand the physiological consequences of long-term pain on cardiovascular regulation. PMID:27445972

  4. Modulation of the androgenetic response in diverse skin cell types: the pilosebaceous unit

    International Nuclear Information System (INIS)

    Androgens play a central role in diverse morphogenetic processes of the skin. Hair growth and follicular cycle are regulated in part by androgens. Androgens also play a key function, together with other receptors such as the PPARs receptors family, on the proliferation and differentiation of the sebaceous gland that forms part of the pilosebaceous unit and influences hair growth and skin well-being. UV radiation may affect androgens regulation of skin homeostasis. Objectives: to study the modulation of androgenetic response related to UV radiation on the pilosebaceous unit, in two skin conditions: androgenetic alopecia and acne, both affecting skin and constituting major concerns for affected individuals. Methods: primary cultures of cells and established cell lines from the pilosebaceous unit: dermal papillae cells, keratinocytes and sebocytes. Analysis of lipid content, inflammatory response and proliferation of cells under the influence of androgens, PPARs ligands and UVR. Results: sebocytes primary cultures were obtained from human sebaceous glands. Proliferation and differentiation, as well as the expression of proinflammatory molecules (IL-1, TNF alpha, iNOs) and lipogenic enzymes (FASN) under androgens and UV treatment were assessed. The response to androgens under UV exposure was also analyzed in dermal papillae cells in culture. (authors)

  5. Short-term cadmium exposure induces stress responses in frog (Pelophylax bergeri) skin organ culture.

    Science.gov (United States)

    Simoncelli, Francesca; Belia, Silvia; Di Rosa, Ines; Paracucchi, Romina; Rossi, Roberta; La Porta, Gianandrea; Lucentini, Livia; Fagotti, Anna

    2015-12-01

    There have been a few studies on the negative effects of pollutants on amphibian skin, the first structural barrier that interacts with the environment and its potential contaminants. In this study an ex vivo skin organ culture from the amphibian Pelophylax bergeri was used to evaluate cell stress responses induced by short-term exposure to cadmium (Cd), a toxic heavy metal known to be an environmental hazard to both humans and wildlife. Histopathological studies were carried out on skin explants using light microscopy and changes in the expression of stress proteins, such as Metallothionein (MT) and Heat shock proteins (HSPs), were investigated by Real-time RT-PCR. Results revealed that amphibian skin reacts to Cd-induced stress by activating biological responses such as morphological alterations and dose- and time-dependent induction of Mt and Hsp70 mRNA expression, suggesting their potential role as biomarkers of exposure to Cd. This work provides a basis for a better understanding of the tissue-specific responses of amphibian skin as a target organ to Cd exposure and its in vitro use for testing potentially harmful substances present in the environment.

  6. Effects of niacin restriction on sirtuin and PARP responses to photodamage in human skin.

    Directory of Open Access Journals (Sweden)

    Claudia A Benavente

    Full Text Available Sirtuins (SIRTs and poly(ADP-ribose polymerases (PARPs, NAD(+-dependent enzymes, link cellular energy status with responses to environmental stresses. Skin is frequently exposed to the DNA damaging effects of UV irradiation, a known etiology in skin cancer. Thus, understanding the defense mechanisms in response to UV, including the role of SIRTs and PARPs, may be important in developing skin cancer prevention strategies. Here, we report expression of the seven SIRT family members in human skin. SIRTs gene expressions are progressively upregulated in A431 epidermoid carcinoma cells (SIRTs1 and 3, actinic keratoses (SIRTs 2, 3, 5, 6, and 7 and squamous cell carcinoma (SIRTs 1-7. Photodamage induces dynamic changes in SIRT expression with upregulation of both SIRT1 and SIRT4 mRNAs. Specific losses of SIRT proteins occur early after photodamage followed by accumulation later, especially for SIRT4. Niacin restriction, which decreases NAD(+, the sirtuin substrate, results in an increase in acetylated proteins, upregulation of SIRTs 2 and 4, increased inherent DNA damage, alterations in SIRT responses to photodamage, abrogation of PARP activation following photodamage, and increased sensitivity to photodamage that is completely reversed by repleting niacin. These data support the hypothesis that SIRTs and PARPs play important roles in resistance to photodamage and identify specific SIRTs that respond to photodamage and may be targets for skin cancer prevention.

  7. Frequency-response-based analysis of respiratory sensor measuring capacitance built across skin

    Science.gov (United States)

    Terasawa, Makie; Kumagai, Shinya; Sasaki, Minoru

    2016-04-01

    A capacitive respiratory sensor is studied by attaching the electrodes to the skin. The signal characteristics related to the electrode position and body motion are examined. The frequency response indicates the nearly pure capacitance characteristics. The sensing mechanism model based on the equivalent skin thickness change generated by the body volume change accompanying respiration is reasonably consistent with the experimental results. The sensing method is examined by measuring the frequency response under some different conditions including the grounding issue. The electrode attached to the concave site tends to show a smaller signal difference between inhalation and exhalation. The convex site stabilizes the measurement. The bellyband combined with the electrode realizes stable sensing with comfortable fit on the skin.

  8. Therapeutic efficacy and immunological response of CCL5 antagonists in models of contact skin reaction.

    Directory of Open Access Journals (Sweden)

    Miriam Canavese

    Full Text Available Skin-infiltrating T-cells play a predominant role in allergic and inflammatory skin diseases such as atopic dermatitis, psoriasis and allergic contact dermatitis. These T-cells are attracted by several chemotactic factors including the chemokine CCL5/RANTES, a CC chemokine inducing both the migration and activation of specific leukocyte subsets. CCL5 has been found to be associated with various cell-mediated hypersensitive disorders such as psoriasis, atopic dermatitis and irritant contact dermatitis. We have used two antagonists, the first, Met-CCL5, a dual CCR1/CCR5 antagonist and the second, a variant in which GAG binding is abrogated, (44AANA(47-CCL5, which acts as a dominant negative inhibitor of CCL5. The antagonists were tested in two models of contact skin reaction. The first, irritant contact dermatitis (ICD is a pathological non-specific inflammatory skin condition arising from the release of pro-inflammatory cytokines by keratinocytes in response to haptens, usually chemicals. The second, contact hypersensitivity (CHS is a T-cell dependent model, mimicking in part the T-cell-mediated skin diseases such as psoriasis. In both models, the CCL5 antagonists showed therapeutic efficacy by reducing swelling by 50% as well as the reduction of soluble mediators in homogenates derived from challenged ears. These results demonstrate that blocking the receptor or the ligand are both effective strategies to inhibit skin inflammation.

  9. Effect of Prayer and “OM” Meditation in Enhancing Galvanic Skin Response

    Directory of Open Access Journals (Sweden)

    Ira Das

    2012-10-01

    Full Text Available The research was conducted with the purpose to study the effect of prayer and meditation on galvanic skin response (GSR. It was hypothesized that there was a significant positive effect of prayer and meditation (Om chanting on galvanic skin response (GSR. The sample consisted of 20 normal, healthy female participants through purposive sampling. The age group of the sample was 18 to 24 years (Mean= 18.7, SD= 1.55. Gender was female and minimum education was graduation. The daily practice time of prayer and meditation session was 30 minutes for one month. Pre- Post data were recorded before and after intervention of prayer and meditation session by using single group pre-post research design. Recordings of galvanic skin response (GSR were made on a computerized polygraph (Model Physiopac, PP 4, Medicaid Systems, Chandigarh, India test. The results revealed a significant increase in GSR values as an effect of prayer and meditation which suggested the psychophysiological relaxation. Practicing prayer and meditation increases the galvanic skin response and hence decreases the stress level of the individual.

  10. Media Research with a Galvanic Skin Response Biosensor: Some Kids Work Up a Sweat!

    Science.gov (United States)

    Clariana, Roy B.

    This study considers the galvanic skin response (GSR) of sixth-grade students (n=20) using print, video, and microcomputer segments. Subjects received all three media treatments, in randomized order. Data for analysis consisted of standardized test scores and GSR measures; a moderate positive relationship was shown between cumulative GSR and…

  11. Thermal Response of In Vivo Human Skin to Fractional Radiofrequency Microneedle Device

    Directory of Open Access Journals (Sweden)

    Woraphong Manuskiatti

    2016-01-01

    Full Text Available Background. Fractional radiofrequency microneedle system (FRMS is a novel fractional skin resurfacing system. Data on thermal response to this fractional resurfacing technique is limited. Objectives. To investigate histologic response of in vivo human skin to varying energy settings and pulse stacking of a FRMS in dark-skinned subjects. Methods. Two female volunteers who were scheduled for abdominoplasty received treatment with a FRMS with varying energy settings at 6 time periods including 3 months, 1 month, 1 week, 3 days, 1 day, and the time immediately before abdominoplasty. Biopsy specimens were analyzed using hematoxylin and eosin (H&E, Verhoeff-Van Gieson (VVG, colloidal iron, and Fontana-Masson stain. Immunohistochemical study was performed by using Heat Shock Protein 70 (HSP70 antibody and collagen III monoclonal antibody. Results. The average depth of radiofrequency thermal zone (RFTZ ranged from 100 to 300 μm, correlating with energy levels. Columns of cell necrosis and collagen denaturation followed by inflammatory response were initially demonstrated, with subsequent increasing of mucin at 1 and 3 months after treatment. Immunohistochemical study showed positive stain with HSP70. Conclusion. A single treatment with a FRMS using appropriate energy setting induces neocollagenesis. This wound healing response may serve as a mean to improve the appearance of photodamaged skin and atrophic scars.

  12. Thermal Response of In Vivo Human Skin to Fractional Radiofrequency Microneedle Device.

    Science.gov (United States)

    Manuskiatti, Woraphong; Pattanaprichakul, Penvadee; Inthasotti, Siriluk; Sitthinamsuwan, Panitta; Hanamornroongruang, Suchanan; Wanitphakdeedecha, Rungsima; Chu-Ongsakol, Sorawuth

    2016-01-01

    Background. Fractional radiofrequency microneedle system (FRMS) is a novel fractional skin resurfacing system. Data on thermal response to this fractional resurfacing technique is limited. Objectives. To investigate histologic response of in vivo human skin to varying energy settings and pulse stacking of a FRMS in dark-skinned subjects. Methods. Two female volunteers who were scheduled for abdominoplasty received treatment with a FRMS with varying energy settings at 6 time periods including 3 months, 1 month, 1 week, 3 days, 1 day, and the time immediately before abdominoplasty. Biopsy specimens were analyzed using hematoxylin and eosin (H&E), Verhoeff-Van Gieson (VVG), colloidal iron, and Fontana-Masson stain. Immunohistochemical study was performed by using Heat Shock Protein 70 (HSP70) antibody and collagen III monoclonal antibody. Results. The average depth of radiofrequency thermal zone (RFTZ) ranged from 100 to 300 μm, correlating with energy levels. Columns of cell necrosis and collagen denaturation followed by inflammatory response were initially demonstrated, with subsequent increasing of mucin at 1 and 3 months after treatment. Immunohistochemical study showed positive stain with HSP70. Conclusion. A single treatment with a FRMS using appropriate energy setting induces neocollagenesis. This wound healing response may serve as a mean to improve the appearance of photodamaged skin and atrophic scars. PMID:27247943

  13. Biological response modifiers and their potential use in the treatment of inflammatory skin diseases

    DEFF Research Database (Denmark)

    Villadsen, Louise S; Skov, Lone; Baadsgaard, Ole

    2003-01-01

    and fewer side-effects than the current systemic therapies now used for severe psoriasis, contact dermatitis and atopic dermatitis. In the pathogenesis of inflammatory skin diseases, the immune system plays a pivotal role, and this is where biological response modifiers such as monoclonal antibodies...

  14. Pathological gambling: Relation of skin conductance response to dopaminergic neurotransmission and sensation-seeking

    DEFF Research Database (Denmark)

    Peterson, Ericka; Møller, Arne; Doudet, Doris;

    2010-01-01

    Absent Skin Conductance Response (SCR) in pathological gambling (PG) may relate to dopaminergic mechanisms. We recruited equal numbers of PG subjects and healthy control (HC) subjects, and then tested the claim that SCR is less conditioned by dopaminergic activity in PG subjects. During active...

  15. Force sensor in simulated skin and neural model mimic tactile SAI afferent spiking response to ramp and hold stimuli

    OpenAIRE

    Kim Elmer K; Wellnitz Scott A; Bourdon Sarah M; Lumpkin Ellen A; Gerling Gregory J

    2012-01-01

    Abstract Background The next generation of prosthetic limbs will restore sensory feedback to the nervous system by mimicking how skin mechanoreceptors, innervated by afferents, produce trains of action potentials in response to compressive stimuli. Prior work has addressed building sensors within skin substitutes for robotics, modeling skin mechanics and neural dynamics of mechanotransduction, and predicting response timing of action potentials for vibration. The effort here is unique because...

  16. A comparison of the effects of captopril and enalapril on skin responses to intradermal bradykinin and skin blood flow in the human forearm.

    OpenAIRE

    LI KAM WA, T. C.; Cooke, E D; Turner, P

    1993-01-01

    1. The effects of captopril and enalapril on skin responses to intradermal injections of bradykinin and skin blood flow in the forearm were investigated in this randomised, double-blind, placebo-controlled, cross-over study. 2. Intradermal injections of 0, 1, 2.5 and 5 micrograms of bradykinin in 0.9% sodium chloride were made into the forearm of twelve healthy volunteers before and at 2, 6 and 24 h after single oral doses of 25 mg captopril, 10 mg enalapril or placebo. Forearm skin blood flo...

  17. The Heritability of the Skin Conductance Orienting Response: A Longitudinal Twin Study

    OpenAIRE

    Tuvblad, Catherine; Gao, Yu; Isen, Joshua; Botwick, Theodore; Raine, Adrian; Baker, Laura A.

    2011-01-01

    The orienting response is a widely used experimental paradigm that reflects the association between electrodermal activity and psychological processes. The present study examined the genetic and environmental etiology of skin conductance orienting response (SCOR) magnitude in a sample of twins assessed at ages 9-10, 11-13 and 14-16 years. Structural equation modeling at each visit showed that genetic influences explained 56%, 83%, and 48% of the total variance in SCOR at visit 1, 2, and 3 res...

  18. Arsenic-induced enhancement of ultraviolet radiation carcinogenesis in mouse skin: a dose-response study.

    OpenAIRE

    Burns, Fredric J.; Uddin, Ahmed N.; Wu, Feng; Nádas, Arthur; Rossman, Toby G.

    2004-01-01

    The present study was designed to establish the form of the dose-response relationship for dietary sodium arsenite as a co-carcinogen with ultraviolet radiation (UVR) in a mouse skin model. Hairless mice (strain Skh1) were fed sodium arsenite continuously in drinking water starting at 21 days of age at concentrations of 0.0, 1.25, 2.5, 5.0, and 10 mg/L. At 42 days of age, solar spectrum UVR exposures were applied three times weekly to the dorsal skin at 1.0 kJ/m2 per exposure until the experi...

  19. Mechanical response of porcine skin under compression from low to high strain rates

    Science.gov (United States)

    Bo, Chiara; Butler, Ben; Williams, Alun; Brown, Katherine; Proud, William

    2013-06-01

    Uniaxial compression experiments were performed on fresh porcine skin samples at different strain rates to study the stress-strain response. Low strain rate experiments were performed with an Instron 5566, while high strain rates were achieved using a Split Hopkinson Pressure Bar system. Magnesium bars and semiconductor strain gauges were used respectively to maximize the signal transmission from porcine skin to the output bar and to allow the signal measurement. Skin samples were harvested from different area of the animal to investigate the heterogeneity of such material. The experimental results showed that the mechanical response of skin in compression is strongly dependent on the strain rate of loading and on the location from which the samples were collected. Specimens collected from the rump showed a stiffer response compared to samples harvested from the thigh. Finally, a histological analysis of the samples post compression was carried out to examine the extent of tissue damage as a function of strain rate. This work is supported by the Atomic Weapons Establishment, UK and The Royal British Legion Centre for Blast Injury Studies at Imperial College London, UK.

  20. Primary Sjögrens syndrome is associated with impaired autonomic response to orthostasis and sympathetic failure

    Science.gov (United States)

    Ng, W.-F.; Stangroom, A.J.; Davidson, A.; Wilton, K.; Mitchell, S.; Newton, J.L.

    2012-01-01

    Background: Symptoms in keeping with autonomic dysfunction are commonly described by primary Sjögrens syndrome patients (pSS); whether objective abnormalities of autonomic function occur is unclear. This study set out to explore dynamic cardiovascular autonomic responses in pSS and their relationship with symptoms and quality of life. Methods: Twenty-one people from the UK pSS registry, 21 community controls and 21 patients with the autoimmune liver disease primary biliary cirrhosis (PBC) (matched case-wise for age and sex) attended for assessment of autonomic responses to orthostasis and Valsalva manoeuvre (VM). pSS patients also completed EULAR Sjögrens Syndrome patient-reported index (ESSPRI), EULAR Sjögren’s syndrome disease activity index (ESSDAI), fatigue impact scale and EURO-QOL 5-dimension (EQ-5D). Results: Compared with controls, pSS patients had significantly lower baseline systolic blood pressure (SBP) (114 ± 13 vs. 127 ± 20; P = 0.02), which dropped to a significantly lower value (98 ± 22 vs. 119 ± 24, P = 0.009). When area under the curve (AUC) was calculated for when the SBP was below baseline this was significantly greater in pSS compared to both control groups (pSS vs. control vs. PBC: 153 ± 236 vs. 92 ± 85 vs. 1.2 ± 0.3, P = 0.005). Peak phase IV SBP during the VM was significantly lower in pSS (P = 0.007) indicating early sympathetic failure. Increased heart rate associated with fatigue (P = 0.02; r2 = 0.2) and EQ-5D. A shift in sympathetic-vagal balance associated with overall symptom burden (ESSPRI) (P = 0.04, r2 = 0.3) and EULAR sicca score (P = 0.016; r2 = 0.3), the latter also correlated with baroreceptor effectiveness (P = 0.03; r2 = 0.2) and diastolic blood pressure variability (P = 0.003; r2 = 0.4). Conclusion: pSS patients have impaired blood pressure response to standing. Dysautonomia correlates with PSS-associated symptoms and quality of life. PMID:22976617

  1. Perinatal taurine exposure programs patterns of autonomic nerve activity responses to tooth pulp stimulation in adult male rats

    Science.gov (United States)

    Khimsuksri, Sawita; Wyss, J. Michael; Thaeomor, Atcharaporn; Paphangkorakit, Jarin; Jirakulsomchok, Dusit; Roysommuti, Sanya

    2016-01-01

    Perinatal taurine excess or deficit influences adult health and disease, especially relative to the autonomic nervous system. This study tests the hypothesis that perinatal taurine exposure influences adult autonomic nervous system control of arterial pressure in response to acute electrical tooth pulp stimulation. Female Sprague-Dawley rats were fed normal rat chow with 3% β-alanine (taurine depletion, TD), 3% taurine (taurine supplementation, TS) or water alone (control, C) from conception to weaning. Their male offspring were fed normal rat chow and tap water throughout the experiment. At 8–10 weeks of age, blood chemistry, arterial pressure, heart rate and renal sympathetic nerve activity were measured in anesthetized rats. Age, body weight, mean arterial pressure, heart rate, plasma electrolytes, blood urea nitrogen, plasma creatinine and plasma cortisol were not significantly different among the three groups. Before tooth pulp stimulation, low (0.3–0.5 Hz) and high frequency (0.5–4.0 Hz) power spectral densities of arterial pressure were not significantly different among groups, while the power spectral densities of renal sympathetic nerve activity were significantly decreased in TD compared to control rats. Tooth pulp stimulation did not change arterial pressure, heart rate, renal sympathetic nerve and arterial pressure power spectral densities in the 0.3–4.0 Hz spectrum or renal sympathetic nerve firing rate in any group. In contrast, perinatal taurine imbalance disturbed very low frequency power spectral densities of both arterial pressure and renal sympathetic nerve activity (below 0.1 Hz), both before and after the tooth pulp stimulation. The power densities of TS were most sensitive to ganglionic blockade and central adrenergic inhibition, while those of TD were sensitive to both central and peripheral adrenergic inhibition. The present data indicate that perinatal taurine imbalance can lead to aberrant autonomic nervous system responses in

  2. High-power femtosecond-terahertz pulse induces a wound response in mouse skin

    Science.gov (United States)

    Kim, Kyu-Tae; Park, Jaehun; Jo, Sung Jin; Jung, Seonghoon; Kwon, Oh Sang; Gallerano, Gian Piero; Park, Woong-Yang; Park, Gun-Sik

    2013-08-01

    Terahertz (THz) technology has emerged for biomedical applications such as scanning, molecular spectroscopy, and medical imaging. Although a thorough assessment to predict potential concerns has to precede before practical utilization of THz source, the biological effect of THz radiation is not yet fully understood with scant related investigations. Here, we applied a femtosecond-terahertz (fs-THz) pulse to mouse skin to evaluate non-thermal effects of THz radiation. Analysis of the genome-wide expression profile in fs-THz-irradiated skin indicated that wound responses were predominantly mediated by transforming growth factor-beta (TGF-β) signaling pathways. We validated NFκB1- and Smad3/4-mediated transcriptional activation in fs-THz-irradiated skin by chromatin immunoprecipitation assay. Repeated fs-THz radiation delayed the closure of mouse skin punch wounds due to up-regulation of TGF-β. These findings suggest that fs-THz radiation initiate a wound-like signal in skin with increased expression of TGF-β and activation of its downstream target genes, which perturbs the wound healing process in vivo.

  3. Mom feels what her child feels: thermal signatures of vicarious autonomic response while watching children in a stressful situation

    Directory of Open Access Journals (Sweden)

    Barbara eManini

    2013-06-01

    Full Text Available Maternal attunement with an infant's emotional states is thought to represent a distinctive feature of the human primary bond. It implies the mother’s ability of empathizing with her child in order to fulfil the child’s needs in an immediate and appropriate manner. Thus, it is particularly involved in stressful situations. By assuming that maternal attunement embodies a direct sharing of physiological responses with the child, we compared the autonomic response of mothers observing their own distressed child with those of other women observing an unknown child involved in an ecological distressful condition (mishap paradigm. The hypothesis was that the adult’s response was more attuned with the child’s response in the former group than in the latter group. The autonomic response was non-invasively evaluated through the recording of the thermal facial imprints by means of thermal infrared (IR imaging. Nine mother-child dyads and nine woman-unknown child dyads were studied. We found marked similarities between the facial temperature dynamics of women and children along the experimental procedure, thus providing evidence for a direct emotional sharing within the adult-child dyad. The evidence for common dynamics in the time course of the temperatures was assessed through correlation analysis and, nevertheless, resulted stronger in the mother-child dyads than in the other women–child dyads. In addition, temporal analysis showed a faster response in mothers than in other women, thus confirming our study hypothesis. Besides confirming the extraordinary capability of thermal infrared imaging to preserve ecological context in the study of social or non-verbal interactions, these results suggest that maternity appears to potentiate the emotional attunement with the child. Although based on preliminary results, this study opens new perspectives in the study of the factors modulating vicarious socio-emotional processes.

  4. [Autonomic neuropathies].

    Science.gov (United States)

    Siepmann, T; Penzlin, A I; Illigens, B M W

    2013-07-01

    Autonomic neuropathies are a heterogeneous group of diseases that involve damage of small peripheral autonomic Aδ- and C-fibers. Causes of autonomic nerve fiber damage are disorders such as diabetes mellitus and HIV-infection. Predominant symptoms of autonomic neuropathy are orthostatic hypotension, gastro-intestinal problems, urogenital dysfunction, and cardiac arrhythmia, which can severely impair the quality of life in affected patients. Furthermore, autonomic neuropathies can be induced by autoimmune diseases such as acute inflammatory demyelinating polyneuropathy, hereditary disorders such as the lysosomal storage disorder Fabry disease and hereditary sensory and autonomic neuropathies, as well as certain toxins and drugs.

  5. Effects of psychological stress test on the cardiac response of public safety workers: alternative parameters to autonomic balance

    International Nuclear Information System (INIS)

    It is well known that public safety workers (PSW) face many stressful situations that yield them as high-risk population for suffering chronic stress diseases. In this multidisciplinary research the cardiac response to induced psychological stress by a short duration Stroop test was evaluated in 20 female and 19 male PSW, in order to compare traditionally used cardiac response parameters with alternative ones. Electrocardiograms have been recorded using the Eindhoven electrodes configuration for 1 min before, 3 min during and 1 min after the test. Signals analysis has been performed for the heart rate and the power spectra of its variability and of the variability of the amplitude of the R-wave, i.e. the highest peak of the electrocardiographic signal periodic sequence. The results demonstrated that the traditional autonomic balance index shows no significant differences between stages. In contrast, the median of the area of the power spectrum of the R-wave amplitude variability in the frequency region dominated by the autonomous nervous system (0.04-to-0.4 Hz) is the more sensitive parameter. Moreover, this parameter allows to identify gender differences consistent with those encountered in other studies

  6. Autonomic responses to cold face stimulation in sickle cell disease: a time-varying model analysis

    Science.gov (United States)

    Chalacheva, Patjanaporn; Kato, Roberta M; Sangkatumvong, Suvimol; Detterich, Jon; Bush, Adam; Wood, John C; Meiselman, Herbert; Coates, Thomas D; Khoo, Michael C K

    2015-01-01

    Sickle cell disease (SCD) is characterized by sudden onset of painful vaso-occlusive crises (VOC), which occur on top of the underlying chronic blood disorder. The mechanisms that trigger VOC remain elusive, but recent work suggests that autonomic dysfunction may be an important predisposing factor. Heart-rate variability has been employed in previous studies, but the derived indices have provided only limited univariate information about autonomic cardiovascular control in SCD. To circumvent this limitation, a time-varying modeling approach was applied to investigate the functional mechanisms relating blood pressure (BP) and respiration to heart rate and peripheral vascular resistance in healthy controls, untreated SCD subjects and SCD subjects undergoing chronic transfusion therapy. Measurements of respiration, heart rate, continuous noninvasive BP and peripheral vascular resistance were made before, during and after the application of cold face stimulation (CFS), which perturbs both the parasympathetic and sympathetic nervous systems. Cardiac baroreflex sensitivity estimated from the model was found to be impaired in nontransfused SCD subjects, but partially restored in SCD subjects undergoing transfusion therapy. Respiratory-cardiac coupling gain was decreased in SCD and remained unchanged by chronic transfusion. These results are consistent with autonomic dysfunction in the form of impaired parasympathetic control and sympathetic overactivity. As well, CFS led to a significant reduction in vascular resistance baroreflex sensitivity in the nontransfused SCD subjects but not in the other groups. This blunting of the baroreflex control of peripheral vascular resistance during elevated sympathetic drive could be a potential factor contributing to the triggering of VOC in SCD. PMID:26177958

  7. Autonomic responses to cold face stimulation in sickle cell disease: a time-varying model analysis.

    Science.gov (United States)

    Chalacheva, Patjanaporn; Kato, Roberta M; Sangkatumvong, Suvimol; Detterich, Jon; Bush, Adam; Wood, John C; Meiselman, Herbert; Coates, Thomas D; Khoo, Michael C K

    2015-07-14

    Sickle cell disease (SCD) is characterized by sudden onset of painful vaso-occlusive crises (VOC), which occur on top of the underlying chronic blood disorder. The mechanisms that trigger VOC remain elusive, but recent work suggests that autonomic dysfunction may be an important predisposing factor. Heart-rate variability has been employed in previous studies, but the derived indices have provided only limited univariate information about autonomic cardiovascular control in SCD. To circumvent this limitation, a time-varying modeling approach was applied to investigate the functional mechanisms relating blood pressure (BP) and respiration to heart rate and peripheral vascular resistance in healthy controls, untreated SCD subjects and SCD subjects undergoing chronic transfusion therapy. Measurements of respiration, heart rate, continuous noninvasive BP and peripheral vascular resistance were made before, during and after the application of cold face stimulation (CFS), which perturbs both the parasympathetic and sympathetic nervous systems. Cardiac baroreflex sensitivity estimated from the model was found to be impaired in nontransfused SCD subjects, but partially restored in SCD subjects undergoing transfusion therapy. Respiratory-cardiac coupling gain was decreased in SCD and remained unchanged by chronic transfusion. These results are consistent with autonomic dysfunction in the form of impaired parasympathetic control and sympathetic overactivity. As well, CFS led to a significant reduction in vascular resistance baroreflex sensitivity in the nontransfused SCD subjects but not in the other groups. This blunting of the baroreflex control of peripheral vascular resistance during elevated sympathetic drive could be a potential factor contributing to the triggering of VOC in SCD. PMID:26177958

  8. Immune Responses to Trichloroethylene and Skin Gene Expression Profiles in Sprague Dawley Rats

    Institute of Scientific and Technical Information of China (English)

    XIAO-YAN CHEN; ZHI-XIONG ZHUANG; XIAO-HUI WANG; JIN-ZHOU ZHANG

    2006-01-01

    Objective To characterize the immune reaction in SD rats exposed to trichloroethylene (TCE) and to identify the gene expression profiles involved in skin after TCE exposure. Methods Fifteen percent of TCE was injected intradermally into the rat back (100 μL/120 g) at intervals of 7 days. Whole blood was collected 24 h after the fifth or seventh intradermic administration of TCE. The percentages of CD4+ and CD8+ of T lymphocytes were measured by a flow cytometer. The concentrations of IFN-gamma and IL-4 in the serum were semi-quantified by ELISA. Total RNAs of skin samples at 3 h or 24 h after the seventh dose of TCE in SD rats were extracted, and gene expression profiles of these tissues were analyszed by rat toxicology U34 array of Affymetrix. Results Obvious decline of CD4+ in T lymphocytes was observed in theTCE-administer group. No significant concentration differences in IFN-gamma and IL-4 were found between TCE-treated and control rats. Gadd45a and Mel were significantly up regulated in skin tissue 24 h after TCE exposure. The expression regulation of immune response factors was as active as proteins associated with lipid metabolism and synthesis process in these skin samples of SD rats exposed to TCE. Conclusion T-helper type 1 cells mediate immune response can not be elicited in TCE-treated SD rats, but certain immune disorder can be induced.

  9. Three-dimensional model on thermal response of skin subject to laser heating.

    Science.gov (United States)

    Shen, Wensheng; Zhang, Jun; Yang, Fuqian

    2005-04-01

    A three-dimensional (3D) multilayer model based on the skin physical structure is developed to investigate the transient thermal response of human skin subject to laser heating. The temperature distribution of the skin is modeled by the bioheat transfer equation, and the influence of laser heating is expressed as a source term where the strength of the source is a product of a Gaussian shaped incident irradiance, an exponentially shaped axial attenuation, and a time function. The water evaporation and diffusion is included in the model by adding two terms regarding the heat loss due to the evaporation and diffusion, where the rate of water evaporation is determined based on the theory of laminar boundary layer. Cryogen spray cooling (CSC) in laser therapy is studied, as well as its effect on the skin thermal response. The time-dependent equation is discretized using the finite difference method with the Crank-Nicholson scheme and the stability of the numerical method is analyzed. The large sparse linear system resulted from discretizing the governing partial differential equation is solved by a GMRES solver and the expected simulation results are obtained.

  10. A 41-year-old man with polyarthritis and severe autonomic neuropathy

    Directory of Open Access Journals (Sweden)

    Matthew E Bourcier

    2008-09-01

    Full Text Available Matthew E Bourcier, Aaron I VinikEastern Virginia Medical School, Norfolk, VA, USAAbstract: Orthostasis due to autonomic neuropathy can cause severe debilitation and prove refractory to treatment. This report describes a case of severe sympathetic and parasympathetic autonomic dysfunction as a consequence of acetylcholine receptor antibodies and Sjogren’s syndrome. Symptomatic management, plasma fluid expanders, and IVIG therapy failed to offer a salutary response to the condition. Etanercept therapy provided improvement of the orthostasis and autonomic function measured as high and low frequency respiratory effects on heart rate variability as well as enhancement of skin blood flow using Laser Doppler. It would be of considerable interest to determine the effectiveness of etanercept in other autoimmune neuropathies.Keywords: autonomic neuropathy, etanercept, IntraEpidermal Nerve Fibers (IENF, acetylcholine receptor antibodies, laser doppler skin blood flow, orthostasis

  11. Evaluation of Autonomic Dysfunction in Obstructive Sleep Apnea Syndrome

    Directory of Open Access Journals (Sweden)

    Ahmet Turan Evlice

    2012-04-01

    Full Text Available The nervous system, which controls the body's internal organs is called Autonomic Nervous System. Parkinson's disease, vascular diseases, diabetes mellitus and Guilllain-Barre syndrome cause to disotonomia. Recent studies has been shown, obstructive sleep apnea syndrome cause to disotonomia too. To investigate disotonomia in in obstructive sleep apnea syndrome , should be preferred the methods like analysis of heart rate variability and sympathetic skin response which have low cost and easy applicability. Thus, it will be possible to prevent morbidity and mortality due to autonomic dysfuncion. [Archives Medical Review Journal 2012; 21(2.000: 109-121

  12. Effects of emotion regulation difficulties on the tonic and phasic cardiac autonomic response.

    Directory of Open Access Journals (Sweden)

    Guillaume Berna

    Full Text Available Emotion regulation theory aims to explain the interactions between individuals and the environment. In this context, Emotion Regulation Difficulties (ERD disrupt the physiological component of emotions through the autonomic nervous system and are involved in several psychopathological states.We were interested in comparing the influence of a film-elicited emotion procedure on the autonomic nervous system activity of two groups with different levels of emotion regulation difficulties.A total of 63 women (undergraduate students ranging from 18 to 27 (20.7 ± 1.99 years old were included. Using the upper and lower quartile of a questionnaire assessing the daily difficulties in regulating emotions, two groups, one with low (LERD and one with high (HERD levels of emotion regulation difficulties, were constituted and studied during a film-elicited emotion procedure. Cardiac vagal activity (HF-HRV was analyzed during three periods: baseline, film-elicited emotion, and recovery.The cardiovascular results showed a decrease in HF-HRV from baseline to elicitation for both groups. Then, from elicitation to recovery, HF-HRV increased for the LERD group, whereas a low HF-HRV level persisted for the HERD group.The HERD group exhibited inappropriate cardiac vagal recovery after a negative emotion elicitation had ended. Cardiac vagal tone took longer to return to its initial state in the HERD group than in the LERD group. Prolonged cardiac vagal suppression might constitute an early marker of emotion regulation difficulties leading to lower cardiac vagal tone.

  13. BRN 3.1 Knockouts Affect the Vestibular, Autonomic, and Circadian Rhythm Responses to 2G Exposure

    Science.gov (United States)

    Murakami, D. M.; Erkman, L.; Rosenfeld, M. G.; Fuller, C. A.

    1999-01-01

    Our previous studies have demonstrated that 2G exposure via centrifugation significantly attenuated the daily mean and circadian rhythm amplitude of rat body temperature (Tb), heart rate, and activity (Act). In addition, 2G exposure activates neural responses in several vestibular, autonomic, and circadian nuclei. Although we have characterized the effect of 2G on an animal's physiological, neuronal, and behavioral responses, it will be important to understand the underlying neural and physiological mechanisms that mediate those responses. For example, the vestibular responses, proprioceptive feedback, or fluid shifts may be the critical factors that mediate the responses to 2G. As a first step to understand the relative importance of these different response pathways to altered gravitational fields, this study examined the contribution of the vestibular system by utilizing an animal model from molecular biology. Brain 3.1 (Bm 3.1) is a POU domain homeobox gene involved in the normal development of the vestibular and auditory system. Brn 3.1 deletion results in a loss of hair cells in the otoliths, semicircular canals, and cochlea. As a result mice with a Brn 3.1 deletion do not have a functioning vestibular or auditory system. The BRN 3.1 knockout mouse could be a very useful animal model for isolating the role of the vestibular system in mediating the physiological responses to 2G exposure. Therefore, this study compared the effect of 2G exposure via centrifugation between Brn 3.1 knockout (KO) versus Wildtype (W) mice.

  14. Hypothalamic-pituitary-adrenal and cardiac autonomic responses to transrectal examination differ with behavioral reactivity in dairy cows.

    Science.gov (United States)

    Kovács, L; Kézér, F L; Kulcsár-Huszenicza, M; Ruff, F; Szenci, O; Jurkovich, V

    2016-09-01

    Behavior, hypothalamic-pituitary-adrenal axis, and cardiac autonomic nervous system (ANS) activity were evaluated in response to transrectal examination in nonlactating Holstein-Friesian cows with different behavioral reactivity. According to behavioral reactions shown to the procedure of fixing the heart rate (HR) monitors, the 20 cows with the highest and the 20 cows with the lowest behavioral reactivity were involved in the study (high responder, n=20; and low responder, n=20, respectively). Activity of the ANS was assessed by HR and HR variability parameters. Blood and saliva were collected at 5 min before (baseline) and 0, 5 10, 15, 20, 30, 40, 60, and 120 min after the examination to determine cortisol concentrations. The examination lasted for 5 min. Cardiac parameters included HR, the root mean square of successive differences between the consecutive interbeat intervals, the high frequency (HF) component of heart rate variability, and the ratio between the low frequency (LF) and HF parameter (LF/HF). Following the examination, peak plasma and saliva cortisol levels and the amplitude of the plasma and saliva cortisol response were higher in high responder cows than in low responders. Areas under the plasma and saliva cortisol response curves were greater in high responder cows. Plasma and salivary cortisol levels correlated significantly at baseline (r=0.91), right after examination (r=0.98), and at peak levels (r=0.96). Area under the HR response curve was higher in low responder cows; however, maximum HR and the amplitude of the HR response showed no differences between groups. Minimum values of both parameters calculated for the examination were higher in high responders. Following the examination, response parameters of root mean square of successive differences and HF did not differ between groups. The maximum and the amplitude of LF/HF response and area under the LF/HF response curve were lower in low responder cows, suggesting a lower sympathetic

  15. Catecholamines and diabetic autonomic neuropathy

    DEFF Research Database (Denmark)

    Hilsted, J

    1995-01-01

    In diabetic patients with autonomic neuropathy plasma noradrenaline concentration, used as an index of sympathetic nervous activity, is low. This decrease is, however, only found in patients with a long duration of diabetes with clinically severe autonomic neuropathy. This apparent insensitivity...... of plasma catecholamine measurements is not due to changes in the clearance of catecholamines in diabetic autonomic neuropathy. The physiological responses to infused adrenaline and to noradrenaline are enhanced, for noradrenaline mainly cardiovascular responses. Adrenoceptors (alpha and beta adrenoceptors......) are not altered in circulating blood cells in diabetic autonomic neuropathy. Thus, a generalized up-regulation of adrenoceptors does not occur in diabetic autonomic neuropathy....

  16. Olfactory ensheathing cell transplantation improves sympathetic skin responses in chronic spinal cord injury

    OpenAIRE

    Zheng, Zuncheng; Liu, Guifeng; Chen, Yuexia; Wei, Shugang

    2013-01-01

    Forty-three patients with chronic spinal cord injury for over 6 months were transplanted with bryonic olfactory ensheathing cells, 2–4 × 106, into multiple sites in the injured area under the surgical microscope. The sympathetic skin response in patients was measured with an electromyography/evoked potential instrument 1 day before transplantation and 3–8 weeks after transtion. Spinal nerve function of patients was assessed using the American Spinal Injury Association impairment scale. The sy...

  17. Early delayed hypersensitivity responses in tuberculin skin tests after heavy occupational exposure to tuberculosis.

    OpenAIRE

    Gibbs, J. H.; Grange, J. M.; Beck, J S; Jawad, E; Potts, R C; Bothamley, G H; Kardjito, T.

    1991-01-01

    The early (six hours) reaction to tuberculin skin testing was studied in 33 Indonesian hospital workers with frequent occupational exposure to M tuberculosis and compared with responses maximal at the usual time (48 hours) in factory workers, from the same locality but with only occasional occupational exposure, to determine the nature of the early reaction. The early reaction had the same general histopathological appearance as that seen in the conventional (48 hour) reaction, and both had a...

  18. Optimising a model-based approach to inferring fear learning from skin conductance responses

    OpenAIRE

    Staib, M.; Castegnetti, G.; Bach, D R

    2015-01-01

    Anticipatory sympathetic arousal is often inferred from skin conductance responses (SCR) and used to quantify fear learning. We have previously provided a model-based approach for this inference, based on a quantitative Psychophysiological Model (PsPM) formulated in non-linear dynamic equations. Here we seek to optimise the inversion of this PsPM. Using two independent fear conditioning datasets, we benchmark predictive validity as the sensitivity to separate the likely presence or absence of...

  19. An improved algorithm for model-based analysis of evoked skin conductance responses

    OpenAIRE

    Bach, D R; Friston, K.J.; Dolan, R. J.

    2013-01-01

    Model-based analysis of psychophysiological signals is more robust to noise - compared to standard approaches - and may furnish better predictors of psychological state, given a physiological signal. We have previously established the improved predictive validity of model-based analysis of evoked skin conductance responses to brief stimuli, relative to standard approaches. Here, we consider some technical aspects of the underlying generative model and demonstrate further improvements. Most im...

  20. Agent, autonomous

    OpenAIRE

    Luciani, Annie

    2007-01-01

    The expression autonomous agents, widely used in virtual reality, computer graphics, artificial intelligence and artificial life, corresponds to the simulation of autonomous creatures, virtual (i.e. totally computed by a program), or embodied in a physical envelope, as done in autonomous robots.

  1. Response of skin to audible signal and skin-hearing aid%皮肤对于声音信号响应与皮肤听声器

    Institute of Scientific and Technical Information of China (English)

    李建文; 于晓明; 曹力佳

    2008-01-01

    ①介绍了皮肤听声器的基本组成与昕声效果.这种新型的助听工具可使任何人通过皮肤获得听觉,但辨析语音的效果还不理想.②为了进一步研究皮肤响应声音信号的理论,构造了测试皮肤响应声音信号的实验环境.通过实验测试了皮肤响应声音信号的关键部件音频变压器、平面电极与皮肤听声之间的临界频率电压特性曲线,讨论了皮肤响应声音信号的关键部件与皮肤听声效果之间的关系,说明了通过声一电转换实现皮肤听声的特点和可行性.③介绍了新型可便携、低功耗助听产品一皮肤听声器,并与助听器、电子耳蜗、导聋犬等传统的助听工具进行了对比,说明了皮肤听声器的优越性能.%This study was designed to introduce basic components and sound-receiving effects of skin-hearing aid with transformer. This new device helped all people receive audible signals via skin, but the effects on discriminating phone were still not ideal.The experimental environment of the response of skin to audible signals was constructed for the theory research. The response on critical frequency and voltage among the transformer, the flat electrode and the skin has gotten in the experiment. It was discussed that the effect of the response of skin to audible signal between the key parts of device of hearing by skin with transformer and the skin. It was illustrated the practicability of skin hearing by sound-electricity converting.The skin-hearing aid, a low power consumption aid, was compared with traditional tools, such as hearing aid, electronic cochlea, and guide dogs, and the results proved the superiority of skin-hearing aid.

  2. The effect of selenium supplementation on DTH skin responses in healthy North American men.

    Science.gov (United States)

    Hawkes, Wayne Chris; Hwang, Amie; Alkan, Zeynep

    2009-01-01

    The trace element selenium (Se) is essential for immune system development and function in animals. However, the exact functions of Se in the human immune system and the achievable health benefits from Se supplementation remain unclear. To test whether an increased intake of dietary Se affects immune function, we conducted a randomized, controlled trial of Se supplementation in healthy free-living men. Forty-two men were administered 300microg of Se a day as high-Se Baker's yeast, or low-Se yeast for 48 weeks. Serum immunoglobulins, differential complete blood counts and lymphocyte sub-populations were measured every 6 weeks. Tests of delayed-type hypersensitivity (DTH) skin responses to mumps, candida, trychophyton, tuberculin-purified protein, and tetanus were performed at baseline and at the end of 48 weeks of treatment. Supplementation increased blood Se concentration by 50%. Surprisingly, consumption of the low-Se yeast induced anergy in DTH skin responses and increased counts of natural killer (NK) cells and T lymphocytes expressing both subunits of the high affinity interleukin-2 receptor (IL2R). DTH skin responses and IL2R+ cells did not change in the high-Se group, suggesting Se supplementation blocked induction of DTH anergy. There were no differences between groups in quality of life indicators, number of days sick, other leukocyte phenotypes, serum immunoglobulins, or complement factors. These results suggest that Se plays a role in immunotolerization, a cell-mediated process involved in many aspects of immune function.

  3. Skindex, a quality-of-life measure for patients with skin disease: reliability, validity, and responsiveness.

    Science.gov (United States)

    Chren, M M; Lasek, R J; Quinn, L M; Mostow, E N; Zyzanski, S J

    1996-11-01

    To measure the effects of skin disease on patients' quality of life, we developed a 61-item self-administered survey instrument called Skindex. Skindex has eight scales, each of which addresses a construct, or an abstract component, in a comprehensive conceptual framework: cognitive effects, social effects, depression, fear, embarrassment, anger, physical discomfort, and physical limitations. Item responses are standardized from 0 (no effect) to 100 (maximal effect); a scale score is the average of responses to items addressing a construct. In 201 patients seen by dermatologists, mean scale scores (+/-SD) ranged from 14 (+/-17) for physical limitations to 31 (+/-22) for physical discomfort. Scale scores were reproducible after 72 h (r = 0.68-0.90) and were internally consistent (Cronbach's alpha = 0.76-0.86). Construct validity was assessed in two ways: (i) in a comparison of patients with inflammatory dermatoses and patients with isolated lesions, patients with inflammatory dermatoses had higher scale scores, and (ii) in an exploratory factor analysis, 78% of the common variance was explained by seven factors that correlated with the scale scores of Skindex. Most of the a priori scale scores changed in the expected direction in patients who reported that their skin conditions had improved or worsened after 6 mo. Finally, physicians' judgments of disease severity did not consistently correlate with Skindex scores. These preliminary data suggest that Skindex reliably and responsively measures the effects of skin disease on patients' quality of life and may supplement clinical judgments of disease severity. PMID:8875954

  4. Resting cerebral metabolism correlates with skin conductance and functional brain activation during fear conditioning

    OpenAIRE

    Linnman, Clas; Zeidan, Mohamed A.; Pitman, Roger K.; Milad, Mohammed R.

    2011-01-01

    We investigated whether resting brain metabolism can be used to predict autonomic and neuronal responses during fear conditioning in 20 healthy humans. Regional cerebral metabolic rate for glucose was measured via positron emission tomography at rest. During conditioning, autonomic responses were measured via skin conductance, and blood oxygen level dependent signal was measured via functional magnetic resonance imaging. Resting dorsal anterior cingulate metabolism positively predicted differ...

  5. Intestinal Microbiota Promotes Psoriasis-Like Skin Inflammation by Enhancing Th17 Response

    Science.gov (United States)

    Zákostelská, Zuzana; Málková, Jana; Klimešová, Klára; Rossmann, Pavel; Hornová, Michaela; Novosádová, Iva; Stehlíková, Zuzana; Kostovčík, Martin; Hudcovic, Tomáš; Štepánková, Renata; Jůzlová, Kateřina; Hercogová, Jana; Tlaskalová-Hogenová, Helena

    2016-01-01

    Psoriasis is a chronic inflammatory skin disease in which Th17 cells play a crucial role. Since indigenous gut microbiota influences the development and reactivity of immune cells, we analyzed the link among microbiota, T cells and the formation of psoriatic lesions in the imiquimod-induced murine model of psoriasis. To explore the role of microbiota, we induced skin inflammation in germ-free (GF), broad-spectrum antibiotic (ATB)-treated or conventional (CV) BALB/c and C57BL/6 mice. We found that both mice reared in GF conditions for several generations and CV mice treated with ATB were more resistant to imiquimod-induced skin inflammation than CV mice. The ATB treatment dramatically changed the diversity of gut bacteria, which remained stable after subsequent imiquimod application; ATB treatment resulted in a substantial increase in the order Lactobacillales and a significant decrease in Coriobacteriales and Clostridiales. Moreover, as compared to CV mice, imiquimod induced a lower degree of local and systemic Th17 activation in both GF and ATB-treated mice. These findings suggest that gut microbiota control imiquimod-induced skin inflammation by altering the T cell response. PMID:27434104

  6. Autonomous Star Tracker Algorithms

    DEFF Research Database (Denmark)

    Betto, Maurizio; Jørgensen, John Leif; Kilsgaard, Søren;

    1998-01-01

    Proposal, in response to an ESA R.f.P., to design algorithms for autonomous star tracker operations.The proposal also included the development of a star tracker breadboard to test the algorithms performances.......Proposal, in response to an ESA R.f.P., to design algorithms for autonomous star tracker operations.The proposal also included the development of a star tracker breadboard to test the algorithms performances....

  7. Possible role of the histaminergic system in autonomic and cardiovascular responses to neuropeptide Y.

    Science.gov (United States)

    Tanida, Mamoru; Shen, Jiao; Nagai, Katsuya

    2009-02-01

    Previous studies have demonstrated that neuropeptide Y (NPY) affects blood pressure (BP) in anesthetized rats. Here, we examined the effects of the third cerebral ventricular (3CV) injection of various doses of NPY on renal sympathetic nerve activity (RSNA) and BP in anesthetized rats. 3CV injection of NPY suppressed RSNA and BP in a dose-dependent manner. Moreover, suppressing effects of NPY on RSNA and BP were eliminated by lateral cerebral ventricular (LCV) preinjection of thioperamide, an antagonist of histaminergic H3-receptor, not diphenhydramine, an antagonist of histaminergic H1-receptor. In addition, 3CV injection of NPY accelerated gastric vagal nerve activity (GVNA) and inhibited brown adipose tissue sympathetic nerve activity (BAT-SNA) of anesthetized rats, and lowered brown adipose tissue temperature (BAT-T) of conscious rats. Thus, these evidences suggest that central NPY affects autonomic nerves containing RSNA, GVNA or BAT-SNA, and BP by mediating central histaminergic H3-receptors.

