WorldWideScience

Sample records for autonomic skin responses

  1. Autonomic skin responses in females with Fabry disease

    DEFF Research Database (Denmark)

    Møller, Anette Torvin; Bach, Flemming W.; Feldt-Rasmussen, Ulla;

    2009-01-01

    Fabry disease is a genetic lysosomal disorder with dysfunction of the lysosomal enzyme alpha-galactosidase A causing accumulation of glycolipids in multiple organs including the nervous system and with neuropathy as a prominent manifestation. Neurological symptoms include pain and autonomic dysfu...... response to iontophoresis of acetylcholine (p = 0.04) and a smaller capsaicin-induced flare compared to controls. These findings suggest that female patients both have an impaired C-fiber function and local abnormalities in blood vessels and sweat glands......., and the cold pressor test; and (3) cutaneous blood flow following capsaicin. The vasoconstrictor response to inspiratory gasp was increased in Fabry patients compared to controls (p = 0.03), while the response to cold and mental stress did not change. Female patients with Fabry disease had a reduced sweat...... dysfunction. This study examined peripheral autonomic nerve function in 19 female patients with Fabry disease and 19 sex and age-matched controls by measuring (1) sweat production following acetylcholine challenge; (2) the sympathetically mediated vasoconstrictor responses to inspiratory gasp, stress...

  2. Sympathetic skin response: simple test for evaluation of autonomic function in patients with diabetes mellitus?

    Institute of Scientific and Technical Information of China (English)

    Srinivasa Jayachandra; Maxim Pinto; Urban J. A. D'Souza

    2005-01-01

    @@ To the Editor: We read with interest the excellent article by Huang YN et al.1 This important and carefully conducted study illustrates the sympathetic skin response (SSR) test can detect early dysfunction of the small sympathetic fibers in people affected by diabetes mellitus.

  3. The Impact of Autonomic Dysreflexia on Blood Flow and Skin Response in Individuals with Spinal Cord Injury

    Directory of Open Access Journals (Sweden)

    J. C. Ramella-Roman

    2008-08-01

    Full Text Available Autonomic dysreflexia (AD is an inappropriate response of the sympathetic nervous system that commonly occurs when individuals with spinal cord injury (SCI, at or above the sixth thoracic (T6 vertebra, are subjected to a noxious stimulus below the level of injury. An AD event can be put into motion by something as simple as an ingrown toenail or a full bladder, with symptoms ranging from headache, high blood pressure, and even stroke. We have characterized the onset of AD and resulting autonomic events in an individual with SCI using a fiberoptic-based probe. Two probes were located above and below the injury level, on the subjects forearm and thigh, respectively, and were connected to a dual channel spectrophotometer. Oxygen saturation was calculated using the reflectance spectra and an algorithm based on melanin and hemoglobin absorption. We noticed that during an AD event the amount of oxygen in the skin below the injury level dropped by as much as 40%, while above the injury level, skin oxygenation remained constant. In addition, we found that the level of skin perspiration below the level of injury increased significantly. We hypothesize that the combination of AD-related ischemia with pressure-related ischemia and increased perspiration places individuals with spinal cord injury level at T6 or above at an elevated risk for developing a pressure sore below the injury site.

  4. Peripheral autonomic neuropathy: diagnostic contribution of skin biopsy.

    Science.gov (United States)

    Donadio, Vincenzo; Incensi, Alex; Giannoccaro, Maria Pia; Cortelli, Pietro; Di Stasi, Vitantonio; Pizza, Fabio; Jaber, Masen Abdel; Baruzzi, Agostino; Liguori, Rocco

    2012-11-01

    Skin biopsy has gained widespread use for the diagnosis of somatic small-fiber neuropathy, but it also provides information on sympathetic fiber morphology. We aimed to ascertain the diagnostic accuracy of skin biopsy in disclosing sympathetic nerve abnormalities in patients with autonomic neuropathy. Peripheral nerve fiber autonomic involvement was confirmed by routine autonomic laboratory test abnormalities. Punch skin biopsies were taken from the thigh and lower leg of 28 patients with various types of autonomic neuropathy for quantitative evaluation of skin autonomic innervation. Results were compared with scores obtained from 32 age-matched healthy controls and 25 patients with somatic neuropathy. The autonomic cutoff score was calculated using the receiver operating characteristic curve analysis. Skin biopsy disclosed a significant autonomic innervation decrease in autonomic neuropathy patients versus controls and somatic neuropathy patients. Autonomic innervation density was abnormal in 96% of patients in the lower leg and in 79% of patients in the thigh. The abnormal findings disclosed by routine autonomic tests ranged from 48% to 82%. These data indicate the high sensitivity and specificity of skin biopsy in detecting sympathetic abnormalities; this method should be useful for the diagnosis of autonomic neuropathy, together with currently available routine autonomic testing.

  5. The sensory channel of presentation alters subjective ratings and autonomic responses towards disgusting stimuli -Blood pressure, heart rate and skin conductance in response to visual, auditory, haptic and olfactory presented disgusting stimuli-

    Directory of Open Access Journals (Sweden)

    Ilona eCroy

    2013-09-01

    Full Text Available Disgust causes specific reaction patterns, observable in mimic responses and body reactions. Most research on disgust deals with visual stimuli. However, pictures may cause another disgust experience than sounds, odors or tactile stimuli. Therefore disgust experience evoked by four different sensory channels was compared.A total of 119 participants received 3 different disgusting and one control stimulus, each presented through the visual, auditory, tactile and olfactory channel. Ratings of evoked disgust as well as responses of the autonomic nervous system (heart rate, skin conductance level, systolic blood pressure were recorded and the effect of stimulus labeling and of repeated presentation was analyzed. Ratings suggested that disgust could be evoked through all senses; they were highest for visual stimuli. However, autonomic reaction towards disgusting stimuli differed according to the channel of presentation. In contrast to the other, olfactory disgust stimuli provoked a strong decrease of systolic blood pressure. Additionally, labeling enhanced disgust ratings and autonomic reaction for olfactory and tactile, but not for visual and auditory stimuli. Repeated presentation indicated that participant’s disgust rating diminishes to all but olfactory disgust stimuli. Taken together we argue that the sensory channel through which a disgust reaction is evoked matters.

  6. Autonomic responses to suggestions for cold and warmth in hypnosis.

    Science.gov (United States)

    Kistler, A; Mariauzouls, C; Wyler, F; Bircher, A J; Wyler-Harper, J

    1999-02-01

    The goal of the present study was to investigate whether suggestions for cold or warmth during hypnosis affect fingertip skin temperature. Hypnosis without specific suggestions for cold or warmth ('neutral hypnosis') caused a drop in respiration frequency, however, pulse rate, fingertip skin temperature, and electrodermal activity were not affected. The cold and warmth suggestions decreased and increased fingertip skin temperature, respectively. Compared with the neutral trance phase, the other three autonomic variables measured were also affected by suggestions for cold. However, there was no association between the changes in autonomic variables induced by suggestions and hypnotizability scores measured by the 'Stanford Hypnotic Clinical Scale for Adults'. Fingertip skin temperature was mostly affected when the images used for the cold and warmth suggestions during hypnosis included experiences of physical temperature and psychological stress or relaxation, indicating that the psychological content of the imagery amplified the autonomic response.

  7. Responsibility and autonomous nursing practice.

    Science.gov (United States)

    Holden, R J

    1991-04-01

    In this paper, the consequences were there greater autonomy in nursing practice, are considered. Autonomous practice implies accountability which entails both personal and professional responsibility: a personal responsibility to endorse ethical conduct consistent with professional practice; and a professional responsibility to exercise discretionary powers to the ultimate benefit of the patient. In this context, discretionary responsibility implies: recognizing a patient's wants may not be consistent with a patient's needs; abstaining from collusion with noncompliant patients; supporting the patient's right to refuse treatment only after full psychological exploration; understanding the psychological ramifications of informed consent from a practitioner and recipient point of view; maintaining appropriate personal and professional boundaries; and fostering collegiate relationships with the medical fraternity grounded on egalitarian principles. The author provides a philosophical and psychological analysis of responsibility in an effort to achieve a deeper understanding of the relationship this has with the concepts of 'freedom' and 'accountability'.

  8. Autonomic Nervous System Responses Can Reveal Visual Fatigue Induced by 3D Displays

    Directory of Open Access Journals (Sweden)

    Eui Chul Lee

    2013-09-01

    Full Text Available Previous research has indicated that viewing 3D displays may induce greater visual fatigue than viewing 2D displays. Whether viewing 3D displays can evoke measureable emotional responses, however, is uncertain. In the present study, we examined autonomic nervous system responses in subjects viewing 2D or 3D displays. Autonomic responses were quantified in each subject by heart rate, galvanic skin response, and skin temperature. Viewers of both 2D and 3D displays showed strong positive correlations with heart rate, which indicated little differences between groups. In contrast, galvanic skin response and skin temperature showed weak positive correlations with average difference between viewing 2D and 3D. We suggest that galvanic skin response and skin temperature can be used to measure and compare autonomic nervous responses in subjects viewing 2D and 3D displays.

  9. Human skin hypoxia modulates cerebrovascular and autonomic functions.

    Directory of Open Access Journals (Sweden)

    Olivia Pucci

    Full Text Available Because the skin is an oxygen sensor in amphibians and mice, we thought to confirm this function also in humans. The human upright posture, however, introduces additional functional demands for the maintenance of oxygen homeostasis in which cerebral blood flow and autonomic nervous system (ANS function may also be involved. We examined nine males and three females. While subjects were breathing ambient air, at sea level, we changed gases in a plastic body-bag during two conditions of the experiment such as to induce skin hypoxia (with pure nitrogen or skin normoxia (with air. The subjects performed a test of hypoxic ventilatory drive during each condition of the experiment. We found no differences in the hypoxic ventilatory drive tests. However, ANS function and cerebral blood flow velocities were modulated by skin hypoxia and the effect was significantly greater on the left than right middle cerebral arteries. We conclude that skin hypoxia modulates ANS function and cerebral blood flow velocities and this might impact life styles and tolerance to ambient hypoxia at altitude. Thus the skin in normal humans, in addition to its numerous other functions, is also an oxygen sensor.

  10. Blunted autonomic response in cluster headache patients

    DEFF Research Database (Denmark)

    Barloese, Mads; Brinth, Louise; Mehlsen, Jesper

    2015-01-01

    BACKGROUND: Cluster headache (CH) is a disabling headache disorder with chronobiological features. The posterior hypothalamus is involved in CH pathophysiology and is a hub for autonomic control. We studied autonomic response to the head-up tilt table test (HUT) including heart rate variability...

  11. Autonomic fiber sprouting in the skin in chronic inflammation

    Directory of Open Access Journals (Sweden)

    Longo Geraldine

    2008-11-01

    Full Text Available Abstract Pain is a major symptom associated with chronic inflammation. In previous work from our laboratory, we have shown that in animal models of neuropathic pain there is a sprouting of sympathetic fibers into the upper dermis, a territory normally devoid of them. However, it is not known whether such sympathetic spouting, which is likely trophic factor mediated, also occurs in chronic inflammation and arthritis. In the present study, we used a rat model of chronic inflammation in which a small single dose of complete Freund's adjuvant (CFA was injected subcutaneously, unilaterally, into the plantar surface of the hindpaw. This led to a localized long-term skin inflammation and arthritis in all joints of the hindpaw. Animals were perfused with histological fixatives at 1, 2, 3 or 4 weeks after the injection. Experimental animals treated with CFA were compared to saline-injected animals. We then investigated the changes in the pattern of peripheral innervation of the peptidergic nociceptors and sympathetic fibers in rat glabrous hindpaw skin. Antibodies directed towards calcitonin gene-related peptide (CGRP and dopamine beta-hydroxylase (DBH were used for the staining of peptidergic and sympathetic fibers, respectively. Immunofluorescence was then used to analyze the different nerve fiber populations of the upper dermis. At 4 weeks following CFA treatment, DBH-immunoreactive (IR fibers were found to sprout into the upper dermis, in a pattern similar to the one we had observed in animals with a chronic constriction injury of the sciatic nerve in a previous publication. There was also a significant increase in the density of CGRP-IR fibers in the upper dermis in CFA treated animals at 2, 3 and 4 weeks post-injection. The increased peptidergic fiber innervation and the ectopic autonomic fibers found in the upper dermis may have a role in the pain-related behavior displayed by these animals.

  12. SYMPATHETIC SKIN RESPONSE AND GALVANIC SKIN RESISTANCE IN MALES WITH TYPE 2 DIABETES MELLITUS

    Directory of Open Access Journals (Sweden)

    Saravanan Mohanraj

    2016-06-01

    Full Text Available BACKGROUND Diabetes mellitus, a metabolic disorder affects the nervous system due to alteration in various metabolic pathways. As neuropathy manifests in longstanding diabetes mellitus, autonomic nervous system also gets affected. The study was started based on the hypothesis that the sweat glands innervated by autonomic nervous system will be affected in patients with type 2 diabetes mellitus patients with clinical features of neuropathy. This study was undertaken to compare the sympathetic skin response (SSR and galvanic skin resistance (GSR in males with type 2 diabetes mellitus and in controls. METHODS Thirty males in the age group of 45-55 years, known to have diabetes mellitus and having a history of neuropathic symptoms served as subjects and thirty males in the same age group with no history of diabetes mellitus and neuropathy served as controls. SSR and GSR were recorded using Recorders and Medicare Systems 4 channel polygraph in the noise and light reduced research laboratory, Department of Physiology. All the recordings were done between 10-12 noon at ambient temperature. SSR was measured by deep inspiration and the GSR was measured in the supine and standing response. Comparison of latency and amplitude of the sympathetic skin response and the percentage of decrease in galvanic skin resistance was done. RESULT A statistically significant delay in the latency and a reduction in the amplitude of sympathetic skin response was observed in the diabetes patients. There was a lesser percentage of decrease in GSR in the diabetic patients. CONCLUSION This study shows that the SSR and GSR responses are significantly reduced in diabetic individuals and can be used as a diagnostic tool in the detection of diabetic autonomic neuropathy.

  13. Impaired autonomic responses to emotional stimuli in autoimmune limbic encephalitis

    Directory of Open Access Journals (Sweden)

    Olga eSchröder

    2015-11-01

    Full Text Available Limbic encephalitis (LE is an autoimmune-mediated disorder that affects structures of the limbic system, in particular the amygdala. The amygdala constitutes a brain area substantial for processing of emotional, especially fear-related signals. The amygdala is also involved in neuroendocrine and autonomic functions, including skin conductance responses (SCRs to emotionally arousing stimuli. This study investigates behavioral and autonomic responses to discrete emotion-evoking and neutral film clips in a patient suffering from LE associated with contactin-associated protein-2 (CASPR2-antibodies as compared to a healthy control group. Results show a lack of SCRs in the patient while watching the film clips, with significant differences compared to healthy controls in the case of fear-inducing videos. There was no comparable impairment in behavioral data (emotion report, valence and arousal ratings. The results point to a defective modulation of sympathetic responses during emotional stimulation in patients with LE, probably due to impaired functioning of the amygdala.

  14. Skin conductance response to the pain of others predicts later costly helping.

    Directory of Open Access Journals (Sweden)

    Grit Hein

    Full Text Available People show autonomic responses when they empathize with the suffering of another person. However, little is known about how these autonomic changes are related to prosocial behavior. We measured skin conductance responses (SCRs and affect ratings in participants while either receiving painful stimulation themselves, or observing pain being inflicted on another person. In a later session, they could prevent the infliction of pain in the other by choosing to endure pain themselves. Our results show that the strength of empathy-related vicarious skin conductance responses predicts later costly helping. Moreover, the higher the match between SCR magnitudes during the observation of pain in others and SCR magnitude during self pain, the more likely a person is to engage in costly helping. We conclude that prosocial motivation is fostered by the strength of the vicarious autonomic response as well as its match with first-hand autonomic experience.

  15. Brain Circuitry Supporting Multi-Organ Autonomic Outflow in Response to Nausea.

    Science.gov (United States)

    Sclocco, Roberta; Kim, Jieun; Garcia, Ronald G; Sheehan, James D; Beissner, Florian; Bianchi, Anna M; Cerutti, Sergio; Kuo, Braden; Barbieri, Riccardo; Napadow, Vitaly

    2016-02-01

    While autonomic outflow is an important co-factor of nausea physiology, central control of this outflow is poorly understood. We evaluated sympathetic (skin conductance level) and cardiovagal (high-frequency heart rate variability) modulation, collected synchronously with functional MRI (fMRI) data during nauseogenic visual stimulation aimed to induce vection in susceptible individuals. Autonomic data guided analysis of neuroimaging data, using a stimulus-based (analysis windows set by visual stimulation protocol) and percept-based (windows set by subjects' ratings) approach. Increased sympathetic and decreased parasympathetic modulation was associated with robust and anti-correlated brain activity in response to nausea. Specifically, greater autonomic response was associated with reduced fMRI signal in brain regions such as the insula, suggesting an inhibitory relationship with premotor brainstem nuclei. Interestingly, some sympathetic/parasympathetic specificity was noted. Activity in default mode network and visual motion areas was anti-correlated with parasympathetic outflow at peak nausea. In contrast, lateral prefrontal cortical activity was anti-correlated with sympathetic outflow during recovery, soon after cessation of nauseogenic stimulation. These results suggest divergent central autonomic control for sympathetic and parasympathetic response to nausea. Autonomic outflow and the central autonomic network underlying ANS response to nausea may be an important determinant of overall nausea intensity and, ultimately, a potential therapeutic target.

  16. Autonomous Aerobraking Using Thermal Response Surface Analysis

    Science.gov (United States)

    Prince, Jill L.; Dec, John A.; Tolson, Robert H.

    2007-01-01

    Aerobraking is a proven method of significantly increasing the science payload that can be placed into low Mars orbits when compared to an all propulsive capture. However, the aerobraking phase is long and has mission cost and risk implications. The main cost benefit is that aerobraking permits the use of a smaller and cheaper launch vehicle, but additional operational costs are incurred during the long aerobraking phase. Risk is increased due to the repeated thermal loading of spacecraft components and the multiple attitude and propulsive maneuvers required for successful aerobraking. Both the cost and risk burdens can be significantly reduced by automating the aerobraking operations phase. All of the previous Mars orbiter missions that have utilized aerobraking have increasingly relied on onboard calculations during aerobraking. Even though the temperature of spacecraft components has been the limiting factor, operational methods have relied on using a surrogate variable for mission control. This paper describes several methods, based directly on spacecraft component maximum temperature, for autonomously predicting the subsequent aerobraking orbits and prescribing apoapsis propulsive maneuvers to maintain the spacecraft within specified temperature limits. Specifically, this paper describes the use of thermal response surface analysis in predicting the temperature of the spacecraft components and the corresponding uncertainty in this temperature prediction.

  17. Intact electrodermal skin conductance responses after bilateral amygdala damage.

    Science.gov (United States)

    Tranel, D; Damasio, H

    1989-01-01

    Several lines of evidence have suggested that the amygdala is a crucial component of the anatomical network that mediates the skin conductance orienting response (SCOR). In this study, the electrodermal activity of a patient whose entire amygdaloid complex had been destroyed bilaterally, and of 7 age- and gender-matched controls, was recorded under the same experimental conditions. The results indicate unequivocally that the subject could generate normal skin conductance and SCORs, in response to stimuli of different sensory modalities and configurations. This suggests that the amygdala is not a necessary component of the neural network underlying SCORs and that there are alternate neural units and pathways that link sensory cortices to autonomic effectors.

  18. Foreclosing Dystopias: Responsibilities, Inequalities and Injustice for Autonomous Vehicles

    DEFF Research Database (Denmark)

    Liu, Hin-Yan

    2017-01-01

    With their prospect for causing both novel and known forms of damage and injury, the issue of responsibility has been a recurring theme in the debate concerning autonomous vehicles. Yet, the question of responsibility has largely been applied in broad brush strokes that obscure the finer details...... by refining the underlying concepts that together inform the idea of responsibility. Two different approaches are offered to the question of responsibility and autonomous vehicles: targeting and risk distribution. These map roughly onto the perspective from the agent (those who deploy or benefit from...... autonomous vehicle use) and the patient (those who bear the burdens of the activities of others) respectively. Unifying both approaches to the responsibility question unearths troubling common denominators that may be introduced through autonomous vehicles: increased and entrenched societal inequalities...

  19. The sensory channel of presentation alters subjective ratings and autonomic responses toward disgusting stimuli – Blood pressure, heart rate and skin conductance in response to visual, auditory, haptic and olfactory presented disgusting stimuli

    OpenAIRE

    Croy, Ilona; Laqua, Kerstin; Süß, Frank; Joraschky, Peter; Ziemssen, Tjalf; Hummel, Thomas

    2014-01-01

    Disgust causes specific reaction patterns, observable in mimic responses and body reactions. Most research on disgust deals with visual stimuli. However, pictures may cause another disgust experience than sounds, odors, or tactile stimuli. Therefore, disgust experience evoked by four different sensory channels was compared. A total of 119 participants received 3 different disgusting and one control stimulus, each presented through the visual, auditory, tactile, and olfactory channel. Ratings ...

  20. The sensory channel of presentation alters subjective ratings and autonomic responses toward disgusting stimuli—Blood pressure, heart rate and skin conductance in response to visual, auditory, haptic and olfactory presented disgusting stimuli

    OpenAIRE

    Croy, Ilona; Laqua, Kerstin; Süß, Frank; Joraschky, Peter; Ziemssen, Tjalf; Hummel, Thomas

    2013-01-01

    Disgust causes specific reaction patterns, observable in mimic responses and body reactions. Most research on disgust deals with visual stimuli. However, pictures may cause another disgust experience than sounds, odors, or tactile stimuli. Therefore, disgust experience evoked by four different sensory channels was compared. A total of 119 participants received 3 different disgusting and one control stimulus, each presented through the visual, auditory, tactile, and olfactory channel. Ratings ...

  1. Metabolic and cardiovascular responses to epinephrine in diabetic autonomic neuropathy

    DEFF Research Database (Denmark)

    Hilsted, J; Richter, E; Madsbad, S

    1987-01-01

    . To study these responses, we administered epinephrine in a graded intravenous infusion (0.5 to 5 micrograms per minute) to seven diabetic patients without neuropathy, seven diabetic patients with autonomic neuropathy, and seven normal subjects. Mean arterial pressure decreased significantly in the patients...... with autonomic neuropathy than in the other groups (P less than 0.05). These findings indicate that several beta-receptor-mediated responses to epinephrine are enhanced in patients with diabetic autonomic neuropathy. The underlying mechanism remains to be elucidated.......Norepinephrine-induced vasoconstriction, which is mediated by alpha-adrenergic receptors, is accentuated in patients with autonomic neuropathy. In contrast, responses mediated by beta-adrenergic receptors, including vasodilatation and metabolic changes, have not been evaluated in these patients...

  2. Dynamics of autonomic nervous system responses and facial expressions to odors

    Directory of Open Access Journals (Sweden)

    Wei eHe

    2014-02-01

    Full Text Available Why we like or dislike certain products may be better captured by physiological and behavioral measures of the autonomic nervous system than by conscious or classical sensory tests. Responses to pleasant and unpleasant food odors presented in varying concentrations were assessed continuously using facial expressions and responses of the autonomic nervous system (ANS. Results of 26 young and healthy female participants showed that the unpleasant fish odor triggered higher heart rates and skin conductance responses, lower skin temperature, fewer neutral facial expressions and more disgusted and angry expressions (p < .05. Neutral facial expressions differentiated between odors within 100 ms, after the start of the odor presentation followed by expressions of disgust (180 ms, anger (500 ms, surprised (580 ms, sadness (820 ms, scared (1020 ms, and happy (1780 ms (all p values < .05. Heart rate differentiated between odors after 400 ms, whereas skin conductance responses differentiated between odors after 3920 ms. At shorter intervals (between 520 and 1000 ms and between 2690 and 3880 ms skin temperature for fish was higher than that for orange, but became considerable lower after 5440 ms. This temporal unfolding of emotions in reactions to odors, as seen in facial expressions and physiological measurements supports sequential appraisal theories.

  3. Differentiation of Internet addiction risk level based on autonomic nervous responses: the Internet-addiction hypothesis of autonomic activity.

    Science.gov (United States)

    Lu, Dong Wei; Wang, Jenn Wu; Huang, Andrew Chih Wei

    2010-08-01

    How high-risk Internet addiction (IA) abusers respond to different autonomic nervous activities compared with low-risk subjects may be a critical research goal with prevention and treatment implications. The aim of the present study was to address this issue by observing differences between high- and low-risk IA abusers in four physiological assessments when surfing the Internet: blood volume pulse (BVP), skin conductance (SC), peripheral temperature (PTEMP), and respiratory response (RESPR). Forty-two male and ten female participants aged 18-24 years were screened with the Chen Internet Addiction Scale (CIAS, 2003), and then separated into high- and low-risk IA groups. Using psychophysiology equipment, participants encountered a 3-minute adaptation period followed by a 6-minute testing period for surfing the Internet on baseline and testing phases. The present results indicate that: (a) the CIAS scores were positively and negatively correlated with the RESPR and the PTEMP; (b) the PTEMP and RESPR of high-risk IA abusers were respectively weaker and stronger than those of low-risk IA abusers; the BVP and SC of high-risk IA abusers were respectively augmented and decreased relative to low-risk IA abusers. Thus we suggest that four autonomic responses may be differentially sensitive to abusers' potency in terms of the IA hypothesis of autonomic activity. The stronger BVP and RESPR responses and the weaker PTEMP reactions of the high-risk IA abusers indicate the sympathetic nervous system was heavily activated in these individuals. However, SC activates parasympathetic responses at the same time in the high-risk IA abusers. The paradoxical responses between the sympathetic and parasympathetic actions are addressed in the discussion.

  4. Some relationships between punishment, stuttering, and galvanic skin responses.

    Science.gov (United States)

    Reed, C G; Lingwall, J B

    1976-06-01

    The simultaneous effects of response-contingent punishment on stuttering behaviors and the frequency of galvanic skin response (GSR) deflections for 10 subjects were investigated. GSR's and stuttering responses were recorded during base rate, treatment, and extinction conditions. The subjects demonstrated a 50% or greater decrease in stuttering frequency during the treatment condition. Combined data for all subjects indicated that the mean frequency of GSR deflections remained stable or declined across conditions of the study. Analysis of individual data revealed that GSR deflections during treatment as compared with base rate increased for four subjects, remained essentially the same in two subjects, and decreased for four subjects. These results suggest that experimental procedures which result in functional punishment effects on stuttering frequency may not be associated with any predictable pattern on concomitant autonomic arousal.

  5. Autonomous Aerobraking: Thermal Analysis and Response Surface Development

    Science.gov (United States)

    Dec, John A.; Thornblom, Mark N.

    2011-01-01

    A high-fidelity thermal model of the Mars Reconnaissance Orbiter was developed for use in an autonomous aerobraking simulation study. Response surface equations were derived from the high-fidelity thermal model and integrated into the autonomous aerobraking simulation software. The high-fidelity thermal model was developed using the Thermal Desktop software and used in all phases of the analysis. The use of Thermal Desktop exclusively, represented a change from previously developed aerobraking thermal analysis methodologies. Comparisons were made between the Thermal Desktop solutions and those developed for the previous aerobraking thermal analyses performed on the Mars Reconnaissance Orbiter during aerobraking operations. A variable sensitivity screening study was performed to reduce the number of variables carried in the response surface equations. Thermal analysis and response surface equation development were performed for autonomous aerobraking missions at Mars and Venus.

  6. Investigating the autonomic nervous system response to anxiety in children with autism spectrum disorders.

    Science.gov (United States)

    Kushki, Azadeh; Drumm, Ellen; Pla Mobarak, Michele; Tanel, Nadia; Dupuis, Annie; Chau, Tom; Anagnostou, Evdokia

    2013-01-01

    Assessment of anxiety symptoms in autism spectrum disorders (ASD) is a challenging task due to the symptom overlap between the two conditions as well as the difficulties in communication and awareness of emotions in ASD. This motivates the development of a physiological marker of anxiety in ASD that is independent of language and does not require observation of overt behaviour. In this study, we investigated the feasibility of using indicators of autonomic nervous system (ANS) activity for this purpose. Specially, the objectives of the study were to 1) examine whether or not anxiety causes significant measurable changes in indicators of ANS in an ASD population, and 2) characterize the pattern of these changes in ASD. We measured three physiological indicators of the autonomic nervous system response (heart rate, electrodermal activity, and skin temperature) during a baseline (movie watching) and anxiety condition (Stroop task) in a sample of typically developing children (n = 17) and children with ASD (n = 12). The anxiety condition caused significant changes in heart rate and electrodermal activity in both groups, however, a differential pattern of response was found between the two groups. In particular, the ASD group showed elevated heart rate during both baseline and anxiety conditions. Elevated and blunted phasic electrodermal activity were found in the ASD group during baseline and anxiety conditions, respectively. Finally, the ASD group did not show the typical decrease in skin temperature in response to anxiety. These results suggest that 1) signals of the autonomic nervous system may be used as indicators of anxiety in children with ASD, and 2) ASD may be associated with an atypical autonomic response to anxiety that is most consistent with sympathetic over-arousal and parasympathetic under-arousal.

  7. Investigating the Autonomic Nervous System Response to Anxiety in Children with Autism Spectrum Disorders

    Science.gov (United States)

    Kushki, Azadeh; Drumm, Ellen; Pla Mobarak, Michele; Tanel, Nadia; Dupuis, Annie; Chau, Tom; Anagnostou, Evdokia

    2013-01-01

    Assessment of anxiety symptoms in autism spectrum disorders (ASD) is a challenging task due to the symptom overlap between the two conditions as well as the difficulties in communication and awareness of emotions in ASD. This motivates the development of a physiological marker of anxiety in ASD that is independent of language and does not require observation of overt behaviour. In this study, we investigated the feasibility of using indicators of autonomic nervous system (ANS) activity for this purpose. Specially, the objectives of the study were to 1) examine whether or not anxiety causes significant measurable changes in indicators of ANS in an ASD population, and 2) characterize the pattern of these changes in ASD. We measured three physiological indicators of the autonomic nervous system response (heart rate, electrodermal activity, and skin temperature) during a baseline (movie watching) and anxiety condition (Stroop task) in a sample of typically developing children (n = 17) and children with ASD (n = 12). The anxiety condition caused significant changes in heart rate and electrodermal activity in both groups, however, a differential pattern of response was found between the two groups. In particular, the ASD group showed elevated heart rate during both baseline and anxiety conditions. Elevated and blunted phasic electrodermal activity were found in the ASD group during baseline and anxiety conditions, respectively. Finally, the ASD group did not show the typical decrease in skin temperature in response to anxiety. These results suggest that 1) signals of the autonomic nervous system may be used as indicators of anxiety in children with ASD, and 2) ASD may be associated with an atypical autonomic response to anxiety that is most consistent with sympathetic over-arousal and parasympathetic under-arousal. PMID:23577072

  8. Investigating the autonomic nervous system response to anxiety in children with autism spectrum disorders.

    Directory of Open Access Journals (Sweden)

    Azadeh Kushki

    Full Text Available Assessment of anxiety symptoms in autism spectrum disorders (ASD is a challenging task due to the symptom overlap between the two conditions as well as the difficulties in communication and awareness of emotions in ASD. This motivates the development of a physiological marker of anxiety in ASD that is independent of language and does not require observation of overt behaviour. In this study, we investigated the feasibility of using indicators of autonomic nervous system (ANS activity for this purpose. Specially, the objectives of the study were to 1 examine whether or not anxiety causes significant measurable changes in indicators of ANS in an ASD population, and 2 characterize the pattern of these changes in ASD. We measured three physiological indicators of the autonomic nervous system response (heart rate, electrodermal activity, and skin temperature during a baseline (movie watching and anxiety condition (Stroop task in a sample of typically developing children (n = 17 and children with ASD (n = 12. The anxiety condition caused significant changes in heart rate and electrodermal activity in both groups, however, a differential pattern of response was found between the two groups. In particular, the ASD group showed elevated heart rate during both baseline and anxiety conditions. Elevated and blunted phasic electrodermal activity were found in the ASD group during baseline and anxiety conditions, respectively. Finally, the ASD group did not show the typical decrease in skin temperature in response to anxiety. These results suggest that 1 signals of the autonomic nervous system may be used as indicators of anxiety in children with ASD, and 2 ASD may be associated with an atypical autonomic response to anxiety that is most consistent with sympathetic over-arousal and parasympathetic under-arousal.

  9. Leader Style and Anxiety Level: Their Relation to Autonomic Response.

    Science.gov (United States)

    Seemann, Daniel C.

    1982-01-01

    Studied effects of leader style and a group of people classified as either high-anxious or low-anxious. Measured participants' (N=71) responses to the leader styles using Galvanic Skin Response. Results indicated similar responses of participants to both autocratic and democratic leadership styles. (RC)

  10. Cognitive modulation of psychophysical, respiratory and autonomic responses to cold pressor test.

    Science.gov (United States)

    Santarcangelo, Enrica L; Paoletti, Giulia; Chiavacci, Iacopo; Palombo, Carlo; Carli, Giancarlo; Varanini, Maurizio

    2013-01-01

    In healthy subjects with high hypnotisability (highs) under hypnosis, subjectively effective suggestions for analgesia abolish the increases in blood pressure associated with cold pressor test (cpt) by reducing the peripheral vascular resistance. The aim of the present study was to investigate the effects of the suggestions of analgesia on the responses to cpt in healthy highs (n = 22) and in low hypnotisable participants (lows, n = 22) out of hypnosis. Cpt was administered without (CPT) and with suggestions for analgesia (CPT+AN). Psychophysical (pain intensity, pain threshold, cpt duration (time of immersion) and pain tolerance, defined as the difference between cpt duration and pain threshold), respiratory (amplitude and frequency) and autonomic variables (tonic skin conductance, mean RR interval (RR = 1/heart rate), blood pressure, skin blood flow) were studied. The suggestions for analgesia increased cpt duration and RR in both groups, but decreased pain intensity and enhanced pain threshold only in highs; in both groups they did not modulate systolic blood pressure, tonic skin conductance and skin blood flow; thus, increased parasympathetic activity appears responsible for the heart rate reduction induced by suggestions in both groups. In conclusion, our findings show that suggestions modulate pain experience differentially in highs and lows, and are partially effective also in lows. We hypothesize that the mechanisms responsible for the efficacy of suggestions in healthy lows may be involved also in their efficacy in chronic pain patients with low hypnotisability.

  11. Cognitive modulation of psychophysical, respiratory and autonomic responses to cold pressor test.

    Directory of Open Access Journals (Sweden)

    Enrica L Santarcangelo

    Full Text Available In healthy subjects with high hypnotisability (highs under hypnosis, subjectively effective suggestions for analgesia abolish the increases in blood pressure associated with cold pressor test (cpt by reducing the peripheral vascular resistance. The aim of the present study was to investigate the effects of the suggestions of analgesia on the responses to cpt in healthy highs (n = 22 and in low hypnotisable participants (lows, n = 22 out of hypnosis. Cpt was administered without (CPT and with suggestions for analgesia (CPT+AN. Psychophysical (pain intensity, pain threshold, cpt duration (time of immersion and pain tolerance, defined as the difference between cpt duration and pain threshold, respiratory (amplitude and frequency and autonomic variables (tonic skin conductance, mean RR interval (RR = 1/heart rate, blood pressure, skin blood flow were studied. The suggestions for analgesia increased cpt duration and RR in both groups, but decreased pain intensity and enhanced pain threshold only in highs; in both groups they did not modulate systolic blood pressure, tonic skin conductance and skin blood flow; thus, increased parasympathetic activity appears responsible for the heart rate reduction induced by suggestions in both groups. In conclusion, our findings show that suggestions modulate pain experience differentially in highs and lows, and are partially effective also in lows. We hypothesize that the mechanisms responsible for the efficacy of suggestions in healthy lows may be involved also in their efficacy in chronic pain patients with low hypnotisability.

  12. Immune response associated with nonmelanoma skin cancer.

    Science.gov (United States)

    Strickland, F M; Kripke, M L

    1997-10-01

    It is now clear that UV radiation causes nonmelanoma skin cancer in at least two ways: by causing permanent changes in the genetic code and by preventing immunologic recognition of mutant cells. These are interacting rather than separate mechanisms. Damage to DNA results in disregulation of cellular proliferation and initiates immune suppression by stimulating the production of suppressive cytokines. These cytokines contribute to the loss of immunosurveillance. Ultraviolet radiation has both local and systemic immunosuppressive effects. Locally, it depletes and alters antigen-presenting LC at the site of UV irradiation. Systemic suppression results when Ts cells are induced, by altered LC, by inflammatory macrophages that enter the skin following UV irradiation, or by the action of cytokines. Damage to DNA appears to be one of the triggering events in inducing systemic immunosuppression via the release of immunosuppressive cytokines and mediators. Immunologic approaches to treating skin cancers so far have concentrated on nonspecifically stimulating immune cells that infiltrate these tumors, but induction of specific immune responses against these tumors with antitumor vaccines has received little attention as yet. Preventive measures include sun avoidance and the use of sunscreens to prevent DNA damage by UV light. Future strategies may employ means to reverse UV-induced immunosuppression by using anti-inflammatory agents, biologicals that accelerate DNA repair or prevent the generation of immunosuppressive cytokines, and specific immunotherapy with tumor antigens. New approaches for studying the immunology of human skin cancers are needed to accelerate progress in this field.

  13. Responsibility for crashes of autonomous vehicles: an ethical analysis.

    Science.gov (United States)

    Hevelke, Alexander; Nida-Rümelin, Julian

    2015-06-01

    A number of companies including Google and BMW are currently working on the development of autonomous cars. But if fully autonomous cars are going to drive on our roads, it must be decided who is to be held responsible in case of accidents. This involves not only legal questions, but also moral ones. The first question discussed is whether we should try to design the tort liability for car manufacturers in a way that will help along the development and improvement of autonomous vehicles. In particular, Patrick Lin's concern that any security gain derived from the introduction of autonomous cars would constitute a trade-off in human lives will be addressed. The second question is whether it would be morally permissible to impose liability on the user based on a duty to pay attention to the road and traffic and to intervene when necessary to avoid accidents. Doubts about the moral legitimacy of such a scheme are based on the notion that it is a form of defamation if a person is held to blame for causing the death of another by his inattention if he never had a real chance to intervene. Therefore, the legitimacy of such an approach would depend on the user having an actual chance to do so. The last option discussed in this paper is a system in which a person using an autonomous vehicle has no duty (and possibly no way) of interfering, but is still held (financially, not criminally) responsible for possible accidents. Two ways of doing so are discussed, but only one is judged morally feasible.

  14. Cognitive load and autonomic response patterns under negative priming demand in depersonalization-derealization disorder.

    Science.gov (United States)

    Lemche, Erwin; Sierra-Siegert, Mauricio; David, Anthony S; Phillips, Mary L; Gasston, David; Williams, Steven C R; Giampietro, Vincent P

    2016-04-01

    Previous studies have yielded evidence for cognitive processing abnormalities and alterations of autonomic functioning in depersonalization-derealization disorder (DPRD). However, multimodal neuroimaging and psychophysiology studies have not yet been conducted to test for functional and effective connectivity under cognitive stress in patients with DPRD. DPRD and non-referred control subjects underwent a combined Stroop/negative priming task, and the neural correlates of Stroop interference effect, negative priming effect, error rates, cognitive load span and average amplitude of skin conductance responses were ascertained for both groups. Evoked haemodynamic responses for basic Stroop/negative priming activations were compared. For basic Stroop to neutral contrast, patients with DPRD differed in the location (inferior vs. superior lobule) of the parietal region involved, but showed similar activations in the left frontal region. In addition, patients with DPRD also co-activated the dorsomedial prefrontal cortex (BA9) and posterior cingulate cortex (BA31), which were also found to be the main between-group difference regions. These regions furthermore showed connectivity with frequency of depersonalization states. Evoked haemodynamic responses drawn from regions of interest indicated significant between-group differences in 30-40% of time points. Brain-behaviour correlations differed mainly in laterality, yet only slightly in regions. A reversal of autonomic patterning became evident in patients with DPRD for cognitive load spans, indicating less effective arousal suppression under cognitive stress - patients with DPRD showed positive associations of cognitive load with autonomic responses, whereas controls exhibit respective inverse association. Overall, the results of the present study show only minor executive cognitive peculiarities, but further support the notion of abnormalities in autonomic functioning in patients with DPRD.

  15. Basic emotions evoked by odorants: comparison between autonomic responses and self-evaluation.

    Science.gov (United States)

    Alaoui-Ismaïli, O; Robin, O; Rada, H; Dittmar, A; Vernet-Maury, E

    1997-10-01

    The present study was designed to analyze the relationship between self-report and physiological expression of basic emotions (happiness, surprise, fear, sadness, disgust and anger) in response to odorants. 44 subjects inhaled five odorants: vanillin, menthol, eugenol, methyl methacrylate, and propionic acid. Six autonomic nervous systems (ANS) parameters were simultaneously recorded in real time and without interference: Skin Potential (SP), Skin Resistance (SR), Skin Temperature (ST), Skin Blood Flow (SBF), Instantaneous Respiratory Frequency (IRF) and Instantaneous Heart Rate (IHR). At the end of the recording, subjects were instructed i) to identify the odorants roughly II) to situate them on an 11-point hedonic scale from highly pleasant (0) to highly unpleasant (10); and iii) to define what type of basic emotion was evoked by each odorant. In this study, the expected affects were aroused in the subjects. Vanillin and menthol were rated pleasant, while methyl methacrylate and propionic acid were judged unpleasant. Eugenol was median in hedonic estimation. ANS evaluation (each autonomic pattern induced by an odorant was transcripted into a basic emotion) shows that pleasantly connoted odorants evoked mainly happiness and surprise, but that unpleasant ones induced mainly disgust and anger. Eugenol was associated with positive and negative affects. Comparison between conscious (verbal) and unconscious (ANS) emotions, reveals that these two estimations 1) were not significantly different as far as the two pleasant odorants were concerned, 2) showed a tendency to be significantly different for eugenol odorant which was variably scored on the hedonic axis, and 3) exhibited a significant difference for the two unpleasant odorants, for which the corresponding "verbal emotion" was mainly "disgust", while the most frequent ANS emotion was "anger". In conclusion, these results show quite a good correlation between verbal and ANS estimated basic emotions. The main

  16. Olfactory ensheathing cell transplantation improves sympathetic skin responses in chronic spinal cord injury

    Institute of Scientific and Technical Information of China (English)

    Zuncheng Zheng; Guifeng Liu; Yuexia Chen; Shugang Wei

    2013-01-01

    Forty-three patients with chronic spinal cord injury for over 6 months were transplanted with bryonic olfactory ensheathing cells, 2-4 × 106, into multiple sites in the injured area under the sur-gical microscope. The sympathetic skin response in patients was measured with an electromyo-graphy/evoked potential instrument 1 day before transplantation and 3-8 weeks after trans-tion. Spinal nerve function of patients was assessed using the American Spinal Injury Association impairment scale. The sympathetic skin response was elicited in 32 cases before olfactory en-sheathing celltransplantation, while it was observed in 34 cases after transplantation. tantly, sympathetic skin response latency decreased significantly and amplitude increased cantly after transplantation. Transplantation of olfactory ensheathing cells also improved American Spinal Injury Association scores for movement, pain and light touch. Our findings indicate that factory ensheathing celltransplantation improves motor, sensory and autonomic nerve functions in patients with chronic spinal cord injury.

  17. Self-report, personality and autonomic system modulation in response to empathic conflictual versus non conflictual situation.

    Science.gov (United States)

    Balconi, Michela; Bortolotti, Adriana

    2014-01-01

    The present study integrated three different measures of emotional empathic behaviour in a social context: verbal self-report measures (empathic response, emotional involvement, emotional significance, and valence), autonomic response (skin conductance, SCR, and heart rate, HR), and personal response to empathic scale (BEES). Thirty-five younger adults were presented with different interpersonal scene types (co-operation, non-co-operation, conflict, neutral). Different empathic sensitivity to these interpersonal situations was tested, since we hypothesised self-report on empathy, emotional involvement and valence varied as a function of interpersonal context. As supposed, self-report measures of empathy and autonomic measures were found to be related: SCR and HR increased in response to conflictual and non-co-operative situations. Moreover, high empathic subjects were more responsive (on both self-report and autonomic response) to empathy-related situations than low empathic subjects. The convergence of these multidimensional measures are discussed: emotional components of empathy are elucidated in relation to self-report, autonomic modulation, and personality trait variation.

  18. Heart rate responses to autonomic challenges in obstructive sleep apnea.

    Directory of Open Access Journals (Sweden)

    Paul M Macey

    Full Text Available Obstructive sleep apnea (OSA is accompanied by structural alterations and dysfunction in central autonomic regulatory regions, which may impair dynamic and static cardiovascular regulation, and contribute to other syndrome pathologies. Characterizing cardiovascular responses to autonomic challenges may provide insights into central nervous system impairments, including contributions by sex, since structural alterations are enhanced in OSA females over males. The objective was to assess heart rate responses in OSA versus healthy control subjects to autonomic challenges, and, separately, characterize female and male patterns. We studied 94 subjects, including 37 newly-diagnosed, untreated OSA patients (6 female, age mean ± std: 52.1 ± 8.1 years; 31 male aged 54.3 ± 8.4 years, and 57 healthy control subjects (20 female, 50.5 ± 8.1 years; 37 male, 45.6 ± 9.2 years. We measured instantaneous heart rate with pulse oximetry during cold pressor, hand grip, and Valsalva maneuver challenges. All challenges elicited significant heart rate differences between OSA and control groups during and after challenges (repeated measures ANOVA, p<0.05. In post-hoc analyses, OSA females showed greater impairments than OSA males, which included: for cold pressor, lower initial increase (OSA vs. control: 9.5 vs. 7.3 bpm in females, 7.6 vs. 3.7 bpm in males, OSA delay to initial peak (2.5 s females/0.9 s males, slower mid-challenge rate-of-increase (OSA vs. control: -0.11 vs. 0.09 bpm/s in females, 0.03 vs. 0.06 bpm/s in males; for hand grip, lower initial peak (OSA vs. control: 2.6 vs. 4.6 bpm in females, 5.3 vs. 6.0 bpm in males; for Valsalva maneuver, lower Valsalva ratio (OSA vs. control: 1.14 vs. 1.30 in females, 1.29 vs. 1.34 in males, and OSA delay during phase II (0.68 s females/1.31 s males. Heart rate responses showed lower amplitude, delayed onset, and slower rate changes in OSA patients over healthy controls, and impairments may be more pronounced in

  19. Active skin perfusion and thermoregulatory response in the hand following nerve injury and repair in human upper extremities.

    Science.gov (United States)

    Deng, Aidong; Liu, Dan; Gu, Chen; Gu, Xiaosong; Gu, Jianhui; Hu, Wen

    2016-01-01

    Cutaneous vasoconstriction/vasodilatation occurs in response to whole body and local cooling/heating, and the vasomotor activities play a pivotal role in thermal control of the human body. The mechanisms underlying regulation of skin blood flow involve both neurogenic and humeral/local chemical influence, contributing to the initial response to thermal stimuli and the prolonged phase of response, respectively. Previous studies have suggested the impairment of cutaneous thermal regulation after nerve injury. However, the evidence regarding how the skin perfusion and thermoregulatory response evolve after nerve injury and repair remains limited. Here we observed, by utilizing laser-Doppler perfusion imaging, baseline skin perfusion and perfusion change in response to thermal stimuli after median and ulnar nerve injury, and the results showed that baseline perfusion in autonomous skin area profoundly decreased and active rewarming after clod stress dramatically diminished before sensory recovery of the skin became detectable. In addition, baseline cutaneous perfusion was recovered as the skin regained touch sensation, and exhibited positive correlation to touch sensibility of the skin. These data indicate that both active perfusion and thermoregulatory response of the skin are markedly compromised during skin denervation and can be recovered by re-innervation. This suggests the importance of timely repair of injured nerve, especially in the practice of replantation.

  20. Sympathetic skin response in patients with myasthenia gravis A comparative analysis

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    BACKGROUND: The examination of sympathetic skin response is an important index for assessing the autonomic nerve function, and patients with myasthenia gravis are always accompanied by dysautonomia.Therefore, it will be important to know whether sympathetic skin response can be used as the index for the clinical evaluation of myasthenia gravis.OBJECTIVE: To investigate the diagnostic value of sympathetic skin response in the damage of autonomic nerve function of patients with myasthenia gravis.DESIGN: A case-controlled comparative observation.SETTING: Department of Neurology and Room of Nerve Electromyogram, the Affiliated Hospital of North Sichuan Medical College.PARTICIPANTS: Thirty outpatients or inpatients with myasthenia gravis were selected from the Department of Neurology, the Affiliated Hospital of North Sichuan Medical College from May 2006 to May 2007, including 9 males and 21 females, aged 8 - 72 years with a mean age of (28±5) years old. They were all accorded with the diagnostic standards of myasthenia gravis, accompanied by different severity of autonomic nerve symptoms, including poor skin nutrition, sweating of hands and feet, pyknocardia,persistent hypotension, abdominal pain, constipation, etc. They all had not taken any drug affecting the autonomic nerve function before the examination. Informed consents were obtained from all the patients.Meanwhile, 30 healthy physical examinees were enrolled as the normal control group, including 10 males and 20 females, aged 10 - 75 years with a mean age of (31±5) years old. Approval was obtained from the hospital ethic committee.METHODS: After admission, the patients were examined with sympathetic skin response using DANTEC keypoint 2.0 electromyography evoked potential apparatus (Danmark). The changes of the latency and wave amplitude of sympathetic skin response were observed. The subjects in the normal control group were examined with the same methods at physical examination. Abnormality was judged by

  1. Characterizing human skin blood flow regulation in response to different local skin temperature perturbations.

    Science.gov (United States)

    Wu, Y; Nieuwenhoff, M D; Huygen, F J P M; van der Helm, F C T; Niehof, S; Schouten, A C

    2017-05-01

    Small nerve fibers regulate local skin blood flow in response to local thermal perturbations. Small nerve fiber function is difficult to assess with classical neurophysiological tests. In this study, a vasomotor response model in combination with a heating protocol was developed to quantitatively characterize the control mechanism of small nerve fibers in regulating skin blood flow in response to local thermal perturbation. The skin of healthy subjects' hand dorsum (n=8) was heated to 42°C with an infrared lamp, and then naturally cooled down. The distance between the lamp and the hand was set to three different levels in order to change the irradiation intensity on the skin and implement three different skin temperature rise rates (0.03°C/s, 0.02°C/s and 0.01°C/s). A laser Doppler imager (LDI) and a thermographic video camera recorded the temporal profile of the skin blood flow and the skin temperature, respectively. The relationship between the skin blood flow and the skin temperature was characterized by a vasomotor response model. The model fitted the skin blood flow response well with a variance accounted for (VAF) between 78% and 99%. The model parameters suggested a similar mechanism for the skin blood flow regulation with the thermal perturbations at 0.03°C/s and 0.02°C/s. But there was an accelerated skin vasoconstriction after a slow heating (0.01°C/s) (p-value<0.05). An attenuation of the skin vasodilation was also observed in four out of the seven subjects during the slow heating (0.01°C/s). Our method provides a promising way to quantitatively assess the function of small nerve fibers non-invasively and non-contact.

  2. DNA repair responses in human skin cells

    Energy Technology Data Exchange (ETDEWEB)

    Hanawalt, P.C.; Liu, S.C.; Parsons, C.S.

    1981-07-01

    Sunlight and some environmental chemical agents produce lesions in the DNA of human skin cells that if unrepaired may interfere with normal functioning of these cells. The most serious outcome of such interactions may be malignancy. It is therefore important to develop an understanding of mechanisms by which the lesions may be repaired or tolerated without deleterious consequences. Our models for the molecular processing of damaged DNA have been derived largely from the study of bacterial systems. Some similarities but significant differences are revealed when human cell responses are tested against these models. It is also of importance to learn DNA repair responses of epidermal keratinocytes for comparison with the more extensive studies that have been carried out with dermal fibroblasts. Our experimental results thus far indicate similarities for the excision-repair of ultraviolet-induced pyrimidine dimers in human keratinocytes and fibroblasts. Both the monoadducts and the interstrand crosslinks produced in DNA by photoactivated 8-methoxypsoralen (PUVA) can be repaired in normal human fibroblasts but not in those from xeroderma pigmentosum patients. The monoadducts, like pyrimidine dimers, are probably the more mutagenic/carcinogenic lesions while the crosslinks are less easily repaired and probably result in more effective blocking of DNA function. It is suggested that a split-dose protocol that maximizes the production of crosslinks while minimizing the yield of monoadducts may be more effective and potentially less carcinogenic than the single ultraviolet exposure regimen in PUVA therapy for psoriasis.

  3. Skin conductance orienting response in unmedicated RDC schizophrenic, schizoaffective, depressed, and control subjects.

    Science.gov (United States)

    Levinson, D F

    1991-10-01

    In an evaluation of the skin conductance orienting response (SCOR) as a marker for schizophrenia, skin conductance (SC) activity was studied in 36 Research Diagnostic Criteria (RDC) schizophrenic (SCZ), 17 schizoaffective--mainly schizophrenic (SA), 24 depressed (DEP), and 25 psychiatrically well control (CONT) subjects. All subjects were unmedicated. Data are presented from four paradigms: a series of 1 s 70 dB tones in a no-task habituation paradigm; a similar series of 103 dB tones; a series of tones with a button-press (reaction time) task; and a loud white noise stimulus (without task). The proportion of SCOR nonresponse to the first 70 dB tone was 39% for SCZ, 82% for SA, 46% for DEP, and 36% for CONT subjects; the response rate for SA subjects was significantly lower than for all other groups. The CONT group was less responsive than in most previous studies. SCZ subjects did not show increased responsivity to more intense and to task-relevant stimuli, although SA subjects did show such increases. DEP subjects showed some evidence of autonomic hyperarousal (higher tonic SC level, trend toward more spontaneous SC responses). The overall pattern of results does not support SCOR to neutral, moderate-intensity tones as a specific marker for schizophrenia, although there was some evidence for a generalized decrease in autonomic responsivity to stimuli.

  4. Responsive corneosurfametry following in vivo skin preconditioning.

    Science.gov (United States)

    Uhoda, E; Goffin, V; Pierard, G E

    2003-12-01

    Skin is subjected to many environmental threats, some of which altering the structure and function of the stratum corneum. Among them, surfactants are recognized factors that may influence irritant contact dermatitis. The present study was conducted to compare the variations in skin capacitance and corneosurfametry (CSM) reactivity before and after skin exposure to repeated subclinical injuries by 2 hand dishwashing liquids. A forearm immersion test was performed on 30 healthy volunteers. 2 daily soak sessions were performed for 5 days. At inclusion and the day following the last soak session, skin capacitance was measured and cyanoacrylate skin-surface strippings were harvested. The latter specimens were used for the ex vivo microwave CSM. Both types of assessments clearly differentiated the 2 hand dishwashing liquids. The forearm immersion test allowed the discriminant sensitivity of CSM to increase. Intact skin capacitance did not predict CSM data. By contrast, a significant correlation was found between the post-test conductance and the corresponding CSM data. In conclusion, a forearm immersion test under realistic conditions can discriminate the irritation potential between surfactant-based products by measuring skin conductance and performing CSM. In vivo skin preconditioning by surfactants increases CSM sensitivity to the same surfactants.

  5. Latent inhibition and autonomic responses: a psychophysiological approach.

    Science.gov (United States)

    Vaitl, D; Lipp, O V

    1997-10-01

    Latent inhibition, retarded learning after preexposure to the to-be-conditioned stimulus, has been implied as a tool for the investigation of attentional deficits in schizophrenia and related disorders. The present paper reviews research that used Pavlovian conditioning as indexed by autonomic responses (electrodermal, vasomotor, cardiac) to investigate latent inhibition in adult humans. Latent inhibition has been demonstrated repeatedly in healthy subjects in absence of a masking task that is required in other latent inhibition paradigms. Moreover, latent inhibition of Pavlovian conditioning is stimulus-specific and increases with an increased number of preexposure trials which mirrors results from research in animals. A reduction of latent inhibition has been shown in healthy subjects who score high on questionnaire measures of psychosis proneness and in unmedicated schizophrenic patients. The latter result was obtained in a within-subject paradigm that holds promise for research with patient samples.

  6. The framing effect and skin conductance responses

    Directory of Open Access Journals (Sweden)

    Patrick eRing

    2015-08-01

    Full Text Available Individuals often rely on simple heuristics when they face complex choice situations under uncertainty. Traditionally, it has been proposed that cognitive processes are the main driver to evaluate different choice options and finally to reach a decision. Growing evidence, however, highlights a strong interrelation between judgment and decision-making (JDM on the one hand, and emotional processes on the other hand. This also seems to apply to judgmental heuristics, i.e. decision-processes that are typically considered to be fast and intuitive. In this study, participants are exposed to different probabilities of receiving an unpleasant electric shock. Information about electric shock probabilities is either positively or negatively framed. Integrated skin conductance responses (ISCRs while waiting for electric shock realization are used as an indicator for participants' emotional arousal. This measure is compared to objective probabilities. I find evidence for a relation between emotional body reactions measured by ISCRs and the framing effect. Under negative frames, participants show significantly higher ISCRs while waiting for an electric shock to be delivered than under positive frames. This result might contribute to a better understanding of the psychological processes underlying JDM. Further studies are necessary to reveal the causality underlying this finding, i.e. whether emotional processes influence JDM or vice versa.

  7. The framing effect and skin conductance responses.

    Science.gov (United States)

    Ring, Patrick

    2015-01-01

    Individuals often rely on simple heuristics when they face complex choice situations under uncertainty. Traditionally, it has been proposed that cognitive processes are the main driver to evaluate different choice options and to finally reach a decision. Growing evidence, however, highlights a strong interrelation between judgment and decision-making (JDM) on the one hand, and emotional processes on the other hand. This also seems to apply to judgmental heuristics, i.e., decision processes that are typically considered to be fast and intuitive. In this study, participants are exposed to different probabilities of receiving an unpleasant electric shock. Information about electric shock probabilities is either positively or negatively framed. Integrated skin conductance responses (ISCRs) while waiting for electric shock realization are used as an indicator for participants' emotional arousal. This measure is compared to objective probabilities. I find evidence for a relation between emotional body reactions measured by ISCRs and the framing effect. Under negative frames, participants show significantly higher ISCRs while waiting for an electric shock to be delivered than under positive frames. This result might contribute to a better understanding of the psychological processes underlying JDM. Further studies are necessary to reveal the causality underlying this finding, i.e., whether emotional processes influence JDM or vice versa.

  8. Electrochemical Skin Conductance May Be Used to Screen for Diabetic Cardiac Autonomic Neuropathy in a Chinese Population with Diabetes

    Science.gov (United States)

    He, Tianyi; Wang, Chuan; Zuo, Anju; Liu, Pan; Li, Wenjuan

    2017-01-01

    Aims. This study aimed to assess whether the electrochemical skin conductance (ESC) could be used to screen for diabetic cardiac autonomic neuropathy (DCAN) in a Chinese population with diabetes. Methods. We recruited 75 patients with type 2 diabetes mellitus (T2DM) and 45 controls without diabetes. DCAN was diagnosed by the cardiovascular autonomic reflex tests (CARTs) as gold standard. In all subjects ESCs of hands and feet were also detected by SUDOSCAN™ as a new screening method. The efficacy was assessed by receiver operating characteristic (ROC) curve analysis. Results. The ESCs of both hands and feet were significantly lower in T2DM patients with DCAN than those without DCAN (67.33 ± 15.37 versus 78.03 ± 13.73, P = 0.002, and 57.77 ± 20.99 versus 75.03 ± 11.41, P diabetes before further diagnosis with CARTs.

  9. Evaluation of distal symmetric polyneuropathy: the role of autonomic testing, nerve biopsy, and skin biopsy (an evidence-based review).

    Science.gov (United States)

    England, J D; Gronseth, G S; Franklin, G; Carter, G T; Kinsella, L J; Cohen, J A; Asbury, A K; Szigeti, K; Lupski, J R; Latov, N; Lewis, R A; Low, P A; Fisher, M A; Herrmann, D; Howard, J F; Lauria, G; Miller, R G; Polydefkis, M; Sumner, A J

    2009-01-01

    Distal symmetric polyneuropathy (DSP) is the most common variety of neuropathy. Since the evaluation of this disorder is not standardized, the available literature was reviewed to provide evidence-based guidelines regarding the role of autonomic testing, nerve biopsy, and skin biopsy for the assessment of polyneuropathy. A literature review using MEDLINE, EMBASE, Science Citation Index, and Current Contents was performed to identify the best evidence regarding the evaluation of polyneuropathy published between 1980 and March 2007. Articles were classified according to a four-tiered level of evidence scheme and recommendations were based on the level of evidence. (1) Autonomic testing may be considered in the evaluation of patients with polyneuropathy to document autonomic nervous system dysfunction (Level B). Such testing should be considered especially for the evaluation of suspected autonomic neuropathy (Level B) and distal small fiber sensory polyneuropathy (SFSN) (Level C). A battery of validated tests is recommended to achieve the highest diagnostic accuracy (Level B). (2) Nerve biopsy is generally accepted as useful in the evaluation of certain neuropathies as in patients with suspected amyloid neuropathy, mononeuropathy multiplex due to vasculitis, or with atypical forms of chronic inflammatory demyelinating polyneuropathy (CIDP). However, the literature is insufficient to provide a recommendation regarding when a nerve biopsy may be useful in the evaluation of DSP (Level U). (3) Skin biopsy is a validated technique for determining intraepidermal nerve fiber (IENF) density and may be considered for the diagnosis of DSP, particularly SFSN (Level C). There is a need for additional prospective studies to define more exact guidelines for the evaluation of polyneuropathy.

  10. Control of the skin scarring response

    Directory of Open Access Journals (Sweden)

    Lydia M. Ferreira

    2009-09-01

    Full Text Available There comes a time when the understanding of the cutaneous healing process becomes essential due to the need for a precocious tissue repair to reduce the physical, social, and psychological morbidity. Advances in the knowledge on the control of interaction among cells, matrix and growth factors will provide more information on the Regenerative Medicine, an emerging area of research in medical bioengineering. However, considering the dynamism and complexity of the cutaneous healing response, it is fundamental to understand the control mechanism exerted by the interaction and synergism of both systems, cutaneous nervous and central nervous, via hypothalamus hypophysis-adrenal axis, a relevant subject, but hardly ever explored. The present study reviews the neuro-immune-endocrine physiology of the skin responsible for its multiple functions and the extreme disturbances of the healing process, like the excess and deficiency of the extracellular matrix deposition.Aproxima-se uma época na qual é fundamental a compreensão do processo cicatricial cutâneo frente à necessidade da restauração tecidual precoce, visando a diminuição das morbidades física, social e psicológica. O avanço no conhecimento acerca do controle das interações entre as células, a matriz e os fatores de crescimento dará maiores informações à Medicina Regenerativa, área de pesquisa emergente da bioengenharia médica. Entretanto, diante do dinamismo e complexidade da resposta cicatricial cutânea torna-se indispensável o entendimento do mecanismo de controle exercido pela interação e sinergismo do sistema nervoso cutâneo e o sistema nervoso central, via eixo hipotálamo-hipófise-adrenal, tema relevante, porém, pouco abordado. O presente estudo revisa a fisiologia neuro-imuno-endócrina da pele, responsável por suas múltiplas funções, e os distúrbios extremos do processocicatricial, como o excesso e deficiência de deposição da matriz extracelular.

  11. Autonomous Experimentation of Carbon Nanotube Using Response Surface Methods

    Science.gov (United States)

    2015-03-26

    on the unique challenges of creating autonomous research robots . v Table of Contents Page Abstract...direction could represent a small region where a local maximum exists. If outliers or other nuisance factors are continually problematic , experiment...materials research technology, detailed discussion is also provided on the unique challenges of creating autonomous research robots . 15. SUBJECT

  12. Sympathetic skin responses from the scalp evoked by electrical stimulation in seborrheic dermatitis.

    Science.gov (United States)

    Altunrende, Burcu; Yildiz, Serpil; Kandi, Basak; Yildiz, Nebil

    2013-06-01

    Although the role of autonomic nervous system in seborrheic dermatitis (SD) is still unclear, seborrhea is sometimes accepted as a sign of autonomic dysfunction in several nervous system diseases. Therefore, we aimed to investigate the sympathetic nervous system (SNS) activity in SD by recording sympathetic skin responses (SSR) from the scalp (S-SSR). Thirty-one control subjects and 22 SD patients were studied by evoking right and left S-SSR with electrical stimulation of the right median nerve at the wrist. Mean latencies and maximum amplitudes were calculated for both sides in each group. In seven out of 31 control subjects and in 13 out of 22 patients, the S-SSR could not be elicited on either side. There were four subjects with unilateral response in the patient group. There were significantly more non-responders among the patients with SD (P < 0.000). This study suggests that in SD, the autonomic nervous system may be involved. The S-SSR is a new site for recording SSR. The responses are relatively symmetrical and can be evoked easily by electrical stimulation, and may be used to evaluate the SNS function in SD patients and also in healthy subjects.

