WorldWideScience

Sample records for autonomic skin responses

  1. Autonomic skin responses in females with Fabry disease

    DEFF Research Database (Denmark)

    Møller, Anette Torvin; Bach, Flemming W.; Feldt-Rasmussen, Ulla;

    2009-01-01

    Fabry disease is a genetic lysosomal disorder with dysfunction of the lysosomal enzyme alpha-galactosidase A causing accumulation of glycolipids in multiple organs including the nervous system and with neuropathy as a prominent manifestation. Neurological symptoms include pain and autonomic...... response to iontophoresis of acetylcholine (p = 0.04) and a smaller capsaicin-induced flare compared to controls. These findings suggest that female patients both have an impaired C-fiber function and local abnormalities in blood vessels and sweat glands....

  2. Sympathetic skin response: simple test for evaluation of autonomic function in patients with diabetes mellitus?

    Institute of Scientific and Technical Information of China (English)

    Srinivasa Jayachandra; Maxim Pinto; Urban J. A. D'Souza

    2005-01-01

    @@ To the Editor: We read with interest the excellent article by Huang YN et al.1 This important and carefully conducted study illustrates the sympathetic skin response (SSR) test can detect early dysfunction of the small sympathetic fibers in people affected by diabetes mellitus.

  3. The Impact of Autonomic Dysreflexia on Blood Flow and Skin Response in Individuals with Spinal Cord Injury

    Directory of Open Access Journals (Sweden)

    J. C. Ramella-Roman

    2008-08-01

    Full Text Available Autonomic dysreflexia (AD is an inappropriate response of the sympathetic nervous system that commonly occurs when individuals with spinal cord injury (SCI, at or above the sixth thoracic (T6 vertebra, are subjected to a noxious stimulus below the level of injury. An AD event can be put into motion by something as simple as an ingrown toenail or a full bladder, with symptoms ranging from headache, high blood pressure, and even stroke. We have characterized the onset of AD and resulting autonomic events in an individual with SCI using a fiberoptic-based probe. Two probes were located above and below the injury level, on the subjects forearm and thigh, respectively, and were connected to a dual channel spectrophotometer. Oxygen saturation was calculated using the reflectance spectra and an algorithm based on melanin and hemoglobin absorption. We noticed that during an AD event the amount of oxygen in the skin below the injury level dropped by as much as 40%, while above the injury level, skin oxygenation remained constant. In addition, we found that the level of skin perspiration below the level of injury increased significantly. We hypothesize that the combination of AD-related ischemia with pressure-related ischemia and increased perspiration places individuals with spinal cord injury level at T6 or above at an elevated risk for developing a pressure sore below the injury site.

  4. The sensory channel of presentation alters subjective ratings and autonomic responses towards disgusting stimuli -Blood pressure, heart rate and skin conductance in response to visual, auditory, haptic and olfactory presented disgusting stimuli-

    Directory of Open Access Journals (Sweden)

    Ilona eCroy

    2013-09-01

    Full Text Available Disgust causes specific reaction patterns, observable in mimic responses and body reactions. Most research on disgust deals with visual stimuli. However, pictures may cause another disgust experience than sounds, odors or tactile stimuli. Therefore disgust experience evoked by four different sensory channels was compared.A total of 119 participants received 3 different disgusting and one control stimulus, each presented through the visual, auditory, tactile and olfactory channel. Ratings of evoked disgust as well as responses of the autonomic nervous system (heart rate, skin conductance level, systolic blood pressure were recorded and the effect of stimulus labeling and of repeated presentation was analyzed. Ratings suggested that disgust could be evoked through all senses; they were highest for visual stimuli. However, autonomic reaction towards disgusting stimuli differed according to the channel of presentation. In contrast to the other, olfactory disgust stimuli provoked a strong decrease of systolic blood pressure. Additionally, labeling enhanced disgust ratings and autonomic reaction for olfactory and tactile, but not for visual and auditory stimuli. Repeated presentation indicated that participant’s disgust rating diminishes to all but olfactory disgust stimuli. Taken together we argue that the sensory channel through which a disgust reaction is evoked matters.

  5. Juvenile Cobalamin Deficiency in a 17 Year Old Child with Autonomic Dysfunction and Skin Changes

    OpenAIRE

    Siddiqui, Abdul Hafeez; Ansari, Aamir; Beech, Cameron M.; Shah, Nidhi P.; Tanner, Stephan M.; Sarnaik, Sharada A.

    2012-01-01

    We report a rare case of juvenile cobalamin deficiency who presented at the age of seventeen years. He was underweight and had skin changes, normocytic anemia and autonomic dysfunction which lead to adynamic ileus and acute post-renal failure. The expected macrocytosis was masked by an underlying alpha thalassemia trait. The patient had an excellent response to parenteral cobalamin treatment.

  6. Human Skin Hypoxia Modulates Cerebrovascular and Autonomic Functions

    OpenAIRE

    Olivia Pucci; Clifford Qualls; Anne Battisti-Charbonney; Balaban, Dahlia Y.; Fisher, Joe A.; Jim Duffin; Otto Appenzeller

    2012-01-01

    Because the skin is an oxygen sensor in amphibians and mice, we thought to confirm this function also in humans. The human upright posture, however, introduces additional functional demands for the maintenance of oxygen homeostasis in which cerebral blood flow and autonomic nervous system (ANS) function may also be involved. We examined nine males and three females. While subjects were breathing ambient air, at sea level, we changed gases in a plastic body-bag during two conditions of the exp...

  7. Framing the ultimatum game: gender differences and autonomic responses.

    Science.gov (United States)

    Sarlo, Michela; Lotto, Lorella; Palomba, Daniela; Scozzari, Simona; Rumiati, Rino

    2013-01-01

    The present study aimed at investigating whether the way offers are framed in the Ultimatum Game (UG) affects behavioral and autonomic responses in men and women. The "I give you" and "I take" expressions were used as gain and loss frames, respectively. Skin conductance and heart rate were recorded as indices of autonomic activation in response to unfair, mid-value, and fair offers. Acceptance rates were higher in men than in women under the gain frame. Moreover, men showed higher acceptance rates under the gain than under the loss frame with mid-value offers, whereas women's choices were not affected by frame. On the physiological level, men produced differential autonomic response patterns during decision-making when offers were presented under gain and loss framing. The "I take" frame, by acting as a loss frame, elicited in men the characteristic defensive response pattern that is evoked by aversive stimulation, in which increases in skin conductance are coupled with increases in heart rate. On the other hand, the "I give you" frame, by acting as a gain frame, elicited in men increases in skin conductance associated with prevailing heart rate deceleratory responses, reflecting a state of enhanced attention and orienting. In contrast, women's autonomic reactivity was not affected by frame, consistent with behavioral results. Phasic changes in heart rate were crucial in revealing differential functional significance of skin conductance responses under different frames in men, thus questioning the assumption that this autonomic measure can be used as an index of negative emotional arousal in the UG. PMID:22494303

  8. Human skin hypoxia modulates cerebrovascular and autonomic functions.

    Directory of Open Access Journals (Sweden)

    Olivia Pucci

    Full Text Available Because the skin is an oxygen sensor in amphibians and mice, we thought to confirm this function also in humans. The human upright posture, however, introduces additional functional demands for the maintenance of oxygen homeostasis in which cerebral blood flow and autonomic nervous system (ANS function may also be involved. We examined nine males and three females. While subjects were breathing ambient air, at sea level, we changed gases in a plastic body-bag during two conditions of the experiment such as to induce skin hypoxia (with pure nitrogen or skin normoxia (with air. The subjects performed a test of hypoxic ventilatory drive during each condition of the experiment. We found no differences in the hypoxic ventilatory drive tests. However, ANS function and cerebral blood flow velocities were modulated by skin hypoxia and the effect was significantly greater on the left than right middle cerebral arteries. We conclude that skin hypoxia modulates ANS function and cerebral blood flow velocities and this might impact life styles and tolerance to ambient hypoxia at altitude. Thus the skin in normal humans, in addition to its numerous other functions, is also an oxygen sensor.

  9. Human skin hypoxia modulates cerebrovascular and autonomic functions.

    Science.gov (United States)

    Pucci, Olivia; Qualls, Clifford; Battisti-Charbonney, Anne; Balaban, Dahlia Y; Fisher, Joe A; Duffin, Jim; Appenzeller, Otto

    2012-01-01

    Because the skin is an oxygen sensor in amphibians and mice, we thought to confirm this function also in humans. The human upright posture, however, introduces additional functional demands for the maintenance of oxygen homeostasis in which cerebral blood flow and autonomic nervous system (ANS) function may also be involved. We examined nine males and three females. While subjects were breathing ambient air, at sea level, we changed gases in a plastic body-bag during two conditions of the experiment such as to induce skin hypoxia (with pure nitrogen) or skin normoxia (with air). The subjects performed a test of hypoxic ventilatory drive during each condition of the experiment. We found no differences in the hypoxic ventilatory drive tests. However, ANS function and cerebral blood flow velocities were modulated by skin hypoxia and the effect was significantly greater on the left than right middle cerebral arteries. We conclude that skin hypoxia modulates ANS function and cerebral blood flow velocities and this might impact life styles and tolerance to ambient hypoxia at altitude. Thus the skin in normal humans, in addition to its numerous other functions, is also an oxygen sensor. PMID:23056597

  10. Autonomous Demand Response for Primary Frequency Regulation

    Energy Technology Data Exchange (ETDEWEB)

    Donnelly, Matt; Trudnowski, Daniel J.; Mattix, S.; Dagle, Jeffery E.

    2012-02-28

    The research documented within this report examines the use of autonomous demand response to provide primary frequency response in an interconnected power grid. The work builds on previous studies in several key areas: it uses a large realistic model (i.e., the interconnection of the western United States and Canada); it establishes a set of metrics that can be used to assess the effectiveness of autonomous demand response; and it independently adjusts various parameters associated with using autonomous demand response to assess effectiveness and to examine possible threats or vulnerabilities associated with the technology.

  11. Blunted autonomic response in cluster headache patients

    DEFF Research Database (Denmark)

    Barloese, Mads; Brinth, Louise; Mehlsen, Jesper;

    2015-01-01

    BACKGROUND: Cluster headache (CH) is a disabling headache disorder with chronobiological features. The posterior hypothalamus is involved in CH pathophysiology and is a hub for autonomic control. We studied autonomic response to the head-up tilt table test (HUT) including heart rate variability...... (HRV) in CH patients and compared results to healthy controls. METHODS AND MATERIALS: Twenty-seven episodic and chronic CH patients and an equal number of age-, sex- and BMI-matched controls were included. We analyzed responses to HUT in the time and frequency domain and by non-linear analysis. RESULTS...

  12. Autonomic fiber sprouting in the skin in chronic inflammation

    Directory of Open Access Journals (Sweden)

    Longo Geraldine

    2008-11-01

    Full Text Available Abstract Pain is a major symptom associated with chronic inflammation. In previous work from our laboratory, we have shown that in animal models of neuropathic pain there is a sprouting of sympathetic fibers into the upper dermis, a territory normally devoid of them. However, it is not known whether such sympathetic spouting, which is likely trophic factor mediated, also occurs in chronic inflammation and arthritis. In the present study, we used a rat model of chronic inflammation in which a small single dose of complete Freund's adjuvant (CFA was injected subcutaneously, unilaterally, into the plantar surface of the hindpaw. This led to a localized long-term skin inflammation and arthritis in all joints of the hindpaw. Animals were perfused with histological fixatives at 1, 2, 3 or 4 weeks after the injection. Experimental animals treated with CFA were compared to saline-injected animals. We then investigated the changes in the pattern of peripheral innervation of the peptidergic nociceptors and sympathetic fibers in rat glabrous hindpaw skin. Antibodies directed towards calcitonin gene-related peptide (CGRP and dopamine beta-hydroxylase (DBH were used for the staining of peptidergic and sympathetic fibers, respectively. Immunofluorescence was then used to analyze the different nerve fiber populations of the upper dermis. At 4 weeks following CFA treatment, DBH-immunoreactive (IR fibers were found to sprout into the upper dermis, in a pattern similar to the one we had observed in animals with a chronic constriction injury of the sciatic nerve in a previous publication. There was also a significant increase in the density of CGRP-IR fibers in the upper dermis in CFA treated animals at 2, 3 and 4 weeks post-injection. The increased peptidergic fiber innervation and the ectopic autonomic fibers found in the upper dermis may have a role in the pain-related behavior displayed by these animals.

  13. Mind-body relationships in elite apnea divers during breath holding: a study of autonomic responses to acute hypoxemia

    OpenAIRE

    Laurino, Marco; Menicucci, Danilo; Mastorci, Francesca; Allegrini, Paolo; Piarulli, Andrea; Scilingo, Enzo P.; Bedini, Remo; Pingitore, Alessandro; Passera, Mirko; L'Abbate, Antonio; Gemignani, Angelo

    2012-01-01

    The mental control of ventilation with all associated phenomena, from relaxation to modulation of emotions, from cardiovascular to metabolic adaptations, constitutes a psychophysiological condition characterizing voluntary breath-holding (BH). BH induces several autonomic responses, involving both autonomic cardiovascular and cutaneous pathways, whose characterization is the main aim of this study. Electrocardiogram and skin conductance (SC) recordings were collected from 14 elite divers duri...

  14. Motor execution detection based on autonomic nervous system responses

    International Nuclear Information System (INIS)

    Triggered assistance has been shown to be a successful robotic strategy for provoking motor plasticity, probably because it requires neurologic patients’ active participation to initiate a movement involving their impaired limb. Triggered assistance, however, requires sufficient residual motor control to activate the trigger and, thus, is not applicable to individuals with severe neurologic injuries. In these situations, brain and body–computer interfaces have emerged as promising solutions to control robotic devices. In this paper, we investigate the feasibility of a body–machine interface to detect motion execution only monitoring the autonomic nervous system (ANS) response. Four physiological signals were measured (blood pressure, breathing rate, skin conductance response and heart rate) during an isometric pinching task and used to train a classifier based on hidden Markov models. We performed an experiment with six healthy subjects to test the effectiveness of the classifier to detect rest and active pinching periods. The results showed that the movement execution can be accurately classified based only on peripheral autonomic signals, with an accuracy level of 84.5%, sensitivity of 83.8% and specificity of 85.2%. These results are encouraging to perform further research on the use of the ANS response in body–machine interfaces. (paper)

  15. Microvascular inflammatory response in the skin

    OpenAIRE

    Evilevitch, Vladimir

    2005-01-01

    This thesis examines the microvascular inflammatory response in the skin. The microvascular response includes vasodilatation and plasma exudation. In the first three studies, the combined response was measured in guinea pig skin with a technique based on detection of radiolabelled protein. Transferrin was labelled in vivo by injection of 113mIn and the conversion electrons detected over the skin using a plastic scintillator. The duration of the microvascular response after histamine an...

  16. Autonomic and cardiovascular responses of preschool children to television programs.

    Science.gov (United States)

    Gröer, M; Howell, M

    1990-01-01

    This exploratory study examined the heart rates (HR) and skin temperatures (ST) of 18 preschool children while they viewed two clips of everyday children's television (TV) programming. The measurements were made in a day care setting, in a naturalistic environment designed to mimic the real world of children's TV viewing. The purpose of the study was to determine whether cardiovascular and autonomic arousal to TV programming might occur in some children. Since a large body of psychosocial literature addresses the affects of TV violence on children, HR and ST were examined during exposure to scenes from Mr. Roger's Neighborhood and G.I. Joe cartoons. The Mr. Roger's clip was slow, rhythmic, prosocial, and nonviolent, while the G.I. Joe clip was fast-paced, staccato, colorful, and full of verbal and action violence. The study found a significant effect of exposure to the cartoon violence on HR, with HR increasing. ST decreased, but not significantly, and there was a significant effect of time on the ST, due possibly to habituation. This finding has relevance to nursing assessment, intervention, and education of parents and children, since TV viewing is a pervasive cultural phenomenon. The possibility of excessive or inappropriate autonomic and cardiovascular responsiveness in some children to TV must be considered. PMID:2213521

  17. Skin conductance response to the pain of others predicts later costly helping.

    Directory of Open Access Journals (Sweden)

    Grit Hein

    Full Text Available People show autonomic responses when they empathize with the suffering of another person. However, little is known about how these autonomic changes are related to prosocial behavior. We measured skin conductance responses (SCRs and affect ratings in participants while either receiving painful stimulation themselves, or observing pain being inflicted on another person. In a later session, they could prevent the infliction of pain in the other by choosing to endure pain themselves. Our results show that the strength of empathy-related vicarious skin conductance responses predicts later costly helping. Moreover, the higher the match between SCR magnitudes during the observation of pain in others and SCR magnitude during self pain, the more likely a person is to engage in costly helping. We conclude that prosocial motivation is fostered by the strength of the vicarious autonomic response as well as its match with first-hand autonomic experience.

  18. Skin conductance response to the pain of others predicts later costly helping

    OpenAIRE

    Hein, G.; Lamm, C.; Brodbeck, C.; Singer, T

    2011-01-01

    People show autonomic responses when they empathize with the suffering of another person. However, little is known about how these autonomic changes are related to prosocial behavior. We measured skin conductance responses (SCRs) and affect ratings in participants while either receiving painful stimulation themselves, or observing pain being inflicted on another person. In a later session, they could prevent the infliction of pain in the other by choosing to endure pain themselves. Our result...

  19. Fatigue while driving in a car simulator : effects on vigilance performance and autonomic skin conductance

    OpenAIRE

    Inkeri, Heidi

    2010-01-01

    In this vigilance research the effect of fatigue on driver’s voluntary reaction times (RT) and autonomic skin conductance (SC) was studied. Participants (n=17) drove approximately 3 hours in a simulator responding simultaneously on a peripheral visual vigilance task (PVVT). RTs were classified into 5 quintiles according to their latency. Also misses and misclassifications were explored. Results indicated that RTs increased linearly over time. SC amplitudes differed significantly between RT qu...

  20. Eye contact with neutral and smiling faces: effects on autonomic responses and frontal EEG asymmetry

    OpenAIRE

    Laura Maria Pönkänen

    2012-01-01

    In our previous studies we have shown that seeing another person “live” with a direct vs. averted gaze results in greater relative left-sided frontal asymmetry in the electroencephalography (EEG), associated with approach motivation, and in enhanced skin conductance responses indicating autonomic arousal. In our studies, however, the stimulus persons had a neutral expression. In real-life social interaction, eye contact is often associated with a smile, which is another signal of the sender’s...

  1. The sensory channel of presentation alters subjective ratings and autonomic responses towards disgusting stimuli -Blood pressure, heart rate and skin conductance in response to visual, auditory, haptic and olfactory presented disgusting stimuli-

    OpenAIRE

    Ilona eCroy; Kerstin eLaqua; Frank eSuess; Peter eJoraschky; Tjalf eZiemssen; Thomas eHummel

    2013-01-01

    Disgust causes specific reaction patterns, observable in mimic responses and body reactions. Most research on disgust deals with visual stimuli. However, pictures may cause another disgust experience than sounds, odors or tactile stimuli. Therefore disgust experience evoked by four different sensory channels was compared.A total of 119 participants received 3 different disgusting and one control stimulus, each presented through the visual, auditory, tactile and olfactory channel. Ratings of e...

  2. The sensory channel of presentation alters subjective ratings and autonomic responses toward disgusting stimuli – Blood pressure, heart rate and skin conductance in response to visual, auditory, haptic and olfactory presented disgusting stimuli

    OpenAIRE

    Croy, Ilona; Laqua, Kerstin; Süß, Frank; Joraschky, Peter; Ziemssen, Tjalf; Hummel, Thomas

    2014-01-01

    Disgust causes specific reaction patterns, observable in mimic responses and body reactions. Most research on disgust deals with visual stimuli. However, pictures may cause another disgust experience than sounds, odors, or tactile stimuli. Therefore, disgust experience evoked by four different sensory channels was compared. A total of 119 participants received 3 different disgusting and one control stimulus, each presented through the visual, auditory, tactile, and olfactory channel. Ratings ...

  3. Responsibility for Crashes of Autonomous Vehicles: An Ethical Analysis

    OpenAIRE

    Hevelke, Alexander; Nida-Rümelin, Julian

    2014-01-01

    A number of companies including Google and BMW are currently working on the development of autonomous cars. But if fully autonomous cars are going to drive on our roads, it must be decided who is to be held responsible in case of accidents. This involves not only legal questions, but also moral ones. The first question discussed is whether we should try to design the tort liability for car manufacturers in a way that will help along the development and improvement of autonomous vehicles. In p...

  4. Motor/autonomic stress responses in a competitive piano performance.

    Science.gov (United States)

    Yoshie, Michiko; Kudo, Kazutoshi; Ohtsuki, Tatsuyuki

    2009-07-01

    The present study examined the effects of psychological stress on performance quality, autonomic responses, and upper extremity muscle activity in skilled pianists through comparisons between stressful (competition) and nonstressful (rehearsal) conditions. We observed increased levels of subjective anxiety, autonomic arousal, and electromyographic activity in the competition condition, which could contribute to the impairment of performance quality. The results provide important practical implications for enhancing performance quality as well as preventing playing-related musculoskeletal disorders in musicians. PMID:19673810

  5. Facial feedback and autonomic responsiveness reflect impaired emotional processing in Parkinson's Disease.

    Science.gov (United States)

    Balconi, Michela; Pala, Francesca; Manenti, Rosa; Brambilla, Michela; Cobelli, Chiara; Rosini, Sandra; Benussi, Alberto; Padovani, Alessandro; Borroni, Barbara; Cotelli, Maria

    2016-01-01

    Emotional deficits are part of the non-motor features of Parkinson's disease but few attention has been paid to specific aspects such as subjective emotional experience and autonomic responses. This study aimed to investigate the mechanisms of emotional recognition in Parkinson's Disease (PD) using the following levels: explicit evaluation of emotions (Self-Assessment Manikin) and implicit reactivity (Skin Conductance Response; electromyographic measure of facial feedback of the zygomaticus and corrugator muscles). 20 PD Patients and 34 healthy controls were required to observe and evaluate affective pictures during physiological parameters recording. In PD, the appraisal process on both valence and arousal features of emotional cues were preserved, but we found significant impairment in autonomic responses. Specifically, in comparison to healthy controls, PD patients revealed lower Skin Conductance Response values to negative and high arousing emotional stimuli. In addition, the electromyographic measures showed defective responses exclusively limited to negative and high arousing emotional category: PD did not show increasing of corrugator activity in response to negative emotions as happened in heathy controls. PD subjects inadequately respond to the emotional categories which were considered more "salient": they had preserved appraisal process, but impaired automatic ability to distinguish between different emotional contexts. PMID:27509848

  6. Facial feedback and autonomic responsiveness reflect impaired emotional processing in Parkinson’s Disease

    Science.gov (United States)

    Balconi, Michela; Pala, Francesca; Manenti, Rosa; Brambilla, Michela; Cobelli, Chiara; Rosini, Sandra; Benussi, Alberto; Padovani, Alessandro; Borroni, Barbara; Cotelli, Maria

    2016-01-01

    Emotional deficits are part of the non-motor features of Parkinson’s disease but few attention has been paid to specific aspects such as subjective emotional experience and autonomic responses. This study aimed to investigate the mechanisms of emotional recognition in Parkinson’s Disease (PD) using the following levels: explicit evaluation of emotions (Self-Assessment Manikin) and implicit reactivity (Skin Conductance Response; electromyographic measure of facial feedback of the zygomaticus and corrugator muscles). 20 PD Patients and 34 healthy controls were required to observe and evaluate affective pictures during physiological parameters recording. In PD, the appraisal process on both valence and arousal features of emotional cues were preserved, but we found significant impairment in autonomic responses. Specifically, in comparison to healthy controls, PD patients revealed lower Skin Conductance Response values to negative and high arousing emotional stimuli. In addition, the electromyographic measures showed defective responses exclusively limited to negative and high arousing emotional category: PD did not show increasing of corrugator activity in response to negative emotions as happened in heathy controls. PD subjects inadequately respond to the emotional categories which were considered more “salient”: they had preserved appraisal process, but impaired automatic ability to distinguish between different emotional contexts. PMID:27509848

  7. Distribution and putative function of autonomic nerve fibres in the bill skin of the platypus (Ornithorhynchus anatinus).

    OpenAIRE

    Manger, P. R.; Keast, J R; Pettigrew, J D; Troutt, L

    1998-01-01

    The electroreceptors located in the bill skin of the platypus are modified secretory glands. The electroreceptive nerve terminals form bare endings in close proximity to the duct of these glands. In this study, we describe the autonomic innervation of the glands and a separate specialized autonomic innervation of the epidermal portion of the glandular duct. A range of immunohistochemical labels showed that the gland cells of the electroreceptors have a non-noradrenergic (putative parasympathe...

  8. Cognitive modulation of psychophysical, respiratory and autonomic responses to cold pressor test.

    Directory of Open Access Journals (Sweden)

    Enrica L Santarcangelo

    Full Text Available In healthy subjects with high hypnotisability (highs under hypnosis, subjectively effective suggestions for analgesia abolish the increases in blood pressure associated with cold pressor test (cpt by reducing the peripheral vascular resistance. The aim of the present study was to investigate the effects of the suggestions of analgesia on the responses to cpt in healthy highs (n = 22 and in low hypnotisable participants (lows, n = 22 out of hypnosis. Cpt was administered without (CPT and with suggestions for analgesia (CPT+AN. Psychophysical (pain intensity, pain threshold, cpt duration (time of immersion and pain tolerance, defined as the difference between cpt duration and pain threshold, respiratory (amplitude and frequency and autonomic variables (tonic skin conductance, mean RR interval (RR = 1/heart rate, blood pressure, skin blood flow were studied. The suggestions for analgesia increased cpt duration and RR in both groups, but decreased pain intensity and enhanced pain threshold only in highs; in both groups they did not modulate systolic blood pressure, tonic skin conductance and skin blood flow; thus, increased parasympathetic activity appears responsible for the heart rate reduction induced by suggestions in both groups. In conclusion, our findings show that suggestions modulate pain experience differentially in highs and lows, and are partially effective also in lows. We hypothesize that the mechanisms responsible for the efficacy of suggestions in healthy lows may be involved also in their efficacy in chronic pain patients with low hypnotisability.

  9. Responsibility for crashes of autonomous vehicles: an ethical analysis.

    Science.gov (United States)

    Hevelke, Alexander; Nida-Rümelin, Julian

    2015-06-01

    A number of companies including Google and BMW are currently working on the development of autonomous cars. But if fully autonomous cars are going to drive on our roads, it must be decided who is to be held responsible in case of accidents. This involves not only legal questions, but also moral ones. The first question discussed is whether we should try to design the tort liability for car manufacturers in a way that will help along the development and improvement of autonomous vehicles. In particular, Patrick Lin's concern that any security gain derived from the introduction of autonomous cars would constitute a trade-off in human lives will be addressed. The second question is whether it would be morally permissible to impose liability on the user based on a duty to pay attention to the road and traffic and to intervene when necessary to avoid accidents. Doubts about the moral legitimacy of such a scheme are based on the notion that it is a form of defamation if a person is held to blame for causing the death of another by his inattention if he never had a real chance to intervene. Therefore, the legitimacy of such an approach would depend on the user having an actual chance to do so. The last option discussed in this paper is a system in which a person using an autonomous vehicle has no duty (and possibly no way) of interfering, but is still held (financially, not criminally) responsible for possible accidents. Two ways of doing so are discussed, but only one is judged morally feasible. PMID:25027859

  10. Autonomous Reparative Unit (ARU): a new concept of repairing free flap donor site with local full-thickness skin graft

    OpenAIRE

    Squadrelli-Saraceno, M; Compan, A; Bimbi, G; Gatto, L.; Riccio, S; S. Colombo

    2010-01-01

    Usually, harvesting free flap in the limbs creates an inevitable sequence of aesthetic damage not only in the donor site but also in the area of the graft used to repair the free flap donor site. Aim of the study was to standardize a simple method, defined Autonomous Reparative Unit, that allows closing of the donor site defects with a skin graft from the adjacent cutaneous area, avoiding further aesthetic damage in a third area. We define the “Autonomous Reparative Unit”the rectangular shape...

  11. Eye contact with neutral and smiling faces: effects on frontal EEG asymmetry and autonomic responses

    Directory of Open Access Journals (Sweden)

    Laura Maria Pönkänen

    2012-05-01

    Full Text Available In our previous studies we have shown that seeing another person “live” with a direct vs. averted gaze results in greater relative left-sided frontal asymmetry in the electroencephalography (EEG, associated with approach motivation, and in enhanced skin conductance responses indicating autonomic arousal. In our studies, however, the stimulus persons had a neutral expression. In real-life social interaction, eye contact is often associated with a smile, which is another signal of the sender’s approach-related motivation. A smile could therefore enhance the affective-motivational responses to eye contact. In the present study, we investigated whether the facial expression (neutral vs. smile would modulate the frontal EEG asymmetry and autonomic arousal to seeing a direct vs. an averted gaze in faces presented “live” through a liquid crystal shutter. The results showed that the skin conductance responses were greater for the direct than the averted gaze and that the effect of gaze direction was more pronounced for a smiling than a neutral face. However, the frontal EEG asymmetry results revealed a more complex pattern. Participants whose responses to seeing the other person were overall indicative of leftward frontal activity (indicative of approach showed greater relative left-sided asymmetry for the direct vs. averted gaze, whereas participants whose responses were overall indicative of rightward frontal activity (indicative of avoidance showed greater relative right-sided asymmetry to direct vs. averted gaze. The other person’s facial expression did not have an effect on the frontal EEG asymmetry. These findings may reflect that another’s direct gaze, as compared to their smile, has a more dominant role in regulating perceivers’ approach motivation.

  12. Physiological correlates of the big 5: autonomic responses to video presentations.

    Science.gov (United States)

    Brumbaugh, Claudia Chloe; Kothuri, Ravi; Marci, Carl; Siefert, Caleb; Pfaff, Donald D

    2013-12-01

    Personality's link to emotional experience has been demonstrated, but specific biological responses to emotion as a function of personality have not been well-established. Here, the association between personality and physiological responses (heart rate, skin conductance, and respiration) to emotional videos was assessed. One-hundred sixty-nine participants self-reported on their Big 5 personality traits and underwent ambulatory monitoring as they watched four brief video clips from primetime television content showing scenes containing violence, fear, sadness, and tension. Generally, the negatively-toned emotional scenes provoked increases in skin conductance response and declines in heart rate. We found that physiological outcomes depended on the particular emotional scene and on personality, most notably Extraversion and Neuroticism. Extraversion, and to a lesser degree, Neuroticism, were associated with increases in autonomic arousal responses to the scenes. Gender also interacted with personality to predict responses, such that women who scored higher on measures of Extraversion, Neuroticism, and Conscientious tended to show more physiological arousal than men. Overall, the emotional scenes evoked increases in arousal and more controlled attention. The findings are discussed in context of the limited capacity model and shed light on how personality and gender affect physiological reactions to emotional experiences in everyday life. PMID:24129901

  13. Anticipatory autonomic response to a public speaking task in women: the role of trait anxiety.

    Science.gov (United States)

    Gonzalez-Bono, Esperanza; Moya-Albiol, Luis; Salvador, Alicia; Carrillo, Eduvigis; Ricarte, Jorge; Gomez-Amor, Jesus

    2002-01-01

    The aim of this research was to study anticipatory autonomic responses their relationship to trait anxiety. Twenty-three women prepared an evaluated speech (S-condition) and 22 women an evaluated essay (W-condition). Heart rate (HR), finger pulse volume (FPV) and skin conductance were recorded before, during and after preparation of the task and during task performance; state-anxiety was evaluated before and after the task. In the total sample, state-anxiety was higher in the S- than in W-condition and this anxiety increase was accompanied by FPV reductions. However, when the sample was split according to trait anxiety scores, HR during preparation and increases of state-anxiety were greater in S- than W-condition in only in high-anxious women. Results suggest that specificity of anticipatory HR response to a public speaking task in women is moderated by cognitive anxiety. PMID:12100844

  14. Heart rate responses to autonomic challenges in obstructive sleep apnea.

    Directory of Open Access Journals (Sweden)

    Paul M Macey

    Full Text Available Obstructive sleep apnea (OSA is accompanied by structural alterations and dysfunction in central autonomic regulatory regions, which may impair dynamic and static cardiovascular regulation, and contribute to other syndrome pathologies. Characterizing cardiovascular responses to autonomic challenges may provide insights into central nervous system impairments, including contributions by sex, since structural alterations are enhanced in OSA females over males. The objective was to assess heart rate responses in OSA versus healthy control subjects to autonomic challenges, and, separately, characterize female and male patterns. We studied 94 subjects, including 37 newly-diagnosed, untreated OSA patients (6 female, age mean ± std: 52.1 ± 8.1 years; 31 male aged 54.3 ± 8.4 years, and 57 healthy control subjects (20 female, 50.5 ± 8.1 years; 37 male, 45.6 ± 9.2 years. We measured instantaneous heart rate with pulse oximetry during cold pressor, hand grip, and Valsalva maneuver challenges. All challenges elicited significant heart rate differences between OSA and control groups during and after challenges (repeated measures ANOVA, p<0.05. In post-hoc analyses, OSA females showed greater impairments than OSA males, which included: for cold pressor, lower initial increase (OSA vs. control: 9.5 vs. 7.3 bpm in females, 7.6 vs. 3.7 bpm in males, OSA delay to initial peak (2.5 s females/0.9 s males, slower mid-challenge rate-of-increase (OSA vs. control: -0.11 vs. 0.09 bpm/s in females, 0.03 vs. 0.06 bpm/s in males; for hand grip, lower initial peak (OSA vs. control: 2.6 vs. 4.6 bpm in females, 5.3 vs. 6.0 bpm in males; for Valsalva maneuver, lower Valsalva ratio (OSA vs. control: 1.14 vs. 1.30 in females, 1.29 vs. 1.34 in males, and OSA delay during phase II (0.68 s females/1.31 s males. Heart rate responses showed lower amplitude, delayed onset, and slower rate changes in OSA patients over healthy controls, and impairments may be more pronounced in

  15. Autonomously-triggered microfluidic cooling using thermo-responsive hydrogels.

    Science.gov (United States)

    Agarwal, Abhishek K; Dong, Liang; Beebe, David J; Jiang, Hongrui

    2007-03-01

    We present autonomously-triggered on-chip microfluidic cooling devices that utilize thermo-responsive hydrogels to adapt to local environmental temperatures. An external rotating magnetic stirrer couples with an in situ fabricated nickel impeller in these centrifugal-based microfluidic cooling devices to recirculate cooler water. Temperature-responsive hydrogels, which exhibit volumetric expansion and contraction, are integrated at the axle of the impeller. In this design, the hydrogels behave similar to an automotive clutch, to autonomously control the impeller's rotation as a function of the local environmental temperature. Therefore, the hydrogels act as both sensors and actuators and help take away the necessity for additional temperature sensing, feedback, and/or control units here. Cooling devices capable of on-chip thermal management at multiple predetermined onset operation points are realized by changes to the composition of hydrogel to alter its lowest critical solution temperature (LCST). Furthermore, the effect of magnetic stirrer frequency on the fluid cooling and flowrates for different two-blade nickel impeller designs are presented. PMID:17330161

  16. Dorsal and ventral hippocampus modulate autonomic responses but not behavioral consequences associated to acute restraint stress in rats.

    Science.gov (United States)

    Scopinho, América A; Lisboa, Sabrina F S; Guimarães, Francisco S; Corrêa, Fernando M A; Resstel, Leonardo B M; Joca, Sâmia R L

    2013-01-01

    Recent evidence has suggested that the dorsal (DH) and the ventral (VH) poles of the hippocampus are structurally, molecularly and functionally different regions. While the DH is preferentially involved in the modulation of spatial learning and memory, the VH modulates defensive behaviors related to anxiety. Acute restraint is an unavoidable stress situation that evokes marked and sustained autonomic changes, which are characterized by elevated blood pressure (BP), intense heart rate (HR) increases, skeletal muscle vasodilatation and cutaneous vasoconstriction, which are accompanied by a rapid skin temperature drop followed by body temperature increases. In addition to those autonomic responses, animals submitted to restraint also present behavioral changes, such as reduced exploration of the open arms of an elevated plus-maze (EPM), an anxiogenic-like effect. In the present work, we report a comparison between the effects of pharmacological inhibition of DH and VH neurotransmission on autonomic and behavioral responses evoked by acute restraint stress in rats. Bilateral microinjection of the unspecific synaptic blocker cobalt chloride (CoCl2, 1mM) into the DH or VH attenuated BP and HR responses, as well as the decrease in the skin temperature, elicited by restraint stress exposure. Moreover, DH or VH inhibition before restraint did not change the delayed increased anxiety behavior observed 24 h later in the EPM. The present results demonstrate for the first time that both DH and VH mediate stress-induced autonomic responses to restraint but they are not involved in the modulation of the delayed emotional consequences elicited by such stress. PMID:24147071

  17. Responses to hyperthermia. Optimizing heat dissipation by convection and evaporation: Neural control of skin blood flow and sweating in humans.

    Science.gov (United States)

    Smith, Caroline J; Johnson, John M

    2016-04-01

    Under normothermic, resting conditions, humans dissipate heat from the body at a rate approximately equal to heat production. Small discrepancies between heat production and heat elimination would, over time, lead to significant changes in heat storage and body temperature. When heat production or environmental temperature is high the challenge of maintaining heat balance is much greater. This matching of heat elimination with heat production is a function of the skin circulation facilitating heat transport to the body surface and sweating, enabling evaporative heat loss. These processes are manifestations of the autonomic control of cutaneous vasomotor and sudomotor functions and form the basis of this review. We focus on these systems in the responses to hyperthermia. In particular, the cutaneous vascular responses to heat stress and the current understanding of the neurovascular mechanisms involved. The available research regarding cutaneous active vasodilation and vasoconstriction is highlighted, with emphasis on active vasodilation as a major responder to heat stress. Involvement of the vasoconstrictor and active vasodilator controls of the skin circulation in the context of heat stress and nonthermoregulatory reflexes (blood pressure, exercise) are also considered. Autonomic involvement in the cutaneous vascular responses to direct heating and cooling of the skin are also discussed. We examine the autonomic control of sweating, including cholinergic and noncholinergic mechanisms, the local control of sweating, thermoregulatory and nonthermoregulatory reflex control and the possible relationship between sudomotor and cutaneous vasodilator function. Finally, we comment on the clinical relevance of these control schemes in conditions of autonomic dysfunction. PMID:26830064

  18. The radiation response of skin in young and old rats

    International Nuclear Information System (INIS)

    The results of this investigation clearly demonstrate the different radiation skin response in rats of differing ages. The reasons for these differences cannot be clarified until cell kinetic studies have been completed. These results obtained for rodent skin would appear to be in disagreement with the available data for human skin (Rubin and Casarett 1968) where no marked age-related changes were reported. Also, in pig skin studies (Hopewell and Young 1982) there was no evidence of an age effect in the dermal vascular response in 3-12-month-old animals. This may be related to the different tissue being investigated or it may reflect important species differences. Whatever the reasons behind these observations, the different skin response to radiation in rats of 7, 14 and 52 weeks of age has clearly been demonstrated and should be borne in mind when extrapolating data with rodent skin to the clinical situation. (author)

  19. Responsive corneosurfametry following in vivo skin preconditioning.

    Science.gov (United States)

    Uhoda, E; Goffin, V; Pierard, G E

    2003-12-01

    Skin is subjected to many environmental threats, some of which altering the structure and function of the stratum corneum. Among them, surfactants are recognized factors that may influence irritant contact dermatitis. The present study was conducted to compare the variations in skin capacitance and corneosurfametry (CSM) reactivity before and after skin exposure to repeated subclinical injuries by 2 hand dishwashing liquids. A forearm immersion test was performed on 30 healthy volunteers. 2 daily soak sessions were performed for 5 days. At inclusion and the day following the last soak session, skin capacitance was measured and cyanoacrylate skin-surface strippings were harvested. The latter specimens were used for the ex vivo microwave CSM. Both types of assessments clearly differentiated the 2 hand dishwashing liquids. The forearm immersion test allowed the discriminant sensitivity of CSM to increase. Intact skin capacitance did not predict CSM data. By contrast, a significant correlation was found between the post-test conductance and the corresponding CSM data. In conclusion, a forearm immersion test under realistic conditions can discriminate the irritation potential between surfactant-based products by measuring skin conductance and performing CSM. In vivo skin preconditioning by surfactants increases CSM sensitivity to the same surfactants. PMID:15025702

  20. The framing effect and skin conductance responses

    Directory of Open Access Journals (Sweden)

    Patrick Ring

    2015-08-01

    Full Text Available Individuals often rely on simple heuristics when they face complex choice situations under uncertainty. Traditionally, it has been proposed that cognitive processes are the main driver to evaluate different choice options and finally to reach a decision. Growing evidence, however, highlights a strong interrelation between judgment and decision-making (JDM on the one hand, and emotional processes on the other hand. This also seems to apply to judgmental heuristics, i.e. decision-processes that are typically considered to be fast and intuitive. In this study, participants are exposed to different probabilities of receiving an unpleasant electric shock. Information about electric shock probabilities is either positively or negatively framed. Integrated skin conductance responses (ISCRs while waiting for electric shock realization are used as an indicator for participants' emotional arousal. This measure is compared to objective probabilities. I find evidence for a relation between emotional body reactions measured by ISCRs and the framing effect. Under negative frames, participants show significantly higher ISCRs while waiting for an electric shock to be delivered than under positive frames. This result might contribute to a better understanding of the psychological processes underlying JDM. Further studies are necessary to reveal the causality underlying this finding, i.e. whether emotional processes influence JDM or vice versa.

  1. Mind-body relationships in elite apnea divers during breath holding: a study of autonomic responses to acute hypoxemia

    Directory of Open Access Journals (Sweden)

    Marco eLaurino

    2012-03-01

    Full Text Available The mental control of ventilation with all associated phenomena,from relaxation to modulation of emotions, from cardiovascular tometabolic adaptations, constitutes a psychophysiological conditioncharacterizing voluntary breath holding (BH. BH induces severalautonomic responses, involving both autonomic cardiovascular andcutaneous pathways, whose characterization is the main aim ofthis study. Electrocardiogram and skin conductance (SC recordingswere collected from 14 elite divers during three conditions: freebreathing (FB, normoxic phase of BH (NPBH and hypoxic phaseof BH (HPBH. Thus, we compared a set of features describing signaldynamics between the three experimental conditions: from heart ratevariability features (in time and frequency domains and by usingnonlinear methods to rate and shape of spontaneous SC responses.The main result of the study rises by applying a Factor Analysis tothe subset of features significantly changed in the two BH phases.Indeed, the Factor Analysis allowed to uncover the structure of latentfactors which modeled the autonomic response: a factor describingthe autonomic balance, one the information increase rate, and alatter the central nervous system driver. The BH did not disrupt theFB factorial structure, and only few features moved among factors.Factor Analysis indicates that during BH i only the SC described theemotional output, ii the sympathetic tone on heart did not change, iiithe dynamics of interbeats intervals showed an increase of long rangecorrelation that anticipates the HPBH, followed by a drop to a randombehavior. In conclusion, data show that the autonomic control onheart rate and skin conductance are differentially modulated duringBH, which could be related to a more pronounced effect on emotionalcontrol induced by the mental training to BH.

  2. Reliability of Autonomic Responses and Malaise Across Multiple Motion Sickness Stimulation Tests

    Science.gov (United States)

    Stout, Cynthia S.; Toscano, William B.; Cowings, Patricia S.

    1993-01-01

    There is general agreement that a high degree of variability exists between subjects in their autonomic nervous system responses to motion sickness stimulation. Additionally, a paucity of data exists that examines the variability within an individual across repeated motion sickness tests. Investigators have also examined the relationship of autonomic responses to motion sickness development. These investigations have used analyses at discrete points in time to describe this relationship. This approach fails to address the time course of autonomic responses and malaise development throughout the motion sickness test. Our objectives were to examine the reliability of autonomic responses and malaise using the final minute of the motion sickness test across five testing occasions, to examine the reliability of the change in autonomic responses and the change in malaise across five testing occasions, and to examine the relationship between changes in autonomic responses and changes in malaise level across the entire motion sickness test. Our results indicate that, based on the final minute of testing, the autonomic responses of heart rate, blood volume pulse, and respiration rate are moderately stable across multiple tests. Changes in heart rate, blood volume pulse, respiration rate, and malaise throughout the test duration were less stable across the tests. We attribute this instability to variations in individual susceptibility and the error associated with estimating a measure of autonomic gain.

  3. Control of the skin scarring response

    Directory of Open Access Journals (Sweden)

    Lydia M. Ferreira

    2009-09-01

    Full Text Available There comes a time when the understanding of the cutaneous healing process becomes essential due to the need for a precocious tissue repair to reduce the physical, social, and psychological morbidity. Advances in the knowledge on the control of interaction among cells, matrix and growth factors will provide more information on the Regenerative Medicine, an emerging area of research in medical bioengineering. However, considering the dynamism and complexity of the cutaneous healing response, it is fundamental to understand the control mechanism exerted by the interaction and synergism of both systems, cutaneous nervous and central nervous, via hypothalamus hypophysis-adrenal axis, a relevant subject, but hardly ever explored. The present study reviews the neuro-immune-endocrine physiology of the skin responsible for its multiple functions and the extreme disturbances of the healing process, like the excess and deficiency of the extracellular matrix deposition.Aproxima-se uma época na qual é fundamental a compreensão do processo cicatricial cutâneo frente à necessidade da restauração tecidual precoce, visando a diminuição das morbidades física, social e psicológica. O avanço no conhecimento acerca do controle das interações entre as células, a matriz e os fatores de crescimento dará maiores informações à Medicina Regenerativa, área de pesquisa emergente da bioengenharia médica. Entretanto, diante do dinamismo e complexidade da resposta cicatricial cutânea torna-se indispensável o entendimento do mecanismo de controle exercido pela interação e sinergismo do sistema nervoso cutâneo e o sistema nervoso central, via eixo hipotálamo-hipófise-adrenal, tema relevante, porém, pouco abordado. O presente estudo revisa a fisiologia neuro-imuno-endócrina da pele, responsável por suas múltiplas funções, e os distúrbios extremos do processocicatricial, como o excesso e deficiência de deposição da matriz extracelular.

  4. TRPM8 mechanism of autonomic nerve response to cold in respiratory airway

    Directory of Open Access Journals (Sweden)

    Wang Cong-Yi

    2008-06-01

    Full Text Available Abstract Breathing cold air without proper temperature exchange can induce strong respiratory autonomic responses including cough, airway constriction and mucosal secretion, and can exacerbate existing asthma conditions and even directly trigger an asthma attack. Vagal afferent fiber is thought to be involved in the cold-induced respiratory responses through autonomic nerve reflex. However, molecular mechanisms by which vagal afferent fibers are excited by cold remain unknown. Using retrograde labeling, immunostaining, calcium imaging, and electrophysiological recordings, here we show that a subpopulation of airway vagal afferent nerves express TRPM8 receptors and that activation of TRPM8 receptors by cold excites these airway autonomic nerves. Thus activation of TRPM8 receptors may provoke autonomic nerve reflex to increase airway resistance. This putative autonomic response may be associated with cold-induced exacerbation of asthma and other pulmonary disorders, making TRPM8 receptors a possible target for prevention of cold-associated respiratory disorders.

  5. Autonomic and Emotional Responses of Graduate Student Clinicians in Speech-Language Pathology to Stuttered Speech

    Science.gov (United States)

    Guntupalli, Vijaya K.; Nanjundeswaran, Chayadevie; Dayalu, Vikram N.; Kalinowski, Joseph

    2012-01-01

    Background: Fluent speakers and people who stutter manifest alterations in autonomic and emotional responses as they view stuttered relative to fluent speech samples. These reactions are indicative of an aroused autonomic state and are hypothesized to be triggered by the abrupt breakdown in fluency exemplified in stuttered speech. Furthermore,…

  6. University EFL Learners' Perceptions of Their Autonomous Learning Responsibilities and Abilities

    Science.gov (United States)

    Abdel Razeq, Anwar Ahmad

    2014-01-01

    This study investigated the readiness of university students for autonomous learning of English as a foreign language. Data was collected using questionnaires and interviews. The study assessed learners' readiness for autonomous learning across three dimensions: a) learners' perceptions of their educational responsibilities; b)…

  7. Sensor Webs: Autonomous Rapid Response to Monitor Transient Science Events

    Science.gov (United States)

    Mandl, Dan; Grosvenor, Sandra; Frye, Stu; Sherwood, Robert; Chien, Steve; Davies, Ashley; Cichy, Ben; Ingram, Mary Ann; Langley, John; Miranda, Felix

    2005-01-01

    To better understand how physical phenomena, such as volcanic eruptions, evolve over time, multiple sensor observations over the duration of the event are required. Using sensor web approaches that integrate original detections by in-situ sensors and global-coverage, lower-resolution, on-orbit assets with automated rapid response observations from high resolution sensors, more observations of significant events can be made with increased temporal, spatial, and spectral resolution. This paper describes experiments using Earth Observing 1 (EO-1) along with other space and ground assets to implement progressive mission autonomy to identify, locate and image with high resolution instruments phenomena such as wildfires, volcanoes, floods and ice breakup. The software that plans, schedules and controls the various satellite assets are used to form ad hoc constellations which enable collaborative autonomous image collections triggered by transient phenomena. This software is both flight and ground based and works in concert to run all of the required assets cohesively and includes software that is model-based, artificial intelligence software.

  8. Lower corticosteroid skin blanching response is associated with severe COPD.

    Directory of Open Access Journals (Sweden)

    Susan J M Hoonhorst

    Full Text Available BACKGROUND: Chronic obstructive pulmonary disease (COPD is characterized by chronic airflow limitation caused by ongoing inflammatory and remodeling processes of the airways and lung tissue. Inflammation can be targeted by corticosteroids. However, airway inflammation is generally less responsive to steroids in COPD than in asthma. The underlying mechanisms are yet unclear. This study aimed to assess whether skin corticosteroid insensitivity is associated with COPD and COPD severity using the corticosteroid skin blanching test. METHODS: COPD patients GOLD stage I-IV (n = 27, 24, 22, and 16 respectively and healthy never-smokers and smokers (n = 28 and 56 respectively were included. Corticosteroid sensitivity was assessed by the corticosteroid skin blanching test. Budesonide was applied in 8 logarithmically increasing concentrations (0-100 μg/ml on subject's forearm. Assessment of blanching was performed after 7 hours using a 7-point scale (normal skin to intense blanching. All subjects performed spirometry and body plethysmography. RESULTS: Both GOLD III and GOLD IV COPD patients showed significantly lower skin blanching responses than healthy never-smokers and smokers, GOLD I, and GOLD II patients. Their area under the dose-response curve values of the skin blanching response were 586 and 243 vs. 1560, 1154, 1380, and 1309 respectively, p<0.05. Lower FEV1 levels and higher RV/TLC ratios were significantly associated with lower skin blanching responses (p = 0.001 and p = 0.004 respectively. GOLD stage I, II, III and IV patients had similar age and packyears. CONCLUSIONS: In this study, severe and very severe COPD patients had lower skin corticosteroid sensitivity than mild and moderate COPD patients and non-COPD controls with comparable age and packyears. Our findings together suggest that the reduced skin blanching response fits with a subgroup of COPD patients that has an early-onset COPD phenotype.

  9. Deceased donor skin allograft banking: Response and utilization

    Directory of Open Access Journals (Sweden)

    Gore Madhuri

    2010-10-01

    Full Text Available Background: In the absence of xenograft and biosynthetic skin substitutes, deceased donor skin allografts is a feasible option for saving life of patient with extensive burn injury in our country. Aims: The first deceased donor skin allograft bank in India became functional at Lokmanya Tilak Municipal (LTM medical college and hospital on 24 th April 2000. The response of Indian society to this new concept of skin donation after death and the pattern of utilization of banked allografts from 2000 to 2010 has been presented in this study. Settings and Design: This allograft skin bank was established by the department of surgery. The departments of surgery and microbiology share the responsibility of smooth functioning of the bank. Materials and Methods: The response in terms of number of donations and the profile of donors was analyzed from records. Pattern and outcome of allograft utilization was studied from specially designed forms. Results: During these ten years, 262 deceased donor skin allograft donations were received. The response showed significant improvement after counselling was extended to the community. Majority of the donors were above 70 years of age and procurement was done at home for most. Skin allografts from 249 donors were used for 165 patients in ten years. The outcome was encouraging with seven deaths in 151 recipients with burn injuries. Conclusions: Our experience shows that the Indian society is ready to accept the concept of skin donation after death. Use of skin allografts is life saving for large burns. We need to prepare guidelines for the establishment of more skin banks in the country.

  10. Cognitive load and autonomic response patterns under negative priming demand in depersonalization-derealization disorder.

    Science.gov (United States)

    Lemche, Erwin; Sierra-Siegert, Mauricio; David, Anthony S; Phillips, Mary L; Gasston, David; Williams, Steven C R; Giampietro, Vincent P

    2016-04-01

    Previous studies have yielded evidence for cognitive processing abnormalities and alterations of autonomic functioning in depersonalization-derealization disorder (DPRD). However, multimodal neuroimaging and psychophysiology studies have not yet been conducted to test for functional and effective connectivity under cognitive stress in patients with DPRD. DPRD and non-referred control subjects underwent a combined Stroop/negative priming task, and the neural correlates of Stroop interference effect, negative priming effect, error rates, cognitive load span and average amplitude of skin conductance responses were ascertained for both groups. Evoked haemodynamic responses for basic Stroop/negative priming activations were compared. For basic Stroop to neutral contrast, patients with DPRD differed in the location (inferior vs. superior lobule) of the parietal region involved, but showed similar activations in the left frontal region. In addition, patients with DPRD also co-activated the dorsomedial prefrontal cortex (BA9) and posterior cingulate cortex (BA31), which were also found to be the main between-group difference regions. These regions furthermore showed connectivity with frequency of depersonalization states. Evoked haemodynamic responses drawn from regions of interest indicated significant between-group differences in 30-40% of time points. Brain-behaviour correlations differed mainly in laterality, yet only slightly in regions. A reversal of autonomic patterning became evident in patients with DPRD for cognitive load spans, indicating less effective arousal suppression under cognitive stress - patients with DPRD showed positive associations of cognitive load with autonomic responses, whereas controls exhibit respective inverse association. Overall, the results of the present study show only minor executive cognitive peculiarities, but further support the notion of abnormalities in autonomic functioning in patients with DPRD. PMID:26791018

  11. Responses of the autonomic nervous system in altitude adapted and high altitude pulmonary oedema subjects

    Science.gov (United States)

    Mathew, Lazar; Purkayastha, S. S.; Jayashankar, A.; Radhakrishnan, U.; Sen Gupta, J.; Nayar, H. S.

    1985-06-01

    Studies were carried out to ascertain the role of sympatho-parasympathetic responses in the process of adaptation to altitude. The assessment of status of autonomic balance was carried out in a group of 20 young male subjects by recording their resting heart rate, blood pressure, oral temperature, mean skin temperature, extremity temperatures, pupillary diameter, cold pressor response, oxygen consumption, cardioacceleration during orthostasis and urinary excretion of catecholamines; in a thermoneutral laboratory. The same parameters were repeated on day 3 and at weekly intervals for a period of 3 weeks, after exposing them to 3,500 m; and also after return to sea level. At altitude, similar studies were carried out in a group of 10 acclimatized lowlanders, 10 high altitude natives and 6 patients who had recently recovered from high altitude pulmonary oedema. In another phase, similar studies were done in two groups of subjects, one representing 15 subjects who had stayed at altitude (3,500 4,000 m) without any ill effects and the other comprising of 10 subjects who had either suffered from high altitude pulmonary oedema (HAPO) or acute mountain sickness (AMS). The results revealed sympathetic overactivity on acute induction to altitude which showed gradual recovery on prolonged stay, the high altitude natives had preponderance to parasympathetic system. Sympathetic preponderance may not be an essential etiological factor for the causation of maladaptation syndromes.

  12. Central efferent pathways mediating skin cooling-evoked sympathetic thermogenesis in brown adipose tissue

    OpenAIRE

    Nakamura, Kazuhiro; Morrison, Shaun F.

    2006-01-01

    Control of thermoregulatory effectors by the autonomic nervous system is a critical component of rapid cold-defense responses, which are triggered by thermal information from the skin. However, the central autonomic mechanism driving thermoregulatory effector responses to skin thermal signals remains to be determined. Here, we examined the involvement of several autonomic brain regions in sympathetic thermogenic responses in brown adipose tissue (BAT) to skin cooling in urethane-chloralose-an...

  13. TRPM8 mechanism of autonomic nerve response to cold in respiratory airway

    OpenAIRE

    Wang Cong-Yi; Tominaga Makoto; Johnson Richard D; Chen Meng; Ling Jennifer X; Xing Hong; Gu Jianguo

    2008-01-01

    Abstract Breathing cold air without proper temperature exchange can induce strong respiratory autonomic responses including cough, airway constriction and mucosal secretion, and can exacerbate existing asthma conditions and even directly trigger an asthma attack. Vagal afferent fiber is thought to be involved in the cold-induced respiratory responses through autonomic nerve reflex. However, molecular mechanisms by which vagal afferent fibers are excited by cold remain unknown. Using retrograd...

  14. The thyroid hormone receptors modulate the skin response to retinoids.

    Directory of Open Access Journals (Sweden)

    Laura García-Serrano

    Full Text Available BACKGROUND: Retinoids play an important role in skin homeostasis and when administered topically cause skin hyperplasia, abnormal epidermal differentiation and inflammation. Thyroidal status in humans also influences skin morphology and function and we have recently shown that the thyroid hormone receptors (TRs are required for a normal proliferative response to 12-O-tetradecanolyphorbol-13-acetate (TPA in mice. METHODOLOGY/PRINCIPAL FINDINGS: We have compared the epidermal response of mice lacking the thyroid hormone receptor binding isoforms TRα1 and TRβ to retinoids and TPA. Reduced hyperplasia and a decreased number of proliferating cells in the basal layer in response to 9-cis-RA and TPA were found in the epidermis of TR-deficient mice. Nuclear levels of proteins important for cell proliferation were altered, and expression of keratins 5 and 6 was also reduced, concomitantly with the decreased number of epidermal cell layers. In control mice the retinoid (but not TPA induced parakeratosis and diminished expression of keratin 10 and loricrin, markers of early and terminal epidermal differentiation, respectively. This reduction was more accentuated in the TR deficient animals, whereas they did not present parakeratosis. Therefore, TRs modulate both the proliferative response to retinoids and their inhibitory effects on skin differentiation. Reduced proliferation, which was reversed upon thyroxine treatment, was also found in hypothyroid mice, demonstrating that thyroid hormone binding to TRs is required for the normal response to retinoids. In addition, the mRNA levels of the pro-inflammatory cytokines TNFα and IL-6 and the chemotactic proteins S1008A and S1008B were significantly elevated in the skin of TR knock-out mice after TPA or 9-cis-RA treatment and immune cell infiltration was also enhanced. CONCLUSIONS/SIGNIFICANCE: Since retinoids are commonly used for the treatment of skin disorders, these results demonstrating that TRs

  15. Comparison of changes in heart rate variability and sacral skin perfusion in response to postural changes in people with spinal cord injury

    Directory of Open Access Journals (Sweden)

    Yih-Kuen Jan, PT, PhD

    2013-04-01

    Full Text Available The current clinical practice has established guidelines to assess influences of severity of autonomic injury on the control of heart and blood pressure following spinal cord injury (SCI. However, the influences of SCI-induced autonomic impairment on microvascular dysfunction have not yet been established. Heart rate variability (HRV has been shown to be a potential tool for quantifying residual sympathovagal regulation of the cardiovascular system following SCI and may be used to assess the effect of autonomic injury on skin microvascular dysfunction. A total of 26 people were recruited into the study, including 12 people with SCI and 14 nondisabled controls. HRV and sacral skin intervals and sacral skin perfusion were continually recorded during 10 min upright and 10 min prone postures. The sympathovagal balance was defined as the ratio of the power of the low frequency to the high frequency of HRV. The results showed that postural changes of nondisabled people produced significant changes in the sympathovagal balance; lower sympathovagal balance was associated with higher skin perfusion (p < 0.05. People with SCI did not show a significant change of HRV and skin perfusion in response to postural changes. In this study, we have demonstrated that the sympathovagal balance assessed by HRV was associated with the skin vasoconstrictive response to postural changes.

  16. Effects of heart rate variability biofeedback on cardiovascular responses and autonomic sympathovagal modulation following stressor tasks in prehypertensives.

    Science.gov (United States)

    Chen, S; Sun, P; Wang, S; Lin, G; Wang, T

    2016-02-01

    Autonomic dysfunction is implicated in prehypertension, and previous studies have suggested that therapies that improve modulation of sympathovagal balance, such as biofeedback and slow abdominal breathing, are effective in patients with prehypertension at rest. However, considering that psychophysiological stressors may be associated with greater cardiovascular risk in prehypertensives, it is important to investigate whether heart rate variability biofeedback (HRV-BF) results in equivalent effects on autonomic cardiovascular responses control during stressful conditions in prehypertensives. A total of 32 college students with prehypertension were enrolled and randomly assigned to HRV-BF (n=12), slow abdominal breathing (SAB, n=10) or no treatment (control, n=10) groups. Then, a training experiment consisting of 15 sessions was employed to compare the effect of each intervention on the following cardiovascular response indicators before and after intervention: heart rate (HR); heart rate variability (HRV) components; blood volume pulse amplitude (BVPamp); galvanic skin response; respiration rate (RSP); and blood pressure. In addition, the cold pressor test and the mental arithmetic challenge test were also performed over two successive days before and after the invention as well as after 3 months of follow-up. A significant decrease in HR and RSP and a significant increase in BVPamp were observed after the HRV-BF intervention (P<0.001). For the HRV analysis, HRV-BF significantly reduced the ratio of low-frequency power to high-frequency power (the LF/HF ratio, P<0.001) and increased the normalized high-frequency power (HFnm) (P<0.001) during the stress tests, and an added benefit over SAB by improving HRV was also observed. In the 3-month follow-up study, similar effects on RSP, BVPamp, LF/HF and HFnm were observed in the HRV-BF group compared with the SAB group. HRV-BF training contributes to the beneficial effect of reducing the stress-related cardiovascular

  17. Autonomic markers of emotional processing: skin sympathetic nerve activity in humans during exposure to emotionally-charged images

    Directory of Open Access Journals (Sweden)

    RachaelBrown

    2012-10-01

    Full Text Available The sympathetic innervation of the skin primarily subserves thermoregulation, but the system has also been commandeered as a means of expressing emotion. While it is known that the level of skin sympathetic nerve activity (SSNA is affected by anxiety, the majority of emotional studies have utilized the galvanic skin response as a means of inferring increases in SSNA. The purpose of the present study was to characterize the changes in SSNA when showing subjects neutral or emotionally-charged images from the International Affective Picture System. Skin sympathetic nerve activity was recorded via tungsten microelectrodes inserted into cutaneous fascicles of the common peroneal nerve in ten subjects. Neutral images, positively-charged images (erotica or negatively-charged images (mutilation were presented in blocks of fifteen images of a specific type, each block lasting two minutes. Images of erotica or mutilation were presented in a quasi-random fashion, each block following a block of neutral images. Both images of erotica or images of mutilation caused significant increases in SSNA, but the increases in SSNA were greater for mutilation. The increases in SSNA were often coupled with sweat release and cutaneous vasoconstriction, however, these markers were not always consistent with the SSNA increases. We conclude that SSNA, comprising cutaneous vasoconstrictor and sudomotor activity, increases with both positively-charged and negatively-charged emotional images. Measurement of SSNA provides a more comprehensive assessment of sympathetic outflow to the skin than does the use of sweat release alone as a marker of emotional processing.

  18. Control of the skin scarring response

    OpenAIRE

    Ferreira, Lydia M; Alfredo Gragnani; Fabianne Furtado; Bernardo Hochman

    2009-01-01

    There comes a time when the understanding of the cutaneous healing process becomes essential due to the need for a precocious tissue repair to reduce the physical, social, and psychological morbidity. Advances in the knowledge on the control of interaction among cells, matrix and growth factors will provide more information on the Regenerative Medicine, an emerging area of research in medical bioengineering. However, considering the dynamism and complexity of the cutaneous healing response, i...

  19. EEG and autonomic responses during performance of matching and non-matching to sample working memory tasks with emotional content.

    Directory of Open Access Journals (Sweden)

    Ana Garcia

    2011-12-01

    Full Text Available Working memory (WM is a neural system responsible for the temporary storage of information and its utilization in problem solving. The central executive is theorized as the controller of storage functions that support WM. Neurophysiological data suggest that EEG theta and alpha oscillations in frontal and midline regions are involved in neural communication between the central executive and storage functions during WM performance. Emotion is known to modulate several memory systems, including WM, through central and peripheral pathways. However, the physiological correlations (electroencephalographic – EEG; autonomic nervous activity of the effect of emotion over WM are not well described. In this study we aimed to identify physiological responses related to emotional WM performance. EEG (21 channels, heart rate (HR and galvanic skin response (GSR recordings were obtained from 54 volunteers while performing delayed matching and non-matching to sample tasks (DMTS/DNMTS. Emotional and neutral pictures from the International Affective Picture System and geometric figures were used as stimuli. As expected, WM performance was accompanied by presence of theta (frontal and midline electrodes and Alpha power (parietal electrodes. Beta and gamma oscillations were concentrated in frontopolar and left temporal regions. DNMTS task was accompanied by increases in Beta power, HR and GSR compared to DMTS task. Correlation analysis showed a positive tendency for gamma in Fp2 site, ratio of LF/HF (HR low and high frequency and skin conductance in both tasks. The HR results indicate an inverse reaction related to parasympathetic and sympathetic nervous system during the performance of the tasks. Taken together, our results contribute to elucidate the complex interactions between central and autonomic nervous systems in the modulation of emotional WM tasks.