  8. Autonomic Nervous System Responses to Viewing Green and Built Settings: Differentiating Between Sympathetic and Parasympathetic Activity

    Science.gov (United States)

    van den Berg, Magdalena M.H.E.; Maas, Jolanda; Muller, Rianne; Braun, Anoek; Kaandorp, Wendy; van Lien, René; van Poppel, Mireille N.M.; van Mechelen, Willem; van den Berg, Agnes E.

    2015-01-01

    This laboratory study explored buffering and recovery effects of viewing urban green and built spaces on autonomic nervous system activity. Forty-six students viewed photos of green and built spaces immediately following, and preceding acute stress induction. Simultaneously recorded electrocardiogram and impedance cardiogram signal was used to derive respiratory sinus arrhythmia (RSA) and pre-ejection period (PEP), indicators of respectively parasympathetic and sympathetic activity. The findings provide support for greater recovery after viewing green scenes, as marked by a stronger increase in RSA as a marker of parasympathetic activity. There were no indications for greater recovery after viewing green scenes in PEP as a marker of sympathetic activity, and there were also no indications of greater buffering effects of green space in neither RSA nor PEP. Overall, our findings are consistent with a predominant role of the parasympathetic nervous system in restorative effects of viewing green space. PMID:26694426

  9. Autonomic Nervous System Responses to Viewing Green and Built Settings: Differentiating Between Sympathetic and Parasympathetic Activity

    Directory of Open Access Journals (Sweden)

    Magdalena M.H.E. van den Berg

    2015-12-01

    Full Text Available This laboratory study explored buffering and recovery effects of viewing urban green and built spaces on autonomic nervous system activity. Forty-six students viewed photos of green and built spaces immediately following, and preceding acute stress induction. Simultaneously recorded electrocardiogram and impedance cardiogram signal was used to derive respiratory sinus arrhythmia (RSA and pre-ejection period (PEP, indicators of respectively parasympathetic and sympathetic activity. The findings provide support for greater recovery after viewing green scenes, as marked by a stronger increase in RSA as a marker of parasympathetic activity. There were no indications for greater recovery after viewing green scenes in PEP as a marker of sympathetic activity, and there were also no indications of greater buffering effects of green space in neither RSA nor PEP. Overall, our findings are consistent with a predominant role of the parasympathetic nervous system in restorative effects of viewing green space.

  10. Autonomic nervous system response to L-dopa in patients with advanced Parkinson's disease.

    Science.gov (United States)

    Ruonala, Verneri; Tarvainen, Mika P; Karjalainen, Pasi A; Pekkonen, Eero; Rissanen, Saara M

    2015-01-01

    Levodopa is the main treatment method for reducing the symptoms of Parkinson's disease. Whereas it reduces the motor symptoms efficiently, its effect on autonomous nervous system is not clear. The information about effect of levodopa on heart rate variability is not coherent between the studies. In this study, ECG of 11 patients with Parkinson's disease was measured during levodopa challenge with pronounced dose of fast release levodopa to ensure the positive drug effect for deep brain stimulation treatment. Heart rate variability analysis was done at three time points, before administration of levodopa, 30 and 60 minutes after administration. After 30 minutes of administration, the HRV parameters show that parasympathetic nervous system activity is decreased and the sympatho-vagal balance is shifted towards sympathetic control. At 60 minutes after administration the parasympathetic nervous system activates slightly and causes a decrease in heart rate.

  11. Standardization of a computerized method for calculating autonomic function test responses in healthy subjects and patients with diabetes mellitus

    Directory of Open Access Journals (Sweden)

    C. Neumann

    1997-02-01

    Full Text Available The objectives of the present study were 1 to compare results obtained by the traditional manual method of measuring heart rate (HR and heart rate response (HRR to the Valsalva maneuver, standing and deep breathing, with those obtained using a computerized data analysis system attached to a standard electrocardiograph machine; 2 to standardize the responses of healthy subjects to cardiovascular tests, and 3 to evaluate the response to these tests in a group of patients with diabetes mellitus (DM. In all subjects (97 healthy and 143 with DM we evaluated HRR to deep breathing, HRR to standing, HRR to the Valsalva maneuver, and blood pressure response (BPR to standing up and to a sustained handgrip. Since there was a strong positive correlation between the results obtained with the computerized method and the traditional method, we conclude that the new method can replace the traditional manual method for evaluating cardiovascular responses with the advantages of speed and objectivity. HRR and BPR of men and women did not differ. A correlation between age and HRR was observed for standing (r = -0.48, P<0.001 and deep breathing (r = -0.41, P<0.002. Abnormal BPR to standing was usually observed only in diabetic patients with definite and severe degrees of autonomic neuropathy.

  12. A dose-response analysis of skin cancer from inorganic arsenic in drinking water

    Energy Technology Data Exchange (ETDEWEB)

    Brown, K.G.; Boyle, K.E.; Chen, C.W.; Gibb, H.J. (Research Triangle Institute, Research Triangle Park, NC (USA))

    1989-12-01

    A study of the prevalence of skin cancer among 40,421 persons consuming arsenic-contaminated drinking water in Taiwan was used for a cancer dose-response assessment of ingested arsenic. The numbers of persons at risk over three dose intervals and four exposure durations were estimated from the data in order to apply the method of maximum likelihood to a multistage-Weibull time/dose-response model. A constant exposure level since birth for each of the exposure categories was assumed. It was found that the cumulative hazard increases as a power of three in age, and is linear or quadratic (with a linear coefficient) in dose. Observations from a smaller epidemiologic survey in Mexico were similar to what would be predicted from the model of the Taiwan data. Assuming that the skin cancer risk from ingested arsenic in the American population would also be similar to the Taiwan population, an American male would have a lifetime risk of developing skin cancer of 1.3 x 10(-3) (3.0 x 10(-3)) if exposed to 1 microgram/kg/day for a 76-year lifespan (median lifespan in the U.S.).

  13. Responsiveness of the Spanish Version of the “Skin Cancer Index”

    Directory of Open Access Journals (Sweden)

    M. de Troya-Martín

    2016-01-01

    Full Text Available Background. Skin Cancer Index (SCI is a specific questionnaire measuring health related quality of life (HRQL in patients with cervicofacial non-melanoma skin cancer (CFNMSC. The original scale has recently been adapted and validated into Spanish. Objectives. Evaluate the responsiveness of the Spanish version of SCI. Methods. Patients with CFNMSC candidate for surgical treatment were administered the questionnaire at time of diagnostic (t0, 7 days after surgery (t1, and 5 months after surgery (t2. The scale and subscales scores (C1: social/appearance, C2: emotional were then evaluated. Differences between t0-t1, t1-t2, and t0-t2 were determined and a gender-and-age segmented analysis was performed. Results. 88 patients, 54.8% male, mean age 62.5 years, completed the study. Differences between t0-t1 and t1-t2 scores were statistically significant (p<0.05. The lowest values were found at time of diagnosis and postsurgery. Women and patients under 65 years showed the lowest values at the three times. Limitations. Concrete geographic and cultural area. Clinical and histological variables are not analysed. Conclusions. Our results confirm responsiveness of the Spanish version of the SCI. Further development of the instrument in Spanish-speaking countries and populations will make it possible to extend worldwide research and knowledge horizons on skin cancer.

  14. Mechanisms of DNA damage response to targeted irradiation in organotypic 3D skin cultures.

    Directory of Open Access Journals (Sweden)

    Anna Acheva

    Full Text Available DNA damage (caused by direct cellular exposure and bystander signaling and the complex pathways involved in its repair are critical events underpinning cellular and tissue response following radiation exposures. There are limited data addressing the dynamics of DNA damage induction and repair in the skin particularly in areas not directly exposed. Here we investigate the mechanisms regulating DNA damage, repair, intracellular signalling and their impact on premature differentiation and development of inflammatory-like response in the irradiated and surrounding areas of a 3D organotypic skin model. Following localized low-LET irradiation (225 kVp X-rays, low levels of 53BP1 foci were observed in the 3D model (3.8±0.28 foci/Gy/cell with foci persisting and increasing in size up to 48 h post irradiation. In contrast, in cell monolayers 14.2±0.6 foci/Gy/cell and biphasic repair kinetics with repair completed before 24 h was observed. These differences are linked to differences in cellular status with variable level of p21 driving apoptotic signalling in 2D and accelerated differentiation in both the directly irradiated and bystander areas of the 3D model. The signalling pathways utilized by irradiated keratinocytes to induce DNA damage in non-exposed areas of the skin involved the NF-κB transcription factor and its downstream target COX-2.

  15. Non-Invasive Measurement of Skin Microvascular Response during Pharmacological and Physiological Provocations.

    Directory of Open Access Journals (Sweden)

    Fredrik Iredahl

    Full Text Available Microvascular changes in the skin due to pharmacological and physiological provocations can be used as a marker for vascular function. While laser Doppler flowmetry (LDF has been used extensively for measurement of skin microvascular responses, Laser Speckle Contrast Imaging (LSCI and Tissue Viability Imaging (TiVi are novel imaging techniques. TiVi measures red blood cell concentration, while LDF and LSCI measure perfusion. Therefore, the aim of this study was to compare responses to provocations in the skin using these different techniques.Changes in skin microcirculation were measured in healthy subjects during (1 iontophoresis of sodium nitroprusside (SNP and noradrenaline (NA, (2 local heating and (3 post-occlusive reactive hyperemia (PORH using LDF, LSCI and TiVi.Iontophoresis of SNP increased perfusion (LSCI: baseline 40.9±6.2 PU; 10-min 100±25 PU; p<0.001 and RBC concentration (TiVi: baseline 119±18; 10-min 150±41 AU; p = 0.011. No change in perfusion (LSCI was observed after iontophoresis of NA (baseline 38.0±4.4 PU; 10-min 38.9±5.0 PU; p = 0.64, while RBC concentration decreased (TiVi: baseline 59.6±11.8 AU; 10-min 54.4±13.3 AU; p = 0.021. Local heating increased perfusion (LDF: baseline 8.8±3.6 PU; max 112±55 PU; p<0.001, LSCI: baseline 50.8±8.0 PU; max 151±22 PU; p<0.001 and RBC concentration (TiVi: baseline 49.2±32.9 AU; max 99.3±28.3 AU; p<0.001. After 5 minutes of forearm occlusion with prior exsanguination, a decrease was seen in perfusion (LDF: p = 0.027; LSCI: p<0.001 and in RBC concentration (p = 0.045. Only LSCI showed a significant decrease in perfusion after 5 minutes of occlusion without prior exsanguination (p<0.001. Coefficients of variation were lower for LSCI and TiVi compared to LDF for most responses.LSCI is more sensitive than TiVi for measuring microvascular changes during SNP-induced vasodilatation and forearm occlusion. TiVi is more sensitive to noradrenaline-induced vasoconstriction. LSCI and Ti

  16. Skin-conductance orienting response in chronic schizophrenics: the role of neuroleptics.

    Science.gov (United States)

    Spohn, H E; Coyne, L; Wilson, J K; Hayes, K

    1989-11-01

    The primary aim of this study was to determine whether there is an association between neuroleptic treatment and skin-conductance orienting response (SCOR) nonresponding in chronic schizophrenics. In a design adapted to this purpose, we were unable to demonstrate a relationship between neuroleptics and nonresponding. Although inability to prove the null hypothesis precludes a claim that neuroleptic treatment and SCOR nonresponding are unrelated, internal evidence and prior studies strongly suggest that such a dissociation exists in most chronic schizophrenic nonresponders. We also found stable nonspecific and toxic skin conductance activity differences between SCOR "responders" and "nonresponders" on three occasions of testing. We interpret our results as bearing on state and trait issues in chronic schizophrenics.

  17. An integrated stochastic multi-regional long-term energy planning model incorporating autonomous power systems and demand response

    International Nuclear Information System (INIS)

    The power sector faces a rapid transformation worldwide from a dominant fossil-fueled towards a low carbon electricity generation mix. Renewable energy technologies (RES) are steadily becoming a greater part of the global energy mix, in particular in regions that have put in place policies and measures to promote their utilization. This paper presents an optimization-based approach to address the generation expansion planning (GEP) problem of a large-scale, central power system in a highly uncertain and volatile electricity industry environment. A multi-regional, multi-period linear mixed-integer linear programming (MILP) model is presented, combining optimization techniques with a Monte Carlo (MCA) method and demand response concepts. The optimization goal concerns the minimization of the total discounted cost by determining optimal power capacity additions per time interval and region, and the power generation mix per technology and time period. The model is evaluated on the Greek power system (GPS), taking also into consideration the scheduled interconnection of the mainland power system with those of selected autonomous islands (Cyclades and Crete), and aims at providing full insight into the composition of the long-term energy roadmap at a national level. - Highlights: • A spatial, multi-period, long-term generation expansion planning model is presented. • A Monte-Carlo method along with a demand response mechanism are incorporated. • Autonomous power systems interconnection is considered. • Electricity and CO2 emission trade are taken into account. • Lignite, natural gas and wind power comprise the dominant power technologies

  18. Bioimpedance-Based Wearable Measurement Instrumentation for Studying the Autonomic Nerve System Response to Stressful Working Conditions

    International Nuclear Information System (INIS)

    The assessment of mental stress on workers under hard and stressful conditions is critical to identify which workers are not ready to undertake a mission that might put in risk their own life and the life of others. The ATREC project aims to enable Real Time Assessment of Mental Stress of the Spanish Armed Forces during military activities. Integrating sensors with garments and using wearable measurement devices, the following physiological measurements were recorded: heart and respiration rate, skin galvanic response as well as peripheral temperature. The measuring garments are the following: a sensorized glove, an upper-arm strap and a repositionable textrode chest strap system with 6 textrodes. The implemented textile-enabled instrumentation contains: one skin galvanometer, two temperature sensors, for skin and environmental, and an Impedance Cardiographer/Pneumographer containing a 1 channel ECG amplifier to record cardiogenic biopotentials. The implemented wearable systems operated accordingly to the specifications and are ready to be used for the mental stress experiments that will be executed in the coming phases of the project in healthy volunteers.

  19. Bioimpedance-Based Wearable Measurement Instrumentation for Studying the Autonomic Nerve System Response to Stressful Working Conditions

    Science.gov (United States)

    Ferreira, J.; Álvarez, L.; Buendía, R.; Ayllón, D.; Llerena, C.; Gil-Pita, R.; Seoane, F.

    2013-04-01

    The assessment of mental stress on workers under hard and stressful conditions is critical to identify which workers are not ready to undertake a mission that might put in risk their own life and the life of others. The ATREC project aims to enable Real Time Assessment of Mental Stress of the Spanish Armed Forces during military activities. Integrating sensors with garments and using wearable measurement devices, the following physiological measurements were recorded: heart and respiration rate, skin galvanic response as well as peripheral temperature. The measuring garments are the following: a sensorized glove, an upper-arm strap and a repositionable textrode chest strap system with 6 textrodes. The implemented textile-enabled instrumentation contains: one skin galvanometer, two temperature sensors, for skin and environmental, and an Impedance Cardiographer/Pneumographer containing a 1 channel ECG amplifier to record cardiogenic biopotentials. The implemented wearable systems operated accordingly to the specifications and are ready to be used for the mental stress experiments that will be executed in the coming phases of the project in healthy volunteers.

  20. Situational reactivity of autonomic functions in schizophrenic patients.

    Science.gov (United States)

    Albus, M; Ackenheil, M; Engel, R R; Müller, F

    1982-06-01

    In a study designed to evaluate the state of arousal and the autonomic reactivity to experimental conditions in schizophrenic patients, 12 acute, unmedicated schizophrenic patients with paranoid hallucinatory symptomatology and 63 healthy normal control subjects were administered four standardized tasks: cold pressor test, noise, mental arithmetic, and active relaxation. Biochemical (norepinephrine and cortisol) and physiological (electromyogram, electroencephalogram, skin and conductance response, skin conductance level, finger pulse amplitude, finger temperature, heart rate, respiratory volume, pulse wave velocity, and electrogastrogram) parameters were measured simultaneously. Schizophrenic patients showed elevated levels of cortisol and norepinephrine, as well as heightened responsivity on measures of electromyographic activity, skin conductance level, and heart rate, throughout the trial, and reduced responsivity to conditions of stress. It is concluded that schizophrenic patients show higher nonspecific activation and reduced ability to react to external stimulation, perhaps induced by lack of inhibition of the reticular formation by the limbic system.

  1. Responsiveness of the Spanish Version of the “Skin Cancer Index”

    Science.gov (United States)

    Rivas-Ruiz, F.; Blázquez-Sánchez, N.; Fernández-Canedo, I.; Aguilar-Bernier, M.; Repiso-Jiménez, J. B.; Toribio-Montero, J. C.; Jones-Caballero, M.; Rhee, J.

    2016-01-01

    Background. Skin Cancer Index (SCI) is a specific questionnaire measuring health related quality of life (HRQL) in patients with cervicofacial non-melanoma skin cancer (CFNMSC). The original scale has recently been adapted and validated into Spanish. Objectives. Evaluate the responsiveness of the Spanish version of SCI. Methods. Patients with CFNMSC candidate for surgical treatment were administered the questionnaire at time of diagnostic (t0), 7 days after surgery (t1), and 5 months after surgery (t2). The scale and subscales scores (C1: social/appearance, C2: emotional) were then evaluated. Differences between t0-t1, t1-t2, and t0-t2 were determined and a gender-and-age segmented analysis was performed. Results. 88 patients, 54.8% male, mean age 62.5 years, completed the study. Differences between t0-t1 and t1-t2 scores were statistically significant (p Spanish version of the SCI. Further development of the instrument in Spanish-speaking countries and populations will make it possible to extend worldwide research and knowledge horizons on skin cancer.

  2. Regulating Inflammation Using Acid-Responsive Electrospun Fibrous Scaffolds for Skin Scarless Healing

    Directory of Open Access Journals (Sweden)

    Ziming Yuan

    2014-01-01

    Full Text Available Skin injury in adult mammals brings about a series of events and inflammation in the wounded area is initiated first and provides lots of inflammatory factors, which is critical for the final scar formation. While the postinjured skin of fetus and nude mice heals scarlessly owing to the absence of inflammation or immunodeficient, we designed a feasible acid-responsive ibuprofen-loaded poly(L-lactide (PLLA fibrous scaffolds via doping sodium bicarbonate to prevent excessive inflammation and achieve scarless healing finally. The morphological results of in vivo experiments revealed that animals treated with acid-responsive ibuprofen-loaded PLLA fibrous scaffolds exhibited alleviative inflammation, accelerated healing process, and regulated collagen deposition via interference in the collagen distribution, the α-smooth muscle actin (α-SMA, and the basic fibroblast growth factor (bFGF expression. The lower ratios of collagen I/collagen III and TGF-β1/TGF-β3 and higher ratio of matrix metalloproteinase-1 (MMP-1/tissue inhibitor of metalloproteinase-1 (TIMP-1 in acid-responsive ibuprofen-loaded PLLA fibrous scaffolds group were confirmed by real-time qPCR as well. These results suggest that inhibiting the excessive inflammation will result in regular collagen distribution and appropriate ratio between the factors, which promote or suppress the scar formation, then decrease the scar area, and finally achieve the scarless healing.

  3. Regulating inflammation using acid-responsive electrospun fibrous scaffolds for skin scarless healing.

    Science.gov (United States)

    Yuan, Ziming; Zhao, Jingwen; Chen, Yigang; Yang, Zhili; Cui, Wenguo; Zheng, Qi

    2014-01-01

    Skin injury in adult mammals brings about a series of events and inflammation in the wounded area is initiated first and provides lots of inflammatory factors, which is critical for the final scar formation. While the postinjured skin of fetus and nude mice heals scarlessly owing to the absence of inflammation or immunodeficient, we designed a feasible acid-responsive ibuprofen-loaded poly(L-lactide) (PLLA) fibrous scaffolds via doping sodium bicarbonate to prevent excessive inflammation and achieve scarless healing finally. The morphological results of in vivo experiments revealed that animals treated with acid-responsive ibuprofen-loaded PLLA fibrous scaffolds exhibited alleviative inflammation, accelerated healing process, and regulated collagen deposition via interference in the collagen distribution, the α-smooth muscle actin (α-SMA), and the basic fibroblast growth factor (bFGF) expression. The lower ratios of collagen I/collagen III and TGF-β1/TGF-β3 and higher ratio of matrix metalloproteinase-1 (MMP-1)/tissue inhibitor of metalloproteinase-1 (TIMP-1) in acid-responsive ibuprofen-loaded PLLA fibrous scaffolds group were confirmed by real-time qPCR as well. These results suggest that inhibiting the excessive inflammation will result in regular collagen distribution and appropriate ratio between the factors, which promote or suppress the scar formation, then decrease the scar area, and finally achieve the scarless healing.

  4. Pathological gambling: Relation of skin conductance response to dopaminergic neurotransmission and sensation-seeking

    DEFF Research Database (Denmark)

    Peterson, Ericka Ann; Møller, Arne; Doudet, Doris J.;

    2010-01-01

    Absent Skin Conductance Response (SCR) in pathological gambling (PG) may relate to dopaminergic mechanisms. We recruited equal numbers of PG subjects and healthy control (HC) subjects, and then tested the claim that SCR is less conditioned by dopaminergic activity in PG subjects. During active...... gambling, SCR differed in PG and HC subjects (P < 0.05), but positron emission tomography revealed the same dopamine receptor availability. However, highly sensation-seeking (HS) PG subjects had lower dopamine receptor availability (P < 0.0001) in the baseline, compared to normal sensation-seeking (NS) PG...

  5. Elevated HbA1c Levels Are Associated with the Blunted Autonomic Response Assessed by Heart Rate Variability during Blood Volume Reduction.

    Science.gov (United States)

    Kamakura, Miho; Maruyama, Ryoko

    2016-01-01

    A high glycemic status increases the risk for autonomic dysfunction and cardiovascular failure. The aim of this study was to investigate time-dependent changes in the autonomic response and cardiovascular dynamics and the association between the level of hemoglobin A1c (HbA1c) and autonomic response during blood volume reduction. The study population consisted of 26 preoperative participants who were scheduled for autologous blood donation (200-400 mL of whole blood) for intraoperative or postoperative use. These participants without circulatory, respiratory, or brain disease and diabetes mellitus were grouped according to their HbA1c levels: HbA1c HbA1c ≥ 6.5% group, the HF component did not significantly change, and the increase in the LF/HF ratio was delayed. Time-dependent changes in HRV were related to blood volume reduction only in the HbA1c HbA1c levels are associated with the decrease in the autonomic response induced by blood volume reduction. PMID:27615262

  6. Multi-Source Autonomous Response for Targeting and Monitoring of Volcanic Activity

    Science.gov (United States)

    Davies, Ashley G.; Doubleday, Joshua R.; Tran, Daniel Q.

    2014-01-01

    ' inputs. The software framework uses multiple source languages and is a general framework for combining inputs and incrementally submitting observation requests/reconfigurations, accounting for prior requests. The autonomous aspect of operations is unique, especially in the context of the wide range of inputs that includes manually inputted electronic reports (such as the Air Force Weather Advisories), automated satellite-based detection methods (such as MODVOLC and GOESVOLC), and in situ sensor networks.

  7. Autonomic neuropathy

    DEFF Research Database (Denmark)

    Hilsted, J

    1983-01-01

    The diagnosis of autonomic neuropathy is often difficult to establish, since clinical symptoms generally appear late in the course of the disease, and may be non-specific. A number of recently developed quantifiable and reproducible autonomic nerve function tests are reviewed, with emphasis on th...

  8. Cutaneous antigen priming via gene gun leads to skin-selective Th2 immune-inflammatory responses.

    Science.gov (United States)

    Alvarez, David; Harder, Greg; Fattouh, Ramzi; Sun, Jiangfeng; Goncharova, Susanna; Stämpfli, Martin R; Coyle, Anthony J; Bramson, Jonathan L; Jordana, Manel

    2005-02-01

    It is becoming increasingly evident that the compartmentalization of immune responses is governed, in part, by tissue-selective homing instructions imprinted during T cell differentiation. In the context of allergic diseases, the fact that "disease" primarily manifests in particular tissue sites, despite pervasive allergen exposure, supports this notion. However, whether the original site of Ag exposure distinctly privileges memory Th2 immune-inflammatory responses to the same site, while sparing remote tissue compartments, remains to be fully investigated. We examined whether skin-targeted delivery of plasmid DNA encoding OVA via gene-gun technology in mice could generate allergic sensitization and give rise to Th2 effector responses in the skin as well as in the lung upon subsequent Ag encounter. Our data show that cutaneous Ag priming induced OVA-specific serum IgE and IgG1, robust Th2-cytokine production, and late-phase cutaneous responses and systemic anaphylactic shock upon skin and systemic Ag recall, respectively. However, repeated respiratory exposure to aerosolized OVA failed to instigate airway inflammatory responses in cutaneous Ag-primed mice, but not in mice initially sensitized to OVA via the respiratory mucosa. Importantly, these contrasting airway memory responses correlated with the occurrence of Th2 differentiation events at anatomically separate sites: indeed cutaneous Ag priming resulted in Ag-specific proliferative responses and Th2 differentiation in skin-, but not thoracic-, draining lymph nodes. These data indicate that Ag exposure to the skin leads to Th2 differentiation within skin-draining lymph nodes and subsequent Th2 immunity that is selectively manifested in the skin. PMID:15661930

  9. Laser speckle contrast imaging of skin blood perfusion responses induced by laser coagulation

    Energy Technology Data Exchange (ETDEWEB)

    Ogami, M; Kulkarni, R; Wang, H; Reif, R; Wang, R K [University of Washington, Department of Bioengineering, Seattle, Washington 98195 (United States)

    2014-08-31

    We report application of laser speckle contrast imaging (LSCI), i.e., a fast imaging technique utilising backscattered light to distinguish such moving objects as red blood cells from such stationary objects as surrounding tissue, to localise skin injury. This imaging technique provides detailed information about the acute perfusion response after a blood vessel is occluded. In this study, a mouse ear model is used and pulsed laser coagulation serves as the method of occlusion. We have found that the downstream blood vessels lacked blood flow due to occlusion at the target site immediately after injury. Relative flow changes in nearby collaterals and anastomotic vessels have been approximated based on differences in intensity in the nearby collaterals and anastomoses. We have also estimated the density of the affected downstream vessels. Laser speckle contrast imaging is shown to be used for highresolution and fast-speed imaging for the skin microvasculature. It also allows direct visualisation of the blood perfusion response to injury, which may provide novel insights to the field of cutaneous wound healing. (laser biophotonics)

  10. Heat-killed Propionibacterium acnes is capable of inducing inflammatory responses in skin.

    Science.gov (United States)

    Lyte, Peter; Sur, Runa; Nigam, Anu; Southall, Michael D

    2009-12-01

    The etiology of acne is a complex process, and acne is one of the most common skin disorders affecting millions of people. The pathogenesis of acne is closely associated with the bacterium, Propionibacterium acnes which was previously known as Corynebacterium parvum. Both viable and non-viable P. acnes/C. parvum have been shown to induce an immunostimulatory effect in vivo, suggesting that even dead bacteria continue to activate an inflammatory response. Acne treatments with lasers or devices, induce a bactericidal effect through heat generation which may not address the immunogenic activity of P. acnes and the resulting acne inflammation. Therefore, we sought to determine whether killed P. acnes is capable of inducing an inflammatory response and therefore could be a contributing factor in acne. Direct heat treatment of P. acnes cultures with temperatures ranging from 50 degrees C to 80 degrees C reduced P. acnes viability. Both viable and heat-killed P. acnes activated the p38 MAP kinase and its downstream substrate Hsp27. Stimulating keratinocytes with normal and heat-inactivated P. acnes resulted in an induction of proinflammatory nitric oxide and IL-8 production. Thus killed P. acnes is capable of inducing inflammation in skin suggesting that therapies that have both bactericidal and anti-inflammatory effects may result in a more effective treatment of patients with acne than treatments that are bactericidal alone. PMID:19624731

  11. Laser speckle contrast imaging of skin blood perfusion responses induced by laser coagulation

    Science.gov (United States)

    Ogami, M.; Kulkarni, R.; Wang, H.; Reif, R.; Wang, R. K.

    2014-08-01

    We report application of laser speckle contrast imaging (LSCI), i.e., a fast imaging technique utilising backscattered light to distinguish such moving objects as red blood cells from such stationary objects as surrounding tissue, to localise skin injury. This imaging technique provides detailed information about the acute perfusion response after a blood vessel is occluded. In this study, a mouse ear model is used and pulsed laser coagulation serves as the method of occlusion. We have found that the downstream blood vessels lacked blood flow due to occlusion at the target site immediately after injury. Relative flow changes in nearby collaterals and anastomotic vessels have been approximated based on differences in intensity in the nearby collaterals and anastomoses. We have also estimated the density of the affected downstream vessels. Laser speckle contrast imaging is shown to be used for highresolution and fast-speed imaging for the skin microvasculature. It also allows direct visualisation of the blood perfusion response to injury, which may provide novel insights to the field of cutaneous wound healing.

  12. Autonomic cardiac regulation and morpho-physiological responses to eight week training preparation in junior soccer players

    Directory of Open Access Journals (Sweden)

    Michal Botek

    2014-09-01

    Full Text Available Background: Training preparation in soccer is thought to improve body composition and performance level, especially the maximal aerobic capacity (VO2max. However, an enhancement in performance may be attenuated by the increase of fatigue. Heart rate variability (HRV as a non-invasive index of autonomic nervous system (ANS activity has been considered to be a sensitive tool in fatigue assessment. Objective: This study was focused to evaluate the response of ANS activity and morpho-physiological parameters to eight week training preparation. Methods: Study included 12 trained soccer players aged 17.2 ± 1.2 years. Athletes underwent pre- and post-preparation testing that included the ANS activity assessment by spectral analysis of HRV in supine and upright position. Further, body composition was analyzed via electrical bio-impedance method and physiological parameters were assessed during maximal stress tests. ANS activity and subjective feeling of fatigue was assessed continuously within subsequent weeks of preparation. Results: No significant differences in all HRV variables within weeks were found. Pre vs. post analyses revealed a significant (p < .05 increase in body weight, fat free mass, body mass index, and peak power. A significant decline in mean maximal heart rate (HR and resting HR at standing was identified at the end of preparation. Since no significant changes between pre- post-preparation in the mean VO2max occurred, the positive correlation between the individual change in VO2max and the vagally related HRV [supine LnHF (r = .78, Ln rMSSD (r = .63, and the standing LnHF (r = .73, p < .05] was found. Conclusions: This study showed that an 8 week training program modified particularly fat free mass and short-term endurance, whereas both the autonomic cardiac regulation and the feeling of fatigue remained almost unaffected. Standing position seems to be more sensitive in terms of the HR response in relation to fatigue

  13. Transcranial Doppler and cardiovascular responses during cardiovascular autonomic tests in migraineurs during and outside attacks

    DEFF Research Database (Denmark)

    Thomsen, L L; Iversen, Helle Klingenberg; Boesen, F;

    1995-01-01

    to a head-up tilt test, a cold-pressor test and a Valsalva manoeuvre. The cardiovascular reflexes in response to the Valsalva manoeuvre suggested a mild parasympathetic hypofunction in migraineurs, both those with and those without aura. On the basis of the present results and previous findings by others...

  14. The skin conductance orienting response in neuroleptic-free schizophrenics: replication of the scoring criteria effect.

    Science.gov (United States)

    Levinson, D F; Edelberg, R; Maricq, H R

    1985-06-01

    It has been suggested that the use of invalid scoring criteria might be responsible for the finding of excessive nonhabituation of the skin conductance orienting response (SCOR) in schizophrenia. Certain criteria may confuse SCOR and spontaneous SC activity in subjects with high rates of the latter (Levinson et al. 1984). To replicate this finding, data were reanalyzed from a study of 25 neuroleptic-free schizophrenic patients and 23 normal male subjects. Analysis of response latency and amplitude during a habituation paradigm of 11 78.5-dB tones confirmed the predictions. Broad scoring criteria (SCOR onset 1-5 sec poststimulus, and a three-no-response-trials habituation criterion) produced significantly different habituation scores than more restrictive criteria (1.6-3.0 sec latency window and a two-trials habituation criterion). Nonhabituation was scored in five patients and six normals by the former criteria, but in no patient and one normal by the latter. Nonhabituators, defined by using the broad criteria, had higher rates of spontaneous activity. The narrow latency window contained significantly more responses than could be explained by the spontaneous activity rate, but this was not true for the added time permitted by the broad window. It is concluded that the use of more restrictive scoring criteria may help to clarify the validity of SCOR nonresponse or hyporesponse as a marker for a type of schizophrenic illness.

  15. Sex-specific effects of intranasal oxytocin on autonomic nervous system and emotional responses to couple conflict

    Science.gov (United States)

    Nater, Urs M.; Schaer, Marcel; La Marca, Roberto; Bodenmann, Guy; Ehlert, Ulrike; Heinrichs, Markus

    2013-01-01

    Unhappy couple relationships are associated with impaired individual health, an effect thought to be mediated through ongoing couple conflicts. Little is known, however, about the underlying mechanisms regulating psychobiological stress, and particularly autonomic nervous system (ANS) reactivity, during negative couple interaction. In this study, we tested the effects of the neuropeptide oxytocin on ANS reactivity during couple conflict in a standardized laboratory paradigm. In a double-blind, placebo-controlled design, 47 heterosexual couples (total n = 94) received oxytocin or placebo intranasally prior to instructed couple conflict. Participants’ behavior was videotaped and salivary alpha-amylase (sAA), a measure of sympathetic activity, and emotional arousal were repeatedly measured during the experiment. Oxytocin significantly reduced sAA during couple conflict in women, whereas men showed increases in sAA levels (sex × group interaction: B = −49.36, t = −2.68, P = 0.009). In men, these increases were related to augmented emotional arousal (r = 0.286, P = 0.028) and more positive behavior (r = 0.291, P = 0.026), whereas there was no such association in women. Our results imply sex-specific effects of oxytocin on sympathetic activity, to negative couple interaction, with the neuropeptide reducing sAA responses and emotional arousal in women while increasing them in men. PMID:22842905

  16. Ensuring 3es and Responsiveness in the Delivery of Educational Services in the Autonomous Region in Muslim Mindanao, Philippines

    Directory of Open Access Journals (Sweden)

    Sapia Moalam Abdulrachman

    2013-08-01

    Full Text Available The Autonomous Region in Muslim Mindanao (ARMM is a public organization in the Philippines located in between the national government and the local governments. It performs unique functions quite distinct from other public organizations in the coun-try, as it performs both political and administrative functions. Using unobtrusive research design, as it relies on mostly secondary data, this paper analyzes the educational system in the region and proposes strategies in attaining administrative efficiency, economy, effectiveness and responsiveness. The paper starts with the introduction which consist of the background and statement of the problem. It is followed by a review of theoretical perspective and then by the research methodology. The fourth part portrays the findings of the study which include: DepEd ARMM resources; the management of DepEd ARMM, and the management outputs such as: net enrollment ratio, achievement rate and literacy rate. The fifth part of the paper deals with the analyses and conclusion. The paper concludes that in addition to certain structural innovation, inculcation of appropriate work ethics in accordance with the Ethi-cal Standards Act, the Anti-Corruption Law, the Civil Service Rules and Regulations as well as the Islamic Practices on Employment must be enshrined in the reform agenda. Finally, among other things that could facilitate the attainment of 3Es and R in the delivery of educational services is a strategy that requires the joint collaboration and teamwork between the civil society, non-government organizations and government organizations in the region.

  17. Evaluating Autonomic Parameters: The Role of ‎Sleep ‎Duration in Emotional Responses to Music ‎

    Directory of Open Access Journals (Sweden)

    Atefeh Goshvarpour

    2016-02-01

    Full Text Available Objective: It has been recognized that sleep has an important effect on emotion processing. The aim ‎of this study was to investigate the effect of previous night sleep duration on autonomicresponses to musical stimuli in different emotional contexts.‎Method: A frequency based measure of GSR, PR and ECG signals were examined in 35 healthy ‎students in three groups of oversleeping, lack of sleep and normal sleep. ‎Results: The results of this study revealed that regardless of the emotional context of the musical ‎stimuli (happy, relax, fear, and sadness, there was an increase in the maximum power of ‎GSR, ECG and PR during the music time compared to the rest time in all the three ‎groups. In addition, the higher value of these measures was achieved while the ‎participants listened to relaxing music. Statistical analysis of the extracted features ‎between each pair of emotional states revealed that the most significant differences ‎were attained for ECG signals. These differences were more obvious in the participants ‎with normal sleeping (p<10-18. The higher value of the indices has been shown, ‎comparing long sleep duration with the normal one.‎Conclusion: There was a strong relation between emotion and sleep duration, and this association can ‎be observed by means of the ECG signals.‎ 

  18. Modeling the Mechanical Response of In Vivo Human Skin Under a Rich Set of Deformations

    KAUST Repository

    Flynn, Cormac

    2011-03-11

    Determining the mechanical properties of an individual\\'s skin is important in the fields of pathology, biomedical device design, and plastic surgery. To address this need, we present a finite element model that simulates the skin of the anterior forearm and posterior upper arm under a rich set of three-dimensional deformations. We investigated the suitability of the Ogden and Tong and Fung strain energy functions along with a quasi-linear viscoelastic law. Using non-linear optimization techniques, we found material parameters and in vivo pre-stresses for different volunteers. The model simulated the experiments with errors-of-fit ranging from 13.7 to 21.5%. Pre-stresses ranging from 28 to 92 kPa were estimated. We show that using only in-plane experimental data in the parameter optimization results in a poor prediction of the out-of-plane response. The identifiability of the model parameters, which are evaluated using different determinability criteria, improves by increasing the number of deformation orientations in the experiments. © 2011 Biomedical Engineering Society.

  19. Assessing the sensitivity of human skin hyperspectral responses to increasing anemia severity levels

    Science.gov (United States)

    Baranoski, Gladimir V. G.; Dey, Ankita; Chen, Tenn F.

    2015-09-01

    Anemia is a prevalent medical condition that seriously affects millions of people all over the world. In many regions, not only its initial detection but also its monitoring are hindered by limited access to laboratory facilities. This situation has motivated the development of a wide range of optical devices and procedures to assist physicians in these tasks. Although noticeable progress has been achieved in this area, the search for reliable, low-cost, and risk-free solutions still continues, and the strengthening of the knowledge base about this disorder and its effects is essential for the success of these initiatives. We contribute to these efforts by closely examining the sensitivity of human skin hyperspectral responses (within and outside the visible region of the light spectrum) to reduced hemoglobin concentrations associated with increasing anemia severity levels. This investigation, which involves skin specimens with distinct biophysical and morphological characteristics, is supported by controlled in silico experiments performed using a predictive light transport model and measured data reported in the biomedical literature. We also propose a noninvasive procedure to be employed in the monitoring of this condition at the point-of-care.

  20. Imaging immune response of skin mast cells in vivo with two-photon microscopy

    Science.gov (United States)

    Li, Chunqiang; Pastila, Riikka K.; Lin, Charles P.

    2012-02-01

    Intravital multiphoton microscopy has provided insightful information of the dynamic process of immune cells in vivo. However, the use of exogenous labeling agents limits its applications. There is no method to perform functional imaging of mast cells, a population of innate tissue-resident immune cells. Mast cells are widely recognized as the effector cells in allergy. Recently their roles as immunoregulatory cells in certain innate and adaptive immune responses are being actively investigated. Here we report in vivo mouse skin mast cells imaging with two-photon microscopy using endogenous tryptophan as the fluorophore. We studied the following processes. 1) Mast cells degranulation, the first step in the mast cell activation process in which the granules are released into peripheral tissue to trigger downstream reactions. 2) Mast cell reconstitution, a procedure commonly used to study mast cells functioning by comparing the data from wild type mice, mast cell-deficient mice, and mast-cell deficient mice reconstituted with bone marrow-derived mast cells (BMMCs). Imaging the BMMCs engraftment in tissue reveals the mast cells development and the efficiency of BMMCs reconstitution. We observed the reconstitution process for 6 weeks in the ear skin of mast cell-deficient Kit wsh/ w-sh mice by two-photon imaging. Our finding is the first instance of imaging mast cells in vivo with endogenous contrast.

  1. Optimising a model-based approach to inferring fear learning from skin conductance responses.

    Science.gov (United States)

    Staib, Matthias; Castegnetti, Giuseppe; Bach, Dominik R

    2015-11-30

    Anticipatory sympathetic arousal is often inferred from skin conductance responses (SCR) and used to quantify fear learning. We have previously provided a model-based approach for this inference, based on a quantitative Psychophysiological Model (PsPM) formulated in non-linear dynamic equations. Here we seek to optimise the inversion of this PsPM. Using two independent fear conditioning datasets, we benchmark predictive validity as the sensitivity to separate the likely presence or absence of the unconditioned stimulus. Predictive validity is optimised across both datasets by (a) using a canonical form of the SCR shape (b) filtering the signal with a bi-directional band-pass filter with cut off frequencies 0.0159 and 5 Hz, (c) simultaneously inverting two trials (d) explicitly modelling skin conductance level changes between trials (e) the choice of the inversion algorithm (f) z-scoring estimates of anticipatory sympathetic arousal from each participant across trials. The original model-based method has higher predictive validity than conventional peak-scoring or an alternative model-based method (Ledalab), and benefits from constraining the model, optimised data preconditioning, and post-processing of ensuing parameters. PMID:26291885

  2. Minimal erythema response (MED to solar simulated irradiation in normal Indian skin

    Directory of Open Access Journals (Sweden)

    Mehta Rai Vandana

    2004-09-01

    Full Text Available BACKGROUND: Phototesting is an essential tool in the investigation of photodermatoses. AIMS: The main aim was to study the cutaneous response to UVR in terms of minimal erythema dose (MED to both UVA and UVB in normal Indian subjects with a solar simulator and to study the relationship of skin type to MED. METHODS: One hundred healthy volunteers not on any medication and without any history of photodermatoses were phototested using a solar simulator with whole spectrum irradiation (UVA, UVB and visible light and only visible and UVA radiation. The tested areas were marked with gentian violet and readings were taken after 24 hrs. RESULTS: Of the 100 volunteers, 48% were males and 52% were females, with a mean age of 36.6 ± 11.6 yrs. The most common skin type among Indians was type 5 (46% followed by type 4 (41%. The mean MED for UVB was 61.5 ± 17.25J/cm2. The MED for UVA could not be determined as none of the patients showed any erythema after irradiation for 45 minutes. CONCLUSIONS: As the MED is found to be low in idiopathic acquired photodermatoses, the MED in the normal population could serve as a baseline data in the investigation.

  3. Cortisol, biochemical, and galvanic skin responses to music stimuli of different preference values by college students in biology and music.

    Science.gov (United States)

    VanderArk, S D; Ely, D

    1993-08-01

    The purpose of this study was to examine biochemical and galvanic skin responses to music stimuli. Specifically, 30 university biology and 30 music students' plasma levels of norepinephrine and cortisol and their galvanic skin responses were measured before and after listening to two different musical selections, one of which was preferred (liked) by the music students and not preferred (disliked) by the biology students. The music-listening sessions and the controlled silent sessions were done in an anechoic chamber. 30 biology majors and 30 music majors were in the experimental groups; 14 biology and 17 music majors comprised the control group. Analysis indicated that the cortisol levels and galvanic skin responses were significantly higher for the music majors than the biology majors. The data indicate that music majors listen more critically and analytically to music than biology majors, and cortisol levels are associated with this as increases in music majors and decreases in biology majors after the music. PMID:8367245

  4. Value of sympathetic skin response test in the early diagnosis of diabetic neuropathy

    Institute of Scientific and Technical Information of China (English)

    黄一宁; 贾志荣; 石昕; 孙相如

    2004-01-01

    Background Diabetic neuropathy is common in diabetes mellitus. The early stage of diabetic neuropathy is often symptomless and difficult to be treated. The aim of this study was to assess the correlation between the results of the sympathetic skin response (SSR) test and the development of diabetic neuropathy, and explore the use of SSR as an objective basis for the early diagnosis of diabetic neuropathy.Methods The latencies and amplitudes of initiation and of the N and P waves were determined by SSR testing of the extremities of 80 diabetic patients and 30 healthy controls. Results The latencies of initiation and of the N and P waves were significantly (P0.05). All but two patients (97.5%) demonstrated abnormal SSR in at least one limb. Conclusions SSR can detect early dysfunction of the small sympathetic fibers in people affected by diabetes mellitus, and may be a useful electrophysiological test for the early diagnosis of diabetic neuropathy.

  5. Analysis of skin conductance response during evaluation of preferences for cosmetic products

    Science.gov (United States)

    Ohira, Hideki; Hirao, Naoyasu

    2015-01-01

    We analyzed skin conductance response (SCR) as a psychophysiological index to evaluate affective aspects of consumer preferences for cosmetic products. To examine the test-retest reliability of association between preferences and SCR, we asked 33 female volunteers to complete two experimental sessions approximately 1 year apart. The participants indicated their preferences in a typical paired comparison task by choosing the better option from a combination of two products among four products. We measured anticipatory SCR prior to expressions of the preferences. We found that the mean amplitude of the SCR elicited by the preferred products was significantly larger than that elicited by the non-preferred products. The participants' preferences and corresponding SCR patterns were well preserved at the second session 1 year later. Our results supported cumulating findings that SCR is a useful index of consumer preferences that has future potential, both in laboratory and marketing settings. PMID:25709593

  6. Thin-skinned salt tectonics as a response to crustal movements in a recent convergent setting

    Science.gov (United States)

    Vendeville, Bruno; Gaullier, Virginie; Deverchere, Jacques; Sage, Françoise

    2014-05-01

    Published data from the seismic survey "MARADJA 1" conducted in August and September 2003 offshore the Algerian coast have imaged the Messinian salt response to tectonic activity within the basement. This helps to understand how the vertical movements of basement blocks have been recorded by thin-skinned salt tectonics. The area is undergoing crustal convergence, as attested by the Boumerdes earthquake (magnitude 6.8), which happened in 2003. The seismic data have revealed the presence of an elevated plateau, forming a 3D promontory restricted to the area offshore Algiers and is absent west and east of that area. The promontory is likely related to the contractional reactivation of the margin, as was recorded by subsalt thrusts mapped by Domzig et al. (2006). The data provided additional information on the deformation of the Messinian mobile evaporite unit and its Plio-Quaternary overburden. Margin-perpendicular profiles show mostly compressional features (anticlines and synclines) that had little or no activity during Messinian times. By contrast, margin-parallel profiles clearly show that extensional, reactive salt diapiric ridges formed early, as early as the time of deposition of the Messinian Upper Unit, as recorded by fan-shaped strata. These ridges have recorded E-W, thin-skinned gravity gliding above the Messinian salt, as a response to the rise of the basement plateau. We tested this hypothesis using analogue models. Indeed, the rise of the plateau generated preferential E-W extension above the salt, rather than N-S, which was prevented by the compressional regional tectonic stresses related to the convergence of the African and European plates.

  7. Sympathetic skin responses in hemiplegic patients with and without complex regional pain syndrome

    Directory of Open Access Journals (Sweden)

    Selçuk Barin

    2006-01-01

    Full Text Available Background and Aims: To investigate whether there were changes in the sympathetic skin responses (SSR in the limbs with complex regional pain syndrome (CRPS type I in hemiplegic patients. Setting: A physical medicine and rehabilitation center in Turkey . Materials and Methods: Sympathetic skin responses were evaluated in 69 stroke patients (41 with CRPS and 28 without CRPS and 20 healthy volunteers. SSR were recorded on the paretic and healthy hands after stimulation of the ipsilateral median nerve. Patients′ ages ranged from 33 to 77 years, with a mean of 60.0 ± 12.9 years. Results: The SSR were obtained in all patients with CRPS, whereas SSR was absent in 9 of 28 patients with hemiplegia who did not have CRPS after stimulation of the plegic side and the difference was statistically significant ( P =0.023. SSR amplitudes were increased at the hemiplegic limbs in patients affected by CRPS compared to individuals unaffected; this group difference was statistically significant ( P =0.014. The mean amplitude of the SSR in the advanced stage of CRPS was greater than lower stage and the difference was statistically significant ( P =0.035. Conclusion: Our results suggest that SSR can be obtained in stroke patients with CRPS even in the early stages of CRPS. SSR acquirability and amplitude increase as the stage of the disease advances. As an electrophysiologic technique, SSR may be used in the evaluation of the sympathetic function in hemiplegic patients and also in the diagnosis of CRPS and in monitoring of its treatment.

  8. Skin Metabolite, Farnesyl Pyrophosphate, Regulates Epidermal Response to Inflammation, Oxidative Stress, and Migration.