  13. TRPM8 mechanism of autonomic nerve response to cold in respiratory airway

    Directory of Open Access Journals (Sweden)

    Wang Cong-Yi

    2008-06-01

    Full Text Available Abstract Breathing cold air without proper temperature exchange can induce strong respiratory autonomic responses including cough, airway constriction and mucosal secretion, and can exacerbate existing asthma conditions and even directly trigger an asthma attack. Vagal afferent fiber is thought to be involved in the cold-induced respiratory responses through autonomic nerve reflex. However, molecular mechanisms by which vagal afferent fibers are excited by cold remain unknown. Using retrograde labeling, immunostaining, calcium imaging, and electrophysiological recordings, here we show that a subpopulation of airway vagal afferent nerves express TRPM8 receptors and that activation of TRPM8 receptors by cold excites these airway autonomic nerves. Thus activation of TRPM8 receptors may provoke autonomic nerve reflex to increase airway resistance. This putative autonomic response may be associated with cold-induced exacerbation of asthma and other pulmonary disorders, making TRPM8 receptors a possible target for prevention of cold-associated respiratory disorders.

  14. Autonomic and Emotional Responses of Graduate Student Clinicians in Speech-Language Pathology to Stuttered Speech

    Science.gov (United States)

    Guntupalli, Vijaya K.; Nanjundeswaran, Chayadevie; Dayalu, Vikram N.; Kalinowski, Joseph

    2012-01-01

    Background: Fluent speakers and people who stutter manifest alterations in autonomic and emotional responses as they view stuttered relative to fluent speech samples. These reactions are indicative of an aroused autonomic state and are hypothesized to be triggered by the abrupt breakdown in fluency exemplified in stuttered speech. Furthermore,…

  15. University EFL Learners' Perceptions of Their Autonomous Learning Responsibilities and Abilities

    Science.gov (United States)

    Abdel Razeq, Anwar Ahmad

    2014-01-01

    This study investigated the readiness of university students for autonomous learning of English as a foreign language. Data was collected using questionnaires and interviews. The study assessed learners' readiness for autonomous learning across three dimensions: a) learners' perceptions of their educational responsibilities; b) learners' abilities…

  16. Lower corticosteroid skin blanching response is associated with severe COPD.

    Directory of Open Access Journals (Sweden)

    Susan J M Hoonhorst

    Full Text Available BACKGROUND: Chronic obstructive pulmonary disease (COPD is characterized by chronic airflow limitation caused by ongoing inflammatory and remodeling processes of the airways and lung tissue. Inflammation can be targeted by corticosteroids. However, airway inflammation is generally less responsive to steroids in COPD than in asthma. The underlying mechanisms are yet unclear. This study aimed to assess whether skin corticosteroid insensitivity is associated with COPD and COPD severity using the corticosteroid skin blanching test. METHODS: COPD patients GOLD stage I-IV (n = 27, 24, 22, and 16 respectively and healthy never-smokers and smokers (n = 28 and 56 respectively were included. Corticosteroid sensitivity was assessed by the corticosteroid skin blanching test. Budesonide was applied in 8 logarithmically increasing concentrations (0-100 μg/ml on subject's forearm. Assessment of blanching was performed after 7 hours using a 7-point scale (normal skin to intense blanching. All subjects performed spirometry and body plethysmography. RESULTS: Both GOLD III and GOLD IV COPD patients showed significantly lower skin blanching responses than healthy never-smokers and smokers, GOLD I, and GOLD II patients. Their area under the dose-response curve values of the skin blanching response were 586 and 243 vs. 1560, 1154, 1380, and 1309 respectively, p<0.05. Lower FEV1 levels and higher RV/TLC ratios were significantly associated with lower skin blanching responses (p = 0.001 and p = 0.004 respectively. GOLD stage I, II, III and IV patients had similar age and packyears. CONCLUSIONS: In this study, severe and very severe COPD patients had lower skin corticosteroid sensitivity than mild and moderate COPD patients and non-COPD controls with comparable age and packyears. Our findings together suggest that the reduced skin blanching response fits with a subgroup of COPD patients that has an early-onset COPD phenotype.

  17. Deceased donor skin allograft banking: Response and utilization

    Directory of Open Access Journals (Sweden)

    Gore Madhuri

    2010-10-01

    Full Text Available Background: In the absence of xenograft and biosynthetic skin substitutes, deceased donor skin allografts is a feasible option for saving life of patient with extensive burn injury in our country. Aims: The first deceased donor skin allograft bank in India became functional at Lokmanya Tilak Municipal (LTM medical college and hospital on 24 th April 2000. The response of Indian society to this new concept of skin donation after death and the pattern of utilization of banked allografts from 2000 to 2010 has been presented in this study. Settings and Design: This allograft skin bank was established by the department of surgery. The departments of surgery and microbiology share the responsibility of smooth functioning of the bank. Materials and Methods: The response in terms of number of donations and the profile of donors was analyzed from records. Pattern and outcome of allograft utilization was studied from specially designed forms. Results: During these ten years, 262 deceased donor skin allograft donations were received. The response showed significant improvement after counselling was extended to the community. Majority of the donors were above 70 years of age and procurement was done at home for most. Skin allografts from 249 donors were used for 165 patients in ten years. The outcome was encouraging with seven deaths in 151 recipients with burn injuries. Conclusions: Our experience shows that the Indian society is ready to accept the concept of skin donation after death. Use of skin allografts is life saving for large burns. We need to prepare guidelines for the establishment of more skin banks in the country.

  18. Maternal Sensitivity and Infant Autonomic and Endocrine Stress Responses

    Science.gov (United States)

    Enlow, Michelle Bosquet; King, Lucy; Schreier, Hannah; Howard, Jamie M.; Rosenfield, David; Ritz, Thomas; Wright, Rosalind J.

    2014-01-01

    Background Early environmental exposures may help shape the development of the autonomic nervous system (ANS) and hypothalamic-pituitary-adrenal (HPA) axis, influencing vulnerability for health problems across the lifespan. Little is known about the role of maternal sensitivity in influencing the development of the ANS in early life. Aims To examine associations among maternal sensitivity and infant behavioral distress and ANS and HPA axis reactivity to the Repeated Still-Face Paradigm (SFP-R), a dyadic stress task. Study Design Observational repeated measures study. Subjects Thirty-five urban, sociodemographically diverse mothers and their 6-month-old infants. Outcome Measures Changes in infant affective distress, heart rate, respiratory sinus arrhythmia (RSA), and T-wave amplitude (TWA) across episodes of the SFP-R were assessed. A measure of cortisol output (area under the curve) in the hour following cessation of the SFP-R was also obtained. Results Greater maternal insensitivity was associated with greater infant sympathetic activation (TWA) during periods of stress and tended to be associated with greater cortisol output following the SFP-R. There was also evidence for greater affective distress and less parasympathetic activation (RSA) during the SFP-R among infants of predominantly insensitive mothers. Conclusions Caregiving quality in early life may influence the responsiveness of the sympathetic and parasympathetic branches of the ANS as well as the HPA axis. Consideration of the ANS and HPA axis systems together provides a fuller representation of adaptive versus maladaptive stress responses. The findings highlight the importance of supporting high quality caregiving in the early years of life, which is likely to promote later health. PMID:24794304

  19. Responses of the autonomic nervous system in altitude adapted and high altitude pulmonary oedema subjects

    Science.gov (United States)

    Mathew, Lazar; Purkayastha, S. S.; Jayashankar, A.; Radhakrishnan, U.; Sen Gupta, J.; Nayar, H. S.

    1985-06-01

    Studies were carried out to ascertain the role of sympatho-parasympathetic responses in the process of adaptation to altitude. The assessment of status of autonomic balance was carried out in a group of 20 young male subjects by recording their resting heart rate, blood pressure, oral temperature, mean skin temperature, extremity temperatures, pupillary diameter, cold pressor response, oxygen consumption, cardioacceleration during orthostasis and urinary excretion of catecholamines; in a thermoneutral laboratory. The same parameters were repeated on day 3 and at weekly intervals for a period of 3 weeks, after exposing them to 3,500 m; and also after return to sea level. At altitude, similar studies were carried out in a group of 10 acclimatized lowlanders, 10 high altitude natives and 6 patients who had recently recovered from high altitude pulmonary oedema. In another phase, similar studies were done in two groups of subjects, one representing 15 subjects who had stayed at altitude (3,500 4,000 m) without any ill effects and the other comprising of 10 subjects who had either suffered from high altitude pulmonary oedema (HAPO) or acute mountain sickness (AMS). The results revealed sympathetic overactivity on acute induction to altitude which showed gradual recovery on prolonged stay, the high altitude natives had preponderance to parasympathetic system. Sympathetic preponderance may not be an essential etiological factor for the causation of maladaptation syndromes.

  20. No response of pancreatic hormones to hypoglycemia in diabetic autonomic neuropathy

    DEFF Research Database (Denmark)

    Hilsted, J; Madsbad, S; Krarup, T

    1982-01-01

    The responses of pancreatic hormones (i.e. glucagon, pancreatic polypeptide, and somatostatin) to insulin-induced hypoglycemia were investigated in 18 insulin-dependent diabetics without residual beta-cell function and in 6 normal subjects. Nine of the diabetics had autonomic neuropathy, and 9 had...... no neuropathy. After hypoglycemia, no significant increase in any of the 3 pancreatic hormones was found in the diabetics with autonomic neuropathy, whereas significant increments were found in the diabetics without neuropathy and in the normal subjects. These results suggest that autonomic nervous activity...

  1. Excessive parasympathetic responses to sympathetic challenges: a treatable, hidden, dynamic autonomic imbalance

    OpenAIRE

    David L. Bellin; Nicholas L. DePace; Robert J. Bulgarelli; Peng Li; Joe Colombo

    2015-01-01

    Background: A common assumption with autonomic assessment is that one branch opposes the other. With independent measures of parasympathetic (P) and sympathetic (S) activity, based on concurrent time-frequency analysis of respiratory activity and heart rate variability, this assumption has been challenged. Clinical observations of unprovoked P-excess during S-stimulation have been associated with treatable, abnormal responses. Method: Serial autonomic profiling of 12,967 patients was perfo...

  2. Effects of heart rate variability biofeedback on cardiovascular responses and autonomic sympathovagal modulation following stressor tasks in prehypertensives.

    Science.gov (United States)

    Chen, S; Sun, P; Wang, S; Lin, G; Wang, T

    2016-02-01

    Autonomic dysfunction is implicated in prehypertension, and previous studies have suggested that therapies that improve modulation of sympathovagal balance, such as biofeedback and slow abdominal breathing, are effective in patients with prehypertension at rest. However, considering that psychophysiological stressors may be associated with greater cardiovascular risk in prehypertensives, it is important to investigate whether heart rate variability biofeedback (HRV-BF) results in equivalent effects on autonomic cardiovascular responses control during stressful conditions in prehypertensives. A total of 32 college students with prehypertension were enrolled and randomly assigned to HRV-BF (n=12), slow abdominal breathing (SAB, n=10) or no treatment (control, n=10) groups. Then, a training experiment consisting of 15 sessions was employed to compare the effect of each intervention on the following cardiovascular response indicators before and after intervention: heart rate (HR); heart rate variability (HRV) components; blood volume pulse amplitude (BVPamp); galvanic skin response; respiration rate (RSP); and blood pressure. In addition, the cold pressor test and the mental arithmetic challenge test were also performed over two successive days before and after the invention as well as after 3 months of follow-up. A significant decrease in HR and RSP and a significant increase in BVPamp were observed after the HRV-BF intervention (P<0.001). For the HRV analysis, HRV-BF significantly reduced the ratio of low-frequency power to high-frequency power (the LF/HF ratio, P<0.001) and increased the normalized high-frequency power (HFnm) (P<0.001) during the stress tests, and an added benefit over SAB by improving HRV was also observed. In the 3-month follow-up study, similar effects on RSP, BVPamp, LF/HF and HFnm were observed in the HRV-BF group compared with the SAB group. HRV-BF training contributes to the beneficial effect of reducing the stress-related cardiovascular

  3. Autonomic markers of emotional processing: skin sympathetic nerve activity in humans during exposure to emotionally-charged images

    Directory of Open Access Journals (Sweden)

    Rachael eBrown

    2012-10-01

    Full Text Available The sympathetic innervation of the skin primarily subserves thermoregulation, but the system has also been commandeered as a means of expressing emotion. While it is known that the level of skin sympathetic nerve activity (SSNA is affected by anxiety, the majority of emotional studies have utilized the galvanic skin response as a means of inferring increases in SSNA. The purpose of the present study was to characterize the changes in SSNA when showing subjects neutral or emotionally-charged images from the International Affective Picture System. Skin sympathetic nerve activity was recorded via tungsten microelectrodes inserted into cutaneous fascicles of the common peroneal nerve in ten subjects. Neutral images, positively-charged images (erotica or negatively-charged images (mutilation were presented in blocks of fifteen images of a specific type, each block lasting two minutes. Images of erotica or mutilation were presented in a quasi-random fashion, each block following a block of neutral images. Both images of erotica or images of mutilation caused significant increases in SSNA, but the increases in SSNA were greater for mutilation. The increases in SSNA were often coupled with sweat release and cutaneous vasoconstriction, however, these markers were not always consistent with the SSNA increases. We conclude that SSNA, comprising cutaneous vasoconstrictor and sudomotor activity, increases with both positively-charged and negatively-charged emotional images. Measurement of SSNA provides a more comprehensive assessment of sympathetic outflow to the skin than does the use of sweat release alone as a marker of emotional processing.

  4. EEG and autonomic responses during performance of matching and non-matching to sample working memory tasks with emotional content.

    Directory of Open Access Journals (Sweden)

    Ana eGarcia

    2011-12-01

    Full Text Available Working memory (WM is a neural system responsible for the temporary storage of information and its utilization in problem solving. The central executive is theorized as the controller of storage functions that support WM. Neurophysiological data suggest that EEG theta and alpha oscillations in frontal and midline regions are involved in neural communication between the central executive and storage functions during WM performance. Emotion is known to modulate several memory systems, including WM, through central and peripheral pathways. However, the physiological correlations (electroencephalographic – EEG; autonomic nervous activity of the effect of emotion over WM are not well described. In this study we aimed to identify physiological responses related to emotional WM performance. EEG (21 channels, heart rate (HR and galvanic skin response (GSR recordings were obtained from 54 volunteers while performing delayed matching and non-matching to sample tasks (DMTS/DNMTS. Emotional and neutral pictures from the International Affective Picture System and geometric figures were used as stimuli. As expected, WM performance was accompanied by presence of theta (frontal and midline electrodes and Alpha power (parietal electrodes. Beta and gamma oscillations were concentrated in frontopolar and left temporal regions. DNMTS task was accompanied by increases in Beta power, HR and GSR compared to DMTS task. Correlation analysis showed a positive tendency for gamma in Fp2 site, ratio of LF/HF (HR low and high frequency and skin conductance in both tasks. The HR results indicate an inverse reaction related to parasympathetic and sympathetic nervous system during the performance of the tasks. Taken together, our results contribute to elucidate the complex interactions between central and autonomic nervous systems in the modulation of emotional WM tasks.

  5. Autonomic and Neuroendocrine Responses to a Psychosocial Stressor in Adults with Autistic Spectrum

    Science.gov (United States)

    Jansen, Lucres M. C.; Gispen-de Wied, Christine C.; Wiegant, Victor M.; Westenberg, Herman G. M.; Lahuis, Bertine E.; van Engeland, Herman

    2006-01-01

    Objective of the study was to replicate in adults our previous findings of decreased heart rate and normal endocrine responses to stress in autistic children and to elucidate the discrepancy between autonomic and endocrine stress responses by including epinephrine, norepinephrine, oxytocin and vasopressin measurements. Ten autistic spectrum…

  6. Characterization of the Frictional Response of Squamata Shed Skin in Comparison to Human skin

    CERN Document Server

    Abdel-Aal, H A

    2010-01-01

    Deterministic surfaces are constructs of which profile, topography and textures are integral to the function of the system they enclose. They are designed to yield a predetermined rubbing response. Developing such entities relies on controlling the structure of the rubbing interface so that, not only the surface is of optimized topography, but also is able to self-adjust its behavior according to the evolution of sliding conditions. Inspirations for such designs are frequently encountered in natural species. In particular, and from a tribological point of view, Squamate Reptiles, offer diverse examples where surface texturing, submicron and nano-scale features, achieves frictional regulation. In this paper, we study the frictional response of shed skin obtained from a Python regius snake. The study employed a specially designed tribo-acoustic probe capable of measuring the coefficient of friction and detecting the acoustical behavior of the skin in vivo. The results confirm the anisotropy of the frictional re...

  7. Relationships between Irritable Bowel Syndrome Pain, Skin Temperature Indices of Autonomic Dysregulation, and Sensitivity to Thermal Cutaneous Stimulation

    Directory of Open Access Journals (Sweden)

    Fong Wong

    2010-01-01

    Full Text Available This study evaluated relationships between irritable bowel syndrome (IBS pain, sympathetic dysregulation, and thermal pain sensitivity. Eight female patients with diarrhea-predominant IBS and ten healthy female controls were tested for sensitivity to thermal stimulation of the left palm. A new method of response-dependent thermal stimulation was used to maintain pain intensity at a predetermined level (35% by adjusting thermal stimulus intensity as a function of pain ratings. Clinical pain levels were assessed prior to each testing session. Skin temperatures were recorded before and after pain sensitivity testing. The temperature of palmar skin dropped (1.5∘C when the corresponding location on the opposite hand of control subjects was subjected to prolonged thermal stimulation, but this response was absent for IBS pain patients. The patients also required significantly lower stimulus temperatures than controls to maintain a 35% pain rating. Baseline skin temperatures of patients were significantly correlated with thermode temperatures required to maintain 35% pain ratings. IBS pain intensity was not significantly correlated with skin temperature or pain sensitivity. The method of response-dependent stimulation revealed thermal hyperalgesia and increased sympathetic tone for chronic pain patients, relative to controls. Similarly, a significant correlation between resting skin temperatures and thermal pain sensitivity for IBS but not control subjects indicates that tonic sympathetic activation and a thermal hyperalgesia were generated by the chronic presence of visceral pain. However, lack of a significant relationship between sympathetic tone and ratings of IBS pain casts doubt on propositions that the magnitude of IBS pain is determined by psychological stress.

  8. Depersonalization disorder: disconnection of cognitive evaluation from autonomic responses to emotional stimuli.

    Directory of Open Access Journals (Sweden)

    Matthias Michal

    Full Text Available BACKGROUND: Patients with depersonalization disorder (DPD typically complain about emotional detachment. Previous studies found reduced autonomic responsiveness to emotional stimuli for DPD patients as compared to patients with anxiety disorders. We aimed to investigate autonomic responsiveness to emotional auditory stimuli of DPD patients as compared to patient controls. Furthermore, we examined the modulatory effect of mindful breathing on these responses as well as on depersonalization intensity. METHODS: 22 DPD patients and 15 patient controls balanced for severity of depression and anxiety, age, sex and education, were compared regarding 1 electrodermal and heart rate data during a resting period, and 2 autonomic responses and cognitive appraisal of standardized acoustic affective stimuli in two conditions (normal listening and mindful breathing. RESULTS: DPD patients rated the emotional sounds as significantly more neutral as compared to patient controls and standardized norm ratings. At the same time, however, they responded more strongly to acoustic emotional stimuli and their electrodermal response pattern was more modulated by valence and arousal as compared to patient controls. Mindful breathing reduced severity of depersonalization in DPD patients and increased the arousal modulation of electrodermal responses in the whole sample. Finally, DPD patients showed an increased electrodermal lability in the rest period as compared to patient controls. CONCLUSIONS: These findings demonstrated that the cognitive evaluation of emotional sounds in DPD patients is disconnected from their autonomic responses to those emotional stimuli. The increased electrodermal lability in DPD may reflect increased introversion and cognitive control of emotional impulses. The findings have important psychotherapeutic implications.

  9. Watching neutral and threatening movies: subjective experience and autonomic responses in subjects with different hypnotizability levels.

    Science.gov (United States)

    Santarcangelo, E L; Paoletti, G; Balocchi, R; Scattina, E; Ghelarducci, B; Varanini, M

    2012-04-01

    Subjects with high hypnotizability scores (Highs) have been considered more prone to experience negative affect and more vulnerable to its autonomic effects with respect to low hypnotizable individuals (Lows). The aim of the study was to analyze the subjective experience, tonic skin conductance (SC), respiratory frequency (RF), heart rate (HR) and heart rate variability (HRV) of healthy Highs and Lows during a long-lasting, emotionally neutral task (Session R, 46 subjects) and a moderately threatening one (Session T, 35 subjects). At the end of the relaxing Session R, all participants reported an increased relaxation. At the end of the threatening Session T, only 20 subjects reported a decreased relaxation (effective T: eT subsample). Highs and Lows of this subsample reported a similarly reduced relaxation and showed a similarly increased skin conductance. HR and HRV did not differ between the two sessions and between Highs and Lows. Among the subjects not reporting decreased relaxation at the end of Session T (ineffective T: iT subsample, n=15), relaxation was deeper and associated with lower skin conductance in Highs, although HR and HRV did not differ between Highs and Lows. All together, the results do not support the hypothesis of higher proneness of Highs to experience negative affect and to exhibit the autonomic correlates of negative emotion.

  10. Blunted autonomic response to volume expansion in formerly preeclamptic women with low plasma volume.

    NARCIS (Netherlands)

    Krabbendam, I.; Courtar, D.A.; Janssen, B.J.; Aardenburg, R.; Peeters, L.L.; Spaanderman, M.E.A.

    2009-01-01

    OBJECTIVE: We hypothesize that low plasma volume in normotensive formerly preeclamptic women reflects reduced venous storage capacity. To test this hypothesis, we compared circulatory and autonomic responses to acute volume loading between women with low and those with normal plasma volume. METHODS:

  11. Autonomous Sensory Meridian Response (ASMR) and Frisson: Mindfully Induced Sensory Phenomena That Promote Happiness

    Science.gov (United States)

    del Campo, Marisa A.; Kehle, Thomas J.

    2016-01-01

    There are many important phenomena involved in human functioning that are unnoticed, misunderstood, not applied, or do not pique the interest of the scientific community. Among these, "autonomous sensory meridian response" ("ASMR") and "frisson" are two very noteworthy instances that may prove to be therapeutically…

  12. Autonomic Nervous System Responses to Concussion: Arterial Pulse Contour Analysis

    Directory of Open Access Journals (Sweden)

    Michael F La Fountaine

    2016-02-01

    Full Text Available The arterial pulse wave (APW has a distinct morphology whose contours reflect dynamics in cardiac function and peripheral vascular tone as a result of sympathetic nervous system (SNS control. With a transition from rest to increased metabolic demand, the expected augmentation of SNS outflow will not only affect arterial blood pressure and heart rate, it will also induce changes to the contours of the APW. Following a sports concussion, a transient state cardiovascular autonomic dysfunction is present. How this state affects the APW, has yet to be described. A prospective, parallel-group study on cardiovascular autonomic control (i.e., digital electrocardiogram and continuous beat-to-beat blood pressure was performed in the seated upright position in ten athletes with concussion and 7 non-injured control athletes. Changes in APW were compared at rest and during the first 60 seconds (F60 of an isometric handgrip test (IHGT in concussed athletes and non-injured controls within 48 hours (48hr and 1 week (1wk of injury. The concussion group was further separated by the length of time until they were permitted to return to play (RTP>1wk; RTP≤1wk. SysSlope, an indirect measurement of stroke volume, was significantly lower in the concussion group at rest and during F60 at 48hr and 1wk; a paradoxical decline in SysSlope occurred at each visit during the transition from rest to IHGT F60. The RTP>1wk group had lower SysSlope (405±200; 420±88; 454±236 mmHg/s, respectively at rest 48hr compared to the RTP≤1wk and controls. Similarly at 48hr rest, several measurements of arterial stiffness were abnormal in RTP>1wk compared to RTP≤1wk and controls: Peak-to-Notch Latency (0.12±0.04; 0.16±0.02; 0.17±0.05, respectively, Notch Relative Amplitude (0.70±0.03; 0.71±0.04; 0.66±0.14, respectively and Stiffness Index (6.4±0.2; 5.7±0.4; 5.8±0.5, respectively. Use of APW revealed that concussed athletes have a transient increase in peripheral artery

  13. The autonomic and rate pressure product responses of Tai Chi practitioners

    Directory of Open Access Journals (Sweden)

    Michael A Figueroa

    2012-01-01

    Full Text Available Background: Spectral analysis of autonomic nervous system activity can provide insight into cardiovascular function. Rate pressure product is the parameter often targeted pharmacologically to decrease the incidence of myocardial events. Aim: The purpose of this study was to investigate whether or not Tai Chi Chuan practitioners would demonstrate autonomic responses that would be more cardioprotective when compared to non-trained controls. Materials and Methods: This was a cross-sectional study that measured the autonomic responses and rate pressure product of 2 groups of subjects; a Tai Chi Chuan trained (n = 13 and non-trained sedentary controls (n = 13 at rest and during 2 stressor phases that simulated functional activities of daily living. Results: The Tai Chi group maintained a greater parasympathetic outflow at rest and during the isometric grip stressor phase (P<0.05. Sympathetic outflow, systolic blood pressure and rate pressure product were significantly lower in the Tai Chi group at rest, during the isometric grip and standing stressor phases (P<0.05. Conclusion: Although a cause-and-effect relationship cannot be concluded in this study, the Tai Chi group was able to demonstrate efficiency of the myocardium with suppressed rate pressure product values and autonomic responses that favored parasympathetic outflow. This type of training may complement non-pharmacological anti-hypertensive therapy.

  14. Cytisine induces autonomic cardiovascular responses via activations of different nicotinic receptors.

    Science.gov (United States)

    Li, Yi-Fan; Lacroix, Carly; Freeling, Jessica

    2010-04-19

    Nicotinic cholinergic receptors mediate autonomic transmission at ganglia. However, whether different subtypes of nicotinic cholinergic receptors expressed in autonomic ganglia elicit distinct roles in mediating sympathetic and parasympathetic regulations remain to be defined. In this study, we observed that different subtypes of nicotinic receptors were responsible for the sympathetic and parasympathetic cardiovascular responses. In urethane anesthetized mice, intravenous injection with cytisine, a non-selective nicotinic agonist, induced a brief but pronounced decrease in heart rate, followed by increases in heart rate and arterial blood pressure. The bradycardic response was blocked by atropine, and the pressor response was blocked by prazosin, confirming that these responses were parasympathetic and sympathetic activities, respectively. Hexamethonium, a ganglionic blocker, blocked both sympathetic and parasympathetic responses. Pretreatment with methyllycaconitine citrate, a selective alpha7 nicotinic receptor antagonist, significantly attenuated cytisine-induced sympathetic response with little effect on the parasympathetic response. In contrast, pretreatment with dihydro-beta-erythroidine hydrobromide, a selective alpha4beta2 nicotinic receptor antagonist, blocked cytisine-induced parasympathetic response but not the sympathetic response. Pretreatment with dihydro-beta-erythroidine hydrobromide also blocked baroreflex associated parasympathetic bradycardic response. Moreover, treatment with nicotine induced a bradycardic response without a significant pressor response, which was also attenuated by dihydro-beta-erythroidine hydrobromide. Collectively, these data suggest that different nicotinic receptors play distinct roles in sympathetic and parasympathetic ganglia. Specifically, activations of alpha7 and alpha4beta2 nicotinic receptors are involved in cytisine-induced cardiovascular sympathetic and parasympathetic responses, respectively.

  15. Oppositionality and sympathetic skin response in adolescents: specific associations with the headstrong/hurtful dimension.

    Science.gov (United States)

    Silva, Nanucha Teixeira da; Schestatsky, Pedro; Winckler, Pablo Brea; Salum, Giovanni Abrahão; Petroceli, Alana Wypyszynski; Heldt, Elizeth Paz da Silva

    2014-12-01

    Oppositionality encompasses distinct dimensions, and few studies have investigated the validity of such distinctions from a pathophysiological perspective. Our aim was to investigate the association between sympathetic skin responses (SSR) and distinct oppositional dimensions in a community sample of adolescents. Forty adolescents aged 13.84±1.46 years participated in this study. Oppositionality was measured by externalizing behavior and bullying scores (dependent variables), while SSR was recorded by electrical changes at the skin level (independent variables). Results showed that increased SSRs were associated with oppositionality; however, these associations were specific to the headstrong/hurtful dimension. Further exploratory analyses demonstrated that increased SSRs were associated with several types of headstrong/hurtful behaviors and underscore the importance of the first aversive stimuli to differentiate groups with low and high headstrong/hurtful behaviors. There were no differences between groups regarding time until habituation. This study provides insights about how dysfunctions in autonomic balance may contribute to the emergence of oppositional behavior among adolescents.

  16. Cardiovascular, hormonal and metabolic responses to graded exercise in juvenile diabetics with and without autonomic neuropathy

    DEFF Research Database (Denmark)

    Hilsted, J; Galbo, H; Christensen, N J

    1980-01-01

    Thirteen juvenile diabetics were studied in order to determine if decreased beat-to-beat variation during deep respiration, indicating abnormal autonomic nerve function, imply that cardiovascular, hormonal and metabolic responses are impaired. Patients with decreased beat-to-beat variation had...... to be more heavily stressed during exercise to reach a certain heart rate or catecholamine level. The relation between other metabolic and hormonal response is discussed....

  17. Heart rate variability response to mental arithmetic stress in patients with schizophrenia Autonomic response to stress in schizophrenia

    NARCIS (Netherlands)

    Castro, Mariana N.; Vigo, Daniel E.; Weidema, Hylke; Fahrer, Rodolfo D.; Chu, Elvina M.; De Achaval, Delfina; Nogues, Martin; Leiguarda, Ramon C.; Cardinali, Daniel P.; Guinjoan, Salvador N.

    2008-01-01

    Background: The vulnerability-stress hypothesis is an established model of schizophrenia symptom formation. We sought to characterise the pattern of the cardiac autonomic response to mental arithmetic stress in patients with stable schizophrenia. Methods: We performed heart rate variability (HRV) an

  18. Acupuncture Effect and Central Autonomic Regulation

    Directory of Open Access Journals (Sweden)

    Qian-Qian Li

    2013-01-01

    Full Text Available Acupuncture is a therapeutic technique and part of traditional Chinese medicine (TCM. Acupuncture has clinical efficacy on various autonomic nerve-related disorders, such as cardiovascular diseases, epilepsy, anxiety and nervousness, circadian rhythm disorders, polycystic ovary syndrome (PCOS and subfertility. An increasing number of studies have demonstrated that acupuncture can control autonomic nerve system (ANS functions including blood pressure, pupil size, skin conductance, skin temperature, muscle sympathetic nerve activities, heart rate and/or pulse rate, and heart rate variability. Emerging evidence indicates that acupuncture treatment not only activates distinct brain regions in different kinds of diseases caused by imbalance between the sympathetic and parasympathetic activities, but also modulates adaptive neurotransmitter in related brain regions to alleviate autonomic response. This review focused on the central mechanism of acupuncture in modulating various autonomic responses, which might provide neurobiological foundations for acupuncture effects.

  19. Investigation research on autonomous responsive materials; Jiritsu oto zairyo ni kansuru chosa kenkyu

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1996-03-01

    A survey was made on autonomous responsive materials as a new material which reversibly change molecular structures and the aggregation state according to external stimuli. Autonomous responsive materials imitate environmental responsibility in the living organism system and have sensing, control and active functions for external stimuli. The materials are highly efficient and environmentally friendly. In biomimetic materials for soft actuators, drastic changes by temperature of elastic modulus of water-swollen hydrogel are used to the motion. In order to molecularly design stimulus-responsible polymer gel, studied are the relation between the micro structure and stimulus responsibility, dynamic correlation between the micro structure and the macro structure, etc. In the biomedical field, new cure and diagnosis using innovative materials are expected, and the application of autonomous responsive materials to the field is studied. For example, using hydrogel responding the temperature and the surface and controlling by temperature the interaction with components of the organism such as protein and cells, drug delivery in the organism is optimized. Also studied is the application of hydrophilic/hydrophobic changes by temperature to the chromatography. 215 refs., 47 figs., 11 tabs.

  20. Role of autonomic reflex arcs in cardiovascular responses to air pollution exposure.

    Science.gov (United States)

    Perez, Christina M; Hazari, Mehdi S; Farraj, Aimen K

    2015-01-01

    The body responds to environmental stressors by triggering autonomic reflexes in the pulmonary receptors, baroreceptors, and chemoreceptors to maintain homeostasis. Numerous studies have shown that exposure to various gases and airborne particles can alter the functional outcome of these reflexes, particularly with respect to the cardiovascular system. Modulation of autonomic neural input to the heart and vasculature following direct activation of sensory nerves in the respiratory system, elicitation of oxidative stress and inflammation, or through other mechanisms is one of the primary ways that exposure to air pollution affects normal cardiovascular function. Any homeostatic process that utilizes the autonomic nervous system to regulate organ function might be affected. Thus, air pollution and other inhaled environmental irritants have the potential to alter both local airway function and baro- and chemoreflex responses, which modulate autonomic control of blood pressure and detect concentrations of key gases in the body. While each of these reflex pathways causes distinct responses, the systems are heavily integrated and communicate through overlapping regions of the brainstem to cause global effects. This short review summarizes the function of major pulmonary sensory receptors, baroreceptors, and carotid body chemoreceptors and discusses the impacts of air pollution exposure on these systems.

  1. A study on the frictional response of reptilian shed skin

    Science.gov (United States)

    Abdel-Aal, H. A.; Vargiolu, R.; Zahouani, H.; El Mansori, M.

    2011-08-01

    Deterministic surfaces are constructs of which profile, topography and textures are integral to the function of the system they enclose. They are designed to yield a predetermined tribological response. Developing such entities relies on controlling the structure of the rubbing interface so that, not only the surface is of optimized topography, but also is able to self-adjust its tribological behaviour according to the evolution of sliding conditions. In seeking inspirations for such designs, many engineers are turning toward the biological world to study the construction and behaviour of bio-analogues, and to probe the role surface topography assumes in conditioning of frictional response. That is how a bio-analogue can self-adjust its tribological response to adapt to habitat constraints. From a tribological point of view, Squamate Reptiles, offer diverse examples where surface texturing, submicron and nano-scale features, achieves frictional regulation. In this paper, we study the frictional response of shed skin obtained from a snake (Python regius). The study employed a specially designed tribo-acoustic probe capable of measuring the coefficient of friction and detecting the acoustical behavior of the skin in vivo. The results confirm the anisotropy of the frictional response of snakes. The coefficient of friction depends on the direction of sliding: the value in forward motion is lower than that in the backward direction. Diagonal and side winding motion induces a different value of the friction coefficient. We discuss the origin of such a phenomenon in relation to surface texturing and study the energy constraints, implied by anisotropic friction, on the motion of the reptile.

  2. Analysis of Individual Variations in Autonomic Responses to Urban and Forest Environments.

    Science.gov (United States)

    Kobayashi, Hiromitsu; Song, Chorong; Ikei, Harumi; Kagawa, Takahide; Miyazaki, Yoshifumi

    2015-01-01

    Autonomic responses to urban and forest environments were studied in 625 young male subjects. The experimental sites were 57 forests and 57 urban areas across Japan. The subjects viewed the landscape (forest or urban environment) for a period of 15 min while sitting on a chair. During this period, heart rate variability (HRV) was monitored continuously. The results were presented as histograms and analyzed with special reference to individual variations. Approximately 80% of the subjects showed an increase in the parasympathetic indicator of HRV (lnHF), whereas the remaining subjects showed a decrease in the parasympathetic activity. Similarly, 64.0% of the subjects exhibited decreases in the sympathetic indicator of HRV (ln[LF/HF]), whereas the remaining subjects showed opposite responses. Analysis of the distribution of HRV indices (lnHF and ln[LF/HF]) demonstrated the effect of forest environments on autonomic activity more specifically than the conventional analysis based on the difference in mean values.

  3. The association between anger-related personality trait and cardiac autonomic response abnormalities in elderly subjects.

    Science.gov (United States)

    Narita, Kosuke; Murata, Tetsuhito; Takahashi, Tetsuya; Hamada, Toshihiko; Kosaka, Hirotaka; Yoshida, Haruyoshi; Wada, Yuji

    2007-09-01

    Cardiac autonomic response abnormality associated with trait anger has been recognized to elevate blood pressure in daily life, leading to atherosclerotic progression and cardiovascular disease. To clarify the relationship between anger-related personality traits and cardiac autonomic response in healthy elderly subjects, 54 volunteers consisting of 30 male (mean age 62.2+/-5.4) and 24 female (mean age 58.4+/-4.6) subjects underwent testing of heart rate variability (HRV) with head-up tilt. For the evaluation of trait anger, we used a questionnaire corresponding to the trait anger score taken from the State and Trait Anger Expression Inventory. Furthermore, we measured carotid intima-medial thickness (IMT) to evaluate atherosclerotic progression in subjects with anger trait. In female subjects, higher trait anger was positively associated with elevated carotid IMT and the suppression of HRV vagal attenuation from the supine to head-up position, and negatively associated with the HRV sympathetic activity in the head-up position and also with the HRV sympathetic response from the supine to head-up position. In male subjects, trait anger was not significantly associated with carotid IMT or any HRV component with or without head-up tilt testing. We conclude that a simple noninvasive measure, short-term HRV with head-up tilt testing, could be a useful method to investigate the association between cardiac autonomic imbalance and increased risk of atherosclerosis associated with trait anger in healthy elderly subjects.

  4. How Can Music Influence the Autonomic Nervous System Response in Patients with Severe Disorder of Consciousness?

    Science.gov (United States)

    Riganello, Francesco; Cortese, Maria D; Arcuri, Francesco; Quintieri, Maria; Dolce, Giuliano

    2015-01-01

    Activations to pleasant and unpleasant musical stimuli were observed within an extensive neuronal network and different brain structures, as well as in the processing of the syntactic and semantic aspects of the music. Previous studies evidenced a correlation between autonomic activity and emotion evoked by music listening in patients with Disorders of Consciousness (DoC). In this study, we analyzed retrospectively the autonomic response to musical stimuli by mean of normalized units of Low Frequency (nuLF) and Sample Entropy (SampEn) of Heart Rate Variability (HRV) parameters, and their possible correlation to the different complexity of four musical samples (i.e., Mussorgsky, Tchaikovsky, Grieg, and Boccherini) in Healthy subjects and Vegetative State/Unresponsive Wakefulness Syndrome (VS/UWS) patients. The complexity of musical sample was based on Formal Complexity and General Dynamics parameters defined by Imberty's semiology studies. The results showed a significant difference between the two groups for SampEn during the listening of Mussorgsky's music and for nuLF during the listening of Boccherini and Mussorgsky's music. Moreover, the VS/UWS group showed a reduction of nuLF as well as SampEn comparing music of increasing Formal Complexity and General Dynamics. These results put in evidence how the internal structure of the music can change the autonomic response in patients with DoC. Further investigations are required to better comprehend how musical stimulation can modify the autonomic response in DoC patients, in order to administer the stimuli in a more effective way.

  5. How can music influence the Autonomic Nervous System response in patients with severe Disorder of Consciousness?

    Directory of Open Access Journals (Sweden)

    Francesco eRiganello

    2015-12-01

    Full Text Available Activations to pleasant and unpleasant musical stimuli were observed within an extensive neuronal network and different brain structures, as well as in the processing of the syntactic and semantic aspects of the music. Previous studies evidenced a correlation between autonomic activity and emotion evoked by music listening in patients with Disorders of Consciousness (DoC. In this study, we analyzed retrospectively the autonomic response to musical stimuli by mean of normalized units of Low Frequency (nuLF and Sample Entropy (SampEn of Heart Rate Variability (HRV parameters, and their possible correlation to the different complexity of four musical samples (i.e. Mussorgsky, Tchaikovsky, Grieg and Boccherini in Healthy subjects and Vegetative State/Unresponsive Wakefulness Syndrome (VS/UWS patients.The complexity of musical sample was based on Formal Complexity and General Dynamics parameters defined by Imberty’s semiology studies.The results showed a significant difference between the two groups for SampEn during the listening of Mussorgsky’s music and for nuLF during the listening of Boccherini and Mussorgsky’s music.Moreover, the VS/UWS group showed a reduction of nuLF as well as SampEn comparing music of increasing Formal Complexity and General Dynamics.These results put in evidence how the internal structure of the music can change the autonomic response in patients with DoC. Further investigations are required to better comprehend how musical stimulation can modify the autonomic response in DoC patients, in order to administer the stimuli in a more effective way.

  6. Autonomic neuropathy

    DEFF Research Database (Denmark)

    Hilsted, J

    1980-01-01

    In order to elucidate the physiological significance of autonomic neuropathy in juvenile diabetics, cardiovascular, hormonal and metabolic functions have been investigated in three groups of juvenile diabetics: One group had no signs of neuropathy, one group had presumably slight autonomic...... neuropathy (reduced beat-to-beat variation in heart rate during hyperventilation) and one group had clinically severe autonomic neuropathy, defined by presence of orthostatic hypotension. In all three experimental situations we found sympathetic dysfunction causing cardiovascular and/or hormonal...... maladjustments in patients with autonomic neuropathy. Regarding metabolic functions we found normal responses to graded exercise and insulin-induced hypoglycemia in patients with autonomic neuropathy in spite of blunted catecholamine responses, suggesting increased sensitivity of glycogen stores and adipose...

  7. Sympathetic skin response: a new test to diagnose erectile dysfunction

    Institute of Scientific and Technical Information of China (English)

    Guang-You ZHU; Yan SHEN

    2001-01-01

    Electrophysiological monitoring of the activity of the penile sympathetic skin responses (PSSR) in healthy men and patients with erectile dysfunction (ED). Methods: PSSR were recorded from the skin of penis with disk electrodes at the time of electric stimulation of left median nerves. Results: PSSR were recorded from all the healthy men and almost all the patients. In healthy men the latency of P0, the latency of N1, the duration of N1 and the amplitude of N1 were 1249 ± 111 ms, 2239 ± 286 ms, 1832 ± 505 ms and 470 μV (median), respectively. In ED patients the latency of P0, the latency of N1, the duration of N1 and the amplitude of N1 were 1467 ± 183 ms ( P < 0.01), 2561±453 ms (P <0.05), 2560±861 ms (P <0.01) and 91 μV (P <0.01), respectively. The normal latency of P0 was less than 1471 ms. The normal amplitude of N1 was more than 235 μV. According to this normal value, of 20 patients 11 showed longer latency of P0, and 14 showed lower amplitude of N1 as compared with those of normal subjects.Conclusion: PSSR can be used as an electrophysiological method in assisting the diagnosis of ED.

  8. Autonomic and muscular responses and recovery to one-hour laboratory mental stress in healthy subjects

    Directory of Open Access Journals (Sweden)

    Nilsen Kristian B

    2007-08-01

    Full Text Available Abstract Background Stress is a risk factor for musculoskeletal pain. We wanted to explore stress related physiology in healthy subjects in order to gain insight into mechanisms of pain development which may relate to the pathophysiology of musculoskeletal pain disorders. Methods Continuous blood pressure, heart rate, finger skin blood flow, respiration, surface electromyography together with perception of pain, fatigue and tension were recorded on 35 healthy women and 9 healthy men before, during a 60 minute period with task-related low-grade mental stress, and in the following 30 minute rest period. Results Subjects responded physiologically to the stressful task with an increase in trapezius and frontalis muscle activity, increased blood pressure, respiration frequency and heart rate together with reduced finger skin blood flow. The blood pressure response and the finger skin blood flow response did not recover to baseline values during the 30-minute rest period, whereas respiration frequency, heart rate, and surface electromyography of the trapezius and frontalis muscles recovered to baseline within 10 minutes after the stressful task. Sixty-eight percent responded subjectively with pain development and 64% reported at least 30% increase in pain. Reduced recovery of the blood pressure was weakly correlated to fatigue development during stress, but was not correlated to pain or tension. Conclusion Based on a lack of recovery of the blood pressure and the acral finger skin blood flow response to mental stress we conclude that these responses are more protracted than other physiological stress responses.

  9. Transfer function analysis of the autonomic response to respiratory activity during random interval breathing

    Science.gov (United States)

    Chen, M. H.; Berger, R. D.; Saul, J. P.; Stevenson, K.; Cohen, R. J.

    1987-01-01

    We report a new method for the noninvasive characterization of the frequency response of the autonomic nervous system (ANS) in mediating fluctuations in heart rate (HR). The approach entails computation of the transfer function magnitude and phase between instantaneous lung volume and HR. Broad band fluctuations in lung volume were initiated when subjects breathed on cue to a sequence of beeps spaced randomly in time. We studied 10 subjects in both supine and standing positions. The transfer function, averaged among all the subjects, showed systematic differences between the two postures, reflecting the differing frequency responses of the sympathetic and parasympathetic divisions of the ANS.

  10. Autonomic nervous system modulation affects the inflammatory immune response in mice with acute Chagas disease.

    Science.gov (United States)

    Machado, Marcus Paulo Ribeiro; Rocha, Aletheia Moraes; de Oliveira, Lucas Felipe; de Cuba, Marília Beatriz; de Oliveira Loss, Igor; Castellano, Lucio Roberto; Silva, Marcus Vinicius; Machado, Juliana Reis; Nascentes, Gabriel Antonio Nogueira; Paiva, Luciano Henrique; Savino, Wilson; Junior, Virmondes Rodrigues; Brum, Patricia Chakur; Prado, Vania Ferreira; Prado, Marco Antonio Maximo; Silva, Eliane Lages; Montano, Nicola; Ramirez, Luis Eduardo; Dias da Silva, Valdo Jose

    2012-11-01

    The aim of the present study was to evaluate the effects of changes to the autonomic nervous system in mice during the acute phase of Chagas disease, which is an infection caused by the parasite Trypanosoma cruzi. The following types of mice were inoculated with T. cruzi (CHG): wild-type (WT) and vesicular acetylcholine transporter knockdown (KDVAChT) C57BL/6j mice; wild-type non-treated (NT) FVB mice; FVB mice treated with pyridostigmine bromide (PYR) or salbutamol (SALB); and β(2)-adrenergic receptor knockout (KOβ2) FVB mice. During infection and at 18-21 days after infection (acute phase), the survival curves, parasitaemia, electrocardiograms, heart rate variability, autonomic tonus and histopathology of the animals were evaluated. Negative control groups were matched for age, genetic background and treatment. The KDVAChT-CHG mice exhibited a significant shift in the electrocardiographic, autonomic and histopathological profiles towards a greater inflammatory immune response that was associated with a reduction in blood and tissue parasitism. In contrast, the CHG-PYR mice manifested reduced myocardial inflammation and lower blood and tissue parasitism. Similar results were observed in CHG-SALB animals. Unexpectedly, the KOβ2-CHG mice exhibited less myocardial inflammation and higher blood and tissue parasitism, which were associated with reduced mortality. These findings could have been due to the increase in vagal tone observed in the KOβ2 mice, which rendered them more similar to the CHG-PYR animals. In conclusion, our results indicate a marked immunomodulatory role for the parasympathetic and sympathetic autonomic nervous systems, which inhibit both the inflammatory immune response and parasite clearance during the acute phase of experimental Chagas heart disease in mice.

  11. Diabetic autonomic neuropathy.

    Science.gov (United States)

    Freeman, Roy

    2014-01-01

    Diabetes mellitus is the commonest cause of an autonomic neuropathy in the developed world. Diabetic autonomic neuropathy causes a constellation of symptoms and signs affecting cardiovascular, urogenital, gastrointestinal, pupillomotor, thermoregulatory, and sudomotor systems. Several discrete syndromes associated with diabetes cause autonomic dysfunction. The most prevalent of these are: generalized diabetic autonomic neuropathy, autonomic neuropathy associated with the prediabetic state, treatment-induced painful and autonomic neuropathy, and transient hypoglycemia-associated autonomic neuropathy. These autonomic manifestations of diabetes are responsible for the most troublesome and disabling features of diabetic peripheral neuropathy and result in a significant proportion of the mortality and morbidity associated with the disease.

  12. Comparison of skin stripping, in vitro release, and skin blanching response methods to measure dose response and similarity of triamcinolone acetonide cream strengths from two manufactured sources.

    Science.gov (United States)

    Pershing, Lynn K; Bakhtian, Shahrzad; Poncelet, Craig E; Corlett, Judy L; Shah, Vinod P

    2002-05-01

    The collective studies compare in vitro drug release, in vivo skin stripping, and skin blanching response methods for dose responsiveness and bioequivalence assessment of triamcinolone acetonide cream products, as a function of application duration, drug concentration, and manufacturer source. Commercially available triamcinolone acetonide creams (0.025%, 0.1%, and 0.5%) from two manufacturers were evaluated in vitro for rate and extent of drug release across synthetic membranes and in vivo for rate, extent, and variability of drug uptake into human stratum corneum and skin blanching response in human forearm skin. Data demonstrate that increasing triamcinolone acetonide cream concentration applied increased the rate and extent of drug released in vitro as well as the extent of drug uptake and skin blanching response in human skin in vivo. No difference (p blanching response methods. Dermatopharmacokinetic analysis of triamcinonide acetonide in vivo is therefore dose responsive to drug concentration applied and application duration and agrees with in vivo skin blanching results. Data support the use of dermatopharmacokinetic methods for bioequivalence and bioavailability assessment of topical drug products.

  13. Cardiac autonomic responses at onset of exercise: effects of aerobic fitness.

    Science.gov (United States)

    D'Agosto, T; Peçanha, T; Bartels, R; Moreira, D N; Silva, L P; Nóbrega, A C L; Lima, J R P

    2014-09-01

    Analyzes of cardiac autonomic responses at the initial transient of exercise have been used for the investigation of the cardiovascular health. We evaluated the influence of aerobic fitness on HR and HRV responses at the onset of exercise. 25 male subjects (22.3±2.4 years) were divided into 2 groups: 'low aerobic fitness' (36.2±2.6ml.kg(-1).min(-1); n=10) and 'high aerobic fitness' (46.4±5.0ml.kg(-1).min(-1); n=15). The experimental session consisted of assessing the beat-to-beat HR at rest and during submaximal exercise. The autonomic responses at the onset of exercise were calculated by fitting the HR and HRV (rMSSD-index) curves during the initial 300s of exercise into a first-order exponential equation. The time constant of HR and of the rMSSD index (τonHR and τonrMSSD) were calculated for analysis. We observed lower values of τonrMSSD in the high aerobic fitness group compared to the low aerobic fitness group (26.8±5s vs. 38.0±18s, respectively; p=0.02). The τonHR (42.0±15 vs. 49.3±26s, p=0.38) for the groups showed no difference. Aerobic fitness partially influenced the autonomic responses during exercise, since individuals with higher fitness showed faster decreases in beat-to-beat HRV at the onset of exercise.

  14. A Review of Cardiac Autonomic Measures: Considerations for Examination of Physiological Response in Children with Autism Spectrum Disorder

    Science.gov (United States)

    Benevides, Teal W.; Lane, Shelly J.

    2015-01-01

    The autonomic nervous system (ANS) is responsible for multiple physiological responses, and dysfunction of this system is often hypothesized as contributing to cognitive, affective, and behavioral responses in children. Research suggests that examination of ANS activity may provide insight into behavioral dysregulation in children with autism…

  15. Prediction of nuclear submariner adaptability from autonomic indices and Rorschach Inkblot responses. Interim report

    Energy Technology Data Exchange (ETDEWEB)

    Weybrew, B.B.; Molish, H.B.

    1986-09-09

    To identify the most valid predictors of submariner adaptability, the authors derived 23 indices from the responses of 170 nuclear submariners to the Rorschach Inkblot Test, 11 measures of Autonomic Nervous System (ANS) reactivity to contrived stress, and five adjustment criteria. Factor analysis of this 39x39 correlation matrix yielded two Rorschach Factors, one of which correlated with three criterion dimensions. Two unique factors were also discovered, one, a structured ANS factor, and the other, a complex criterion scale. Selected Rorschach scores and, to a lesser extent, certain ANS indices emanating from this study, may be usefully-valid predictors of the adaptability of nuclear submariners during long patrols.

  16. Appreciating the image of God in all humanity: Towards a pastoral response to skin lightening as image enhancement to exit dark skin

    Directory of Open Access Journals (Sweden)

    Noah K. Tenai

    2016-03-01

    Full Text Available The practice of skin lightening is prevalent amongst dark-skinned people globally. Various current studies that map this practice and that seek motivations behind the practice are examined. It is observed that through shrewd marketing, dark-skinned people are offered a promise of a better quality of life, obtained by a lighter skin, through the use of skin lighteners. In spite of the severe health risks involved, the promise is ostensibly irresistible to some dark-skinned persons. A pastoral response is offered that affirms the full personhood and complete humanity of dark-skinned people as fully human and whole in their dark skins.Keywords: Skin lightening, Dark skin, Image of God

  17. Dose-response relationships and threshold levels in skin and respiratory allergy

    NARCIS (Netherlands)

    Arts, J.H.E.; Mommers, C.; Heer, C.de

    2006-01-01

    A literature study was performed to evaluate dose-response relationships and no-effect levels for sensitization and elicitation in skin- and respiratory allergy. With respect to the skin, dose-response relationships and no-effect levels were found for both intradermal and topical induction, as well

  18. Response of cardiac autonomic modulation after a single exposure to musical auditory stimulation

    Directory of Open Access Journals (Sweden)

    Lucas L Ferreira

    2015-01-01

    Full Text Available The acute effects after exposure to different styles of music on cardiac autonomic modulation assessed through heart rate variability (HRV analysis have not yet been well elucidated. We aimed to investigate the recovery response of cardiac autonomic modulation in women after exposure to musical auditory stimulation of different styles. The study was conducted on 30 healthy women aged between 18 years and 30 years. We did not include subjects having previous experience with musical instruments and those who had an affinity for music styles. The volunteers remained at rest for 10 min and were exposed to classical baroque (64-84 dB and heavy metal (75-84 dB music for 10 min, and their HRV was evaluated for 30 min after music cessation. We analyzed the following HRV indices: Standard deviation of normal-to-normal (SDNN intervals, root mean square of successive differences (RMSSD, percentage of normal-to-normal 50 (pNN50, low frequency (LF, high frequency (HF, and LF/HF ratio. SDNN, LF in absolute units (ms 2 and normalized (nu, and LF/HF ratio increased while HF index (nu decreased after exposure to classical baroque music. Regarding the heavy metal music style, it was observed that there were increases in SDNN, RMSSD, pNN50, and LF (ms 2 after the musical stimulation. In conclusion, the recovery response of cardiac autonomic modulation after exposure to auditory stimulation with music featured an increased global activity of both systems for the two musical styles, with a cardiac sympathetic modulation for classical baroque music and a cardiac vagal tone for the heavy metal style.

  19. Response of cardiac autonomic modulation after a single exposure to musical auditory stimulation.

    Science.gov (United States)

    Ferreira, Lucas L; Vanderlei, Luiz Carlos M; Guida, Heraldo L; de Abreu, Luiz Carlos; Garner, David M; Vanderlei, Franciele M; Ferreira, Celso; Valenti, Vitor E

    2015-01-01

    The acute effects after exposure to different styles of music on cardiac autonomic modulation assessed through heart rate variability (HRV) analysis have not yet been well elucidated. We aimed to investigate the recovery response of cardiac autonomic modulation in women after exposure to musical auditory stimulation of different styles. The study was conducted on 30 healthy women aged between 18 years and 30 years. We did not include subjects having previous experience with musical instruments and those who had an affinity for music styles. The volunteers remained at rest for 10 min and were exposed to classical baroque (64-84 dB) and heavy metal (75-84 dB) music for 10 min, and their HRV was evaluated for 30 min after music cessation. We analyzed the following HRV indices: Standard deviation of normal-to-normal (SDNN) intervals, root mean square of successive differences (RMSSD), percentage of normal-to-normal 50 (pNN50), low frequency (LF), high frequency (HF), and LF/HF ratio. SDNN, LF in absolute units (ms 2 ) and normalized (nu), and LF/HF ratio increased while HF index (nu) decreased after exposure to classical baroque music. Regarding the heavy metal music style, it was observed that there were increases in SDNN, RMSSD, pNN50, and LF (ms 2 ) after the musical stimulation. In conclusion, the recovery response of cardiac autonomic modulation after exposure to auditory stimulation with music featured an increased global activity of both systems for the two musical styles, with a cardiac sympathetic modulation for classical baroque music and a cardiac vagal tone for the heavy metal style.

  20. Skin thermal response to sapphire contact and cryogen spray cooling: a comparative study based on measurements in a skin phantom

    Science.gov (United States)

    Torres, Jorge H.; Nelson, J. Stuart; Tanenbaum, B. S.; Anvari, Bahman

    2000-05-01

    Non-specific thermal injury to the epidermis may occur as a result of laser treatment of cutaneous hypervascular malformations (e.g. port wine stains) and other dermatoses. Methods to protect the epidermis from thermal injury include sapphire contact cooling (SCC) and cryogen spray cooling (CSC). Evaluation of the skin thermal response to either cooling method and better understanding of the heat transfer process at the skin surface are essential for further optimization of cooling technique during laser therapy. We present internal temperature measurements in an epoxy resin phantom in response to both SCC and CSC, and use the results in conjunction with a mathematical model to predict the temperature distributions within human skin. Based on our results, a conductive heat transfer process at the skin interface appears to be the primary mechanism for both SCC and CSC. In the case of CSC, 'film cooling' rather than 'evaporative cooling' seems to be the dominant mode during the spurt duration. Currently, due to the lower temperature of the cryogen film and its shorter time of application, CSC produces larger temperature reductions at the skin surface and smaller temperature reductions at depths greater than 200 micrometer (i.e., higher spatial selectivity) when compared to SCC. However, SCC can potentially induce temperature reductions comparable to those produced by CSC if a sapphire temperature similar to that for a cryogen could be achieved in practice.

  1. Effects of active recovery on autonomic and haemodynamic responses after aerobic exercise.

    Science.gov (United States)

    Soares, Antonio H G; Oliveira, Tiago P; Cavalcante, Bruno R; Farah, Breno Q; Lima, Aluísio H R A; Cucato, Gabriel G; Cardoso, Crivaldo G; Ritti-Dias, Raphael M

    2017-01-01

    The aim of this study was to examine the effect of active recovery on autonomic and haemodynamic responses after exercise in healthy adults. Nineteen healthy young male individuals underwent two experimental sessions: exercise with active recovery (AR) and exercise with passive recovery (PR). The exercise sessions comprised three phases: warm-up (5 min), exercise phase (cycle ergometer, 30 min, intensity between 60 and 70% of the heart rate reserve) and recovery (5 min). In the AR, the subjects remained cycling in the recovery phase at intensity between 30% and 35% of heart rate reserve, while in the PR, the subjects stopped the exercise after finishing the exercise phase. Blood pressure and heart rate were measured before and over the 30 min after the interventions. There were no differences for systolic and diastolic blood pressures, heart rate and rate pressure product between active and passive recovery sessions. Also, all heart rate variability parameters changed similarly after exercise with passive or active recovery sessions. In summary, exercise with active recovery does not affect the autonomic and haemodynamic responses after moderate-intensity aerobic exercise in healthy young male individuals.

  2. Sinoatrial tissue of crucian carp heart has only negative contractile responses to autonomic agonists

    Directory of Open Access Journals (Sweden)

    Hälinen Mervi

    2010-06-01

    Full Text Available Abstract Background In the anoxia-tolerant crucian carp (Carassius carassius cardiac activity varies according to the seasons. To clarify the role of autonomic nervous control in modulation of cardiac activity, responses of atrial contraction and heart rate (HR to carbacholine (CCh and isoprenaline (Iso were determined in fish acclimatized to winter (4°C, cold-acclimated, CA and summer (18°C, warm-acclimated, WA temperatures. Results Inhibitory action of CCh was much stronger on atrial contractility than HR. CCh reduced force of atrial contraction at an order of magnitude lower concentrations (EC50 2.75-3.5·10-8 M in comparison to its depressive effect on HR (EC50 1.23-2.02·10-7 M (P -8 M and 10-7 M CCh, respectively (P + current, IK,CCh, with an EC50 value of 3-4.5·10-7 M and inhibited Ca2+ current (ICa by 28 ± 8% and 51 ± 6% at 10-7 M and 10-6 M, respectively. These currents can explain the shortening of AP. Iso did not elicit any responses in crucian carp sinoatrial preparations nor did it have any effect on atrial ICa, probably due to the saturation of the β-adrenergic cascade in the basal state. Conclusion In the crucian carp, HR and force of atrial contraction show cardio-depressive responses to the cholinergic agonist, but do not have any responses to the β-adrenergic agonist. The scope of inhibitory regulation by CCh is increased by the high basal tone of the adenylate cyclase-cAMP cascade. Higher concentrations of CCh were required to induce IK,CCh and inhibit ICa than was needed for CCh's negative inotropic effect on atrial muscle suggesting that neither IK,CCh nor ICa alone can mediate CCh's actions but they might synergistically reduce AP duration and atrial force production. Autonomic responses were similar in CA winter fish and WA summer fish indicating that cardiac sensitivity to external modulation by the autonomic nervous system is not involved in seasonal acclimatization of the crucian carp heart to cold and anoxic

  3. Emotional Responses to Odors in Children with High-Functioning Autism: Autonomic Arousal, Facial Behavior and Self-Report

    Science.gov (United States)

    Legisa, Jasna; Messinger, Daniel S.; Kermol, Enzo; Marlier, Luc

    2013-01-01

    Although emotional functioning is impaired in children with autism, it is unclear if this impairment is due to difficulties with facial expression, autonomic responsiveness, or the verbal description of emotional states. To shed light on this issue, we examined responses to pleasant and unpleasant odors in eight children (8-14 years) with…

  4. Skin barrier response to occlusion of healthy and irritated skin: Differences in trans-epidermal water loss, erythema and stratum corneum lipids

    DEFF Research Database (Denmark)

    Jungersted, J.M.; Høgh, Julie Kaae; Hellgren, Lars

    2010-01-01

    been damaged by either sodium lauryl sulfate (SLS) or tape stripping, respectively, was determined and compared with that of to non-occluded pre-damaged skin. Skin barrier function was assessed by measurements of trans-epidermal water loss (TEWL) and erythema. In study A, stratum corneum lipids were...... analysed. Results: Occlusion of healthy skin did not significantly influence skin barrier function, ceramide profile or the ceramide/cholesterol ratio. Occlusion of the skin after SLS irritation resulted in higher TEWL than in the control (P = 0.049). Occlusion of the skin after tape stripping resulted......Background: Occlusion of the skin is a risk factor for development of irritant contact dermatitis. Occlusion may, however, have a positive effect on skin healing. No consensus on the effect of occlusion has been reached. Objectives: To investigate skin barrier response to occlusion on intact...

  5. Distribution of T Cells in Rainbow Trout (Oncorhynchus mykiss) Skin and Responsiveness to Viral Infection

    Science.gov (United States)

    Leal, Esther; Granja, Aitor G.; Zarza, Carlos; Tafalla, Carolina

    2016-01-01

    Although the skin constitutes the first line of defense against waterborne pathogens, there is a great lack of information regarding the skin associated lymphoid tissue (SALT) and whether immune components of the skin are homogeneously distributed through the surface of the fish is still unknown. In the current work, we have analyzed the transcription of several immune genes throughout different rainbow trout (Oncorhynchus mykiss) skin areas. We found that immunoglobulin and chemokine gene transcription levels were higher in a skin area close to the gills. Furthermore, this skin area as well as other anterior sections also transcribed significantly higher levels of many different immune genes related to T cell immunity such as T cell receptor α (TCRα), TCRγ, CD3, CD4, CD8, perforin, GATA3, Tbet, FoxP3, interferon γ (IFNγ), CD40L and Eomes in comparison to posterior skin sections. In agreement with these results, immunohistochemical analysis revealed that anterior skin areas had a higher concentration of CD3+ T cells and flow cytometry analysis confirmed that the percentage of CD8+ T lymphocytes was also higher in anterior skin sections. These results demonstrate for the first time that T cells are not homogeneously distributed throughout the teleost skin. Additionally, we studied the transcriptional regulation of these and additional T cell markers in response to a bath infection with viral hemorrhagic septicemia virus (VHSV). We found that VHSV regulated the transcription of several of these T cell markers in both the skin and the spleen; with some differences between anterior and posterior skin sections. Altogether, our results point to skin T cells as major players of teleost skin immunity in response to waterborne viral infections. PMID:26808410

  6. Autonomous Sensory Meridian Response (ASMR: a flow-like mental state

    Directory of Open Access Journals (Sweden)

    Emma L. Barratt

    2015-03-01

    Full Text Available Autonomous Sensory Meridian Response (ASMR is a previously unstudied sensory phenomenon, in which individuals experience a tingling, static-like sensation across the scalp, back of the neck and at times further areas in response to specific triggering audio and visual stimuli. This sensation is widely reported to be accompanied by feelings of relaxation and well-being. The current study identifies several common triggers used to achieve ASMR, including whispering, personal attention, crisp sounds and slow movements. Data obtained also illustrates temporary improvements in symptoms of depression and chronic pain in those who engage in ASMR. A high prevalence of synaesthesia (5.9% within the sample suggests a possible link between ASMR and synaesthesia, similar to that of misophonia. Links between number of effective triggers and heightened flow state suggest that flow may be necessary to achieve sensations associated with ASMR.