  20. Characterization of the Frictional Response of Squamata Shed Skin in Comparison to Human skin

    CERN Document Server

    Abdel-Aal, H A

    2010-01-01

    Deterministic surfaces are constructs of which profile, topography and textures are integral to the function of the system they enclose. They are designed to yield a predetermined rubbing response. Developing such entities relies on controlling the structure of the rubbing interface so that, not only the surface is of optimized topography, but also is able to self-adjust its behavior according to the evolution of sliding conditions. Inspirations for such designs are frequently encountered in natural species. In particular, and from a tribological point of view, Squamate Reptiles, offer diverse examples where surface texturing, submicron and nano-scale features, achieves frictional regulation. In this paper, we study the frictional response of shed skin obtained from a Python regius snake. The study employed a specially designed tribo-acoustic probe capable of measuring the coefficient of friction and detecting the acoustical behavior of the skin in vivo. The results confirm the anisotropy of the frictional re...

  1. Attenuated skin blood flow response to hyperthermia in paraplegic men.

    Science.gov (United States)

    Freund, P R; Brengelmann, G L; Rowell, L B; Halar, E

    1984-04-01

    To clarify how skin and internal temperatures interact in control of skin blood flow, five male paraplegic subjects (lesions at the level of thoracic vertebrae 1-11) (29-47 yr old) were heated in water-perfused suits to elevate oral temperature (To) 1-1.5 degrees C. In part I only the insensate skin was heated; sensate skin was kept at 32-34 degrees C. No appreciable elevation of forearm blood flow (FBF) or sweating occurred, even with To at 38 degrees C. In part II the suit was applied to the whole body so that skin temperature was 40 degrees C, except for one arm that remained at 32-34 degrees C for FBF measurement. Sweating was noted above the lesion in all but one subject. FBF increased in all subjects but was far below levels previously reported for hyperthermic normal men; also, thresholds appeared elevated. To the extent that effector connections are intact, attenuated FBF response implies that either 1) some vasoconstrictor bias associated with cardiovascular regulation is active or 2) thermoregulatory effector outflow is diminished. If the latter is true, it follows that the effector outflow reduction relates to diminished afferent input. But the component of the effector outflow contributed by peripheral thermoreception is small; thus these findings may indicate that what is lacking in the afferent input is central thermoreception from below the lesion, possibly from the spinal cord itself. PMID:6725058

  2. Multifractal and nonlinear assessment of autonomous nervous system response during transient myocardial ischaemia

    International Nuclear Information System (INIS)

    We assess autonomic nervous system response during prolonged percutaneous transluminal coronary angioplasty (PTCA) using heart rate variability analysis with multifractal indices. These indices are used to evaluate the effects of the PTCA procedures at different arteries and locations. A total of 55 patients from the Staff3 database, with no prior history of myocardial infarction, were included in the study. The indices increased significantly during the transient ischaemia and reperfusion periods, indicating an increase in nonlinear multifractal characteristics and a change in temporal correlations in heartbeat fluctuations. This indicates that significant multifractal and nonlinear complex reactions in the autonomic control of the heart rate occurred during coronary artery occlusions and suggests that the multifractal indices may be a promising nonlinear technique for evaluating autonomic nervous system response in the presence of transient myocardial ischaemia

  3. Blunted autonomic response to volume expansion in formerly preeclamptic women with low plasma volume.

    NARCIS (Netherlands)

    Krabbendam, I.; Courtar, D.A.; Janssen, B.J.; Aardenburg, R.; Peeters, L.L.; Spaanderman, M.E.A.

    2009-01-01

    OBJECTIVE: We hypothesize that low plasma volume in normotensive formerly preeclamptic women reflects reduced venous storage capacity. To test this hypothesis, we compared circulatory and autonomic responses to acute volume loading between women with low and those with normal plasma volume. METHODS:

  4. Cardiovascular, hormonal and metabolic responses to graded exercise in juvenile diabetics with and without autonomic neuropathy

    DEFF Research Database (Denmark)

    Hilsted, J; Galbo, H; Christensen, N J

    1980-01-01

    Thirteen juvenile diabetics were studied in order to determine if decreased beat-to-beat variation during deep respiration, indicating abnormal autonomic nerve function, imply that cardiovascular, hormonal and metabolic responses are impaired. Patients with decreased beat-to-beat variation had to...

  5. Axon Count and Sympathetic Skin Responses in Lumbosacral Radiculopathy

    OpenAIRE

    Erdem Tilki, Hacer; Coşkun, Melek; Ünal Akdemir, Neslihan; İncesu, Lütfi

    2014-01-01

    Background and Purpose Electrodiagnostic studies can be used to confirm the diagnosis of lumbosacral radiculopathies, but more sensitive diagnostic methods are often needed to measure the ensuing motor neuronal loss and sympathetic failure. Methods Twenty-six patients with lumbar radiculopathy and 30 controls were investigated using nerve conduction studies, motor unit number estimation (MUNE), testing of the sympathetic skin response (SSR), quantitative electromyography (QEMG), and magnetic ...

  6. Predicting Performance Under Stressful Conditions Using Galvanic Skin Response

    OpenAIRE

    Mundell, Carter; Vielma, Juan Pablo; Zaman, Tauhid

    2016-01-01

    The rapid growth of the availability of wearable biosensors has created the opportunity for using biological signals to measure worker performance. An important question is how to use such signals to not just measure, but actually predict worker performance on a task under stressful and potentially high risk conditions. Here we show that the biological signal known as galvanic skin response (GSR) allows such a prediction. We conduct an experiment where subjects answer arithmetic questions und...

  7. Response of pig skin to fractionated radiation doses

    International Nuclear Information System (INIS)

    The individual components of a fractionated course of irradiation treatment have been considered separately. Methods of accurate measurement of individual parameters has brought to light different interpretations of the observations. Reasons are given for the necessity of having a radiobiological model which has a direct relevance to the clinical situation. Results are reported for fractionated regimes of irradiation in which the dose has been varied above and below normal tissue tolerance which has been equated with clinical skin necrosis. The components of the acute skin reaction, erythema, pigmentation and desquamation have been analysed separately and their contribution as a method of measurement assessed. Initially, the range of numerical scores attributed to erythema did not reach the scores attributed to necrosis but we now believe that radiation damage expressed as erythema can move directly into necrosis without passing through desquamation. Desquamation, on the other hand, only became a useful parameter at higher dose levels; it has also been shown to be a component associated with skin breakdown. Pigmentation showed no dose response at the dose levels employed in our experiments and it is our belief that this is due to this system being fully saturated under these circumstances. Measurement of the late radiation reaction in the skin has been considered in detail and our results have been expressed by comparing the relative lengths of irradiated and control fields in the same pig. From these findings iso-effect graphs have been constructed and time and fractionation factors have been derived. (author)

  8. Head Exposure to Cold during Whole-Body Cryostimulation: Influence on Thermal Response and Autonomic Modulation

    Science.gov (United States)

    Louis, Julien; Schaal, Karine; Bieuzen, François; Le Meur, Yann; Filliard, Jean-Robert; Volondat, Marielle; Brisswalter, Jeanick; Hausswirth, Christophe

    2015-01-01

    Recent research on whole-body cryotherapy has hypothesized a major responsibility of head cooling in the physiological changes classically reported after a cryostimulation session. The aim of this experiment was to verify this hypothesis by studying the influence of exposing the head to cold during whole-body cryostimulation sessions, on the thermal response and the autonomic nervous system (ANS). Over five consecutive days, two groups of 10 participants performed one whole-body cryostimulation session daily, in one of two different systems; one exposing the whole-body to cold (whole-body cryostimulation, WBC), and the other exposing the whole-body except the head (partial-body cryostimulation, PBC).10 participants constituted a control group (CON) not receiving any cryostimulation. In order to isolate the head-cooling effect on recorded variables, it was ensured that the WBC and PBC systems induced the same decrease in skin temperature for all body regions (mean decrease over the 5 exposures: -8.6°C±1.3°C and -8.3±0.7°C for WBC and PBC, respectively), which persisted up to 20-min after the sessions (P20). The WBC sessions caused an almost certain decrease in tympanic temperature from Pre to P20 (-0.28 ±0.11°C), while it only decreased at P20 (-0.14±0.05°C) after PBC sessions. Heart rate almost certainly decreased after PBC (-8.6%) and WBC (-12.3%) sessions. Resting vagal-related heart rate variability indices (the root-mean square difference of successive normal R-R intervals, RMSSD, and high frequency band, HF) were very likely to almost certainly increased after PBC (RMSSD:+49.1%, HF: +123.3%) and WBC (RMSSD: +38.8%, HF:+70.3%). Plasma norepinephrine concentration was likely increased in similar proportions after PBC and WBC, but only after the first session. Both cryostimulation techniques stimulated the ANS with a predominance of parasympathetic tone activation from the first to the fifth session and in slightly greater proportion with WBC than PBC

  9. The autonomic and rate pressure product responses of Tai Chi practitioners

    Directory of Open Access Journals (Sweden)

    Michael A Figueroa

    2012-01-01

    Full Text Available Background: Spectral analysis of autonomic nervous system activity can provide insight into cardiovascular function. Rate pressure product is the parameter often targeted pharmacologically to decrease the incidence of myocardial events. Aim: The purpose of this study was to investigate whether or not Tai Chi Chuan practitioners would demonstrate autonomic responses that would be more cardioprotective when compared to non-trained controls. Materials and Methods: This was a cross-sectional study that measured the autonomic responses and rate pressure product of 2 groups of subjects; a Tai Chi Chuan trained (n = 13 and non-trained sedentary controls (n = 13 at rest and during 2 stressor phases that simulated functional activities of daily living. Results: The Tai Chi group maintained a greater parasympathetic outflow at rest and during the isometric grip stressor phase (P<0.05. Sympathetic outflow, systolic blood pressure and rate pressure product were significantly lower in the Tai Chi group at rest, during the isometric grip and standing stressor phases (P<0.05. Conclusion: Although a cause-and-effect relationship cannot be concluded in this study, the Tai Chi group was able to demonstrate efficiency of the myocardium with suppressed rate pressure product values and autonomic responses that favored parasympathetic outflow. This type of training may complement non-pharmacological anti-hypertensive therapy.

  10. Investigation research on autonomous responsive materials; Jiritsu oto zairyo ni kansuru chosa kenkyu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1996-03-01

    A survey was made on autonomous responsive materials as a new material which reversibly change molecular structures and the aggregation state according to external stimuli. Autonomous responsive materials imitate environmental responsibility in the living organism system and have sensing, control and active functions for external stimuli. The materials are highly efficient and environmentally friendly. In biomimetic materials for soft actuators, drastic changes by temperature of elastic modulus of water-swollen hydrogel are used to the motion. In order to molecularly design stimulus-responsible polymer gel, studied are the relation between the micro structure and stimulus responsibility, dynamic correlation between the micro structure and the macro structure, etc. In the biomedical field, new cure and diagnosis using innovative materials are expected, and the application of autonomous responsive materials to the field is studied. For example, using hydrogel responding the temperature and the surface and controlling by temperature the interaction with components of the organism such as protein and cells, drug delivery in the organism is optimized. Also studied is the application of hydrophilic/hydrophobic changes by temperature to the chromatography. 215 refs., 47 figs., 11 tabs.

  11. Autonomic response to approachability characteristics, approach behavior, and social functioning in Williams syndrome.

    Science.gov (United States)

    Järvinen, Anna; Ng, Rowena; Bellugi, Ursula

    2015-11-01

    Williams syndrome (WS) is a neurogenetic disorder that is saliently characterized by a unique social phenotype, most notably associated with a dramatically increased affinity and approachability toward unfamiliar people. Despite a recent proliferation of studies into the social profile of WS, the underpinnings of the pro-social predisposition are poorly understood. To this end, the present study was aimed at elucidating approach behavior of individuals with WS contrasted with typical development (TD) by employing a multidimensional design combining measures of autonomic arousal, social functioning, and two levels of approach evaluations. Given previous evidence suggesting that approach behaviors of individuals with WS are driven by a desire for social closeness, approachability tendencies were probed across two levels of social interaction: talking versus befriending. The main results indicated that while overall level of approachability did not differ between groups, an important qualitative between-group difference emerged across the two social interaction contexts: whereas individuals with WS demonstrated a similar willingness to approach strangers across both experimental conditions, TD individuals were significantly more willing to talk to than to befriend strangers. In WS, high approachability to positive faces across both social interaction levels was further associated with more normal social functioning. A novel finding linked autonomic responses with willingness to befriend negative faces in the WS group: elevated autonomic responsivity was associated with increased affiliation to negative face stimuli, which may represent an autonomic correlate of approach behavior in WS. Implications for underlying organization of the social brain are discussed. PMID:26459097

  12. Reduced autonomic responses to faces in Capgras delusion.

    OpenAIRE

    Ellis, H D; A. W. Young; Quayle, A H; de Pauw, K W

    1997-01-01

    People experiencing the Capgras delusion claim that others, usually those quite close emotionally, have been replaced by near-identical impostors. Ellis & Young suggested in 1990 that the Capgras delusion results from damage to a neurological system involved in orienting responses to seen faces based on their personal significance. This hypothesis predicts that people suffering the Capgras delusion will be hyporesponsive to familiar faces. We tested this prediction in five people with Capgras...

  13. Kissing reduces allergic skin wheal responses and plasma neurotrophin levels.

    Science.gov (United States)

    Kimata, Hajime

    2003-11-01

    The effect of kissing on allergen-induced skin wheal responses and plasma neurotrophin levels were studied in 30 normal subjects, 30 patients with allergic rhinitis (AR), and 30 patients with atopic dermatitis (AD). All of the patients with AR or AD are allergic to house dust mite (HDM) and Japanese cedar pollen (JCP). They are all Japanese and they do not kiss habitually. The subject kissed freely during 30 min with their lover or spouse alone in a room with closed doors while listening to soft music. Before and after kissing, skin prick tests were performed using commercial HDM allergen, JCP allergen, as well as histamine and control solution, and wheal responses were measured. Simultaneously, plasma levels of neurotrophin, including nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), neurotrophin-3 (NT-3) and -4 (NT-4) were measured. Kissing significantly reduced wheal responses induced by HDM and JCP, but not by histamine, and decreased plasma levels of NGF, BDNF, NT-3, and NT-4 in patients with AR or AD, while it failed to do so in normal subjects. These finding indicate that kissing have some implication in the study of neuroimmunology in allergic patients. PMID:14637240

  14. Analysis of cerebral and autonomic response to respiratory events in patients with Sleep Apnea Syndrome

    OpenAIRE

    Milioli, Giulia

    2015-01-01

    The arousal scoring in Obstructive Sleep Apnea Syndrome (OSAS) is important to clarify the impact of the disease on sleep but the currently applied American Academy of Sleep Medicine (AASM) definition may underestimate the subtle alterations of sleep. The aims of the present study were to evaluate the impact of respiratory events on cortical and autonomic arousal response and to quantify the additional value of cyclic alternating pattern (CAP) and pulse wave amplitude (PWA) for a more ac...

  15. Modeling cooperative and autonomous adaptive cruise control dynamic responses using experimental data

    OpenAIRE

    Milanés, Vicente; Shladover, Steven E.

    2014-01-01

    Vehicle longitudinal control systems such as (commercially available) autonomous Adaptive Cruise Control (ACC) and its more sophisticated variant Cooperative ACC (CACC) could potentially have significant impacts on traffic flow. Accurate models of the dynamic responses of both of these systems are needed to produce realistic predictions of their effects on highway capacity and traffic flow dynamics. This paper describes the develop-ment of models of both ACC and CACC control systems that are ...

  16. A study on the frictional response of reptilian shed skin

    International Nuclear Information System (INIS)

    Deterministic surfaces are constructs of which profile, topography and textures are integral to the function of the system they enclose. They are designed to yield a predetermined tribological response. Developing such entities relies on controlling the structure of the rubbing interface so that, not only the surface is of optimized topography, but also is able to self-adjust its tribological behaviour according to the evolution of sliding conditions. In seeking inspirations for such designs, many engineers are turning toward the biological world to study the construction and behaviour of bio-analogues, and to probe the role surface topography assumes in conditioning of frictional response. That is how a bio-analogue can self-adjust its tribological response to adapt to habitat constraints. From a tribological point of view, Squamate Reptiles, offer diverse examples where surface texturing, submicron and nano-scale features, achieves frictional regulation. In this paper, we study the frictional response of shed skin obtained from a snake (Python regius). The study employed a specially designed tribo-acoustic probe capable of measuring the coefficient of friction and detecting the acoustical behavior of the skin in vivo. The results confirm the anisotropy of the frictional response of snakes. The coefficient of friction depends on the direction of sliding: the value in forward motion is lower than that in the backward direction. Diagonal and side winding motion induces a different value of the friction coefficient. We discuss the origin of such a phenomenon in relation to surface texturing and study the energy constraints, implied by anisotropic friction, on the motion of the reptile.

  17. Abnormal autonomic cardiac response to transient hypoxia in sickle cell anemia

    International Nuclear Information System (INIS)

    The objective of this study was to non-invasively assess cardiac autonomic control in subjects with sickle cell anemia (SCA) by tracking the changes in heart rate variability (HRV) that occur following brief exposure to a hypoxic stimulus. Five African–American SCA patients and seven healthy control subjects were recruited to participate in this study. Each subject was exposed to a controlled hypoxic stimulus consisting of five breaths of nitrogen. Time-varying spectral analysis of HRV was applied to estimate the cardiac autonomic response to the transient episode of hypoxia. The confounding effects of changes in respiration on the HRV spectral indices were reduced by using a computational model. A significant decrease in the parameters related to parasympathetic control was detected in the post-hypoxic responses of the SCA subjects relative to normal controls. The spectral index related to sympathetic activity, on the other hand, showed a tendency to increase the following hypoxic stimulation, but the change was not significant. This study suggests that there is some degree of cardiovascular autonomic dysfunction in SCA that is revealed by the response to transient hypoxia

  18. How Can Music Influence the Autonomic Nervous System Response in Patients with Severe Disorder of Consciousness?

    Science.gov (United States)

    Riganello, Francesco; Cortese, Maria D.; Arcuri, Francesco; Quintieri, Maria; Dolce, Giuliano

    2015-01-01

    Activations to pleasant and unpleasant musical stimuli were observed within an extensive neuronal network and different brain structures, as well as in the processing of the syntactic and semantic aspects of the music. Previous studies evidenced a correlation between autonomic activity and emotion evoked by music listening in patients with Disorders of Consciousness (DoC). In this study, we analyzed retrospectively the autonomic response to musical stimuli by mean of normalized units of Low Frequency (nuLF) and Sample Entropy (SampEn) of Heart Rate Variability (HRV) parameters, and their possible correlation to the different complexity of four musical samples (i.e., Mussorgsky, Tchaikovsky, Grieg, and Boccherini) in Healthy subjects and Vegetative State/Unresponsive Wakefulness Syndrome (VS/UWS) patients. The complexity of musical sample was based on Formal Complexity and General Dynamics parameters defined by Imberty's semiology studies. The results showed a significant difference between the two groups for SampEn during the listening of Mussorgsky's music and for nuLF during the listening of Boccherini and Mussorgsky's music. Moreover, the VS/UWS group showed a reduction of nuLF as well as SampEn comparing music of increasing Formal Complexity and General Dynamics. These results put in evidence how the internal structure of the music can change the autonomic response in patients with DoC. Further investigations are required to better comprehend how musical stimulation can modify the autonomic response in DoC patients, in order to administer the stimuli in a more effective way. PMID:26696818

  19. How can music influence the Autonomic Nervous System response in patients with severe Disorder of Consciousness?

    Directory of Open Access Journals (Sweden)

    Francesco eRiganello

    2015-12-01

    Full Text Available Activations to pleasant and unpleasant musical stimuli were observed within an extensive neuronal network and different brain structures, as well as in the processing of the syntactic and semantic aspects of the music. Previous studies evidenced a correlation between autonomic activity and emotion evoked by music listening in patients with Disorders of Consciousness (DoC. In this study, we analyzed retrospectively the autonomic response to musical stimuli by mean of normalized units of Low Frequency (nuLF and Sample Entropy (SampEn of Heart Rate Variability (HRV parameters, and their possible correlation to the different complexity of four musical samples (i.e. Mussorgsky, Tchaikovsky, Grieg and Boccherini in Healthy subjects and Vegetative State/Unresponsive Wakefulness Syndrome (VS/UWS patients.The complexity of musical sample was based on Formal Complexity and General Dynamics parameters defined by Imberty’s semiology studies.The results showed a significant difference between the two groups for SampEn during the listening of Mussorgsky’s music and for nuLF during the listening of Boccherini and Mussorgsky’s music.Moreover, the VS/UWS group showed a reduction of nuLF as well as SampEn comparing music of increasing Formal Complexity and General Dynamics.These results put in evidence how the internal structure of the music can change the autonomic response in patients with DoC. Further investigations are required to better comprehend how musical stimulation can modify the autonomic response in DoC patients, in order to administer the stimuli in a more effective way.

  20. One night of partial sleep deprivation affects habituation of hypothalamus and skin conductance responses.

    Science.gov (United States)

    Peters, Anja C; Blechert, Jens; Sämann, Philipp G; Eidner, Ines; Czisch, Michael; Spoormaker, Victor I

    2014-09-15

    Sleep disturbances are prevalent in clinical anxiety, but it remains unclear whether they are cause and/or consequence of this condition. Fear conditioning constitutes a valid laboratory model for the acquisition of normal and pathological anxiety. To explore the relationship between disturbed sleep and anxiety in more detail, the present study evaluated the effect of partial sleep deprivation (SD) on fear conditioning in healthy individuals. The neural correlates of 1) nonassociative learning and physiological processing and 2) associative learning (differential fear conditioning) were addressed. Measurements entailed simultaneous functional MRI, EEG, skin conductance response (SCR), and pulse recordings. Regarding nonassociative learning, partial SD resulted in a generalized failure to habituate during fear conditioning, as evidenced by reduced habituation of SCR and hypothalamus responses to all stimuli. Furthermore, SCR and hypothalamus activity were correlated, supporting their functional relationship. Regarding associative learning, effects of partial SD on the acquisition of conditioned fear were weaker and did not reach statistical significance. The hypothalamus plays an integral role in the regulation of sleep and autonomic arousal. Thus sleep disturbances may play a causal role in the development of normal and possibly pathological fear by increasing the susceptibility of the sympathetic nervous system to stressful experiences. PMID:24920020

  1. Presence of human friends and pet dogs as moderators of autonomic responses to stress in women.

    Science.gov (United States)

    Allen, K M; Blascovich, J; Tomaka, J; Kelsey, R M

    1991-10-01

    Autonomic responses were measured while 45 adult women performed a standard experimental stress task in the laboratory with only the experimenter present and 2 weeks later at home in the presence of a female friend, pet dog, or neither. Results demonstrated that autonomic reactivity was moderated by the presence of a companion, the nature of whom was critical to the size and direction of the effect. Ss in the friend condition exhibited higher physiological reactivity and poorer performance than subjects in the control and pet conditions. Ss in the pet condition showed less physiological reactivity during stressful tasks than Ss in the other conditions. The results are interpreted in terms of the degree to which friends and pets are perceived as evaluative during stressful task performance. Physiological reactivity was consistent across the laboratory and field settings. PMID:1960650

  2. Transcranial Doppler and cardiovascular responses during cardiovascular autonomic tests in migraineurs during and outside attacks

    DEFF Research Database (Denmark)

    Thomsen, L L; Iversen, Helle Klingenberg; Boesen, F; Olesen, J

    The transcranial Doppler (TCD) and cardiovascular responses to established tests of autonomic function were studied in 50 migraineurs (23 of whom experienced aura and 27 who did not) and 30 healthy control subjects. In addition to the measurements outside attacks, 10 migraineurs were also tested...... to a head-up tilt test, a cold-pressor test and a Valsalva manoeuvre. The cardiovascular reflexes in response to the Valsalva manoeuvre suggested a mild parasympathetic hypofunction in migraineurs, both those with and those without aura. On the basis of the present results and previous findings by...

  3. Sympathetic skin response: a new test to diagnose erectile dysfunction

    Institute of Scientific and Technical Information of China (English)

    Guang-You ZHU; Yan SHEN

    2001-01-01

    Electrophysiological monitoring of the activity of the penile sympathetic skin responses (PSSR) in healthy men and patients with erectile dysfunction (ED). Methods: PSSR were recorded from the skin of penis with disk electrodes at the time of electric stimulation of left median nerves. Results: PSSR were recorded from all the healthy men and almost all the patients. In healthy men the latency of P0, the latency of N1, the duration of N1 and the amplitude of N1 were 1249 ± 111 ms, 2239 ± 286 ms, 1832 ± 505 ms and 470 μV (median), respectively. In ED patients the latency of P0, the latency of N1, the duration of N1 and the amplitude of N1 were 1467 ± 183 ms ( P < 0.01), 2561±453 ms (P <0.05), 2560±861 ms (P <0.01) and 91 μV (P <0.01), respectively. The normal latency of P0 was less than 1471 ms. The normal amplitude of N1 was more than 235 μV. According to this normal value, of 20 patients 11 showed longer latency of P0, and 14 showed lower amplitude of N1 as compared with those of normal subjects.Conclusion: PSSR can be used as an electrophysiological method in assisting the diagnosis of ED.

  4. Evaluating Autonomic Parameters: The Role of Sleep ‎Duration in Emotional Responses to Music ‎

    OpenAIRE

    Atefeh Goshvarpour; Ataollah Abbasi; Ateke Goshvarpour

    2016-01-01

    Objective: It has been recognized that sleep has an important effect on emotion processing. The aim ‎of this study was to investigate the effect of previous night sleep duration on autonomicresponses to musical stimuli in different emotional contexts.‎Method: A frequency based measure of GSR, PR and ECG signals were examined in 35 healthy ‎students in three groups of oversleeping, lack of sleep and normal sleep. ‎Results: The results of this study revealed that regardless of the emotional c...

  5. Prediction of nuclear submariner adaptability from autonomic indices and Rorschach Inkblot responses. Interim report

    Energy Technology Data Exchange (ETDEWEB)

    Weybrew, B.B.; Molish, H.B.

    1986-09-09

    To identify the most valid predictors of submariner adaptability, the authors derived 23 indices from the responses of 170 nuclear submariners to the Rorschach Inkblot Test, 11 measures of Autonomic Nervous System (ANS) reactivity to contrived stress, and five adjustment criteria. Factor analysis of this 39x39 correlation matrix yielded two Rorschach Factors, one of which correlated with three criterion dimensions. Two unique factors were also discovered, one, a structured ANS factor, and the other, a complex criterion scale. Selected Rorschach scores and, to a lesser extent, certain ANS indices emanating from this study, may be usefully-valid predictors of the adaptability of nuclear submariners during long patrols.

  6. On-line identification of the speed, steering and diving response parameters of an autonomous underwater vehicle from experimental data

    OpenAIRE

    Bahrke, Fredric G.

    1992-01-01

    Approved for public release; distribution is unlimited. The experimental response data from autonomous maneuvering using the NPS AUV II vehicle has been analyzed with a view to defining Kalman filters to provide on-line estimates of system parameters and their variability. Kalman filters, designed for parameter estimation are expected to be the first step in the development of autonomous fault detection systems for underwater vehicles. Secondly, extraction of vehicle hydrodynamic coefficie...

  7. Autonomic Cardiovascular Responses in Acclimatized Lowlanders on Prolonged Stay at High Altitude: A Longitudinal Follow Up Study

    OpenAIRE

    Dhar, Priyanka; Sharma, Vijay K.; Hota, Kalpana B.; Das, Saroj K; Hota, Sunil K.; Srivastava, Ravi B.; Singh, Shashi B

    2014-01-01

    Acute exposure to hypobaric hypoxia at high altitude is reported to cause sympathetic dominance that may contribute to the pathophysiology of high altitude illnesses. The effect of prolonged stay at high altitude on autonomic functions, however, remains to be explored. Thus, the present study aimed at investigating the effect of high altitude on autonomic neural control of cardiovascular responses by monitoring heart rate variability (HRV) during chronic hypobaric hypoxia. Baseline electrocar...

  8. Additional support for the existence of skin conductance responses at unconditioned stimulus omission.

    Science.gov (United States)

    Spoormaker, Victor I; Blechert, Jens; Goya-Maldonado, Roberto; Sämann, Philipp G; Wilhelm, Frank H; Czisch, Michael

    2012-11-15

    The existence of a skin conductance response to an expected but omitted aversive stimulus has recently been challenged. To counter this claim, we provide a review of the literature and a temporal analysis of two independent skin conductance data sets during aversive conditioning and extinction that demonstrates a consistent and reproducible skin conductance response at omission of an anticipated aversive stimulus. The validity of this so-called unconditioned stimulus (US) omission response is relevant for skin conductance modeling in the context of neuroimaging and more generally for conditioning theory. PMID:22922467

  9. Synchronization of Sacral Skin Blood Flow Oscillations in Response to Local Heating

    OpenAIRE

    Jan, Yih-Kuen; Liao, Fuyuan

    2011-01-01

    Local heating causes an increase in skin blood flow by activating sensory axon reflex and metabolic nitric oxide controls. It has been observed that the remote skin area without temperature changes also shows a slightly increase in blood flow. The responsible mechanism of this indirect vasodilation remains unclear. We hypothesized that the remote skin area will have enhanced synchronization of blood flow oscillations (BFO), thus inducing a vasodilatory response. We studied BFO in two sites se...

  10. Appreciating the image of God in all humanity: Towards a pastoral response to skin lightening as image enhancement to exit dark skin

    Directory of Open Access Journals (Sweden)

    Noah K. Tenai

    2016-03-01

    Full Text Available The practice of skin lightening is prevalent amongst dark-skinned people globally. Various current studies that map this practice and that seek motivations behind the practice are examined. It is observed that through shrewd marketing, dark-skinned people are offered a promise of a better quality of life, obtained by a lighter skin, through the use of skin lighteners. In spite of the severe health risks involved, the promise is ostensibly irresistible to some dark-skinned persons. A pastoral response is offered that affirms the full personhood and complete humanity of dark-skinned people as fully human and whole in their dark skins.Keywords: Skin lightening, Dark skin, Image of God

  11. Trials and intensity effects in single-trial ERP components and autonomic responses in a dishabituation paradigm with very long ISIs.

    Science.gov (United States)

    MacDonald, Brett; Barry, Robert J; Bonfield, Rebecca C

    2015-12-01

    The phasic orienting reflex (OR) was investigated using single-trial data collected concurrently from 4 autonomic measures and event-related potentials (ERPs). In an auditory dishabituation paradigm, twelve indifferent tones of two intensities (60 or 80 dB, intensity change on trial 11, counterbalanced between subjects) were presented at very long interstimulus intervals (ISIs). Novelty and intensity based stimulus-response patterns were examined seeking ERP analogues of autonomic measures representing pre-OR and OR processing. Skin conductance response (SCR) represented the phasic OR index. EOG-corrected ERP data for 16 subjects were decomposed by a temporal Principal Components Analysis (PCA). SCR diminished over 10 standard trials, recovered on change trial 11, dishabituated to the re-presentation of the standard tone on trial 12, and showed intensity effects at the change - formal requirements for an OR index. The evoked cardiac response (HR) showed no trial or intensity effects. Respiratory pause (RP) decreased linearly over trials and showed recovery but no dishabituation or intensity effect. Peripheral vasoconstriction (PVC) failed to decrement but exhibited an intensity effect. Ten identifiable ERP components were extracted: Na, P1, N1-1, PN, P2, P3a, P3b, a novelty-sensitive HabP3, an intensity-sensitive IntP3, and the Slow Wave (SW). Pattern 1 showed no trial or intensity effects (HR, P1, PN, P2); Pattern 2 showed no trial effect but an intensity effect (PVC, Na, N1-1, P3a); and Pattern 3 demonstrated habituation and an intensity effect (SCR, RP, P3b, HabP3, IntP3, SW). The observed fractionation of autonomic and central measures is consistent with Preliminary Process Theory (PPT) rather than the notion of a unitary OR. PMID:26255255

  12. Sinoatrial tissue of crucian carp heart has only negative contractile responses to autonomic agonists

    Directory of Open Access Journals (Sweden)

    Hälinen Mervi

    2010-06-01

    Full Text Available Abstract Background In the anoxia-tolerant crucian carp (Carassius carassius cardiac activity varies according to the seasons. To clarify the role of autonomic nervous control in modulation of cardiac activity, responses of atrial contraction and heart rate (HR to carbacholine (CCh and isoprenaline (Iso were determined in fish acclimatized to winter (4°C, cold-acclimated, CA and summer (18°C, warm-acclimated, WA temperatures. Results Inhibitory action of CCh was much stronger on atrial contractility than HR. CCh reduced force of atrial contraction at an order of magnitude lower concentrations (EC50 2.75-3.5·10-8 M in comparison to its depressive effect on HR (EC50 1.23-2.02·10-7 M (P -8 M and 10-7 M CCh, respectively (P + current, IK,CCh, with an EC50 value of 3-4.5·10-7 M and inhibited Ca2+ current (ICa by 28 ± 8% and 51 ± 6% at 10-7 M and 10-6 M, respectively. These currents can explain the shortening of AP. Iso did not elicit any responses in crucian carp sinoatrial preparations nor did it have any effect on atrial ICa, probably due to the saturation of the β-adrenergic cascade in the basal state. Conclusion In the crucian carp, HR and force of atrial contraction show cardio-depressive responses to the cholinergic agonist, but do not have any responses to the β-adrenergic agonist. The scope of inhibitory regulation by CCh is increased by the high basal tone of the adenylate cyclase-cAMP cascade. Higher concentrations of CCh were required to induce IK,CCh and inhibit ICa than was needed for CCh's negative inotropic effect on atrial muscle suggesting that neither IK,CCh nor ICa alone can mediate CCh's actions but they might synergistically reduce AP duration and atrial force production. Autonomic responses were similar in CA winter fish and WA summer fish indicating that cardiac sensitivity to external modulation by the autonomic nervous system is not involved in seasonal acclimatization of the crucian carp heart to cold and anoxic

  13. Sympathetic skin response--a method of assessing unmyelinated axon dysfunction in peripheral neuropathies.

    OpenAIRE

    Shahani, B T; Halperin, J J; Boulu, P; Cohen, J.

    1984-01-01

    The sympathetic skin response (SSR) was measured in 33 patients with peripheral neuropathies and in 30 normal control subjects. Abnormalities of the response were correlated with clinical, pathologic, and EMG observations. The response was usually absent in axonal neuropathies, but present in demyelinating disorders. Abnormalities of the sympathetic skin response did not correlate well with clinical evidence of dysautonomia, but were a reliable indicator of disorders affecting unmyelinated ax...

  14. Human skin pigmentation: melanocytes modulate skin color in response to stress.

    Science.gov (United States)

    Costin, Gertrude-E; Hearing, Vincent J

    2007-04-01

    All organisms, from simple invertebrates to complex human beings, exist in different colors and patterns, which arise from the unique distribution of pigments throughout the body. Pigmentation is highly heritable, being regulated by genetic, environmental, and endocrine factors that modulate the amount, type, and distribution of melanins in the skin, hair, and eyes. In addition to its roles in camouflage, heat regulation, and cosmetic variation, melanin protects against UV radiation and thus is an important defense system in human skin against harmful factors. Being the largest organ of the body that is always under the influence of internal and external factors, the skin often reacts to those agents by modifying the constitutive pigmentation pattern. The focus of this review is to provide an updated overview of important physiological and biological factors that increase pigmentation and the mechanisms by which they do so. We consider endocrine factors that induce temporary (e.g., during pregnancy) or permanent (e.g., during aging) changes in skin color, environmental factors (e.g., UV), certain drugs, and chemical compounds, etc. Understanding the mechanisms by which different factors and compounds induce melanogenesis is of great interest pharmaceutically (as therapy for pigmentary diseases) and cosmeceutically (e.g., to design tanning products with potential to reduce skin cancer risk). PMID:17242160

  15. Modifications of Control Loop to Improve the Depth Response of Autonomous Underwater Vehicles

    Directory of Open Access Journals (Sweden)

    Sheng-Ping Hsu

    2014-01-01

    Full Text Available During a constant depth maneuver of an autonomous underwater vehicle (AUV, its pitch attitude and stern plane deflections create forces and moments to achieve equilibrium in the vertical plane. If an AUV has a proportional controller only in its depth control loop, then different weights or centers of gravity will cause different steady-state depth errors at trimmed conditions. In general, a steady-state depth error can be eliminated by adding an integral controller in the depth control loop. However, an improper integrator may lead to a bad transient response, even though the steady-state depth error can finally be eliminated. To remove the steady-state depth error, this study proposes methods that adjust the depth command and add a switching integral controller in the depth control loop. Simulation results demonstrate that the steady-state depth error can be eliminated and the transient response can be improved.

  16. Chemosensory perception, symptoms and autonomic responses during chemical exposure in multiple chemical sensitivity

    DEFF Research Database (Denmark)

    Andersson, Linus; Claeson, Anna Sara; Dantoft, Thomas Meinertz;

    2016-01-01

    Purpose: Multiple chemical sensitivity (MCS) is a prevalent medically unexplained symptom characterized by symptom reactions to everyday chemical exposure below hygienic thresholds. The aim of this study was to investigate the expressions of hyper-reactivity in MCS during whole-body exposure to l...... found for breathing rate or tonic electrodermal activity responses. Conclusions: We conclude that MCS sufferers differ from healthy controls in terms of autonomic responses, symptoms and chemosensory perception during chemical exposure......./m3. Results: MCS participants, compared with controls, reported greater perceived odor intensities, more unpleasantness to the exposure and increasing symptoms over time. MCS participants also expressed higher pulse rate and lower pulse rate variability than controls did. No group differences were...

  17. Autonomous Sensory Meridian Response (ASMR: a flow-like mental state

    Directory of Open Access Journals (Sweden)

    Emma L. Barratt

    2015-03-01

    Full Text Available Autonomous Sensory Meridian Response (ASMR is a previously unstudied sensory phenomenon, in which individuals experience a tingling, static-like sensation across the scalp, back of the neck and at times further areas in response to specific triggering audio and visual stimuli. This sensation is widely reported to be accompanied by feelings of relaxation and well-being. The current study identifies several common triggers used to achieve ASMR, including whispering, personal attention, crisp sounds and slow movements. Data obtained also illustrates temporary improvements in symptoms of depression and chronic pain in those who engage in ASMR. A high prevalence of synaesthesia (5.9% within the sample suggests a possible link between ASMR and synaesthesia, similar to that of misophonia. Links between number of effective triggers and heightened flow state suggest that flow may be necessary to achieve sensations associated with ASMR.

  18. Emotional Responses to Odors in Children with High-Functioning Autism: Autonomic Arousal, Facial Behavior and Self-Report

    Science.gov (United States)

    Legisa, Jasna; Messinger, Daniel S.; Kermol, Enzo; Marlier, Luc

    2013-01-01

    Although emotional functioning is impaired in children with autism, it is unclear if this impairment is due to difficulties with facial expression, autonomic responsiveness, or the verbal description of emotional states. To shed light on this issue, we examined responses to pleasant and unpleasant odors in eight children (8-14 years) with…

  19. Response of rat skin flaps to sinusoidal electromagnetic fields

    International Nuclear Information System (INIS)

    Electrical stimulation to heal bone fractures has been used clinically since the early 1970s. As a result of treatment with either direct current or electromagnetic fields, there was an indication that the electrical signals enhanced the ingrowth of blood vessels into the treated area. This possibility was one of the reasons for the initial studies on the influence of pulsed electromagnetic fields (PEMFs) on healing of skin flaps. These investigations reported a decrease in the amount of necrosis of a skin flap after PEMF treatment. The skin flap model was chosen in these studies, as it is generally accepted for the investigation of the influence of different treatments on wound healing. The skin flap is a partially detached portion of the skin which retains part of its blood supply. However, if the flap is too long for its width, part of it will die after the transfer. Flap necrosis, therefore, represents a difficult clinical problem, especially in classes where a large area has to be covered. In the present study the authors address whether enhanced skin flap survival after treatment with PEMF is signal specific, that is , whether one could obtain similar results using various sinusoidal electromagnetic fields (SEMFs). Specifically, they investigated the influence on skin flap survival of SEMFs with different frequencies but the same maximum of dB/dt

  20. Distribution of T Cells in Rainbow Trout (Oncorhynchus mykiss) Skin and Responsiveness to Viral Infection.

    Science.gov (United States)

    Leal, Esther; Granja, Aitor G; Zarza, Carlos; Tafalla, Carolina

    2016-01-01

    Although the skin constitutes the first line of defense against waterborne pathogens, there is a great lack of information regarding the skin associated lymphoid tissue (SALT) and whether immune components of the skin are homogeneously distributed through the surface of the fish is still unknown. In the current work, we have analyzed the transcription of several immune genes throughout different rainbow trout (Oncorhynchus mykiss) skin areas. We found that immunoglobulin and chemokine gene transcription levels were higher in a skin area close to the gills. Furthermore, this skin area as well as other anterior sections also transcribed significantly higher levels of many different immune genes related to T cell immunity such as T cell receptor α (TCRα), TCRγ, CD3, CD4, CD8, perforin, GATA3, Tbet, FoxP3, interferon γ (IFNγ), CD40L and Eomes in comparison to posterior skin sections. In agreement with these results, immunohistochemical analysis revealed that anterior skin areas had a higher concentration of CD3(+) T cells and flow cytometry analysis confirmed that the percentage of CD8(+) T lymphocytes was also higher in anterior skin sections. These results demonstrate for the first time that T cells are not homogeneously distributed throughout the teleost skin. Additionally, we studied the transcriptional regulation of these and additional T cell markers in response to a bath infection with viral hemorrhagic septicemia virus (VHSV). We found that VHSV regulated the transcription of several of these T cell markers in both the skin and the spleen; with some differences between anterior and posterior skin sections. Altogether, our results point to skin T cells as major players of teleost skin immunity in response to waterborne viral infections. PMID:26808410

  1. Distribution of T Cells in Rainbow Trout (Oncorhynchus mykiss Skin and Responsiveness to Viral Infection.

    Directory of Open Access Journals (Sweden)

    Esther Leal

    Full Text Available Although the skin constitutes the first line of defense against waterborne pathogens, there is a great lack of information regarding the skin associated lymphoid tissue (SALT and whether immune components of the skin are homogeneously distributed through the surface of the fish is still unknown. In the current work, we have analyzed the transcription of several immune genes throughout different rainbow trout (Oncorhynchus mykiss skin areas. We found that immunoglobulin and chemokine gene transcription levels were higher in a skin area close to the gills. Furthermore, this skin area as well as other anterior sections also transcribed significantly higher levels of many different immune genes related to T cell immunity such as T cell receptor α (TCRα, TCRγ, CD3, CD4, CD8, perforin, GATA3, Tbet, FoxP3, interferon γ (IFNγ, CD40L and Eomes in comparison to posterior skin sections. In agreement with these results, immunohistochemical analysis revealed that anterior skin areas had a higher concentration of CD3(+ T cells and flow cytometry analysis confirmed that the percentage of CD8(+ T lymphocytes was also higher in anterior skin sections. These results demonstrate for the first time that T cells are not homogeneously distributed throughout the teleost skin. Additionally, we studied the transcriptional regulation of these and additional T cell markers in response to a bath infection with viral hemorrhagic septicemia virus (VHSV. We found that VHSV regulated the transcription of several of these T cell markers in both the skin and the spleen; with some differences between anterior and posterior skin sections. Altogether, our results point to skin T cells as major players of teleost skin immunity in response to waterborne viral infections.

  2. Neuroendocrine Responses to Transvascular Autonomic Modulation: A Modified Balloon Angioplasty in Multiple Sclerosis Patients.

    Science.gov (United States)

    Arata, M; Sternberg, Z

    2016-02-01

    Balloon angioplasty (BA) is a treatment modality to correct vascular lesions in multiple sclerosis (MS) patients, who present with chronic cerebrospinal venous insufficiency (CCSVI). We hypothesized that BA clinical benefits stems in part from improvement in cardiovascular autonomic nervous system (ANS) function. We adopted the Transvascular Autonomic Modulation (TVAM), as a modified BA technique, with the objective of further enhancing ANS functional activities. TVAM involved dilation of multiple vascular beds, including IJVs, azygos and renal veins, and application of manual compression. Since the ANS regulates the function of the hypothalamus pituitary (HPA) axis, we examined TVAM effects on HPA axis in MS patients, and determined the relationship between ANS function and HPA activity. The adrenocorticotropic hormone (ACTH) and cortisol serum levels, systolic and diastolic blood pressure (BP), and heart rate variability (HRV) parameters were measured before and 24 h after TVAM procedure in 72 MS patients. Baseline ACTH and cortisol serum levels were lower than normal ranges in 18% and 25% MS patients respectively. The intervention resulted in significant reductions in both ACTH and cortisol (pcounter to the stress-mediated increases in serum levels of these hormones, which are expected following an invasive procedure. The clinical implications of this unexpected response warrant further investigations. PMID:25789986

  3. Basic taste stimuli elicit unique responses in facial skin blood flow.

    Directory of Open Access Journals (Sweden)

    Hideaki Kashima

    Full Text Available Facial expression changes characteristically with the emotions induced by basic tastes in humans. We tested the hypothesis that the five basic tastes also elicit unique responses in facial skin blood flow. Facial skin blood flow was measured using laser speckle flowgraphy in 16 healthy subjects before and during the application of basic taste stimuli in the oral cavity for 20 s. The skin blood flow in the eyelid increased in response to sweet and umami taste stimuli, while that in the nose decreased in response to a bitter stimulus. There was a significant correlation between the subjective hedonic scores accompanying these taste stimuli and the above changes in skin blood flow. These results demonstrate that sweet, umami, and bitter tastes induce unique changes in facial skin blood flow that reflect subjective hedonic scores.

  4. Considerations on command and response language features for a network of heterogeneous autonomous computers

    Science.gov (United States)

    Engelberg, N.; Shaw, C., III

    1984-01-01

    The design of a uniform command language to be used in a local area network of heterogeneous, autonomous nodes is considered. After examining the major characteristics of such a network, and after considering the profile of a scientist using the computers on the net as an investigative aid, a set of reasonable requirements for the command language are derived. Taking into account the possible inefficiencies in implementing a guest-layered network operating system and command language on a heterogeneous net, the authors examine command language naming, process/procedure invocation, parameter acquisition, help and response facilities, and other features found in single-node command languages, and conclude that some features may extend simply to the network case, others extend after some restrictions are imposed, and still others require modifications. In addition, it is noted that some requirements considered reasonable (user accounting reports, for example) demand further study before they can be efficiently implemented on a network of the sort described.

  5. Staphylococcus pseudintermedius infection associated with nodular skin lesions and systemic inflammatory response syndrome in a dog

    OpenAIRE

    Min, Sa-Hee; Kang, Min-Hee; Sur, Jung-Hyang; Park, Hee-Myung

    2014-01-01

    A 10-year-old Pekingese dog with atopic dermatitis was referred due to pyrexia, multiple skin nodules, anorexia, and depression. The dog was diagnosed as having systemic inflammatory response syndrome (SIRS) induced by bacterial dermatitis. This case presents diagnosis and treatment of SIRS with staphylococcal skin infection in a dog that was immunosuppressed due to long-term use of corticosteroid.

  6. Skin Blood Perfusion and Cellular Response to Insertion of Insulin Pen Needles With Different Diameters

    DEFF Research Database (Denmark)

    Præstmark, Kezia Ann; Stallknecht, Bente Merete; Bo Jensen, Casper;

    2014-01-01

    there was a trend of an increased response with increasing needle diameter. Skin blood perfusion response to pen needle insertions rank according to needle diameter, and the tissue response caused by hooked 32G needles corresponds to that of 28G needles. The relation between needle diameter and trauma...... skin blood perfusion response around needle insertion sites. Three common sized pen needles of 28G, 30G, and 32G as well as hooked 32G needles, were inserted into the neck skin of pigs and then removed. Laser Speckle Contrast Analysis was used to measure skin blood perfusion for 20 minutes after the...... insertions. Seven pigs were included in the study and a total of 118 randomized needle insertions were conducted. Histology was made of tissue samples inserted with 18G, 28G, and 32G needles, and stained to quantify red and white blood cell response. Based on area under curve, calculated for each individual...

  7. Area 3a Neuron Response to Skin Nociceptor Afferent Drive

    OpenAIRE

    Whitsel, Barry L.; Favorov, Oleg V; Li, Yongbiao; Quibrera, Miguel; Tommerdahl, Mark

    2008-01-01

    Area 3a neurons are identified that respond weakly or not at all to skin contact with a 25–38 °C probe, but vigorously to skin contact with the probe at ≥49 °C. Maximal rate of spike firing associated with 1- to 7-s contact at ≥49 °C occurs 1-2 s after probe removal from the skin. The activity evoked by 5-s contact with the probe at 51 °C remains above-background for ∼20 s after probe retraction. After 1-s contact at 55–56 °C activity remains above-background for ∼4 s. Magnitude of spike firi...

  8. Cardiovascular, metabolic, and hormonal responses to noradrenaline in diabetic patients with autonomic neuropathy

    DEFF Research Database (Denmark)

    Dejgaard, Anders; Andersen, P; Hvidberg, A;

    1996-01-01

    resistance, glucose kinetics, metabolites (beta-hydroxybuturate, glycerol, and lactate), and glucoregulatory hormones (noradrenaline, adrenaline, growth hormone, pancreatic polypeptide, cortisol, and insulin). Systolic and mean blood pressure increased in all groups but diabetic patients with autonomic......Denervation hypersensitivity is a well-known phenomenon in patients with autonomic failure. In diabetic autonomic neuropathy hypersensitivity to beta-adrenergic stimulation has been demonstrated. We infused noradrenaline, mainly an alpha-adrenoceptor agonist, in three escalating doses (0.5, 2...

  9. Skin barrier response to occlusion of healthy and irritated skin: Differences in trans-epidermal water loss, erythema and stratum corneum lipids

    DEFF Research Database (Denmark)

    Jungersted, J.M.; Høgh, Julie Kaae; Hellgren, Lars;

    2010-01-01

    Background: Occlusion of the skin is a risk factor for development of irritant contact dermatitis. Occlusion may, however, have a positive effect on skin healing. No consensus on the effect of occlusion has been reached. Objectives: To investigate skin barrier response to occlusion on intact and...... been damaged by either sodium lauryl sulfate (SLS) or tape stripping, respectively, was determined and compared with that of to non-occluded pre-damaged skin. Skin barrier function was assessed by measurements of trans-epidermal water loss (TEWL) and erythema. In study A, stratum corneum lipids were...

  10. The Autonomous Development Strategies of Micro and Small Entrepreneurs Through Coorporate Social Responsibility in Bogor District of West Java

    OpenAIRE

    Faizal Maad; Sumardjo Sumardjo; Amiruddin Saleh; Pudji Muljono

    2014-01-01

    The objective  of this  reseach were to: (1) analyze the level of autonomous of mikro and small entreprise (SMEs) entrepreneurs are empowered through Coorporate Social Responsibility (CSR); (2) analyze the dominant factors that influence autonomous of MSEs entrepreneurs  are empowered through CSR;  and (3) formulate an appropriate  a strategy  in developing autonomy of MSEs entrepreneurs through CSR. The reseach  was conduct  in the village built two companies running CSR in Bogor district in...

  11. The use of infrared thermography to detect the skin temperature response to physical activity

    Science.gov (United States)

    Tanda, G.

    2015-11-01

    Physical activity has a noticeable effect on skin blood flow and temperature. The thermal regulatory and hemodynamic processes during physical activity are controlled by two conflicting mechanisms: the skin vasoconstriction induced by the blood flow demand to active muscles and the skin vasodilation required by thermoregulation to increase warm blood flow and heat conduction to the skin. The time-evolution of skin temperature during exercise can give useful information about the adaptation of the subject as a function of specific type, intensity and duration of exercise. In this paper, infrared thermography is used to investigate the thermal response of skin temperature during running exercise on treadmill for a group of seven healthy and trained runners. Two different treadmill exercises are considered: a graded load exercise and a constant load exercise; for both exercises the duration was 30 minutes. Within the limits due to the relatively small size of the sample group, results typically indicate a fall in skin temperature during the initial stage of running exercise. As the exercise progresses, the dynamics of the skin temperature response depends on the type of exercise (graded versus constant load) and probably on the level of training of the subject.

  12. Human responses to upright tilt: a window on central autonomic integration

    Science.gov (United States)

    Cooke, W. H.; Hoag, J. B.; Crossman, A. A.; Kuusela, T. A.; Tahvanainen, K. U.; Eckberg, D. L.

    1999-01-01

    1. We examined interactions between haemodynamic and autonomic neural oscillations during passive upright tilt, to gain better insight into human autonomic regulatory mechanisms. 2. We recorded the electrocardiogram, finger photoplethysmographic arterial pressure, respiration and peroneal nerve muscle sympathetic activity in nine healthy young adults. Subjects breathed in time with a metronome at 12 breaths min-1 (0.2 Hz) for 5 min each, in supine, and 20, 40, 60, 70 and 80 deg head-up positions. We performed fast Fourier transform (and autoregressive) power spectral analyses and integrated low-frequency (0.05-0.15 Hz) and respiratory-frequency (0. 15-0.5 Hz) spectral powers. 3. Integrated areas of muscle sympathetic bursts and their low- and respiratory-frequency spectral powers increased directly and significantly with the tilt angle. The centre frequency of low-frequency sympathetic oscillations was constant before and during tilt. Sympathetic bursts occurred more commonly during expiration than inspiration at low tilt angles, but occurred equally in expiration and inspiration at high tilt angles. 4. Systolic and diastolic pressures and their low- and respiratory-frequency spectral powers increased, and R-R intervals and their respiratory-frequency spectral power decreased progressively with the tilt angle. Low-frequency R-R interval spectral power did not change. 5. The cross-spectral phase angle between systolic pressures and R-R intervals remained constant and consistently negative at the low frequency, but shifted progressively from positive to negative at the respiratory frequency during tilt. The arterial baroreflex modulus, calculated from low-frequency cross-spectra, decreased at high tilt angles. 6. Our results document changes of baroreflex responses during upright tilt, which may reflect leftward movement of subjects on their arterial pressure sympathetic and vagal response relations. The intensity, but not the centre frequency of low

  13. Key Role of CRF in the Skin Stress Response System

    OpenAIRE

    Slominski, Andrzej T.; Zmijewski, Michal A.; Zbytek, Blazej; Tobin, Desmond J.; Theoharides, Theoharis C.; Rivier, Jean

    2013-01-01

    The discovery of corticotropin-releasing factor (CRF) or CRH defining the upper regulatory arm of the hypothalamic-pituitary-adrenal (HPA) axis, along with the identification of the corresponding receptors (CRFRs 1 and 2), represents a milestone in our understanding of central mechanisms regulating body and local homeostasis. We focused on the CRF-led signaling systems in the skin and offer a model for regulation of peripheral homeostasis based on the interaction of CRF and the structurally r...

  14. Forehead versus forearm skin vascular responses at presyncope in humans

    OpenAIRE

    Gagnon, Daniel; Matthew Brothers, R.; Ganio, Matthew S; Hastings, Jeffrey L.; Crandall, Craig G.

    2014-01-01

    Facial pallor is commonly observed at presyncope in humans, suggestive of reductions in facial skin blood flow (SkBF). Yet, cutaneous vasoconstriction is usually minimal at presyncope when measured at the forearm. We tested the hypothesis that reductions in forehead SkBF at presyncope are greater than in the forearm. Forehead and forearm SkBF (laser-Doppler) and blood pressure (Finometer or radial artery catheterization) were measured during lower body negative pressure (LBNP) to presyncope i...

  15. Central nervous system involvement in the autonomic responses to psychological distress

    OpenAIRE

    de Morree, H. M.; Szabó, B. M.; Rutten, G.-J.; Kop, W.J.

    2012-01-01

    Psychological distress can trigger acute coronary syndromes and sudden cardiac death in vulnerable patients. The primary pathophysiological mechanism that plays a role in stress-induced cardiac events involves the autonomic nervous system, particularly disproportional sympathetic activation and parasympathetic withdrawal. This article describes the relation between psychological distress and autonomic nervous system function, with a focus on subsequent adverse cardiovascular outcomes. The rol...

  16. Motivational processes and autonomic responsivity in Asperger's disorder: evidence from the Iowa Gambling Task.

    Science.gov (United States)

    Johnson, Shannon A; Yechiam, Eldad; Murphy, Robin R; Queller, Sarah; Stout, Julie C

    2006-09-01

    Asperger's disorder (ASP), like other autism spectrum disorders, is associated with altered responsiveness to social stimuli. This study investigated learning and responsiveness to nonsocial, but motivational, stimuli in ASP. We examined choice behavior and galvanic skin conductance responses (SCRs) during the Iowa Gambling Task (IGT; Bechara et al., 1994) in 15 adolescents and young adults with ASP and 14 comparison subjects. We examined aspects of learning, attention to wins and losses, and response style with a formal cognitive model, the Expectancy-Valence Learning model (Busemeyer & Stout, 2002). The ASP group did not differ from the comparison group in proportions of selections from advantageous decks. However, ASP participants showed a distinct pattern of selection characterized by frequent shifts between the four IGT decks, whereas comparison participants developed clear deck preferences. SCR results showed some evidence of reduced responsiveness in the ASP group during the IGT. Results from the cognitive model indicated that, in contrast to the comparison group, the ASP group's selections were less consistent with the motivational significance they assigned to decks. Findings are discussed in the context of the neurobiological substrates associated with IGT performance. PMID:16961948

  17. Skin rubdown with a dry towel, 'kanpu-masatsu' is an aerobic exercise affecting body temperature, energy production, and the immune and autonomic nervous systems.

    Science.gov (United States)

    Watanabe, Mayumi; Takano, Osamu; Tomiyama, Chikako; Matsumoto, Hiroaki; Kobayashi, Takahiro; Urahigashi, Nobuatsu; Urahigashi, Nobuatsu; Abo, Toru

    2012-01-01

    Skin rubdown using a dry towel (SRDT) to scrub the whole body is a traditional therapy for health promotion. To investigate its mechanism, 24 healthy male volunteers were studied. Body temperature, pulse rate, red blood cells (RBCs), serum levels of catecholamines and cortisol, blood gases (PO(2), sO(2), PCO(2) and pH), lactate and glucose, and the ratio and number of white blood cells (WBCs) were assessed before and after SRDT. After SRDT, pulse rate and body temperature were increased. PO(2), sO(2) and pH were also increased and there was no Rouleaux formation by RBCs. Lactate level tended to increase, whereas that of glucose did not. Adrenaline and noradrenaline levels increased, indicating sympathetic nerve (SN) dominance with increase in granulocytes. WBC number and ratio were divided into two groups according to granulocyte ratio (≤ or < 60%) before SRDT: a normal group and a SN group. Only in the SN group did the granulocyte ratio decrease and the lymphocyte ratio and number increase after SRDT. It is suggested that SRDT is a mild aerobic, systemic exercise that might affect the immune system via the autonomic nervous system. PMID:22975635

  18. Biological response modifiers and their potential use in the treatment of inflammatory skin diseases

    DEFF Research Database (Denmark)

    Villadsen, Louise S; Skov, Lone; Baadsgaard, Ole

    2003-01-01

    and fewer side-effects than the current systemic therapies now used for severe psoriasis, contact dermatitis and atopic dermatitis. In the pathogenesis of inflammatory skin diseases, the immune system plays a pivotal role, and this is where biological response modifiers such as monoclonal antibodies......In recent years, a more detailed understanding of the pathogenesis of several inflammatory skin diseases, combined with the developments within biotechnology, has made it possible to design more selective response modifiers. Biological response modifiers hold the potential for greater effectiveness......, recombinant cytokines, or fusion proteins may be effective. Several biological response modifiers have already shown positive results in phase II/III clinical trials in skin diseases, and many new biological response modifiers are in progress....

  19. Analysis of cardiorespiratory phase coupling and cardiovascular autonomic responses during food ingestion.

    Science.gov (United States)

    Niizeki, Kyuichi; Saitoh, Tadashi

    2016-05-15

    The present study analyzed whether the phase coherency (λ) of respiratory sinus arrhythmia (RSA) is altered by food ingestion in healthy young subjects. After 5min of resting control, 13 healthy volunteers were asked to eat a solid meal with access to water at their own pace, followed by 5min of the postprandial state. The R-R interval (RRI), beat-to-beat blood pressure (BP), and respiratory activity were recorded using electrocardiography, a Finapres device, and inductance plethysmography, respectively. The stroke volume was calculated by the pulse-contour method from continuous BP measurement, and the cardiac output (CO) was obtained by multiplying the stroke volume by the heart rate. From the oscillatory signals of RSA and respiration, λ was computed; additionally, frequency domain indexes of the heart rate variability (HRV) were calculated using a short-time Fourier transform. A steady-state 3-min resting period (R), food ingestion period (FOOD), and the first 2-min and the last 3-min of the post prandial period were analyzed separately. We also compared the responses to gum chewing (GUM) and water intake (WATER) using the same protocol on separate days. A shortening of RRI and increases in BP and CO were observed in FOOD compared to R, suggesting a shift of sympathovagal balance toward sympathetic activation. Similar responses but smaller magnitudes were observed in the GUM condition, whereas only transient shortening of RRI was observed in the WATER condition. The HRV indexes did not show any significant changes in response to GUM and WATER but sympathovagal balance was shifted in favor of sympathetic dominance in FOOD. λ decreased during all of the conditions. There was a significant negative correlation between λ and the indirect measure of sympathovagal balance. These results suggest that ingestion of food induces enhanced cardiac sympathetic activity and that a phase coherence of RSA could provide a sensitive measure for evaluating the cardiac

  20. Evaluating Autonomic Parameters: The Role of Sleep ‎Duration in Emotional Responses to Music ‎

    Science.gov (United States)

    Goshvarpour‎, Atefeh; Abbasi, Ataollah; Goshvarpour‎, Ateke

    2016-01-01

    Objective: It has been recognized that sleep has an important effect on emotion processing. The aim ‎of this study was to investigate the effect of previous night sleep duration on autonomicresponses to musical stimuli in different emotional contexts.‎ Method: A frequency based measure of GSR, PR and ECG signals were examined in 35 healthy ‎students in three groups of oversleeping, lack of sleep and normal sleep. ‎ Results: The results of this study revealed that regardless of the emotional context of the musical ‎stimuli (happy, relax, fear, and sadness), there was an increase in the maximum power of ‎GSR, ECG and PR during the music time compared to the rest time in all the three ‎groups. In addition, the higher value of these measures was achieved while the ‎participants listened to relaxing music. Statistical analysis of the extracted features ‎between each pair of emotional states revealed that the most significant differences ‎were attained for ECG signals. These differences were more obvious in the participants ‎with normal sleeping (p<10-18). The higher value of the indices has been shown, ‎comparing long sleep duration with the normal one.‎ Conclusion: There was a strong relation between emotion and sleep duration, and this association can ‎be observed by means of the ECG signals.‎ PMID:27252770

  1. Sensorized Garments and Textrode-Enabled Measurement Instrumentation for Ambulatory Assessment of the Autonomic Nervous System Response in the ATREC Project

    Directory of Open Access Journals (Sweden)

    Cosme Llerena

    2013-07-01

    Full Text Available Advances in textile materials, technology and miniaturization of electronics for measurement instrumentation has boosted the development of wearable measurement systems. In several projects sensorized garments and non-invasive instrumentation have been integrated to assess on emotional, cognitive responses as well as physical arousal and status of mental stress through the study of the autonomous nervous system. Assessing the mental state of workers under stressful conditions is critical to identify which workers are in the proper state of mind and which are not ready to undertake a mission, which might consequently risk their own life and the lives of others. The project Assessment in Real Time of the Stress in Combatants (ATREC aims to enable real time assessment of mental stress of the Spanish Armed Forces during military activities using a wearable measurement system containing sensorized garments and textile-enabled non-invasive instrumentation. This work describes the multiparametric sensorized garments and measurement instrumentation implemented in the first phase of the project required to evaluate physiological indicators and recording candidates that can be useful for detection of mental stress. For such purpose different sensorized garments have been constructed: a textrode chest-strap system with six repositionable textrodes, a sensorized glove and an upper-arm strap. The implemented textile-enabled instrumentation contains one skin galvanometer, two temperature sensors for skin and environmental temperature and an impedance pneumographer containing a 1-channel ECG amplifier to record cardiogenic biopotentials. With such combinations of garments and non-invasive measurement devices, a multiparametric wearable measurement system has been implemented able to record the following physiological parameters: heart and respiration rate, skin galvanic response, environmental and peripheral temperature. To ensure the proper functioning of the

  2. Sensorized garments and textrode-enabled measurement instrumentation for ambulatory assessment of the autonomic nervous system response in the ATREC project.

    Science.gov (United States)

    Seoane, Fernando; Ferreira, Javier; Alvarez, Lorena; Buendia, Ruben; Ayllón, David; Llerena, Cosme; Gil-Pita, Roberto

    2013-01-01

    Advances in textile materials, technology and miniaturization of electronics for measurement instrumentation has boosted the development of wearable measurement systems. In several projects sensorized garments and non-invasive instrumentation have been integrated to assess on emotional, cognitive responses as well as physical arousal and status of mental stress through the study of the autonomous nervous system. Assessing the mental state of workers under stressful conditions is critical to identify which workers are in the proper state of mind and which are not ready to undertake a mission, which might consequently risk their own life and the lives of others. The project Assessment in Real Time of the Stress in Combatants (ATREC) aims to enable real time assessment of mental stress of the Spanish Armed Forces during military activities using a wearable measurement system containing sensorized garments and textile-enabled non-invasive instrumentation. This work describes the multiparametric sensorized garments and measurement instrumentation implemented in the first phase of the project required to evaluate physiological indicators and recording candidates that can be useful for detection of mental stress. For such purpose different sensorized garments have been constructed: a textrode chest-strap system with six repositionable textrodes, a sensorized glove and an upper-arm strap. The implemented textile-enabled instrumentation contains one skin galvanometer, two temperature sensors for skin and environmental temperature and an impedance pneumographer containing a 1-channel ECG amplifier to record cardiogenic biopotentials. With such combinations of garments and non-invasive measurement devices, a multiparametric wearable measurement system has been implemented able to record the following physiological parameters: heart and respiration rate, skin galvanic response, environmental and peripheral temperature. To ensure the proper functioning of the implemented

  3. Hypoglycemia-associated autonomic failure in insulin-dependent diabetes mellitus. Recent antecedent hypoglycemia reduces autonomic responses to, symptoms of, and defense against subsequent hypoglycemia.