    Science.gov (United States)

    Pastar, Irena; Stojadinovic, Olivera; Sawaya, Andrew P; Stone, Rivka C; Lindley, Linsey E; Ojeh, Nkemcho; Vukelic, Sasa; Samuels, Herbert H; Tomic-Canic, Marjana

    2016-11-01

    Skin produces cholesterol and a wide array of sterols and non-sterol mevalonate metabolites, including isoprenoid derivative farnesyl pyrophosphate (FPP). To characterize FPP action in epidermis, we generated transcriptional profiles of primary human keratinocytes treated with zaragozic acid (ZGA), a squalene synthase inhibitor that blocks conversion of FPP to squalene resulting in endogenous accumulation of FPP. The elevated levels of intracellular FPP resulted in regulation of epidermal differentiation and adherens junction signaling, insulin growth factor (IGF) signaling, oxidative stress response and interferon (IFN) signaling. Immunosuppressive properties of FPP were evidenced by STAT-1 downregulation and prominent suppression of its nuclear translocation by IFNγ. Furthermore, FPP profoundly downregulated genes involved in epidermal differentiation of keratinocytes in vitro and in human skin ex vivo. Elevated levels of FPP resulted in induction of cytoprotective transcriptional factor Nrf2 and its target genes. We have previously shown that FPP functions as ligand for the glucocorticoid receptor (GR), one of the major regulator of epidermal homeostasis. Comparative microarray analyses show significant but not complete overlap between FPP and glucocorticoid regulated genes, suggesting that FPP may have wider transcriptional impact. This was further supported by co-transfection and chromatin immunoprecipitation experiments where we show that upon binding to GR, FPP recruits β-catenin and, unlike glucocorticoids, recruits co-repressor GRIP1 to suppress keratin 6 gene. These findings have many clinical implications related to epidermal lipid metabolism, response to glucocorticoid therapy as well as pleiotropic effects of cholesterol lowering therapeutics, statins. J. Cell. Physiol. 231: 2452-2463, 2016. © 2016 Wiley Periodicals, Inc. PMID:26916741

  9. Local Antiglycan Antibody Responses to Skin Stage and Migratory Schistosomula of Schistosoma japonicum.

    Science.gov (United States)

    Smit, Cornelis H; Kies, Christiaan L; McWilliam, Hamish E G; Meeusen, Els N T; Hokke, Cornelis H; van Diepen, Angela

    2016-01-01

    Schistosomiasis is a tropical disease affecting over 230 million people worldwide. Although effective drug treatment is available, reinfections are common, and development of immunity is slow. Most antibodies raised during schistosome infection are directed against glycans, some of which are thought to be protective. Developing schistosomula are considered most vulnerable to immune attack, and better understanding of local antibody responses raised against glycans expressed by this life stage might reveal possible glycan vaccine candidates for future vaccine research. We used antibody-secreting cell (ASC) probes to characterize local antiglycan antibody responses against migrating Schistosoma japonicum schistosomula in different tissues of rats. Analysis by shotgun Schistosoma glycan microarray resulted in the identification of antiglycan antibody response patterns that reflected the migratory pathway of schistosomula. Antibodies raised by skin lymph node (LN) ASC probes mainly targeted N-glycans with terminal mannose residues, Galβ1-4GlcNAc (LacNAc) and Galβ1-4(Fucα1-3)GlcNAc (LeX). Also, responses to antigenic and schistosome-specific glycosphingolipid (GSL) glycans containing highly fucosylated GalNAcβ1-4(GlcNAcβ1)n stretches that are believed to be present at the parasite's surface constitutively upon transformation were found. Antibody targets recognized by lung LN ASC probes were mainly N-glycans presenting GalNAcβ1-4GlcNAc (LDN) and GlcNAc motifs. Surprisingly, antibodies against highly antigenic multifucosylated motifs of GSL glycans were not observed in lung LN ASC probes, indicating that these antigens are not expressed in lung stage schistosomula or are not appropriately exposed to induce immune responses locally. The local antiglycan responses observed in this study highlight the stage- and tissue-specific expression of antigenic parasite glycans and provide insights into glycan targets possibly involved in resistance to S. japonicum infection

  10. Stress effects on mood, HPA axis, and autonomic response: comparison of three psychosocial stress paradigms.

    Science.gov (United States)

    Giles, Grace E; Mahoney, Caroline R; Brunyé, Tad T; Taylor, Holly A; Kanarek, Robin B

    2014-01-01

    Extensive experimental psychology research has attempted to parse the complex relationship between psychosocial stress, mood, cognitive performance, and physiological changes. To do so, it is necessary to have effective, validated methods to experimentally induce psychosocial stress. The Trier Social Stress Test (TSST) is the most commonly used method of experimentally inducing psychosocial stress, but it is resource intensive. Less resource intense psychosocial stress tasks include the Socially Evaluative Cold Pressor Task (SECPT) and a computerized mental arithmetic task (MAT). These tasks effectively produce a physiological and psychological stress response and have the benefits of requiring fewer experimenters and affording data collection from multiple participants simultaneously. The objective of this study was to compare the magnitude and duration of these three experimental psychosocial stress induction paradigms. On each of four separate days, participants completed either a control non-stressful task or one of the three experimental stressors: the TSST, SECPT, or MAT. We measured mood, working memory performance, salivary cortisol and alpha-amylase (AA), and heart rate. The TSST and SECPT exerted the most robust effects on mood and physiological measures. TSST effects were generally evident immediately post-stress as well as 10- and 20-minutes after stress cessation, whereas SECPT effects were generally limited to the duration of the stressor. The stress duration is a key determinant when planning a study that utilizes an experimental stressor, as researchers may be interested in collecting dependent measures prior to stress cessation. In this way, the TSST would allow the investigator a longer window to administer tasks of interest.

  11. Inclusion of Height and Limb Length when Interpreting Sympathetic Skin Response

    Directory of Open Access Journals (Sweden)

    Mohamadreza Emad

    2016-01-01

    Full Text Available It is more than a decade since scientists are making use of sympathetic skin response (SSR as a clinical and research method to evaluate sympathetic nervous system. A major portion of the efferent pathway of this response is composed of non-myelinated nerves. Thus, the latency of the response may be significantly different in normal individuals with different height and limb lengths. This study was designed to investigate the effect of these parameters on the SSR results. We measured the height and limb length of 65 normal individuals with different heights (divided into 3 groups of height ≤150 cm, 150-170 cm, and ≥170 cm. The participants had neither peripheral nor central neuropathy. They also had none of the exclusion criteria. Then, they underwent SSR testing of both palms and soles. The correlation between the height and limb length in relation to SSR parameters (latency and amplitude was analyzed statistically by Pearson’s correlation. No significant correlation was detected between the height and limb length and the SSR amplitude. However, the results showed significant correlation between SSR latency recorded from all four sites (both palms and soles and the height of participants. Furthermore, there was a significant correlation between SSR latency recorded from any limb and the length of that limb. Regarding the significant effect of the height and limb length on the SSR latency, both the height and limb length should be considered when interpreting the results of SSR.

  12. Comparison of blood volume pulse and skin conductance responses to mental and affective stimuli at different anatomical sites

    International Nuclear Information System (INIS)

    Measurements of blood volume pulse (BVP) and skin conductance are commonly used as indications of psychological arousal in affective computing and human–machine interfaces. To date, palmar surfaces remain the primary site for these measurements. Placement of sensors on palmar surfaces, however, is undesirable when recordings are fraught with motion and pressure artifacts. These artifacts are frequent when the human participant has involuntary movements as in hyperkinetic cerebral palsy. This motivates the use of alternative measurement sites. The present study examined the correlation between measurements of blood volume pulse and skin conductance obtained from three different sites on the body (fingers, toes and ear for BVP; fingers, toes and arch of the foot for skin conductance) in response to cognitive and affective stimuli. The results of this pilot study indicated significant inter-site correlation among signal features derived from different sites, with the exception of BVP amplitude, the number of electrodermal reactions and the slope of the electrodermal activity response. We attribute these differences in part to inter-site discrepancies in local skin conditions, such as skin temperature. Despite these differences, significant changes from baseline were present in the responses to the cognitive and affective stimuli at non-palmar sites, suggesting that these sites may provide viable signal measurements for use in affective computing and human–machine interface applications

  13. Comparison of blood volume pulse and skin conductance responses to mental and affective stimuli at different anatomical sites

    Science.gov (United States)

    Kushki, Azadeh; Fairley, Jillian; Merja, Satyam; King, Gillian

    2016-01-01

    Measurements of blood volume pulse (BVP) and skin conductance are commonly used as indications of psychological arousal in affective computing and human–machine interfaces. To date, palmar surfaces remain the primary site for these measurements. Placement of sensors on palmar surfaces, however, is undesirable when recordings are fraught with motion and pressure artifacts. These artifacts are frequent when the human participant has involuntary movements as in hyperkinetic cerebral palsy. This motivates the use of alternative measurement sites. The present study examined the correlation between measurements of blood volume pulse and skin conductance obtained from three different sites on the body (fingers, toes and ear for BVP; fingers, toes and arch of the foot for skin conductance) in response to cognitive and affective stimuli. The results of this pilot study indicated significant inter-site correlation among signal features derived from different sites, with the exception of BVP amplitude, the number of electrodermal reactions and the slope of the electrodermal activity response. We attribute these differences in part to inter-site discrepancies in local skin conditions, such as skin temperature. Despite these differences, significant changes from baseline were present in the responses to the cognitive and affective stimuli at non-palmar sites, suggesting that these sites may provide viable signal measurements for use in affective computing and human–machine interface applications. PMID:21849720

  14. Measurement of the force–displacement response of in vivo human skin under a rich set of deformations

    KAUST Repository

    Flynn, Cormac

    2011-06-01

    The non-linear, anisotropic, and viscoelastic properties of human skin vary according to location on the body, age, and individual. The measurement of skin\\'s mechanical properties is important in several fields including medicine, cosmetics, and forensics. In this study, a novel force-sensitive micro-robot applied a rich set of three-dimensional deformations to the skin surface of different areas of the arms of 20 volunteers. The force-displacement response of each area in different directions was measured. All tested areas exhibited a non-linear, viscoelastic, and anisotropic force-displacement response. There was a wide quantitative variation in the stiffness of the response. For the right anterior forearm, the ratio of the maximum probe reaction force to maximum probe displacement ranged from 0.44Nmm-1 to 1.45Nmm-1. All volunteers exhibited similar qualitative anisotropic characteristics. For the anterior right forearm, the stiffest force-displacement response was when the probe displaced along the longitudinal axis of the forearm. The response of the anterior left forearm was stiffest in a direction 20° to the longitudinal axis of the forearm. The posterior upper arm was stiffest in a direction 90° to the longitudinal axis of the arm. The averaged posterior upper arm response was less stiff than the averaged anterior forearm response. The maximum probe force at 1.3mm probe displacement was 0.69N for the posterior upper arm and 1.1N for the right anterior forearm. The average energy loss during the loading-unloading cycle ranged from 11.9% to 34.2%. This data will be very useful for studying the non-linear, anisotropic, and viscoelastic behaviour of skin and also for generating material parameters for appropriate constitutive models. © 2011 IPEM.

  15. Autonomous data transmission apparatus

    Science.gov (United States)

    Kotlyar, Oleg M.

    1997-01-01

    A autonomous borehole data transmission apparatus for transmitting measurement data from measuring instruments at the downhole end of a drill string by generating pressure pulses utilizing a transducer longitudinally responsive to magnetic field pulses caused by electrical pulses corresponding to the measured downhole parameters.

  16. Reduced cardiac autonomic response to deep breathing: A heritable vulnerability trait in patients with schizophrenia and their healthy first-degree relatives.

    Science.gov (United States)

    Liu, Yu-Wen; Tzeng, Nian-Sheng; Yeh, Chin-Bin; Kuo, Terry B J; Huang, San-Yuan; Chang, Chuan-Chia; Chang, Hsin-An

    2016-09-30

    Reduced resting heart rate variability (HRV) has been observed in patients with schizophrenia and their relatives, suggesting genetic predispositions. However, findings have not been consistent. We assessed cardiac autonomic response to deep breathing in first-degree relatives of patients with schizophrenia (n=45; 26 female; aged 39.69±14.82 years). Data were compared to healthy controls (n=45; 26 female; aged 38.27±9.79 years) matched for age, gender, body mass index and physical activity as well as to unmedicated patients with acute schizophrenia (n=45; 25 female; aged 37.31±12.65 years). Electrocardiograms were recorded under supine resting and deep-breathing conditions (10-12breaths/min). We measured HRV components including variance, low-frequency (LF) power, which may reflect baroreflex function, high-frequency (HF) power, which reflects cardiac parasympathetic activity, and LF/HF ratio, which may reflect sympatho-vagal balance. Patients rather than relatives exhibited lower resting-state HRV (variance, LF, and HF) than controls. As expected, deep breathing induced an increase in variance and HF-HRV in controls. However, such a response was significantly reduced in both patients and their relatives. In conclusion, the diminished cardiac autonomic reactivity to deep breathing seen in patients and their unaffected relatives indicates that this pattern of cardiac autonomic dysregulation may be regarded as a genetic trait marker for schizophrenia. PMID:27442977

  17. Enhanced insulin sensitivity mediated by adipose tissue browning perturbs islet morphology and hormone secretion in response to autonomic nervous activation in female mice.

    Science.gov (United States)

    Omar, Bilal A; Kvist-Reimer, Martina; Enerbäck, Sven; Ahrén, Bo

    2016-01-01

    Insulin resistance results in a compensatory increase in insulin secretion to maintain normoglycemia. Conversely, high insulin sensitivity results in reduced insulin secretion to prevent hypoglycemia. The mechanisms for this inverse adaptation are not well understood. We utilized highly insulin-sensitive mice, due to adipocyte-specific overexpression of the FOXC2 transcription factor, to study mechanisms of the reversed islet adaptation to increased insulin sensitivity. We found that Foxc2TG mice responded to mild hyperglycemia with insulin secretion significantly lower than that of wild-type mice; however, when severe hyperglycemia was induced, Foxc2TG mice demonstrated insulin secretion equal to or greater than that of wild-type mice. In response to autonomic nervous activation by 2-deoxyglucose, the acute suppression of insulin seen in wild-type mice was absent in Foxc2TG mice, suggesting impaired sympathetic signaling to the islet. Basal glucagon was increased in Foxc2TG mice, but they displayed severely impaired glucagon responses to cholinergic and autonomic nervous stimuli. These data suggest that the autonomic nerves contribute to the islet adaptation to high insulin sensitivity, which is compatible with a neuro-adipo regulation of islet function being instrumental for maintaining glucose regulation.

  18. The heritability of the skin conductance orienting response: a longitudinal twin study.

    Science.gov (United States)

    Tuvblad, Catherine; Gao, Yu; Isen, Joshua; Botwick, Theodore; Raine, Adrian; Baker, Laura A

    2012-01-01

    The orienting response is a widely used experimental paradigm that reflects the association between electrodermal activity and psychological processes. The present study examined the genetic and environmental etiology of skin conductance orienting response (SCOR) magnitude in a sample of twins assessed at ages 9-10, 11-13 and 14-16 years. Structural equation modeling at each visit showed that genetic influences explained 56%, 83%, and 48% of the total variance in SCOR at visits 1, 2, and 3, respectively, with the remaining variance explained by non-shared environmental factors. SCOR was moderately stable across ages, with phenotypic correlations between time points ranging from .35 to .45. A common genetic factor explained 36%, 45% and 49% of the variance in SCOR magnitude across development. Additional age-specific genetic effects were found at ages 9-10 and 11-13 years, explaining 18% and 35% of the variance, respectively. The genetic correlations among the three time points were high, ranging from .55 to .73, indicating a substantial continuity in genetic influences from ages 9 to 16. These findings suggest that genetic factors are important influences in SCOR magnitude during late childhood and adolescence.

  19. Divergent metabolic responses of Apostichopus japonicus suffered from skin ulceration syndrome and pathogen challenge.

    Science.gov (United States)

    Shao, Yina; Li, Chenghua; Ou, Changrong; Zhang, Peng; Lu, Yali; Su, Xiurong; Li, Ye; Li, Taiwu

    2013-11-13

    Skin ulceration syndrome (SUS) is the main limitation in the development of Apostichopus japonicus culture industries, in which Vibrio splendidus has been well documented as one of the major pathogens. However, the intrinsic mechanisms toward pathogen challenge and disease outbreak remain largely unknown at the metabolic level. In this work, the metabolic responses were investigated in muscles of sea cucumber among natural SUS-diseased and V. splendidus-challenged samples. The pathogen did not induce obvious biological effects in A. japonicus samples after infection for the first 24 h. An enhanced energy storage (or reduced energy demand) and immune responses were observed in V. splendidus-challenged A. japonicus samples at 48 h, as marked by increased glucose and branched chain amino acids, respectively. Afterward, infection of V. splendidus induced significant increases in energy demand in A. japonicus samples at both 72 and 96 h, confirmed by decreased glucose and glycogen, and increased ATP. Surprisingly, high levels of glycogen and glucose and low levels of threonine, alanine, arginine, glutamate, glutamine, taurine and ATP were founded in natural SUS-diseased sea cucumber. Our present results provided essential metabolic information about host-pathogen interaction for sea cucumber, and informed that the metabolic biomarkers induced by V. splendidus were not usable for the prediction of SUS disease in practice. PMID:24127639

  20. Body visual discontinuity affects feeling of ownership and skin conductance responses.

    Science.gov (United States)

    Tieri, Gaetano; Tidoni, Emmanuele; Pavone, Enea Francesco; Aglioti, Salvatore Maria

    2015-01-01

    When we look at our hands we are immediately aware that they belong to us and we rarely doubt about the integrity, continuity and sense of ownership of our bodies. Here we explored whether the mere manipulation of the visual appearance of a virtual limb could influence the subjective feeling of ownership and the physiological responses (Skin Conductance Responses, SCRs) associated to a threatening stimulus approaching the virtual hand. Participants observed in first person perspective a virtual body having the right hand-forearm (i) connected by a normal wrist (Full-Limb) or a thin rigid wire connection (Wire) or (ii) disconnected because of a missing wrist (m-Wrist) or a missing wrist plus a plexiglass panel positioned between the hand and the forearm (Plexiglass). While the analysis of subjective ratings revealed that only the observation of natural full connected virtual limb elicited high levels of ownership, high amplitudes of SCRs were found also during observation of the non-natural, rigid wire connection condition. This result suggests that the conscious embodiment of an artificial limb requires a natural looking visual body appearance while implicit reactivity to threat may require physical body continuity, even non-naturally looking, that allows the implementation of protective reactions to threat.

  1. The influence of hostility and family history of cardiovascular disease on autonomic activation in response to controllable versus noncontrollable stress, anger imagery induction, and relaxation imagery.

    Science.gov (United States)

    Nelson, Charles; Franks, Susan; Brose, Andrea; Raven, Peter; Williamson, Jon; Shi, Xiangrong; McGill, Jerry; Harrell, Ernest

    2005-06-01

    Autonomic activation in response to controllable versus noncontrollable stress, anger imagery induction, and relaxation imagery was studied among 80 participants between the ages of 18 and 34 years. Participants differed in level of trait hostility and family history of cardiovascular disease. Results were obtained through power spectral analyses of electrocardiograph R-R intervals, which produced an index of autonomic nervous system activation. For both male and female populations, parasympathetic regulation was diminished during anger induction for individuals with high levels of trait hostility and having a family history of cardiovascular disease. Similar results were obtained for women during the uncontrolled stress condition. Based on family history of cardiovascular disease and trait hostility, men responded differentially to relaxation imagery induction, whereas no differences were found among females. PMID:16015455

  2. Spitting Image: Tick Saliva Assists the Causative Agent of Lyme Disease in Evading Host Skin's Innate Immune Response

    NARCIS (Netherlands)

    J.W.R. Hovius

    2009-01-01

    Lyme disease is caused by the spirochete Borrelia burgdorferi and is transmitted through ticks. Inhibition of host skin's innate immune response might be instrumental to both tick feeding and B. burgdorferi transmission. The article by Marchal et al. describes how tick saliva suppresses B. burgdorfe

  3. The effect of pertussis toxin and whole-cell pertussis vaccine on haemodynamics and autonomic responsiveness in the rat depends on route of administration and age.

    Science.gov (United States)

    van Amsterdam, J G; te Biesebeek, J D; van de Kuil, T; van der Laan, J W; Wemer, J; de Wildt, D J; Vleeming, W

    1998-04-01

    Vaccination of children with Diphtheria, Tetanus, Poliomyelitis and pertussis vaccine (DTPoP-vaccine) containing the whole-cell pertussis component is known to be associated with manifestation of side-effects such as acute encephalopathy, convulsions and hypotensive-hyporesponsive episodes. In young and adult rats the effects of pertussis toxin and DTPoP-vaccine on haemodynamics and autonomic responsiveness are evaluated following treatment with high dose via different routes of administration (s.c., i.p. and i.v.). The effect of pertussis toxin is dose-dependent (between 1 and 20 micrograms kg-1) and largest responses are observed after i.v. administration. At 20 micrograms kg-1, i.v. pertussis toxin decreases baseline diastolic blood pressure and increases baseline heart rate by 31% and inhibits autonomic responsiveness (salbutamol-induced increase in diastolic blood pressure and arecoline-induced decrease in heart rate). In adult rats DTPoP-vaccine induces generally more prominent effects than in young rats. In adult rats DTPoP-vaccine reduces baseline diastolic blood pressure by 25% while no response is observed in young rats. In adult rats DTPoP inhibits the adrenergic response though less compared to treatment of pertussis toxin. After treatment with DTPoP-vaccine (single or twice) only minor differences are observed between young and adult rats. Present results show that adult rats are more sensitive to pertussis toxin and pertussis vaccine than young rats and that the responses depend on the route of administration.

  4. Exercise and autonomic function.

    Science.gov (United States)

    Goldsmith, R L; Bloomfield, D M; Rosenwinkel, E T

    2000-03-01

    The complex interplay between the dichotomous subdivisions of the autonomic nervous system establishes and maintains a delicately tuned homeostasis in spite of an ever-changing environment. Aerobic exercise training can increase activity of the parasympathetic nervous system and decrease sympathetic activity. Conversely, it is well-documented that cardiac disease is often characterized by attenuated parasympathetic activity and heightened sympathetic tone. A correlation between autonomic disequilibrium and disease has led to the hypothesis that exercise training, as a therapy that restores the autonomic nervous system towards normal function, may be associated with, and possibly responsible for, outcome improvements in various populations. This is merely one of the many benefits that is conferred by chronic exercise training and reviewed in this issue. PMID:10758814

  5. The effect of local corticosteroid injection on F-wave conduction velocity and sympathetic skin response in carpal tunnel syndrome

    OpenAIRE

    Deniz, Orhan; Aygül, Recep; Kotan, Dilcan; Özdemir, Gökhan; Odabaş, Faruk Ömer; Kaya, M. Dursun; Ulvi, Hızır

    2011-01-01

    The aim of this study was to evaluate the efficacy of steroid injection for the treatment of the carpal tunnel syndrome (CTS), with F-wave parameters and sympathetic skin response (SSR). Seventeen hands of 10 women patients were treated with local steroid injection with 2-month follow-up. All patients underwent single injection into the carpal tunnel. Response to injection was measured nerve conduction studies (NCSs), median nerve F waves, and SSR before and after treatment. To determine the ...

  6. Temporal aspects of tumorigenic response to individual and mixed carcinogens. Comprehensive progress report, June 1, 1975--May 31, 1978. [Mouse skin, rats, hamsters

    Energy Technology Data Exchange (ETDEWEB)

    Albert, R.E.; Burns, F.J.; Altshuler, B.

    1978-02-01

    The research proposed here is designed to obtain a better understanding of the temporal kinetics of tumor induction when one or more carcinogens are present simultaneously or sequentially for prolonged periods of time. Studies done to date under this contract have shown that carcinogenesis in mouse skin by polycyclic aromatic hydrocarbon carcinogens is consistent with the induction of dependent and autonomous cell transformations by the carcinogen followed by the conversion of autonomous tumor cells into malignancies at a rate which is determined by the level of carcinogen exposure. Dependent cell transformations remain latent in the skin unless expressed by a promoting agent. Dependent neoplasia appears to follow one-hit kinetics while malignancy is a multihit endpoint. Dose-related and time-related aspects of tumor induction are separable in the initiation-promotion system of mouse skin which along with rat skin and hamster lung is being used as a model for testing hypotheses. Results to date provide the basis for a new interpretation of the linear non-threshold extrapolation model. The broad aim of the study is to provide a basis or rationale for estimating risks associated with prolonged exposures to carcinogens found in the environment and to predict how different tissues and species respond to the same carcinogens.

  7. DOSE-RESPONSE STUDIES OF SODIUM ARSENITE IN THE SKIN OF K6/ODC TRANSGENIC MOUSE

    Science.gov (United States)

    It has previously been observed that chronic exposure to inorganic arsenic and/or its metabolites increase(s) tumor frequency in the skin of K6/ODC transgenic mice. To identify potential biomarkers and modes of action for this skin tumorigenicity, gene expression profiles w...

  8. An analysis of the skin conductance orienting response in samples of American, British, and German schizophrenics.

    Science.gov (United States)

    Bernstein, A S; Frith, C D; Gruzelier, J H; Patterson, T; Straube, E; Venables, P H; Zahn, T P

    1982-01-01

    The existing literature dealing with the phasic orienting response (OR) in schizophrenia, examining, for the most part, the skin conductance component (SCOR), reports conflicting results with divergent implications for the nature of the attentional dysfunction in these patients. The present authors have contributed to that literature and to its divergencies. The present report addresses this issue by applying a common set of response definitions and uniform statistical-analytic procedures to the previously gathered electrodermal data obtained independently in each author's laboratory. A total of 14 studies is involved, drawn from six laboratories in the U.S.A., the U.K., and West Germany. Collectively, these studies examine chronic and acute schizophrenics, males and females, those receiving neuroleptic drugs and those not receiving them, recording SCOR from either (or both) hands using a variety of instruments and somewhat differing instructions and conditions, to both auditory and visual stimuli of different intensities and rise-time properties. The authors' purpose is two-fold. First, to determine whether some 'universal' dysfunction can be demonstrated across laboratories, conditions, and samples. Given the heterogeneous origins of these data such a finding would offer fairly strong evidence of 'real' dysfunction in schizophrenia. Second, where disagreement exists, to describe the scope and nature of the disagreement, and to articulate more clearly the findings on each side of a disputed area. One such 'universal' dysfunction emerged. Consistently, schizophrenics displayed an abnormally high incidence of nonresponsiveness, involving nearly 50% of the schizophrenic sample on average. The next most common finding is that many of the schizophrenics who display an SCOR often habituate faster than do nonschizophrenic responders. This was seen in a majority of the studies and laboratories, but conflicting evidence was presented by a minority. Evidence for a

  9. THE EFFECT OF PHASE OF MENSTRUAL CYCLE ON SYMPATHETIC SKIN RESPONSE AMONG HEALTHY YOUNG INDIAN WOMEN

    Directory of Open Access Journals (Sweden)

    David Pansy

    2014-04-01

    Full Text Available This descriptive study was undertaken to investigate the influence of menstrual cycle on sympathetic skin response (SSR during different phases of menstrual cycle in young healthy Indian women. A comparison of SSR latencies and amplitudes were done in the follicular, ovulatory and mid luteal phases of menstrual cycle. Fifty women in age group of 18 – 25 years having regular menstrual cycles were chosen for this study. After confirming the regularity of menstrual cycle, SSR was performed on them. The recording was done under standardized conditions using standardized procedure. Amplitude of SSR was found to vary in the three phases, but the differences were statistically not significant. Latency of SSR was found to be greatest in the follicular phase (1.54 ± 0.22 s and least in the mid-luteal phase (1.35 ± 0.18 s. Statistically significant differences were found between mean SSR latency in the follicular phase and the other two phases (p < 0.01. This study concludes that SSR is enhanced during the mid-luteal phase in women with regular menstrual cycles indicating sympathetic dominance.

  10. Optical spectroscopy of radiotherapy and photodynamic therapy responses in normal rat skin shows vascular breakdown products

    Science.gov (United States)

    Teles de Andrade, Cintia; Nogueira, Marcelo S.; Kanick, Stephen C.; Marra, Kayla; Gunn, Jason; Andreozzi, Jacqueline; Samkoe, Kimberley S.; Kurachi, Cristina; Pogue, Brian W.

    2016-03-01

    Photodynamic therapy (PDT) and radiotherapy are non-systemic cancer treatment options with different mechanisms of damage. So combining these techniques has been shown to have some synergy, and can mitigate their limitations such as low PDT light penetration or radiotherapy side effects. The present study monitored the induced tissue changes after PDT, radiotherapy, and a combination protocol in normal rat skin, using an optical spectroscopy system to track the observed biophysical changes. The Wistar rats were treated with one of the protocols: PDT followed by radiotherapy, PDT, radiotherapy and radiotherapy followed by PDT. Reflectance spectra were collected in order to observe the effects of these combined therapies, especially targeting vascular response. From the reflectance, information about oxygen saturation, met-hemoglobin and bilirubin concentration, blood volume fraction (BVF) and vessel radius were extracted from model fitting of the spectra. The rats were monitored for 24 hours after treatment. Results showed that there was no significant variation in the vessel size or BVF after the treatments. However, the PDT caused a significant increase in the met-hemoglobin and bilirubin concentrations, indicating an important blood breakdown. These results may provide an important clue on how the damage establishment takes place, helping to understand the effect of the combination of those techniques in order to verify the existence of a known synergistic effect.

  11. Skin microvascular and metabolic response to pressure relief maneuvers in people with spinal cord injury

    Science.gov (United States)

    Ramella-Roman, Jessica C.; Le, Du V. N.; Ghassemi, Pejhman; Nguyen, Thu A.; Lichy, Alison; Groah, Suzanne

    2013-02-01

    Clinician's recommendations on wheelchair pressure reliefs in the context of the high prevalence of pressure ulcers that occur in people with spinal cord injury is not supported by strong experimental evidence. Some data indicates that altered tissue perfusion and oxygenation occurring under pressure loads, such as during sitting, induce various pathophysiologic changes that may lead to pressure ulcers. Pressure causes a cascade of responses, including initial tissue hypoxia, which leads to ischemia, vascular leakage, tissue acidification, compensatory angiogenesis, thrombosis, and hyperemia, all of which may lead to tissue damage. We have developed an advanced skin sensor that allows measurement of oxygenation in addition to perfusion, and can be safely used during sitting. The sensor consists of a set of fiber optics probes, spectroscopic and Laser Doppler techniques that are used to obtain parameters of interest. The overriding goal of this project is to develop the evidence base for clinical recommendations on pressure reliefs. In this paper we will illustrate the experimental apparatus as well as some preliminary results of a small clinical trial conducted at the National Rehabilitation Hospital.

  12. Skin barrier response to occlusion of healthy and irritated skin: Differences in trans-epidermal water loss, erythema and stratum corneum lipids

    DEFF Research Database (Denmark)

    Jungersted, J.M.; Høgh, Julie Kaae; Hellgren, Lars;

    2010-01-01

    been damaged by either sodium lauryl sulfate (SLS) or tape stripping, respectively, was determined and compared with that of to non-occluded pre-damaged skin. Skin barrier function was assessed by measurements of trans-epidermal water loss (TEWL) and erythema. In study A, stratum corneum lipids were...... analysed. Results: Occlusion of healthy skin did not significantly influence skin barrier function, ceramide profile or the ceramide/cholesterol ratio. Occlusion of the skin after SLS irritation resulted in higher TEWL than in the control (P = 0.049). Occlusion of the skin after tape stripping resulted...

  13. Estrogens and aging skin

    OpenAIRE

    Thornton, M. Julie

    2013-01-01

    Estrogen deficiency following menopause results in atrophic skin changes and acceleration of skin aging. Estrogens significantly modulate skin physiology, targeting keratinocytes, fibroblasts, melanocytes, hair follicles and sebaceous glands, and improve angiogenesis, wound healing and immune responses. Estrogen insufficiency decreases defense against oxidative stress; skin becomes thinner with less collagen, decreased elasticity, increased wrinkling, increased dryness and reduced vascularity...

  14. The effect of occlusive and unocclusive exposure to xylene and benzene on skin irritation and molecular responses in hairless rats

    Energy Technology Data Exchange (ETDEWEB)

    Chatterjee, A.; Babu, R.J.; Ahaghotu, E.; Singh, M. [Florida A and M University, College of Pharmacy and Pharmaceutical Sciences, Tallahassee, FL (United States)

    2005-05-01

    Aromatic hydrocarbons readily penetrate the skin on dermal exposure, leading to irritation, inflammation and cytotoxicity. The effects of short-term occlusive and long-term unocclusive dermal exposure to benzene and xylene on the skin irritation response (transepidermal water loss (TEWL), skin moisture content and erythema) and cytokine/chemokine expression (interleukin-1{alpha} (IL-1{alpha}), tumor necrosis factor-{alpha} (TNF-{alpha}) and monocyte chemoattractant protein-1 (MCP-1)) were investigated in hairless rats. Occlusive dermal exposure was carried out with 230 {mu}L of the chemicals for 1 h using Hill top chambers. In unocclusive dermal exposure, 15 {mu}L of the chemicals were applied to the skin every 2 h, for 8 h a day, for 4 days. The occlusive dermal exposure revealed a clear difference in the TEWL and erythema response of these chemicals (xylene>benzene) whereas unocclusive exposure revealed similar TEWL and erythema scores for both benzene and xylene. The expression of IL-1{alpha} was elevated 2.5- and 3.8-fold in response to occlusive and unocclusive exposure, respectively, vs control (P<0.01) for both the chemicals (benzene and xylene). Similarly, TNF-{alpha} levels were elevated about 2.4- and 6.0-fold as a result of occlusive and unocclusive exposure, respectively, vs control (P<0.01). These results show that unocclusive exposure induced significantly higher TNF-{alpha} expression than occlusive exposure (P<0.05). The MCP-1 expression in blood was slightly elevated compared with the control group, but this increase was not statistically significant (P>0.05). Similarly, MCP levels in skin were increased approximately 1.7- and 1.8-fold by occlusive and unocclusive exposure, respectively, compared with the control group (P<0.05). Our study demonstrates that the skin irritation profiles of benzene and xylene are similar and unocclusive long-term exposure to small amounts of these chemicals can induce more skin irritation and cytokine response than

  15. Autonomic Nervous System Responses During Perception of Masked Speech may Reflect Constructs other than Subjective Listening Effort.

    Science.gov (United States)

    Francis, Alexander L; MacPherson, Megan K; Chandrasekaran, Bharath; Alvar, Ann M

    2016-01-01

    Typically, understanding speech seems effortless and automatic. However, a variety of factors may, independently or interactively, make listening more effortful. Physiological measures may help to distinguish between the application of different cognitive mechanisms whose operation is perceived as effortful. In the present study, physiological and behavioral measures associated with task demand were collected along with behavioral measures of performance while participants listened to and repeated sentences. The goal was to measure psychophysiological reactivity associated with three degraded listening conditions, each of which differed in terms of the source of the difficulty (distortion, energetic masking, and informational masking), and therefore were expected to engage different cognitive mechanisms. These conditions were chosen to be matched for overall performance (keywords correct), and were compared to listening to unmasked speech produced by a natural voice. The three degraded conditions were: (1) Unmasked speech produced by a computer speech synthesizer, (2) Speech produced by a natural voice and masked byspeech-shaped noise and (3) Speech produced by a natural voice and masked by two-talker babble. Masked conditions were both presented at a -8 dB signal to noise ratio (SNR), a level shown in previous research to result in comparable levels of performance for these stimuli and maskers. Performance was measured in terms of proportion of key words identified correctly, and task demand or effort was quantified subjectively by self-report. Measures of psychophysiological reactivity included electrodermal (skin conductance) response frequency and amplitude, blood pulse amplitude and pulse rate. Results suggest that the two masked conditions evoked stronger psychophysiological reactivity than did the two unmasked conditions even when behavioral measures of listening performance and listeners' subjective perception of task demand were comparable across the three

  16. Autonomic nervous system responses during perception of masked speech may reflect constructs other than subjective listening effort

    Directory of Open Access Journals (Sweden)

    Alexander L. Francis

    2016-03-01

    Full Text Available Typically, understanding speech seems effortless and automatic. However, a variety of factors may, independently or interactively, make listening more effortful. Physiological measures may help to distinguish between the application of different cognitive mechanisms whose operation is perceived as effortful. In the present study, physiological and behavioral measures associated with task demand were collected along with behavioral measures of performance while participants listened to and repeated sentences. The goal was to measure psychophysiological reactivity associated with three degraded listening conditions, each of which differed in terms of the source of the difficulty (distortion, energetic masking, and informational masking, and therefore were expected to engage different cognitive mechanisms. These conditions were chosen to be matched for overall performance (keywords correct, and were compared to listening to unmasked speech produced by a natural voice. The three degraded conditions were: (1 Unmasked speech produced by a computer speech synthesizer, (2 Speech produced by a natural voice and masked by speech-shaped noise and (3 Speech produced by a natural voice and masked by two-talker babble. Masked conditions were both presented at a -8 dB signal to noise ratio (SNR, a level shown in previous research to result in comparable levels of performance for these stimuli and maskers. Performance was measured in terms of proportion of key words identified correctly, and task demand or effort was quantified subjectively by self-report. Measures of psychophysiological reactivity included electrodermal (skin conductance response frequency and amplitude, blood pulse amplitude and pulse rate. Results suggest that the two masked conditions evoked stronger psychophysiological reactivity than did the two unmasked conditions even when behavioral measures of listening performance and listeners’ subjective perception of task demand were comparable

  17. Response-surface models for deterministic effects of localized irradiation of the skin by discrete {beta}/{gamma} -emitting sources

    Energy Technology Data Exchange (ETDEWEB)

    Scott, B.R.

    1995-12-01

    Individuals who work at nuclear reactor facilities can be at risk for deterministic effects in the skin from exposure to discrete {Beta}- and {gamma}-emitting ({Beta}{gamma}E) sources (e.g., {Beta}{gamma}E hot particles) on the skin or clothing. Deterministic effects are non-cancer effects that have a threshold and increase in severity as dose increases (e.g., ulcer in skin). Hot {Beta}{gamma}E particles are {sup 60}Co- or nuclear fuel-derived particles with diameters > 10 {mu}m and < 3 mm and contain at least 3.7 kBq (0.1 {mu}Ci) of radioactivity. For such {Beta}{gamma}E sources on the skin, it is the beta component of the dose that is most important. To develop exposure limitation systems that adequately control exposure of workers to discrete {Beta}{gamma}E sources, models are needed for systems that adequately control exposure of workers to discrete {Beta}{gamma}E sources, models are needed for evaluating the risk of deterministic effects of localized {Beta} irradiation of the skin. The purpose of this study was to develop dose-rate and irradiated-area dependent, response-surface models for evaluating risks of significant deterministic effects of localized irradiation of the skin by discrete {Beta}{gamma}E sources and to use modeling results to recommend approaches to limiting occupational exposure to such sources. The significance of the research results as follows: (1) response-surface models are now available for evaluating the risk of specific deterministic effects of localized irradiation of the skin; (2) modeling results have been used to recommend approaches to limiting occupational exposure of workers to {Beta} radiation from {Beta}{gamma}E sources on the skin or on clothing; and (3) the generic irradiated-volume, weighting-factor approach to limiting exposure can be applied to other organs including the eye, the ear, and organs of the respiratory or gastrointestinal tract and can be used for both deterministic and stochastic effects.

  18. Autonomic nervous system response patterns in freshmen with different resilience in a military university%某军校不同心理弹性水平的大一新生自主神经反应特点

    Institute of Scientific and Technical Information of China (English)

    张佳佳; 彭李; 李敏

    2011-01-01

    目的 研究不同心理弹性水平军校大学生自主神经反应特点.方法 采用成人心理弹性量表(resilience scale for adults,RSA)对重庆某军校大一新生进行心理测评,筛选出心理弹性高分组和低分组被试共144名,再从中选取愿意参加本实验的心理弹性高分组和低分组被试各27名,其进行自主神经反应(心率、皮电、皮温、指端血容振幅)特点的实验研究.结果 ①静息状态下,心理弹性高分组和低分组被试的自主神经反应没有统计学差异(P>0.05).②悲伤情绪诱导下,心理弹性高分组在皮电上低于心理弹性低分组(t=-2.077,P=0.043).③悲伤情绪诱导后,心理弹性高分组和心理弹性低分组的各个指标的恢复时间上均无统计学差异(P>0.05).结论 心理弹性水平不同的大学生的自主神经活动模式可能存在一定程度的差异.%Objective To investigate the autonomic nervous system response pattern in military college students with different levels of resilience. Methods Resilience Scale for Adults (R.SA) was applied to test 144 college students, and based on the RSA score 54 freshmen who accepted to join the test were selected and were divided into a high resilience group and a low resilience group. Each 27 freshmen of the two groups were tested for autonomic nervous system response pattern. Results ① At resting state, students of the high resilience group and low resilience group did not show significant differences in heart rate ( HR) , skin conductance (SC), skin temperature (ST) and blood volume pulse (BVP) (P>0. 05). ② Compared with those indices obtained at resting state, students of the high resilience group scored lower in HR, SC and ST under sad mood induction, but higher in BVP; students of the low resilience group scored higher in HR and SC under sad mood induction, but lower in ST and BVP. Sad mood induction showed that SC of the high resilience group was significantly lower than that of the

  19. Different oxidative stress response in keratinocytes and fibroblasts of reconstructed skin exposed to non extreme daily-ultraviolet radiation.

    Directory of Open Access Journals (Sweden)

    Claire Marionnet

    Full Text Available Experiments characterizing the biological effects of sun exposure have usually involved solar simulators. However, they addressed the worst case scenario i.e. zenithal sun, rarely found in common outdoor activities. A non-extreme ultraviolet radiation (UV spectrum referred as "daily UV radiation" (DUVR with a higher UVA (320-400 nm to UVB (280-320 nm irradiance ratio has therefore been defined. In this study, the biological impact of an acute exposure to low physiological doses of DUVR (corresponding to 10 and 20% of the dose received per day in Paris mid-April on a 3 dimensional reconstructed skin model, was analysed. In such conditions, epidermal and dermal morphological alterations could only be detected after the highest dose of DUVR. We then focused on oxidative stress response induced by DUVR, by analyzing the modulation of mRNA level of 24 markers in parallel in fibroblasts and keratinocytes. DUVR significantly modulated mRNA levels of these markers in both cell types. A cell type differential response was noticed: it was faster in fibroblasts, with a majority of inductions and high levels of modulation in contrast to keratinocyte response. Our results thus revealed a higher sensitivity in response to oxidative stress of dermal fibroblasts although located deeper in the skin, giving new insights into the skin biological events occurring in everyday UV exposure.

  20. Skin-Specific Unsaturated Fatty Acids Boost the Staphylococcus aureus Innate Immune Response

    OpenAIRE

    Nguyen, Minh Thu; Hanzelmann, Dennis; Härtner, Thomas; Peschel, Andreas; Götz, Friedrich

    2015-01-01

    Antimicrobial fatty acids (AFAs) protect the human epidermis against invasion by pathogenic bacteria. In this study, we questioned whether human skin fatty acids (FAs) can be incorporated into the lipid moiety of lipoproteins and whether such incorporation would have an impact on innate immune stimulation in the model organism Staphylococcus aureus USA300 JE2. This organism synthesized only saturated FAs. However, when feeding USA300 with unsaturated FAs present on human skin (C16:1, C18:1, o...

  1. Arsenic Transformation Predisposes Human Skin Keratinocytes To UV-induced DNA Damage Yet Enhances Their Survival Apparently by Diminishing Oxidant Response

    OpenAIRE

    Sun, Yang(Department of Physics, Shanghai Jiao Tong University, Shanghai 200240, China); Kojima, Chikara; Chignell, Colin; Mason, Ronald; Waalkes, Michael P.

    2011-01-01

    Inorganic arsenic and UV, both human skin carcinogens, may act together as skin co-carcinogens. We find human skin keratinocytes (HaCaT cells) are malignantly transformed by low-level arsenite (100 nM, 30 weeks; termed As-TM cells) and with transformation concurrently undergo full adaptation to arsenic toxicity involving reduced apoptosis and oxidative stress response to high arsenite concentrations. Oxidative DNA damage (ODD) is a possible mechanism in arsenic carcinogenesis and a hallmark o...

  2. Genetic covariance between psychopathic traits and anticipatory skin conductance responses to threat: Evidence for a potential endophenotype

    OpenAIRE

    Wang, Pan; Gao, Yu; Isen, Joshua; Tuvblad, Catherine; Raine, Adrian; Baker, Laura A.

    2015-01-01

    The genetic architecture of the association between psychopathic traits and reduced skin conductance responses (SCRs) is poorly understood. By using 752 twins aged 9–10 years, this study investigated the heritability of two SCR measures (anticipatory SCRs to impending aversive stimuli and unconditioned SCRs to the aversive stimuli themselves) in a countdown task. The study also investigated the genetic and environmental sources of the covariance between these SCR measures and two psychopathic...

  3. Contribution of the skin, rectus abdominis and their sheaths to the structural response of the abdominal wall ex vivo

    OpenAIRE

    TRAN, Doris; Mitton, David; Voirin, David; TURQUIER, Frédéric; Beillas, Philippe

    2014-01-01

    A better understanding of the abdominal wall biomechanics could help designing new treatments for incisional hernia. In the current study, a new experimental protocol was developed to evaluate the contributions of the abdominal wall components to the mechanical response of the anterior part of the abdominal wall. The specimens underwent 3 dissections (removal of 1: skin and subcutaneous fat, 2: anterior rectus sheath, 3: rectus abdominis muscles). After each dissection, they were subjected to...

  4. Force sensor in simulated skin and neural model mimic tactile SAI afferent spiking response to ramp and hold stimuli

    Directory of Open Access Journals (Sweden)

    Kim Elmer K

    2012-07-01

    Full Text Available Abstract Background The next generation of prosthetic limbs will restore sensory feedback to the nervous system by mimicking how skin mechanoreceptors, innervated by afferents, produce trains of action potentials in response to compressive stimuli. Prior work has addressed building sensors within skin substitutes for robotics, modeling skin mechanics and neural dynamics of mechanotransduction, and predicting response timing of action potentials for vibration. The effort here is unique because it accounts for skin elasticity by measuring force within simulated skin, utilizes few free model parameters for parsimony, and separates parameter fitting and model validation. Additionally, the ramp-and-hold, sustained stimuli used in this work capture the essential features of the everyday task of contacting and holding an object. Methods This systems integration effort computationally replicates the neural firing behavior for a slowly adapting type I (SAI afferent in its temporally varying response to both intensity and rate of indentation force by combining a physical force sensor, housed in a skin-like substrate, with a mathematical model of neuronal spiking, the leaky integrate-and-fire. Comparison experiments were then conducted using ramp-and-hold stimuli on both the spiking-sensor model and mouse SAI afferents. The model parameters were iteratively fit against recorded SAI interspike intervals (ISI before validating the model to assess its performance. Results Model-predicted spike firing compares favorably with that observed for single SAI afferents. As indentation magnitude increases (1.2, 1.3, to 1.4 mm, mean ISI decreases from 98.81 ± 24.73, 54.52 ± 6.94, to 41.11 ± 6.11 ms. Moreover, as rate of ramp-up increases, ISI during ramp-up decreases from 21.85 ± 5.33, 19.98 ± 3.10, to 15.42 ± 2.41 ms. Considering first spikes, the predicted latencies exhibited a decreasing trend as stimulus rate increased, as is

  5. Nociceptive Sensory Neurons Drive Interleukin-23 Mediated Psoriasiform Skin Inflammation

    Science.gov (United States)

    Riol-Blanco, Lorena; Ordovas-Montanes, Jose; Perro, Mario; Naval, Elena; Thiriot, Aude; Alvarez, David; Wood, John N.; von Andrian, Ulrich H.

    2014-01-01

    The skin has a dual function as a barrier and a sensory interface between the body and the environment. To protect against invading pathogens, the skin harbors specialized immune cells, including dermal dendritic cells (DDCs) and interleukin (IL)-17 producing γδ T cells (γδT17), whose aberrant activation by IL-23 can provoke psoriasis-like inflammation1–4. The skin is also innervated by a meshwork of peripheral nerves consisting of relatively sparse autonomic and abundant sensory fibers. Interactions between the autonomic nervous system and immune cells in lymphoid organs are known to contribute to systemic immunity, but how peripheral nerves regulate cutaneous immune responses remains unclear5,6. Here, we have exposed the skin of mice to imiquimod (IMQ), which induces IL-23 dependent psoriasis-like inflammation7,8. We show that a subset of sensory neurons expressing the ion channels TRPV1 and NaV1.8 is essential to drive this inflammatory response. Imaging of intact skin revealed that a large fraction of DDCs, the principal source of IL-23, is in close contact with these nociceptors. Upon selective pharmacological or genetic ablation of nociceptors9–11, DDCs failed to produce IL-23 in IMQ exposed skin. Consequently, the local production of IL-23 dependent inflammatory cytokines by dermal γδT17 cells and the subsequent recruitment of inflammatory cells to the skin were dramatically reduced. Intradermal injection of IL-23 bypassed the requirement for nociceptor communication with DDCs and restored the inflammatory response12. These findings indicate that TRPV1+NaV1.8+ nociceptors, by interacting with DDCs, regulate the IL-23/IL-17 pathway and control cutaneous immune responses. PMID:24759321

  6. Nociceptive sensory neurons drive interleukin-23-mediated psoriasiform skin inflammation.

    Science.gov (United States)

    Riol-Blanco, Lorena; Ordovas-Montanes, Jose; Perro, Mario; Naval, Elena; Thiriot, Aude; Alvarez, David; Paust, Silke; Wood, John N; von Andrian, Ulrich H

    2014-06-01

    The skin has a dual function as a barrier and a sensory interface between the body and the environment. To protect against invading pathogens, the skin harbours specialized immune cells, including dermal dendritic cells (DDCs) and interleukin (IL)-17-producing γδ T (γδT17) cells, the aberrant activation of which by IL-23 can provoke psoriasis-like inflammation. The skin is also innervated by a meshwork of peripheral nerves consisting of relatively sparse autonomic and abundant sensory fibres. Interactions between the autonomic nervous system and immune cells in lymphoid organs are known to contribute to systemic immunity, but how peripheral nerves regulate cutaneous immune responses remains unclear. We exposed the skin of mice to imiquimod, which induces IL-23-dependent psoriasis-like inflammation. Here we show that a subset of sensory neurons expressing the ion channels TRPV1 and Nav1.8 is essential to drive this inflammatory response. Imaging of intact skin revealed that a large fraction of DDCs, the principal source of IL-23, is in close contact with these nociceptors. Upon selective pharmacological or genetic ablation of nociceptors, DDCs failed to produce IL-23 in imiquimod-exposed skin. Consequently, the local production of IL-23-dependent inflammatory cytokines by dermal γδT17 cells and the subsequent recruitment of inflammatory cells to the skin were markedly reduced. Intradermal injection of IL-23 bypassed the requirement for nociceptor communication with DDCs and restored the inflammatory response. These findings indicate that TRPV1(+)Nav1.8(+) nociceptors, by interacting with DDCs, regulate the IL-23/IL-17 pathway and control cutaneous immune responses. PMID:24759321

  7. The Effect of Clothing on the Responses of Autonomic Nervous System Activity while Walking and Running

    OpenAIRE

    小柴, 朋子; 斎藤, 嘉代

    2011-01-01

    To determine what kind of walking wear is suitable for one's health, we examined the changes in autonomic nervous system activity by analyzing heart rate variability and the changes of salivary a -amylase activity during exercise.First, ten female subjects were kept sedentary for 30 minutes in the experimental room at 25°C before the experiments. The subjects were asked to walk at 3km/h and run at 5krn/h on the treadmill for 5 minutes each after lying, sitting, and standing.Additionally, hear...