  7. Autonomous Sensory Meridian Response (ASMR): a flow-like mental state.

    Science.gov (United States)

    Barratt, Emma L; Davis, Nick J

    2015-01-01

    Autonomous Sensory Meridian Response (ASMR) is a previously unstudied sensory phenomenon, in which individuals experience a tingling, static-like sensation across the scalp, back of the neck and at times further areas in response to specific triggering audio and visual stimuli. This sensation is widely reported to be accompanied by feelings of relaxation and well-being. The current study identifies several common triggers used to achieve ASMR, including whispering, personal attention, crisp sounds and slow movements. Data obtained also illustrates temporary improvements in symptoms of depression and chronic pain in those who engage in ASMR. A high prevalence of synaesthesia (5.9%) within the sample suggests a possible link between ASMR and synaesthesia, similar to that of misophonia. Links between number of effective triggers and heightened flow state suggest that flow may be necessary to achieve sensations associated with ASMR.

  8. Modifications of Control Loop to Improve the Depth Response of Autonomous Underwater Vehicles

    Directory of Open Access Journals (Sweden)

    Sheng-Ping Hsu

    2014-01-01

    Full Text Available During a constant depth maneuver of an autonomous underwater vehicle (AUV, its pitch attitude and stern plane deflections create forces and moments to achieve equilibrium in the vertical plane. If an AUV has a proportional controller only in its depth control loop, then different weights or centers of gravity will cause different steady-state depth errors at trimmed conditions. In general, a steady-state depth error can be eliminated by adding an integral controller in the depth control loop. However, an improper integrator may lead to a bad transient response, even though the steady-state depth error can finally be eliminated. To remove the steady-state depth error, this study proposes methods that adjust the depth command and add a switching integral controller in the depth control loop. Simulation results demonstrate that the steady-state depth error can be eliminated and the transient response can be improved.

  9. Pain-related emotions modulate experimental pain perception and autonomic responses.

    Science.gov (United States)

    Rainville, Pierre; Bao, Quoc Viet Huynh; Chrétien, Pablo

    2005-12-05

    The effect of emotions on pain perception is generally recognized but the underlying mechanisms remain unclear. Here, emotions related to pain were induced in healthy volunteers using hypnosis, during 1-min immersions of the hand in painfully hot water. In Experiment 1, hypnotic suggestions were designed to induce various positive or negative emotions. Compared to a control condition with hypnotic-relaxation, negative emotions produced robust increases in pain. In Experiment 2, induction of pain-related anger and sadness were found to increase pain. Pain increases were associated with increases in self-rated desire for relief and decreases in expectation of relief, and with increases in arousal, negative affective valence and decreases in perceived control. In Experiment 3, hypnotic suggestions specifically designed to increase and decrease the desire for relief produced increases and decreases in pain, respectively. In all three experiments, emotion-induced changes in pain were most consistently found on ratings of pain unpleasantness compared to pain intensity. Changes in pain-evoked cardiac responses (R-R interval decrease), measured in experiments 2 and 3, were consistent with changes in pain unpleasantness. Correlation and multiple regression analyses suggest that negative emotions and desire for relief influence primarily pain affect and that pain-evoked autonomic responses are strongly associated with pain affect. These results confirm the hypothesized influence of the desire for relief on pain perception, and particularly on pain affect, and support the functional relation between pain affect and autonomic nociceptive responses. This study provides further experimental confirmation that pain-related emotions influence pain perception and pain-related physiological responses.

  10. The coordinated Response of the Physical and Antimicrobial Peptide Barriers of the Skin

    Science.gov (United States)

    Borkowski, Andrew W.; Gallo, Richard L.

    2011-01-01

    Antimicrobial peptides (AMPs) are an essential and multifunctional element for immune defense of the skin during infection and injury. In this issue, Ahrens et al. characterize the response of β-defensins, a class of AMPs, following acute and chronic challenges to the permeability barrier of the skin. Their findings suggest that the antimicrobial and permeability barriers of the skin are closely linked. PMID:21228809

  11. Comparative Autonomic Responses to Diagnostic Interviewing between Individuals with GAD, MDD, SAD and Healthy Controls

    Science.gov (United States)

    Diamond, Allison E.; Fisher, Aaron J.

    2017-01-01

    .01) compared to healthy controls. Worry itself was found to be a more significant predictor of both decreased PEP (p = 0.02) and increased HR (p = 0.05). Suppression exhibited a dampening effect on individuals with worry and GAD, whereby those who suppressed had dampened HR responsiveness compared to those who did not suppress. These findings are consistent with existing literature supporting a decreased autonomic flexibility in certain psychological disorders, as well as indicate distinct physiological differences across certain transdiagnostic features of mood and anxiety disorders. PMID:28123361

  12. An analysis of the responses of rat striatal neurones to scrotal skin temperature.

    Science.gov (United States)

    Taylor, D C; Steele, J E; Gayton, R J

    1987-09-01

    The responses of neurones in the caudate-putamen complex of anaesthetised rats to different scrotal skin temperatures were examined, together with the electroencephalogram (EEG). Caudate neuronal firing patterns did not change independently of rate, unlike the thermo-responsive cells of the hypothalamus previously reported. The scrotal skin temperature threshold for the caudate neuronal response corresponds precisely with the temperature which provokes desynchronisation of the EEG.

  13. Skin Blood Perfusion and Cellular Response to Insertion of Insulin Pen Needles With Different Diameters

    DEFF Research Database (Denmark)

    Præstmark, Kezia Ann; Stallknecht, Bente Merete; Bo Jensen, Casper;

    2014-01-01

    Today most research on pen needle design revolves around pain perception statements through clinical trials, but these are both costly, timely, and require high sample sizes. The purpose of this study was to test if tissue damage, caused by different types of needles, can be assessed by evaluating...... skin blood perfusion response around needle insertion sites. Three common sized pen needles of 28G, 30G, and 32G as well as hooked 32G needles, were inserted into the neck skin of pigs and then removed. Laser Speckle Contrast Analysis was used to measure skin blood perfusion for 20 minutes after......, but there was a trend of an increased response with increasing needle diameter. Skin blood perfusion response to pen needle insertions rank according to needle diameter, and the tissue response caused by hooked 32G needles corresponds to that of 28G needles. The relation between needle diameter and trauma when...

  14. Coordination of cortisol response to social evaluative threat with autonomic and inflammatory responses is moderated by stress appraisals and affect.

    Science.gov (United States)

    Laurent, Heidemarie K; Lucas, Todd; Pierce, Jennifer; Goetz, Stefan; Granger, Douglas A

    2016-07-01

    Recent approaches to stress regulation have emphasized coordination among multiple biological systems. This study builds on evidence that hypothalamic-pituitary-adrenal (HPA) axis activity should be considered in coordination with other stress-sensitive biological systems to characterize healthy responses. Healthy African-Americans (n=115) completed the Trier Social Stress Test, and biological responses were assessed through salivary cortisol, dehydroepiandrosterone-sulfate (DHEA-S), alpha amylase (sAA), and C-reactive protein (sCRP). Multilevel modeling demonstrated that cortisol responses typically aligned with changes in DHEA-S, sAA, and sCRP across the session. At the same time, the degree of cortisol coordination with sAA and sCRP varied by participants' subjective stress following the task; participants with higher secondary stress appraisals showed greater cortisol-sAA alignment, whereas those experiencing more negative affect showed greater cortisol-sCRP alignment. Results highlight the importance of a multisystem approach to stress and suggest that positive HPA axis coordination with the autonomic response, but not with the immune/inflammatory response, may be adaptive.

  15. The impact of emotion-related autonomic nervous system responsiveness on pain sensitivity in female patients with fibromyalgia

    NARCIS (Netherlands)

    Middendorp, H. van; Lumley, M.A.; Houtveen, J.H.; Jacobs, J.W.G.; Bijlsma, J.W.J.; Geenen, R.

    2013-01-01

    OBJECTIVE: Patients with fibromyalgia have shown hyporeactive autonomic nervous system (ANS) responses to physical stressors, augmented pain to ANS changes, and heightened negative emotions, which can increase pain. This study examined ANS reactivity to negative emotions and its association with pai

  16. Acupuncture Affects Autonomic and Endocrine but Not Behavioural Responses Induced by Startle in Horses

    Directory of Open Access Journals (Sweden)

    Julia Dias Villas-Boas

    2015-01-01

    Full Text Available Startle is a fast response elicited by sudden acoustic, tactile, or visual stimuli in a variety of animals and in humans. As the magnitude of startle response can be modulated by external and internal variables, it can be a useful tool to study reaction to stress. Our study evaluated whether acupuncture can change cardiac autonomic modulation (heart rate variability; and behavioural (reactivity and endocrine (cortisol levels parameters in response to startle. Brazilian Sport horses (n=6 were subjected to a model of startle in which an umbrella was abruptly opened near the horse. Before startle, the horses were subjected to a 20-minute session of acupuncture in acupoints GV1, HT7, GV20, and BL52 (ACUP and in nonpoints (NP or left undisturbed (CTL. For analysis of the heart rate variability, ultrashort-term (64 s heart rate series were interpolated (4 Hz and divided into 256-point segments and the spectra integrated into low (LF; 0.01–0.07 Hz; index of sympathetic modulation and high (HF; 0.07–0.50 Hz; index of parasympathetic modulation frequency bands. Acupuncture (ACUP changed the sympathovagal balance with a shift towards parasympathetic modulation, reducing the prompt startle-induced increase in LF/HF and reducing cortisol levels 30 min after startle. However, acupuncture elicited no changes in behavioural parameters.

  17. Cardiac autonomic responses during upper versus lower limb resistance exercise in healthy elderly men

    Directory of Open Access Journals (Sweden)

    Heloisa G. Machado-Vidotti

    2014-01-01

    Full Text Available Objective: To investigate the cardiac autonomic responses during upper versus lower limb discontinuous resistance exercise (RE at different loads in healthy older men. Method: Ten volunteers (65±1.2 years underwent the one-repetition maximum (1RM test to determine the maximum load for the bench press and the leg press. Discontinuous RE was initiated at a load of 10%1RM with subsequent increases of 10% until 30%1RM, followed by increases of 5%1RM until exhaustion. Heart rate (HR and R-R interval were recorded at rest and for 4 minutes at each load applied. Heart rate variability (HRV was analyzed in 5-min segments at rest and at each load in the most stable 2-min signal. Results: Parasympathetic indices decreased significantly in both exercises from 30%1RM compared to rest (rMSSD: 20±2 to 11±3 and 29±5 to 12±2 ms; SD1: 15±2 to 8±1 and 23±4 to 7±1 ms, for upper and lower limb exercise respectively and HR increased (69±4 to 90±4 bpm for upper and 66±2 to 89±1 bpm for lower. RMSM increased for upper limb exercise, but decreased for lower limb exercise (28±3 to 45±9 and 34±5 to 14±3 ms, respectively. In the frequency domain, the sympathetic (LF and sympathovagal balance (LF/HF indices were higher and the parasympathetic index (HF was lower for upper limb exercise than for lower limb exercise from 35% of 1RM. Conclusions: Cardiac autonomic change occurred from 30% of 1RM regardless of RE limb. However, there was more pronounced sympathetic increase and vagal decrease for upper limb exercise than for lower limb exercise. These results provide a basis for more effective prescription of RE to promote health in this population.

  18. The use of infrared thermography to detect the skin temperature response to physical activity

    Science.gov (United States)

    Tanda, G.

    2015-11-01

    Physical activity has a noticeable effect on skin blood flow and temperature. The thermal regulatory and hemodynamic processes during physical activity are controlled by two conflicting mechanisms: the skin vasoconstriction induced by the blood flow demand to active muscles and the skin vasodilation required by thermoregulation to increase warm blood flow and heat conduction to the skin. The time-evolution of skin temperature during exercise can give useful information about the adaptation of the subject as a function of specific type, intensity and duration of exercise. In this paper, infrared thermography is used to investigate the thermal response of skin temperature during running exercise on treadmill for a group of seven healthy and trained runners. Two different treadmill exercises are considered: a graded load exercise and a constant load exercise; for both exercises the duration was 30 minutes. Within the limits due to the relatively small size of the sample group, results typically indicate a fall in skin temperature during the initial stage of running exercise. As the exercise progresses, the dynamics of the skin temperature response depends on the type of exercise (graded versus constant load) and probably on the level of training of the subject.

  19. Impaired Memory Retrieval Correlates with Individual Differences in Cortisol Response but Not Autonomic Response

    Science.gov (United States)

    Tranel, Daniel; Adolphs, Ralph; Buchanan, Tony W.

    2006-01-01

    Stress can enhance or impair memory performance. Both cortisol release and sympathetic nervous system responses have been implicated in these differential effects. Here we investigated how memory retrieval might be affected by stress-induced cortisol release, independently of sympathetic nervous system stress responses. Thirty-two healthy…

  20. Autonomic Function Predicts Fitness Response to Short-Term High-Intensity Interval Training.

    Science.gov (United States)

    Kiviniemi, A M; Tulppo, M P; Eskelinen, J J; Savolainen, A M; Kapanen, J; Heinonen, I H A; Hautala, A J; Hannukainen, J C; Kalliokoski, K K

    2015-11-01

    We tested the hypothesis that baseline cardiac autonomic function and its acute response to all-out interval exercise explains individual fitness responses to high-intensity interval training (HIT). Healthy middle-aged sedentary men performed HIT (n=12, 4-6×30 s of all-out cycling efforts with 4-min recovery) or aerobic training (AET, n=9, 40-60 min at 60% of peak workload in exercise test [Loadpeak]), comprising 6 sessions within 2 weeks. Low (LF) and high frequency (HF) power of R-R interval oscillation were analyzed from data recorded at supine and standing position (5+5 min) every morning during the intervention. A significant training effect (ptraining*group interaction, was observed in Loadpeak and peak oxygen consumption (VO2peak). Pre-training supine LF/HF ratio, an estimate of sympathovagal balance, correlated with training outcome in Loadpeak (Spearman's rho [rs]=-0.74, p=0.006) and VO2peak (rs=- 0.59, p=0.042) in the HIT but not the AET group. Also, the mean change in the standing LF/HF ratio in the morning after an acute HIT exercise during the 1(st) week of intervention correlated with training response in Loadpeak (rs=- 0.68, p=0.014) and VO2peak (rs=-0.60, p=0.039) with HIT but not with AET. In conclusion, pre-training cardiac sympathovagal balance and its initial alterations in response to acute HIT exercise were related to fitness responses to short-term HIT.

  1. Differences in thermal optical response between intact diabetic and nondiabetic human skin

    Science.gov (United States)

    Yeh, Shu-Jen; Hanna, Charles F.; Kantor, Stan; Hohs, Ronald; Khalil, Omar S.

    2003-07-01

    We observed a difference in the thermal response of localized reflectance signal of human skin between type-2 diabetic and non-diabetic volunteers. We investigated the use of this thermo-optical behavior as a basis for a non-invasive method for the determination of the diabetic status of a subject. We used a two-site temperature differential method, which is predicated upon the measurement of localized reflectance from two areas on the surface of the skin, each of these areas is subjected to a different thermal perturbation. The response of skin localized reflectance to temperature was measured and used in a classification algorithm. We used a discriminant function to classify subjects as diabetics or non-diabetics. In a prediction set of 24 non-invasive tests collected from 6 diabetics and 6 non-diabetics, the sensitivity ranged between 73% and 100%, and the specificity ranged between 75% and 100%, depending on the thermal conditions and probe-skin contact time. The difference in thermo-optical response of the skin of the two groups may be explained in terms of difference in response of cutaneous microcirculation to temperature, which is manifested as a difference in the near infrared light absorption and scattering. Another factor is the difference in the temperature response of the scattering coefficient between the two groups, which may be caused by cutaneous structural differences induced by non-enzymatic glycation of skin protein fibers, and/or by the difference in blood cell aggregation.

  2. Impaired memory retrieval correlates with individual differences in cortisol response but not autonomic response

    OpenAIRE

    Buchanan, Tony W.; Tranel, Daniel; Adolphs, Ralph

    2006-01-01

    Stress can enhance or impair memory performance. Both cortisol release and sympathetic nervous system responses have been implicated in these differential effects. Here we investigated how memory retrieval might be affected by stress-induced cortisol release, independently of sympathetic nervous system stress responses. Thirty-two healthy participants (16 women) learned emotionally arousing and neutral words. One hour later, half of the participants underwent a stressor (cold pressor test) an...

  3. An Examination of Personality Traits Associated with Autonomous Sensory Meridian Response (ASMR)

    Science.gov (United States)

    Fredborg, Beverley; Clark, Jim; Smith, Stephen D.

    2017-01-01

    Autonomous Sensory Meridian Response (ASMR) is a perceptual condition in which the presentation of particular audio-visual stimuli triggers intense, pleasurable tingling sensations in the head and neck regions, which may spread to the periphery of the body. These triggering stimuli are often socially intimate in nature, and usually involve repetition of movements and/or sounds (e.g., hearing whispering, watching someone brush her hair). Reports of ASMR experiences first appeared in online communities in 2010; since this time, these communities have expanded, with some groups consisting of over 100,000 members. However, despite the apparent prevalence of ASMR, there is currently no research on the personality characteristics that co-occur with this condition. In the current study, 290 individuals with ASMR and 290 matched controls completed the Big Five Personality Inventory (BFI; John et al., 1991); participants with ASMR also completed a questionnaire related to their ASMR phenomenology. Individuals with ASMR demonstrated significantly higher scores on Openness-to-Experience and Neuroticism, and significantly lower levels of Conscientiousness, Extraversion, and Agreeableness compared to matched controls. Further, ratings of subjective ASMR intensity in response to 14 common ASMR stimuli were positively correlated with the Openness-to-Experience and Neuroticism dimensions of the BFI. These results provide preliminary evidence that ASMR is associated with specific personality traits and suggest avenues for further investigation. PMID:28280478

  4. Biological response modifiers and their potential use in the treatment of inflammatory skin diseases

    DEFF Research Database (Denmark)

    Villadsen, Louise S; Skov, Lone; Baadsgaard, Ole

    2003-01-01

    and fewer side-effects than the current systemic therapies now used for severe psoriasis, contact dermatitis and atopic dermatitis. In the pathogenesis of inflammatory skin diseases, the immune system plays a pivotal role, and this is where biological response modifiers such as monoclonal antibodies......In recent years, a more detailed understanding of the pathogenesis of several inflammatory skin diseases, combined with the developments within biotechnology, has made it possible to design more selective response modifiers. Biological response modifiers hold the potential for greater effectiveness......, recombinant cytokines, or fusion proteins may be effective. Several biological response modifiers have already shown positive results in phase II/III clinical trials in skin diseases, and many new biological response modifiers are in progress....

  5. Cardiac autonomic response following high-intensity running work-to-rest interval manipulation.

    Science.gov (United States)

    Cipryan, Lukas; Laursen, Paul B; Plews, Daniel J

    2016-10-01

    The cardiorespiratory, cardiac autonomic (via heart rate variability (HRV)) and plasma volume responses to varying sequences of high-intensity interval training (HIT) of consistent external work were investigated. Twelve moderately trained males underwent three HIT bouts and one control session. The HIT trials consisted of warm-up, followed by 12 min of 15 s, 30 s or 60 s work:relief HIT sequences at an exercise intensity of 100% of the individual velocity at [Formula: see text]O2max (v[Formula: see text]O2max), interspersed by relief intervals at 60% [Formula: see text]O2max (work/relief ratio = 1). HRV was evaluated via the square root of the mean sum of the squared differences between R-R intervals (rMSSD) before, 1 h, 3 h and 24 h after the exercise. Plasma volume was assessed before, immediately after, and 3 h and 24 h after. There were no substantial between-trial differences in acute cardiorespiratory responses. The rMSSD values remained decreased 1 h after the exercise cessation in all exercise groups. The rMSSD subsequently increased between 1 h and 3 h after exercise, with the most pronounced change in the 15/15 group. There were no relationships between HRV and plasma volume. All HIT protocols resulted in similar cardiorespiratory responses with slightly varying post-exercise HRV responses, with the 30/30 protocol eliciting the least disruption to post-exercise HRV. These post-exercise HRV findings suggest that the 30/30 sequence may be the preferable HIT prescription when the between-training period is limited.

  6. The effect of surface wave propagation on neural responses to vibration in primate glabrous skin.

    Science.gov (United States)

    Manfredi, Louise R; Baker, Andrew T; Elias, Damian O; Dammann, John F; Zielinski, Mark C; Polashock, Vicky S; Bensmaia, Sliman J

    2012-01-01

    Because tactile perception relies on the response of large populations of receptors distributed across the skin, we seek to characterize how a mechanical deformation of the skin at one location affects the skin at another. To this end, we introduce a novel non-contact method to characterize the surface waves produced in the skin under a variety of stimulation conditions. Specifically, we deliver vibrations to the fingertip using a vibratory actuator and measure, using a laser Doppler vibrometer, the surface waves at different distances from the locus of stimulation. First, we show that a vibration applied to the fingertip travels at least the length of the finger and that the rate at which it decays is dependent on stimulus frequency. Furthermore, the resonant frequency of the skin matches the frequency at which a subpopulation of afferents, namely Pacinian afferents, is most sensitive. We show that this skin resonance can lead to a two-fold increase in the strength of the response of a simulated afferent population. Second, the rate at which vibrations propagate across the skin is dependent on the stimulus frequency and plateaus at 7 m/s. The resulting delay in neural activation across locations does not substantially blur the temporal patterning in simulated populations of afferents for frequencies less than 200 Hz, which has important implications about how vibratory frequency is encoded in the responses of somatosensory neurons. Third, we show that, despite the dependence of decay rate and propagation speed on frequency, the waveform of a complex vibration is well preserved as it travels across the skin. Our results suggest, then, that the propagation of surface waves promotes the encoding of spectrally complex vibrations as the entire neural population is exposed to essentially the same stimulus. We also discuss the implications of our results for biomechanical models of the skin.

  7. The effect of surface wave propagation on neural responses to vibration in primate glabrous skin.

    Directory of Open Access Journals (Sweden)

    Louise R Manfredi

    Full Text Available Because tactile perception relies on the response of large populations of receptors distributed across the skin, we seek to characterize how a mechanical deformation of the skin at one location affects the skin at another. To this end, we introduce a novel non-contact method to characterize the surface waves produced in the skin under a variety of stimulation conditions. Specifically, we deliver vibrations to the fingertip using a vibratory actuator and measure, using a laser Doppler vibrometer, the surface waves at different distances from the locus of stimulation. First, we show that a vibration applied to the fingertip travels at least the length of the finger and that the rate at which it decays is dependent on stimulus frequency. Furthermore, the resonant frequency of the skin matches the frequency at which a subpopulation of afferents, namely Pacinian afferents, is most sensitive. We show that this skin resonance can lead to a two-fold increase in the strength of the response of a simulated afferent population. Second, the rate at which vibrations propagate across the skin is dependent on the stimulus frequency and plateaus at 7 m/s. The resulting delay in neural activation across locations does not substantially blur the temporal patterning in simulated populations of afferents for frequencies less than 200 Hz, which has important implications about how vibratory frequency is encoded in the responses of somatosensory neurons. Third, we show that, despite the dependence of decay rate and propagation speed on frequency, the waveform of a complex vibration is well preserved as it travels across the skin. Our results suggest, then, that the propagation of surface waves promotes the encoding of spectrally complex vibrations as the entire neural population is exposed to essentially the same stimulus. We also discuss the implications of our results for biomechanical models of the skin.

  8. Autoimmune autonomic disorders.

    Science.gov (United States)

    Mckeon, Andrew; Benarroch, Eduardo E

    2016-01-01

    Autoimmune autonomic disorders occur because of an immune response directed against sympathetic, parasympathetic, and enteric ganglia, autonomic nerves, or central autonomic pathways. In general, peripheral autoimmune disorders manifest with either generalized or restricted autonomic failure, whereas central autoimmune disorders manifest primarily with autonomic hyperactivity. Some autonomic disorders are generalized, and others are limited in their anatomic extent, e.g., isolated gastrointestinal dysmotility. Historically, these disorders were poorly recognized, and thought to be neurodegenerative. Over the last 20 years a number of autoantibody biomarkers have been discovered that have enabled the identification of certain patients as having an autoimmune basis for either autonomic failure or hyperactivity. Peripheral autoimmune autonomic disorders include autoimmune autonomic ganglionopathy (AAG), paraneoplastic autonomic neuropathy, and acute autonomic and sensory neuropathy. AAG manifests with acute or subacute onset of generalized or selective autonomic failure. Antibody targeting the α3 subunit of the ganglionic-type nicotinic acetylcholine receptor (α3gAChR) is detected in approximately 50% of cases of AAG. Some other disorders are characterized immunologically by paraneoplastic antibodies with a high positive predictive value for cancer, such as antineuronal nuclear antibody, type 1 (ANNA-1: anti-Hu); others still are seronegative. Recognition of an autoimmune basis for autonomic disorders is important, as their manifestations are disabling, may reflect an underlying neoplasm, and have the potential to improve with a combination of symptomatic and immune therapies.

  9. Triclosan Induces Thymic Stromal Lymphopoietin in Skin Promoting Th2 Allergic Responses.

    Science.gov (United States)

    Marshall, Nikki B; Lukomska, Ewa; Long, Carrie M; Kashon, Michael L; Sharpnack, Douglas D; Nayak, Ajay P; Anderson, Katie L; Jean Meade, B; Anderson, Stacey E

    2015-09-01

    Triclosan is an antimicrobial chemical incorporated into many personal, medical and household products. Approximately, 75% of the U.S. population has detectable levels of triclosan in their urine, and although it is not typically considered a contact sensitizer, recent studies have begun to link triclosan exposure with augmented allergic disease. We examined the effects of dermal triclosan exposure on the skin and lymph nodes of mice and in a human skin model to identify mechanisms for augmenting allergic responses. Triclosan (0%-3%) was applied topically at 24-h intervals to the ear pinnae of OVA-sensitized BALB/c mice. Skin and draining lymph nodes were evaluated for cellular responses and cytokine expression over time. The effects of triclosan (0%-0.75%) on cytokine expression in a human skin tissue model were also examined. Exposure to triclosan increased the expression of TSLP, IL-1β, and TNF-α in the skin with concomitant decreases in IL-25, IL-33, and IL-1α. Similar changes in TSLP, IL1B, and IL33 expression occurred in human skin. Topical application of triclosan also increased draining lymph node cellularity consisting of activated CD86(+)GL-7(+) B cells, CD80(+)CD86(+) dendritic cells, GATA-3(+)OX-40(+)IL-4(+)IL-13(+) Th2 cells and IL-17 A(+) CD4 T cells. In vivo antibody blockade of TSLP reduced skin irritation, IL-1β expression, lymph node cellularity, and Th2 responses augmented by triclosan. Repeated dermal exposure to triclosan induces TSLP expression in skin tissue as a potential mechanism for augmenting allergic responses.

  10. Assessment of autonomic nervous system activity by heart rate recovery response

    Institute of Scientific and Technical Information of China (English)

    MENG Zhaohui; BAI Jing

    2004-01-01

    The assessment of autonomic nervous system (ANS) activity is a tool for diagnosing or predicting cardiovascular diseases,while heart rate recovery response (HRRR) after exercise has been promoted as a process under the regulation of ANS (sympathetic and parasympathetic nervous systems).Therefore,assessment of ANS activity was performed by HRRR in this study.Firstly,HRRR signal was extracted based on wavelet decomposition and difference curve of coarse component from heart rate signal.Then,HRRR was divided into quickly descending interval (QDI) and slowly descending interval (SDI).Finally,3 groups of indexes (Difference,Exponential and Quadratic Groups) from QDI and SDI were compared between 50 normotensive and 61 hypertensive subjects.The results showed that the indexes of Difference Group were better choices than others in analyzing the features of HRRR.Furthermore,parasympathetic activity is dominant in QDI,while sympathetic and parasympathetic activities affect SDI together.In conclusion,the proposed method was effective to assess ANS activity.

  11. Allergic Responses Induced by the Immunomodulatory Effects of Nanomaterials upon Skin Exposure

    Science.gov (United States)

    Yoshioka, Yasuo; Kuroda, Etsushi; Hirai, Toshiro; Tsutsumi, Yasuo; Ishii, Ken J.

    2017-01-01

    Over the past decade, a vast array of nanomaterials has been created through the development of nanotechnology. With the increasing application of these nanomaterials in various fields, such as foods, cosmetics, and medicines, there has been concern about their safety, that is, nanotoxicity. Therefore, there is an urgent need to collect information about the biological effects of nanomaterials so that we can exploit their potential benefits and design safer nanomaterials, while avoiding nanotoxicity as a result of inhalation or skin exposure. In particular, the immunomodulating effect of nanomaterials is one of most interesting aspects of nanotoxicity. However, the immunomodulating effects of nanomaterials through skin exposure have not been adequately discussed compared with the effects of inhalation exposure, because skin penetration by nanomaterials is thought to be extremely low under normal conditions. On the other hand, the immunomodulatory effects of nanomaterials via skin may cause severe problems for people with impaired skin barrier function, because some nanomaterials could penetrate the deep layers of their allergic or damaged skin. In addition, some studies, including ours, have shown that nanomaterials could exhibit significant immunomodulating effects even if they do not penetrate the skin. In this review, we summarize our current knowledge of the allergic responses induced by nanomaterials upon skin exposure. First, we discuss nanomaterial penetration of the intact or impaired skin barrier. Next, we describe the immunomodulating effects of nanomaterials, focusing on the sensitization potential of nanomaterials and the effects of co-exposure of nanomaterials with substances such as chemical sensitizers or allergens, on the onset of allergy, following skin exposure. Finally, we discuss the potential mechanisms underlying the immunomodulating effects of nanomaterials by describing the involvement of the protein corona in the interaction of

  12. A psychophysiological inquiry into the nature of the Sokolovian orienting response comparator model: skin conductance and EEG data.

    Science.gov (United States)

    Barceló, F; Hall, M; Gale, A

    1995-10-01

    The mechanisms which trigger the orienting response (OR) are still the subject of lively debate. Sokolov (1990) proposes the development of a multidimensional model of the physical parameters of stimulation. Recent OR research has shown that the skin conductance OR (SCOR) is related to task demands and controlled processing, although this is not so clear for central physiological indexes of orienting. Seventy-three subjects performed visual discriminations of stimuli within a warning-stimulus paradigm. The physical complexity of stimuli and their task relevance were manipulated within subjects, while the nonspecific effects of workload were controlled with a group factor. SCORs were measured concurrently with 1-s epochs of EEG alpha and theta power from Fz, Cz, Pz, and Oz. Neither index was reliably affected by the physical complexity of stimulation alone. However, both higher task relevance and higher workload significantly increased the magnitude of EEGORs and SCORs. Task averages of central and autonomic activity showed an overall pattern of covariation, but a second-by-second breakdown of EEG spectra suggests that the SCOR may be an aggregate of the activation of diverse brain mechanisms responsible for physiological orienting. The results are consistent with a model of orienting as a continuous dimension of resource allocation to anticipated and current task demands, rather than with the abrupt dichotomy between voluntary and involuntary orienting. Implications for the classical OR Sokolovian model are discussed.

  13. Stuttered and Fluent Speakers' Heart Rate and Skin Conductance in Response to Fluent and Stuttered Speech

    Science.gov (United States)

    Zhang, Jianliang; Kalinowski, Joseph; Saltuklaroglu, Tim; Hudock, Daniel

    2010-01-01

    Background: Previous studies have found simultaneous increases in skin conductance response and decreases in heart rate when normally fluent speakers watched and listened to stuttered speech compared with fluent speech, suggesting that stuttering induces arousal and emotional unpleasantness in listeners. However, physiological responses of persons…

  14. Time- and frequency-domain parameters of heart rate variability and sympathetic skin response in Parkinson's disease.

    Science.gov (United States)

    Maetzler, Walter; Karam, Marie; Berger, Monika Fruhmann; Heger, Tanja; Maetzler, Corina; Ruediger, Heinz; Bronzova, Juliana; Lobo, Patricia Pita; Ferreira, Joaquim J; Ziemssen, Tjalf; Berg, Daniela

    2015-03-01

    The autonomic nervous system (ANS) is regularly affected in Parkinson's disease (PD). Information on autonomic dysfunction can be derived from e.g. altered heart rate variability (HRV) and sympathetic skin response (SSR). Such parameters can be quantified easily and measured repeatedly which might be helpful for evaluating disease progression and therapeutic outcome. In this 2-center study, HRV and SSR of 45 PD patients and 26 controls were recorded. HRV was measured during supine metronomic breathing and analyzed in time- and frequency-domains. SSR was evoked by repetitive auditory stimulation. Various ANS parameters were compared (1) between patients and healthy controls, (2) to clinical scales (Unified Parkinson's disease rating scale, Mini-Mental State Examination, Becks Depression Inventory), and (3) to disease duration. Root mean square of successive differences (RMSSD) and low frequency/high frequency (LF/HF) ratio differed significantly between PD and controls. Both, HRV and SSR parameters showed low or no association with clinical scores. Time-domain parameters tended to be affected already at early PD stages but did not consistently change with longer disease duration. In contrast, frequency-domain parameters were not altered in early PD phases but tended to be lower (LF, LF/HF ratio), respectively higher (HF) with increasing disease duration. This report confirms previous results of altered ANS parameters in PD. In addition, it suggests that (1) these ANS parameters are not relevantly associated with motor, behavioral, and cognitive changes in PD, (2) time-domain parameters are useful for the assessment of early PD, and (3) frequency-domain parameters are more closely associated with disease duration.

  15. Sensorized Garments and Textrode-Enabled Measurement Instrumentation for Ambulatory Assessment of the Autonomic Nervous System Response in the ATREC Project

    Directory of Open Access Journals (Sweden)

    Cosme Llerena

    2013-07-01

    Full Text Available Advances in textile materials, technology and miniaturization of electronics for measurement instrumentation has boosted the development of wearable measurement systems. In several projects sensorized garments and non-invasive instrumentation have been integrated to assess on emotional, cognitive responses as well as physical arousal and status of mental stress through the study of the autonomous nervous system. Assessing the mental state of workers under stressful conditions is critical to identify which workers are in the proper state of mind and which are not ready to undertake a mission, which might consequently risk their own life and the lives of others. The project Assessment in Real Time of the Stress in Combatants (ATREC aims to enable real time assessment of mental stress of the Spanish Armed Forces during military activities using a wearable measurement system containing sensorized garments and textile-enabled non-invasive instrumentation. This work describes the multiparametric sensorized garments and measurement instrumentation implemented in the first phase of the project required to evaluate physiological indicators and recording candidates that can be useful for detection of mental stress. For such purpose different sensorized garments have been constructed: a textrode chest-strap system with six repositionable textrodes, a sensorized glove and an upper-arm strap. The implemented textile-enabled instrumentation contains one skin galvanometer, two temperature sensors for skin and environmental temperature and an impedance pneumographer containing a 1-channel ECG amplifier to record cardiogenic biopotentials. With such combinations of garments and non-invasive measurement devices, a multiparametric wearable measurement system has been implemented able to record the following physiological parameters: heart and respiration rate, skin galvanic response, environmental and peripheral temperature. To ensure the proper functioning of the

  16. Cardiovascular, metabolic, and hormonal responses to noradrenaline in diabetic patients with autonomic neuropathy

    DEFF Research Database (Denmark)

    Dejgaard, Anders; Andersen, P; Hvidberg, A

    1996-01-01

    Denervation hypersensitivity is a well-known phenomenon in patients with autonomic failure. In diabetic autonomic neuropathy hypersensitivity to beta-adrenergic stimulation has been demonstrated. We infused noradrenaline, mainly an alpha-adrenoceptor agonist, in three escalating doses (0.5, 2.......5, and 5 micrograms min-1) in three age and sex matched groups of eight subjects: healthy volunteers, diabetic patients with and without autonomic neuropathy. During steady state in each infusion period we measured heart rate, blood pressure, cardiac output, hepato-splanchnic blood flow, vascular...... resistance, glucose kinetics, metabolites (beta-hydroxybuturate, glycerol, and lactate), and glucoregulatory hormones (noradrenaline, adrenaline, growth hormone, pancreatic polypeptide, cortisol, and insulin). Systolic and mean blood pressure increased in all groups but diabetic patients with autonomic...

  17. The Autonomous Development Strategies of Micro and Small Entrepreneurs Through Coorporate Social Responsibility in Bogor District of West Java

    Directory of Open Access Journals (Sweden)

    Faizal Maad

    2014-05-01

    Full Text Available The objective  of this  reseach were to: (1 analyze the level of autonomous of mikro and small entreprise (SMEs entrepreneurs are empowered through Coorporate Social Responsibility (CSR; (2 analyze the dominant factors that influence autonomous of MSEs entrepreneurs  are empowered through CSR;  and (3 formulate an appropriate  a strategy  in developing autonomy of MSEs entrepreneurs through CSR. The reseach  was conduct  in the village built two companies running CSR in Bogor district involved 212  (SMEs entrepreneurs which determined from population (450 SMEs entrepreneurs by Solvin formula with level of error 5 % and drawn by cluster random sampling. Data collection was conducted from July to November 2013, and consisted  the primary and secondary data. Data analysis was simulated by using structural equation model (SEM . The results showed that the degree  of autonomous MSEs entrepreneurs is low, its core was 36.89 out of 100.00. There are three strategies that must be done to develop of  autonomous MSEs entrepreneurs through  CSR, such as; (a an increase the empowerment sustainable of MSEs entrepereneurs (b improve the quality of  the environment  supporting MSEs and (c an increase in intensity of  empowerment for MSEs entrepreneurs.

  18. Characterization of the Frictional Response of Squamata Shed Skin in Comparison to Human skin

    OpenAIRE

    Abdel-Aal, H. A.; Mansori, M. El

    2010-01-01

    Deterministic surfaces are constructs of which profile, topography and textures are integral to the function of the system they enclose. They are designed to yield a predetermined rubbing response. Developing such entities relies on controlling the structure of the rubbing interface so that, not only the surface is of optimized topography, but also is able to self-adjust its behavior according to the evolution of sliding conditions. Inspirations for such designs are frequently encountered in ...

  19. Molecular genetic response to varied wavelengths of light in Xiphophorus maculatus skin.

    Science.gov (United States)

    Chang, Jordan; Lu, Yuan; Boswell, William T; Boswell, Mikki; Caballero, Kaela L; Walter, Ronald B

    2015-12-01

    Xiphophorus fishes represent a model often utilized to study UVB induced tumorigenesis. Recently, varied genetic responses to UVB exposure have been documented in the skin of female and male Xiphophorus, as have differences in UVB response in the skin of different parental species and for interspecies hybrids produced from crossing them. Additionally, it has been shown that exposure to "cool white" fluorescent light induces a shift in the genetic profiles of Xiphophorus skin that is nearly as robust as the UVB response, but involves a fundamentally different set of genes. Given these results and the use of Xiphophorus interspecies hybrids as an experimental model for UVB inducible melanoma, it is of interest to characterize genes that may be transcriptionally modulated in a wavelength specific manner. The global molecular genetic response of skin upon exposure of the intact animal to specific wavelengths of light has not been investigated. Herein, we report results of RNA-Seq experiments from the skin of male Xiphophorus maculatus Jp 163 B following exposure to varied 50nm wavelengths of light ranging from 300-600nm. We identify two specific wavelength regions, 350-400nm (88 genes) and 500-550nm (276 genes), that exhibit transcriptional modulation of a significantly greater number of transcripts than any of the other 50nm regions in the 300-600nm range. Observed functional sets of genes modulated within these two transcriptionally active light regions suggest different mechanisms of gene modulation.

  20. Global brain blood-oxygen level responses to autonomic challenges in obstructive sleep apnea.

    Directory of Open Access Journals (Sweden)

    Paul M Macey

    Full Text Available Obstructive sleep apnea (OSA is accompanied by brain injury, perhaps resulting from apnea-related hypoxia or periods of impaired cerebral perfusion. Perfusion changes can be determined indirectly by evaluation of cerebral blood volume and oxygenation alterations, which can be measured rapidly and non-invasively with the global blood oxygen level dependent (BOLD signal, a magnetic resonance imaging procedure. We assessed acute BOLD responses in OSA subjects to pressor challenges that elicit cerebral blood flow changes, using a two-group comparative design with healthy subjects as a reference. We separately assessed female and male patterns, since OSA characteristics and brain injury differ between sexes. We studied 94 subjects, 37 with newly-diagnosed, untreated OSA (6 female (age mean ± std: 52.1±8.1 yrs; apnea/hypopnea index [AHI]: 27.7±15.6 events/hr and 31 male 54.3±8.4 yrs; AHI: 37.4±19.6 events/hr, and 20 female (age 50.5±8.1 yrs and 37 male (age 45.6±9.2 yrs healthy control subjects. We measured brain BOLD responses every 2 s while subjects underwent cold pressor, hand grip, and Valsalva maneuver challenges. The global BOLD signal rapidly changed after the first 2 s of each challenge, and differed in magnitude between groups to two challenges (cold pressor, hand grip, but not to the Valsalva maneuver (repeated measures ANOVA, p<0.05. OSA females showed greater differences from males in response magnitude and pattern, relative to healthy counterparts. Cold pressor BOLD signal increases (mean ± adjusted standard error at the 8 s peak were: OSA 0.14±0.08% vs. Control 0.31±0.06%, and hand grip at 6 s were: OSA 0.08±0.03% vs. Control at 0.30±0.02%. These findings, indicative of reduced cerebral blood flow changes to autonomic challenges in OSA, complement earlier reports of altered resting blood flow and reduced cerebral artery responsiveness. Females are more affected than males, an outcome which may contribute to the sex

  1. Evaluation of the autonomic response in healthy subjects during treadmill training with assistance of a robot-driven gait orthosis.

    Science.gov (United States)

    Magagnin, Valentina; Porta, Alberto; Fusini, Laura; Licari, Vittorio; Bo, Ivano; Turiel, Maurizio; Molteni, Franco; Cerutti, Sergio; Caiani, Enrico G

    2009-04-01

    Body weight supported treadmill training assisted with a robotic driven gait orthosis is an emerging clinical tool helpful to restore gait in individuals with loss of motor skills. However, the autonomic response during this rehabilitation protocol is not known. The aim of the study was to evaluate the autonomic response during a routine protocol of motor rehabilitation through spectral and symbolic analyses of short-term heart rate variability in a group of 20 healthy subjects (11 men, mean age 25+/-3.8 years). The protocol included the following phases: (1) sitting position; (2) standing position; (3) suspension during subject instrumentation; (4 and 5) robotic-assisted treadmill locomotion at 1.5km/h and 2.5km/h respectively with partial body weight support; (6) standing recovery after exercise. Results showed a significant tachycardia associated with the reduction in variance during the suspended phase of the protocol compared to the sitting position. Spectral analysis did not demonstrate any significant autonomic response during the entire protocol, while symbolic analysis detected an increase in sympathetic modulation during body suspension and an increase of vagal modulation during walking. These results could be used to improve understanding of the cardiovascular effects of rehabilitation in subjects undergoing robotic driven gait orthosis treadmill training.

  2. Lower Corticosteroid Skin Blanching Response Is Associated with Severe COPD

    NARCIS (Netherlands)

    Hoonhorst, Susan J. M.; ten Hacken, Nicolaas; Loi, Adele T. Lo Tam; Koenderman, Leo; Lammers, Jan Willem J.; Telenga, Eef D.; Boezen, Hendrika; van den Berge, Maarten; Postma, Dirkje S.

    2014-01-01

    Background: Chronic obstructive pulmonary disease (COPD) is characterized by chronic airflow limitation caused by ongoing inflammatory and remodeling processes of the airways and lung tissue. Inflammation can be targeted by corticosteroids. However, airway inflammation is generally less responsive t

  3. Sympathetic Responses to Noxious Stimulation of Muscle and Skin

    OpenAIRE

    Burton, Alexander R.; Fazalbhoy, Azharuddin; Vaughan G Macefield

    2016-01-01

    Acute pain triggers adaptive physiological responses that serve as protective mechanisms that prevent continuing damage to tissues and cause the individual to react to remove or escape the painful stimulus. However, an extension of the pain response beyond signaling tissue damage and healing, such as in chronic pain states, serves no particular biological function; it is maladaptive. The increasing number of chronic pain sufferers is concerning, and the associated disease burden is putting he...

  4. Sympathetic Responses to Noxious Stimulation of Muscle and Skin.

    Science.gov (United States)

    Burton, Alexander R; Fazalbhoy, Azharuddin; Macefield, Vaughan G

    2016-01-01

    Acute pain triggers adaptive physiological responses that serve as protective mechanisms that prevent continuing damage to tissues and cause the individual to react to remove or escape the painful stimulus. However, an extension of the pain response beyond signaling tissue damage and healing, such as in chronic pain states, serves no particular biological function; it is maladaptive. The increasing number of chronic pain sufferers is concerning, and the associated disease burden is putting healthcare systems around the world under significant pressure. The incapacitating effects of long-lasting pain are not just psychological - reflexes driven by nociceptors during the establishment of chronic pain may cause serious physiological consequences on regulation of other body systems. The sympathetic nervous system is inherently involved in a host of physiological responses evoked by noxious stimulation. Experimental animal and human models demonstrate a diverse array of heterogeneous reactions to nociception. The purpose of this review is to understand how pain affects the sympathetic nervous system by investigating the reflex cardiovascular and neural responses to acute pain and the long-lasting physiological responses to prolonged (tonic) pain. By observing the sympathetic responses to long-lasting pain, we can begin to understand the physiological consequences of long-term pain on cardiovascular regulation.

  5. Effects of niacin restriction on sirtuin and PARP responses to photodamage in human skin.

    Directory of Open Access Journals (Sweden)

    Claudia A Benavente

    Full Text Available Sirtuins (SIRTs and poly(ADP-ribose polymerases (PARPs, NAD(+-dependent enzymes, link cellular energy status with responses to environmental stresses. Skin is frequently exposed to the DNA damaging effects of UV irradiation, a known etiology in skin cancer. Thus, understanding the defense mechanisms in response to UV, including the role of SIRTs and PARPs, may be important in developing skin cancer prevention strategies. Here, we report expression of the seven SIRT family members in human skin. SIRTs gene expressions are progressively upregulated in A431 epidermoid carcinoma cells (SIRTs1 and 3, actinic keratoses (SIRTs 2, 3, 5, 6, and 7 and squamous cell carcinoma (SIRTs 1-7. Photodamage induces dynamic changes in SIRT expression with upregulation of both SIRT1 and SIRT4 mRNAs. Specific losses of SIRT proteins occur early after photodamage followed by accumulation later, especially for SIRT4. Niacin restriction, which decreases NAD(+, the sirtuin substrate, results in an increase in acetylated proteins, upregulation of SIRTs 2 and 4, increased inherent DNA damage, alterations in SIRT responses to photodamage, abrogation of PARP activation following photodamage, and increased sensitivity to photodamage that is completely reversed by repleting niacin. These data support the hypothesis that SIRTs and PARPs play important roles in resistance to photodamage and identify specific SIRTs that respond to photodamage and may be targets for skin cancer prevention.

  6. Short-term cadmium exposure induces stress responses in frog (Pelophylax bergeri) skin organ culture.

    Science.gov (United States)

    Simoncelli, Francesca; Belia, Silvia; Di Rosa, Ines; Paracucchi, Romina; Rossi, Roberta; La Porta, Gianandrea; Lucentini, Livia; Fagotti, Anna

    2015-12-01

    There have been a few studies on the negative effects of pollutants on amphibian skin, the first structural barrier that interacts with the environment and its potential contaminants. In this study an ex vivo skin organ culture from the amphibian Pelophylax bergeri was used to evaluate cell stress responses induced by short-term exposure to cadmium (Cd), a toxic heavy metal known to be an environmental hazard to both humans and wildlife. Histopathological studies were carried out on skin explants using light microscopy and changes in the expression of stress proteins, such as Metallothionein (MT) and Heat shock proteins (HSPs), were investigated by Real-time RT-PCR. Results revealed that amphibian skin reacts to Cd-induced stress by activating biological responses such as morphological alterations and dose- and time-dependent induction of Mt and Hsp70 mRNA expression, suggesting their potential role as biomarkers of exposure to Cd. This work provides a basis for a better understanding of the tissue-specific responses of amphibian skin as a target organ to Cd exposure and its in vitro use for testing potentially harmful substances present in the environment.

  7. Muscle cells challenged with saturated fatty acids mount an autonomous inflammatory response that activates macrophages

    Directory of Open Access Journals (Sweden)

    Pillon Nicolas J

    2012-10-01

    Full Text Available Abstract Obesity is associated with chronic low-grade inflammation. Within adipose tissue of mice fed a high fat diet, resident and infiltrating macrophages assume a pro-inflammatory phenotype characterized by the production of cytokines which in turn impact on the surrounding tissue. However, inflammation is not restricted to adipose tissue and high fat-feeding is responsible for a significant increase in pro-inflammatory cytokine expression in muscle. Although skeletal muscle is the major disposer of dietary glucose and a major determinant of glycemia, the origin and consequence of muscle inflammation in the development of insulin resistance are poorly understood. We used a cell culture approach to investigate the vectorial crosstalk between muscle cells and macrophages upon exposure to physiological, low levels of saturated and unsaturated fatty acids. Inflammatory pathway activation and cytokine expression were analyzed in L6 muscle cells expressing myc-tagged GLUT4 (L6GLUT4myc exposed to 0.2 mM palmitate or palmitoleate. Conditioned media thereof, free of fatty acids, were then tested for their ability to activate RAW264.7 macrophages. Palmitate -but not palmitoleate- induced IL-6, TNFα and CCL2 expression in muscle cells, through activation of the NF-κB pathway. Palmitate (0.2 mM alone did not induce insulin resistance in muscle cells, yet conditioned media from palmitate-challenged muscle cells selectively activated macrophages towards a pro-inflammatory phenotype. These results demonstrate that low concentrations of palmitate activate autonomous inflammation in muscle cells to release factors that turn macrophages pro-inflammatory. We hypothesize that saturated fat-induced, low-grade muscle cell inflammation may trigger resident skeletal muscle macrophage polarization, possibly contributing to insulin resistance in vivo.

  8. A suction blister model reliably assesses skin barrier restoration and immune response.

    Science.gov (United States)

    Smith, Tracey J; Wilson, Marques A; Young, Andrew J; Montain, Scott J

    2015-02-01

    Skin wound healing models can be used to detect changes in immune function in response to interventions. This study used a test-retest format to assess the reliability of a skin suction blister procedure for quantitatively evaluating human immune function in repeated measures type studies. Up to eight suction blisters (~30 mm(2)) were induced via suction on each participant's left and right forearm (randomized order; blister session 1 and 2), separated by approximately one week. Fluid was sampled from each blister, and the top layer of each blister was removed to reveal up to eight skin wounds. Fluid from each wound was collected 4, 7 and 24h after blisters were induced, and proinflammatory cytokines were measured. Transepidermal water loss (TEWL), to assess skin barrier recovery, was measured daily at each wound site until values were within 90% of baseline values (i.e., unbroken skin). Sleep, stress and inflammation (i.e., factors that affect wound healing and immune function), preceding the blister induction, were assessed via activity monitors (Actical, Philips Respironics, Murrysville, Pennsylvania), the Perceived Stress Scale (PSS) and C-reactive protein (CRP), respectively. Area-under-the-curve and TEWL, between blister session 1 and 2, were compared using Pearson correlations and partial correlations (controlling for average nightly sleep, PSS scores and CRP). The suction blister method was considered reliable for assessing immune response and skin barrier recovery if correlation coefficients reached 0.7. Volunteers (n=16; 12 M; 4F) were 23 ± 5 years [mean ± SD]. Time to skin barrier restoration was 4.9 ± 0.8 and 4.8 ± 0.9 days for sessions 1 and 2, respectively. Correlation coefficients for skin barrier restoration, IL-6, IL-8 and MIP-1α were 0.9 (Pblister method is sufficiently reliable for assessing skin barrier restoration and immune responsiveness. This data can be used to determine sample sizes for cross-sectional or repeated-measures types of

  9. Effects of autonomous motivational priming on motivation and affective responses towards high-intensity interval training.

    Science.gov (United States)

    Brown, Denver M Y; Teseo, Amanda J; Bray, Steven R

    2016-08-01

    This study examined the effect of autonomous motivational priming on motivation, attitudes and intentions towards high-intensity interval training (HIT). Participants (N = 42) performed a graded exercise test to determine their peak aerobic power (WPEAK). At a subsequent testing session, participants were randomised to complete either an autonomous or neutral motivational priming task followed by a 10 × 1 HIT exercise protocol, alternating 1-min bouts of hard (70% WPEAK) and light (12.5% WPEAK) exercises for 20 min. Participants primed with autonomous motivation reported greater enjoyment, P = .009, ηp(2) = .16, and perceived competence, P = .005, ηp(2) = .18, post-exercise compared to those in the neutral priming condition. Participants in the autonomous motivational priming condition also reported more positive attitudes, P = .014, ηp(2) = .14, towards HIT; however, there was no difference between the conditions for task motivation during HIT or intentions, P = .53, ηp(2) = .01, to engage in HIT. These findings highlight autonomous motivational priming as a method of enhancing affective and motivational experiences regarding HIT.

  10. Classical conditioning of autonomic fear responses is independent of contingency awareness.

    Science.gov (United States)

    Schultz, Douglas H; Helmstetter, Fred J

    2010-10-01

    The role of contingency awareness in classical conditioning experiments using human subjects is currently under debate. This study took a novel approach to manipulating contingency awareness in a differential Pavlovian conditioning paradigm. Complex sine wave gratings were used as visual conditional stimuli (CS). By manipulating the fundamental spatial frequency of the displays, we were able to construct pairs of stimuli that varied in discriminability. One group of subjects was given an "easy" discrimination, and another was exposed to a "difficult" CS+ and CS-. A 3rd group was exposed to a stimulus that was paired with the unconditional stimulus (UCS) 50% of the time and served as a control. Skin conductance response (SCR) and continuous UCS expectancy data were measured concurrently throughout the experiment. Differential UCS expectancy was found only in the easy discrimination group. Differential SCRs were found in the easy discrimination group as well as in the difficult discrimination group, but not in the 50% contingency control. The difficult discrimination group did not exhibit differential UCS expectancy but did show clear differential SCR. These observations support a dual process interpretation of classical conditioning whereby conditioning on an implicit level can occur without explicit knowledge about the contingencies. The role of contingency awareness in classical conditioning experiments using human subjects is currently under debate. This study took a novel approach to manipulating contingency awareness in a differential Pavlovian conditioning paradigm. Complex sine wave gratings were used as visual conditional stimuli (CS). By manipulating the fundamental spatial frequency of the displays, we were able to construct pairs of stimuli that varied in discriminability. One group of subjects was given an "easy" discrimination, and another was exposed to a "difficult" CS+ and CS-. A 3rd group was exposed to a stimulus that was paired with the

  11. Innate and adaptive immune responses in allergic contact dermatitis and autoimmune skin diseases.

    Science.gov (United States)

    Edele, Fanny; Esser, Philipp R; Lass, Christian; Laszczyk, Melanie N; Oswald, Eva; Strüh, Christian M; Rensing-Ehl, Anne; Martin, Stefan F

    2007-12-01

    Allergic contact dermatitis is induced by chemicals or metal ions. A hallmark of this T cell mediated skin disease is the activation of the innate immune system by contact allergens. This immune response results in inflammation and is a prerequisite for the activation of the adaptive immune system with tissue-specific migration of effector and regulatory T cells. Recent studies have begun to address in detail the innate immune cells as well as the innate receptors on these cells and the associated signaling pathways which lead to skin inflammation. We review here recent findings regarding innate and adaptive immune responses and immune regulation of contact dermatitis and other skin diseases as well as recent developments towards an in vitro assessment of the allergenic potential of chemicals. The elucidation of the innate inflammatory pathways, cellular components and mediators will help to identify new drug targets for more efficient treatment of allergic contact dermatitis and hopefully also for its prevention.

  12. [Response of pancreatic polypeptide to a protein rich meal in insulin non dependent diabetes melitus and autonomic neuropathy].

    Science.gov (United States)

    Kostić, N; Zamaklar, M; Novaković, R; Stajić, S

    1994-01-01

    Parasympathetic function and plasma hPP response to a protein rich meal were evaluated in 105 insulin non-dependent diabetic patients: 20 with autonomic neuropathy (group A), diagnosed by Clonidin test; 35 patients with neurophysiological evidence of polyneuropath (group B); 30 patients with autonomic neuropathy and polineuropathy (group C), and 20 patients without any sign of neuropathy (group D). Plasma hPP levels were determined by RIA using an anti-hPP antiserum, kindly provided by Prof. S. R. Bloom (Hammersmith Hospital, London). Blood was taken at 0. 45 and 60 minutes after the beginning of the meal. In groups A and C, the meal induced hPP increase was significantly lower than in group D (p 0.001). All group B patients had a marked increase in the peptide, similar to that in diabetics without neuropathy. These result ssuggest that diabetic autonomic neuropathy is associated with dysfunction of hPP secretion, and that the evaluation of hPP response to test meal may be a sensitive and simple method for the assessment of paraympathetic impairment in diabetes.

  13. Therapeutic efficacy and immunological response of CCL5 antagonists in models of contact skin reaction.

    Directory of Open Access Journals (Sweden)

    Miriam Canavese

    Full Text Available Skin-infiltrating T-cells play a predominant role in allergic and inflammatory skin diseases such as atopic dermatitis, psoriasis and allergic contact dermatitis. These T-cells are attracted by several chemotactic factors including the chemokine CCL5/RANTES, a CC chemokine inducing both the migration and activation of specific leukocyte subsets. CCL5 has been found to be associated with various cell-mediated hypersensitive disorders such as psoriasis, atopic dermatitis and irritant contact dermatitis. We have used two antagonists, the first, Met-CCL5, a dual CCR1/CCR5 antagonist and the second, a variant in which GAG binding is abrogated, (44AANA(47-CCL5, which acts as a dominant negative inhibitor of CCL5. The antagonists were tested in two models of contact skin reaction. The first, irritant contact dermatitis (ICD is a pathological non-specific inflammatory skin condition arising from the release of pro-inflammatory cytokines by keratinocytes in response to haptens, usually chemicals. The second, contact hypersensitivity (CHS is a T-cell dependent model, mimicking in part the T-cell-mediated skin diseases such as psoriasis. In both models, the CCL5 antagonists showed therapeutic efficacy by reducing swelling by 50% as well as the reduction of soluble mediators in homogenates derived from challenged ears. These results demonstrate that blocking the receptor or the ligand are both effective strategies to inhibit skin inflammation.

  14. Regulating Response Time in an Autonomic Computing System: A Comparison of Proportional Control and Fuzzy Control Approaches

    Directory of Open Access Journals (Sweden)

    Harish S. Venkatarama

    2010-10-01

    Full Text Available Ecommerce is an area where an Autonomic Computing system could be very effectively deployed. Ecommerce has created demand for high quality information technology services and businesses are seeking quality of service guarantees from their service providers. These guarantees are expressed as part of service level agreements. Properly adjusting tuning parameters for enforcement of the service level agreement is time-consuming and skills-intensive. Moreover, in case of changes to the workload, the setting of the parameters may no longer be optimum. In an ecommerce system, where the workload changes frequently, there is a need to update the parameters at regular intervals. This paper describes two approaches, one, using a proportional controller and two, using a fuzzy controller, to automate the tuning of MaxClients parameter of Apache web server based on the required response time and the current workload. This is an illustration of the self-optimizing characteristic of an autonomic computing system.

  15. Regulating Response Time in an Autonomic Computing System: A Comparison of Proportional Control and Fuzzy Control Approaches

    Directory of Open Access Journals (Sweden)

    Harish S. Venkatarama

    2010-10-01

    Full Text Available Ecommerce is an area where an Autonomic Computing system could be very effectively deployed.Ecommerce has created demand for high quality information technology services and businesses areseeking quality of service guarantees from their service providers. These guarantees are expressed aspart of service level agreements. Properly adjusting tuning parameters for enforcement of the servicelevel agreement is time-consuming and skills-intensive. Moreover, in case of changes to the workload, thesetting of the parameters may no longer be optimum. In an ecommerce system, where the workloadchanges frequently, there is a need to update the parameters at regular intervals. This paper describestwo approaches, one, using a proportional controller and two, using a fuzzy controller, to automate thetuning of MaxClients parameter of Apache web server based on the required response time and thecurrent workload. This is an illustration of the self-optimizing characteristic of an autonomic computingsystem.

  16. Pathological gambling: Relation of skin conductance response to dopaminergic neurotransmission and sensation-seeking

    DEFF Research Database (Denmark)

    Peterson, Ericka; Møller, Arne; Doudet, Doris;

    2010-01-01

    Absent Skin Conductance Response (SCR) in pathological gambling (PG) may relate to dopaminergic mechanisms. We recruited equal numbers of PG subjects and healthy control (HC) subjects, and then tested the claim that SCR is less conditioned by dopaminergic activity in PG subjects. During active...

  17. Acute dissociation predicts rapid habituation of skin conductance responses to aversive auditory probes

    NARCIS (Netherlands)

    Giesbrecht, T.; Merckelbach, H.L.G.J.; Burg, L. ter; Cima, M.; Simeon, D.

    2008-01-01

    The present study examined how acute dissociation, trait-like dissociative symptoms, and physiological reactivity relate to each other. Sixty-nine undergraduate students were exposed to 14 aversive auditory probes, while their skin conductance responses were measured. A combination of self-reported

  18. Media Research with a Galvanic Skin Response Biosensor: Some Kids Work Up a Sweat!

    Science.gov (United States)

    Clariana, Roy B.

    This study considers the galvanic skin response (GSR) of sixth-grade students (n=20) using print, video, and microcomputer segments. Subjects received all three media treatments, in randomized order. Data for analysis consisted of standardized test scores and GSR measures; a moderate positive relationship was shown between cumulative GSR and…

  19. Impact of Diabetes Type 1 in Children on Autonomic Modulation at Rest and in Response to the Active Orthostatic Test

    Science.gov (United States)

    Giacon, Thais Roque; Vanderlei, Franciele Marques; Christofaro, Diego Giulliano Destro; Vanderlei, Luiz Carlos Marques

    2016-01-01

    Introduction Cardiovascular autonomic neuropathy is one of the most common complications of diabetes mellitus type 1 (DM1), of which one of the first subclinical manifestations is changes in heart rate variability (HRV). Thus, analysis of HRV associated with the autonomic active orthostatic test is important in this population. Objectives To analyze the autonomic modulation responses induced by the implementation of the active orthostatic test, in children with DM1, and study the autonomic modulation by means of HRV indices. Method Data of 35 children were analyzed, of both sexes, aged between 7 and 15 years, who were divided into two groups: Diabetic (n = 16) and Control (n = 19). The following variables were collected initially: weight, height, body fat percentage, heart rate, blood pressure and casual blood glucose. Subsequently, for analysis of autonomic modulation, the beat-to-beat heart rate was captured by a heart rate monitor in the supine position for 30 minutes and after 10 minutes standing during performance of the active orthostatic test. HRV indices were calculated in the time and frequency domains. For data analysis, covariance analysis was used to compare groups and ANOVA for repeated measures to compare the effects of the active orthostatic test. These data were adjusted for age, sex, ethnicity, body fat percentage and casual blood glucose, with a 5% significance level. Results The results suggested that diabetic children at rest present a decrease in SDNN (50.4 vs. 75.2), rMSSD (38.7 vs 57.6) and LF [ms2] (693.6 vs 1874.6). During the active orthostatic test the children in both groups demonstrated a reduction in SDNN, RMSSD and LF [ms2] compared to the resting position, and this response was less pronounced in the diabetic group. Conclusion We conclude that regardless of age, sex, ethnicity, body fat percentage and casual blood glucose, performing the active orthostatic test promoted increased sympathetic modulation and reduced parasympathetic

  20. Autonomic nervous system responses to viewing green and built settings: differentiating between sympathetic and parasympathetic activity

    NARCIS (Netherlands)

    van den Berg, Magdalena; Maas, Jolanda; Mulder, Rianne; Braun, Anoek; Kaandorp, Wendy; van Lien, René; van Poppel, Mireille; van Mechelen, Willem; van den Berg, Agnes

    2015-01-01

    his laboratory study explored buffering and recovery effects of viewing urban green and built spaces on autonomic nervous system activity. Forty-six students viewed photos of green and built spaces immediately following, and preceding acute stress induction. Simultaneously recorded electrocardiogram

  1. High-power femtosecond-terahertz pulse induces a wound response in mouse skin

    Science.gov (United States)

    Kim, Kyu-Tae; Park, Jaehun; Jo, Sung Jin; Jung, Seonghoon; Kwon, Oh Sang; Gallerano, Gian Piero; Park, Woong-Yang; Park, Gun-Sik

    2013-08-01

    Terahertz (THz) technology has emerged for biomedical applications such as scanning, molecular spectroscopy, and medical imaging. Although a thorough assessment to predict potential concerns has to precede before practical utilization of THz source, the biological effect of THz radiation is not yet fully understood with scant related investigations. Here, we applied a femtosecond-terahertz (fs-THz) pulse to mouse skin to evaluate non-thermal effects of THz radiation. Analysis of the genome-wide expression profile in fs-THz-irradiated skin indicated that wound responses were predominantly mediated by transforming growth factor-beta (TGF-β) signaling pathways. We validated NFκB1- and Smad3/4-mediated transcriptional activation in fs-THz-irradiated skin by chromatin immunoprecipitation assay. Repeated fs-THz radiation delayed the closure of mouse skin punch wounds due to up-regulation of TGF-β. These findings suggest that fs-THz radiation initiate a wound-like signal in skin with increased expression of TGF-β and activation of its downstream target genes, which perturbs the wound healing process in vivo.