    OpenAIRE

    Dagogo-Jack, S E; Craft, S; Cryer, P E

    1993-01-01

    We hypothesize that in patients with insulin-dependent diabetes mellitus (IDDM), recent antecedent iatrogenic hypoglycemia is a major cause of hypoglycemia-associated autonomic failure, a disorder distinct from classical diabetic autonomic neuropathy (CDAN), and that hypoglycemia-associated autonomic failure, by reducing both symptoms of and defense against developing hypoglycemia, results in recurrent iatrogenic hypoglycemia, thus creating a vicious cycle. We used the hyperinsulinemic (12.0 ...

  4. Role of Autonomic Reflex Arcs in Cardiovascular Responses to Air Pollution Exposure

    OpenAIRE

    Perez, Christina M.; Hazari, Mehdi S.; Farraj, Aimen K.

    2015-01-01

    The body responds to environmental stressors by triggering autonomic reflexes in the pulmonary receptors, baroreceptors, and chemoreceptors to maintain homeostasis. Numerous studies have shown that exposure to various gases and airborne particles can alter the functional outcome of these reflexes, particularly with respect to the cardiovascular system. Modulation of autonomic neural input to the heart and vasculature following direct activation of sensory nerves in the respiratory system, eli...

  5. Autonomic responses to cold face stimulation in sickle cell disease: a time-varying model analysis

    OpenAIRE

    Chalacheva, Patjanaporn; Kato, Roberta M.; Sangkatumvong, Suvimol; Detterich, Jon; Bush, Adam; Wood, John C.; Meiselman, Herbert; Coates, Thomas D; Khoo, Michael C.K.

    2015-01-01

    Sickle cell disease (SCD) is characterized by sudden onset of painful vaso-occlusive crises (VOC), which occur on top of the underlying chronic blood disorder. The mechanisms that trigger VOC remain elusive, but recent work suggests that autonomic dysfunction may be an important predisposing factor. Heart-rate variability has been employed in previous studies, but the derived indices have provided only limited univariate information about autonomic cardiovascular control in SCD. To circumvent...

  6. The Autonomous Development Strategies of Micro and Small Entrepreneurs Through Coorporate Social Responsibility in Bogor District of West Java

    Directory of Open Access Journals (Sweden)

    Faizal Maad

    2014-05-01

    Full Text Available The objective  of this  reseach were to: (1 analyze the level of autonomous of mikro and small entreprise (SMEs entrepreneurs are empowered through Coorporate Social Responsibility (CSR; (2 analyze the dominant factors that influence autonomous of MSEs entrepreneurs  are empowered through CSR;  and (3 formulate an appropriate  a strategy  in developing autonomy of MSEs entrepreneurs through CSR. The reseach  was conduct  in the village built two companies running CSR in Bogor district involved 212  (SMEs entrepreneurs which determined from population (450 SMEs entrepreneurs by Solvin formula with level of error 5 % and drawn by cluster random sampling. Data collection was conducted from July to November 2013, and consisted  the primary and secondary data. Data analysis was simulated by using structural equation model (SEM . The results showed that the degree  of autonomous MSEs entrepreneurs is low, its core was 36.89 out of 100.00. There are three strategies that must be done to develop of  autonomous MSEs entrepreneurs through  CSR, such as; (a an increase the empowerment sustainable of MSEs entrepereneurs (b improve the quality of  the environment  supporting MSEs and (c an increase in intensity of  empowerment for MSEs entrepreneurs.

  7. Attention to eye contact in the West and East: autonomic responses and evaluative ratings.

    Directory of Open Access Journals (Sweden)

    Hironori Akechi

    Full Text Available Eye contact has a fundamental role in human social interaction. The special appearance of the human eye (i.e., white sclera contrasted with a coloured iris implies the importance of detecting another person's face through eye contact. Empirical studies have demonstrated that faces making eye contact are detected quickly and processed preferentially (i.e., the eye contact effect. Such sensitivity to eye contact seems to be innate and universal among humans; however, several studies suggest that cultural norms affect eye contact behaviours. For example, Japanese individuals exhibit less eye contact than do individuals from Western European or North American cultures. However, how culture modulates eye contact behaviour is unclear. The present study investigated cultural differences in autonomic correlates of attentional orienting (i.e., heart rate and looking time. Additionally, we examined evaluative ratings of eye contact with another real person, displaying an emotionally neutral expression, between participants from Western European (Finnish and East Asian (Japanese cultures. Our results showed that eye contact elicited stronger heart rate deceleration responses (i.e., attentional orienting, shorter looking times, and higher ratings of subjective feelings of arousal as compared to averted gaze in both cultures. Instead, cultural differences in the eye contact effect were observed in various evaluative responses regarding the stimulus faces (e.g., facial emotion, approachability etc.. The rating results suggest that individuals from an East Asian culture perceive another's face as being angrier, unapproachable, and unpleasant when making eye contact as compared to individuals from a Western European culture. The rating results also revealed that gaze direction (direct vs. averted could influence perceptions about another person's facial affect and disposition. These results suggest that cultural differences in eye contact behaviour emerge from

  8. Stuttered and Fluent Speakers' Heart Rate and Skin Conductance in Response to Fluent and Stuttered Speech

    Science.gov (United States)

    Zhang, Jianliang; Kalinowski, Joseph; Saltuklaroglu, Tim; Hudock, Daniel

    2010-01-01

    Background: Previous studies have found simultaneous increases in skin conductance response and decreases in heart rate when normally fluent speakers watched and listened to stuttered speech compared with fluent speech, suggesting that stuttering induces arousal and emotional unpleasantness in listeners. However, physiological responses of persons…

  9. Recurrent painful interoceptive sensations of the digestive tract increase general autonomic defensive response activation regardless of picture induced valence

    OpenAIRE

    Ceunen, Erik; Herssens, Natacha; Van Oudenhove*, Lukas; Bogaerts, Katleen; Ly, Huynh Giao; Coen, Steven; Tack, Jan; Vlaeyen, Johan; Van Diest, Ilse

    2012-01-01

    You can view the poster by scrolling down and clicking on "View/Open" at the bottom right of this page. Cite as: Ceunen, E., Herssens, N., Van Oudenhove, L., Bogaerts, K., Ly, H., Coen, S., Tack, J., Vlaeyen, J., Van Diest, I. (2012). Recurrent painful interoceptive sensations of the digestive tract increase general autonomic defensive response activation regardless of picture induced valence. Psychophysiology: vol. 49 (S1), S93.

  10. Memory association machine: an account of the realization and interpretation of an autonomous responsive site-specific artwork.

    OpenAIRE

    Bogart, Benjamin David Robert

    2008-01-01

    This thesis is an account of the realization and interpretation of the autonomous responsive electronic media artwork "Memory Association Machine" (MAM). Realization and interpretation are components of the creative process that braids conceptual, site-specific, electronic media art and artificial intelligence practises. The meaning of MAM is dependent on its unique location in space and time. MAM relates itself to its context using three primary processes: perception, the integration of sens...

  11. Global brain blood-oxygen level responses to autonomic challenges in obstructive sleep apnea.

    Directory of Open Access Journals (Sweden)

    Paul M Macey

    Full Text Available Obstructive sleep apnea (OSA is accompanied by brain injury, perhaps resulting from apnea-related hypoxia or periods of impaired cerebral perfusion. Perfusion changes can be determined indirectly by evaluation of cerebral blood volume and oxygenation alterations, which can be measured rapidly and non-invasively with the global blood oxygen level dependent (BOLD signal, a magnetic resonance imaging procedure. We assessed acute BOLD responses in OSA subjects to pressor challenges that elicit cerebral blood flow changes, using a two-group comparative design with healthy subjects as a reference. We separately assessed female and male patterns, since OSA characteristics and brain injury differ between sexes. We studied 94 subjects, 37 with newly-diagnosed, untreated OSA (6 female (age mean ± std: 52.1±8.1 yrs; apnea/hypopnea index [AHI]: 27.7±15.6 events/hr and 31 male 54.3±8.4 yrs; AHI: 37.4±19.6 events/hr, and 20 female (age 50.5±8.1 yrs and 37 male (age 45.6±9.2 yrs healthy control subjects. We measured brain BOLD responses every 2 s while subjects underwent cold pressor, hand grip, and Valsalva maneuver challenges. The global BOLD signal rapidly changed after the first 2 s of each challenge, and differed in magnitude between groups to two challenges (cold pressor, hand grip, but not to the Valsalva maneuver (repeated measures ANOVA, p<0.05. OSA females showed greater differences from males in response magnitude and pattern, relative to healthy counterparts. Cold pressor BOLD signal increases (mean ± adjusted standard error at the 8 s peak were: OSA 0.14±0.08% vs. Control 0.31±0.06%, and hand grip at 6 s were: OSA 0.08±0.03% vs. Control at 0.30±0.02%. These findings, indicative of reduced cerebral blood flow changes to autonomic challenges in OSA, complement earlier reports of altered resting blood flow and reduced cerebral artery responsiveness. Females are more affected than males, an outcome which may contribute to the sex

  12. Stress and immune responses in skin of turbot (Scophthalmus maximus) under different stocking densities.

    Science.gov (United States)

    Jia, Rui; Liu, Bao-Liang; Feng, Wen-Rong; Han, Cen; Huang, Bin; Lei, Ji-Lin

    2016-08-01

    Fish skin and its mucus provide the first line of defense against chemical, physical and biological stressors, but little is known about the role of skin and its mucus in immune response to crowding stress. In the present study, we investigated the stress and immune responses in skin of turbot (Scophthalmus maximus) under different stocking densities. Turbot (average weight 185.4 g) were reared for 120 days under three densities: low density (LD), medium density (MD), and high density (HD). After 120 days, fish were weighed and sampled to obtain blood, mucus and skin tissues which were used for analyses of biochemical parameters and genes expression. The results showed HD treatment significantly suppressed growth and enhanced plasma cortisol and glucose levels (P GST), interleukin-1β (IL-1β), tumor necrosis factor -α (TNF-α), insulin-like growth factor- (IGF-) and LZM (P < 0.05). Overall, the data suggested that overly high stocking density was a stressor which caused an immunosuppression in skin of turbot. Moreover, this information would help to understand the skin immunity and their relation with stress and disease in fish. PMID:27235366

  13. Homeostatic tissue responses in skin biopsies from NOMID patients with constitutive overproduction of IL-1β.

    Directory of Open Access Journals (Sweden)

    Pamela Aubert

    Full Text Available The autoinflammatory disorder, Neonatal-onset Multisystem Inflammatory Disease (NOMID is the most severe phenotype of disorders caused by mutations in CIAS1 that result in increased production and secretion of active IL-1β. NOMID patients present with systemic and organ-specific inflammation of the skin, central nervous system and bone, and respond dramatically to treatment with IL-1 blocking agents. We compared the cellular infiltrates and transcriptome of skin biopsies from patients with NOMID (n = 14 before treatment (lesional (LS and non-lesional (pre-NL skin and after treatment (post-NL with the IL-1 blocker anakinra (recombinant IL-1 receptor antagonist, Kineret®, Swedish Orphan Biovitrum AB, SOBI, to normal skin (n = 5 to assess tissue responses in the context of untreated and treated disease. Abundant neutrophils distinguish LS skin from pre-NL and post-NL skin. CD11c(+ dermal dendritic cells and CD163(+ macrophages expressed activated caspase-1 and are a likely source of cutaneous IL-1 production. Treatment with anakinra led to the disappearance of neutrophils, but CD3(+ T cells and HLA-DR(+ cells remained elevated. Among the upregulated genes IL-6, IL-8, TNF, IL-17A, CCL20, and the neutrophil defensins DEFA1 and DEFA3 were differentially regulated in LS tissues (compared to normal skin. Important significantly downregulated pathways in LS skin included IL-1R/TLR signaling, type I and II cytokine receptor signaling, mitochondrial dysfunction, and antigen presentation. The differential expression and regulation of microRNAs and pathways involved in post-transcriptional modification were suggestive of epigenetic modification in the chronically inflamed tissue. Overall, the dysregulated genes and pathways suggest extensive "adaptive" mechanisms to control inflammation and maintain tissue homeostasis, likely triggered by chronic IL-1 release in the skin of patients with NOMID.

  14. Muscle cells challenged with saturated fatty acids mount an autonomous inflammatory response that activates macrophages

    Directory of Open Access Journals (Sweden)

    Pillon Nicolas J

    2012-10-01

    Full Text Available Abstract Obesity is associated with chronic low-grade inflammation. Within adipose tissue of mice fed a high fat diet, resident and infiltrating macrophages assume a pro-inflammatory phenotype characterized by the production of cytokines which in turn impact on the surrounding tissue. However, inflammation is not restricted to adipose tissue and high fat-feeding is responsible for a significant increase in pro-inflammatory cytokine expression in muscle. Although skeletal muscle is the major disposer of dietary glucose and a major determinant of glycemia, the origin and consequence of muscle inflammation in the development of insulin resistance are poorly understood. We used a cell culture approach to investigate the vectorial crosstalk between muscle cells and macrophages upon exposure to physiological, low levels of saturated and unsaturated fatty acids. Inflammatory pathway activation and cytokine expression were analyzed in L6 muscle cells expressing myc-tagged GLUT4 (L6GLUT4myc exposed to 0.2 mM palmitate or palmitoleate. Conditioned media thereof, free of fatty acids, were then tested for their ability to activate RAW264.7 macrophages. Palmitate -but not palmitoleate- induced IL-6, TNFα and CCL2 expression in muscle cells, through activation of the NF-κB pathway. Palmitate (0.2 mM alone did not induce insulin resistance in muscle cells, yet conditioned media from palmitate-challenged muscle cells selectively activated macrophages towards a pro-inflammatory phenotype. These results demonstrate that low concentrations of palmitate activate autonomous inflammation in muscle cells to release factors that turn macrophages pro-inflammatory. We hypothesize that saturated fat-induced, low-grade muscle cell inflammation may trigger resident skeletal muscle macrophage polarization, possibly contributing to insulin resistance in vivo.

  15. Effects of autonomous motivational priming on motivation and affective responses towards high-intensity interval training.

    Science.gov (United States)

    Brown, Denver M Y; Teseo, Amanda J; Bray, Steven R

    2016-08-01

    This study examined the effect of autonomous motivational priming on motivation, attitudes and intentions towards high-intensity interval training (HIT). Participants (N = 42) performed a graded exercise test to determine their peak aerobic power (WPEAK). At a subsequent testing session, participants were randomised to complete either an autonomous or neutral motivational priming task followed by a 10 × 1 HIT exercise protocol, alternating 1-min bouts of hard (70% WPEAK) and light (12.5% WPEAK) exercises for 20 min. Participants primed with autonomous motivation reported greater enjoyment, P = .009, ηp(2) = .16, and perceived competence, P = .005, ηp(2) = .18, post-exercise compared to those in the neutral priming condition. Participants in the autonomous motivational priming condition also reported more positive attitudes, P = .014, ηp(2) = .14, towards HIT; however, there was no difference between the conditions for task motivation during HIT or intentions, P = .53, ηp(2) = .01, to engage in HIT. These findings highlight autonomous motivational priming as a method of enhancing affective and motivational experiences regarding HIT. PMID:26634389

  16. Sympathetic Responses to Noxious Stimulation of Muscle and Skin.

    Science.gov (United States)

    Burton, Alexander R; Fazalbhoy, Azharuddin; Macefield, Vaughan G

    2016-01-01

    Acute pain triggers adaptive physiological responses that serve as protective mechanisms that prevent continuing damage to tissues and cause the individual to react to remove or escape the painful stimulus. However, an extension of the pain response beyond signaling tissue damage and healing, such as in chronic pain states, serves no particular biological function; it is maladaptive. The increasing number of chronic pain sufferers is concerning, and the associated disease burden is putting healthcare systems around the world under significant pressure. The incapacitating effects of long-lasting pain are not just psychological - reflexes driven by nociceptors during the establishment of chronic pain may cause serious physiological consequences on regulation of other body systems. The sympathetic nervous system is inherently involved in a host of physiological responses evoked by noxious stimulation. Experimental animal and human models demonstrate a diverse array of heterogeneous reactions to nociception. The purpose of this review is to understand how pain affects the sympathetic nervous system by investigating the reflex cardiovascular and neural responses to acute pain and the long-lasting physiological responses to prolonged (tonic) pain. By observing the sympathetic responses to long-lasting pain, we can begin to understand the physiological consequences of long-term pain on cardiovascular regulation. PMID:27445972

  17. Modulation of the androgenetic response in diverse skin cell types: the pilosebaceous unit

    International Nuclear Information System (INIS)

    Androgens play a central role in diverse morphogenetic processes of the skin. Hair growth and follicular cycle are regulated in part by androgens. Androgens also play a key function, together with other receptors such as the PPARs receptors family, on the proliferation and differentiation of the sebaceous gland that forms part of the pilosebaceous unit and influences hair growth and skin well-being. UV radiation may affect androgens regulation of skin homeostasis. Objectives: to study the modulation of androgenetic response related to UV radiation on the pilosebaceous unit, in two skin conditions: androgenetic alopecia and acne, both affecting skin and constituting major concerns for affected individuals. Methods: primary cultures of cells and established cell lines from the pilosebaceous unit: dermal papillae cells, keratinocytes and sebocytes. Analysis of lipid content, inflammatory response and proliferation of cells under the influence of androgens, PPARs ligands and UVR. Results: sebocytes primary cultures were obtained from human sebaceous glands. Proliferation and differentiation, as well as the expression of proinflammatory molecules (IL-1, TNF alpha, iNOs) and lipogenic enzymes (FASN) under androgens and UV treatment were assessed. The response to androgens under UV exposure was also analyzed in dermal papillae cells in culture. (authors)

  18. Effects of niacin restriction on sirtuin and PARP responses to photodamage in human skin.

    Science.gov (United States)

    Benavente, Claudia A; Schnell, Stephanie A; Jacobson, Elaine L

    2012-01-01

    Sirtuins (SIRTs) and poly(ADP-ribose) polymerases (PARPs), NAD(+)-dependent enzymes, link cellular energy status with responses to environmental stresses. Skin is frequently exposed to the DNA damaging effects of UV irradiation, a known etiology in skin cancer. Thus, understanding the defense mechanisms in response to UV, including the role of SIRTs and PARPs, may be important in developing skin cancer prevention strategies. Here, we report expression of the seven SIRT family members in human skin. SIRTs gene expressions are progressively upregulated in A431 epidermoid carcinoma cells (SIRTs1 and 3), actinic keratoses (SIRTs 2, 3, 5, 6, and 7) and squamous cell carcinoma (SIRTs 1-7). Photodamage induces dynamic changes in SIRT expression with upregulation of both SIRT1 and SIRT4 mRNAs. Specific losses of SIRT proteins occur early after photodamage followed by accumulation later, especially for SIRT4. Niacin restriction, which decreases NAD(+), the sirtuin substrate, results in an increase in acetylated proteins, upregulation of SIRTs 2 and 4, increased inherent DNA damage, alterations in SIRT responses to photodamage, abrogation of PARP activation following photodamage, and increased sensitivity to photodamage that is completely reversed by repleting niacin. These data support the hypothesis that SIRTs and PARPs play important roles in resistance to photodamage and identify specific SIRTs that respond to photodamage and may be targets for skin cancer prevention. PMID:22860104

  19. Regulating Response Time in an Autonomic Computing System: A Comparison of Proportional Control and Fuzzy Control Approaches

    Directory of Open Access Journals (Sweden)

    Harish S. Venkatarama

    2010-10-01

    Full Text Available Ecommerce is an area where an Autonomic Computing system could be very effectively deployed.Ecommerce has created demand for high quality information technology services and businesses areseeking quality of service guarantees from their service providers. These guarantees are expressed aspart of service level agreements. Properly adjusting tuning parameters for enforcement of the servicelevel agreement is time-consuming and skills-intensive. Moreover, in case of changes to the workload, thesetting of the parameters may no longer be optimum. In an ecommerce system, where the workloadchanges frequently, there is a need to update the parameters at regular intervals. This paper describestwo approaches, one, using a proportional controller and two, using a fuzzy controller, to automate thetuning of MaxClients parameter of Apache web server based on the required response time and thecurrent workload. This is an illustration of the self-optimizing characteristic of an autonomic computingsystem.

  20. Regulating Response Time in an Autonomic Computing System: A Comparison of Proportional Control and Fuzzy Control Approaches

    Directory of Open Access Journals (Sweden)

    Harish S. Venkatarama

    2010-10-01

    Full Text Available Ecommerce is an area where an Autonomic Computing system could be very effectively deployed. Ecommerce has created demand for high quality information technology services and businesses are seeking quality of service guarantees from their service providers. These guarantees are expressed as part of service level agreements. Properly adjusting tuning parameters for enforcement of the service level agreement is time-consuming and skills-intensive. Moreover, in case of changes to the workload, the setting of the parameters may no longer be optimum. In an ecommerce system, where the workload changes frequently, there is a need to update the parameters at regular intervals. This paper describes two approaches, one, using a proportional controller and two, using a fuzzy controller, to automate the tuning of MaxClients parameter of Apache web server based on the required response time and the current workload. This is an illustration of the self-optimizing characteristic of an autonomic computing system.

  1. Frequency-response-based analysis of respiratory sensor measuring capacitance built across skin

    Science.gov (United States)

    Terasawa, Makie; Kumagai, Shinya; Sasaki, Minoru

    2016-04-01

    A capacitive respiratory sensor is studied by attaching the electrodes to the skin. The signal characteristics related to the electrode position and body motion are examined. The frequency response indicates the nearly pure capacitance characteristics. The sensing mechanism model based on the equivalent skin thickness change generated by the body volume change accompanying respiration is reasonably consistent with the experimental results. The sensing method is examined by measuring the frequency response under some different conditions including the grounding issue. The electrode attached to the concave site tends to show a smaller signal difference between inhalation and exhalation. The convex site stabilizes the measurement. The bellyband combined with the electrode realizes stable sensing with comfortable fit on the skin.

  2. HABITUATION OF SKIN CONDUCTANCE RESPONSES IN PATIENTS WITH ANXIETY STATES

    OpenAIRE

    Biswas, P K; Chattopadhyay, P. K.

    1981-01-01

    SUMMARY Habituation of the GSR responses obtained from a group of 20 patients sufferings from anxiety states was compared with a group of 20 matched normals, selected for lack of anxiety. Habituation parameter did differentiate the two groups very distinctly, where very fast habituation WP.S noted in the normals. Findings were interpreted in terms of the level of arousal of the patients/subjects tested.

  3. Media Research with a Galvanic Skin Response Biosensor: Some Kids Work Up a Sweat!

    Science.gov (United States)

    Clariana, Roy B.

    This study considers the galvanic skin response (GSR) of sixth-grade students (n=20) using print, video, and microcomputer segments. Subjects received all three media treatments, in randomized order. Data for analysis consisted of standardized test scores and GSR measures; a moderate positive relationship was shown between cumulative GSR and…

  4. Thermal Response of In Vivo Human Skin to Fractional Radiofrequency Microneedle Device

    Directory of Open Access Journals (Sweden)

    Woraphong Manuskiatti

    2016-01-01

    Full Text Available Background. Fractional radiofrequency microneedle system (FRMS is a novel fractional skin resurfacing system. Data on thermal response to this fractional resurfacing technique is limited. Objectives. To investigate histologic response of in vivo human skin to varying energy settings and pulse stacking of a FRMS in dark-skinned subjects. Methods. Two female volunteers who were scheduled for abdominoplasty received treatment with a FRMS with varying energy settings at 6 time periods including 3 months, 1 month, 1 week, 3 days, 1 day, and the time immediately before abdominoplasty. Biopsy specimens were analyzed using hematoxylin and eosin (H&E, Verhoeff-Van Gieson (VVG, colloidal iron, and Fontana-Masson stain. Immunohistochemical study was performed by using Heat Shock Protein 70 (HSP70 antibody and collagen III monoclonal antibody. Results. The average depth of radiofrequency thermal zone (RFTZ ranged from 100 to 300 μm, correlating with energy levels. Columns of cell necrosis and collagen denaturation followed by inflammatory response were initially demonstrated, with subsequent increasing of mucin at 1 and 3 months after treatment. Immunohistochemical study showed positive stain with HSP70. Conclusion. A single treatment with a FRMS using appropriate energy setting induces neocollagenesis. This wound healing response may serve as a mean to improve the appearance of photodamaged skin and atrophic scars.

  5. Thermal Response of In Vivo Human Skin to Fractional Radiofrequency Microneedle Device

    Science.gov (United States)

    Manuskiatti, Woraphong; Pattanaprichakul, Penvadee; Inthasotti, Siriluk; Sitthinamsuwan, Panitta; Hanamornroongruang, Suchanan; Wanitphakdeedecha, Rungsima; Chu-ongsakol, Sorawuth

    2016-01-01

    Background. Fractional radiofrequency microneedle system (FRMS) is a novel fractional skin resurfacing system. Data on thermal response to this fractional resurfacing technique is limited. Objectives. To investigate histologic response of in vivo human skin to varying energy settings and pulse stacking of a FRMS in dark-skinned subjects. Methods. Two female volunteers who were scheduled for abdominoplasty received treatment with a FRMS with varying energy settings at 6 time periods including 3 months, 1 month, 1 week, 3 days, 1 day, and the time immediately before abdominoplasty. Biopsy specimens were analyzed using hematoxylin and eosin (H&E), Verhoeff-Van Gieson (VVG), colloidal iron, and Fontana-Masson stain. Immunohistochemical study was performed by using Heat Shock Protein 70 (HSP70) antibody and collagen III monoclonal antibody. Results. The average depth of radiofrequency thermal zone (RFTZ) ranged from 100 to 300 μm, correlating with energy levels. Columns of cell necrosis and collagen denaturation followed by inflammatory response were initially demonstrated, with subsequent increasing of mucin at 1 and 3 months after treatment. Immunohistochemical study showed positive stain with HSP70. Conclusion. A single treatment with a FRMS using appropriate energy setting induces neocollagenesis. This wound healing response may serve as a mean to improve the appearance of photodamaged skin and atrophic scars. PMID:27247943

  6. Functional analysis of the skin-swelling response to phytohaemagglutinin

    Czech Academy of Sciences Publication Activity Database

    Vinkler, Michal; Bainová, H.; Albrecht, Tomáš

    2010-01-01

    Roč. 24, č. 5 (2010), s. 1081-1086. ISSN 0269-8463 R&D Projects: GA ČR GA206/08/1281; GA ČR GA206/08/0640; GA MŠk LC06073 Institutional research plan: CEZ:AV0Z60930519 Keywords : avian innate and adaptive immunity * ecoimmunology * ecological immunology * ecotoxicology * inflammatory response * PHA-induced hypersensitivity * phytohaemagglutinin * T-cell-mediated immunocompetence Subject RIV: EG - Zoology Impact factor: 4.645, year: 2010

  7. Force sensor in simulated skin and neural model mimic tactile SAI afferent spiking response to ramp and hold stimuli

    OpenAIRE

    Kim Elmer K; Wellnitz Scott A; Bourdon Sarah M; Lumpkin Ellen A; Gerling Gregory J

    2012-01-01

    Abstract Background The next generation of prosthetic limbs will restore sensory feedback to the nervous system by mimicking how skin mechanoreceptors, innervated by afferents, produce trains of action potentials in response to compressive stimuli. Prior work has addressed building sensors within skin substitutes for robotics, modeling skin mechanics and neural dynamics of mechanotransduction, and predicting response timing of action potentials for vibration. The effort here is unique because...

  8. A comparison of the effects of captopril and enalapril on skin responses to intradermal bradykinin and skin blood flow in the human forearm.

    OpenAIRE

    LI KAM WA, T. C.; Cooke, E D; Turner, P

    1993-01-01

    1. The effects of captopril and enalapril on skin responses to intradermal injections of bradykinin and skin blood flow in the forearm were investigated in this randomised, double-blind, placebo-controlled, cross-over study. 2. Intradermal injections of 0, 1, 2.5 and 5 micrograms of bradykinin in 0.9% sodium chloride were made into the forearm of twelve healthy volunteers before and at 2, 6 and 24 h after single oral doses of 25 mg captopril, 10 mg enalapril or placebo. Forearm skin blood flo...

  9. The Heritability of the Skin Conductance Orienting Response: A Longitudinal Twin Study

    OpenAIRE

    Tuvblad, Catherine; Gao, Yu; Isen, Joshua; Botwick, Theodore; Raine, Adrian; Baker, Laura A.

    2011-01-01

    The orienting response is a widely used experimental paradigm that reflects the association between electrodermal activity and psychological processes. The present study examined the genetic and environmental etiology of skin conductance orienting response (SCOR) magnitude in a sample of twins assessed at ages 9-10, 11-13 and 14-16 years. Structural equation modeling at each visit showed that genetic influences explained 56%, 83%, and 48% of the total variance in SCOR at visit 1, 2, and 3 res...

  10. Arsenic-induced enhancement of ultraviolet radiation carcinogenesis in mouse skin: a dose-response study.

    OpenAIRE

    Burns, Fredric J.; Uddin, Ahmed N.; Wu, Feng; Nádas, Arthur; Rossman, Toby G.

    2004-01-01

    The present study was designed to establish the form of the dose-response relationship for dietary sodium arsenite as a co-carcinogen with ultraviolet radiation (UVR) in a mouse skin model. Hairless mice (strain Skh1) were fed sodium arsenite continuously in drinking water starting at 21 days of age at concentrations of 0.0, 1.25, 2.5, 5.0, and 10 mg/L. At 42 days of age, solar spectrum UVR exposures were applied three times weekly to the dorsal skin at 1.0 kJ/m2 per exposure until the experi...

  11. Mechanical response of porcine skin under compression from low to high strain rates

    Science.gov (United States)

    Bo, Chiara; Butler, Ben; Williams, Alun; Brown, Katherine; Proud, William

    2013-06-01

    Uniaxial compression experiments were performed on fresh porcine skin samples at different strain rates to study the stress-strain response. Low strain rate experiments were performed with an Instron 5566, while high strain rates were achieved using a Split Hopkinson Pressure Bar system. Magnesium bars and semiconductor strain gauges were used respectively to maximize the signal transmission from porcine skin to the output bar and to allow the signal measurement. Skin samples were harvested from different area of the animal to investigate the heterogeneity of such material. The experimental results showed that the mechanical response of skin in compression is strongly dependent on the strain rate of loading and on the location from which the samples were collected. Specimens collected from the rump showed a stiffer response compared to samples harvested from the thigh. Finally, a histological analysis of the samples post compression was carried out to examine the extent of tissue damage as a function of strain rate. This work is supported by the Atomic Weapons Establishment, UK and The Royal British Legion Centre for Blast Injury Studies at Imperial College London, UK.

  12. Enhanced immune responses by skin vaccination with influenza subunit vaccine in young hosts.

    Science.gov (United States)

    Koutsonanos, Dimitrios G; Esser, E Stein; McMaster, Sean R; Kalluri, Priya; Lee, Jeong-Woo; Prausnitz, Mark R; Skountzou, Ioanna; Denning, Timothy L; Kohlmeier, Jacob E; Compans, Richard W

    2015-09-01

    Skin has gained substantial attention as a vaccine target organ due to its immunological properties, which include a high density of professional antigen presenting cells (APCs). Previous studies have demonstrated the effectiveness of this vaccination route not only in animal models but also in adults. Young children represent a population group that is at high risk from influenza infection. As a result, this group could benefit significantly from influenza vaccine delivery approaches through the skin and the improved immune response it can induce. In this study, we compared the immune responses in young BALB/c mice upon skin delivery of influenza vaccine with vaccination by the conventional intramuscular route. Young mice that received 5 μg of H1N1 A/Ca/07/09 influenza subunit vaccine using MN demonstrated an improved serum antibody response (IgG1 and IgG2a) when compared to the young IM group, accompanied by higher numbers of influenza-specific antibody secreting cells (ASCs) in the bone marrow. In addition, we observed increased activation of follicular helper T cells and formation of germinal centers in the regional lymph nodes in the MN immunized group, rapid clearance of the virus from their lungs as well as complete survival, compared with partial protection observed in the IM-vaccinated group. Our results support the hypothesis that influenza vaccine delivery through the skin would be beneficial for protecting the high-risk young population from influenza infection. PMID:25744228

  13. The electromagnetic response of human skin in the millimetre and submillimetre wave range

    Science.gov (United States)

    Feldman, Yuri; Puzenko, Alexander; Ben Ishai, Paul; Caduff, Andreas; Davidovich, Issak; Sakran, Fadi; Agranat, Aharon J.

    2009-06-01

    Recent studies of the minute morphology of the skin by optical coherence tomography revealed that the sweat ducts in human skin are helically shaped tubes, filled with a conductive aqueous solution. This, together with the fact that the dielectric permittivity of the dermis is higher than that of the epidermis, brings forward the supposition that as electromagnetic entities, the sweat ducts could be regarded as low Q helical antennas. The implications of this statement were further investigated by electromagnetic simulation and experiment of the in vivo reflectivity of the skin of subjects under varying physiological conditions (Feldman et al 2008 Phys. Rev. Lett. 100 128102). The simulation and experimental results are in a good agreement and both demonstrate that sweat ducts in the skin could indeed behave as low Q antennas. Thus, the skin spectral response in the sub-Terahertz region is governed by the level of activity of the perspiration system and shows the minimum of reflectivity at some frequencies in the frequency band of 75-110 GHz. It is also correlated to physiological stress as manifested by the pulse rate and the systolic blood pressure. As such, it has the potential to become the underlying principle for remote sensing of the physiological parameters and the mental state of the examined subject.

  14. Study on the correlation of the autonomic nervous system responses to a stressor of high discomfort with personality traits.

    Science.gov (United States)

    LeBlanc, J; Ducharme, M B; Thompson, M

    2004-09-30

    The present study investigated Eysenck's predictions concerning the correlation of personality to arousal at higher levels of stress. Twenty young adults were exposed to a physical stress causing great discomfort, specifically a cold wind (4 degrees C at 60 km/h) exposure to the face for 3 min. Autonomic nervous system (ANS) responses were measured by continuous heart rate and plasma catecholamine determinations before, during and after the test. At the end of the test, the participants gave a rating of discomfort on a 0 to 10 scale. The personality traits were assessed with the Big-Five Inventory test (BFI). Results indicated that higher levels of trait extraversion were positively correlated with discomfort ratings and with the increased heart rate and the noradrenaline responses. Neuroticism was negatively correlated to discomfort and the autonomic responses. These findings tend to support Eysenck's theory on the role of personality on arousal at higher levels of stress. It is also proposed that the better tolerance to this severe stress observed with neuroticism is correlated to a certain habituation process caused by light to moderate arousal frequently experienced by participants with this personality trait during their daily activities. PMID:15327912

  15. Immune Responses to Trichloroethylene and Skin Gene Expression Profiles in Sprague Dawley Rats

    Institute of Scientific and Technical Information of China (English)

    XIAO-YAN CHEN; ZHI-XIONG ZHUANG; XIAO-HUI WANG; JIN-ZHOU ZHANG

    2006-01-01

    Objective To characterize the immune reaction in SD rats exposed to trichloroethylene (TCE) and to identify the gene expression profiles involved in skin after TCE exposure. Methods Fifteen percent of TCE was injected intradermally into the rat back (100 μL/120 g) at intervals of 7 days. Whole blood was collected 24 h after the fifth or seventh intradermic administration of TCE. The percentages of CD4+ and CD8+ of T lymphocytes were measured by a flow cytometer. The concentrations of IFN-gamma and IL-4 in the serum were semi-quantified by ELISA. Total RNAs of skin samples at 3 h or 24 h after the seventh dose of TCE in SD rats were extracted, and gene expression profiles of these tissues were analyszed by rat toxicology U34 array of Affymetrix. Results Obvious decline of CD4+ in T lymphocytes was observed in theTCE-administer group. No significant concentration differences in IFN-gamma and IL-4 were found between TCE-treated and control rats. Gadd45a and Mel were significantly up regulated in skin tissue 24 h after TCE exposure. The expression regulation of immune response factors was as active as proteins associated with lipid metabolism and synthesis process in these skin samples of SD rats exposed to TCE. Conclusion T-helper type 1 cells mediate immune response can not be elicited in TCE-treated SD rats, but certain immune disorder can be induced.

  16. Primary Sjögrens syndrome is associated with impaired autonomic response to orthostasis and sympathetic failure

    Science.gov (United States)

    Ng, W.-F.; Stangroom, A.J.; Davidson, A.; Wilton, K.; Mitchell, S.; Newton, J.L.

    2012-01-01

    Background: Symptoms in keeping with autonomic dysfunction are commonly described by primary Sjögrens syndrome patients (pSS); whether objective abnormalities of autonomic function occur is unclear. This study set out to explore dynamic cardiovascular autonomic responses in pSS and their relationship with symptoms and quality of life. Methods: Twenty-one people from the UK pSS registry, 21 community controls and 21 patients with the autoimmune liver disease primary biliary cirrhosis (PBC) (matched case-wise for age and sex) attended for assessment of autonomic responses to orthostasis and Valsalva manoeuvre (VM). pSS patients also completed EULAR Sjögrens Syndrome patient-reported index (ESSPRI), EULAR Sjögren’s syndrome disease activity index (ESSDAI), fatigue impact scale and EURO-QOL 5-dimension (EQ-5D). Results: Compared with controls, pSS patients had significantly lower baseline systolic blood pressure (SBP) (114 ± 13 vs. 127 ± 20; P = 0.02), which dropped to a significantly lower value (98 ± 22 vs. 119 ± 24, P = 0.009). When area under the curve (AUC) was calculated for when the SBP was below baseline this was significantly greater in pSS compared to both control groups (pSS vs. control vs. PBC: 153 ± 236 vs. 92 ± 85 vs. 1.2 ± 0.3, P = 0.005). Peak phase IV SBP during the VM was significantly lower in pSS (P = 0.007) indicating early sympathetic failure. Increased heart rate associated with fatigue (P = 0.02; r2 = 0.2) and EQ-5D. A shift in sympathetic-vagal balance associated with overall symptom burden (ESSPRI) (P = 0.04, r2 = 0.3) and EULAR sicca score (P = 0.016; r2 = 0.3), the latter also correlated with baroreceptor effectiveness (P = 0.03; r2 = 0.2) and diastolic blood pressure variability (P = 0.003; r2 = 0.4). Conclusion: pSS patients have impaired blood pressure response to standing. Dysautonomia correlates with PSS-associated symptoms and quality of life. PMID:22976617

  17. Perinatal taurine exposure programs patterns of autonomic nerve activity responses to tooth pulp stimulation in adult male rats

    Science.gov (United States)

    Khimsuksri, Sawita; Wyss, J. Michael; Thaeomor, Atcharaporn; Paphangkorakit, Jarin; Jirakulsomchok, Dusit; Roysommuti, Sanya

    2016-01-01

    Perinatal taurine excess or deficit influences adult health and disease, especially relative to the autonomic nervous system. This study tests the hypothesis that perinatal taurine exposure influences adult autonomic nervous system control of arterial pressure in response to acute electrical tooth pulp stimulation. Female Sprague-Dawley rats were fed normal rat chow with 3% β-alanine (taurine depletion, TD), 3% taurine (taurine supplementation, TS) or water alone (control, C) from conception to weaning. Their male offspring were fed normal rat chow and tap water throughout the experiment. At 8–10 weeks of age, blood chemistry, arterial pressure, heart rate and renal sympathetic nerve activity were measured in anesthetized rats. Age, body weight, mean arterial pressure, heart rate, plasma electrolytes, blood urea nitrogen, plasma creatinine and plasma cortisol were not significantly different among the three groups. Before tooth pulp stimulation, low (0.3–0.5 Hz) and high frequency (0.5–4.0 Hz) power spectral densities of arterial pressure were not significantly different among groups, while the power spectral densities of renal sympathetic nerve activity were significantly decreased in TD compared to control rats. Tooth pulp stimulation did not change arterial pressure, heart rate, renal sympathetic nerve and arterial pressure power spectral densities in the 0.3–4.0 Hz spectrum or renal sympathetic nerve firing rate in any group. In contrast, perinatal taurine imbalance disturbed very low frequency power spectral densities of both arterial pressure and renal sympathetic nerve activity (below 0.1 Hz), both before and after the tooth pulp stimulation. The power densities of TS were most sensitive to ganglionic blockade and central adrenergic inhibition, while those of TD were sensitive to both central and peripheral adrenergic inhibition. The present data indicate that perinatal taurine imbalance can lead to aberrant autonomic nervous system responses in

  18. Mom feels what her child feels: thermal signatures of vicarious autonomic response while watching children in a stressful situation

    Directory of Open Access Journals (Sweden)

    Barbara eManini

    2013-06-01

    Full Text Available Maternal attunement with an infant's emotional states is thought to represent a distinctive feature of the human primary bond. It implies the mother’s ability of empathizing with her child in order to fulfil the child’s needs in an immediate and appropriate manner. Thus, it is particularly involved in stressful situations. By assuming that maternal attunement embodies a direct sharing of physiological responses with the child, we compared the autonomic response of mothers observing their own distressed child with those of other women observing an unknown child involved in an ecological distressful condition (mishap paradigm. The hypothesis was that the adult’s response was more attuned with the child’s response in the former group than in the latter group. The autonomic response was non-invasively evaluated through the recording of the thermal facial imprints by means of thermal infrared (IR imaging. Nine mother-child dyads and nine woman-unknown child dyads were studied. We found marked similarities between the facial temperature dynamics of women and children along the experimental procedure, thus providing evidence for a direct emotional sharing within the adult-child dyad. The evidence for common dynamics in the time course of the temperatures was assessed through correlation analysis and, nevertheless, resulted stronger in the mother-child dyads than in the other women–child dyads. In addition, temporal analysis showed a faster response in mothers than in other women, thus confirming our study hypothesis. Besides confirming the extraordinary capability of thermal infrared imaging to preserve ecological context in the study of social or non-verbal interactions, these results suggest that maternity appears to potentiate the emotional attunement with the child. Although based on preliminary results, this study opens new perspectives in the study of the factors modulating vicarious socio-emotional processes.

  19. IN SITU IMMUNE RESPONSE EVALUATION VIA IMMUNOHISTOCHEMISTRY IN SKIN BIOPSIES FROM PATIENTS AFFECTED BY AUTOIMMUNE BLISTERING DISEASES

    OpenAIRE

    Ana Maria Abreu Velez; Paul B. Googe, Jr.; Howard, Michael S.

    2013-01-01

    Introduction: The in situ immune response in skin biopsies from patients affected by autoimmune skin blistering diseases (ABD) is not well characterized. Aim: Our investigation attempts to immunophenotype cells in lesional skin in several ABD, utilizing immunohistochemistry (ICH). Methods: We tested by IHC for CD4, CD8, CD19, CD20, CD45, CD56/NCAM, PAX-5, granzyme B, myeloperoxidase, neutrophil elastase, LAT and ZAP-70 in patients affected by ABD. We tested 30 patients with endemic pemphigus ...

  20. Effects of psychological stress test on the cardiac response of public safety workers: alternative parameters to autonomic balance

    International Nuclear Information System (INIS)

    It is well known that public safety workers (PSW) face many stressful situations that yield them as high-risk population for suffering chronic stress diseases. In this multidisciplinary research the cardiac response to induced psychological stress by a short duration Stroop test was evaluated in 20 female and 19 male PSW, in order to compare traditionally used cardiac response parameters with alternative ones. Electrocardiograms have been recorded using the Eindhoven electrodes configuration for 1 min before, 3 min during and 1 min after the test. Signals analysis has been performed for the heart rate and the power spectra of its variability and of the variability of the amplitude of the R-wave, i.e. the highest peak of the electrocardiographic signal periodic sequence. The results demonstrated that the traditional autonomic balance index shows no significant differences between stages. In contrast, the median of the area of the power spectrum of the R-wave amplitude variability in the frequency region dominated by the autonomous nervous system (0.04-to-0.4 Hz) is the more sensitive parameter. Moreover, this parameter allows to identify gender differences consistent with those encountered in other studies

  1. Effects of psychological stress test on the cardiac response of public safety workers: alternative parameters to autonomic balance

    Science.gov (United States)

    Huerta-Franco, M. R.; Vargas-Luna, F. M.; Delgadillo-Holtfort, I.

    2015-01-01

    It is well known that public safety workers (PSW) face many stressful situations that yield them as high-risk population for suffering chronic stress diseases. In this multidisciplinary research the cardiac response to induced psychological stress by a short duration Stroop test was evaluated in 20 female and 19 male PSW, in order to compare traditionally used cardiac response parameters with alternative ones. Electrocardiograms have been recorded using the Eindhoven electrodes configuration for 1 min before, 3 min during and 1 min after the test. Signals analysis has been performed for the heart rate and the power spectra of its variability and of the variability of the amplitude of the R-wave, i.e. the highest peak of the electrocardiographic signal periodic sequence. The results demonstrated that the traditional autonomic balance index shows no significant differences between stages. In contrast, the median of the area of the power spectrum of the R-wave amplitude variability in the frequency region dominated by the autonomous nervous system (0.04-to-0.4 Hz) is the more sensitive parameter. Moreover, this parameter allows to identify gender differences consistent with those encountered in other studies.

  2. Autonomic responses to cold face stimulation in sickle cell disease: a time-varying model analysis

    Science.gov (United States)

    Chalacheva, Patjanaporn; Kato, Roberta M; Sangkatumvong, Suvimol; Detterich, Jon; Bush, Adam; Wood, John C; Meiselman, Herbert; Coates, Thomas D; Khoo, Michael C K

    2015-01-01

    Sickle cell disease (SCD) is characterized by sudden onset of painful vaso-occlusive crises (VOC), which occur on top of the underlying chronic blood disorder. The mechanisms that trigger VOC remain elusive, but recent work suggests that autonomic dysfunction may be an important predisposing factor. Heart-rate variability has been employed in previous studies, but the derived indices have provided only limited univariate information about autonomic cardiovascular control in SCD. To circumvent this limitation, a time-varying modeling approach was applied to investigate the functional mechanisms relating blood pressure (BP) and respiration to heart rate and peripheral vascular resistance in healthy controls, untreated SCD subjects and SCD subjects undergoing chronic transfusion therapy. Measurements of respiration, heart rate, continuous noninvasive BP and peripheral vascular resistance were made before, during and after the application of cold face stimulation (CFS), which perturbs both the parasympathetic and sympathetic nervous systems. Cardiac baroreflex sensitivity estimated from the model was found to be impaired in nontransfused SCD subjects, but partially restored in SCD subjects undergoing transfusion therapy. Respiratory-cardiac coupling gain was decreased in SCD and remained unchanged by chronic transfusion. These results are consistent with autonomic dysfunction in the form of impaired parasympathetic control and sympathetic overactivity. As well, CFS led to a significant reduction in vascular resistance baroreflex sensitivity in the nontransfused SCD subjects but not in the other groups. This blunting of the baroreflex control of peripheral vascular resistance during elevated sympathetic drive could be a potential factor contributing to the triggering of VOC in SCD. PMID:26177958

  3. Olfactory ensheathing cell transplantation improves sympathetic skin responses in chronic spinal cord injury

    OpenAIRE

    Zheng, Zuncheng; Liu, Guifeng; Chen, Yuexia; Wei, Shugang

    2013-01-01

    Forty-three patients with chronic spinal cord injury for over 6 months were transplanted with bryonic olfactory ensheathing cells, 2–4 × 106, into multiple sites in the injured area under the surgical microscope. The sympathetic skin response in patients was measured with an electromyography/evoked potential instrument 1 day before transplantation and 3–8 weeks after transtion. Spinal nerve function of patients was assessed using the American Spinal Injury Association impairment scale. The sy...

  4. Optimising a model-based approach to inferring fear learning from skin conductance responses

    OpenAIRE

    Staib, M.; Castegnetti, G.; Bach, D R

    2015-01-01

    Anticipatory sympathetic arousal is often inferred from skin conductance responses (SCR) and used to quantify fear learning. We have previously provided a model-based approach for this inference, based on a quantitative Psychophysiological Model (PsPM) formulated in non-linear dynamic equations. Here we seek to optimise the inversion of this PsPM. Using two independent fear conditioning datasets, we benchmark predictive validity as the sensitivity to separate the likely presence or absence of...

  5. An improved algorithm for model-based analysis of evoked skin conductance responses

    OpenAIRE

    Bach, D R; Friston, K.J.; Dolan, R. J.

    2013-01-01

    Model-based analysis of psychophysiological signals is more robust to noise - compared to standard approaches - and may furnish better predictors of psychological state, given a physiological signal. We have previously established the improved predictive validity of model-based analysis of evoked skin conductance responses to brief stimuli, relative to standard approaches. Here, we consider some technical aspects of the underlying generative model and demonstrate further improvements. Most im...

  6. Early delayed hypersensitivity responses in tuberculin skin tests after heavy occupational exposure to tuberculosis.

    OpenAIRE

    Gibbs, J. H.; Grange, J. M.; Beck, J S; Jawad, E; Potts, R C; Bothamley, G H; Kardjito, T.

    1991-01-01

    The early (six hours) reaction to tuberculin skin testing was studied in 33 Indonesian hospital workers with frequent occupational exposure to M tuberculosis and compared with responses maximal at the usual time (48 hours) in factory workers, from the same locality but with only occasional occupational exposure, to determine the nature of the early reaction. The early reaction had the same general histopathological appearance as that seen in the conventional (48 hour) reaction, and both had a...

  7. Skindex, a quality-of-life measure for patients with skin disease: reliability, validity, and responsiveness.

    Science.gov (United States)

    Chren, M M; Lasek, R J; Quinn, L M; Mostow, E N; Zyzanski, S J

    1996-11-01

    To measure the effects of skin disease on patients' quality of life, we developed a 61-item self-administered survey instrument called Skindex. Skindex has eight scales, each of which addresses a construct, or an abstract component, in a comprehensive conceptual framework: cognitive effects, social effects, depression, fear, embarrassment, anger, physical discomfort, and physical limitations. Item responses are standardized from 0 (no effect) to 100 (maximal effect); a scale score is the average of responses to items addressing a construct. In 201 patients seen by dermatologists, mean scale scores (+/-SD) ranged from 14 (+/-17) for physical limitations to 31 (+/-22) for physical discomfort. Scale scores were reproducible after 72 h (r = 0.68-0.90) and were internally consistent (Cronbach's alpha = 0.76-0.86). Construct validity was assessed in two ways: (i) in a comparison of patients with inflammatory dermatoses and patients with isolated lesions, patients with inflammatory dermatoses had higher scale scores, and (ii) in an exploratory factor analysis, 78% of the common variance was explained by seven factors that correlated with the scale scores of Skindex. Most of the a priori scale scores changed in the expected direction in patients who reported that their skin conditions had improved or worsened after 6 mo. Finally, physicians' judgments of disease severity did not consistently correlate with Skindex scores. These preliminary data suggest that Skindex reliably and responsively measures the effects of skin disease on patients' quality of life and may supplement clinical judgments of disease severity. PMID:8875954

  8. Resting cerebral metabolism correlates with skin conductance and functional brain activation during fear conditioning

    OpenAIRE

    Linnman, Clas; Zeidan, Mohamed A.; Pitman, Roger K.; Milad, Mohammed R.

    2011-01-01

    We investigated whether resting brain metabolism can be used to predict autonomic and neuronal responses during fear conditioning in 20 healthy humans. Regional cerebral metabolic rate for glucose was measured via positron emission tomography at rest. During conditioning, autonomic responses were measured via skin conductance, and blood oxygen level dependent signal was measured via functional magnetic resonance imaging. Resting dorsal anterior cingulate metabolism positively predicted differ...

  9. Effects of emotion regulation difficulties on the tonic and phasic cardiac autonomic response.

    Directory of Open Access Journals (Sweden)

    Guillaume Berna

    Full Text Available Emotion regulation theory aims to explain the interactions between individuals and the environment. In this context, Emotion Regulation Difficulties (ERD disrupt the physiological component of emotions through the autonomic nervous system and are involved in several psychopathological states.We were interested in comparing the influence of a film-elicited emotion procedure on the autonomic nervous system activity of two groups with different levels of emotion regulation difficulties.A total of 63 women (undergraduate students ranging from 18 to 27 (20.7 ± 1.99 years old were included. Using the upper and lower quartile of a questionnaire assessing the daily difficulties in regulating emotions, two groups, one with low (LERD and one with high (HERD levels of emotion regulation difficulties, were constituted and studied during a film-elicited emotion procedure. Cardiac vagal activity (HF-HRV was analyzed during three periods: baseline, film-elicited emotion, and recovery.The cardiovascular results showed a decrease in HF-HRV from baseline to elicitation for both groups. Then, from elicitation to recovery, HF-HRV increased for the LERD group, whereas a low HF-HRV level persisted for the HERD group.The HERD group exhibited inappropriate cardiac vagal recovery after a negative emotion elicitation had ended. Cardiac vagal tone took longer to return to its initial state in the HERD group than in the LERD group. Prolonged cardiac vagal suppression might constitute an early marker of emotion regulation difficulties leading to lower cardiac vagal tone.

  10. Intestinal Microbiota Promotes Psoriasis-Like Skin Inflammation by Enhancing Th17 Response

    Science.gov (United States)

    Zákostelská, Zuzana; Málková, Jana; Klimešová, Klára; Rossmann, Pavel; Hornová, Michaela; Novosádová, Iva; Stehlíková, Zuzana; Kostovčík, Martin; Hudcovic, Tomáš; Štepánková, Renata; Jůzlová, Kateřina; Hercogová, Jana; Tlaskalová-Hogenová, Helena

    2016-01-01

    Psoriasis is a chronic inflammatory skin disease in which Th17 cells play a crucial role. Since indigenous gut microbiota influences the development and reactivity of immune cells, we analyzed the link among microbiota, T cells and the formation of psoriatic lesions in the imiquimod-induced murine model of psoriasis. To explore the role of microbiota, we induced skin inflammation in germ-free (GF), broad-spectrum antibiotic (ATB)-treated or conventional (CV) BALB/c and C57BL/6 mice. We found that both mice reared in GF conditions for several generations and CV mice treated with ATB were more resistant to imiquimod-induced skin inflammation than CV mice. The ATB treatment dramatically changed the diversity of gut bacteria, which remained stable after subsequent imiquimod application; ATB treatment resulted in a substantial increase in the order Lactobacillales and a significant decrease in Coriobacteriales and Clostridiales. Moreover, as compared to CV mice, imiquimod induced a lower degree of local and systemic Th17 activation in both GF and ATB-treated mice. These findings suggest that gut microbiota control imiquimod-induced skin inflammation by altering the T cell response. PMID:27434104

  11. BRN 3.1 Knockouts Affect the Vestibular, Autonomic, and Circadian Rhythm Responses to 2G Exposure

    Science.gov (United States)

    Murakami, D. M.; Erkman, L.; Rosenfeld, M. G.; Fuller, C. A.

    1999-01-01

    Our previous studies have demonstrated that 2G exposure via centrifugation significantly attenuated the daily mean and circadian rhythm amplitude of rat body temperature (Tb), heart rate, and activity (Act). In addition, 2G exposure activates neural responses in several vestibular, autonomic, and circadian nuclei. Although we have characterized the effect of 2G on an animal's physiological, neuronal, and behavioral responses, it will be important to understand the underlying neural and physiological mechanisms that mediate those responses. For example, the vestibular responses, proprioceptive feedback, or fluid shifts may be the critical factors that mediate the responses to 2G. As a first step to understand the relative importance of these different response pathways to altered gravitational fields, this study examined the contribution of the vestibular system by utilizing an animal model from molecular biology. Brain 3.1 (Bm 3.1) is a POU domain homeobox gene involved in the normal development of the vestibular and auditory system. Brn 3.1 deletion results in a loss of hair cells in the otoliths, semicircular canals, and cochlea. As a result mice with a Brn 3.1 deletion do not have a functioning vestibular or auditory system. The BRN 3.1 knockout mouse could be a very useful animal model for isolating the role of the vestibular system in mediating the physiological responses to 2G exposure. Therefore, this study compared the effect of 2G exposure via centrifugation between Brn 3.1 knockout (KO) versus Wildtype (W) mice.

  12. Hypothalamic-pituitary-adrenal and cardiac autonomic responses to transrectal examination differ with behavioral reactivity in dairy cows.

    Science.gov (United States)

    Kovács, L; Kézér, F L; Kulcsár-Huszenicza, M; Ruff, F; Szenci, O; Jurkovich, V

    2016-09-01

    Behavior, hypothalamic-pituitary-adrenal axis, and cardiac autonomic nervous system (ANS) activity were evaluated in response to transrectal examination in nonlactating Holstein-Friesian cows with different behavioral reactivity. According to behavioral reactions shown to the procedure of fixing the heart rate (HR) monitors, the 20 cows with the highest and the 20 cows with the lowest behavioral reactivity were involved in the study (high responder, n=20; and low responder, n=20, respectively). Activity of the ANS was assessed by HR and HR variability parameters. Blood and saliva were collected at 5 min before (baseline) and 0, 5 10, 15, 20, 30, 40, 60, and 120 min after the examination to determine cortisol concentrations. The examination lasted for 5 min. Cardiac parameters included HR, the root mean square of successive differences between the consecutive interbeat intervals, the high frequency (HF) component of heart rate variability, and the ratio between the low frequency (LF) and HF parameter (LF/HF). Following the examination, peak plasma and saliva cortisol levels and the amplitude of the plasma and saliva cortisol response were higher in high responder cows than in low responders. Areas under the plasma and saliva cortisol response curves were greater in high responder cows. Plasma and salivary cortisol levels correlated significantly at baseline (r=0.91), right after examination (r=0.98), and at peak levels (r=0.96). Area under the HR response curve was higher in low responder cows; however, maximum HR and the amplitude of the HR response showed no differences between groups. Minimum values of both parameters calculated for the examination were higher in high responders. Following the examination, response parameters of root mean square of successive differences and HF did not differ between groups. The maximum and the amplitude of LF/HF response and area under the LF/HF response curve were lower in low responder cows, suggesting a lower sympathetic

  13. Agent, autonomous

    OpenAIRE

    Luciani, Annie

    2007-01-01

    The expression autonomous agents, widely used in virtual reality, computer graphics, artificial intelligence and artificial life, corresponds to the simulation of autonomous creatures, virtual (i.e. totally computed by a program), or embodied in a physical envelope, as done in autonomous robots.

  14. Autonomous Star Tracker Algorithms

    DEFF Research Database (Denmark)

    Betto, Maurizio; Jørgensen, John Leif; Kilsgaard, Søren;

    1998-01-01

    Proposal, in response to an ESA R.f.P., to design algorithms for autonomous star tracker operations.The proposal also included the development of a star tracker breadboard to test the algorithms performances.......Proposal, in response to an ESA R.f.P., to design algorithms for autonomous star tracker operations.The proposal also included the development of a star tracker breadboard to test the algorithms performances....

  15. Mechanisms of DNA damage response to targeted irradiation in organotypic 3D skin cultures.

    Directory of Open Access Journals (Sweden)

    Anna Acheva

    Full Text Available DNA damage (caused by direct cellular exposure and bystander signaling and the complex pathways involved in its repair are critical events underpinning cellular and tissue response following radiation exposures. There are limited data addressing the dynamics of DNA damage induction and repair in the skin particularly in areas not directly exposed. Here we investigate the mechanisms regulating DNA damage, repair, intracellular signalling and their impact on premature differentiation and development of inflammatory-like response in the irradiated and surrounding areas of a 3D organotypic skin model. Following localized low-LET irradiation (225 kVp X-rays, low levels of 53BP1 foci were observed in the 3D model (3.8±0.28 foci/Gy/cell with foci persisting and increasing in size up to 48 h post irradiation. In contrast, in cell monolayers 14.2±0.6 foci/Gy/cell and biphasic repair kinetics with repair completed before 24 h was observed. These differences are linked to differences in cellular status with variable level of p21 driving apoptotic signalling in 2D and accelerated differentiation in both the directly irradiated and bystander areas of the 3D model. The signalling pathways utilized by irradiated keratinocytes to induce DNA damage in non-exposed areas of the skin involved the NF-κB transcription factor and its downstream target COX-2.

  16. Botulinum toxin type A reduces histamine-induced itch and vasomotor responses in human skin

    DEFF Research Database (Denmark)

    Gazerani, Parisa; Pedersen, N. S.; Drewes, Asbjørn Mohr;

    2009-01-01

    temperature measurements (F(1,26) = 27.6, P < 0.001) clearly showed the suppressive effect of BoNT/A on vasomotor reactions, with the maximal effect on days 3 and 7. CONCLUSIONS: BoNT/A reduced the itch intensity, blood flow and neurogenic inflammation in response to the histamine prick test in human skin...... subcutaneous administration of BoNT/A on experimentally histamine-induced itch in human skin. METHODS: In this double-blind, placebo-controlled study, 14 healthy men (mean +/- SD age 26.3 +/- 2.6 years) received BoNT/A (Botox; Allergan, Irvine, CA, U.S.A.; 5 U) and isotonic saline on the volar surface of...

  17. When Beauty Is Skin Deep: Regulation of the Wound Response by Caspase-8, RIPK3, and the Inflammasome.

    Science.gov (United States)

    Vince, James E

    2015-08-01

    Caspase-8 downregulation is observed in the epidermis of wounded skin, whereas permanent epidermal caspase-8 deletion causes chronic skin inflammation, suggesting that caspase-8 is a critical regulator of skin homeostasis and, possibly, the wound response. In this issue, Lee et al. document how epidermal caspase-8 deletion, or cutaneous wounding, results in increased NF-κB activation to drive keratinocyte caspase-1 expression and subsequent secretion of the pro-inflammatory cytokines, IL-1β and IL-1α. Consequently, loss of NF-κB activity, caspase-1, or the IL-1 receptor delays wound healing. Previous studies have documented how chronic skin inflammation in caspase-8-deficient mice is rescued by RIPK3 co-deletion. Therefore, targeting caspase-1, IL-1, or RIPK3 itself may benefit treatment of chronic inflammatory skin diseases, or where an inappropriate inflammatory response proves detrimental to wound healing, such as in type 2 diabetes. PMID:26174535

  18. Standardization of a computerized method for calculating autonomic function test responses in healthy subjects and patients with diabetes mellitus

    Directory of Open Access Journals (Sweden)

    C. Neumann

    1997-02-01

    Full Text Available The objectives of the present study were 1 to compare results obtained by the traditional manual method of measuring heart rate (HR and heart rate response (HRR to the Valsalva maneuver, standing and deep breathing, with those obtained using a computerized data analysis system attached to a standard electrocardiograph machine; 2 to standardize the responses of healthy subjects to cardiovascular tests, and 3 to evaluate the response to these tests in a group of patients with diabetes mellitus (DM. In all subjects (97 healthy and 143 with DM we evaluated HRR to deep breathing, HRR to standing, HRR to the Valsalva maneuver, and blood pressure response (BPR to standing up and to a sustained handgrip. Since there was a strong positive correlation between the results obtained with the computerized method and the traditional method, we conclude that the new method can replace the traditional manual method for evaluating cardiovascular responses with the advantages of speed and objectivity. HRR and BPR of men and women did not differ. A correlation between age and HRR was observed for standing (r = -0.48, P<0.001 and deep breathing (r = -0.41, P<0.002. Abnormal BPR to standing was usually observed only in diabetic patients with definite and severe degrees of autonomic neuropathy.

  19. In vivo imaging of immune cell dynamics in skin in response to zinc-oxide nanoparticle exposure

    OpenAIRE

    Graf, Benedikt W.; Chaney, Eric J.; Marjanovic, Marina; De Lisio, Michael; Valero, Maria C; Boppart, Marni D.; Boppart, Stephen A.

    2013-01-01

    Zinc oxide (ZnO) nanoparticles (NPs) are widely used in cosmetic and sunscreen products which are applied topically to the skin. Despite their widespread use, the safety and biological response of these particles remains an active area of investigation. In this paper we present methods based on in vivo multiphoton microscopy (MPM) in skin to address relevant questions about the potential toxicity and immunological response of ZnO NPs. Registration of time-lapse volumetric MPM images allows th...

  20. An integrated stochastic multi-regional long-term energy planning model incorporating autonomous power systems and demand response

    International Nuclear Information System (INIS)

    The power sector faces a rapid transformation worldwide from a dominant fossil-fueled towards a low carbon electricity generation mix. Renewable energy technologies (RES) are steadily becoming a greater part of the global energy mix, in particular in regions that have put in place policies and measures to promote their utilization. This paper presents an optimization-based approach to address the generation expansion planning (GEP) problem of a large-scale, central power system in a highly uncertain and volatile electricity industry environment. A multi-regional, multi-period linear mixed-integer linear programming (MILP) model is presented, combining optimization techniques with a Monte Carlo (MCA) method and demand response concepts. The optimization goal concerns the minimization of the total discounted cost by determining optimal power capacity additions per time interval and region, and the power generation mix per technology and time period. The model is evaluated on the Greek power system (GPS), taking also into consideration the scheduled interconnection of the mainland power system with those of selected autonomous islands (Cyclades and Crete), and aims at providing full insight into the composition of the long-term energy roadmap at a national level. - Highlights: • A spatial, multi-period, long-term generation expansion planning model is presented. • A Monte-Carlo method along with a demand response mechanism are incorporated. • Autonomous power systems interconnection is considered. • Electricity and CO2 emission trade are taken into account. • Lignite, natural gas and wind power comprise the dominant power technologies

  1. Bioimpedance-Based Wearable Measurement Instrumentation for Studying the Autonomic Nerve System Response to Stressful Working Conditions

    International Nuclear Information System (INIS)

    The assessment of mental stress on workers under hard and stressful conditions is critical to identify which workers are not ready to undertake a mission that might put in risk their own life and the life of others. The ATREC project aims to enable Real Time Assessment of Mental Stress of the Spanish Armed Forces during military activities. Integrating sensors with garments and using wearable measurement devices, the following physiological measurements were recorded: heart and respiration rate, skin galvanic response as well as peripheral temperature. The measuring garments are the following: a sensorized glove, an upper-arm strap and a repositionable textrode chest strap system with 6 textrodes. The implemented textile-enabled instrumentation contains: one skin galvanometer, two temperature sensors, for skin and environmental, and an Impedance Cardiographer/Pneumographer containing a 1 channel ECG amplifier to record cardiogenic biopotentials. The implemented wearable systems operated accordingly to the specifications and are ready to be used for the mental stress experiments that will be executed in the coming phases of the project in healthy volunteers.

  2. Bioimpedance-Based Wearable Measurement Instrumentation for Studying the Autonomic Nerve System Response to Stressful Working Conditions

    Science.gov (United States)

    Ferreira, J.; Álvarez, L.; Buendía, R.; Ayllón, D.; Llerena, C.; Gil-Pita, R.; Seoane, F.