  8. Multiple helminth infection of the skin causes lymphocyte hypo-responsiveness mediated by Th2 conditioning of dermal myeloid cells.

    Directory of Open Access Journals (Sweden)

    Peter C Cook

    2011-03-01

    Full Text Available Infection of the mammalian host by schistosome larvae occurs via the skin, although nothing is known about the development of immune responses to multiple exposures of schistosome larvae, and/or their excretory/secretory (E/S products. Here, we show that multiple (4x exposures, prior to the onset of egg laying by adult worms, modulate the skin immune response and induce CD4(+ cell hypo-responsiveness in the draining lymph node, and even modulate the formation of hepatic egg-induced granulomas. Compared to mice exposed to a single infection (1x, dermal cells from multiply infected mice (4x, were less able to support lymph node cell proliferation. Analysis of dermal cells showed that the most abundant in 4x mice were eosinophils (F4/80(+MHC-II(-, but they did not impact the ability of antigen presenting cells (APC to support lymphocyte proliferation to parasite antigen in vitro. However, two other cell populations from the dermal site of infection appear to have a critical role. The first comprises arginase-1(+, Ym-1(+ alternatively activated macrophage-like cells, and the second are functionally compromised MHC-II(hi cells. Through the administration of exogenous IL-12 to multiply infected mice, we show that these suppressive myeloid cell phenotypes form as a consequence of events in the skin, most notably an enrichment of IL-4 and IL-13, likely resulting from an influx of RELMα-expressing eosinophils. We further illustrate that the development of these suppressive dermal cells is dependent upon IL-4Rα signalling. The development of immune hypo-responsiveness to schistosome larvae and their effect on the subsequent response to the immunopathogenic egg is important in appreciating how immune responses to helminth infections are modulated by repeated exposure to the infective early stages of development.

  9. Reversible inactivation of rostral nucleus raphe pallidus attenuates acute autonomic responses but not their habituation to repeated audiogenic stress in rats.

    Science.gov (United States)

    Nyhuis, Tara J; Masini, Cher V; Taufer, Kirsten L; Day, Heidi E W; Campeau, Serge

    2016-01-01

    The medullary nucleus raphe pallidus (RPa) mediates several autonomic responses evoked by acute stress exposure, including tachycardia and hyperthermia. The present study assessed whether the RPa contributes to the decline/habituation of these responses observed during repeated audiogenic stress. Adult male rats were implanted with cannulae aimed at the RPa, and abdominal E-mitters that wirelessly acquire heart rate and core body temperature. After surgical recovery, animals were injected with muscimol or vehicle (aCSF) in the RPa region, followed by 30 min of 95-dBA loud noise or no noise control exposures on 3 consecutive days at 24-h intervals. Forty-eight hours after the third exposure, animals were exposed to an additional, but injection-free, loud noise or no noise test to assess habituation of hyperthermia and tachycardia. Three days later, rats were restrained for 30-min to evaluate their ability to display normal acute autonomic responses following the repeated muscimol injection regimen. The results indicated that the inhibition of cellular activity induced by the GABAA-receptor agonist muscimol centered in the RPa region reliably attenuated acute audiogenic stress-evoked tachycardia and hyperthermia, compared with vehicle-injected rats. Animals in the stress groups exhibited similar attenuated tachycardia and hyperthermia during the injection-free fourth audiogenic stress exposure, and displayed similar and robust increases in these responses to the subsequent restraint test. These results suggest that cellular activity in neurons of the RPa region is necessary for the expression of acute audiogenic stress-induced tachycardia and hyperthermia, but may not be necessary for the acquisition of habituated tachycardic responses to repeated stress.

  10. Autonomous Search

    CERN Document Server

    Hamadi, Youssef; Saubion, Frédéric

    2012-01-01

    Decades of innovations in combinatorial problem solving have produced better and more complex algorithms. These new methods are better since they can solve larger problems and address new application domains. They are also more complex which means that they are hard to reproduce and often harder to fine-tune to the peculiarities of a given problem. This last point has created a paradox where efficient tools are out of reach of practitioners. Autonomous search (AS) represents a new research field defined to precisely address the above challenge. Its major strength and originality consist in the

  11. Trigeminal autonomic cephalalgias.

    Science.gov (United States)

    Eller, M; Goadsby, P J

    2016-01-01

    The trigeminal autonomic cephalalgias (TACs) are a group of primary headache disorders characterised by lateralized symptoms: prominent headache and ipsilateral cranial autonomic features, such as conjunctival injection, lacrimation and rhinorrhea. The TACs are: cluster headache (CH), paroxysmal hemicrania (PH), short-lasting unilateral neuralgiform headache attacks with conjunctival injection and tearing (SUNCT)/short-lasting neuralgiform headache attacks with cranial autonomic features (SUNA) and hemicrania continua (HC). Their diagnostic criteria are outlined in the International Classification of Headache Disorders, third edition-beta (ICHD-IIIb). These conditions are distinguished by their attack duration and frequency, as well as response to treatment. HC is continuous and by definition responsive to indomethacin. The main differential when considering this headache is chronic migraine. Other TACs are remarkable for their short duration and must be distinguished from other short-lasting painful conditions, such as trigeminal neuralgia and primary stabbing headache. Cluster headache is characterised by exquisitely painful attacks that occur in discrete episodes lasting 15-180 min a few times a day. In comparison, PH occurs more frequently and is of shorter duration, and like HC is responsive to indomethacin. SUNCT/SUNA is the shortest duration and highest frequency TAC; attacks can occur over a hundred times every day. PMID:24888770

  12. Trigeminal autonomic cephalalgias.

    Science.gov (United States)

    Eller, M; Goadsby, P J

    2016-01-01

    The trigeminal autonomic cephalalgias (TACs) are a group of primary headache disorders characterised by lateralized symptoms: prominent headache and ipsilateral cranial autonomic features, such as conjunctival injection, lacrimation and rhinorrhea. The TACs are: cluster headache (CH), paroxysmal hemicrania (PH), short-lasting unilateral neuralgiform headache attacks with conjunctival injection and tearing (SUNCT)/short-lasting neuralgiform headache attacks with cranial autonomic features (SUNA) and hemicrania continua (HC). Their diagnostic criteria are outlined in the International Classification of Headache Disorders, third edition-beta (ICHD-IIIb). These conditions are distinguished by their attack duration and frequency, as well as response to treatment. HC is continuous and by definition responsive to indomethacin. The main differential when considering this headache is chronic migraine. Other TACs are remarkable for their short duration and must be distinguished from other short-lasting painful conditions, such as trigeminal neuralgia and primary stabbing headache. Cluster headache is characterised by exquisitely painful attacks that occur in discrete episodes lasting 15-180 min a few times a day. In comparison, PH occurs more frequently and is of shorter duration, and like HC is responsive to indomethacin. SUNCT/SUNA is the shortest duration and highest frequency TAC; attacks can occur over a hundred times every day.

  13. Experimental characterization and damage model of the human skin response to dynamic loadings

    OpenAIRE

    JACQUEMOUD,C; Coret, M; BRUYERE-GARNIER,K; Brunet, M.

    2007-01-01

    The objective of this work is to characterize and to model the damage of planar and fibrous soft tissues at high strain rate. As first step, we choose to study the human skin. A dynamic tensile test up to failure is performed on 10x30mm human skin samples. The test is based on the drop test principle and allows loading of samples at a strain rate close to 40 s-1. Classical measurement techniques give global strains whereas a full local strain field is measured on the sample surface by an Imag...

  14. IN SITU IMMUNE RESPONSE EVALUATION VIA IMMUNOHISTOCHEMISTRY IN SKIN BIOPSIES FROM PATIENTS AFFECTED BY AUTOIMMUNE BLISTERING DISEASES

    Directory of Open Access Journals (Sweden)

    Ana Maria Abreu Velez

    2013-11-01

    Full Text Available Introduction: The in situ immune response in skin biopsies from patients affected by autoimmune skin blistering diseases (ABD is not well characterized. Aim: Our investigation attempts to immunophenotype cells in lesional skin in several ABD, utilizing immunohistochemistry (ICH. Methods: We tested by IHC for CD4, CD8, CD19, CD20, CD45, CD56/NCAM, PAX-5, granzyme B, myeloperoxidase, neutrophil elastase, LAT and ZAP-70 in patients affected by ABD. We tested 30 patients with endemic pemphigus foliaceus (EPF, 15 controls from the EPF endemic area, and 15 biopsies from healthy controls from the USA. We also tested archival biopsies from patients with selected ABD, including 30 patients with bullous pemphigoid, 20 with pemphigus vulgaris, 8 with pemphigus foliaceus and 14 with dermatitis herpetiformis. Results: We found a predominantly CD8 positive/CD45 positive T cell infiltrate in all ABD. Our skin biopsies demonstrated consistently positive staining for myeloperoxidase, but negative staining for neutrophil elastase. Most ABD biopsies displayed negative staining for CD4 and B cell markers; natural killer cell markers were also rarely seen. ZAP-70 and LAT were frequently detected. In El Bagre-EPF, a significant fragmentation of T cells in lesional skin was noted, as well as autoreactivity to lymph nodes. Conclusions: The documented T cell and myeloperoxidase staining are indicative of the role of T lymphocytes and neutrophils in lesional biopsies in patients with ABD, in addition to previously documented deposition of B cells, immunoglobulins and complement in situ. In El Bagre-EPF, T cells could also target lymph nodes; however, further studies are needed to confirm this possibility.

  15. Galvanic zinc-copper microparticles produce electrical stimulation that reduces the inflammatory and immune responses in skin.

    Science.gov (United States)

    Kaur, Simarna; Lyte, Peter; Garay, Michelle; Liebel, Frank; Sun, Ying; Liu, Jue-Chen; Southall, Michael D

    2011-10-01

    The human body has its own innate electrical system that regulates the body's functions via communications among organs through the well-known neural system. While the effect of low-level electrical stimulation on wound repair has been reported, few studies have examined the effect of electric potential on non-wounded, intact skin. A galvanic couple comprised of elemental zinc and copper was used to determine the effects of low-level electrical stimulation on intact skin physiology using a Dermacorder device. Zn-Cu induced the electrical potential recorded on intact skin, enhanced H(2)O(2) production and activated p38 MAPK and Hsp27 in primary keratinocytes. Treatment with Zn-Cu was also found to reduce pro-inflammatory cytokines, such as IL-1α, IL-2, NO and TNF-α in multiple cell types after stimulation with PHA or Propionibacterium acnes bacteria. The Zn-Cu complex led to a dose-dependent inhibition of TNF-α-induced NF-κB levels in keratinocytes as measured by a dual-luciferase promoter assay, and prevented p65 translocation to the nucleus observed via immunofluorescence. Suppression of NF-κB activity via crosstalk with p38 MAPK might be one of the potential pathways by which Zn-Cu exerted its inflammatory effects. Topical application of Zn-Cu successfully mitigated TPA-induced dermatitis and oxazolone-induced hypersensitivity in mice models of ear edema. Anti-inflammatory activity induced by the Zn-Cu galvanic couple appears to be mediated, at least in part, by production of low level of hydrogen peroxide since this activity is reversed by the addition of Catalase enzyme. Collectively, these results show that a galvanic couple containing Zn-Cu strongly reduces the inflammatory and immune responses in intact skin, providing evidence for the role of electric stimulation in non-wounded skin.

  16. Developmental and Metabolic Plasticity of White-Skinned Grape Berries in Response to Botrytis cinerea during Noble Rot1[OPEN

    Science.gov (United States)

    Collins, Thomas S.; Vicente, Ariel R.; Doyle, Carolyn L.; Ye, Zirou; Allen, Greg; Heymann, Hildegarde

    2015-01-01

    Noble rot results from exceptional infections of ripe grape (Vitis vinifera) berries by Botrytis cinerea. Unlike bunch rot, noble rot promotes favorable changes in grape berries and the accumulation of secondary metabolites that enhance wine grape composition. Noble rot-infected berries of cv Sémillon, a white-skinned variety, were collected over 3 years from a commercial vineyard at the same time that fruit were harvested for botrytized wine production. Using an integrated transcriptomics and metabolomics approach, we demonstrate that noble rot alters the metabolism of cv Sémillon berries by inducing biotic and abiotic stress responses as well as ripening processes. During noble rot, B. cinerea induced the expression of key regulators of ripening-associated pathways, some of which are distinctive to the normal ripening of red-skinned cultivars. Enhancement of phenylpropanoid metabolism, characterized by a restricted flux in white-skinned berries, was a common outcome of noble rot and red-skinned berry ripening. Transcript and metabolite analyses together with enzymatic assays determined that the biosynthesis of anthocyanins is a consistent hallmark of noble rot in cv Sémillon berries. The biosynthesis of terpenes and fatty acid aroma precursors also increased during noble rot. We finally characterized the impact of noble rot in botrytized wines. Altogether, the results of this work demonstrated that noble rot causes a major reprogramming of berry development and metabolism. This desirable interaction between a fruit and a fungus stimulates pathways otherwise inactive in white-skinned berries, leading to a greater accumulation of compounds involved in the unique flavor and aroma of botrytized wines. PMID:26450706

  17. Surgical implantation and functional assessment of an invasive telemetric system to measure autonomic responses in domestic pigs.

    Science.gov (United States)

    Krause, A; Zebunke, M; Bellmann, O; Mohr, E; Langbein, J; Puppe, B

    2016-01-01

    The first aim of this study was to establish a surgical procedure to implant a new telemetric device for the continuous recording of electrocardiogram (ECG) and blood pressure (BP) in freely moving pigs. A second aim was the functional assessment of cardiovascular parameters, including heart rate variability (HRV) and blood pressure variability (BPV), so that these data could be used as the basis for the objective evaluation of autonomic activity and balance in different behavioural contexts. Eleven domestic pigs (German Landrace) underwent surgery for the placement of a telemetric device. At day 15 after surgery, 512 consecutive inter-beat intervals and pressure waves were analysed using different detection methods (automatic and manually corrected) while the animals were resting or feeding, respectively. HRV and BPV were calculated. Incomplete datasets were found in four pigs due to missing ECG or BP signals. Technical and surgical issues concerning catheterisation and detachment of the negative ECG lead were continuously improved. In the remaining pigs, excellent signal quality (manually corrected data of 1%) was obtained during resting and acceptable signal quality (ECG recordings. Sympathetic arousal with accompanying vagal withdrawal during feeding was documented. The established surgical implantation and functional assessment of the telemetric system with the reliable registration of cardiovascular parameters in freely moving pigs could serve as a basis for future studies of autonomic regulation in context of stress and animal welfare. PMID:26626089

  18. Optical coherence tomography microangiography for monitoring the response of vascular perfusion to external pressure on human skin tissue

    Science.gov (United States)

    Choi, Woo June; Wang, Hequn; Wang, Ruikang K.

    2014-05-01

    Characterization of the relationship between external pressure and blood flow is important in the examination of pressure-induced disturbance in tissue microcirculation. Optical coherence tomography (OCT)-based microangiography is a promising imaging technique, capable of providing the noninvasive extraction of functional vessels within the skin tissue with capillary-scale resolution. Here, we present a feasibility study of OCT microangiography (OMAG) to evaluate changes in blood perfusion in response to externally applied pressure on human skin tissue in vivo. External force is loaded normal to the tissue surface at the nailfold region of a healthy human volunteer. An incremental force is applied step by step and then followed by an immediate release. Skin perfusion events including baseline are continuously imaged by OMAG, allowing for visualization and quantification of the capillary perfusion in the nailfold tissue. The tissue strain maps are simultaneously evaluated through the available OCT structural images to assess the relationship of the microcirculation response to the applied pressure. The results indicate that the perfusion progressively decreases with the constant increase of pressure. Reactive hyperemia occurs right after the removal of the pressure. The perfusion returns to the baseline level after a few minutes. These findings suggest that OMAG may have great potential for quantitatively assessing tissue microcirculation in the locally pressed tissue in vivo.

  19. Photo-oxidation products of skin surface squalene mediate metabolic and inflammatory responses to solar UV in human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Vladimir Kostyuk

    Full Text Available UNLABELLED: The study aimed to identify endogenous lipid mediators of metabolic and inflammatory responses of human keratinocytes to solar UV irradiation. Physiologically relevant doses of solar simulated UVA+UVB were applied to human skin surface lipids (SSL or to primary cultures of normal human epidermal keratinocytes (NHEK. The decay of photo-sensitive lipid-soluble components, alpha-tocopherol, squalene (Sq, and cholesterol in SSL was analysed and products of squalene photo-oxidation (SqPx were quantitatively isolated from irradiated SSL. When administered directly to NHEK, low-dose solar UVA+UVB induced time-dependent inflammatory and metabolic responses. To mimic UVA+UVB action, NHEK were exposed to intact or photo-oxidised SSL, Sq or SqPx, 4-hydroxy-2-nonenal (4-HNE, and the product of tryptophan photo-oxidation 6-formylindolo[3,2-b]carbazole (FICZ. FICZ activated exclusively metabolic responses characteristic for UV, i.e. the aryl hydrocarbon receptor (AhR machinery and downstream CYP1A1/CYP1B1 gene expression, while 4-HNE slightly stimulated inflammatory UV markers IL-6, COX-2, and iNOS genes. On contrast, SqPx induced the majority of metabolic and inflammatory responses characteristic for UVA+UVB, acting via AhR, EGFR, and G-protein-coupled arachidonic acid receptor (G2A. CONCLUSIONS/SIGNIFICANCE: Our findings indicate that Sq could be a primary sensor of solar UV irradiation in human SSL, and products of its photo-oxidation mediate/induce metabolic and inflammatory responses of keratinocytes to UVA+UVB, which could be relevant for skin inflammation in the sun-exposed oily skin.

  20. Responses of Six-Weeks Aquatic Exercise on the Autonomic Nervous System, Peak Nasal Inspiratory Flow and Lung Functions in Young Adults with Allergic Rhinitis

    Directory of Open Access Journals (Sweden)

    Taweesak Janyacharoen

    2015-10-01

    Full Text Available Allergic rhinitis is a chronic respiratory disease. Sympathetic hypofunction is identified in all of the allergic rhinitis patients. Moreover, allergic rhinitis is associated with decreased peak nasal inspiratory flow (PNIF and impaired lung functions. The aim of this study was to investigate effects of six-week of aquatic exercise on the autonomic nervous system function, PNIF and lung functions in allergic rhinitis patients.Twenty-six allergic rhinitis patients, 12 males and 14 females were recruited in this study. Subjects were diagnosed by a physician based on history, physical examination, and positive reaction to a skin prick test. Subjects were randomly assigned to two groups. The control allergic rhinitis group received education and maintained normal life. The aquatic group performed aquatic exercise for 30 minutes a day, three days a week for six weeks. Heart rate variability, PNIF and lung functions were measured at the beginning, after three weeks and six weeks.There were statistically significant increased low frequency normal units (LF n.u., PNIF and showed decreased high frequency normal units (HF n.u. at six weeks after aquatic exercise compared with the control group.Six weeks of aquatic exercise could increase sympathetic activity and PNIF in allergicrhinitis patients.

  1. Acute response of pig skin to irradiation with 12C-ions or 200 kV X-rays

    International Nuclear Information System (INIS)

    The acute response of pig skin to treatment with high energy carbon ions (plateau region) at the Gesellschaft fuer Schwerionenforschung (GSI, Darmstadt, Germany) was compared to changes after 200 kV X-irradiation. Carbon doses isoeffective to the X-ray doses were computed with a recently established model for calculation of the biological effect of heavy ions (1, 2). Clinical changes and physiological symptoms (blood flow, erythema, transepidermal water loss, skin hydration) were scored. The parameters analyzed were maximum and mean values of each symptom during days 24 to 70 post irradiation, and the quantal endpoints for the establishment of dose-effect curves were the median values of these. With exception of the maximum change in the red blood cell concentration (p12C-ions (plateau region) and may at least for epidermis be applied to treatment planning. (orig.)

  2. Pure Autonomic Failure

    Science.gov (United States)

    ... Drugs GARD Information Navigator FAQs About Rare Diseases Pure autonomic failure Title Other Names: Bradbury Eggleston syndrome; ... Categories: Nervous System Diseases ; RDCRN Summary Summary Listen Pure autonomic failure is characterized by generalized autonomic failure ...

  3. Skin microbiome imbalance in patients with STAT1/STAT3 defects impairs innate host defense responses

    NARCIS (Netherlands)

    Smeekens, S.P.; Huttenhower, C.; Riza, A.L.; Veerdonk, F.L. van de; Zeeuwen, P.L.J.M.; Schalkwijk, J.; Meer, J.W.M. van der; Xavier, R.J.; Netea, M.G.; Gevers, D.

    2014-01-01

    BACKGROUND: Chronic mucocutaneous candidiasis (CMC) and hyper-IgE syndrome (HIES) are primary immunodeficiencies mainly caused by mutations in STAT1 and STAT3, respectively. CMC and HIES patients have an increased risk for skin and mucosal infections with fungal pathogens and Staphylococcus aureus.

  4. Skin Conductance Response in ICU patients with various stressors: a case series

    NARCIS (Netherlands)

    Tjan, D.H.T.; Schellaars, R.; Volders, J.; Weda, J.; Johnson, M.T.; Lubberding, M.; Dijk, E.O.; Ouwerkerk, M.; Van Zanten, A.R.H.

    2012-01-01

    Measuring stress levels in the ICU is not well defined and lacks reliable and valid methods of detection. ICU patients experience different kinds of stress like pain, dyspnoea, anxiety and general discomfort. Skin conductance has recently been shown to be a promising physiological indicator of pain

  5. Human facial skin detection in thermal video to effectively measure electrodermal activity (EDA)

    Science.gov (United States)

    Kaur, Balvinder; Hutchinson, J. Andrew; Leonard, Kevin R.; Nelson, Jill K.

    2011-06-01

    In the past, autonomic nervous system response has often been determined through measuring Electrodermal Activity (EDA), sometimes referred to as Skin Conductance (SC). Recent work has shown that high resolution thermal cameras can passively and remotely obtain an analog to EDA by assessing the activation of facial eccrine skin pores. This paper investigates a method to distinguish facial skin from non-skin portions on the face to generate a skin-only Dynamic Mask (DM), validates the DM results, and demonstrates DM performance by removing false pore counts. Moreover, this paper shows results from these techniques using data from 20+ subjects across two different experiments. In the first experiment, subjects were presented with primary screening questions for which some had jeopardy. In the second experiment, subjects experienced standard emotion-eliciting stimuli. The results from using this technique will be shown in relation to data and human perception (ground truth). This paper introduces an automatic end-to-end skin detection approach based on texture feature vectors. In doing so, the paper contributes not only a new capability of tracking facial skin in thermal imagery, but also enhances our capability to provide non-contact, remote, passive, and real-time methods for determining autonomic nervous system responses for medical and security applications.

  6. Aluminum sulfate significantly reduces the skin test response to common allergens in sensitized patients

    Directory of Open Access Journals (Sweden)

    Grier Thomas J

    2006-02-01

    Full Text Available Abstract Background Avoidance of allergens is still recommended as the first and best way to prevent allergic illnesses and their comorbid diseases. Despite a variety of attempts there has been very limited success in the area of environmental control of allergic disease. Our objective was to identify a non-invasive, non-pharmacological method to reduce indoor allergen loads in atopic persons' homes and public environments. We employed a novel in vivo approach to examine the possibility of using aluminum sulfate to control environmental allergens. Methods Fifty skin test reactive patients were simultaneously skin tested with conventional test materials and the actions of the protein/glycoprotein modifier, aluminum sulfate. Common allergens, dog, cat, dust mite, Alternaria, and cockroach were used in the study. Results Skin test reactivity was significantly reduced by the modifier aluminum sulfate. Our studies demonstrate that the effects of histamine were not affected by the presence of aluminum sulfate. In fact, skin test reactivity was reduced independent of whether aluminum sulfate was present in the allergen test material or removed prior to testing, indicating that the allergens had in some way been inactivated. Conclusion Aluminum sulfate was found to reduce the in vivo allergic reaction cascade induced by skin testing with common allergens. The exact mechanism is not clear but appears to involve the alteration of IgE-binding epitopes on the allergen. Our results indicate that it may be possible to diminish the allergenicity of an environment by application of the active agent aluminum sulfate, thus producing environmental control without complete removal of the allergen.

  7. An Integrated Approach for the Monitoring of Brain and Autonomic Response of Children with Autism Spectrum Disorders during Treatment by Wearable Technologies

    Science.gov (United States)

    Billeci, Lucia; Tonacci, Alessandro; Tartarisco, Gennaro; Narzisi, Antonio; Di Palma, Simone; Corda, Daniele; Baldus, Giovanni; Cruciani, Federico; Anzalone, Salvatore M.; Calderoni, Sara; Pioggia, Giovanni; Muratori, Filippo

    2016-01-01

    Autism Spectrum Disorders (ASD) are associated with physiological abnormalities, which are likely to contribute to the core symptoms of the condition. Wearable technologies can provide data in a semi-naturalistic setting, overcoming the limitations given by the constrained situations in which physiological signals are usually acquired. In this study an integrated system based on wearable technologies for the acquisition and analysis of neurophysiological and autonomic parameters during treatment is proposed and an application on five children with ASD is presented. Signals were acquired during a therapeutic session based on an imitation protocol in ASD children. Data were analyzed with the aim of extracting quantitative EEG (QEEG) features from EEG signals as well as heart rate and heart rate variability (HRV) from ECG. The system allowed evidencing changes in neurophysiological and autonomic response from the state of disengagement to the state of engagement of the children, evidencing a cognitive involvement in the children in the tasks proposed. The high grade of acceptability of the monitoring platform is promising for further development and implementation of the tool. In particular if the results of this feasibility study would be confirmed in a larger sample of subjects, the system proposed could be adopted in more naturalistic paradigms that allow real world stimuli to be incorporated into EEG/psychophysiological studies for the monitoring of the effect of the treatment and for the implementation of more individualized therapeutic programs. PMID:27445652

  8. An Integrated Approach for the Monitoring of Brain and Autonomic Response of Children with Autism Spectrum Disorders during Treatment by Wearable Technologies.

    Science.gov (United States)

    Billeci, Lucia; Tonacci, Alessandro; Tartarisco, Gennaro; Narzisi, Antonio; Di Palma, Simone; Corda, Daniele; Baldus, Giovanni; Cruciani, Federico; Anzalone, Salvatore M; Calderoni, Sara; Pioggia, Giovanni; Muratori, Filippo

    2016-01-01

    Autism Spectrum Disorders (ASD) are associated with physiological abnormalities, which are likely to contribute to the core symptoms of the condition. Wearable technologies can provide data in a semi-naturalistic setting, overcoming the limitations given by the constrained situations in which physiological signals are usually acquired. In this study an integrated system based on wearable technologies for the acquisition and analysis of neurophysiological and autonomic parameters during treatment is proposed and an application on five children with ASD is presented. Signals were acquired during a therapeutic session based on an imitation protocol in ASD children. Data were analyzed with the aim of extracting quantitative EEG (QEEG) features from EEG signals as well as heart rate and heart rate variability (HRV) from ECG. The system allowed evidencing changes in neurophysiological and autonomic response from the state of disengagement to the state of engagement of the children, evidencing a cognitive involvement in the children in the tasks proposed. The high grade of acceptability of the monitoring platform is promising for further development and implementation of the tool. In particular if the results of this feasibility study would be confirmed in a larger sample of subjects, the system proposed could be adopted in more naturalistic paradigms that allow real world stimuli to be incorporated into EEG/psychophysiological studies for the monitoring of the effect of the treatment and for the implementation of more individualized therapeutic programs. PMID:27445652

  9. The response of human skin commensal bacteria as a reflection of UV radiation: UV-B decreases porphyrin production.

    Directory of Open Access Journals (Sweden)

    Yanhan Wang

    Full Text Available Recent global radiation fears reflect the urgent need for a new modality that can simply determine if people are in a radiation risk of developing cancer and other illnesses. Ultraviolet (UV radiation has been thought to be the major risk factor for most skin cancers. Although various biomarkers derived from the responses of human cells have been revealed, detection of these biomarkers is cumbersome, probably requires taking live human tissues, and varies significantly depending on human immune status. Here we hypothesize that the reaction of Propionibacterium acnes (P. acnes, a human resident skin commensal, to UV radiation can serve as early surrogate markers for radiation risk because the bacteria are immediately responsive to radiation. In addition, the bacteria can be readily accessible and exposed to the same field of radiation as human body. To test our hypothesis, P. acnes was exposed to UV-B radiation. The production of porphyrins in P. acnes was significantly reduced with increasing doses of UV-B. The porphyrin reduction can be detected in both P. acnes and human skin bacterial isolates. Exposure of UV-B to P. acnes- inoculated mice led to a significant decrease in porphyrin production in a single colony of P. acnes and simultaneously induced the formation of cyclobutane pyrimidine dimers (CPD in the epidermal layers of mouse skin. Mass spectrometric analysis via a linear trap quadrupole (LTQ-Orbitrap XL showed that five peptides including an internal peptide (THLPTGIVVSCQNER of a peptide chain release factor 2 (RF2 were oxidized by UV-B. Seven peptides including three internal peptides of 60 kDa chaperonin 1 were de-oxidized by UV-B. When compared to UV-B, gamma radiation also decreased the porphyrin production of P. acnes in a dose-dependent manner, but induced a different signature of protein oxidation/de-oxidation. We highlight that uncovering response of skin microbiome to radiation will facilitate the development of pre

  10. Effects of lidocaine constant rate infusion on sevoflurane requirement, autonomic responses, and postoperative analgesia in dogs undergoing ovariectomy under opioid-based balanced anesthesia.

    Science.gov (United States)

    Columbano, Nicolò; Secci, Fabio; Careddu, Giovanni M; Sotgiu, Giovanni; Rossi, Gabriele; Driessen, Bernd

    2012-08-01

    The effects of constant rate infusion (CRI) of lidocaine on sevoflurane (SEVO) requirements, autonomic responses to noxious stimulation, and postoperative pain relief were evaluated in dogs undergoing opioid-based balanced anesthesia. Twenty-four dogs scheduled for elective ovariectomy were randomly assigned to one of four groups: BC, receiving buprenorphine without lidocaine; FC, receiving fentanyl without lidocaine; BL, receiving buprenorphine and lidocaine; FL, receiving fentanyl and lidocaine. Dogs were anesthetized with intravenous (IV) diazepam and ketamine and anesthesia maintained with SEVO in oxygen/air. Lidocaine (2mg/kg plus 50 μg/kg/min) or saline were infused in groups BL/FL and BC/FC, respectively. After initiation of lidocaine or saline CRI IV buprenorphine (0.02 mg/kg) or fentanyl (4 μg/kg plus 8 μg/kg/h CRI) were administered IV in BC/BL and FC/FL, respectively. Respiratory and hemodynamic variables, drug plasma concentrations, and end-tidal SEVO concentrations (E'SEVO) were measured. Behaviors and pain scores were subjectively assessed 1 and 2h post-extubation. Lidocaine CRI produced median drug plasma concentrations <0.4 μg/mL during peak surgical stimulation. Lidocaine produced a 14% decrease in E'SEVO in the BL (P<0.01) but none in the FL group and no change in cardio-pulmonary responses to surgery or postoperative behaviors and pain scores in any group. Thus, depending on the opioid used, supplementing opioid-based balanced anesthesia with lidocaine (50 μg/kg/min) may not have any or only a minor impact on anesthetic outcome in terms of total anesthetic dose, autonomic responses to visceral nociception, and postoperative analgesia. PMID:22261004

  11. Hemodynamic and autonomic nervous system responses to mixed meal ingestion in healthy young and old subjects and dysautonomic patients with postprandial hypotension

    Science.gov (United States)

    Lipsitz, L. A.; Ryan, S. M.; Parker, J. A.; Freeman, R.; Wei, J. Y.; Goldberger, A. L.

    1993-01-01

    BACKGROUND. Although postprandial hypotension is a common cause of falls and syncope in elderly persons and in patients with autonomic insufficiency, the pathophysiology of this disorder remains unknown. METHODS AND RESULTS. We examined the hemodynamic, splanchnic blood pool, plasma norepinephrine (NE), and heart rate (HR) power spectra responses to a standardized 400-kcal mixed meal in 11 healthy young (age, 26 +/- 5 years) and nine healthy elderly (age, 80 +/- 5 years) subjects and 10 dysautonomic patients with symptomatic postprandial hypotension (age, 65 +/- 16 years). Cardiac and splanchnic blood pools were determined noninvasively by radionuclide scans, and forearm vascular resistance was determined using venous occlusion plethysmography. In healthy young and old subjects, splanchnic blood volume increased, but supine blood pressure remained unchanged after the meal. In both groups, HR increased and systemic vascular resistance remained stable. Forearm vascular resistance and cardiac index increased after the meal in elderly subjects, whereas these responses were highly variable and of smaller magnitude in the young. Young subjects demonstrated postprandial increases in low-frequency HR spectral power, representing cardiac sympatho-excitation, but plasma NE remained unchanged. In elderly subjects, plasma NE increased after the meal but without changes in the HR power spectrum. Patients with dysautonomia had a large postprandial decline in blood pressure associated with no change in forearm vascular resistance, a fall in systemic vascular resistance, and reduction in left ventricular end diastolic volume index. HR increased in these patients but without changes in plasma NE or the HR power spectrum. CONCLUSIONS. 1) In healthy elderly subjects, the maintenance of blood pressure homeostasis after food ingestion is associated with an increase in HR, forearm vascular resistance, cardiac index, and plasma NE. In both young and old, systemic vascular resistance is

  12. Frequency response of an electric equivalent circuit for a skin type system

    OpenAIRE

    F. Gómez-Aguilar; J. Bernal-Alvarado; J. Rosales-García; M. Guía-Calderón; T Córdova-Fraga; M. Sosa-Aquino

    2011-01-01

    In the present work we consider a theoretical representation of an electrical circuit equivalent to a multilayer biological system. The proposed system is of the skin type, containing epidermis, dermis and the subcutaneous tissue. Electrical circuit theory is used, and the behavior of the system is shown in the form of Nyquist and Bode plots. The proposed theoretical approach is a general treatment to describe the bioelectrical transport in a three-layered system, especially in the ele...

  13. Lipocalin-2 exacerbates psoriasiform skin inflammation by augmenting T-helper 17 response.

    Science.gov (United States)

    Hau, Carren S; Kanda, Naoko; Tada, Yayoi; Shibata, Sayaka; Uozaki, Hiroshi; Fukusato, Toshio; Sato, Shinichi; Watanabe, Shinichi

    2016-07-01

    Lipocalin-2 (LCN2) is an antimicrobial protein and adipokine associated with insulin resistance, obesity and atherosclerotic disease. Psoriasis is a T-helper (Th)1/Th17-mediated, chronic inflammatory dermatosis related to metabolic syndromes and serum LCN2 levels are elevated in psoriatic patients. We examined the in vivo effects of LCN2 on topical imiquimod (IMQ)-induced psoriasiform skin in BALB/c mice and in vitro on human keratinocytes (KC). Clinically, i.p. injected LCN2 exacerbated erythema and scaling in IMQ-treated murine skin compared with phosphate-buffered saline injection alone, and it augmented interleukin (IL)-17A, IL-17F, IL-22, IL-23p19, IL-12p40, CCL20, tumor necrosis factor-α, chemokine (C-X-C motif) ligand (CXCL)1, CXCL2, DEFB4, DEFB14, LCN2 and S100A7 mRNA levels of IMQ-treated murine skin while it did not increase the mRNA levels of interferon-γ, IL-12p35 or CXCL10. LCN2 in synergy with IL-17 increased mRNA levels of CCL20, LCN2 and DEFB4A but not of CXCL10 in human KC in vitro. These results suggest that LCN2 enhances the expression of Th17 cytokines/chemokines and antimicrobial peptides in murine IMQ-treated psoriatic skin and KC. LCN2 may potentiate the development of psoriasis via the enhancement of Th17- and antimicrobial peptide-mediated inflammation. PMID:26702876

  14. The vitamin D3 transcriptomic response in skin cells derived from the Atlantic bottlenose dolphin

    OpenAIRE

    Ellis, Blake C.; Gattoni-Celli, Sebastiano; Mancia, Annalaura; Kindy, Mark S.

    2009-01-01

    The Atlantic bottlenose dolphin has attracted attention due to the evident impact that environmental stressors have taken on its health. In order to better understand the mechanisms linking environmental health with dolphin health, we have established cell cultures from dolphin skin as in vitro tools for molecular evaluations. The vitamin D3 pathway is one mechanism of interest because of its well established chemopreventative and immunomodulatory properties in terrestrial mammals. On the oth...

  15. Protein Kinases and Transcription Factors Activation in Response to UV-Radiation of Skin: Implications for Carcinogenesis

    Directory of Open Access Journals (Sweden)

    Laurence A. Marchat

    2011-12-01

    Full Text Available Solar ultraviolet (UV radiation is an important environmental factor that leads to immune suppression, inflammation, photoaging, and skin carcinogenesis. Here, we reviewed the specific signal transduction pathways and transcription factors involved in the cellular response to UV-irradiation. Increasing experimental data supporting a role for p38, MAPK, JNK, ERK1/2, and ATM kinases in the response network to UV exposure is discussed. We also reviewed the participation of NF-κB, AP-1, and NRF2 transcription factors in the control of gene expression after UV-irradiation. In addition, we discussed the promising chemotherapeutic intervention of transcription factors signaling by natural compounds. Finally, we focused on the review of data emerging from the use of DNA microarray technology to determine changes in global gene expression in keratinocytes and melanocytes in response to UV treatment. Efforts to obtain a comprehensive portrait of the transcriptional events regulating photodamage of intact human epidermis after UV exposure reveals the existence of novel factors participating in UV-induced cell death. Progress in understanding the multitude of mechanisms induced by UV-irradiation could lead to the potential use of protein kinases and novel proteins as specific targets for the prevention and control of skin cancer.

  16. The Influence of Autonomic Dysfunction Associated with Aging and Type 2 Diabetes on Daily Life Activities

    Directory of Open Access Journals (Sweden)

    Jerrold Petrofsky

    2012-01-01

    Full Text Available Type 2 diabetes (T2D and ageing have well documented effects on every organ in the body. In T2D the autonomic nervous system is impaired due to damage to neurons, sensory receptors, synapses and the blood vessels. This paper will concentrate on how autonomic impairment alters normal daily activities. Impairments include the response of the blood vessels to heat, sweating, heat transfer, whole body heating, orthostatic intolerance, balance, and gait. Because diabetes is more prevalent in older individuals, the effects of ageing will be examined. Beginning with endothelial dysfunction, blood vessels have impairment in their ability to vasodilate. With this and synaptic damage, the autonomic nervous system cannot compensate for effectors such as pressure on and heating of the skin. This and reduced ability of the heart to respond to stress, reduces autonomic orthostatic compensation. Diminished sweating causes the skin and core temperature to be high during whole body heating. Impaired orthostatic tolerance, impaired vision and vestibular sensing, causes poor balance and impaired gait. Overall, people with T2D must be made aware and counseled relative to the potential consequence of these impairments.

  17. Real-time Needle Steering in Response to Rolling Vein Deformation by a 9-DOF Image-Guided Autonomous Venipuncture Robot

    Science.gov (United States)

    Chen, Alvin I.; Balter, Max L.; Maguire, Timothy J.; Yarmush, Martin L.

    2015-01-01

    Venipuncture is the most common invasive medical procedure performed in the United States and the number one cause of hospital injury. Failure rates are particularly high in pediatric and elderly patients, whose veins tend to deform, move, or roll as the needle is introduced. To improve venipuncture accuracy in challenging patient populations, we have developed a portable device that autonomously servos a needle into a suitable vein under image guidance. The device operates in real time, combining near-infrared and ultrasound imaging, computer vision software, and a 9 degrees-of-freedom robot that servos the needle. In this paper, we present the kinematic and mechanical design of the latest generation robot. We then investigate in silico and in vitro the mechanics of vessel rolling and deformation in response to needle insertions performed by the robot. Finally, we demonstrate how the robot can make real-time adjustments under ultrasound image guidance to compensate for subtle vessel motions during venipuncture. PMID:26779381

  18. Cutaneous autonomic denervation in Parkinson's disease.

    Science.gov (United States)

    Navarro-Otano, Judith; Casanova-Mollà, Jordi; Morales, Merche; Valls-Solé, Josep; Tolosa, Eduard

    2015-08-01

    Numerous studies have detailed involvement of the peripheral autonomic nervous system (PANS) in Parkinson's disease (PD). We assessed autonomic innervation of dermal annexes through quantitative fluorescence measurement from skin obtained via punch biopsies at distal leg region in PD and control subjects. We defined a ratio between the area corresponding to protein gen product (PGP) immunoreactivity and the area corresponding to blood vessel or sweat gland as a quantitative measure of autonomic innervation. Presence of alpha-synuclein (AS) deposits in dermis and hypodermis was also assessed by immunohistochemistry. Skin biopsies form six PD patients and six healthy controls were studied. Autonomic innervation scores were lower in PD than in controls in both blood vessels and sweat glands. No AS or phosphorylated AS (pAS) immunoreactivity was detected in dermis or hypodermis in any of the studied subjects. The results of this investigation suggest that autonomic innervation of dermal annexes in living patients with PD is reduced compared to controls. AS or pAS deposits were not found in dermis or hypodermis suggesting that distal leg skin study is not useful for in vivo detection of AS in PD.

  19. Resting cerebral metabolism correlates with skin conductance and functional brain activation during fear conditioning.

    Science.gov (United States)

    Linnman, Clas; Zeidan, Mohamed A; Pitman, Roger K; Milad, Mohammed R

    2012-02-01

    We investigated whether resting brain metabolism can be used to predict autonomic and neuronal responses during fear conditioning in 20 healthy humans. Regional cerebral metabolic rate for glucose was measured via positron emission tomography at rest. During conditioning, autonomic responses were measured via skin conductance, and blood oxygen level dependent signal was measured via functional magnetic resonance imaging. Resting dorsal anterior cingulate metabolism positively predicted differentially conditioned skin conductance responses. Midbrain and insula resting metabolism negatively predicted midbrain and insula functional reactivity, while dorsal anterior cingulate resting metabolism positively predicted midbrain functional reactivity. We conclude that resting metabolism in limbic areas can predict some aspects of psychophysiological and neuronal reactivity during fear learning. PMID:22207247

  20. Infrared sensing based sensitive skin

    Institute of Scientific and Technical Information of China (English)

    CAO Zheng-cai; FU Yi-li; WANG Shu-guo; JIN Bao

    2006-01-01

    Developed robotics sensitive skin is a modularized, flexible, mini-type array of infrared sensors with data processing capabilities, which can be used to cover the body of a robot. Depending on the infrared sensors and periphery processing circuit, robotics sensitive skin can in real-time provide existence and distance information about obstacles for robots within sensory areas. The methodology of designing sensitive skin and the algorithm of a mass of IR data fusion are presented. The experimental results show that the multi-joint robot with this sensitive skin can work autonomously in an unknown environment.

  1. Skin-Specific Unsaturated Fatty Acids Boost the Staphylococcus aureus Innate Immune Response.

    Science.gov (United States)

    Nguyen, Minh Thu; Hanzelmann, Dennis; Härtner, Thomas; Peschel, Andreas; Götz, Friedrich

    2016-01-01

    Antimicrobial fatty acids (AFAs) protect the human epidermis against invasion by pathogenic bacteria. In this study, we questioned whether human skin fatty acids (FAs) can be incorporated into the lipid moiety of lipoproteins and whether such incorporation would have an impact on innate immune stimulation in the model organism Staphylococcus aureus USA300 JE2. This organism synthesized only saturated FAs. However, when feeding USA300 with unsaturated FAs present on human skin (C16:1, C18:1, or C18:2), those were taken up, elongated stepwise by two carbon units, and finally found in the bacterial (phospho)lipid fraction. They were also observed in the lipid moiety of lipoproteins. When USA300 JE2 was fed with the unsaturated FAs, the cells and cell lysates showed an increased innate immune activation with various immune cells and peripheral blood mononuclear cells (PBMCs). Immune activation was highest with linoleic acid (C18:2). There are several pieces of evidence that the enhanced immune stimulating effect was due to the incorporation of unsaturated FAs in lipoproteins. First, the enhanced stimulation was dependent on Toll-like receptor 2 (TLR2). Second, an lgt mutant, unable to carry out lipidation of prolipoproteins, was unable to carry out immune stimulation when fed with unsaturated FAs. Third, the supplied FAs did not significantly affect growth, protein release, or expression of the model lipoprotein Lpl1. Although S. aureus is unable to synthesize unsaturated FAs, it incorporates long-chain unsaturated FAs into its lipoproteins, with the effect that the cells are better recognized by the innate immune system. This is an additional mechanism how our skin controls bacterial colonization and infection. PMID:26502910

  2. Augmented supraorbital skin sympathetic nerve activity responses to symptom trigger events in rosacea patients.

    Science.gov (United States)

    Metzler-Wilson, Kristen; Toma, Kumika; Sammons, Dawn L; Mann, Sarah; Jurovcik, Andrew J; Demidova, Olga; Wilson, Thad E

    2015-09-01

    Facial flushing in rosacea is often induced by trigger events. However, trigger causation mechanisms are currently unclear. This study tested the central hypothesis that rosacea causes sympathetic and axon reflex-mediated alterations resulting in trigger-induced symptomatology. Twenty rosacea patients and age/sex-matched controls participated in one or a combination of symptom triggering stressors. In protocol 1, forehead skin sympathetic nerve activity (SSNA; supraorbital microneurography) was measured during sympathoexcitatory mental (2-min serial subtraction of novel numbers) and physical (2-min isometric handgrip) stress. In protocol 2, forehead skin blood flow (laser-Doppler flowmetry) and transepithelial water loss/sweat rate (capacitance hygrometry) were measured during sympathoexcitatory heat stress (whole body heating by perfusing 50°C water through a tube-lined suit). In protocol 3, cheek, forehead, forearm, and palm skin blood flow were measured during nonpainful local heating to induce axon reflex vasodilation. Heart rate (HR) and mean arterial pressure (MAP) were recorded via finger photoplethysmography to calculate cutaneous vascular conductance (CVC; flux·100/MAP). Higher patient transepithelial water loss was observed (rosacea 0.20 ± 0.02 vs. control 0.10 ± 0.01 mg·cm(-2)·min(-1), P MAP changes were not different between groups during sympathoexcitatory stressors or local heating. SSNA during early mental (32 ± 9 and 9 ± 4% increase) and physical (25 ± 4 and 5 ± 1% increase, rosacea and controls, respectively) stress was augmented in rosacea (both P < 0.05). Heat stress induced more rapid sweating and cutaneous vasodilation onset in rosacea compared with controls. No axon reflex vasodilation differences were observed between groups. These data indicate that rosacea affects SSNA and that hyperresponsiveness to trigger events appears to have a sympathetic component. PMID:26133800

  3. Severity of gambling problems modulates autonomic reactions to near outcomes in gambling.

    Science.gov (United States)

    Ulrich, Natalie; Ambach, Wolfgang; Hewig, Johannes

    2016-09-01

    Outcomes in gambling games cannot only be classified based on their valence (wins and misses) but also based on their closeness (near and full outcomes). The present study investigated autonomic responses (phasic heart period changes and skin conductance responses) to near and full outcomes on a wheel of fortune in a sample of males with different degrees of gambling problems. Near relative to full outcomes elicited increased interbeat intervals shortly after outcome presentation. Furthermore, participants with more severe gambling problems showed increased skin conductance responses following near relative to full outcomes as well as relatively smaller interbeat interval responses to near relative to full misses. The findings confirm different processing of near compared to full outcomes and altered processing of gambling outcomes with increasing severity of gambling problems.

  4. Altered Cortical Responsiveness to Pain Stimuli after High Frequency Electrical Stimulation of the Skin in Patients with Persistent Pain after Inguinal Hernia Repair

    OpenAIRE

    Broeke, E.N. van den; Koeslag, L.; Arendsen, L.J.; Nienhuijs, S.W.; Rosman, C.; van Rijn, C.M.

    2013-01-01

    Background High Frequency electrical Stimulation (HFS) of the skin induces enhanced brain responsiveness expressed as enhanced Event-Related Potential (ERP) N1 amplitude to stimuli applied to the surrounding unconditioned skin in healthy volunteers. The aim of the present study was to investigate whether this enhanced ERP N1 amplitude could be a potential marker for altered cortical sensory processing in patients with persistent pain after surgery. Materials and Methods Nineteen male patients...

  5. Altered Cortical Responsiveness to Pain Stimuli after High Frequency Electrical Stimulation of the Skin in Patients with Persistent Pain after Inguinal Hernia Repair

    OpenAIRE

    van den Broeke, Emanuel N; Lonneke Koeslag; Arendsen, Laura J.; Nienhuijs, Simon W; Camiel Rosman; van Rijn, Clementina M.; Oliver H G Wilder-Smith; Harry van Goor

    2013-01-01

    BACKGROUND: High Frequency electrical Stimulation (HFS) of the skin induces enhanced brain responsiveness expressed as enhanced Event-Related Potential (ERP) N1 amplitude to stimuli applied to the surrounding unconditioned skin in healthy volunteers. The aim of the present study was to investigate whether this enhanced ERP N1 amplitude could be a potential marker for altered cortical sensory processing in patients with persistent pain after surgery. MATERIALS AND METHODS: Nineteen male patien...

  6. Acute Activation of Oxidative Pentose Phosphate Pathway as First-Line Response to Oxidative Stress in Human Skin Cells.

    Science.gov (United States)

    Kuehne, Andreas; Emmert, Hila; Soehle, Joern; Winnefeld, Marc; Fischer, Frank; Wenck, Horst; Gallinat, Stefan; Terstegen, Lara; Lucius, Ralph; Hildebrand, Janosch; Zamboni, Nicola

    2015-08-01

    Integrity of human skin is endangered by exposure to UV irradiation and chemical stressors, which can provoke a toxic production of reactive oxygen species (ROS) and oxidative damage. Since oxidation of proteins and metabolites occurs virtually instantaneously, immediate cellular countermeasures are pivotal to mitigate the negative implications of acute oxidative stress. We investigated the short-term metabolic response in human skin fibroblasts and keratinocytes to H2O2 and UV exposure. In time-resolved metabolomics experiments, we observed that within seconds after stress induction, glucose catabolism is routed to the oxidative pentose phosphate pathway (PPP) and nucleotide synthesis independent of previously postulated blocks in glycolysis (i.e., of GAPDH or PKM2). Through ultra-short (13)C labeling experiments, we provide evidence for multiple cycling of carbon backbones in the oxidative PPP, potentially maximizing NADPH reduction. The identified metabolic rerouting in oxidative and non-oxidative PPP has important physiological roles in stabilization of the redox balance and ROS clearance.