  2. The electromagnetic response of human skin in the millimetre and submillimetre wave range

    Energy Technology Data Exchange (ETDEWEB)

    Feldman, Yuri; Puzenko, Alexander; Ben Ishai, Paul; Caduff, Andreas; Davidovich, Issak; Sakran, Fadi; Agranat, Aharon J [Department of Applied Physics, Hebrew University of Jerusalem, Givat Ram, 91904, Jerusalem (Israel)], E-mail: yurif@vms.huji.ac.il

    2009-06-07

    Recent studies of the minute morphology of the skin by optical coherence tomography revealed that the sweat ducts in human skin are helically shaped tubes, filled with a conductive aqueous solution. This, together with the fact that the dielectric permittivity of the dermis is higher than that of the epidermis, brings forward the supposition that as electromagnetic entities, the sweat ducts could be regarded as low Q helical antennas. The implications of this statement were further investigated by electromagnetic simulation and experiment of the in vivo reflectivity of the skin of subjects under varying physiological conditions (Feldman et al 2008 Phys. Rev. Lett. 100 128102). The simulation and experimental results are in a good agreement and both demonstrate that sweat ducts in the skin could indeed behave as low Q antennas. Thus, the skin spectral response in the sub-Terahertz region is governed by the level of activity of the perspiration system and shows the minimum of reflectivity at some frequencies in the frequency band of 75-110 GHz. It is also correlated to physiological stress as manifested by the pulse rate and the systolic blood pressure. As such, it has the potential to become the underlying principle for remote sensing of the physiological parameters and the mental state of the examined subject.

  3. Three-dimensional model on thermal response of skin subject to laser heating.

    Science.gov (United States)

    Shen, Wensheng; Zhang, Jun; Yang, Fuqian

    2005-04-01

    A three-dimensional (3D) multilayer model based on the skin physical structure is developed to investigate the transient thermal response of human skin subject to laser heating. The temperature distribution of the skin is modeled by the bioheat transfer equation, and the influence of laser heating is expressed as a source term where the strength of the source is a product of a Gaussian shaped incident irradiance, an exponentially shaped axial attenuation, and a time function. The water evaporation and diffusion is included in the model by adding two terms regarding the heat loss due to the evaporation and diffusion, where the rate of water evaporation is determined based on the theory of laminar boundary layer. Cryogen spray cooling (CSC) in laser therapy is studied, as well as its effect on the skin thermal response. The time-dependent equation is discretized using the finite difference method with the Crank-Nicholson scheme and the stability of the numerical method is analyzed. The large sparse linear system resulted from discretizing the governing partial differential equation is solved by a GMRES solver and the expected simulation results are obtained.

  4. Immune Responses to Trichloroethylene and Skin Gene Expression Profiles in Sprague Dawley Rats

    Institute of Scientific and Technical Information of China (English)

    XIAO-YAN CHEN; ZHI-XIONG ZHUANG; XIAO-HUI WANG; JIN-ZHOU ZHANG

    2006-01-01

    Objective To characterize the immune reaction in SD rats exposed to trichloroethylene (TCE) and to identify the gene expression profiles involved in skin after TCE exposure. Methods Fifteen percent of TCE was injected intradermally into the rat back (100 μL/120 g) at intervals of 7 days. Whole blood was collected 24 h after the fifth or seventh intradermic administration of TCE. The percentages of CD4+ and CD8+ of T lymphocytes were measured by a flow cytometer. The concentrations of IFN-gamma and IL-4 in the serum were semi-quantified by ELISA. Total RNAs of skin samples at 3 h or 24 h after the seventh dose of TCE in SD rats were extracted, and gene expression profiles of these tissues were analyszed by rat toxicology U34 array of Affymetrix. Results Obvious decline of CD4+ in T lymphocytes was observed in theTCE-administer group. No significant concentration differences in IFN-gamma and IL-4 were found between TCE-treated and control rats. Gadd45a and Mel were significantly up regulated in skin tissue 24 h after TCE exposure. The expression regulation of immune response factors was as active as proteins associated with lipid metabolism and synthesis process in these skin samples of SD rats exposed to TCE. Conclusion T-helper type 1 cells mediate immune response can not be elicited in TCE-treated SD rats, but certain immune disorder can be induced.

  5. Orbital response indicates nasal pungency: analysis of biomechanical strain on the skin.

    Science.gov (United States)

    Jalowayski, A A; Johnson, B N; Wise, P M; Schmid-Schönbein, G W; Cain, W S

    2001-10-01

    Stimulation of the human nasal passage with pungent vapor elicits motor responses in a zone around the eye. This investigation addressed whether quantification of such responses, particularly activity of the orbicularis oculi muscle, could yield a sensitive index of nasal pungency. We placed an array of small, high-contrast targets just beneath the lower eyelid and videotaped their movement to capture deformation of the skin atop the orbicularis oculi during 3 s stimulation with pungent concentrations of ethyl acetate. Eleven subjects participated. Analysis of the movements served to determine mechanical strain, which yielded a single index that we termed 'maximum strain'. This increased with concentration of the vapor and with time during and just after stimulation. Comparison with psychophysical data showed that the strain became evident at concentrations just detectable as pungent. Maximum strain measured on the skin shows promise as an objective index of pungency.

  6. Human thermal sensation: frequency response to sinusoidal stimuli at the surface of the skin

    DEFF Research Database (Denmark)

    Ring, J.W.; de Dear, Richard; Melikov, Arsen Krikor

    1993-01-01

    The question of how the human organism perceives changing thermal stimuli has been recently studied and reported in experiments where these stimuli were either ramps and plateaux or simply step changes. Other experiments have been done in which the stimuli have been periodically varying airflows...... function. This function is then compared with the functional form found in two experiments where the stimuli were pulsating airflows of differing frequency. The PSI model seems to simulate well the form of the response of the human skin system to varying temperature changes of a whole range of frequencies....... A psychosensory intensity (PSI) model has been developed to relate experimentally derived sensation data to simulated cutaneous thermoreceptor responses to the temperature ramp-plateaux and step stimuli applied to the skin surface by thermodes. From the point of view of signal processing, a natural extension...

  7. Highly wearable galvanic skin response sensor using flexible and conductive polymer foam.

    Science.gov (United States)

    Kim, Jeehoon; Kwon, Sungjun; Seo, Sangwon; Park, Kwangsuk

    2014-01-01

    Owing to advancements in daily physiological monitoring technology, diverse healthcare applications have emerged recently. The monitoring of skin conductance responses has extensive feasibility to support healthcare applications such as detecting emotion changes. In this study, we proposed a highly wearable and reliable galvanic skin response (GSR) sensor that measures the signals from the back of the user. To enhance its wearability and usability, we employed flexible conductive foam as the sensing material and designed it to be easily attachable to (and detachable from) a wide variety of clothes. We evaluated the sensing reliability of the proposed sensor by comparing its signal with a reference GSR. The average correlation between the two signals was 0.768; this is sufficiently high to validate the feasibility of the proposed sensor for reliable GSR sensing on the back.

  8. Post-weaning social isolation induces abnormal forms of aggression in conjunction with increased glucocorticoid and autonomic stress responses.

    Science.gov (United States)

    Toth, Mate; Mikics, Eva; Tulogdi, Aron; Aliczki, Mano; Haller, Jozsef

    2011-06-01

    We showed earlier that social isolation from weaning (a paradigm frequently used to model social neglect in children) induces abnormal forms of attack in rats, and assumed that these are associated with hyperarousal. To investigate this hypothesis, we deprived rats of social contacts from weaning and studied their behavior, glucocorticoid and autonomic stress responses in the resident-intruder paradigm at the age of 82 days. Social isolation resulted in abnormal attack patterns characterized by attacks on vulnerable targets, deficient social communication and increased defensive behaviors (defensive upright, flight, freezing). During aggressive encounters, socially deprived rats rapidly switched from one behavior to another, i.e. showed an increased number of behavioral transitions as compared to controls. We tentatively term this behavioral feature "behavioral fragmentation" and considered it a form of behavioral arousal. Basal levels of plasma corticosterone regularly assessed by radioimmunoassay between 27 and 78 days of age were not affected. In contrast, aggression-induced glucocorticoid responses were approximately doubled by socially isolation. Diurnal oscillations in heart rate assessed by in vivo biotelemetry were not affected by social isolation. In contrast, the aggression-induced increase in heart rate was higher in socially isolated than in socially housed rats. Thus, post-weaning social isolation induced abnormal forms of aggression that developed on the background of increased behavioral, endocrine and autonomic arousal. We suggest that this paradigm may be used to model aggression-related psychopathologies associated with hyperarousal, particularly those that are triggered by adverse rearing conditions.

  9. Effects of psychological stress test on the cardiac response of public safety workers: alternative parameters to autonomic balance

    Science.gov (United States)

    Huerta-Franco, M. R.; Vargas-Luna, F. M.; Delgadillo-Holtfort, I.

    2015-01-01

    It is well known that public safety workers (PSW) face many stressful situations that yield them as high-risk population for suffering chronic stress diseases. In this multidisciplinary research the cardiac response to induced psychological stress by a short duration Stroop test was evaluated in 20 female and 19 male PSW, in order to compare traditionally used cardiac response parameters with alternative ones. Electrocardiograms have been recorded using the Eindhoven electrodes configuration for 1 min before, 3 min during and 1 min after the test. Signals analysis has been performed for the heart rate and the power spectra of its variability and of the variability of the amplitude of the R-wave, i.e. the highest peak of the electrocardiographic signal periodic sequence. The results demonstrated that the traditional autonomic balance index shows no significant differences between stages. In contrast, the median of the area of the power spectrum of the R-wave amplitude variability in the frequency region dominated by the autonomous nervous system (0.04-to-0.4 Hz) is the more sensitive parameter. Moreover, this parameter allows to identify gender differences consistent with those encountered in other studies.

  10. A 41-year-old man with polyarthritis and severe autonomic neuropathy

    Directory of Open Access Journals (Sweden)

    Matthew E Bourcier

    2008-09-01

    Full Text Available Matthew E Bourcier, Aaron I VinikEastern Virginia Medical School, Norfolk, VA, USAAbstract: Orthostasis due to autonomic neuropathy can cause severe debilitation and prove refractory to treatment. This report describes a case of severe sympathetic and parasympathetic autonomic dysfunction as a consequence of acetylcholine receptor antibodies and Sjogren’s syndrome. Symptomatic management, plasma fluid expanders, and IVIG therapy failed to offer a salutary response to the condition. Etanercept therapy provided improvement of the orthostasis and autonomic function measured as high and low frequency respiratory effects on heart rate variability as well as enhancement of skin blood flow using Laser Doppler. It would be of considerable interest to determine the effectiveness of etanercept in other autoimmune neuropathies.Keywords: autonomic neuropathy, etanercept, IntraEpidermal Nerve Fibers (IENF, acetylcholine receptor antibodies, laser doppler skin blood flow, orthostasis

  11. The effect of selenium supplementation on DTH skin responses in healthy North American men.

    Science.gov (United States)

    Hawkes, Wayne Chris; Hwang, Amie; Alkan, Zeynep

    2009-01-01

    The trace element selenium (Se) is essential for immune system development and function in animals. However, the exact functions of Se in the human immune system and the achievable health benefits from Se supplementation remain unclear. To test whether an increased intake of dietary Se affects immune function, we conducted a randomized, controlled trial of Se supplementation in healthy free-living men. Forty-two men were administered 300microg of Se a day as high-Se Baker's yeast, or low-Se yeast for 48 weeks. Serum immunoglobulins, differential complete blood counts and lymphocyte sub-populations were measured every 6 weeks. Tests of delayed-type hypersensitivity (DTH) skin responses to mumps, candida, trychophyton, tuberculin-purified protein, and tetanus were performed at baseline and at the end of 48 weeks of treatment. Supplementation increased blood Se concentration by 50%. Surprisingly, consumption of the low-Se yeast induced anergy in DTH skin responses and increased counts of natural killer (NK) cells and T lymphocytes expressing both subunits of the high affinity interleukin-2 receptor (IL2R). DTH skin responses and IL2R+ cells did not change in the high-Se group, suggesting Se supplementation blocked induction of DTH anergy. There were no differences between groups in quality of life indicators, number of days sick, other leukocyte phenotypes, serum immunoglobulins, or complement factors. These results suggest that Se plays a role in immunotolerization, a cell-mediated process involved in many aspects of immune function.

  12. Posterior superior temporal sulcus responses predict perceived pleasantness of skin stroking

    Directory of Open Access Journals (Sweden)

    Monika Davidovic

    2016-09-01

    Full Text Available Love and affection is expressed through a range of physically intimate gestures, including caresses. Recent studies suggest that posterior temporal lobe areas typically associated with visual processing of social cues also respond to interpersonal touch. Here, we asked whether these areas are selective to caress-like skin stroking. We collected functional magnetic resonance imaging (fMRI data from 23 healthy participants and compared brain responses to skin stroking and vibration. We did not find any significant differences between stroking and vibration in the posterior temporal lobe; however, right posterior superior temporal sulcus (pSTS responses predicted healthy participant's perceived pleasantness of skin stroking, but not vibration. These findings link right pSTS responses to individual variability in perceived pleasantness of caress-like tactile stimuli. We speculate that the right pSTS may play a role in the translation of tactile stimuli into positively valenced, socially relevant interpersonal touch and that this system may be affected in disorders associated with impaired attachment.

  13. Response of skin to audible signal and skin-hearing aid%皮肤对于声音信号响应与皮肤听声器

    Institute of Scientific and Technical Information of China (English)

    李建文; 于晓明; 曹力佳

    2008-01-01

    ①介绍了皮肤听声器的基本组成与昕声效果.这种新型的助听工具可使任何人通过皮肤获得听觉,但辨析语音的效果还不理想.②为了进一步研究皮肤响应声音信号的理论,构造了测试皮肤响应声音信号的实验环境.通过实验测试了皮肤响应声音信号的关键部件音频变压器、平面电极与皮肤听声之间的临界频率电压特性曲线,讨论了皮肤响应声音信号的关键部件与皮肤听声效果之间的关系,说明了通过声一电转换实现皮肤听声的特点和可行性.③介绍了新型可便携、低功耗助听产品一皮肤听声器,并与助听器、电子耳蜗、导聋犬等传统的助听工具进行了对比,说明了皮肤听声器的优越性能.%This study was designed to introduce basic components and sound-receiving effects of skin-hearing aid with transformer. This new device helped all people receive audible signals via skin, but the effects on discriminating phone were still not ideal.The experimental environment of the response of skin to audible signals was constructed for the theory research. The response on critical frequency and voltage among the transformer, the flat electrode and the skin has gotten in the experiment. It was discussed that the effect of the response of skin to audible signal between the key parts of device of hearing by skin with transformer and the skin. It was illustrated the practicability of skin hearing by sound-electricity converting.The skin-hearing aid, a low power consumption aid, was compared with traditional tools, such as hearing aid, electronic cochlea, and guide dogs, and the results proved the superiority of skin-hearing aid.

  14. Evaluation of Autonomic Dysfunction in Obstructive Sleep Apnea Syndrome

    Directory of Open Access Journals (Sweden)

    Ahmet Turan Evlice

    2012-04-01

    Full Text Available The nervous system, which controls the body's internal organs is called Autonomic Nervous System. Parkinson's disease, vascular diseases, diabetes mellitus and Guilllain-Barre syndrome cause to disotonomia. Recent studies has been shown, obstructive sleep apnea syndrome cause to disotonomia too. To investigate disotonomia in in obstructive sleep apnea syndrome , should be preferred the methods like analysis of heart rate variability and sympathetic skin response which have low cost and easy applicability. Thus, it will be possible to prevent morbidity and mortality due to autonomic dysfuncion. [Archives Medical Review Journal 2012; 21(2.000: 109-121

  15. Skin biopsy and quantitative sensory testing do not predict response to lidocaine patch in painful neuropathies.

    Science.gov (United States)

    Herrmann, David N; Pannoni, Valerie; Barbano, Richard L; Pennella-Vaughan, Janet; Dworkin, Robert H

    2006-01-01

    Predictors of response to neuropathic pain treatment in patients with painful distal sensory neuropathies are lacking. The 5% lidocaine patch is believed to exert its effects on neuropathic pain via a local stabilizing effect on cutaneous sensory afferents. As such, it provides a model to assess whether the status of epidermal innervation as determined by skin biopsy or quantitative sensory testing (QST) of small- and large-diameter sensory afferents might serve as predictors of response to topical, locally active treatment. In this study we assessed associations between epidermal nerve fiber (ENF) densities, sensory nerve conduction studies (NCS), QST, and response to a 5% lidocaine patch in patients with painful distal sensory neuropathies. We observed no association between distal leg epidermal and subepidermal innervation and response to the lidocaine patch. Several patients with complete loss of distal leg ENF showed a response to the lidocaine patch. Similarly we observed no consistent association between treatment response and QST for vibration, cooling, warm, heat-pain, and cold-pain thresholds, or distal sensory NCS. Thus, distal-leg skin biopsy, QST, and sensory NCS cannot be used to identify patients with painful polyneuropathy likely to respond to a lidocaine patch in clinical practice. Further studies are required to clarify precisely the mechanism and site of action of the lidocaine patch in patients with peripheral neuropathic pain.

  16. [Autonomic neuropathies].

    Science.gov (United States)

    Siepmann, T; Penzlin, A I; Illigens, B M W

    2013-07-01

    Autonomic neuropathies are a heterogeneous group of diseases that involve damage of small peripheral autonomic Aδ- and C-fibers. Causes of autonomic nerve fiber damage are disorders such as diabetes mellitus and HIV-infection. Predominant symptoms of autonomic neuropathy are orthostatic hypotension, gastro-intestinal problems, urogenital dysfunction, and cardiac arrhythmia, which can severely impair the quality of life in affected patients. Furthermore, autonomic neuropathies can be induced by autoimmune diseases such as acute inflammatory demyelinating polyneuropathy, hereditary disorders such as the lysosomal storage disorder Fabry disease and hereditary sensory and autonomic neuropathies, as well as certain toxins and drugs.

  17. Musical Auditory Stimulation Influences Heart Rate Autonomic Responses to Endodontic Treatment

    Science.gov (United States)

    Martiniano, Eli Carlos; Monteiro, Larissa Raylane Lucas; Valenti, Vitor E.; Sorpreso, Isabel Cristina Esposito; de Abreu, Luiz Carlos

    2017-01-01

    We aimed to evaluate the acute effect of musical auditory stimulation on heart rate autonomic regulation during endodontic treatment. The study included 50 subjects from either gender between 18 and 40 years old, diagnosed with irreversible pulpitis or pulp necrosis of the upper front teeth and endodontic treatment indication. HRV was recorded 10 minutes before (T1), during (T2), and immediately (T3 and T4) after endodontic treatment. The volunteers were randomly divided into two equal groups: exposed to music (during T2, T3, and T4) or not. We found no difference regarding salivary cortisol and anxiety score. In the group with musical stimulation heart rate decreased in T3 compared to T1 and mean RR interval increased in T2 and T3 compared to T1. SDNN and TINN indices decreased in T3 compared to T4, the RMSSD and SD1 increased in T4 compared to T1, the SD2 increased compared to T3, and LF (low frequency band) increased in T4 compared to T1 and T3. In the control group, only RMSSD and SD1 increased in T3 compared to T1. Musical auditory stimulation enhanced heart rate autonomic modulation during endodontic treatment. PMID:28182118

  18. Effects of robot-driven gait orthosis treadmill training on the autonomic response in rehabilitation-responsive stroke and cervical spondylotic myelopathy patients.

    Science.gov (United States)

    Magagnin, Valentina; Bo, Ivano; Turiel, Maurizio; Fornari, Maurizio; Caiani, Enrico G; Porta, Alberto

    2010-06-01

    Body weight supported treadmill training (BWSTT) assisted with a robotic-driven gait orthosis is utilized in rehabilitation of individuals with lost motor skills. A typical rehabilitation session included: sitting, standing, suspension, robotic-assisted walking at 1.5 and 2.5km/h, respectively with 50% body weight support and recovery. While the effects of robotic-assisted BWSTT on motor performances were deeply studied, the influences on the cardiovascular control are still unknown. The aim of the study was to evaluate in stroke (ST) and cervical spondylotic myelopathy (CSM) patients: (1) the autonomic response during a traditional robotic-assisted BWSTT session of motor rehabilitation; (2) the effects of 30 daily sessions of BWSTT on cardiovascular regulation. The autonomic response was assessed through symbolic analysis of short-term heart rate variability in 11 pathologic subjects (5 ST and 6 CSM patients) whose motor skills were improved as a result of the rehabilitation therapy. Results showed variable individual responses to the rehabilitation session in ST patients at the beginning of the therapy. At the end of the rehabilitation process, the responses of ST patients were less variable and more similar to those previously observed in healthy subjects. CSM patients exhibited an exaggerated vagal response to the fastest walking phase during the first rehabilitative session. This abnormal response was limited after the last rehabilitative session. We conclude that robotic-assisted BWSTT is helpful in restoring cardiovascular control in rehabilitation-responsive ST patients and limiting vagal responses in rehabilitation-responsive CSM patients.

  19. The Effects of Low Dose Irradiation on Inflammatory Response Proteins in a 3D Reconstituted Human Skin Tissue Model

    Energy Technology Data Exchange (ETDEWEB)

    Varnum, Susan M.; Springer, David L.; Chaffee, Mary E.; Lien, Katie A.; Webb-Robertson, Bobbie-Jo M.; Waters, Katrina M.; Sacksteder, Colette A.

    2012-12-01

    Skin responses to moderate and high doses of ionizing radiation include the induction of DNA repair, apoptosis, and stress response pathways. Additionally, numerous studies indicate that radiation exposure leads to inflammatory responses in skin cells and tissue. However, the inflammatory response of skin tissue to low dose radiation (<10 cGy) is poorly understood. In order to address this, we have utilized a reconstituted human skin tissue model (MatTek EpiDerm FT) and assessed changes in 23 cytokines twenty-four and forty eight hours following treatment of skin with either 3 or 10 cGy low-dose of radiation. Three cytokines, IFN-γ, IL-2, MIP-1α, were significantly altered in response to low dose radiation. In contrast, seven cytokines were significantly altered in response to a high radiation dose of 200 cGy (IL-2, IL-10, IL-13, IFN-γ, MIP-1α, TNF α, and VEGF) or the tumor promoter 12-O-tetradecanoylphorbol 13-acetate (G-CSF, GM-CSF, IL-1α, IL-8, MIP-1α, MIP-1β, RANTES). Additionally, radiation induced inflammation appears to have a distinct cytokine response relative to the non-radiation induced stressor, TPA. Overall, these results indicate that there are subtle changes in the inflammatory protein levels following exposure to low dose radiation and this response is a sub-set of what is seen following a high dose in a human skin tissue model.

  20. Responsiveness of the Spanish Version of the “Skin Cancer Index”

    Directory of Open Access Journals (Sweden)

    M. de Troya-Martín

    2016-01-01

    Full Text Available Background. Skin Cancer Index (SCI is a specific questionnaire measuring health related quality of life (HRQL in patients with cervicofacial non-melanoma skin cancer (CFNMSC. The original scale has recently been adapted and validated into Spanish. Objectives. Evaluate the responsiveness of the Spanish version of SCI. Methods. Patients with CFNMSC candidate for surgical treatment were administered the questionnaire at time of diagnostic (t0, 7 days after surgery (t1, and 5 months after surgery (t2. The scale and subscales scores (C1: social/appearance, C2: emotional were then evaluated. Differences between t0-t1, t1-t2, and t0-t2 were determined and a gender-and-age segmented analysis was performed. Results. 88 patients, 54.8% male, mean age 62.5 years, completed the study. Differences between t0-t1 and t1-t2 scores were statistically significant (p<0.05. The lowest values were found at time of diagnosis and postsurgery. Women and patients under 65 years showed the lowest values at the three times. Limitations. Concrete geographic and cultural area. Clinical and histological variables are not analysed. Conclusions. Our results confirm responsiveness of the Spanish version of the SCI. Further development of the instrument in Spanish-speaking countries and populations will make it possible to extend worldwide research and knowledge horizons on skin cancer.

  1. Non-Invasive Measurement of Skin Microvascular Response during Pharmacological and Physiological Provocations.

    Directory of Open Access Journals (Sweden)

    Fredrik Iredahl

    Full Text Available Microvascular changes in the skin due to pharmacological and physiological provocations can be used as a marker for vascular function. While laser Doppler flowmetry (LDF has been used extensively for measurement of skin microvascular responses, Laser Speckle Contrast Imaging (LSCI and Tissue Viability Imaging (TiVi are novel imaging techniques. TiVi measures red blood cell concentration, while LDF and LSCI measure perfusion. Therefore, the aim of this study was to compare responses to provocations in the skin using these different techniques.Changes in skin microcirculation were measured in healthy subjects during (1 iontophoresis of sodium nitroprusside (SNP and noradrenaline (NA, (2 local heating and (3 post-occlusive reactive hyperemia (PORH using LDF, LSCI and TiVi.Iontophoresis of SNP increased perfusion (LSCI: baseline 40.9±6.2 PU; 10-min 100±25 PU; p<0.001 and RBC concentration (TiVi: baseline 119±18; 10-min 150±41 AU; p = 0.011. No change in perfusion (LSCI was observed after iontophoresis of NA (baseline 38.0±4.4 PU; 10-min 38.9±5.0 PU; p = 0.64, while RBC concentration decreased (TiVi: baseline 59.6±11.8 AU; 10-min 54.4±13.3 AU; p = 0.021. Local heating increased perfusion (LDF: baseline 8.8±3.6 PU; max 112±55 PU; p<0.001, LSCI: baseline 50.8±8.0 PU; max 151±22 PU; p<0.001 and RBC concentration (TiVi: baseline 49.2±32.9 AU; max 99.3±28.3 AU; p<0.001. After 5 minutes of forearm occlusion with prior exsanguination, a decrease was seen in perfusion (LDF: p = 0.027; LSCI: p<0.001 and in RBC concentration (p = 0.045. Only LSCI showed a significant decrease in perfusion after 5 minutes of occlusion without prior exsanguination (p<0.001. Coefficients of variation were lower for LSCI and TiVi compared to LDF for most responses.LSCI is more sensitive than TiVi for measuring microvascular changes during SNP-induced vasodilatation and forearm occlusion. TiVi is more sensitive to noradrenaline-induced vasoconstriction. LSCI and Ti

  2. Skin-conductance orienting response in chronic schizophrenics: the role of neuroleptics.

    Science.gov (United States)

    Spohn, H E; Coyne, L; Wilson, J K; Hayes, K

    1989-11-01

    The primary aim of this study was to determine whether there is an association between neuroleptic treatment and skin-conductance orienting response (SCOR) nonresponding in chronic schizophrenics. In a design adapted to this purpose, we were unable to demonstrate a relationship between neuroleptics and nonresponding. Although inability to prove the null hypothesis precludes a claim that neuroleptic treatment and SCOR nonresponding are unrelated, internal evidence and prior studies strongly suggest that such a dissociation exists in most chronic schizophrenic nonresponders. We also found stable nonspecific and toxic skin conductance activity differences between SCOR "responders" and "nonresponders" on three occasions of testing. We interpret our results as bearing on state and trait issues in chronic schizophrenics.

  3. Cold pressor pain in skin picking disorder.

    Science.gov (United States)

    Grant, Jon E; Redden, Sarah A; Chamberlain, Samuel R

    2017-03-01

    Excoriation (skin-picking) disorder (SPD) is a disabling, under-recognized condition in which individuals repeatedly pick at their skin, leading to noticeable tissue damage. There has been no examination as to whether individuals with SPD have different pain thresholds or pain tolerances compared to healthy counterparts. Adults with SPD were examined on a variety of clinical measures including symptom severity and functioning. All participants underwent the cold pressor test. Heart rate, blood pressure, and self-reported pain were compared between SPD participants (n=14) and healthy controls (n=14). Adults with SPD demonstrated significantly dampened autonomic response to cold pressor pain as exhibited by reduced heart rate compared to controls (group x time interaction using repeated ANOVA F=3.258, p<0.001). There were no significant differences between the groups in terms of overall pain tolerance (measured in seconds), recovery time, or blood pressure. SPD symptom severity was not significantly associated with autonomic response in the patients. In this study, adults with SPD exhibited a dampened autonomic response to pain while reporting pain intensity similar to that reported by the controls. The lack of an autonomic response may explain why the SPD participants continue a behavior that they cognitively find painful and may offer options for future interventions.

  4. Autonomic Nervous System Responses to Viewing Green and Built Settings: Differentiating Between Sympathetic and Parasympathetic Activity.

    Science.gov (United States)

    van den Berg, Magdalena M H E; Maas, Jolanda; Muller, Rianne; Braun, Anoek; Kaandorp, Wendy; van Lien, René; van Poppel, Mireille N M; van Mechelen, Willem; van den Berg, Agnes E

    2015-12-14

    This laboratory study explored buffering and recovery effects of viewing urban green and built spaces on autonomic nervous system activity. Forty-six students viewed photos of green and built spaces immediately following, and preceding acute stress induction. Simultaneously recorded electrocardiogram and impedance cardiogram signal was used to derive respiratory sinus arrhythmia (RSA) and pre-ejection period (PEP), indicators of respectively parasympathetic and sympathetic activity. The findings provide support for greater recovery after viewing green scenes, as marked by a stronger increase in RSA as a marker of parasympathetic activity. There were no indications for greater recovery after viewing green scenes in PEP as a marker of sympathetic activity, and there were also no indications of greater buffering effects of green space in neither RSA nor PEP. Overall, our findings are consistent with a predominant role of the parasympathetic nervous system in restorative effects of viewing green space.

  5. Autonomic nervous system response to L-dopa in patients with advanced Parkinson's disease.

    Science.gov (United States)

    Ruonala, Verneri; Tarvainen, Mika P; Karjalainen, Pasi A; Pekkonen, Eero; Rissanen, Saara M

    2015-01-01

    Levodopa is the main treatment method for reducing the symptoms of Parkinson's disease. Whereas it reduces the motor symptoms efficiently, its effect on autonomous nervous system is not clear. The information about effect of levodopa on heart rate variability is not coherent between the studies. In this study, ECG of 11 patients with Parkinson's disease was measured during levodopa challenge with pronounced dose of fast release levodopa to ensure the positive drug effect for deep brain stimulation treatment. Heart rate variability analysis was done at three time points, before administration of levodopa, 30 and 60 minutes after administration. After 30 minutes of administration, the HRV parameters show that parasympathetic nervous system activity is decreased and the sympatho-vagal balance is shifted towards sympathetic control. At 60 minutes after administration the parasympathetic nervous system activates slightly and causes a decrease in heart rate.

  6. Possible role of the histaminergic system in autonomic and cardiovascular responses to neuropeptide Y.

    Science.gov (United States)

    Tanida, Mamoru; Shen, Jiao; Nagai, Katsuya

    2009-02-01

    Previous studies have demonstrated that neuropeptide Y (NPY) affects blood pressure (BP) in anesthetized rats. Here, we examined the effects of the third cerebral ventricular (3CV) injection of various doses of NPY on renal sympathetic nerve activity (RSNA) and BP in anesthetized rats. 3CV injection of NPY suppressed RSNA and BP in a dose-dependent manner. Moreover, suppressing effects of NPY on RSNA and BP were eliminated by lateral cerebral ventricular (LCV) preinjection of thioperamide, an antagonist of histaminergic H3-receptor, not diphenhydramine, an antagonist of histaminergic H1-receptor. In addition, 3CV injection of NPY accelerated gastric vagal nerve activity (GVNA) and inhibited brown adipose tissue sympathetic nerve activity (BAT-SNA) of anesthetized rats, and lowered brown adipose tissue temperature (BAT-T) of conscious rats. Thus, these evidences suggest that central NPY affects autonomic nerves containing RSNA, GVNA or BAT-SNA, and BP by mediating central histaminergic H3-receptors.

  7. Autonomic Nervous System Responses to Viewing Green and Built Settings: Differentiating Between Sympathetic and Parasympathetic Activity

    Science.gov (United States)

    van den Berg, Magdalena M.H.E.; Maas, Jolanda; Muller, Rianne; Braun, Anoek; Kaandorp, Wendy; van Lien, René; van Poppel, Mireille N.M.; van Mechelen, Willem; van den Berg, Agnes E.

    2015-01-01

    This laboratory study explored buffering and recovery effects of viewing urban green and built spaces on autonomic nervous system activity. Forty-six students viewed photos of green and built spaces immediately following, and preceding acute stress induction. Simultaneously recorded electrocardiogram and impedance cardiogram signal was used to derive respiratory sinus arrhythmia (RSA) and pre-ejection period (PEP), indicators of respectively parasympathetic and sympathetic activity. The findings provide support for greater recovery after viewing green scenes, as marked by a stronger increase in RSA as a marker of parasympathetic activity. There were no indications for greater recovery after viewing green scenes in PEP as a marker of sympathetic activity, and there were also no indications of greater buffering effects of green space in neither RSA nor PEP. Overall, our findings are consistent with a predominant role of the parasympathetic nervous system in restorative effects of viewing green space. PMID:26694426

  8. Autonomic Nervous System Responses to Viewing Green and Built Settings: Differentiating Between Sympathetic and Parasympathetic Activity

    Directory of Open Access Journals (Sweden)

    Magdalena M.H.E. van den Berg

    2015-12-01

    Full Text Available This laboratory study explored buffering and recovery effects of viewing urban green and built spaces on autonomic nervous system activity. Forty-six students viewed photos of green and built spaces immediately following, and preceding acute stress induction. Simultaneously recorded electrocardiogram and impedance cardiogram signal was used to derive respiratory sinus arrhythmia (RSA and pre-ejection period (PEP, indicators of respectively parasympathetic and sympathetic activity. The findings provide support for greater recovery after viewing green scenes, as marked by a stronger increase in RSA as a marker of parasympathetic activity. There were no indications for greater recovery after viewing green scenes in PEP as a marker of sympathetic activity, and there were also no indications of greater buffering effects of green space in neither RSA nor PEP. Overall, our findings are consistent with a predominant role of the parasympathetic nervous system in restorative effects of viewing green space.

  9. Autonomic substrates of the response to pups in male prairie voles.

    Directory of Open Access Journals (Sweden)

    William M Kenkel

    Full Text Available Caregiving by nonparents (alloparenting and fathers is a defining aspect of human social behavior, yet this phenomenon is rare among mammals. Male prairie voles (Microtus ochrogaster spontaneously exhibit high levels of alloparental care, even in the absence of reproductive experience. In previous studies, exposure to a pup was selectively associated with increased activity in oxytocin and vasopressin neurons along with decreased plasma corticosterone. In the present study, physiological, pharmacological and neuroanatomical methods were used to explore the autonomic and behavioral consequences of exposing male prairie voles to a pup. Reproductively naïve, adult male prairie voles were implanted with radiotransmitters used for recording ECG, temperature and activity. Males responded with a sustained increase in heart-rate during pup exposure. This prolonged increase in heart rate was not explained by novelty, locomotion or thermoregulation. Although heart rate was elevated during pup exposure, respiratory sinus arrhythmia (RSA did not differ between these males and males exposed to control stimuli indicating that vagal inhibition of the heart was maintained. Blockade of beta-adrenergic receptors with atenolol abolished the pup-induced heart rate increase, implicating sympathetic activity in the pup-induced increase in heart rate. Blockade of vagal input to the heart delayed the males' approach to the pup. Increased activity in brainstem autonomic regulatory nuclei was also observed in males exposed to pups. Together, these findings suggest that exposure to a pup activates both vagal and sympathetic systems. This unique physiological state (i.e. increased sympathetic excitation of the heart, while maintaining some vagal cardiac tone associated with male caregiving behavior may allow males to both nurture and protect infants.

  10. Autonomous Star Tracker Algorithms

    DEFF Research Database (Denmark)

    Betto, Maurizio; Jørgensen, John Leif; Kilsgaard, Søren

    1998-01-01

    Proposal, in response to an ESA R.f.P., to design algorithms for autonomous star tracker operations.The proposal also included the development of a star tracker breadboard to test the algorithms performances.......Proposal, in response to an ESA R.f.P., to design algorithms for autonomous star tracker operations.The proposal also included the development of a star tracker breadboard to test the algorithms performances....

  11. Standardization of a computerized method for calculating autonomic function test responses in healthy subjects and patients with diabetes mellitus

    Directory of Open Access Journals (Sweden)

    C. Neumann

    1997-02-01

    Full Text Available The objectives of the present study were 1 to compare results obtained by the traditional manual method of measuring heart rate (HR and heart rate response (HRR to the Valsalva maneuver, standing and deep breathing, with those obtained using a computerized data analysis system attached to a standard electrocardiograph machine; 2 to standardize the responses of healthy subjects to cardiovascular tests, and 3 to evaluate the response to these tests in a group of patients with diabetes mellitus (DM. In all subjects (97 healthy and 143 with DM we evaluated HRR to deep breathing, HRR to standing, HRR to the Valsalva maneuver, and blood pressure response (BPR to standing up and to a sustained handgrip. Since there was a strong positive correlation between the results obtained with the computerized method and the traditional method, we conclude that the new method can replace the traditional manual method for evaluating cardiovascular responses with the advantages of speed and objectivity. HRR and BPR of men and women did not differ. A correlation between age and HRR was observed for standing (r = -0.48, P<0.001 and deep breathing (r = -0.41, P<0.002. Abnormal BPR to standing was usually observed only in diabetic patients with definite and severe degrees of autonomic neuropathy.

  12. Responsiveness of the Spanish Version of the “Skin Cancer Index”

    Science.gov (United States)

    Rivas-Ruiz, F.; Blázquez-Sánchez, N.; Fernández-Canedo, I.; Aguilar-Bernier, M.; Repiso-Jiménez, J. B.; Toribio-Montero, J. C.; Jones-Caballero, M.; Rhee, J.

    2016-01-01

    Background. Skin Cancer Index (SCI) is a specific questionnaire measuring health related quality of life (HRQL) in patients with cervicofacial non-melanoma skin cancer (CFNMSC). The original scale has recently been adapted and validated into Spanish. Objectives. Evaluate the responsiveness of the Spanish version of SCI. Methods. Patients with CFNMSC candidate for surgical treatment were administered the questionnaire at time of diagnostic (t0), 7 days after surgery (t1), and 5 months after surgery (t2). The scale and subscales scores (C1: social/appearance, C2: emotional) were then evaluated. Differences between t0-t1, t1-t2, and t0-t2 were determined and a gender-and-age segmented analysis was performed. Results. 88 patients, 54.8% male, mean age 62.5 years, completed the study. Differences between t0-t1 and t1-t2 scores were statistically significant (p Spanish version of the SCI. Further development of the instrument in Spanish-speaking countries and populations will make it possible to extend worldwide research and knowledge horizons on skin cancer.

  13. Low-dose radiation modifies skin response to acute gamma-rays and protons.

    Science.gov (United States)

    Mao, Xiao Wen; Pecaut, Michael J; Cao, Jeffrey D; Moldovan, Maria; Gridley, Daila S

    2013-01-01

    The goal of the present study was to obtain pilot data on the effects of protracted low-dose/low-dose-rate (LDR) γ-rays on the skin, both with and without acute gamma or proton irradiation (IR). Six groups of C57BL/6 mice were examined: a) 0 Gy control, b) LDR, c) Gamma, d) LDR+Gamma, e) Proton, and f) LDR+Proton. LDR radiation was delivered to a total dose of 0.01 Gy (0.03 cGy/h), whereas the Gamma and Proton groups received 2 Gy (0.9 Gy/min and 1.0 Gy/min, respectively). Assays were performed 56 days after exposure. Skin samples from all irradiated groups had activated caspase-3, indicative of apoptosis. The significant (pGamma and Proton groups were not present when LDR pre-exposure was included. However, the terminal deoxynucleotidyl transferase dUTP nick-end labeling assay for DNA fragmentation and histological examination of hematoxylin and eosin-stained sections revealed no significant differences among groups, regardless of radiation regimen. The data demonstrate that caspase-3 activation initially triggered by both forms of acute radiation was greatly elevated in the skin nearly two months after whole-body exposure. In addition, LDR γ-ray priming ameliorated this response.

  14. Rubbing test responses of the skin to man-made mineral fibres of different diameters.

    Science.gov (United States)

    Stam-Westerveld, E B; Coenraads, P J; van der Valk, P G; de Jong, M C; Fidler, V

    1994-07-01

    The irritant potency of 5 types of insulation wools (2 types of rockwool and 3 types of glasswool) were studied on the basis of their differences in diameter by a standardized rubbing test. Assessment was done by laser Doppler flowmetry (LDF) and erythema scores. Insulation wools show a wide distribution of the diameter around the mean. Of the rockwool material, 30% consisted of small grains, called "shot". The control test site did not change over time; thus, the rubbing procedure itself does not seem to contribute to the skin reactions. All fibre types proved to be irritant to the skin. The irritant reactions did not correspond with the mean diameter, although the fibre type with the smallest diameter was the least irritant and the fibre type with the largest diameter the strongest. The presence of "shot" had a significant effect on the LDF responses. "Shot" and the distribution around the mean diameter may play a role in eliciting the skin irritation by insulation wools.

  15. Biological and metabolic response in STS-135 space-flown mouse skin.

    Science.gov (United States)

    Mao, X W; Pecaut, M J; Stodieck, L S; Ferguson, V L; Bateman, T A; Bouxsein, M L; Gridley, D S

    2014-08-01

    There is evidence that space flight condition-induced biological damage is associated with increased oxidative stress and extracellular matrix (ECM) remodeling. To explore possible mechanisms, changes in gene expression profiles implicated in oxidative stress and in ECM remodeling in mouse skin were examined after space flight. The metabolic effects of space flight in skin tissues were also characterized. Space Shuttle Atlantis (STS-135) was launched at the Kennedy Space Center on a 13-day mission. Female C57BL/6 mice were flown in the STS-135 using animal enclosure modules (AEMs). Within 3-5 h after landing, the mice were euthanized and skin samples were harvested for gene array analysis and metabolic biochemical assays. Many genes responsible for regulating production and metabolism of reactive oxygen species (ROS) were significantly (p 1.5 compared to AEM control. For ECM profile, several genes encoding matrix and metalloproteinases involved in ECM remodeling were significantly up-/down-regulated following space flight. To characterize the metabolic effects of space flight, global biochemical profiles were evaluated. Of 332 named biochemicals, 19 differed significantly (p space flight skin samples and AEM ground controls, with 12 up-regulated and 7 down-regulated including altered amino acid, carbohydrate metabolism, cell signaling, and transmethylation pathways. Collectively, the data demonstrated that space flight condition leads to a shift in biological and metabolic homeostasis as the consequence of increased regulation in cellular antioxidants, ROS production, and tissue remodeling. This indicates that astronauts may be at increased risk for pathophysiologic damage or carcinogenesis in cutaneous tissue.

  16. Bioimpedance-Based Wearable Measurement Instrumentation for Studying the Autonomic Nerve System Response to Stressful Working Conditions

    Science.gov (United States)

    Ferreira, J.; Álvarez, L.; Buendía, R.; Ayllón, D.; Llerena, C.; Gil-Pita, R.; Seoane, F.

    2013-04-01

    The assessment of mental stress on workers under hard and stressful conditions is critical to identify which workers are not ready to undertake a mission that might put in risk their own life and the life of others. The ATREC project aims to enable Real Time Assessment of Mental Stress of the Spanish Armed Forces during military activities. Integrating sensors with garments and using wearable measurement devices, the following physiological measurements were recorded: heart and respiration rate, skin galvanic response as well as peripheral temperature. The measuring garments are the following: a sensorized glove, an upper-arm strap and a repositionable textrode chest strap system with 6 textrodes. The implemented textile-enabled instrumentation contains: one skin galvanometer, two temperature sensors, for skin and environmental, and an Impedance Cardiographer/Pneumographer containing a 1 channel ECG amplifier to record cardiogenic biopotentials. The implemented wearable systems operated accordingly to the specifications and are ready to be used for the mental stress experiments that will be executed in the coming phases of the project in healthy volunteers.

  17. Regulating Inflammation Using Acid-Responsive Electrospun Fibrous Scaffolds for Skin Scarless Healing

    Directory of Open Access Journals (Sweden)

    Ziming Yuan

    2014-01-01

    Full Text Available Skin injury in adult mammals brings about a series of events and inflammation in the wounded area is initiated first and provides lots of inflammatory factors, which is critical for the final scar formation. While the postinjured skin of fetus and nude mice heals scarlessly owing to the absence of inflammation or immunodeficient, we designed a feasible acid-responsive ibuprofen-loaded poly(L-lactide (PLLA fibrous scaffolds via doping sodium bicarbonate to prevent excessive inflammation and achieve scarless healing finally. The morphological results of in vivo experiments revealed that animals treated with acid-responsive ibuprofen-loaded PLLA fibrous scaffolds exhibited alleviative inflammation, accelerated healing process, and regulated collagen deposition via interference in the collagen distribution, the α-smooth muscle actin (α-SMA, and the basic fibroblast growth factor (bFGF expression. The lower ratios of collagen I/collagen III and TGF-β1/TGF-β3 and higher ratio of matrix metalloproteinase-1 (MMP-1/tissue inhibitor of metalloproteinase-1 (TIMP-1 in acid-responsive ibuprofen-loaded PLLA fibrous scaffolds group were confirmed by real-time qPCR as well. These results suggest that inhibiting the excessive inflammation will result in regular collagen distribution and appropriate ratio between the factors, which promote or suppress the scar formation, then decrease the scar area, and finally achieve the scarless healing.

  18. Regulating inflammation using acid-responsive electrospun fibrous scaffolds for skin scarless healing.

    Science.gov (United States)

    Yuan, Ziming; Zhao, Jingwen; Chen, Yigang; Yang, Zhili; Cui, Wenguo; Zheng, Qi

    2014-01-01

    Skin injury in adult mammals brings about a series of events and inflammation in the wounded area is initiated first and provides lots of inflammatory factors, which is critical for the final scar formation. While the postinjured skin of fetus and nude mice heals scarlessly owing to the absence of inflammation or immunodeficient, we designed a feasible acid-responsive ibuprofen-loaded poly(L-lactide) (PLLA) fibrous scaffolds via doping sodium bicarbonate to prevent excessive inflammation and achieve scarless healing finally. The morphological results of in vivo experiments revealed that animals treated with acid-responsive ibuprofen-loaded PLLA fibrous scaffolds exhibited alleviative inflammation, accelerated healing process, and regulated collagen deposition via interference in the collagen distribution, the α-smooth muscle actin (α-SMA), and the basic fibroblast growth factor (bFGF) expression. The lower ratios of collagen I/collagen III and TGF-β1/TGF-β3 and higher ratio of matrix metalloproteinase-1 (MMP-1)/tissue inhibitor of metalloproteinase-1 (TIMP-1) in acid-responsive ibuprofen-loaded PLLA fibrous scaffolds group were confirmed by real-time qPCR as well. These results suggest that inhibiting the excessive inflammation will result in regular collagen distribution and appropriate ratio between the factors, which promote or suppress the scar formation, then decrease the scar area, and finally achieve the scarless healing.

  19. Histone H3 Phosphorylation in Human Skin Histoculture as a Tool to Evaluate Patient’s Response to Antiproliferative Drugs

    Science.gov (United States)

    Ugarte, Fernando; Porth, Katherine; Sadekova, Svetlana

    2015-01-01

    Evaluation of patient’s response to chemotherapeutic drugs is often difficult and time consuming. Skin punch biopsies are easily accessible material that can be used for the evaluation of surrogate biomarkers of a patient’s response to a drug. In this study, we hypothesized that assessment of phosphorylated histone H3 in human skin punch biopsies could be used as a pharmacodynamics biomarker of patient’s response to the kinesin spindle protein inhibitor SCH2047069. To test this hypothesis, we used a human skin histoculture technique that allows culturing intact human skin in the presence of the drug. Human melanoma and skin histocultures were treated with SCH2047069, and the effect of the drug was assessed by increasing histone H3 phosphorylation using immunohistochemistry. Our results demonstrate that SCH2047069 has a significant effect on cell proliferation in human melanoma and skin histoculture and justify using human skin punch biopsies for evaluation of the pharmacodynamic changes induced by SCH2047069. ACRONYMS Histone subunit H3 (H3), Kinesin spindle protein (KSP), 5-ethynyl-2′-deoxyuridine (EDU), Dimethyl sulfoxide (DMSO), Formalin-fixed paraffin embedded (FFPE). PMID:26917945

  20. Situational reactivity of autonomic functions in schizophrenic patients.

    Science.gov (United States)

    Albus, M; Ackenheil, M; Engel, R R; Müller, F

    1982-06-01

    In a study designed to evaluate the state of arousal and the autonomic reactivity to experimental conditions in schizophrenic patients, 12 acute, unmedicated schizophrenic patients with paranoid hallucinatory symptomatology and 63 healthy normal control subjects were administered four standardized tasks: cold pressor test, noise, mental arithmetic, and active relaxation. Biochemical (norepinephrine and cortisol) and physiological (electromyogram, electroencephalogram, skin and conductance response, skin conductance level, finger pulse amplitude, finger temperature, heart rate, respiratory volume, pulse wave velocity, and electrogastrogram) parameters were measured simultaneously. Schizophrenic patients showed elevated levels of cortisol and norepinephrine, as well as heightened responsivity on measures of electromyographic activity, skin conductance level, and heart rate, throughout the trial, and reduced responsivity to conditions of stress. It is concluded that schizophrenic patients show higher nonspecific activation and reduced ability to react to external stimulation, perhaps induced by lack of inhibition of the reticular formation by the limbic system.

  1. 575 Photoaging Attenuates Skin Test Response to Histamine More Than Natural Aging

    OpenAIRE

    King, Monroe James; Fitzhugh, David; Lockey, Richard F.

    2012-01-01

    Background Clinical experience suggests that skin test reactivity is often decreased in photo-exposed skin versus sun-protected skin in older individuals. The current study was designed to address whether photoaging or natural aging of skin causes a greater diminution in skin test reponse. Methods Prick-puncture skin tests to histamine were performed on sun-exposed and sun-protected areas in younger (n = 61, age 20–50) and older (n = 63, age 60–87) adult volunteers who were recruited for skin...

  2. Catecholamines and diabetic autonomic neuropathy

    DEFF Research Database (Denmark)

    Hilsted, J

    1995-01-01

    In diabetic patients with autonomic neuropathy plasma noradrenaline concentration, used as an index of sympathetic nervous activity, is low. This decrease is, however, only found in patients with a long duration of diabetes with clinically severe autonomic neuropathy. This apparent insensitivity...... of plasma catecholamine measurements is not due to changes in the clearance of catecholamines in diabetic autonomic neuropathy. The physiological responses to infused adrenaline and to noradrenaline are enhanced, for noradrenaline mainly cardiovascular responses. Adrenoceptors (alpha and beta adrenoceptors...

  3. Laser speckle contrast imaging of skin blood perfusion responses induced by laser coagulation

    Energy Technology Data Exchange (ETDEWEB)

    Ogami, M; Kulkarni, R; Wang, H; Reif, R; Wang, R K [University of Washington, Department of Bioengineering, Seattle, Washington 98195 (United States)

    2014-08-31

    We report application of laser speckle contrast imaging (LSCI), i.e., a fast imaging technique utilising backscattered light to distinguish such moving objects as red blood cells from such stationary objects as surrounding tissue, to localise skin injury. This imaging technique provides detailed information about the acute perfusion response after a blood vessel is occluded. In this study, a mouse ear model is used and pulsed laser coagulation serves as the method of occlusion. We have found that the downstream blood vessels lacked blood flow due to occlusion at the target site immediately after injury. Relative flow changes in nearby collaterals and anastomotic vessels have been approximated based on differences in intensity in the nearby collaterals and anastomoses. We have also estimated the density of the affected downstream vessels. Laser speckle contrast imaging is shown to be used for highresolution and fast-speed imaging for the skin microvasculature. It also allows direct visualisation of the blood perfusion response to injury, which may provide novel insights to the field of cutaneous wound healing. (laser biophotonics)

  4. Laser speckle contrast imaging of skin blood perfusion responses induced by laser coagulation

    Science.gov (United States)

    Ogami, M.; Kulkarni, R.; Wang, H.; Reif, R.; Wang, R. K.

    2014-08-01

    We report application of laser speckle contrast imaging (LSCI), i.e., a fast imaging technique utilising backscattered light to distinguish such moving objects as red blood cells from such stationary objects as surrounding tissue, to localise skin injury. This imaging technique provides detailed information about the acute perfusion response after a blood vessel is occluded. In this study, a mouse ear model is used and pulsed laser coagulation serves as the method of occlusion. We have found that the downstream blood vessels lacked blood flow due to occlusion at the target site immediately after injury. Relative flow changes in nearby collaterals and anastomotic vessels have been approximated based on differences in intensity in the nearby collaterals and anastomoses. We have also estimated the density of the affected downstream vessels. Laser speckle contrast imaging is shown to be used for highresolution and fast-speed imaging for the skin microvasculature. It also allows direct visualisation of the blood perfusion response to injury, which may provide novel insights to the field of cutaneous wound healing.

  5. Syk/Src Pathway-Targeted Inhibition of Skin Inflammatory Responses by Carnosic Acid

    Directory of Open Access Journals (Sweden)

    Jueun Oh

    2012-01-01

    Full Text Available Carnosic acid (CA is a diterpene compound exhibiting antioxidative, anticancer, anti-angiogenic, anti-inflammatory, anti-metabolic disorder, and hepatoprotective and neuroprotective activities. In this study, the effect of CA on various skin inflammatory responses and its inhibitory mechanism were examined. CA strongly suppressed the production of IL-6, IL-8, and MCP-1 from keratinocyte HaCaT cells stimulated with sodium lauryl sulfate (SLS and retinoic acid (RA. In addition, CA blocked the release of nitric oxide (NO, tumor necrosis factor (TNF-α, and prostaglandin E2 (PGE2 from RAW264.7 cells activated by the toll-like receptor (TLR-2 ligands, Gram-positive bacterium-derived peptidoglycan (PGN and pam3CSK, and the TLR4 ligand, Gram-negative bacterium-derived lipopolysaccharide (LPS. CA arrested the growth of dermatitis-inducing Gram-positive and Gram-negative microorganisms such Propionibacterium acnes, Pseudomonas aeruginosa, and Staphylococcus aureus. CA also blocked the nuclear translocation of nuclear factor (NF-κB and its upstream signaling including Syk/Src, phosphoinositide 3-kinase (PI3K, Akt, inhibitor of κBα (IκBα kinase (IKK, and IκBα for NF-κB activation. Kinase assays revealed that Syk could be direct enzymatic target of CA in its anti-inflammatory action. Therefore, our data strongly suggest the potential of CA as an anti-inflammatory drug against skin inflammatory responses with Src/NF-κB inhibitory properties.

  6. Personality change at the intersection of autonomic arousal and stress.

    Science.gov (United States)

    Hart, Daniel; Eisenberg, Nancy; Valiente, Carlos

    2007-06-01

    We hypothesized that personality change in children can be predicted by the interaction of family risk with susceptibility to autonomic arousal and that children characterized by both high-risk families and highly reactive autonomic nervous systems tend to show maladaptive change. This hypothesis was tested in a 6-year longitudinal study in which personality-type prototypicality, problem behavior, and negative emotional intensity were measured at 2-year intervals. The results indicated that children who both had exaggerated skin conductance responses (a measure of autonomic reactivity) and were living in families with multiple risk factors were most likely to develop an undercontrolled personality type and to exhibit increases in problem behavior and negative emotional intensity. The implications of the results for understanding personality change are discussed.

  7. Exposed to events that never happen: Generalized unsafety, the default stress response, and prolonged autonomic activity.

    Science.gov (United States)

    Brosschot, Jos F; Verkuil, Bart; Thayer, Julian F

    2017-03-01

    Based on neurobiological and evolutionary arguments, the generalized unsafety theory of stress (GUTS) hypothesizes that the stress response is a default response, and that chronic stress responses are caused by generalized unsafety (GU), independent of stressors or their cognitive representation. Three highly prevalent conditions are particularly vulnerable to becoming 'compromised' in terms of GU, and carry considerable health risks: Thus, GUTS critically revises and expands stress theory, by focusing on safety instead of threat, and by including risk factors that have hitherto not been attributed to stress.

  8. Women with metabolic syndrome present different autonomic modulation and blood pressure response to an acute resistance exercise session compared with women without metabolic syndrome.

    Science.gov (United States)

    Tibana, Ramires A; Boullosa, Daniel A; Leicht, Anthony S; Prestes, Jonato

    2013-09-01

    Metabolic syndrome (MetS) is a cluster of risk factors in individuals with high risk of diabetes and heart disease. Resistance training (RT) has been proposed to be a safe, effective and worthwhile method for the prevention and treatment of metabolic and cardiovascular diseases. However, no study has analysed the acute response of blood pressure (BP) and autonomic control of heart rate (HR) after a RT session in female patients with MetS. The aim of the present study was to analyse the response of laboratory assessed and ambulatory BP and cardiac autonomic modulation after a RT session in women with MetS. Nine women without MetS (35.0 ± 6.7 years) and 10 women with MetS (34.1 ± 9.4 years) completed one experimental exercise session and a control session. Laboratory BP, heart rate variability (HRV) and ambulatory BP of each subject were measured at rest, over 60 min, and for 24 h after the end of the sessions, respectively. There was a significant reduction in systolic blood pressure (SBP), night time diastolic blood pressure (DBP) and mean blood pressure (MBP) only for women with MetS, for all periods after the RT session when compared with the control session (Pwomen with MetS (Pwomen with MetS that may offer a cardio-protective effect. Women with MetS exhibited an impaired autonomic modulation at rest and a lower acute autonomic responsiveness to a RT session. The dissociation between BP and HRV responses suggests that other factors than autonomic control could be involved in the hypotensive effect of a RT session in MetS patients.

  9. The skin conductance orienting response in neuroleptic-free schizophrenics: replication of the scoring criteria effect.

    Science.gov (United States)

    Levinson, D F; Edelberg, R; Maricq, H R

    1985-06-01

    It has been suggested that the use of invalid scoring criteria might be responsible for the finding of excessive nonhabituation of the skin conductance orienting response (SCOR) in schizophrenia. Certain criteria may confuse SCOR and spontaneous SC activity in subjects with high rates of the latter (Levinson et al. 1984). To replicate this finding, data were reanalyzed from a study of 25 neuroleptic-free schizophrenic patients and 23 normal male subjects. Analysis of response latency and amplitude during a habituation paradigm of 11 78.5-dB tones confirmed the predictions. Broad scoring criteria (SCOR onset 1-5 sec poststimulus, and a three-no-response-trials habituation criterion) produced significantly different habituation scores than more restrictive criteria (1.6-3.0 sec latency window and a two-trials habituation criterion). Nonhabituation was scored in five patients and six normals by the former criteria, but in no patient and one normal by the latter. Nonhabituators, defined by using the broad criteria, had higher rates of spontaneous activity. The narrow latency window contained significantly more responses than could be explained by the spontaneous activity rate, but this was not true for the added time permitted by the broad window. It is concluded that the use of more restrictive scoring criteria may help to clarify the validity of SCOR nonresponse or hyporesponse as a marker for a type of schizophrenic illness.

  10. Autonomic cardiac regulation and morpho-physiological responses to eight week training preparation in junior soccer players

    Directory of Open Access Journals (Sweden)

    Michal Botek

    2014-09-01

    Full Text Available Background: Training preparation in soccer is thought to improve body composition and performance level, especially the maximal aerobic capacity (VO2max. However, an enhancement in performance may be attenuated by the increase of fatigue. Heart rate variability (HRV as a non-invasive index of autonomic nervous system (ANS activity has been considered to be a sensitive tool in fatigue assessment. Objective: This study was focused to evaluate the response of ANS activity and morpho-physiological parameters to eight week training preparation. Methods: Study included 12 trained soccer players aged 17.2 ± 1.2 years. Athletes underwent pre- and post-preparation testing that included the ANS activity assessment by spectral analysis of HRV in supine and upright position. Further, body composition was analyzed via electrical bio-impedance method and physiological parameters were assessed during maximal stress tests. ANS activity and subjective feeling of fatigue was assessed continuously within subsequent weeks of preparation. Results: No significant differences in all HRV variables within weeks were found. Pre vs. post analyses revealed a significant (p < .05 increase in body weight, fat free mass, body mass index, and peak power. A significant decline in mean maximal heart rate (HR and resting HR at standing was identified at the end of preparation. Since no significant changes between pre- post-preparation in the mean VO2max occurred, the positive correlation between the individual change in VO2max and the vagally related HRV [supine LnHF (r = .78, Ln rMSSD (r = .63, and the standing LnHF (r = .73, p < .05] was found. Conclusions: This study showed that an 8 week training program modified particularly fat free mass and short-term endurance, whereas both the autonomic cardiac regulation and the feeling of fatigue remained almost unaffected. Standing position seems to be more sensitive in terms of the HR response in relation to fatigue

  11. Assessing the sensitivity of human skin hyperspectral responses to increasing anemia severity levels

    Science.gov (United States)

    Baranoski, Gladimir V. G.; Dey, Ankita; Chen, Tenn F.

    2015-09-01

    Anemia is a prevalent medical condition that seriously affects millions of people all over the world. In many regions, not only its initial detection but also its monitoring are hindered by limited access to laboratory facilities. This situation has motivated the development of a wide range of optical devices and procedures to assist physicians in these tasks. Although noticeable progress has been achieved in this area, the search for reliable, low-cost, and risk-free solutions still continues, and the strengthening of the knowledge base about this disorder and its effects is essential for the success of these initiatives. We contribute to these efforts by closely examining the sensitivity of human skin hyperspectral responses (within and outside the visible region of the light spectrum) to reduced hemoglobin concentrations associated with increasing anemia severity levels. This investigation, which involves skin specimens with distinct biophysical and morphological characteristics, is supported by controlled in silico experiments performed using a predictive light transport model and measured data reported in the biomedical literature. We also propose a noninvasive procedure to be employed in the monitoring of this condition at the point-of-care.

  12. Modeling the Mechanical Response of In Vivo Human Skin Under a Rich Set of Deformations

    KAUST Repository

    Flynn, Cormac

    2011-03-11

    Determining the mechanical properties of an individual\\'s skin is important in the fields of pathology, biomedical device design, and plastic surgery. To address this need, we present a finite element model that simulates the skin of the anterior forearm and posterior upper arm under a rich set of three-dimensional deformations. We investigated the suitability of the Ogden and Tong and Fung strain energy functions along with a quasi-linear viscoelastic law. Using non-linear optimization techniques, we found material parameters and in vivo pre-stresses for different volunteers. The model simulated the experiments with errors-of-fit ranging from 13.7 to 21.5%. Pre-stresses ranging from 28 to 92 kPa were estimated. We show that using only in-plane experimental data in the parameter optimization results in a poor prediction of the out-of-plane response. The identifiability of the model parameters, which are evaluated using different determinability criteria, improves by increasing the number of deformation orientations in the experiments. © 2011 Biomedical Engineering Society.

  13. An Autonomous Attestation Token to Secure Mobile Agents in Disaster Response

    Science.gov (United States)

    Hein, Daniel M.; Toegl, Ronald

    Modern communication and computing devices have the potential to increase the efficiency of disaster response. Mobile agents are a decentralized and flexible technology to leverage this potential. While mobile agent platforms suffer from a greater variety of security risks than the classic client-server approach, Trusted Computing is capable of alleviating these problems. Unfortunately, Remote Attestation, a core concept of Trusted Computing, requires a powerful networked entity to perform trust decisions. The existence and availability of such a service in a disaster response scenario cannot be relied upon.

  14. Autonomic neuropathy

    DEFF Research Database (Denmark)

    Hilsted, J

    1983-01-01

    The diagnosis of autonomic neuropathy is often difficult to establish, since clinical symptoms generally appear late in the course of the disease, and may be non-specific. A number of recently developed quantifiable and reproducible autonomic nerve function tests are reviewed, with emphasis on th...