    2013-04-01

    The assessment of mental stress on workers under hard and stressful conditions is critical to identify which workers are not ready to undertake a mission that might put in risk their own life and the life of others. The ATREC project aims to enable Real Time Assessment of Mental Stress of the Spanish Armed Forces during military activities. Integrating sensors with garments and using wearable measurement devices, the following physiological measurements were recorded: heart and respiration rate, skin galvanic response as well as peripheral temperature. The measuring garments are the following: a sensorized glove, an upper-arm strap and a repositionable textrode chest strap system with 6 textrodes. The implemented textile-enabled instrumentation contains: one skin galvanometer, two temperature sensors, for skin and environmental, and an Impedance Cardiographer/Pneumographer containing a 1 channel ECG amplifier to record cardiogenic biopotentials. The implemented wearable systems operated accordingly to the specifications and are ready to be used for the mental stress experiments that will be executed in the coming phases of the project in healthy volunteers.

  3. Pathological gambling: Relation of skin conductance response to dopaminergic neurotransmission and sensation-seeking

    DEFF Research Database (Denmark)

    Peterson, Ericka; Møller, Arne; Doudet, Doris;

    2010-01-01

    Absent Skin Conductance Response (SCR) in pathological gambling (PG) may relate to dopaminergic mechanisms. We recruited equal numbers of PG subjects and healthy control (HC) subjects, and then tested the claim that SCR is less conditioned by dopaminergic activity in PG subjects. During active...... gambling, SCR differed in PG and HC subjects (Pb0.05), but positron emission tomography revealed the same dopamine receptor availability. However, highly sensation-seeking (HS) PG subjects had lower dopamine receptor availability (Pb0.0001) in the baseline, compared to normal sensation-seeking (NS) PG...

  4. Pathological gambling: Relation of skin conductance response to dopaminergic neurotransmission and sensation-seeking

    DEFF Research Database (Denmark)

    Peterson, Ericka Ann; Møller, Arne; Doudet, Doris J.;

    2010-01-01

    Absent Skin Conductance Response (SCR) in pathological gambling (PG) may relate to dopaminergic mechanisms. We recruited equal numbers of PG subjects and healthy control (HC) subjects, and then tested the claim that SCR is less conditioned by dopaminergic activity in PG subjects. During active...... gambling, SCR differed in PG and HC subjects (P < 0.05), but positron emission tomography revealed the same dopamine receptor availability. However, highly sensation-seeking (HS) PG subjects had lower dopamine receptor availability (P < 0.0001) in the baseline, compared to normal sensation-seeking (NS) PG...

  5. Catecholamines and diabetic autonomic neuropathy

    DEFF Research Database (Denmark)

    Hilsted, J

    1995-01-01

    plasma catecholamine measurements is not due to changes in the clearance of catecholamines in diabetic autonomic neuropathy. The physiological responses to infused adrenaline and to noradrenaline are enhanced, for noradrenaline mainly cardiovascular responses. Adrenoceptors (alpha and beta adrenoceptors......In diabetic patients with autonomic neuropathy plasma noradrenaline concentration, used as an index of sympathetic nervous activity, is low. This decrease is, however, only found in patients with a long duration of diabetes with clinically severe autonomic neuropathy. This apparent insensitivity of...

  6. Cutaneous antigen priming via gene gun leads to skin-selective Th2 immune-inflammatory responses.

    Science.gov (United States)

    Alvarez, David; Harder, Greg; Fattouh, Ramzi; Sun, Jiangfeng; Goncharova, Susanna; Stämpfli, Martin R; Coyle, Anthony J; Bramson, Jonathan L; Jordana, Manel

    2005-02-01

    It is becoming increasingly evident that the compartmentalization of immune responses is governed, in part, by tissue-selective homing instructions imprinted during T cell differentiation. In the context of allergic diseases, the fact that "disease" primarily manifests in particular tissue sites, despite pervasive allergen exposure, supports this notion. However, whether the original site of Ag exposure distinctly privileges memory Th2 immune-inflammatory responses to the same site, while sparing remote tissue compartments, remains to be fully investigated. We examined whether skin-targeted delivery of plasmid DNA encoding OVA via gene-gun technology in mice could generate allergic sensitization and give rise to Th2 effector responses in the skin as well as in the lung upon subsequent Ag encounter. Our data show that cutaneous Ag priming induced OVA-specific serum IgE and IgG1, robust Th2-cytokine production, and late-phase cutaneous responses and systemic anaphylactic shock upon skin and systemic Ag recall, respectively. However, repeated respiratory exposure to aerosolized OVA failed to instigate airway inflammatory responses in cutaneous Ag-primed mice, but not in mice initially sensitized to OVA via the respiratory mucosa. Importantly, these contrasting airway memory responses correlated with the occurrence of Th2 differentiation events at anatomically separate sites: indeed cutaneous Ag priming resulted in Ag-specific proliferative responses and Th2 differentiation in skin-, but not thoracic-, draining lymph nodes. These data indicate that Ag exposure to the skin leads to Th2 differentiation within skin-draining lymph nodes and subsequent Th2 immunity that is selectively manifested in the skin. PMID:15661930

  7. Laser speckle contrast imaging of skin blood perfusion responses induced by laser coagulation

    International Nuclear Information System (INIS)

    We report application of laser speckle contrast imaging (LSCI), i.e., a fast imaging technique utilising backscattered light to distinguish such moving objects as red blood cells from such stationary objects as surrounding tissue, to localise skin injury. This imaging technique provides detailed information about the acute perfusion response after a blood vessel is occluded. In this study, a mouse ear model is used and pulsed laser coagulation serves as the method of occlusion. We have found that the downstream blood vessels lacked blood flow due to occlusion at the target site immediately after injury. Relative flow changes in nearby collaterals and anastomotic vessels have been approximated based on differences in intensity in the nearby collaterals and anastomoses. We have also estimated the density of the affected downstream vessels. Laser speckle contrast imaging is shown to be used for highresolution and fast-speed imaging for the skin microvasculature. It also allows direct visualisation of the blood perfusion response to injury, which may provide novel insights to the field of cutaneous wound healing. (laser biophotonics)

  8. Early mucosal responses in blue catfish (Ictalurus furcatus) skin to Aeromonas hydrophila infection.

    Science.gov (United States)

    Li, Chao; Beck, Benjamin; Su, Baofeng; Terhune, Jeffery; Peatman, Eric

    2013-03-01

    Bacterial pathogens are well-equipped to detect, adhere to, and initiate infection in their finfish hosts. The mucosal surfaces of fish, such as the skin, function as the front line of defense against such bacterial insults that are routinely encountered in the aquatic environment. While recent progress has been made, and despite the obvious importance of mucosal surfaces, the precise molecular events that occur soon after encountering bacterial pathogens remain unclear. Indeed, these early events are critical in mounting appropriate responses that ultimately determine host survival or death. In the present study, we investigated the transcriptional consequences of a virulent Aeromonas hydrophila challenge in the skin of blue catfish, Ictalurus furcatus. We utilized an 8×60K Agilent microarray to examine gene expression profiles at key early timepoints following challenge (2 h, 12 h, and 24 h). A total of 1155 unique genes were significantly altered during at least one timepoint. We observed dysregulation in a number of genes involved in diverse pathways including those involved in antioxidant responses, apoptosis, cytoskeletal rearrangement, immunity, and extracellular matrix protein diversity and regulation. Taken together, A. hydrophila coordinately modulates mucosal factors across numerous cellular pathways in a manner predicted to enhance its ability to adhere to and infect the blue catfish host. PMID:23337110

  9. Laser speckle contrast imaging of skin blood perfusion responses induced by laser coagulation

    Energy Technology Data Exchange (ETDEWEB)

    Ogami, M; Kulkarni, R; Wang, H; Reif, R; Wang, R K [University of Washington, Department of Bioengineering, Seattle, Washington 98195 (United States)

    2014-08-31

    We report application of laser speckle contrast imaging (LSCI), i.e., a fast imaging technique utilising backscattered light to distinguish such moving objects as red blood cells from such stationary objects as surrounding tissue, to localise skin injury. This imaging technique provides detailed information about the acute perfusion response after a blood vessel is occluded. In this study, a mouse ear model is used and pulsed laser coagulation serves as the method of occlusion. We have found that the downstream blood vessels lacked blood flow due to occlusion at the target site immediately after injury. Relative flow changes in nearby collaterals and anastomotic vessels have been approximated based on differences in intensity in the nearby collaterals and anastomoses. We have also estimated the density of the affected downstream vessels. Laser speckle contrast imaging is shown to be used for highresolution and fast-speed imaging for the skin microvasculature. It also allows direct visualisation of the blood perfusion response to injury, which may provide novel insights to the field of cutaneous wound healing. (laser biophotonics)

  10. Laser speckle contrast imaging of skin blood perfusion responses induced by laser coagulation

    Science.gov (United States)

    Ogami, M.; Kulkarni, R.; Wang, H.; Reif, R.; Wang, R. K.

    2014-08-01

    We report application of laser speckle contrast imaging (LSCI), i.e., a fast imaging technique utilising backscattered light to distinguish such moving objects as red blood cells from such stationary objects as surrounding tissue, to localise skin injury. This imaging technique provides detailed information about the acute perfusion response after a blood vessel is occluded. In this study, a mouse ear model is used and pulsed laser coagulation serves as the method of occlusion. We have found that the downstream blood vessels lacked blood flow due to occlusion at the target site immediately after injury. Relative flow changes in nearby collaterals and anastomotic vessels have been approximated based on differences in intensity in the nearby collaterals and anastomoses. We have also estimated the density of the affected downstream vessels. Laser speckle contrast imaging is shown to be used for highresolution and fast-speed imaging for the skin microvasculature. It also allows direct visualisation of the blood perfusion response to injury, which may provide novel insights to the field of cutaneous wound healing.

  11. Multi-Source Autonomous Response for Targeting and Monitoring of Volcanic Activity

    Science.gov (United States)

    Davies, Ashley G.; Doubleday, Joshua R.; Tran, Daniel Q.

    2014-01-01

    ' inputs. The software framework uses multiple source languages and is a general framework for combining inputs and incrementally submitting observation requests/reconfigurations, accounting for prior requests. The autonomous aspect of operations is unique, especially in the context of the wide range of inputs that includes manually inputted electronic reports (such as the Air Force Weather Advisories), automated satellite-based detection methods (such as MODVOLC and GOESVOLC), and in situ sensor networks.

  12. Autonomic cardiac regulation and morpho-physiological responses to eight week training preparation in junior soccer players

    Directory of Open Access Journals (Sweden)

    Michal Botek

    2014-09-01

    Full Text Available Background: Training preparation in soccer is thought to improve body composition and performance level, especially the maximal aerobic capacity (VO2max. However, an enhancement in performance may be attenuated by the increase of fatigue. Heart rate variability (HRV as a non-invasive index of autonomic nervous system (ANS activity has been considered to be a sensitive tool in fatigue assessment. Objective: This study was focused to evaluate the response of ANS activity and morpho-physiological parameters to eight week training preparation. Methods: Study included 12 trained soccer players aged 17.2 ± 1.2 years. Athletes underwent pre- and post-preparation testing that included the ANS activity assessment by spectral analysis of HRV in supine and upright position. Further, body composition was analyzed via electrical bio-impedance method and physiological parameters were assessed during maximal stress tests. ANS activity and subjective feeling of fatigue was assessed continuously within subsequent weeks of preparation. Results: No significant differences in all HRV variables within weeks were found. Pre vs. post analyses revealed a significant (p < .05 increase in body weight, fat free mass, body mass index, and peak power. A significant decline in mean maximal heart rate (HR and resting HR at standing was identified at the end of preparation. Since no significant changes between pre- post-preparation in the mean VO2max occurred, the positive correlation between the individual change in VO2max and the vagally related HRV [supine LnHF (r = .78, Ln rMSSD (r = .63, and the standing LnHF (r = .73, p < .05] was found. Conclusions: This study showed that an 8 week training program modified particularly fat free mass and short-term endurance, whereas both the autonomic cardiac regulation and the feeling of fatigue remained almost unaffected. Standing position seems to be more sensitive in terms of the HR response in relation to fatigue

  13. Sensitivity of the resting-state haemodynamic response function estimation to autonomic nervous system fluctuations.

    Science.gov (United States)

    Wu, Guo-Rong; Marinazzo, Daniele

    2016-05-13

    The haemodynamic response function (HRF) is a key component of the blood oxygen level-dependent (BOLD) signal, providing the mapping between neural activity and the signal measured with functional magnetic resonance imaging (fMRI). Most of the time the HRF is associated with task-based fMRI protocols, in which its onset is explicitly included in the design matrix. On the other hand, the HRF also mediates the relationship between spontaneous neural activity and the BOLD signal in resting-state protocols, in which no explicit stimulus is taken into account. It has been shown that resting-state brain dynamics can be characterized by looking at sparse BOLD 'events', which can be retrieved by point process analysis. These events can be then used to retrieve the HRF at rest. Crucially, cardiac activity can also induce changes in the BOLD signal, thus affecting both the number of these events and the estimation of the haemodynamic response. In this study, we compare the resting-state haemodynamic response retrieved by means of a point process analysis, taking the cardiac fluctuations into account. We find that the resting-state HRF estimation is significantly modulated in the brainstem and surrounding cortical areas. From the analysis of two high-quality datasets with different temporal and spatial resolution, and through the investigation of intersubject correlation, we suggest that spontaneous point process response durations are associated with the mean interbeat interval and low-frequency power of heart rate variability in the brainstem. PMID:27044997

  14. Elevated HbA1c Levels Are Associated with the Blunted Autonomic Response Assessed by Heart Rate Variability during Blood Volume Reduction.

    Science.gov (United States)

    Kamakura, Miho; Maruyama, Ryoko

    2016-01-01

    A high glycemic status increases the risk for autonomic dysfunction and cardiovascular failure. The aim of this study was to investigate time-dependent changes in the autonomic response and cardiovascular dynamics and the association between the level of hemoglobin A1c (HbA1c) and autonomic response during blood volume reduction. The study population consisted of 26 preoperative participants who were scheduled for autologous blood donation (200-400 mL of whole blood) for intraoperative or postoperative use. These participants without circulatory, respiratory, or brain disease and diabetes mellitus were grouped according to their HbA1c levels: rate variability (HRV) to quantify cardiac autonomic regulation throughout blood donation. During blood volume reduction, which was about 10% of the circulating blood volume, the BP and heart rate varied within normal ranges in both groups. The high-frequency (HF) component, an index of parasympathetic nerve activity, and the ratio of low-frequency (LF) to HF components (LF/HF), an index of sympathetic nerve activity, significantly decreased and increased with the progression of blood volume reduction, respectively, in the HbA1c < 6.5% group. In contrast, in the HbA1c ≥ 6.5% group, the HF component did not significantly change, and the increase in the LF/HF ratio was delayed. Time-dependent changes in HRV were related to blood volume reduction only in the HbA1c < 6.5% group. Thus, elevated HbA1c levels are associated with the decrease in the autonomic response induced by blood volume reduction. PMID:27615262

  15. Optimising a model-based approach to inferring fear learning from skin conductance responses.

    Science.gov (United States)

    Staib, Matthias; Castegnetti, Giuseppe; Bach, Dominik R

    2015-11-30

    Anticipatory sympathetic arousal is often inferred from skin conductance responses (SCR) and used to quantify fear learning. We have previously provided a model-based approach for this inference, based on a quantitative Psychophysiological Model (PsPM) formulated in non-linear dynamic equations. Here we seek to optimise the inversion of this PsPM. Using two independent fear conditioning datasets, we benchmark predictive validity as the sensitivity to separate the likely presence or absence of the unconditioned stimulus. Predictive validity is optimised across both datasets by (a) using a canonical form of the SCR shape (b) filtering the signal with a bi-directional band-pass filter with cut off frequencies 0.0159 and 5 Hz, (c) simultaneously inverting two trials (d) explicitly modelling skin conductance level changes between trials (e) the choice of the inversion algorithm (f) z-scoring estimates of anticipatory sympathetic arousal from each participant across trials. The original model-based method has higher predictive validity than conventional peak-scoring or an alternative model-based method (Ledalab), and benefits from constraining the model, optimised data preconditioning, and post-processing of ensuing parameters. PMID:26291885

  16. Imaging immune response of skin mast cells in vivo with two-photon microscopy

    Science.gov (United States)

    Li, Chunqiang; Pastila, Riikka K.; Lin, Charles P.

    2012-02-01

    Intravital multiphoton microscopy has provided insightful information of the dynamic process of immune cells in vivo. However, the use of exogenous labeling agents limits its applications. There is no method to perform functional imaging of mast cells, a population of innate tissue-resident immune cells. Mast cells are widely recognized as the effector cells in allergy. Recently their roles as immunoregulatory cells in certain innate and adaptive immune responses are being actively investigated. Here we report in vivo mouse skin mast cells imaging with two-photon microscopy using endogenous tryptophan as the fluorophore. We studied the following processes. 1) Mast cells degranulation, the first step in the mast cell activation process in which the granules are released into peripheral tissue to trigger downstream reactions. 2) Mast cell reconstitution, a procedure commonly used to study mast cells functioning by comparing the data from wild type mice, mast cell-deficient mice, and mast-cell deficient mice reconstituted with bone marrow-derived mast cells (BMMCs). Imaging the BMMCs engraftment in tissue reveals the mast cells development and the efficiency of BMMCs reconstitution. We observed the reconstitution process for 6 weeks in the ear skin of mast cell-deficient Kit wsh/ w-sh mice by two-photon imaging. Our finding is the first instance of imaging mast cells in vivo with endogenous contrast.

  17. Assessing the sensitivity of human skin hyperspectral responses to increasing anemia severity levels

    Science.gov (United States)

    Baranoski, Gladimir V. G.; Dey, Ankita; Chen, Tenn F.

    2015-09-01

    Anemia is a prevalent medical condition that seriously affects millions of people all over the world. In many regions, not only its initial detection but also its monitoring are hindered by limited access to laboratory facilities. This situation has motivated the development of a wide range of optical devices and procedures to assist physicians in these tasks. Although noticeable progress has been achieved in this area, the search for reliable, low-cost, and risk-free solutions still continues, and the strengthening of the knowledge base about this disorder and its effects is essential for the success of these initiatives. We contribute to these efforts by closely examining the sensitivity of human skin hyperspectral responses (within and outside the visible region of the light spectrum) to reduced hemoglobin concentrations associated with increasing anemia severity levels. This investigation, which involves skin specimens with distinct biophysical and morphological characteristics, is supported by controlled in silico experiments performed using a predictive light transport model and measured data reported in the biomedical literature. We also propose a noninvasive procedure to be employed in the monitoring of this condition at the point-of-care.

  18. Modeling the Mechanical Response of In Vivo Human Skin Under a Rich Set of Deformations

    KAUST Repository

    Flynn, Cormac

    2011-03-11

    Determining the mechanical properties of an individual\\'s skin is important in the fields of pathology, biomedical device design, and plastic surgery. To address this need, we present a finite element model that simulates the skin of the anterior forearm and posterior upper arm under a rich set of three-dimensional deformations. We investigated the suitability of the Ogden and Tong and Fung strain energy functions along with a quasi-linear viscoelastic law. Using non-linear optimization techniques, we found material parameters and in vivo pre-stresses for different volunteers. The model simulated the experiments with errors-of-fit ranging from 13.7 to 21.5%. Pre-stresses ranging from 28 to 92 kPa were estimated. We show that using only in-plane experimental data in the parameter optimization results in a poor prediction of the out-of-plane response. The identifiability of the model parameters, which are evaluated using different determinability criteria, improves by increasing the number of deformation orientations in the experiments. © 2011 Biomedical Engineering Society.

  19. Minimal erythema response (MED to solar simulated irradiation in normal Indian skin

    Directory of Open Access Journals (Sweden)

    Mehta Rai Vandana

    2004-09-01

    Full Text Available BACKGROUND: Phototesting is an essential tool in the investigation of photodermatoses. AIMS: The main aim was to study the cutaneous response to UVR in terms of minimal erythema dose (MED to both UVA and UVB in normal Indian subjects with a solar simulator and to study the relationship of skin type to MED. METHODS: One hundred healthy volunteers not on any medication and without any history of photodermatoses were phototested using a solar simulator with whole spectrum irradiation (UVA, UVB and visible light and only visible and UVA radiation. The tested areas were marked with gentian violet and readings were taken after 24 hrs. RESULTS: Of the 100 volunteers, 48% were males and 52% were females, with a mean age of 36.6 ± 11.6 yrs. The most common skin type among Indians was type 5 (46% followed by type 4 (41%. The mean MED for UVB was 61.5 ± 17.25J/cm2. The MED for UVA could not be determined as none of the patients showed any erythema after irradiation for 45 minutes. CONCLUSIONS: As the MED is found to be low in idiopathic acquired photodermatoses, the MED in the normal population could serve as a baseline data in the investigation.

  20. Dorsomedial hypothalamus mediates autonomic, neuroendocrine, and locomotor responses evoked from the medial preoptic area

    OpenAIRE

    Hunt, Joseph L.; Zaretsky, Dmitry V.; Sarkar, Sumit; DiMicco, Joseph A.

    2009-01-01

    Previous studies suggest that sympathetic responses evoked from the preoptic area in anesthetized rats require activation of neurons in the dorsomedial hypothalamus. Disinhibition of neurons in the dorsomedial hypothalamus in conscious rats produces physiological and behavioral changes resembling those evoked by microinjection of muscimol, a GABAA receptor agonist and neuronal inhibitor, into the medial preoptic area. We tested the hypothesis that all of these effects evoked from the medial p...

  1. The Brain Mechanisms Underlying the Perception of Pungent Taste of Capsaicin and the Subsequent Autonomic Responses

    OpenAIRE

    Kawakami, Shinpei; Sato, Hajime; Akihiro T Sasaki; Tanabe, Hiroki C.; Yoshida, Yumiko; Saito, Mitsuru; Toyoda, Hiroki; Sadato, Norihiro; Kang, Youngnam

    2016-01-01

    In a human fMRI study, it has been demonstrated that tasting and ingesting capsaicin activate the ventral part of the middle and posterior short gyri (M/PSG) of the insula which is known as the primary gustatory area, suggesting that capsaicin is recognized as a taste. Tasting and digesting spicy foods containing capsaicin induce various physiological responses such as perspiration from face, salivation, and facilitation of cardiovascular activity, which are thought to be caused through visce...

  2. Character of skin on photo-thermal response and its regeneration process using second-harmonic generation microscopy.

    Science.gov (United States)

    Wu, Shu-lian; Li, Hui; Zhang, Xiao-man; Chen, Wei R; Wang, Yun-Xia

    2014-01-01

    Quantitative characterization of skin collagen on photo-thermal response and its regeneration process is an important but difficult task. In this study, morphology and spectrum characteristics of collagen during photo-thermal response and its light-induced remodeling process were obtained by second-harmonic generation microscope in vivo. The texture feature of collagen orientation index and fractal dimension was extracted by image processing. The aim of this study is to detect the information hidden in skin texture during the process of photo-thermal response and its regeneration. The quantitative relations between injured collagen and texture feature were established for further analysis of the injured characteristics. Our results show that it is feasible to determine the main impacts of phototherapy on the skin. It is important to understand the process of collagen remodeling after photo-thermal injuries from texture feature. PMID:23508280

  3. Ensuring 3es and Responsiveness in the Delivery of Educational Services in the Autonomous Region in Muslim Mindanao, Philippines

    Directory of Open Access Journals (Sweden)

    Sapia Moalam Abdulrachman

    2013-08-01

    Full Text Available The Autonomous Region in Muslim Mindanao (ARMM is a public organization in the Philippines located in between the national government and the local governments. It performs unique functions quite distinct from other public organizations in the coun-try, as it performs both political and administrative functions. Using unobtrusive research design, as it relies on mostly secondary data, this paper analyzes the educational system in the region and proposes strategies in attaining administrative efficiency, economy, effectiveness and responsiveness. The paper starts with the introduction which consist of the background and statement of the problem. It is followed by a review of theoretical perspective and then by the research methodology. The fourth part portrays the findings of the study which include: DepEd ARMM resources; the management of DepEd ARMM, and the management outputs such as: net enrollment ratio, achievement rate and literacy rate. The fifth part of the paper deals with the analyses and conclusion. The paper concludes that in addition to certain structural innovation, inculcation of appropriate work ethics in accordance with the Ethi-cal Standards Act, the Anti-Corruption Law, the Civil Service Rules and Regulations as well as the Islamic Practices on Employment must be enshrined in the reform agenda. Finally, among other things that could facilitate the attainment of 3Es and R in the delivery of educational services is a strategy that requires the joint collaboration and teamwork between the civil society, non-government organizations and government organizations in the region.

  4. Evaluating Autonomic Parameters: The Role of ‎Sleep ‎Duration in Emotional Responses to Music ‎

    Directory of Open Access Journals (Sweden)

    Atefeh Goshvarpour

    2016-02-01

    Full Text Available Objective: It has been recognized that sleep has an important effect on emotion processing. The aim ‎of this study was to investigate the effect of previous night sleep duration on autonomicresponses to musical stimuli in different emotional contexts.‎Method: A frequency based measure of GSR, PR and ECG signals were examined in 35 healthy ‎students in three groups of oversleeping, lack of sleep and normal sleep. ‎Results: The results of this study revealed that regardless of the emotional context of the musical ‎stimuli (happy, relax, fear, and sadness, there was an increase in the maximum power of ‎GSR, ECG and PR during the music time compared to the rest time in all the three ‎groups. In addition, the higher value of these measures was achieved while the ‎participants listened to relaxing music. Statistical analysis of the extracted features ‎between each pair of emotional states revealed that the most significant differences ‎were attained for ECG signals. These differences were more obvious in the participants ‎with normal sleeping (p<10-18. The higher value of the indices has been shown, ‎comparing long sleep duration with the normal one.‎Conclusion: There was a strong relation between emotion and sleep duration, and this association can ‎be observed by means of the ECG signals.‎ 

  5. Value of sympathetic skin response test in the early diagnosis of diabetic neuropathy

    Institute of Scientific and Technical Information of China (English)

    黄一宁; 贾志荣; 石昕; 孙相如

    2004-01-01

    Background Diabetic neuropathy is common in diabetes mellitus. The early stage of diabetic neuropathy is often symptomless and difficult to be treated. The aim of this study was to assess the correlation between the results of the sympathetic skin response (SSR) test and the development of diabetic neuropathy, and explore the use of SSR as an objective basis for the early diagnosis of diabetic neuropathy.Methods The latencies and amplitudes of initiation and of the N and P waves were determined by SSR testing of the extremities of 80 diabetic patients and 30 healthy controls. Results The latencies of initiation and of the N and P waves were significantly (P0.05). All but two patients (97.5%) demonstrated abnormal SSR in at least one limb. Conclusions SSR can detect early dysfunction of the small sympathetic fibers in people affected by diabetes mellitus, and may be a useful electrophysiological test for the early diagnosis of diabetic neuropathy.

  6. Sympathetic skin responses in hemiplegic patients with and without complex regional pain syndrome

    Directory of Open Access Journals (Sweden)

    Selçuk Barin

    2006-01-01

    Full Text Available Background and Aims: To investigate whether there were changes in the sympathetic skin responses (SSR in the limbs with complex regional pain syndrome (CRPS type I in hemiplegic patients. Setting: A physical medicine and rehabilitation center in Turkey . Materials and Methods: Sympathetic skin responses were evaluated in 69 stroke patients (41 with CRPS and 28 without CRPS and 20 healthy volunteers. SSR were recorded on the paretic and healthy hands after stimulation of the ipsilateral median nerve. Patients′ ages ranged from 33 to 77 years, with a mean of 60.0 ± 12.9 years. Results: The SSR were obtained in all patients with CRPS, whereas SSR was absent in 9 of 28 patients with hemiplegia who did not have CRPS after stimulation of the plegic side and the difference was statistically significant ( P =0.023. SSR amplitudes were increased at the hemiplegic limbs in patients affected by CRPS compared to individuals unaffected; this group difference was statistically significant ( P =0.014. The mean amplitude of the SSR in the advanced stage of CRPS was greater than lower stage and the difference was statistically significant ( P =0.035. Conclusion: Our results suggest that SSR can be obtained in stroke patients with CRPS even in the early stages of CRPS. SSR acquirability and amplitude increase as the stage of the disease advances. As an electrophysiologic technique, SSR may be used in the evaluation of the sympathetic function in hemiplegic patients and also in the diagnosis of CRPS and in monitoring of its treatment.

  7. Skin Metabolite, Farnesyl Pyrophosphate, Regulates Epidermal Response to Inflammation, Oxidative Stress, and Migration.

    Science.gov (United States)

    Pastar, Irena; Stojadinovic, Olivera; Sawaya, Andrew P; Stone, Rivka C; Lindley, Linsey E; Ojeh, Nkemcho; Vukelic, Sasa; Samuels, Herbert H; Tomic-Canic, Marjana

    2016-11-01

    Skin produces cholesterol and a wide array of sterols and non-sterol mevalonate metabolites, including isoprenoid derivative farnesyl pyrophosphate (FPP). To characterize FPP action in epidermis, we generated transcriptional profiles of primary human keratinocytes treated with zaragozic acid (ZGA), a squalene synthase inhibitor that blocks conversion of FPP to squalene resulting in endogenous accumulation of FPP. The elevated levels of intracellular FPP resulted in regulation of epidermal differentiation and adherens junction signaling, insulin growth factor (IGF) signaling, oxidative stress response and interferon (IFN) signaling. Immunosuppressive properties of FPP were evidenced by STAT-1 downregulation and prominent suppression of its nuclear translocation by IFNγ. Furthermore, FPP profoundly downregulated genes involved in epidermal differentiation of keratinocytes in vitro and in human skin ex vivo. Elevated levels of FPP resulted in induction of cytoprotective transcriptional factor Nrf2 and its target genes. We have previously shown that FPP functions as ligand for the glucocorticoid receptor (GR), one of the major regulator of epidermal homeostasis. Comparative microarray analyses show significant but not complete overlap between FPP and glucocorticoid regulated genes, suggesting that FPP may have wider transcriptional impact. This was further supported by co-transfection and chromatin immunoprecipitation experiments where we show that upon binding to GR, FPP recruits β-catenin and, unlike glucocorticoids, recruits co-repressor GRIP1 to suppress keratin 6 gene. These findings have many clinical implications related to epidermal lipid metabolism, response to glucocorticoid therapy as well as pleiotropic effects of cholesterol lowering therapeutics, statins. J. Cell. Physiol. 231: 2452-2463, 2016. © 2016 Wiley Periodicals, Inc. PMID:26916741

  8. Thin-skinned salt tectonics as a response to crustal movements in a recent convergent setting

    Science.gov (United States)

    Vendeville, Bruno; Gaullier, Virginie; Deverchere, Jacques; Sage, Françoise

    2014-05-01

    Published data from the seismic survey "MARADJA 1" conducted in August and September 2003 offshore the Algerian coast have imaged the Messinian salt response to tectonic activity within the basement. This helps to understand how the vertical movements of basement blocks have been recorded by thin-skinned salt tectonics. The area is undergoing crustal convergence, as attested by the Boumerdes earthquake (magnitude 6.8), which happened in 2003. The seismic data have revealed the presence of an elevated plateau, forming a 3D promontory restricted to the area offshore Algiers and is absent west and east of that area. The promontory is likely related to the contractional reactivation of the margin, as was recorded by subsalt thrusts mapped by Domzig et al. (2006). The data provided additional information on the deformation of the Messinian mobile evaporite unit and its Plio-Quaternary overburden. Margin-perpendicular profiles show mostly compressional features (anticlines and synclines) that had little or no activity during Messinian times. By contrast, margin-parallel profiles clearly show that extensional, reactive salt diapiric ridges formed early, as early as the time of deposition of the Messinian Upper Unit, as recorded by fan-shaped strata. These ridges have recorded E-W, thin-skinned gravity gliding above the Messinian salt, as a response to the rise of the basement plateau. We tested this hypothesis using analogue models. Indeed, the rise of the plateau generated preferential E-W extension above the salt, rather than N-S, which was prevented by the compressional regional tectonic stresses related to the convergence of the African and European plates.

  9. Illusory ownership of an invisible body reduces autonomic and subjective social anxiety responses.

    Science.gov (United States)

    Guterstam, Arvid; Abdulkarim, Zakaryah; Ehrsson, H Henrik

    2015-01-01

    What is it like to be invisible? This question has long fascinated man and has been the central theme of many classic literary works. Recent advances in materials science suggest that invisibility cloaking of the human body may be possible in the not-so-distant future. However, it remains unknown how invisibility affects body perception and embodied cognition. To address these questions, we developed a perceptual illusion of having an entire invisible body. Through a series of experiments, we characterized the multisensory rules that govern the elicitation of the illusion and show that the experience of having an invisible body reduces the social anxiety response to standing in front of an audience. This study provides an experimental model of what it is like to be invisible and shows that this experience affects bodily self-perception and social cognition. PMID:25906330

  10. Comparison of blood volume pulse and skin conductance responses to mental and affective stimuli at different anatomical sites

    International Nuclear Information System (INIS)

    Measurements of blood volume pulse (BVP) and skin conductance are commonly used as indications of psychological arousal in affective computing and human–machine interfaces. To date, palmar surfaces remain the primary site for these measurements. Placement of sensors on palmar surfaces, however, is undesirable when recordings are fraught with motion and pressure artifacts. These artifacts are frequent when the human participant has involuntary movements as in hyperkinetic cerebral palsy. This motivates the use of alternative measurement sites. The present study examined the correlation between measurements of blood volume pulse and skin conductance obtained from three different sites on the body (fingers, toes and ear for BVP; fingers, toes and arch of the foot for skin conductance) in response to cognitive and affective stimuli. The results of this pilot study indicated significant inter-site correlation among signal features derived from different sites, with the exception of BVP amplitude, the number of electrodermal reactions and the slope of the electrodermal activity response. We attribute these differences in part to inter-site discrepancies in local skin conditions, such as skin temperature. Despite these differences, significant changes from baseline were present in the responses to the cognitive and affective stimuli at non-palmar sites, suggesting that these sites may provide viable signal measurements for use in affective computing and human–machine interface applications

  11. Measurement of the force–displacement response of in vivo human skin under a rich set of deformations

    KAUST Repository

    Flynn, Cormac

    2011-06-01

    The non-linear, anisotropic, and viscoelastic properties of human skin vary according to location on the body, age, and individual. The measurement of skin\\'s mechanical properties is important in several fields including medicine, cosmetics, and forensics. In this study, a novel force-sensitive micro-robot applied a rich set of three-dimensional deformations to the skin surface of different areas of the arms of 20 volunteers. The force-displacement response of each area in different directions was measured. All tested areas exhibited a non-linear, viscoelastic, and anisotropic force-displacement response. There was a wide quantitative variation in the stiffness of the response. For the right anterior forearm, the ratio of the maximum probe reaction force to maximum probe displacement ranged from 0.44Nmm-1 to 1.45Nmm-1. All volunteers exhibited similar qualitative anisotropic characteristics. For the anterior right forearm, the stiffest force-displacement response was when the probe displaced along the longitudinal axis of the forearm. The response of the anterior left forearm was stiffest in a direction 20° to the longitudinal axis of the forearm. The posterior upper arm was stiffest in a direction 90° to the longitudinal axis of the arm. The averaged posterior upper arm response was less stiff than the averaged anterior forearm response. The maximum probe force at 1.3mm probe displacement was 0.69N for the posterior upper arm and 1.1N for the right anterior forearm. The average energy loss during the loading-unloading cycle ranged from 11.9% to 34.2%. This data will be very useful for studying the non-linear, anisotropic, and viscoelastic behaviour of skin and also for generating material parameters for appropriate constitutive models. © 2011 IPEM.

  12. Stress effects on mood, HPA axis, and autonomic response: comparison of three psychosocial stress paradigms.

    Directory of Open Access Journals (Sweden)

    Grace E Giles

    Full Text Available Extensive experimental psychology research has attempted to parse the complex relationship between psychosocial stress, mood, cognitive performance, and physiological changes. To do so, it is necessary to have effective, validated methods to experimentally induce psychosocial stress. The Trier Social Stress Test (TSST is the most commonly used method of experimentally inducing psychosocial stress, but it is resource intensive. Less resource intense psychosocial stress tasks include the Socially Evaluative Cold Pressor Task (SECPT and a computerized mental arithmetic task (MAT. These tasks effectively produce a physiological and psychological stress response and have the benefits of requiring fewer experimenters and affording data collection from multiple participants simultaneously. The objective of this study was to compare the magnitude and duration of these three experimental psychosocial stress induction paradigms. On each of four separate days, participants completed either a control non-stressful task or one of the three experimental stressors: the TSST, SECPT, or MAT. We measured mood, working memory performance, salivary cortisol and alpha-amylase (AA, and heart rate. The TSST and SECPT exerted the most robust effects on mood and physiological measures. TSST effects were generally evident immediately post-stress as well as 10- and 20-minutes after stress cessation, whereas SECPT effects were generally limited to the duration of the stressor. The stress duration is a key determinant when planning a study that utilizes an experimental stressor, as researchers may be interested in collecting dependent measures prior to stress cessation. In this way, the TSST would allow the investigator a longer window to administer tasks of interest.

  13. Development of a porcine skin injury model and characterization of the dose-dependent response to high-dose radiation

    International Nuclear Information System (INIS)

    A porcine skin model was developed to characterize the dose-dependent response to high-dose radiation. The dorsal skin of a mini pig was divided into four paraspinal sections, with 11 small irradiation fields (2 cm × 2 cm) in each section, and a single fraction of 15, 30, 50 or 75 Gy was delivered to each section using a 6 MeV electron beam. A spectrophotometer measured gross skin changes, and a biopsy for each radiation dose was performed in the 1st, 2nd, 4th, 6th and 9th weeks for histology, immunostaining with anti-CD31, and western blotting with IL-6 and TGF-β1 to determine the degree of skin damage. After a 4-week latency period, erythema and dry desquamation, moist desquamation, and ulceration appeared at 4, 6 and 9 weeks, respectively. Gross skin toxicity was more pronounced, occurred early and continued to progress with irradiation >50 Gy, whereas complete healing was observed 12 weeks after 15 Gy. Spectrophotometry showed erythema indices rapidly increased during the first 4 weeks after irradiation. The number of eosinophils began rising sharply at 4 weeks and normalized after reaching peaks at 7-8 weeks. Microvessel density showed a biphasic pattern with a transient peak at 1 week, a nadir at 4-6 weeks, and maximum recovery at 9 weeks. Increase in the levels of IL-6 and TGF-β1 was detected soon after irradiation. Most of these parameters indicated complete healing of the skin 12 weeks after 15 Gy. Our porcine skin model provides an effective platform for studying high-dose radiation-induced skin injury, in particular histologic and molecular changes, during the early latency period. (author)

  14. Divergent metabolic responses of Apostichopus japonicus suffered from skin ulceration syndrome and pathogen challenge.

    Science.gov (United States)

    Shao, Yina; Li, Chenghua; Ou, Changrong; Zhang, Peng; Lu, Yali; Su, Xiurong; Li, Ye; Li, Taiwu

    2013-11-13

    Skin ulceration syndrome (SUS) is the main limitation in the development of Apostichopus japonicus culture industries, in which Vibrio splendidus has been well documented as one of the major pathogens. However, the intrinsic mechanisms toward pathogen challenge and disease outbreak remain largely unknown at the metabolic level. In this work, the metabolic responses were investigated in muscles of sea cucumber among natural SUS-diseased and V. splendidus-challenged samples. The pathogen did not induce obvious biological effects in A. japonicus samples after infection for the first 24 h. An enhanced energy storage (or reduced energy demand) and immune responses were observed in V. splendidus-challenged A. japonicus samples at 48 h, as marked by increased glucose and branched chain amino acids, respectively. Afterward, infection of V. splendidus induced significant increases in energy demand in A. japonicus samples at both 72 and 96 h, confirmed by decreased glucose and glycogen, and increased ATP. Surprisingly, high levels of glycogen and glucose and low levels of threonine, alanine, arginine, glutamate, glutamine, taurine and ATP were founded in natural SUS-diseased sea cucumber. Our present results provided essential metabolic information about host-pathogen interaction for sea cucumber, and informed that the metabolic biomarkers induced by V. splendidus were not usable for the prediction of SUS disease in practice. PMID:24127639

  15. Chemosensory signals of competition increase the skin conductance response in humans.

    Science.gov (United States)

    Adolph, Dirk; Schlösser, Sabine; Hawighorst, Maren; Pause, Bettina M

    2010-12-01

    In vertebrates, chemosensory signals of competition are communicated between conspecifics, eliciting behavioral and physiological adaptations in the perceiving animal. The current study investigates, whether chemosensory signals of competition are also communicated between humans, and whether they elicit physiological changes in the perceiver. It is further investigated whether personality traits alter this physiological responding. Axillary sweat was collected from six male donors during a competition (badminton match) and a sport control condition (running). The donors' testosterone rose stronger during the competition as compared to the sport control condition. The chemosensory stimuli were presented to 18 (9 male) participants through a constant-flow olfactometer, while the skin conductance response (SCR) was measured. Results reveal that the SCR was larger in response to chemosensory signals collected during the competition condition as compared to those collected during the sport control condition. Furthermore, regression analyses showed, that higher scores on trait social anxiety were related to larger SCRs towards the chemosensory signals of competition. The current result suggests that chemosensory signals of competition can be communicated between humans, and that they elicit orienting in the perceiving individual. These data are consistent with current research, suggesting that high socially anxious individuals process threatening social information preferentially. The current results add to the growing body of research into human chemosensory communication of social information, and extend previous research on the chemosensory communication of anxiety. PMID:20708023

  16. Behavioral and neural responses of toads to salt solutions correlate with basolateral membrane potential of epidermal cells of the skin

    DEFF Research Database (Denmark)

    Hillyard, Stanley D; Baula, Victor; Tuttle, Wendy;

    2007-01-01

    (t) remained low, V(b) transiently hyperpolarized to values near the equilibrium potential for K(+) and corresponded with the reduced neural response. These results support the hypothesis that chemosensory function of the skin is analogous to that of mammalian taste cells but utilizes paracellular ion...

  17. Sex hormone effects on autonomic mechanisms of thermoregulation in humans.

    Science.gov (United States)

    Charkoudian, Nisha; Stachenfeld, Nina

    2016-04-01

    Autonomic mechanisms are fundamental to human physiological thermoregulation, and female reproductive hormones have substantial influences on several aspects of these mechanisms. Of these, the best recognized are the thermoregulatory responses that occur at menopause (hot flushes) and the changes in body temperature within the menstrual cycle which may help couples predict ovulation. Our goal in this brief review is to summarize current knowledge regarding the influences of reproductive hormones on autonomic mechanisms in human thermoregulation. In general, estrogens tend to promote lower body temperatures via augmentation of heat dissipation responses, whereas progesterone tends to promote higher body temperatures. Recent evidence suggests specific influences of estrogens on central autonomic nuclei involved in control of skin blood flow and sweating. Estrogens also augment vasodilation by direct effects on peripheral blood vessels. Influences of progesterone are less well understood, but include both centrally regulated changes in thermoregulatory set-point as well as and peripheral effects, including augmented vasoconstriction in the skin. We conclude with a brief discussion of thermoregulatory adjustments associated with changing hormone levels during menopause, pregnancy and polycystic ovary syndrome. PMID:26674572

  18. Reduced cardiac autonomic response to deep breathing: A heritable vulnerability trait in patients with schizophrenia and their healthy first-degree relatives.

    Science.gov (United States)

    Liu, Yu-Wen; Tzeng, Nian-Sheng; Yeh, Chin-Bin; Kuo, Terry B J; Huang, San-Yuan; Chang, Chuan-Chia; Chang, Hsin-An

    2016-09-30

    Reduced resting heart rate variability (HRV) has been observed in patients with schizophrenia and their relatives, suggesting genetic predispositions. However, findings have not been consistent. We assessed cardiac autonomic response to deep breathing in first-degree relatives of patients with schizophrenia (n=45; 26 female; aged 39.69±14.82 years). Data were compared to healthy controls (n=45; 26 female; aged 38.27±9.79 years) matched for age, gender, body mass index and physical activity as well as to unmedicated patients with acute schizophrenia (n=45; 25 female; aged 37.31±12.65 years). Electrocardiograms were recorded under supine resting and deep-breathing conditions (10-12breaths/min). We measured HRV components including variance, low-frequency (LF) power, which may reflect baroreflex function, high-frequency (HF) power, which reflects cardiac parasympathetic activity, and LF/HF ratio, which may reflect sympatho-vagal balance. Patients rather than relatives exhibited lower resting-state HRV (variance, LF, and HF) than controls. As expected, deep breathing induced an increase in variance and HF-HRV in controls. However, such a response was significantly reduced in both patients and their relatives. In conclusion, the diminished cardiac autonomic reactivity to deep breathing seen in patients and their unaffected relatives indicates that this pattern of cardiac autonomic dysregulation may be regarded as a genetic trait marker for schizophrenia. PMID:27442977

  19. The effect of local corticosteroid injection on F-wave conduction velocity and sympathetic skin response in carpal tunnel syndrome

    OpenAIRE

    Deniz, Orhan; Aygül, Recep; Kotan, Dilcan; Özdemir, Gökhan; Odabaş, Faruk Ömer; Kaya, M. Dursun; Ulvi, Hızır

    2011-01-01

    The aim of this study was to evaluate the efficacy of steroid injection for the treatment of the carpal tunnel syndrome (CTS), with F-wave parameters and sympathetic skin response (SSR). Seventeen hands of 10 women patients were treated with local steroid injection with 2-month follow-up. All patients underwent single injection into the carpal tunnel. Response to injection was measured nerve conduction studies (NCSs), median nerve F waves, and SSR before and after treatment. To determine the ...

  20. Exercise and autonomic function.

    Science.gov (United States)

    Goldsmith, R L; Bloomfield, D M; Rosenwinkel, E T

    2000-03-01

    The complex interplay between the dichotomous subdivisions of the autonomic nervous system establishes and maintains a delicately tuned homeostasis in spite of an ever-changing environment. Aerobic exercise training can increase activity of the parasympathetic nervous system and decrease sympathetic activity. Conversely, it is well-documented that cardiac disease is often characterized by attenuated parasympathetic activity and heightened sympathetic tone. A correlation between autonomic disequilibrium and disease has led to the hypothesis that exercise training, as a therapy that restores the autonomic nervous system towards normal function, may be associated with, and possibly responsible for, outcome improvements in various populations. This is merely one of the many benefits that is conferred by chronic exercise training and reviewed in this issue. PMID:10758814

  1. Temporal aspects of tumorigenic response to individual and mixed carcinogens. Comprehensive progress report, June 1, 1975--May 31, 1978. [Mouse skin, rats, hamsters

    Energy Technology Data Exchange (ETDEWEB)

    Albert, R.E.; Burns, F.J.; Altshuler, B.

    1978-02-01

    The research proposed here is designed to obtain a better understanding of the temporal kinetics of tumor induction when one or more carcinogens are present simultaneously or sequentially for prolonged periods of time. Studies done to date under this contract have shown that carcinogenesis in mouse skin by polycyclic aromatic hydrocarbon carcinogens is consistent with the induction of dependent and autonomous cell transformations by the carcinogen followed by the conversion of autonomous tumor cells into malignancies at a rate which is determined by the level of carcinogen exposure. Dependent cell transformations remain latent in the skin unless expressed by a promoting agent. Dependent neoplasia appears to follow one-hit kinetics while malignancy is a multihit endpoint. Dose-related and time-related aspects of tumor induction are separable in the initiation-promotion system of mouse skin which along with rat skin and hamster lung is being used as a model for testing hypotheses. Results to date provide the basis for a new interpretation of the linear non-threshold extrapolation model. The broad aim of the study is to provide a basis or rationale for estimating risks associated with prolonged exposures to carcinogens found in the environment and to predict how different tissues and species respond to the same carcinogens.

  2. DOSE-RESPONSE STUDIES OF SODIUM ARSENITE IN THE SKIN OF K6/ODC TRANSGENIC MOUSE

    Science.gov (United States)

    It has previously been observed that chronic exposure to inorganic arsenic and/or its metabolites increase(s) tumor frequency in the skin of K6/ODC transgenic mice. To identify potential biomarkers and modes of action for this skin tumorigenicity, gene expression profiles w...

  3. THE EFFECT OF PHASE OF MENSTRUAL CYCLE ON SYMPATHETIC SKIN RESPONSE AMONG HEALTHY YOUNG INDIAN WOMEN

    Directory of Open Access Journals (Sweden)

    David Pansy

    2014-04-01

    Full Text Available This descriptive study was undertaken to investigate the influence of menstrual cycle on sympathetic skin response (SSR during different phases of menstrual cycle in young healthy Indian women. A comparison of SSR latencies and amplitudes were done in the follicular, ovulatory and mid luteal phases of menstrual cycle. Fifty women in age group of 18 – 25 years having regular menstrual cycles were chosen for this study. After confirming the regularity of menstrual cycle, SSR was performed on them. The recording was done under standardized conditions using standardized procedure. Amplitude of SSR was found to vary in the three phases, but the differences were statistically not significant. Latency of SSR was found to be greatest in the follicular phase (1.54 ± 0.22 s and least in the mid-luteal phase (1.35 ± 0.18 s. Statistically significant differences were found between mean SSR latency in the follicular phase and the other two phases (p < 0.01. This study concludes that SSR is enhanced during the mid-luteal phase in women with regular menstrual cycles indicating sympathetic dominance.

  4. Estrogens and aging skin

    OpenAIRE

    Thornton, M. Julie

    2013-01-01

    Estrogen deficiency following menopause results in atrophic skin changes and acceleration of skin aging. Estrogens significantly modulate skin physiology, targeting keratinocytes, fibroblasts, melanocytes, hair follicles and sebaceous glands, and improve angiogenesis, wound healing and immune responses. Estrogen insufficiency decreases defense against oxidative stress; skin becomes thinner with less collagen, decreased elasticity, increased wrinkling, increased dryness and reduced vascularity...

  5. The effect of occlusive and unocclusive exposure to xylene and benzene on skin irritation and molecular responses in hairless rats

    Energy Technology Data Exchange (ETDEWEB)

    Chatterjee, A.; Babu, R.J.; Ahaghotu, E.; Singh, M. [Florida A and M University, College of Pharmacy and Pharmaceutical Sciences, Tallahassee, FL (United States)

    2005-05-01

    Aromatic hydrocarbons readily penetrate the skin on dermal exposure, leading to irritation, inflammation and cytotoxicity. The effects of short-term occlusive and long-term unocclusive dermal exposure to benzene and xylene on the skin irritation response (transepidermal water loss (TEWL), skin moisture content and erythema) and cytokine/chemokine expression (interleukin-1{alpha} (IL-1{alpha}), tumor necrosis factor-{alpha} (TNF-{alpha}) and monocyte chemoattractant protein-1 (MCP-1)) were investigated in hairless rats. Occlusive dermal exposure was carried out with 230 {mu}L of the chemicals for 1 h using Hill top chambers. In unocclusive dermal exposure, 15 {mu}L of the chemicals were applied to the skin every 2 h, for 8 h a day, for 4 days. The occlusive dermal exposure revealed a clear difference in the TEWL and erythema response of these chemicals (xylene>benzene) whereas unocclusive exposure revealed similar TEWL and erythema scores for both benzene and xylene. The expression of IL-1{alpha} was elevated 2.5- and 3.8-fold in response to occlusive and unocclusive exposure, respectively, vs control (P<0.01) for both the chemicals (benzene and xylene). Similarly, TNF-{alpha} levels were elevated about 2.4- and 6.0-fold as a result of occlusive and unocclusive exposure, respectively, vs control (P<0.01). These results show that unocclusive exposure induced significantly higher TNF-{alpha} expression than occlusive exposure (P<0.05). The MCP-1 expression in blood was slightly elevated compared with the control group, but this increase was not statistically significant (P>0.05). Similarly, MCP levels in skin were increased approximately 1.7- and 1.8-fold by occlusive and unocclusive exposure, respectively, compared with the control group (P<0.05). Our study demonstrates that the skin irritation profiles of benzene and xylene are similar and unocclusive long-term exposure to small amounts of these chemicals can induce more skin irritation and cytokine response than

  6. Response-surface models for deterministic effects of localized irradiation of the skin by discrete β/γ -emitting sources

    International Nuclear Information System (INIS)

    Individuals who work at nuclear reactor facilities can be at risk for deterministic effects in the skin from exposure to discrete Β- and γ-emitting (ΒγE) sources (e.g., ΒγE hot particles) on the skin or clothing. Deterministic effects are non-cancer effects that have a threshold and increase in severity as dose increases (e.g., ulcer in skin). Hot ΒγE particles are 60Co- or nuclear fuel-derived particles with diameters > 10 μm and < 3 mm and contain at least 3.7 kBq (0.1 μCi) of radioactivity. For such ΒγE sources on the skin, it is the beta component of the dose that is most important. To develop exposure limitation systems that adequately control exposure of workers to discrete ΒγE sources, models are needed for systems that adequately control exposure of workers to discrete ΒγE sources, models are needed for evaluating the risk of deterministic effects of localized Β irradiation of the skin. The purpose of this study was to develop dose-rate and irradiated-area dependent, response-surface models for evaluating risks of significant deterministic effects of localized irradiation of the skin by discrete ΒγE sources and to use modeling results to recommend approaches to limiting occupational exposure to such sources. The significance of the research results as follows: (1) response-surface models are now available for evaluating the risk of specific deterministic effects of localized irradiation of the skin; (2) modeling results have been used to recommend approaches to limiting occupational exposure of workers to Β radiation from ΒγE sources on the skin or on clothing; and (3) the generic irradiated-volume, weighting-factor approach to limiting exposure can be applied to other organs including the eye, the ear, and organs of the respiratory or gastrointestinal tract and can be used for both deterministic and stochastic effects

  7. Response-surface models for deterministic effects of localized irradiation of the skin by discrete {beta}/{gamma} -emitting sources

    Energy Technology Data Exchange (ETDEWEB)

    Scott, B.R.

    1995-12-01

    Individuals who work at nuclear reactor facilities can be at risk for deterministic effects in the skin from exposure to discrete {Beta}- and {gamma}-emitting ({Beta}{gamma}E) sources (e.g., {Beta}{gamma}E hot particles) on the skin or clothing. Deterministic effects are non-cancer effects that have a threshold and increase in severity as dose increases (e.g., ulcer in skin). Hot {Beta}{gamma}E particles are {sup 60}Co- or nuclear fuel-derived particles with diameters > 10 {mu}m and < 3 mm and contain at least 3.7 kBq (0.1 {mu}Ci) of radioactivity. For such {Beta}{gamma}E sources on the skin, it is the beta component of the dose that is most important. To develop exposure limitation systems that adequately control exposure of workers to discrete {Beta}{gamma}E sources, models are needed for systems that adequately control exposure of workers to discrete {Beta}{gamma}E sources, models are needed for evaluating the risk of deterministic effects of localized {Beta} irradiation of the skin. The purpose of this study was to develop dose-rate and irradiated-area dependent, response-surface models for evaluating risks of significant deterministic effects of localized irradiation of the skin by discrete {Beta}{gamma}E sources and to use modeling results to recommend approaches to limiting occupational exposure to such sources. The significance of the research results as follows: (1) response-surface models are now available for evaluating the risk of specific deterministic effects of localized irradiation of the skin; (2) modeling results have been used to recommend approaches to limiting occupational exposure of workers to {Beta} radiation from {Beta}{gamma}E sources on the skin or on clothing; and (3) the generic irradiated-volume, weighting-factor approach to limiting exposure can be applied to other organs including the eye, the ear, and organs of the respiratory or gastrointestinal tract and can be used for both deterministic and stochastic effects.

  8. Skin graft

    Science.gov (United States)

    Skin transplant; Skin autografting; FTSG; STSG; Split thickness skin graft; Full thickness skin graft ... site. Most people who are having a skin graft have a split-thickness skin graft. This takes ...

  9. Different oxidative stress response in keratinocytes and fibroblasts of reconstructed skin exposed to non extreme daily-ultraviolet radiation.

    Directory of Open Access Journals (Sweden)

    Claire Marionnet

    Full Text Available Experiments characterizing the biological effects of sun exposure have usually involved solar simulators. However, they addressed the worst case scenario i.e. zenithal sun, rarely found in common outdoor activities. A non-extreme ultraviolet radiation (UV spectrum referred as "daily UV radiation" (DUVR with a higher UVA (320-400 nm to UVB (280-320 nm irradiance ratio has therefore been defined. In this study, the biological impact of an acute exposure to low physiological doses of DUVR (corresponding to 10 and 20% of the dose received per day in Paris mid-April on a 3 dimensional reconstructed skin model, was analysed. In such conditions, epidermal and dermal morphological alterations could only be detected after the highest dose of DUVR. We then focused on oxidative stress response induced by DUVR, by analyzing the modulation of mRNA level of 24 markers in parallel in fibroblasts and keratinocytes. DUVR significantly modulated mRNA levels of these markers in both cell types. A cell type differential response was noticed: it was faster in fibroblasts, with a majority of inductions and high levels of modulation in contrast to keratinocyte response. Our results thus revealed a higher sensitivity in response to oxidative stress of dermal fibroblasts although located deeper in the skin, giving new insights into the skin biological events occurring in everyday UV exposure.

  10. Autonomic Nervous System Responses During Perception of Masked Speech may Reflect Constructs other than Subjective Listening Effort.

    Science.gov (United States)

    Francis, Alexander L; MacPherson, Megan K; Chandrasekaran, Bharath; Alvar, Ann M

    2016-01-01

    Typically, understanding speech seems effortless and automatic. However, a variety of factors may, independently or interactively, make listening more effortful. Physiological measures may help to distinguish between the application of different cognitive mechanisms whose operation is perceived as effortful. In the present study, physiological and behavioral measures associated with task demand were collected along with behavioral measures of performance while participants listened to and repeated sentences. The goal was to measure psychophysiological reactivity associated with three degraded listening conditions, each of which differed in terms of the source of the difficulty (distortion, energetic masking, and informational masking), and therefore were expected to engage different cognitive mechanisms. These conditions were chosen to be matched for overall performance (keywords correct), and were compared to listening to unmasked speech produced by a natural voice. The three degraded conditions were: (1) Unmasked speech produced by a computer speech synthesizer, (2) Speech produced by a natural voice and masked byspeech-shaped noise and (3) Speech produced by a natural voice and masked by two-talker babble. Masked conditions were both presented at a -8 dB signal to noise ratio (SNR), a level shown in previous research to result in comparable levels of performance for these stimuli and maskers. Performance was measured in terms of proportion of key words identified correctly, and task demand or effort was quantified subjectively by self-report. Measures of psychophysiological reactivity included electrodermal (skin conductance) response frequency and amplitude, blood pulse amplitude and pulse rate. Results suggest that the two masked conditions evoked stronger psychophysiological reactivity than did the two unmasked conditions even when behavioral measures of listening performance and listeners' subjective perception of task demand were comparable across the three

  11. Skin-Specific Unsaturated Fatty Acids Boost the Staphylococcus aureus Innate Immune Response

    OpenAIRE

    Nguyen, Minh Thu; Hanzelmann, Dennis; Härtner, Thomas; Peschel, Andreas; Götz, Friedrich

    2015-01-01

    Antimicrobial fatty acids (AFAs) protect the human epidermis against invasion by pathogenic bacteria. In this study, we questioned whether human skin fatty acids (FAs) can be incorporated into the lipid moiety of lipoproteins and whether such incorporation would have an impact on innate immune stimulation in the model organism Staphylococcus aureus USA300 JE2. This organism synthesized only saturated FAs. However, when feeding USA300 with unsaturated FAs present on human skin (C16:1, C18:1, o...

  12. Arsenic Transformation Predisposes Human Skin Keratinocytes To UV-induced DNA Damage Yet Enhances Their Survival Apparently by Diminishing Oxidant Response

    OpenAIRE

    Sun, Yang(Department of Physics, Shanghai Jiao Tong University, Shanghai 200240, China); Kojima, Chikara; Chignell, Colin; Mason, Ronald; Waalkes, Michael P.

    2011-01-01

    Inorganic arsenic and UV, both human skin carcinogens, may act together as skin co-carcinogens. We find human skin keratinocytes (HaCaT cells) are malignantly transformed by low-level arsenite (100 nM, 30 weeks; termed As-TM cells) and with transformation concurrently undergo full adaptation to arsenic toxicity involving reduced apoptosis and oxidative stress response to high arsenite concentrations. Oxidative DNA damage (ODD) is a possible mechanism in arsenic carcinogenesis and a hallmark o...

  13. Autonomic nervous system response patterns in freshmen with different resilience in a military university%某军校不同心理弹性水平的大一新生自主神经反应特点

    Institute of Scientific and Technical Information of China (English)

    张佳佳; 彭李; 李敏

    2011-01-01

    目的 研究不同心理弹性水平军校大学生自主神经反应特点.方法 采用成人心理弹性量表(resilience scale for adults,RSA)对重庆某军校大一新生进行心理测评,筛选出心理弹性高分组和低分组被试共144名,再从中选取愿意参加本实验的心理弹性高分组和低分组被试各27名,其进行自主神经反应(心率、皮电、皮温、指端血容振幅)特点的实验研究.结果 ①静息状态下,心理弹性高分组和低分组被试的自主神经反应没有统计学差异(P>0.05).②悲伤情绪诱导下,心理弹性高分组在皮电上低于心理弹性低分组(t=-2.077,P=0.043).③悲伤情绪诱导后,心理弹性高分组和心理弹性低分组的各个指标的恢复时间上均无统计学差异(P>0.05).结论 心理弹性水平不同的大学生的自主神经活动模式可能存在一定程度的差异.%Objective To investigate the autonomic nervous system response pattern in military college students with different levels of resilience. Methods Resilience Scale for Adults (R.SA) was applied to test 144 college students, and based on the RSA score 54 freshmen who accepted to join the test were selected and were divided into a high resilience group and a low resilience group. Each 27 freshmen of the two groups were tested for autonomic nervous system response pattern. Results ① At resting state, students of the high resilience group and low resilience group did not show significant differences in heart rate ( HR) , skin conductance (SC), skin temperature (ST) and blood volume pulse (BVP) (P>0. 05). ② Compared with those indices obtained at resting state, students of the high resilience group scored lower in HR, SC and ST under sad mood induction, but higher in BVP; students of the low resilience group scored higher in HR and SC under sad mood induction, but lower in ST and BVP. Sad mood induction showed that SC of the high resilience group was significantly lower than that of the

  14. Exercise Reveals the Interrelation of Physical Fitness, Inflammatory Response, Psychopathology, and Autonomic Function in Patients With Schizophrenia

    OpenAIRE

    Ostermann, Stefanie; Herbsleb, Marco; Schulz, Steffen; Donath, Lars; Berger, Sandy; Eisenträger, Daniela; Siebert, Tobias; Müller, Hans-Josef; Puta, Christian; Voss, Andreas; Gabriel, Holger W.; Koch, Kathrin; Bär, Karl-Jürgen

    2012-01-01

    Maintaining and improving fitness are associated with a lower risk of premature death from cardiovascular disease. Patients with schizophrenia are known to exercise less and have poorer health behaviors than average. Physical fitness and physiological regulation during exercise tasks have not been investigated to date among patients with schizophrenia. We studied autonomic modulation in a stepwise exhaustion protocol in 23 patients with schizophrenia and in matched controls, using spirometry ...

  15. Autonomic response to an experimental psychological stressor in healthy subjects: measurement of sympathetic, parasympathetic, and pituitary-adrenal parameters: test-retest reliability

    DEFF Research Database (Denmark)

    Jørgensen, L S; Christiansen, P; Raundahl, U; Ostgaard, S; Christensen, N J; Fenger, M; Flachs, H

    1990-01-01

    A mental arithmetic test (the stressor; 15 min) significantly increased systolic and diastolic blood pressure, heart rate and plasma adrenaline by 11%, 12%, 28% and 152% respectively, with a prompt return to resting values after the test. Plasma noradrenaline and serum cortisol did not increase....... The increments in systolic blood pressure and heart rate were significantly lower at retest. MSSD at stress, but not at rest, was significantly lower at retest. The mental arithmetic stress test as described here produces a sufficient autonomic response to make it viable for laboratory stress research...

  16. Genetic covariance between psychopathic traits and anticipatory skin conductance responses to threat: Evidence for a potential endophenotype

    OpenAIRE

    Wang, Pan; Gao, Yu; Isen, Joshua; Tuvblad, Catherine; Raine, Adrian; Baker, Laura A.

    2015-01-01

    The genetic architecture of the association between psychopathic traits and reduced skin conductance responses (SCRs) is poorly understood. By using 752 twins aged 9–10 years, this study investigated the heritability of two SCR measures (anticipatory SCRs to impending aversive stimuli and unconditioned SCRs to the aversive stimuli themselves) in a countdown task. The study also investigated the genetic and environmental sources of the covariance between these SCR measures and two psychopathic...

  17. Quantitative thermal sensory testing and sympathetic skin response in primary Restless legs syndrome - A prospective study on 57 Indian patients

    OpenAIRE

    Garima Shukla; Vinay Goyal; Achal Srivastava; Madhuri Behari

    2012-01-01

    Patients with restless leg syndrome present with sensory symptoms similar to peripheral neuropathy. While there is evidence of abnormalities of dopaminergic pathways, the peripheral nervous system has been studied infrequently. We studied conventional nerve conduction studies, quantitative thermal sensory testing and sympathetic skin response in 57 patients with primary restless leg syndrome. Almost two third patients demonstrated abnormalities in the detailed testing of the peripheral nervou...

  18. Contribution of the skin, rectus abdominis and their sheaths to the structural response of the abdominal wall ex vivo

    OpenAIRE

    TRAN, Doris; Mitton, David; Voirin, David; TURQUIER, Frédéric; Beillas, Philippe

    2014-01-01

    A better understanding of the abdominal wall biomechanics could help designing new treatments for incisional hernia. In the current study, a new experimental protocol was developed to evaluate the contributions of the abdominal wall components to the mechanical response of the anterior part of the abdominal wall. The specimens underwent 3 dissections (removal of 1: skin and subcutaneous fat, 2: anterior rectus sheath, 3: rectus abdominis muscles). After each dissection, they were subjected to...