  7. Evaluation of the autonomic neuropathy function immediately after a change to upright posture using the impulse response function; Impulse oto kansu wo mochiita shisei henkan katoki ni okeru jiritsu shinkei kino hyoka

    Energy Technology Data Exchange (ETDEWEB)

    Yokoyama, K. [Nagoya City University, Nagoya (Japan); Moyoshi, M.; Takata, K. [Daido Institute of Technology, Nagoya (Japan); Watanabe, Y. [Toyota College of Technology, Aichi (Japan)

    1997-05-20

    Autonomic neuropathy function immediately after a change to upright posture has been evaluated by applying transient response function of the system to the blood regulation system. The impulse response function was determined from the change in heart rate before postural change to the upright posture, and was compared with the transient change immediately after a change to the upright posture. The time series of R-R interval of electrocardiogram was used as the time series of the change in heart rate. To determine the impulse response function, an autoregressive model was applied to the R-R interval time series. The impulse response function at the steady state is a transient reaction at the impulse stimulation added to the blood regulation system. The R-R interval decreases rapidly by the autonomic neuropathy reaction in which the blood is rapidly transferred into the legs immediately after a change to upright posture. There is a close correlation between the initial temporary decrease in R-R interval and the impulse response function derived from the change in heart rate immediately after a change to the upright posture. Accordingly, the blood regulation and autonomic neuropathy functions can be evaluated by the impulse response function without actual standing test and load of tested persons. 9 refs., 3 figs., 1 tab.

  8. The impact of psychosocial stress on healthy skin.

    Science.gov (United States)

    Hunter, H J A; Momen, S E; Kleyn, C E

    2015-07-01

    Dermatologists are only too aware of the significant role psychosocial stress plays in the exacerbation of skin disease; indeed, it is often the first precipitant patients mention when they attend outpatient clinics. Of late, research has focused on understanding the 'brain-skin' axis, a complex interplay between the nervous and immune systems and the skin. In particular, there is an evolving body of literature exploring the underlying pathophysiological mechanisms by which psychosocial stress influences skin homeostasis. This article provides a broad overview of the literature, emphasizing the importance of individual stress perception and summarizing the varied roles of the major cutaneous stress-response pathways. Both central [the hypothalamic-pituitary-adrenal (HPA) axis and the locus ceruleus-norepinephrine (LC-NE) sympathetic adrenomedullary system] and peripheral (the intracutaneous HPA axis and the release of mediators from peripheral sensory and autonomic nerves) pathways are discussed. Moreover, how activation of these pathways affects the skin's immune system, barrier function, wound healing and susceptibility to infection is reviewed. Although this field of research is rapidly expanding, several important questions remain unanswered, including: what is the precise role of mast cells in the cutaneous stress response?; what is the role of regulatory T-cells?; can therapeutic intervention be harnessed to prevent the stress-induced exacerbation of skin disease? It is anticipated that an improved understanding of the underlying mechanisms through which psychosocial stress affects the homeostasis of healthy skin will not only increase knowledge of the brain-skin axis but will also improve the holistic management of stress-responsive cutaneous disease.

  9. Morphologic Changes in Autonomic Nerves in Diabetic Autonomic Neuropathy

    Directory of Open Access Journals (Sweden)

    Heung Yong Jin

    2015-12-01

    Full Text Available Diabetic neuropathy is one of the major complications of diabetes, and it increases morbidity and mortality in patients with both type 1 diabetes mellitus (T1DM and type 2 diabetes mellitus (T2DM. Because the autonomic nervous system, for example, parasympathetic axons, has a diffuse and wide distribution, we do not know the morphological changes that occur in autonomic neural control and their exact mechanisms in diabetic patients with diabetic autonomic neuropathy (DAN. Although the prevalence of sympathetic and parasympathetic neuropathy is similar in T1DM versus T2DM patients, sympathetic nerve function correlates with parasympathetic neuropathy only in T1DM patients. The explanation for these discrepancies might be that parasympathetic nerve function was more severely affected among T2DM patients. As parasympathetic nerve damage seems to be more advanced than sympathetic nerve damage, it might be that parasympathetic neuropathy precedes sympathetic neuropathy in T2DM, which was Ewing's concept. This could be explained by the intrinsic morphologic difference. Therefore, the morphological changes in the sympathetic and parasympathetic nerves of involved organs in T1DM and T2DM patients who have DAN should be evaluated. In this review, evaluation methods for morphological changes in the epidermal nerves of skin, and the intrinsic nerves of the stomach will be discussed.

  10. Preparation of reactive oxygen scavenging peptides from tilapia (Oreochromis niloticus) skin gelatin: optimization using response surface methodology.

    Science.gov (United States)

    Zhuang, Yongliang; Sun, Liping

    2011-04-01

    Gelatin extracted from tilapia skin was hydrolyzed with Properase E. Response surface methodology (RSM) was applied to optimize the hydrolysis condition (temperature [T], enzyme-to-substrate ratio [E/S], pH and reaction time [t]), to obtain the hydrolysate with the highest hydroxyl radical (•OH) scavenging activity. The optimum conditions obtained were T of 44.2 °C, E/S of 2.2%, pH of 9.2, and t of 3.4 h. The predicted •OH scavenging activity of the hydrolysate under the optimum conditions was 60.7%, and the actually experimental scavenging activity was 60.8%. The hydrolysate was fractionated by ultrafiltration, and 4 fractions were collected. The fraction TSGH4 (MWindustries.

  11. Genetic covariance between psychopathic traits and anticipatory skin conductance responses to threat: Evidence for a potential endophenotype.

    Science.gov (United States)

    Wang, Pan; Gao, Yu; Isen, Joshua; Tuvblad, Catherine; Raine, Adrian; Baker, Laura A

    2015-11-01

    The genetic architecture of the association between psychopathic traits and reduced skin conductance responses (SCRs) is poorly understood. By using 752 twins aged 9-10 years, this study investigated the heritability of two SCR measures (anticipatory SCRs to impending aversive stimuli and unconditioned SCRs to the aversive stimuli themselves) in a countdown task. The study also investigated the genetic and environmental sources of the covariance between these SCR measures and two psychopathic personality traits: impulsive/disinhibited (reflecting impulsive-antisocial tendencies) and manipulative/deceitful (reflecting the affective-interpersonal features). For anticipatory SCRs, 27%, 14%, and 59% of the variation was due to genetic, shared environmental, and nonshared environmental effects, respectively, while the percentages for unconditioned SCRs were 44%, 2%, and 54%. The manipulative/deceitful (not impulsive/disinhibited) traits were negatively associated with both anticipatory SCRs (r = -.14, p psychopathic traits in males. PMID:26439076

  12. EFFECTS OF MONOSODIUM GLUTAMATE (UMAMI TASTE) WITH AND WITHOUT GUANOSINE 5'-MONOPHOSPHATE ON RAT AUTONOMIC RESPONSES TO MEALS

    NARCIS (Netherlands)

    STEFFENS, AB; LEUVENINK, H; SCHEURINK, AJW

    1994-01-01

    Monosodium glutamate (MSG) is used as a food additive to improve the taste of food. The effect of MSG on sweet taste is enhanced by guanosine 5'-monophosphate (GMP). Because increased palatability is known to increase the vagally mediated preabsorptive insulin response (PIR), we hypothesized that MS

  13. A Simple Autonomous Current-Sharing Control Strategy for Fast Dynamic Response of Parallel Inverters in Islanded Microgrids

    DEFF Research Database (Denmark)

    Guan, Yajuan; Vasquez, Juan Carlos; Guerrero, Josep M.

    2014-01-01

    This paper proposed a novel control strategy based on a virtual resistance and a phase locked loop for parallel three-phase inverters. The proposed controller can overcome the drawbacks of the conventional droop control such as slow transient response, complex design, and limited stability margins...

  14. Bilateral skin conductance, finger pulse volume, and EEG orienting response to tones of differing intensities in chronic schizophrenics and controls.

    Science.gov (United States)

    Bernstein, A S; Taylor, K W; Starkey, P; Juni, S; Lubowsky, J; Paley, H

    1981-08-01

    Skin conductance (SCOR), finger pulse volume (FPV-OR), and EEG orienting responses were examined to repeated tones of either 60- or 90-dB intensity in chronic schizophrenics, nonschizophrenic psychiatric patients, and normals. SCOR reaffirmed previous findings with schizophrenics displaying significantly more frequent nonresponsiveness to 60-dB tones, and faster habituation among patients who did respond. Increased stimulus intensity decreased the incidence of nonresponsiveness to the level of controls, but did not alter the rapid habituation of schizophrenics. These results generalized fully to the FPV-OR, despite the independence demonstrated between SCOR and FPV-OR, but did not generalize to EEG response. There were no significant differences between schizophrenics and controls in EEG reactivity-only in background activity, particularly in a slowing of dominant alpha frequency in schizophrenics. Schizophrenics displayed the same degree of bilateral asymmetry as controls in both SCOR and EEG; there was no evidence of a specifically schizophrenic asymmetry. Schizophrenics nonresponsive in either SCOR or FPV-OR showed significantly greater Conceptual Disorganization and Emotional Withdrawal, and significantly less Excitement than responders in blind clinical ratings on the Brief Psychiatric Rating Scale. None of the findings could be attributed to the effect of neuroleptics. Comparisons between medicated and nonmedicated patients showed no drug-associated effect on any OR variable under study. Drug effects were apparent only in skin conductance level (SCL). Neuroleptics were associated with a significant reduction in SCL in both schizophrenics and nonschizophrenics, together with a flattening of an otherwise incrementing SCL among schizophrenics.

  15. Autonomic Nervous System Disorders

    Science.gov (United States)

    Your autonomic nervous system is the part of your nervous system that controls involuntary actions, such as the beating of your heart ... breathing and swallowing Erectile dysfunction in men Autonomic nervous system disorders can occur alone or as the result ...

  16. Autoimmune Autonomic Ganglionopathy

    Science.gov (United States)

    ... Accessed 9/2/2015. Autoimmune Autonomic Ganglionopathy Summary. Dysautonomia International . http://www.dysautonomiainternational.org/page.php?ID= ... page Basic Information In Depth Information Basic Information Dysautonomia International offers an information page on Autoimmune autonomic ...

  17. Selective CD28 Antagonist Blunts Memory Immune Responses and Promotes Long-Term Control of Skin Inflammation in Nonhuman Primates.

    Science.gov (United States)

    Poirier, Nicolas; Chevalier, Melanie; Mary, Caroline; Hervouet, Jeremy; Minault, David; Baker, Paul; Ville, Simon; Le Bas-Bernardet, Stephanie; Dilek, Nahzli; Belarif, Lyssia; Cassagnau, Elisabeth; Scobie, Linda; Blancho, Gilles; Vanhove, Bernard

    2016-01-01

    Novel therapies that specifically target activation and expansion of pathogenic immune cell subsets responsible for autoimmune attacks are needed to confer long-term remission. Pathogenic cells in autoimmunity include memory T lymphocytes that are long-lived and present rapid recall effector functions with reduced activation requirements. Whereas the CD28 costimulation pathway predominantly controls priming of naive T cells and hence generation of adaptive memory cells, the roles of CD28 costimulation on established memory T lymphocytes and the recall of memory responses remain controversial. In contrast to CD80/86 antagonists (CTLA4-Ig), selective CD28 antagonists blunt T cell costimulation while sparing CTLA-4 and PD-L1-dependent coinhibitory signals. Using a new selective CD28 antagonist, we showed that Ag-specific reactivation of human memory T lymphocytes was prevented. Selective CD28 blockade controlled both cellular and humoral memory recall in nonhuman primates and induced long-term Ag-specific unresponsiveness in a memory T cell-mediated inflammatory skin model. No modification of memory T lymphocytes subsets or numbers was observed in the periphery, and importantly no significant reactivation of quiescent viruses was noticed. These findings indicate that pathogenic memory T cell responses are controlled by both CD28 and CTLA-4/PD-L1 cosignals in vivo and that selectively targeting CD28 would help to promote remission of autoimmune diseases and control chronic inflammation. PMID:26597009

  18. 皮肤细胞DNA光损伤后反应机制研究进展%Mechanisms underlying the response of skin cells to DNA photodamage

    Institute of Scientific and Technical Information of China (English)

    闵玮; 骆丹

    2011-01-01

    紫外线可引起皮肤细胞DNA损伤,诱发皮肤肿瘤和光老化.DNA损伤类型包括:DNA单链断裂、链间交联、核苷酸碱基修饰等.细胞拥有DNA损伤后反应机制以维持基因组稳定,如细胞周期监控点、DNA修复和细胞早衰等.细胞周期监控系统检测到染色体结构异常时将引起细胞周期停滞并启动修复进程;而在检测到无法修复的损伤时则会诱使细胞衰老.因此皮肤光老化也是一种预防肿瘤发生的防御机制,ATR-Chk1信号通路在其中起着关键的调控作用.%Ultraviolet radiation can induce DNA damage in skin cells, cause skin tumors and accelerate skin photoaging. UV-induced DNA damage in skin cells includes DNA single strand breaks, DNA interstrand cross-links and nucleotide base modifications. Skin cells could exert DNA damage responses, such as cell cycle checkpoints, DNA repair and premature senescence to prevent genomic instability. When cell cycle checkpoint systems sense the abnormal chromosomal DNA structures, they execute cell cycle arrest and DNA repair process will be initiated. Cellular senescence is also executed by checkpoint responses when unrepairble and extensive chromosomal abnormalities are detected. So skin photoaging is thought to be one of the major mechanisms against skin carcinogenesis. ATR-Chk1 signaling pathway plays a key role in the regulation of DNA damage response process.

  19. [Trigeminal autonomic cephalgias].

    Science.gov (United States)

    Maximova, M Yu; Piradov, M A; Suanova, E T; Sineva, N A

    2015-01-01

    Review of literature on the trigeminal autonomic cephalgias are presented. Trigeminal autonomic cephalgias are primary headaches with phenotype consisting of trigeminal pain with autonomic sign including lacrimation, rhinorrhea and miosis. Discussed are issues of classification, pathogenesis, clinical picture, diagnosis, differential diagnosis and treatment of this headache. Special attention is paid to cluster headache, paroxysmal hemicrania, SUNCT syndrome, hemicrania continua.

  20. Stratum corneum cytokines and skin irritation response to sodium lauryl sulfate

    NARCIS (Netherlands)

    C.M. de Jongh; M.M. Verberk; C.E.T. Withagen; J.J.L. Jacobs; T. Rustemeyer; S. Kezic

    2006-01-01

    Little is known about cytokines involved in chronic irritant contact dermatitis. Individual cytokine profiles might explain at least part of the differences in the individual response to irritation. Our objective was to investigate the relation between baseline stratum corneum (SC) cytokine levels a

  1. Effect of functional electrostimulation on impaired skin vasodilator responses to local heating in spinal cord injury.

    NARCIS (Netherlands)

    Duijnhoven, N.T.L. van; Janssen, T.W.; Green, D.J.; Minson, C.T.; Hopman, M.T.E.; Thijssen, D.H.J.

    2009-01-01

    Spinal cord injury (SCI) induces vascular adaptations below the level of the lesion, such as impaired cutaneous vasodilation. However, the mechanisms underlying these differences are unclear. The aim of this study is to examine arm and leg cutaneous vascular conductance (CVC) responses to local heat

  2. Autonomic contributions to empathy: evidence from patients with primary autonomic failure.

    Science.gov (United States)

    Chauhan, Bina; Mathias, Christopher J; Critchley, Hugo D

    2008-06-01

    Empathy for the emotions of others may require simulatory engagement of corresponding autonomic arousal states. We tested the hypothesis that disruption of autonomic control impairs the ability to empathize emotionally with others. Fifteen patients with primary autonomic failure showed attenuated scores on the Mehrabian Balanced Emotional Empathy Scale (BEES), compared to both younger and older controls. This effect was not accounted for by age, gender, mood state or functional disability. These early observations provide preliminary evidence for a direct contribution of autonomic responsivity to the 'higher-order' social cognitive process of empathy, and may inform the dynamics of supportive care.

  3. Cardiovascular autonomic neuropathy in the diabetic patients.

    Directory of Open Access Journals (Sweden)

    Maria Eugenia Niño Mantilla

    2007-11-01

    Full Text Available the dysfunction of the autonomic nervous system is a serious problem in diabetic patients. The cardiovacular autonomic neuropathy is the most important autonomic dysfuntion for it´s implication in the increasesof the mortality rate in diabetis patients. tis ethiopatogenesis is the result of a multifactorial process caused by chronic hyperglycemia, ending up in damage of the autonomic fibers thet innervate the heart and blood vessels, leading to dysfuntional hearth rate control and abnormal vascular dynamics. the associated clinical manifestations include orthotatic hypotension, excecise intolerance, intraoperative cardiovascular liability and silent myocardial ischemia. Being important its recognition, quantitative test to evaluate the cardiovascular funtion, to value its evolution and the effects of the treatment ahould be done, being the most used, the hearth rate response to standing test, and teh valsalva maneuver. the handling of this entity is done improving control of glucose blood levels its the most effective way to prevent the cardiovascular autonomic neuropathy in the diabetic patients.

  4. A single bout of exercise with a flexible pole induces significant cardiac autonomic responses in healthy men

    Directory of Open Access Journals (Sweden)

    Cristiane M. Ogata

    2014-09-01

    Full Text Available OBJECTIVES: Flexible poles can provide rapid eccentric and concentric muscle contractions. Muscle vibration is associated with a "tonic vibration reflex” that is stimulated by a sequence of rapid muscle stretching, activation of the muscle spindles and stimulation of a response that is similar to the myotatic reflex. Literature studies analyzing the acute cardiovascular responses to different exercises performed with this instrument are lacking. We investigated the acute effects of exercise with flexible poles on the heart period in healthy men. METHOD: The study was performed on ten young adult males between 18 and 25 years old. We evaluated the heart rate variability in the time and frequency domains. The subjects remained at rest for 10 min. After the rest period, the volunteers performed the exercises with the flexible poles. Immediately after the exercise protocol, the volunteers remained seated at rest for 30 min and their heart rate variability was analyzed. RESULTS: The pNN50 was reduced at 5-10 and 15-20 min after exercise compared to 25-30 min after exercise (p = 0.0019, the SDNN was increased at 25-30 min after exercise compared to at rest and 0-10 min after exercise (p = 0.0073 and the RMSSD was increased at 25-30 min after exercise compared to 5-15 min after exercise (p = 0.0043. The LF in absolute units was increased at 25-30 min after exercise compared to 5-20 min after exercise (p = 0.0184. CONCLUSION: A single bout of exercise with a flexible pole reduced the heart rate variability and parasympathetic recovery was observed approximately 30 min after exercise.

  5. Aging Skin

    Science.gov (United States)

    ... email address Submit Home > Healthy Aging > Wellness Healthy Aging Aging skin More information on aging skin When it ... treated early. Return to top More information on Aging skin Read more from womenshealth.gov Varicose Veins ...

  6. Skin Conditions

    Science.gov (United States)

    Your skin is your body's largest organ. It covers and protects your body. Your skin Holds body fluids in, preventing dehydration Keeps harmful ... it Anything that irritates, clogs, or inflames your skin can cause symptoms such as redness, swelling, burning, ...

  7. Deep tissue injury in development of pressure ulcers: a decrease of inflammasome activation and changes in human skin morphology in response to aging and mechanical load.

    Directory of Open Access Journals (Sweden)

    Olivera Stojadinovic

    Full Text Available Molecular mechanisms leading to pressure ulcer development are scarce in spite of high mortality of patients. Development of pressure ulcers that is initially observed as deep tissue injury is multifactorial. We postulate that biomechanical forces and inflammasome activation, together with ischemia and aging, may play a role in pressure ulcer development. To test this we used a newly-developed bio-mechanical model in which ischemic young and aged human skin was subjected to a constant physiological compressive stress (load of 300 kPa (determined by pressure plate analyses of a person in a reclining position for 0.5-4 hours. Collagen orientation was assessed using polarized light, whereas inflammasome proteins were quantified by immunoblotting. Loaded skin showed marked changes in morphology and NLRP3 inflammasome protein expression. Sub-epidermal separations and altered orientation of collagen fibers were observed in aged skin at earlier time points. Aged skin showed significant decreases in the levels of NLRP3 inflammasome proteins. Loading did not alter NLRP3 inflammasome proteins expression in aged skin, whereas it significantly increased their levels in young skin. We conclude that aging contributes to rapid morphological changes and decrease in inflammasome proteins in response to tissue damage, suggesting that a decline in the innate inflammatory response in elderly skin could contribute to pressure ulcer pathogenesis. Observed morphological changes suggest that tissue damage upon loading may not be entirely preventable. Furthermore, newly developed model described here may be very useful in understanding the mechanisms of deep tissue injury that may lead towards development of pressure ulcers.

  8. Th17 and regulatory T cells contribute to the in situ immune response in skin lesions of Jorge Lobo's disease.

    Science.gov (United States)

    Kanashiro-Galo, Luciane; Pagliari, Carla; Barboza, Tania Cristina; de Brito, Arival Cardoso; Xavier, Marilia Brasil; de Oliveira, Clivia Maria Moraes; Unger, Deborah Aben Athar; Sotto, Mirian Nacagami; Quaresma, Juarez Antonio Simões; Duarte, Maria Irma Seixas

    2016-01-01

    Jorge Lobo's disease (JLD) is a chronic granulomatous mycosis described in various Latin American countries. The main objective of the present study was to investigate the possible role of Th17 and Foxp3+ Treg cells in the pathogenesis of Jorge Lobo's disease. Human skin biopsies were submitted to an immunohistochemistry protocol to detect Foxp3, interleukin (IL)-1beta, CD25, IL-6, IL-17, and IL-23. The epidermis presented acanthosis, hyperkeratosis, and frequent presence of fungi. The dermis presented inflammatory infiltrate comprising macrophages, lymphocytes, epithelioid and multinucleated cells, and an intense number of fungi. Foxp3+ Treg cells and IL-17+ cells were visualized in lymphocytes in the inflammatory infiltrate. IL-1, IL-2R (CD25), IL-6, and IL-23 were visualized in the dermis, intermingled with fungal cells, permeating or participating of the granuloma. Following IL-17, the most prominent cytokine was IL-6. IL-23 and cells expressing CD25 were present in fewer number. The comparative analysis between IL-17 and Foxp3 demonstrated a statistically significant increased number of IL-17+ cells. Th17 cells play a role in the immune response of JLD. IL-1beta and IL-6 added to the previously described increased number of TGF-beta would stimulate such pattern of response. Th17 cells could be present as an effort to modulate the local immune response; however, high levels of a Th17 profile could overcome the role of Treg cells. The unbalance between Treg/Th17 cells seems to corroborate with the less effective immune response against the fungus.

  9. Arsenic transformation predisposes human skin keratinocytes to UV-induced DNA damage yet enhances their survival apparently by diminishing oxidant response

    International Nuclear Information System (INIS)

    Inorganic arsenic and UV, both human skin carcinogens, may act together as skin co-carcinogens. We find human skin keratinocytes (HaCaT cells) are malignantly transformed by low-level arsenite (100 nM, 30 weeks; termed As-TM cells) and with transformation concurrently undergo full adaptation to arsenic toxicity involving reduced apoptosis and oxidative stress response to high arsenite concentrations. Oxidative DNA damage (ODD) is a possible mechanism in arsenic carcinogenesis and a hallmark of UV-induced skin cancer. In the current work, inorganic arsenite exposure (100 nM) did not induce ODD during the 30 weeks required for malignant transformation. Although acute UV-treatment (UVA, 25 J/cm2) increased ODD in passage-matched control cells, once transformed by arsenic to As-TM cells, acute UV actually further increased ODD (> 50%). Despite enhanced ODD, As-TM cells were resistant to UV-induced apoptosis. The response of apoptotic factors and oxidative stress genes was strongly mitigated in As-TM cells after UV exposure including increased Bcl2/Bax ratio and reduced Caspase-3, Nrf2, and Keap1 expression. Several Nrf2-related genes (HO-1, GCLs, SOD) showed diminished responses in As-TM cells after UV exposure consistent with reduced oxidant stress response. UV-exposed As-TM cells showed increased expression of cyclin D1 (proliferation gene) and decreased p16 (tumor suppressor). UV exposure enhanced the malignant phenotype of As-TM cells. Thus, the co-carcinogenicity between UV and arsenic in skin cancer might involve adaptation to chronic arsenic exposure generally mitigating the oxidative stress response, allowing apoptotic by-pass after UV and enhanced cell survival even in the face of increased UV-induced oxidative stress and increased ODD. - Highlights: → Arsenic transformation adapted to UV-induced apoptosis. → Arsenic transformation diminished oxidant response. → Arsenic transformation enhanced UV-induced DNA damage.

  10. Inflammatory response, parasite load and AgNOR expression in ear skin of symptomatic and asymptomatic Leishmania (Leishmania chagasi infected dogs

    Directory of Open Access Journals (Sweden)

    Verçosa BLA

    2011-01-01

    Full Text Available The skin has an important role in the transmission of visceral leishmaniasis (VL as the infection pathway in dogs. To better characterize the inflammatory response of intact skin in VL, sixty infected dogs (30 symptomatic and 30 asymptomatic and six non-infected controls were studied. Diagnosis of visceral leishmaniasis was confirmed by RIFI and ELISA; direct visualization of the parasite in bone marrow aspirate; imprints of popliteal lymph nodes, spleen, liver and skin; culture in NNN-phase liquid Schneider's medium; and PCR (performed only in the ear skin. Amastigote forms of the parasite in intact skin were found only in symptomatic dogs. Inflammatory infiltrates were observed in all groups, varying from intense and/or moderate in symptomatic to discrete and/or negligible in asymptomatic and control animals. Parasite load was associated with the intensity of the inflammatory response and with clinical manifestations in canine visceral leishmaniasis. AgNOr as active transcription markers were expressed in inflammatory cells and within apoptotic bodies in all groups, including controls, with no statistical difference. Therefore, cell activation and transcription do occur in both symptomatic and asymptomatic canine visceral leishmaniasis and may result in more necrosis and inflammation or in apoptosis and less symptoms, depending on the parasite load.

  11. Autonomous Mission Operations Roadmap

    Science.gov (United States)

    Frank, Jeremy David

    2014-01-01

    As light time delays increase, the number of such situations in which crew autonomy is the best way to conduct the mission is expected to increase. However, there are significant open questions regarding which functions to allocate to ground and crew as the time delays increase. In situations where the ideal solution is to allocate responsibility to the crew and the vehicle, a second question arises: should the activity be the responsibility of the crew or an automated vehicle function? More specifically, we must answer the following questions: What aspects of mission operation responsibilities (Plan, Train, Fly) should be allocated to ground based or vehicle based planning, monitoring, and control in the presence of significant light-time delay between the vehicle and the Earth?How should the allocated ground based planning, monitoring, and control be distributed across the flight control team and ground system automation? How should the allocated vehicle based planning, monitoring, and control be distributed between the flight crew and onboard system automation?When during the mission should responsibility shift from flight control team to crew or from crew to vehicle, and what should the process of shifting responsibility be as the mission progresses? NASA is developing a roadmap of capabilities for Autonomous Mission Operations for human spaceflight. This presentation will describe the current state of development of this roadmap, with specific attention to in-space inspection tasks that crews might perform with minimum assistance from the ground.

  12. Nordihydroguaiaretic Acid from Creosote Bush (Larrea tridentata Mitigates 12-O-Tetradecanoylphorbol-13-Acetate-Induced Inflammatory and Oxidative Stress Responses of Tumor Promotion Cascade in Mouse Skin

    Directory of Open Access Journals (Sweden)

    Shakilur Rahman

    2011-01-01

    Full Text Available Nordihydroguaiaretic acid (NDGA is a phenolic antioxidant found in the leaves and twigs of the evergreen desert shrub, Larrea tridentata (Sesse and Moc. ex DC Coville (creosote bush. It has a long history of traditional medicinal use by the Native Americans and Mexicans. The modulatory effects of topically applied NDGA was studied on acute inflammatory and oxidative stress responses in mouse skin induced by stage I tumor promoting agent, 12-O-tetradecanoylphorbol-13-acetate (TPA. Double TPA treatment adversely altered many of the marker responses of stage I skin tumor promotion cascade. Pretreatment of NDGA in TPA-treated mice mitigated cutaneous lipid peroxidation and inhibited production of hydrogen peroxide. NDGA treatment also restored reduced glutathione level and activities of antioxidant enzymes. Elevated activities of myeloperoxidase, xanthine oxidase and skin edema formation in TPA-treated mice were also lowered by NDGA indicating a restrained inflammatory response. Furthermore, results of histological study demonstrated inhibitory effect of NDGA on cellular inflammatory responses. This study provides a direct evidence of antioxidative and anti-inflammatory properties of NDGA against TPA-induced cutaneous inflammation and oxidative stress corroborating its chemopreventive potential against skin cancer.

  13. Potent response of QS-21 as a vaccine adjuvant in the skin when delivered with the Nanopatch, resulted in adjuvant dose sparing.

    Science.gov (United States)

    Ng, Hwee-Ing; Fernando, Germain J P; Depelsenaire, Alexandra C I; Kendall, Mark A F

    2016-01-01

    Adjuvants play a key role in boosting immunogenicity of vaccines, particularly for subunit protein vaccines. In this study we investigated the induction of antibody response against trivalent influenza subunit protein antigen and a saponin adjuvant, QS-21. Clinical trials of QS-21 have demonstrated the safety but, also a need of high dose for optimal immunity, which could possibly reduce patient acceptability. Here, we proposed the use of a skin delivery technology - the Nanopatch - to reduce both adjuvant and antigen dose but also retain its immune stimulating effects when compared to the conventional needle and syringe intramuscular (IM) delivery. We have demonstrated that Nanopatch delivery to skin requires only 1/100(th) of the IM antigen dose to induce equivalent humoral response. QS-21 enhanced humoral response in both skin and muscle route. Additionally, Nanopatch has demonstrated 30-fold adjuvant QS-21 dose sparing while retaining immune stimulating effects compared to IM. QS-21 induced localised, controlled cell death in the skin, suggesting that the danger signals released from dead cells contributed to the enhanced immunogenicity. Taken together, these findings demonstrated the suitability of reduced dose of QS-21 and the antigen using the Nanopatch to enhance humoral responses, and the potential to increase patient acceptability of QS-21 adjuvant. PMID:27404789

  14. Relationship between Sympathetic Skin Responses and Auditory Hypersensitivity to Different Auditory Stimuli.

    Science.gov (United States)

    Kato, Fumi; Iwanaga, Ryoichiro; Chono, Mami; Fujihara, Saori; Tokunaga, Akiko; Murata, Jun; Tanaka, Koji; Nakane, Hideyuki; Tanaka, Goro

    2014-07-01

    [Purpose] Auditory hypersensitivity has been widely reported in patients with autism spectrum disorders. However, the neurological background of auditory hypersensitivity is currently not clear. The present study examined the relationship between sympathetic nervous system responses and auditory hypersensitivity induced by different types of auditory stimuli. [Methods] We exposed 20 healthy young adults to six different types of auditory stimuli. The amounts of palmar sweating resulting from the auditory stimuli were compared between groups with (hypersensitive) and without (non-hypersensitive) auditory hypersensitivity. [Results] Although no group × type of stimulus × first stimulus interaction was observed for the extent of reaction, significant type of stimulus × first stimulus interaction was noted for the extent of reaction. For an 80 dB-6,000 Hz stimulus, the trends for palmar sweating differed between the groups. For the first stimulus, the variance became larger in the hypersensitive group than in the non-hypersensitive group. [Conclusion] Subjects who regularly felt excessive reactions to auditory stimuli tended to have excessive sympathetic responses to repeated loud noises compared with subjects who did not feel excessive reactions. People with auditory hypersensitivity may be classified into several subtypes depending on their reaction patterns to auditory stimuli.

  15. Inter-subject, inter-ocular and inter-session repeatability of the photopic negative response of the electroretinogram recorded using DTL and skin electrodes.

    Science.gov (United States)

    Mortlock, Katharine E; Binns, Alison M; Aldebasi, Yousef H; North, Rachel V

    2010-10-01

    The photopic negative response (PhNR) has attracted interest as a flash ERG component reflecting inner retinal activity, with investigators adopting various approaches to analysing the response. This study has two principal aims: first to determine the most reliable technique for assessing the PhNR amplitude; secondly to compare the repeatability characteristics of the PhNR recorded using DTL and skin active electrodes. Electroretinograms were recorded in 31 subjects, using both electrode types, in response to a Ganzfeld red stimulus (Lee filter "bright red"; 1.76 log phot td.s; 4 Hz) presented over a steady blue background (Schott glass filter BG28; 3.9 log scot td). Sixteen subjects returned to assess repeatability. PhNR amplitude was measured from b-wave peak-to-PhNR trough, pre-stimulus baseline to trough, and from peak and baseline to a fixed time-point; a ratio of b-wave/PhNR amplitude was also calculated. Coefficients of variation (CoV), and inter-ocular and inter-session limits of agreement (LoA) were calculated for all measures. The ratio of b-wave/PhNR amplitude showed the lowest CoV (14.3% DTL; 23.2% skin), inter-ocular LoA (22.2% DTL; 25.0% skin), and inter-session LoA (22.8% DTL; 20.3% skin). The peak-to-trough and peak-to-fixed-time measurements were also consistently reliable. Least reliable measures were those measured from baseline. While skin electrode responses were significantly smaller than DTL responses (P DTL electrodes for recording the PhNR.

  16. Increased skin conductance responses and neural activity during fear conditioning are associated with a repressive coping style

    Directory of Open Access Journals (Sweden)

    Tim eKlucken

    2015-06-01

    Full Text Available The investigation of individual differences in coping styles in response to fear conditioning is an important issue for a better understanding of the etiology and treatment of psychiatric disorders. It has been assumed that an avoidant (repressive coping style is characterized by increased emotion regulation efforts in context of fearful stimuli as compared to a more vigilant coping style. However, no study so far has investigated the neural correlates of fear conditioning of repressors and sensitizers.In the present fMRI study, 76 participants were classified as repressors or as sensitizers and were exposed to a fear conditioning paradigm, in which the CS+ predicted electrical stimulation, while another neutral stimulus (CS- did not. In addition, skin conductance responses (SCRs were measured continuously.As the main findings, we found increased neural activations in repressors as compared to sensitizers in the ventromedial prefrontal cortex and the anterior cingulate cortex during fear conditioning. In addition, elevated activity to the CS+ in amygdala, insula, occipital, and orbitofrontal cortex as well as conditioned SCRs were found in repressors.The present results demonstrate increased neural activations in structures linked to emotion down-regulation mechanisms like the ventromedial prefrontal cortex, which may reflect the increased coping effort in repressors. At the same time, repressors showed increased activations in arousal and evaluation-associated structures like the amygdala, the occipital cortex, and the orbitofrontal cortex, which is also mirrored in increased SCRs. The present results support recent assumptions about a two-process model of repression postulating a fast vigilant response to fearful stimuli, but also a second emotion down-regulating process.

  17. Tuberculin skin test reversion following isoniazid preventive therapy reflects diversity of immune response to primary Mycobacterium tuberculosis infection.

    Directory of Open Access Journals (Sweden)

    Denise F Johnson

    Full Text Available RATIONALE: Healthy household contacts (HHC of individuals with Tuberculosis (TB with Tuberculin Skin Test (TST conversions are considered to harbor latent Mycobacterium tuberculosis (Mtb, and at risk for TB. The immunologic, clinical, and public health implications of TST reversions that occur following Isoniazid preventive therapy (IPT remain controversial. OBJECTIVES: To measure frequency of TST reversion following IPT, and variation in interferon-gamma (IFN-γ responses to Mtb, in healthy Ugandan TB HHC with primary Mtb infection evidenced by TST conversion. METHODS: Prospective cohort study of healthy, HIV-uninfected, TST-negative TB HHC with TST conversions. Repeat TST was performed 12 months following conversion (3 months following completion of 9 month IPT course to assess for stable conversion vs. reversion. Whole blood IFN-γ responses to Mtb antigen 85B (MtbA85B and whole Mtb bacilli (wMtb were measured in a subset (n = 27 and n = 42, respectively at enrollment and TST conversion, prior to initiation of IPT. RESULTS: Of 122 subjects, TST reversion was noted in 25 (20.5%. There were no significant differences in demographic, clinical, or exposure variables between reverters and stable converters. At conversion, reverters had significantly smaller TST compared to stable converters (13.7 mm vs 16.4 mm, respectively; p = 0.003. At enrollment, there were no significant differences in IFN-γ responses to MtbA85B or wMTB between groups. At conversion, stable converters demonstrated significant increases in IFN-γ responses to Ag85B and wMtb compared to enrollment (p = 0.001, p<0.001, respectively, while there were no significant changes among reverters. CONCLUSIONS: TST reversion following IPT is common following primary Mtb infection and associated with unique patterns of Mtb-induced IFN-γ production. We have demonstrated that immune responses to primary Mtb infection are heterogeneous, and submit that prospective

  18. Influence of corticosteroids on chemotactic response and collagen metabolism of human skin fibroblasts.

    Science.gov (United States)

    Hein, R; Mauch, C; Hatamochi, A; Krieg, T

    1988-07-15

    Following chronic administration of corticosteroids in vivo, a number of complications occur, which mainly involve the metabolism of connective tissue cells. Therefore, several attempts have been made to develop corticosteroids, which show less pronounced side effects. Fibroblasts were kept in monolayer cultures and were exposed to corticosteroids demonstrating similar anti-inflammatory activity (prednicarbate, desoximetasone). Chemotaxis of fibroblasts was studied over 4 hr, protein and collagen synthesis were estimated using proteinchemical methods and also by dot blot hybridization. Corticosteroids used in a high dosage (10 microM) affected all biosynthetic capacities of the investigated fibroblasts. Protein synthesis and production of collagen types I and III were reduced and a similar decrease of mRNA levels for collagen type I could be found indicating an influence on the pretranslational control. In the same concentrations desoximetasone was much more active than prednicarbate. Fibroblast migration was dosage dependently inhibited from 10(-9) M to 10(-5) M for desoximetasone, while incubation with prednicarbate did not cause a reduction of the chemotactic response at concentrations lower than 10(-7) M. These data suggest that modifications of corticosteroids might result in a dissociation of some of their biological activities and can specifically influence their effects on biosynthetic capacities of fibroblasts. PMID:3395353

  19. Chronic stress induces a hyporeactivity of the autonomic nervous system in response to acute mental stressor and impairs cognitive performance in business executives.

    Science.gov (United States)

    Teixeira, Renata Roland; Díaz, Miguel Mauricio; Santos, Tatiane Vanessa da Silva; Bernardes, Jean Tofoles Martins; Peixoto, Leonardo Gomes; Bocanegra, Olga Lucia; Neto, Morun Bernardino; Espindola, Foued Salmen

    2015-01-01

    The present study examined the incidence of chronic stress in business executives (109 subjects: 75 male and 34 female) and its relationship with cortisol levels, cognitive performance, and autonomic nervous system (ANS) reactivity after an acute mental stressor. Blood samples were collected from the subjects to measure cortisol concentration. After the sample collection, the subjects completed the Lipp Inventory of Stress Symptoms for Adults and the Stroop Color-Word Test to evaluate stress and cognitive performance levels, respectively. Saliva samples were collected prior to, immediately after, and five minutes after the test. The results revealed that 90.1% of the stressed subjects experienced stress phases that are considered chronic stress. At rest, the subjects with chronic stress showed higher cortisol levels, and no gender differences were observed. No differences were found between the stressed and non-stressed subjects regarding salivary amylase activity prior to test. Chronic stress also impaired performance on the Stroop test, which revealed higher rates of error and longer reaction times in the incongruent stimulus task independently of gender. For the congruent stimulus task of the Stroop test, the stressed males presented a higher rate of errors than the non-stressed males and a longer reaction time than the stressed females. After the acute mental stressor, the non-stressed male group showed an increase in salivary alpha-amylase activity, which returned to the initial values five minutes after the test; this ANS reactivity was not observed in the chronically stressed male subjects. The ANS responses of the non-stressed vs stressed female groups were not different prior to or after the Stroop test. This study is the first to demonstrate a blunted reactivity of the ANS when male subjects with chronic psychological stress were subjected to an acute mental stressor, and this change could contribute to impairments in cognitive performance. PMID:25807003

  20. A comparison of autonomic responses in humans induced by two simulation models of weightlessness: lower body positive pressure and 6 degrees head-down tilt.

    Science.gov (United States)

    Fu, Q; Sugiyama, Y; Kamiya, A; Mano, T

    2000-04-12

    Six-degree head-down tilt (HDT) is well accepted as an effective weightlessness model in humans. However, some researchers utilized lower body positive pressure (LBPP) to simulate the cardiovascular and renal effects of a decreased gravitational stress. In order to determine whether LBPP was a suitable model for simulated weightlessness, we compared the differences between these two methods. Ten healthy males, aged 21-41 years, were subjected to graded LBPP at 10, 20 and 30 mmHg, as well as 6 degrees HDT. Muscle sympathetic nerve activity (MSNA) was microneurographically recorded from the tibial nerve along with cardiovascular variables. We found that MSNA decreased by 27% to a similar extent both at low levels of LBPP (10 and 20 mmHg) and HDT. However, at a high level of LBPP (30 mmHg), MSNA tended to increase. Mean arterial pressure was elevated significantly by 11% (10 mmHg) at 30 mmHg LBPP, but remained unchanged at low levels of LBPP and HDT. Heart rate did not change during the entire LBPP and HDT procedures. Total peripheral resistance markedly increased by 36% at 30 mmHg LBPP, but decreased by 9% at HDT. Both stroke volume and cardiac output tended to decrease at 30 mmHg LBPP, but increased at HDT. These results suggest that although both LBPP and HDT induce fluid shifts from the lower body toward the thoracic compartment, autonomic responses are different, especially at LBPP greater than 20 mmHg. We note that high levels of LBPP (>20 mmHg) activate not only cardiopulmonary and arterial baroreflexes, but also intramuscular mechanoreflexes, while 6 degrees HDT only activates cardiopulmonary baroreflexes. We conclude that LBPP is not a suitable model for simulated weightlessness in humans.

  1. Chronic stress induces a hyporeactivity of the autonomic nervous system in response to acute mental stressor and impairs cognitive performance in business executives.

    Directory of Open Access Journals (Sweden)

    Renata Roland Teixeira

    Full Text Available The present study examined the incidence of chronic stress in business executives (109 subjects: 75 male and 34 female and its relationship with cortisol levels, cognitive performance, and autonomic nervous system (ANS reactivity after an acute mental stressor. Blood samples were collected from the subjects to measure cortisol concentration. After the sample collection, the subjects completed the Lipp Inventory of Stress Symptoms for Adults and the Stroop Color-Word Test to evaluate stress and cognitive performance levels, respectively. Saliva samples were collected prior to, immediately after, and five minutes after the test. The results revealed that 90.1% of the stressed subjects experienced stress phases that are considered chronic stress. At rest, the subjects with chronic stress showed higher cortisol levels, and no gender differences were observed. No differences were found between the stressed and non-stressed subjects regarding salivary amylase activity prior to test. Chronic stress also impaired performance on the Stroop test, which revealed higher rates of error and longer reaction times in the incongruent stimulus task independently of gender. For the congruent stimulus task of the Stroop test, the stressed males presented a higher rate of errors than the non-stressed males and a longer reaction time than the stressed females. After the acute mental stressor, the non-stressed male group showed an increase in salivary alpha-amylase activity, which returned to the initial values five minutes after the test; this ANS reactivity was not observed in the chronically stressed male subjects. The ANS responses of the non-stressed vs stressed female groups were not different prior to or after the Stroop test. This study is the first to demonstrate a blunted reactivity of the ANS when male subjects with chronic psychological stress were subjected to an acute mental stressor, and this change could contribute to impairments in cognitive

  2. Chronic stress induces a hyporeactivity of the autonomic nervous system in response to acute mental stressor and impairs cognitive performance in business executives.

    Science.gov (United States)

    Teixeira, Renata Roland; Díaz, Miguel Mauricio; Santos, Tatiane Vanessa da Silva; Bernardes, Jean Tofoles Martins; Peixoto, Leonardo Gomes; Bocanegra, Olga Lucia; Neto, Morun Bernardino; Espindola, Foued Salmen

    2015-01-01

    The present study examined the incidence of chronic stress in business executives (109 subjects: 75 male and 34 female) and its relationship with cortisol levels, cognitive performance, and autonomic nervous system (ANS) reactivity after an acute mental stressor. Blood samples were collected from the subjects to measure cortisol concentration. After the sample collection, the subjects completed the Lipp Inventory of Stress Symptoms for Adults and the Stroop Color-Word Test to evaluate stress and cognitive performance levels, respectively. Saliva samples were collected prior to, immediately after, and five minutes after the test. The results revealed that 90.1% of the stressed subjects experienced stress phases that are considered chronic stress. At rest, the subjects with chronic stress showed higher cortisol levels, and no gender differences were observed. No differences were found between the stressed and non-stressed subjects regarding salivary amylase activity prior to test. Chronic stress also impaired performance on the Stroop test, which revealed higher rates of error and longer reaction times in the incongruent stimulus task independently of gender. For the congruent stimulus task of the Stroop test, the stressed males presented a higher rate of errors than the non-stressed males and a longer reaction time than the stressed females. After the acute mental stressor, the non-stressed male group showed an increase in salivary alpha-amylase activity, which returned to the initial values five minutes after the test; this ANS reactivity was not observed in the chronically stressed male subjects. The ANS responses of the non-stressed vs stressed female groups were not different prior to or after the Stroop test. This study is the first to demonstrate a blunted reactivity of the ANS when male subjects with chronic psychological stress were subjected to an acute mental stressor, and this change could contribute to impairments in cognitive performance.

  3. DOES RESPONSE EVALUATION OF GENE EXPRESSION PROFILES IN THE SKIN OF K6/ODC MICE EXPOSED TO SODIUM ARSENITE

    Science.gov (United States)

    Abstract - Chronic drinking water exposure to inorganic arsenic and its metabolites increases tumor frequency in the skin of K6/ODC transgenic mice. To identify potential biomarkers and modes of action for this skin tumorigenicity, gene expression profiles were characterized fro...

  4. The autonomic phenotype of rumination.

    Science.gov (United States)

    Ottaviani, Cristina; Shapiro, David; Davydov, Dmitry M; Goldstein, Iris B; Mills, Paul J

    2009-06-01

    Recent studies suggest that ruminative thoughts may be mediators of the prolonged physiological effects of stress. We hypothesized that autonomic dysregulation plays a role in the relation between rumination and health. Rumination was induced by an anger-recall task in 45 healthy subjects. Heart rate variability (HRV), baroreflex sensitivity (BRS), and baroreflex effectiveness index (BEI) change scores were evaluated to obtain the autonomic phenotype of rumination. Personality traits and endothelial activation were examined for their relation to autonomic responses during rumination. Degree of endothelial activation was assessed by circulating soluble intercellular adhesion molecule-1 (sICAM-1). Vagal withdrawal during rumination was greater for women than men. Larger decreases in the high frequency component of HRV were associated with higher levels of anger-in, depression, and sICAM-1 levels. BRS reactivity was negatively related to trait anxiety. BEI reactivity was positively related to anger-in, hostility, anxiety, and depression. Lower BEI and BRS recovery were associated with lower social desirability and higher anger-out, anxiety, and depression. Findings suggest that the autonomic dysregulation that characterizes rumination plays a role in the relationships between personality and cardiovascular health. PMID:19272312

  5. Skin Biomes.

    Science.gov (United States)

    Fyhrquist, N; Salava, A; Auvinen, P; Lauerma, A

    2016-05-01

    The cutaneous microbiome has been investigated broadly in recent years and some traditional perspectives are beginning to change. A diverse microbiome exists on human skin and has a potential to influence pathogenic microbes and modulate the course of skin disorders, e.g. atopic dermatitis. In addition to the known dysfunctions in barrier function of the skin and immunologic disturbances, evidence is rising that frequent skin disorders, e.g. atopic dermatitis, might be connected to a dysbiosis of the microbial community and changes in the skin microbiome. As a future perspective, examining the skin microbiome could be seen as a potential new diagnostic and therapeutic target in inflammatory skin disorders.

  6. Olfaction in Asian tiger mosquito Aedes albopictus: flight orientation response to certain saturated carboxylic acids in human skin emanations.

    Science.gov (United States)

    Seenivasagan, T; Guha, Lopamudra; Parashar, B D; Agrawal, O P; Sukumaran, D

    2014-05-01

    The flight orientation response of nonblood-fed and hungry Aedes albopictus females was studied in a Y-tube olfactometer at 10(-6) to 10(-2) g odor plumes of saturated carboxylic acids (C1-C20), in which C2-C18 were the main constituents of human skin emanations. Thirteen acids viz C1, C2, C3, C5, C6, C8 C9, C10, C12, C14, C16, C18, and C20 showed attractance at odor plumes ranging from 10(-5) to 10(-3) g doses, while five acids viz C4, C7, C11, C15, and C19 showed repellence at 10(-4) to 10(-2) g to test mosquitoes. Tridecanoic acid (C13) showed attractance only at 10(-4) g dose while higher doses caused repellence. Dose-dependent reversal of orientation behavior from attractance to repellence was observed at 10(-2) g plumes of C5, C9, C10, C13, C17, C19, and C20 acids. The outcome of the study will help in the identification of odoriferous acids as potential attractants, repellents, or attraction inhibitors, which may find their application in the repellent formulations and odor-baited traps for surveillance and control of mosquitoes.

  7. Estradiol levels in women predict skin conductance response but not valence and expectancy ratings in conditioned fear extinction.