  15. Analysis of skin conductance response during evaluation of preferences for cosmetic products

    Science.gov (United States)

    Ohira, Hideki; Hirao, Naoyasu

    2015-01-01

    We analyzed skin conductance response (SCR) as a psychophysiological index to evaluate affective aspects of consumer preferences for cosmetic products. To examine the test-retest reliability of association between preferences and SCR, we asked 33 female volunteers to complete two experimental sessions approximately 1 year apart. The participants indicated their preferences in a typical paired comparison task by choosing the better option from a combination of two products among four products. We measured anticipatory SCR prior to expressions of the preferences. We found that the mean amplitude of the SCR elicited by the preferred products was significantly larger than that elicited by the non-preferred products. The participants' preferences and corresponding SCR patterns were well preserved at the second session 1 year later. Our results supported cumulating findings that SCR is a useful index of consumer preferences that has future potential, both in laboratory and marketing settings. PMID:25709593

  16. Value of sympathetic skin response test in the early diagnosis of diabetic neuropathy

    Institute of Scientific and Technical Information of China (English)

    黄一宁; 贾志荣; 石昕; 孙相如

    2004-01-01

    Background Diabetic neuropathy is common in diabetes mellitus. The early stage of diabetic neuropathy is often symptomless and difficult to be treated. The aim of this study was to assess the correlation between the results of the sympathetic skin response (SSR) test and the development of diabetic neuropathy, and explore the use of SSR as an objective basis for the early diagnosis of diabetic neuropathy.Methods The latencies and amplitudes of initiation and of the N and P waves were determined by SSR testing of the extremities of 80 diabetic patients and 30 healthy controls. Results The latencies of initiation and of the N and P waves were significantly (P0.05). All but two patients (97.5%) demonstrated abnormal SSR in at least one limb. Conclusions SSR can detect early dysfunction of the small sympathetic fibers in people affected by diabetes mellitus, and may be a useful electrophysiological test for the early diagnosis of diabetic neuropathy.

  17. A stress sensor based on Galvanic Skin Response (GSR) controlled by ZigBee.

    Science.gov (United States)

    Villarejo, María Viqueira; Zapirain, Begoña García; Zorrilla, Amaia Méndez

    2012-01-01

    Sometimes, one needs to control different emotional situations which can lead the person suffering them to dangerous situations, in both the medium and short term. There are studies which indicate that stress increases the risk of cardiac problems. In this study we have designed and built a stress sensor based on Galvanic Skin Response (GSR), and controlled by ZigBee. In order to check the device's performance, we have used 16 adults (eight women and eight men) who completed different tests requiring a certain degree of effort, such as mathematical operations or breathing deeply. On completion, we appreciated that GSR is able to detect the different states of each user with a success rate of 76.56%. In the future, we plan to create an algorithm which is able to differentiate between each state.

  18. Transcranial Doppler and cardiovascular responses during cardiovascular autonomic tests in migraineurs during and outside attacks

    DEFF Research Database (Denmark)

    Thomsen, L L; Iversen, Helle Klingenberg; Boesen, F;

    1995-01-01

    to a head-up tilt test, a cold-pressor test and a Valsalva manoeuvre. The cardiovascular reflexes in response to the Valsalva manoeuvre suggested a mild parasympathetic hypofunction in migraineurs, both those with and those without aura. On the basis of the present results and previous findings by others......, we conclude that mild parasympathetic hypofunctioning with preserved sympathetic functioning is an established finding in migraine both with and without aura....

  19. Sympathetic skin responses in hemiplegic patients with and without complex regional pain syndrome

    Directory of Open Access Journals (Sweden)

    Selçuk Barin

    2006-01-01

    Full Text Available Background and Aims: To investigate whether there were changes in the sympathetic skin responses (SSR in the limbs with complex regional pain syndrome (CRPS type I in hemiplegic patients. Setting: A physical medicine and rehabilitation center in Turkey . Materials and Methods: Sympathetic skin responses were evaluated in 69 stroke patients (41 with CRPS and 28 without CRPS and 20 healthy volunteers. SSR were recorded on the paretic and healthy hands after stimulation of the ipsilateral median nerve. Patients′ ages ranged from 33 to 77 years, with a mean of 60.0 ± 12.9 years. Results: The SSR were obtained in all patients with CRPS, whereas SSR was absent in 9 of 28 patients with hemiplegia who did not have CRPS after stimulation of the plegic side and the difference was statistically significant ( P =0.023. SSR amplitudes were increased at the hemiplegic limbs in patients affected by CRPS compared to individuals unaffected; this group difference was statistically significant ( P =0.014. The mean amplitude of the SSR in the advanced stage of CRPS was greater than lower stage and the difference was statistically significant ( P =0.035. Conclusion: Our results suggest that SSR can be obtained in stroke patients with CRPS even in the early stages of CRPS. SSR acquirability and amplitude increase as the stage of the disease advances. As an electrophysiologic technique, SSR may be used in the evaluation of the sympathetic function in hemiplegic patients and also in the diagnosis of CRPS and in monitoring of its treatment.

  20. Local Antiglycan Antibody Responses to Skin Stage and Migratory Schistosomula of Schistosoma japonicum.

    Science.gov (United States)

    Smit, Cornelis H; Kies, Christiaan L; McWilliam, Hamish E G; Meeusen, Els N T; Hokke, Cornelis H; van Diepen, Angela

    2015-10-12

    Schistosomiasis is a tropical disease affecting over 230 million people worldwide. Although effective drug treatment is available, reinfections are common, and development of immunity is slow. Most antibodies raised during schistosome infection are directed against glycans, some of which are thought to be protective. Developing schistosomula are considered most vulnerable to immune attack, and better understanding of local antibody responses raised against glycans expressed by this life stage might reveal possible glycan vaccine candidates for future vaccine research. We used antibody-secreting cell (ASC) probes to characterize local antiglycan antibody responses against migrating Schistosoma japonicum schistosomula in different tissues of rats. Analysis by shotgun Schistosoma glycan microarray resulted in the identification of antiglycan antibody response patterns that reflected the migratory pathway of schistosomula. Antibodies raised by skin lymph node (LN) ASC probes mainly targeted N-glycans with terminal mannose residues, Galβ1-4GlcNAc (LacNAc) and Galβ1-4(Fucα1-3)GlcNAc (LeX). Also, responses to antigenic and schistosome-specific glycosphingolipid (GSL) glycans containing highly fucosylated GalNAcβ1-4(GlcNAcβ1)n stretches that are believed to be present at the parasite's surface constitutively upon transformation were found. Antibody targets recognized by lung LN ASC probes were mainly N-glycans presenting GalNAcβ1-4GlcNAc (LDN) and GlcNAc motifs. Surprisingly, antibodies against highly antigenic multifucosylated motifs of GSL glycans were not observed in lung LN ASC probes, indicating that these antigens are not expressed in lung stage schistosomula or are not appropriately exposed to induce immune responses locally. The local antiglycan responses observed in this study highlight the stage- and tissue-specific expression of antigenic parasite glycans and provide insights into glycan targets possibly involved in resistance to S. japonicum infection.

  1. Evaluating Autonomic Parameters: The Role of ‎Sleep ‎Duration in Emotional Responses to Music ‎

    Directory of Open Access Journals (Sweden)

    Atefeh Goshvarpour

    2016-02-01

    Full Text Available Objective: It has been recognized that sleep has an important effect on emotion processing. The aim ‎of this study was to investigate the effect of previous night sleep duration on autonomicresponses to musical stimuli in different emotional contexts.‎Method: A frequency based measure of GSR, PR and ECG signals were examined in 35 healthy ‎students in three groups of oversleeping, lack of sleep and normal sleep. ‎Results: The results of this study revealed that regardless of the emotional context of the musical ‎stimuli (happy, relax, fear, and sadness, there was an increase in the maximum power of ‎GSR, ECG and PR during the music time compared to the rest time in all the three ‎groups. In addition, the higher value of these measures was achieved while the ‎participants listened to relaxing music. Statistical analysis of the extracted features ‎between each pair of emotional states revealed that the most significant differences ‎were attained for ECG signals. These differences were more obvious in the participants ‎with normal sleeping (p<10-18. The higher value of the indices has been shown, ‎comparing long sleep duration with the normal one.‎Conclusion: There was a strong relation between emotion and sleep duration, and this association can ‎be observed by means of the ECG signals.‎ 

  2. Sex-specific effects of intranasal oxytocin on autonomic nervous system and emotional responses to couple conflict

    Science.gov (United States)

    Nater, Urs M.; Schaer, Marcel; La Marca, Roberto; Bodenmann, Guy; Ehlert, Ulrike; Heinrichs, Markus

    2013-01-01

    Unhappy couple relationships are associated with impaired individual health, an effect thought to be mediated through ongoing couple conflicts. Little is known, however, about the underlying mechanisms regulating psychobiological stress, and particularly autonomic nervous system (ANS) reactivity, during negative couple interaction. In this study, we tested the effects of the neuropeptide oxytocin on ANS reactivity during couple conflict in a standardized laboratory paradigm. In a double-blind, placebo-controlled design, 47 heterosexual couples (total n = 94) received oxytocin or placebo intranasally prior to instructed couple conflict. Participants’ behavior was videotaped and salivary alpha-amylase (sAA), a measure of sympathetic activity, and emotional arousal were repeatedly measured during the experiment. Oxytocin significantly reduced sAA during couple conflict in women, whereas men showed increases in sAA levels (sex × group interaction: B = −49.36, t = −2.68, P = 0.009). In men, these increases were related to augmented emotional arousal (r = 0.286, P = 0.028) and more positive behavior (r = 0.291, P = 0.026), whereas there was no such association in women. Our results imply sex-specific effects of oxytocin on sympathetic activity, to negative couple interaction, with the neuropeptide reducing sAA responses and emotional arousal in women while increasing them in men. PMID:22842905

  3. Ensuring 3es and Responsiveness in the Delivery of Educational Services in the Autonomous Region in Muslim Mindanao, Philippines

    Directory of Open Access Journals (Sweden)

    Sapia Moalam Abdulrachman

    2013-08-01

    Full Text Available The Autonomous Region in Muslim Mindanao (ARMM is a public organization in the Philippines located in between the national government and the local governments. It performs unique functions quite distinct from other public organizations in the coun-try, as it performs both political and administrative functions. Using unobtrusive research design, as it relies on mostly secondary data, this paper analyzes the educational system in the region and proposes strategies in attaining administrative efficiency, economy, effectiveness and responsiveness. The paper starts with the introduction which consist of the background and statement of the problem. It is followed by a review of theoretical perspective and then by the research methodology. The fourth part portrays the findings of the study which include: DepEd ARMM resources; the management of DepEd ARMM, and the management outputs such as: net enrollment ratio, achievement rate and literacy rate. The fifth part of the paper deals with the analyses and conclusion. The paper concludes that in addition to certain structural innovation, inculcation of appropriate work ethics in accordance with the Ethi-cal Standards Act, the Anti-Corruption Law, the Civil Service Rules and Regulations as well as the Islamic Practices on Employment must be enshrined in the reform agenda. Finally, among other things that could facilitate the attainment of 3Es and R in the delivery of educational services is a strategy that requires the joint collaboration and teamwork between the civil society, non-government organizations and government organizations in the region.

  4. Inclusion of Height and Limb Length when Interpreting Sympathetic Skin Response

    Directory of Open Access Journals (Sweden)

    Mohamadreza Emad

    2016-01-01

    Full Text Available It is more than a decade since scientists are making use of sympathetic skin response (SSR as a clinical and research method to evaluate sympathetic nervous system. A major portion of the efferent pathway of this response is composed of non-myelinated nerves. Thus, the latency of the response may be significantly different in normal individuals with different height and limb lengths. This study was designed to investigate the effect of these parameters on the SSR results. We measured the height and limb length of 65 normal individuals with different heights (divided into 3 groups of height ≤150 cm, 150-170 cm, and ≥170 cm. The participants had neither peripheral nor central neuropathy. They also had none of the exclusion criteria. Then, they underwent SSR testing of both palms and soles. The correlation between the height and limb length in relation to SSR parameters (latency and amplitude was analyzed statistically by Pearson’s correlation. No significant correlation was detected between the height and limb length and the SSR amplitude. However, the results showed significant correlation between SSR latency recorded from all four sites (both palms and soles and the height of participants. Furthermore, there was a significant correlation between SSR latency recorded from any limb and the length of that limb. Regarding the significant effect of the height and limb length on the SSR latency, both the height and limb length should be considered when interpreting the results of SSR.

  5. Measurement of the force–displacement response of in vivo human skin under a rich set of deformations

    KAUST Repository

    Flynn, Cormac

    2011-06-01

    The non-linear, anisotropic, and viscoelastic properties of human skin vary according to location on the body, age, and individual. The measurement of skin\\'s mechanical properties is important in several fields including medicine, cosmetics, and forensics. In this study, a novel force-sensitive micro-robot applied a rich set of three-dimensional deformations to the skin surface of different areas of the arms of 20 volunteers. The force-displacement response of each area in different directions was measured. All tested areas exhibited a non-linear, viscoelastic, and anisotropic force-displacement response. There was a wide quantitative variation in the stiffness of the response. For the right anterior forearm, the ratio of the maximum probe reaction force to maximum probe displacement ranged from 0.44Nmm-1 to 1.45Nmm-1. All volunteers exhibited similar qualitative anisotropic characteristics. For the anterior right forearm, the stiffest force-displacement response was when the probe displaced along the longitudinal axis of the forearm. The response of the anterior left forearm was stiffest in a direction 20° to the longitudinal axis of the forearm. The posterior upper arm was stiffest in a direction 90° to the longitudinal axis of the arm. The averaged posterior upper arm response was less stiff than the averaged anterior forearm response. The maximum probe force at 1.3mm probe displacement was 0.69N for the posterior upper arm and 1.1N for the right anterior forearm. The average energy loss during the loading-unloading cycle ranged from 11.9% to 34.2%. This data will be very useful for studying the non-linear, anisotropic, and viscoelastic behaviour of skin and also for generating material parameters for appropriate constitutive models. © 2011 IPEM.

  6. Efficient capture of infected neutrophils by dendritic cells in the skin inhibits the early anti-leishmania response.

    Directory of Open Access Journals (Sweden)

    Flavia L Ribeiro-Gomes

    2012-02-01

    Full Text Available Neutrophils and dendritic cells (DCs converge at localized sites of acute inflammation in the skin following pathogen deposition by the bites of arthropod vectors or by needle injection. Prior studies in mice have shown that neutrophils are the predominant recruited and infected cells during the earliest stage of Leishmania major infection in the skin, and that neutrophil depletion promotes host resistance to sand fly transmitted infection. How the massive influx of neutrophils aimed at wound repair and sterilization might modulate the function of DCs in the skin has not been previously addressed. The infected neutrophils recovered from the skin expressed elevated apoptotic markers compared to uninfected neutrophils, and were preferentially captured by dermal DCs when injected back into the mouse ear dermis. Following challenge with L. major directly, the majority of the infected DCs recovered from the skin at 24 hr stained positive for neutrophil markers, indicating that they acquired their parasites via uptake of infected neutrophils. When infected, dermal DCs were recovered from neutrophil depleted mice, their expression of activation markers was markedly enhanced, as was their capacity to present Leishmania antigens ex vivo. Neutrophil depletion also enhanced the priming of L. major specific CD4(+ T cells in vivo. The findings suggest that following their rapid uptake by neutrophils in the skin, L. major exploits the immunosuppressive effects associated with the apoptotic cell clearance function of DCs to inhibit the development of acquired resistance until the acute neutrophilic response is resolved.

  7. Stress effects on mood, HPA axis, and autonomic response: comparison of three psychosocial stress paradigms.

    Science.gov (United States)

    Giles, Grace E; Mahoney, Caroline R; Brunyé, Tad T; Taylor, Holly A; Kanarek, Robin B

    2014-01-01

    Extensive experimental psychology research has attempted to parse the complex relationship between psychosocial stress, mood, cognitive performance, and physiological changes. To do so, it is necessary to have effective, validated methods to experimentally induce psychosocial stress. The Trier Social Stress Test (TSST) is the most commonly used method of experimentally inducing psychosocial stress, but it is resource intensive. Less resource intense psychosocial stress tasks include the Socially Evaluative Cold Pressor Task (SECPT) and a computerized mental arithmetic task (MAT). These tasks effectively produce a physiological and psychological stress response and have the benefits of requiring fewer experimenters and affording data collection from multiple participants simultaneously. The objective of this study was to compare the magnitude and duration of these three experimental psychosocial stress induction paradigms. On each of four separate days, participants completed either a control non-stressful task or one of the three experimental stressors: the TSST, SECPT, or MAT. We measured mood, working memory performance, salivary cortisol and alpha-amylase (AA), and heart rate. The TSST and SECPT exerted the most robust effects on mood and physiological measures. TSST effects were generally evident immediately post-stress as well as 10- and 20-minutes after stress cessation, whereas SECPT effects were generally limited to the duration of the stressor. The stress duration is a key determinant when planning a study that utilizes an experimental stressor, as researchers may be interested in collecting dependent measures prior to stress cessation. In this way, the TSST would allow the investigator a longer window to administer tasks of interest.

  8. Stress effects on mood, HPA axis, and autonomic response: comparison of three psychosocial stress paradigms.

    Directory of Open Access Journals (Sweden)

    Grace E Giles

    Full Text Available Extensive experimental psychology research has attempted to parse the complex relationship between psychosocial stress, mood, cognitive performance, and physiological changes. To do so, it is necessary to have effective, validated methods to experimentally induce psychosocial stress. The Trier Social Stress Test (TSST is the most commonly used method of experimentally inducing psychosocial stress, but it is resource intensive. Less resource intense psychosocial stress tasks include the Socially Evaluative Cold Pressor Task (SECPT and a computerized mental arithmetic task (MAT. These tasks effectively produce a physiological and psychological stress response and have the benefits of requiring fewer experimenters and affording data collection from multiple participants simultaneously. The objective of this study was to compare the magnitude and duration of these three experimental psychosocial stress induction paradigms. On each of four separate days, participants completed either a control non-stressful task or one of the three experimental stressors: the TSST, SECPT, or MAT. We measured mood, working memory performance, salivary cortisol and alpha-amylase (AA, and heart rate. The TSST and SECPT exerted the most robust effects on mood and physiological measures. TSST effects were generally evident immediately post-stress as well as 10- and 20-minutes after stress cessation, whereas SECPT effects were generally limited to the duration of the stressor. The stress duration is a key determinant when planning a study that utilizes an experimental stressor, as researchers may be interested in collecting dependent measures prior to stress cessation. In this way, the TSST would allow the investigator a longer window to administer tasks of interest.

  9. The heritability of the skin conductance orienting response: a longitudinal twin study.

    Science.gov (United States)

    Tuvblad, Catherine; Gao, Yu; Isen, Joshua; Botwick, Theodore; Raine, Adrian; Baker, Laura A

    2012-01-01

    The orienting response is a widely used experimental paradigm that reflects the association between electrodermal activity and psychological processes. The present study examined the genetic and environmental etiology of skin conductance orienting response (SCOR) magnitude in a sample of twins assessed at ages 9-10, 11-13 and 14-16 years. Structural equation modeling at each visit showed that genetic influences explained 56%, 83%, and 48% of the total variance in SCOR at visits 1, 2, and 3, respectively, with the remaining variance explained by non-shared environmental factors. SCOR was moderately stable across ages, with phenotypic correlations between time points ranging from .35 to .45. A common genetic factor explained 36%, 45% and 49% of the variance in SCOR magnitude across development. Additional age-specific genetic effects were found at ages 9-10 and 11-13 years, explaining 18% and 35% of the variance, respectively. The genetic correlations among the three time points were high, ranging from .55 to .73, indicating a substantial continuity in genetic influences from ages 9 to 16. These findings suggest that genetic factors are important influences in SCOR magnitude during late childhood and adolescence.

  10. Body visual discontinuity affects feeling of ownership and skin conductance responses.

    Science.gov (United States)

    Tieri, Gaetano; Tidoni, Emmanuele; Pavone, Enea Francesco; Aglioti, Salvatore Maria

    2015-01-01

    When we look at our hands we are immediately aware that they belong to us and we rarely doubt about the integrity, continuity and sense of ownership of our bodies. Here we explored whether the mere manipulation of the visual appearance of a virtual limb could influence the subjective feeling of ownership and the physiological responses (Skin Conductance Responses, SCRs) associated to a threatening stimulus approaching the virtual hand. Participants observed in first person perspective a virtual body having the right hand-forearm (i) connected by a normal wrist (Full-Limb) or a thin rigid wire connection (Wire) or (ii) disconnected because of a missing wrist (m-Wrist) or a missing wrist plus a plexiglass panel positioned between the hand and the forearm (Plexiglass). While the analysis of subjective ratings revealed that only the observation of natural full connected virtual limb elicited high levels of ownership, high amplitudes of SCRs were found also during observation of the non-natural, rigid wire connection condition. This result suggests that the conscious embodiment of an artificial limb requires a natural looking visual body appearance while implicit reactivity to threat may require physical body continuity, even non-naturally looking, that allows the implementation of protective reactions to threat.

  11. Reduced cardiac autonomic response to deep breathing: A heritable vulnerability trait in patients with schizophrenia and their healthy first-degree relatives.

    Science.gov (United States)

    Liu, Yu-Wen; Tzeng, Nian-Sheng; Yeh, Chin-Bin; Kuo, Terry B J; Huang, San-Yuan; Chang, Chuan-Chia; Chang, Hsin-An

    2016-09-30

    Reduced resting heart rate variability (HRV) has been observed in patients with schizophrenia and their relatives, suggesting genetic predispositions. However, findings have not been consistent. We assessed cardiac autonomic response to deep breathing in first-degree relatives of patients with schizophrenia (n=45; 26 female; aged 39.69±14.82 years). Data were compared to healthy controls (n=45; 26 female; aged 38.27±9.79 years) matched for age, gender, body mass index and physical activity as well as to unmedicated patients with acute schizophrenia (n=45; 25 female; aged 37.31±12.65 years). Electrocardiograms were recorded under supine resting and deep-breathing conditions (10-12breaths/min). We measured HRV components including variance, low-frequency (LF) power, which may reflect baroreflex function, high-frequency (HF) power, which reflects cardiac parasympathetic activity, and LF/HF ratio, which may reflect sympatho-vagal balance. Patients rather than relatives exhibited lower resting-state HRV (variance, LF, and HF) than controls. As expected, deep breathing induced an increase in variance and HF-HRV in controls. However, such a response was significantly reduced in both patients and their relatives. In conclusion, the diminished cardiac autonomic reactivity to deep breathing seen in patients and their unaffected relatives indicates that this pattern of cardiac autonomic dysregulation may be regarded as a genetic trait marker for schizophrenia.

  12. Long Term High Fat Diet Treatment: An Appropriate Approach to Study the Sex-Specificity of the Autonomic and Cardiovascular Responses to Obesity in Mice.

    Science.gov (United States)

    Bruder-Nascimento, Thiago; Ekeledo, Obioma J; Anderson, Ruchi; Le, Huy B; Belin de Chantemèle, Eric J

    2017-01-01

    Obesity-related cardiovascular disease (CVD) involves increased sympathetic activity in men and male animals. Although women exhibit increased visceral fat, metabolic disorders, inflammation and CVD with obesity, whether body weight gain affects autonomic control of cardiovascular function in females remain unknown. Due to the lack of adequate model to mimic the human pathology, this study aimed to develop a murine model, which would allow studying the sex-specificity of the response of the autonomic nervous system to obesity and identifying the origin of potential sex-differences. We tested the hypothesis that sexual dimorphisms in the autonomic response to obesity disappear in mice matched for changes in body weight, metabolic and inflammatory disorders. Male and female C57Bl/6 mice were submitted to control (CD) or high fat diet (HFD) for 24 weeks. Female mice gained more adipose mass and lost more lean mass than males but reached similar visceral adipose mass and body weight, as males, at the end of the diet. 24 weeks of HFD matched male and female mice for visceral adiposity, glycaemia, plasma insulin, lipids, and inflammatory cytokines levels, demonstrating the suitability of the model to study human pathology. HFD did not elevate BP, but similarly increased heart rate (HR) in males (CD: 571 ± 9 vs. HFD: 631 ± 14 bpm, P function in males and females, via sex-specific mechanisms and independent of fat distribution, metabolic disorder or inflammation.

  13. Enhanced insulin sensitivity mediated by adipose tissue browning perturbs islet morphology and hormone secretion in response to autonomic nervous activation in female mice.

    Science.gov (United States)

    Omar, Bilal A; Kvist-Reimer, Martina; Enerbäck, Sven; Ahrén, Bo

    2016-01-01

    Insulin resistance results in a compensatory increase in insulin secretion to maintain normoglycemia. Conversely, high insulin sensitivity results in reduced insulin secretion to prevent hypoglycemia. The mechanisms for this inverse adaptation are not well understood. We utilized highly insulin-sensitive mice, due to adipocyte-specific overexpression of the FOXC2 transcription factor, to study mechanisms of the reversed islet adaptation to increased insulin sensitivity. We found that Foxc2TG mice responded to mild hyperglycemia with insulin secretion significantly lower than that of wild-type mice; however, when severe hyperglycemia was induced, Foxc2TG mice demonstrated insulin secretion equal to or greater than that of wild-type mice. In response to autonomic nervous activation by 2-deoxyglucose, the acute suppression of insulin seen in wild-type mice was absent in Foxc2TG mice, suggesting impaired sympathetic signaling to the islet. Basal glucagon was increased in Foxc2TG mice, but they displayed severely impaired glucagon responses to cholinergic and autonomic nervous stimuli. These data suggest that the autonomic nerves contribute to the islet adaptation to high insulin sensitivity, which is compatible with a neuro-adipo regulation of islet function being instrumental for maintaining glucose regulation.

  14. Temporal aspects of tumorigenic response to individual and mixed carcinogens. Comprehensive progress report, June 1, 1975--May 31, 1978. [Mouse skin, rats, hamsters

    Energy Technology Data Exchange (ETDEWEB)

    Albert, R.E.; Burns, F.J.; Altshuler, B.

    1978-02-01

    The research proposed here is designed to obtain a better understanding of the temporal kinetics of tumor induction when one or more carcinogens are present simultaneously or sequentially for prolonged periods of time. Studies done to date under this contract have shown that carcinogenesis in mouse skin by polycyclic aromatic hydrocarbon carcinogens is consistent with the induction of dependent and autonomous cell transformations by the carcinogen followed by the conversion of autonomous tumor cells into malignancies at a rate which is determined by the level of carcinogen exposure. Dependent cell transformations remain latent in the skin unless expressed by a promoting agent. Dependent neoplasia appears to follow one-hit kinetics while malignancy is a multihit endpoint. Dose-related and time-related aspects of tumor induction are separable in the initiation-promotion system of mouse skin which along with rat skin and hamster lung is being used as a model for testing hypotheses. Results to date provide the basis for a new interpretation of the linear non-threshold extrapolation model. The broad aim of the study is to provide a basis or rationale for estimating risks associated with prolonged exposures to carcinogens found in the environment and to predict how different tissues and species respond to the same carcinogens.

  15. The effect of pertussis toxin and whole-cell pertussis vaccine on haemodynamics and autonomic responsiveness in the rat depends on route of administration and age.

    Science.gov (United States)

    van Amsterdam, J G; te Biesebeek, J D; van de Kuil, T; van der Laan, J W; Wemer, J; de Wildt, D J; Vleeming, W

    1998-04-01

    Vaccination of children with Diphtheria, Tetanus, Poliomyelitis and pertussis vaccine (DTPoP-vaccine) containing the whole-cell pertussis component is known to be associated with manifestation of side-effects such as acute encephalopathy, convulsions and hypotensive-hyporesponsive episodes. In young and adult rats the effects of pertussis toxin and DTPoP-vaccine on haemodynamics and autonomic responsiveness are evaluated following treatment with high dose via different routes of administration (s.c., i.p. and i.v.). The effect of pertussis toxin is dose-dependent (between 1 and 20 micrograms kg-1) and largest responses are observed after i.v. administration. At 20 micrograms kg-1, i.v. pertussis toxin decreases baseline diastolic blood pressure and increases baseline heart rate by 31% and inhibits autonomic responsiveness (salbutamol-induced increase in diastolic blood pressure and arecoline-induced decrease in heart rate). In adult rats DTPoP-vaccine induces generally more prominent effects than in young rats. In adult rats DTPoP-vaccine reduces baseline diastolic blood pressure by 25% while no response is observed in young rats. In adult rats DTPoP inhibits the adrenergic response though less compared to treatment of pertussis toxin. After treatment with DTPoP-vaccine (single or twice) only minor differences are observed between young and adult rats. Present results show that adult rats are more sensitive to pertussis toxin and pertussis vaccine than young rats and that the responses depend on the route of administration.

  16. An analysis of the skin conductance orienting response in samples of American, British, and German schizophrenics.

    Science.gov (United States)

    Bernstein, A S; Frith, C D; Gruzelier, J H; Patterson, T; Straube, E; Venables, P H; Zahn, T P

    1982-01-01

    The existing literature dealing with the phasic orienting response (OR) in schizophrenia, examining, for the most part, the skin conductance component (SCOR), reports conflicting results with divergent implications for the nature of the attentional dysfunction in these patients. The present authors have contributed to that literature and to its divergencies. The present report addresses this issue by applying a common set of response definitions and uniform statistical-analytic procedures to the previously gathered electrodermal data obtained independently in each author's laboratory. A total of 14 studies is involved, drawn from six laboratories in the U.S.A., the U.K., and West Germany. Collectively, these studies examine chronic and acute schizophrenics, males and females, those receiving neuroleptic drugs and those not receiving them, recording SCOR from either (or both) hands using a variety of instruments and somewhat differing instructions and conditions, to both auditory and visual stimuli of different intensities and rise-time properties. The authors' purpose is two-fold. First, to determine whether some 'universal' dysfunction can be demonstrated across laboratories, conditions, and samples. Given the heterogeneous origins of these data such a finding would offer fairly strong evidence of 'real' dysfunction in schizophrenia. Second, where disagreement exists, to describe the scope and nature of the disagreement, and to articulate more clearly the findings on each side of a disputed area. One such 'universal' dysfunction emerged. Consistently, schizophrenics displayed an abnormally high incidence of nonresponsiveness, involving nearly 50% of the schizophrenic sample on average. The next most common finding is that many of the schizophrenics who display an SCOR often habituate faster than do nonschizophrenic responders. This was seen in a majority of the studies and laboratories, but conflicting evidence was presented by a minority. Evidence for a

  17. Autonomic Responses to an Acute Bout of High-Intensity Body Weight Resistance Exercise vs. Treadmill Running.

    Science.gov (United States)

    Kliszczewicz, Brian M; Esco, Michael R; Quindry, John C; Blessing, Daniel L; Oliver, Gretchen D; Taylor, Kyle J; Price, Brandi M

    2016-04-01

    The aim of this study was to compare postexercise autonomic nervous system (ANS) recovery between a high-intensity training protocol (HITP) and high-intensity treadmill running (TM) in 10 physically fit males. For each trial, ANS activity was measured through the heart rate variability markers of log-transformed square root of the successive R-R differences (lnRMSSD) and high frequency power (lnHF). These markers were analyzed in 5-minute segments at 5-10 minutes of the pre-exercise period (PRE) and during the postexercise period at 15-20 minutes (POST15-20min), 20-25 minutes (POST20-25min), 25-30 minutes (POST25-30min), and 1 hour (POST60min). Plasma epinephrine (E) and norepinephrine (NE) were also examined at PRE, immediately post exercise (IPE), 1-hour post (1HP), and 2-hour post (2HP). The results of this study demonstrate a significant overall time-dependent decreases in lnRMSSD and lnHF (p = 0.003 and 0.001, respectively) in both trials. Trial-dependent differences were also observed in postexercise lnRMSSD and lnHF measures, HITP being significantly lower than TM (p = 0.002 and 0.000, respectively). lnRMSSD at POST60min-HITP remained significantly lower compared to PRE (p ≤ 0.05). lnHF returned to baseline in HIPT and TM (p = 0.081 and 0.065, respectively). A time-dependent increase in E and NE was observed in both trials at time point IPE when compared to PRE (p ≤ 0.05). E at 1HP and 2HP returned to near resting levels (p = 0.62, p = 0.26), whereas NE remained slightly elevated in both groups (p = 0.003, p = 0.021). A trial-dependent increase was observed with the HITP eliciting a greater E response (p = 0.025) and NE response (p = 0.03). The HITP causes a greater disruption of the ANS than intensity-matched TM exercise.

  18. Skin microvascular and metabolic response to pressure relief maneuvers in people with spinal cord injury

    Science.gov (United States)

    Ramella-Roman, Jessica C.; Le, Du V. N.; Ghassemi, Pejhman; Nguyen, Thu A.; Lichy, Alison; Groah, Suzanne

    2013-02-01

    Clinician's recommendations on wheelchair pressure reliefs in the context of the high prevalence of pressure ulcers that occur in people with spinal cord injury is not supported by strong experimental evidence. Some data indicates that altered tissue perfusion and oxygenation occurring under pressure loads, such as during sitting, induce various pathophysiologic changes that may lead to pressure ulcers. Pressure causes a cascade of responses, including initial tissue hypoxia, which leads to ischemia, vascular leakage, tissue acidification, compensatory angiogenesis, thrombosis, and hyperemia, all of which may lead to tissue damage. We have developed an advanced skin sensor that allows measurement of oxygenation in addition to perfusion, and can be safely used during sitting. The sensor consists of a set of fiber optics probes, spectroscopic and Laser Doppler techniques that are used to obtain parameters of interest. The overriding goal of this project is to develop the evidence base for clinical recommendations on pressure reliefs. In this paper we will illustrate the experimental apparatus as well as some preliminary results of a small clinical trial conducted at the National Rehabilitation Hospital.

  19. Botulinum toxin A for palmar hyperhidrosis: assessment with sympathetic skin responses evoked by train of stimuli.

    Science.gov (United States)

    Al-Hashel, J Y; Youssry, D; Rashaed, H M; Shamov, T; Rousseff, R T

    2016-07-01

    Objective assessment of the effect of botulinum toxin A (BT) treatment in primary palmar hyperhidrosis (PH) is attempted by different methods. We decided to use for this purpose sympathetic skin responses evoked by train of stimuli (TSSR). Twenty patients with severe PH (five female, median age 24, range 18-36) were examined regularly over 3 months after receiving 50 UI BT in each palm. TSSR were recorded from the palms after sensory stimulation by a train of three supramaximal electric pulses 3 millisecond apart. Results were compared to longitudinally studied TSSR of 20 healthy sex- and age-matched control subjects. All hyperhidrosis patients reported excellent improvement. TSSR amplitudes decreased at week 1 (mean 54% range 48%-67%) and over the following months in a clinically significant trend (slope R=-.82, P<.0001). TSSR in controls changed insignificantly (±13% from the baseline). The difference between patients and controls was highly significant at any time point (P<.001). This study suggests that TSSR may help in assessment of treatments in PH. It confirms objectively the efficacy of BT in PH.

  20. Evaluating the Efficacy of a Sternocleidomastoid Flap via Galvanic Skin Responses in Superficial Parotidectomy.

    Science.gov (United States)

    Basut, Oguz; Noyan, Behzat; Demirci, Ugur

    2014-01-01

    In the present study, we evaluated the efficacy of flaps via measurement of galvanic skin responses (GSR) in patients who had undergone superficial parotidectomy either with or without sternocleidomastoid (SCM) muscle flaps. Retrospective study design was used. The setting included University of Uludag School of Medicine Department of Otorhinolaryngology. Eleven patients who had undergone superficial parotidectomy for benign diseases in our clinic between June 2003 and August 2006 were included in the study. SCM muscle flaps were used in four patients. The GSR of the patients were measured using a MP 30 System. The Mann-Whitney U test was used for the analysis of data. There were complaints that resembled Frey's syndrome in three patients in whom flaps had not been performed. Patients with flaps had no complaints. In patients with flaps, no significant GSR changes were observed between the control and operated sides (P > 0.05). In patients without flaps, the GSR levels were significantly higher on the operated side compared to the control side (P SCM flap is an efficient method by which to prevent Frey's syndrome, and the GSR test is beneficial both in diagnosiing and determining the severity of the disease as well as evaluating the efficacy of surgical techniques used to prevent Frey's syndrome.

  1. The effect of occlusive and unocclusive exposure to xylene and benzene on skin irritation and molecular responses in hairless rats

    Energy Technology Data Exchange (ETDEWEB)

    Chatterjee, A.; Babu, R.J.; Ahaghotu, E.; Singh, M. [Florida A and M University, College of Pharmacy and Pharmaceutical Sciences, Tallahassee, FL (United States)

    2005-05-01

    Aromatic hydrocarbons readily penetrate the skin on dermal exposure, leading to irritation, inflammation and cytotoxicity. The effects of short-term occlusive and long-term unocclusive dermal exposure to benzene and xylene on the skin irritation response (transepidermal water loss (TEWL), skin moisture content and erythema) and cytokine/chemokine expression (interleukin-1{alpha} (IL-1{alpha}), tumor necrosis factor-{alpha} (TNF-{alpha}) and monocyte chemoattractant protein-1 (MCP-1)) were investigated in hairless rats. Occlusive dermal exposure was carried out with 230 {mu}L of the chemicals for 1 h using Hill top chambers. In unocclusive dermal exposure, 15 {mu}L of the chemicals were applied to the skin every 2 h, for 8 h a day, for 4 days. The occlusive dermal exposure revealed a clear difference in the TEWL and erythema response of these chemicals (xylene>benzene) whereas unocclusive exposure revealed similar TEWL and erythema scores for both benzene and xylene. The expression of IL-1{alpha} was elevated 2.5- and 3.8-fold in response to occlusive and unocclusive exposure, respectively, vs control (P<0.01) for both the chemicals (benzene and xylene). Similarly, TNF-{alpha} levels were elevated about 2.4- and 6.0-fold as a result of occlusive and unocclusive exposure, respectively, vs control (P<0.01). These results show that unocclusive exposure induced significantly higher TNF-{alpha} expression than occlusive exposure (P<0.05). The MCP-1 expression in blood was slightly elevated compared with the control group, but this increase was not statistically significant (P>0.05). Similarly, MCP levels in skin were increased approximately 1.7- and 1.8-fold by occlusive and unocclusive exposure, respectively, compared with the control group (P<0.05). Our study demonstrates that the skin irritation profiles of benzene and xylene are similar and unocclusive long-term exposure to small amounts of these chemicals can induce more skin irritation and cytokine response than

  2. Facial skin blood flow responses during exposures to emotionally charged movies.

    Science.gov (United States)

    Matsukawa, Kanji; Endo, Kana; Ishii, Kei; Ito, Momoka; Liang, Nan

    2017-01-21

    The changes in regional facial skin blood flow and vascular conductance have been assessed for the first time with noninvasive two-dimensional laser speckle flowmetry during audiovisually elicited emotional challenges for 2 min (comedy, landscape, and horror movie) in 12 subjects. Limb skin blood flow and vascular conductance and systemic cardiovascular variables were simultaneously measured. The extents of pleasantness and consciousness for each emotional stimulus were estimated by the subjective rating from -5 (the most unpleasant; the most unconscious) to +5 (the most pleasant; the most conscious). Facial skin blood flow and vascular conductance, especially in the lips, decreased during viewing of comedy and horror movies, whereas they did not change during viewing of a landscape movie. The decreases in facial skin blood flow and vascular conductance were the greatest with the comedy movie. The changes in lip, cheek, and chin skin blood flow negatively correlated (P blood flow and vascular conductance and systemic hemodynamics correlated with the subjective ratings. The mental arithmetic task did not alter facial and limb skin blood flows, although the task influenced systemic cardiovascular variables. These findings suggest that the more emotional status becomes pleasant or conscious, the more neurally mediated vasoconstriction may occur in facial skin blood vessels.

  3. Autonomous Evolutionary Information Systems

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Traditional information systems are passive, i.e., data orknowledge is created , retrieved, modified, updated, and deleted only in response to operations issued by users or application programs, and the systems only can execute queries or t ransactions explicitly submitted by users or application programs but have no ab ility to do something actively by themselves. Unlike a traditional information system serving just as a storehouse of data or knowledge and working passively a ccording to queries or transactions explicitly issued by users and application p rograms, an autonomous evolutionary information system serves as an autonomous a nd evolutionary partner of its users that discovers new knowledge from its datab ase or knowledge-base autonomously, cooperates with its users in solving proble m s actively by providing the users with advices, and has a certain mechanism to i mprove its own state of “knowing” and ability of “working”. This paper semi nall y defines what is an autonomous evolutionary information system, explain why aut onomous evolutionary information systems are needed, and presents some new issue s, fundamental considerations, and research directions in design and development of autonomous evolutionary information systems.

  4. Response-surface models for deterministic effects of localized irradiation of the skin by discrete {beta}/{gamma} -emitting sources

    Energy Technology Data Exchange (ETDEWEB)

    Scott, B.R.

    1995-12-01

    Individuals who work at nuclear reactor facilities can be at risk for deterministic effects in the skin from exposure to discrete {Beta}- and {gamma}-emitting ({Beta}{gamma}E) sources (e.g., {Beta}{gamma}E hot particles) on the skin or clothing. Deterministic effects are non-cancer effects that have a threshold and increase in severity as dose increases (e.g., ulcer in skin). Hot {Beta}{gamma}E particles are {sup 60}Co- or nuclear fuel-derived particles with diameters > 10 {mu}m and < 3 mm and contain at least 3.7 kBq (0.1 {mu}Ci) of radioactivity. For such {Beta}{gamma}E sources on the skin, it is the beta component of the dose that is most important. To develop exposure limitation systems that adequately control exposure of workers to discrete {Beta}{gamma}E sources, models are needed for systems that adequately control exposure of workers to discrete {Beta}{gamma}E sources, models are needed for evaluating the risk of deterministic effects of localized {Beta} irradiation of the skin. The purpose of this study was to develop dose-rate and irradiated-area dependent, response-surface models for evaluating risks of significant deterministic effects of localized irradiation of the skin by discrete {Beta}{gamma}E sources and to use modeling results to recommend approaches to limiting occupational exposure to such sources. The significance of the research results as follows: (1) response-surface models are now available for evaluating the risk of specific deterministic effects of localized irradiation of the skin; (2) modeling results have been used to recommend approaches to limiting occupational exposure of workers to {Beta} radiation from {Beta}{gamma}E sources on the skin or on clothing; and (3) the generic irradiated-volume, weighting-factor approach to limiting exposure can be applied to other organs including the eye, the ear, and organs of the respiratory or gastrointestinal tract and can be used for both deterministic and stochastic effects.

  5. Dissociated Emergent-Response System and Fine-Processing System in Human Neural Network and a Heuristic Neural Architecture for Autonomous Humanoid Robots

    Directory of Open Access Journals (Sweden)

    Xiaodan Yan

    2010-01-01

    Full Text Available The current study investigated the functional connectivity of the primary sensory system with resting state fMRI and applied such knowledge into the design of the neural architecture of autonomous humanoid robots. Correlation and Granger causality analyses were utilized to reveal the functional connectivity patterns. Dissociation was within the primary sensory system, in that the olfactory cortex and the somatosensory cortex were strongly connected to the amygdala whereas the visual cortex and the auditory cortex were strongly connected with the frontal cortex. The posterior cingulate cortex (PCC and the anterior cingulate cortex (ACC were found to maintain constant communication with the primary sensory system, the frontal cortex, and the amygdala. Such neural architecture inspired the design of dissociated emergent-response system and fine-processing system in autonomous humanoid robots, with separate processing units and another consolidation center to coordinate the two systems. Such design can help autonomous robots to detect and respond quickly to danger, so as to maintain their sustainability and independence.

  6. Skin barrier response to occlusion of healthy and irritated skin: differences in trans-epidermal water loss, erythema and stratum corneum lipids

    DEFF Research Database (Denmark)

    Jungersted, Jakob Mutanu; Høgh, Julie Kaae; Hellgren, Lars

    2010-01-01

    Occlusion of the skin is a risk factor for development of irritant contact dermatitis. Occlusion may, however, have a positive effect on skin healing. No consensus on the effect of occlusion has been reached.......Occlusion of the skin is a risk factor for development of irritant contact dermatitis. Occlusion may, however, have a positive effect on skin healing. No consensus on the effect of occlusion has been reached....

  7. Comparison of human skin opto-thermal response to near-infrared and visible laser irradiations: a theoretical investigation

    Energy Technology Data Exchange (ETDEWEB)

    Dai Tianhong [Department of Bioengineering, Rice University, Houston, TX 77251 (United States); Pikkula, Brian M [Department of Bioengineering, Rice University, Houston, TX 77251 (United States); Wang, Lihong V [Department of Biomedical Engineering, Texas A and M University, College Station, TX 77843 (United States); Anvari, Bahman [Department of Bioengineering, Rice University, Houston, TX 77251 (United States)

    2004-11-07

    Near-infrared wavelengths are absorbed less by epidermal melanin, and penetrate deeper into human skin dermis and blood than visible wavelengths. Therefore, laser irradiation using near-infrared wavelengths may improve the therapeutic outcome of cutaneous hyper-vascular malformations in moderately to heavily pigmented skin patients and those with large-sized blood vessels or blood vessels extending deeply into the skin. A mathematical model composed of a Monte Carlo algorithm to estimate the distribution of absorbed light, numerical solution of a bio-heat diffusion equation to calculate the transient temperature distribution, and a damage integral based on an empirical Arrhenius relationship to quantify the tissue damage was utilized to investigate the opto-thermal response of human skin to near-infrared and visible laser irradiations in conjunction with cryogen spray cooling. In addition, the thermal effects of a single continuous laser pulse and micropulse-composed laser pulse profiles were compared. Simulation results indicated that a 940 nm wavelength induces improved therapeutic outcome compared with a 585 and 595 nm wavelengths for the treatment of patients with large-sized blood vessels and moderately to heavily pigmented skin. On the other hand, a 585 nm wavelength shows the best efficacy in treating small-sized blood vessels, as characterized by the largest laser-induced blood vessel damage depth compared with 595 and 940 nm wavelengths. Dermal blood content has a considerable effect on the threshold incident dosage for epidermal damage, while the effect of blood vessel size is minimal. For the same macropulse duration and incident dosage, a micropulse-composed pulse profile results in higher peak temperature at the basal layer of skin epidermis than an ideal single continuous pulse profile.

  8. Visible Light Induces Melanogenesis in Human Skin through a Photoadaptive Response

    Science.gov (United States)

    Randhawa, Manpreet; Seo, InSeok; Liebel, Frank; Southall, Michael D.; Kollias, Nikiforos; Ruvolo, Eduardo

    2015-01-01

    Visible light (400–700 nm) lies outside of the spectral range of what photobiologists define as deleterious radiation and as a result few studies have studied the effects of visible light range of wavelengths on skin. This oversight is important considering that during outdoors activities skin is exposed to the full solar spectrum, including visible light, and to multiple exposures at different times and doses. Although the contribution of the UV component of sunlight to skin damage has been established, few studies have examined the effects of non-UV solar radiation on skin physiology in terms of inflammation, and limited information is available regarding the role of visible light on pigmentation. The purpose of this study was to determine the effect of visible light on the pro-pigmentation pathways and melanin formation in skin. Exposure to visible light in ex-vivo and clinical studies demonstrated an induction of pigmentation in skin by visible light. Results showed that a single exposure to visible light induced very little pigmentation whereas multiple exposures with visible light resulted in darker and sustained pigmentation. These findings have potential implications on the management of photo-aggravated pigmentary disorders, the proper use of sunscreens, and the treatment of depigmented lesions. PMID:26121474

  9. Dose response of retinol and isotretinoin in the prevention of nonmelanoma skin cancer recurrence.

    Science.gov (United States)

    Clouser, Mary C; Roe, Denise J; Foote, Janet A; Harris, Robin B; Alberts, David S

    2010-01-01

    Using data from a randomized, double blind, study of the efficacy of retinol or isotretinoin vs. placebo on recurrence of nonmelanoma skin cancer in high-risk subjects, a reanalysis of the original intent to treat analysis was performed in a dose-response format. Cox proportional hazards models describe the relationship between dose quartiles of isotretinoin and retinol use and time to first occurrence of squamous cell carcinoma (SCC) or basal cell carcinoma (BCC) in crude and adjusted models. Neither the isotretinoin nor retinol models showed any significance at any quartile for reduction in first BCC or SCC occurrence. Crude and adjusted retinol models show a statistically significant increase in risk of developing an SCC in the first quartile, whereas only the crude model shows a statistically significant increase in risk in the first quartile of the isotretinoin model. For retinol and SCC, hazard ratios (HRs) for the first quartile were as follows: HR = 2.92, 95% confidence interval (CI) = 1.67-5.10 crude; HR = 1.95, 95% CI = 1.00-3.80 adjusted. For isotretinoin and SCC, HRs for the first quartile were as follows: HR = 2.38, 95% CI = 1.35-4.19 crude; HR = 1.69, 95% CI = 0.87-3.31 adjusted. Test for trend was not significant in any of the models. These analyses confirm the results of the original intent to treat analyses and raise an interesting question related to the potential for increased risk for patients in the first quartile of retinol dose.

  10. Dorsal skin responses to subchronic ultraviolet B (UVB)-irradiation in Wistar-derived hypotrichotic WBN/ILA-Ht rats

    OpenAIRE

    2002-01-01

    Dorsal skin responses to a subchronic UVBirradiation (10kJ/m2/rat /day), were examined in Wistarderived hypotrichotic WBN/ILA-Ht rats for up to 3 months. Hyperplasia of epidermal cells and hair follicle epithelial cells as well as parakeratosis developed at 1 month and progressed thereafter, resulting in a prominent epidermis thickening and formation of epidermal ingrowths projecting into the dermis. At the same time, the percentage of proliferating cell nuclea...

  11. Force sensor in simulated skin and neural model mimic tactile SAI afferent spiking response to ramp and hold stimuli

    Directory of Open Access Journals (Sweden)

    Kim Elmer K

    2012-07-01

    Full Text Available Abstract Background The next generation of prosthetic limbs will restore sensory feedback to the nervous system by mimicking how skin mechanoreceptors, innervated by afferents, produce trains of action potentials in response to compressive stimuli. Prior work has addressed building sensors within skin substitutes for robotics, modeling skin mechanics and neural dynamics of mechanotransduction, and predicting response timing of action potentials for vibration. The effort here is unique because it accounts for skin elasticity by measuring force within simulated skin, utilizes few free model parameters for parsimony, and separates parameter fitting and model validation. Additionally, the ramp-and-hold, sustained stimuli used in this work capture the essential features of the everyday task of contacting and holding an object. Methods This systems integration effort computationally replicates the neural firing behavior for a slowly adapting type I (SAI afferent in its temporally varying response to both intensity and rate of indentation force by combining a physical force sensor, housed in a skin-like substrate, with a mathematical model of neuronal spiking, the leaky integrate-and-fire. Comparison experiments were then conducted using ramp-and-hold stimuli on both the spiking-sensor model and mouse SAI afferents. The model parameters were iteratively fit against recorded SAI interspike intervals (ISI before validating the model to assess its performance. Results Model-predicted spike firing compares favorably with that observed for single SAI afferents. As indentation magnitude increases (1.2, 1.3, to 1.4 mm, mean ISI decreases from 98.81 ± 24.73, 54.52 ± 6.94, to 41.11 ± 6.11 ms. Moreover, as rate of ramp-up increases, ISI during ramp-up decreases from 21.85 ± 5.33, 19.98 ± 3.10, to 15.42 ± 2.41 ms. Considering first spikes, the predicted latencies exhibited a decreasing trend as stimulus rate increased, as is

  12. Autonomic nervous system response patterns in freshmen with different resilience in a military university%某军校不同心理弹性水平的大一新生自主神经反应特点

    Institute of Scientific and Technical Information of China (English)

    张佳佳; 彭李; 李敏

    2011-01-01

    目的 研究不同心理弹性水平军校大学生自主神经反应特点.方法 采用成人心理弹性量表(resilience scale for adults,RSA)对重庆某军校大一新生进行心理测评,筛选出心理弹性高分组和低分组被试共144名,再从中选取愿意参加本实验的心理弹性高分组和低分组被试各27名,其进行自主神经反应(心率、皮电、皮温、指端血容振幅)特点的实验研究.结果 ①静息状态下,心理弹性高分组和低分组被试的自主神经反应没有统计学差异(P>0.05).②悲伤情绪诱导下,心理弹性高分组在皮电上低于心理弹性低分组(t=-2.077,P=0.043).③悲伤情绪诱导后,心理弹性高分组和心理弹性低分组的各个指标的恢复时间上均无统计学差异(P>0.05).结论 心理弹性水平不同的大学生的自主神经活动模式可能存在一定程度的差异.%Objective To investigate the autonomic nervous system response pattern in military college students with different levels of resilience. Methods Resilience Scale for Adults (R.SA) was applied to test 144 college students, and based on the RSA score 54 freshmen who accepted to join the test were selected and were divided into a high resilience group and a low resilience group. Each 27 freshmen of the two groups were tested for autonomic nervous system response pattern. Results ① At resting state, students of the high resilience group and low resilience group did not show significant differences in heart rate ( HR) , skin conductance (SC), skin temperature (ST) and blood volume pulse (BVP) (P>0. 05). ② Compared with those indices obtained at resting state, students of the high resilience group scored lower in HR, SC and ST under sad mood induction, but higher in BVP; students of the low resilience group scored higher in HR and SC under sad mood induction, but lower in ST and BVP. Sad mood induction showed that SC of the high resilience group was significantly lower than that of the

  13. Autonomic response to an experimental psychological stressor in healthy subjects: measurement of sympathetic, parasympathetic, and pituitary-adrenal parameters: test-retest reliability

    DEFF Research Database (Denmark)

    Jørgensen, L S; Christiansen, P; Raundahl, U

    1990-01-01

    A mental arithmetic test (the stressor; 15 min) significantly increased systolic and diastolic blood pressure, heart rate and plasma adrenaline by 11%, 12%, 28% and 152% respectively, with a prompt return to resting values after the test. Plasma noradrenaline and serum cortisol did not increase...... in systolic blood pressure and heart rate were significantly lower at retest. MSSD at stress, but not at rest, was significantly lower at retest. The mental arithmetic stress test as described here produces a sufficient autonomic response to make it viable for laboratory stress research. However, if repeated...

  14. Autonomic Neuropathy

    Science.gov (United States)

    ... harm. Alpha-lipoic acid Preliminary research suggests this antioxidant may be helpful in slowing or even reversing ... electrical waves transmitted through electrodes placed on the skin, may help ease pain associated with diabetic neuropathy. ...

  15. Altered cortical responsiveness to pain stimuli after high frequency electrical stimulation of the skin in patients with persistent pain after inguinal hernia repair

    NARCIS (Netherlands)

    Broeke, E.N. van den; Koeslag, L.; Arendsen, L.J.; Nienhuijs, S.W.; Rosman, C.; Rijn, C.M. van; Wilder-Smith, O.H.G.; Goor, H. van

    2013-01-01

    BACKGROUND: High Frequency electrical Stimulation (HFS) of the skin induces enhanced brain responsiveness expressed as enhanced Event-Related Potential (ERP) N1 amplitude to stimuli applied to the surrounding unconditioned skin in healthy volunteers. The aim of the present study was to investigate w

  16. Altered Cortical Responsiveness to Pain Stimuli after High Frequency Electrical Stimulation of the Skin in Patients with Persistent Pain after Inguinal Hernia Repair

    NARCIS (Netherlands)

    Broeke, E.N. van den; Koeslag, L.; Arendsen, L.J.; Nienhuijs, S.W.; Rosman, C.; Rijn, C.M. van

    2013-01-01

    Background High Frequency electrical Stimulation (HFS) of the skin induces enhanced brain responsiveness expressed as enhanced Event-Related Potential (ERP) N1 amplitude to stimuli applied to the surrounding unconditioned skin in healthy volunteers. The aim of the present study was to investigate wh

  17. Multiple helminth infection of the skin causes lymphocyte hypo-responsiveness mediated by Th2 conditioning of dermal myeloid cells.

    Directory of Open Access Journals (Sweden)

    Peter C Cook

    2011-03-01

    Full Text Available Infection of the mammalian host by schistosome larvae occurs via the skin, although nothing is known about the development of immune responses to multiple exposures of schistosome larvae, and/or their excretory/secretory (E/S products. Here, we show that multiple (4x exposures, prior to the onset of egg laying by adult worms, modulate the skin immune response and induce CD4(+ cell hypo-responsiveness in the draining lymph node, and even modulate the formation of hepatic egg-induced granulomas. Compared to mice exposed to a single infection (1x, dermal cells from multiply infected mice (4x, were less able to support lymph node cell proliferation. Analysis of dermal cells showed that the most abundant in 4x mice were eosinophils (F4/80(+MHC-II(-, but they did not impact the ability of antigen presenting cells (APC to support lymphocyte proliferation to parasite antigen in vitro. However, two other cell populations from the dermal site of infection appear to have a critical role. The first comprises arginase-1(+, Ym-1(+ alternatively activated macrophage-like cells, and the second are functionally compromised MHC-II(hi cells. Through the administration of exogenous IL-12 to multiply infected mice, we show that these suppressive myeloid cell phenotypes form as a consequence of events in the skin, most notably an enrichment of IL-4 and IL-13, likely resulting from an influx of RELMα-expressing eosinophils. We further illustrate that the development of these suppressive dermal cells is dependent upon IL-4Rα signalling. The development of immune hypo-responsiveness to schistosome larvae and their effect on the subsequent response to the immunopathogenic egg is important in appreciating how immune responses to helminth infections are modulated by repeated exposure to the infective early stages of development.

  18. Developmental and Metabolic Plasticity of White-Skinned Grape Berries in Response to Botrytis cinerea during Noble Rot.

    Science.gov (United States)

    Blanco-Ulate, Barbara; Amrine, Katherine C H; Collins, Thomas S; Rivero, Rosa M; Vicente, Ariel R; Morales-Cruz, Abraham; Doyle, Carolyn L; Ye, Zirou; Allen, Greg; Heymann, Hildegarde; Ebeler, Susan E; Cantu, Dario

    2015-12-01

    Noble rot results from exceptional infections of ripe grape (Vitis vinifera) berries by Botrytis cinerea. Unlike bunch rot, noble rot promotes favorable changes in grape berries and the accumulation of secondary metabolites that enhance wine grape composition. Noble rot-infected berries of cv Sémillon, a white-skinned variety, were collected over 3 years from a commercial vineyard at the same time that fruit were harvested for botrytized wine production. Using an integrated transcriptomics and metabolomics approach, we demonstrate that noble rot alters the metabolism of cv Sémillon berries by inducing biotic and abiotic stress responses as well as ripening processes. During noble rot, B. cinerea induced the expression of key regulators of ripening-associated pathways, some of which are distinctive to the normal ripening of red-skinned cultivars. Enhancement of phenylpropanoid metabolism, characterized by a restricted flux in white-skinned berries, was a common outcome of noble rot and red-skinned berry ripening. Transcript and metabolite analyses together with enzymatic assays determined that the biosynthesis of anthocyanins is a consistent hallmark of noble rot in cv Sémillon berries. The biosynthesis of terpenes and fatty acid aroma precursors also increased during noble rot. We finally characterized the impact of noble rot in botrytized wines. Altogether, the results of this work demonstrated that noble rot causes a major reprogramming of berry development and metabolism. This desirable interaction between a fruit and a fungus stimulates pathways otherwise inactive in white-skinned berries, leading to a greater accumulation of compounds involved in the unique flavor and aroma of botrytized wines.

  19. Response of pigmented porcine skin (Sus scrofa domestica) to single 3.8-micron laser radiation pulses

    Science.gov (United States)

    Bostick, Anthony C.; Johnson, Thomas E.; Randolph, Donald Q.; Winston, Golda C. H.

    2005-04-01

    Background and purpose: The purpose of this study is to determine the impact of melanin on skin response to single 3.8 micron, eight microsecond laser pulses and the difference in lesion formation thresholds for input into laser safety standards. Williams et al., performed a study examining laser tissue interaction from 3.8-micron lasers in lightly pigmented Yorkshire pigs (Sus scrofa domestica). However, studies performed by Eggleston et al comparing pigmented and lightly pigmented skin with human skin found that the Yucatan mini-pig is a superior model for laser skin exposures. Methods: Five Yucatan mini-pigs under general anesthesia were exposed to 3.8 micron laser pulses ranging from 0.8 J/cm2 to 93 J/cm2. Gross examinations were done acutely and 24 hours after laser exposure. Skin biopsies were then collected at various times post exposure, and histologic examinations were conducted. Results: The 24 hour ED50 was determined to be 4.5 J/cm2 with fiducial limits of 6.2 and 2.2 J/cm2. As deposited energy was increased, the lesion presentation ranged from whitening of the epidermis (4 J/cm2) to whitening with inflammatory centers (14 J/cm2), and at the highest energy levels inflammatory areas were replaced with an epidermal ulcerated central area (>21 J/cm2). Conclusion: Preliminary findings suggest pigmentation or melanin may play a minor role in the mechanism of laser-tissue damage. The ED50 of Yorkshire pigs was 2.6 J/cm2. The ED50 of the Yucatan mini-pig was found to be 3.6 J/cm2, and although it was higher, it is still within the 95% fiducial limits.

  20. Galvanic zinc-copper microparticles produce electrical stimulation that reduces the inflammatory and immune responses in skin.

    Science.gov (United States)

    Kaur, Simarna; Lyte, Peter; Garay, Michelle; Liebel, Frank; Sun, Ying; Liu, Jue-Chen; Southall, Michael D

    2011-10-01

    The human body has its own innate electrical system that regulates the body's functions via communications among organs through the well-known neural system. While the effect of low-level electrical stimulation on wound repair has been reported, few studies have examined the effect of electric potential on non-wounded, intact skin. A galvanic couple comprised of elemental zinc and copper was used to determine the effects of low-level electrical stimulation on intact skin physiology using a Dermacorder device. Zn-Cu induced the electrical potential recorded on intact skin, enhanced H(2)O(2) production and activated p38 MAPK and Hsp27 in primary keratinocytes. Treatment with Zn-Cu was also found to reduce pro-inflammatory cytokines, such as IL-1α, IL-2, NO and TNF-α in multiple cell types after stimulation with PHA or Propionibacterium acnes bacteria. The Zn-Cu complex led to a dose-dependent inhibition of TNF-α-induced NF-κB levels in keratinocytes as measured by a dual-luciferase promoter assay, and prevented p65 translocation to the nucleus observed via immunofluorescence. Suppression of NF-κB activity via crosstalk with p38 MAPK might be one of the potential pathways by which Zn-Cu exerted its inflammatory effects. Topical application of Zn-Cu successfully mitigated TPA-induced dermatitis and oxazolone-induced hypersensitivity in mice models of ear edema. Anti-inflammatory activity induced by the Zn-Cu galvanic couple appears to be mediated, at least in part, by production of low level of hydrogen peroxide since this activity is reversed by the addition of Catalase enzyme. Collectively, these results show that a galvanic couple containing Zn-Cu strongly reduces the inflammatory and immune responses in intact skin, providing evidence for the role of electric stimulation in non-wounded skin.

  1. IN SITU IMMUNE RESPONSE EVALUATION VIA IMMUNOHISTOCHEMISTRY IN SKIN BIOPSIES FROM PATIENTS AFFECTED BY AUTOIMMUNE BLISTERING DISEASES

    Directory of Open Access Journals (Sweden)

    Ana Maria Abreu Velez

    2013-11-01

    Full Text Available Introduction: The in situ immune response in skin biopsies from patients affected by autoimmune skin blistering diseases (ABD is not well characterized. Aim: Our investigation attempts to immunophenotype cells in lesional skin in several ABD, utilizing immunohistochemistry (ICH. Methods: We tested by IHC for CD4, CD8, CD19, CD20, CD45, CD56/NCAM, PAX-5, granzyme B, myeloperoxidase, neutrophil elastase, LAT and ZAP-70 in patients affected by ABD. We tested 30 patients with endemic pemphigus foliaceus (EPF, 15 controls from the EPF endemic area, and 15 biopsies from healthy controls from the USA. We also tested archival biopsies from patients with selected ABD, including 30 patients with bullous pemphigoid, 20 with pemphigus vulgaris, 8 with pemphigus foliaceus and 14 with dermatitis herpetiformis. Results: We found a predominantly CD8 positive/CD45 positive T cell infiltrate in all ABD. Our skin biopsies demonstrated consistently positive staining for myeloperoxidase, but negative staining for neutrophil elastase. Most ABD biopsies displayed negative staining for CD4 and B cell markers; natural killer cell markers were also rarely seen. ZAP-70 and LAT were frequently detected. In El Bagre-EPF, a significant fragmentation of T cells in lesional skin was noted, as well as autoreactivity to lymph nodes. Conclusions: The documented T cell and myeloperoxidase staining are indicative of the role of T lymphocytes and neutrophils in lesional biopsies in patients with ABD, in addition to previously documented deposition of B cells, immunoglobulins and complement in situ. In El Bagre-EPF, T cells could also target lymph nodes; however, further studies are needed to confirm this possibility.