  19. Photo-Oxidation Products of Skin Surface Squalene Mediate Metabolic and Inflammatory Responses to Solar UV in Human Keratinocytes

    OpenAIRE

    Kostyuk, Vladimir; Potapovich, Alla; Stancato, Andrea; De Luca, Chiara; Lulli, Daniela; Pastore, Saveria; Korkina, Liudmila

    2012-01-01

    The study aimed to identify endogenous lipid mediators of metabolic and inflammatory responses of human keratinocytes to solar UV irradiation. Physiologically relevant doses of solar simulated UVA+UVB were applied to human skin surface lipids (SSL) or to primary cultures of normal human epidermal keratinocytes (NHEK). The decay of photo-sensitive lipid-soluble components, alpha-tocopherol, squalene (Sq), and cholesterol in SSL was analysed and products of squalene photo-oxidation (SqPx) were ...

  20. Force sensor in simulated skin and neural model mimic tactile SAI afferent spiking response to ramp and hold stimuli

    Directory of Open Access Journals (Sweden)

    Kim Elmer K

    2012-07-01

    Full Text Available Abstract Background The next generation of prosthetic limbs will restore sensory feedback to the nervous system by mimicking how skin mechanoreceptors, innervated by afferents, produce trains of action potentials in response to compressive stimuli. Prior work has addressed building sensors within skin substitutes for robotics, modeling skin mechanics and neural dynamics of mechanotransduction, and predicting response timing of action potentials for vibration. The effort here is unique because it accounts for skin elasticity by measuring force within simulated skin, utilizes few free model parameters for parsimony, and separates parameter fitting and model validation. Additionally, the ramp-and-hold, sustained stimuli used in this work capture the essential features of the everyday task of contacting and holding an object. Methods This systems integration effort computationally replicates the neural firing behavior for a slowly adapting type I (SAI afferent in its temporally varying response to both intensity and rate of indentation force by combining a physical force sensor, housed in a skin-like substrate, with a mathematical model of neuronal spiking, the leaky integrate-and-fire. Comparison experiments were then conducted using ramp-and-hold stimuli on both the spiking-sensor model and mouse SAI afferents. The model parameters were iteratively fit against recorded SAI interspike intervals (ISI before validating the model to assess its performance. Results Model-predicted spike firing compares favorably with that observed for single SAI afferents. As indentation magnitude increases (1.2, 1.3, to 1.4 mm, mean ISI decreases from 98.81 ± 24.73, 54.52 ± 6.94, to 41.11 ± 6.11 ms. Moreover, as rate of ramp-up increases, ISI during ramp-up decreases from 21.85 ± 5.33, 19.98 ± 3.10, to 15.42 ± 2.41 ms. Considering first spikes, the predicted latencies exhibited a decreasing trend as stimulus rate increased, as is

  1. The effect of heating rate on the cutaneous vasomotion responses of forearm and leg skin in humans.

    Science.gov (United States)

    Del Pozzi, Andrew T; Miller, James T; Hodges, Gary J

    2016-05-01

    We examined skin blood flow (SkBF) and vasomotion in the forearm and leg using laser-Doppler fluxmetry (LDF) and spectral analysis to investigate endothelial, sympathetic, and myogenic activities in response to slow (0.1°C·10s(-1)) and fast (0.5°C·10s(-1)) local heating. At 33°C (thermoneutral) endothelial activity was higher in the legs than the forearms (P≤0.02). Fast-heating increased SkBF more than slow heating (P=0.037 forearm; P=0.002 leg). At onset of 42°C, endothelial (P=0.043 forearm; P=0.48 leg) activity increased in both regions during the fast-heating protocol. Following prolonged heating (42°C) endothelial activity was higher in both the forearm (P=0.002) and leg (P<0.001) following fast-heating. These results confirm regional differences in the response to local heating and suggest that the greater increase in SkBF in response to fast local heating is initially due to increased endothelial and sympathetic activity. Furthermore, with sustained local skin heating, greater vasodilatation was observed with fast heating compared to slow heating. These data indicate that this difference is due to greater endothelial activity following fast heating compared to slow heating, suggesting that the rate of skin heating may alter the mechanisms contributing to cutaneous vasodilatation. PMID:26808211

  2. Quantitative assessment of autonomic dysreflexia with combined spectroscopic and perfusion probes

    Science.gov (United States)

    Ramella-Roman, Jessica C.; Pfefer, Allison; Hidler, Joseph

    2009-02-01

    Autonomic Dysreflexia (AD) is an uncontrolled response of sympathetic output occurring in individuals with an injury at the sixth thoracic (T6) neurologic level. Any noxious stimulus below the injury level can trigger an AD episode. Progression of an AD attack can result in severe vasoconstriction below the injury level. Skin oxygenation can decrease up to 40% during an AD event. We present a quantitative and non-invasive method of assessing the progression of an AD event by measuring patient's skin oxygen levels and blood flow using a fiber optic based system.

  3. Nociceptive Sensory Neurons Drive Interleukin-23 Mediated Psoriasiform Skin Inflammation

    Science.gov (United States)

    Riol-Blanco, Lorena; Ordovas-Montanes, Jose; Perro, Mario; Naval, Elena; Thiriot, Aude; Alvarez, David; Wood, John N.; von Andrian, Ulrich H.

    2014-01-01

    The skin has a dual function as a barrier and a sensory interface between the body and the environment. To protect against invading pathogens, the skin harbors specialized immune cells, including dermal dendritic cells (DDCs) and interleukin (IL)-17 producing γδ T cells (γδT17), whose aberrant activation by IL-23 can provoke psoriasis-like inflammation1–4. The skin is also innervated by a meshwork of peripheral nerves consisting of relatively sparse autonomic and abundant sensory fibers. Interactions between the autonomic nervous system and immune cells in lymphoid organs are known to contribute to systemic immunity, but how peripheral nerves regulate cutaneous immune responses remains unclear5,6. Here, we have exposed the skin of mice to imiquimod (IMQ), which induces IL-23 dependent psoriasis-like inflammation7,8. We show that a subset of sensory neurons expressing the ion channels TRPV1 and NaV1.8 is essential to drive this inflammatory response. Imaging of intact skin revealed that a large fraction of DDCs, the principal source of IL-23, is in close contact with these nociceptors. Upon selective pharmacological or genetic ablation of nociceptors9–11, DDCs failed to produce IL-23 in IMQ exposed skin. Consequently, the local production of IL-23 dependent inflammatory cytokines by dermal γδT17 cells and the subsequent recruitment of inflammatory cells to the skin were dramatically reduced. Intradermal injection of IL-23 bypassed the requirement for nociceptor communication with DDCs and restored the inflammatory response12. These findings indicate that TRPV1+NaV1.8+ nociceptors, by interacting with DDCs, regulate the IL-23/IL-17 pathway and control cutaneous immune responses. PMID:24759321

  4. Nociceptive sensory neurons drive interleukin-23-mediated psoriasiform skin inflammation.

    Science.gov (United States)

    Riol-Blanco, Lorena; Ordovas-Montanes, Jose; Perro, Mario; Naval, Elena; Thiriot, Aude; Alvarez, David; Paust, Silke; Wood, John N; von Andrian, Ulrich H

    2014-06-01

    The skin has a dual function as a barrier and a sensory interface between the body and the environment. To protect against invading pathogens, the skin harbours specialized immune cells, including dermal dendritic cells (DDCs) and interleukin (IL)-17-producing γδ T (γδT17) cells, the aberrant activation of which by IL-23 can provoke psoriasis-like inflammation. The skin is also innervated by a meshwork of peripheral nerves consisting of relatively sparse autonomic and abundant sensory fibres. Interactions between the autonomic nervous system and immune cells in lymphoid organs are known to contribute to systemic immunity, but how peripheral nerves regulate cutaneous immune responses remains unclear. We exposed the skin of mice to imiquimod, which induces IL-23-dependent psoriasis-like inflammation. Here we show that a subset of sensory neurons expressing the ion channels TRPV1 and Nav1.8 is essential to drive this inflammatory response. Imaging of intact skin revealed that a large fraction of DDCs, the principal source of IL-23, is in close contact with these nociceptors. Upon selective pharmacological or genetic ablation of nociceptors, DDCs failed to produce IL-23 in imiquimod-exposed skin. Consequently, the local production of IL-23-dependent inflammatory cytokines by dermal γδT17 cells and the subsequent recruitment of inflammatory cells to the skin were markedly reduced. Intradermal injection of IL-23 bypassed the requirement for nociceptor communication with DDCs and restored the inflammatory response. These findings indicate that TRPV1(+)Nav1.8(+) nociceptors, by interacting with DDCs, regulate the IL-23/IL-17 pathway and control cutaneous immune responses. PMID:24759321

  5. Multiple helminth infection of the skin causes lymphocyte hypo-responsiveness mediated by Th2 conditioning of dermal myeloid cells.

    Directory of Open Access Journals (Sweden)

    Peter C Cook

    2011-03-01

    Full Text Available Infection of the mammalian host by schistosome larvae occurs via the skin, although nothing is known about the development of immune responses to multiple exposures of schistosome larvae, and/or their excretory/secretory (E/S products. Here, we show that multiple (4x exposures, prior to the onset of egg laying by adult worms, modulate the skin immune response and induce CD4(+ cell hypo-responsiveness in the draining lymph node, and even modulate the formation of hepatic egg-induced granulomas. Compared to mice exposed to a single infection (1x, dermal cells from multiply infected mice (4x, were less able to support lymph node cell proliferation. Analysis of dermal cells showed that the most abundant in 4x mice were eosinophils (F4/80(+MHC-II(-, but they did not impact the ability of antigen presenting cells (APC to support lymphocyte proliferation to parasite antigen in vitro. However, two other cell populations from the dermal site of infection appear to have a critical role. The first comprises arginase-1(+, Ym-1(+ alternatively activated macrophage-like cells, and the second are functionally compromised MHC-II(hi cells. Through the administration of exogenous IL-12 to multiply infected mice, we show that these suppressive myeloid cell phenotypes form as a consequence of events in the skin, most notably an enrichment of IL-4 and IL-13, likely resulting from an influx of RELMα-expressing eosinophils. We further illustrate that the development of these suppressive dermal cells is dependent upon IL-4Rα signalling. The development of immune hypo-responsiveness to schistosome larvae and their effect on the subsequent response to the immunopathogenic egg is important in appreciating how immune responses to helminth infections are modulated by repeated exposure to the infective early stages of development.

  6. The response of mouse skin to re-irradiation with x-rays or fast neutrons

    International Nuclear Information System (INIS)

    Effects of neutrons and x-rays on mouse skin which had been previously irradiated with x-rays were investigated. Two tattoo marks were placed in the hairless legs of mice at intervals of 15 mm. The legs were exposed to various doses of x-ray and neutrons to determine the relative biological effectiveness (RBE) using the contraction of the skin as an index. The RBE was 0.93 - 1.73. The legs of the mice were preexposed to 25 Gy of x-ray, and exposed 4 months later. The contraction of the skin began earlier than after the first irradiation. RBE was 2.18 - 2.47. This RBE was higher than that in untreated mice. These results suggest that previously irradiated normal tissues are much more sensitive to neutrons than to x-rays. (author)

  7. Benefits of plasma rich in growth factors (PRGF) in skin photodamage: clinical response and histological assessment.

    Science.gov (United States)

    Díaz-Ley, B; Cuevast, J; Alonso-Castro, L; Calvo, M I; Ríos-Buceta, L; Orive, G; Anitua, E; Jaén, P

    2015-01-01

    Skin ageing is characterized by small and fine wrinkles, roughness, laxity, and pigmentation as a result of epidermal thinning, collagen degradation, dermal atrophy, and fewer fibroblasts. Plasma rich in growth factors (PRGF) is an autologous plasma preparation enriched in proteins obtained from patient's own blood aimed at accelerating tissue repair and regeneration. To evaluate the benefits of PRGF in skin photodamage, 10 healthy volunteers were treated with three consecutive intradermal injections of PRGF in the facial area. Clinical outcomes and histological analysis were performed. A statistically significant increase in the epidermis and papillary dermis thickness was seen after PRGF treatment (p photodamage (p photodamage (p photodamage. Intradermal PRGF infiltration appears to be an effective treatment for the photodamaged skin. PMID:25864463

  8. Experimental characterization and damage model of the human skin response to dynamic loadings

    OpenAIRE

    JACQUEMOUD,C; Coret, M; BRUYERE-GARNIER,K; Brunet, M.

    2007-01-01

    The objective of this work is to characterize and to model the damage of planar and fibrous soft tissues at high strain rate. As first step, we choose to study the human skin. A dynamic tensile test up to failure is performed on 10x30mm human skin samples. The test is based on the drop test principle and allows loading of samples at a strain rate close to 40 s-1. Classical measurement techniques give global strains whereas a full local strain field is measured on the sample surface by an Imag...

  9. IN SITU IMMUNE RESPONSE EVALUATION VIA IMMUNOHISTOCHEMISTRY IN SKIN BIOPSIES FROM PATIENTS AFFECTED BY AUTOIMMUNE BLISTERING DISEASES

    Directory of Open Access Journals (Sweden)

    Ana Maria Abreu Velez

    2013-11-01

    Full Text Available Introduction: The in situ immune response in skin biopsies from patients affected by autoimmune skin blistering diseases (ABD is not well characterized. Aim: Our investigation attempts to immunophenotype cells in lesional skin in several ABD, utilizing immunohistochemistry (ICH. Methods: We tested by IHC for CD4, CD8, CD19, CD20, CD45, CD56/NCAM, PAX-5, granzyme B, myeloperoxidase, neutrophil elastase, LAT and ZAP-70 in patients affected by ABD. We tested 30 patients with endemic pemphigus foliaceus (EPF, 15 controls from the EPF endemic area, and 15 biopsies from healthy controls from the USA. We also tested archival biopsies from patients with selected ABD, including 30 patients with bullous pemphigoid, 20 with pemphigus vulgaris, 8 with pemphigus foliaceus and 14 with dermatitis herpetiformis. Results: We found a predominantly CD8 positive/CD45 positive T cell infiltrate in all ABD. Our skin biopsies demonstrated consistently positive staining for myeloperoxidase, but negative staining for neutrophil elastase. Most ABD biopsies displayed negative staining for CD4 and B cell markers; natural killer cell markers were also rarely seen. ZAP-70 and LAT were frequently detected. In El Bagre-EPF, a significant fragmentation of T cells in lesional skin was noted, as well as autoreactivity to lymph nodes. Conclusions: The documented T cell and myeloperoxidase staining are indicative of the role of T lymphocytes and neutrophils in lesional biopsies in patients with ABD, in addition to previously documented deposition of B cells, immunoglobulins and complement in situ. In El Bagre-EPF, T cells could also target lymph nodes; however, further studies are needed to confirm this possibility.

  10. Developmental and Metabolic Plasticity of White-Skinned Grape Berries in Response to Botrytis cinerea during Noble Rot.

    Science.gov (United States)

    Blanco-Ulate, Barbara; Amrine, Katherine C H; Collins, Thomas S; Rivero, Rosa M; Vicente, Ariel R; Morales-Cruz, Abraham; Doyle, Carolyn L; Ye, Zirou; Allen, Greg; Heymann, Hildegarde; Ebeler, Susan E; Cantu, Dario

    2015-12-01

    Noble rot results from exceptional infections of ripe grape (Vitis vinifera) berries by Botrytis cinerea. Unlike bunch rot, noble rot promotes favorable changes in grape berries and the accumulation of secondary metabolites that enhance wine grape composition. Noble rot-infected berries of cv Sémillon, a white-skinned variety, were collected over 3 years from a commercial vineyard at the same time that fruit were harvested for botrytized wine production. Using an integrated transcriptomics and metabolomics approach, we demonstrate that noble rot alters the metabolism of cv Sémillon berries by inducing biotic and abiotic stress responses as well as ripening processes. During noble rot, B. cinerea induced the expression of key regulators of ripening-associated pathways, some of which are distinctive to the normal ripening of red-skinned cultivars. Enhancement of phenylpropanoid metabolism, characterized by a restricted flux in white-skinned berries, was a common outcome of noble rot and red-skinned berry ripening. Transcript and metabolite analyses together with enzymatic assays determined that the biosynthesis of anthocyanins is a consistent hallmark of noble rot in cv Sémillon berries. The biosynthesis of terpenes and fatty acid aroma precursors also increased during noble rot. We finally characterized the impact of noble rot in botrytized wines. Altogether, the results of this work demonstrated that noble rot causes a major reprogramming of berry development and metabolism. This desirable interaction between a fruit and a fungus stimulates pathways otherwise inactive in white-skinned berries, leading to a greater accumulation of compounds involved in the unique flavor and aroma of botrytized wines. PMID:26450706

  11. Developmental and Metabolic Plasticity of White-Skinned Grape Berries in Response to Botrytis cinerea during Noble Rot1[OPEN

    Science.gov (United States)

    Collins, Thomas S.; Vicente, Ariel R.; Doyle, Carolyn L.; Ye, Zirou; Allen, Greg; Heymann, Hildegarde

    2015-01-01

    Noble rot results from exceptional infections of ripe grape (Vitis vinifera) berries by Botrytis cinerea. Unlike bunch rot, noble rot promotes favorable changes in grape berries and the accumulation of secondary metabolites that enhance wine grape composition. Noble rot-infected berries of cv Sémillon, a white-skinned variety, were collected over 3 years from a commercial vineyard at the same time that fruit were harvested for botrytized wine production. Using an integrated transcriptomics and metabolomics approach, we demonstrate that noble rot alters the metabolism of cv Sémillon berries by inducing biotic and abiotic stress responses as well as ripening processes. During noble rot, B. cinerea induced the expression of key regulators of ripening-associated pathways, some of which are distinctive to the normal ripening of red-skinned cultivars. Enhancement of phenylpropanoid metabolism, characterized by a restricted flux in white-skinned berries, was a common outcome of noble rot and red-skinned berry ripening. Transcript and metabolite analyses together with enzymatic assays determined that the biosynthesis of anthocyanins is a consistent hallmark of noble rot in cv Sémillon berries. The biosynthesis of terpenes and fatty acid aroma precursors also increased during noble rot. We finally characterized the impact of noble rot in botrytized wines. Altogether, the results of this work demonstrated that noble rot causes a major reprogramming of berry development and metabolism. This desirable interaction between a fruit and a fungus stimulates pathways otherwise inactive in white-skinned berries, leading to a greater accumulation of compounds involved in the unique flavor and aroma of botrytized wines. PMID:26450706

  12. Trigeminal autonomic cephalalgias.

    Science.gov (United States)

    Eller, M; Goadsby, P J

    2016-01-01

    The trigeminal autonomic cephalalgias (TACs) are a group of primary headache disorders characterised by lateralized symptoms: prominent headache and ipsilateral cranial autonomic features, such as conjunctival injection, lacrimation and rhinorrhea. The TACs are: cluster headache (CH), paroxysmal hemicrania (PH), short-lasting unilateral neuralgiform headache attacks with conjunctival injection and tearing (SUNCT)/short-lasting neuralgiform headache attacks with cranial autonomic features (SUNA) and hemicrania continua (HC). Their diagnostic criteria are outlined in the International Classification of Headache Disorders, third edition-beta (ICHD-IIIb). These conditions are distinguished by their attack duration and frequency, as well as response to treatment. HC is continuous and by definition responsive to indomethacin. The main differential when considering this headache is chronic migraine. Other TACs are remarkable for their short duration and must be distinguished from other short-lasting painful conditions, such as trigeminal neuralgia and primary stabbing headache. Cluster headache is characterised by exquisitely painful attacks that occur in discrete episodes lasting 15-180 min a few times a day. In comparison, PH occurs more frequently and is of shorter duration, and like HC is responsive to indomethacin. SUNCT/SUNA is the shortest duration and highest frequency TAC; attacks can occur over a hundred times every day. PMID:24888770

  13. Autonomous Search

    CERN Document Server

    Hamadi, Youssef; Saubion, Frédéric

    2012-01-01

    Decades of innovations in combinatorial problem solving have produced better and more complex algorithms. These new methods are better since they can solve larger problems and address new application domains. They are also more complex which means that they are hard to reproduce and often harder to fine-tune to the peculiarities of a given problem. This last point has created a paradox where efficient tools are out of reach of practitioners. Autonomous search (AS) represents a new research field defined to precisely address the above challenge. Its major strength and originality consist in the

  14. Photo-oxidation products of skin surface squalene mediate metabolic and inflammatory responses to solar UV in human keratinocytes.

    Directory of Open Access Journals (Sweden)

    Vladimir Kostyuk

    Full Text Available UNLABELLED: The study aimed to identify endogenous lipid mediators of metabolic and inflammatory responses of human keratinocytes to solar UV irradiation. Physiologically relevant doses of solar simulated UVA+UVB were applied to human skin surface lipids (SSL or to primary cultures of normal human epidermal keratinocytes (NHEK. The decay of photo-sensitive lipid-soluble components, alpha-tocopherol, squalene (Sq, and cholesterol in SSL was analysed and products of squalene photo-oxidation (SqPx were quantitatively isolated from irradiated SSL. When administered directly to NHEK, low-dose solar UVA+UVB induced time-dependent inflammatory and metabolic responses. To mimic UVA+UVB action, NHEK were exposed to intact or photo-oxidised SSL, Sq or SqPx, 4-hydroxy-2-nonenal (4-HNE, and the product of tryptophan photo-oxidation 6-formylindolo[3,2-b]carbazole (FICZ. FICZ activated exclusively metabolic responses characteristic for UV, i.e. the aryl hydrocarbon receptor (AhR machinery and downstream CYP1A1/CYP1B1 gene expression, while 4-HNE slightly stimulated inflammatory UV markers IL-6, COX-2, and iNOS genes. On contrast, SqPx induced the majority of metabolic and inflammatory responses characteristic for UVA+UVB, acting via AhR, EGFR, and G-protein-coupled arachidonic acid receptor (G2A. CONCLUSIONS/SIGNIFICANCE: Our findings indicate that Sq could be a primary sensor of solar UV irradiation in human SSL, and products of its photo-oxidation mediate/induce metabolic and inflammatory responses of keratinocytes to UVA+UVB, which could be relevant for skin inflammation in the sun-exposed oily skin.

  15. Acute response of pig skin to irradiation with 12C-ions or 200 kV X-rays

    International Nuclear Information System (INIS)

    The acute response of pig skin to treatment with high energy carbon ions (plateau region) at the Gesellschaft fuer Schwerionenforschung (GSI, Darmstadt, Germany) was compared to changes after 200 kV X-irradiation. Carbon doses isoeffective to the X-ray doses were computed with a recently established model for calculation of the biological effect of heavy ions (1, 2). Clinical changes and physiological symptoms (blood flow, erythema, transepidermal water loss, skin hydration) were scored. The parameters analyzed were maximum and mean values of each symptom during days 24 to 70 post irradiation, and the quantal endpoints for the establishment of dose-effect curves were the median values of these. With exception of the maximum change in the red blood cell concentration (p12C-ions (plateau region) and may at least for epidermis be applied to treatment planning. (orig.)

  16. From membrane to skin: aqueous permeation control through light-responsive amphiphilic polymer co-networks

    Czech Academy of Sciences Publication Activity Database

    Schöller, K.; Küpfer, S.; Baumann, L.; Hoyer, P.M.; de Courten, D.; Rossi, R.M.; Vetushka, Aliaksi; Wolf, M.; Bruns, N.; Scherer, L.J.

    2014-01-01

    Roč. 24, č. 33 (2014), s. 5194-5201. ISSN 1616-301X R&D Projects: GA ČR GB14-37427G; GA MŠk(CZ) LM2011026 Institutional support : RVO:68378271 Keywords : transdermal drug- delivery * porcine ear skin * in-vitro * surface modification Subject RIV: JI - Composite Materials Impact factor: 11.805, year: 2014

  17. Bovine Tuberculosis: Effect of the Tuberculin Skin Test on In vitro Interferon gamma Responses

    Science.gov (United States)

    Bovine tuberculosis (bTB) is a disease of zoonotic and economic importance. In many countries, control is based on test and slaughter policies and/or abattoir surveillance. For testing, cell mediated immune- (CMI-) based assays (i.e., Tuberculin skin test (TST) supplemented by the interferon gamma (...

  18. Early mucosal responses in blue catfish (Ictalurus furcatus) skin to Aeromonas hydrophila infection

    Science.gov (United States)

    Bacterial pathogens are well-equipped to detect, adhere to, and initiate infection in their finfish hosts. The mucosal surfaces of fish, such as the skin, function as the front line of defense against such bacterial insults that are routinely encountered in the aquatic environment. While recent prog...

  19. Human facial skin detection in thermal video to effectively measure electrodermal activity (EDA)

    Science.gov (United States)

    Kaur, Balvinder; Hutchinson, J. Andrew; Leonard, Kevin R.; Nelson, Jill K.

    2011-06-01

    In the past, autonomic nervous system response has often been determined through measuring Electrodermal Activity (EDA), sometimes referred to as Skin Conductance (SC). Recent work has shown that high resolution thermal cameras can passively and remotely obtain an analog to EDA by assessing the activation of facial eccrine skin pores. This paper investigates a method to distinguish facial skin from non-skin portions on the face to generate a skin-only Dynamic Mask (DM), validates the DM results, and demonstrates DM performance by removing false pore counts. Moreover, this paper shows results from these techniques using data from 20+ subjects across two different experiments. In the first experiment, subjects were presented with primary screening questions for which some had jeopardy. In the second experiment, subjects experienced standard emotion-eliciting stimuli. The results from using this technique will be shown in relation to data and human perception (ground truth). This paper introduces an automatic end-to-end skin detection approach based on texture feature vectors. In doing so, the paper contributes not only a new capability of tracking facial skin in thermal imagery, but also enhances our capability to provide non-contact, remote, passive, and real-time methods for determining autonomic nervous system responses for medical and security applications.

  20. Aluminum sulfate significantly reduces the skin test response to common allergens in sensitized patients

    Directory of Open Access Journals (Sweden)

    Grier Thomas J

    2006-02-01

    Full Text Available Abstract Background Avoidance of allergens is still recommended as the first and best way to prevent allergic illnesses and their comorbid diseases. Despite a variety of attempts there has been very limited success in the area of environmental control of allergic disease. Our objective was to identify a non-invasive, non-pharmacological method to reduce indoor allergen loads in atopic persons' homes and public environments. We employed a novel in vivo approach to examine the possibility of using aluminum sulfate to control environmental allergens. Methods Fifty skin test reactive patients were simultaneously skin tested with conventional test materials and the actions of the protein/glycoprotein modifier, aluminum sulfate. Common allergens, dog, cat, dust mite, Alternaria, and cockroach were used in the study. Results Skin test reactivity was significantly reduced by the modifier aluminum sulfate. Our studies demonstrate that the effects of histamine were not affected by the presence of aluminum sulfate. In fact, skin test reactivity was reduced independent of whether aluminum sulfate was present in the allergen test material or removed prior to testing, indicating that the allergens had in some way been inactivated. Conclusion Aluminum sulfate was found to reduce the in vivo allergic reaction cascade induced by skin testing with common allergens. The exact mechanism is not clear but appears to involve the alteration of IgE-binding epitopes on the allergen. Our results indicate that it may be possible to diminish the allergenicity of an environment by application of the active agent aluminum sulfate, thus producing environmental control without complete removal of the allergen.

  1. Surgical implantation and functional assessment of an invasive telemetric system to measure autonomic responses in domestic pigs.

    Science.gov (United States)

    Krause, A; Zebunke, M; Bellmann, O; Mohr, E; Langbein, J; Puppe, B

    2016-01-01

    The first aim of this study was to establish a surgical procedure to implant a new telemetric device for the continuous recording of electrocardiogram (ECG) and blood pressure (BP) in freely moving pigs. A second aim was the functional assessment of cardiovascular parameters, including heart rate variability (HRV) and blood pressure variability (BPV), so that these data could be used as the basis for the objective evaluation of autonomic activity and balance in different behavioural contexts. Eleven domestic pigs (German Landrace) underwent surgery for the placement of a telemetric device. At day 15 after surgery, 512 consecutive inter-beat intervals and pressure waves were analysed using different detection methods (automatic and manually corrected) while the animals were resting or feeding, respectively. HRV and BPV were calculated. Incomplete datasets were found in four pigs due to missing ECG or BP signals. Technical and surgical issues concerning catheterisation and detachment of the negative ECG lead were continuously improved. In the remaining pigs, excellent signal quality (manually corrected data of 1%) was obtained during resting and acceptable signal quality (ECG recordings. Sympathetic arousal with accompanying vagal withdrawal during feeding was documented. The established surgical implantation and functional assessment of the telemetric system with the reliable registration of cardiovascular parameters in freely moving pigs could serve as a basis for future studies of autonomic regulation in context of stress and animal welfare. PMID:26626089

  2. Responses of Six-Weeks Aquatic Exercise on the Autonomic Nervous System, Peak Nasal Inspiratory Flow and Lung Functions in Young Adults with Allergic Rhinitis

    Directory of Open Access Journals (Sweden)

    Taweesak Janyacharoen

    2015-10-01

    Full Text Available Allergic rhinitis is a chronic respiratory disease. Sympathetic hypofunction is identified in all of the allergic rhinitis patients. Moreover, allergic rhinitis is associated with decreased peak nasal inspiratory flow (PNIF and impaired lung functions. The aim of this study was to investigate effects of six-week of aquatic exercise on the autonomic nervous system function, PNIF and lung functions in allergic rhinitis patients.Twenty-six allergic rhinitis patients, 12 males and 14 females were recruited in this study. Subjects were diagnosed by a physician based on history, physical examination, and positive reaction to a skin prick test. Subjects were randomly assigned to two groups. The control allergic rhinitis group received education and maintained normal life. The aquatic group performed aquatic exercise for 30 minutes a day, three days a week for six weeks. Heart rate variability, PNIF and lung functions were measured at the beginning, after three weeks and six weeks.There were statistically significant increased low frequency normal units (LF n.u., PNIF and showed decreased high frequency normal units (HF n.u. at six weeks after aquatic exercise compared with the control group.Six weeks of aquatic exercise could increase sympathetic activity and PNIF in allergicrhinitis patients.

  3. Pure Autonomic Failure

    Science.gov (United States)

    ... Drugs GARD Information Navigator FAQs About Rare Diseases Pure autonomic failure Title Other Names: Bradbury Eggleston syndrome; ... Categories: Nervous System Diseases ; RDCRN Summary Summary Listen Pure autonomic failure is characterized by generalized autonomic failure ...

  4. The acute effects of alpha and beta irradiation of mouse skin and the factors affecting the response

    International Nuclear Information System (INIS)

    Several problems regarding acute effects of alpha and beta irradiation were investigated in order to clarify protection problems of localised doses to the skin. A study into the acute biological effects of different energy beta emitters and the effects of energy and area on the response showed direct relationships between these criteria for a range of different acute responses with different time courses. Three different types of acute response were found and these are described as 'moist desquamation', 'acute ulceration' and 'acute epidermal necrosis'. An unexpected finding was that the lower energy beta emitter 170Tm was as efficient at inducing scab formation as the higher energy 90Sr sources for the same area of exposure. Experiments using 2x4 cm2 exposures to 224Cm alpha particles showed that the response to this poorly penetrating radiation was minimal after doses as high as 180 Gy measured at 10 μm into the skin. In comparison, large area exposure to 170Tm produced areas of prolonged scabbing after doses up to 100 Gy. However, the intensity of the reaction varied between strains. (author)

  5. The response of human skin commensal bacteria as a reflection of UV radiation: UV-B decreases porphyrin production.

    Directory of Open Access Journals (Sweden)

    Yanhan Wang

    Full Text Available Recent global radiation fears reflect the urgent need for a new modality that can simply determine if people are in a radiation risk of developing cancer and other illnesses. Ultraviolet (UV radiation has been thought to be the major risk factor for most skin cancers. Although various biomarkers derived from the responses of human cells have been revealed, detection of these biomarkers is cumbersome, probably requires taking live human tissues, and varies significantly depending on human immune status. Here we hypothesize that the reaction of Propionibacterium acnes (P. acnes, a human resident skin commensal, to UV radiation can serve as early surrogate markers for radiation risk because the bacteria are immediately responsive to radiation. In addition, the bacteria can be readily accessible and exposed to the same field of radiation as human body. To test our hypothesis, P. acnes was exposed to UV-B radiation. The production of porphyrins in P. acnes was significantly reduced with increasing doses of UV-B. The porphyrin reduction can be detected in both P. acnes and human skin bacterial isolates. Exposure of UV-B to P. acnes- inoculated mice led to a significant decrease in porphyrin production in a single colony of P. acnes and simultaneously induced the formation of cyclobutane pyrimidine dimers (CPD in the epidermal layers of mouse skin. Mass spectrometric analysis via a linear trap quadrupole (LTQ-Orbitrap XL showed that five peptides including an internal peptide (THLPTGIVVSCQNER of a peptide chain release factor 2 (RF2 were oxidized by UV-B. Seven peptides including three internal peptides of 60 kDa chaperonin 1 were de-oxidized by UV-B. When compared to UV-B, gamma radiation also decreased the porphyrin production of P. acnes in a dose-dependent manner, but induced a different signature of protein oxidation/de-oxidation. We highlight that uncovering response of skin microbiome to radiation will facilitate the development of pre

  6. An Integrated Approach for the Monitoring of Brain and Autonomic Response of Children with Autism Spectrum Disorders during Treatment by Wearable Technologies

    Science.gov (United States)

    Billeci, Lucia; Tonacci, Alessandro; Tartarisco, Gennaro; Narzisi, Antonio; Di Palma, Simone; Corda, Daniele; Baldus, Giovanni; Cruciani, Federico; Anzalone, Salvatore M.; Calderoni, Sara; Pioggia, Giovanni; Muratori, Filippo

    2016-01-01

    Autism Spectrum Disorders (ASD) are associated with physiological abnormalities, which are likely to contribute to the core symptoms of the condition. Wearable technologies can provide data in a semi-naturalistic setting, overcoming the limitations given by the constrained situations in which physiological signals are usually acquired. In this study an integrated system based on wearable technologies for the acquisition and analysis of neurophysiological and autonomic parameters during treatment is proposed and an application on five children with ASD is presented. Signals were acquired during a therapeutic session based on an imitation protocol in ASD children. Data were analyzed with the aim of extracting quantitative EEG (QEEG) features from EEG signals as well as heart rate and heart rate variability (HRV) from ECG. The system allowed evidencing changes in neurophysiological and autonomic response from the state of disengagement to the state of engagement of the children, evidencing a cognitive involvement in the children in the tasks proposed. The high grade of acceptability of the monitoring platform is promising for further development and implementation of the tool. In particular if the results of this feasibility study would be confirmed in a larger sample of subjects, the system proposed could be adopted in more naturalistic paradigms that allow real world stimuli to be incorporated into EEG/psychophysiological studies for the monitoring of the effect of the treatment and for the implementation of more individualized therapeutic programs. PMID:27445652

  7. The vitamin D3 transcriptomic response in skin cells derived from the Atlantic bottlenose dolphin

    OpenAIRE

    Ellis, Blake C.; Gattoni-Celli, Sebastiano; Mancia, Annalaura; Kindy, Mark S.

    2009-01-01

    The Atlantic bottlenose dolphin has attracted attention due to the evident impact that environmental stressors have taken on its health. In order to better understand the mechanisms linking environmental health with dolphin health, we have established cell cultures from dolphin skin as in vitro tools for molecular evaluations. The vitamin D3 pathway is one mechanism of interest because of its well established chemopreventative and immunomodulatory properties in terrestrial mammals. On the oth...

  8. Frequency response of an electric equivalent circuit for a skin type system

    OpenAIRE

    F. Gómez-Aguilar; J. Bernal-Alvarado; J. Rosales-García; M. Guía-Calderón; T Córdova-Fraga; M. Sosa-Aquino

    2011-01-01

    In the present work we consider a theoretical representation of an electrical circuit equivalent to a multilayer biological system. The proposed system is of the skin type, containing epidermis, dermis and the subcutaneous tissue. Electrical circuit theory is used, and the behavior of the system is shown in the form of Nyquist and Bode plots. The proposed theoretical approach is a general treatment to describe the bioelectrical transport in a three-layered system, especially in the ele...

  9. The symmetry energy, neutron skin thickness and isovector dipole response of neutron-rich nuclei

    OpenAIRE

    Horvat A.; Paar N.

    2015-01-01

    The isotopic evolution of the relationship between the symmetry energy at saturation density of nuclear matter (J), neutron skin thickness (ΔR) and relevant observables related to isovector dipole excitations in neutron rich 116−136Sn isotopes has been investigated in the framework of relativistic nuclear energy density functional theory. The description employs a family of effective interactions with density dependent meson-nucleon couplings (DDME) spanning the range of values J = 30 − 38 Me...

  10. The symmetry energy, neutron skin thickness and isovector dipole response of neutron-rich nuclei

    Directory of Open Access Journals (Sweden)

    Horvat A.

    2015-01-01

    Full Text Available The isotopic evolution of the relationship between the symmetry energy at saturation density of nuclear matter (J, neutron skin thickness (ΔR and relevant observables related to isovector dipole excitations in neutron rich 116−136Sn isotopes has been investigated in the framework of relativistic nuclear energy density functional theory. The description employs a family of effective interactions with density dependent meson-nucleon couplings (DDME spanning the range of values J = 30 − 38 MeV.

  11. Effects of lidocaine constant rate infusion on sevoflurane requirement, autonomic responses, and postoperative analgesia in dogs undergoing ovariectomy under opioid-based balanced anesthesia.

    Science.gov (United States)

    Columbano, Nicolò; Secci, Fabio; Careddu, Giovanni M; Sotgiu, Giovanni; Rossi, Gabriele; Driessen, Bernd

    2012-08-01

    The effects of constant rate infusion (CRI) of lidocaine on sevoflurane (SEVO) requirements, autonomic responses to noxious stimulation, and postoperative pain relief were evaluated in dogs undergoing opioid-based balanced anesthesia. Twenty-four dogs scheduled for elective ovariectomy were randomly assigned to one of four groups: BC, receiving buprenorphine without lidocaine; FC, receiving fentanyl without lidocaine; BL, receiving buprenorphine and lidocaine; FL, receiving fentanyl and lidocaine. Dogs were anesthetized with intravenous (IV) diazepam and ketamine and anesthesia maintained with SEVO in oxygen/air. Lidocaine (2mg/kg plus 50 μg/kg/min) or saline were infused in groups BL/FL and BC/FC, respectively. After initiation of lidocaine or saline CRI IV buprenorphine (0.02 mg/kg) or fentanyl (4 μg/kg plus 8 μg/kg/h CRI) were administered IV in BC/BL and FC/FL, respectively. Respiratory and hemodynamic variables, drug plasma concentrations, and end-tidal SEVO concentrations (E'SEVO) were measured. Behaviors and pain scores were subjectively assessed 1 and 2h post-extubation. Lidocaine CRI produced median drug plasma concentrations <0.4 μg/mL during peak surgical stimulation. Lidocaine produced a 14% decrease in E'SEVO in the BL (P<0.01) but none in the FL group and no change in cardio-pulmonary responses to surgery or postoperative behaviors and pain scores in any group. Thus, depending on the opioid used, supplementing opioid-based balanced anesthesia with lidocaine (50 μg/kg/min) may not have any or only a minor impact on anesthetic outcome in terms of total anesthetic dose, autonomic responses to visceral nociception, and postoperative analgesia. PMID:22261004

  12. Hemodynamic and autonomic nervous system responses to mixed meal ingestion in healthy young and old subjects and dysautonomic patients with postprandial hypotension

    Science.gov (United States)

    Lipsitz, L. A.; Ryan, S. M.; Parker, J. A.; Freeman, R.; Wei, J. Y.; Goldberger, A. L.

    1993-01-01

    BACKGROUND. Although postprandial hypotension is a common cause of falls and syncope in elderly persons and in patients with autonomic insufficiency, the pathophysiology of this disorder remains unknown. METHODS AND RESULTS. We examined the hemodynamic, splanchnic blood pool, plasma norepinephrine (NE), and heart rate (HR) power spectra responses to a standardized 400-kcal mixed meal in 11 healthy young (age, 26 +/- 5 years) and nine healthy elderly (age, 80 +/- 5 years) subjects and 10 dysautonomic patients with symptomatic postprandial hypotension (age, 65 +/- 16 years). Cardiac and splanchnic blood pools were determined noninvasively by radionuclide scans, and forearm vascular resistance was determined using venous occlusion plethysmography. In healthy young and old subjects, splanchnic blood volume increased, but supine blood pressure remained unchanged after the meal. In both groups, HR increased and systemic vascular resistance remained stable. Forearm vascular resistance and cardiac index increased after the meal in elderly subjects, whereas these responses were highly variable and of smaller magnitude in the young. Young subjects demonstrated postprandial increases in low-frequency HR spectral power, representing cardiac sympatho-excitation, but plasma NE remained unchanged. In elderly subjects, plasma NE increased after the meal but without changes in the HR power spectrum. Patients with dysautonomia had a large postprandial decline in blood pressure associated with no change in forearm vascular resistance, a fall in systemic vascular resistance, and reduction in left ventricular end diastolic volume index. HR increased in these patients but without changes in plasma NE or the HR power spectrum. CONCLUSIONS. 1) In healthy elderly subjects, the maintenance of blood pressure homeostasis after food ingestion is associated with an increase in HR, forearm vascular resistance, cardiac index, and plasma NE. In both young and old, systemic vascular resistance is

  13. Protein kinases and transcription factors activation in response to UV-radiation of skin: implications for carcinogenesis.

    Science.gov (United States)

    López-Camarillo, César; Ocampo, Elena Aréchaga; Casamichana, Mavil López; Pérez-Plasencia, Carlos; Alvarez-Sánchez, Elizbeth; Marchat, Laurence A

    2012-01-01

    Solar ultraviolet (UV) radiation is an important environmental factor that leads to immune suppression, inflammation, photoaging, and skin carcinogenesis. Here, we reviewed the specific signal transduction pathways and transcription factors involved in the cellular response to UV-irradiation. Increasing experimental data supporting a role for p38, MAPK, JNK, ERK1/2, and ATM kinases in the response network to UV exposure is discussed. We also reviewed the participation of NF-κB, AP-1, and NRF2 transcription factors in the control of gene expression after UV-irradiation. In addition, we discussed the promising chemotherapeutic intervention of transcription factors signaling by natural compounds. Finally, we focused on the review of data emerging from the use of DNA microarray technology to determine changes in global gene expression in keratinocytes and melanocytes in response to UV treatment. Efforts to obtain a comprehensive portrait of the transcriptional events regulating photodamage of intact human epidermis after UV exposure reveals the existence of novel factors participating in UV-induced cell death. Progress in understanding the multitude of mechanisms induced by UV-irradiation could lead to the potential use of protein kinases and novel proteins as specific targets for the prevention and control of skin cancer. PMID:22312244

  14. Protein Kinases and Transcription Factors Activation in Response to UV-Radiation of Skin: Implications for Carcinogenesis

    Directory of Open Access Journals (Sweden)

    Laurence A. Marchat

    2011-12-01

    Full Text Available Solar ultraviolet (UV radiation is an important environmental factor that leads to immune suppression, inflammation, photoaging, and skin carcinogenesis. Here, we reviewed the specific signal transduction pathways and transcription factors involved in the cellular response to UV-irradiation. Increasing experimental data supporting a role for p38, MAPK, JNK, ERK1/2, and ATM kinases in the response network to UV exposure is discussed. We also reviewed the participation of NF-κB, AP-1, and NRF2 transcription factors in the control of gene expression after UV-irradiation. In addition, we discussed the promising chemotherapeutic intervention of transcription factors signaling by natural compounds. Finally, we focused on the review of data emerging from the use of DNA microarray technology to determine changes in global gene expression in keratinocytes and melanocytes in response to UV treatment. Efforts to obtain a comprehensive portrait of the transcriptional events regulating photodamage of intact human epidermis after UV exposure reveals the existence of novel factors participating in UV-induced cell death. Progress in understanding the multitude of mechanisms induced by UV-irradiation could lead to the potential use of protein kinases and novel proteins as specific targets for the prevention and control of skin cancer.

  15. Analysis and Modeling of the Galvanic Skin Response Spontaneous Component in the context of Intelligent Biofeedback Systems Development

    Science.gov (United States)

    Unakafov, A.

    2009-01-01

    The paper presents an approach to galvanic skin response (GSR) spontaneous component analysis and modeling. In the study a classification of biofeedback training methods is given, importance of intelligent methods development is shown. The INTENS method, which is perspective for intellectualization, is presented. An important problem of biofeedback training method intellectualization - estimation of the GSR spontaneous component - is solved in the main part of the work. Its main characteristics are described; results of GSR spontaneous component modeling are shown. Results of small research of an optimum material for GSR probes are presented.

  16. Resting cerebral metabolism correlates with skin conductance and functional brain activation during fear conditioning.

    Science.gov (United States)

    Linnman, Clas; Zeidan, Mohamed A; Pitman, Roger K; Milad, Mohammed R

    2012-02-01

    We investigated whether resting brain metabolism can be used to predict autonomic and neuronal responses during fear conditioning in 20 healthy humans. Regional cerebral metabolic rate for glucose was measured via positron emission tomography at rest. During conditioning, autonomic responses were measured via skin conductance, and blood oxygen level dependent signal was measured via functional magnetic resonance imaging. Resting dorsal anterior cingulate metabolism positively predicted differentially conditioned skin conductance responses. Midbrain and insula resting metabolism negatively predicted midbrain and insula functional reactivity, while dorsal anterior cingulate resting metabolism positively predicted midbrain functional reactivity. We conclude that resting metabolism in limbic areas can predict some aspects of psychophysiological and neuronal reactivity during fear learning. PMID:22207247

  17. Infrared sensing based sensitive skin

    Institute of Scientific and Technical Information of China (English)

    CAO Zheng-cai; FU Yi-li; WANG Shu-guo; JIN Bao

    2006-01-01

    Developed robotics sensitive skin is a modularized, flexible, mini-type array of infrared sensors with data processing capabilities, which can be used to cover the body of a robot. Depending on the infrared sensors and periphery processing circuit, robotics sensitive skin can in real-time provide existence and distance information about obstacles for robots within sensory areas. The methodology of designing sensitive skin and the algorithm of a mass of IR data fusion are presented. The experimental results show that the multi-joint robot with this sensitive skin can work autonomously in an unknown environment.

  18. The Influence of Autonomic Dysfunction Associated with Aging and Type 2 Diabetes on Daily Life Activities

    Directory of Open Access Journals (Sweden)

    Jerrold Petrofsky

    2012-01-01

    Full Text Available Type 2 diabetes (T2D and ageing have well documented effects on every organ in the body. In T2D the autonomic nervous system is impaired due to damage to neurons, sensory receptors, synapses and the blood vessels. This paper will concentrate on how autonomic impairment alters normal daily activities. Impairments include the response of the blood vessels to heat, sweating, heat transfer, whole body heating, orthostatic intolerance, balance, and gait. Because diabetes is more prevalent in older individuals, the effects of ageing will be examined. Beginning with endothelial dysfunction, blood vessels have impairment in their ability to vasodilate. With this and synaptic damage, the autonomic nervous system cannot compensate for effectors such as pressure on and heating of the skin. This and reduced ability of the heart to respond to stress, reduces autonomic orthostatic compensation. Diminished sweating causes the skin and core temperature to be high during whole body heating. Impaired orthostatic tolerance, impaired vision and vestibular sensing, causes poor balance and impaired gait. Overall, people with T2D must be made aware and counseled relative to the potential consequence of these impairments.

  19. Real-time Needle Steering in Response to Rolling Vein Deformation by a 9-DOF Image-Guided Autonomous Venipuncture Robot

    Science.gov (United States)

    Chen, Alvin I.; Balter, Max L.; Maguire, Timothy J.; Yarmush, Martin L.

    2015-01-01

    Venipuncture is the most common invasive medical procedure performed in the United States and the number one cause of hospital injury. Failure rates are particularly high in pediatric and elderly patients, whose veins tend to deform, move, or roll as the needle is introduced. To improve venipuncture accuracy in challenging patient populations, we have developed a portable device that autonomously servos a needle into a suitable vein under image guidance. The device operates in real time, combining near-infrared and ultrasound imaging, computer vision software, and a 9 degrees-of-freedom robot that servos the needle. In this paper, we present the kinematic and mechanical design of the latest generation robot. We then investigate in silico and in vitro the mechanics of vessel rolling and deformation in response to needle insertions performed by the robot. Finally, we demonstrate how the robot can make real-time adjustments under ultrasound image guidance to compensate for subtle vessel motions during venipuncture. PMID:26779381

  20. Differential immune response of congenic mice to ultraviolet-treated major histocompatibility complex class II-incompatible skin grafts

    International Nuclear Information System (INIS)

    The influence of ultraviolet (UVB) irradiation on the survival of H-2 class II-disparate skin grafts was studied in congenic mouse strains. Isolated skin was UVB irradiated in vitro at a dose of 40 mJ/cm2 from both sides to remove Ia immunogenicity. Immediately after irradiation the skin was transplanted onto the flank of allogeneic mice. When B10.AQR grafts were transplanted onto B10.T(6R) recipients, a significant prolongation of the survival time was observed, while 50% of the UVB-treated grafts were not rejected at all. However, in the opposite direction--i.e., B10.T(6R) grafts onto B10.AQR recipients, no significant prolongation of the survival was observed. To test whether this effect was due to a difference in susceptibility of the donor skin to UVB irradiation or to a different immune response in the recipients, (B10.T(6R) x B10.AQR) grafts were transplanted onto the parent strains. Similar results were obtained, in that UVB-treated grafts did not show a prolonged survival in B10.AQR recipients, whereas a significant prolongation (50% of the grafts survived more than 100 days) was observed in B10.T(6R) recipients. UVB-treated (B10.T(6R) x B10.AQR)F1 grafts were also transplanted onto (B10.T(6R) x C57B1/10)F1, (B10.AQR x C57B1/10)F1, (B10.T(6R) x Balb/c)F1 and (B10.AQR x Balb/c)F1 recipients--but in none of these combinations was a prolonged survival time observed. These data suggest that, in contrast to all in vitro experiments, the abrogation of the immune response by UVB treatment of the stimulator cells is, in vivo, not a general phenomenon. The genetic constitution of the responder mice seems to play an important role in determining whether or not an immune response takes place

  1. Skin-Specific Unsaturated Fatty Acids Boost the Staphylococcus aureus Innate Immune Response.

    Science.gov (United States)

    Nguyen, Minh Thu; Hanzelmann, Dennis; Härtner, Thomas; Peschel, Andreas; Götz, Friedrich

    2016-01-01

    Antimicrobial fatty acids (AFAs) protect the human epidermis against invasion by pathogenic bacteria. In this study, we questioned whether human skin fatty acids (FAs) can be incorporated into the lipid moiety of lipoproteins and whether such incorporation would have an impact on innate immune stimulation in the model organism Staphylococcus aureus USA300 JE2. This organism synthesized only saturated FAs. However, when feeding USA300 with unsaturated FAs present on human skin (C16:1, C18:1, or C18:2), those were taken up, elongated stepwise by two carbon units, and finally found in the bacterial (phospho)lipid fraction. They were also observed in the lipid moiety of lipoproteins. When USA300 JE2 was fed with the unsaturated FAs, the cells and cell lysates showed an increased innate immune activation with various immune cells and peripheral blood mononuclear cells (PBMCs). Immune activation was highest with linoleic acid (C18:2). There are several pieces of evidence that the enhanced immune stimulating effect was due to the incorporation of unsaturated FAs in lipoproteins. First, the enhanced stimulation was dependent on Toll-like receptor 2 (TLR2). Second, an lgt mutant, unable to carry out lipidation of prolipoproteins, was unable to carry out immune stimulation when fed with unsaturated FAs. Third, the supplied FAs did not significantly affect growth, protein release, or expression of the model lipoprotein Lpl1. Although S. aureus is unable to synthesize unsaturated FAs, it incorporates long-chain unsaturated FAs into its lipoproteins, with the effect that the cells are better recognized by the innate immune system. This is an additional mechanism how our skin controls bacterial colonization and infection. PMID:26502910

  2. Augmented supraorbital skin sympathetic nerve activity responses to symptom trigger events in rosacea patients.

    Science.gov (United States)

    Metzler-Wilson, Kristen; Toma, Kumika; Sammons, Dawn L; Mann, Sarah; Jurovcik, Andrew J; Demidova, Olga; Wilson, Thad E

    2015-09-01

    Facial flushing in rosacea is often induced by trigger events. However, trigger causation mechanisms are currently unclear. This study tested the central hypothesis that rosacea causes sympathetic and axon reflex-mediated alterations resulting in trigger-induced symptomatology. Twenty rosacea patients and age/sex-matched controls participated in one or a combination of symptom triggering stressors. In protocol 1, forehead skin sympathetic nerve activity (SSNA; supraorbital microneurography) was measured during sympathoexcitatory mental (2-min serial subtraction of novel numbers) and physical (2-min isometric handgrip) stress. In protocol 2, forehead skin blood flow (laser-Doppler flowmetry) and transepithelial water loss/sweat rate (capacitance hygrometry) were measured during sympathoexcitatory heat stress (whole body heating by perfusing 50°C water through a tube-lined suit). In protocol 3, cheek, forehead, forearm, and palm skin blood flow were measured during nonpainful local heating to induce axon reflex vasodilation. Heart rate (HR) and mean arterial pressure (MAP) were recorded via finger photoplethysmography to calculate cutaneous vascular conductance (CVC; flux·100/MAP). Higher patient transepithelial water loss was observed (rosacea 0.20 ± 0.02 vs. control 0.10 ± 0.01 mg·cm(-2)·min(-1), P MAP changes were not different between groups during sympathoexcitatory stressors or local heating. SSNA during early mental (32 ± 9 and 9 ± 4% increase) and physical (25 ± 4 and 5 ± 1% increase, rosacea and controls, respectively) stress was augmented in rosacea (both P < 0.05). Heat stress induced more rapid sweating and cutaneous vasodilation onset in rosacea compared with controls. No axon reflex vasodilation differences were observed between groups. These data indicate that rosacea affects SSNA and that hyperresponsiveness to trigger events appears to have a sympathetic component. PMID:26133800

  3. Complete Electric Dipole Response and the Neutron Skin in 208Pb

    International Nuclear Information System (INIS)

    A benchmark experiment on 208Pb shows that polarized proton inelastic scattering at very forward angles including 0 deg. is a powerful tool for high-resolution studies of electric dipole (E1) and spin magnetic dipole (M1) modes in nuclei over a broad excitation energy range to test up-to-date nuclear models. The extracted E1 polarizability leads to a neutron skin thickness rskin=0.156-0.021+0.025 fm in 208Pb derived within a mean-field model [Phys. Rev. C 81, 051303 (2010)], thereby constraining the symmetry energy and its density dependence relevant to the description of neutron stars.

  4. Skin Diseases: Skin Health and Skin Diseases

    Science.gov (United States)

    ... threatening skin cancer. The "ABCD's" of what to watch for with the moles on your skin: Asymmetry : ... skin cancer has been increasing. Exposure to the sun is a major factor. In 2006, over 30 ...

  5. Pinpointing brainstem mechanisms responsible for autonomic dysfunction in Rett syndrome: therapeutic perspectives for 5-HT1A agonists.

    Science.gov (United States)

    Abdala, Ana P; Bissonnette, John M; Newman-Tancredi, Adrian

    2014-01-01

    Rett syndrome is a neurological disorder caused by loss of function of methyl-CpG-binding protein 2 (MeCP2). Reduced function of this ubiquitous transcriptional regulator has a devastating effect on the central nervous system. One of the most severe and life-threatening presentations of this syndrome is brainstem dysfunction, which results in autonomic disturbances such as breathing deficits, typified by episodes of breathing cessation intercalated with episodes of hyperventilation or irregular breathing. Defects in numerous neurotransmitter systems have been observed in Rett syndrome both in animal models and patients. Here we dedicate special attention to serotonin due to its role in promoting regular breathing, increasing vagal tone, regulating mood, alleviating Parkinsonian-like symptoms and potential for therapeutic translation. A promising new symptomatic strategy currently focuses on regulation of serotonergic function using highly selective serotonin type 1A (5-HT1A) "biased agonists." We address this newly emerging therapy for respiratory brainstem dysfunction and challenges for translation with a holistic perspective of Rett syndrome, considering potential mood and motor effects. PMID:24910619

  6. Altered Cortical Responsiveness to Pain Stimuli after High Frequency Electrical Stimulation of the Skin in Patients with Persistent Pain after Inguinal Hernia Repair

    OpenAIRE

    Broeke, E.N. van den; Koeslag, L.; Arendsen, L.J.; Nienhuijs, S.W.; Rosman, C.; van Rijn, C.M.

    2013-01-01

    Background High Frequency electrical Stimulation (HFS) of the skin induces enhanced brain responsiveness expressed as enhanced Event-Related Potential (ERP) N1 amplitude to stimuli applied to the surrounding unconditioned skin in healthy volunteers. The aim of the present study was to investigate whether this enhanced ERP N1 amplitude could be a potential marker for altered cortical sensory processing in patients with persistent pain after surgery. Materials and Methods Nineteen male patients...

  7. Altered Cortical Responsiveness to Pain Stimuli after High Frequency Electrical Stimulation of the Skin in Patients with Persistent Pain after Inguinal Hernia Repair

    OpenAIRE

    van den Broeke, Emanuel N; Lonneke Koeslag; Arendsen, Laura J.; Nienhuijs, Simon W; Camiel Rosman; van Rijn, Clementina M.; Oliver H G Wilder-Smith; Harry van Goor

    2013-01-01

    BACKGROUND: High Frequency electrical Stimulation (HFS) of the skin induces enhanced brain responsiveness expressed as enhanced Event-Related Potential (ERP) N1 amplitude to stimuli applied to the surrounding unconditioned skin in healthy volunteers. The aim of the present study was to investigate whether this enhanced ERP N1 amplitude could be a potential marker for altered cortical sensory processing in patients with persistent pain after surgery. MATERIALS AND METHODS: Nineteen male patien...

  8. Altered cortical responsiveness to pain stimuli after high frequency electrical stimulation of the skin in patients with persistent pain after inguinal hernia repair

    OpenAIRE

    Broeke, E.N. van den; Koeslag, L.; Arendsen, L.J.; Nienhuijs, S.W.; Rosman, C.; Rijn, C.M. van; Wilder-Smith, O.H.G.; van Goor, H.

    2013-01-01

    BACKGROUND: High Frequency electrical Stimulation (HFS) of the skin induces enhanced brain responsiveness expressed as enhanced Event-Related Potential (ERP) N1 amplitude to stimuli applied to the surrounding unconditioned skin in healthy volunteers. The aim of the present study was to investigate whether this enhanced ERP N1 amplitude could be a potential marker for altered cortical sensory processing in patients with persistent pain after surgery. MATERIALS AND METHODS: Nineteen male patien...

  9. Adaptive technique for matching the spectral response in skin lesions' images

    Science.gov (United States)

    Pavlova, P.; Borisova, E.; Pavlova, E.; Avramov, L.

    2015-03-01

    The suggested technique is a subsequent stage for data obtaining from diffuse reflectance spectra and images of diseased tissue with a final aim of skin cancer diagnostics. Our previous work allows us to extract patterns for some types of skin cancer, as a ratio between spectra, obtained from healthy and diseased tissue in the range of 380 - 780 nm region. The authenticity of the patterns depends on the tested point into the area of lesion, and the resulting diagnose could also be fixed with some probability. In this work, two adaptations are implemented to localize pixels of the image lesion, where the reflectance spectrum corresponds to pattern. First adapts the standard to the personal patient and second - translates the spectrum white point basis to the relative white point of the image. Since the reflectance spectra and the image pixels are regarding to different white points, a correction of the compared colours is needed. The latest is done using a standard method for chromatic adaptation. The technique follows the steps below: -Calculation the colorimetric XYZ parameters for the initial white point, fixed by reflectance spectrum from healthy tissue; -Calculation the XYZ parameters for the distant white point on the base of image of nondiseased tissue; -Transformation the XYZ parameters for the test-spectrum by obtained matrix; -Finding the RGB values of the XYZ parameters for the test-spectrum according sRGB; Finally, the pixels of the lesion's image, corresponding to colour from the test-spectrum and particular diagnostic pattern are marked with a specific colour.

  10. Effects of repeated administration of intradermal skin test by Mantoux method on delayed-type hypersensitivity responses in healthy young and elderly subjects

    Science.gov (United States)

    Multi-test CMI to test immune response is no longer commercially available. DTH response is a highly suitable marker of immune function. Because delayed-type hypersensitivity (DTH) skin test can predict morbidity and mortality, it may be clinically meaningful test to evaluate the effect of nutrition...

  11. Early atherosclerosis and cardiac autonomic responses to mental stress: a population-based study of the moderating influence of impaired endothelial function

    Directory of Open Access Journals (Sweden)

    Juonala Markus

    2010-03-01

    Full Text Available Abstract Background Acute mental stress may contribute to the cardiovascular disease progression via autonomic nervous system controlled negative effects on the endothelium. The joint effects of stress-induced sympathetic or parasympathetic activity and endothelial function on atherosclerosis development have not been investigated. The present study aims to examine the interactive effect of acute mental stress-induced cardiac reactivity/recovery and endothelial function on the prevalence of carotid atherosclerosis. Methods Participants were 81 healthy young adults aged 24-39 years. Preclinical atherosclerosis was assessed by carotid intima-media thickness (IMT and endothelial function was measured as flow-mediated dilatation (FMD using ultrasound techniques. We also measured heart rate, respiratory sinus arrhythmia (RSA, and pre-ejection period (PEP in response to the mental arithmetic and speech tasks. Results We found a significant interaction of FMD and cardiac RSA recovery for IMT (p = 0.037, and a significant interaction of FMD and PEP recovery for IMT (p = 0.006. Among participants with low FMD, slower PEP recovery was related to higher IMT. Among individuals with high FMD, slow RSA recovery predicted higher IMT. No significant interactions of FMD and cardiac reactivity for IMT were found. Conclusions Cardiac recovery plays a role in atherosclerosis development in persons with high and low FMD. The role of sympathetically mediated cardiac activity seems to be more important in those with impaired FMD, and parasympathetically mediated in those with relatively high FMD. The development of endothelial dysfunction may be one possible mechanism linking slow cardiac recovery and atherosclerosis via autonomic nervous system mediated effect.

  12. A Study on the Effects of Sympathetic Skin Response Parameters in Diagnosis of Fibromyalgia Using Artificial Neural Networks.

    Science.gov (United States)

    Ozkan, Ozhan; Yildiz, Murat; Arslan, Evren; Yildiz, Sedat; Bilgin, Suleyman; Akkus, Selami; Koyuncuoglu, Hasan R; Koklukaya, Etem

    2016-03-01

    Fibromyalgia syndrome (FMS), usually observed commonly in females over age 30, is a rheumatic disease accompanied by extensive chronic pain. In the diagnosis of the disease non-objective psychological tests and physiological tests and laboratory test results are evaluated and clinical experiences stand out. However, these tests are insufficient in differentiating FMS with similar diseases that demonstrate symptoms of extensive pain. Thus, objective tests that would help the diagnosis are needed. This study analyzes the effect of sympathetic skin response (SSR) parameters on the auxiliary tests used in FMS diagnosis, the laboratory tests and physiological tests. The study was conducted in Suleyman Demirel University, Faculty of Medicine, Physical Medicine and Rehabilitation Clinic in Turkey with 60 patients diagnosed with FMS for the first time and a control group of 30 healthy individuals. In the study all participants underwent laboratory tests (blood tests), certain physiological tests (pulsation, skin temperature, respiration) and SSR measurements. The test data and SSR parameters obtained were classified using artificial neural network (ANN). Finally, in the ANN framework, where only laboratory and physiological test results were used as input, a simulation result of 96.51 % was obtained, which demonstrated diagnostic accuracy. This data, with the addition of SSR parameter values obtained increased to 97.67 %. This result including SSR parameters - meaning a higher diagnostic accuracy - demonstrated that SSR could be a new auxillary diagnostic method that could be used in the diagnosis of FMS. PMID:26645318

  13. Genetic covariance between psychopathic traits and anticipatory skin conductance responses to threat: Evidence for a potential endophenotype.

    Science.gov (United States)

    Wang, Pan; Gao, Yu; Isen, Joshua; Tuvblad, Catherine; Raine, Adrian; Baker, Laura A

    2015-11-01

    The genetic architecture of the association between psychopathic traits and reduced skin conductance responses (SCRs) is poorly understood. By using 752 twins aged 9-10 years, this study investigated the heritability of two SCR measures (anticipatory SCRs to impending aversive stimuli and unconditioned SCRs to the aversive stimuli themselves) in a countdown task. The study also investigated the genetic and environmental sources of the covariance between these SCR measures and two psychopathic personality traits: impulsive/disinhibited (reflecting impulsive-antisocial tendencies) and manipulative/deceitful (reflecting the affective-interpersonal features). For anticipatory SCRs, 27%, 14%, and 59% of the variation was due to genetic, shared environmental, and nonshared environmental effects, respectively, while the percentages for unconditioned SCRs were 44%, 2%, and 54%. The manipulative/deceitful (not impulsive/disinhibited) traits were negatively associated with both anticipatory SCRs (r = -.14, p psychopathic traits in males. PMID:26439076

  14. Autonomic Function in Neurodegenerative Diseases

    DEFF Research Database (Denmark)

    Sørensen, Gertrud Laura; Jennum, Poul Jørgen

    2013-01-01

    involving brain stem areas, which is consistent with the Braak hypothesis. In the narcolepsy patients, it was shown that a reduced HRR to arousals was primarily predicted by hypocretin deficiency in both rapid-eye-movement (REM) and non-REM sleep, independent of cataplexy and other factors. The results......, which includes the cardiac centre and controls autonomic functions, and therefore autonomic dysfunction may be experienced early in the disease course. Sleep disturbances are also common non-motor complications of PD, and therefore PD patients undergo polysomnography at the Danish Center for Sleep...... narcolepsy patients on autonomic function and on the sleep transition rate. The results showed an attenuated heart rate response (HRR) in PD patients compared to controls and early PD (iRBD patients). Also iRBD patients had an attenuated HRR compared to control subjects, and the method to measure the HRR may...