    Science.gov (United States)

    White, Emily C; Graham, Bronwyn M

    2016-10-01

    Anxiety disorders are more prevalent in women than men. One contributing factor may be the sex hormone estradiol, which is known to impact the long term recall of conditioned fear extinction, a laboratory procedure that forms the basis of exposure therapy for anxiety disorders. To date, the literature examining estradiol and fear extinction in humans has focused primarily on physiological measures of fear, such as skin conductance response (SCR) and fear potentiated startle. This is surprising, given that models of anxiety identify at least three important components: physiological symptoms, cognitive beliefs, and avoidance behavior. To help address this gap, we exposed women with naturally high (n=20) or low estradiol (n=19), women using hormonal contraceptives (n=16), and a male control group (n=18) to a fear extinction task, and measured SCR, US expectancy and CS valence ratings. During extinction recall, low estradiol was associated with greater recovery of SCR, but was not related to US expectancy or CS evaluation. Importantly, women using hormonal contraceptives showed a dissociation between SCR and cognitive beliefs: they exhibited a greater recovery of SCR during extinction recall, yet reported similar US expectancy and CS valence ratings to the other female groups. This divergence underscores the importance of assessing multiple measures of fear when examining the role of estradiol in human fear extinction, especially when considering the potential of estradiol as an enhancement for psychological treatments for anxiety disorders. PMID:27544848

  8. The Role of AKT/mTOR Pathway in Stress Response to UV-Irradiation: Implication in Skin Carcinogenesis by Regulation of Apoptosis, Autophagy and Senescence

    Directory of Open Access Journals (Sweden)

    Elwira Strozyk

    2013-07-01

    Full Text Available Induction of DNA damage by UVB and UVA radiation may generate mutations and genomic instability leading to carcinogenesis. Therefore, skin cells being repeatedly exposed to ultraviolet (UV light have acquired multilayered protective mechanisms to avoid malignant transformation. Besides extensive DNA repair mechanisms, the damaged skin cells can be eliminated by induction of apoptosis, which is mediated through the action of tumor suppressor p53. In order to prevent the excessive loss of skin cells and to maintain the skin barrier function, apoptotic pathways are counteracted by anti-apoptotic signaling including the AKT/mTOR pathway. However, AKT/mTOR not only prevents cell death, but is also active in cell cycle transition and hyper-proliferation, thereby also counteracting p53. In turn, AKT/mTOR is tuned down by the negative regulators being controlled by the p53. This inhibition of AKT/mTOR, in combination with transactivation of damage-regulated autophagy modulators, guides the p53-mediated elimination of damaged cellular components by autophagic clearance. Alternatively, p53 irreversibly blocks cell cycle progression to prevent AKT/mTOR-driven proliferation, thereby inducing premature senescence. Conclusively, AKT/mTOR via an extensive cross talk with p53 influences the UV response in the skin with no black and white scenario deciding over death or survival.

  9. Validity of bioeffect dose response models for normal tissue early and late complications of the skin

    International Nuclear Information System (INIS)

    Background: The bioeffect of a physical dose depends on the nature of the tissue, fractionation scheme, dose rate and treatment time. Certainly, experienced radiotherapists are convinced of the existence of patient-to-patient variability in normal tissue response to radiotherapy for malignant tumours. The absorbed dose needs to be translated into a bioeffect dose, which takes into account treatment variables and the radiobiological characteristics of the relevant tissue. Various bioeffect models such as NSD, CRE, TDF and BED have been proposed to predict the biological effect of radiotherapy treatments. Aim: This study was aimed at deriving tolerance bioeffect dose values for normal tissue complication rate. Materials/Methods: Compiled clinical data of time dose fractionation schedules and incidence of erythema, desquamation and telangiectasia were used for the present analysis. Results: For erythema and desquamation the radiation dose varied from 23.9 to 55.1 Gy in 04 to 50 fractions (dose per fraction 1.1 to 7.3 Gy) in 11 to 40 days. For telangiectasia (score .1 at 3 years) the radiation dose varied from 25.8 to 55.1 Gy in 04 to 50 fractions (dose per fraction 1.1 to 7.3 Gy) in 11 to 40 days. For telangiectasia (score .2 at 5 years) the radiation dose varied from 25.8 to 63.0 Gy in 04 to 50 fractions (dose per fraction 1.1 to 7.3 Gy) in 11 to 68 days. For telangiectasia (score .1, .2, .3, .4 at 10 years) the radiation dose varied from 25.8 to 63.0 Gy in 04 to 35 fractions (dose per fraction 1.7 to 7.3 Gy) in 22 to 68 days. TDF and LQF values for erythema, desquamation and telangiectasia were evaluated with a/b values of 7.5 Gy, 11.2 Gy and 2.8 Gy respectively. TDF and LQF had a statistically significant correlation with probability of erythema, desquamation and telangiectasia (p<0.001). Conclusions: TDF and LQF values should be limited to 60 and 86 Gy in order to limit the probability of telangiectasia. (authors)

  10. An elastic second skin

    Science.gov (United States)

    Yu, Betty; Kang, Soo-Young; Akthakul, Ariya; Ramadurai, Nithin; Pilkenton, Morgan; Patel, Alpesh; Nashat, Amir; Anderson, Daniel G.; Sakamoto, Fernanda H.; Gilchrest, Barbara A.; Anderson, R. Rox; Langer, Robert

    2016-08-01

    We report the synthesis and application of an elastic, wearable crosslinked polymer layer (XPL) that mimics the properties of normal, youthful skin. XPL is made of a tunable polysiloxane-based material that can be engineered with specific elasticity, contractility, adhesion, tensile strength and occlusivity. XPL can be topically applied, rapidly curing at the skin interface without the need for heat- or light-mediated activation. In a pilot human study, we examined the performance of a prototype XPL that has a tensile modulus matching normal skin responses at low strain (skin barrier function, pharmaceutical delivery and wound dressings.

  11. Functional autonomic nervous system profile in children with autism spectrum disorder

    OpenAIRE

    Kushki, Azadeh; Brian, Jessica; Dupuis, Annie; Anagnostou, Evdokia

    2014-01-01

    Background Autonomic dysregulation has been recently reported as a feature of autism spectrum disorder (ASD). However, the nature of autonomic atypicalities in ASD remain largely unknown. The goal of this study was to characterize the cardiac autonomic profile of children with ASD across four domains affected in ASD (anxiety, attention, response inhibition, and social cognition), and suggested to be affected by autonomic dysregulation. Methods We compared measures of autonomic cardiac regulat...

  12. The Immune Response to Skin Trauma Is Dependent on the Etiology of Injury in a Mouse Model of Burn and Excision.

    Science.gov (United States)

    Valvis, Samantha M; Waithman, Jason; Wood, Fiona M; Fear, Mark W; Fear, Vanessa S

    2015-08-01

    Skin trauma has many different causes including incision, blunt force, and burn. All of these traumas trigger an immune response. However, it is currently unclear whether the immune response is specific to the etiology of the injury. This study was established to determine whether the immune response to excision and burn injury of equivalent extent was the same. Using a mouse model of a full-thickness 19 mm diameter excision or 19 mm diameter full-thickness burn injury, we examined the innate immune response at the level of serum cytokine induction, whole-blood lymphocyte populations, dendritic cell function/phenotype, and the ensuing adaptive immune responses of CD4 and CD8 T-cell populations. Strikingly, both the innate and adaptive immune system responses differed between the burn and excision injuries. Acute cytokine induction was faster and different in profile to that of excision injury, leading to changes in systemic monocyte and neutrophil levels. Differences in the immune profile between burn and excision were also noted up to day 84 post injury, suggesting that the etiology of injury leads to sustained changes in the response. This may in part underlie clinical observations of differences in patient morbidity and mortality in response to different skin injury types. PMID:25826422

  13. 帕金森病50例皮肤交感反应特点分析%Sympathetic skin response studies of Parkinson disease in 50 patients

    Institute of Scientific and Technical Information of China (English)

    冯新红; 尹琳

    2012-01-01

    目的 分析帕金森病(PD)患者的皮肤交感反应(SSR)的特点,并探讨其与自主神经损害的关系.方法 收集2008年6月~2012年1月我院门诊或病房收治的PD患者50例,同时收集年龄、性别匹配的健康人50例,均采用常规肌电图检查,测定其运动神经传导、F波、感觉神经传导(SCV)和SSR.结果 正常对照组SSR全部引出,50例PD患者中,上肢5例波形缺失,下肢16例波形缺失.SSR潜伏期:正常对照组上肢(1.33±0.04)s,下肢(1.99±0.38)s,PD组上肢(1.50±0.11)s,下肢(2.16±0.17)s,两组比较差异有高度统计学意义(P<0.01).SSR波幅:正常对照组上肢(3.31±2.15)mv,下肢(1.73±0.98)mv,PD组上肢(1.23±0.67)mv,下肢(0.72±0.45)mv,两组比较差异有高度统计学意义(P<0.01).在50例PD患者中,SSR异常35例(70%),其中上肢异常10例,下肢异常35例,上肢SR异常的患者,其下肢SSR均有异常.下肢异常率明显高于上肢,二者比较差异有高度统计学意义(P<0.01).PD患者SSR异常主要表现在:波形消失16例,潜伏期延长7例,波幅下降19例.自主神经损伤症状组SSR异常率明显高于无自主神经损伤症状组.结论 PD患者可出现SSR的异常,SSR能为PD的自主神经功能受损提供依据.%Objective To investigate the features of sympathetic skin response in patients with Parkinson disease arid explore the correlation between SSR and automatic dysfunction. Methods The data of outpatients and inpatients diagnosed with PD were collected in the second affiliated hospital of Dalian Medical University from June 2008 to January 2012. Sympathetic skin response were measured in median nerve. Parameters analyses mainly included SSR. Latency and amplitude. Results The SSR was present in 100% of the controls but was absent in 5 cases in the hands and 16 cases in the feet in PD patients. The mean latency of the PD patients [palmar SSR: (1.50±0.11)s, plantar SSR:(2.16±0.17)s] were longer than that of the controls [palmar SSR: (1.33

  14. Objective evaluation of stress with the blind by the monitoring of autonomic nervous system activity.

    Science.gov (United States)

    Massot, Bertrand; Baltenneck, Nicolas; Gehin, Claudine; Dittmar, Andre; McAdams, Eric

    2010-01-01

    Accessibility for the blind in an urban space must be studied under real conditions in their daily environment. A new approach for evaluating the impact of environmental conditions on blind pedestrians is the objective measure of stress by the monitoring of the autonomic nervous system (ANS) activity. Original techniques of data analysis and spatial representation are proposed for the detection of the ANS activity through the assessment of the electrodermal activity. Skin resistance was recorded with an EmoSense system on 10 blind subjects who followed a charted course independently. The course was 1065 meters long and consisted of various environmental conditions in an urban space. The spatial frequency of the non-specific skin resistance responses was used to provide a more relevant representation of geographic hotspots. Results of statistical analysis based on this new parameter are discussed to conclude on phenomena causing mental stress with the blind moving in an urban space.

  15. Trigeminal autonomic cephalgias

    OpenAIRE

    Benoliel, Rafael

    2012-01-01

    1. Trigeminal autonomic cephalgias (TACs) are headaches/facial pains classified together based on:a suspected common pathophysiology involving the trigeminovascular system, the trigeminoparasympathetic reflex and centres controlling circadian rhythms;a similar clinical presentation of trigeminal pain, and autonomic activation.

  16. Testing for autonomic neuropathy

    DEFF Research Database (Denmark)

    Hilsted, J

    1984-01-01

    Autonomic neuropathy is a common complication in long-term diabetes, about 30% of the patients showing measurable signs of autonomic dysfunction after 10 years duration of disease. The diagnosis is often difficult to establish because clinical symptoms generally occur late in the course...

  17. Analysis of sympathetic skin response and R-R phase change rate in patients with bipolar disorder%双相情感障碍患者中交感神经皮肤反应和R-R间期变化率的分析

    Institute of Scientific and Technical Information of China (English)

    张锋利; 淳彩濮; 阿丽亚·艾尔肯

    2015-01-01

    Objective:To explore the diagnostic value of sympathetic skin response and R-R phase change rate for the autonomic nerve damage in patients with bipolar disorder.Methods:The SSR and RRIV characteristics of 235 cases of patients with bipolar disorder were detected.Results:The abnormal rate of SSR and RRIV were 85.1% and 81.5 % respectively.There were no significant differences of SSR and RRIV among various subgroups(P>0.05).Conclusion:SSR and RRIV could be used as objective indicators to evaluate the autonomic nerve damage of bipolar disorder.%目的:探讨交感神经皮肤反应技术(SSR)和R-R间期变化率(RRIV)对双相情感障碍患者自主神经损害的诊断价值。方法:检测235例双相情感障碍患者的 SSR 及 RRIV 特点。结果:SSR 和 RRIV 异常率分别为85.1%和81.5%,各亚组间SSR和RRIV差异均无统计学意义(P>0.05)。结论:SSR和RRIV可作为评价双相情感障碍自主神经损害的客观指标。

  18. Gating of the vertex somatosensory and auditory evoked potential P50 and the correlation to skin conductance orienting response in healthy men

    DEFF Research Database (Denmark)

    Arnfred, S M; Eder, D N; Hemmingsen, R P;

    2001-01-01

    to the skin conductance orienting response (SCOR) in 20 healthy men. We measured mid-latency vertex components (SEP: P50, N65, P85 and N100; AEP: P30, N45, P50 and N80). The gating was most pronounced at ISI 500 ms where the SEP P50 and N100 gating were 0.59 and 0.37, respectively, as compared to a gating...

  19. Quantitative thermal sensory testing and sympathetic skin response in primary Restless legs syndrome – A prospective study on 57 Indian patients

    OpenAIRE

    Garima Shukla; Vinay Goyal; Achal Srivastava; Madhuri Behari

    2012-01-01

    Patients with restless leg syndrome present with sensory symptoms similar to peripheral neuropathy. While there is evidence of abnormalities of dopaminergic pathways, the peripheral nervous system has been studied infrequently. We studied conventional nerve conduction studies, quantitative thermal sensory testing and sympathetic skin response in 57 patients with primary restless leg syndrome. Almost two third patients demonstrated abnormalities in the detailed testing of the peripheral nervou...

  20. The relationship between the sympathetic skin response and event-related brain potentials in sensorimotor control of human voluntary movements

    OpenAIRE

    Shimoda, Masahiro

    2000-01-01

    The autonomic nervous syste m (ANS) maintains the internal environment of the human body. It has recently been suggested that the ANS also contributes to the control of voluntary movements. Especially, the sympathetic nervous system in the ANS plays an important role in subserving voluntary movements. Many researchers have become to be interested in the neuro-behavioral relationship between the ANS and the cortical motor areas, such as the primary motor area, supplementary motor area, and cin...

  1. Sagging Skin

    Science.gov (United States)

    ... turkey neck,” this occurs as skin loses its elasticity and in cases where individuals have lost a ... technique or procedure is appropriate for my skin type? Did the doctor show me before-and-after ...

  2. Skin Dictionary

    Science.gov (United States)

    ... resources Meet our partners Español Donate Diseases and treatments Acne and rosacea Bumps and growths Color problems Contagious skin diseases Cosmetic treatments Dry / sweaty skin Eczema / dermatitis Hair and scalp ...

  3. Skin Biopsy

    Science.gov (United States)

    ... skin condition cannot be diagnosed by the patient's history and what the physician finds on examination alone. Confirming a clinical diagnosis may also be necessary prior to starting therapy. Skin biopsy types are as follows: Shave biopsies Punch biopsies ...

  4. Skin tears.

    Science.gov (United States)

    Baranoski, S

    2001-08-01

    Skin tears are a serious, painful problem for older patients. Find out how your staff can recognize patients at risk, what they can do to prevent skin tears, and how to manage them effectively if they occur.

  5. Skin Cancer

    Science.gov (United States)

    Skin cancer is the most common form of cancer in the United States. The two most common types ... face, neck, hands, and arms. Another type of skin cancer, melanoma, is more dangerous but less common. Anyone ...

  6. Dose-Response on the Chemopreventive Effects of Sarcophine-Diol on UVB-Induced Skin Tumor Development in SKH-1 Hairless Mice

    Directory of Open Access Journals (Sweden)

    Chandradhar Dwivedi

    2012-09-01

    Full Text Available Sarcophine-diol (SD is a lactone ring-opened analogue of sarcophine. It has shown chemopreventive effects on chemically-induced skin tumor development in female CD-1 mice, as well as in a UVB-induced skin tumor development model in hairless SKH-1 mice at a dose of 30 μg SD applied topically and 180 mJ/cm2 UVB. The objective of this study was to determine the dose-response on the chemopreventive effects of SD on SKH-1 hairless mice when exposed to a UVB radiation dose of 30 mJ/cm2. This UVB dose better represents chronic human skin exposure to sunlight leading to skin cancer than previous studies applying much higher UVB doses. Carcinogenesis was initiated and promoted by UVB radiation. Female hairless SKH-1 mice were divided into five groups. The control group was topically treated with 200 μL of acetone (vehicle, and the SD treatment groups were topically treated with SD (30 μg, 45 μg, and 60 μg dissolved in 200 μL of acetone 1 h before UVB radiation (30 mJ/cm2. The last group of animals received 60 μg SD/200 μL acetone without UVB exposure. These treatments were continued for 27 weeks. Tumor multiplicity and tumor volumes were recorded on a weekly basis for 27 weeks. Weight gain and any signs of toxicity were also closely monitored. Histological characteristics and the proliferating cell nuclear antigen (PCNA were evaluated in the mice skin collected at the end of the experiment. The dose-response study proved a modest increase in chemopreventive effects with the increase in SD dose. SD reduced the number of cells positively stained with PCNA proliferation marker in mice skin. The study also showed that SD application without UVB exposure has no effect on the structure of skin. The results from this study suggest that broader range doses of SD are necessary to improve the chemopreventive effects.

  7. SKIN CANCER

    OpenAIRE

    Made Putri Hendaria; AAGN Asmarajaya; Sri Maliawan

    2013-01-01

    Skin is an organ which protect the human body from the environment. It was build by milion cells. According to the changes in human lifestyle which tends to unhealthy life, increasing ultraviolet radiation, toxins, and genetics makes the cells who build the skin do the abnormal growth being cancer cells. Classification of skin cancer is according the most common three types, they are Basal Cell Carcinoma, Squamous Cell Carcinoma, and Malignant Melanoma. More than 3,5 milion skin cancer cases ...

  8. Human papillomavirus types detected in skin warts and cancer differ in their transforming properties but commonly counteract UVB induced protective responses in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Shterzer, Naama; Heyman, Dariya; Shapiro, Beny; Yaniv, Abraham; Jackman, Anna [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel); Serour, Francis [Department of Pediatric Surgery, The E. Wolfson Medical Center, Holon (Israel); Chaouat, Malka [Laboratory of Experimental Surgery, Hadassah University Hospital, Ein Karem, Jerusalem (Israel); Gonen, Pinhas [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel); Tommasino, Massimo [International Agency for Research on Cancer, World Health Organization, Lyon (France); Sherman, Levana [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel)

    2014-11-15

    In the present study, E6E7 and E6 proteins of human papillomaviruses (HPVs) associated with skin warts and cancer were compared for their transforming and carcinogenic abilities in primary human keratinocytes (PHKs). We show that E6E7 of cancer associated beta HPV types, notably 49 and 24, were able to extend the life span and enhance the clonogenic efficiency of PHKs when maintained in serum free/low calcium medium. Activities of the beta HPV E6E7 were lower than those of HPV16 E6E7. In contrast, E6 proteins from HPV types detected in skin warts or cancer, notably 10, 49 and 38, attenuated UVB induced protective responses in PHKs including cell death, proliferation arrest and accumulation of the proapoptotic proteins, p53, bax or bak. Together, this investigation revealed functional differences and commonalities between HPVs associated with skin warts and cancer, and allowed the identification of specific properties of beta HPVs supporting their involvement in skin carcinogenesis. - Highlights: • Primary keratinocytes were used to evaluate transforming and carcinogenic abilities of cutaneous HPVs. • E6E7 of cancer associated β HPV types transform primary human keratinocytes. • E6 proteins of cancer and wart associated HPVs inhibit UVB induced cell death. • E6s of cancer and wart associated HPVs attenuate UVB induced proliferation arrest. • E6s of cancer and wart associated HPVs attenuate UVB induced apoptosis signaling.

  9. Skin Aging

    Science.gov (United States)

    Your skin changes as you age. You might notice wrinkles, age spots and dryness. Your skin also becomes thinner and loses fat, making it ... heal, too. Sunlight is a major cause of skin aging. You can protect yourself by staying out ...

  10. Evaluation of autonomic functions in subclinical hypothyroid and hypothyroid patients

    OpenAIRE

    Mahajan, Aarti S.; Ram Lal; Dhanwal, Dinesh K.; Jain, Ajay K.; Veena Chowdhury

    2013-01-01

    Background: Autonomic dysfunction may contribute to cardiovascular morbidity in subclinical hypothyroid patients. It is controversial whether the abnormality exists in sympathetic or the parasympathetic function. It is also not known whether the severity of autonomic dysfunction is related to the degree of thyroid deficiency. Design of Study: Prospective case control. Materials and Methods: Autonomic functions based on heart rate (HR) and blood pressure (BP) responses to various maneuvers wer...

  11. Early atherosclerosis and cardiac autonomic responses to mental stress: a population-based study of the moderating influence of impaired endothelial function

    OpenAIRE

    Juonala Markus; Ravaja Niklas; Hintsa Taina; Hintsanen Mirka; Chumaeva Nadja; Raitakari Olli T; Keltikangas-Järvinen Liisa

    2010-01-01

    Abstract Background Acute mental stress may contribute to the cardiovascular disease progression via autonomic nervous system controlled negative effects on the endothelium. The joint effects of stress-induced sympathetic or parasympathetic activity and endothelial function on atherosclerosis development have not been investigated. The present study aims to examine the interactive effect of acute mental stress-induced cardiac reactivity/recovery and endothelial function on the prevalence of c...

  12. Responses of Six-Weeks Aquatic Exercise on the Autonomic Nervous System, Peak Nasal Inspiratory Flow and Lung Functions in Young Adults with Allergic Rhinitis

    OpenAIRE

    Taweesak Janyacharoen; Narupon Kunbootsri; Preeda Arayawichanon; Seksun Chainansamit; Kittisak Sawanyawisuth

    2015-01-01

    Allergic rhinitis is a chronic respiratory disease. Sympathetic hypofunction is identified in all of the allergic rhinitis patients. Moreover, allergic rhinitis is associated with decreased peak nasal inspiratory flow (PNIF) and impaired lung functions. The aim of this study was to investigate effects of six-week of aquatic exercise on the autonomic nervous system function, PNIF and lung functions in allergic rhinitis patients.Twenty-six allergic rhinitis patients, 12 males and 14 females wer...

  13. Autonomic dysregulation in headache patients.

    Science.gov (United States)

    Gass, Jason J; Glaros, Alan G

    2013-12-01

    To analyze autonomic nervous system activity in headache subjects, measurements of heart rate variability (HRV), skin temperature, skin conductance, and respiration were compared to a matched control group. HRV data were recorded in time and frequency domains. Subjects also completed self-report questionnaires assessing psychological distress, fatigue, and sleep dysfunction. Twenty-one headache and nineteen control subjects participated. In the time domain, the number of consecutive R-to-R intervals that varied by more than 50 ms and the standard deviation of the normalized R-to-R intervals, both indices of parasympathetic nervous system activity, were significantly lower in the headache group than the control group. Groups did not differ statistically on HRV measures in the frequency domain. Self-report measures showed significantly increased somatization, hostility, anxiety, symptom distress, fatigue, and sleep problems in the headache group. The results suggest headache subjects have increased sympathetic nervous system activity and decreased parasympathetic activity compared to non-headache control subjects. Headaches subjects also showed greater emotional distress, fatigue, and sleep problems. The results indicate an association between headaches and cardiovascular functioning suggestive of sympathetic nervous system activation in this sample of mixed migraine and tension-type headache sufferers. PMID:23912525

  14. Oral fibroblasts produce more HGF and KGF than skin fibroblasts in response to co-culture with keratinocytes

    DEFF Research Database (Denmark)

    Grøn, Birgitte; Stoltze, Kaj; Andersson, Anders;

    2002-01-01

    cells were maintained in collagen, the level of HGF and KGF was decreased mainly in skin cultures. However, in oral fibroblasts, induction after stimulation was at a similar level in collagen compared to on polystyrene. Skin fibroblasts maintained in collagen produced almost no HGF whether......The production of hepatocyte growth factor (HGF) and keratinocyte growth factor (KGF) in subepithelial fibroblasts from buccal mucosa, periodontal ligament, and skin was determined after co-culture with keratinocytes. The purpose was to detect differences between the fibroblast subpopulations...... that could explain regional variation in epithelial growth and wound healing. Normal human fibroblasts were cultured on polystyrene or maintained in collagen matrix and stimulated with keratinocytes cultured on membranes. The amount of HGF and KGF protein in the culture medium was determined every 24 h for 5...

  15. Sexual features of the old rats’ autonomic nervous system response to the development of necrotic process in heart on the background of melatonin

    Directory of Open Access Journals (Sweden)

    M. R. Khara

    2016-01-01

    Full Text Available Aim. An effect of melatonin on the autonomic regulation of the heart in terms of damage was studied in adult and old male and female rats. Methods and results. Necrotic process in the myocardium was caused by the injection of epinephrine (1 mg / kg, single dose, intramuscular 1 h after injection of melatonin (5 mg / kg intravenous. In 1 and 24 hours after administration of epinephrine heart rate was determined and features of autonomic regulation of the heart on indicators Mo (mode, AMo (mode amplitude, ΔH (variation range of cardio intervals, and SI (stress index of regulatory mechanisms were evaluated. It was found that the effects of melatonin aimed at increasing the role of cholinergic ANS link in the formation of heart rate and reducing the adrenergic participation in the body of older individuals significantly decreased. To a greater extent this applies to older males. In the dynamics of adrenalin necrosis the character of vegetative regulation of heart rate of old rats reflects greater, than in adults, role of adrenergic link in animals of both sexes and reduce of the impact of cholinergic one – only in older males, which resulted in a significant tension of regulatory mechanisms. Conclusion. The obtained results show that with increasing age in rats effectiveness of melatonin as a drug which can affect the autonomic regulation of the heart by activating cardio-protective effects decreases, especially in male rats.

  16. Autonomous linear lossless systems

    OpenAIRE

    Rao, Shodhan; Rapisarda, Paolo

    2008-01-01

    We define a lossless autonomous system as one having a quadratic differential form associated with it called an energy function, which is positive and which is conserved. We define an oscillatory system as one which has all its trajectories bounded on the entire time axis. In this paper, we show that an autonomous system is lossless if and only if it is oscillatory. Next we discuss a few properties of energy functions of autonomous lossless systems and a suitable way of splitting a given ener...

  17. Autonomous surveillance for biosecurity.

    Science.gov (United States)

    Jurdak, Raja; Elfes, Alberto; Kusy, Branislav; Tews, Ashley; Hu, Wen; Hernandez, Emili; Kottege, Navinda; Sikka, Pavan

    2015-04-01

    The global movement of people and goods has increased the risk of biosecurity threats and their potential to incur large economic, social, and environmental costs. Conventional manual biosecurity surveillance methods are limited by their scalability in space and time. This article focuses on autonomous surveillance systems, comprising sensor networks, robots, and intelligent algorithms, and their applicability to biosecurity threats. We discuss the spatial and temporal attributes of autonomous surveillance technologies and map them to three broad categories of biosecurity threat: (i) vector-borne diseases; (ii) plant pests; and (iii) aquatic pests. Our discussion reveals a broad range of opportunities to serve biosecurity needs through autonomous surveillance. PMID:25744760

  18. Highly Autonomous Systems Workshop

    Science.gov (United States)

    Doyle, R.; Rasmussen, R.; Man, G.; Patel, K.

    1998-01-01

    It is our aim by launching a series of workshops on the topic of highly autonomous systems to reach out to the larger community interested in technology development for remotely deployed systems, particularly those for exploration.

  19. Autonomic Nervous System Disorders

    Science.gov (United States)

    ... with breathing and swallowing Erectile dysfunction in men Autonomic nervous system disorders can occur alone or as the result of another disease, such as Parkinson's disease, alcoholism and diabetes. Problems can affect either part ...

  20. The impact of methylmercury on 1,25-dihydroxyvitamin D3-induced transcriptomic responses in dolphin skin cells.

    Science.gov (United States)

    Ellis, Blake C; Gattoni-Celli, Sebastiano; Kindy, Mark S

    2010-01-01

    The Atlantic bottlenose dolphin has been the focus of much attention owing to the considerable impact of environmental stress on its health and the associated implications for human health. Here, we used skin cells from the dolphin to investigate the protective role of the vitamin D pathway against environmental stressors. We previously reported that dolphin skin cells respond to 1,25-dihydroxyvitamin D3 (1,25D3), the bioactive metabolite of vitamin D3, by upregulation of the vitamin D receptor (VDR) and expression of several genes. Methylmercury is a highly bioaccumulative environmental stressor of relevance to the dolphin. We currently report that in dolphin cells sublethal concentrations of methylmercury compromise the ability of 1,25D3 to upregulate VDR, to transactivate a vitamin D-sensitive promoter, and to express specific target genes. These results help elucidate the effects of vitamin D and methylmercury on innate immunity in dolphin skin and potentially in human skin as well, considering similarities in the vitamin D pathway between the two species.

  1. The effect of salmeterol and salbutamol on mediator release and skin responses in immediate and late phase allergic cutaneous reactions

    DEFF Research Database (Denmark)

    Petersen, Lars Jelstrup; Skov, P S

    1999-01-01

    clinical and biochemical EAR and LPR in human skin. METHODS: Measurement of wheal and flare reactions to allergen, codeine, and histamine, and LPR (induration) to allergen. Assessment of histamine and prostaglandin D2 (PGD2) release by microdialysis technique in EAR, and measurement of mediators in LPR by...

  2. Psychopathic Traits and Physiological Responses to Aversive Stimuli in Children Aged 9–11 Years

    OpenAIRE

    Wang, Pan; Baker, Laura A.; Gao, Yu; Raine, Adrian; Lozano, Dora Isabel

    2012-01-01

    Atypical eletrodermal and cardiovascular response patterns in psychopathic individuals are thought to be biological indicators of fearless and disinhibition. This study investigated the relationship between psychopathic traits and these autonomic response patterns using a count-down task in 843 children (aged 9–10 years). Heart rate (HR) and non-specific skin conductance responses (NS-SCRs) were recorded while participants anticipated and reacted to 105 dB signaled or unsignaled white-noise b...

  3. Skin Diseases: Skin Health and Skin Diseases

    Science.gov (United States)

    ... Usually the cause is staphylococcal (staph), but sometimes streptococcus (strep) can cause it, too. It is most ... color or outline, or in any other way. Psoriasis © 2008 Logical Images, Inc. Psoriasis —A skin disease ...

  4. Autonomic nervous system:its response and adaptation to exercises%自主神经系统对运动反应、适应的研究与进展

    Institute of Scientific and Technical Information of China (English)

    邵连杰

    2015-01-01

    背景:心血管系统满足运动过程中不同组织和器官的需求,一次性运动和长时间运动会引起不同的心脏自主神经系统的反应和变化。通过分析心率变异指标提取人体变化的信息,用于运动效果和个体方案的制定成为一个重要的研究领域。目的:从传统的心率变异指标在运动中的应用入手,并结合最新的研究动态,为进一步的心脏自主神经对运动反应和适应研究提供理论支撑。方法:通过计算机检索学术谷歌和PubMed数据库相关文献。检索时间范围为1997年1月至2015年3月。英文检索词为“autonomic nervous system,heart rate variability,HRV,exercise intervention,exercise training”。结果与结论:共检索到405篇相关文献,根据纳入标准保留79篇文献。根据一次性运动心脏自主神经的变化,可以评定有氧工作能力和制定个体干预方案。心脏自主神经对运动干预的反应和适应取决于强度和持续时间,存在较大的个体差异。交感神经和迷走神经长时间兴奋或抑制可能预示过度训练发生。%BACKGROUND:The cardiovascular system meets the demand of different tissues and organs in the motor process. One-time exercise and long-time exercise wil cause different responses and changes of the cardiac autonomic nervous system. Information about changes of the human body can be extractedvia indicators of heart rate variability, which wil be used for formulation of exercise effect and individualized program. It wil be an important field in the future. OBJECTIVE:To study the conventional indicators of heart rate variability used in exercise in combination with the latest research trends, and to provide theoretical support for studying the response and adaptation of cardiac autonomic nervous system to exercises. METHODS: A computer-based search of Google Scholar and PubMed database was performed for relevant articles published from January

  5. Changes in skin levels of two neutotrophins (glial cell line derived neurotrohic factor and neurotrophin-3) cause alterations in cutaneous neuron responses to mechanical stimuli

    Institute of Scientific and Technical Information of China (English)

    Jeffrey Lawson; Sabrina L. Mcllwrath; H. Richard Koerber

    2008-01-01

    Neurotrophins are important for the development and maintenance of both high and low threshold mechanoreceptors (HTMRs and LTMRs). In this series of studies, the effects of constitutive overexpression of two different neurotrophins, neurotrophin-3 (NT-3) and glial cell line derived neurotrohic factor (GDNF), were examined. Previous studies indicated that both of them may be implicated in the normal development of mouse dorsal root ganglion (DRG) neurons. Neurons from mice transgenically altered to overexpress NT-3 or GDNF (NT-3-OE or GDNF-OE mice) in the skin were examined using several physiological, immunohistochemi-cal and molecular techniques. Ex vivo skin/nerve/DRG/spinal cord and skin/nerve preparations were used to determine the response characteristics of the cutaneous neurons; immunohistochemistry was used to examine the biochemical phenotype of DRG cells and the skin; RT-PCR was used to examine the levels of candidate ion channels in skin and DRG that may correlate with changes in physiologi-cal responses. In GDNF-OE mice, I-isolectin B4 (IB4)-immunopositive C-HTMRs (nociceptors), a large percentage of which are sensitive to GDNF, had significantly lower mechanical thresholds than wildtype (WT) neurons. Heat thresholds for the same cells were not different. Mechanical sensitivity changes in GDNF-OE mice were correlated with significant increases in acid sensing ion channels 2a (ASIC2a) and 2b (ASIC2b) and transient receptor potential channel AI (TRPAI), all of which are putative mechanosensitive ion channels. Overexpression of NT-3 affected the responses of A-LTMRs and A-HTMRs, hut had no effect on C-HTMRs. Slowly adapting type 1 (SA1) LTMRs and A-HTMRs had increased mechanical sensitivity compared to WT. Mechanical sensitivity was correlated with significant increases in acid-sensing ion channels ASIC1 and ASIC3. This data indicates that both neurotrophins play roles in determining mechanical thresholds of cutaneous HTMRs and LTMRs and that sensitivity

  6. Blood pressure regulation in diabetic autonomic neuropathy

    DEFF Research Database (Denmark)

    Hilsted, J

    1985-01-01

    Defective blood pressure responses to standing, exercise and epinephrine infusions have been demonstrated in diabetic patients with autonomic neuropathy. The circulatory mechanisms underlying blood pressure responses to exercise and standing up in these patients are well characterized: In both...... experimental situations insufficient contraction of resistance vessels has been demonstrated. The vasoconstrictor defects demonstrated are of a magnitude sufficient to account for the prevailing hypotension. Furthermore, during exercise cardiac output is low in patients with autonomic neuropathy, a finding...... which may contribute to exercise hypotension in these patients. During hypoglycemia, blood pressure regulation seems intact in patients with autonomic neuropathy. This is probably due to release of substantial amounts of catecholamines during these experiments. During epinephrine infusions a substantial...

  7. Subdominant H60 antigen-specific CD8 T-cell response precedes dominant H4 antigen-specific response during the initial phase of allogenic skin graft rejection.

    Science.gov (United States)

    Yoo, Kang Il; Jeon, Ji Yeong; Ryu, Su Jeong; Nam, Giri; Youn, Hyewon; Choi, Eun Young

    2015-02-13

    In allogeneic transplantation, including the B6 anti-BALB.B settings, H60 and H4 are two representative dominant minor histocompatibility antigens that induce strong CD8 T-cell responses. With different distribution patterns, H60 expression is restricted to hematopoietic cells, whereas H4 is ubiquitously expressed. H60-specific CD8 T-cell response has been known to be dominant in most cases of B6 anti-BALB.B allo-responses, except in the case of skin transplantation. To understand the mechanism underlying the subdominance of H60 during allogeneic skin transplantation, we investigated the dynamics of the H60-specific CD8 T cells in B6 mice transplanted with allogeneic BALB.B tail skin. Unexpectedly, longitudinal bioluminescence imaging and flow cytometric analyses revealed that H60-specific CD8 T cells were not always subdominant to H4-specific cells but instead showed a brief dominance before the H4 response became predominant. H60-specific CD8 T cells could expand in the draining lymph node and migrate to the BALB.B allografts, indicating their active participation in the anti-BALB.B allo-response. Enhancing the frequencies of H60-reactive CD8 T cells prior to skin transplantation reversed the immune hierarchy between H60 and H4. Additionally, H60 became predominant when antigen presentation was limited to the direct pathway. However, when antigen presentation was restricted to the indirect pathway, the expansion of H60-specific CD8 T cells was limited, whereas H4-specific CD8 T cells expanded significantly, suggesting that the temporary immunodominance and eventual subdominance of H60 could be due to their reliance on the direct antigen presentation pathway. These results enhance our understanding of the immunodominance phenomenon following allogeneic tissue transplantation.

  8. Curious Skin

    OpenAIRE

    Angel, G.

    2010-01-01

    Some of Henry Wellcome’s collection of tattoos on human skin will be on display in our forthcoming Skin exhibition. But how did the Parisian doctor from whom they were acquired come by his macabre collection of tattoos in the first place, and what did they mean to those whose skin they were on? It’s Gemma Angel‘s job to find out…

  9. Contingency Software in Autonomous Systems: Technical Level Briefing

    Science.gov (United States)

    Lutz, Robyn R.; Patterson-Hines, Ann

    2006-01-01

    Contingency management is essential to the robust operation of complex systems such as spacecraft and Unpiloted Aerial Vehicles (UAVs). Automatic contingency handling allows a faster response to unsafe scenarios with reduced human intervention on low-cost and extended missions. Results, applied to the Autonomous Rotorcraft Project and Mars Science Lab, pave the way to more resilient autonomous systems.

  10. Extracellular Matrix Modulates Morphology, Growth, Oxidative Stress Response and Functionality of Human Skin Fibroblasts during Aging In Vitro

    DEFF Research Database (Denmark)

    Jørgensen, Peter; Rattan, Suresh

    2014-01-01

    The Hayflick system of cellular aging and replicative senescence in vitro has been used widely in both basic and applied research in biogerontology. The state of replicative senescence is generally considered to be irreversible, but is modifiable by genetic and environmental manipulations. Some...... recent observations indicate that replicative lifespan, senescence and functionality of cells in vitro can be significantly affected by the quality of the extra cellular matrix (ECM). Following up on those reports, here we show that using the ECM prepared from early passage young cells, partial...... rejuvenation of serially passaged human facial skin fibroblasts was possible in pre-senescent middle-aged cells, but not in fully senescent late passage cells. ECM from young cells improved the appearance, viability, stress tolerance and wound healing ability of skin fibroblasts. Furthermore, young ECM...

  11. Two-step tuberculin skin testing in school-going adolescents with initial 0-4 millimeter responses in a high tuberculosis prevalence setting in South India.

    Directory of Open Access Journals (Sweden)

    Maitreyi Murthy

    Full Text Available BACKGROUND: The utility of two-step tuberculin skin testing among adolescents in high tuberculosis prevalence settings is not well established. OBJECTIVES: To determine the proportion and determinants of a 0-4 mm response to an initial standard tuberculin skin test (TST and evaluating 'boosting' with repeat testing. METHODS: Adolescents between 11 and 18 years attending schools/colleges underwent a TST; those with a response of between 0-4 mm had a repeat TST 1-4 weeks later. RESULTS: Initial TST was done for 6608/6643 participants; 1257 (19% developed a 0-4 mm response to the initial TST. Younger age and under-nutrition were more likely to be associated with a 0-4 mm response, while the presence of BCG (Bacillus Calmette Guerin scar and higher socio-economic class were less likely to be associated with a 0-4 mm response. On repeat testing boosting was seen in 13.2% (145/1098; ≥ 6 mm over the initial test while 4.3% showed boosting using a more conservative cutoff of a repeat TST ≥ 10 mm with an increment of at least 6 mm (47/1098. History of exposure to a tuberculosis (TB case was associated with enhanced response. CONCLUSION: The proportion of adolescents who demonstrated boosting on two-step TST testing in our study was relatively low. As a result repeat testing did not greatly alter the prevalence of TST positivity. However, the two-step TST helps identify individuals who can potentially boost their immune response to a second test, and thus, prevents them from being misclassified as those with newly acquired infection, or tuberculin converters. While two-step tuberculin skin testing may have a limited role in population- level TST surveys, it may be useful where serial tuberculin testing needs to be performed to distinguish those who show an enhanced response or boosters from those who indeed have a new infection, or converters.

  12. The role of variants from the innate immune system genes in tuberculosis and skin test response in a Native American population.

    Science.gov (United States)

    Lindenau, Juliana D; Salzano, Francisco M; Hurtado, Ana M; Hill, Kim R; Hutz, Mara H

    2016-10-01

    Native American populations show higher tuberculosis (TB) mortality and infectivity rates than non-Native populations. Variants in the innate immune system seem to have an important role on TB susceptibility. The role of some innate immune system variants in TB susceptibility and/or skin test response (PPD) were investigated in the Aché, a Native American population. Complement receptor 1 and toll like receptor 9 variants were associated with anergy to PPD and protection to TB, respectively. These findings demonstrate an important role of the innate immune system variants in TB susceptibility.

  13. 5-HT1A/1B receptors as targets for optimizing pigmentary responses in C57BL/6 mouse skin to stress.

    Directory of Open Access Journals (Sweden)

    Hua-Li Wu

    Full Text Available Stress has been reported to induce alterations of skin pigmentary response. Acute stress is associated with increased turnover of serotonin (5-hydroxytryptamine; 5-HT whereas chronic stress causes a decrease. 5-HT receptors have been detected in pigment cells, indicating their role in skin pigmentation. To ascertain the precise role of 5-HT in stress-induced pigmentary responses, C57BL/6 mice were subjected to chronic restraint stress and chronic unpredictable mild stress (CRS and CUMS, two models of chronic stress for 21 days, finally resulting in abnormal pigmentary responses. Subsequently, stressed mice were characterized by the absence of a black pigment in dorsal coat. The down-regulation of tyrosinase (TYR and tyrosinase-related proteins (TRP1 and TRP2 expression in stressed skin was accompanied by reduced levels of 5-HT and decreased expression of 5-HT receptor (5-HTR system. In both murine B16F10 melanoma cells and normal human melanocytes (NHMCs, 5-HT had a stimulatory effect on melanin production, dendricity and migration. When treated with 5-HT in cultured hair follicles (HFs, the increased expression of melanogenesis-related genes and the activation of 5-HT1A, 1B and 7 receptors also occurred. The serum obtained from stressed mice showed significantly decreased tyrosinase activity in NHMCs compared to that from nonstressed mice. The decrease in tyrosinase activity was further augmented in the presence of 5-HTR1A, 1B and 7 antagonists, WAY100635, SB216641 and SB269970. In vivo, stressed mice received 5-HT precursor 5-hydroxy-l-tryptophan (5-HTP, a member of the class of selective serotonin reuptake inhibitors (fluoxetine; FX and 5-HTR1A/1B agonists (8-OH-DPAT/CP94253, finally contributing to the normalization of pigmentary responses. Taken together, these data strongly suggest that the serotoninergic system plays an important role in the regulation of stress-induced depigmentation, which can be mediated by 5-HT1A/1B receptors. 5-HT

  14. Autonomic disturbances in narcolepsy.

    Science.gov (United States)

    Plazzi, Giuseppe; Moghadam, Keivan Kaveh; Maggi, Leonardo Serra; Donadio, Vincenzo; Vetrugno, Roberto; Liguori, Rocco; Zoccoli, Giovanna; Poli, Francesca; Pizza, Fabio; Pagotto, Uberto; Ferri, Raffaele

    2011-06-01

    Narcolepsy is a clinical condition characterized mainly by excessive sleepiness and cataplexy. Hypnagogic hallucinations and sleep paralysis complete the narcoleptic tetrad; disrupted night sleep, automatic behaviors and weight gain are also usual complaints. Different studies focus on autonomic changes or dysfunctions among narcoleptic patients, such as pupillary abnormalities, fainting spells, erectile dysfunction, night sweats, gastric problems, low body temperature, systemic hypotension, dry mouth, heart palpitations, headache and extremities dysthermia. Even if many studies lack sufficient standardization or their results have not been replicated, a non-secondary involvement of the autonomic nervous system in narcolepsy is strongly suggested, mainly by metabolic and cardiovascular findings. Furthermore, the recent discovery of a high risk for overweight and for metabolic syndrome in narcoleptic patients represents an important warning for clinicians in order to monitor and follow them up for their autonomic functions. We review here studies on autonomic functions and clinical disturbances in narcoleptic patients, trying to shed light on the possible contribute of alterations of the hypocretin system in autonomic pathophysiology.

  15. Oily skin

    Science.gov (United States)

    ... keep your skin clean using warm water and soap, or a soapless cleanser. Clean your face with astringent pads if frequent face washing causes irritation. Use only water-based or oil-free cosmetics if you have oily skin. Your ...

  16. Architecture of autonomous systems

    Science.gov (United States)

    Dikshit, Piyush; Guimaraes, Katia; Ramamurthy, Maya; Agrawala, Ashok; Larsen, Ronald L.

    1989-01-01

    Automation of Space Station functions and activities, particularly those involving robotic capabilities with interactive or supervisory human control, is a complex, multi-disciplinary systems design problem. A wide variety of applications using autonomous control can be found in the literature, but none of them seem to address the problem in general. All of them are designed with a specific application in mind. In this report, an abstract model is described which unifies the key concepts underlying the design of automated systems such as those studied by the aerospace contractors. The model has been kept as general as possible. The attempt is to capture all the key components of autonomous systems. With a little effort, it should be possible to map the functions of any specific autonomous system application to the model presented here.

  17. Decreased myocardial perfusion reserve in diabetic autonomic neuropathy

    DEFF Research Database (Denmark)

    Taskiran, Mustafa; Fritz-Hansen, Thomas; Rasmussen, Verner;

    2002-01-01

    The pathophysiological mechanisms responsible for increased cardiovascular mortality in diabetic autonomic neuropathy are unknown. To investigate the effect of autonomic neuropathy on myocardial function, we performed dynamic contrast-enhanced magnetic resonance perfusion imaging during baseline...... conditions and after Dipyridamole-induced vasodilatation in nine type 1 diabetic patients with autonomic neuropathy (AN+), defined by cardiovascular tests, as well as in 10 type 1 diabetic patients without autonomic neuropathy (AN-) and 10 healthy control subjects. Baseline myocardial perfusion index (K...... blood pressure response to Dipyridamole and myocardial perfusion reserve index. We conclude that type 1 diabetic patients with autonomic neuropathy have a decreased myocardial perfusion reserve capacity when challenged with a vasodilatator, a finding that may in part be the pathophysiological substrate...

  18. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  19. Autonomous electrochromic assembly

    Science.gov (United States)

    Berland, Brian Spencer; Lanning, Bruce Roy; Stowell, Jr., Michael Wayne

    2015-03-10

    This disclosure describes system and methods for creating an autonomous electrochromic assembly, and systems and methods for use of the autonomous electrochromic assembly in combination with a window. Embodiments described herein include an electrochromic assembly that has an electrochromic device, an energy storage device, an energy collection device, and an electrochromic controller device. These devices may be combined into a unitary electrochromic insert assembly. The electrochromic assembly may have the capability of generating power sufficient to operate and control an electrochromic device. This control may occur through the application of a voltage to an electrochromic device to change its opacity state. The electrochromic assembly may be used in combination with a window.

  20. Systemic morphine treatment induces changes in firing patterns and responses of nociceptive afferent fibers in mouse glabrous skin

    OpenAIRE

    Hogan, Dale; Baker, Alyssa L.; Morón, Jose A.; Carlton, Susan M.

    2013-01-01

    Patients receiving opioids for pain may experience decreased effectiveness of the drug and even abnormal pain sensitivity – either hyperalgesia and/or allodynia. We hypothesize that peripheral nociceptor hyperexcitability contributes to opioid-induced hyperalgesia and test this using an in vitro mouse glabrous skin-nerve preparation. Mice were injected i.p. with escalating doses of morphine (5, 8, 10, 15 mg/kg) or saline every 12 h for 48 h and sacrificed ~12 h following the last injection. R...

  1. Detection of pathogenic bacteria in skin lesions of patients with chiclero's ulcer: reluctant response to antimonial treatment

    Directory of Open Access Journals (Sweden)

    Isaac-Márquez Angélica Patricia

    2003-01-01

    Full Text Available We investigated the bacterial flora present in skin lesions of patients with chiclero's ulcer from the Yucatan peninsula of Mexico using conventional culture methods (11 patients, and an immunocolorimetric detection of pathogenic Streptococcus pyogenes (15 patients. Prevalence of bacteria isolated by culture methods was 90.9% (10/11. We cultured, from chiclero's ulcers (60%, pathogenic bacterial such as Staphylococcus aureus (20%, S. pyogenes (1.6%, Pseudomonas aeruginosa (1.6%, Morganella morganii (1.6%, and opportunist pathogenic bacteria such as Klebsiella spp. (20.0%, Enterobacter spp. (20%, and Enterococcus spp. (20%. We also cultured coagulase-negative staphylococci in 40% (4/10 of the remaining patients. Micrococcus spp. and coagulase-negative staphylococci constituted the bacterial genuses more frequently isolated in the normal skin of patients with chiclero's ulcer and healthy individuals used as controls. We also undertook another study to find out the presence of S. pyogenes by an immunocolorimetric assay. This study indicated that 60% (9/15 of the ulcerated lesions, but not normal controls, were contaminated with S. pyogenes. Importantly, individuals with purulent secretion and holding concomitant infections with S. pyogenes, S. aureus, P. aeruginosa, M. morganii, and E. durans took longer to heal Leishmania (L. mexicana infections treated with antimonial drugs. Our results suggest the need to eliminate bacterial purulent infections, by antibiotic treatment, before starting antimonial administration to patients with chiclero's ulcer.