  2. Delayed-type hypersensitivity, contact sensitivity, and phytohemagglutinin skin-test responses of heat- and cold-stressed calves.

    Science.gov (United States)

    Kelley, K W; Greenfield, R E; Evermann, J F; Parish, S M; Perryman, L E

    1982-05-01

    Three-week-old Holstein bull calves were used to investigate the effect of a 2-week chronic heat (35 C) or cold (-5 C) exposure on delayed-type hypersensitivity (DTH) reactions to purified protein derivative after sensitization with heat-killed Mycobacterium tuberculosis, contact sensitivity (CS) reactions to 1-fluoro-2,4-dinitrobenzene, and phytohemagglutinin (PHA) skin tests. Heat exposure reduced expression of DTH reactions by 42% and CS reactions by 38% at 24 hours after elicitation of the responses. The PHA-induced skin tests were not affected after 1 week of heat exposure, but this reaction was reduced by 20% after 2 weeks of heat exposure. The immune response of calves exposed to cold air temperatures was more complex. Cold exposure suppressed CS reactions by 39% at the end of both the 1st and 2nd weeks. The PHA response was reduced by 39% after 2 weeks of cold exposure. The DTH response depended on duration of cold exposure. The DTH reaction was increased by 42% after 1 week, but was reduced by 14% after 2 weeks. These data are consistent with the hypothesis that environmental stressors alter host resistance by affecting the immune system. Furthermore, these stress-induced changes in immune events depend on the type of immune response, the nature of the environmental stressor, and the length of time that calves are exposed to the stressor.

  3. Optical coherence tomography microangiography for monitoring the response of vascular perfusion to external pressure on human skin tissue

    Science.gov (United States)

    Choi, Woo June; Wang, Hequn; Wang, Ruikang K.

    2014-05-01

    Characterization of the relationship between external pressure and blood flow is important in the examination of pressure-induced disturbance in tissue microcirculation. Optical coherence tomography (OCT)-based microangiography is a promising imaging technique, capable of providing the noninvasive extraction of functional vessels within the skin tissue with capillary-scale resolution. Here, we present a feasibility study of OCT microangiography (OMAG) to evaluate changes in blood perfusion in response to externally applied pressure on human skin tissue in vivo. External force is loaded normal to the tissue surface at the nailfold region of a healthy human volunteer. An incremental force is applied step by step and then followed by an immediate release. Skin perfusion events including baseline are continuously imaged by OMAG, allowing for visualization and quantification of the capillary perfusion in the nailfold tissue. The tissue strain maps are simultaneously evaluated through the available OCT structural images to assess the relationship of the microcirculation response to the applied pressure. The results indicate that the perfusion progressively decreases with the constant increase of pressure. Reactive hyperemia occurs right after the removal of the pressure. The perfusion returns to the baseline level after a few minutes. These findings suggest that OMAG may have great potential for quantitatively assessing tissue microcirculation in the locally pressed tissue in vivo.

  4. Skin microbiome imbalance in patients with STAT1/STAT3 defects impairs innate host defense responses

    NARCIS (Netherlands)

    Smeekens, S.P.; Huttenhower, C.; Riza, A.L.; Veerdonk, F.L. van de; Zeeuwen, P.L.J.M.; Schalkwijk, J.; Meer, J.W.M. van der; Xavier, R.J.; Netea, M.G.; Gevers, D.

    2014-01-01

    BACKGROUND: Chronic mucocutaneous candidiasis (CMC) and hyper-IgE syndrome (HIES) are primary immunodeficiencies mainly caused by mutations in STAT1 and STAT3, respectively. CMC and HIES patients have an increased risk for skin and mucosal infections with fungal pathogens and Staphylococcus aureus.

  5. Skin Conductance Response in ICU patients with various stressors: a case series

    NARCIS (Netherlands)

    Tjan, D.H.T.; Schellaars, R.; Volders, J.; Weda, J.; Johnson, M.T.; Lubberding, M.; Dijk, E.O.; Ouwerkerk, M.; Van Zanten, A.R.H.

    2012-01-01

    Measuring stress levels in the ICU is not well defined and lacks reliable and valid methods of detection. ICU patients experience different kinds of stress like pain, dyspnoea, anxiety and general discomfort. Skin conductance has recently been shown to be a promising physiological indicator of pain

  6. Bovine Tuberculosis: Effect of the Tuberculin Skin Test on In vitro Interferon gamma Responses

    Science.gov (United States)

    Bovine tuberculosis (bTB) is a disease of zoonotic and economic importance. In many countries, control is based on test and slaughter policies and/or abattoir surveillance. For testing, cell mediated immune- (CMI-) based assays (i.e., Tuberculin skin test (TST) supplemented by the interferon gamma (...

  7. Surface Lipids as Multifunctional Mediators of Skin Responses to Environmental Stimuli

    Directory of Open Access Journals (Sweden)

    Chiara De Luca

    2010-01-01

    Full Text Available Skin surface lipid (SSL film is a mixture of sebum and keratinocyte membrane lipids, protecting skin from environment. Its composition is unique for the high percentage of long chain fatty acids, and of the polyterpenoid squalene, absent in other human tissues, and in non-human Primates sebum. Here, the still incomplete body of information on SSL as mediators of external chemical, physical, and microbial signals and stressors is revised, focusing on the central event of the continuous oxidative modification induced by the metabolic activity of residential and pathological microbial flora, natural or iatrogenic UV irradiation, exposure to chemicals and cosmetics. Once alpha-tocopherol and ubiquinol-10 antioxidant defences of SSL are overcome, oxidation of squalene and cholesterol gives rise to reactive by-products penetrating deeper into skin layers, to mediate local defensive inflammatory, photo-protective, immune reactions or, at higher concentrations, inducing local but also systemic immune depression, ultimately implicating skin cancerogenesis. Qualitative modifications of SSL represent a pathogenetic sign of diagnostic value in dermatological disorders involving altered sebum production, like pytiriasis versicolor, acne, atopic or seborrheic dermatitis, as well as photo-aging. Achievements of nutriceutical interventions aimed at restoring normal SSL composition and homeostasis are discussed, as feasible therapeutic goals and major means of photo-protection.

  8. Reversible inactivation of rostral nucleus raphe pallidus attenuates acute autonomic responses but not their habituation to repeated audiogenic stress in rats.

    Science.gov (United States)

    Nyhuis, Tara J; Masini, Cher V; Taufer, Kirsten L; Day, Heidi E W; Campeau, Serge

    2016-01-01

    The medullary nucleus raphe pallidus (RPa) mediates several autonomic responses evoked by acute stress exposure, including tachycardia and hyperthermia. The present study assessed whether the RPa contributes to the decline/habituation of these responses observed during repeated audiogenic stress. Adult male rats were implanted with cannulae aimed at the RPa, and abdominal E-mitters that wirelessly acquire heart rate and core body temperature. After surgical recovery, animals were injected with muscimol or vehicle (aCSF) in the RPa region, followed by 30 min of 95-dBA loud noise or no noise control exposures on 3 consecutive days at 24-h intervals. Forty-eight hours after the third exposure, animals were exposed to an additional, but injection-free, loud noise or no noise test to assess habituation of hyperthermia and tachycardia. Three days later, rats were restrained for 30-min to evaluate their ability to display normal acute autonomic responses following the repeated muscimol injection regimen. The results indicated that the inhibition of cellular activity induced by the GABAA-receptor agonist muscimol centered in the RPa region reliably attenuated acute audiogenic stress-evoked tachycardia and hyperthermia, compared with vehicle-injected rats. Animals in the stress groups exhibited similar attenuated tachycardia and hyperthermia during the injection-free fourth audiogenic stress exposure, and displayed similar and robust increases in these responses to the subsequent restraint test. These results suggest that cellular activity in neurons of the RPa region is necessary for the expression of acute audiogenic stress-induced tachycardia and hyperthermia, but may not be necessary for the acquisition of habituated tachycardic responses to repeated stress.

  9. Aluminum sulfate significantly reduces the skin test response to common allergens in sensitized patients

    Directory of Open Access Journals (Sweden)

    Grier Thomas J

    2006-02-01

    Full Text Available Abstract Background Avoidance of allergens is still recommended as the first and best way to prevent allergic illnesses and their comorbid diseases. Despite a variety of attempts there has been very limited success in the area of environmental control of allergic disease. Our objective was to identify a non-invasive, non-pharmacological method to reduce indoor allergen loads in atopic persons' homes and public environments. We employed a novel in vivo approach to examine the possibility of using aluminum sulfate to control environmental allergens. Methods Fifty skin test reactive patients were simultaneously skin tested with conventional test materials and the actions of the protein/glycoprotein modifier, aluminum sulfate. Common allergens, dog, cat, dust mite, Alternaria, and cockroach were used in the study. Results Skin test reactivity was significantly reduced by the modifier aluminum sulfate. Our studies demonstrate that the effects of histamine were not affected by the presence of aluminum sulfate. In fact, skin test reactivity was reduced independent of whether aluminum sulfate was present in the allergen test material or removed prior to testing, indicating that the allergens had in some way been inactivated. Conclusion Aluminum sulfate was found to reduce the in vivo allergic reaction cascade induced by skin testing with common allergens. The exact mechanism is not clear but appears to involve the alteration of IgE-binding epitopes on the allergen. Our results indicate that it may be possible to diminish the allergenicity of an environment by application of the active agent aluminum sulfate, thus producing environmental control without complete removal of the allergen.

  10. Skin Diseases: Skin Health and Skin Diseases

    Science.gov (United States)

    Skip Navigation Bar Home Current Issue Past Issues Skin Diseases Skin Health and Skin Diseases Past Issues / Fall 2008 Table of Contents ... acne to wrinkles Did you know that your skin is the largest organ of your body? It ...

  11. The response of human skin commensal bacteria as a reflection of UV radiation: UV-B decreases porphyrin production.

    Directory of Open Access Journals (Sweden)

    Yanhan Wang

    Full Text Available Recent global radiation fears reflect the urgent need for a new modality that can simply determine if people are in a radiation risk of developing cancer and other illnesses. Ultraviolet (UV radiation has been thought to be the major risk factor for most skin cancers. Although various biomarkers derived from the responses of human cells have been revealed, detection of these biomarkers is cumbersome, probably requires taking live human tissues, and varies significantly depending on human immune status. Here we hypothesize that the reaction of Propionibacterium acnes (P. acnes, a human resident skin commensal, to UV radiation can serve as early surrogate markers for radiation risk because the bacteria are immediately responsive to radiation. In addition, the bacteria can be readily accessible and exposed to the same field of radiation as human body. To test our hypothesis, P. acnes was exposed to UV-B radiation. The production of porphyrins in P. acnes was significantly reduced with increasing doses of UV-B. The porphyrin reduction can be detected in both P. acnes and human skin bacterial isolates. Exposure of UV-B to P. acnes- inoculated mice led to a significant decrease in porphyrin production in a single colony of P. acnes and simultaneously induced the formation of cyclobutane pyrimidine dimers (CPD in the epidermal layers of mouse skin. Mass spectrometric analysis via a linear trap quadrupole (LTQ-Orbitrap XL showed that five peptides including an internal peptide (THLPTGIVVSCQNER of a peptide chain release factor 2 (RF2 were oxidized by UV-B. Seven peptides including three internal peptides of 60 kDa chaperonin 1 were de-oxidized by UV-B. When compared to UV-B, gamma radiation also decreased the porphyrin production of P. acnes in a dose-dependent manner, but induced a different signature of protein oxidation/de-oxidation. We highlight that uncovering response of skin microbiome to radiation will facilitate the development of pre

  12. Trigeminal autonomic cephalalgias.

    Science.gov (United States)

    Eller, M; Goadsby, P J

    2016-01-01

    The trigeminal autonomic cephalalgias (TACs) are a group of primary headache disorders characterised by lateralized symptoms: prominent headache and ipsilateral cranial autonomic features, such as conjunctival injection, lacrimation and rhinorrhea. The TACs are: cluster headache (CH), paroxysmal hemicrania (PH), short-lasting unilateral neuralgiform headache attacks with conjunctival injection and tearing (SUNCT)/short-lasting neuralgiform headache attacks with cranial autonomic features (SUNA) and hemicrania continua (HC). Their diagnostic criteria are outlined in the International Classification of Headache Disorders, third edition-beta (ICHD-IIIb). These conditions are distinguished by their attack duration and frequency, as well as response to treatment. HC is continuous and by definition responsive to indomethacin. The main differential when considering this headache is chronic migraine. Other TACs are remarkable for their short duration and must be distinguished from other short-lasting painful conditions, such as trigeminal neuralgia and primary stabbing headache. Cluster headache is characterised by exquisitely painful attacks that occur in discrete episodes lasting 15-180 min a few times a day. In comparison, PH occurs more frequently and is of shorter duration, and like HC is responsive to indomethacin. SUNCT/SUNA is the shortest duration and highest frequency TAC; attacks can occur over a hundred times every day.

  13. Shh-mediated degradation of Hhip allows cell autonomous and non-cell autonomous Shh signalling.

    Science.gov (United States)

    Kwong, Lina; Bijlsma, Maarten F; Roelink, Henk

    2014-09-12

    The distribution of Sonic Hedgehog (Shh) is a highly regulated and critical process for development. Several negative feedback mechanisms are in place, including the Shh-induced upregulation of Hedgehog-interacting protein (Hhip). Hhip sequesters Shh, leading to a non-cell autonomous inhibition of the pathway. Hhip overexpression has a severe effect on neural tube development, raising the question why normal sites of Hhip expression have a seemingly unimpaired response to Shh. Here we show that although Hhip is able to leave its sites of synthesis to inhibit Shh non-cell autonomously, activation of Smoothened (Smo) drastically increases Hhip internalization and degradation cell autonomously. Although Hhip is unable to cell autonomously inhibit the consequences of Smo activation, it can inhibit the Shh response non-cell autonomously. Our data provide a mechanism by which the Shh ligand can activate the response and negate cell autonomous effects of Hhip, while Hhip can still induce non-cell autonomous inhibition.

  14. Responses of Six-Weeks Aquatic Exercise on the Autonomic Nervous System, Peak Nasal Inspiratory Flow and Lung Functions in Young Adults with Allergic Rhinitis

    Directory of Open Access Journals (Sweden)

    Taweesak Janyacharoen

    2015-10-01

    Full Text Available Allergic rhinitis is a chronic respiratory disease. Sympathetic hypofunction is identified in all of the allergic rhinitis patients. Moreover, allergic rhinitis is associated with decreased peak nasal inspiratory flow (PNIF and impaired lung functions. The aim of this study was to investigate effects of six-week of aquatic exercise on the autonomic nervous system function, PNIF and lung functions in allergic rhinitis patients.Twenty-six allergic rhinitis patients, 12 males and 14 females were recruited in this study. Subjects were diagnosed by a physician based on history, physical examination, and positive reaction to a skin prick test. Subjects were randomly assigned to two groups. The control allergic rhinitis group received education and maintained normal life. The aquatic group performed aquatic exercise for 30 minutes a day, three days a week for six weeks. Heart rate variability, PNIF and lung functions were measured at the beginning, after three weeks and six weeks.There were statistically significant increased low frequency normal units (LF n.u., PNIF and showed decreased high frequency normal units (HF n.u. at six weeks after aquatic exercise compared with the control group.Six weeks of aquatic exercise could increase sympathetic activity and PNIF in allergicrhinitis patients.

  15. Responses of Six-Weeks Aquatic Exercise on the Autonomic Nervous System, Peak Nasal Inspiratory Flow and Lung Functions in Young Adults with Allergic Rhinitis.

    Science.gov (United States)

    Janyacharoen, Taweesak; Kunbootsri, Narupon; Arayawichanon, Preeda; Chainansamit, Seksun; Sawanyawisuth, Kittisak

    2015-06-01

    Allergic rhinitis is a chronic respiratory disease. Sympathetic hypofunction is identified in all of the allergic rhinitis patients. Moreover, allergic rhinitis is associated with decreased peak nasal inspiratory flow (PNIF) and impaired lung functions. The aim of this study was to investigate effects of six-week of aquatic exercise on the autonomic nervous system function, PNIF and lung functions in allergic rhinitis patients. Twenty-six allergic rhinitis patients, 12 males and 14 females were recruited in this study. Subjects were diagnosed by a physician based on history, physical examination, and positive reaction to a skin prick test. Subjects were randomly assigned to two groups. The control allergic rhinitis group received education and maintained normal life. The aquatic group performed aquatic exercise for 30 minutes a day, three days a week for six weeks. Heart rate variability, PNIF and lung functions were measured at the beginning, after three weeks and six weeks. There were statistically significant increased low frequency normal units (LF n.u.), PNIF and showed decreased high frequency normal units (HF n.u.) at six weeks after aquatic exercise compared with the control group. Six weeks of aquatic exercise could increase sympathetic activity and PNIF in allergic rhinitis patients.

  16. Autonomous Search

    CERN Document Server

    Hamadi, Youssef; Saubion, Frédéric

    2012-01-01

    Decades of innovations in combinatorial problem solving have produced better and more complex algorithms. These new methods are better since they can solve larger problems and address new application domains. They are also more complex which means that they are hard to reproduce and often harder to fine-tune to the peculiarities of a given problem. This last point has created a paradox where efficient tools are out of reach of practitioners. Autonomous search (AS) represents a new research field defined to precisely address the above challenge. Its major strength and originality consist in the

  17. Fluoxetine ameliorates atopic dermatitis-like skin lesions in BALB/c mice through reducing psychological stress and inflammatory response

    Directory of Open Access Journals (Sweden)

    Yanxi Li

    2016-09-01

    Full Text Available Atopic dermatitis (AD is a common chronic inflammatory skin disorder, and patients with AD suffer from severe psychological stress, which markedly increases the prevalence rate of depression and anxiety disorders in later life. Fluoxetine, a selective serotonin reuptake inhibitor, has recently been reported to exert anti-inflammatory and immunosuppressive effects. However, it is unclear whether fluoxetine is effective in the treatment of AD through reducing psychological stress and inflammatory reaction. Here, we reported that a BALB/c mouse model of AD was induced by application of 2,4‑dinitrochlorobenzene (DNCB onto hairless dorsal skin. Chronic fluoxetine treatment (10 mg/kg per day, i.p. significantly attenuated AD-like symptoms, as reflected by a dramatic decrease in scratching bouts, as well as a decrease in anxiety- and depressive-like behaviors. Furthermore, these behavioral changes were accompanied by a significant decrease in epidermal thickness, the number of mast cells in skin tissue, mRNA levels of interleukin-4 (IL-4 and IL-13 in the spleen, as well as serum immunoglobulin E (IgE in the DNCB-treated mice by treatment with fluoxetine. Taken together, these results indicate that fluoxetine may suppress psychological stress and inflammatory response during AD development, and subsequently ameliorate AD symptoms, suggesting that fluoxetine may be a potential therapeutic agent against AD in clinic.

  18. Sensory responses of human skin to synthetic histamine analogues and histamine.

    OpenAIRE

    Davies, M. G.; Greaves, M W

    1980-01-01

    The potential for itch production in human skin of the synthetic analogues of histamine, 2-methyl histamine (an H1-receptor agonist) and 4-methyl histamine and dimaprit (H2-receptor agonists) has been studied in vivo and compared with histamine. Itch thresholds for 2-methyl histamine were consistently much higher than for histamine (P < 0.001). The H1-receptor antagonist chlorpheniramine raised the itch thresholds to 2-methyl histamine and histamine significantly (P < 0.001). Pruritus was not...

  19. Transdermal glyceryl trinitrate (nitroglycerin in healthy persons: acute effects on skin temperature and hemodynamic orthostatic response

    Directory of Open Access Journals (Sweden)

    Eva Maria Augusta Boeckh Haebisch

    Full Text Available In order to find an explanation for individual reactions to transdermal glyceryl trinitrate (GTN we studied the skin temperature and hemodynamic reactions in 63 healthy persons. The data were obtained before and after the application of GTN and Glycerin (GL placebo patches, during one hour. The skin temperature was measured on both forearms, the local (left sided and systemic (right sided reaction on GTN was related to the skin fold and the calculated body fat content. The bilateral rise of skin temperature and its duration was higher and longer in obese than in lean persons mainly in obese women. The UV induced thermo and the later photothermoreaction (Erythema was reduced on the left forearm after the application of GTN and GL patches. The observed hemodynamic GTN effect confirmed known postural reactions, such as decreased arterial pressure (ΔmAP = -2.9%, increased heart rate (ΔHR = +7,4% and QTc prolongation (ΔQTc = +4,9% in upright position. An adverse drug effect with increased mean blood pressure (ΔmAP = +12% and increased heart rate (ΔHR = + 10.4% mainly in supine position was observed in 11 % of the participants, but only in men. Such a reaction was already described by Murell, 1879. Individual GTN effects were analyzed and related to habits and family history. In male smokers and in persons with hypertensive and diabetic close relatives, the hypotensive GTN effect was accentuated in supine position. In the upright position the group with hypertensives in the family presented a moderate hypotensive reaction without secondary tachycardia and the smokers presented only a slightly increased heart rate. Our observations suggest that individual reactions to transdermal glyceryl trinitrate (GTN with its active component nitric oxide (NO depends on physiological conditions, related to endogenous vasoactive substances, mainly the interaction with EDRF (the endogenous NO and the activity of the Renin-Angiotensin System.

  20. Augmented supraorbital skin sympathetic nerve activity responses to symptom trigger events in rosacea patients.

    Science.gov (United States)

    Metzler-Wilson, Kristen; Toma, Kumika; Sammons, Dawn L; Mann, Sarah; Jurovcik, Andrew J; Demidova, Olga; Wilson, Thad E

    2015-09-01

    Facial flushing in rosacea is often induced by trigger events. However, trigger causation mechanisms are currently unclear. This study tested the central hypothesis that rosacea causes sympathetic and axon reflex-mediated alterations resulting in trigger-induced symptomatology. Twenty rosacea patients and age/sex-matched controls participated in one or a combination of symptom triggering stressors. In protocol 1, forehead skin sympathetic nerve activity (SSNA; supraorbital microneurography) was measured during sympathoexcitatory mental (2-min serial subtraction of novel numbers) and physical (2-min isometric handgrip) stress. In protocol 2, forehead skin blood flow (laser-Doppler flowmetry) and transepithelial water loss/sweat rate (capacitance hygrometry) were measured during sympathoexcitatory heat stress (whole body heating by perfusing 50°C water through a tube-lined suit). In protocol 3, cheek, forehead, forearm, and palm skin blood flow were measured during nonpainful local heating to induce axon reflex vasodilation. Heart rate (HR) and mean arterial pressure (MAP) were recorded via finger photoplethysmography to calculate cutaneous vascular conductance (CVC; flux·100/MAP). Higher patient transepithelial water loss was observed (rosacea 0.20 ± 0.02 vs. control 0.10 ± 0.01 mg·cm(-2)·min(-1), P rosacea and controls, respectively) stress was augmented in rosacea (both P rosacea compared with controls. No axon reflex vasodilation differences were observed between groups. These data indicate that rosacea affects SSNA and that hyperresponsiveness to trigger events appears to have a sympathetic component.

  1. Assessment of skin barrier function and biochemical changes of ex vivo human skin in response to physical and chemical barrier disruption.

    Science.gov (United States)

    Döge, Nadine; Avetisyan, Araks; Hadam, Sabrina; Pfannes, Eva Katharina Barbosa; Rancan, Fiorenza; Blume-Peytavi, Ulrike; Vogt, Annika

    2016-12-21

    Topical dermatotherapy is intended to be used on diseased skin. Novel drug delivery systems even address differences between intact and diseased skin underlining the need for pre-clinical assessment of different states of barrier disruption. Herein, we studied how short-term incubation in culture media compared to incubation in humidified chambers affects human skin barrier function and viability. On both models we assessed different types and intensities of physical and chemical barrier disruption methods with regard to structural integrity, biophysical parameters and cytokine levels. Tissue degeneration and proliferative activity limited the use of tissue cultures to 48h. Viability is better preserved in cultured tissue. Tape-stripping (50×TS) and 4h sodium lauryl sulfate (SLS) pre-treatment were identified as highly reproducible and effective procedures for barrier disruption. Transepidermal water loss (TEWL) values reproducibly increased with the intensity of disruption while sebum content and skin surface pH were of limited value. Interleukin (IL)-6/8 and various chemokines and proteases were increased in tape-stripped skin which was more pronounced in SLS-treated skin tissue extracts. Thus, albeit limited to 48h, cultured full-thickness skin maintained several barrier characteristics and responded to different intensities of barrier disruption. Potentially, these models can be used to assess pre-clinically the efficacy and penetration of anti-inflammatory compounds.

  2. An Integrated Approach for the Monitoring of Brain and Autonomic Response of Children with Autism Spectrum Disorders during Treatment by Wearable Technologies.

    Science.gov (United States)

    Billeci, Lucia; Tonacci, Alessandro; Tartarisco, Gennaro; Narzisi, Antonio; Di Palma, Simone; Corda, Daniele; Baldus, Giovanni; Cruciani, Federico; Anzalone, Salvatore M; Calderoni, Sara; Pioggia, Giovanni; Muratori, Filippo

    2016-01-01

    Autism Spectrum Disorders (ASD) are associated with physiological abnormalities, which are likely to contribute to the core symptoms of the condition. Wearable technologies can provide data in a semi-naturalistic setting, overcoming the limitations given by the constrained situations in which physiological signals are usually acquired. In this study an integrated system based on wearable technologies for the acquisition and analysis of neurophysiological and autonomic parameters during treatment is proposed and an application on five children with ASD is presented. Signals were acquired during a therapeutic session based on an imitation protocol in ASD children. Data were analyzed with the aim of extracting quantitative EEG (QEEG) features from EEG signals as well as heart rate and heart rate variability (HRV) from ECG. The system allowed evidencing changes in neurophysiological and autonomic response from the state of disengagement to the state of engagement of the children, evidencing a cognitive involvement in the children in the tasks proposed. The high grade of acceptability of the monitoring platform is promising for further development and implementation of the tool. In particular if the results of this feasibility study would be confirmed in a larger sample of subjects, the system proposed could be adopted in more naturalistic paradigms that allow real world stimuli to be incorporated into EEG/psychophysiological studies for the monitoring of the effect of the treatment and for the implementation of more individualized therapeutic programs.

  3. A recurrence network approach for the analysis of skin blood flow dynamics in response to loading pressure.

    Science.gov (United States)

    Liao, Fuyuan; Jan, Yih-Kuen

    2012-06-01

    This paper presents a recurrence network approach for the analysis of skin blood flow dynamics in response to loading pressure. Recurrence is a fundamental property of many dynamical systems, which can be explored in phase spaces constructed from observational time series. A visualization tool of recurrence analysis called recurrence plot (RP) has been proved to be highly effective to detect transitions in the dynamics of the system. However, it was found that delay embedding can produce spurious structures in RPs. Network-based concepts have been applied for the analysis of nonlinear time series recently. We demonstrate that time series with different types of dynamics exhibit distinct global clustering coefficients and distributions of local clustering coefficients and that the global clustering coefficient is robust to the embedding parameters. We applied the approach to study skin blood flow oscillations (BFO) response to loading pressure. The results showed that global clustering coefficients of BFO significantly decreased in response to loading pressure (precurrence network approach can practically quantify the nonlinear dynamics of BFO.

  4. Protein Kinases and Transcription Factors Activation in Response to UV-Radiation of Skin: Implications for Carcinogenesis

    Directory of Open Access Journals (Sweden)

    Laurence A. Marchat

    2011-12-01

    Full Text Available Solar ultraviolet (UV radiation is an important environmental factor that leads to immune suppression, inflammation, photoaging, and skin carcinogenesis. Here, we reviewed the specific signal transduction pathways and transcription factors involved in the cellular response to UV-irradiation. Increasing experimental data supporting a role for p38, MAPK, JNK, ERK1/2, and ATM kinases in the response network to UV exposure is discussed. We also reviewed the participation of NF-κB, AP-1, and NRF2 transcription factors in the control of gene expression after UV-irradiation. In addition, we discussed the promising chemotherapeutic intervention of transcription factors signaling by natural compounds. Finally, we focused on the review of data emerging from the use of DNA microarray technology to determine changes in global gene expression in keratinocytes and melanocytes in response to UV treatment. Efforts to obtain a comprehensive portrait of the transcriptional events regulating photodamage of intact human epidermis after UV exposure reveals the existence of novel factors participating in UV-induced cell death. Progress in understanding the multitude of mechanisms induced by UV-irradiation could lead to the potential use of protein kinases and novel proteins as specific targets for the prevention and control of skin cancer.

  5. Quantitative thermal sensory testing and sympathetic skin response in primary Restless legs syndrome - A prospective study on 57 Indian patients

    Directory of Open Access Journals (Sweden)

    Garima Shukla

    2012-01-01

    Full Text Available Patients with restless leg syndrome present with sensory symptoms similar to peripheral neuropathy. While there is evidence of abnormalities of dopaminergic pathways, the peripheral nervous system has been studied infrequently. We studied conventional nerve conduction studies, quantitative thermal sensory testing and sympathetic skin response in 57 patients with primary restless leg syndrome. Almost two third patients demonstrated abnormalities in the detailed testing of the peripheral nervous system. Sbtle abnormalities of the peripheral nervous system may be more common than previously believed.

  6. Analysis and Modeling of the Galvanic Skin Response Spontaneous Component in the context of Intelligent Biofeedback Systems Development

    Science.gov (United States)

    Unakafov, A.

    2009-01-01

    The paper presents an approach to galvanic skin response (GSR) spontaneous component analysis and modeling. In the study a classification of biofeedback training methods is given, importance of intelligent methods development is shown. The INTENS method, which is perspective for intellectualization, is presented. An important problem of biofeedback training method intellectualization - estimation of the GSR spontaneous component - is solved in the main part of the work. Its main characteristics are described; results of GSR spontaneous component modeling are shown. Results of small research of an optimum material for GSR probes are presented.

  7. Behavioral and electrophysiological responses of Aedes albopictus to certain acids and alcohols present in human skin emanations.

    Science.gov (United States)

    Guha, Lopamudra; Seenivasagan, T; Iqbal, S Thanvir; Agrawal, O P; Parashar, B D

    2014-10-01

    Human skin emanations attract hungry female mosquitoes toward their host for blood feeding. In this study, we report the flight orientation and electroantennogram response of Aedes albopictus females to certain unsaturated acids and alcohols found in human skin. In the Y-tube olfactometer, odors of lactic acid and 2-methyl-3-pentanol attracted 54-65% of Ae. albopictus females at all doses in a dose-dependent manner. However, at the highest dose (10(-2) g), the acids repelled 40-45% females. Attractancy (ca. 62-68%) at lower doses and repellency (ca. 30-45%) at higher doses were recorded for 3-methyl-3-pentanol and 1-octen-3-ol, while 5-hexen-1-ol, cis-2-hexen-1-ol, and trans 2-hexen-1-ol odor repelled ca. 55-65% of Ae. albopictus females at all doses. Antenna of female Ae. albopictus exhibited a dose-dependent EAG response up to 10(-3) g of L-lactic acid, trans-2-methyl-2-pentenoic acid, 2-octenoic acid, trans-2-hexen-1-ol and 1-octen-3-ol stimulations; however, the highest dose (10(-2) g) caused a little decline in the EAG response. EAG response of 9-10-fold was elicited by lactic acid, 2-octenoic acid, trans-2-hexenoic acid, and 3-methyl-3-pentanol, while cis-2-hexen-1-ol and trans-2-methyl pentenoic acid elicited 1-5-fold responses compared to solvent control. A blend of attractive compounds could be utilized in odor-baited trap for surveillance and repellent molecules with suitable formulation could be used to reduce the biting menace of mosquitoes.

  8. Tephrosia purpurea alleviates phorbol ester-induced tumor promotion response in murine skin.

    Science.gov (United States)

    Saleem, M; Ahmed Su; Alam, A; Sultana, S

    2001-02-01

    In recent years, considerable emphasis has been placed on identifying new cancer chemopreventive agents, which could be useful for the human population. Tephrosia purpurea has been shown to possess significant activity against hepatotoxicity, pharmacological and physiological disorders. Earlier we showed that Tephrosia purpurea inhibits benzoyl peroxide-mediated cutaneous oxidative stress and toxicity. In the present study, we therefore assessed the effect of Tephrosia purpurea on 12-O-tetradecanoyl phorbal-13-acetate (TPA; a well-known phorbol ester) induced cutaneous oxidative stress and toxicity in murine skin. The pre-treatment of Swiss albino mice with Tephrosia purpurea prior to application of croton oil (phorbol ester) resulted in a dose-dependent inhibition of cutaneous carcinogenesis. Skin tumor initiation was achieved by a single topical application of 7,12-dimethyl benz(a)anthracene (DMBA) (25 microg per animal per 0.2 ml acetone) to mice. Ten days later tumor promotion was started by twice weekly topical application of croton oil (0.5% per animal per 0.2 ml acetone, v /v). Topical application of Tephrosia purpurea 1 h prior to each application of croton oil (phorbol ester) resulted in a significant protection against cutaneous carcinogenesis in a dose-dependent manner. The animals pre-treated with Tephrosia purpurea showed a decrease in both tumor incidence and tumor yield as compared to the croton oil (phorbol ester)-treated control group. In addition, a significant reduction in TPA-mediated induction in cutaneous ornithine decarboxylase (ODC) activity and [3H]thymidine incorporation was also observed in animals pre-treated with a topical application of Tephrosia purpurea. The effect of topical application of Tephrosia purpurea on TPA-mediated depletion in the level of enzymatic and non-enzymatic molecules in skin was also evaluated and it was observed that topical application of Tephrosia purpurea prior to TPA resulted in the significant recovery of

  9. Infrared sensing based sensitive skin

    Institute of Scientific and Technical Information of China (English)

    CAO Zheng-cai; FU Yi-li; WANG Shu-guo; JIN Bao

    2006-01-01

    Developed robotics sensitive skin is a modularized, flexible, mini-type array of infrared sensors with data processing capabilities, which can be used to cover the body of a robot. Depending on the infrared sensors and periphery processing circuit, robotics sensitive skin can in real-time provide existence and distance information about obstacles for robots within sensory areas. The methodology of designing sensitive skin and the algorithm of a mass of IR data fusion are presented. The experimental results show that the multi-joint robot with this sensitive skin can work autonomously in an unknown environment.

  10. The Influence of Autonomic Dysfunction Associated with Aging and Type 2 Diabetes on Daily Life Activities

    Directory of Open Access Journals (Sweden)

    Jerrold Petrofsky

    2012-01-01

    Full Text Available Type 2 diabetes (T2D and ageing have well documented effects on every organ in the body. In T2D the autonomic nervous system is impaired due to damage to neurons, sensory receptors, synapses and the blood vessels. This paper will concentrate on how autonomic impairment alters normal daily activities. Impairments include the response of the blood vessels to heat, sweating, heat transfer, whole body heating, orthostatic intolerance, balance, and gait. Because diabetes is more prevalent in older individuals, the effects of ageing will be examined. Beginning with endothelial dysfunction, blood vessels have impairment in their ability to vasodilate. With this and synaptic damage, the autonomic nervous system cannot compensate for effectors such as pressure on and heating of the skin. This and reduced ability of the heart to respond to stress, reduces autonomic orthostatic compensation. Diminished sweating causes the skin and core temperature to be high during whole body heating. Impaired orthostatic tolerance, impaired vision and vestibular sensing, causes poor balance and impaired gait. Overall, people with T2D must be made aware and counseled relative to the potential consequence of these impairments.

  11. Real-time Needle Steering in Response to Rolling Vein Deformation by a 9-DOF Image-Guided Autonomous Venipuncture Robot.

    Science.gov (United States)

    Chen, Alvin I; Balter, Max L; Maguire, Timothy J; Yarmush, Martin L

    2015-01-01

    Venipuncture is the most common invasive medical procedure performed in the United States and the number one cause of hospital injury. Failure rates are particularly high in pediatric and elderly patients, whose veins tend to deform, move, or roll as the needle is introduced. To improve venipuncture accuracy in challenging patient populations, we have developed a portable device that autonomously servos a needle into a suitable vein under image guidance. The device operates in real time, combining near-infrared and ultrasound imaging, computer vision software, and a 9 degrees-of-freedom robot that servos the needle. In this paper, we present the kinematic and mechanical design of the latest generation robot. We then investigate in silico and in vitro the mechanics of vessel rolling and deformation in response to needle insertions performed by the robot. Finally, we demonstrate how the robot can make real-time adjustments under ultrasound image guidance to compensate for subtle vessel motions during venipuncture.

  12. [Effect of a constant and low frequency magnetic field on the behavioral and autonomic responses of the human operator].

    Science.gov (United States)

    Medvedev, M A; Urazaev, A M; Kulakov, Iu A

    1976-01-01

    The object of the study was conjugation of latencies of sensorimotor reactions and of following physiological characteristics: respiratory rate, heart rate, skin resistance and temperature, in man doing the work of operator, under the action of DC and AC (50 c/s) magnetic fields with maximal tension equalling 8-10 a/m on the head. "Disfunction" of behavioural reactions and of their vegetative sufficiency was observed in the magnetic field. The degree of deterioration of control and compensatory properties of the central nervous system is of inverse dependence on the quality of the operator's work and the level of the central nervous system functional possibilities.

  13. Cutaneous autonomic denervation in Parkinson's disease.

    Science.gov (United States)

    Navarro-Otano, Judith; Casanova-Mollà, Jordi; Morales, Merche; Valls-Solé, Josep; Tolosa, Eduard

    2015-08-01

    Numerous studies have detailed involvement of the peripheral autonomic nervous system (PANS) in Parkinson's disease (PD). We assessed autonomic innervation of dermal annexes through quantitative fluorescence measurement from skin obtained via punch biopsies at distal leg region in PD and control subjects. We defined a ratio between the area corresponding to protein gen product (PGP) immunoreactivity and the area corresponding to blood vessel or sweat gland as a quantitative measure of autonomic innervation. Presence of alpha-synuclein (AS) deposits in dermis and hypodermis was also assessed by immunohistochemistry. Skin biopsies form six PD patients and six healthy controls were studied. Autonomic innervation scores were lower in PD than in controls in both blood vessels and sweat glands. No AS or phosphorylated AS (pAS) immunoreactivity was detected in dermis or hypodermis in any of the studied subjects. The results of this investigation suggest that autonomic innervation of dermal annexes in living patients with PD is reduced compared to controls. AS or pAS deposits were not found in dermis or hypodermis suggesting that distal leg skin study is not useful for in vivo detection of AS in PD.

  14. Multifaceted role of TREX2 in the skin defense against UV-induced skin carcinogenesis.

    Science.gov (United States)

    Manils, Joan; Gómez, Diana; Salla-Martret, Mercè; Fischer, Heinz; Fye, Jason M; Marzo, Elena; Marruecos, Laura; Serrano, Inma; Salgado, Rocío; Rodrigo, Juan P; Garcia-Pedrero, Juana M; Serafin, Anna M; Cañas, Xavier; Benito, Carmen; Toll, Agustí; Forcales, Sònia-Vanina; Perrino, Fred W; Eckhart, Leopold; Soler, Concepció

    2015-09-08

    TREX2 is a 3'-DNA exonuclease specifically expressed in keratinocytes. Here, we investigated the relevance and mechanisms of TREX2 in ultraviolet (UV)-induced skin carcinogenesis. TREX2 expression was up-regulated by chronic UV exposure whereas it was de-regulated or lost in human squamous cell carcinomas (SCCs). Moreover, we identified SNPs in the TREX2 gene that were more frequent in patients with head and neck SCCs than in healthy individuals. In mice, TREX2 deficiency led to enhanced susceptibility to UVB-induced skin carcinogenesis which was preceded by aberrant DNA damage removal and degradation as well as reduced inflammation. Specifically, TREX2 loss diminished the up-regulation of IL12 and IFNγ, key cytokines related to DNA repair and antitumor immunity. In UV-treated keratinocytes, TREX2 promoted DNA repair and passage to late apoptotic stages. Notably, TREX2 was recruited to low-density nuclear chromatin and micronuclei, where it interacted with phosphorylated H2AX histone, which is a critical player in both DNA repair and cell death. Altogether, our data provide new insights in the molecular mechanisms of TREX2 activity and establish cell autonomous and non-cell autonomous functions of TREX2 in the UVB-induced skin response.

  15. Your Skin

    Science.gov (United States)

    ... Room? What Happens in the Operating Room? Your Skin KidsHealth > For Kids > Your Skin Print A A ... are really dead skin cells. continue Bye-Bye Skin Cells These old cells are tough and strong, ...

  16. Use of reflectance near-infrared spectroscopy to investigate the effects of daily moisturizer application on skin optical response and barrier function.

    Science.gov (United States)

    Qassem, Meha; Kyriacou, Panayiotis

    2014-08-01

    A number of noninvasive techniques and instruments have emerged over the years allowing much progress toward clarifying the structure and function of human skin and studying the effects of various applied substances. All of this research has provided great insight into the interactions between skin and various products through quantitative and qualitative measurements. Such methods include near-infrared spectroscopy (NIRS), a technique which has gained popularity over the years and has often been employed to accurately determine the moisture levels and water content of skin based on its sensitivity to hydrogen bonding. NIRS has also been applied in many studies to report the efficacy of moisturizing products and assess their benefits to the skin. However, many of these studies have reported an increase in skin water content following moisturizer application while some have challenged the benefits of long-term moisturizer use, particularly on normal skin, and even suggested that it can increase the skin's susceptibility to irritants. This paper reports the results of a pilot in vivo study carried out on the skin of 20 healthy volunteers, categorized into groups depending on their skin type and frequency of moisturizer use, in order to investigate the optical response of human skin after direct short-term contact with water followed by application of a moisturizer. The measurements were obtained using a highly advanced spectrophotometer in the region of 900 to 2100 nm equipped with a customized reflectance fiber optic handheld probe. Scatter graphs of group results and second derivative spectra have shown an interesting pattern between frequent users of moisturizers and individuals who do not use moisturizers, suggesting that long-term daily moisturization may have an effect on skin barrier function. The results also raise some questions regarding the optical characteristics of different skin types, as well as the varying response between different water bands in the

  17. Severity of gambling problems modulates autonomic reactions to near outcomes in gambling.

    Science.gov (United States)

    Ulrich, Natalie; Ambach, Wolfgang; Hewig, Johannes

    2016-09-01

    Outcomes in gambling games cannot only be classified based on their valence (wins and misses) but also based on their closeness (near and full outcomes). The present study investigated autonomic responses (phasic heart period changes and skin conductance responses) to near and full outcomes on a wheel of fortune in a sample of males with different degrees of gambling problems. Near relative to full outcomes elicited increased interbeat intervals shortly after outcome presentation. Furthermore, participants with more severe gambling problems showed increased skin conductance responses following near relative to full outcomes as well as relatively smaller interbeat interval responses to near relative to full misses. The findings confirm different processing of near compared to full outcomes and altered processing of gambling outcomes with increasing severity of gambling problems.

  18. Effect of nifedipine on depolarization-induced force responses in skinned skeletal muscle fibres of rat and toad.

    Science.gov (United States)

    Posterino, G S; Lamb, G D

    1998-01-01

    The effect of the dihydropyridine, nifedipine, on excitation-contraction coupling was compared in toad and rat skeletal muscle, using the mechanically skinned fibre technique, in order to understand better the apparently disparate results of previous studies and to examine recent proposals on the importance of certain intracellular factors in determining the efficacy of dihydropyridines. In twitch fibres from the iliofibularis muscle of the toad, 10 microM nifedipine completely inhibited depolarization-induced force responses within 30 s, without interfering with direct activation of the Ca(2+)-release channels by caffeine application or reduction of myoplasmic [Mg2+]. At low concentrations of nifedipine, inhibition was considerably augmented by repeated depolarizations, with half-maximal inhibition occurring at < 0.1 microM nifedipine. In contrast, in rat extensor digitorum longus (EDL) fibres 1 microM nifedipine had virtually no effect on depolarization-induced force responses, and 10 microM nifedipine caused only approximately 25% reduction in the responses, even upon repeated depolarizations. In rat fibres, 10 microM nifedipine shifted the steady-state force inactivation curve to more negative potentials by < 11 mV, whereas in toad fibres the potent inhibitory effect of nifedipine indicated a much larger shift. The inhibitory effect of nifedipine in rat fibres was little, if at all, increased by the absence of Ca2+ in the transverse tubular (t-) system, provided that the Ca2+ was replaced with sufficient Mg2+. The presence of the reducing agents dithiothreitol (10 mM) or glutathione (10 mM) in the solution bathing a toad skinned fibre did not reduce the inhibitory effect of nifedipine, suggesting that the potency of nifedipine in toad skinned fibres was not due to the washout of intracellular reducing agents. The results are considered in terms of a model that can account for the markedly different effects of nifedipine on the two putative functions of the

  19. A Study on the Effects of Sympathetic Skin Response Parameters in Diagnosis of Fibromyalgia Using Artificial Neural Networks.

    Science.gov (United States)

    Ozkan, Ozhan; Yildiz, Murat; Arslan, Evren; Yildiz, Sedat; Bilgin, Suleyman; Akkus, Selami; Koyuncuoglu, Hasan R; Koklukaya, Etem

    2016-03-01

    Fibromyalgia syndrome (FMS), usually observed commonly in females over age 30, is a rheumatic disease accompanied by extensive chronic pain. In the diagnosis of the disease non-objective psychological tests and physiological tests and laboratory test results are evaluated and clinical experiences stand out. However, these tests are insufficient in differentiating FMS with similar diseases that demonstrate symptoms of extensive pain. Thus, objective tests that would help the diagnosis are needed. This study analyzes the effect of sympathetic skin response (SSR) parameters on the auxiliary tests used in FMS diagnosis, the laboratory tests and physiological tests. The study was conducted in Suleyman Demirel University, Faculty of Medicine, Physical Medicine and Rehabilitation Clinic in Turkey with 60 patients diagnosed with FMS for the first time and a control group of 30 healthy individuals. In the study all participants underwent laboratory tests (blood tests), certain physiological tests (pulsation, skin temperature, respiration) and SSR measurements. The test data and SSR parameters obtained were classified using artificial neural network (ANN). Finally, in the ANN framework, where only laboratory and physiological test results were used as input, a simulation result of 96.51 % was obtained, which demonstrated diagnostic accuracy. This data, with the addition of SSR parameter values obtained increased to 97.67 %. This result including SSR parameters - meaning a higher diagnostic accuracy - demonstrated that SSR could be a new auxillary diagnostic method that could be used in the diagnosis of FMS.

  20. Preslaughter diet management in sheep and goats: effects on physiological responses and microbial loads on skin and carcass.

    Science.gov (United States)

    Kannan, Govind; Gutta, Venkat R; Lee, Jung Hoon; Kouakou, Brou; Getz, Will R; McCommon, George W

    2014-01-01

    Sixteen crossbred buck goats (Kiko x Spanish; BW = 32.8 kg) and wether sheep (Dorset x Suffolk; BW = 39.9 kg) were used to determine the effect of preslaughter diet and feed deprivation time (FDT) on physiological responses and microbial loads on skin and carcasses. Experimental animals were fed either a concentrate (CD) or a hay diet (HD) for 4 d and then deprived of feed for either 12-h or 24-h before slaughter. Blood samples were collected for plasma cortisol and blood metabolite analyses. Longisimus muscle (LM) pH was measured. Skin and carcass swabs were obtained to assess microbial loads. Plasma creatine kinase activity (863.9 and 571.7 ± 95.21 IU) and non-esterified fatty acid concentrations (1,056.1 and 589.8 ± 105.01 mEq/L) were different (P  0.05) on E. coli and TCC in carcass swab samples. The APC of carcass swab samples were only affected (P < 0.05) by the FDT. The results indicated that preslaughter dietary management had no significant changes on hormone and blood metabolite concentrations and sheep might be more prone for fecal contamination than goats in the holding pens at abattoir.

  1. Sink or swim: a test of tadpole behavioral responses to predator cues and potential alarm pheromones from skin secretions.

    Science.gov (United States)

    Maag, Nino; Gehrer, Lukas; Woodhams, Douglas C

    2012-11-01

    Chemical signaling is a vital mode of communication for most organisms, including larval amphibians. However, few studies have determined the identity or source of chemical compounds signaling amphibian defensive behaviors, in particular, whether alarm pheromones can be actively secreted from tadpoles signaling danger to conspecifics. Here we exposed tadpoles of the common toad Bufo bufo and common frog Rana temporaria to known cues signaling predation risk and to potential alarm pheromones. In both species, an immediate reduction in swimming activity extending over an hour was caused by chemical cues from the predator Aeshna cyanea (dragonfly larvae) that had been feeding on conspecific tadpoles. However, B. bufo tadpoles did not detectably alter their behavior upon exposure to potential alarm pheromones, neither to their own skin secretions, nor to the abundant predator-defense peptide bradykinin. Thus, chemicals signaling active predation had a stronger effect than general alarm secretions of other common toad tadpoles. This species may invest in a defensive strategy alternative to communication by alarm pheromones, given that Bufonidae are toxic to some predators and not known to produce defensive skin peptides. Comparative behavioral physiology of amphibian alarm responses may elucidate functional trade-offs in pheromone production and the evolution of chemical communication.

  2. Acute Activation of Oxidative Pentose Phosphate Pathway as First-Line Response to Oxidative Stress in Human Skin Cells.

    Science.gov (United States)

    Kuehne, Andreas; Emmert, Hila; Soehle, Joern; Winnefeld, Marc; Fischer, Frank; Wenck, Horst; Gallinat, Stefan; Terstegen, Lara; Lucius, Ralph; Hildebrand, Janosch; Zamboni, Nicola

    2015-08-01

    Integrity of human skin is endangered by exposure to UV irradiation and chemical stressors, which can provoke a toxic production of reactive oxygen species (ROS) and oxidative damage. Since oxidation of proteins and metabolites occurs virtually instantaneously, immediate cellular countermeasures are pivotal to mitigate the negative implications of acute oxidative stress. We investigated the short-term metabolic response in human skin fibroblasts and keratinocytes to H2O2 and UV exposure. In time-resolved metabolomics experiments, we observed that within seconds after stress induction, glucose catabolism is routed to the oxidative pentose phosphate pathway (PPP) and nucleotide synthesis independent of previously postulated blocks in glycolysis (i.e., of GAPDH or PKM2). Through ultra-short (13)C labeling experiments, we provide evidence for multiple cycling of carbon backbones in the oxidative PPP, potentially maximizing NADPH reduction. The identified metabolic rerouting in oxidative and non-oxidative PPP has important physiological roles in stabilization of the redox balance and ROS clearance.

  3. Effect of extraction conditions on lycopene extractions from tomato processing waste skin using response surface methodology.

    Science.gov (United States)

    Kaur, Devinder; Wani, Ali Abas; Oberoi, D P S; Sogi, D S

    2008-05-15

    Skin, rich in lycopene, is an important component of waste originating from tomato paste manufacturing plants. A central composite design with five independent variables, namely solvent/meal ratio (20:1, 30:1, 40:1, 50:1, and 60:1v/w); number of extractions (1, 2, 3, 4 and 5); temperature (20, 30, 40, 50 and 60°C); particle size (0.05, 0.15, 0.25, 0.35 and 0.43mm); extraction time (4, 8, 12, 16 and 20min) was used to study their effects on lycopene extraction. The experimental values of lycopene ranged between 0.639 and 1.98mg/100g. The second order model obtained for extracted lycopene revealed a coefficient of determination (R(2)) of 0.99 and a standard error of 0.03. Maximum lycopene (1.98mg/100g) was extracted when the solvent/meal ratio, number of extractions, temperature, particle size and extraction time were 30:1v/w, 4, 50°C, 0.15mm and 8min, respectively.

  4. Preparation of reactive oxygen scavenging peptides from tilapia (Oreochromis niloticus) skin gelatin: optimization using response surface methodology.

    Science.gov (United States)

    Zhuang, Yongliang; Sun, Liping

    2011-04-01

    Gelatin extracted from tilapia skin was hydrolyzed with Properase E. Response surface methodology (RSM) was applied to optimize the hydrolysis condition (temperature [T], enzyme-to-substrate ratio [E/S], pH and reaction time [t]), to obtain the hydrolysate with the highest hydroxyl radical (•OH) scavenging activity. The optimum conditions obtained were T of 44.2 °C, E/S of 2.2%, pH of 9.2, and t of 3.4 h. The predicted •OH scavenging activity of the hydrolysate under the optimum conditions was 60.7%, and the actually experimental scavenging activity was 60.8%. The hydrolysate was fractionated by ultrafiltration, and 4 fractions were collected. The fraction TSGH4 (MWindustries.

  5. Bilateral skin conductance, finger pulse volume, and EEG orienting response to tones of differing intensities in chronic schizophrenics and controls.

    Science.gov (United States)

    Bernstein, A S; Taylor, K W; Starkey, P; Juni, S; Lubowsky, J; Paley, H

    1981-08-01

    Skin conductance (SCOR), finger pulse volume (FPV-OR), and EEG orienting responses were examined to repeated tones of either 60- or 90-dB intensity in chronic schizophrenics, nonschizophrenic psychiatric patients, and normals. SCOR reaffirmed previous findings with schizophrenics displaying significantly more frequent nonresponsiveness to 60-dB tones, and faster habituation among patients who did respond. Increased stimulus intensity decreased the incidence of nonresponsiveness to the level of controls, but did not alter the rapid habituation of schizophrenics. These results generalized fully to the FPV-OR, despite the independence demonstrated between SCOR and FPV-OR, but did not generalize to EEG response. There were no significant differences between schizophrenics and controls in EEG reactivity-only in background activity, particularly in a slowing of dominant alpha frequency in schizophrenics. Schizophrenics displayed the same degree of bilateral asymmetry as controls in both SCOR and EEG; there was no evidence of a specifically schizophrenic asymmetry. Schizophrenics nonresponsive in either SCOR or FPV-OR showed significantly greater Conceptual Disorganization and Emotional Withdrawal, and significantly less Excitement than responders in blind clinical ratings on the Brief Psychiatric Rating Scale. None of the findings could be attributed to the effect of neuroleptics. Comparisons between medicated and nonmedicated patients showed no drug-associated effect on any OR variable under study. Drug effects were apparent only in skin conductance level (SCL). Neuroleptics were associated with a significant reduction in SCL in both schizophrenics and nonschizophrenics, together with a flattening of an otherwise incrementing SCL among schizophrenics.

  6. Autologous serum skin test response in chronic spontaneous urticaria and respiratory diseases and its relationship with serum interleukin-18 level.

    Science.gov (United States)

    Kurt, Emel; Aktas, Ayse; Aksu, Kurtulus; Keren, Metin; Dokumacioglu, Ali; Goss, Christopher H; Alatas, Ozkan

    2011-11-01

    Autologous serum skin test (ASST) is mostly used in chronic spontaneous urticaria (CSU) to show autoreactivity. Interleukin-18 (IL-18) has also been shown to be involved in autoimmune conditions. To investigate the role of autoreactivity assessed by ASST in CSU and respiratory diseases and to investigate whether this autoreactive state is related to IL-18 level or other clinical covariates. Fifty-five patients with CSU (mean age: 40.3 ± 12.3 years), 70 patients with persistent asthma (mean age: 43.7 ± 9.6 years), 21 patients with seasonal allergic rhinitis (SAR) (mean age: 35.5 ± 11.8 years) and 20 normal controls (mean age: 37.7 ± 9.8) were included. All subjects underwent a laboratory examination and skin prick test. ASST was performed and serum IL-18 levels were measured in all subjects. Positive response to ASST and serum IL-18 levels were higher in CSU patients than those with respiratory diseases (asthma and SAR) (P = 0.034 and 0.002, respectively) and normal controls (P = 0.004 and 0.031, respectively). Considering all patients, IL-18 levels were higher in patients with positive ASST (301.8 ± 194.4 vs. 241.8 ± 206.3 pg/ml, P = 0.036) than ASST negative patients. ASST response was associated with disease severity in CSU (P = 0.037) and asthma patients (P = 0.001). Multivariate analysis showed that positive response to ASST was significantly associated with diagnosis of CSU (OR: 3.13, 95% CI: 1.25-7.87) and female gender (OR: 3.98, 95% CI: 1.19-13.38). ASST response could be related with activity of the disease. A positive ASST response found in respiratory diseases patients suggests that it may occur as a result of some inflammatory events during the diseases' process.

  7. The impact of psychosocial stress on healthy skin.

    Science.gov (United States)

    Hunter, H J A; Momen, S E; Kleyn, C E

    2015-07-01

    Dermatologists are only too aware of the significant role psychosocial stress plays in the exacerbation of skin disease; indeed, it is often the first precipitant patients mention when they attend outpatient clinics. Of late, research has focused on understanding the 'brain-skin' axis, a complex interplay between the nervous and immune systems and the skin. In particular, there is an evolving body of literature exploring the underlying pathophysiological mechanisms by which psychosocial stress influences skin homeostasis. This article provides a broad overview of the literature, emphasizing the importance of individual stress perception and summarizing the varied roles of the major cutaneous stress-response pathways. Both central [the hypothalamic-pituitary-adrenal (HPA) axis and the locus ceruleus-norepinephrine (LC-NE) sympathetic adrenomedullary system] and peripheral (the intracutaneous HPA axis and the release of mediators from peripheral sensory and autonomic nerves) pathways are discussed. Moreover, how activation of these pathways affects the skin's immune system, barrier function, wound healing and susceptibility to infection is reviewed. Although this field of research is rapidly expanding, several important questions remain unanswered, including: what is the precise role of mast cells in the cutaneous stress response?; what is the role of regulatory T-cells?; can therapeutic intervention be harnessed to prevent the stress-induced exacerbation of skin disease? It is anticipated that an improved understanding of the underlying mechanisms through which psychosocial stress affects the homeostasis of healthy skin will not only increase knowledge of the brain-skin axis but will also improve the holistic management of stress-responsive cutaneous disease.

  8. Rate of change in cerebral oxygenation and blood pressure in response to passive changes in posture: a comparison between pure autonomic failure patients and controls.

    Science.gov (United States)

    Tachtsidis, Ilias; Elwell, Clare E; Leung, Terence S; Bleasdale-Barr, Katharine; Hunt, Katharine; Toms, Nathan; Smith, Martin; Mathias, Christopher J; Delpy, David T

    2005-01-01

    The cardiovascular and cerebrovascular responses to head-up postural change are compromised in pure autonomic failure (PAF) patients because of sympathetic denervation. The aim of this study was to characterize the rate of change of systemic mean blood pressure (MBP) and cerebral haemodynamics in response to passive posture changes. Nine PAF patients and 9 age-matched controls took part in this study. MBP and oxy- (O2Hb), deoxy-haemoglobin (HHb), and tissue oxygenation index (TOI) on the forehead were continuously monitored non-invasively using the Portapres and near-infrared spectroscopy (NIRS), respectively. From visual inspection of the haemoglobin difference signal (Hb(diff) = O2Hb-HHb), seven distinct phases were marked (1: supine, 2: start passive tilt, 3: head up to 60 degrees degrees, 4: end of tilt, 5: tilt reversal, 6: return to supine, 7: rest); the same time points were used for all of the other signals. For each phase, the slope was calculated using a linear regression algorithm. Significant differences were found between PAF patients and controls in the Hb(diff) slope magnitudes for phases 3 (P rate of change suggest differences in blood vessel resistance related to sympathetic activation.

  9. The effect of salmeterol and salbutamol on mediator release and skin responses in immediate and late phase allergic cutaneous reactions

    DEFF Research Database (Denmark)

    Petersen, Lars Jelstrup; Skov, P S

    1999-01-01

    BACKGROUND: Salmeterol is a long-acting beta2-agonist which in animal studies has been shown to possess anti-inflammatory effects on early (EAR) and late (LPR) phase allergic responses. PURPOSE: To evaluate the anti-inflammatory effects of intradermally injected salmeterol and salbutamol on clini......BACKGROUND: Salmeterol is a long-acting beta2-agonist which in animal studies has been shown to possess anti-inflammatory effects on early (EAR) and late (LPR) phase allergic responses. PURPOSE: To evaluate the anti-inflammatory effects of intradermally injected salmeterol and salbutamol...... and histamine were not or only marginally reduced. Salmeterol and salbutamol (10(-6) M) inhibited clinical LPR at 6 h by 71% and 48%, Except for the clinical LPR, no statistical differences were found between the two drugs on any parameters. None of the drugs inhibited levels of histamine, tryptase......, myeloperoxidase, or eosinophil cationic protein in LPR. CONCLUSIONS: Salmeterol and salbutamol inhibited allergen-induced skin responses, and reduced mediator release in EAR but not LPR. In general, the anti-inflammatory effects of salmeterol did not differ from those induced by salbutamol....

  10. Evaluation of the autonomic neuropathy function immediately after a change to upright posture using the impulse response function; Impulse oto kansu wo mochiita shisei henkan katoki ni okeru jiritsu shinkei kino hyoka

    Energy Technology Data Exchange (ETDEWEB)

    Yokoyama, K. [Nagoya City University, Nagoya (Japan); Moyoshi, M.; Takata, K. [Daido Institute of Technology, Nagoya (Japan); Watanabe, Y. [Toyota College of Technology, Aichi (Japan)

    1997-05-20

    Autonomic neuropathy function immediately after a change to upright posture has been evaluated by applying transient response function of the system to the blood regulation system. The impulse response function was determined from the change in heart rate before postural change to the upright posture, and was compared with the transient change immediately after a change to the upright posture. The time series of R-R interval of electrocardiogram was used as the time series of the change in heart rate. To determine the impulse response function, an autoregressive model was applied to the R-R interval time series. The impulse response function at the steady state is a transient reaction at the impulse stimulation added to the blood regulation system. The R-R interval decreases rapidly by the autonomic neuropathy reaction in which the blood is rapidly transferred into the legs immediately after a change to upright posture. There is a close correlation between the initial temporary decrease in R-R interval and the impulse response function derived from the change in heart rate immediately after a change to the upright posture. Accordingly, the blood regulation and autonomic neuropathy functions can be evaluated by the impulse response function without actual standing test and load of tested persons. 9 refs., 3 figs., 1 tab.

  11. Inter-subject, inter-ocular and inter-session repeatability of the photopic negative response of the electroretinogram recorded using DTL and skin electrodes.

    Science.gov (United States)

    Mortlock, Katharine E; Binns, Alison M; Aldebasi, Yousef H; North, Rachel V

    2010-10-01

    The photopic negative response (PhNR) has attracted interest as a flash ERG component reflecting inner retinal activity, with investigators adopting various approaches to analysing the response. This study has two principal aims: first to determine the most reliable technique for assessing the PhNR amplitude; secondly to compare the repeatability characteristics of the PhNR recorded using DTL and skin active electrodes. Electroretinograms were recorded in 31 subjects, using both electrode types, in response to a Ganzfeld red stimulus (Lee filter "bright red"; 1.76 log phot td.s; 4 Hz) presented over a steady blue background (Schott glass filter BG28; 3.9 log scot td). Sixteen subjects returned to assess repeatability. PhNR amplitude was measured from b-wave peak-to-PhNR trough, pre-stimulus baseline to trough, and from peak and baseline to a fixed time-point; a ratio of b-wave/PhNR amplitude was also calculated. Coefficients of variation (CoV), and inter-ocular and inter-session limits of agreement (LoA) were calculated for all measures. The ratio of b-wave/PhNR amplitude showed the lowest CoV (14.3% DTL; 23.2% skin), inter-ocular LoA (22.2% DTL; 25.0% skin), and inter-session LoA (22.8% DTL; 20.3% skin). The peak-to-trough and peak-to-fixed-time measurements were also consistently reliable. Least reliable measures were those measured from baseline. While skin electrode responses were significantly smaller than DTL responses (P < 0.0001), the variability was only slightly increased. This study suggests that peak-to-trough measurements are the most reliable means of measuring the PhNR and ratio calculation further improves repeatability. Skin electrodes provided a viable alternative to DTL electrodes for recording the PhNR.

  12. Autonomic dysreflexia: a medical emergency

    Science.gov (United States)

    Bycroft, J; Shergill, I; Choong, E; Arya, N; Shah, P

    2005-01-01

    Autonomic dysreflexia is an important clinical diagnosis that requires prompt treatment to avoid devastating complications. The condition may present itself to all members of medical and surgical specialties, who may not be accustomed to treating it. It is the clinician's responsibility to have a basic understanding of the pathophysiology of the condition and the simple steps required to treat it. PMID:15811886

  13. Skin conductance responses of spider phobics to backwardly masked phobic cues

    NARCIS (Netherlands)

    Mayer, B; Merckelbach, H; de Jong, Peter; Leeuw, W.J.F.

    1999-01-01

    The present study was carried out to test Ohman's (1994) hypothesis that a pre-attentive analysis of phobic stimuli is sufficient for a fear response to occur. Spider phobic (n = 47) and nonphobic (n = 41) subjects were exposed to phobic slides (spiders) and nonphobic slides (flowers, mushrooms, and

  14. Effect of functional electrostimulation on impaired skin vasodilator responses to local heating in spinal cord injury.