  15. 皮肤细胞DNA光损伤后反应机制研究进展%Mechanisms underlying the response of skin cells to DNA photodamage

    Institute of Scientific and Technical Information of China (English)

    闵玮; 骆丹

    2011-01-01

    紫外线可引起皮肤细胞DNA损伤,诱发皮肤肿瘤和光老化.DNA损伤类型包括:DNA单链断裂、链间交联、核苷酸碱基修饰等.细胞拥有DNA损伤后反应机制以维持基因组稳定,如细胞周期监控点、DNA修复和细胞早衰等.细胞周期监控系统检测到染色体结构异常时将引起细胞周期停滞并启动修复进程;而在检测到无法修复的损伤时则会诱使细胞衰老.因此皮肤光老化也是一种预防肿瘤发生的防御机制,ATR-Chk1信号通路在其中起着关键的调控作用.%Ultraviolet radiation can induce DNA damage in skin cells, cause skin tumors and accelerate skin photoaging. UV-induced DNA damage in skin cells includes DNA single strand breaks, DNA interstrand cross-links and nucleotide base modifications. Skin cells could exert DNA damage responses, such as cell cycle checkpoints, DNA repair and premature senescence to prevent genomic instability. When cell cycle checkpoint systems sense the abnormal chromosomal DNA structures, they execute cell cycle arrest and DNA repair process will be initiated. Cellular senescence is also executed by checkpoint responses when unrepairble and extensive chromosomal abnormalities are detected. So skin photoaging is thought to be one of the major mechanisms against skin carcinogenesis. ATR-Chk1 signaling pathway plays a key role in the regulation of DNA damage response process.

  16. Autonomic Nervous System Disorders

    Science.gov (United States)

    Your autonomic nervous system is the part of your nervous system that controls involuntary actions, such as the beating of your heart ... breathing and swallowing Erectile dysfunction in men Autonomic nervous system disorders can occur alone or as the result ...

  17. Autoimmune Autonomic Ganglionopathy

    Science.gov (United States)

    ... Accessed 9/2/2015. Autoimmune Autonomic Ganglionopathy Summary. Dysautonomia International . http://www.dysautonomiainternational.org/page.php?ID= ... page Basic Information In Depth Information Basic Information Dysautonomia International offers an information page on Autoimmune autonomic ...

  18. EFFECTS OF MONOSODIUM GLUTAMATE (UMAMI TASTE) WITH AND WITHOUT GUANOSINE 5'-MONOPHOSPHATE ON RAT AUTONOMIC RESPONSES TO MEALS

    NARCIS (Netherlands)

    STEFFENS, AB; LEUVENINK, H; SCHEURINK, AJW

    1994-01-01

    Monosodium glutamate (MSG) is used as a food additive to improve the taste of food. The effect of MSG on sweet taste is enhanced by guanosine 5'-monophosphate (GMP). Because increased palatability is known to increase the vagally mediated preabsorptive insulin response (PIR), we hypothesized that MS

  19. A Simple Autonomous Current-Sharing Control Strategy for Fast Dynamic Response of Parallel Inverters in Islanded Microgrids

    DEFF Research Database (Denmark)

    Guan, Yajuan; Vasquez, Juan Carlos; Guerrero, Josep M.

    2014-01-01

    This paper proposed a novel control strategy based on a virtual resistance and a phase locked loop for parallel three-phase inverters. The proposed controller can overcome the drawbacks of the conventional droop control such as slow transient response, complex design, and limited stability margins...

  20. Aging Skin

    Science.gov (United States)

    ... email address Submit Home > Healthy Aging > Wellness Healthy Aging Aging skin More information on aging skin When it ... treated early. Return to top More information on Aging skin Read more from womenshealth.gov Varicose Veins ...

  1. Skin Conditions

    Science.gov (United States)

    Your skin is your body's largest organ. It covers and protects your body. Your skin Holds body fluids in, preventing dehydration Keeps harmful ... it Anything that irritates, clogs, or inflames your skin can cause symptoms such as redness, swelling, burning, ...

  2. Stratum corneum cytokines and skin irritation response to sodium lauryl sulfate

    NARCIS (Netherlands)

    C.M. de Jongh; M.M. Verberk; C.E.T. Withagen; J.J.L. Jacobs; T. Rustemeyer; S. Kezic

    2006-01-01

    Little is known about cytokines involved in chronic irritant contact dermatitis. Individual cytokine profiles might explain at least part of the differences in the individual response to irritation. Our objective was to investigate the relation between baseline stratum corneum (SC) cytokine levels a

  3. Response of mouse skin to tattooing: use of SKH-1 mice as a surrogate model for human tattooing

    International Nuclear Information System (INIS)

    Tattooing is a popular cosmetic practice involving more than 45 million US citizens. Since the toxicology of tattoo inks and pigments used to formulate tattoo inks has not been reported, we studied the immunological impact of tattooing and determined recovery time from this trauma. SKH-1 hairless mice were tattooed using commercial tattoo inks or suspensions of titanium dioxide, cadmium sulfide, or iron oxide, and sacrificed at 0.5, 1, 3, 4, 7, or 14 days post-tattooing. Histological evaluation revealed dermal hemorrhage at 0.5 and 1 day. Acute inflammation and epidermal necrosis were initiated at 0.5 day decreasing in incidence by day 14. Dermal necrosis and epidermal hyperplasia were prominent by day 3, reducing in severity by day 14. Chronic active inflammation persisted in all tattooed mice from day 3 to 14 post-tattooing. Inguinal and axillary lymph nodes were pigmented, the inguinal being most reactive as evidenced by lymphoid hyperplasia and polymorphonuclear infiltration. Cutaneous nuclear protein concentrations of nuclear factor-kappa B were elevated between 0.5 and 4 days. Inflammatory and proliferative biomarkers, cyclooxygenase-1, cyclooxygenase-2, and ornithine decarboxylase protein levels were elevated between 0.5 and 4 days in the skin and decreased to control levels by day 14. Interleukin-1 beta and interleukin-10 were elevated in the lymph nodes but suppressed in the tattooed skin, with maximal suppression occurring between days 0.5 and 4. These data demonstrate that mice substantially recover from the tattooing insult by 14 days, leaving behind pigment in the dermis and the regional lymph nodes. The response seen in mice is similar to acute injury seen in humans, suggesting that the murine model might be a suitable surrogate for investigating the toxicological and phototoxicological properties of ingredients used in tattooing

  4. Effects of vocalization on cardiovascular and electrodermal responses during mental arithmetic.

    Science.gov (United States)

    Tomaka, J; Blascovich, J; Swart, L

    1994-10-01

    This study assessed the contribution of vocalization to autonomic responses during mental arithmetic. Specifically this study compared the autonomic responses of subjects during aloud and silent phases of repeated mental arithmetic tasks. The results were consistent for both tasks. As expected, heart rate and skin conductance responses were elevated during the aloud phases. Preejection period and cardiac output reactions, however, were greater during the silent phases. Furthermore, stroke volume declined during the aloud phases, but was maintained near resting levels during the silent phases. There were no phase effects for systolic pressure, diastolic pressure, or total peripheral resistance. The pattern of autonomic responses between aloud and silent phases of mental arithmetic suggest that the relationship between vocalization and autonomic response is not unidirectional but varies depending on the physiological parameter under investigation. PMID:7876036

  5. Th17 and regulatory T cells contribute to the in situ immune response in skin lesions of Jorge Lobo's disease.

    Science.gov (United States)

    Kanashiro-Galo, Luciane; Pagliari, Carla; Barboza, Tania Cristina; de Brito, Arival Cardoso; Xavier, Marilia Brasil; de Oliveira, Clivia Maria Moraes; Unger, Deborah Aben Athar; Sotto, Mirian Nacagami; Quaresma, Juarez Antonio Simões; Duarte, Maria Irma Seixas

    2016-01-01

    Jorge Lobo's disease (JLD) is a chronic granulomatous mycosis described in various Latin American countries. The main objective of the present study was to investigate the possible role of Th17 and Foxp3+ Treg cells in the pathogenesis of Jorge Lobo's disease. Human skin biopsies were submitted to an immunohistochemistry protocol to detect Foxp3, interleukin (IL)-1beta, CD25, IL-6, IL-17, and IL-23. The epidermis presented acanthosis, hyperkeratosis, and frequent presence of fungi. The dermis presented inflammatory infiltrate comprising macrophages, lymphocytes, epithelioid and multinucleated cells, and an intense number of fungi. Foxp3+ Treg cells and IL-17+ cells were visualized in lymphocytes in the inflammatory infiltrate. IL-1, IL-2R (CD25), IL-6, and IL-23 were visualized in the dermis, intermingled with fungal cells, permeating or participating of the granuloma. Following IL-17, the most prominent cytokine was IL-6. IL-23 and cells expressing CD25 were present in fewer number. The comparative analysis between IL-17 and Foxp3 demonstrated a statistically significant increased number of IL-17+ cells. Th17 cells play a role in the immune response of JLD. IL-1beta and IL-6 added to the previously described increased number of TGF-beta would stimulate such pattern of response. Th17 cells could be present as an effort to modulate the local immune response; however, high levels of a Th17 profile could overcome the role of Treg cells. The unbalance between Treg/Th17 cells seems to corroborate with the less effective immune response against the fungus. PMID:26333354

  6. Inflammatory response, parasite load and AgNOR expression in ear skin of symptomatic and asymptomatic Leishmania (Leishmania chagasi infected dogs

    Directory of Open Access Journals (Sweden)

    Verçosa BLA

    2011-01-01

    Full Text Available The skin has an important role in the transmission of visceral leishmaniasis (VL as the infection pathway in dogs. To better characterize the inflammatory response of intact skin in VL, sixty infected dogs (30 symptomatic and 30 asymptomatic and six non-infected controls were studied. Diagnosis of visceral leishmaniasis was confirmed by RIFI and ELISA; direct visualization of the parasite in bone marrow aspirate; imprints of popliteal lymph nodes, spleen, liver and skin; culture in NNN-phase liquid Schneider's medium; and PCR (performed only in the ear skin. Amastigote forms of the parasite in intact skin were found only in symptomatic dogs. Inflammatory infiltrates were observed in all groups, varying from intense and/or moderate in symptomatic to discrete and/or negligible in asymptomatic and control animals. Parasite load was associated with the intensity of the inflammatory response and with clinical manifestations in canine visceral leishmaniasis. AgNOr as active transcription markers were expressed in inflammatory cells and within apoptotic bodies in all groups, including controls, with no statistical difference. Therefore, cell activation and transcription do occur in both symptomatic and asymptomatic canine visceral leishmaniasis and may result in more necrosis and inflammation or in apoptosis and less symptoms, depending on the parasite load.

  7. Arsenic transformation predisposes human skin keratinocytes to UV-induced DNA damage yet enhances their survival apparently by diminishing oxidant response

    International Nuclear Information System (INIS)

    Inorganic arsenic and UV, both human skin carcinogens, may act together as skin co-carcinogens. We find human skin keratinocytes (HaCaT cells) are malignantly transformed by low-level arsenite (100 nM, 30 weeks; termed As-TM cells) and with transformation concurrently undergo full adaptation to arsenic toxicity involving reduced apoptosis and oxidative stress response to high arsenite concentrations. Oxidative DNA damage (ODD) is a possible mechanism in arsenic carcinogenesis and a hallmark of UV-induced skin cancer. In the current work, inorganic arsenite exposure (100 nM) did not induce ODD during the 30 weeks required for malignant transformation. Although acute UV-treatment (UVA, 25 J/cm2) increased ODD in passage-matched control cells, once transformed by arsenic to As-TM cells, acute UV actually further increased ODD (> 50%). Despite enhanced ODD, As-TM cells were resistant to UV-induced apoptosis. The response of apoptotic factors and oxidative stress genes was strongly mitigated in As-TM cells after UV exposure including increased Bcl2/Bax ratio and reduced Caspase-3, Nrf2, and Keap1 expression. Several Nrf2-related genes (HO-1, GCLs, SOD) showed diminished responses in As-TM cells after UV exposure consistent with reduced oxidant stress response. UV-exposed As-TM cells showed increased expression of cyclin D1 (proliferation gene) and decreased p16 (tumor suppressor). UV exposure enhanced the malignant phenotype of As-TM cells. Thus, the co-carcinogenicity between UV and arsenic in skin cancer might involve adaptation to chronic arsenic exposure generally mitigating the oxidative stress response, allowing apoptotic by-pass after UV and enhanced cell survival even in the face of increased UV-induced oxidative stress and increased ODD. - Highlights: → Arsenic transformation adapted to UV-induced apoptosis. → Arsenic transformation diminished oxidant response. → Arsenic transformation enhanced UV-induced DNA damage.

  8. Nordihydroguaiaretic Acid from Creosote Bush (Larrea tridentata Mitigates 12-O-Tetradecanoylphorbol-13-Acetate-Induced Inflammatory and Oxidative Stress Responses of Tumor Promotion Cascade in Mouse Skin

    Directory of Open Access Journals (Sweden)

    Shakilur Rahman

    2011-01-01

    Full Text Available Nordihydroguaiaretic acid (NDGA is a phenolic antioxidant found in the leaves and twigs of the evergreen desert shrub, Larrea tridentata (Sesse and Moc. ex DC Coville (creosote bush. It has a long history of traditional medicinal use by the Native Americans and Mexicans. The modulatory effects of topically applied NDGA was studied on acute inflammatory and oxidative stress responses in mouse skin induced by stage I tumor promoting agent, 12-O-tetradecanoylphorbol-13-acetate (TPA. Double TPA treatment adversely altered many of the marker responses of stage I skin tumor promotion cascade. Pretreatment of NDGA in TPA-treated mice mitigated cutaneous lipid peroxidation and inhibited production of hydrogen peroxide. NDGA treatment also restored reduced glutathione level and activities of antioxidant enzymes. Elevated activities of myeloperoxidase, xanthine oxidase and skin edema formation in TPA-treated mice were also lowered by NDGA indicating a restrained inflammatory response. Furthermore, results of histological study demonstrated inhibitory effect of NDGA on cellular inflammatory responses. This study provides a direct evidence of antioxidative and anti-inflammatory properties of NDGA against TPA-induced cutaneous inflammation and oxidative stress corroborating its chemopreventive potential against skin cancer.

  9. Potent response of QS-21 as a vaccine adjuvant in the skin when delivered with the Nanopatch, resulted in adjuvant dose sparing.

    Science.gov (United States)

    Ng, Hwee-Ing; Fernando, Germain J P; Depelsenaire, Alexandra C I; Kendall, Mark A F

    2016-01-01

    Adjuvants play a key role in boosting immunogenicity of vaccines, particularly for subunit protein vaccines. In this study we investigated the induction of antibody response against trivalent influenza subunit protein antigen and a saponin adjuvant, QS-21. Clinical trials of QS-21 have demonstrated the safety but, also a need of high dose for optimal immunity, which could possibly reduce patient acceptability. Here, we proposed the use of a skin delivery technology - the Nanopatch - to reduce both adjuvant and antigen dose but also retain its immune stimulating effects when compared to the conventional needle and syringe intramuscular (IM) delivery. We have demonstrated that Nanopatch delivery to skin requires only 1/100(th) of the IM antigen dose to induce equivalent humoral response. QS-21 enhanced humoral response in both skin and muscle route. Additionally, Nanopatch has demonstrated 30-fold adjuvant QS-21 dose sparing while retaining immune stimulating effects compared to IM. QS-21 induced localised, controlled cell death in the skin, suggesting that the danger signals released from dead cells contributed to the enhanced immunogenicity. Taken together, these findings demonstrated the suitability of reduced dose of QS-21 and the antigen using the Nanopatch to enhance humoral responses, and the potential to increase patient acceptability of QS-21 adjuvant. PMID:27404789

  10. Cardiovascular autonomic neuropathy in the diabetic patients.

    Directory of Open Access Journals (Sweden)

    Maria Eugenia Niño Mantilla

    2007-11-01

    Full Text Available the dysfunction of the autonomic nervous system is a serious problem in diabetic patients. The cardiovacular autonomic neuropathy is the most important autonomic dysfuntion for it´s implication in the increasesof the mortality rate in diabetis patients. tis ethiopatogenesis is the result of a multifactorial process caused by chronic hyperglycemia, ending up in damage of the autonomic fibers thet innervate the heart and blood vessels, leading to dysfuntional hearth rate control and abnormal vascular dynamics. the associated clinical manifestations include orthotatic hypotension, excecise intolerance, intraoperative cardiovascular liability and silent myocardial ischemia. Being important its recognition, quantitative test to evaluate the cardiovascular funtion, to value its evolution and the effects of the treatment ahould be done, being the most used, the hearth rate response to standing test, and teh valsalva maneuver. the handling of this entity is done improving control of glucose blood levels its the most effective way to prevent the cardiovascular autonomic neuropathy in the diabetic patients.

  11. Design and fabrication of a sensor integrated MEMS/NANO-skin system for human physiological response measurement

    Science.gov (United States)

    Leng, Hongjie; Lin, Yingzi

    2010-04-01

    Human state in human-machine systems highly affects the system performance, and should be monitored. Physiological cues are more suitable for monitoring the human state in human-machine system. This study was focused on developing a new sensing system, i.e. NANO-Skin, to non-intrusively measure physiological cues from human-machine contact surfaces for human state recognition. The first part was to analyze the relation between human state and physiological cues. Generally, heart rate, skin conductance, skin temperature, operating force, blood alcohol concentration, sweat rate, and electromyography have close relation with human state, and can be measured from human skin. The second part was to compare common sensors, MEMS sensors, and NANO sensors. It was found that MEMS sensors and NANO sensors can offer unique contributions to the development of NANO-Skin. The third part was to discuss the design and manufacture of NANO-Skin. The NANO-Skin involves five components, the flexible substrate, sensors, special integrated circuit, interconnection between sensors and special integrated circuit, and protection layer. Experiments were performed to verify the measurement accuracy of NANO-Skin. It is feasible to use NANO-Skins to non-intrusively measure physiological cues from human-machine contact surfaces for human state recognition.

  12. A single bout of exercise with a flexible pole induces significant cardiac autonomic responses in healthy men

    Directory of Open Access Journals (Sweden)

    Cristiane M. Ogata

    2014-09-01

    Full Text Available OBJECTIVES: Flexible poles can provide rapid eccentric and concentric muscle contractions. Muscle vibration is associated with a "tonic vibration reflex” that is stimulated by a sequence of rapid muscle stretching, activation of the muscle spindles and stimulation of a response that is similar to the myotatic reflex. Literature studies analyzing the acute cardiovascular responses to different exercises performed with this instrument are lacking. We investigated the acute effects of exercise with flexible poles on the heart period in healthy men. METHOD: The study was performed on ten young adult males between 18 and 25 years old. We evaluated the heart rate variability in the time and frequency domains. The subjects remained at rest for 10 min. After the rest period, the volunteers performed the exercises with the flexible poles. Immediately after the exercise protocol, the volunteers remained seated at rest for 30 min and their heart rate variability was analyzed. RESULTS: The pNN50 was reduced at 5-10 and 15-20 min after exercise compared to 25-30 min after exercise (p = 0.0019, the SDNN was increased at 25-30 min after exercise compared to at rest and 0-10 min after exercise (p = 0.0073 and the RMSSD was increased at 25-30 min after exercise compared to 5-15 min after exercise (p = 0.0043. The LF in absolute units was increased at 25-30 min after exercise compared to 5-20 min after exercise (p = 0.0184. CONCLUSION: A single bout of exercise with a flexible pole reduced the heart rate variability and parasympathetic recovery was observed approximately 30 min after exercise.

  13. Neuromuscular abnormality and autonomic dysfunction in patients with cerebrotendinous xanthomatosis

    Directory of Open Access Journals (Sweden)

    Huang Chi-Ren

    2011-05-01

    Full Text Available Abstract Background Cerebrotendinous xanthomatosis (CTX is a rare lipid-storage disease. Neuromuscular abnormality and autonomic system (ANS dysfuction in CTX are rarely examined in large-scale studies in the literature. We studied the peripheral nervous system, myopathology, and autonomic system of four CTX patients and performed a literature review of the reported CTX patients with peripheral neuropathy. Methods Four biochemically and genetically confirmed CTX patients, belonging to two families, were included for study and all received nerve conduction study (NCS, muscle biopsy for histopathologic and ultrastructural study, skin biopsy for intraepidermal nerve fiber (INEF density measurement, autonomic testings including sympathetic skin response, R-R interval variation and head-up tilt test using an automated tilt table to record the changes of blood pressure and heart rate in different postures. The Q-Sweat test was also applied for the detection of sweat amount and onset time of response. The clinical characteristics, study methods and results of 13 studies of peripheral neuropathy in CTX patients in the literature were also recorded for analysis. Results The results of NCS study showed axonal sensory-motor polyneuropathy in three CTX cases and mixed axonal and demyelinating sensor-motor polyneuropathy in one. The myopathological and histopathologic studies revealed mild denervation characteristics, but the ultrastructural study revealed changes of mitochondria and the membranous system, and increased amounts of glycogen, lipofuscin and lipid deposition. The ANS study revealed different degrees of abnormalities in the applied tests and the INEF density measurement showed small fiber neuropathy in three of the four CTX patients. The literature review of peripheral neuropathy in CTX revealed different types of peripheral neuropathy, of which axonal peripheral neuropathy was the most common. Conclusions Peripheral neuropathy, especially the

  14. Autonomous Mission Operations Roadmap

    Science.gov (United States)

    Frank, Jeremy David

    2014-01-01

    As light time delays increase, the number of such situations in which crew autonomy is the best way to conduct the mission is expected to increase. However, there are significant open questions regarding which functions to allocate to ground and crew as the time delays increase. In situations where the ideal solution is to allocate responsibility to the crew and the vehicle, a second question arises: should the activity be the responsibility of the crew or an automated vehicle function? More specifically, we must answer the following questions: What aspects of mission operation responsibilities (Plan, Train, Fly) should be allocated to ground based or vehicle based planning, monitoring, and control in the presence of significant light-time delay between the vehicle and the Earth?How should the allocated ground based planning, monitoring, and control be distributed across the flight control team and ground system automation? How should the allocated vehicle based planning, monitoring, and control be distributed between the flight crew and onboard system automation?When during the mission should responsibility shift from flight control team to crew or from crew to vehicle, and what should the process of shifting responsibility be as the mission progresses? NASA is developing a roadmap of capabilities for Autonomous Mission Operations for human spaceflight. This presentation will describe the current state of development of this roadmap, with specific attention to in-space inspection tasks that crews might perform with minimum assistance from the ground.

  15. Increased skin conductance responses and neural activity during fear conditioning are associated with a repressive coping style

    Directory of Open Access Journals (Sweden)

    Tim eKlucken

    2015-06-01

    Full Text Available The investigation of individual differences in coping styles in response to fear conditioning is an important issue for a better understanding of the etiology and treatment of psychiatric disorders. It has been assumed that an avoidant (repressive coping style is characterized by increased emotion regulation efforts in context of fearful stimuli as compared to a more vigilant coping style. However, no study so far has investigated the neural correlates of fear conditioning of repressors and sensitizers.In the present fMRI study, 76 participants were classified as repressors or as sensitizers and were exposed to a fear conditioning paradigm, in which the CS+ predicted electrical stimulation, while another neutral stimulus (CS- did not. In addition, skin conductance responses (SCRs were measured continuously.As the main findings, we found increased neural activations in repressors as compared to sensitizers in the ventromedial prefrontal cortex and the anterior cingulate cortex during fear conditioning. In addition, elevated activity to the CS+ in amygdala, insula, occipital, and orbitofrontal cortex as well as conditioned SCRs were found in repressors.The present results demonstrate increased neural activations in structures linked to emotion down-regulation mechanisms like the ventromedial prefrontal cortex, which may reflect the increased coping effort in repressors. At the same time, repressors showed increased activations in arousal and evaluation-associated structures like the amygdala, the occipital cortex, and the orbitofrontal cortex, which is also mirrored in increased SCRs. The present results support recent assumptions about a two-process model of repression postulating a fast vigilant response to fearful stimuli, but also a second emotion down-regulating process.

  16. Influence of corticosteroids on chemotactic response and collagen metabolism of human skin fibroblasts.

    Science.gov (United States)

    Hein, R; Mauch, C; Hatamochi, A; Krieg, T

    1988-07-15

    Following chronic administration of corticosteroids in vivo, a number of complications occur, which mainly involve the metabolism of connective tissue cells. Therefore, several attempts have been made to develop corticosteroids, which show less pronounced side effects. Fibroblasts were kept in monolayer cultures and were exposed to corticosteroids demonstrating similar anti-inflammatory activity (prednicarbate, desoximetasone). Chemotaxis of fibroblasts was studied over 4 hr, protein and collagen synthesis were estimated using proteinchemical methods and also by dot blot hybridization. Corticosteroids used in a high dosage (10 microM) affected all biosynthetic capacities of the investigated fibroblasts. Protein synthesis and production of collagen types I and III were reduced and a similar decrease of mRNA levels for collagen type I could be found indicating an influence on the pretranslational control. In the same concentrations desoximetasone was much more active than prednicarbate. Fibroblast migration was dosage dependently inhibited from 10(-9) M to 10(-5) M for desoximetasone, while incubation with prednicarbate did not cause a reduction of the chemotactic response at concentrations lower than 10(-7) M. These data suggest that modifications of corticosteroids might result in a dissociation of some of their biological activities and can specifically influence their effects on biosynthetic capacities of fibroblasts. PMID:3395353

  17. An elastic second skin

    Science.gov (United States)

    Yu, Betty; Kang, Soo-Young; Akthakul, Ariya; Ramadurai, Nithin; Pilkenton, Morgan; Patel, Alpesh; Nashat, Amir; Anderson, Daniel G.; Sakamoto, Fernanda H.; Gilchrest, Barbara A.; Anderson, R. Rox; Langer, Robert

    2016-08-01

    We report the synthesis and application of an elastic, wearable crosslinked polymer layer (XPL) that mimics the properties of normal, youthful skin. XPL is made of a tunable polysiloxane-based material that can be engineered with specific elasticity, contractility, adhesion, tensile strength and occlusivity. XPL can be topically applied, rapidly curing at the skin interface without the need for heat- or light-mediated activation. In a pilot human study, we examined the performance of a prototype XPL that has a tensile modulus matching normal skin responses at low strain (skin barrier function, pharmaceutical delivery and wound dressings.

  18. DOES RESPONSE EVALUATION OF GENE EXPRESSION PROFILES IN THE SKIN OF K6/ODC MICE EXPOSED TO SODIUM ARSENITE

    Science.gov (United States)

    Abstract - Chronic drinking water exposure to inorganic arsenic and its metabolites increases tumor frequency in the skin of K6/ODC transgenic mice. To identify potential biomarkers and modes of action for this skin tumorigenicity, gene expression profiles were characterized fro...

  19. The Role of AKT/mTOR Pathway in Stress Response to UV-Irradiation: Implication in Skin Carcinogenesis by Regulation of Apoptosis, Autophagy and Senescence

    Directory of Open Access Journals (Sweden)

    Elwira Strozyk

    2013-07-01

    Full Text Available Induction of DNA damage by UVB and UVA radiation may generate mutations and genomic instability leading to carcinogenesis. Therefore, skin cells being repeatedly exposed to ultraviolet (UV light have acquired multilayered protective mechanisms to avoid malignant transformation. Besides extensive DNA repair mechanisms, the damaged skin cells can be eliminated by induction of apoptosis, which is mediated through the action of tumor suppressor p53. In order to prevent the excessive loss of skin cells and to maintain the skin barrier function, apoptotic pathways are counteracted by anti-apoptotic signaling including the AKT/mTOR pathway. However, AKT/mTOR not only prevents cell death, but is also active in cell cycle transition and hyper-proliferation, thereby also counteracting p53. In turn, AKT/mTOR is tuned down by the negative regulators being controlled by the p53. This inhibition of AKT/mTOR, in combination with transactivation of damage-regulated autophagy modulators, guides the p53-mediated elimination of damaged cellular components by autophagic clearance. Alternatively, p53 irreversibly blocks cell cycle progression to prevent AKT/mTOR-driven proliferation, thereby inducing premature senescence. Conclusively, AKT/mTOR via an extensive cross talk with p53 influences the UV response in the skin with no black and white scenario deciding over death or survival.

  20. Water bath hyperthermia is a simple therapy for psoriasis and also stimulates skin tanning in response to sunlight

    International Nuclear Information System (INIS)

    An eight week trial, involving superficial hyperthermia delivered biweekly via simple water bath immersion, was tested for its ability to clear mild to moderate psoriatic lesions. Seven patients were treated and three cases rapidly improved. In the remaining patients, the treatment frequency was increased to alternate days; two cases improved significantly, one patient showed a partial response, and the fourth had no visible change (this was the only patient taking concurrent drug therapy - etretinate). In addition to resolving psoriatic lesions, water bath hyperthermia also reduced edema (swelling) and relieved pruritus (itching) in all patients, both during the treatment period and for up to several months after lesions had returned. Lesion reappearance occurred within one to three months after the last heat treatment. We retreated one patient and produced a second complete remission. These results indicate that simple repetitive water bath hyperthermia alone is effective in the treatment of psoriatic lesions in heatable locations. An unexpected side effect was enhanced melanin content (tanning) in all areas where hyperthermia treated skin was exposed to sunlight. (author)

  1. Optically-tracked handheld fluorescence imaging platform for monitoring skin response in the management of soft tissue sarcoma

    Science.gov (United States)

    Chamma, Emilie; Qiu, Jimmy; Lindvere-Teene, Liis; Blackmore, Kristina M.; Majeed, Safa; Weersink, Robert; Dickie, Colleen I.; Griffin, Anthony M.; Wunder, Jay S.; Ferguson, Peter C.; DaCosta, Ralph S.

    2015-07-01

    Standard clinical management of extremity soft tissue sarcomas includes surgery with radiation therapy. Wound complications (WCs) arising from treatment may occur due to bacterial infection and tissue breakdown. The ability to detect changes in these parameters during treatment may lead to earlier interventions that mitigate WCs. We describe the use of a new system composed of an autofluorescence imaging device and an optical three-dimensional tracking system to detect and coregister the presence of bacteria with radiation doses. The imaging device visualized erythema using white light and detected bacterial autofluorescence using 405-nm excitation light. Its position was tracked relative to the patient using IR reflective spheres and registration to the computed tomography coordinates. Image coregistration software was developed to spatially overlay radiation treatment plans and dose distributions on the white light and autofluorescence images of the surgical site. We describe the technology, its use in the operating room, and standard operating procedures, as well as demonstrate technical feasibility and safety intraoperatively. This new clinical tool may help identify patients at greater risk of developing WCs and investigate correlations between radiation dose, skin response, and changes in bacterial load as biomarkers associated with WCs.

  2. Validity of bioeffect dose response models for normal tissue early and late complications of the skin

    International Nuclear Information System (INIS)

    Background: The bioeffect of a physical dose depends on the nature of the tissue, fractionation scheme, dose rate and treatment time. Certainly, experienced radiotherapists are convinced of the existence of patient-to-patient variability in normal tissue response to radiotherapy for malignant tumours. The absorbed dose needs to be translated into a bioeffect dose, which takes into account treatment variables and the radiobiological characteristics of the relevant tissue. Various bioeffect models such as NSD, CRE, TDF and BED have been proposed to predict the biological effect of radiotherapy treatments. Aim: This study was aimed at deriving tolerance bioeffect dose values for normal tissue complication rate. Materials/Methods: Compiled clinical data of time dose fractionation schedules and incidence of erythema, desquamation and telangiectasia were used for the present analysis. Results: For erythema and desquamation the radiation dose varied from 23.9 to 55.1 Gy in 04 to 50 fractions (dose per fraction 1.1 to 7.3 Gy) in 11 to 40 days. For telangiectasia (score .1 at 3 years) the radiation dose varied from 25.8 to 55.1 Gy in 04 to 50 fractions (dose per fraction 1.1 to 7.3 Gy) in 11 to 40 days. For telangiectasia (score .2 at 5 years) the radiation dose varied from 25.8 to 63.0 Gy in 04 to 50 fractions (dose per fraction 1.1 to 7.3 Gy) in 11 to 68 days. For telangiectasia (score .1, .2, .3, .4 at 10 years) the radiation dose varied from 25.8 to 63.0 Gy in 04 to 35 fractions (dose per fraction 1.7 to 7.3 Gy) in 22 to 68 days. TDF and LQF values for erythema, desquamation and telangiectasia were evaluated with a/b values of 7.5 Gy, 11.2 Gy and 2.8 Gy respectively. TDF and LQF had a statistically significant correlation with probability of erythema, desquamation and telangiectasia (p<0.001). Conclusions: TDF and LQF values should be limited to 60 and 86 Gy in order to limit the probability of telangiectasia. (authors)

  3. Chronic stress induces a hyporeactivity of the autonomic nervous system in response to acute mental stressor and impairs cognitive performance in business executives.

    Science.gov (United States)

    Teixeira, Renata Roland; Díaz, Miguel Mauricio; Santos, Tatiane Vanessa da Silva; Bernardes, Jean Tofoles Martins; Peixoto, Leonardo Gomes; Bocanegra, Olga Lucia; Neto, Morun Bernardino; Espindola, Foued Salmen

    2015-01-01

    The present study examined the incidence of chronic stress in business executives (109 subjects: 75 male and 34 female) and its relationship with cortisol levels, cognitive performance, and autonomic nervous system (ANS) reactivity after an acute mental stressor. Blood samples were collected from the subjects to measure cortisol concentration. After the sample collection, the subjects completed the Lipp Inventory of Stress Symptoms for Adults and the Stroop Color-Word Test to evaluate stress and cognitive performance levels, respectively. Saliva samples were collected prior to, immediately after, and five minutes after the test. The results revealed that 90.1% of the stressed subjects experienced stress phases that are considered chronic stress. At rest, the subjects with chronic stress showed higher cortisol levels, and no gender differences were observed. No differences were found between the stressed and non-stressed subjects regarding salivary amylase activity prior to test. Chronic stress also impaired performance on the Stroop test, which revealed higher rates of error and longer reaction times in the incongruent stimulus task independently of gender. For the congruent stimulus task of the Stroop test, the stressed males presented a higher rate of errors than the non-stressed males and a longer reaction time than the stressed females. After the acute mental stressor, the non-stressed male group showed an increase in salivary alpha-amylase activity, which returned to the initial values five minutes after the test; this ANS reactivity was not observed in the chronically stressed male subjects. The ANS responses of the non-stressed vs stressed female groups were not different prior to or after the Stroop test. This study is the first to demonstrate a blunted reactivity of the ANS when male subjects with chronic psychological stress were subjected to an acute mental stressor, and this change could contribute to impairments in cognitive performance. PMID:25807003

  4. Chronic stress induces a hyporeactivity of the autonomic nervous system in response to acute mental stressor and impairs cognitive performance in business executives.

    Directory of Open Access Journals (Sweden)

    Renata Roland Teixeira

    Full Text Available The present study examined the incidence of chronic stress in business executives (109 subjects: 75 male and 34 female and its relationship with cortisol levels, cognitive performance, and autonomic nervous system (ANS reactivity after an acute mental stressor. Blood samples were collected from the subjects to measure cortisol concentration. After the sample collection, the subjects completed the Lipp Inventory of Stress Symptoms for Adults and the Stroop Color-Word Test to evaluate stress and cognitive performance levels, respectively. Saliva samples were collected prior to, immediately after, and five minutes after the test. The results revealed that 90.1% of the stressed subjects experienced stress phases that are considered chronic stress. At rest, the subjects with chronic stress showed higher cortisol levels, and no gender differences were observed. No differences were found between the stressed and non-stressed subjects regarding salivary amylase activity prior to test. Chronic stress also impaired performance on the Stroop test, which revealed higher rates of error and longer reaction times in the incongruent stimulus task independently of gender. For the congruent stimulus task of the Stroop test, the stressed males presented a higher rate of errors than the non-stressed males and a longer reaction time than the stressed females. After the acute mental stressor, the non-stressed male group showed an increase in salivary alpha-amylase activity, which returned to the initial values five minutes after the test; this ANS reactivity was not observed in the chronically stressed male subjects. The ANS responses of the non-stressed vs stressed female groups were not different prior to or after the Stroop test. This study is the first to demonstrate a blunted reactivity of the ANS when male subjects with chronic psychological stress were subjected to an acute mental stressor, and this change could contribute to impairments in cognitive

  5. High-Intensity Resistance Exercise Promotes Postexercise Hypotension Greater than Moderate Intensity and Affects Cardiac Autonomic Responses in Women Who Are Hypertensive.

    Science.gov (United States)

    de Freitas Brito, Aline; Brasileiro-Santos, Maria do S; Coutinho de Oliveira, Caio V; Sarmento da Nóbrega, Thereza K; Lúcia de Moraes Forjaz, Cláudia; da Cruz Santos, Amilton

    2015-12-01

    The purpose of this study was to evaluate the effect of high-intensity resistance exercise (RE) sessions on blood pressure (BP), heart rate (HR), cardiac autonomic modulation, and forearm blood flow (FBF). Sixteen trained hypertensive women (n = 16, 56 ± 3 years) completed the following 3 experimental sessions: control (CS), RE at 50% (EX50%), and RE at 80% (EX80%) of 1 repetition maximum (1RM). Both EX50% and EX80% comprised a set of 10 repetitions of 10 exercises, with an interval of 90 seconds between exercises. Measurements were taken preintervention and postintervention (at 10, 30, 50, 70, and 90 minutes of recovery). Reductions in systolic/diastolic BP after exercise were greater in EX80% (largest declines, -29 ± 4/-14 ± 5 mm Hg) than EX50% (largest declines, -18 ± 6/-8 ± 5 mm Hg, p ≤ 0.05). Heart rate and cardiac sympathovagal balance (LF/HF) increased more in relation to pre-exercise values in EX80% than EX50% (largest increases 96 ± 3 vs. 90 ± 4 b·min, LF/HF = 1.77 ± 0.25 vs. 1.40 ± 0.20, respectively, p ≤ 0.05). Increases in FBF and hyperemia was also higher in EX80% than EX50% compared with pre-exercise (4.97 ± 0.28 vs. 4.36 ± 0.27 ml·min·100 ml and 5.90 ± 0.20 vs. 5.38 ± 0.25 ml·min·100 ml; p ≤ 0.05, respectively). These results suggest that RE of higher intensity promoted greater postexercise hypotension accompanied by greater increases in FBF, vasodilator response, HR, and cardiac sympathovagal balance. PMID:25992658

  6. The Immune Response to Skin Trauma Is Dependent on the Etiology of Injury in a Mouse Model of Burn and Excision.

    Science.gov (United States)

    Valvis, Samantha M; Waithman, Jason; Wood, Fiona M; Fear, Mark W; Fear, Vanessa S

    2015-08-01

    Skin trauma has many different causes including incision, blunt force, and burn. All of these traumas trigger an immune response. However, it is currently unclear whether the immune response is specific to the etiology of the injury. This study was established to determine whether the immune response to excision and burn injury of equivalent extent was the same. Using a mouse model of a full-thickness 19 mm diameter excision or 19 mm diameter full-thickness burn injury, we examined the innate immune response at the level of serum cytokine induction, whole-blood lymphocyte populations, dendritic cell function/phenotype, and the ensuing adaptive immune responses of CD4 and CD8 T-cell populations. Strikingly, both the innate and adaptive immune system responses differed between the burn and excision injuries. Acute cytokine induction was faster and different in profile to that of excision injury, leading to changes in systemic monocyte and neutrophil levels. Differences in the immune profile between burn and excision were also noted up to day 84 post injury, suggesting that the etiology of injury leads to sustained changes in the response. This may in part underlie clinical observations of differences in patient morbidity and mortality in response to different skin injury types. PMID:25826422

  7. Functional autonomic nervous system profile in children with autism spectrum disorder

    OpenAIRE

    Kushki, Azadeh; Brian, Jessica; Dupuis, Annie; Anagnostou, Evdokia

    2014-01-01

    Background Autonomic dysregulation has been recently reported as a feature of autism spectrum disorder (ASD). However, the nature of autonomic atypicalities in ASD remain largely unknown. The goal of this study was to characterize the cardiac autonomic profile of children with ASD across four domains affected in ASD (anxiety, attention, response inhibition, and social cognition), and suggested to be affected by autonomic dysregulation. Methods We compared measures of autonomic cardiac regulat...

  8. Injury-induced innate immune response in human skin mediated by transactivation of the epidermal growth factor receptor

    OpenAIRE

    Sørensen, Ole E.; Thapa, Dharma R.; Roupé, K. Markus; Valore, Erika V.; Sjöbring, Ulf; Roberts, Alice A.; Schmidtchen, Artur; Ganz, Tomas

    2006-01-01

    We found that sterile wounding of human skin induced epidermal expression of the antimicrobial (poly)peptides human β-defensin–3, neutrophil gelatinase–associated lipocalin, and secretory leukocyte protease inhibitor through activation of the epidermal growth factor receptor. After skin wounding, the receptor was activated by heparin-binding epidermal growth factor that was released by a metalloprotease-dependent mechanism. Activation of the epidermal growth factor receptor generated antimicr...

  9. Hypotension, Syncope, and Fever in Systemic Mastocytosis without Skin Infiltration and Rapid Response to Corticosteroid and Cyclosporin: A Case Report

    OpenAIRE

    Sibel Ersoy-Evans; Songul Serefhanoglu; Salih Aksu; Kemal Agbaht; Selcuk Dagdelen; Tomris Erbas; Didem Ozdemir

    2010-01-01

    Mast cell disorders are defined by an abnormal accumulation of tissue mast cells in one or more organ systems. In systemic mastocytosis, at least one extracutaneous organ is involved by definition. Although, systemic mastocytosis usually represents with skin lesion called urticaria pigmentosa, in a small proportion, there is extracutaneous involvement without skin infiltration. Other manifestations are flushing, tachycardia, dyspepsia, diarrhea, hypotension, syncope, and rarely fever. Various...

  10. Sagging Skin

    Science.gov (United States)

    ... turkey neck,” this occurs as skin loses its elasticity and in cases where individuals have lost a ... technique or procedure is appropriate for my skin type? Did the doctor show me before-and-after ...

  11. Skin Dictionary

    Science.gov (United States)

    ... resources Meet our partners Español Donate Diseases and treatments Acne and rosacea Bumps and growths Color problems Contagious skin diseases Cosmetic treatments Dry / sweaty skin Eczema / dermatitis Hair and scalp ...

  12. Skin turgor

    Science.gov (United States)

    ... up during a check. This can indicate severe dehydration that needs quick treatment. You have reduced skin turgor and are unable ... Urinalysis Intravenous fluids may be needed for severe ... treat other conditions that affect skin turgor and elasticity.

  13. Skin Cancer

    Science.gov (United States)

    Skin cancer is the most common form of cancer in the United States. The two most common types ... face, neck, hands, and arms. Another type of skin cancer, melanoma, is more dangerous but less common. Anyone ...

  14. SKIN CANCER

    Directory of Open Access Journals (Sweden)

    Made Putri Hendaria

    2013-03-01

    Full Text Available Skin is an organ which protect the human body from the environment. It was build by milion cells. According to the changes in human lifestyle which tends to unhealthy life, increasing ultraviolet radiation, toxins, and genetics makes the cells who build the skin do the abnormal growth being cancer cells. Classification of skin cancer is according the most common three types, they are Basal Cell Carcinoma, Squamous Cell Carcinoma, and Malignant Melanoma. More than 3,5 milion skin cancer cases was happened in United States, which makes it become the most common cancer type in that country. Skin cancer diagnosis is build from anamnesis, physic examination about skin eufloressence, using dermoscopy, and histopatologic examination as the gold standar. Therapy for skin cancer is classified to surgery and non surgery therapy and its prognostic is depend to the types of the skin cancer itself.

  15. Skin Aging

    Science.gov (United States)

    ... too. Sunlight is a major cause of skin aging. You can protect yourself by staying out of ... person has smoked. Many products claim to revitalize aging skin or reduce wrinkles, but the Food and ...

  16. Skin Biopsy

    Science.gov (United States)

    ... skin condition cannot be diagnosed by the patient's history and what the physician finds on examination alone. Confirming a clinical diagnosis may also be necessary prior to starting therapy. Skin biopsy types are as follows: Shave biopsies Punch biopsies ...

  17. Analysis of sympathetic skin response and R-R phase change rate in patients with bipolar disorder%双相情感障碍患者中交感神经皮肤反应和R-R间期变化率的分析

    Institute of Scientific and Technical Information of China (English)

    张锋利; 淳彩濮; 阿丽亚·艾尔肯

    2015-01-01

    Objective:To explore the diagnostic value of sympathetic skin response and R-R phase change rate for the autonomic nerve damage in patients with bipolar disorder.Methods:The SSR and RRIV characteristics of 235 cases of patients with bipolar disorder were detected.Results:The abnormal rate of SSR and RRIV were 85.1% and 81.5 % respectively.There were no significant differences of SSR and RRIV among various subgroups(P>0.05).Conclusion:SSR and RRIV could be used as objective indicators to evaluate the autonomic nerve damage of bipolar disorder.%目的:探讨交感神经皮肤反应技术(SSR)和R-R间期变化率(RRIV)对双相情感障碍患者自主神经损害的诊断价值。方法:检测235例双相情感障碍患者的 SSR 及 RRIV 特点。结果:SSR 和 RRIV 异常率分别为85.1%和81.5%,各亚组间SSR和RRIV差异均无统计学意义(P>0.05)。结论:SSR和RRIV可作为评价双相情感障碍自主神经损害的客观指标。

  18. Skin Graft

    OpenAIRE

    Ruka Shimizu; Kazuo Kishi

    2012-01-01

    Skin graft is one of the most indispensable techniques in plastic surgery and dermatology. Skin grafts are used in a variety of clinical situations, such as traumatic wounds, defects after oncologic resection, burn reconstruction, scar contracture release, congenital skin deficiencies, hair restoration, vitiligo, and nipple-areola reconstruction. Skin grafts are generally avoided in the management of more complex wounds. Conditions with deep spaces and exposed bones normally require the use o...

  19. SKIN CANCER

    OpenAIRE

    Made Putri Hendaria; AAGN Asmarajaya; Sri Maliawan

    2013-01-01

    Skin is an organ which protect the human body from the environment. It was build by milion cells. According to the changes in human lifestyle which tends to unhealthy life, increasing ultraviolet radiation, toxins, and genetics makes the cells who build the skin do the abnormal growth being cancer cells. Classification of skin cancer is according the most common three types, they are Basal Cell Carcinoma, Squamous Cell Carcinoma, and Malignant Melanoma. More than 3,5 milion skin cancer cases ...

  20. Skin graft

    Science.gov (United States)

    ... caused a large amount of skin loss Burns Cosmetic reasons or reconstructive surgeries where there has been skin damage or skin ... anesthesia are: Reactions to medicines Problems with breathing Risks for this surgery are: Bleeding Chronic pain (rarely) Infection Loss of ...

  1. Skin Aging

    Science.gov (United States)

    Your skin changes as you age. You might notice wrinkles, age spots and dryness. Your skin also becomes thinner and loses fat, making it ... heal, too. Sunlight is a major cause of skin aging. You can protect yourself by staying out ...

  2. Trigeminal autonomic cephalgias

    OpenAIRE

    Benoliel, Rafael

    2012-01-01

    1. Trigeminal autonomic cephalgias (TACs) are headaches/facial pains classified together based on:a suspected common pathophysiology involving the trigeminovascular system, the trigeminoparasympathetic reflex and centres controlling circadian rhythms;a similar clinical presentation of trigeminal pain, and autonomic activation.

  3. Testing for autonomic neuropathy

    DEFF Research Database (Denmark)

    Hilsted, J

    1984-01-01

    disease, and may be nonspecific. A number of recently developed quantifiable and reproducible autonomic nerve function tests are reviewed, with emphasis on the physiological basis of the tests and on practical applicability. Finally, diagnostic criteria, based on autonomic nerve function tests, are...

  4. Selective autonomic screening in Guillain-Barré syndrome

    Directory of Open Access Journals (Sweden)

    Yerdelen Deniz

    2010-01-01

    Full Text Available Background : Autonomic dysfunction is a common and important complication in Guillain-Barre syndrome (GBS and may be the cause of significant morbidity or death. Objectives : To show the possible autonomic involvement in patients with GBS. Materials and Methods : The sympathetic skin response (SSR and the parameters of heart rate variability gathered from a 24-h electrocardiogram recording were studied in 14 patients with GBS [13 with acute inflammatory demyelinating polyneuropathy (AIDP and one with acute motor axonal neuropathy (AMAN]. Results : In two of the patients, SSR couldn′t be elicited. In the rest of the patients, amplitude of SSR was found to be decreased when compared with the control subjects. In the time domain analysis of the 24-h electrocardiogram, SDNN (the standard deviation of all R-R intervals, SDANN (the standard deviation of the averages of R-R intervals during all 5-min periods that constitute the 24-h day, SDNN index (mean of the standard deviations of all R-R intervals for all 5-min segments of the 24-h recording; in the frequency domain analysis HF(high frequency, LF(low frequency, VLF (very low frequency and total power were found decreased in patients when compared with the control subjects. When the mean values with standard deviations of controls were compared with the patients′ values one by one, the pregnant patient with AMAN had increased heart rate variability parameters. The remaining 13 patients had decreased values. Conclusions : These findings reflect an involvement of both the parasympathetic and sympathetic systems in GBS. Our results suggest that SSR and heart rate variability parameters may be used for early detection of any autonomic dysfunction in patients with GBS.

  5. The relationship between the sympathetic skin response and event-related brain potentials in sensorimotor control of human voluntary movements

    OpenAIRE

    Shimoda, Masahiro

    2000-01-01

    The autonomic nervous syste m (ANS) maintains the internal environment of the human body. It has recently been suggested that the ANS also contributes to the control of voluntary movements. Especially, the sympathetic nervous system in the ANS plays an important role in subserving voluntary movements. Many researchers have become to be interested in the neuro-behavioral relationship between the ANS and the cortical motor areas, such as the primary motor area, supplementary motor area, and cin...

  6. Dose-Response on the Chemopreventive Effects of Sarcophine-Diol on UVB-Induced Skin Tumor Development in SKH-1 Hairless Mice

    Directory of Open Access Journals (Sweden)

    Chandradhar Dwivedi

    2012-09-01

    Full Text Available Sarcophine-diol (SD is a lactone ring-opened analogue of sarcophine. It has shown chemopreventive effects on chemically-induced skin tumor development in female CD-1 mice, as well as in a UVB-induced skin tumor development model in hairless SKH-1 mice at a dose of 30 μg SD applied topically and 180 mJ/cm2 UVB. The objective of this study was to determine the dose-response on the chemopreventive effects of SD on SKH-1 hairless mice when exposed to a UVB radiation dose of 30 mJ/cm2. This UVB dose better represents chronic human skin exposure to sunlight leading to skin cancer than previous studies applying much higher UVB doses. Carcinogenesis was initiated and promoted by UVB radiation. Female hairless SKH-1 mice were divided into five groups. The control group was topically treated with 200 μL of acetone (vehicle, and the SD treatment groups were topically treated with SD (30 μg, 45 μg, and 60 μg dissolved in 200 μL of acetone 1 h before UVB radiation (30 mJ/cm2. The last group of animals received 60 μg SD/200 μL acetone without UVB exposure. These treatments were continued for 27 weeks. Tumor multiplicity and tumor volumes were recorded on a weekly basis for 27 weeks. Weight gain and any signs of toxicity were also closely monitored. Histological characteristics and the proliferating cell nuclear antigen (PCNA were evaluated in the mice skin collected at the end of the experiment. The dose-response study proved a modest increase in chemopreventive effects with the increase in SD dose. SD reduced the number of cells positively stained with PCNA proliferation marker in mice skin. The study also showed that SD application without UVB exposure has no effect on the structure of skin. The results from this study suggest that broader range doses of SD are necessary to improve the chemopreventive effects.

  7. Human papillomavirus types detected in skin warts and cancer differ in their transforming properties but commonly counteract UVB induced protective responses in human keratinocytes

    International Nuclear Information System (INIS)

    In the present study, E6E7 and E6 proteins of human papillomaviruses (HPVs) associated with skin warts and cancer were compared for their transforming and carcinogenic abilities in primary human keratinocytes (PHKs). We show that E6E7 of cancer associated beta HPV types, notably 49 and 24, were able to extend the life span and enhance the clonogenic efficiency of PHKs when maintained in serum free/low calcium medium. Activities of the beta HPV E6E7 were lower than those of HPV16 E6E7. In contrast, E6 proteins from HPV types detected in skin warts or cancer, notably 10, 49 and 38, attenuated UVB induced protective responses in PHKs including cell death, proliferation arrest and accumulation of the proapoptotic proteins, p53, bax or bak. Together, this investigation revealed functional differences and commonalities between HPVs associated with skin warts and cancer, and allowed the identification of specific properties of beta HPVs supporting their involvement in skin carcinogenesis. - Highlights: • Primary keratinocytes were used to evaluate transforming and carcinogenic abilities of cutaneous HPVs. • E6E7 of cancer associated β HPV types transform primary human keratinocytes. • E6 proteins of cancer and wart associated HPVs inhibit UVB induced cell death. • E6s of cancer and wart associated HPVs attenuate UVB induced proliferation arrest. • E6s of cancer and wart associated HPVs attenuate UVB induced apoptosis signaling

  8. Human papillomavirus types detected in skin warts and cancer differ in their transforming properties but commonly counteract UVB induced protective responses in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Shterzer, Naama; Heyman, Dariya; Shapiro, Beny; Yaniv, Abraham; Jackman, Anna [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel); Serour, Francis [Department of Pediatric Surgery, The E. Wolfson Medical Center, Holon (Israel); Chaouat, Malka [Laboratory of Experimental Surgery, Hadassah University Hospital, Ein Karem, Jerusalem (Israel); Gonen, Pinhas [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel); Tommasino, Massimo [International Agency for Research on Cancer, World Health Organization, Lyon (France); Sherman, Levana [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel)

    2014-11-15

    In the present study, E6E7 and E6 proteins of human papillomaviruses (HPVs) associated with skin warts and cancer were compared for their transforming and carcinogenic abilities in primary human keratinocytes (PHKs). We show that E6E7 of cancer associated beta HPV types, notably 49 and 24, were able to extend the life span and enhance the clonogenic efficiency of PHKs when maintained in serum free/low calcium medium. Activities of the beta HPV E6E7 were lower than those of HPV16 E6E7. In contrast, E6 proteins from HPV types detected in skin warts or cancer, notably 10, 49 and 38, attenuated UVB induced protective responses in PHKs including cell death, proliferation arrest and accumulation of the proapoptotic proteins, p53, bax or bak. Together, this investigation revealed functional differences and commonalities between HPVs associated with skin warts and cancer, and allowed the identification of specific properties of beta HPVs supporting their involvement in skin carcinogenesis. - Highlights: • Primary keratinocytes were used to evaluate transforming and carcinogenic abilities of cutaneous HPVs. • E6E7 of cancer associated β HPV types transform primary human keratinocytes. • E6 proteins of cancer and wart associated HPVs inhibit UVB induced cell death. • E6s of cancer and wart associated HPVs attenuate UVB induced proliferation arrest. • E6s of cancer and wart associated HPVs attenuate UVB induced apoptosis signaling.

  9. A New Potent Route of DNA Vaccine Inoculation: DNA-Liposome Complexes on Bare Skin Induce Antigen-Special Antibody Responses

    Directory of Open Access Journals (Sweden)

    Mingxing Duan

    2003-01-01

    Full Text Available Transcutaneous immunization is a novel strategy for genetic vaccine immunization to induce detectable antigen-special antibody in humor and mucosal. In this study, plasmid expressing hepatitis B surface antigen (pGFP-HBsAg was encapsulated in liposome, then DNA- liposome complexes were glued on bare skin of mice ear in different dosage (50μg, 10μg and 1μg. As control, DNA- liposome complexes of pGFP-HBsAg and pGFP vector were inoculated intraperitoneally. The anti-HBsAg antibodies of serum were detected weekly by ELISA. It was found that the detectable antibodies of transcutaneous immunized mouse were elicited after four weeks, and reached a maximum at the sixth week. Even 1μg plasmid DNA in liposomes through immune skin can elicit the highest ELISA antibody titer (> 1:512 in test group, and corresponding percentage of positive response is up to 71% at sixth week, but higher amounts of plasmid DNA (50μg DNA per mice on immune skin cannot induce higher antibody levels. The result showed that DNA- liposome complexes glued on bare skin appear to be a novel method for the administration of DNA vaccines.

  10. Evaluation of autonomic functions in subclinical hypothyroid and hypothyroid patients

    OpenAIRE

    Mahajan, Aarti S.; Ram Lal; Dhanwal, Dinesh K.; Jain, Ajay K.; Veena Chowdhury

    2013-01-01

    Background: Autonomic dysfunction may contribute to cardiovascular morbidity in subclinical hypothyroid patients. It is controversial whether the abnormality exists in sympathetic or the parasympathetic function. It is also not known whether the severity of autonomic dysfunction is related to the degree of thyroid deficiency. Design of Study: Prospective case control. Materials and Methods: Autonomic functions based on heart rate (HR) and blood pressure (BP) responses to various maneuvers wer...

  11. Autonomic dysregulation in headache patients.

    Science.gov (United States)

    Gass, Jason J; Glaros, Alan G

    2013-12-01

    To analyze autonomic nervous system activity in headache subjects, measurements of heart rate variability (HRV), skin temperature, skin conductance, and respiration were compared to a matched control group. HRV data were recorded in time and frequency domains. Subjects also completed self-report questionnaires assessing psychological distress, fatigue, and sleep dysfunction. Twenty-one headache and nineteen control subjects participated. In the time domain, the number of consecutive R-to-R intervals that varied by more than 50 ms and the standard deviation of the normalized R-to-R intervals, both indices of parasympathetic nervous system activity, were significantly lower in the headache group than the control group. Groups did not differ statistically on HRV measures in the frequency domain. Self-report measures showed significantly increased somatization, hostility, anxiety, symptom distress, fatigue, and sleep problems in the headache group. The results suggest headache subjects have increased sympathetic nervous system activity and decreased parasympathetic activity compared to non-headache control subjects. Headaches subjects also showed greater emotional distress, fatigue, and sleep problems. The results indicate an association between headaches and cardiovascular functioning suggestive of sympathetic nervous system activation in this sample of mixed migraine and tension-type headache sufferers. PMID:23912525

  12. Long-term IgG response to porcine Neu5Gc antigens without transmission of PERV in burn patients treated with porcine skin xenografts.

    Science.gov (United States)

    Scobie, Linda; Padler-Karavani, Vered; Le Bas-Bernardet, Stephanie; Crossan, Claire; Blaha, Josef; Matouskova, Magda; Hector, Ralph D; Cozzi, Emanuele; Vanhove, Bernard; Charreau, Beatrice; Blancho, Gilles; Bourdais, Ludovic; Tallacchini, Mariachiara; Ribes, Juan M; Yu, Hai; Chen, Xi; Kracikova, Jitka; Broz, Ludomir; Hejnar, Jiri; Vesely, Pavel; Takeuchi, Yasuhiro; Varki, Ajit; Soulillou, Jean-Paul

    2013-09-15

    Acellular materials of xenogenic origin are used worldwide as xenografts, and phase I trials of viable pig pancreatic islets are currently being performed. However, limited information is available on transmission of porcine endogenous retrovirus (PERV) after xenotransplantation and on the long-term immune response of recipients to xenoantigens. We analyzed the blood of burn patients who had received living pig-skin dressings for up to 8 wk for the presence of PERV as well as for the level and nature of their long term (maximum, 34 y) immune response against pig Ags. Although no evidence of PERV genomic material or anti-PERV Ab response was found, we observed a moderate increase in anti-αGal Abs and a high and sustained anti-non-αGal IgG response in those patients. Abs against the nonhuman sialic acid Neu5Gc constituted the anti-non-αGal response with the recognition pattern on a sialoglycan array differing from that of burn patients treated without pig skin. These data suggest that anti-Neu5Gc Abs represent a barrier for long-term acceptance of porcine xenografts. Because anti-Neu5Gc Abs can promote chronic inflammation, the long-term safety of living and acellular pig tissue implants in recipients warrants further evaluation. PMID:23945141

  13. Long-term IgG response to porcine Neu5Gc-antigens without transmission of PERV in burn patients treated with porcine skin xenografts

    Science.gov (United States)

    Scobie, Linda; Padler-Karavani, Vered; Le Bas-Bernardet, Stephanie; Crossan, Claire; Blaha, Josef; Matouskova, Magda; Hector, Ralph D; Cozzi, Emanuele; Vanhove, Bernard; Charreau, Beatrice; Blancho, Gilles; Bourdais, Ludovic; Tallacchini, Mariachiara; Ribes, Juan M; Yu, Hai; Chen, Xi; Kracikova, Jitka; Broz, Ludomir; Hejnar, Jiri; Vesely, Pavel; Takeuchi, Yasuhiro; Varki, Ajit; Soulillou, Jean-Paul

    2013-01-01

    Acellular materials of xenogenic origin are used worldwide as xenografts and Phase I trials of viable pig pancreatic islets are currently being performed. However, limited information is available on transmission of porcine endogenous retrovirus (PERV) after xenotransplantation and on the long-term immune response of recipients to xenoantigens. We analyzed the blood of burn patients who had received living pig skin dressings for up to 8 weeks for the presence of PERV as well as for the level and nature of their long term (maximum 34 years) immune response against pig antigens. Whilst no evidence of PERV genomic material or anti PERV antibody response was found, we observed a moderate increase in anti αGal antibodies and a high and sustained anti non-αGal IgG response in those patients. Antibodies against the non-human sialic acid Neu5Gc constituted the anti non-αGal response with the recognition pattern on a sialogly can array differing from that of burn patients treated without pig skin. These data suggest that anti-Neu5Gc antibodies may represent a barrier for long-term acceptance of porcine xenografts. As anti-Neu5Gc antibodies can promote chronic inflammation, the long-term safety of living and acellular pig tissue implants in recipients warrants further evaluation. PMID:23945141

  14. Autonomous linear lossless systems

    OpenAIRE

    Rao, Shodhan; Rapisarda, Paolo

    2008-01-01

    We define a lossless autonomous system as one having a quadratic differential form associated with it called an energy function, which is positive and which is conserved. We define an oscillatory system as one which has all its trajectories bounded on the entire time axis. In this paper, we show that an autonomous system is lossless if and only if it is oscillatory. Next we discuss a few properties of energy functions of autonomous lossless systems and a suitable way of splitting a given ener...

  15. Autonomous surveillance for biosecurity.

    Science.gov (United States)

    Jurdak, Raja; Elfes, Alberto; Kusy, Branislav; Tews, Ashley; Hu, Wen; Hernandez, Emili; Kottege, Navinda; Sikka, Pavan

    2015-04-01

    The global movement of people and goods has increased the risk of biosecurity threats and their potential to incur large economic, social, and environmental costs. Conventional manual biosecurity surveillance methods are limited by their scalability in space and time. This article focuses on autonomous surveillance systems, comprising sensor networks, robots, and intelligent algorithms, and their applicability to biosecurity threats. We discuss the spatial and temporal attributes of autonomous surveillance technologies and map them to three broad categories of biosecurity threat: (i) vector-borne diseases; (ii) plant pests; and (iii) aquatic pests. Our discussion reveals a broad range of opportunities to serve biosecurity needs through autonomous surveillance. PMID:25744760

  16. Responses of Six-Weeks Aquatic Exercise on the Autonomic Nervous System, Peak Nasal Inspiratory Flow and Lung Functions in Young Adults with Allergic Rhinitis

    OpenAIRE

    Taweesak Janyacharoen; Narupon Kunbootsri; Preeda Arayawichanon; Seksun Chainansamit; Kittisak Sawanyawisuth

    2015-01-01

    Allergic rhinitis is a chronic respiratory disease. Sympathetic hypofunction is identified in all of the allergic rhinitis patients. Moreover, allergic rhinitis is associated with decreased peak nasal inspiratory flow (PNIF) and impaired lung functions. The aim of this study was to investigate effects of six-week of aquatic exercise on the autonomic nervous system function, PNIF and lung functions in allergic rhinitis patients.Twenty-six allergic rhinitis patients, 12 males and 14 females wer...

  17. RESPIRATORY, AUTONOMIC, AND EXPERIENTIAL RESPONSES TO REPEATED INHALATIONS OF 20% CO2 ENRICHED AIR IN PANIC DISORDER, SOCIAL PHOBIA, AND HEALTHY CONTROLS

    OpenAIRE

    Blechert, Jens; Wilhelm, Frank H.; Meuret, Alicia E.; Wilhelm, Eva M.; Roth, Walton T.

    2010-01-01

    Inhalation of carbon-dioxide (CO2) enriched air triggers anxiety in panic disorder (PD) patients, which is often interpreted as a sign of biological vulnerability. However, most studies have not measured respiration in these tasks. We compared patients with PD (N=20) and social phobia (SP, N=19) to healthy controls (N=18) during eight inhalations of 20% CO2, preceded and followed by two inhalations of room air, while continuously measuring subjective anxiety and dyspnea as well as autonomic a...

  18. Dissociated Emergent-Response System and Fine-Processing System in Human Neural Network and a Heuristic Neural Architecture for Autonomous Humanoid Robots

    OpenAIRE

    Xiaodan Yan

    2010-01-01

    The current study investigated the functional connectivity of the primary sensory system with resting state fMRI and applied such knowledge into the design of the neural architecture of autonomous humanoid robots. Correlation and Granger causality analyses were utilized to reveal the functional connectivity patterns. Dissociation was within the primary sensory system, in that the olfactory cortex and the somatosensory cortex were strongly connected to the amygdala whereas the visual cortex an...

  19. Heart rate variability as a biomarker for autonomic nervous system response differences between children with chronic pain and healthy control children

    OpenAIRE

    Evans S; Seidman LC; Tsao JCI; Lung KC; Zeltzer LK; Naliboff BD

    2013-01-01

    Subhadra Evans,1 Laura C Seidman,1 Jennie CI Tsao,1 Kirsten C Lung,1 Lonnie K Zeltzer,1 Bruce D Naliboff21Pediatric Pain Program, University of California, Los Angeles, CA, USA; 2Department of Psychiatry and Biobehavioral Sciences, University of California, Los Angeles, CA, USAAbstract: Studies in adults have demonstrated a relationship between lowered heart rate variability (HRV) and poor health. However, less is known about the role of autonomic arousal in children's well-being. The aim...