  2. Synthetic antimicrobial and LPS-neutralising peptides suppress inflammatory and immune responses in skin cells and promote keratinocyte migration.

    Science.gov (United States)

    Pfalzgraff, Anja; Heinbockel, Lena; Su, Qi; Gutsmann, Thomas; Brandenburg, Klaus; Weindl, Günther

    2016-01-01

    The stagnation in the development of new antibiotics and the concomitant high increase of resistant bacteria emphasize the urgent need for new therapeutic options. Antimicrobial peptides are promising agents for the treatment of bacterial infections and recent studies indicate that Pep19-2.5, a synthetic anti-lipopolysaccharide (LPS) peptide (SALP), efficiently neutralises pathogenicity factors of Gram-negative (LPS) and Gram-positive (lipoprotein/-peptide, LP) bacteria and protects against sepsis. Here, we investigated the potential of Pep19-2.5 and the structurally related compound Pep19-4LF for their therapeutic application in bacterial skin infections. SALPs inhibited LP-induced phosphorylation of NF-κB p65 and p38 MAPK and reduced cytokine release and gene expression in primary human keratinocytes and dermal fibroblasts. In LPS-stimulated human monocyte-derived dendritic cells and Langerhans-like cells, the peptides blocked IL-6 secretion, downregulated expression of maturation markers and inhibited dendritic cell migration. Both SALPs showed a low cytotoxicity in all investigated cell types. Furthermore, SALPs markedly promoted cell migration via EGFR transactivation and ERK1/2 phosphorylation and accelerated artificial wound closure in keratinocytes. Peptide-induced keratinocyte migration was mediated by purinergic receptors and metalloproteases. In contrast, SALPs did not affect proliferation of keratinocytes. Conclusively, our data suggest a novel therapeutic target for the treatment of patients with acute and chronic skin infections. PMID:27509895

  3. Overview of the Autonomic Nervous System

    Science.gov (United States)

    ... reversible or progressive. Anatomy of the autonomic nervous system The autonomic nervous system is the part of ... they connect with. Function of the autonomic nervous system The autonomic nervous system controls internal body processes ...

  4. Skin Infections Due to Corynebacterium

    OpenAIRE

    Meltem Türkmen; Derya Aytimur

    2010-01-01

    Corynebacteria are Gram-positive, non-sporulated, non-capsulated, aerobic diphtheroid bacteria accounting for nearly 50%of the natural skin biocene. This bacterial family is responsible for various skin diseases such as cutaneous diphteria, cromhydrosis, bromhydrosis but the most common of them are pitted keratolysis, trichobacteriosis and erythrasma. A warm and moist environment and poor hygiene are the predisposition factors for these three diseases. Although this skin diseases are seen mor...

  5. Skin Cancer in Skin of Color

    OpenAIRE

    Bradford, Porcia T.

    2009-01-01

    Skin cancers in skin of color often present atypically or with advanced stage in comparison to Caucasian patients. Health care providers must maintain a high index of suspicion when examining skin lesions in skin of color.

  6. ADAM: ADaptive Autonomous Machine

    NARCIS (Netherlands)

    Oosten, van Daan C.; Nijenhuis, Lucas F.J.; Bakkers, André W.P.; Vervoort, Wiek A.

    1996-01-01

    This paper describes a part of the development of an adaptive autonomous machine that is able to move in an unknown world extract knowledge out of the perceived data, has the possibility to reason, and finally has the capability to exchange experiences and knowledge with other agents. The agent is n

  7. Software Architecture for Autonomous Spacecraft

    Science.gov (United States)

    Shih, Jimmy S.

    1997-01-01

    The thesis objective is to design an autonomous spacecraft architecture to perform both deliberative and reactive behaviors. The Autonomous Small Planet In-Situ Reaction to Events (ASPIRE) project uses the architecture to integrate several autonomous technologies for a comet orbiter mission.

  8. Skin abscess

    Science.gov (United States)

    ... infection (often staphylococcus) A minor wound or injury Boils Folliculitis (infection in a hair follicle) A skin ... Elsevier Churchill Livingstone; 2009:chap 90. Read More Boils Endocarditis Folliculitis MRSA Osteomyelitis Update Date 11/12/ ...

  9. Skin graft

    Science.gov (United States)

    ... caused a large amount of skin loss Burns Cosmetic reasons or reconstructive surgeries where there has been ... Smoking increases your chance of problems such as slow healing. Ask your doctor or nurse for help ...

  10. Skin Pigment

    Science.gov (United States)

    ... This Article Medical Dictionary Also of Interest (Quiz) Vitiligo (Video) Hives Additional Content Medical News Overview of ... Version Pigment Disorders Overview of Skin Pigment Albinism Vitiligo Hyperpigmentation Melasma Melanin is the brown pigment that ...

  11. Shortening Record in the Central Andean Plateau of Southern Peru: Basement Inversion, Thin-skinned Thrusting, and Geomorphic Response

    Science.gov (United States)

    Perez, N.; Horton, B. K.; McQuarrie, N.; Stübner, K.; Ehlers, T. A.

    2015-12-01

    Variations in the inherited structural architecture along western South America influence the timing, magnitude, and style of Andean deformation and topographic evolution. New results from mapping, balanced cross-section construction, apatite and zircon (U-Th)/He thermochronology, and geomorphology spanning the Altiplano, Eastern Cordillera and Subandean zone of southern Peru define the role of Triassic rift inversion on Cenozoic deformation style, thrust belt kinematics, exhumation timing, and spatial variation of canyon incision. A minimum of 130 km (38%) shortening along a 200 km transect accommodated by thin- and thick-skinned structures involved selective reactivation of Triassic normal faults that fed slip to shallower detachments of thin-skinned fold-thrust systems. Map relationships define unique structural domains defined by inherited normal faults. In the Eastern Cordillera, new zircon (U-Th)/He results from a Triassic pluton reveal Oligocene-Miocene (~26-18 Ma) cooling, consistent with previously reported exhumation from ~40 km along strike to the NW. However, rapid ~15 Ma cooling revealed by new apatite (U-Th)/He data is ~11 Myr older than equivalent rocks in a similar structural setting ~40 km to the NW. This suggests a potential middle Miocene shift from synchronous to diachronous exhumation along strike. Modern fluvial profiles constructed along the Eastern Cordillera show a reduction in knickpoint elevations from SE to NW, suggesting more youthful uplift toward the NW, comparable to the spatial trend in apatite (U-Th)/He ages. The deformation front reached the Subandean zone by ~15 Ma, after the majority of reported deformation in the Eastern Cordillera and Altiplano. These variations in exhumation over such distances are consistent with multiple potential scenarios: a northward propagating wave of uplift, spatial variations in climatically driven incision, interactions with mantle dynamics, or complex structural geometries.

  12. Assessing complexity of skin blood flow oscillations in response to locally applied heating and pressure in rats: Implications for pressure ulcer risk

    Science.gov (United States)

    Liao, Fuyuan; O'Brien, William D.; Jan, Yih-Kuen

    2013-10-01

    The objective of this study was to investigate the effects of local heating on the complexity of skin blood flow oscillations (BFO) under prolonged surface pressure in rats. Eleven Sprague-Dawley rats were studied: 7 rats underwent surface pressure with local heating (△t=10 °C) and 4 rats underwent pressure without heating. A pressure of 700 mmHg was applied to the right trochanter area of rats for 3 h. Skin blood flow was measured using laser Doppler flowmetry. The loading period was divided into nonoverlapping 30 min epochs. For each epoch, multifractal detrended fluctuation analysis (MDFA) was utilized to compute DFA coefficients and complexity of endothelial related metabolic, neurogenic, and myogenic frequencies of BFO. The results showed that under surface pressure, local heating led to a significant decrease in DFA coefficients of myogenic frequency during the initial epoch of loading period, a sustained decrease in complexity of myogenic frequency, and a significantly higher degree of complexity of metabolic frequency during the later phase of loading period. Surrogate tests showed that the reduction in complexity of myogenic frequency was associated with a loss of nonlinearity whereas increased complexity of metabolic frequency was associated with enhanced nonlinearity. Our results indicate that increased metabolic activity and decreased myogenic response due to local heating manifest themselves not only in magnitudes of metabolic and myogenic frequencies but also in their structural complexity. This study demonstrates the feasibility of using complexity analysis of BFO to monitor the ischemic status of weight-bearing skin and risk of pressure ulcers.

  13. Influence of Clothing Fabrics on Skin Microcirculation

    Institute of Scientific and Technical Information of China (English)

    CHENG Ling; PAN Ning; ZHAO Lian-ying; HUAUNG Gu

    2010-01-01

    This study investigated the effects of clothing fabric on human skin microcirculation. Once skin is covered with a clothing fabric, human sensations, namely, coolness, warmth, softness, and roughness, are amused immediately, and the cutaneous micrecireulation may be changed consequently. Since the complex relationships of the human skin, the environment, and the clothing, there is few publication focusing on the physiological responses of the skin to the fabrics. In this paper, a Laser Doppler Flowmetry (LDF) was used to test the dynamic responses of the skin blood flow when the fabric was placed on the skin. Effects of different fabrics on the skin blood flux were investigated. The results show that cold stimulation of fabric has remarkable influences on the skin blood flux, and the surface properties of fabric are of importance to affect the human skin blood flow.

  14. Skin Cancer Screening

    Science.gov (United States)

    ... Genetics of Skin Cancer Skin Cancer Screening Research Skin Cancer Screening (PDQ®)–Patient Version What is screening? Go ... These are called diagnostic tests . General Information About Skin Cancer Key Points Skin cancer is a disease in ...

  15. Pain-induced skin autoimmunity

    OpenAIRE

    Odoardi, Francesca; Neuhuber, Winfried; Flügel, Alexander

    2014-01-01

    A recent paper published in Nature reports sensory nerve fibers in the skin that give local immune cells important instructions for the organization of an immune response; in this particular case the cooperation between the nervous and immune systems had disastrous consequences, namely an auto-destruction of the skin.

  16. Response of the snowmelt and glacier runoff to the climate warming-up in the last 40 years in Xinjiang Autonomous Region, China

    Institute of Scientific and Technical Information of China (English)

    叶佰生; 丁永建; 康尔泗; 李纲; 韩添丁

    1999-01-01

    Some analytical results of the measured runoff during 1950s to 1980s at outlet hydrological stations of 33 main rivers and climatic data collected from 84 meteorological stations in Xinjiang Autonomous Region are presented.Comparison of hydrological and climatic parameters before and after 1980 shows that the spring runoff for most rivers after 1980s increased obviously at a rate of about 10%, though the spring air temperature did not rise very much. Especially,an increment by 20% for alpine runoff is observed during May when intensive snow melting occurred in the alpine region. To the contrary, the runoff in June decreased about 5%. When the summer or annual runoff is taken into account,direct relationship can be found between the change in runoff and the ratio of glacier-coverage, except the runoff in August when the glacier melting is strong, indicating that climatic warming has an obvious effect on the contribution of glacier melting to the runoff increase.

  17. The Association between Baseline Subjective Anxiety Rating and Changes in Cardiac Autonomic Nervous Activity in Response to Tryptophan Depletion in Healthy Volunteers.

    Science.gov (United States)

    Hsiao, Chih Yin; Tsai, Hsin Chun; Chi, Mei Hung; Chen, Kao Chin; Chen, Po See; Lee, I Hui; Yeh, Tzung Lieh; Yang, Yen Kuang

    2016-05-01

    The aim of this study was to investigate the influence of serotonin on anxiety and autonomic nervous system (ANS) function; the correlation between subjective anxiety rating and changes of ANS function following tryptophan depletion (TD) in healthy volunteers was examined. Twenty-eight healthy participants, consisting of 15 females and 13 males, with an average age of 33.3 years, were recruited.Baseline Chinese Symptom Checklist-90-Revised and ANS function measurements were taken. TD was carried out on the testing day, and participants provided blood samples right before and 5 hours after TD. ANS function, somatic symptoms, and Visual Analogue Scales (VASs) were determined after TD. Wilcoxon signed rank test and Spearman ρ correlation were adapted for analyses of the results.The TD procedure reduced total and free plasma tryptophan effectively. After TD, the sympathetic nervous activity increased and parasympathetic nervous activity decreased. Baseline anxiety ratings positively correlated with post-TD changes in sympathetic nervous activity, VAS ratings, and physical symptoms. However, a negative correlation with post-TD changes in parasympathetic nervous activity was found.The change in ANS function after TD was associated with the severity of anxiety in healthy volunteers. This supports the fact that the effect of anxiety on heart rate variability is related to serotonin vulnerability. Furthermore, it also shows that the subjective anxiety rating has a biological basis related to serotonin.

  18. Skin Infections Due to Corynebacterium

    Directory of Open Access Journals (Sweden)

    Meltem Türkmen

    2010-03-01

    Full Text Available Corynebacteria are Gram-positive, non-sporulated, non-capsulated, aerobic diphtheroid bacteria accounting for nearly 50%of the natural skin biocene. This bacterial family is responsible for various skin diseases such as cutaneous diphteria, cromhydrosis, bromhydrosis but the most common of them are pitted keratolysis, trichobacteriosis and erythrasma. A warm and moist environment and poor hygiene are the predisposition factors for these three diseases. Although this skin diseases are seen more frequently, they usually mistaken for a mycotic infection by general practitioners, with subsequent antimycotic treatment. Here skin diseases compromised with Corynebacterium are presented with their demographic features and discussed on the basis of a literature review.

  19. Immunity and skin cancer

    Energy Technology Data Exchange (ETDEWEB)

    Smith, E.B.; Brysk, M.M.

    1981-01-01

    Observations in humans and animal studies support the theory that immunologic surveillance plays an important role in limiting the development of skin malignancies. These immune responses undergo progressive diminution with age. In addition, other factors, such as bereavement, poor nutrition, and acute and chronic exposure to ultraviolet light, can further diminish immune mechanisms.

  20. Gating of the vertex somatosensory and auditory evoked potential P50 and the correlation to skin conductance orienting response in healthy men.

    Science.gov (United States)

    Arnfred, S M; Eder, D N; Hemmingsen, R P; Glenthøj, B Y; Chen, A C

    2001-04-15

    A defect in auditory evoked potential (AEP) P50 gating supports the theory of information-processing deficits in schizophrenia. The relationship between gating of the mid-latency evoked potentials (EP) in the somatosensory and the auditory modalities has not been studied together before. In schizophrenia, we might expect the processing deficits to act on multiple modalities. We have examined the gating of median nerve somatosensory EP (SEP) following paired stimulation identical to the AEP P50 gating paradigm using interstimulus intervals (ISI) of 500, 750 and 1000 ms and the correlation of gating to the skin conductance orienting response (SCOR) in 20 healthy men. We measured mid-latency vertex components (SEP: P50, N65, P85 and N100; AEP: P30, N45, P50 and N80). The gating was most pronounced at ISI 500 ms where the SEP P50 and N100 gating were 0.59 and 0.37, respectively, as compared to a gating of 0.61 in P30, 0.33 in P50 and 0.45 in N80 in the AEP. Repetition effects in the two modalities were not correlated. AEP P50 gating was correlated to skin conductance level (SCL). The combination of recording repetition effects on the mid-latency EP in two modalities could provide a method for investigating if deficits of information processing in schizophrenia are cross-modal.

  1. Autophagy in human skin fibroblasts: Comparison between young and aged cells and evaluation of its cellular rhythm and response to Ultraviolet A radiation.

    Science.gov (United States)

    Pernodet, Nadine; Dong, Kelly; Pelle, Edward

    2016-01-01

    Autophagic mechanisms play critical roles in cell maintenance. Damaged organelles that are not removed by autophagosomes, which act by engulfing and degrading these cellular components, have been linked to various pathologies. Recently, the progression of aging has also been correlated to a compromised autophagic response. Here, we report for the first time a significant reduction in autophagic levels in synchronized aged normal human skin fibroblasts as compared to young fibroblasts. We measured a 77.9% reduction in autophagy as determined by reverse transcription-polymerase chain reaction for LC3B expression, a microtubule-associated protein correlated to late stage autophagosome formation. In addition, we visualized these same changes by immunocytofluorescence with antibodies directed against LC3B. By harvesting synchronized, as well as unsynchronized cells over time, we were also able to measure for the first time a nighttime peak in autophagy that was present in young but absent in aged fibroblasts. Finally, since human skin is constantly subjected to environmentally induced oxidative stress from sunlight, we exposed fibroblasts to 10 J/cm2 ultraviolet A and found, in good agreement with current literature, not only that irradiation could partially reactivate autophagy in the aged cells, but also that this increase was phase shifted earlier from its endogenous temporal pattern because of its loss of synchronization with circadian rhythm.

  2. Psychophysiological responses to auditory change.

    Science.gov (United States)

    Chuen, Lorraine; Sears, David; McAdams, Stephen

    2016-06-01

    A comprehensive characterization of autonomic and somatic responding within the auditory domain is currently lacking. We studied whether simple types of auditory change that occur frequently during music listening could elicit measurable changes in heart rate, skin conductance, respiration rate, and facial motor activity. Participants heard a rhythmically isochronous sequence consisting of a repeated standard tone, followed by a repeated target tone that changed in pitch, timbre, duration, intensity, or tempo, or that deviated momentarily from rhythmic isochrony. Changes in all parameters produced increases in heart rate. Skin conductance response magnitude was affected by changes in timbre, intensity, and tempo. Respiratory rate was sensitive to deviations from isochrony. Our findings suggest that music researchers interpreting physiological responses as emotional indices should consider acoustic factors that may influence physiology in the absence of induced emotions. PMID:26927928

  3. Exercise and the autonomic nervous system.

    Science.gov (United States)

    Fu, Qi; Levine, Benjamin D

    2013-01-01

    The autonomic nervous system plays a crucial role in the cardiovascular response to acute (dynamic) exercise in animals and humans. During exercise, oxygen uptake is a function of the triple-product of heart rate and stroke volume (i.e., cardiac output) and arterial-mixed venous oxygen difference (the Fick principle). The degree to which each of the variables can increase determines maximal oxygen uptake (V˙O2max). Both "central command" and "the exercise pressor reflex" are important in determining the cardiovascular response and the resetting of the arterial baroreflex during exercise to precisely match systemic oxygen delivery with metabolic demand. In general, patients with autonomic disorders have low levels of V˙O2max, indicating reduced physical fitness and exercise capacity. Moreover, the vast majority of the patients have blunted or abnormal cardiovascular response to exercise, especially during maximal exercise. There is now convincing evidence that some of the protective and therapeutic effects of chronic exercise training are related to the impact on the autonomic nervous system. Additionally, training induced improvement in vascular function, blood volume expansion, cardiac remodeling, insulin resistance and renal-adrenal function may also contribute to the protection and treatment of cardiovascular, metabolic and autonomic disorders. Exercise training also improves mental health, helps to prevent depression, and promotes or maintains positive self-esteem. Moderate-intensity exercise at least 30 minutes per day and at least 5 days per week is recommended for the vast majority of people. Supervised exercise training is preferable to maximize function capacity, and may be particularly important for patients with autonomic disorders. PMID:24095123

  4. Effect of Sleep/Wake Cycle on Autonomic Regulation

    International Nuclear Information System (INIS)

    Objective: To evaluate the association between irregular sleep/wake cycle in shift workers and autonomic regulation. Study Design: Cross-sectional, analytical study. Place and Duration of Study: Dow University Hospital, Karachi, from August to November 2013. Methodology: All health care providers working in rotating shifts making a total (n=104) were included. Instrument was an integrated questionnaire applied to assess autonomic regulation, taken from Kroz et al. on scoring criteria, ranging from 18 - 54, where higher rating signifies strong autonomic regulation, indicating a stable Autonomic Nervous System (ANS) and vice versa. Participants were interviewed and their response was recorded by the investigator. Influence of sleep misalignment was measured quantitatively to extract index of autonomic activity. Results: There was a reduced trend in autonomic strength amongst shift workers. The mean score obtained on the Autonomic Scale was 37.8 ± 5.9. Conclusion: Circadian misalignment has an injurious influence on ANS which might be valuable in controlling autonomic dysfunction that leads to fatal triggers in rotating shift workers. (author)

  5. Skin barrier function in healthy volunteers as assessed by transepidermal water loss and vascular response to hexyl nicotinate: intra- and inter-individual variability.

    Science.gov (United States)

    Oestmann, E; Lavrijsen, A P; Hermans, J; Ponec, M

    1993-02-01

    This study assesses the variability of two non-invasive methods of measuring stratum corneum barrier function in vivo. Transepidermal water loss (TEWL), and the vascular response to hexyl nicotinate (HN) penetration as determined by laser-Doppler flowmetry, were measured in a group of 21 healthy volunteers. Each time profile of the vascular response to HN penetration was analysed using the following parameters: the baseline cutaneous blood flow, the lag-time between application and initial response (t0), the time between application and maximum response (tmax), the maximum response, and the slope of the curve. TEWL measured on the left volar forearm showed a normal range of 3.9-7.6 g/m2h and a small inter-individual variability [coefficient of variation (CV) 19.4%]. TEWL values at three other forearm sites did not show differences of clinical importance compared with the left volar forearm. The parameters of the vascular response to HN penetration spanned a wider normal range than the TEWL values (CV between 33 and 52%). Repeat measurements after a 1-2 month interval showed highly reproducible individual TEWL values. The mean difference between first and second measurements was only 0.03 g/m2h; the relative difference 0.6%. The intra-individual reproducibility of t0 and tmax. for HN penetration was also high (relative differences of 2.8 and 3.1%, respectively). The other vascular response parameters were less reproducible (relative differences of 6.9-18.6%). We conclude that TEWL and selected parameters of HN penetration, as non-invasive tests of the stratum corneum barrier function, yield reproducible results and are hence useful for investigations assessing the skin barrier function in various disorders.

  6. Pathophysiological Study of Sensitive Skin.

    Science.gov (United States)

    Buhé, Virginie; Vié, Katell; Guéré, Christelle; Natalizio, Audrey; Lhéritier, Céline; Le Gall-Ianotto, Christelle; Huet, Flavien; Talagas, Matthieu; Lebonvallet, Nicolas; Marcorelles, Pascale; Carré, Jean-Luc; Misery, Laurent

    2016-03-01

    Sensitive skin is a clinical syndrome characterized by the occurrence of unpleasant sensations, such as pruritus, burning or pain, in response to various factors, including skincare products, water, cold, heat, or other physical and/or chemical factors. Although these symptoms suggest inflammation and the activation of peripheral innervation, the pathophysiogeny of sensitive skin remains unknown. We systematically analysed cutaneous biopsies from 50 healthy women with non-sensitive or sensitive skin and demonstrated that the intraepidermal nerve fibre density, especially that of peptidergic C-fibres, was lower in the sensitive skin group. These fibres are involved in pain, itching and temperature perception, and their degeneration may promote allodynia and similar symptoms. These results suggest that the pathophysiology of skin sensitivity resembles that of neuropathic pruritus within the context of small fibre neuropathy, and that environmental factors may alter skin innervation.

  7. Pathophysiological Study of Sensitive Skin.

    Science.gov (United States)

    Buhé, Virginie; Vié, Katell; Guéré, Christelle; Natalizio, Audrey; Lhéritier, Céline; Le Gall-Ianotto, Christelle; Huet, Flavien; Talagas, Matthieu; Lebonvallet, Nicolas; Marcorelles, Pascale; Carré, Jean-Luc; Misery, Laurent

    2016-03-01

    Sensitive skin is a clinical syndrome characterized by the occurrence of unpleasant sensations, such as pruritus, burning or pain, in response to various factors, including skincare products, water, cold, heat, or other physical and/or chemical factors. Although these symptoms suggest inflammation and the activation of peripheral innervation, the pathophysiogeny of sensitive skin remains unknown. We systematically analysed cutaneous biopsies from 50 healthy women with non-sensitive or sensitive skin and demonstrated that the intraepidermal nerve fibre density, especially that of peptidergic C-fibres, was lower in the sensitive skin group. These fibres are involved in pain, itching and temperature perception, and their degeneration may promote allodynia and similar symptoms. These results suggest that the pathophysiology of skin sensitivity resembles that of neuropathic pruritus within the context of small fibre neuropathy, and that environmental factors may alter skin innervation. PMID:26337000

  8. Mobile Autonomous Humanoid Assistant

    Science.gov (United States)

    Diftler, M. A.; Ambrose, R. O.; Tyree, K. S.; Goza, S. M.; Huber, E. L.

    2004-01-01

    A mobile autonomous humanoid robot is assisting human co-workers at the Johnson Space Center with tool handling tasks. This robot combines the upper body of the National Aeronautics and Space Administration (NASA)/Defense Advanced Research Projects Agency (DARPA) Robonaut system with a Segway(TradeMark) Robotic Mobility Platform yielding a dexterous, maneuverable humanoid perfect for aiding human co-workers in a range of environments. This system uses stereo vision to locate human team mates and tools and a navigation system that uses laser range and vision data to follow humans while avoiding obstacles. Tactile sensors provide information to grasping algorithms for efficient tool exchanges. The autonomous architecture utilizes these pre-programmed skills to form human assistant behaviors. The initial behavior demonstrates a robust capability to assist a human by acquiring a tool from a remotely located individual and then following the human in a cluttered environment with the tool for future use.

  9. Effects of Betel chewing on the central and autonomic nervous systems.

    Science.gov (United States)

    Chu, N S

    2001-01-01

    Betel chewing has been claimed to produce a sense of well-being, euphoria, heightened alertness, sweating, salivation, a hot sensation in the body and increased capacity to work. Betel chewing also leads to habituation, addiction and withdrawal. However, the mechanisms underlying these effects remain poorly understood. Arecoline, the major alkaloid of Areca nut, has been extensively studied, and several effects of betel chewing are thought to be related to the actions of this parasympathomimetic constituent. However, betel chewing may produce complex reactions and interactions. In the presence of lime, arecoline and guvacoline in Areca nut are hydrolyzed into arecaidine and guvacine, respectively, which are strong inhibitors of GABA uptake. Piper betle flower or leaf contains aromatic phenolic compounds which have been found to stimulate the release of catecholamines in vitro. Thus, betel chewing may affect parasympathetic, GABAnergic and sympathetic functions. Betel chewing produces an increase in heart rate, blood pressure, sweating and body temperature. In addition, EEG shows widespread cortical desynchronization indicating a state of arousal. In autonomic function tests, both the sympathetic skin response and RR interval variation are affected. Betel chewing also increases plasma concentrations of norepinephrine and epinephrine. These results suggest that betel chewing mainly affects the central and autonomic nervous systems. Future studies should investigate both the acute and chronic effects of betel chewing. Such studies may further elucidate the psychoactive mechanisms responsible for the undiminished popularity of betel chewing since antiquity. PMID:11385294

  10. Mobile Intelligent Autonomous Systems

    OpenAIRE

    Jitendra R. Raol; Ajith Gopal

    2010-01-01

    Mobile intelligent autonomous systems (MIAS) is a fast emerging research area. Although it can be regarded as a general R&D area, it is mainly directed towards robotics. Several important subtopics within MIAS research are:(i) perception and reasoning, (ii) mobility and navigation,(iii) haptics and teleoperation, (iv) image fusion/computervision, (v) modelling of manipulators, (vi) hardware/software architectures for planning and behaviour learning leadingto robotic architecture, (vii) ve...

  11. Delayed habituation of the skin-conductance orienting response correlates with impaired performance on the Wisconsin Card Sorting Task in schizophrenia.

    Science.gov (United States)

    Schiffer, R A; Sigal, M; Mintz, M

    1996-11-15

    The skin-conductance orienting response (SCOR) in schizophrenia is often characterized by either nonresponding or delayed habituation to repeated nonsignal tones. These abnormalities are poorly related to other dimensions of schizophrenia. In the present study, we confirmed that about 50% of patients with chronic schizophrenia are SCOR nonresponders. Nonresponders, however, did not differ from responders on postmorbid psychiatric or pharmacological course, and we therefore could not confirm the hypothesis that course of illness follows a more marked pattern of increasing severity in nonresponders. Performance on the Wisconsin Card Sorting Test (WCST) was particularly poor in a subgroup of responders who exhibited either delayed habituation and/or dishabituation of SCORs to tones applied after a short rest period. It is possible that pathology of the prefrontal cortex mediates the SCOR abnormalities that characterize schizophrenic patients who perform poorly on the WCST.

  12. Investigating the Effect of Sympathetic Skin Response Parameters on the Psychological Test Scores in Patients with Fibromyalgia Syndrome by Using ANNS

    Directory of Open Access Journals (Sweden)

    Murat Yıldız

    2013-01-01

    Full Text Available In this study, psychological tests such as Visual Analogue Pain Scale, Verbal Pain Scale, Beck Depression Inventory, Beck Anxiety Inventory, Hamilton Depression Rating Scale and Hamilton Anxiety Scale were applied to the selected healthy subjects and patients with Fibromyalgia Syndrome (FMS in Suleyman Demirel University, Faculty of Medicine, Department of Physical Medicine and Rehabilitation and the scores were recorded. A measurement system was established in the same department of the university to measure the sympathetic skin response (SSR from the subjects. The SSR was measured and recorded. The parameters such as latency time, maximum amplitude and the elapsed time were calculated by using Matlab software from the recorded SSR data. SSR parameters were added to the scores and diagnosis accuracy percentages of the FMS calculated by using artificial neural networks (ANNs. Obtained results from the simulations showed that the specified parameters of the SSR and FMS were concerned and these parameters can be used as a diagnostic method in FMS.

  13. The diverse and amazing allergic responses to coloured semi-synthetic fabrics in skin of man, woman and transgenders (MTF and FTM

    Directory of Open Access Journals (Sweden)

    lLorenzo Martini

    2016-04-01

    Full Text Available We have attempted to determinate how three particular synthetic or semi-synthetic fabrics (that are serge, polycotton and spandex may interact with the skin of Males, Females or Transsexuals (MtFs and/or FtMs, when these individuals put on these fibers directly on nude epidermis. Transsexuals are to be considered, in this seat, all the subjects that take on purpose the relative opposite hormones to try to change or determinately change their sex, that is Men who take estrogens and Women who take Testosterone to grow transgender. Hormonal influence is to be reputed the chief responsible cause of the occurrence of diverse cutaneous manifestations. Results are extremely suggestive and show that hormonal influence is actually the primary cause of histamine and bradikyne cascade, apt to evoke odd cutaneous manifestations in Man, Woman or Transgender, depending on the type, idest, if the transgender is MtF or FtM.

  14. The vasomotor component of the orienting response in man related to spontaneous fluctuation of vasomotor activity in the acral skin zone.

    Science.gov (United States)

    Kellerová, E; Ruttkay-Nedecký, I

    1978-10-01

    A plethymographic study of the effect of a weak indifferent light or sound stimulus and of a physically identical light stimulus with signal meaning on vasomotor activity in the acral skin zone of man has shown that during stimulus presentation there was a significant rise in the percent of occurrence of vasmotor waves corresponding to the criteria for the vasomotor orienting response (VOR). VOR is elicited significantly more often by stimuli with signal meaning than by physically identical indifferent stimuli. After the acute extinction or VOR disinhibition followed in all cases, and after 40--60 repeated stimuli the occurrence of VOR was still significant. Repeated stimuli had a significant effect on the course of the plethysmographic curve, especially on the component of waves of third order, changing the frequency spectrum and time contingency of waves.

  15. Nature's Autonomous Oscillators

    Science.gov (United States)

    Mayr, H. G.; Yee, J.-H.; Mayr, M.; Schnetzler, R.

    2012-01-01

    Nonlinearity is required to produce autonomous oscillations without external time dependent source, and an example is the pendulum clock. The escapement mechanism of the clock imparts an impulse for each swing direction, which keeps the pendulum oscillating at the resonance frequency. Among nature's observed autonomous oscillators, examples are the quasi-biennial oscillation and bimonthly oscillation of the Earth atmosphere, and the 22-year solar oscillation. The oscillations have been simulated in numerical models without external time dependent source, and in Section 2 we summarize the results. Specifically, we shall discuss the nonlinearities that are involved in generating the oscillations, and the processes that produce the periodicities. In biology, insects have flight muscles, which function autonomously with wing frequencies that far exceed the animals' neural capacity; Stretch-activation of muscle contraction is the mechanism that produces the high frequency oscillation of insect flight, discussed in Section 3. The same mechanism is also invoked to explain the functioning of the cardiac muscle. In Section 4, we present a tutorial review of the cardio-vascular system, heart anatomy, and muscle cell physiology, leading up to Starling's Law of the Heart, which supports our notion that the human heart is also a nonlinear oscillator. In Section 5, we offer a broad perspective of the tenuous links between the fluid dynamical oscillators and the human heart physiology.

  16. Functional Imaging of Autonomic Regulation: Methods and Key Findings

    Directory of Open Access Journals (Sweden)

    Paul M Macey

    2016-01-01

    Full Text Available Central nervous system processing of autonomic function involves a network of regions throughout the brain which can be visualized and measured with neuroimaging techniques, notably functional magnetic resonance imaging (fMRI. The development of fMRI procedures has both confirmed and extended earlier findings from animal models, and human stroke and lesion studies. Assessments with fMRI can elucidate interactions between different central sites in regulating normal autonomic patterning, and demonstrate how disturbed systems can interact to produce aberrant regulation during autonomic challenges. Understanding autonomic dysfunction in various illnesses reveals mechanisms that potentially lead to interventions in the impairments. The objectives here are to: 1 describe the fMRI neuroimaging methodology for assessment of autonomic neural control, 2 outline the widespread, lateralized distribution of function in autonomic sites in the normal brain which includes structures from the neocortex through the medulla and cerebellum, 3 illustrate the importance of the time course of neural changes when coordinating responses, and how those patterns are impacted in conditions of sleep-disordered breathing, and 4 highlight opportunities for future research studies with emerging methodologies. Methodological considerations specific to autonomic testing include timing of challenges relative to the underlying fMRI signal, spatial resolution sufficient to identify autonomic brainstem nuclei, blood pressure and blood oxygenation influences on the fMRI signal, and the sustained timing, often measured in minutes of challenge periods and recovery. Key findings include the lateralized nature of autonomic organization, which is reminiscent of asymmetric motor, sensory and language pathways. Testing brain function during autonomic challenges demonstrate closely-integrated timing of responses in connected brain areas during autonomic challenges, and the involvement with

  17. Identification of organ-autonomous constituents of the molecular memory conferred by thyroid hormone exposure in cold temperature-arrested metamorphosing Rana (Lithobates) catesbeiana tadpoles.

    Science.gov (United States)

    Austin Hammond, S; Jackman, Kevin W; Partovi, Shireen H; Veldhoen, Nik; Helbing, Caren C

    2016-03-01

    Environmental temperature modulates thyroid hormone (TH)-dependent metamorphosis in some amphibian species. The North American bullfrog--Rana (Lithobates) catesbeiana - tadpole is naturally adapted to a wide range of temperatures over multiple seasons. Cold temperatures delay while warmer temperatures accelerate metamorphosis. Exogenous TH exposure of premetamorphic tadpoles results in a rapid precocious induction of metamorphosis at warm temperatures (20-25 °C). The same exposure at cold temperatures (4-5 °C) does not elicit an overt metamorphic response. However, a molecular memory of TH exposure is established such that cold, TH-exposed tadpoles returned to permissive warm temperatures will rapidly execute TH-induced genetic programs. Previous mRNA profiling has identified TH-regulated transcription factors encoded by thra, thrb, thibz, klf9, and cebp1 as components of the molecular memory after one week post-exposure. However, a further hierarchy may exist within the initiation phase since many gene transcripts demonstrated tissue-specific patterns. Whether the molecular memory is organ autonomous or requires additional modulating factors is unknown. Herein we examine tail fin and back skin and determine that thibz is the only transcript that is TH-responsive after 2 days post-exposure at low temperature in both tissues in the intact animal. In back skin, cebp1 is also TH-responsive under these conditions. Serum-free tail fin organ culture (C-Fin) reveals that the thibz response is organ autonomous whereas cultured back skin (C-Skin) results suggest that thibz and cebp1 require an additional factor for induction from elsewhere within the intact animal. Subsequent investigations are now possible to identify endogenous factors that modulate the molecular memory in intact animals.

  18. The effects of feeding with synbiotic (Pediococcus acidilactici and fructooligosaccharide) enriched adult Artemia on skin mucus immune responses, stress resistance, intestinal microbiota and performance of angelfish (Pterophyllum scalare).

    Science.gov (United States)

    Azimirad, Mahmood; Meshkini, Saeed; Ahmadifard, Nasrollah; Hoseinifar, Seyed Hossein

    2016-07-01

    The aim of this study was to evaluate the effects of feeding on synbiotic (Pediococcus acidilactici and fructooligosaccharide) enriched adult Artemia franciscana on skin mucus immune responses, stress resistance, intestinal microbiota and growth performance of angelfish (Pterophyllum scalare). Three hundred and sixty fish with initial weight 3.2 ± 0.13 g were randomly divided into twelve aquaria (50 L) assigned to four groups in triplicates. Fish were fed for 7 weeks with dietary treatments, including treatment 1: feeding adult Artemia without enrichment (control group), treatment 2: feeding adult Artemia enriched with lyophilised probiotic P. acidilactici (700 mg L(-1)), 3: feeding adult Artemia enriched with prebiotic fructooligosaccharide (FOS) (100 mg L(-1)), group 4: feeding adult Artemia enriched with synbiotic (P. acidilactici (700 mg L(-1)) + FOS (100 mg L(-1))). Skin mucus immune responses (lysozyme activity, total Immunoglobulin and protease), stress resistance against environmental stress (acute decrease of temperature and increase salinity), intestinal microbiota as well as growth indices were measured at the end of feeding trial. Artemia enriched with synbiotic significantly improved growth performance compared to other treatments (P < 0.05). The highest weight gain and specific growth rate (SGR) was observed in synbiotic fed fish (P < 0.05). Compared to the other treatments, the population of lactic acid bacteria was significantly higher in the intestinal microbiota of fish fed synbiotic supplemented diet (P < 0.05). In the environmental stress challenge test, the maximum resistance to abrupt decrease of temperature (17 °C) or elevation of salinity (12 g per liter) was observed in the synbiotic treatment. Also, the total immunoglobulin and lysozyme activity level of skin mucus was significantly elevated in fish fed Artemia enriched with synbiotic (P < 0.05). These results revealed that feeding angelfish with synbiotic

  19. Tuberculin Skin Testing Compared with T-Cell Responses to Mycobacterium tuberculosis-Specific and Nonspecific Antigens for Detection of Latent Infection in Persons with Recent Tuberculosis Contact

    Science.gov (United States)

    Arend, Sandra M.; Engelhard, Anrik C. F.; Groot, Gertjan; de Boer, Kirsten; Andersen, Peter; Ottenhoff, Tom H. M.; van Dissel, Jaap T.

    2001-01-01

    The tuberculin skin test (TST) is used for the identification of latent tuberculosis (TB) infection (LTBI) but lacks specificity in Mycobacterium bovis BCG-vaccinated individuals, who constitute an increasing proportion of TB patients and their contacts from regions where TB is endemic. In previous studies, T-cell responses to ESAT-6 and CFP-10, M. tuberculosis-specific antigens that are absent from BCG, were sensitive and specific for detection of active TB. We studied 44 close contacts of a patient with smear-positive pulmonary TB and compared the standard screening procedure for LTBI by TST or chest radiographs with T-cell responses to M. tuberculosis-specific and nonspecific antigens. Peripheral blood mononuclear cells were cocultured with ESAT-6, CFP-10, TB10.4 (each as recombinant antigen and as a mixture of overlapping synthetic peptides), M. tuberculosis sonicate, purified protein derivative (PPD), and short-term culture filtrate, using gamma interferon production as the response measure. LTBI screening was by TST in 36 participants and by chest radiographs in 8 persons. Nineteen contacts were categorized as TST negative, 12 were categorized as TST positive, and 5 had indeterminate TST results. Recombinant antigens and peptide mixtures gave similar results. Responses to TB10.4 were neither sensitive nor specific for LTBI. T-cell responses to ESAT-6 and CFP-10 were less sensitive for detection of LTBI than those to PPD (67 versus 100%) but considerably more specific (100 versus 72%). The specificity of the TST or in vitro responses to PPD will be even less when the proportion of BCG-vaccinated persons among TB contacts evaluated for LTBI increases. PMID:11687445

  20. Preclinical and clinical evaluation of autonomic function in humans.

    Science.gov (United States)

    Joyner, Michael J

    2016-07-15

    This review focuses on how to assess autonomic function in humans including various ways to measure heart rate, catecholamines, and sympathetic neural activity. The need to assess autonomic function is paramount in many experimental paradigms because of the following. (1) Autonomic dysfunction is present in common diseases like hypertension, diabetes and heart failure, and the magnitude of this dysfunction is broadly related to morbidity and mortality in these disorders. (2) The relationship between autonomic dysfunction and morbidity and mortality can be causal. (3) Interventions that modulate or reverse autonomic dysfunction can improve outcomes in the affected patients. The techniques discussed are also frequently used to understand the autonomic response to sympathoexcitatory manoeuvres like exercise, the cold pressor test or mental stress. Because these manoeuvres can engage a variety of sensory and efferent pathways, under some circumstances the physiological responses measured by many of the techniques are directionally similar, in others they are divergent. Thus any investigator seeking to study the autonomic nervous system or its contribution to either normal physiology or pathophysiological conditions must carefully balance a number of considerations to ensure that the right technique is used to address the question of interest. PMID:27098282

  1. Marked depletion of dorsal spinal cord substance P and calcitonin gene-related peptide with intact skin flare responses in multiple system atrophy.

    OpenAIRE

    Anand, P; Bannister, R; McGregor, G P; Ghatei, M A; Mulderry, P K; Bloom, S R

    1988-01-01

    In view of the presence of neuropeptides in spinal cord autonomic pathways, their regional concentration was studied in post mortem thoracic cord from four cases of multiple system atrophy with progressive autonomic failure (MSA). A marked depletion was observed of substance P, its related peptide substance K, and of calcitonin gene-related peptide (CGRP), particularly in dorsal regions where peptide-containing sensory fibres terminate. As substance P and CGRP in primary sensory fibres are co...

  2. Abnormal autonomic and associated brain activities during rest in autism spectrum disorder

    OpenAIRE

    Eilam-Stock, Tehila; Xu, Pengfei; Cao, Miao; Gu, Xiaosi; Van Dam, Nicholas T.; Anagnostou, Evdokia; Kolevzon, Alexander; Soorya, Latha; Park, Yunsoo; Siller, Michael; He, Yong; Hof, Patrick R.; Fan, Jin

    2014-01-01

    Autism spectrum disorders are associated with social and emotional deficits, the aetiology of which are not well understood. A growing consensus is that the autonomic nervous system serves a key role in emotional processes, by providing physiological signals essential to subjective states. We hypothesized that altered autonomic processing is related to the socio-emotional deficits in autism spectrum disorders. Here, we investigated the relationship between non-specific skin conductance respon...

  3. Central gene expression changes associated with enhanced neuroendocrine and autonomic response habituation to repeated noise stress after voluntary wheel running in rats

    OpenAIRE

    Sarah K eSasse; Tara J eNyhuis; Cher V eMasini; Heidi E W eDay; Serge eCampeau

    2013-01-01

    Accumulating evidence indicates that regular physical exercise benefits health in part by counteracting some of the negative physiological impacts of stress. While some studies identified reductions in some measures of acute stress responses with prior exercise, limited data were available concerning effects on cardiovascular function, and reported effects on HPA axis responses were largely inconsistent. Given that exposure to repeated or prolonged stress is strongly implicated in the preci...

  4. Noninvasive evaluation of the vascular response to transplantation of alginate encapsulated islets using the dorsal skin-fold model.

    Science.gov (United States)

    Krishnan, Rahul; Arora, Rajan P; Alexander, Michael; White, Sean M; Lamb, Morgan W; Foster, Clarence E; Choi, Bernard; Lakey, Jonathan R T

    2014-01-01

    Alginate encapsulation reduces the risk of transplant rejection by evading immune-mediated cell injury and rejection; however, poor vascular perfusion results in graft failure. Since existing imaging models are incapable of quantifying the vascular response to biomaterial implants after transplantation, in this study, we demonstrate the use of in vivo laser speckle imaging (LSI) and wide-field functional imaging (WiFI) to monitor the microvascular environment surrounding biomaterial implants. The vascular response to two islet-containing biomaterial encapsulation devices, alginate microcapsules and a high-guluronate alginate sheet, was studied and compared after implantation into the mouse dorsal window chamber (N = 4 per implant group). Images obtained over a 14-day period using LSI and WiFI were analyzed using algorithms to quantify blood flow, hemoglobin oxygen saturation and vascular density. Using our method, we were able to monitor the changes in the peri-implant microvasculature noninvasively without the use of fluorescent dyes. Significant changes in blood flow, hemoglobin oxygen saturation and vascular density were noted as early as the first week post-transplant. The dorsal window chamber model enables comparison of host responses to transplanted biomaterials. Future experiments will study the effect of changes in alginate composition on the vascular and immune responses. PMID:24176195

  5. Behavioral and neural responses of toads to salt solutions correlate with basolateral membrane potential of epidermal cells of the skin

    DEFF Research Database (Denmark)

    Hillyard, Stanley D; Baula, Victor; Tuttle, Wendy;

    2007-01-01

    Dehydrated toads initiated water absorption response (WR) behavior and absorbed water from dilute NaCl solutions. With 200-250 mM NaCl, WR behavior and water absorption were both suppressed. With 200-250 mM Na-gluconate, WR initiation was significantly greater than with NaCl but water loss was gr...

  6. Jam avoidance with autonomous systems

    OpenAIRE

    Tordeux, Antoine; Lassarre, Sylvain

    2015-01-01

    Many car-following models are developed for jam avoidance in highways. Two mechanisms are used to improve the stability: feedback control with autonomous models and increasing of the interaction within cooperative ones. In this paper, we compare the linear autonomous and collective optimal velocity (OV) models. We observe that the stability is significantly increased by adding predecessors in interaction with collective models. Yet autonomous and collective approaches are close when the speed...

  7. Chemical Specification of Autonomic Systems

    OpenAIRE

    Banâtre, Jean-Pierre; Fradet, Pascal; Radenac, Yann

    2004-01-01

    Autonomic computing provides a vision of information systems allowing self-management of many predefined properties. Such systems take care of their own behavior and of their interactions with other components without any external intervention. One of the major challenges concerns the expression of properties and constraints of autonomic systems. We believe that the {\\em chemical programming paradigm} (represented here by the Gamma formalism) is well-suited to the specification of autonomic s...

  8. Jam avoidance with autonomous systems

    CERN Document Server

    Tordeux, Antoine

    2016-01-01

    Many car-following models are developed for jam avoidance in highways. Two mechanisms are used to improve the stability: feedback control with autonomous models and increasing of the interaction within cooperative ones. In this paper, we compare the linear autonomous and collective optimal velocity (OV) models. We observe that the stability is significantly increased by adding predecessors in interaction with collective models. Yet autonomous and collective approaches are close when the speed difference term is taking into account. Within the linear OV models tested, the autonomous models including speed difference are sufficient to maximise the stability.

  9. Robotics and Autonomous Systems Laboratory

    Data.gov (United States)

    Federal Laboratory Consortium — FUNCTION: Provides an environment for developing and evaluating intelligent software for both actual and simulated autonomous vehicles. Laboratory computers provide...

  10. Autonomous packaging robot

    OpenAIRE

    Vo, Van Thanh

    2010-01-01

    The objective of the autonomous packaging robot application is to replace manual product packaging in food industry with a fully automatic robot. The objective is achieved by using the combination of machine vision, central computer, sensors, microcontroller and a typical ABB robot. The method is to equip the robot with different sensors: camera as “eyes” of robot, distance sensor and microcontroller as “sense of touch” of the robot, central computer as “brain” of the robot. Because the ro...

  11. Experimental Autonomous Vehicle Systems

    DEFF Research Database (Denmark)

    Ravn, Ole; Andersen, Nils Axel

    1998-01-01

    The paper describes the requirements for and a prototype configuration of a software architecture for control of an experimental autonomous vehicle. The test bed nature of the system is emphasised in the choice of architecture making re-configurability, data logging and extendability simple....... The central element of the architecture is the ‘global database’ that serves several purposes, such as storing system parameters, making signals available for data logging and inter-process communication. Standard software components are used to a large extent, OS-9 as real-time operating system, a custom...

  12. Gene expression in Atlantic salmon skin in response to infection with the parasitic copepod Lepeophtheirus salmonis, cortisol implant, and their combination

    Directory of Open Access Journals (Sweden)

    Krasnov Aleksei

    2012-04-01

    Full Text Available Abstract Background The salmon louse is an ectoparasitic copepod that causes major economic losses in the aquaculture industry of Atlantic salmon. This host displays a high level of susceptibility to lice which can be accounted for by several factors including stress. In addition, the parasite itself acts as a potent stressor of the host, and outcomes of infection can depend on biotic and abiotic factors that stimulate production of cortisol. Consequently, examination of responses to infection with this parasite, in addition to stress hormone regulation in Atlantic salmon, is vital for better understanding of the host pathogen interaction. Results Atlantic salmon post smolts were organised into four experimental groups: lice + cortisol, lice + placebo, no lice + cortisol, no lice + placebo. Infection levels were equal in both treatments upon termination of the experiment. Gene expression changes in skin were assessed with 21 k oligonucleotide microarray and qPCR at the chalimus stage 18 days post infection at 9°C. The transcriptomic effects of hormone treatment were significantly greater than lice-infection induced changes. Cortisol stimulated expression of genes involved in metabolism of steroids and amino acids, chaperones, responses to oxidative stress and eicosanoid metabolism and suppressed genes related to antigen presentation, B and T cells, antiviral and inflammatory responses. Cortisol and lice equally down-regulated a large panel of motor proteins that can be important for wound contraction. Cortisol also suppressed multiple genes involved in wound healing, parts of which were activated by the parasite. Down-regulation of collagens and other structural proteins was in parallel with the induction of proteinases that degrade extracellular matrix (MMP9 and MMP13. Cortisol reduced expression of genes encoding proteins involved in formation of various tissue structures, regulators of cell differentiation and growth factors. Conclusions

  13. Influenza nucleoprotein DNA vaccination by a skin targeted, dry coated, densely packed microprojection array (Nanopatch) induces potent antibody and CD8(+) T cell responses.