    NARCIS (Netherlands)

    Duijnhoven, N.T.L. van; Janssen, T.W.; Green, D.J.; Minson, C.T.; Hopman, M.T.E.; Thijssen, D.H.J.

    2009-01-01

    Spinal cord injury (SCI) induces vascular adaptations below the level of the lesion, such as impaired cutaneous vasodilation. However, the mechanisms underlying these differences are unclear. The aim of this study is to examine arm and leg cutaneous vascular conductance (CVC) responses to local heat

  15. A Simple Autonomous Current-Sharing Control Strategy for Fast Dynamic Response of Parallel Inverters in Islanded Microgrids

    DEFF Research Database (Denmark)

    Guan, Yajuan; Vasquez, Juan Carlos; Guerrero, Josep M.

    2014-01-01

    This paper proposed a novel control strategy based on a virtual resistance and a phase locked loop for parallel three-phase inverters. The proposed controller can overcome the drawbacks of the conventional droop control such as slow transient response, complex design, and limited stability margin...

  16. Morphologic Changes in Autonomic Nerves in Diabetic Autonomic Neuropathy

    Directory of Open Access Journals (Sweden)

    Heung Yong Jin

    2015-12-01

    Full Text Available Diabetic neuropathy is one of the major complications of diabetes, and it increases morbidity and mortality in patients with both type 1 diabetes mellitus (T1DM and type 2 diabetes mellitus (T2DM. Because the autonomic nervous system, for example, parasympathetic axons, has a diffuse and wide distribution, we do not know the morphological changes that occur in autonomic neural control and their exact mechanisms in diabetic patients with diabetic autonomic neuropathy (DAN. Although the prevalence of sympathetic and parasympathetic neuropathy is similar in T1DM versus T2DM patients, sympathetic nerve function correlates with parasympathetic neuropathy only in T1DM patients. The explanation for these discrepancies might be that parasympathetic nerve function was more severely affected among T2DM patients. As parasympathetic nerve damage seems to be more advanced than sympathetic nerve damage, it might be that parasympathetic neuropathy precedes sympathetic neuropathy in T2DM, which was Ewing's concept. This could be explained by the intrinsic morphologic difference. Therefore, the morphological changes in the sympathetic and parasympathetic nerves of involved organs in T1DM and T2DM patients who have DAN should be evaluated. In this review, evaluation methods for morphological changes in the epidermal nerves of skin, and the intrinsic nerves of the stomach will be discussed.

  17. Sensitivity Analysis of Vagus Nerve Stimulation Parameters on Acute Cardiac Autonomic Responses: Chronotropic, Inotropic and Dromotropic Effects

    Science.gov (United States)

    Ojeda, David; Le Rolle, Virginie; Romero-Ugalde, Hector M.; Gallet, Clément; Bonnet, Jean-Luc; Henry, Christine; Bel, Alain; Mabo, Philippe; Carrault, Guy; Hernández, Alfredo I.

    2016-01-01

    Although the therapeutic effects of Vagus Nerve Stimulation (VNS) have been recognized in pre-clinical and pilot clinical studies, the effect of different stimulation configurations on the cardiovascular response is still an open question, especially in the case of VNS delivered synchronously with cardiac activity. In this paper, we propose a formal mathematical methodology to analyze the acute cardiac response to different VNS configurations, jointly considering the chronotropic, dromotropic and inotropic cardiac effects. A latin hypercube sampling method was chosen to design a uniform experimental plan, composed of 75 different VNS configurations, with different values for the main parameters (current amplitude, number of delivered pulses, pulse width, interpulse period and the delay between the detected cardiac event and VNS onset). These VNS configurations were applied to 6 healthy, anesthetized sheep, while acquiring the associated cardiovascular response. Unobserved VNS configurations were estimated using a Gaussian process regression (GPR) model. In order to quantitatively analyze the effect of each parameter and their combinations on the cardiac response, the Sobol sensitivity method was applied to the obtained GPR model and inter-individual sensitivity markers were estimated using a bootstrap approach. Results highlight the dominant effect of pulse current, pulse width and number of pulses, which explain respectively 49.4%, 19.7% and 6.0% of the mean global cardiovascular variability provoked by VNS. More interestingly, results also quantify the effect of the interactions between VNS parameters. In particular, the interactions between current and pulse width provoke higher cardiac effects than the changes on the number of pulses alone (between 6 and 25% of the variability). Although the sensitivity of individual VNS parameters seems similar for chronotropic, dromotropic and inotropic responses, the interacting effects of VNS parameters provoke

  18. Th17 and regulatory T cells contribute to the in situ immune response in skin lesions of Jorge Lobo's disease.

    Science.gov (United States)

    Kanashiro-Galo, Luciane; Pagliari, Carla; Barboza, Tania Cristina; de Brito, Arival Cardoso; Xavier, Marilia Brasil; de Oliveira, Clivia Maria Moraes; Unger, Deborah Aben Athar; Sotto, Mirian Nacagami; Quaresma, Juarez Antonio Simões; Duarte, Maria Irma Seixas

    2016-01-01

    Jorge Lobo's disease (JLD) is a chronic granulomatous mycosis described in various Latin American countries. The main objective of the present study was to investigate the possible role of Th17 and Foxp3+ Treg cells in the pathogenesis of Jorge Lobo's disease. Human skin biopsies were submitted to an immunohistochemistry protocol to detect Foxp3, interleukin (IL)-1beta, CD25, IL-6, IL-17, and IL-23. The epidermis presented acanthosis, hyperkeratosis, and frequent presence of fungi. The dermis presented inflammatory infiltrate comprising macrophages, lymphocytes, epithelioid and multinucleated cells, and an intense number of fungi. Foxp3+ Treg cells and IL-17+ cells were visualized in lymphocytes in the inflammatory infiltrate. IL-1, IL-2R (CD25), IL-6, and IL-23 were visualized in the dermis, intermingled with fungal cells, permeating or participating of the granuloma. Following IL-17, the most prominent cytokine was IL-6. IL-23 and cells expressing CD25 were present in fewer number. The comparative analysis between IL-17 and Foxp3 demonstrated a statistically significant increased number of IL-17+ cells. Th17 cells play a role in the immune response of JLD. IL-1beta and IL-6 added to the previously described increased number of TGF-beta would stimulate such pattern of response. Th17 cells could be present as an effort to modulate the local immune response; however, high levels of a Th17 profile could overcome the role of Treg cells. The unbalance between Treg/Th17 cells seems to corroborate with the less effective immune response against the fungus.

  19. Deep tissue injury in development of pressure ulcers: a decrease of inflammasome activation and changes in human skin morphology in response to aging and mechanical load.

    Directory of Open Access Journals (Sweden)

    Olivera Stojadinovic

    Full Text Available Molecular mechanisms leading to pressure ulcer development are scarce in spite of high mortality of patients. Development of pressure ulcers that is initially observed as deep tissue injury is multifactorial. We postulate that biomechanical forces and inflammasome activation, together with ischemia and aging, may play a role in pressure ulcer development. To test this we used a newly-developed bio-mechanical model in which ischemic young and aged human skin was subjected to a constant physiological compressive stress (load of 300 kPa (determined by pressure plate analyses of a person in a reclining position for 0.5-4 hours. Collagen orientation was assessed using polarized light, whereas inflammasome proteins were quantified by immunoblotting. Loaded skin showed marked changes in morphology and NLRP3 inflammasome protein expression. Sub-epidermal separations and altered orientation of collagen fibers were observed in aged skin at earlier time points. Aged skin showed significant decreases in the levels of NLRP3 inflammasome proteins. Loading did not alter NLRP3 inflammasome proteins expression in aged skin, whereas it significantly increased their levels in young skin. We conclude that aging contributes to rapid morphological changes and decrease in inflammasome proteins in response to tissue damage, suggesting that a decline in the innate inflammatory response in elderly skin could contribute to pressure ulcer pathogenesis. Observed morphological changes suggest that tissue damage upon loading may not be entirely preventable. Furthermore, newly developed model described here may be very useful in understanding the mechanisms of deep tissue injury that may lead towards development of pressure ulcers.

  20. Skin Conditions

    Science.gov (United States)

    Your skin is your body's largest organ. It covers and protects your body. Your skin Holds body fluids in, preventing dehydration Keeps harmful ... it Anything that irritates, clogs, or inflames your skin can cause symptoms such as redness, swelling, burning, ...

  1. Curcumin induces stress response and hormetically modulates wound healing ability of human skin fibroblasts undergoing ageing in vitro.

    Science.gov (United States)

    Demirovic, Dino; Rattan, Suresh I S

    2011-10-01

    Wound healing becomes impaired in several diseases and during ageing. A commonly used model for the study of wound healing is a scratched monolayer of cells in vitro, which is convenient for the analysis of the cellular and molecular changes occurring during the two phases of wound healing, namely cell migration and cell proliferation. Cell migration, which is the primary event to occur during initial wound healing, is inversely dependent on the number of focal adhesions (FA) that attach cells to the extracellular matrix. Here we report that the number of FA, measured by determining the levels of FA-proteins paxillin and talin, increase with increasing population doubling level of the serially passaged normal adult skin fibroblasts, and that this increase may account for the age-related slowing down of wound healing in vitro. We also report that curcumin, a component of the widely used spice turmeric, modulates wound healing in vitro in a biphasic dose response manner, being stimulatory at low doses (between 1 and 5 μM), and inhibitory at higher doses. Furthermore, our results show that the hormetic effects of low levels of curcumin are achieved by virtue of it being a hormetin in terms of the induction of stress response pathways, including Nrf2 and HO-1 in human cells.

  2. Diagnosis and behavior in autonomic trigeminal headaches

    Directory of Open Access Journals (Sweden)

    Erélido Hernández Valero

    2008-04-01

    Full Text Available Autonomic trigeminal headaches are primary headaches which include: cluster headaches, paroxistical hemicranea, and syndrome of unilateral headache in a neuralgic way, of short duration, accompanied by cojunctival injection and tearing and the continuous hemicranea. It is also accompanied by autonomic manifestations such as: palpebrate ptosis, tearing, nasal congestion, rhinorrhea, Horner syndrome (palpebrate ptosis, miosis, and enophthalmos and changes in the coloration of the periocular skin and in the cheek. In this paper we propose the most likely diagnosis and therapeutic to this nosologic entity

  3. Inflammatory response, parasite load and AgNOR expression in ear skin of symptomatic and asymptomatic Leishmania (Leishmania chagasi infected dogs

    Directory of Open Access Journals (Sweden)

    Verçosa BLA

    2011-01-01

    Full Text Available The skin has an important role in the transmission of visceral leishmaniasis (VL as the infection pathway in dogs. To better characterize the inflammatory response of intact skin in VL, sixty infected dogs (30 symptomatic and 30 asymptomatic and six non-infected controls were studied. Diagnosis of visceral leishmaniasis was confirmed by RIFI and ELISA; direct visualization of the parasite in bone marrow aspirate; imprints of popliteal lymph nodes, spleen, liver and skin; culture in NNN-phase liquid Schneider's medium; and PCR (performed only in the ear skin. Amastigote forms of the parasite in intact skin were found only in symptomatic dogs. Inflammatory infiltrates were observed in all groups, varying from intense and/or moderate in symptomatic to discrete and/or negligible in asymptomatic and control animals. Parasite load was associated with the intensity of the inflammatory response and with clinical manifestations in canine visceral leishmaniasis. AgNOr as active transcription markers were expressed in inflammatory cells and within apoptotic bodies in all groups, including controls, with no statistical difference. Therefore, cell activation and transcription do occur in both symptomatic and asymptomatic canine visceral leishmaniasis and may result in more necrosis and inflammation or in apoptosis and less symptoms, depending on the parasite load.

  4. Development of New Generation of Perspireable Skin

    Science.gov (United States)

    2015-02-20

    AFRL-OSR-VA-TR-2015-0229 DEVELOPMENT OF NEW GENERATION OF PERSPIREABLE SKIN Patrick Kwon MICHIGAN STATE UNIV EAST LANSING Final Report 02/20/2015...Report 06/15/2010-11/14/2014 DEVELOPMENT OF NEW GENERATION OF PERSPIRABLE SKIN FA9550-10-1-0238 Patrick Kwon Professor Department of mechanical...autonomous, self-cooling multi-functional material systems. Similar to our skin that maintains our body temperature, the proposed material system

  5. Autonomic thermoregulatory dysfunction in neurofibromatosis type 1

    Directory of Open Access Journals (Sweden)

    Luciana G Madeira

    Full Text Available ABSTRACT Objective Neurofibromatosis type 1 (NF1 causes neural and cutaneous disorders and reduced exercise capacity. Exercise/heat exposure increasing internal temperature must be compensated by eccrine sweat function and warmed skin vasodilation. We suspected NF1 could adversely affect eccrine sweat function and/or vascular thermoregulatory responses (VTR. Methods The eccrine sweat function and VTR of 25 NF1 volunteers (14 males, 11 females; 16–57 years old were compared with 23 non-NF1 controls matched by sex, age, height and weight (CG. Sweating was induced by 1 pilocarpine 1% iontophoresis (PILO; and 2 by passive heating (HEAT via the lower third of the legs being immersed in 42°C water for one hour. Previously established eccrine sweat function and VTR protocols were used. Results The NF1 group showed: a lower sweat rate than the CG group during PILO; b a smaller diastolic pressure decrease; and c higher tympanic temperatures than controls during HEAT (p < 0.05. Conclusion Reduced sweating and vascular thermoregulatory responses suggest autonomic dysfunction in NF1 individuals.

  6. Autonomic Nervous System Disorders

    Science.gov (United States)

    Your autonomic nervous system is the part of your nervous system that controls involuntary actions, such as the beating of your heart ... breathing and swallowing Erectile dysfunction in men Autonomic nervous system disorders can occur alone or as the result ...

  7. Nordihydroguaiaretic Acid from Creosote Bush (Larrea tridentata Mitigates 12-O-Tetradecanoylphorbol-13-Acetate-Induced Inflammatory and Oxidative Stress Responses of Tumor Promotion Cascade in Mouse Skin

    Directory of Open Access Journals (Sweden)

    Shakilur Rahman

    2011-01-01

    Full Text Available Nordihydroguaiaretic acid (NDGA is a phenolic antioxidant found in the leaves and twigs of the evergreen desert shrub, Larrea tridentata (Sesse and Moc. ex DC Coville (creosote bush. It has a long history of traditional medicinal use by the Native Americans and Mexicans. The modulatory effects of topically applied NDGA was studied on acute inflammatory and oxidative stress responses in mouse skin induced by stage I tumor promoting agent, 12-O-tetradecanoylphorbol-13-acetate (TPA. Double TPA treatment adversely altered many of the marker responses of stage I skin tumor promotion cascade. Pretreatment of NDGA in TPA-treated mice mitigated cutaneous lipid peroxidation and inhibited production of hydrogen peroxide. NDGA treatment also restored reduced glutathione level and activities of antioxidant enzymes. Elevated activities of myeloperoxidase, xanthine oxidase and skin edema formation in TPA-treated mice were also lowered by NDGA indicating a restrained inflammatory response. Furthermore, results of histological study demonstrated inhibitory effect of NDGA on cellular inflammatory responses. This study provides a direct evidence of antioxidative and anti-inflammatory properties of NDGA against TPA-induced cutaneous inflammation and oxidative stress corroborating its chemopreventive potential against skin cancer.

  8. Nordihydroguaiaretic Acid from Creosote Bush (Larrea tridentata) Mitigates 12-O-Tetradecanoylphorbol-13-Acetate-Induced Inflammatory and Oxidative Stress Responses of Tumor Promotion Cascade in Mouse Skin.

    Science.gov (United States)

    Rahman, Shakilur; Ansari, Rizwan Ahmed; Rehman, Hasibur; Parvez, Suhel; Raisuddin, Sheikh

    2011-01-01

    Nordihydroguaiaretic acid (NDGA) is a phenolic antioxidant found in the leaves and twigs of the evergreen desert shrub, Larrea tridentata (Sesse and Moc. ex DC) Coville (creosote bush). It has a long history of traditional medicinal use by the Native Americans and Mexicans. The modulatory effects of topically applied NDGA was studied on acute inflammatory and oxidative stress responses in mouse skin induced by stage I tumor promoting agent, 12-O-tetradecanoylphorbol-13-acetate (TPA). Double TPA treatment adversely altered many of the marker responses of stage I skin tumor promotion cascade. Pretreatment of NDGA in TPA-treated mice mitigated cutaneous lipid peroxidation and inhibited production of hydrogen peroxide. NDGA treatment also restored reduced glutathione level and activities of antioxidant enzymes. Elevated activities of myeloperoxidase, xanthine oxidase and skin edema formation in TPA-treated mice were also lowered by NDGA indicating a restrained inflammatory response. Furthermore, results of histological study demonstrated inhibitory effect of NDGA on cellular inflammatory responses. This study provides a direct evidence of antioxidative and anti-inflammatory properties of NDGA against TPA-induced cutaneous inflammation and oxidative stress corroborating its chemopreventive potential against skin cancer.

  9. Skin conductance fear conditioning impairments and aggression: a longitudinal study.

    Science.gov (United States)

    Gao, Yu; Tuvblad, Catherine; Schell, Anne; Baker, Laura; Raine, Adrian

    2015-02-01

    Autonomic fear conditioning deficits have been linked to child aggression and adult criminal behavior. However, it is unknown if fear conditioning deficits are specific to certain subtypes of aggression, and longitudinal research is rare. In the current study, reactive and proactive aggression were assessed in a sample of males and females when aged 10, 12, 15, and 18 years old. Skin conductance fear conditioning data were collected when they were 18 years old. Individuals who were persistently high on proactive aggression measures had significantly poorer conditioned responses at 18 years old when compared to others. This association was not found for reactive aggression. Consistent with prior literature, findings suggest that persistent antisocial individuals have unique neurobiological characteristics and that poor autonomic fear conditioning is associated with the presence of increased instrumental aggressive behavior.

  10. Relationship between Sympathetic Skin Responses and Auditory Hypersensitivity to Different Auditory Stimuli.

    Science.gov (United States)

    Kato, Fumi; Iwanaga, Ryoichiro; Chono, Mami; Fujihara, Saori; Tokunaga, Akiko; Murata, Jun; Tanaka, Koji; Nakane, Hideyuki; Tanaka, Goro

    2014-07-01

    [Purpose] Auditory hypersensitivity has been widely reported in patients with autism spectrum disorders. However, the neurological background of auditory hypersensitivity is currently not clear. The present study examined the relationship between sympathetic nervous system responses and auditory hypersensitivity induced by different types of auditory stimuli. [Methods] We exposed 20 healthy young adults to six different types of auditory stimuli. The amounts of palmar sweating resulting from the auditory stimuli were compared between groups with (hypersensitive) and without (non-hypersensitive) auditory hypersensitivity. [Results] Although no group × type of stimulus × first stimulus interaction was observed for the extent of reaction, significant type of stimulus × first stimulus interaction was noted for the extent of reaction. For an 80 dB-6,000 Hz stimulus, the trends for palmar sweating differed between the groups. For the first stimulus, the variance became larger in the hypersensitive group than in the non-hypersensitive group. [Conclusion] Subjects who regularly felt excessive reactions to auditory stimuli tended to have excessive sympathetic responses to repeated loud noises compared with subjects who did not feel excessive reactions. People with auditory hypersensitivity may be classified into several subtypes depending on their reaction patterns to auditory stimuli.

  11. Design and fabrication of a sensor integrated MEMS/NANO-skin system for human physiological response measurement

    Science.gov (United States)

    Leng, Hongjie; Lin, Yingzi

    2010-04-01

    Human state in human-machine systems highly affects the system performance, and should be monitored. Physiological cues are more suitable for monitoring the human state in human-machine system. This study was focused on developing a new sensing system, i.e. NANO-Skin, to non-intrusively measure physiological cues from human-machine contact surfaces for human state recognition. The first part was to analyze the relation between human state and physiological cues. Generally, heart rate, skin conductance, skin temperature, operating force, blood alcohol concentration, sweat rate, and electromyography have close relation with human state, and can be measured from human skin. The second part was to compare common sensors, MEMS sensors, and NANO sensors. It was found that MEMS sensors and NANO sensors can offer unique contributions to the development of NANO-Skin. The third part was to discuss the design and manufacture of NANO-Skin. The NANO-Skin involves five components, the flexible substrate, sensors, special integrated circuit, interconnection between sensors and special integrated circuit, and protection layer. Experiments were performed to verify the measurement accuracy of NANO-Skin. It is feasible to use NANO-Skins to non-intrusively measure physiological cues from human-machine contact surfaces for human state recognition.

  12. [Trigeminal autonomic cephalgias].

    Science.gov (United States)

    Maximova, M Yu; Piradov, M A; Suanova, E T; Sineva, N A

    2015-01-01

    Review of literature on the trigeminal autonomic cephalgias are presented. Trigeminal autonomic cephalgias are primary headaches with phenotype consisting of trigeminal pain with autonomic sign including lacrimation, rhinorrhea and miosis. Discussed are issues of classification, pathogenesis, clinical picture, diagnosis, differential diagnosis and treatment of this headache. Special attention is paid to cluster headache, paroxysmal hemicrania, SUNCT syndrome, hemicrania continua.

  13. Autonomic contributions to empathy: evidence from patients with primary autonomic failure.

    Science.gov (United States)

    Chauhan, Bina; Mathias, Christopher J; Critchley, Hugo D

    2008-06-01

    Empathy for the emotions of others may require simulatory engagement of corresponding autonomic arousal states. We tested the hypothesis that disruption of autonomic control impairs the ability to empathize emotionally with others. Fifteen patients with primary autonomic failure showed attenuated scores on the Mehrabian Balanced Emotional Empathy Scale (BEES), compared to both younger and older controls. This effect was not accounted for by age, gender, mood state or functional disability. These early observations provide preliminary evidence for a direct contribution of autonomic responsivity to the 'higher-order' social cognitive process of empathy, and may inform the dynamics of supportive care.

  14. Eldercare at Home: Skin Problems

    Science.gov (United States)

    ... disorders that give rise to serious medical problems. Older skin is less oily, less elastic, and thinner. It ... of old age." Response Yes, it is true older skin is less oily and it is thinner than ...

  15. Prostaglandin receptor EP2 is responsible for cyclooxygenase-2 induction by prostaglandin E2 in mouse skin.

    Science.gov (United States)

    Ansari, Kausar M; Sung, You Me; He, Guobin; Fischer, Susan M

    2007-10-01

    The EP2 prostanoid receptor is one of the four subtypes of receptors for prostaglandin E2 (PGE2). We previously reported that deletion of EP2 led to resistance to chemically induced mouse skin carcinogenesis, whereas overexpression of EP2 resulted in enhanced tumor development. The purpose of this study was to investigate the underlying molecular mechanisms. We found that EP2 knockout mice had reduced cyclooxygenase-2 (COX-2) expression after 12-O-tetradecanoylphorbol-13-acetate (TPA) treatment compared with wild-type (WT) mice. Further, primary keratinocytes from EP2 transgenic mice had increased COX-2 expression after either TPA or PGE2 treatment and COX-2 expression was blocked by 10 microM SQ 22,536, an adenylate cyclase inhibitor. EP2 knockout mice had significantly decreased, whereas EP2 transgenic mice had significantly increased PGE2 production in response to a single treatment of TPA. Cyclic AMP response element-binding protein (CREB) phosphorylation was elevated to a greater extent in keratinocytes from EP2 transgenic mice compared with those of WT mice following PGE2 treatment. A protein kinase A (PKA) inhibitor reduced PGE2-mediated CREB phosphorylation in keratinocytes from EP2 transgenic mice. Furthermore, we found that there was no CREB phosphorylation in EP2 knockout mice following PGE2 treatment. PGE2-induced DNA synthesis (cell proliferation) was significantly decreased in keratinocytes from EP2 knockout mice following pretreatment with 10 microM SQ 22,536. Taken together, EP2 activation of the PKA/CREB-signaling pathway is responsible for keratinocyte proliferation and our findings reveal a positive feedback loop between COX-2 and PGE2 that is mediated by the EP2 receptor.

  16. Increased skin conductance responses and neural activity during fear conditioning are associated with a repressive coping style

    Directory of Open Access Journals (Sweden)

    Tim eKlucken

    2015-06-01

    Full Text Available The investigation of individual differences in coping styles in response to fear conditioning is an important issue for a better understanding of the etiology and treatment of psychiatric disorders. It has been assumed that an avoidant (repressive coping style is characterized by increased emotion regulation efforts in context of fearful stimuli as compared to a more vigilant coping style. However, no study so far has investigated the neural correlates of fear conditioning of repressors and sensitizers.In the present fMRI study, 76 participants were classified as repressors or as sensitizers and were exposed to a fear conditioning paradigm, in which the CS+ predicted electrical stimulation, while another neutral stimulus (CS- did not. In addition, skin conductance responses (SCRs were measured continuously.As the main findings, we found increased neural activations in repressors as compared to sensitizers in the ventromedial prefrontal cortex and the anterior cingulate cortex during fear conditioning. In addition, elevated activity to the CS+ in amygdala, insula, occipital, and orbitofrontal cortex as well as conditioned SCRs were found in repressors.The present results demonstrate increased neural activations in structures linked to emotion down-regulation mechanisms like the ventromedial prefrontal cortex, which may reflect the increased coping effort in repressors. At the same time, repressors showed increased activations in arousal and evaluation-associated structures like the amygdala, the occipital cortex, and the orbitofrontal cortex, which is also mirrored in increased SCRs. The present results support recent assumptions about a two-process model of repression postulating a fast vigilant response to fearful stimuli, but also a second emotion down-regulating process.

  17. Tuberculin skin test reversion following isoniazid preventive therapy reflects diversity of immune response to primary Mycobacterium tuberculosis infection.

    Directory of Open Access Journals (Sweden)

    Denise F Johnson

    Full Text Available RATIONALE: Healthy household contacts (HHC of individuals with Tuberculosis (TB with Tuberculin Skin Test (TST conversions are considered to harbor latent Mycobacterium tuberculosis (Mtb, and at risk for TB. The immunologic, clinical, and public health implications of TST reversions that occur following Isoniazid preventive therapy (IPT remain controversial. OBJECTIVES: To measure frequency of TST reversion following IPT, and variation in interferon-gamma (IFN-γ responses to Mtb, in healthy Ugandan TB HHC with primary Mtb infection evidenced by TST conversion. METHODS: Prospective cohort study of healthy, HIV-uninfected, TST-negative TB HHC with TST conversions. Repeat TST was performed 12 months following conversion (3 months following completion of 9 month IPT course to assess for stable conversion vs. reversion. Whole blood IFN-γ responses to Mtb antigen 85B (MtbA85B and whole Mtb bacilli (wMtb were measured in a subset (n = 27 and n = 42, respectively at enrollment and TST conversion, prior to initiation of IPT. RESULTS: Of 122 subjects, TST reversion was noted in 25 (20.5%. There were no significant differences in demographic, clinical, or exposure variables between reverters and stable converters. At conversion, reverters had significantly smaller TST compared to stable converters (13.7 mm vs 16.4 mm, respectively; p = 0.003. At enrollment, there were no significant differences in IFN-γ responses to MtbA85B or wMTB between groups. At conversion, stable converters demonstrated significant increases in IFN-γ responses to Ag85B and wMtb compared to enrollment (p = 0.001, p<0.001, respectively, while there were no significant changes among reverters. CONCLUSIONS: TST reversion following IPT is common following primary Mtb infection and associated with unique patterns of Mtb-induced IFN-γ production. We have demonstrated that immune responses to primary Mtb infection are heterogeneous, and submit that prospective

  18. A single bout of exercise with a flexible pole induces significant cardiac autonomic responses in healthy men

    Directory of Open Access Journals (Sweden)

    Cristiane M. Ogata

    2014-09-01

    Full Text Available OBJECTIVES: Flexible poles can provide rapid eccentric and concentric muscle contractions. Muscle vibration is associated with a "tonic vibration reflex” that is stimulated by a sequence of rapid muscle stretching, activation of the muscle spindles and stimulation of a response that is similar to the myotatic reflex. Literature studies analyzing the acute cardiovascular responses to different exercises performed with this instrument are lacking. We investigated the acute effects of exercise with flexible poles on the heart period in healthy men. METHOD: The study was performed on ten young adult males between 18 and 25 years old. We evaluated the heart rate variability in the time and frequency domains. The subjects remained at rest for 10 min. After the rest period, the volunteers performed the exercises with the flexible poles. Immediately after the exercise protocol, the volunteers remained seated at rest for 30 min and their heart rate variability was analyzed. RESULTS: The pNN50 was reduced at 5-10 and 15-20 min after exercise compared to 25-30 min after exercise (p = 0.0019, the SDNN was increased at 25-30 min after exercise compared to at rest and 0-10 min after exercise (p = 0.0073 and the RMSSD was increased at 25-30 min after exercise compared to 5-15 min after exercise (p = 0.0043. The LF in absolute units was increased at 25-30 min after exercise compared to 5-20 min after exercise (p = 0.0184. CONCLUSION: A single bout of exercise with a flexible pole reduced the heart rate variability and parasympathetic recovery was observed approximately 30 min after exercise.

  19. Autonomous power system intelligent diagnosis and control

    Science.gov (United States)

    Ringer, Mark J.; Quinn, Todd M.; Merolla, Anthony

    1991-01-01

    The Autonomous Power System (APS) project at NASA Lewis Research Center is designed to demonstrate the abilities of integrated intelligent diagnosis, control, and scheduling techniques to space power distribution hardware. Knowledge-based software provides a robust method of control for highly complex space-based power systems that conventional methods do not allow. The project consists of three elements: the Autonomous Power Expert System (APEX) for fault diagnosis and control, the Autonomous Intelligent Power Scheduler (AIPS) to determine system configuration, and power hardware (Brassboard) to simulate a space based power system. The operation of the Autonomous Power System as a whole is described and the responsibilities of the three elements - APEX, AIPS, and Brassboard - are characterized. A discussion of the methodologies used in each element is provided. Future plans are discussed for the growth of the Autonomous Power System.

  20. Cardiovascular autonomic neuropathy in the diabetic patients.

    Directory of Open Access Journals (Sweden)

    Maria Eugenia Niño Mantilla

    2007-11-01

    Full Text Available the dysfunction of the autonomic nervous system is a serious problem in diabetic patients. The cardiovacular autonomic neuropathy is the most important autonomic dysfuntion for it´s implication in the increasesof the mortality rate in diabetis patients. tis ethiopatogenesis is the result of a multifactorial process caused by chronic hyperglycemia, ending up in damage of the autonomic fibers thet innervate the heart and blood vessels, leading to dysfuntional hearth rate control and abnormal vascular dynamics. the associated clinical manifestations include orthotatic hypotension, excecise intolerance, intraoperative cardiovascular liability and silent myocardial ischemia. Being important its recognition, quantitative test to evaluate the cardiovascular funtion, to value its evolution and the effects of the treatment ahould be done, being the most used, the hearth rate response to standing test, and teh valsalva maneuver. the handling of this entity is done improving control of glucose blood levels its the most effective way to prevent the cardiovascular autonomic neuropathy in the diabetic patients.

  1. Neuromuscular abnormality and autonomic dysfunction in patients with cerebrotendinous xanthomatosis

    Directory of Open Access Journals (Sweden)

    Huang Chi-Ren

    2011-05-01

    Full Text Available Abstract Background Cerebrotendinous xanthomatosis (CTX is a rare lipid-storage disease. Neuromuscular abnormality and autonomic system (ANS dysfuction in CTX are rarely examined in large-scale studies in the literature. We studied the peripheral nervous system, myopathology, and autonomic system of four CTX patients and performed a literature review of the reported CTX patients with peripheral neuropathy. Methods Four biochemically and genetically confirmed CTX patients, belonging to two families, were included for study and all received nerve conduction study (NCS, muscle biopsy for histopathologic and ultrastructural study, skin biopsy for intraepidermal nerve fiber (INEF density measurement, autonomic testings including sympathetic skin response, R-R interval variation and head-up tilt test using an automated tilt table to record the changes of blood pressure and heart rate in different postures. The Q-Sweat test was also applied for the detection of sweat amount and onset time of response. The clinical characteristics, study methods and results of 13 studies of peripheral neuropathy in CTX patients in the literature were also recorded for analysis. Results The results of NCS study showed axonal sensory-motor polyneuropathy in three CTX cases and mixed axonal and demyelinating sensor-motor polyneuropathy in one. The myopathological and histopathologic studies revealed mild denervation characteristics, but the ultrastructural study revealed changes of mitochondria and the membranous system, and increased amounts of glycogen, lipofuscin and lipid deposition. The ANS study revealed different degrees of abnormalities in the applied tests and the INEF density measurement showed small fiber neuropathy in three of the four CTX patients. The literature review of peripheral neuropathy in CTX revealed different types of peripheral neuropathy, of which axonal peripheral neuropathy was the most common. Conclusions Peripheral neuropathy, especially the

  2. A toll-like receptor 2-responsive lipid effector pathway protects mammals against skin infections with gram-positive bacteria.

    Science.gov (United States)

    Georgel, Philippe; Crozat, Karine; Lauth, Xavier; Makrantonaki, Evgenia; Seltmann, Holger; Sovath, Sosathya; Hoebe, Kasper; Du, Xin; Rutschmann, Sophie; Jiang, Zhengfan; Bigby, Timothy; Nizet, Victor; Zouboulis, Christos C; Beutler, Bruce

    2005-08-01

    flake (flk), an N-ethyl-N-nitrosourea-induced recessive germ line mutation of C57BL/6 mice, impairs the clearance of skin infections by Streptococcus pyogenes and Staphylococcus aureus, gram-positive pathogens that elicit innate immune responses by activating Toll-like receptor 2 (TLR2). Positional cloning and sequencing revealed that flk is a novel allele of the stearoyl coenzyme A desaturase 1 gene (Scd1). flake homozygotes show reduced sebum production and are unable to synthesize the monounsaturated fatty acids (MUFA) palmitoleate (C(16:1)) and oleate (C(18:1)), both of which are bactericidal against gram-positive (but not gram-negative) organisms in vitro. However, intradermal MUFA administration to S. aureus-infected mice partially rescues the flake phenotype, which indicates that an additional component of the sebum may be required to improve bacterial clearance. In normal mice, transcription of Scd1-a gene with numerous NF-kappaB elements in its promoter--is strongly and specifically induced by TLR2 signaling. Similarly, the SCD1 gene is induced by TLR2 signaling in a human sebocyte cell line. These observations reveal the existence of a regulated, lipid-based antimicrobial effector pathway in mammals and suggest new approaches to the treatment or prevention of infections with gram-positive bacteria.

  3. Olfaction in Asian tiger mosquito Aedes albopictus: flight orientation response to certain saturated carboxylic acids in human skin emanations.

    Science.gov (United States)

    Seenivasagan, T; Guha, Lopamudra; Parashar, B D; Agrawal, O P; Sukumaran, D

    2014-05-01

    The flight orientation response of nonblood-fed and hungry Aedes albopictus females was studied in a Y-tube olfactometer at 10(-6) to 10(-2) g odor plumes of saturated carboxylic acids (C1-C20), in which C2-C18 were the main constituents of human skin emanations. Thirteen acids viz C1, C2, C3, C5, C6, C8 C9, C10, C12, C14, C16, C18, and C20 showed attractance at odor plumes ranging from 10(-5) to 10(-3) g doses, while five acids viz C4, C7, C11, C15, and C19 showed repellence at 10(-4) to 10(-2) g to test mosquitoes. Tridecanoic acid (C13) showed attractance only at 10(-4) g dose while higher doses caused repellence. Dose-dependent reversal of orientation behavior from attractance to repellence was observed at 10(-2) g plumes of C5, C9, C10, C13, C17, C19, and C20 acids. The outcome of the study will help in the identification of odoriferous acids as potential attractants, repellents, or attraction inhibitors, which may find their application in the repellent formulations and odor-baited traps for surveillance and control of mosquitoes.

  4. Skin Infections

    Science.gov (United States)

    ... Old Feeding Your 8- to 12-Month-Old Feeding Your 1- to 2-Year-Old First Aid: Skin ... (bacterial infection of the deeper layers of the skin and tissues beneath) are typical childhood skin infections. The usual bacterial culprits in skin ...

  5. The autonomic laboratory

    Science.gov (United States)

    Low, P. A.; Opfer-Gehrking, T. L.

    1999-01-01

    The autonomic nervous system can now be studied quantitatively, noninvasively, and reproducibly in a clinical autonomic laboratory. The approach at the Mayo Clinic is to study the postganglionic sympathetic nerve fibers of peripheral nerve (using the quantitative sudomotor axon reflex test [QSART]), the parasympathetic nerves to the heart (cardiovagal tests), and the regulation of blood pressure by the baroreflexes (adrenergic tests). Patient preparation is extremely important, since the state of the patient influences the results of autonomic function tests. The autonomic technologist in this evolving field needs to have a solid core of knowledge of autonomic physiology and autonomic function tests, followed by training in the performance of these tests in a standardized fashion. The range and utilization of tests of autonomic function will likely continue to evolve.

  6. Skin Biomes.

    Science.gov (United States)

    Fyhrquist, N; Salava, A; Auvinen, P; Lauerma, A

    2016-05-01

    The cutaneous microbiome has been investigated broadly in recent years and some traditional perspectives are beginning to change. A diverse microbiome exists on human skin and has a potential to influence pathogenic microbes and modulate the course of skin disorders, e.g. atopic dermatitis. In addition to the known dysfunctions in barrier function of the skin and immunologic disturbances, evidence is rising that frequent skin disorders, e.g. atopic dermatitis, might be connected to a dysbiosis of the microbial community and changes in the skin microbiome. As a future perspective, examining the skin microbiome could be seen as a potential new diagnostic and therapeutic target in inflammatory skin disorders.

  7. A mixture of peptides and sugars derived from plant cell walls increases plant defense responses to stress and attenuates ageing-associated molecular changes in cultured skin cells.

    Science.gov (United States)

    Apone, Fabio; Tito, Annalisa; Carola, Antonietta; Arciello, Stefania; Tortora, Assunta; Filippini, Lucio; Monoli, Irene; Cucchiara, Mirna; Gibertoni, Simone; Chrispeels, Maarten J; Colucci, Gabriella

    2010-02-15

    Small peptides and aminoacid derivatives have been extensively studied for their effect of inducing plant defense responses, and thus increasing plant tolerance to a wide range of abiotic stresses. Similarly to plants, these compounds can activate different signaling pathways in mammalian skin cells as well, leading to the up-regulation of anti-aging specific genes. This suggests the existence of analogous defense response mechanisms, well conserved both in plants and animal cells. In this article, we describe the preparation of a new mixture of peptides and sugars derived from the chemical and enzymatic digestion of plant cell wall glycoproteins. We investigate the multiple roles of this product as potential "biostimulator" to protect plants from abiotic stresses, and also as potential cosmeceutical. In particular, the molecular effects of the peptide/sugar mixture of inducing plant defense responsive genes and protecting cultured skin cells from oxidative burst damages were deeply evaluated.

  8. The effect of local corticosteroid injection on F-wave conduction velocity and sympathetic skin response in carpal tunnel syndrome.

    Science.gov (United States)

    Deniz, Orhan; Aygül, Recep; Kotan, Dilcan; Ozdemir, Gökhan; Odabaş, Faruk Omer; Kaya, M Dursun; Ulvi, Hızır

    2012-05-01

    The aim of this study was to evaluate the efficacy of steroid injection for the treatment of the carpal tunnel syndrome (CTS), with F-wave parameters and sympathetic skin response (SSR). Seventeen hands of 10 women patients were treated with local steroid injection with 2-month follow-up. All patients underwent single injection into the carpal tunnel. Response to injection was measured nerve conduction studies (NCSs), median nerve F waves, and SSR before and after treatment. To determine the normal values, 42 hands of 21 healthy women were also studied. There was a significant improvement of sensory and motor nerve conduction values when compared to baseline values (P sensory distal latency and the sensory latency differences between the median and the ulnar nerve were improved 35 and 65%, respectively. The maximum, mean F-wave amplitudes and chronodispersion showed a slight improvement with respect to baseline values and controls, but statistical significance was not achieved after treatment. Although no statistically significant improvements were observed in SSR parameters, slightly decreased amplitudes and increased habituation of SSR were noted at the end of the treatment. The present study shows that the local steroid injection results in improvement in NCSs values, but the F-wave parameters were not effectual in short-term outcome of CTS treatment. These findings suggest that the sensory latency differences between the median and the ulnar wrist-to-digit 4 are better parameters in the median nerve recovery after treatment than the median sensory distal latency. Furthermore, the SSR does not seem to be a sensitive method in follow-up of CTS treatment.

  9. Skin barrier function

    DEFF Research Database (Denmark)

    2016-01-01

    Renowned experts present the latest knowledge Although a very fragile structure, the skin barrier is probably one of the most important organs of the body. Inward/out it is responsible for body integrity and outward/in for keeping microbes, chemicals, and allergens from penetrating the skin. Since...... the role of barrier integrity in atopic dermatitis and the relationship to filaggrin mutations was discovered a decade ago, research focus has been on the skin barrier, and numerous new publications have become available. This book is an interdisciplinary update offering a wide range of information...... on the subject. It covers new basic research on skin markers, including results on filaggrin and on methods for the assessment of the barrier function. Biological variation and aspects of skin barrier function restoration are discussed as well. Further sections are dedicated to clinical implications of skin...

  10. Chronic stress induces a hyporeactivity of the autonomic nervous system in response to acute mental stressor and impairs cognitive performance in business executives.

    Science.gov (United States)

    Teixeira, Renata Roland; Díaz, Miguel Mauricio; Santos, Tatiane Vanessa da Silva; Bernardes, Jean Tofoles Martins; Peixoto, Leonardo Gomes; Bocanegra, Olga Lucia; Neto, Morun Bernardino; Espindola, Foued Salmen

    2015-01-01

    The present study examined the incidence of chronic stress in business executives (109 subjects: 75 male and 34 female) and its relationship with cortisol levels, cognitive performance, and autonomic nervous system (ANS) reactivity after an acute mental stressor. Blood samples were collected from the subjects to measure cortisol concentration. After the sample collection, the subjects completed the Lipp Inventory of Stress Symptoms for Adults and the Stroop Color-Word Test to evaluate stress and cognitive performance levels, respectively. Saliva samples were collected prior to, immediately after, and five minutes after the test. The results revealed that 90.1% of the stressed subjects experienced stress phases that are considered chronic stress. At rest, the subjects with chronic stress showed higher cortisol levels, and no gender differences were observed. No differences were found between the stressed and non-stressed subjects regarding salivary amylase activity prior to test. Chronic stress also impaired performance on the Stroop test, which revealed higher rates of error and longer reaction times in the incongruent stimulus task independently of gender. For the congruent stimulus task of the Stroop test, the stressed males presented a higher rate of errors than the non-stressed males and a longer reaction time than the stressed females. After the acute mental stressor, the non-stressed male group showed an increase in salivary alpha-amylase activity, which returned to the initial values five minutes after the test; this ANS reactivity was not observed in the chronically stressed male subjects. The ANS responses of the non-stressed vs stressed female groups were not different prior to or after the Stroop test. This study is the first to demonstrate a blunted reactivity of the ANS when male subjects with chronic psychological stress were subjected to an acute mental stressor, and this change could contribute to impairments in cognitive performance.

  11. Chronic stress induces a hyporeactivity of the autonomic nervous system in response to acute mental stressor and impairs cognitive performance in business executives.

    Directory of Open Access Journals (Sweden)

    Renata Roland Teixeira

    Full Text Available The present study examined the incidence of chronic stress in business executives (109 subjects: 75 male and 34 female and its relationship with cortisol levels, cognitive performance, and autonomic nervous system (ANS reactivity after an acute mental stressor. Blood samples were collected from the subjects to measure cortisol concentration. After the sample collection, the subjects completed the Lipp Inventory of Stress Symptoms for Adults and the Stroop Color-Word Test to evaluate stress and cognitive performance levels, respectively. Saliva samples were collected prior to, immediately after, and five minutes after the test. The results revealed that 90.1% of the stressed subjects experienced stress phases that are considered chronic stress. At rest, the subjects with chronic stress showed higher cortisol levels, and no gender differences were observed. No differences were found between the stressed and non-stressed subjects regarding salivary amylase activity prior to test. Chronic stress also impaired performance on the Stroop test, which revealed higher rates of error and longer reaction times in the incongruent stimulus task independently of gender. For the congruent stimulus task of the Stroop test, the stressed males presented a higher rate of errors than the non-stressed males and a longer reaction time than the stressed females. After the acute mental stressor, the non-stressed male group showed an increase in salivary alpha-amylase activity, which returned to the initial values five minutes after the test; this ANS reactivity was not observed in the chronically stressed male subjects. The ANS responses of the non-stressed vs stressed female groups were not different prior to or after the Stroop test. This study is the first to demonstrate a blunted reactivity of the ANS when male subjects with chronic psychological stress were subjected to an acute mental stressor, and this change could contribute to impairments in cognitive

  12. A comparison of autonomic responses in humans induced by two simulation models of weightlessness: lower body positive pressure and 6 degrees head-down tilt.

    Science.gov (United States)

    Fu, Q; Sugiyama, Y; Kamiya, A; Mano, T

    2000-04-12

    Six-degree head-down tilt (HDT) is well accepted as an effective weightlessness model in humans. However, some researchers utilized lower body positive pressure (LBPP) to simulate the cardiovascular and renal effects of a decreased gravitational stress. In order to determine whether LBPP was a suitable model for simulated weightlessness, we compared the differences between these two methods. Ten healthy males, aged 21-41 years, were subjected to graded LBPP at 10, 20 and 30 mmHg, as well as 6 degrees HDT. Muscle sympathetic nerve activity (MSNA) was microneurographically recorded from the tibial nerve along with cardiovascular variables. We found that MSNA decreased by 27% to a similar extent both at low levels of LBPP (10 and 20 mmHg) and HDT. However, at a high level of LBPP (30 mmHg), MSNA tended to increase. Mean arterial pressure was elevated significantly by 11% (10 mmHg) at 30 mmHg LBPP, but remained unchanged at low levels of LBPP and HDT. Heart rate did not change during the entire LBPP and HDT procedures. Total peripheral resistance markedly increased by 36% at 30 mmHg LBPP, but decreased by 9% at HDT. Both stroke volume and cardiac output tended to decrease at 30 mmHg LBPP, but increased at HDT. These results suggest that although both LBPP and HDT induce fluid shifts from the lower body toward the thoracic compartment, autonomic responses are different, especially at LBPP greater than 20 mmHg. We note that high levels of LBPP (>20 mmHg) activate not only cardiopulmonary and arterial baroreflexes, but also intramuscular mechanoreflexes, while 6 degrees HDT only activates cardiopulmonary baroreflexes. We conclude that LBPP is not a suitable model for simulated weightlessness in humans.

  13. 帕金森病50例皮肤交感反应特点分析%Sympathetic skin response studies of Parkinson disease in 50 patients

    Institute of Scientific and Technical Information of China (English)

    冯新红; 尹琳

    2012-01-01

    目的 分析帕金森病(PD)患者的皮肤交感反应(SSR)的特点,并探讨其与自主神经损害的关系.方法 收集2008年6月~2012年1月我院门诊或病房收治的PD患者50例,同时收集年龄、性别匹配的健康人50例,均采用常规肌电图检查,测定其运动神经传导、F波、感觉神经传导(SCV)和SSR.结果 正常对照组SSR全部引出,50例PD患者中,上肢5例波形缺失,下肢16例波形缺失.SSR潜伏期:正常对照组上肢(1.33±0.04)s,下肢(1.99±0.38)s,PD组上肢(1.50±0.11)s,下肢(2.16±0.17)s,两组比较差异有高度统计学意义(P<0.01).SSR波幅:正常对照组上肢(3.31±2.15)mv,下肢(1.73±0.98)mv,PD组上肢(1.23±0.67)mv,下肢(0.72±0.45)mv,两组比较差异有高度统计学意义(P<0.01).在50例PD患者中,SSR异常35例(70%),其中上肢异常10例,下肢异常35例,上肢SR异常的患者,其下肢SSR均有异常.下肢异常率明显高于上肢,二者比较差异有高度统计学意义(P<0.01).PD患者SSR异常主要表现在:波形消失16例,潜伏期延长7例,波幅下降19例.自主神经损伤症状组SSR异常率明显高于无自主神经损伤症状组.结论 PD患者可出现SSR的异常,SSR能为PD的自主神经功能受损提供依据.%Objective To investigate the features of sympathetic skin response in patients with Parkinson disease arid explore the correlation between SSR and automatic dysfunction. Methods The data of outpatients and inpatients diagnosed with PD were collected in the second affiliated hospital of Dalian Medical University from June 2008 to January 2012. Sympathetic skin response were measured in median nerve. Parameters analyses mainly included SSR. Latency and amplitude. Results The SSR was present in 100% of the controls but was absent in 5 cases in the hands and 16 cases in the feet in PD patients. The mean latency of the PD patients [palmar SSR: (1.50±0.11)s, plantar SSR:(2.16±0.17)s] were longer than that of the controls [palmar SSR: (1.33

  14. Association between skin surface pH, temperature and Staphylococcus pseudintermedius in dogs with immunomodulatory-responsive lymphocytic-plasmacytic pododermatitis.

    Science.gov (United States)

    Breathnach, Rory M; Quinn, Patrick J; Baker, Kenneth P; McGeady, Thomas; Strobl, Eric; Abbott, Yvonne; Jones, Boyd R

    2011-08-01

    Secondary bacterial infection is a frequent complication in lesional skin of dogs with immunomodulatory-responsive lymphocytic-plasmacytic pododermatitis (ImR-LPP). However, the influence of skin pH and temperature in determining the composition of the cutaneous microflora at lesional sites has not been investigated. The association between ImR-LPP and pedal skin temperature, pH and Staphylococcus pseudintermedius isolates was thus evaluated. Temperature and pH were measured in 20 dogs with ImR-LPP and in 30 clinically healthy control dogs, and S. pseudintermedius was cultured from interdigital and palmoplantar swabs in both groups and scored semi-quantitatively for bacterial growth. In the ImR-LPP group, mean skin pH was slightly, but significantly, higher at both interdigital and palmoplantar sites. Staphylococcus pseudintermedius was isolated more frequently, and scores for bacterial growth were also significantly higher. However, mean skin temperatures were not significantly different from those in the control group. The isolation of S. pseudintermedius was significantly associated with ImR-LPP, with the single exception of isolates on Columbia blood agar from the palmoplantar region. However, pH and temperature were not significantly associated with the disease, and were not associated with the isolation of S. pseudintermedius at most sites sampled. Staphylococcus pseudintermedius was not isolated from all feet sampled in dogs with ImR-LPP. Taken together, these data would suggest that S. pseudintermedius infection is most likely to be a secondary phenomenon in dogs with ImR-LPP, and that changes in skin pH and temperature are not significant risk factors for this disease.

  15. Analysis of sympathetic skin response and R-R phase change rate in patients with bipolar disorder%双相情感障碍患者中交感神经皮肤反应和R-R间期变化率的分析

    Institute of Scientific and Technical Information of China (English)

    张锋利; 淳彩濮; 阿丽亚·艾尔肯

    2015-01-01

    Objective:To explore the diagnostic value of sympathetic skin response and R-R phase change rate for the autonomic nerve damage in patients with bipolar disorder.Methods:The SSR and RRIV characteristics of 235 cases of patients with bipolar disorder were detected.Results:The abnormal rate of SSR and RRIV were 85.1% and 81.5 % respectively.There were no significant differences of SSR and RRIV among various subgroups(P>0.05).Conclusion:SSR and RRIV could be used as objective indicators to evaluate the autonomic nerve damage of bipolar disorder.%目的:探讨交感神经皮肤反应技术(SSR)和R-R间期变化率(RRIV)对双相情感障碍患者自主神经损害的诊断价值。方法:检测235例双相情感障碍患者的 SSR 及 RRIV 特点。结果:SSR 和 RRIV 异常率分别为85.1%和81.5%,各亚组间SSR和RRIV差异均无统计学意义(P>0.05)。结论:SSR和RRIV可作为评价双相情感障碍自主神经损害的客观指标。

  16. Quantitative thermal sensory testing and sympathetic skin response in primary Restless legs syndrome – A prospective study on 57 Indian patients

    OpenAIRE

    Garima Shukla; Vinay Goyal; Achal Srivastava; Madhuri Behari

    2012-01-01

    Patients with restless leg syndrome present with sensory symptoms similar to peripheral neuropathy. While there is evidence of abnormalities of dopaminergic pathways, the peripheral nervous system has been studied infrequently. We studied conventional nerve conduction studies, quantitative thermal sensory testing and sympathetic skin response in 57 patients with primary restless leg syndrome. Almost two third patients demonstrated abnormalities in the detailed testing of the peripheral nervou...

  17. Skin Cancer

    Science.gov (United States)

    ... are round and lie directly under squamous cells. Melanocytes are specialized skin cells that produce pigment called melanin. The melanin pigment produced by melanocytes gives skin its color. It also protects the ...

  18. Skin Cancer

    Science.gov (United States)

    ... the head, face, neck, hands, and arms. Another type of skin cancer, melanoma, is more dangerous but less common. Anyone ... cancer is found early. If not treated, some types of skin cancer cells can spread to other tissues and organs. ...

  19. Sagging Skin

    Science.gov (United States)

    ... Dermatologic Surgery Expertise for the life of your skin (TM) Public Resources Dermatologic Surgery Conditions Treatments and ... learn-more"> 3 million Americans are diagnosed with skin cancer every year Any suspicious new growths or ...

  20. Skin tears.

    Science.gov (United States)

    Baranoski, S

    2001-08-01

    Skin tears are a serious, painful problem for older patients. Find out how your staff can recognize patients at risk, what they can do to prevent skin tears, and how to manage them effectively if they occur.

  1. Skin turgor

    Science.gov (United States)

    ... arm or abdomen is checked. The skin is held for a few seconds then released. Skin with ... University of Washington, Seattle, WA. Also reviewed by David Zieve, MD, MHA, Isla Ogilvie, PhD, and the ...

  2. Human papillomavirus types detected in skin warts and cancer differ in their transforming properties but commonly counteract UVB induced protective responses in human keratinocytes.

    Science.gov (United States)

    Shterzer, Naama; Heyman, Dariya; Shapiro, Beny; Yaniv, Abraham; Jackman, Anna; Serour, Francis; Chaouat, Malka; Gonen, Pinhas; Tommasino, Massimo; Sherman, Levana

    2014-11-01

    In the present study, E6E7 and E6 proteins of human papillomaviruses (HPVs) associated with skin warts and cancer were compared for their transforming and carcinogenic abilities in primary human keratinocytes (PHKs). We show that E6E7 of cancer associated beta HPV types, notably 49 and 24, were able to extend the life span and enhance the clonogenic efficiency of PHKs when maintained in serum free/low calcium medium. Activities of the beta HPV E6E7 were lower than those of HPV16 E6E7. In contrast, E6 proteins from HPV types detected in skin warts or cancer, notably 10, 49 and 38, attenuated UVB induced protective responses in PHKs including cell death, proliferation arrest and accumulation of the proapoptotic proteins, p53, bax or bak. Together, this investigation revealed functional differences and commonalities between HPVs associated with skin warts and cancer, and allowed the identification of specific properties of beta HPVs supporting their involvement in skin carcinogenesis.

  3. Human papillomavirus types detected in skin warts and cancer differ in their transforming properties but commonly counteract UVB induced protective responses in human keratinocytes

    Energy Technology Data Exchange (ETDEWEB)

    Shterzer, Naama; Heyman, Dariya; Shapiro, Beny; Yaniv, Abraham; Jackman, Anna [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel); Serour, Francis [Department of Pediatric Surgery, The E. Wolfson Medical Center, Holon (Israel); Chaouat, Malka [Laboratory of Experimental Surgery, Hadassah University Hospital, Ein Karem, Jerusalem (Israel); Gonen, Pinhas [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel); Tommasino, Massimo [International Agency for Research on Cancer, World Health Organization, Lyon (France); Sherman, Levana [Department of Clinical Microbiology and Immunology, Sackler School of Medicine, Tel-Aviv University, Tel-Aviv (Israel)

    2014-11-15

    In the present study, E6E7 and E6 proteins of human papillomaviruses (HPVs) associated with skin warts and cancer were compared for their transforming and carcinogenic abilities in primary human keratinocytes (PHKs). We show that E6E7 of cancer associated beta HPV types, notably 49 and 24, were able to extend the life span and enhance the clonogenic efficiency of PHKs when maintained in serum free/low calcium medium. Activities of the beta HPV E6E7 were lower than those of HPV16 E6E7. In contrast, E6 proteins from HPV types detected in skin warts or cancer, notably 10, 49 and 38, attenuated UVB induced protective responses in PHKs including cell death, proliferation arrest and accumulation of the proapoptotic proteins, p53, bax or bak. Together, this investigation revealed functional differences and commonalities between HPVs associated with skin warts and cancer, and allowed the identification of specific properties of beta HPVs supporting their involvement in skin carcinogenesis. - Highlights: • Primary keratinocytes were used to evaluate transforming and carcinogenic abilities of cutaneous HPVs. • E6E7 of cancer associated β HPV types transform primary human keratinocytes. • E6 proteins of cancer and wart associated HPVs inhibit UVB induced cell death. • E6s of cancer and wart associated HPVs attenuate UVB induced proliferation arrest. • E6s of cancer and wart associated HPVs attenuate UVB induced apoptosis signaling.

  4. Nicotinamide for skin cancer chemoprevention.

    Science.gov (United States)

    Damian, Diona L

    2017-03-20

    Nicotinamide (vitamin B3 ) has a range of photoprotective effects in vitro and in vivo; it enhances DNA repair, reduces UV radiation-induced suppression of skin immune responses, modulates inflammatory cytokine production and skin barrier function and restores cellular energy levels after UV exposure. Pharmacological doses of nicotinamide have been shown to reduce actinic keratoses and nonmelanoma skin cancer incidence in high-risk individuals, making this a nontoxic and accessible option for skin cancer chemoprevention in this population.

  5. Objective evaluation of stress with the blind by the monitoring of autonomic nervous system activity.

    Science.gov (United States)

    Massot, Bertrand; Baltenneck, Nicolas; Gehin, Claudine; Dittmar, Andre; McAdams, Eric

    2010-01-01

    Accessibility for the blind in an urban space must be studied under real conditions in their daily environment. A new approach for evaluating the impact of environmental conditions on blind pedestrians is the objective measure of stress by the monitoring of the autonomic nervous system (ANS) activity. Original techniques of data analysis and spatial representation are proposed for the detection of the ANS activity through the assessment of the electrodermal activity. Skin resistance was recorded with an EmoSense system on 10 blind subjects who followed a charted course independently. The course was 1065 meters long and consisted of various environmental conditions in an urban space. The spatial frequency of the non-specific skin resistance responses was used to provide a more relevant representation of geographic hotspots. Results of statistical analysis based on this new parameter are discussed to conclude on phenomena causing mental stress with the blind moving in an urban space.

  6. Skin Aging

    Science.gov (United States)

    Your skin changes as you age. You might notice wrinkles, age spots and dryness. Your skin also becomes thinner and loses fat, making it ... heal, too. Sunlight is a major cause of skin aging. You can protect yourself by staying out ...

  7. Influence of the Chungkookjang on histamine-induced wheal and flare skin response: a randomized, double-blind, placebo controlled trial

    Directory of Open Access Journals (Sweden)

    Kwon Dae-Young

    2011-12-01

    Full Text Available Abstracts Background Allergic disease is a consequence of exposure to normally innocuous substances that elicit the activation of mast cells. Mast-cell-mediated allergic response is involved in many diseases such as anaphylaxis, urticaria, allergic rhinitis, asthma and allergic dermatitis. The development of food products for the prevention of allergic disease is an important subject in human health. The chungkookjang (CKJ has been reported to exhibit antiallergic inflammatory activity. Therefore, the aim of the study is to examine the effects of the CKJ to reduce histamine-induced wheal and flare skin responses. Methods/Design A randomized, double-blind, placebo-controlled study in 60 healthy subjects will be carried out. Sixty volunteers (aged 20-80 who gave a written consent before entering the study will be randomized in two groups of thirty subjects each. The skin prick test with histamine solution of 10 mg/ml will be performed on the ventral forearm, 10 cm from the elbow. The subjects will be instructed to take 35 g per day of either the CKJ pills or a placebo pills for a period of 3 months. Diameters of wheal and flare will be assessing 15 minutes after performing the above-mentioned skin prick test. The primary outcome is change in wheal and flare responses. Secondary outcomes will be include change in serum histamine, immunoglobulin E, cytokines (interferon-gamma, interleukin-4, -10, and tumor necrosis factor-alpha, and eosinophil cationic protein. Discussion This study will show the potential anti-inflammatory properties of the CKJ in their skin activity when histamine is the challenging agent as occurs in the clinical situation. And the present protocol will confirm the efficacy and safety of the CKJ for allergy symptoms, suggesting more basic knowledge to conduct further randomized controlled trials (RCT. If this study will be successfully performed, the CKJ will be an alternative dietary supplemental remedy for allergy patients

  8. Semi-Autonomous Systems Laboratory

    Data.gov (United States)

    Federal Laboratory Consortium — Vision The Semi-Autonomous Systems Lab focuses on developing a comprehensive framework for semi-autonomous coordination of networked robotic systems. Semi-autonomous...

  9. Semi-Autonomous Systems Laboratory

    Data.gov (United States)

    Federal Laboratory Consortium — VisionThe Semi-Autonomous Systems Lab focuses on developing a comprehensive framework for semi-autonomous coordination of networked robotic systems. Semi-autonomous...

  10. Oral fibroblasts produce more HGF and KGF than skin fibroblasts in response to co-culture with keratinocytes

    DEFF Research Database (Denmark)

    Grøn, Birgitte; Stoltze, Kaj; Andersson, Anders;

    2002-01-01

    cells were maintained in collagen, the level of HGF and KGF was decreased mainly in skin cultures. However, in oral fibroblasts, induction after stimulation was at a similar level in collagen compared to on polystyrene. Skin fibroblasts maintained in collagen produced almost no HGF whether...... that could explain regional variation in epithelial growth and wound healing. Normal human fibroblasts were cultured on polystyrene or maintained in collagen matrix and stimulated with keratinocytes cultured on membranes. The amount of HGF and KGF protein in the culture medium was determined every 24 h for 5...

  11. Testing for autonomic neuropathy

    DEFF Research Database (Denmark)

    Hilsted, J

    1984-01-01

    Autonomic neuropathy is a common complication in long-term diabetes, about 30% of the patients showing measurable signs of autonomic dysfunction after 10 years duration of disease. The diagnosis is often difficult to establish because clinical symptoms generally occur late in the course...

  12. Gating of the vertex somatosensory and auditory evoked potential P50 and the correlation to skin conductance orienting response in healthy men

    DEFF Research Database (Denmark)

    Arnfred, S M; Eder, D N; Hemmingsen, R P

    2001-01-01

    to the skin conductance orienting response (SCOR) in 20 healthy men. We measured mid-latency vertex components (SEP: P50, N65, P85 and N100; AEP: P30, N45, P50 and N80). The gating was most pronounced at ISI 500 ms where the SEP P50 and N100 gating were 0.59 and 0.37, respectively, as compared to a gating...... of 0.61 in P30, 0.33 in P50 and 0.45 in N80 in the AEP. Repetition effects in the two modalities were not correlated. AEP P50 gating was correlated to skin conductance level (SCL). The combination of recording repetition effects on the mid-latency EP in two modalities could provide a method...

  13. The impact of methylmercury on 1,25-dihydroxyvitamin D3-induced transcriptomic responses in dolphin skin cells.

    Science.gov (United States)

    Ellis, Blake C; Gattoni-Celli, Sebastiano; Kindy, Mark S

    2010-01-01

    The Atlantic bottlenose dolphin has been the focus of much attention owing to the considerable impact of environmental stress on its health and the associated implications for human health. Here, we used skin cells from the dolphin to investigate the protective role of the vitamin D pathway against environmental stressors. We previously reported that dolphin skin cells respond to 1,25-dihydroxyvitamin D3 (1,25D3), the bioactive metabolite of vitamin D3, by upregulation of the vitamin D receptor (VDR) and expression of several genes. Methylmercury is a highly bioaccumulative environmental stressor of relevance to the dolphin. We currently report that in dolphin cells sublethal concentrations of methylmercury compromise the ability of 1,25D3 to upregulate VDR, to transactivate a vitamin D-sensitive promoter, and to express specific target genes. These results help elucidate the effects of vitamin D and methylmercury on innate immunity in dolphin skin and potentially in human skin as well, considering similarities in the vitamin D pathway between the two species.

  14. Suppressive Effect of Dietary Fucoidan on Proinflammatory Immune Response and MMP-1 Expression in UVB-Irradiated Mouse Skin.