  20. The effect of salmeterol and salbutamol on mediator release and skin responses in immediate and late phase allergic cutaneous reactions

    DEFF Research Database (Denmark)

    Petersen, Lars Jelstrup; Skov, P S

    1999-01-01

    clinical and biochemical EAR and LPR in human skin. METHODS: Measurement of wheal and flare reactions to allergen, codeine, and histamine, and LPR (induration) to allergen. Assessment of histamine and prostaglandin D2 (PGD2) release by microdialysis technique in EAR, and measurement of mediators in LPR by...

  1. Curious Skin

    OpenAIRE

    Angel, G.

    2010-01-01

    Some of Henry Wellcome’s collection of tattoos on human skin will be on display in our forthcoming Skin exhibition. But how did the Parisian doctor from whom they were acquired come by his macabre collection of tattoos in the first place, and what did they mean to those whose skin they were on? It’s Gemma Angel‘s job to find out…

  2. AUTONOMOUS DRIVEN CAR

    OpenAIRE

    Meeshika Arora

    2013-01-01

    In order to achieve autonomous operation of a vehiclein urban situations with unpredictable traffic, several real timesystems must interoperate, including environment perceptionplanning and control. In addition a robust vehicle platform withappropriate sensors, computational hardware, networking andsoftware infrastructure is essential.

  3. Highly Autonomous Systems Workshop

    Science.gov (United States)

    Doyle, R.; Rasmussen, R.; Man, G.; Patel, K.

    1998-01-01

    It is our aim by launching a series of workshops on the topic of highly autonomous systems to reach out to the larger community interested in technology development for remotely deployed systems, particularly those for exploration.

  4. Psychopathic Traits and Physiological Responses to Aversive Stimuli in Children Aged 9–11 Years

    OpenAIRE

    Wang, Pan; Baker, Laura A.; Gao, Yu; Raine, Adrian; Lozano, Dora Isabel

    2012-01-01

    Atypical eletrodermal and cardiovascular response patterns in psychopathic individuals are thought to be biological indicators of fearless and disinhibition. This study investigated the relationship between psychopathic traits and these autonomic response patterns using a count-down task in 843 children (aged 9–10 years). Heart rate (HR) and non-specific skin conductance responses (NS-SCRs) were recorded while participants anticipated and reacted to 105 dB signaled or unsignaled white-noise b...

  5. Changes in skin levels of two neutotrophins (glial cell line derived neurotrohic factor and neurotrophin-3) cause alterations in cutaneous neuron responses to mechanical stimuli

    Institute of Scientific and Technical Information of China (English)

    Jeffrey Lawson; Sabrina L. Mcllwrath; H. Richard Koerber

    2008-01-01

    Neurotrophins are important for the development and maintenance of both high and low threshold mechanoreceptors (HTMRs and LTMRs). In this series of studies, the effects of constitutive overexpression of two different neurotrophins, neurotrophin-3 (NT-3) and glial cell line derived neurotrohic factor (GDNF), were examined. Previous studies indicated that both of them may be implicated in the normal development of mouse dorsal root ganglion (DRG) neurons. Neurons from mice transgenically altered to overexpress NT-3 or GDNF (NT-3-OE or GDNF-OE mice) in the skin were examined using several physiological, immunohistochemi-cal and molecular techniques. Ex vivo skin/nerve/DRG/spinal cord and skin/nerve preparations were used to determine the response characteristics of the cutaneous neurons; immunohistochemistry was used to examine the biochemical phenotype of DRG cells and the skin; RT-PCR was used to examine the levels of candidate ion channels in skin and DRG that may correlate with changes in physiologi-cal responses. In GDNF-OE mice, I-isolectin B4 (IB4)-immunopositive C-HTMRs (nociceptors), a large percentage of which are sensitive to GDNF, had significantly lower mechanical thresholds than wildtype (WT) neurons. Heat thresholds for the same cells were not different. Mechanical sensitivity changes in GDNF-OE mice were correlated with significant increases in acid sensing ion channels 2a (ASIC2a) and 2b (ASIC2b) and transient receptor potential channel AI (TRPAI), all of which are putative mechanosensitive ion channels. Overexpression of NT-3 affected the responses of A-LTMRs and A-HTMRs, hut had no effect on C-HTMRs. Slowly adapting type 1 (SA1) LTMRs and A-HTMRs had increased mechanical sensitivity compared to WT. Mechanical sensitivity was correlated with significant increases in acid-sensing ion channels ASIC1 and ASIC3. This data indicates that both neurotrophins play roles in determining mechanical thresholds of cutaneous HTMRs and LTMRs and that sensitivity

  6. Engineering Autonomous Driving Software

    OpenAIRE

    Berger, Christian; Rumpe, Bernhard

    2014-01-01

    A larger number of people with heterogeneous knowledge and skills running a project together needs an adaptable, target, and skill-specific engineering process. This especially holds for a project to develop a highly innovative, autonomously driving vehicle to participate in the 2007 DARPA Urban Challenge. In this contribution, we present essential elements of a software and systems engineering process to develop a so-called artificial intelligence capable of driving autonomously in complex u...

  7. Autonomic nervous system:its response and adaptation to exercises%自主神经系统对运动反应、适应的研究与进展

    Institute of Scientific and Technical Information of China (English)

    邵连杰

    2015-01-01

    背景:心血管系统满足运动过程中不同组织和器官的需求,一次性运动和长时间运动会引起不同的心脏自主神经系统的反应和变化。通过分析心率变异指标提取人体变化的信息,用于运动效果和个体方案的制定成为一个重要的研究领域。目的:从传统的心率变异指标在运动中的应用入手,并结合最新的研究动态,为进一步的心脏自主神经对运动反应和适应研究提供理论支撑。方法:通过计算机检索学术谷歌和PubMed数据库相关文献。检索时间范围为1997年1月至2015年3月。英文检索词为“autonomic nervous system,heart rate variability,HRV,exercise intervention,exercise training”。结果与结论:共检索到405篇相关文献,根据纳入标准保留79篇文献。根据一次性运动心脏自主神经的变化,可以评定有氧工作能力和制定个体干预方案。心脏自主神经对运动干预的反应和适应取决于强度和持续时间,存在较大的个体差异。交感神经和迷走神经长时间兴奋或抑制可能预示过度训练发生。%BACKGROUND:The cardiovascular system meets the demand of different tissues and organs in the motor process. One-time exercise and long-time exercise wil cause different responses and changes of the cardiac autonomic nervous system. Information about changes of the human body can be extractedvia indicators of heart rate variability, which wil be used for formulation of exercise effect and individualized program. It wil be an important field in the future. OBJECTIVE:To study the conventional indicators of heart rate variability used in exercise in combination with the latest research trends, and to provide theoretical support for studying the response and adaptation of cardiac autonomic nervous system to exercises. METHODS: A computer-based search of Google Scholar and PubMed database was performed for relevant articles published from January

  8. Extracellular Matrix Modulates Morphology, Growth, Oxidative Stress Response and Functionality of Human Skin Fibroblasts during Aging In Vitro

    DEFF Research Database (Denmark)

    Jørgensen, Peter; Rattan, Suresh

    2014-01-01

    The Hayflick system of cellular aging and replicative senescence in vitro has been used widely in both basic and applied research in biogerontology. The state of replicative senescence is generally considered to be irreversible, but is modifiable by genetic and environmental manipulations. Some...... recent observations indicate that replicative lifespan, senescence and functionality of cells in vitro can be significantly affected by the quality of the extra cellular matrix (ECM). Following up on those reports, here we show that using the ECM prepared from early passage young cells, partial...... rejuvenation of serially passaged human facial skin fibroblasts was possible in pre-senescent middle-aged cells, but not in fully senescent late passage cells. ECM from young cells improved the appearance, viability, stress tolerance and wound healing ability of skin fibroblasts. Furthermore, young ECM...

  9. Blood pressure regulation in diabetic autonomic neuropathy

    DEFF Research Database (Denmark)

    Hilsted, J

    1985-01-01

    Defective blood pressure responses to standing, exercise and epinephrine infusions have been demonstrated in diabetic patients with autonomic neuropathy. The circulatory mechanisms underlying blood pressure responses to exercise and standing up in these patients are well characterized: In both...... which may contribute to exercise hypotension in these patients. During hypoglycemia, blood pressure regulation seems intact in patients with autonomic neuropathy. This is probably due to release of substantial amounts of catecholamines during these experiments. During epinephrine infusions a substantial...... blood pressure fall ensues in patients with autonomic neuropathy, probably due to excessive muscular vasodilation. It is unresolved why blood pressure regulation is intact during hypoglycemia and severely impaired--at similar catecholamine concentrations--during epinephrine infusions....

  10. Behavioural responses to human skin extracts and antennal phenotypes of sylvatic first filial generation and long rearing laboratory colony Rhodnius prolixus

    Directory of Open Access Journals (Sweden)

    Mario Iván Ortiz

    2011-06-01

    Full Text Available Chagas disease is a major public health issue and is mainly spread by Triatominae insects (Hemiptera: Reduviidae. Rhodnius prolixus is the main vector species in Northern South America. Host-seeking behaviour in R. prolixus is mediated by different compounds that are produced by and emanate from the host or microbiota on the host's skin. We tested the behavioural responses of sylvatic first filial generation (F1 and colony insects to extracts of human skin with a dual choice olfactometer. In addition, we compared the antennal phenotypes in both populations. No statistical differences were found between the two populations at the behavioural level. Both showed a preference for face and feet extracts and this effect was abolished for face extracts after treatment with an antibacterial gel. The observation of the antennal phenotype showed that there were differences between both groups in the total length, total surface area and number and density of bristles. However, the number and density of chemoreceptive sensilla (basiconic and thin and thick-walled trichoids and the total density of sensilla did not show statistically significant differences. These results demonstrate that colony insects, which have only been fed with living hens for the last 30 years, are attracted by human skin extracts in a similar way as F1 sylvatic insects.

  11. Developmental and metabolic plasticity of white-skinned grape berries in response to botrytis cinerea during noble rot

    OpenAIRE

    Blanco-Ulate, B; Amrine, KCH; Collins, TS; Rivero, RM; Vicente, AR; Morales-Cruz, A; Doyle, CL; Ye, Z.; Allen, G.; Heymann, H; Ebeler, SE; Cantu, D.

    2015-01-01

    © 2015 American Society of Plant Biologists. All rights reserved. Noble rot results from exceptional infections of ripe grape (Vitis vinifera) berries by Botrytis cinerea. Unlike bunch rot, noble rot promotes favorable changes in grape berries and the accumulation of secondary metabolites that enhance wine grape composition. Noble rot-infected berries of cv Sémillon, a white-skinned variety, were collected over 3 years from a commercial vineyard at the same time that fruit were harvested for ...

  12. Contingency Software in Autonomous Systems: Technical Level Briefing

    Science.gov (United States)

    Lutz, Robyn R.; Patterson-Hines, Ann

    2006-01-01

    Contingency management is essential to the robust operation of complex systems such as spacecraft and Unpiloted Aerial Vehicles (UAVs). Automatic contingency handling allows a faster response to unsafe scenarios with reduced human intervention on low-cost and extended missions. Results, applied to the Autonomous Rotorcraft Project and Mars Science Lab, pave the way to more resilient autonomous systems.

  13. 5-HT1A/1B receptors as targets for optimizing pigmentary responses in C57BL/6 mouse skin to stress.

    Directory of Open Access Journals (Sweden)

    Hua-Li Wu

    Full Text Available Stress has been reported to induce alterations of skin pigmentary response. Acute stress is associated with increased turnover of serotonin (5-hydroxytryptamine; 5-HT whereas chronic stress causes a decrease. 5-HT receptors have been detected in pigment cells, indicating their role in skin pigmentation. To ascertain the precise role of 5-HT in stress-induced pigmentary responses, C57BL/6 mice were subjected to chronic restraint stress and chronic unpredictable mild stress (CRS and CUMS, two models of chronic stress for 21 days, finally resulting in abnormal pigmentary responses. Subsequently, stressed mice were characterized by the absence of a black pigment in dorsal coat. The down-regulation of tyrosinase (TYR and tyrosinase-related proteins (TRP1 and TRP2 expression in stressed skin was accompanied by reduced levels of 5-HT and decreased expression of 5-HT receptor (5-HTR system. In both murine B16F10 melanoma cells and normal human melanocytes (NHMCs, 5-HT had a stimulatory effect on melanin production, dendricity and migration. When treated with 5-HT in cultured hair follicles (HFs, the increased expression of melanogenesis-related genes and the activation of 5-HT1A, 1B and 7 receptors also occurred. The serum obtained from stressed mice showed significantly decreased tyrosinase activity in NHMCs compared to that from nonstressed mice. The decrease in tyrosinase activity was further augmented in the presence of 5-HTR1A, 1B and 7 antagonists, WAY100635, SB216641 and SB269970. In vivo, stressed mice received 5-HT precursor 5-hydroxy-l-tryptophan (5-HTP, a member of the class of selective serotonin reuptake inhibitors (fluoxetine; FX and 5-HTR1A/1B agonists (8-OH-DPAT/CP94253, finally contributing to the normalization of pigmentary responses. Taken together, these data strongly suggest that the serotoninergic system plays an important role in the regulation of stress-induced depigmentation, which can be mediated by 5-HT1A/1B receptors. 5-HT

  14. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    International Nuclear Information System (INIS)

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response

  15. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  16. Normal tissue response to low doses of radiotherapy assessed by molecular markers - A study of skin in patients treated for prostate cancer

    International Nuclear Information System (INIS)

    The aim of this study was to evaluate normal tissue response by molecular markers to multi fraction low doses of ionizing radiation, with the focus on changes in repopulation, estimated using Ki-67 as the proliferation marker, and on expressions of the p53 and p21 proteins, identified as key proteins in the DNA damage checkpoint. Repeated skin biopsies were taken from patients treated for prostate cancer with radiotherapy. The expressions of Ki-67, p53 and p21 of the keratinocytes in the basal cell layer of the epidermis were quantified immunohistochemically. The dose to the basal layer was 1.1 Gy per fraction, given five times per week for seven weeks. The indices of the three markers were determined over the whole period. A significant suppression of the Ki-67 index was observed during the first weeks, followed by a significant gradual increase in the Ki-67 index over the last weeks. The p53 and p21 protein levels were almost zero in the unirradiated skin. Upon irradiation, both the p53 and p21 index increased in a pattern very congruent to the Ki-67 index. In conclusion, daily fractions of about 1 Gy to the skin resulted in, for the keratinocytes in the basal layer, a cell growth arrest for a couple of weeks and a subsequent acceleration in repopulation during the following weeks of irradiation. The present findings also provided novel insights into the role of the p53/p21 pathway in the response of a normal epithelium to ionizing radiation as it is applied in radiotherapy

  17. Autonomous Language Learning: The Teachers' Perspectives.

    Science.gov (United States)

    Chan, Victoria

    2003-01-01

    Reports on a large-scale study on learner autonomy in language learning carried out with students and English teachers at the Hong Kong Polytechnic University. Examines the teachers' views of their roles and responsibilities, their assessment of their students'decision-making abilities and the autonomous language learning activities that they have…

  18. Systemic morphine treatment induces changes in firing patterns and responses of nociceptive afferent fibers in mouse glabrous skin

    OpenAIRE

    Hogan, Dale; Baker, Alyssa L.; Morón, Jose A.; Carlton, Susan M.

    2013-01-01

    Patients receiving opioids for pain may experience decreased effectiveness of the drug and even abnormal pain sensitivity – either hyperalgesia and/or allodynia. We hypothesize that peripheral nociceptor hyperexcitability contributes to opioid-induced hyperalgesia and test this using an in vitro mouse glabrous skin-nerve preparation. Mice were injected i.p. with escalating doses of morphine (5, 8, 10, 15 mg/kg) or saline every 12 h for 48 h and sacrificed ~12 h following the last injection. R...

  19. Architecture of autonomous systems

    Science.gov (United States)

    Dikshit, Piyush; Guimaraes, Katia; Ramamurthy, Maya; Agrawala, Ashok; Larsen, Ronald L.

    1989-01-01

    Automation of Space Station functions and activities, particularly those involving robotic capabilities with interactive or supervisory human control, is a complex, multi-disciplinary systems design problem. A wide variety of applications using autonomous control can be found in the literature, but none of them seem to address the problem in general. All of them are designed with a specific application in mind. In this report, an abstract model is described which unifies the key concepts underlying the design of automated systems such as those studied by the aerospace contractors. The model has been kept as general as possible. The attempt is to capture all the key components of autonomous systems. With a little effort, it should be possible to map the functions of any specific autonomous system application to the model presented here.

  20. Skin Cancer in Skin of Color

    OpenAIRE

    Bradford, Porcia T.

    2009-01-01

    Skin cancers in skin of color often present atypically or with advanced stage in comparison to Caucasian patients. Health care providers must maintain a high index of suspicion when examining skin lesions in skin of color.

  1. Skin Infections Due to Corynebacterium

    OpenAIRE

    Meltem Türkmen; Derya Aytimur

    2010-01-01

    Corynebacteria are Gram-positive, non-sporulated, non-capsulated, aerobic diphtheroid bacteria accounting for nearly 50%of the natural skin biocene. This bacterial family is responsible for various skin diseases such as cutaneous diphteria, cromhydrosis, bromhydrosis but the most common of them are pitted keratolysis, trichobacteriosis and erythrasma. A warm and moist environment and poor hygiene are the predisposition factors for these three diseases. Although this skin diseases are seen mor...

  2. Effects of topically-applied olive oil on the response of hamster skin to single or multiple doses of 230 kV X-rays

    International Nuclear Information System (INIS)

    The effects of topically-applied olive oil on the response of hamster skin to single or multiple doses of X-rays has been studied. The olive oil was applied either 15 min or 1 hour before the radiation exposures. The treatment did not alter the temporal pattern of development and recovery from the radiation injury. For single exposures, olive oil did not alter the 1-to-30 day average skin response. However, when it was administered at each treatment when three radiation fractions were given over a 4-day interval (3 fractions/4 days), a significant increase in the amount of dose recovered was found compared with control irradiated animals. For controls, the average amount of dose recovered per fractionation interval, (Dsub(n) - Dsub(l)/(n-1), was about 505 rad. For animals treated with olive oil 15 min before irradiation, it was about 720 rad; and for those treated 1 hour before irradiation, it was 782 rad. The data indicated a definite radioprotective effect of topical administration of olive oil, but at present the mechanism is not known. (author)

  3. Skin Pigment

    Science.gov (United States)

    ... This Article Medical Dictionary Also of Interest (Quiz) Vitiligo (Video) Hives Additional Content Medical News Overview of ... Version Pigment Disorders Overview of Skin Pigment Albinism Vitiligo Hyperpigmentation Melasma Melanin is the brown pigment that ...

  4. Skin abscess

    Science.gov (United States)

    ... infection (often staphylococcus) A minor wound or injury Boils Folliculitis (infection in a hair follicle) A skin ... Elsevier Churchill Livingstone; 2009:chap 90. Read More Boils Endocarditis Folliculitis MRSA Osteomyelitis Update Date 11/12/ ...

  5. Detection of pathogenic bacteria in skin lesions of patients with chiclero's ulcer: reluctant response to antimonial treatment

    Directory of Open Access Journals (Sweden)

    Isaac-Márquez Angélica Patricia

    2003-01-01

    Full Text Available We investigated the bacterial flora present in skin lesions of patients with chiclero's ulcer from the Yucatan peninsula of Mexico using conventional culture methods (11 patients, and an immunocolorimetric detection of pathogenic Streptococcus pyogenes (15 patients. Prevalence of bacteria isolated by culture methods was 90.9% (10/11. We cultured, from chiclero's ulcers (60%, pathogenic bacterial such as Staphylococcus aureus (20%, S. pyogenes (1.6%, Pseudomonas aeruginosa (1.6%, Morganella morganii (1.6%, and opportunist pathogenic bacteria such as Klebsiella spp. (20.0%, Enterobacter spp. (20%, and Enterococcus spp. (20%. We also cultured coagulase-negative staphylococci in 40% (4/10 of the remaining patients. Micrococcus spp. and coagulase-negative staphylococci constituted the bacterial genuses more frequently isolated in the normal skin of patients with chiclero's ulcer and healthy individuals used as controls. We also undertook another study to find out the presence of S. pyogenes by an immunocolorimetric assay. This study indicated that 60% (9/15 of the ulcerated lesions, but not normal controls, were contaminated with S. pyogenes. Importantly, individuals with purulent secretion and holding concomitant infections with S. pyogenes, S. aureus, P. aeruginosa, M. morganii, and E. durans took longer to heal Leishmania (L. mexicana infections treated with antimonial drugs. Our results suggest the need to eliminate bacterial purulent infections, by antibiotic treatment, before starting antimonial administration to patients with chiclero's ulcer.

  6. Overview of the Autonomic Nervous System

    Science.gov (United States)

    ... reversible or progressive. Anatomy of the autonomic nervous system The autonomic nervous system is the part of ... they connect with. Function of the autonomic nervous system The autonomic nervous system controls internal body processes ...

  7. Influence of Clothing Fabrics on Skin Microcirculation

    Institute of Scientific and Technical Information of China (English)

    CHENG Ling; PAN Ning; ZHAO Lian-ying; HUAUNG Gu

    2010-01-01

    This study investigated the effects of clothing fabric on human skin microcirculation. Once skin is covered with a clothing fabric, human sensations, namely, coolness, warmth, softness, and roughness, are amused immediately, and the cutaneous micrecireulation may be changed consequently. Since the complex relationships of the human skin, the environment, and the clothing, there is few publication focusing on the physiological responses of the skin to the fabrics. In this paper, a Laser Doppler Flowmetry (LDF) was used to test the dynamic responses of the skin blood flow when the fabric was placed on the skin. Effects of different fabrics on the skin blood flux were investigated. The results show that cold stimulation of fabric has remarkable influences on the skin blood flux, and the surface properties of fabric are of importance to affect the human skin blood flow.

  8. Skin color - patchy

    Science.gov (United States)

    Patchy skin color is areas where the skin color is irregular. Mottling or mottled skin refers to blood vessel changes in ... in the skin cells that gives skin its color Growth of bacteria or other organisms on the ...

  9. Skin Cancer Screening

    Science.gov (United States)

    ... Genetics of Skin Cancer Skin Cancer Screening Research Skin Cancer Screening (PDQ®)–Patient Version What is screening? Go ... These are called diagnostic tests . General Information About Skin Cancer Key Points Skin cancer is a disease in ...

  10. Skin Health and Skin Diseases

    Science.gov (United States)

    ... watch for with the moles on your skin: Asymmetry : the shape of one half does not match ... Number 4 Pages 22 - 25 MedlinePlus | Subscribe | Magazine Information | Contact Us | Viewers & Players Friends of the National ...

  11. Pseudomonas aeruginosa biofilm aggravates skin inflammatory response in BALB/c mice in a novel chronic wound model

    DEFF Research Database (Denmark)

    Trøstrup, Hannah; Thomsen, Kim; Christophersen, Lars J;

    2013-01-01

    Chronic wounds are presumed to persist in the inflammatory state, preventing healing. Emerging evidence indicates a clinical impact of bacterial biofilms in soft tissues, including Pseudomonas aeruginosa (PA) biofilms. To further investigate this, we developed a chronic PA biofilm wound infection...... model in C3H/HeN and BALB/c mice. The chronic wound was established by an injection of seaweed alginate-embedded P. aeruginosa PAO1 beneath a third-degree thermal lesion providing full thickness skin necrosis, as in human chronic wounds. Cultures revealed growth of PA, and both alginate with or without...... PAO1 generated a polymorphonuclear-dominated inflammation early after infection. However, both at days 4 and 7, there were a more acute polymorphonuclear-dominated and higher degree of inflammation in the PAO1 containing group (p <0.05). Furthermore, PNA-FISH and supplemented DAPI staining showed...

  12. Pain-induced skin autoimmunity

    OpenAIRE

    Odoardi, Francesca; Neuhuber, Winfried; Flügel, Alexander

    2014-01-01

    A recent paper published in Nature reports sensory nerve fibers in the skin that give local immune cells important instructions for the organization of an immune response; in this particular case the cooperation between the nervous and immune systems had disastrous consequences, namely an auto-destruction of the skin.

  13. Experimental Autonomous Vehicle Systems

    DEFF Research Database (Denmark)

    Ravn, Ole; Andersen, Nils Axel

    1998-01-01

    The paper describes the requirements for and a prototype configuration of a software architecture for control of an experimental autonomous vehicle. The test bed nature of the system is emphasised in the choice of architecture making re-configurability, data logging and extendability simple. The...

  14. ADAM: ADaptive Autonomous Machine

    NARCIS (Netherlands)

    Oosten, van Daan C.; Nijenhuis, Lucas F.J.; Bakkers, André W.P.; Vervoort, Wiek A.

    1996-01-01

    This paper describes a part of the development of an adaptive autonomous machine that is able to move in an unknown world extract knowledge out of the perceived data, has the possibility to reason, and finally has the capability to exchange experiences and knowledge with other agents. The agent is n

  15. Autonomous Security Patrol System

    OpenAIRE

    Erramouspe, Jake

    2010-01-01

    This project provides an efficient and cost-effective solution to building security and active monitoring. The security is monitored and controlled by autonomous patrol robots. Any indication of a security breach will result in an immediate alarm and activation of the robot group to subdue and tranquilize the intruder.

  16. Shortening Record in the Central Andean Plateau of Southern Peru: Basement Inversion, Thin-skinned Thrusting, and Geomorphic Response

    Science.gov (United States)

    Perez, N.; Horton, B. K.; McQuarrie, N.; Stübner, K.; Ehlers, T. A.

    2015-12-01

    Variations in the inherited structural architecture along western South America influence the timing, magnitude, and style of Andean deformation and topographic evolution. New results from mapping, balanced cross-section construction, apatite and zircon (U-Th)/He thermochronology, and geomorphology spanning the Altiplano, Eastern Cordillera and Subandean zone of southern Peru define the role of Triassic rift inversion on Cenozoic deformation style, thrust belt kinematics, exhumation timing, and spatial variation of canyon incision. A minimum of 130 km (38%) shortening along a 200 km transect accommodated by thin- and thick-skinned structures involved selective reactivation of Triassic normal faults that fed slip to shallower detachments of thin-skinned fold-thrust systems. Map relationships define unique structural domains defined by inherited normal faults. In the Eastern Cordillera, new zircon (U-Th)/He results from a Triassic pluton reveal Oligocene-Miocene (~26-18 Ma) cooling, consistent with previously reported exhumation from ~40 km along strike to the NW. However, rapid ~15 Ma cooling revealed by new apatite (U-Th)/He data is ~11 Myr older than equivalent rocks in a similar structural setting ~40 km to the NW. This suggests a potential middle Miocene shift from synchronous to diachronous exhumation along strike. Modern fluvial profiles constructed along the Eastern Cordillera show a reduction in knickpoint elevations from SE to NW, suggesting more youthful uplift toward the NW, comparable to the spatial trend in apatite (U-Th)/He ages. The deformation front reached the Subandean zone by ~15 Ma, after the majority of reported deformation in the Eastern Cordillera and Altiplano. These variations in exhumation over such distances are consistent with multiple potential scenarios: a northward propagating wave of uplift, spatial variations in climatically driven incision, interactions with mantle dynamics, or complex structural geometries.

  17. Assessing complexity of skin blood flow oscillations in response to locally applied heating and pressure in rats: Implications for pressure ulcer risk

    Science.gov (United States)

    Liao, Fuyuan; O'Brien, William D.; Jan, Yih-Kuen

    2013-10-01

    The objective of this study was to investigate the effects of local heating on the complexity of skin blood flow oscillations (BFO) under prolonged surface pressure in rats. Eleven Sprague-Dawley rats were studied: 7 rats underwent surface pressure with local heating (△t=10 °C) and 4 rats underwent pressure without heating. A pressure of 700 mmHg was applied to the right trochanter area of rats for 3 h. Skin blood flow was measured using laser Doppler flowmetry. The loading period was divided into nonoverlapping 30 min epochs. For each epoch, multifractal detrended fluctuation analysis (MDFA) was utilized to compute DFA coefficients and complexity of endothelial related metabolic, neurogenic, and myogenic frequencies of BFO. The results showed that under surface pressure, local heating led to a significant decrease in DFA coefficients of myogenic frequency during the initial epoch of loading period, a sustained decrease in complexity of myogenic frequency, and a significantly higher degree of complexity of metabolic frequency during the later phase of loading period. Surrogate tests showed that the reduction in complexity of myogenic frequency was associated with a loss of nonlinearity whereas increased complexity of metabolic frequency was associated with enhanced nonlinearity. Our results indicate that increased metabolic activity and decreased myogenic response due to local heating manifest themselves not only in magnitudes of metabolic and myogenic frequencies but also in their structural complexity. This study demonstrates the feasibility of using complexity analysis of BFO to monitor the ischemic status of weight-bearing skin and risk of pressure ulcers.

  18. Software Architecture for Autonomous Spacecraft

    Science.gov (United States)

    Shih, Jimmy S.

    1997-01-01

    The thesis objective is to design an autonomous spacecraft architecture to perform both deliberative and reactive behaviors. The Autonomous Small Planet In-Situ Reaction to Events (ASPIRE) project uses the architecture to integrate several autonomous technologies for a comet orbiter mission.

  19. Skin Infections Due to Corynebacterium

    Directory of Open Access Journals (Sweden)

    Meltem Türkmen

    2010-03-01

    Full Text Available Corynebacteria are Gram-positive, non-sporulated, non-capsulated, aerobic diphtheroid bacteria accounting for nearly 50%of the natural skin biocene. This bacterial family is responsible for various skin diseases such as cutaneous diphteria, cromhydrosis, bromhydrosis but the most common of them are pitted keratolysis, trichobacteriosis and erythrasma. A warm and moist environment and poor hygiene are the predisposition factors for these three diseases. Although this skin diseases are seen more frequently, they usually mistaken for a mycotic infection by general practitioners, with subsequent antimycotic treatment. Here skin diseases compromised with Corynebacterium are presented with their demographic features and discussed on the basis of a literature review.

  20. Autonomous Real Time Requirements Tracing

    Science.gov (United States)

    Plattsmier, George; Stetson, Howard

    2014-01-01

    One of the more challenging aspects of software development is the ability to verify and validate the functional software requirements dictated by the Software Requirements Specification (SRS) and the Software Detail Design (SDD). Insuring the software has achieved the intended requirements is the responsibility of the Software Quality team and the Software Test team. The utilization of Timeliner-TLX(sup TM) Auto- Procedures for relocating ground operations positions to ISS automated on-board operations has begun the transition that would be required for manned deep space missions with minimal crew requirements. This transition also moves the auto-procedures from the procedure realm into the flight software arena and as such the operational requirements and testing will be more structured and rigorous. The autoprocedures would be required to meet NASA software standards as specified in the Software Safety Standard (NASASTD- 8719), the Software Engineering Requirements (NPR 7150), the Software Assurance Standard (NASA-STD-8739) and also the Human Rating Requirements (NPR-8705). The Autonomous Fluid Transfer System (AFTS) test-bed utilizes the Timeliner-TLX(sup TM) Language for development of autonomous command and control software. The Timeliner-TLX(sup TM) system has the unique feature of providing the current line of the statement in execution during real-time execution of the software. The feature of execution line number internal reporting unlocks the capability of monitoring the execution autonomously by use of a companion Timeliner-TLX(sup TM) sequence as the line number reporting is embedded inside the Timeliner-TLX(sup TM) execution engine. This negates I/O processing of this type data as the line number status of executing sequences is built-in as a function reference. This paper will outline the design and capabilities of the AFTS Autonomous Requirements Tracker, which traces and logs SRS requirements as they are being met during real-time execution of the

  1. Psychophysiological responses to auditory change.

    Science.gov (United States)

    Chuen, Lorraine; Sears, David; McAdams, Stephen

    2016-06-01

    A comprehensive characterization of autonomic and somatic responding within the auditory domain is currently lacking. We studied whether simple types of auditory change that occur frequently during music listening could elicit measurable changes in heart rate, skin conductance, respiration rate, and facial motor activity. Participants heard a rhythmically isochronous sequence consisting of a repeated standard tone, followed by a repeated target tone that changed in pitch, timbre, duration, intensity, or tempo, or that deviated momentarily from rhythmic isochrony. Changes in all parameters produced increases in heart rate. Skin conductance response magnitude was affected by changes in timbre, intensity, and tempo. Respiratory rate was sensitive to deviations from isochrony. Our findings suggest that music researchers interpreting physiological responses as emotional indices should consider acoustic factors that may influence physiology in the absence of induced emotions. PMID:26927928

  2. A fiber optic probe for measurement of an autonomic dysreflexia event on SCI patients

    Science.gov (United States)

    Ramella-Roman, J. C.; Hidler, J. M.

    2008-02-01

    Autonomic Dysreflexia (AD) is an inappropriate response of the sympathetic nervous system that often occurs in individuals with spinal cord injury (SCI ) at or above the sixth thoracic vertebrae (T6) level when a noxius stimulus is applied below the level of injury. An AD event can be put into motion by something as simple as an ingrown toenail or a full bladder, with symptoms such as headache, elevated blood pressure, reduced heart rate, decreases in blood flow below the level of injury, and in extreme cases, stroke. We have developed a quantitative method of measuring skin oxygen levels during AD using a fiber optics based probe. Two such probes were located above and below the injury level (on the patient forearm and thigh respectively) and were connected to a dual channel spectrophotometer. Oxygen saturation was calculated using the reflectance spectra and an algorithm based on melanin and hemoglobin absorption. We found that during an AD event, the amount of oxygen in the skin below the injury level drops by as much as 40%, while above the injury level skin oxygenation remains constant. Additionally, we observed elevated persperation levels below the injury level. We hypothesize that the combination of AD-related ischemia with pressure related ischemia and increased perspiration places individuals with injury level at T6 or above at significant risk for developing a pressure sore below the injury site.

  3. Inactivated poliovirus type 2 vaccine delivered to rat skin via high density microprojection array elicits potent neutralising antibody responses.

    Science.gov (United States)

    Muller, David A; Pearson, Frances E; Fernando, Germain J P; Agyei-Yeboah, Christiana; Owens, Nick S; Corrie, Simon R; Crichton, Michael L; Wei, Jonathan C J; Weldon, William C; Oberste, M Steven; Young, Paul R; Kendall, Mark A F

    2016-01-01

    Polio eradication is progressing rapidly, and the live attenuated Sabin strains in the oral poliovirus vaccine (OPV) are being removed sequentially, starting with type 2 in April 2016. For risk mitigation, countries are introducing inactivated poliovirus vaccine (IPV) into routine vaccination programs. After April 2016, monovalent type 2 OPV will be available for type 2 outbreak control. Because the current IPV is not suitable for house-to-house vaccination campaigns (the intramuscular injections require health professionals), we developed a high-density microprojection array, the Nanopatch, delivered monovalent type 2 IPV (IPV2) vaccine to the skin. To assess the immunogenicity of the Nanopatch, we performed a dose-matched study in rats, comparing the immunogenicity of IPV2 delivered by intramuscular injection or Nanopatch immunisation. A single dose of 0.2 D-antigen units of IPV2 elicited protective levels of poliovirus antibodies in 100% of animals. However, animals receiving IPV2 by IM required at least 3 immunisations to reach the same neutralising antibody titres. This level of dose reduction (1/40th of a full dose) is unprecedented for poliovirus vaccine delivery. The ease of administration coupled with the dose reduction observed in this study points to the Nanopatch as a potential tool for facilitating inexpensive IPV for mass vaccination campaigns. PMID:26911254

  4. The diverse and amazing allergic responses to coloured semi-synthetic fabrics in skin of man, woman and transgenders (MTF and FTM

    Directory of Open Access Journals (Sweden)

    lLorenzo Martini

    2016-04-01

    Full Text Available We have attempted to determinate how three particular synthetic or semi-synthetic fabrics (that are serge, polycotton and spandex may interact with the skin of Males, Females or Transsexuals (MtFs and/or FtMs, when these individuals put on these fibers directly on nude epidermis. Transsexuals are to be considered, in this seat, all the subjects that take on purpose the relative opposite hormones to try to change or determinately change their sex, that is Men who take estrogens and Women who take Testosterone to grow transgender. Hormonal influence is to be reputed the chief responsible cause of the occurrence of diverse cutaneous manifestations. Results are extremely suggestive and show that hormonal influence is actually the primary cause of histamine and bradikyne cascade, apt to evoke odd cutaneous manifestations in Man, Woman or Transgender, depending on the type, idest, if the transgender is MtF or FtM.

  5. Investigating the Effect of Sympathetic Skin Response Parameters on the Psychological Test Scores in Patients with Fibromyalgia Syndrome by Using ANNS

    Directory of Open Access Journals (Sweden)

    Murat Yıldız

    2013-01-01

    Full Text Available In this study, psychological tests such as Visual Analogue Pain Scale, Verbal Pain Scale, Beck Depression Inventory, Beck Anxiety Inventory, Hamilton Depression Rating Scale and Hamilton Anxiety Scale were applied to the selected healthy subjects and patients with Fibromyalgia Syndrome (FMS in Suleyman Demirel University, Faculty of Medicine, Department of Physical Medicine and Rehabilitation and the scores were recorded. A measurement system was established in the same department of the university to measure the sympathetic skin response (SSR from the subjects. The SSR was measured and recorded. The parameters such as latency time, maximum amplitude and the elapsed time were calculated by using Matlab software from the recorded SSR data. SSR parameters were added to the scores and diagnosis accuracy percentages of the FMS calculated by using artificial neural networks (ANNs. Obtained results from the simulations showed that the specified parameters of the SSR and FMS were concerned and these parameters can be used as a diagnostic method in FMS.

  6. Effect of Sleep/Wake Cycle on Autonomic Regulation

    International Nuclear Information System (INIS)

    Objective: To evaluate the association between irregular sleep/wake cycle in shift workers and autonomic regulation. Study Design: Cross-sectional, analytical study. Place and Duration of Study: Dow University Hospital, Karachi, from August to November 2013. Methodology: All health care providers working in rotating shifts making a total (n=104) were included. Instrument was an integrated questionnaire applied to assess autonomic regulation, taken from Kroz et al. on scoring criteria, ranging from 18 - 54, where higher rating signifies strong autonomic regulation, indicating a stable Autonomic Nervous System (ANS) and vice versa. Participants were interviewed and their response was recorded by the investigator. Influence of sleep misalignment was measured quantitatively to extract index of autonomic activity. Results: There was a reduced trend in autonomic strength amongst shift workers. The mean score obtained on the Autonomic Scale was 37.8 ± 5.9. Conclusion: Circadian misalignment has an injurious influence on ANS which might be valuable in controlling autonomic dysfunction that leads to fatal triggers in rotating shift workers. (author)

  7. Environment and the skin

    International Nuclear Information System (INIS)

    The skin is an important organ of defense adaptation and a portal of entry for xenobiotics. It is vulnerable to physical, chemical, and biologic agents and capable of expressing responses to these agents in a variety of pathologic patterns. These patterns are characterized by morphologic and functional features which are elicited by careful examination and test procedures. Cutaneous cancer may result from exposure to nonionizing as well as ionizing radiation, to specific identifiable chemical hazards, and may be enhanced by trauma. Cutaneous hazards of chemical sources are largely found in the workplace and among consumer products, including drugs and toilet goods. Environmental skin diseases and injuries are preventable. Prior to use assessment for safety and for possible risks from exposure to an agent, product, or process is of primary importance in the prevention and control of environmental skin disease and injury

  8. Effects of Betel chewing on the central and autonomic nervous systems.

    Science.gov (United States)

    Chu, N S

    2001-01-01

    Betel chewing has been claimed to produce a sense of well-being, euphoria, heightened alertness, sweating, salivation, a hot sensation in the body and increased capacity to work. Betel chewing also leads to habituation, addiction and withdrawal. However, the mechanisms underlying these effects remain poorly understood. Arecoline, the major alkaloid of Areca nut, has been extensively studied, and several effects of betel chewing are thought to be related to the actions of this parasympathomimetic constituent. However, betel chewing may produce complex reactions and interactions. In the presence of lime, arecoline and guvacoline in Areca nut are hydrolyzed into arecaidine and guvacine, respectively, which are strong inhibitors of GABA uptake. Piper betle flower or leaf contains aromatic phenolic compounds which have been found to stimulate the release of catecholamines in vitro. Thus, betel chewing may affect parasympathetic, GABAnergic and sympathetic functions. Betel chewing produces an increase in heart rate, blood pressure, sweating and body temperature. In addition, EEG shows widespread cortical desynchronization indicating a state of arousal. In autonomic function tests, both the sympathetic skin response and RR interval variation are affected. Betel chewing also increases plasma concentrations of norepinephrine and epinephrine. These results suggest that betel chewing mainly affects the central and autonomic nervous systems. Future studies should investigate both the acute and chronic effects of betel chewing. Such studies may further elucidate the psychoactive mechanisms responsible for the undiminished popularity of betel chewing since antiquity. PMID:11385294

  9. Modification of the radiation response of pig skin by manipulation of tissue oxygen tension using anesthetics and administration of BW12C

    International Nuclear Information System (INIS)

    The importance of tissue oxygen tension on radiosensitivity was studied by examining modifications in the incidence of moist desquamation in pig skin after irradiation with strontium-90 plaques. The effects were analyzed using quantal dose-response data and comparisons were made using ED50 values for moist desquamation. Under standard anesthetic conditions of 2% halothane, approximately 70% oxygen, and approximately 30% nitrous oxide, the ED50 value (+/- SE) for moist desquamation was 27.32 +/- 0.52 Gy with no significant variation in radiosensitivity between dorsal, lateral, and ventral skin sites on the flank. Irradiation with 2% halothane and air increased the ED50 to 31.25 +/- 0.94 Gy, primarily due to an increased radioresistance of the dorsal sites. When combined with BW12C, a drug which binds oxygen selectively to hemoglobin and hence reduced the oxygen availability to tissues, a further increase in the ED50 values was observed. This was approximately 39 Gy with BW12C concentrations of 30 mg/kg and 50 mg/kg b.w. of BW12C, indicating a dose modification factor (DMF) of approximately 1.26. However, when animals were breathing the standard gas mixture, this DMF was reduced to 1.15 for 30 mg/kg of BW12C, indicating that a higher level of oxygen partly counteracted the effects of the drug in these studies with BW12C. The greatest variability in radiosensitivity was seen in the dorsal fields. This suggested complex physiological adaptation, a phenomenon that might also explain the absence of any modification of the radiation response when 100 mg/kg of BW12C was used

  10. Probabilistic hazard assessment for skin sensitization potency by dose–response modeling using feature elimination instead of quantitative structure–activity relationships

    Science.gov (United States)

    McKim, James M.; Hartung, Thomas; Kleensang, Andre; Sá-Rocha, Vanessa

    2016-01-01

    Supervised learning methods promise to improve integrated testing strategies (ITS), but must be adjusted to handle high dimensionality and dose–response data. ITS approaches are currently fueled by the increasing mechanistic understanding of adverse outcome pathways (AOP) and the development of tests reflecting these mechanisms. Simple approaches to combine skin sensitization data sets, such as weight of evidence, fail due to problems in information redundancy and high dimension-ality. The problem is further amplified when potency information (dose/response) of hazards would be estimated. Skin sensitization currently serves as the foster child for AOP and ITS development, as legislative pressures combined with a very good mechanistic understanding of contact dermatitis have led to test development and relatively large high-quality data sets. We curated such a data set and combined a recursive variable selection algorithm to evaluate the information available through in silico, in chemico and in vitro assays. Chemical similarity alone could not cluster chemicals’ potency, and in vitro models consistently ranked high in recursive feature elimination. This allows reducing the number of tests included in an ITS. Next, we analyzed with a hidden Markov model that takes advantage of an intrinsic inter-relationship among the local lymph node assay classes, i.e. the monotonous connection between local lymph node assay and dose. The dose-informed random forest/hidden Markov model was superior to the dose-naive random forest model on all data sets. Although balanced accuracy improvement may seem small, this obscures the actual improvement in misclassifications as the dose-informed hidden Markov model strongly reduced "false-negatives" (i.e. extreme sensitizers as non-sensitizer) on all data sets. PMID:26046447

  11. The effects of feeding with synbiotic (Pediococcus acidilactici and fructooligosaccharide) enriched adult Artemia on skin mucus immune responses, stress resistance, intestinal microbiota and performance of angelfish (Pterophyllum scalare).

    Science.gov (United States)

    Azimirad, Mahmood; Meshkini, Saeed; Ahmadifard, Nasrollah; Hoseinifar, Seyed Hossein

    2016-07-01

    The aim of this study was to evaluate the effects of feeding on synbiotic (Pediococcus acidilactici and fructooligosaccharide) enriched adult Artemia franciscana on skin mucus immune responses, stress resistance, intestinal microbiota and growth performance of angelfish (Pterophyllum scalare). Three hundred and sixty fish with initial weight 3.2 ± 0.13 g were randomly divided into twelve aquaria (50 L) assigned to four groups in triplicates. Fish were fed for 7 weeks with dietary treatments, including treatment 1: feeding adult Artemia without enrichment (control group), treatment 2: feeding adult Artemia enriched with lyophilised probiotic P. acidilactici (700 mg L(-1)), 3: feeding adult Artemia enriched with prebiotic fructooligosaccharide (FOS) (100 mg L(-1)), group 4: feeding adult Artemia enriched with synbiotic (P. acidilactici (700 mg L(-1)) + FOS (100 mg L(-1))). Skin mucus immune responses (lysozyme activity, total Immunoglobulin and protease), stress resistance against environmental stress (acute decrease of temperature and increase salinity), intestinal microbiota as well as growth indices were measured at the end of feeding trial. Artemia enriched with synbiotic significantly improved growth performance compared to other treatments (P < 0.05). The highest weight gain and specific growth rate (SGR) was observed in synbiotic fed fish (P < 0.05). Compared to the other treatments, the population of lactic acid bacteria was significantly higher in the intestinal microbiota of fish fed synbiotic supplemented diet (P < 0.05). In the environmental stress challenge test, the maximum resistance to abrupt decrease of temperature (17 °C) or elevation of salinity (12 g per liter) was observed in the synbiotic treatment. Also, the total immunoglobulin and lysozyme activity level of skin mucus was significantly elevated in fish fed Artemia enriched with synbiotic (P < 0.05). These results revealed that feeding angelfish with synbiotic

  12. Mobile Autonomous Humanoid Assistant

    Science.gov (United States)

    Diftler, M. A.; Ambrose, R. O.; Tyree, K. S.; Goza, S. M.; Huber, E. L.

    2004-01-01

    A mobile autonomous humanoid robot is assisting human co-workers at the Johnson Space Center with tool handling tasks. This robot combines the upper body of the National Aeronautics and Space Administration (NASA)/Defense Advanced Research Projects Agency (DARPA) Robonaut system with a Segway(TradeMark) Robotic Mobility Platform yielding a dexterous, maneuverable humanoid perfect for aiding human co-workers in a range of environments. This system uses stereo vision to locate human team mates and tools and a navigation system that uses laser range and vision data to follow humans while avoiding obstacles. Tactile sensors provide information to grasping algorithms for efficient tool exchanges. The autonomous architecture utilizes these pre-programmed skills to form human assistant behaviors. The initial behavior demonstrates a robust capability to assist a human by acquiring a tool from a remotely located individual and then following the human in a cluttered environment with the tool for future use.

  13. Tuberculin Skin Testing Compared with T-Cell Responses to Mycobacterium tuberculosis-Specific and Nonspecific Antigens for Detection of Latent Infection in Persons with Recent Tuberculosis Contact

    Science.gov (United States)

    Arend, Sandra M.; Engelhard, Anrik C. F.; Groot, Gertjan; de Boer, Kirsten; Andersen, Peter; Ottenhoff, Tom H. M.; van Dissel, Jaap T.

    2001-01-01

    The tuberculin skin test (TST) is used for the identification of latent tuberculosis (TB) infection (LTBI) but lacks specificity in Mycobacterium bovis BCG-vaccinated individuals, who constitute an increasing proportion of TB patients and their contacts from regions where TB is endemic. In previous studies, T-cell responses to ESAT-6 and CFP-10, M. tuberculosis-specific antigens that are absent from BCG, were sensitive and specific for detection of active TB. We studied 44 close contacts of a patient with smear-positive pulmonary TB and compared the standard screening procedure for LTBI by TST or chest radiographs with T-cell responses to M. tuberculosis-specific and nonspecific antigens. Peripheral blood mononuclear cells were cocultured with ESAT-6, CFP-10, TB10.4 (each as recombinant antigen and as a mixture of overlapping synthetic peptides), M. tuberculosis sonicate, purified protein derivative (PPD), and short-term culture filtrate, using gamma interferon production as the response measure. LTBI screening was by TST in 36 participants and by chest radiographs in 8 persons. Nineteen contacts were categorized as TST negative, 12 were categorized as TST positive, and 5 had indeterminate TST results. Recombinant antigens and peptide mixtures gave similar results. Responses to TB10.4 were neither sensitive nor specific for LTBI. T-cell responses to ESAT-6 and CFP-10 were less sensitive for detection of LTBI than those to PPD (67 versus 100%) but considerably more specific (100 versus 72%). The specificity of the TST or in vitro responses to PPD will be even less when the proportion of BCG-vaccinated persons among TB contacts evaluated for LTBI increases. PMID:11687445

  14. Autonomous single camera exploration

    OpenAIRE

    Vidal-Calleja, Teresa A.; Sanfeliu, Alberto; Andrade-Cetto, J.

    2006-01-01

    In this paper we present an active exploration strategy for a mobile robot navigating in 3D. The aim is to control a moving robot that autonomously builds a visual feature map while at the same time optimises its localisation in this map. The technique chooses the most appropriate commands maximising the information gain between prior states and measurements, while performing 6DOF bearing only SLAM at video rate. Maximising the mutual information helps the vehicle avoid ill-conditioned measur...

  15. Autonomous Underwater Vehicle control

    OpenAIRE

    Vidal Morató, Jordi; Gomáriz Castro, Spartacus; Manuel Lázaro, Antonio

    2005-01-01

    In this paper the system control design stages for an autonomous underwater vehicle are presented. The vehicle must be able to sail on sea surface, following a path without losing its route and once a position is reached, a dive following a perpendicular path to the surface is carried out. A two level system control are proposed. The primary level will control the navigation of the vehicle where a linear controllers are proposed. Whereas in secondary level guidance system, collision system, s...

  16. The autonomous acoustic buoy

    OpenAIRE

    Pellicer, Francisco; Reitsma, Robert; Agüera, Joaquín; Marinas, Alexandra

    2013-01-01

    The Acoustic Buoy is a project between the Laboratory of Applied Bioacoustics (LAB) and the Universitat Politècnica de Catalunya (UPC). In areas that the human activities produce high noise levels, such as oil exploration or construction, there is a need to monitor the environment for the presence of cetaceans. Another need is for fishing, to prevent endangered species from being killed. This can be done with an Autonomous Acoustic Buoy (AAB). Mooring or anchoring at to the seaflo...

  17. Mobile Intelligent Autonomous Systems

    OpenAIRE

    Jitendra R. Raol; Ajith Gopal

    2010-01-01

    Mobile intelligent autonomous systems (MIAS) is a fast emerging research area. Although it can be regarded as a general R&D area, it is mainly directed towards robotics. Several important subtopics within MIAS research are:(i) perception and reasoning, (ii) mobility and navigation,(iii) haptics and teleoperation, (iv) image fusion/computervision, (v) modelling of manipulators, (vi) hardware/software architectures for planning and behaviour learning leadingto robotic architecture, (vii) ve...

  18. Identification of organ-autonomous constituents of the molecular memory conferred by thyroid hormone exposure in cold temperature-arrested metamorphosing Rana (Lithobates) catesbeiana tadpoles.

    Science.gov (United States)

    Austin Hammond, S; Jackman, Kevin W; Partovi, Shireen H; Veldhoen, Nik; Helbing, Caren C

    2016-03-01

    Environmental temperature modulates thyroid hormone (TH)-dependent metamorphosis in some amphibian species. The North American bullfrog - Rana (Lithobates) catesbeiana - tadpole is naturally adapted to a wide range of temperatures over multiple seasons. Cold temperatures delay while warmer temperatures accelerate metamorphosis. Exogenous TH exposure of premetamorphic tadpoles results in a rapid precocious induction of metamorphosis at warm temperatures (20-25°C). The same exposure at cold temperatures (4-5°C) does not elicit an overt metamorphic response. However, a molecular memory of TH exposure is established such that cold, TH-exposed tadpoles returned to permissive warm temperatures will rapidly execute TH-induced genetic programs. Previous mRNA profiling has identified TH-regulated transcription factors encoded by thra, thrb, thibz, klf9, and cebp1 as components of the molecular memory after one week post-exposure. However, a further hierarchy may exist within the initiation phase since many gene transcripts demonstrated tissue-specific patterns. Whether the molecular memory is organ autonomous or requires additional modulating factors is unknown. Herein we examine tail fin and back skin and determine that thibz is the only transcript that is TH-responsive after 2 days post-exposure at low temperature in both tissues in the intact animal. In back skin, cebp1 is also TH-responsive under these conditions. Serum-free tail fin organ culture (C-Fin) reveals that the thibz response is organ autonomous whereas cultured back skin (C-Skin) results suggest that thibz and cebp1 require an additional factor for induction from elsewhere within the intact animal. Subsequent investigations are now possible to identify endogenous factors that modulate the molecular memory in intact animals. PMID:26795672

  19. Nature's Autonomous Oscillators

    Science.gov (United States)

    Mayr, H. G.; Yee, J.-H.; Mayr, M.; Schnetzler, R.

    2012-01-01

    Nonlinearity is required to produce autonomous oscillations without external time dependent source, and an example is the pendulum clock. The escapement mechanism of the clock imparts an impulse for each swing direction, which keeps the pendulum oscillating at the resonance frequency. Among nature's observed autonomous oscillators, examples are the quasi-biennial oscillation and bimonthly oscillation of the Earth atmosphere, and the 22-year solar oscillation. The oscillations have been simulated in numerical models without external time dependent source, and in Section 2 we summarize the results. Specifically, we shall discuss the nonlinearities that are involved in generating the oscillations, and the processes that produce the periodicities. In biology, insects have flight muscles, which function autonomously with wing frequencies that far exceed the animals' neural capacity; Stretch-activation of muscle contraction is the mechanism that produces the high frequency oscillation of insect flight, discussed in Section 3. The same mechanism is also invoked to explain the functioning of the cardiac muscle. In Section 4, we present a tutorial review of the cardio-vascular system, heart anatomy, and muscle cell physiology, leading up to Starling's Law of the Heart, which supports our notion that the human heart is also a nonlinear oscillator. In Section 5, we offer a broad perspective of the tenuous links between the fluid dynamical oscillators and the human heart physiology.

  20. Functional Imaging of Autonomic Regulation: Methods and Key Findings

    Directory of Open Access Journals (Sweden)

    Paul M Macey

    2016-01-01

    Full Text Available Central nervous system processing of autonomic function involves a network of regions throughout the brain which can be visualized and measured with neuroimaging techniques, notably functional magnetic resonance imaging (fMRI. The development of fMRI procedures has both confirmed and extended earlier findings from animal models, and human stroke and lesion studies. Assessments with fMRI can elucidate interactions between different central sites in regulating normal autonomic patterning, and demonstrate how disturbed systems can interact to produce aberrant regulation during autonomic challenges. Understanding autonomic dysfunction in various illnesses reveals mechanisms that potentially lead to interventions in the impairments. The objectives here are to: 1 describe the fMRI neuroimaging methodology for assessment of autonomic neural control, 2 outline the widespread, lateralized distribution of function in autonomic sites in the normal brain which includes structures from the neocortex through the medulla and cerebellum, 3 illustrate the importance of the time course of neural changes when coordinating responses, and how those patterns are impacted in conditions of sleep-disordered breathing, and 4 highlight opportunities for future research studies with emerging methodologies. Methodological considerations specific to autonomic testing include timing of challenges relative to the underlying fMRI signal, spatial resolution sufficient to identify autonomic brainstem nuclei, blood pressure and blood oxygenation influences on the fMRI signal, and the sustained timing, often measured in minutes of challenge periods and recovery. Key findings include the lateralized nature of autonomic organization, which is reminiscent of asymmetric motor, sensory and language pathways. Testing brain function during autonomic challenges demonstrate closely-integrated timing of responses in connected brain areas during autonomic challenges, and the involvement with

  1. Marked depletion of dorsal spinal cord substance P and calcitonin gene-related peptide with intact skin flare responses in multiple system atrophy.

    OpenAIRE

    Anand, P; Bannister, R; McGregor, G P; Ghatei, M A; Mulderry, P K; Bloom, S R

    1988-01-01

    In view of the presence of neuropeptides in spinal cord autonomic pathways, their regional concentration was studied in post mortem thoracic cord from four cases of multiple system atrophy with progressive autonomic failure (MSA). A marked depletion was observed of substance P, its related peptide substance K, and of calcitonin gene-related peptide (CGRP), particularly in dorsal regions where peptide-containing sensory fibres terminate. As substance P and CGRP in primary sensory fibres are co...

  2. Preclinical and clinical evaluation of autonomic function in humans.

    Science.gov (United States)

    Joyner, Michael J

    2016-07-15

    This review focuses on how to assess autonomic function in humans including various ways to measure heart rate, catecholamines, and sympathetic neural activity. The need to assess autonomic function is paramount in many experimental paradigms because of the following. (1) Autonomic dysfunction is present in common diseases like hypertension, diabetes and heart failure, and the magnitude of this dysfunction is broadly related to morbidity and mortality in these disorders. (2) The relationship between autonomic dysfunction and morbidity and mortality can be causal. (3) Interventions that modulate or reverse autonomic dysfunction can improve outcomes in the affected patients. The techniques discussed are also frequently used to understand the autonomic response to sympathoexcitatory manoeuvres like exercise, the cold pressor test or mental stress. Because these manoeuvres can engage a variety of sensory and efferent pathways, under some circumstances the physiological responses measured by many of the techniques are directionally similar, in others they are divergent. Thus any investigator seeking to study the autonomic nervous system or its contribution to either normal physiology or pathophysiological conditions must carefully balance a number of considerations to ensure that the right technique is used to address the question of interest. PMID:27098282

  3. Autonomic Findings in Takotsubo Cardiomyopathy.

    Science.gov (United States)

    Norcliffe-Kaufmann, Lucy; Kaufmann, Horacio; Martinez, Jose; Katz, Stuart D; Tully, Lisa; Reynolds, Harmony R

    2016-01-15

    Takotsubo cardiomyopathy (TC) often occurs after emotional or physical stress. Norepinephrine levels are unusually high in the acute phase, suggesting a hyperadrenergic mechanism. Comparatively little is known about parasympathetic function in patients with TC. We sought to characterize autonomic function at rest and in response to physical and emotional stimuli in 10 women with a confirmed history of TC and 10 age-matched healthy women. Sympathetic and parasympathetic activity was assessed at rest and during baroreflex stimulation (Valsalva maneuver and tilt testing), cognitive stimulation (Stroop test), and emotional stimulation (event recall, patients). Ambulatory blood pressure monitoring and measurement of brachial artery flow-mediated vasodilation were also performed. TC women (tested an average of 37 months after the event) had excessive pressor responses to cognitive stress (Stroop test: p emotional arousal (recall of TC event: p = 0.03 vs baseline). Pressor responses to hemodynamic stimuli were also amplified (Valsalva overshoot: p <0.05) and prolonged (duration: p <0.01) in the TC women compared with controls. Plasma catecholamine levels did not differ between TC women and controls. Indexes of parasympathetic (vagal) modulation of heart rate induced by respiration and cardiovagal baroreflex gain were significantly decreased in the TC women versus controls. In conclusion, even long after the initial episode, women with previous episode of TC have excessive sympathetic responsiveness and reduced parasympathetic modulation of heart rate. Impaired baroreflex control may therefore play a role in TC. PMID:26743349

  4. Influence of illumination on autonomic thermoregulation and choice of clothing

    Science.gov (United States)

    Kim, Seung Hi; Jeong, Woon Seon

    2002-04-01

    This study was conducted to investigate how different levels of illumination below 1,000 lx would affect the autonomic and behavioral temperature regulation of humans. Seven healthy college-aged women (20+/-0 years) volunteered to participate in this study. They were exposed to a temperature of 26 °C in 320 lx for 30 min ('Equilibrium') followed by 700 lx or 70 lx for 30 min (stage 1). After stage 1, they were exposed to 20 °C for 30 min in the same illumination as in stage 1 (stage 2). In stage 2 the subjects were instructed to select and wear the clothing they needed for their thermal comfort. The data obtained were analyzed by paired t-test and repeated measures of analysis of variance. Forearm skin blood flow tended to remain steady in 700 lx but decreased markedly in 70 lx in stage 1. There were no significant differences between subjective thermal responses of the subjects experiencing 700 lx or 70 lx in both stages although the subjects felt cooler in stage 2 than in stage 1. The subjects were likely to prefer wearing heavier clothing in 70 lx than in 700 lx. It was concluded that vasoconstriction in the upper limbs occurred more strongly in dim light, which might result in different clothing preferences in a cool environment from those associated with brighter light intensity.

  5. Abnormal autonomic and associated brain activities during rest in autism spectrum disorder

    OpenAIRE

    Eilam-Stock, Tehila; Xu, Pengfei; Cao, Miao; Gu, Xiaosi; Van Dam, Nicholas T.; Anagnostou, Evdokia; Kolevzon, Alexander; Soorya, Latha; Park, Yunsoo; Siller, Michael; He, Yong; Hof, Patrick R.; Fan, Jin

    2014-01-01

    Autism spectrum disorders are associated with social and emotional deficits, the aetiology of which are not well understood. A growing consensus is that the autonomic nervous system serves a key role in emotional processes, by providing physiological signals essential to subjective states. We hypothesized that altered autonomic processing is related to the socio-emotional deficits in autism spectrum disorders. Here, we investigated the relationship between non-specific skin conductance respon...

  6. Harnessing dendritic cells in inflammatory skin diseases

    OpenAIRE

    Chu, Chung-Ching; di Meglio, Paola; Nestle, Frank O

    2011-01-01

    The skin immune system harbors a complex network of dendritic cells (DCs). Recent studies highlight a diverse functional specialization of skin DC subsets. In addition to generating cellular and humoral immunity against pathogens, skin DCs are involved in tolerogenic mechanisms to ensure the maintenance of immune homeostasis, as well as in pathogenesis of chronic inflammation in the skin when excessive immune responses are initiated and unrestrained. Harnessing DCs by directly targeting DC-de...

  7. Noninvasive evaluation of the vascular response to transplantation of alginate encapsulated islets using the dorsal skin-fold model.

    Science.gov (United States)

    Krishnan, Rahul; Arora, Rajan P; Alexander, Michael; White, Sean M; Lamb, Morgan W; Foster, Clarence E; Choi, Bernard; Lakey, Jonathan R T

    2014-01-01

    Alginate encapsulation reduces the risk of transplant rejection by evading immune-mediated cell injury and rejection; however, poor vascular perfusion results in graft failure. Since existing imaging models are incapable of quantifying the vascular response to biomaterial implants after transplantation, in this study, we demonstrate the use of in vivo laser speckle imaging (LSI) and wide-field functional imaging (WiFI) to monitor the microvascular environment surrounding biomaterial implants. The vascular response to two islet-containing biomaterial encapsulation devices, alginate microcapsules and a high-guluronate alginate sheet, was studied and compared after implantation into the mouse dorsal window chamber (N = 4 per implant group). Images obtained over a 14-day period using LSI and WiFI were analyzed using algorithms to quantify blood flow, hemoglobin oxygen saturation and vascular density. Using our method, we were able to monitor the changes in the peri-implant microvasculature noninvasively without the use of fluorescent dyes. Significant changes in blood flow, hemoglobin oxygen saturation and vascular density were noted as early as the first week post-transplant. The dorsal window chamber model enables comparison of host responses to transplanted biomaterials. Future experiments will study the effect of changes in alginate composition on the vascular and immune responses. PMID:24176195

  8. Allergy testing - skin

    Science.gov (United States)

    Patch tests - allergy; Scratch tests - allergy; Skin tests - allergy; RAST test ... There are three common methods of allergy skin testing. The skin prick test involves: Placing a small amount of substances that may be causing your symptoms on the skin, ...

  9. Skin Care and Aging

    Science.gov (United States)

    ... Home » Skin Care and Aging Heath and Aging Skin Care and Aging Dry Skin and Itching Bruises Wrinkles Age Spots ... doctor. For More Information About Skin Care and Aging American Academy of Dermatology 1-866-503-7546 ( ...

  10. Skin Care and Aging

    Science.gov (United States)

    ... page please turn Javascript on. Skin Care and Aging How Aging Affects Skin Your skin changes with age. It ... if they bother you. See additional resources on aging skin, including information on treatment options, specific conditions, ...

  11. Skin Pigmentation Disorders

    Science.gov (United States)

    Pigmentation means coloring. Skin pigmentation disorders affect the color of your skin. Your skin gets its color from a pigment called melanin. Special cells in the skin make melanin. When these cells become damaged or ...

  12. Skin Substitutes

    OpenAIRE

    Zavan, Barbara; Vindigni, Vincenzo; Cortivo, Roberta; Abatangelo, Giovanni

    2010-01-01

    The many studies conducted so far reveal that Tissue Engineering of the skin is only at the beginning of its use in human applications. Burns patients were the first targets for such tissue substitutes, then chronic diseases, such as venous ulcers, have followed. The more experience is gained from the surgeon, the more feedback for the basic scientist to improve the product and to broaden clinical indications. Nowadays, progress in cell culture and biomedical material technologies have added ...

  13. Skin aging:

    OpenAIRE

    Puizina-Ivić, Neira

    2008-01-01

    There are two main processes that induce skin aging: intrinsic and extrinsic. A stochastic process that implies random cell damage as a result of mutations during metabolic processes due to the production of free radicals is also implicated. Extrinsic aging is caused by environmental factors such as sun exposure, air pollution, smoking, alcohol abuse, and poor nutrition. Intrinsicaging reflects the genetic background and depends on time. Various expressions of intrinsic aging include smooth, ...