    Science.gov (United States)

    Fernando, Germain J P; Zhang, Jin; Ng, Hwee-Ing; Haigh, Oscar L; Yukiko, Sally R; Kendall, Mark A F

    2016-09-10

    DNA vaccines have many advantages such as thermostability and the ease and rapidity of manufacture; for example, in an influenza pandemic situation where rapid production of vaccine is essential. However, immunogenicity of DNA vaccines was shown to be poor in humans unless large doses of DNA are used. If a highly efficacious DNA vaccine delivery system could be identified, then DNA vaccines have the potential to displace protein vaccines. In this study, we show in a C57BL/6 mouse model, that the Nanopatch, a microprojection array of high density (>21,000 projections/cm(2)), could be used to deliver influenza nucleoprotein DNA vaccine to skin, to generate enhanced antigen specific antibody and CD8(+) T cell responses compared to the conventional intramuscular (IM) delivery by the needle and syringe. Antigen specific antibody was measured using ELISA assays of mice vaccinated with a DNA plasmid containing the nucleoprotein gene of influenza type A/WSN/33 (H1N1). Antigen specific CD8(+) T cell responses were measured ex-vivo in splenocytes of mice using IFN-γ ELISPOT assays. These results and our previous antibody and CD4(+) T cell results using the Nanopatch delivered HSV DNA vaccine indicate that the Nanopatch is an effective delivery system of general utility that could potentially be used in humans to increase the potency of the DNA vaccines. PMID:27381247

  14. Skin Care and Aging

    Science.gov (United States)

    ... page please turn Javascript on. Skin Care and Aging How Aging Affects Skin Your skin changes with age. It ... if they bother you. See additional resources on aging skin, including information on treatment options, specific conditions, ...

  15. Skin Cancer Foundation

    Science.gov (United States)

    ... Host a Fundraising Event | About Us | Store The Skin Cancer Foundation The Skin Cancer Foundation is the ... A "Sunscreen Gene"? Skin Cancer Facts & Statistics The Skin Cancer Foundation's Champions for Change Gala 2016 Learn ...

  16. Skin Pigmentation Disorders

    Science.gov (United States)

    Pigmentation means coloring. Skin pigmentation disorders affect the color of your skin. Your skin gets its color from a pigment called melanin. Special cells in the skin make melanin. When these cells become damaged or ...

  17. Skin Substitutes

    OpenAIRE

    Zavan, Barbara; Vindigni, Vincenzo; Cortivo, Roberta; Abatangelo, Giovanni

    2010-01-01

    The many studies conducted so far reveal that Tissue Engineering of the skin is only at the beginning of its use in human applications. Burns patients were the first targets for such tissue substitutes, then chronic diseases, such as venous ulcers, have followed. The more experience is gained from the surgeon, the more feedback for the basic scientist to improve the product and to broaden clinical indications. Nowadays, progress in cell culture and biomedical material technologies have added ...

  18. Skin aging:

    OpenAIRE

    Puizina-Ivić, Neira

    2008-01-01

    There are two main processes that induce skin aging: intrinsic and extrinsic. A stochastic process that implies random cell damage as a result of mutations during metabolic processes due to the production of free radicals is also implicated. Extrinsic aging is caused by environmental factors such as sun exposure, air pollution, smoking, alcohol abuse, and poor nutrition. Intrinsicaging reflects the genetic background and depends on time. Various expressions of intrinsic aging include smooth, ...

  19. Nemesis Autonomous Test System

    Science.gov (United States)

    Barltrop, Kevin J.; Lee, Cin-Young; Horvath, Gregory A,; Clement, Bradley J.

    2012-01-01

    A generalized framework has been developed for systems validation that can be applied to both traditional and autonomous systems. The framework consists of an automated test case generation and execution system called Nemesis that rapidly and thoroughly identifies flaws or vulnerabilities within a system. By applying genetic optimization and goal-seeking algorithms on the test equipment side, a "war game" is conducted between a system and its complementary nemesis. The end result of the war games is a collection of scenarios that reveals any undesirable behaviors of the system under test. The software provides a reusable framework to evolve test scenarios using genetic algorithms using an operation model of the system under test. It can automatically generate and execute test cases that reveal flaws in behaviorally complex systems. Genetic algorithms focus the exploration of tests on the set of test cases that most effectively reveals the flaws and vulnerabilities of the system under test. It leverages advances in state- and model-based engineering, which are essential in defining the behavior of autonomous systems. It also uses goal networks to describe test scenarios.

  20. Towards autonomous vehicular clouds

    Directory of Open Access Journals (Sweden)

    Stephan Olariu

    2011-09-01

    Full Text Available The dawn of the 21st century has seen a growing interest in vehicular networking and its myriad potential applications. The initial view of practitioners and researchers was that radio-equipped vehicles could keep the drivers informed about potential safety risks and increase their awareness of road conditions. The view then expanded to include access to the Internet and associated services. This position paper proposes and promotes a novel and more comprehensive vision namely, that advances in vehicular networks, embedded devices and cloud computing will enable the formation of autonomous clouds of vehicular computing, communication, sensing, power and physical resources. Hence, we coin the term, autonomous vehicular clouds (AVCs. A key feature distinguishing AVCs from conventional cloud computing is that mobile AVC resources can be pooled dynamically to serve authorized users and to enable autonomy in real-time service sharing and management on terrestrial, aerial, or aquatic pathways or theaters of operations. In addition to general-purpose AVCs, we also envision the emergence of specialized AVCs such as mobile analytics laboratories. Furthermore, we envision that the integration of AVCs with ubiquitous smart infrastructures including intelligent transportation systems, smart cities and smart electric power grids will have an enormous societal impact enabling ubiquitous utility cyber-physical services at the right place, right time and with right-sized resources.

  1. Learning for Autonomous Navigation

    Science.gov (United States)

    Angelova, Anelia; Howard, Andrew; Matthies, Larry; Tang, Benyang; Turmon, Michael; Mjolsness, Eric

    2005-01-01

    Robotic ground vehicles for outdoor applications have achieved some remarkable successes, notably in autonomous highway following (Dickmanns, 1987), planetary exploration (1), and off-road navigation on Earth (1). Nevertheless, major challenges remain to enable reliable, high-speed, autonomous navigation in a wide variety of complex, off-road terrain. 3-D perception of terrain geometry with imaging range sensors is the mainstay of off-road driving systems. However, the stopping distance at high speed exceeds the effective lookahead distance of existing range sensors. Prospects for extending the range of 3-D sensors is strongly limited by sensor physics, eye safety of lasers, and related issues. Range sensor limitations also allow vehicles to enter large cul-de-sacs even at low speed, leading to long detours. Moreover, sensing only terrain geometry fails to reveal mechanical properties of terrain that are critical to assessing its traversability, such as potential for slippage, sinkage, and the degree of compliance of potential obstacles. Rovers in the Mars Exploration Rover (MER) mission have got stuck in sand dunes and experienced significant downhill slippage in the vicinity of large rock hazards. Earth-based off-road robots today have very limited ability to discriminate traversable vegetation from non-traversable vegetation or rough ground. It is impossible today to preprogram a system with knowledge of these properties for all types of terrain and weather conditions that might be encountered.

  2. [Echinococcosis in the Nenets Autonomous Okrug].

    Science.gov (United States)

    Ageeva, N G

    1989-01-01

    The paper presents results of an immunological screening of the population from the Nenets Autonomous Okrug of the Arkhangelsk region for echinococcosis. A high level (8.4 +/- 1.0%) of seropositivity of the population has been found to Echinococcus antigens. Occupational groups, such as reindeer-breeders, domestic servants in the tent of skins, hunters, fur-farmers, furriers) have been identified to be mostly at high risk for Echinococcus infection. Some animal species have been demonstrated to be implicated in the epidemiology of echinococcosis. The most likely source of human granulosus Echinococcus invasion is a dog whose mature Echinococcus infection rate is 5.8 +/- 3.2%, that of multilocularis Echinococcus is a polar fox whose infection rate is 40.3 +/- 4.3%.

  3. Cutaneous skin tag

    Science.gov (United States)

    Skin tag; Acrochordon; Fibroepithelial polyp ... have diabetes. They are thought to occur from skin rubbing against skin. ... The tag sticks out of the skin and may have a short, narrow stalk connecting it to the surface of the skin. Some skin tags are as long as ...

  4. Autonomous immunity in mucosal epithelial cells: fortifying the barrier against infection.

    Science.gov (United States)

    Ross, Karen F; Herzberg, Mark C

    2016-06-01

    Mucosal epithelial cells express an autonomous innate immune response that controls the overgrowth of invaded bacteria, mitigates the harmful effects of the bacteria carried within, and does not rely on other external arms of the immune response. Epithelial cell autonomous innate immunity "respects" the social biology of invading bacteria to achieve symbiosis, and is the primary protective mechanism against pathogens. PMID:27005450

  5. Expanded Perspectives on Autonomous Learners

    Science.gov (United States)

    Oxford, Rebecca L.

    2015-01-01

    This paper explores two general perspectives on autonomous learners: psychological and sociocultural. These perspectives introduce a range of theoretically grounded facets of autonomous learners, facets such as the self-regulated learner, the emotionally intelligent learner, the self-determined learner, the mediated learner, the socioculturally…

  6. Testing the Relationship Between Levels of Endogenous Testosterone and Physiological Responses to Facial Expressions in Men: An Experiment Conducted by Students in an Undergraduate Behavioral Neuroscience Class

    OpenAIRE

    Thompson, Richmond R.; George, Kirsten

    2003-01-01

    To determine if endogenous testosterone (T) is related to physiological responses to aggressive stimuli in human males, students in a behavioral neuroscience laboratory class conducted an experiment that determined if levels of salivary T in adult males are correlated with autonomic and/or somatic responses to angry facial expressions. Each student collected a saliva sample from one subject and, within 30 minutes of collecting the sample, measured heart rate (HR), skin conductance (SC), and c...

  7. Physics Simulation Software for Autonomous Propellant Loading and Gas House Autonomous System Monitoring

    Science.gov (United States)

    Regalado Reyes, Bjorn Constant

    2015-01-01

    1. Kennedy Space Center (KSC) is developing a mobile launching system with autonomous propellant loading capabilities for liquid-fueled rockets. An autonomous system will be responsible for monitoring and controlling the storage, loading and transferring of cryogenic propellants. The Physics Simulation Software will reproduce the sensor data seen during the delivery of cryogenic fluids including valve positions, pressures, temperatures and flow rates. The simulator will provide insight into the functionality of the propellant systems and demonstrate the effects of potential faults. This will provide verification of the communications protocols and the autonomous system control. 2. The High Pressure Gas Facility (HPGF) stores and distributes hydrogen, nitrogen, helium and high pressure air. The hydrogen and nitrogen are stored in cryogenic liquid state. The cryogenic fluids pose several hazards to operators and the storage and transfer equipment. Constant monitoring of pressures, temperatures and flow rates are required in order to maintain the safety of personnel and equipment during the handling and storage of these commodities. The Gas House Autonomous System Monitoring software will be responsible for constantly observing and recording sensor data, identifying and predicting faults and relaying hazard and operational information to the operators.

  8. Prevalence of diabetic autonomic neuropathy measured by simple bedside tests

    DEFF Research Database (Denmark)

    Dyrberg, Torben Bech; Benn, Jette; Christiansen, J S;

    1981-01-01

    To investigate the prevalence of diabetic autonomic neuropathy, five simple bedside tests, beat-to-beat variation during quiet respiration, beat-to-beat variation during forced respiration, heart rate and blood pressure response to standing, heart rate response to exercise, and heart rate response....... The prevalence of diabetic autonomic neuropathy in the whole diabetic population indicated by abnormal response in beat-to-beat variation during forced respiration was 27%. Diabetic autonimic neuropathy increased in frequency with duration of disease. Patients with nephropathy or proliferative retinopathy had...... a significantly higher prevalence of diabetic autonomic neuropathy as indicated by abnormal beat-to-beat variation during forced respirations (p less than 0.01) than patients without these complications....

  9. Forced synchronization of autonomous dynamical Boolean networks

    Energy Technology Data Exchange (ETDEWEB)

    Rivera-Durón, R. R., E-mail: roberto.rivera@ipicyt.edu.mx; Campos-Cantón, E., E-mail: eric.campos@ipicyt.edu.mx [División de Matemáticas Aplicadas, Instituto Potosino de Investigación Científica y Tecnológica A. C., Camino a la Presa San José 2055, Col. Lomas 4 Sección, C.P. 78216, San Luis Potosí, S.L.P. (Mexico); Campos-Cantón, I. [Facultad de Ciencias, Universidad Autónoma de San Luis Potosí, Álvaro Obregón 64, C.P. 78000, San Luis Potosí, S.L.P. (Mexico); Gauthier, Daniel J. [Department of Physics and Center for Nonlinear and Complex Systems, Duke University, Box 90305, Durham, North Carolina 27708 (United States)

    2015-08-15

    We present the design of an autonomous time-delay Boolean network realized with readily available electronic components. Through simulations and experiments that account for the detailed nonlinear response of each circuit element, we demonstrate that a network with five Boolean nodes displays complex behavior. Furthermore, we show that the dynamics of two identical networks display near-instantaneous synchronization to a periodic state when forced by a common periodic Boolean signal. A theoretical analysis of the network reveals the conditions under which complex behavior is expected in an individual network and the occurrence of synchronization in the forced networks. This research will enable future experiments on autonomous time-delay networks using readily available electronic components with dynamics on a slow enough time-scale so that inexpensive data collection systems can faithfully record the dynamics.

  10. Forced synchronization of autonomous dynamical Boolean networks.

    Science.gov (United States)

    Rivera-Durón, R R; Campos-Cantón, E; Campos-Cantón, I; Gauthier, Daniel J

    2015-08-01

    We present the design of an autonomous time-delay Boolean network realized with readily available electronic components. Through simulations and experiments that account for the detailed nonlinear response of each circuit element, we demonstrate that a network with five Boolean nodes displays complex behavior. Furthermore, we show that the dynamics of two identical networks display near-instantaneous synchronization to a periodic state when forced by a common periodic Boolean signal. A theoretical analysis of the network reveals the conditions under which complex behavior is expected in an individual network and the occurrence of synchronization in the forced networks. This research will enable future experiments on autonomous time-delay networks using readily available electronic components with dynamics on a slow enough time-scale so that inexpensive data collection systems can faithfully record the dynamics.

  11. Keratinocyte p38δ loss inhibits Ras-induced tumor formation, while systemic p38δ loss enhances skin inflammation in the early phase of chemical carcinogenesis in mouse skin.

    Science.gov (United States)

    Kiss, Alexi; Koppel, Aaron C; Anders, Joanna; Cataisson, Christophe; Yuspa, Stuart H; Blumenberg, Miroslav; Efimova, Tatiana

    2016-05-01

    p38δ expression and/or activity are increased in human cutaneous malignancies, including invasive squamous cell carcinoma (SCC) and head and neck SCC, but the role of p38δ in cutaneous carcinogenesis has not been well-defined. We have reported that mice with germline loss of p38δ exhibited a reduced susceptibility to skin tumor development compared with wild-type mice in the two-stage 7,12-dimethylbenz(a)anthracene (DMBA)/12-O-tetradecanoylphorbol-13-acetate (TPA) chemical skin carcinogenesis model. Here, we report that p38δ gene ablation inhibited the growth of tumors generated from v-ras(Ha) -transformed keratinocytes in skin orthografts to nude mice, indicating that keratinocyte-intrinsic p38δ is required for Ras-induced tumorigenesis. Gene expression profiling of v-ras(Ha) -transformed p38δ-null keratinocytes revealed transcriptional changes associated with cellular responses linked to tumor suppression, such as reduced proliferation and increased differentiation, cell adhesion, and cell communications. Notably, a short-term DMBA/TPA challenge, modeling the initial stages of chemical skin carcinogenesis treatment, elicited an enhanced inflammation in p38δ-null skin compared with skin of wild-type mice, as assessed by measuring the expression of pro-inflammatory cytokines, including IL-1β, IL-6, IL-17, and TNFα. Additionally, p38δ-null skin and p38δ-null keratinocytes exhibited increased p38α activation and signaling in response to acute inflammatory challenges, suggesting a role for p38α in stimulating the elevated inflammatory response in p38δ-null skin during the initial phases of the DMBA/TPA treatment compared with similarly treated p38δ(+/+) skin. Altogether, our results indicate that p38δ signaling regulates skin carcinogenesis not only by keratinocyte cell-autonomous mechanisms, but also by influencing the interaction between between the epithelial compartment of the developing skin tumor and its stromal microenvironment.

  12. Evolutionary Autonomous Health Monitoring System (EAHMS) Project

    Data.gov (United States)

    National Aeronautics and Space Administration — For supporting NASA's Robotics, Tele-Robotics and Autonomous Systems Roadmap, we are proposing the "Evolutionary Autonomous Health Monitoring System" (EAHMS) for...

  13. Abnormal cardiac autonomic regulation in mice lacking ASIC3.

    Science.gov (United States)

    Cheng, Ching-Feng; Kuo, Terry B J; Chen, Wei-Nan; Lin, Chao-Chieh; Chen, Chih-Cheng

    2014-01-01

    Integration of sympathetic and parasympathetic outflow is essential in maintaining normal cardiac autonomic function. Recent studies demonstrate that acid-sensing ion channel 3 (ASIC3) is a sensitive acid sensor for cardiac ischemia and prolonged mild acidification can open ASIC3 and evoke a sustained inward current that fires action potentials in cardiac sensory neurons. However, the physiological role of ASIC3 in cardiac autonomic regulation is not known. In this study, we elucidate the role of ASIC3 in cardiac autonomic function using Asic3(-/-) mice. Asic3(-/-) mice showed normal baseline heart rate and lower blood pressure as compared with their wild-type littermates. Heart rate variability analyses revealed imbalanced autonomic regulation, with decreased sympathetic function. Furthermore, Asic3(-/-) mice demonstrated a blunted response to isoproterenol-induced cardiac tachycardia and prolonged duration to recover to baseline heart rate. Moreover, quantitative RT-PCR analysis of gene expression in sensory ganglia and heart revealed that no gene compensation for muscarinic acetylcholines receptors and beta-adrenalin receptors were found in Asic3(-/-) mice. In summary, we unraveled an important role of ASIC3 in regulating cardiac autonomic function, whereby loss of ASIC3 alters the normal physiological response to ischemic stimuli, which reveals new implications for therapy in autonomic nervous system-related cardiovascular diseases. PMID:24804235

  14. Abnormal Cardiac Autonomic Regulation in Mice Lacking ASIC3

    Directory of Open Access Journals (Sweden)

    Ching-Feng Cheng

    2014-01-01

    Full Text Available Integration of sympathetic and parasympathetic outflow is essential in maintaining normal cardiac autonomic function. Recent studies demonstrate that acid-sensing ion channel 3 (ASIC3 is a sensitive acid sensor for cardiac ischemia and prolonged mild acidification can open ASIC3 and evoke a sustained inward current that fires action potentials in cardiac sensory neurons. However, the physiological role of ASIC3 in cardiac autonomic regulation is not known. In this study, we elucidate the role of ASIC3 in cardiac autonomic function using Asic3−/− mice. Asic3−/− mice showed normal baseline heart rate and lower blood pressure as compared with their wild-type littermates. Heart rate variability analyses revealed imbalanced autonomic regulation, with decreased sympathetic function. Furthermore, Asic3−/− mice demonstrated a blunted response to isoproterenol-induced cardiac tachycardia and prolonged duration to recover to baseline heart rate. Moreover, quantitative RT-PCR analysis of gene expression in sensory ganglia and heart revealed that no gene compensation for muscarinic acetylcholines receptors and beta-adrenalin receptors were found in Asic3−/− mice. In summary, we unraveled an important role of ASIC3 in regulating cardiac autonomic function, whereby loss of ASIC3 alters the normal physiological response to ischemic stimuli, which reveals new implications for therapy in autonomic nervous system-related cardiovascular diseases.

  15. Autonomous component carrier selection

    DEFF Research Database (Denmark)

    Garcia, Luis Guilherme Uzeda; Pedersen, Klaus; Mogensen, Preben

    2009-01-01

    in local areas, basing our study case on LTE-Advanced. We present extensive network simulation results to demonstrate that a simple and robust interference management scheme, called autonomous component carrier selection allows each cell to select the most attractive frequency configuration; improving......Low-power base stations such as e.g. Femto-cells are one of the candidates for high data rate provisioning in local areas, such as residences, apartment complexes, business offices and outdoor hotspot scenarios. Unfortunately, the benefits are not without new challenges in terms of interference...... management and efficient system operation. Due to the expected large number of user-deployed cells, centralized network planning becomes unpractical and new scalable alternatives must be sought. In this article, we propose a fully distributed and scalable solution to the interference management problem...

  16. Autonomous Gaussian Decomposition

    CERN Document Server

    Lindner, Robert R; Murray, Claire E; Stanimirović, Snežana; Babler, Brian L; Heiles, Carl; Hennebelle, Patrick; Goss, W M; Dickey, John

    2014-01-01

    We present a new algorithm, named Autonomous Gaussian Decomposition (AGD), for automatically decomposing spectra into Gaussian components. AGD uses derivative spectroscopy and machine learning to provide optimized guesses for the number of Gaussian components in the data, and also their locations, widths, and amplitudes. We test AGD and find that it produces results comparable to human-derived solutions on 21cm absorption spectra from the 21cm SPectral line Observations of Neutral Gas with the EVLA (21-SPONGE) survey. We use AGD with Monte Carlo methods to derive the HI line completeness as a function of peak optical depth and velocity width for the 21-SPONGE data, and also show that the results of AGD are stable against varying observational noise intensity. The autonomy and computational efficiency of the method over traditional manual Gaussian fits allow for truly unbiased comparisons between observations and simulations, and for the ability to scale up and interpret the very large data volumes from the up...

  17. Autonomous Flying Controls Testbed

    Science.gov (United States)

    Motter, Mark A.

    2005-01-01

    The Flying Controls Testbed (FLiC) is a relatively small and inexpensive unmanned aerial vehicle developed specifically to test highly experimental flight control approaches. The most recent version of the FLiC is configured with 16 independent aileron segments, supports the implementation of C-coded experimental controllers, and is capable of fully autonomous flight from takeoff roll to landing, including flight test maneuvers. The test vehicle is basically a modified Army target drone, AN/FQM-117B, developed as part of a collaboration between the Aviation Applied Technology Directorate (AATD) at Fort Eustis,Virginia and NASA Langley Research Center. Several vehicles have been constructed and collectively have flown over 600 successful test flights.

  18. Skin-inspired electronic devices

    Directory of Open Access Journals (Sweden)

    Alex Chortos

    2014-09-01

    Full Text Available Electronic devices that mimic the properties of skin have potential important applications in advanced robotics, prosthetics, and health monitoring technologies. Methods for measuring tactile and temperature signals have progressed rapidly due to innovations in materials and processing methods. Imparting skin-like stretchability to electronic devices can be accomplished by patterning traditional electronic materials or developing new materials that are intrinsically stretchable. The incorporation of sensing methods with transistors facilitates large-area sensor arrays. While sensor arrays have surpassed the properties of human skin in terms of sensitivity, time response, and device density, many opportunities remain for future development.

  19. Assessment of immune response in periparturient dairy cows using ex vivo whole blood stimulation assay with lipopolysaccharides and carrageenan skin test.

    Science.gov (United States)

    Jahan, N; Minuti, A; Trevisi, E

    2015-06-15

    The transition period is known to be the most critical phase in the life of high yielding dairy cow. Changes in the immune functions have been observed during the transition period which may account for the onset of clinical and subclinical (e.g. inflammatory response) problems at calving or at the beginning of lactation however this relationship has not yet been adequately investigated. Thus, to establish the potential of the periparturient dairy cow's immune system to respond to stimuli, two challenges [an ex vivo whole blood stimulation assay (WBA) with lipopolysaccharides and a carrageenan skin test (CST)] were performed in addition to characterizing the metabolic and inflammatory profile. The WBA was performed using 0, 0.01 and 5 μg LPS/mL on whole blood and CST was administered by subcutaneous injection of 0.7 mL solution containing 4.2mg of carrageenan to the shoulder region of the cows. These tests were performed on 10 Holstein-Friesian cows at -45 ± 2, -20 ± 2, -3, 3, 7, 28 ± 2 days from parturition (DFP). Cows were also monitored for health status, body condition score, milk yield. The results demonstrate a higher production of IL-1β and IL-6 from leukocytes after LPS stimulation around calving (from -3 to 3 DFP) compared to -45 DFP (P transition period, with low LPS dose, suggests its crucial role in the regulation of inflammatory response around calving. The response of cows to CST decreased a few days before calving (-3 DFP) compared with response at -45 and 28 DFP (P<0.05), and remained low in the first week of lactation. This result suggests the reduction of the functionality of some vascular factors, which decreases diapedesis. Overall, the WBA and CST tests confirm changes in immunocompetence around calving. These tests are able to better describe the changes of the innate immune response at a local and systemic level, mainly when combined with conventional metabolic and inflammatory indices. PMID:25912553

  20. Mobile Intelligent Autonomous Systems

    Directory of Open Access Journals (Sweden)

    Jitendra R. Raol

    2010-01-01

    Full Text Available Mobile intelligent autonomous systems (MIAS is a fast emerging research area. Although it can be regarded as a general R&D area, it is mainly directed towards robotics. Several important subtopics within MIAS research are:(i perception and reasoning, (ii mobility and navigation,(iii haptics and teleoperation, (iv image fusion/computervision, (v modelling of manipulators, (vi hardware/software architectures for planning and behaviour learning leadingto robotic architecture, (vii vehicle-robot path and motionplanning/control, (viii human-machine interfaces for interaction between humans and robots, and (ix application of artificial neural networks (ANNs, fuzzy logic/systems (FLS,probabilistic/approximate reasoning (PAR, Bayesian networks(BN and genetic algorithms (GA to the above-mentioned problems. Also, multi-sensor data fusion (MSDF playsvery crucial role at many levels of the data fusion process:(i kinematic fusion (position/bearing tracking, (ii imagefusion (for scene recognition, (iii information fusion (forbuilding world models, and (iv decision fusion (for tracking,control actions. The MIAS as a technology is useful for automation of complex tasks, surveillance in a hazardousand hostile environment, human-assistance in very difficultmanual works, medical robotics, hospital systems, autodiagnosticsystems, and many other related civil and military systems. Also, other important research areas for MIAScomprise sensor/actuator modelling, failure management/reconfiguration, scene understanding, knowledge representation, learning and decision-making. Examples ofdynamic systems considered within the MIAS would be:autonomous systems (unmanned ground vehicles, unmannedaerial vehicles, micro/mini air vehicles, and autonomousunder water vehicles, mobile/fixed robotic systems, dexterousmanipulator robots, mining robots, surveillance systems,and networked/multi-robot systems, to name a few.Defence Science Journal, 2010, 60(1, pp.3-4,

  1. The optimization of phenolic compounds extraction from cactus pear (Opuntia ficus-indica) skin in a reflux system using response surface methodology

    Institute of Scientific and Technical Information of China (English)

    Aguirre Joya Jorge; De La Garza Toledo Heliodoro; Zugasti Cruz Alejandro; Belmares Cerda Ruth; Aguilar Cristbal No

    2013-01-01

    To extract, quantify, and evaluate the phenolic content in Opuntia ficus-indica skin for their antioxidant capacity with three different methods (ABTS, DPPH, and lipid oxidation) and to optimize the extraction conditions (time, temperature and ethanol concentration) in a reflux system. Methods: The extraction process was done using a reflux system. A San Cristobal II experimental design with three variables and three levels was used. The variables evaluated were time of extraction (h), concentration of ethanol (%, v/v) and temperature (°C). The extraction process was optimized using a response surface methodology. Results: It was observed that at higher temperature more phenolic compounds were extracted, but the antioxidant capacity was decreased. The optimum conditions for phenolic compounds extraction and antioxidant capacity mixing the three methods were as follows: 45% of ethanol, 80 °C and 2 hours of extraction. Values obtained in our results are little higher that other previously reported. Conclusions: It can be concluded the by-products of Opuntia ficus-indica represent a good source of natural antioxidants with possible applications in food, cosmetics or drugs industries.

  2. Investigation of the H reflexes, F waves and sympathetic skin response with electromyography (EMG) in patients with stroke and the determination of the relationship with functional capacity.

    Science.gov (United States)

    Çakır, Tuncay; Evcik, Fatma Deniz; Subaşı, Volkan; Demirdal, Ümit Seçil; Kavuncu, Vural

    2015-09-01

    The purpose of the study was to evaluate the relationship between sympathetic skin responses (SSR), electrodiagnostic reflex activities (F wave, H reflex), and functional capacity in post-stroke patients. The study comprised 40 hemiplegia patients (mean age 57.8 ± 10.9 years) and 40 healthy volunteers (mean age 557 ± 85 years). In electrophysiological studies, SSR, F wave and H reflex were evaluated and for the functional capacities of patients, FIM scores and Brunnstrom stages were calculated. There was no statistical significant difference between SSR latency and amplitude in the hemiplegic and non-hemiplegic extremities of patients (p > 0.05). SSR latency values of patients were higher than those of controls (p < 0.05). Amplitude values of paretic arms were significantly lower than the control group extremities (p < 0.05). There was a significant correlation between SSR amplitude values and FIM scores. A significant increase in H max/M max amplitude rate was detected in the affected side (p < 0.05) and F-wave mean latency values of the affected side were found to be significantly lower in the control group (p < 0.05).

  3. Autonomous Weapon Systems and Risk Management in Hybrid Networks

    DEFF Research Database (Denmark)

    Nørgaard, Katrine

    . The central point of contention is the transfer of decision authority and the attribution of responsibility in cooperative networks of humans and machines with autonomous functions. As a response to the ‘legal irritation’ of hybrid networks, a new type of ‘hybrid law’ has emerged, mediating different regimes...

  4. The impact of BCG vaccination on tuberculin skin test responses in children is age dependent: evidence to be considered when screening children for tuberculosis infection

    Science.gov (United States)

    Seddon, James A; Paton, James; Nademi, Zohreh; Keane, Denis; Williams, Bhanu; Williams, Amanda; Welch, Steven B; Liebeschutz, Sue; Riddell, Anna; Bernatoniene, Jolanta; Patel, Sanjay; Martinez-Alier, Nuria; McMaster, Paddy; Kampmann, Beate

    2016-01-01

    Background Following exposure to TB, contacts are screened to target preventive treatment at those at high risk of developing TB. The UK has recently revised its recommendations for screening and now advises a 5 mm tuberculin skin test (TST) cut-off irrespective of age or BCG status. We sought to evaluate the impact of BCG on TST responses in UK children exposed to TB and the performance of different TST cut-offs to predict interferon γ release assay (IGRA) positivity. Methods Children vaccination on TST positivity was evaluated in IGRA-negative children, as was the performance of different TST cut-offs to predict IGRA positivity. Results Of 422 children recruited (median age 69 months; IQR: 32–113 months), 300 (71%) had been vaccinated with BCG. BCG vaccination affected the TST response in IGRA-negative children less than 5 years old but not in older children. A 5 mm TST cut-off demonstrated good sensitivity and specificity in BCG-unvaccinated children, and an excellent negative predictive value but was associated with low specificity (62.7%; 95% CI 56.1% to 69.0%) in BCG-vaccinated children. For BCG-vaccinated children, a 10 mm cut-off provided a high negative predictive value (97.7%; 95% CI 94.2% to 99.4%) with the positive predictive value increasing with increasing age of the child. Discussion BCG vaccination had little impact on TST size in children over 5 years of age. The revised TST cut-off recommended in the recent revision to the UK TB guidelines demonstrates good sensitivity but is associated with impaired specificity in BCG-vaccinated children. PMID:27335104

  5. Skin Keratins.

    Science.gov (United States)

    Wang, Fengrong; Zieman, Abigail; Coulombe, Pierre A

    2016-01-01

    Keratins comprise the type I and type II intermediate filament-forming proteins and occur primarily in epithelial cells. They are encoded by 54 evolutionarily conserved genes (28 type I, 26 type II) and regulated in a pairwise and tissue type-, differentiation-, and context-dependent manner. Keratins serve multiple homeostatic and stress-enhanced mechanical and nonmechanical functions in epithelia, including the maintenance of cellular integrity, regulation of cell growth and migration, and protection from apoptosis. These functions are tightly regulated by posttranslational modifications as well as keratin-associated proteins. Genetically determined alterations in keratin-coding sequences underlie highly penetrant and rare disorders whose pathophysiology reflects cell fragility and/or altered tissue homeostasis. Moreover, keratin mutation or misregulation represents risk factors or genetic modifiers for several acute and chronic diseases. This chapter focuses on keratins that are expressed in skin epithelia, and details a number of basic protocols and assays that have proven useful for analyses being carried out in skin.

  6. Female Listeners' Autonomic Responses to Dramatic Shifts Between Loud and Soft Music/Sound Passages: A Study of Heavy Metal Songs.

    Science.gov (United States)

    Cheng, Tzu-Han; Tsai, Chen-Gia

    2016-01-01

    Although music and the emotion it conveys unfold over time, little is known about how listeners respond to shifts in musical emotions. A special technique in heavy metal music utilizes dramatic shifts between loud and soft passages. Loud passages are penetrated by distorted sounds conveying aggression, whereas soft passages are often characterized by a clean, calm singing voice and light accompaniment. The present study used heavy metal songs and soft sea sounds to examine how female listeners' respiration rates and heart rates responded to the arousal changes associated with auditory stimuli. The high-frequency power of heart rate variability (HF-HRV) was used to assess cardiac parasympathetic activity. The results showed that the soft passages of heavy metal songs and soft sea sounds expressed lower arousal and induced significantly higher HF-HRVs than the loud passages of heavy metal songs. Listeners' respiration rate was determined by the arousal level of the present music passage, whereas the heart rate was dependent on both the present and preceding passages. Compared with soft sea sounds, the loud music passage led to greater deceleration of the heart rate at the beginning of the following soft music passage. The sea sounds delayed the heart rate acceleration evoked by the following loud music passage. The data provide evidence that sound-induced parasympathetic activity affects listeners' heart rate in response to the following music passage. These findings have potential implications for future research on the temporal dynamics of musical emotions. PMID:26925009

  7. Female listeners’ autonomic responses to dramatic shifts between loud and soft music/sound passages: a study of heavy metal songs

    Directory of Open Access Journals (Sweden)

    Tzu-Han eCheng

    2016-02-01

    Full Text Available Although music and the emotion it conveys unfold over time, little is known about how listeners respond to shifts in musical emotions. A special technique in heavy metal music utilizes dramatic shifts between loud and soft passages. Loud passages are penetrated by distorted sounds conveying aggression, whereas soft passages are often characterized by a clean, calm singing voice and light accompaniment. The present study used heavy metal songs and soft sea sounds to examine how female listeners’ respiration rates and heart rates responded to the arousal changes associated with auditory stimuli. The high-frequency power of heart rate variability (HF-HRV was used to assess cardiac parasympathetic activity. The results showed that the soft passages of heavy metal songs and soft sea sounds expressed lower arousal and induced significantly higher HF-HRVs than the loud passages of heavy metal songs. Listeners’ respiration rate was determined by the arousal level of the present music passage, whereas the heart rate was dependent on both the present and preceding passages. Compared with soft sea sounds, the loud music passage led to greater deceleration of the heart rate at the beginning of the following soft music passage. The sea sounds delayed the heart rate acceleration evoked by the following loud music passage. The data provide evidence that sound-induced parasympathetic activity affects listener’s heart rate in response to the following music passage. These findings have potential implications for future research of the temporal dynamics of musical emotions.

  8. Female Listeners' Autonomic Responses to Dramatic Shifts Between Loud and Soft Music/Sound Passages: A Study of Heavy Metal Songs.

    Science.gov (United States)

    Cheng, Tzu-Han; Tsai, Chen-Gia

    2016-01-01

    Although music and the emotion it conveys unfold over time, little is known about how listeners respond to shifts in musical emotions. A special technique in heavy metal music utilizes dramatic shifts between loud and soft passages. Loud passages are penetrated by distorted sounds conveying aggression, whereas soft passages are often characterized by a clean, calm singing voice and light accompaniment. The present study used heavy metal songs and soft sea sounds to examine how female listeners' respiration rates and heart rates responded to the arousal changes associated with auditory stimuli. The high-frequency power of heart rate variability (HF-HRV) was used to assess cardiac parasympathetic activity. The results showed that the soft passages of heavy metal songs and soft sea sounds expressed lower arousal and induced significantly higher HF-HRVs than the loud passages of heavy metal songs. Listeners' respiration rate was determined by the arousal level of the present music passage, whereas the heart rate was dependent on both the present and preceding passages. Compared with soft sea sounds, the loud music passage led to greater deceleration of the heart rate at the beginning of the following soft music passage. The sea sounds delayed the heart rate acceleration evoked by the following loud music passage. The data provide evidence that sound-induced parasympathetic activity affects listeners' heart rate in response to the following music passage. These findings have potential implications for future research on the temporal dynamics of musical emotions.

  9. Pathophysiology of irradiated skin and breast

    International Nuclear Information System (INIS)

    The evolution, time course, and dose response of gross and histologic changes associated with the acute and late changes of the skin are noted and a composite pathophysiologic operational model given. This model focuses the selection of the observations to be 'scored' to assess the tolerance and cosmetic response of the skin and breast to different dose and combined therapy studies

  10. White matter abnormalities in skin picking disorder

    DEFF Research Database (Denmark)

    Grant, Jon E; Odlaug, Brian Lawrence; Hampshire, Adam;

    2013-01-01

    Skin picking disorder (SPD) is characterized by the repetitive and compulsive picking of skin, resulting in tissue damage. Neurocognitive findings in SPD implicate difficulty with response inhibition (suppression of pre-potent motor responses). This function is dependent on the integrity...

  11. Cybersecurity for aerospace autonomous systems

    Science.gov (United States)

    Straub, Jeremy

    2015-05-01

    High profile breaches have occurred across numerous information systems. One area where attacks are particularly problematic is autonomous control systems. This paper considers the aerospace information system, focusing on elements that interact with autonomous control systems (e.g., onboard UAVs). It discusses the trust placed in the autonomous systems and supporting systems (e.g., navigational aids) and how this trust can be validated. Approaches to remotely detect the UAV compromise, without relying on the onboard software (on a potentially compromised system) as part of the process are discussed. How different levels of autonomy (task-based, goal-based, mission-based) impact this remote characterization is considered.

  12. Periostin in Skin Tissue Skin-Related Diseases

    Directory of Open Access Journals (Sweden)

    Yukie Yamaguchi

    2014-01-01

    Recently, periostin—a matricellular protein—has been highlighted for its pivotal functions in the skin. Analysis of periostin null mice has revealed that periostin contributes to collagen fibrillogenesis, collagen cross-linking, and the formation of ECM meshwork via interactions with other ECM components. Periostin expression is enhanced by mechanical stress or skin injury; this is indicative of the physiologically protective functions of periostin, which promotes wound repair by acting on keratinocytes and fibroblasts. Along with its physiological functions, periostin plays pathogenic roles in skin fibrosis and chronic allergic inflammation. In systemic sclerosis (SSc patients, periostin levels reflect the severity of skin fibrosis. Periostin null mice have shown reduced skin fibrosis in a bleomycin-induced SSc mouse model, indicating a key role of periostin in fibrosis. Moreover, in atopic dermatitis (AD, attenuated AD phenotype has been observed in periostin null mice in a house dust mite extract-induced AD mouse model. Th2 cytokine-induced periostin acts on keratinocytes to produce inflammatory cytokines that further enhance the Th2 response, thereby sustaining and amplifying chronic allergic inflammation. Thus, periostin is deeply involved in the pathogenesis of AD and other inflammation-related disorders affecting the skin. Understanding the dynamic actions of periostin would be key to dissecting pathogenesis of skin-related diseases and to developing novel therapeutic strategies.

  13. Characterization of CD8+ T-Cell Responses in the Peripheral Blood and Skin Injection Sites of Melanoma Patients Treated with mRNA Electroporated Autologous Dendritic Cells (TriMixDC-MEL

    Directory of Open Access Journals (Sweden)

    Daphné Benteyn

    2013-01-01

    Full Text Available Treatment of melanoma patients with mRNA electroporated dendritic cells (TriMixDC-MEL stimulates T-cell responses against the presented tumor-associated antigens (TAAs. In the current clinical trials, melanoma patients with systemic metastases are treated, requiring priming and/or expansion of preexisting TAA-specific T cells that are able to migrate to both the skin and internal organs. We monitored the presence of TAA-specific CD8+ T cells infiltrating the skin at sites of intradermal TriMixDC-MEL injection (SKILs and within the circulation of melanoma patients treated in two clinical trials. In 10 out of fourteen (71% patients screened, CD8+ T cells recognizing any of the four TAA presented by TriMixDC-MEL cellular vaccine were found in both compartments. In total, 30 TAA-specific T-cell responses were detected among the SKILs and 29 among peripheral blood T cells, of which 24 in common. A detailed characterization of the antigen specificity of CD8+ T-cell populations in four patients indicates that the majority of the epitopes detected were only recognized by CD8+ T cells derived from either skin biopsies or peripheral blood, indicating that some compartmentalization occurs after TriMix-DC therapy. To conclude, functional TAA-specific CD8+ T cells distribute both to the skin and peripheral blood of patients after TriMixDC-MEL therapy.

  14. Anyone Can Get Skin Cancer

    Science.gov (United States)

    ... Cancer Skin Cancer Screening Research Anyone Can Get Skin Cancer Order the free Anyone Can Get Skin Cancer ... true that only people with light skin get skin cancer? No. Anyone can get skin cancer. It's more ...

  15. Skin barrier in rosacea.

    Science.gov (United States)

    Addor, Flavia Alvim Sant'Anna

    2016-01-01

    Recent studies about the cutaneous barrier demonstrated consistent evidence that the stratum corneum is a metabolically active structure and also has adaptive functions, may play a regulatory role in the inflammatory response with activation of keratinocytes, angiogenesis and fibroplasia, whose intensity depends primarily on the intensity the stimulus. There are few studies investigating the abnormalities of the skin barrier in rosacea, but the existing data already show that there are changes resulting from inflammation, which can generate a vicious circle caused a prolongation of flare-ups and worsening of symptoms. This article aims to gather the most relevant literature data about the characteristics and effects of the state of the skin barrier in rosacea. PMID:26982780

  16. Effect of Ascaris Lumbricoides specific IgE on tuberculin skin test responses in children in a high-burden setting: a cross-sectional community-based study

    OpenAIRE

    van Soelen Nelda; Mandalakas Anna M; Kirchner H; Walzl Gerhard; Grewal Harleen M S; Jacobsen Marc; Hesseling Anneke C

    2012-01-01

    Abstract Background M.tuberculosis (M.tb) is associated with enhanced T helper cell type 1 (Th1) immune responses while helminth infection is associated with T helper cell type 2 (Th2) immune responses. Our aim was to investigate whether helminth infection could influence the ability to generate an appropriate Th1 immune response that is characterized by a positive tuberculin skin test (TST), in M.tb exposed children. Methods We completed a community-based, cross sectional household contact t...

  17. Could autonomic system assessment be helpful in disorders of consciousness diagnosis? A neurophysiological study.

    Science.gov (United States)

    Leo, Antonino; Naro, Antonino; Cannavò, Antonio; Pisani, Laura Rosa; Bruno, Rocco; Salviera, Carlo; Bramanti, Placido; Calabrò, Rocco Salvatore

    2016-08-01

    Although patients with chronic disorders of consciousness (DOC), including unresponsive wakefulness syndrome (UWS) and minimally conscious state (MCS), show a limited repertoire of awareness signs, owing to a large-scale cortico-thalamo-cortical functional disconnectivity, an activation of some cortical areas in response to relevant stimuli has been described by means of electrophysiological and functional neuroimaging approaches. In addition, cognitive processes associated with autonomic nervous system (ANS) responses elicited by nociceptive stimuli have been identified in some DOC patients. In an attempt to identify ANS functionality markers that could be useful in differentiating UWS and MCS individuals, we measured the amplitude, latency and γ-band power (γPOW) of ultra-late laser-evoked potentials (CLEPs) and skin reflex (SR), which both express some aspects of cognitive processes related to ANS functionality, besides other ANS parameters either during a 24(hh)-polygraphy or following a solid-state laser repetitive nociceptive stimulation. MCS showed physiological modification of vital signs (O2 saturation, hearth rate, hearth rate variability) throughout the night and a preservation of SR-γPOW, whereas UWS did not show significant variations. Following repetitive nociceptive stimulation, MCS patients had a significant increase in CLEP-γPOW, O2 saturation, hearth rate, and hearth rate variability, whereas UWS individuals did not show any significant change (but two patients, who reached high Coma Recovery Scale-Revised scores). Hence, our work suggests that a wide-spectrum electrophysiological evaluation of ANS functionality may support DOC differential diagnosis. Interestingly, the two above-mentioned UWS patients showed MCS-like vital sign modifications and electrophysiological pain responsiveness. It is therefore hypothesizable that our approach could be helpful in identifying residual aware autonomic system-related cognitive processes even in some UWS

  18. Biothermomechanical behavior of skin tissue

    Institute of Scientific and Technical Information of China (English)

    F.Xu; T.J.Lu; K.A.Seffen

    2008-01-01

    Advances in laser,microwave and similar tech nologies have led to recent developments of thermal treatments involving skin tissue.The effectiveness of these treatments is governed by the coupled thermal,mechanical,biological and neural responses of the affected tissue:a favorable interaction results in a procedure with relatively little pain and no lasting side effects.Currently,even though each behavioral facet is to a certain extent established and understood,none exists to date in the interdisciplinarv area.A highly interdisciplinary approach is required for studying the biothermomechanical behavior of skin,involving bioheat transfer.biomechanics and physiology.A comprehensive literature review penrtinent to the subject is presented in this paper,covering four subject areas:(a)skin structure,(b)skin bioheat transfer and thermal damage,(c)skin biomechanics,and(d)skin biothermomechanics.The major problems,issues,and topics for further studies are also outlined.This review finds that significant advances in each of these aspects have been achieved in recent years.Although focus is placed upon the biothermomechanical behavior of skin tissue,the fundamental concepts and methodologies reviewed in this paper may also be applicable for studying other soft tissues.

  19. The Response of microRNAs to Solar UVR in Skin-Resident Melanocytes Differs between Melanoma Patients and Healthy Persons.

    Directory of Open Access Journals (Sweden)

    Jingfeng Sha

    Full Text Available The conversion of melanocytes into cutaneous melanoma is largely dictated by the effects of solar ultraviolet radiation (UVR. Yet to be described, however, is exactly how these cells are affected by intense solar UVR while residing in their natural microenvironment, and whether their response differs in persons with a history of melanoma when compared to that of healthy individuals. By using laser capture microdissection (LCM to isolate a pure population of melanocytes from a small area of skin that had been intermittingly exposed or un-exposed to physiological doses of solar UVR, we can now report for the first time that the majority of UV-responsive microRNAs (miRNAs in the melanocytes of a group of women with a history of melanoma are down-regulated when compared to those in the melanocytes of healthy controls. Among the miRNAs that were commonly and significantly down-regulated in each of these women were miR-193b (P<0.003, miR-342-3p (P<0.003, miR186 (P<0.007, miR-130a (P<0.007, and miR-146a (P<0.007. To identify genes potentially released from inhibition by these repressed UV-miRNAs, we analyzed databases (e.g., DIANA-TarBase containing experimentally validated microRNA-gene interactions. In the end, this enabled us to construct UV-miRNA-gene regulatory networks consisting of individual genes with a probable gain-of-function being intersected not by one, but by several down-regulated UV-miRNAs. Most striking, however, was that these networks typified well-known regulatory modules involved in controlling the epithelial-to-mesenchymal transition and processes associated with the regulation of immune-evasion. We speculate that these pathways become activated by UVR resulting in miRNA down regulation only in melanocytes susceptible to melanoma, and that these changes could be partially responsible for empowering these cells toward tumor progression.

  20. The Response of microRNAs to Solar UVR in Skin-Resident Melanocytes Differs between Melanoma Patients and Healthy Persons.

    Science.gov (United States)

    Sha, Jingfeng; Gastman, Brian R; Morris, Nathan; Mesinkovska, Natasha A; Baron, Elma D; Cooper, Kevin D; McCormick, Thomas; Arbesman, Joshua; Harter, Marian L

    2016-01-01

    The conversion of melanocytes into cutaneous melanoma is largely dictated by the effects of solar ultraviolet radiation (UVR). Yet to be described, however, is exactly how these cells are affected by intense solar UVR while residing in their natural microenvironment, and whether their response differs in persons with a history of melanoma when compared to that of healthy individuals. By using laser capture microdissection (LCM) to isolate a pure population of melanocytes from a small area of skin that had been intermittingly exposed or un-exposed to physiological doses of solar UVR, we can now report for the first time that the majority of UV-responsive microRNAs (miRNAs) in the melanocytes of a group of women with a history of melanoma are down-regulated when compared to those in the melanocytes of healthy controls. Among the miRNAs that were commonly and significantly down-regulated in each of these women were miR-193b (P<0.003), miR-342-3p (P<0.003), miR186 (P<0.007), miR-130a (P<0.007), and miR-146a (P<0.007). To identify genes potentially released from inhibition by these repressed UV-miRNAs, we analyzed databases (e.g., DIANA-TarBase) containing experimentally validated microRNA-gene interactions. In the end, this enabled us to construct UV-miRNA-gene regulatory networks consisting of individual genes with a probable gain-of-function being intersected not by one, but by several down-regulated UV-miRNAs. Most striking, however, was that these networks typified well-known regulatory modules involved in controlling the epithelial-to-mesenchymal transition and processes associated with the regulation of immune-evasion. We speculate that these pathways become activated by UVR resulting in miRNA down regulation only in melanocytes susceptible to melanoma, and that these changes could be partially responsible for empowering these cells toward tumor progression. PMID:27149382