  14. Gene expression in Atlantic salmon skin in response to infection with the parasitic copepod Lepeophtheirus salmonis, cortisol implant, and their combination

    Directory of Open Access Journals (Sweden)

    Krasnov Aleksei

    2012-04-01

    Full Text Available Abstract Background The salmon louse is an ectoparasitic copepod that causes major economic losses in the aquaculture industry of Atlantic salmon. This host displays a high level of susceptibility to lice which can be accounted for by several factors including stress. In addition, the parasite itself acts as a potent stressor of the host, and outcomes of infection can depend on biotic and abiotic factors that stimulate production of cortisol. Consequently, examination of responses to infection with this parasite, in addition to stress hormone regulation in Atlantic salmon, is vital for better understanding of the host pathogen interaction. Results Atlantic salmon post smolts were organised into four experimental groups: lice + cortisol, lice + placebo, no lice + cortisol, no lice + placebo. Infection levels were equal in both treatments upon termination of the experiment. Gene expression changes in skin were assessed with 21 k oligonucleotide microarray and qPCR at the chalimus stage 18 days post infection at 9°C. The transcriptomic effects of hormone treatment were significantly greater than lice-infection induced changes. Cortisol stimulated expression of genes involved in metabolism of steroids and amino acids, chaperones, responses to oxidative stress and eicosanoid metabolism and suppressed genes related to antigen presentation, B and T cells, antiviral and inflammatory responses. Cortisol and lice equally down-regulated a large panel of motor proteins that can be important for wound contraction. Cortisol also suppressed multiple genes involved in wound healing, parts of which were activated by the parasite. Down-regulation of collagens and other structural proteins was in parallel with the induction of proteinases that degrade extracellular matrix (MMP9 and MMP13. Cortisol reduced expression of genes encoding proteins involved in formation of various tissue structures, regulators of cell differentiation and growth factors. Conclusions

  15. Jam avoidance with autonomous systems

    OpenAIRE

    Tordeux, Antoine; Lassarre, Sylvain

    2015-01-01

    Many car-following models are developed for jam avoidance in highways. Two mechanisms are used to improve the stability: feedback control with autonomous models and increasing of the interaction within cooperative ones. In this paper, we compare the linear autonomous and collective optimal velocity (OV) models. We observe that the stability is significantly increased by adding predecessors in interaction with collective models. Yet autonomous and collective approaches are close when the speed...

  16. Chemical Specification of Autonomic Systems

    OpenAIRE

    Banâtre, Jean-Pierre; Fradet, Pascal; Radenac, Yann

    2004-01-01

    Autonomic computing provides a vision of information systems allowing self-management of many predefined properties. Such systems take care of their own behavior and of their interactions with other components without any external intervention. One of the major challenges concerns the expression of properties and constraints of autonomic systems. We believe that the {\\em chemical programming paradigm} (represented here by the Gamma formalism) is well-suited to the specification of autonomic s...

  17. Central gene expression changes associated with enhanced neuroendocrine and autonomic response habituation to repeated noise stress after voluntary wheel running in rats

    OpenAIRE

    Sarah K eSasse; Tara J eNyhuis; Cher V eMasini; Heidi E W eDay; Serge eCampeau

    2013-01-01

    Accumulating evidence indicates that regular physical exercise benefits health in part by counteracting some of the negative physiological impacts of stress. While some studies identified reductions in some measures of acute stress responses with prior exercise, limited data were available concerning effects on cardiovascular function, and reported effects on HPA axis responses were largely inconsistent. Given that exposure to repeated or prolonged stress is strongly implicated in the preci...

  18. Influenza nucleoprotein DNA vaccination by a skin targeted, dry coated, densely packed microprojection array (Nanopatch) induces potent antibody and CD8(+) T cell responses.

    Science.gov (United States)

    Fernando, Germain J P; Zhang, Jin; Ng, Hwee-Ing; Haigh, Oscar L; Yukiko, Sally R; Kendall, Mark A F

    2016-09-10

    DNA vaccines have many advantages such as thermostability and the ease and rapidity of manufacture; for example, in an influenza pandemic situation where rapid production of vaccine is essential. However, immunogenicity of DNA vaccines was shown to be poor in humans unless large doses of DNA are used. If a highly efficacious DNA vaccine delivery system could be identified, then DNA vaccines have the potential to displace protein vaccines. In this study, we show in a C57BL/6 mouse model, that the Nanopatch, a microprojection array of high density (>21,000 projections/cm(2)), could be used to deliver influenza nucleoprotein DNA vaccine to skin, to generate enhanced antigen specific antibody and CD8(+) T cell responses compared to the conventional intramuscular (IM) delivery by the needle and syringe. Antigen specific antibody was measured using ELISA assays of mice vaccinated with a DNA plasmid containing the nucleoprotein gene of influenza type A/WSN/33 (H1N1). Antigen specific CD8(+) T cell responses were measured ex-vivo in splenocytes of mice using IFN-γ ELISPOT assays. These results and our previous antibody and CD4(+) T cell results using the Nanopatch delivered HSV DNA vaccine indicate that the Nanopatch is an effective delivery system of general utility that could potentially be used in humans to increase the potency of the DNA vaccines. PMID:27381247

  19. Robotics and Autonomous Systems Laboratory

    Data.gov (United States)

    Federal Laboratory Consortium — FUNCTION: Provides an environment for developing and evaluating intelligent software for both actual and simulated autonomous vehicles. Laboratory computers provide...

  20. Jam avoidance with autonomous systems

    CERN Document Server

    Tordeux, Antoine

    2016-01-01

    Many car-following models are developed for jam avoidance in highways. Two mechanisms are used to improve the stability: feedback control with autonomous models and increasing of the interaction within cooperative ones. In this paper, we compare the linear autonomous and collective optimal velocity (OV) models. We observe that the stability is significantly increased by adding predecessors in interaction with collective models. Yet autonomous and collective approaches are close when the speed difference term is taking into account. Within the linear OV models tested, the autonomous models including speed difference are sufficient to maximise the stability.

  1. Collaborating with Autonomous Agents

    Science.gov (United States)

    Trujillo, Anna C.; Cross, Charles D.; Fan, Henry; Hempley, Lucas E.; Motter, Mark A.; Neilan, James H.; Qualls, Garry D.; Rothhaar, Paul M.; Tran, Loc D.; Allen, B. Danette

    2015-01-01

    With the anticipated increase of small unmanned aircraft systems (sUAS) entering into the National Airspace System, it is highly likely that vehicle operators will be teaming with fleets of small autonomous vehicles. The small vehicles may consist of sUAS, which are 55 pounds or less that typically will y at altitudes 400 feet and below, and small ground vehicles typically operating in buildings or defined small campuses. Typically, the vehicle operators are not concerned with manual control of the vehicle; instead they are concerned with the overall mission. In order for this vision of high-level mission operators working with fleets of vehicles to come to fruition, many human factors related challenges must be investigated and solved. First, the interface between the human operator and the autonomous agent must be at a level that the operator needs and the agents can understand. This paper details the natural language human factors e orts that NASA Langley's Autonomy Incubator is focusing on. In particular these e orts focus on allowing the operator to interact with the system using speech and gestures rather than a mouse and keyboard. With this ability of the system to understand both speech and gestures, operators not familiar with the vehicle dynamics will be able to easily plan, initiate, and change missions using a language familiar to them rather than having to learn and converse in the vehicle's language. This will foster better teaming between the operator and the autonomous agent which will help lower workload, increase situation awareness, and improve performance of the system as a whole.

  2. Central gene expression changes associated with enhanced neuroendocrine and autonomic response habituation to repeated noise stress after voluntary wheel running in rats

    Directory of Open Access Journals (Sweden)

    Sarah KSasse

    2013-11-01

    Full Text Available Accumulating evidence indicates that regular physical exercise benefits health in part by counteracting some of the negative physiological impacts of stress. While some studies identified reductions in some measures of acute stress responses with prior exercise, limited data were available concerning effects on cardiovascular function, and reported effects on HPA axis responses were largely inconsistent. Given that exposure to repeated or prolonged stress is strongly implicated in the precipitation and exacerbation of illness, we proposed the novel hypothesis that physical exercise might facilitate adaptation to repeated stress, and subsequently demonstrated significant enhancement of both HPA axis (glucocorticoid and cardiovascular (tachycardia response habituation to repeated noise stress in rats with long-term access to running wheels compared to sedentary controls. Stress habituation has been attributed to modifications of brain circuits, but the specific sites of adaptation and the molecular changes driving its expression remain unclear. Here, in situ hybridization histochemistry was used to examine regulation of select stress-associated signaling systems in brain regions representing likely candidates to underlie exercise-enhanced stress habituation. Analyzed brains were collected from active (6 weeks of wheel running and sedentary rats following control, acute, or repeated noise exposures that induced a significantly faster rate of glucocorticoid response habituation in active animals but preserved acute noise responsiveness. Nearly identical experimental manipulations also induce a faster rate of cardiovascular response habituation in exercised, repeatedly stressed rats. The observed regulation of the corticotropin-releasing factor and brain-derived neurotrophic factor systems across several brain regions suggests widespread effects of voluntary exercise on central functions and related adaptations to stress across multiple response

  3. Cutaneous skin tag

    Science.gov (United States)

    Skin tag; Acrochordon; Fibroepithelial polyp ... have diabetes. They are thought to occur from skin rubbing against skin. ... The tag sticks out of the skin and may have a short, narrow stalk connecting it to the surface of the skin. Some skin tags are as long as ...

  4. Autonomous packaging robot

    OpenAIRE

    Vo, Van Thanh

    2010-01-01

    The objective of the autonomous packaging robot application is to replace manual product packaging in food industry with a fully automatic robot. The objective is achieved by using the combination of machine vision, central computer, sensors, microcontroller and a typical ABB robot. The method is to equip the robot with different sensors: camera as “eyes” of robot, distance sensor and microcontroller as “sense of touch” of the robot, central computer as “brain” of the robot. Because the ro...

  5. Autonomous component carrier selection

    DEFF Research Database (Denmark)

    Garcia, Luis Guilherme Uzeda; Pedersen, Klaus; Mogensen, Preben

    2009-01-01

    in local areas, basing our study case on LTE-Advanced. We present extensive network simulation results to demonstrate that a simple and robust interference management scheme, called autonomous component carrier selection allows each cell to select the most attractive frequency configuration; improving...... management and efficient system operation. Due to the expected large number of user-deployed cells, centralized network planning becomes unpractical and new scalable alternatives must be sought. In this article, we propose a fully distributed and scalable solution to the interference management problem...

  6. Autonomous mobile robot teams

    Science.gov (United States)

    Agah, Arvin; Bekey, George A.

    1994-01-01

    This paper describes autonomous mobile robot teams performing tasks in unstructured environments. The behavior and the intelligence of the group is distributed, and the system does not include a central command base or leader. The novel concept of the Tropism-Based Cognitive Architecture is introduced, which is used by the robots in order to produce behavior transforming their sensory information to proper action. The results of a number of simulation experiments are presented. These experiments include worlds where the robot teams must locate, decompose, and gather objects, and defend themselves against hostile predators, while navigating around stationary and mobile obstacles.

  7. Verbal, Facial and Autonomic Responses to Empathy-Eliciting Film Clips by Disruptive Male Adolescents with High versus Low Callous-Unemotional Traits

    Science.gov (United States)

    de Wied, Minet; van Boxtel, Anton; Matthys, Walter; Meeus, Wim

    2012-01-01

    This study examined empathy-related responding in male adolescents with disruptive behavior disorder (DBD), high or low on callous-unemotional (CU) traits. Facial electromyographic (EMG) and heart rate (HR) responses were monitored during exposure to empathy-inducing film clips portraying sadness, anger or happiness. Self-reports were assessed…

  8. Towards autonomous vehicular clouds

    Directory of Open Access Journals (Sweden)

    Stephan Olariu

    2011-09-01

    Full Text Available The dawn of the 21st century has seen a growing interest in vehicular networking and its myriad potential applications. The initial view of practitioners and researchers was that radio-equipped vehicles could keep the drivers informed about potential safety risks and increase their awareness of road conditions. The view then expanded to include access to the Internet and associated services. This position paper proposes and promotes a novel and more comprehensive vision namely, that advances in vehicular networks, embedded devices and cloud computing will enable the formation of autonomous clouds of vehicular computing, communication, sensing, power and physical resources. Hence, we coin the term, autonomous vehicular clouds (AVCs. A key feature distinguishing AVCs from conventional cloud computing is that mobile AVC resources can be pooled dynamically to serve authorized users and to enable autonomy in real-time service sharing and management on terrestrial, aerial, or aquatic pathways or theaters of operations. In addition to general-purpose AVCs, we also envision the emergence of specialized AVCs such as mobile analytics laboratories. Furthermore, we envision that the integration of AVCs with ubiquitous smart infrastructures including intelligent transportation systems, smart cities and smart electric power grids will have an enormous societal impact enabling ubiquitous utility cyber-physical services at the right place, right time and with right-sized resources.

  9. Nemesis Autonomous Test System

    Science.gov (United States)

    Barltrop, Kevin J.; Lee, Cin-Young; Horvath, Gregory A,; Clement, Bradley J.

    2012-01-01

    A generalized framework has been developed for systems validation that can be applied to both traditional and autonomous systems. The framework consists of an automated test case generation and execution system called Nemesis that rapidly and thoroughly identifies flaws or vulnerabilities within a system. By applying genetic optimization and goal-seeking algorithms on the test equipment side, a "war game" is conducted between a system and its complementary nemesis. The end result of the war games is a collection of scenarios that reveals any undesirable behaviors of the system under test. The software provides a reusable framework to evolve test scenarios using genetic algorithms using an operation model of the system under test. It can automatically generate and execute test cases that reveal flaws in behaviorally complex systems. Genetic algorithms focus the exploration of tests on the set of test cases that most effectively reveals the flaws and vulnerabilities of the system under test. It leverages advances in state- and model-based engineering, which are essential in defining the behavior of autonomous systems. It also uses goal networks to describe test scenarios.

  10. Learning for Autonomous Navigation

    Science.gov (United States)

    Angelova, Anelia; Howard, Andrew; Matthies, Larry; Tang, Benyang; Turmon, Michael; Mjolsness, Eric

    2005-01-01

    Robotic ground vehicles for outdoor applications have achieved some remarkable successes, notably in autonomous highway following (Dickmanns, 1987), planetary exploration (1), and off-road navigation on Earth (1). Nevertheless, major challenges remain to enable reliable, high-speed, autonomous navigation in a wide variety of complex, off-road terrain. 3-D perception of terrain geometry with imaging range sensors is the mainstay of off-road driving systems. However, the stopping distance at high speed exceeds the effective lookahead distance of existing range sensors. Prospects for extending the range of 3-D sensors is strongly limited by sensor physics, eye safety of lasers, and related issues. Range sensor limitations also allow vehicles to enter large cul-de-sacs even at low speed, leading to long detours. Moreover, sensing only terrain geometry fails to reveal mechanical properties of terrain that are critical to assessing its traversability, such as potential for slippage, sinkage, and the degree of compliance of potential obstacles. Rovers in the Mars Exploration Rover (MER) mission have got stuck in sand dunes and experienced significant downhill slippage in the vicinity of large rock hazards. Earth-based off-road robots today have very limited ability to discriminate traversable vegetation from non-traversable vegetation or rough ground. It is impossible today to preprogram a system with knowledge of these properties for all types of terrain and weather conditions that might be encountered.

  11. Skin to skin care:heat balance.

    OpenAIRE

    Karlsson, H.

    1996-01-01

    Skin to skin care has been practised in primitive and high technology cultures for body temperature preservation in neonates. Regional skin temperature and heat flow was measured in moderately hypothermic term neonates to quantitate the heat transfer occurring during one hour of skin to skin care. Nine healthy newborns with a mean rectal temperature of 36.3 degrees C were placed skin to skin on their mothers' chests. The mean (SD) rectal temperature increased by 0.7 (0.4) degrees C to 37.0 de...

  12. Testing the Relationship Between Levels of Endogenous Testosterone and Physiological Responses to Facial Expressions in Men: An Experiment Conducted by Students in an Undergraduate Behavioral Neuroscience Class

    OpenAIRE

    Thompson, Richmond R.; George, Kirsten

    2003-01-01

    To determine if endogenous testosterone (T) is related to physiological responses to aggressive stimuli in human males, students in a behavioral neuroscience laboratory class conducted an experiment that determined if levels of salivary T in adult males are correlated with autonomic and/or somatic responses to angry facial expressions. Each student collected a saliva sample from one subject and, within 30 minutes of collecting the sample, measured heart rate (HR), skin conductance (SC), and c...

  13. Skin-inspired electronic devices

    Directory of Open Access Journals (Sweden)

    Alex Chortos

    2014-09-01

    Full Text Available Electronic devices that mimic the properties of skin have potential important applications in advanced robotics, prosthetics, and health monitoring technologies. Methods for measuring tactile and temperature signals have progressed rapidly due to innovations in materials and processing methods. Imparting skin-like stretchability to electronic devices can be accomplished by patterning traditional electronic materials or developing new materials that are intrinsically stretchable. The incorporation of sensing methods with transistors facilitates large-area sensor arrays. While sensor arrays have surpassed the properties of human skin in terms of sensitivity, time response, and device density, many opportunities remain for future development.

  14. Autonomous immunity in mucosal epithelial cells: fortifying the barrier against infection.

    Science.gov (United States)

    Ross, Karen F; Herzberg, Mark C

    2016-06-01

    Mucosal epithelial cells express an autonomous innate immune response that controls the overgrowth of invaded bacteria, mitigates the harmful effects of the bacteria carried within, and does not rely on other external arms of the immune response. Epithelial cell autonomous innate immunity "respects" the social biology of invading bacteria to achieve symbiosis, and is the primary protective mechanism against pathogens. PMID:27005450

  15. Expanded Perspectives on Autonomous Learners

    Science.gov (United States)

    Oxford, Rebecca L.

    2015-01-01

    This paper explores two general perspectives on autonomous learners: psychological and sociocultural. These perspectives introduce a range of theoretically grounded facets of autonomous learners, facets such as the self-regulated learner, the emotionally intelligent learner, the self-determined learner, the mediated learner, the socioculturally…

  16. Physics Simulation Software for Autonomous Propellant Loading and Gas House Autonomous System Monitoring

    Science.gov (United States)

    Regalado Reyes, Bjorn Constant

    2015-01-01

    1. Kennedy Space Center (KSC) is developing a mobile launching system with autonomous propellant loading capabilities for liquid-fueled rockets. An autonomous system will be responsible for monitoring and controlling the storage, loading and transferring of cryogenic propellants. The Physics Simulation Software will reproduce the sensor data seen during the delivery of cryogenic fluids including valve positions, pressures, temperatures and flow rates. The simulator will provide insight into the functionality of the propellant systems and demonstrate the effects of potential faults. This will provide verification of the communications protocols and the autonomous system control. 2. The High Pressure Gas Facility (HPGF) stores and distributes hydrogen, nitrogen, helium and high pressure air. The hydrogen and nitrogen are stored in cryogenic liquid state. The cryogenic fluids pose several hazards to operators and the storage and transfer equipment. Constant monitoring of pressures, temperatures and flow rates are required in order to maintain the safety of personnel and equipment during the handling and storage of these commodities. The Gas House Autonomous System Monitoring software will be responsible for constantly observing and recording sensor data, identifying and predicting faults and relaying hazard and operational information to the operators.

  17. Assessment of immune response in periparturient dairy cows using ex vivo whole blood stimulation assay with lipopolysaccharides and carrageenan skin test.

    Science.gov (United States)

    Jahan, N; Minuti, A; Trevisi, E

    2015-06-15

    The transition period is known to be the most critical phase in the life of high yielding dairy cow. Changes in the immune functions have been observed during the transition period which may account for the onset of clinical and subclinical (e.g. inflammatory response) problems at calving or at the beginning of lactation however this relationship has not yet been adequately investigated. Thus, to establish the potential of the periparturient dairy cow's immune system to respond to stimuli, two challenges [an ex vivo whole blood stimulation assay (WBA) with lipopolysaccharides and a carrageenan skin test (CST)] were performed in addition to characterizing the metabolic and inflammatory profile. The WBA was performed using 0, 0.01 and 5 μg LPS/mL on whole blood and CST was administered by subcutaneous injection of 0.7 mL solution containing 4.2mg of carrageenan to the shoulder region of the cows. These tests were performed on 10 Holstein-Friesian cows at -45 ± 2, -20 ± 2, -3, 3, 7, 28 ± 2 days from parturition (DFP). Cows were also monitored for health status, body condition score, milk yield. The results demonstrate a higher production of IL-1β and IL-6 from leukocytes after LPS stimulation around calving (from -3 to 3 DFP) compared to -45 DFP (P transition period, with low LPS dose, suggests its crucial role in the regulation of inflammatory response around calving. The response of cows to CST decreased a few days before calving (-3 DFP) compared with response at -45 and 28 DFP (P<0.05), and remained low in the first week of lactation. This result suggests the reduction of the functionality of some vascular factors, which decreases diapedesis. Overall, the WBA and CST tests confirm changes in immunocompetence around calving. These tests are able to better describe the changes of the innate immune response at a local and systemic level, mainly when combined with conventional metabolic and inflammatory indices. PMID:25912553

  18. Forced synchronization of autonomous dynamical Boolean networks

    International Nuclear Information System (INIS)

    We present the design of an autonomous time-delay Boolean network realized with readily available electronic components. Through simulations and experiments that account for the detailed nonlinear response of each circuit element, we demonstrate that a network with five Boolean nodes displays complex behavior. Furthermore, we show that the dynamics of two identical networks display near-instantaneous synchronization to a periodic state when forced by a common periodic Boolean signal. A theoretical analysis of the network reveals the conditions under which complex behavior is expected in an individual network and the occurrence of synchronization in the forced networks. This research will enable future experiments on autonomous time-delay networks using readily available electronic components with dynamics on a slow enough time-scale so that inexpensive data collection systems can faithfully record the dynamics

  19. Forced synchronization of autonomous dynamical Boolean networks

    Energy Technology Data Exchange (ETDEWEB)

    Rivera-Durón, R. R., E-mail: roberto.rivera@ipicyt.edu.mx; Campos-Cantón, E., E-mail: eric.campos@ipicyt.edu.mx [División de Matemáticas Aplicadas, Instituto Potosino de Investigación Científica y Tecnológica A. C., Camino a la Presa San José 2055, Col. Lomas 4 Sección, C.P. 78216, San Luis Potosí, S.L.P. (Mexico); Campos-Cantón, I. [Facultad de Ciencias, Universidad Autónoma de San Luis Potosí, Álvaro Obregón 64, C.P. 78000, San Luis Potosí, S.L.P. (Mexico); Gauthier, Daniel J. [Department of Physics and Center for Nonlinear and Complex Systems, Duke University, Box 90305, Durham, North Carolina 27708 (United States)

    2015-08-15

    We present the design of an autonomous time-delay Boolean network realized with readily available electronic components. Through simulations and experiments that account for the detailed nonlinear response of each circuit element, we demonstrate that a network with five Boolean nodes displays complex behavior. Furthermore, we show that the dynamics of two identical networks display near-instantaneous synchronization to a periodic state when forced by a common periodic Boolean signal. A theoretical analysis of the network reveals the conditions under which complex behavior is expected in an individual network and the occurrence of synchronization in the forced networks. This research will enable future experiments on autonomous time-delay networks using readily available electronic components with dynamics on a slow enough time-scale so that inexpensive data collection systems can faithfully record the dynamics.

  20. EEG and autonomic arousal measures in schizophrenics.

    Science.gov (United States)

    Joseph, C

    1989-04-01

    EEG and autonomic indices were measured in basal, tonic, and phasic conditions in order to delineate the nature of arousal dysfunction in schizophrenics as compared to normals. The experimental procedure involved six continuous recording sessions consisting of a basal recording before and after four experimental series. Sequentially, these were the visual nonsignal (VNS), the auditory nonsignal (ANS), the visual signal (VS), and the auditory signal (AS) series. The main findings indicated significant differences between the two groups in cardiovascular indices during the basal and tonic conditions and in the EEG and EMG indices of phasic response. These results suggest a dysfunction of basal and tonic autonomic arousal and a modulatory impairement of the central phasic arousal reaction. The findings are in accordance with the two arousal hypothesis postulated by Routtenberg (1968) and disconfirm the unitary concept of arousal for the explanation of psychophysiological abnormality in schizophrenia. PMID:2744968

  1. The optimization of phenolic compounds extraction from cactus pear (Opuntia ficus-indica) skin in a reflux system using response surface methodology

    Science.gov (United States)

    Jorge, Aguirre Joya; Heliodoro, De La Garza Toledo; Alejandro, Zugasti Cruz; Ruth, Belmares Cerda; Noé, Aguilar Cristóbal

    2013-01-01

    Objective To extract, quantify, and evaluate the phenolic content in Opuntia ficus-indica skin for their antioxidant capacity with three different methods (ABTS, DPPH, and lipid oxidation) and to optimize the extraction conditions (time, temperature and ethanol concentration) in a reflux system. Methods The extraction process was done using a reflux system. A San Cristobal II experimental design with three variables and three levels was used. The variables evaluated were time of extraction (h), concentration of ethanol (%, v/v) and temperature (°C). The extraction process was optimized using a response surface methodology. Results It was observed that at higher temperature more phenolic compounds were extracted, but the antioxidant capacity was decreased. The optimum conditions for phenolic compounds extraction and antioxidant capacity mixing the three methods were as follows: 45% of ethanol, 80 °C and 2 hours of extraction. Values obtained in our results are little higher that other previously reported. Conclusions It can be concluded the by-products of Opuntia ficus-indica represent a good source of natural antioxidants with possible applications in food, cosmetics or drugs industries. PMID:23730555

  2. The optimization of phenolic compounds extraction from cactus pear (Opuntia ficus-indica) skin in a reflux system using response surface methodology

    Institute of Scientific and Technical Information of China (English)

    Aguirre Joya Jorge; De La Garza Toledo Heliodoro; Zugasti Cruz Alejandro; Belmares Cerda Ruth; Aguilar Cristbal No

    2013-01-01

    To extract, quantify, and evaluate the phenolic content in Opuntia ficus-indica skin for their antioxidant capacity with three different methods (ABTS, DPPH, and lipid oxidation) and to optimize the extraction conditions (time, temperature and ethanol concentration) in a reflux system. Methods: The extraction process was done using a reflux system. A San Cristobal II experimental design with three variables and three levels was used. The variables evaluated were time of extraction (h), concentration of ethanol (%, v/v) and temperature (°C). The extraction process was optimized using a response surface methodology. Results: It was observed that at higher temperature more phenolic compounds were extracted, but the antioxidant capacity was decreased. The optimum conditions for phenolic compounds extraction and antioxidant capacity mixing the three methods were as follows: 45% of ethanol, 80 °C and 2 hours of extraction. Values obtained in our results are little higher that other previously reported. Conclusions: It can be concluded the by-products of Opuntia ficus-indica represent a good source of natural antioxidants with possible applications in food, cosmetics or drugs industries.

  3. Evolutionary Autonomous Health Monitoring System (EAHMS) Project

    Data.gov (United States)

    National Aeronautics and Space Administration — For supporting NASA's Robotics, Tele-Robotics and Autonomous Systems Roadmap, we are proposing the "Evolutionary Autonomous Health Monitoring System" (EAHMS) for...

  4. Abnormal cardiac autonomic regulation in mice lacking ASIC3.

    Science.gov (United States)

    Cheng, Ching-Feng; Kuo, Terry B J; Chen, Wei-Nan; Lin, Chao-Chieh; Chen, Chih-Cheng

    2014-01-01

    Integration of sympathetic and parasympathetic outflow is essential in maintaining normal cardiac autonomic function. Recent studies demonstrate that acid-sensing ion channel 3 (ASIC3) is a sensitive acid sensor for cardiac ischemia and prolonged mild acidification can open ASIC3 and evoke a sustained inward current that fires action potentials in cardiac sensory neurons. However, the physiological role of ASIC3 in cardiac autonomic regulation is not known. In this study, we elucidate the role of ASIC3 in cardiac autonomic function using Asic3(-/-) mice. Asic3(-/-) mice showed normal baseline heart rate and lower blood pressure as compared with their wild-type littermates. Heart rate variability analyses revealed imbalanced autonomic regulation, with decreased sympathetic function. Furthermore, Asic3(-/-) mice demonstrated a blunted response to isoproterenol-induced cardiac tachycardia and prolonged duration to recover to baseline heart rate. Moreover, quantitative RT-PCR analysis of gene expression in sensory ganglia and heart revealed that no gene compensation for muscarinic acetylcholines receptors and beta-adrenalin receptors were found in Asic3(-/-) mice. In summary, we unraveled an important role of ASIC3 in regulating cardiac autonomic function, whereby loss of ASIC3 alters the normal physiological response to ischemic stimuli, which reveals new implications for therapy in autonomic nervous system-related cardiovascular diseases. PMID:24804235

  5. Abnormal Cardiac Autonomic Regulation in Mice Lacking ASIC3

    Directory of Open Access Journals (Sweden)

    Ching-Feng Cheng

    2014-01-01

    Full Text Available Integration of sympathetic and parasympathetic outflow is essential in maintaining normal cardiac autonomic function. Recent studies demonstrate that acid-sensing ion channel 3 (ASIC3 is a sensitive acid sensor for cardiac ischemia and prolonged mild acidification can open ASIC3 and evoke a sustained inward current that fires action potentials in cardiac sensory neurons. However, the physiological role of ASIC3 in cardiac autonomic regulation is not known. In this study, we elucidate the role of ASIC3 in cardiac autonomic function using Asic3−/− mice. Asic3−/− mice showed normal baseline heart rate and lower blood pressure as compared with their wild-type littermates. Heart rate variability analyses revealed imbalanced autonomic regulation, with decreased sympathetic function. Furthermore, Asic3−/− mice demonstrated a blunted response to isoproterenol-induced cardiac tachycardia and prolonged duration to recover to baseline heart rate. Moreover, quantitative RT-PCR analysis of gene expression in sensory ganglia and heart revealed that no gene compensation for muscarinic acetylcholines receptors and beta-adrenalin receptors were found in Asic3−/− mice. In summary, we unraveled an important role of ASIC3 in regulating cardiac autonomic function, whereby loss of ASIC3 alters the normal physiological response to ischemic stimuli, which reveals new implications for therapy in autonomic nervous system-related cardiovascular diseases.

  6. Contrasting actions of pressor agents in severe autonomic failure

    Science.gov (United States)

    Jordan, J.; Shannon, J. R.; Biaggioni, I.; Norman, R.; Black, B. K.; Robertson, D.

    1998-01-01

    BACKGROUND: Orthostatic hypotension is the most disabling symptom of autonomic failure. The choice of a pressor agent is largely empiric, and it would be of great value to define predictors of a response. PATIENTS AND METHODS: In 35 patients with severe orthostatic hypotension due to multiple system atrophy or pure autonomic failure, we determined the effect on seated systolic blood pressure (SBP) of placebo, phenylpropanolamine (12.5 mg and 25 mg), yohimbine (5.4 mg), indomethacin (50 mg), ibuprofen (600 mg), caffeine (250 mg), and methylphenidate (5 mg). In a subgroup of patients, we compared the pressor effect of midodrine (5 mg) with the effect of phenylpropanolamine (12.5 mg). RESULTS: There were no significant differences in the pressor responses between patients with multiple system atrophy or pure autonomic failure. When compared with placebo, the pressor response was significant for phenylpropanolamine, yohimbine, and indomethacin. In a subgroup of patients, we confirmed that this pressor effect of phenylpropanolamine, yohimbine, and indomethacin corresponded to a significant increase in standing SBP. The pressor responses to ibuprofen, caffeine, and methylphenidate were not significantly different from placebo. Phenylpropanolamine and midodrine elicited similar pressor responses. There were no significant associations between drug response and autonomic function testing, postprandial hypotension, or plasma catecholamine levels. CONCLUSIONS: We conclude that significant increases in systolic blood pressure can be obtained in patients with orthostatic hypotension due to primary autonomic failure with phenylpropanolamine in low doses or yohimbine or indomethacin in moderate doses. The response to a pressor agent cannot be predicted by autonomic function testing or plasma catecholamines. Therefore, empiric testing with a sequence of medications, based on the risk of side effects in the individual patient and the probability of a response, is a useful approach.

  7. Pathophysiology of irradiated skin and breast

    International Nuclear Information System (INIS)

    The evolution, time course, and dose response of gross and histologic changes associated with the acute and late changes of the skin are noted and a composite pathophysiologic operational model given. This model focuses the selection of the observations to be 'scored' to assess the tolerance and cosmetic response of the skin and breast to different dose and combined therapy studies

  8. Autonomous Gaussian Decomposition

    CERN Document Server

    Lindner, Robert R; Murray, Claire E; Stanimirović, Snežana; Babler, Brian L; Heiles, Carl; Hennebelle, Patrick; Goss, W M; Dickey, John

    2014-01-01

    We present a new algorithm, named Autonomous Gaussian Decomposition (AGD), for automatically decomposing spectra into Gaussian components. AGD uses derivative spectroscopy and machine learning to provide optimized guesses for the number of Gaussian components in the data, and also their locations, widths, and amplitudes. We test AGD and find that it produces results comparable to human-derived solutions on 21cm absorption spectra from the 21cm SPectral line Observations of Neutral Gas with the EVLA (21-SPONGE) survey. We use AGD with Monte Carlo methods to derive the HI line completeness as a function of peak optical depth and velocity width for the 21-SPONGE data, and also show that the results of AGD are stable against varying observational noise intensity. The autonomy and computational efficiency of the method over traditional manual Gaussian fits allow for truly unbiased comparisons between observations and simulations, and for the ability to scale up and interpret the very large data volumes from the up...

  9. Autonomous Flying Controls Testbed

    Science.gov (United States)

    Motter, Mark A.

    2005-01-01

    The Flying Controls Testbed (FLiC) is a relatively small and inexpensive unmanned aerial vehicle developed specifically to test highly experimental flight control approaches. The most recent version of the FLiC is configured with 16 independent aileron segments, supports the implementation of C-coded experimental controllers, and is capable of fully autonomous flight from takeoff roll to landing, including flight test maneuvers. The test vehicle is basically a modified Army target drone, AN/FQM-117B, developed as part of a collaboration between the Aviation Applied Technology Directorate (AATD) at Fort Eustis,Virginia and NASA Langley Research Center. Several vehicles have been constructed and collectively have flown over 600 successful test flights.

  10. Periostin in Skin Tissue Skin-Related Diseases

    Directory of Open Access Journals (Sweden)

    Yukie Yamaguchi

    2014-01-01

    Recently, periostin—a matricellular protein—has been highlighted for its pivotal functions in the skin. Analysis of periostin null mice has revealed that periostin contributes to collagen fibrillogenesis, collagen cross-linking, and the formation of ECM meshwork via interactions with other ECM components. Periostin expression is enhanced by mechanical stress or skin injury; this is indicative of the physiologically protective functions of periostin, which promotes wound repair by acting on keratinocytes and fibroblasts. Along with its physiological functions, periostin plays pathogenic roles in skin fibrosis and chronic allergic inflammation. In systemic sclerosis (SSc patients, periostin levels reflect the severity of skin fibrosis. Periostin null mice have shown reduced skin fibrosis in a bleomycin-induced SSc mouse model, indicating a key role of periostin in fibrosis. Moreover, in atopic dermatitis (AD, attenuated AD phenotype has been observed in periostin null mice in a house dust mite extract-induced AD mouse model. Th2 cytokine-induced periostin acts on keratinocytes to produce inflammatory cytokines that further enhance the Th2 response, thereby sustaining and amplifying chronic allergic inflammation. Thus, periostin is deeply involved in the pathogenesis of AD and other inflammation-related disorders affecting the skin. Understanding the dynamic actions of periostin would be key to dissecting pathogenesis of skin-related diseases and to developing novel therapeutic strategies.

  11. Mobile Intelligent Autonomous Systems

    Directory of Open Access Journals (Sweden)

    Jitendra R. Raol

    2010-01-01

    Full Text Available Mobile intelligent autonomous systems (MIAS is a fast emerging research area. Although it can be regarded as a general R&D area, it is mainly directed towards robotics. Several important subtopics within MIAS research are:(i perception and reasoning, (ii mobility and navigation,(iii haptics and teleoperation, (iv image fusion/computervision, (v modelling of manipulators, (vi hardware/software architectures for planning and behaviour learning leadingto robotic architecture, (vii vehicle-robot path and motionplanning/control, (viii human-machine interfaces for interaction between humans and robots, and (ix application of artificial neural networks (ANNs, fuzzy logic/systems (FLS,probabilistic/approximate reasoning (PAR, Bayesian networks(BN and genetic algorithms (GA to the above-mentioned problems. Also, multi-sensor data fusion (MSDF playsvery crucial role at many levels of the data fusion process:(i kinematic fusion (position/bearing tracking, (ii imagefusion (for scene recognition, (iii information fusion (forbuilding world models, and (iv decision fusion (for tracking,control actions. The MIAS as a technology is useful for automation of complex tasks, surveillance in a hazardousand hostile environment, human-assistance in very difficultmanual works, medical robotics, hospital systems, autodiagnosticsystems, and many other related civil and military systems. Also, other important research areas for MIAScomprise sensor/actuator modelling, failure management/reconfiguration, scene understanding, knowledge representation, learning and decision-making. Examples ofdynamic systems considered within the MIAS would be:autonomous systems (unmanned ground vehicles, unmannedaerial vehicles, micro/mini air vehicles, and autonomousunder water vehicles, mobile/fixed robotic systems, dexterousmanipulator robots, mining robots, surveillance systems,and networked/multi-robot systems, to name a few.Defence Science Journal, 2010, 60(1, pp.3-4,

  12. Anyone Can Get Skin Cancer

    Science.gov (United States)

    ... Cancer Skin Cancer Screening Research Anyone Can Get Skin Cancer Order the free Anyone Can Get Skin Cancer ... true that only people with light skin get skin cancer? No. Anyone can get skin cancer. It's more ...

  13. Skin barrier in rosacea.

    Science.gov (United States)

    Addor, Flavia Alvim Sant'Anna

    2016-01-01

    Recent studies about the cutaneous barrier demonstrated consistent evidence that the stratum corneum is a metabolically active structure and also has adaptive functions, may play a regulatory role in the inflammatory response with activation of keratinocytes, angiogenesis and fibroplasia, whose intensity depends primarily on the intensity the stimulus. There are few studies investigating the abnormalities of the skin barrier in rosacea, but the existing data already show that there are changes resulting from inflammation, which can generate a vicious circle caused a prolongation of flare-ups and worsening of symptoms. This article aims to gather the most relevant literature data about the characteristics and effects of the state of the skin barrier in rosacea. PMID:26982780

  14. Prevalence of diabetic autonomic neuropathy measured by simple bedside tests

    DEFF Research Database (Denmark)

    Dyrberg, Torben Bech; Benn, Jette; Christiansen, J S;

    1981-01-01

    To investigate the prevalence of diabetic autonomic neuropathy, five simple bedside tests, beat-to-beat variation during quiet respiration, beat-to-beat variation during forced respiration, heart rate and blood pressure response to standing, heart rate response to exercise, and heart rate respons...

  15. Characterization of CD8+ T-Cell Responses in the Peripheral Blood and Skin Injection Sites of Melanoma Patients Treated with mRNA Electroporated Autologous Dendritic Cells (TriMixDC-MEL

    Directory of Open Access Journals (Sweden)

    Daphné Benteyn

    2013-01-01

    Full Text Available Treatment of melanoma patients with mRNA electroporated dendritic cells (TriMixDC-MEL stimulates T-cell responses against the presented tumor-associated antigens (TAAs. In the current clinical trials, melanoma patients with systemic metastases are treated, requiring priming and/or expansion of preexisting TAA-specific T cells that are able to migrate to both the skin and internal organs. We monitored the presence of TAA-specific CD8+ T cells infiltrating the skin at sites of intradermal TriMixDC-MEL injection (SKILs and within the circulation of melanoma patients treated in two clinical trials. In 10 out of fourteen (71% patients screened, CD8+ T cells recognizing any of the four TAA presented by TriMixDC-MEL cellular vaccine were found in both compartments. In total, 30 TAA-specific T-cell responses were detected among the SKILs and 29 among peripheral blood T cells, of which 24 in common. A detailed characterization of the antigen specificity of CD8+ T-cell populations in four patients indicates that the majority of the epitopes detected were only recognized by CD8+ T cells derived from either skin biopsies or peripheral blood, indicating that some compartmentalization occurs after TriMix-DC therapy. To conclude, functional TAA-specific CD8+ T cells distribute both to the skin and peripheral blood of patients after TriMixDC-MEL therapy.

  16. Biothermomechanical behavior of skin tissue

    Institute of Scientific and Technical Information of China (English)

    F.Xu; T.J.Lu; K.A.Seffen

    2008-01-01

    Advances in laser,microwave and similar tech nologies have led to recent developments of thermal treatments involving skin tissue.The effectiveness of these treatments is governed by the coupled thermal,mechanical,biological and neural responses of the affected tissue:a favorable interaction results in a procedure with relatively little pain and no lasting side effects.Currently,even though each behavioral facet is to a certain extent established and understood,none exists to date in the interdisciplinarv area.A highly interdisciplinary approach is required for studying the biothermomechanical behavior of skin,involving bioheat transfer.biomechanics and physiology.A comprehensive literature review penrtinent to the subject is presented in this paper,covering four subject areas:(a)skin structure,(b)skin bioheat transfer and thermal damage,(c)skin biomechanics,and(d)skin biothermomechanics.The major problems,issues,and topics for further studies are also outlined.This review finds that significant advances in each of these aspects have been achieved in recent years.Although focus is placed upon the biothermomechanical behavior of skin tissue,the fundamental concepts and methodologies reviewed in this paper may also be applicable for studying other soft tissues.

  17. Female Listeners' Autonomic Responses to Dramatic Shifts Between Loud and Soft Music/Sound Passages: A Study of Heavy Metal Songs.

    Science.gov (United States)

    Cheng, Tzu-Han; Tsai, Chen-Gia

    2016-01-01

    Although music and the emotion it conveys unfold over time, little is known about how listeners respond to shifts in musical emotions. A special technique in heavy metal music utilizes dramatic shifts between loud and soft passages. Loud passages are penetrated by distorted sounds conveying aggression, whereas soft passages are often characterized by a clean, calm singing voice and light accompaniment. The present study used heavy metal songs and soft sea sounds to examine how female listeners' respiration rates and heart rates responded to the arousal changes associated with auditory stimuli. The high-frequency power of heart rate variability (HF-HRV) was used to assess cardiac parasympathetic activity. The results showed that the soft passages of heavy metal songs and soft sea sounds expressed lower arousal and induced significantly higher HF-HRVs than the loud passages of heavy metal songs. Listeners' respiration rate was determined by the arousal level of the present music passage, whereas the heart rate was dependent on both the present and preceding passages. Compared with soft sea sounds, the loud music passage led to greater deceleration of the heart rate at the beginning of the following soft music passage. The sea sounds delayed the heart rate acceleration evoked by the following loud music passage. The data provide evidence that sound-induced parasympathetic activity affects listeners' heart rate in response to the following music passage. These findings have potential implications for future research on the temporal dynamics of musical emotions. PMID:26925009

  18. Female Listeners’ Autonomic Responses to Dramatic Shifts Between Loud and Soft Music/Sound Passages: A Study of Heavy Metal Songs

    Science.gov (United States)

    Cheng, Tzu-Han; Tsai, Chen-Gia

    2016-01-01

    Although music and the emotion it conveys unfold over time, little is known about how listeners respond to shifts in musical emotions. A special technique in heavy metal music utilizes dramatic shifts between loud and soft passages. Loud passages are penetrated by distorted sounds conveying aggression, whereas soft passages are often characterized by a clean, calm singing voice and light accompaniment. The present study used heavy metal songs and soft sea sounds to examine how female listeners’ respiration rates and heart rates responded to the arousal changes associated with auditory stimuli. The high-frequency power of heart rate variability (HF-HRV) was used to assess cardiac parasympathetic activity. The results showed that the soft passages of heavy metal songs and soft sea sounds expressed lower arousal and induced significantly higher HF-HRVs than the loud passages of heavy metal songs. Listeners’ respiration rate was determined by the arousal level of the present music passage, whereas the heart rate was dependent on both the present and preceding passages. Compared with soft sea sounds, the loud music passage led to greater deceleration of the heart rate at the beginning of the following soft music passage. The sea sounds delayed the heart rate acceleration evoked by the following loud music passage. The data provide evidence that sound-induced parasympathetic activity affects listeners’ heart rate in response to the following music passage. These findings have potential implications for future research on the temporal dynamics of musical emotions. PMID:26925009

  19. Female listeners’ autonomic responses to dramatic shifts between loud and soft music/sound passages: a study of heavy metal songs

    Directory of Open Access Journals (Sweden)

    Tzu-Han eCheng

    2016-02-01

    Full Text Available Although music and the emotion it conveys unfold over time, little is known about how listeners respond to shifts in musical emotions. A special technique in heavy metal music utilizes dramatic shifts between loud and soft passages. Loud passages are penetrated by distorted sounds conveying aggression, whereas soft passages are often characterized by a clean, calm singing voice and light accompaniment. The present study used heavy metal songs and soft sea sounds to examine how female listeners’ respiration rates and heart rates responded to the arousal changes associated with auditory stimuli. The high-frequency power of heart rate variability (HF-HRV was used to assess cardiac parasympathetic activity. The results showed that the soft passages of heavy metal songs and soft sea sounds expressed lower arousal and induced significantly higher HF-HRVs than the loud passages of heavy metal songs. Listeners’ respiration rate was determined by the arousal level of the present music passage, whereas the heart rate was dependent on both the present and preceding passages. Compared with soft sea sounds, the loud music passage led to greater deceleration of the heart rate at the beginning of the following soft music passage. The sea sounds delayed the heart rate acceleration evoked by the following loud music passage. The data provide evidence that sound-induced parasympathetic activity affects listener’s heart rate in response to the following music passage. These findings have potential implications for future research of the temporal dynamics of musical emotions.

  20. Cybersecurity for aerospace autonomous systems

    Science.gov (United States)

    Straub, Jeremy

    2015-05-01

    High profile breaches have occurred across numerous information systems. One area where attacks are particularly problematic is autonomous control systems. This paper considers the aerospace information system, focusing on elements that interact with autonomous control systems (e.g., onboard UAVs). It discusses the trust placed in the autonomous systems and supporting systems (e.g., navigational aids) and how this trust can be validated. Approaches to remotely detect the UAV compromise, without relying on the onboard software (on a potentially compromised system) as part of the process are discussed. How different levels of autonomy (task-based, goal-based, mission-based) impact this remote characterization is considered.

  1. Effect of Ascaris Lumbricoides specific IgE on tuberculin skin test responses in children in a high-burden setting: a cross-sectional community-based study

    OpenAIRE

    van Soelen Nelda; Mandalakas Anna M; Kirchner H; Walzl Gerhard; Grewal Harleen M S; Jacobsen Marc; Hesseling Anneke C

    2012-01-01

    Abstract Background M.tuberculosis (M.tb) is associated with enhanced T helper cell type 1 (Th1) immune responses while helminth infection is associated with T helper cell type 2 (Th2) immune responses. Our aim was to investigate whether helminth infection could influence the ability to generate an appropriate Th1 immune response that is characterized by a positive tuberculin skin test (TST), in M.tb exposed children. Methods We completed a community-based, cross sectional household contact t...

  2. Nociceptive Sensory Neurons Drive Interleukin-23 Mediated Psoriasiform Skin Inflammation

    OpenAIRE

    Riol-Blanco, Lorena; Ordovas-Montanes, Jose; Perro, Mario; Naval, Elena; Thiriot, Aude; Alvarez, David; Wood, John N.; Ulrich H von Andrian

    2014-01-01

    The skin has a dual function as a barrier and a sensory interface between the body and the environment. To protect against invading pathogens, the skin harbors specialized immune cells, including dermal dendritic cells (DDCs) and interleukin (IL)-17 producing γδ T cells (γδT17), whose aberrant activation by IL-23 can provoke psoriasis-like inflammation 1–4 . The skin is also innervated by a meshwork of peripheral nerves consisting of relatively sparse autonomic and abundant sensory fibers. In...

  3. Nociceptive Sensory Neurons Drive Interleukin-23 Mediated Psoriasiform Skin Inflammation

    OpenAIRE

    Riol-Blanco, Lorena; Ordovas-Montanes, Jose; Perro, Mario; Naval, Elena; Thiriot, Aude; Alvarez, David; Wood, John N.; Ulrich H von Andrian

    2014-01-01

    The skin has a dual function as a barrier and a sensory interface between the body and the environment. To protect against invading pathogens, the skin harbors specialized immune cells, including dermal dendritic cells (DDCs) and interleukin (IL)-17 producing γδ T cells (γδT17), whose aberrant activation by IL-23 can provoke psoriasis-like inflammation1–4. The skin is also innervated by a meshwork of peripheral nerves consisting of relatively sparse autonomic and abundant sensory fibers. Inte...

  4. The Response of microRNAs to Solar UVR in Skin-Resident Melanocytes Differs between Melanoma Patients and Healthy Persons.

    Directory of Open Access Journals (Sweden)

    Jingfeng Sha

    Full Text Available The conversion of melanocytes into cutaneous melanoma is largely dictated by the effects of solar ultraviolet radiation (UVR. Yet to be described, however, is exactly how these cells are affected by intense solar UVR while residing in their natural microenvironment, and whether their response differs in persons with a history of melanoma when compared to that of healthy individuals. By using laser capture microdissection (LCM to isolate a pure population of melanocytes from a small area of skin that had been intermittingly exposed or un-exposed to physiological doses of solar UVR, we can now report for the first time that the majority of UV-responsive microRNAs (miRNAs in the melanocytes of a group of women with a history of melanoma are down-regulated when compared to those in the melanocytes of healthy controls. Among the miRNAs that were commonly and significantly down-regulated in each of these women were miR-193b (P<0.003, miR-342-3p (P<0.003, miR186 (P<0.007, miR-130a (P<0.007, and miR-146a (P<0.007. To identify genes potentially released from inhibition by these repressed UV-miRNAs, we analyzed databases (e.g., DIANA-TarBase containing experimentally validated microRNA-gene interactions. In the end, this enabled us to construct UV-miRNA-gene regulatory networks consisting of individual genes with a probable gain-of-function being intersected not by one, but by several down-regulated UV-miRNAs. Most striking, however, was that these networks typified well-known regulatory modules involved in controlling the epithelial-to-mesenchymal transition and processes associated with the regulation of immune-evasion. We speculate that these pathways become activated by UVR resulting in miRNA down regulation only in melanocytes susceptible to melanoma, and that these changes could be partially responsible for empowering these cells toward tumor progression.

  5. The Response of microRNAs to Solar UVR in Skin-Resident Melanocytes Differs between Melanoma Patients and Healthy Persons.

    Science.gov (United States)

    Sha, Jingfeng; Gastman, Brian R; Morris, Nathan; Mesinkovska, Natasha A; Baron, Elma D; Cooper, Kevin D; McCormick, Thomas; Arbesman, Joshua; Harter, Marian L

    2016-01-01

    The conversion of melanocytes into cutaneous melanoma is largely dictated by the effects of solar ultraviolet radiation (UVR). Yet to be described, however, is exactly how these cells are affected by intense solar UVR while residing in their natural microenvironment, and whether their response differs in persons with a history of melanoma when compared to that of healthy individuals. By using laser capture microdissection (LCM) to isolate a pure population of melanocytes from a small area of skin that had been intermittingly exposed or un-exposed to physiological doses of solar UVR, we can now report for the first time that the majority of UV-responsive microRNAs (miRNAs) in the melanocytes of a group of women with a history of melanoma are down-regulated when compared to those in the melanocytes of healthy controls. Among the miRNAs that were commonly and significantly down-regulated in each of these women were miR-193b (P<0.003), miR-342-3p (P<0.003), miR186 (P<0.007), miR-130a (P<0.007), and miR-146a (P<0.007). To identify genes potentially released from inhibition by these repressed UV-miRNAs, we analyzed databases (e.g., DIANA-TarBase) containing experimentally validated microRNA-gene interactions. In the end, this enabled us to construct UV-miRNA-gene regulatory networks consisting of individual genes with a probable gain-of-function being intersected not by one, but by several down-regulated UV-miRNAs. Most striking, however, was that these networks typified well-known regulatory modules involved in controlling the epithelial-to-mesenchymal transition and processes associated with the regulation of immune-evasion. We speculate that these pathways become activated by UVR resulting in miRNA down regulation only in melanocytes susceptible to melanoma, and that these changes could be partially responsible for empowering these cells toward tumor progression. PMID:27149382

  6. Skin color - patchy

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/article/003224.htm Skin color - patchy To use the sharing features on this page, please enable JavaScript. Patchy skin color is areas where the skin color is irregular. ...

  7. Skin Cancer Foundation

    Science.gov (United States)

    ... Fundraising Event | About Us | Store The Skin Cancer Foundation The Skin Cancer Foundation is the only international organization devoted solely to ... About Us Contact Us © 2016 The Skin Cancer Foundation | 149 Madison Avenue Suite 901 New York, NY ...

  8. Learning about Skin Cancer

    Science.gov (United States)

    ... Why Deadly Skin Cancers Spread 2000 News Release Learning About Skin Cancer What are the most common ... skin surface. When a melanoma becomes thick and deep, the disease often spreads to other parts of ...

  9. Skin care and incontinence

    Science.gov (United States)

    Incontinence - skin care ... or bowels (called incontinence) are at risk of skin problems around the buttocks, hips, genitals, and the ... rectum (perineum). Excess moisture in these areas makes skin problems such as redness, peeling, irritation, and yeast ...

  10. Normal skin and hypertrophic scar fibroblasts differentially regulate collagen and fibronectin expression as well as mitochondrial membrane potential in response to basic fibroblast growth factor

    OpenAIRE

    Rui Song; Hui-Ning Bian; Wen Lai; Hua-De Chen; Ke-Seng Zhao

    2011-01-01

    Basic fibroblast growth factor (bFGF) regulates skin wound healing; however, the underlying mechanism remains to be defined. In the present study, we determined the effects of bFGF on the regulation of cell growth as well as collagen and fibronectin expression in fibroblasts from normal human skin and from hypertrophic scars. We then explored the involvement of mitochondria in mediating bFGF-inducedeffects on the fibroblasts. We isolated and cultivated normal and hypertrophic scar fibroblasts...

  11. Could autonomic system assessment be helpful in disorders of consciousness diagnosis? A neurophysiological study.

    Science.gov (United States)

    Leo, Antonino; Naro, Antonino; Cannavò, Antonio; Pisani, Laura Rosa; Bruno, Rocco; Salviera, Carlo; Bramanti, Placido; Calabrò, Rocco Salvatore

    2016-08-01

    Although patients with chronic disorders of consciousness (DOC), including unresponsive wakefulness syndrome (UWS) and minimally conscious state (MCS), show a limited repertoire of awareness signs, owing to a large-scale cortico-thalamo-cortical functional disconnectivity, an activation of some cortical areas in response to relevant stimuli has been described by means of electrophysiological and functional neuroimaging approaches. In addition, cognitive processes associated with autonomic nervous system (ANS) responses elicited by nociceptive stimuli have been identified in some DOC patients. In an attempt to identify ANS functionality markers that could be useful in differentiating UWS and MCS individuals, we measured the amplitude, latency and γ-band power (γPOW) of ultra-late laser-evoked potentials (CLEPs) and skin reflex (SR), which both express some aspects of cognitive processes related to ANS functionality, besides other ANS parameters either during a 24(hh)-polygraphy or following a solid-state laser repetitive nociceptive stimulation. MCS showed physiological modification of vital signs (O2 saturation, hearth rate, hearth rate variability) throughout the night and a preservation of SR-γPOW, whereas UWS did not show significant variations. Following repetitive nociceptive stimulation, MCS patients had a significant increase in CLEP-γPOW, O2 saturation, hearth rate, and hearth rate variability, whereas UWS individuals did not show any significant change (but two patients, who reached high Coma Recovery Scale-Revised scores). Hence, our work suggests that a wide-spectrum electrophysiological evaluation of ANS functionality may support DOC differential diagnosis. Interestingly, the two above-mentioned UWS patients showed MCS-like vital sign modifications and electrophysiological pain responsiveness. It is therefore hypothesizable that our approach could be helpful in identifying residual aware autonomic system-related cognitive processes even in some UWS

  12. Evaluation of autonomic functions in subclinical hypothyroid and hypothyroid patients

    Directory of Open Access Journals (Sweden)

    Aarti S Mahajan

    2013-01-01

    Full Text Available Background: Autonomic dysfunction may contribute to cardiovascular morbidity in subclinical hypothyroid patients. It is controversial whether the abnormality exists in sympathetic or the parasympathetic function. It is also not known whether the severity of autonomic dysfunction is related to the degree of thyroid deficiency. Design of Study: Prospective case control. Materials and Methods: Autonomic functions based on heart rate (HR and blood pressure (BP responses to various maneuvers were evaluated and scored in twenty two subclinical hypothyroid patients, 30-50 years and compared with twenty hypothyroid patients. Biochemical estimation of TSH, fT 3 , fT 4 , TPO antibody was done. Result: Sympathetic function abnormalities were seen in 82% subclinical hypothyroid patients and 85%hypothyroid patients when one test was abnormal. Parasympathetic dysfunction was also recorded in eight patients in both groups. When two abnormal tests were used as the selection criteria sympathetic function abnormality was observed in about 41% subclinical hypothyroid and 65% hypothyroid patients. There were no intergroup differences in autonomic functions, score and TPO levels. The TSH levels were not related to type or degree of autonomic dysfunction. Systolic BP in both groups and diastolic BP in hypothyroid patients were higher with lower thyroxine levels but the patients were normotensive. Conclusion: Autonomic dysfunction of comparable degree was seen in subclinical hypothyroid and hypothyroid patients. Sympathetic function abnormality was more common although decreased parasympathetic function reactivity was also present. These abnormalities were unrelated to TSH levels.

  13. Transcranial Direct Current Stimulation (tDCS) of the Right Inferior Frontal Gyrus Attenuates Skin Conductance Responses to Unpredictable Threat Conditions

    Science.gov (United States)

    Herrmann, Martin J.; Beier, Jennifer S.; Simons, Bibiane; Polak, Thomas

    2016-01-01

    Patients with panic and post-traumatic stress disorders seem to show increased psychophysiological reactions to conditions of unpredictable (U) threat, which has been discussed as a neurobiological marker of elevated levels of sustained fear in these disorders. Interestingly, a recent study found that the right inferior frontal gyrus (rIFG) is correlated to the successful regulation of sustained fear during U threat. Therefore this study aimed to examine the potential use of non-invasive brain stimulation to foster the rIFG by means of anodal transcranial direct current stimulation (tDCS) in order to reduce psychophysiological reactions to U threat. Twenty six participants were randomly assigned into an anodal and sham stimulation group in a double-blinded manner. Anodal and cathodal electrodes (7 * 5 cm) were positioned right frontal to target the rIFG. Stimulation intensity was I = 2 mA applied for 20 min during a task including U threat conditions (NPU-task). The effects of the NPU paradigm were measured by assessing the emotional startle modulation and the skin conductance response (SCR) at the outset of the different conditions. We found a significant interaction effect of condition × tDCS for the SCR (F(2,48) = 6.3, p SCR from neutral (N) to U condition was significantly reduced in verum compared to the sham tDCS group (t(24) = 3.84, p < 0.001). Our results emphasize the causal role of rIFG for emotional regulation and the potential use of tDCS to reduce apprehension during U threat conditions and therefore as a treatment for anxiety disorders. PMID:27462211

  14. Transcranial Direct Current Stimulation (tDCS) of the Right Inferior Frontal Gyrus Attenuates Skin Conductance Responses to Unpredictable Threat Conditions.

    Science.gov (United States)

    Herrmann, Martin J; Beier, Jennifer S; Simons, Bibiane; Polak, Thomas

    2016-01-01

    Patients with panic and post-traumatic stress disorders seem to show increased psychophysiological reactions to conditions of unpredictable (U) threat, which has been discussed as a neurobiological marker of elevated levels of sustained fear in these disorders. Interestingly, a recent study found that the right inferior frontal gyrus (rIFG) is correlated to the successful regulation of sustained fear during U threat. Therefore this study aimed to examine the potential use of non-invasive brain stimulation to foster the rIFG by means of anodal transcranial direct current stimulation (tDCS) in order to reduce psychophysiological reactions to U threat. Twenty six participants were randomly assigned into an anodal and sham stimulation group in a double-blinded manner. Anodal and cathodal electrodes (7 * 5 cm) were positioned right frontal to target the rIFG. Stimulation intensity was I = 2 mA applied for 20 min during a task including U threat conditions (NPU-task). The effects of the NPU paradigm were measured by assessing the emotional startle modulation and the skin conductance response (SCR) at the outset of the different conditions. We found a significant interaction effect of condition × tDCS for the SCR (F (2,48) = 6.3, p SCR from neutral (N) to U condition was significantly reduced in verum compared to the sham tDCS group (t (24) = 3.84, p < 0.001). Our results emphasize the causal role of rIFG for emotional regulation and the potential use of tDCS to reduce apprehension during U threat conditions and therefore as a treatment for anxiety disorders. PMID:27462211

  15. Gyrosonics a Novel Stimulant for Autonomic Nervous System

    CERN Document Server

    Ghatak, S K; Choudhuri, R; Banerjee, S

    2009-01-01

    Gyrosonics refers to novel audio binaural stimulus that produces rotational perceptions of sound movement in head at a particular predetermined frequency. Therapeutic effect observed with this is considered to be associated with modification of arousal of autonomic nervous system. The heart rate variability (HRV), non-invasive measure of autonomic nervous system, has been measured for group of 30 subjects for pre- and post- gyrosonic installation. The time- and frequency- domain analysis of HRV results show overall decrease in sympathetic response and increase in para- sympathetic response due to listening of gyro sonics.

  16. Autonomic Dysregulation in Multiple Sclerosis.

    Science.gov (United States)

    Pintér, Alexandra; Cseh, Domonkos; Sárközi, Adrienn; Illigens, Ben M; Siepmann, Timo

    2015-01-01

    Multiple sclerosis (MS) is a chronic, progressive central neurological disease characterized by inflammation and demyelination. In patients with MS, dysregulation of the autonomic nervous system may present with various clinical symptoms including sweating abnormalities, urinary dysfunction, orthostatic dysregulation, gastrointestinal symptoms, and sexual dysfunction. These autonomic disturbances reduce the quality of life of affected patients and constitute a clinical challenge to the physician due to variability of clinical presentation and inconsistent data on diagnosis and treatment. Early diagnosis and initiation of individualized interdisciplinary and multimodal strategies is beneficial in the management of autonomic dysfunction in MS. This review summarizes the current literature on the most prevalent aspects of autonomic dysfunction in MS and provides reference to underlying pathophysiological mechanisms as well as means of diagnosis and treatment. PMID:26213927

  17. Framework for Autonomous Optimization Project

    Data.gov (United States)

    National Aeronautics and Space Administration — Phoenix Integration and MIT propose to create a novel autonomous optimization tool and application programming interface (API). The API will demonstrate the ability...

  18. Nutritional stimulation of the autonomic nervous system

    Institute of Scientific and Technical Information of China (English)

    Misha DP Luyer; Quirine Habes; Richard van Hak; Wim Buurman

    2011-01-01

    Disturbance of the inflammatory response in the gut is important in several clinical diseases ranging from inflammatory bowel disease to postoperative ileus. Several feedback mechanisms exist that control the inflammatory cascade and avoid collateral damage. In the gastrointestinal tract, it is of particular importance to control the immune response to maintain the balance that allows dietary uptake and utilization of nutrients on one hand, while preventing invasion of bacteria and toxins on the other hand. The process of digestion and absorption of nutrients requires a relative hyporesponsiveness of the immune cells in the gut to luminal contents which is not yet fully understood. Recently, the autonomic nervous system has been identified as an important pathway to control local and systemic inflammation and gut barrier integrity. Activation of the pathway is possible via electrical or via pharmacological interventions, but is also achieved in a physiological manner by ingestion of dietary lipids. Administration of dietary lipids has been shown to be very effective in reducing the inflammatory cascade and maintaining intestinal barrier integrity in several experimental studies. This beneficial effect of nutrition on the inflammatory inflammatory response and intestinal barrier integrity opens new therapeutic opportunities for treatment of certain gastrointestinal disorders. Furthermore, this neural feedback mechanism provides more insight in the relative hyporesponsiveness of the immune cells in the gut. Here, we will discuss the regulatory function of the autonomic nervous system on the inflammatory response and gut barrier function and the potential benefit in a clinical setting.

  19. Use of the novel contact heat evoked potential stimulator (CHEPS) for the assessment of small fibre neuropathy: correlations with skin flare responses and intra-epidermal nerve fibre counts

    OpenAIRE

    Chizh Boris A; Misra V Peter; Roberts Katherine M; Facer Paul; Atherton Duncan D; Bountra Chas; Anand Praveen

    2007-01-01

    Abstract Background The Contact Heat Evoked Potential Stimulator (CHEPS) rapidly stimulates cutaneous small nerve fibres, and resulting evoked potentials can be recorded from the scalp. We have studied patients with symptoms of sensory neuropathy and controls using CHEPS, and validated the findings using other objective measures of small nerve fibres i.e. the histamine-induced skin flare response and intra-epidermal fibres (IEF), and also quantitative sensory testing (QST), a subjective measu...

  20. Autonomous Gaussian Decomposition

    Science.gov (United States)

    Lindner, Robert R.; Vera-Ciro, Carlos; Murray, Claire E.; Stanimirović, Snežana; Babler, Brian; Heiles, Carl; Hennebelle, Patrick; Goss, W. M.; Dickey, John

    2015-04-01

    We present a new algorithm, named Autonomous Gaussian Decomposition (AGD), for automatically decomposing spectra into Gaussian components. AGD uses derivative spectroscopy and machine learning to provide optimized guesses for the number of Gaussian components in the data, and also their locations, widths, and amplitudes. We test AGD and find that it produces results comparable to human-derived solutions on 21 cm absorption spectra from the 21 cm SPectral line Observations of Neutral Gas with the EVLA (21-SPONGE) survey. We use AGD with Monte Carlo methods to derive the H i line completeness as a function of peak optical depth and velocity width for the 21-SPONGE data, and also show that the results of AGD are stable against varying observational noise intensity. The autonomy and computational efficiency of the method over traditional manual Gaussian fits allow for truly unbiased comparisons between observations and simulations, and for the ability to scale up and interpret the very large data volumes from the upcoming Square Kilometer Array and pathfinder telescopes.