    Science.gov (United States)

    Maruyama, Hiroko; Tamauchi, Hidekazu; Kawakami, Fumitaka; Yoshinaga, Keiko; Nakano, Takahisa

    2015-10-01

    It is well known that ultraviolet B irradiation leads to dermal inflammation. In this study, we found that Mekabu fucoidan suppressed edema, decreased the thickness of the prickle cell layer, and decreased matrix metalloproteinase 1 in the skin of mice irradiated with ultraviolet B. Moreover, we found that the mean level of interferon gamma of Mekabu fucoidan-treated, ultraviolet B-irradiated mice (approximately 2.2 ng/mL) was not significantly different from that in normal mice (approximately 2.5 ng/mL). In contrast, a significant decrease in the mean level of interferon gamma (approximately 1.3 ng/mL) in ultraviolet B-irradiated control mice was observed compared with that in Mekabu fucoidan-treated, ultraviolet B-irradiated mice. The mean thickness of the prickle cell layer in the skin of Mekabu fucoidan-treated, ultraviolet B-irradiated mice was less than that in the ultraviolet B-irradiated control mice. Metalloproteinase 1 activity was significantly higher in the skin of ultraviolet B-irradiated mice than in the skin of untreated, nonirradiated normal mice. Metalloproteinase 1 in the skin of ultraviolet B-irradiated, Mekabu fucoidan- or L(+)-ascorbic acid (vitamin C)-treated mice was significantly lower than that in the ultraviolet B-irradiated control mice. Mitigation of the morphological changes in Mekabu fucoidan-treated mice was correlated with a decrease in metalloproteinase 1 levels. These data indicate that Mekabu fucoidan is an effective suppressor of inflammation in an ultraviolet B-irradiated mouse model.

  15. Sexual features of the old rats’ autonomic nervous system response to the development of necrotic process in heart on the background of melatonin

    Directory of Open Access Journals (Sweden)

    M. R. Khara

    2016-01-01

    Full Text Available Aim. An effect of melatonin on the autonomic regulation of the heart in terms of damage was studied in adult and old male and female rats. Methods and results. Necrotic process in the myocardium was caused by the injection of epinephrine (1 mg / kg, single dose, intramuscular 1 h after injection of melatonin (5 mg / kg intravenous. In 1 and 24 hours after administration of epinephrine heart rate was determined and features of autonomic regulation of the heart on indicators Mo (mode, AMo (mode amplitude, ΔH (variation range of cardio intervals, and SI (stress index of regulatory mechanisms were evaluated. It was found that the effects of melatonin aimed at increasing the role of cholinergic ANS link in the formation of heart rate and reducing the adrenergic participation in the body of older individuals significantly decreased. To a greater extent this applies to older males. In the dynamics of adrenalin necrosis the character of vegetative regulation of heart rate of old rats reflects greater, than in adults, role of adrenergic link in animals of both sexes and reduce of the impact of cholinergic one – only in older males, which resulted in a significant tension of regulatory mechanisms. Conclusion. The obtained results show that with increasing age in rats effectiveness of melatonin as a drug which can affect the autonomic regulation of the heart by activating cardio-protective effects decreases, especially in male rats.

  16. Eicosanoids in skin inflammation.

    Science.gov (United States)

    Nicolaou, Anna

    2013-01-01

    Eicosanoids play an integral part in homeostatic mechanisms related to skin health and structural integrity. They also mediate inflammatory events developed in response to environmental factors, such as exposure to ultraviolet radiation, and inflammatory and allergic disorders, including psoriasis and atopic dermatitis. This review article discusses biochemical aspects related to cutaneous eicosanoid metabolism, the contribution of these potent autacoids to skin inflammation and related conditions, and considers the importance of nutritional supplementation with bioactives such as omega-3 and omega-6 polyunsaturated fatty acids and plant-derived antioxidants as means of addressing skin health issues.

  17. Changes in skin levels of two neutotrophins (glial cell line derived neurotrohic factor and neurotrophin-3) cause alterations in cutaneous neuron responses to mechanical stimuli

    Institute of Scientific and Technical Information of China (English)

    Jeffrey Lawson; Sabrina L. Mcllwrath; H. Richard Koerber

    2008-01-01

    Neurotrophins are important for the development and maintenance of both high and low threshold mechanoreceptors (HTMRs and LTMRs). In this series of studies, the effects of constitutive overexpression of two different neurotrophins, neurotrophin-3 (NT-3) and glial cell line derived neurotrohic factor (GDNF), were examined. Previous studies indicated that both of them may be implicated in the normal development of mouse dorsal root ganglion (DRG) neurons. Neurons from mice transgenically altered to overexpress NT-3 or GDNF (NT-3-OE or GDNF-OE mice) in the skin were examined using several physiological, immunohistochemi-cal and molecular techniques. Ex vivo skin/nerve/DRG/spinal cord and skin/nerve preparations were used to determine the response characteristics of the cutaneous neurons; immunohistochemistry was used to examine the biochemical phenotype of DRG cells and the skin; RT-PCR was used to examine the levels of candidate ion channels in skin and DRG that may correlate with changes in physiologi-cal responses. In GDNF-OE mice, I-isolectin B4 (IB4)-immunopositive C-HTMRs (nociceptors), a large percentage of which are sensitive to GDNF, had significantly lower mechanical thresholds than wildtype (WT) neurons. Heat thresholds for the same cells were not different. Mechanical sensitivity changes in GDNF-OE mice were correlated with significant increases in acid sensing ion channels 2a (ASIC2a) and 2b (ASIC2b) and transient receptor potential channel AI (TRPAI), all of which are putative mechanosensitive ion channels. Overexpression of NT-3 affected the responses of A-LTMRs and A-HTMRs, hut had no effect on C-HTMRs. Slowly adapting type 1 (SA1) LTMRs and A-HTMRs had increased mechanical sensitivity compared to WT. Mechanical sensitivity was correlated with significant increases in acid-sensing ion channels ASIC1 and ASIC3. This data indicates that both neurotrophins play roles in determining mechanical thresholds of cutaneous HTMRs and LTMRs and that sensitivity

  18. Subdominant H60 antigen-specific CD8 T-cell response precedes dominant H4 antigen-specific response during the initial phase of allogenic skin graft rejection.

    Science.gov (United States)

    Yoo, Kang Il; Jeon, Ji Yeong; Ryu, Su Jeong; Nam, Giri; Youn, Hyewon; Choi, Eun Young

    2015-02-13

    In allogeneic transplantation, including the B6 anti-BALB.B settings, H60 and H4 are two representative dominant minor histocompatibility antigens that induce strong CD8 T-cell responses. With different distribution patterns, H60 expression is restricted to hematopoietic cells, whereas H4 is ubiquitously expressed. H60-specific CD8 T-cell response has been known to be dominant in most cases of B6 anti-BALB.B allo-responses, except in the case of skin transplantation. To understand the mechanism underlying the subdominance of H60 during allogeneic skin transplantation, we investigated the dynamics of the H60-specific CD8 T cells in B6 mice transplanted with allogeneic BALB.B tail skin. Unexpectedly, longitudinal bioluminescence imaging and flow cytometric analyses revealed that H60-specific CD8 T cells were not always subdominant to H4-specific cells but instead showed a brief dominance before the H4 response became predominant. H60-specific CD8 T cells could expand in the draining lymph node and migrate to the BALB.B allografts, indicating their active participation in the anti-BALB.B allo-response. Enhancing the frequencies of H60-reactive CD8 T cells prior to skin transplantation reversed the immune hierarchy between H60 and H4. Additionally, H60 became predominant when antigen presentation was limited to the direct pathway. However, when antigen presentation was restricted to the indirect pathway, the expansion of H60-specific CD8 T cells was limited, whereas H4-specific CD8 T cells expanded significantly, suggesting that the temporary immunodominance and eventual subdominance of H60 could be due to their reliance on the direct antigen presentation pathway. These results enhance our understanding of the immunodominance phenomenon following allogeneic tissue transplantation.

  19. Autonomous surveillance for biosecurity.

    Science.gov (United States)

    Jurdak, Raja; Elfes, Alberto; Kusy, Branislav; Tews, Ashley; Hu, Wen; Hernandez, Emili; Kottege, Navinda; Sikka, Pavan

    2015-04-01

    The global movement of people and goods has increased the risk of biosecurity threats and their potential to incur large economic, social, and environmental costs. Conventional manual biosecurity surveillance methods are limited by their scalability in space and time. This article focuses on autonomous surveillance systems, comprising sensor networks, robots, and intelligent algorithms, and their applicability to biosecurity threats. We discuss the spatial and temporal attributes of autonomous surveillance technologies and map them to three broad categories of biosecurity threat: (i) vector-borne diseases; (ii) plant pests; and (iii) aquatic pests. Our discussion reveals a broad range of opportunities to serve biosecurity needs through autonomous surveillance.

  20. Extracellular Matrix Modulates Morphology, Growth, Oxidative Stress Response and Functionality of Human Skin Fibroblasts during Aging In Vitro

    DEFF Research Database (Denmark)

    Jørgensen, Peter; Rattan, Suresh

    2014-01-01

    The Hayflick system of cellular aging and replicative senescence in vitro has been used widely in both basic and applied research in biogerontology. The state of replicative senescence is generally considered to be irreversible, but is modifiable by genetic and environmental manipulations. Some...... recent observations indicate that replicative lifespan, senescence and functionality of cells in vitro can be significantly affected by the quality of the extra cellular matrix (ECM). Following up on those reports, here we show that using the ECM prepared from early passage young cells, partial...... rejuvenation of serially passaged human facial skin fibroblasts was possible in pre-senescent middle-aged cells, but not in fully senescent late passage cells. ECM from young cells improved the appearance, viability, stress tolerance and wound healing ability of skin fibroblasts. Furthermore, young ECM...

  1. Behavioural responses to human skin extracts and antennal phenotypes of sylvatic first filial generation and long rearing laboratory colony Rhodnius prolixus

    Directory of Open Access Journals (Sweden)

    Mario Iván Ortiz

    2011-06-01

    Full Text Available Chagas disease is a major public health issue and is mainly spread by Triatominae insects (Hemiptera: Reduviidae. Rhodnius prolixus is the main vector species in Northern South America. Host-seeking behaviour in R. prolixus is mediated by different compounds that are produced by and emanate from the host or microbiota on the host's skin. We tested the behavioural responses of sylvatic first filial generation (F1 and colony insects to extracts of human skin with a dual choice olfactometer. In addition, we compared the antennal phenotypes in both populations. No statistical differences were found between the two populations at the behavioural level. Both showed a preference for face and feet extracts and this effect was abolished for face extracts after treatment with an antibacterial gel. The observation of the antennal phenotype showed that there were differences between both groups in the total length, total surface area and number and density of bristles. However, the number and density of chemoreceptive sensilla (basiconic and thin and thick-walled trichoids and the total density of sensilla did not show statistically significant differences. These results demonstrate that colony insects, which have only been fed with living hens for the last 30 years, are attracted by human skin extracts in a similar way as F1 sylvatic insects.

  2. Discrepancies between the responses to skin prick test to food and respiratory antigens in two subtypes of patients with irritable bowel syndrome

    Institute of Scientific and Technical Information of China (English)

    Rosa LS Soares; Hamilton N Figueiredo; Jose M Santos; Rita F Oliveira; Raquel L Godoy; Felipe AP Mendon(c)a

    2008-01-01

    AIM: To compare the response to skin prick tests (SPTs)to food antigens (FAs) and inhalant allergens (IAs) in patients with two subtypes of irritable bowel syndrome (IBS) and healthy controls.METHODS: We compared the results of SPTs for IAs and FAs in 87 volunteers divided into three groups:diarrhea predominant IBS (D-IBS) Group Ⅰ (n = 19),constipation predominant IBS (C-IBS) Group Ⅱ (n = 17),and normal controls Group Ⅲ (n = 51).RESULTS: Of the 285 tests (171 for FAs and 114 for IAs) performed in Group Ⅰ we obtained 45 (26.3%)positive responses for FA and 23 (20.1%) for IA. Of the 153 tests for FA in Group Ⅱ, we obtained 66 (20.1%)positive responses, and of the 102 tests for IA, we obtained 20 (19.6%) positive responses. Of the 459 tests for FA performed in Group Ⅲ, we obtained 39 (84%)positive responses, and of the 306 for IA, we obtained 52 (16.9%) positive responses. The numbers of positive responses were not significantly different between the three groups, but in the D-IBS group, the number of SPT FA responses differed significantly from those for the other two groups (P < 0.01).CONCLUSION: Despite the small number of cases studied, the higher reactivity to FAs in Group Ⅰ compared to Groups Ⅱ and Ⅲ adds new information, and suggests the presence of a possible alteration in intestinal epithelial function.

  3. Analysis of skin and secretions of Dybowski's frogs (Rana dybowskii) exposed to Staphylococcus aureus or Escherichia coli identifies immune response proteins.

    Science.gov (United States)

    Xiao, Xiang-Hong; Miao, Hui-Min; Xu, Yi-Gang; Zhang, Jing-Yu; Chai, Long-Hui; Xu, Jia-Jia

    2014-04-01

    The aim of the present study was to investigate responses in Dybowski's frogs (Rana dybowskii) exposed to bacteria, using proteomic and transcriptomic approaches. Staphylococcus aureus and Escherichia coli were used as representative Gram-positive and Gram-negative bacteria, respectively, in an infectious challenge model. Frog skin and skin secretions were collected and protein expression in infected frogs compared to control frogs by two-dimensional gel electrophoresis, silver staining, and image analysis. Proteins that demonstrated differential expression were analysed by mass spectrometry and identified by searching protein databases. More than 180 protein spots demonstrated differential expression in E. coli- or S. aureus-challenged groups and, of these, more than 55 spots were up- or down-regulated at least sixfold, post-infection. Proteins with a potential function in the immune response were identified, such as stathmin 1a, annexin A1, superoxide dismutase A, C-type lectin, lysozyme, antimicrobial peptides, cofilin-1-B, mannose receptor, histone H4, prohormone convertase 1, carbonyl reductase 1 and some components of the Toll-like receptor (TLR) signalling pathway. These molecules are potential candidates for further investigation of immune mechanisms in R. dybowskii; in particular, TLR-mediated responses, which might be activated in frogs exposed to pathogenic bacteria as part of innate immune defence, but which might also impact on adaptive immunity to infection.

  4. The role of variants from the innate immune system genes in tuberculosis and skin test response in a Native American population.

    Science.gov (United States)

    Lindenau, Juliana D; Salzano, Francisco M; Hurtado, Ana M; Hill, Kim R; Hutz, Mara H

    2016-10-01

    Native American populations show higher tuberculosis (TB) mortality and infectivity rates than non-Native populations. Variants in the innate immune system seem to have an important role on TB susceptibility. The role of some innate immune system variants in TB susceptibility and/or skin test response (PPD) were investigated in the Aché, a Native American population. Complement receptor 1 and toll like receptor 9 variants were associated with anergy to PPD and protection to TB, respectively. These findings demonstrate an important role of the innate immune system variants in TB susceptibility.

  5. 5-HT1A/1B receptors as targets for optimizing pigmentary responses in C57BL/6 mouse skin to stress.

    Directory of Open Access Journals (Sweden)

    Hua-Li Wu

    Full Text Available Stress has been reported to induce alterations of skin pigmentary response. Acute stress is associated with increased turnover of serotonin (5-hydroxytryptamine; 5-HT whereas chronic stress causes a decrease. 5-HT receptors have been detected in pigment cells, indicating their role in skin pigmentation. To ascertain the precise role of 5-HT in stress-induced pigmentary responses, C57BL/6 mice were subjected to chronic restraint stress and chronic unpredictable mild stress (CRS and CUMS, two models of chronic stress for 21 days, finally resulting in abnormal pigmentary responses. Subsequently, stressed mice were characterized by the absence of a black pigment in dorsal coat. The down-regulation of tyrosinase (TYR and tyrosinase-related proteins (TRP1 and TRP2 expression in stressed skin was accompanied by reduced levels of 5-HT and decreased expression of 5-HT receptor (5-HTR system. In both murine B16F10 melanoma cells and normal human melanocytes (NHMCs, 5-HT had a stimulatory effect on melanin production, dendricity and migration. When treated with 5-HT in cultured hair follicles (HFs, the increased expression of melanogenesis-related genes and the activation of 5-HT1A, 1B and 7 receptors also occurred. The serum obtained from stressed mice showed significantly decreased tyrosinase activity in NHMCs compared to that from nonstressed mice. The decrease in tyrosinase activity was further augmented in the presence of 5-HTR1A, 1B and 7 antagonists, WAY100635, SB216641 and SB269970. In vivo, stressed mice received 5-HT precursor 5-hydroxy-l-tryptophan (5-HTP, a member of the class of selective serotonin reuptake inhibitors (fluoxetine; FX and 5-HTR1A/1B agonists (8-OH-DPAT/CP94253, finally contributing to the normalization of pigmentary responses. Taken together, these data strongly suggest that the serotoninergic system plays an important role in the regulation of stress-induced depigmentation, which can be mediated by 5-HT1A/1B receptors. 5-HT

  6. Inherited autonomic neuropathies.

    Science.gov (United States)

    Axelrod, Felicia B; Hilz, Max J

    2003-12-01

    Inherited autonomic neuropathies are a rare group of disorders associated with sensory dysfunction. As a group they are termed the "hereditary sensory and autonomic neuropathies" (HSAN). Classification of the various autonomic and sensory disorders is ongoing. In addition to the numerical classification of four distinct forms proposed by Dyck and Ohta (1975), additional entities have been described. The best known and most intensively studied of the HSANs are familial dysautonomia (Riley-Day syndrome or HSAN type III) and congenital insensitivity to pain with anhidrosis (HSAN type IV). Diagnosis of the HSANs depends primarily on clinical examinations and specific sensory and autonomic assessments. Pathologic examinations are helpful in confirming the diagnosis and in differentiating between the different disorders. In recent years identification of specific genetic mutations for some disorders has aided diagnosis. Replacement or definitive therapies are not available for any of the disorders so that treatment remains supportive and directed toward specific symptoms.

  7. Autonomic cardiac innervation

    OpenAIRE

    Hasan, Wohaib

    2013-01-01

    Autonomic cardiac neurons have a common origin in the neural crest but undergo distinct developmental differentiation as they mature toward their adult phenotype. Progenitor cells respond to repulsive cues during migration, followed by differentiation cues from paracrine sources that promote neurochemistry and differentiation. When autonomic axons start to innervate cardiac tissue, neurotrophic factors from vascular tissue are essential for maintenance of neurons before they reach their targe...

  8. Your Skin

    Science.gov (United States)

    ... your body. Without skin, people's muscles, bones, and organs would be hanging out all over the place. Skin holds everything together. It also: protects our bodies helps keep our bodies at just the right temperature allows us to have the sense of touch Don't Miss Your Epidermis The ...

  9. Oily skin

    Science.gov (United States)

    ... keep your skin clean using warm water and soap, or a soapless cleanser. Clean your face with astringent pads if frequent face washing causes irritation. Use only water-based or oil-free cosmetics if you have oily skin. Your ...

  10. Learner Behaviors and Perceptions of Autonomous Language Learning

    Science.gov (United States)

    Bekleyen, Nilüfer; Selimoglu, Figen

    2016-01-01

    The purpose of the present study was to investigate the learners' behaviors and perceptions about autonomous language learning at the university level in Turkey. It attempts to reveal what type of perceptions learners held regarding teachers' and their own responsibilities in the language learning process. Their autonomous language learning…

  11. Autonomous systems for plant protection

    DEFF Research Database (Denmark)

    Griepentrog, Hans W.; Ruckelshausen, Arno; Jørgensen, Rasmus Nyholm;

    2010-01-01

    Advances in automation are demanded by the market mainly as a response to high labor costs. Robotic outdoor systems are ready to allow not only economically viable operations but also increased efficiency in agriculture, horticulture and forestry. The aim of this chapter is to give examples...... of autonomous operations related to crop protection probably commercially available in the near future. Scouting and monitoring together with the efficient application of chemicals or mechanical treatments are operations which can be successful automated. Drawbacks are that current systems are lacking robust...

  12. An elastic second skin

    Science.gov (United States)

    Yu, Betty; Kang, Soo-Young; Akthakul, Ariya; Ramadurai, Nithin; Pilkenton, Morgan; Patel, Alpesh; Nashat, Amir; Anderson, Daniel G.; Sakamoto, Fernanda H.; Gilchrest, Barbara A.; Anderson, R. Rox; Langer, Robert

    2016-08-01

    We report the synthesis and application of an elastic, wearable crosslinked polymer layer (XPL) that mimics the properties of normal, youthful skin. XPL is made of a tunable polysiloxane-based material that can be engineered with specific elasticity, contractility, adhesion, tensile strength and occlusivity. XPL can be topically applied, rapidly curing at the skin interface without the need for heat- or light-mediated activation. In a pilot human study, we examined the performance of a prototype XPL that has a tensile modulus matching normal skin responses at low strain (<40%), and that withstands elongations exceeding 250%, elastically recoiling with minimal strain-energy loss on repeated deformation. The application of XPL to the herniated lower eyelid fat pads of 12 subjects resulted in an average 2-grade decrease in herniation appearance in a 5-point severity scale. The XPL platform may offer advanced solutions to compromised skin barrier function, pharmaceutical delivery and wound dressings.

  13. Altered cortical responsiveness to pain stimuli after high frequency electrical stimulation of the skin in patients with persistent pain after inguinal hernia repair.

    Directory of Open Access Journals (Sweden)

    Emanuel N van den Broeke

    Full Text Available BACKGROUND: High Frequency electrical Stimulation (HFS of the skin induces enhanced brain responsiveness expressed as enhanced Event-Related Potential (ERP N1 amplitude to stimuli applied to the surrounding unconditioned skin in healthy volunteers. The aim of the present study was to investigate whether this enhanced ERP N1 amplitude could be a potential marker for altered cortical sensory processing in patients with persistent pain after surgery. MATERIALS AND METHODS: Nineteen male patients; 9 with and 10 without persistent pain after inguinal hernia repair received HFS. Before, directly after and thirty minutes after HFS evoked potentials and the subjective pain intensity were measured in response to electric pain stimuli applied to the surrounding unconditioned skin. RESULTS: The results show that, thirty minutes after HFS, the ERP N1 amplitude observed at the conditioned arm was statistically significantly larger than the amplitude at the control arm across all patients. No statistically significant differences were observed regarding ERP N1 amplitude between patients with and without persistent pain. However, thirty minutes after HFS we did observe statistically significant differences of P2 amplitude at the conditioned arm between the two groups. The P2 amplitude decreased in comparison to baseline in the group of patients with pain. CONCLUSION: The ERP N1 effect, induced after HFS, was not different between patients with vs. without persistent pain. The decreasing P2 amplitude was not observed in the patients without pain and also not in the previous healthy volunteer study and thus might be a marker for altered cortical sensory processing in patients with persistent pain after surgery.

  14. Filaggrin silencing by shRNA directly impairs the skin barrier function of normal human epidermal keratinocytes and then induces an immune response

    Energy Technology Data Exchange (ETDEWEB)

    Dang, N.N. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Pang, S.G. [Department of Endocrinology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); Song, H.Y. [Department of Dermatology, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China); An, L.G. [College of Life Science, Shandong Normal University, Jinan, Shandong Province (China); Ma, X.L. [Central Laboratory, Jinan Central Hospital Affiliated to Shandong University, Jinan, Shandong Province (China)

    2014-11-14

    The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.

  15. Autonomic arousal in adults who stutter prior to various reading tasks intended to elicit changes in stuttering frequency.

    Science.gov (United States)

    Bowers, Andrew; Saltuklaroglu, Tim; Kalinowski, Joseph

    2012-01-01

    This study examined relationships between anticipatory autonomic arousal and stuttering in four reading tasks. 13 adult persons who stutter (PWS) reported their 'feared' (expected to elicit more stuttering) sounds. They read phrases initiated by feared (F) and neutral (N) phonemes. Both stimuli sets were read solo (S) and with choral accompaniment (C), creating FS, FC, NS, and NC conditions. Skin conductance (SC) and heart rate (HR) measures were made during a 9s window that followed stimulus presentation and preceded speaking. Only SC measures produced significant differences across conditions. Choral conditions produced decreases in SC measures and stuttered trials. Feared conditions produced increases in SC but not stuttering. HR measures were variable, undifferentiated by condition, but produced a gradually increasing triphasic response pattern. No differences in anticipatory SC or HR measures were found in stuttered versus fluent trial comparisons. However, the NC condition, which eliminated stuttering, produced significantly lower SC measures than the fluent utterances in the other conditions (FS, FC, NS). Furthermore, SC measures from the fluent and stuttered trials were similar in these three conditions. These findings suggest that anticipatory autonomic arousal is better differentiated by the possibility of stuttering than by a fluent/stuttered speech outcome. Trials that produced anticipatory SC responses showed greater final HR deceleration, suggesting autonomic coactivation, a response pattern that is associated with aversive stimuli and herein, likely indicative of speech-related state anxiety. However, these physiological markers of anxiety appear to be neither necessary nor sufficient to induce observable stuttering.

  16. The effects of feeding with synbiotic (Pediococcus acidilactici and fructooligosaccharide) enriched adult Artemia on skin mucus immune responses, stress resistance, intestinal microbiota and performance of angelfish (Pterophyllum scalare).

    Science.gov (United States)

    Azimirad, Mahmood; Meshkini, Saeed; Ahmadifard, Nasrollah; Hoseinifar, Seyed Hossein

    2016-07-01

    The aim of this study was to evaluate the effects of feeding on synbiotic (Pediococcus acidilactici and fructooligosaccharide) enriched adult Artemia franciscana on skin mucus immune responses, stress resistance, intestinal microbiota and growth performance of angelfish (Pterophyllum scalare). Three hundred and sixty fish with initial weight 3.2 ± 0.13 g were randomly divided into twelve aquaria (50 L) assigned to four groups in triplicates. Fish were fed for 7 weeks with dietary treatments, including treatment 1: feeding adult Artemia without enrichment (control group), treatment 2: feeding adult Artemia enriched with lyophilised probiotic P. acidilactici (700 mg L(-1)), 3: feeding adult Artemia enriched with prebiotic fructooligosaccharide (FOS) (100 mg L(-1)), group 4: feeding adult Artemia enriched with synbiotic (P. acidilactici (700 mg L(-1)) + FOS (100 mg L(-1))). Skin mucus immune responses (lysozyme activity, total Immunoglobulin and protease), stress resistance against environmental stress (acute decrease of temperature and increase salinity), intestinal microbiota as well as growth indices were measured at the end of feeding trial. Artemia enriched with synbiotic significantly improved growth performance compared to other treatments (P Artemia enriched with synbiotic (P Artemia was more effective than singular enrichment with probiotics or prebiotics.

  17. Detection of pathogenic bacteria in skin lesions of patients with chiclero's ulcer: reluctant response to antimonial treatment

    Directory of Open Access Journals (Sweden)

    Isaac-Márquez Angélica Patricia

    2003-01-01

    Full Text Available We investigated the bacterial flora present in skin lesions of patients with chiclero's ulcer from the Yucatan peninsula of Mexico using conventional culture methods (11 patients, and an immunocolorimetric detection of pathogenic Streptococcus pyogenes (15 patients. Prevalence of bacteria isolated by culture methods was 90.9% (10/11. We cultured, from chiclero's ulcers (60%, pathogenic bacterial such as Staphylococcus aureus (20%, S. pyogenes (1.6%, Pseudomonas aeruginosa (1.6%, Morganella morganii (1.6%, and opportunist pathogenic bacteria such as Klebsiella spp. (20.0%, Enterobacter spp. (20%, and Enterococcus spp. (20%. We also cultured coagulase-negative staphylococci in 40% (4/10 of the remaining patients. Micrococcus spp. and coagulase-negative staphylococci constituted the bacterial genuses more frequently isolated in the normal skin of patients with chiclero's ulcer and healthy individuals used as controls. We also undertook another study to find out the presence of S. pyogenes by an immunocolorimetric assay. This study indicated that 60% (9/15 of the ulcerated lesions, but not normal controls, were contaminated with S. pyogenes. Importantly, individuals with purulent secretion and holding concomitant infections with S. pyogenes, S. aureus, P. aeruginosa, M. morganii, and E. durans took longer to heal Leishmania (L. mexicana infections treated with antimonial drugs. Our results suggest the need to eliminate bacterial purulent infections, by antibiotic treatment, before starting antimonial administration to patients with chiclero's ulcer.

  18. Biologic activities of molecular chaperones and pharmacologic chaperone imidazole-containing dipeptide-based compounds: natural skin care help and the ultimate challenge: implication for adaptive responses in the skin.

    Science.gov (United States)

    Babizhayev, Mark A; Nikolayev, Gennady M; Nikolayeva, Juliana G; Yegorov, Yegor E

    2012-03-01

    Accumulation of molecular damage and increased molecular heterogeneity are hallmarks of photoaged skin and pathogenesis of human cutaneous disease. Growing evidence demonstrates the ability of molecular chaperone proteins and of pharmacologic chaperones to decrease the environmental stress and ameliorate the oxidation stress-related and glycation disease phenotypes, suggesting that the field of chaperone therapy might hold novel treatments for skin diseases and aging. In this review, we examine the evidence suggesting a role for molecular chaperone proteins in the skin and their inducer and protecting agents: pharmacologic chaperone imidazole dipeptide-based agents (carcinine and related compounds) in cosmetics and dermatology. Furthermore, we discuss the use of chaperone therapy for the treatment of skin photoaging diseases and other skin pathologies that have a component of increased glycation and/or free radical-induced oxidation in their genesis. We examine biologic activities of molecular and pharmacologic chaperones, including strategies for identifying potential chaperone compounds and for experimentally demonstrating chaperone activity in in vitro and in vivo models of human skin disease. This allows the protein to function and traffic to the appropriate location in the skin, thereby increasing protein activity and cellular function and reducing stress on skin cells. The benefits of imidazole dipeptide antioxidants with transglycating activity (such as carcinine) in skin care are that they help protect and repair cell membrane damage and help retain youthful, younger-looking skin. All skin types will benefit from daily, topical application of pharmacologic chaperone antioxidants, anti-irritants, in combination with water-binding protein agents that work to mimic the structure and function of healthy skin. General strategies are presented addressing ground techniques to improve absorption of usually active chaperone proteins and dipeptide compounds, include

  19. Decreased myocardial perfusion reserve in diabetic autonomic neuropathy

    DEFF Research Database (Denmark)

    Taskiran, Mustafa; Fritz-Hansen, Thomas; Rasmussen, Verner

    2002-01-01

    The pathophysiological mechanisms responsible for increased cardiovascular mortality in diabetic autonomic neuropathy are unknown. To investigate the effect of autonomic neuropathy on myocardial function, we performed dynamic contrast-enhanced magnetic resonance perfusion imaging during baseline...... conditions and after Dipyridamole-induced vasodilatation in nine type 1 diabetic patients with autonomic neuropathy (AN+), defined by cardiovascular tests, as well as in 10 type 1 diabetic patients without autonomic neuropathy (AN-) and 10 healthy control subjects. Baseline myocardial perfusion index (K...... blood pressure response to Dipyridamole and myocardial perfusion reserve index. We conclude that type 1 diabetic patients with autonomic neuropathy have a decreased myocardial perfusion reserve capacity when challenged with a vasodilatator, a finding that may in part be the pathophysiological substrate...

  20. Autonomic disturbances in narcolepsy.

    Science.gov (United States)

    Plazzi, Giuseppe; Moghadam, Keivan Kaveh; Maggi, Leonardo Serra; Donadio, Vincenzo; Vetrugno, Roberto; Liguori, Rocco; Zoccoli, Giovanna; Poli, Francesca; Pizza, Fabio; Pagotto, Uberto; Ferri, Raffaele

    2011-06-01

    Narcolepsy is a clinical condition characterized mainly by excessive sleepiness and cataplexy. Hypnagogic hallucinations and sleep paralysis complete the narcoleptic tetrad; disrupted night sleep, automatic behaviors and weight gain are also usual complaints. Different studies focus on autonomic changes or dysfunctions among narcoleptic patients, such as pupillary abnormalities, fainting spells, erectile dysfunction, night sweats, gastric problems, low body temperature, systemic hypotension, dry mouth, heart palpitations, headache and extremities dysthermia. Even if many studies lack sufficient standardization or their results have not been replicated, a non-secondary involvement of the autonomic nervous system in narcolepsy is strongly suggested, mainly by metabolic and cardiovascular findings. Furthermore, the recent discovery of a high risk for overweight and for metabolic syndrome in narcoleptic patients represents an important warning for clinicians in order to monitor and follow them up for their autonomic functions. We review here studies on autonomic functions and clinical disturbances in narcoleptic patients, trying to shed light on the possible contribute of alterations of the hypocretin system in autonomic pathophysiology.

  1. Shortening Record in the Central Andean Plateau of Southern Peru: Basement Inversion, Thin-skinned Thrusting, and Geomorphic Response

    Science.gov (United States)

    Perez, N.; Horton, B. K.; McQuarrie, N.; Stübner, K.; Ehlers, T. A.

    2015-12-01

    Variations in the inherited structural architecture along western South America influence the timing, magnitude, and style of Andean deformation and topographic evolution. New results from mapping, balanced cross-section construction, apatite and zircon (U-Th)/He thermochronology, and geomorphology spanning the Altiplano, Eastern Cordillera and Subandean zone of southern Peru define the role of Triassic rift inversion on Cenozoic deformation style, thrust belt kinematics, exhumation timing, and spatial variation of canyon incision. A minimum of 130 km (38%) shortening along a 200 km transect accommodated by thin- and thick-skinned structures involved selective reactivation of Triassic normal faults that fed slip to shallower detachments of thin-skinned fold-thrust systems. Map relationships define unique structural domains defined by inherited normal faults. In the Eastern Cordillera, new zircon (U-Th)/He results from a Triassic pluton reveal Oligocene-Miocene (~26-18 Ma) cooling, consistent with previously reported exhumation from ~40 km along strike to the NW. However, rapid ~15 Ma cooling revealed by new apatite (U-Th)/He data is ~11 Myr older than equivalent rocks in a similar structural setting ~40 km to the NW. This suggests a potential middle Miocene shift from synchronous to diachronous exhumation along strike. Modern fluvial profiles constructed along the Eastern Cordillera show a reduction in knickpoint elevations from SE to NW, suggesting more youthful uplift toward the NW, comparable to the spatial trend in apatite (U-Th)/He ages. The deformation front reached the Subandean zone by ~15 Ma, after the majority of reported deformation in the Eastern Cordillera and Altiplano. These variations in exhumation over such distances are consistent with multiple potential scenarios: a northward propagating wave of uplift, spatial variations in climatically driven incision, interactions with mantle dynamics, or complex structural geometries.

  2. Assessing complexity of skin blood flow oscillations in response to locally applied heating and pressure in rats: Implications for pressure ulcer risk

    Science.gov (United States)

    Liao, Fuyuan; O'Brien, William D.; Jan, Yih-Kuen

    2013-10-01

    The objective of this study was to investigate the effects of local heating on the complexity of skin blood flow oscillations (BFO) under prolonged surface pressure in rats. Eleven Sprague-Dawley rats were studied: 7 rats underwent surface pressure with local heating (△t=10 °C) and 4 rats underwent pressure without heating. A pressure of 700 mmHg was applied to the right trochanter area of rats for 3 h. Skin blood flow was measured using laser Doppler flowmetry. The loading period was divided into nonoverlapping 30 min epochs. For each epoch, multifractal detrended fluctuation analysis (MDFA) was utilized to compute DFA coefficients and complexity of endothelial related metabolic, neurogenic, and myogenic frequencies of BFO. The results showed that under surface pressure, local heating led to a significant decrease in DFA coefficients of myogenic frequency during the initial epoch of loading period, a sustained decrease in complexity of myogenic frequency, and a significantly higher degree of complexity of metabolic frequency during the later phase of loading period. Surrogate tests showed that the reduction in complexity of myogenic frequency was associated with a loss of nonlinearity whereas increased complexity of metabolic frequency was associated with enhanced nonlinearity. Our results indicate that increased metabolic activity and decreased myogenic response due to local heating manifest themselves not only in magnitudes of metabolic and myogenic frequencies but also in their structural complexity. This study demonstrates the feasibility of using complexity analysis of BFO to monitor the ischemic status of weight-bearing skin and risk of pressure ulcers.

  3. Genetics of host response to Leishmania tropica in mice - different control of skin pathology, chemokine reaction, and invasion into spleen and liver.

    Directory of Open Access Journals (Sweden)

    Tetyana Kobets

    Full Text Available BACKGROUND: Leishmaniasis is a disease caused by protozoan parasites of genus Leishmania. The frequent involvement of Leishmania tropica in human leishmaniasis has been recognized only recently. Similarly as L. major, L. tropica causes cutaneous leishmaniasis in humans, but can also visceralize and cause systemic illness. The relationship between the host genotype and disease manifestations is poorly understood because there were no suitable animal models. METHODS: We studied susceptibility to L. tropica, using BALB/c-c-STS/A (CcS/Dem recombinant congenic (RC strains, which differ greatly in susceptibility to L. major. Mice were infected with L. tropica and skin lesions, cytokine and chemokine levels in serum, and parasite numbers in organs were measured. PRINCIPAL FINDINGS: Females of BALB/c and several RC strains developed skin lesions. In some strains parasites visceralized and were detected in spleen and liver. Importantly, the strain distribution pattern of symptoms caused by L. tropica was different from that observed after L. major infection. Moreover, sex differently influenced infection with L. tropica and L. major. L. major-infected males exhibited either higher or similar skin pathology as females, whereas L. tropica-infected females were more susceptible than males. The majority of L. tropica-infected strains exhibited increased levels of chemokines CCL2, CCL3 and CCL5. CcS-16 females, which developed the largest lesions, exhibited a unique systemic chemokine reaction, characterized by additional transient early peaks of CCL3 and CCL5, which were not present in CcS-16 males nor in any other strain. CONCLUSION: Comparison of L. tropica and L. major infections indicates that the strain patterns of response are species-specific, with different sex effects and largely different host susceptibility genes.

  4. Aging skin.

    Science.gov (United States)

    Bolognia, J L

    1995-01-16

    Aging of the skin is a composite of actinic damage, chronologic aging, and hormonal influences. The majority of changes associated with aging, such as wrinkles and solar lentigines ("liver spots"), are due to photoaging and reflect cumulative sun exposure as well as skin pigmentation. Classically, chronologic aging includes those cutaneous changes that occur in non-sun-exposed areas, such as the buttocks, and are observed in both men and women. A clinical example would be soft tissue sagging due to elastic fiber degeneration. In women, investigations into the effect of hormones on aging of the skin have concentrated on estrogens; in men, there have been a limited number of studies on the influence of testosterone. The latter have shown an age-dependent decrease in tissue androgens in pubic skin, but not scrotal or thigh skin. To date, age has not been shown to have an effect on androgen receptor binding, although a decrease in foreskin 5 alpha-reductase activity with increasing age has been described. In fibroblast cultures from foreskins, there have been conflicting results as to whether 5 alpha-reductase activity decreases in an age-dependent manner. Some of the skin changes that have been categorized as secondary to chronologic aging, such as decreased sebaceous gland activity and decreased hair growth, may actually represent a decline in the concentration of tissue androgens with increasing age. The influence of androgens on age-related changes in keratinocyte and fibroblast function remains speculative.

  5. Exploring relationships for visceral and somatic pain with autonomic control and personality.

    Science.gov (United States)

    Paine, Peter; Kishor, Jessin; Worthen, Sian F; Gregory, Lloyd J; Aziz, Qasim

    2009-08-01

    The autonomic nervous system (ANS) integrates afferent and motor activity for homeostatic processes including pain. The aim of the study was to compare hitherto poorly characterised relations between brainstem autonomic control and personality in response to visceral and somatic pain. Eighteen healthy subjects (16 females, mean age 34) had recordings during rest and pain of heart rate (HR), cardiac vagal tone (CVT), cardiac sensitivity to baroreflex (CSB), skin conductance level (SC), cardiac sympathetic index (CSI) and mean blood pressure (MBP). Visceral pain was induced by balloon distension in proximal (PB) and distal (DB) oesophagus and somatic pain by nail-bed pressure (NBP). Eight painful stimuli were delivered at each site and unpleasantness and intensity measured. Personality was profiled with the Big Five inventory. (1) Oesophageal intubation evoked "fight-flight" responses: HR and sympathetic (CSI, SC, MBP) elevation with parasympathetic (CVT) withdrawal (pintrovert subjects had greater positive pain-related CVT slope change (neuroticism r 0.8, p<0.05; extroversion r -0.5, p<0.05). Pain-evoked heart rate increases were mediated by parasympathetic and sympathetic co-activation - a novel finding in humans but recently described in mammals too. Visceral pain-related parasympathetic change correlated with personality. ANS defence responses are nuanced and may relate to personality type for visceral pain. Clinical relevance of these findings warrants further exploration.

  6. Influence of Clothing Fabrics on Skin Microcirculation

    Institute of Scientific and Technical Information of China (English)

    CHENG Ling; PAN Ning; ZHAO Lian-ying; HUAUNG Gu

    2010-01-01

    This study investigated the effects of clothing fabric on human skin microcirculation. Once skin is covered with a clothing fabric, human sensations, namely, coolness, warmth, softness, and roughness, are amused immediately, and the cutaneous micrecireulation may be changed consequently. Since the complex relationships of the human skin, the environment, and the clothing, there is few publication focusing on the physiological responses of the skin to the fabrics. In this paper, a Laser Doppler Flowmetry (LDF) was used to test the dynamic responses of the skin blood flow when the fabric was placed on the skin. Effects of different fabrics on the skin blood flux were investigated. The results show that cold stimulation of fabric has remarkable influences on the skin blood flux, and the surface properties of fabric are of importance to affect the human skin blood flow.

  7. Simple Autonomous Chaotic Circuits

    Science.gov (United States)

    Piper, Jessica; Sprott, J.

    2010-03-01

    Over the last several decades, numerous electronic circuits exhibiting chaos have been proposed. Non-autonomous circuits with as few as two components have been developed. However, the operation of such circuits relies on the non-ideal behavior of the devices used, and therefore the circuit equations can be quite complex. In this paper, we present two simple autonomous chaotic circuits using only opamps and linear passive components. The circuits each use one opamp as a comparator, to provide a signum nonlinearity. The chaotic behavior is robust, and independent of nonlinearities in the passive components. Moreover, the circuit equations are among the algebraically simplest chaotic systems yet constructed.

  8. Pain-induced skin autoimmunity

    OpenAIRE

    Odoardi, Francesca; Neuhuber, Winfried; Flügel, Alexander

    2014-01-01

    A recent paper published in Nature reports sensory nerve fibers in the skin that give local immune cells important instructions for the organization of an immune response; in this particular case the cooperation between the nervous and immune systems had disastrous consequences, namely an auto-destruction of the skin.

  9. Skin Cancer Prevention

    Science.gov (United States)

    ... Genetics of Skin Cancer Skin Cancer Screening Research Skin Cancer Prevention (PDQ®)–Patient Version What is prevention? ... prevent cancer are being studied. General Information About Skin Cancer Key Points Skin cancer is a disease ...

  10. Skin Cancer Screening

    Science.gov (United States)

    ... Genetics of Skin Cancer Skin Cancer Screening Research Skin Cancer Screening (PDQ®)–Patient Version What is screening? ... These are called diagnostic tests . General Information About Skin Cancer Key Points Skin cancer is a disease ...

  11. Dry Skin (Xerosis)

    Science.gov (United States)

    ... Kids’ zone Video library Find a dermatologist Dry skin Overview Dry, ashy skin: People who had atopic ... often have very dry skin as adults. Dry skin: Overview Also called xerosis Dry skin is common. ...

  12. Gating of the vertex somatosensory and auditory evoked potential P50 and the correlation to skin conductance orienting response in healthy men.

    Science.gov (United States)

    Arnfred, S M; Eder, D N; Hemmingsen, R P; Glenthøj, B Y; Chen, A C

    2001-04-15

    A defect in auditory evoked potential (AEP) P50 gating supports the theory of information-processing deficits in schizophrenia. The relationship between gating of the mid-latency evoked potentials (EP) in the somatosensory and the auditory modalities has not been studied together before. In schizophrenia, we might expect the processing deficits to act on multiple modalities. We have examined the gating of median nerve somatosensory EP (SEP) following paired stimulation identical to the AEP P50 gating paradigm using interstimulus intervals (ISI) of 500, 750 and 1000 ms and the correlation of gating to the skin conductance orienting response (SCOR) in 20 healthy men. We measured mid-latency vertex components (SEP: P50, N65, P85 and N100; AEP: P30, N45, P50 and N80). The gating was most pronounced at ISI 500 ms where the SEP P50 and N100 gating were 0.59 and 0.37, respectively, as compared to a gating of 0.61 in P30, 0.33 in P50 and 0.45 in N80 in the AEP. Repetition effects in the two modalities were not correlated. AEP P50 gating was correlated to skin conductance level (SCL). The combination of recording repetition effects on the mid-latency EP in two modalities could provide a method for investigating if deficits of information processing in schizophrenia are cross-modal.

  13. Autophagy in human skin fibroblasts: Comparison between young and aged cells and evaluation of its cellular rhythm and response to Ultraviolet A radiation.

    Science.gov (United States)

    Pernodet, Nadine; Dong, Kelly; Pelle, Edward

    2016-01-01

    Autophagic mechanisms play critical roles in cell maintenance. Damaged organelles that are not removed by autophagosomes, which act by engulfing and degrading these cellular components, have been linked to various pathologies. Recently, the progression of aging has also been correlated to a compromised autophagic response. Here, we report for the first time a significant reduction in autophagic levels in synchronized aged normal human skin fibroblasts as compared to young fibroblasts. We measured a 77.9% reduction in autophagy as determined by reverse transcription-polymerase chain reaction for LC3B expression, a microtubule-associated protein correlated to late stage autophagosome formation. In addition, we visualized these same changes by immunocytofluorescence with antibodies directed against LC3B. By harvesting synchronized, as well as unsynchronized cells over time, we were also able to measure for the first time a nighttime peak in autophagy that was present in young but absent in aged fibroblasts. Finally, since human skin is constantly subjected to environmentally induced oxidative stress from sunlight, we exposed fibroblasts to 10 J/cm2 ultraviolet A and found, in good agreement with current literature, not only that irradiation could partially reactivate autophagy in the aged cells, but also that this increase was phase shifted earlier from its endogenous temporal pattern because of its loss of synchronization with circadian rhythm.

  14. Time-dependent effects of low-level laser therapy on the morphology and oxidative response in the skin wound healing in rats.

    Science.gov (United States)

    Gonçalves, Reggiani Vilela; Novaes, Rômulo Dias; Cupertino, Marli do Carmo; Moraes, Bruna; Leite, João Paulo Viana; Peluzio, Maria do Carmo Gouveia; Pinto, Marcus Vinicius de Mello; da Matta, Sérgio Luis Pinto

    2013-02-01

    This study aims to investigate the effect of different energy densities provided by low-level laser therapy (LLLT) on the morphology of scar tissue and the oxidative response in the healing of secondary intention skin wounds in rats. Twenty-four male adult Wistar rats were used. Skin wounds were made on the backs of the animals, which were randomized into three groups of eight animals each as follows, 0.9% saline (control); laser GaAsAl 30 J/cm(2) (L30); laser GaAsAl 90 J/cm(2) (L90). The experiment lasted 21 days. Every 7 days, the wound contraction index (WCI) was calculated and tissue from different wounds was removed to assess the proportion of cells and blood vessels, collagen maturation index (CMI), thiobarbituric acid reactive substance (TBARS) levels and catalase activity (CAT). On the 7th and 14th days, the WCI and the proportion of cells were significantly higher in groups L30 and L90 compared to the control (p oxidative status of wounded tissue, constituting a possible mechanism through which the LLLT exerts its effects in the initial phases of tissue repair.

  15. Overview of the Autonomic Nervous System

    Science.gov (United States)

    ... be reversible or progressive. Anatomy of the autonomic nervous system The autonomic nervous system is the part of ... organs they connect with. Function of the autonomic nervous system The autonomic nervous system controls internal body processes ...

  16. Skin barrier function in healthy volunteers as assessed by transepidermal water loss and vascular response to hexyl nicotinate: intra- and inter-individual variability.

    Science.gov (United States)

    Oestmann, E; Lavrijsen, A P; Hermans, J; Ponec, M

    1993-02-01

    This study assesses the variability of two non-invasive methods of measuring stratum corneum barrier function in vivo. Transepidermal water loss (TEWL), and the vascular response to hexyl nicotinate (HN) penetration as determined by laser-Doppler flowmetry, were measured in a group of 21 healthy volunteers. Each time profile of the vascular response to HN penetration was analysed using the following parameters: the baseline cutaneous blood flow, the lag-time between application and initial response (t0), the time between application and maximum response (tmax), the maximum response, and the slope of the curve. TEWL measured on the left volar forearm showed a normal range of 3.9-7.6 g/m2h and a small inter-individual variability [coefficient of variation (CV) 19.4%]. TEWL values at three other forearm sites did not show differences of clinical importance compared with the left volar forearm. The parameters of the vascular response to HN penetration spanned a wider normal range than the TEWL values (CV between 33 and 52%). Repeat measurements after a 1-2 month interval showed highly reproducible individual TEWL values. The mean difference between first and second measurements was only 0.03 g/m2h; the relative difference 0.6%. The intra-individual reproducibility of t0 and tmax. for HN penetration was also high (relative differences of 2.8 and 3.1%, respectively). The other vascular response parameters were less reproducible (relative differences of 6.9-18.6%). We conclude that TEWL and selected parameters of HN penetration, as non-invasive tests of the stratum corneum barrier function, yield reproducible results and are hence useful for investigations assessing the skin barrier function in various disorders.

  17. Mechanisms regulating skin immunity and inflammation.

    Science.gov (United States)

    Pasparakis, Manolis; Haase, Ingo; Nestle, Frank O

    2014-05-01

    Immune responses in the skin are important for host defence against pathogenic microorganisms. However, dysregulated immune reactions can cause chronic inflammatory skin diseases. Extensive crosstalk between the different cellular and microbial components of the skin regulates local immune responses to ensure efficient host defence, to maintain and restore homeostasis, and to prevent chronic disease. In this Review, we discuss recent findings that highlight the complex regulatory networks that control skin immunity, and we provide new paradigms for the mechanisms that regulate skin immune responses in host defence and in chronic inflammation.

  18. The 'beauty' of skin neurobiology.

    Science.gov (United States)

    Pincelli, C; Bonté, F

    2003-07-01

    The skin is the most densely innervated organ in the body and there is a close relationship between the skin and the nervous system. Most skin cells express receptors for neuromediators (NM) and skin cells themselves are an important source of NM. In particular, human keratinocytes synthesize neurotrophins and endorphins and express their receptors. In addition to neurotrophic activity, NM are involved in skin homeostasis, trophism and stress responses. NM released from keratinocytes also function in a paracrine fashion on other skin cells, such as Langerhans cells, melanocytes and fibroblasts. We discuss the influence of NM on these cells, which may be involved in major cosmetic problems like ageing, baldness and dyspigmentation. Based on this correlation, it seems reasonable to target neural factors for cosmetic purposes.

  19. Pathophysiological Study of Sensitive Skin.

    Science.gov (United States)

    Buhé, Virginie; Vié, Katell; Guéré, Christelle; Natalizio, Audrey; Lhéritier, Céline; Le Gall-Ianotto, Christelle; Huet, Flavien; Talagas, Matthieu; Lebonvallet, Nicolas; Marcorelles, Pascale; Carré, Jean-Luc; Misery, Laurent

    2016-03-01

    Sensitive skin is a clinical syndrome characterized by the occurrence of unpleasant sensations, such as pruritus, burning or pain, in response to various factors, including skincare products, water, cold, heat, or other physical and/or chemical factors. Although these symptoms suggest inflammation and the activation of peripheral innervation, the pathophysiogeny of sensitive skin remains unknown. We systematically analysed cutaneous biopsies from 50 healthy women with non-sensitive or sensitive skin and demonstrated that the intraepidermal nerve fibre density, especially that of peptidergic C-fibres, was lower in the sensitive skin group. These fibres are involved in pain, itching and temperature perception, and their degeneration may promote allodynia and similar symptoms. These results suggest that the pathophysiology of skin sensitivity resembles that of neuropathic pruritus within the context of small fibre neuropathy, and that environmental factors may alter skin innervation.

  20. Inactivated poliovirus type 2 vaccine delivered to rat skin via high density microprojection array elicits potent neutralising antibody responses.

    Science.gov (United States)

    Muller, David A; Pearson, Frances E; Fernando, Germain J P; Agyei-Yeboah, Christiana; Owens, Nick S; Corrie, Simon R; Crichton, Michael L; Wei, Jonathan C J; Weldon, William C; Oberste, M Steven; Young, Paul R; Kendall, Mark A F

    2016-02-25

    Polio eradication is progressing rapidly, and the live attenuated Sabin strains in the oral poliovirus vaccine (OPV) are being removed sequentially, starting with type 2 in April 2016. For risk mitigation, countries are introducing inactivated poliovirus vaccine (IPV) into routine vaccination programs. After April 2016, monovalent type 2 OPV will be available for type 2 outbreak control. Because the current IPV is not suitable for house-to-house vaccination campaigns (the intramuscular injections require health professionals), we developed a high-density microprojection array, the Nanopatch, delivered monovalent type 2 IPV (IPV2) vaccine to the skin. To assess the immunogenicity of the Nanopatch, we performed a dose-matched study in rats, comparing the immunogenicity of IPV2 delivered by intramuscular injection or Nanopatch immunisation. A single dose of 0.2 D-antigen units of IPV2 elicited protective levels of poliovirus antibodies in 100% of animals. However, animals receiving IPV2 by IM required at least 3 immunisations to reach the same neutralising antibody titres. This level of dose reduction (1/40th of a full dose) is unprecedented for poliovirus vaccine delivery. The ease of administration coupled with the dose reduction observed in this study points to the Nanopatch as a potential tool for facilitating inexpensive IPV for mass vaccination campaigns.

  1. The prediction of human skin responses by using the combined in vitro fluorescein leakage/Alamar Blue (resazurin) assay.

    Science.gov (United States)

    Clothier, Richard; Starzec, Gemma; Pradel, Lionel; Baxter, Victoria; Jones, Melanie; Cox, Helen; Noble, Linda

    2002-01-01

    A range of cosmetics formulations with human patch-test data were supplied in a coded form, for the examination of the use of a combined in vitro permeability barrier assay and cell viability assay to generate, and then test, a prediction model for assessing potential human skin patch-test results. The target cells employed were of the Madin Darby canine kidney cell line, which establish tight junctions and adherens junctions able to restrict the permeability of sodium fluorescein across the barrier of the confluent cell layer. The prediction model for interpretation of the in vitro assay results included initial effects and the recovery profile over 72 hours. A set of the hand-wash, surfactant-based formulations were tested to generate the prediction model, and then six others were evaluated. The model system was then also evaluated with powder laundry detergents and hand moisturisers: their effects were predicted by the in vitro test system. The model was under-predictive for two of the ten hand-wash products. It was over-predictive for the moisturisers, (two out of six) and eight out of ten laundry powders. However, the in vivo human patch test data were variable, and 19 of the 26 predictions were correct or within 0.5 on the 0-4.0 scale used for the in vivo scores, i.e. within the same variable range reported for the repeat-test hand-wash in vivo data.

  2. Autonomous Hexapod Spider Robot

    DEFF Research Database (Denmark)

    Pandey, Nisha; Pandey, Bishwajeet; Hussain, Dil muhammed Akbar

    2017-01-01

    of a hexapod robot. It is controlled through Arduino-unoR3 based SSC servo control module. Servos of torque 2.5kg-cm are used in robot to show different working movements including back and forth movement and sitting posture. Another trending technology i.e. Bluetooth is used to control autonomous feature...

  3. Experimental Autonomous Vehicle Systems

    DEFF Research Database (Denmark)

    Ravn, Ole; Andersen, Nils Axel

    1998-01-01

    The paper describes the requirements for and a prototype configuration of a software architecture for control of an experimental autonomous vehicle. The test bed nature of the system is emphasised in the choice of architecture making re-configurability, data logging and extendability simple...

  4. Autonomous component carrier selection

    DEFF Research Database (Denmark)

    Garcia, Luis Guilherme Uzeda; Pedersen, Klaus; Mogensen, Preben

    2009-01-01

    in local areas, basing our study case on LTE-Advanced. We present extensive network simulation results to demonstrate that a simple and robust interference management scheme, called autonomous component carrier selection allows each cell to select the most attractive frequency configuration; improving...

  5. Autonomous Forest Fire Detection

    NARCIS (Netherlands)

    Breejen, E. den; Breuers, M.; Cremer, F.; Kemp, R.A.W.; Roos, M.; Schutte, K.; Vries, J.S. de

    1998-01-01

    Forest fire detection is a very important issue in the pre-suppression process. Timely detection allows the suppression units to reach the fire in its initial stages and this will reduce the suppression costs considerably. The autonomous forest fire detection principle is based on temporal contrast

  6. Delayed habituation of the skin-conductance orienting response correlates with impaired performance on the Wisconsin Card Sorting Task in schizophrenia.

    Science.gov (United States)

    Schiffer, R A; Sigal, M; Mintz, M

    1996-11-15

    The skin-conductance orienting response (SCOR) in schizophrenia is often characterized by either nonresponding or delayed habituation to repeated nonsignal tones. These abnormalities are poorly related to other dimensions of schizophrenia. In the present study, we confirmed that about 50% of patients with chronic schizophrenia are SCOR nonresponders. Nonresponders, however, did not differ from responders on postmorbid psychiatric or pharmacological course, and we therefore could not confirm the hypothesis that course of illness follows a more marked pattern of increasing severity in nonresponders. Performance on the Wisconsin Card Sorting Test (WCST) was particularly poor in a subgroup of responders who exhibited either delayed habituation and/or dishabituation of SCORs to tones applied after a short rest period. It is possible that pathology of the prefrontal cortex mediates the SCOR abnormalities that characterize schizophrenic patients who perform poorly on the WCST.

  7. The vasomotor component of the orienting response in man related to spontaneous fluctuation of vasomotor activity in the acral skin zone.

    Science.gov (United States)

    Kellerová, E; Ruttkay-Nedecký, I

    1978-10-01

    A plethymographic study of the effect of a weak indifferent light or sound stimulus and of a physically identical light stimulus with signal meaning on vasomotor activity in the acral skin zone of man has shown that during stimulus presentation there was a significant rise in the percent of occurrence of vasmotor waves corresponding to the criteria for the vasomotor orienting response (VOR). VOR is elicited significantly more often by stimuli with signal meaning than by physically identical indifferent stimuli. After the acute extinction or VOR disinhibition followed in all cases, and after 40--60 repeated stimuli the occurrence of VOR was still significant. Repeated stimuli had a significant effect on the course of the plethysmographic curve, especially on the component of waves of third order, changing the frequency spectrum and time contingency of waves.

  8. Investigating the Effect of Sympathetic Skin Response Parameters on the Psychological Test Scores in Patients with Fibromyalgia Syndrome by Using ANNS

    Directory of Open Access Journals (Sweden)

    Murat Yıldız

    2013-01-01

    Full Text Available In this study, psychological tests such as Visual Analogue Pain Scale, Verbal Pain Scale, Beck Depression Inventory, Beck Anxiety Inventory, Hamilton Depression Rating Scale and Hamilton Anxiety Scale were applied to the selected healthy subjects and patients with Fibromyalgia Syndrome (FMS in Suleyman Demirel University, Faculty of Medicine, Department of Physical Medicine and Rehabilitation and the scores were recorded. A measurement system was established in the same department of the university to measure the sympathetic skin response (SSR from the subjects. The SSR was measured and recorded. The parameters such as latency time, maximum amplitude and the elapsed time were calculated by using Matlab software from the recorded SSR data. SSR parameters were added to the scores and diagnosis accuracy percentages of the FMS calculated by using artificial neural networks (ANNs. Obtained results from the simulations showed that the specified parameters of the SSR and FMS were concerned and these parameters can be used as a diagnostic method in FMS.

  9. Autonomous Real Time Requirements Tracing

    Science.gov (United States)

    Plattsmier, George; Stetson, Howard

    2014-01-01

    One of the more challenging aspects of software development is the ability to verify and validate the functional software requirements dictated by the Software Requirements Specification (SRS) and the Software Detail Design (SDD). Insuring the software has achieved the intended requirements is the responsibility of the Software Quality team and the Software Test team. The utilization of Timeliner-TLX(sup TM) Auto- Procedures for relocating ground operations positions to ISS automated on-board operations has begun the transition that would be required for manned deep space missions with minimal crew requirements. This transition also moves the auto-procedures from the procedure realm into the flight software arena and as such the operational requirements and testing will be more structured and rigorous. The autoprocedures would be required to meet NASA software standards as specified in the Software Safety Standard (NASASTD- 8719), the Software Engineering Requirements (NPR 7150), the Software Assurance Standard (NASA-STD-8739) and also the Human Rating Requirements (NPR-8705). The Autonomous Fluid Transfer System (AFTS) test-bed utilizes the Timeliner-TLX(sup TM) Language for development of autonomous command and control software. The Timeliner-TLX(sup TM) system has the unique feature of providing the current line of the statement in execution during real-time execution of the software. The feature of execution line number internal reporting unlocks the capability of monitoring the execution autonomously by use of a companion Timeliner-TLX(sup TM) sequence as the line number reporting is embedded inside the Timeliner-TLX(sup TM) execution engine. This negates I/O processing of this type data as the line number status of executing sequences is built-in as a function reference. This paper will outline the design and capabilities of the AFTS Autonomous Requirements Tracker, which traces and logs SRS requirements as they are being met during real-time execution of the

  10. Probabilistic hazard assessment for skin sensitization potency by dose–response modeling using feature elimination instead of quantitative structure–activity relationships

    Science.gov (United States)

    McKim, James M.; Hartung, Thomas; Kleensang, Andre; Sá-Rocha, Vanessa

    2016-01-01

    Supervised learning methods promise to improve integrated testing strategies (ITS), but must be adjusted to handle high dimensionality and dose–response data. ITS approaches are currently fueled by the increasing mechanistic understanding of adverse outcome pathways (AOP) and the development of tests reflecting these mechanisms. Simple approaches to combine skin sensitization data sets, such as weight of evidence, fail due to problems in information redundancy and high dimension-ality. The problem is further amplified when potency information (dose/response) of hazards would be estimated. Skin sensitization currently serves as the foster child for AOP and ITS development, as legislative pressures combined with a very good mechanistic understanding of contact dermatitis have led to test development and relatively large high-quality data sets. We curated such a data set and combined a recursive variable selection algorithm to evaluate the information available through in silico, in chemico and in vitro assays. Chemical similarity alone could not cluster chemicals’ potency, and in vitro models consistently ranked high in recursive feature elimination. This allows reducing the number of tests included in an ITS. Next, we analyzed with a hidden Markov model that takes advantage of an intrinsic inter-relationship among the local lymph node assay classes, i.e. the monotonous connection between local lymph node assay and dose. The dose-informed random forest/hidden Markov model was superior to the dose-naive random forest model on all data sets. Although balanced accuracy improvement may seem small, this obscures the actual improvement in misclassifications as the dose-informed hidden Markov model strongly reduced "false-negatives" (i.e. extreme sensitizers as non-sensitizer) on all data sets. PMID:26046447

  11. The Association between Baseline Subjective Anxiety Rating and Changes in Cardiac Autonomic Nervous Activity in Response to Tryptophan Depletion in Healthy Volunteers.

    Science.gov (United States)

    Hsiao, Chih Yin; Tsai, Hsin Chun; Chi, Mei Hung; Chen, Kao Chin; Chen, Po See; Lee, I Hui; Yeh, Tzung Lieh; Yang, Yen Kuang

    2016-05-01

    The aim of this study was to investigate the influence of serotonin on anxiety and autonomic nervous system (ANS) function; the correlation between subjective anxiety rating and changes of ANS function following tryptophan depletion (TD) in healthy volunteers was examined. Twenty-eight healthy participants, consisting of 15 females and 13 males, with an average age of 33.3 years, were recruited.Baseline Chinese Symptom Checklist-90-Revised and ANS function measurements were taken. TD was carried out on the testing day, and participants provided blood samples right before and 5 hours after TD. ANS function, somatic symptoms, and Visual Analogue Scales (VASs) were determined after TD. Wilcoxon signed rank test and Spearman ρ correlation were adapted for analyses of the results.The TD procedure reduced total and free plasma tryptophan effectively. After TD, the sympathetic nervous activity increased and parasympathetic nervous activity decreased. Baseline anxiety ratings positively correlated with post-TD changes in sympathetic nervous activity, VAS ratings, and physical symptoms. However, a negative correlation with post-TD changes in parasympathetic nervous activity was found.The change in ANS function after TD was associated with the severity of anxiety in healthy volunteers. This supports the fact that the effect of anxiety on heart rate variability is related to serotonin vulnerability. Furthermore, it also shows that the subjective anxiety rating has a biological basis related to serotonin.

  12. Response of the snowmelt and glacier runoff to the climate warming-up in the last 40 years in Xinjiang Autonomous Region, China

    Institute of Scientific and Technical Information of China (English)

    叶佰生; 丁永建; 康尔泗; 李纲; 韩添丁

    1999-01-01

    Some analytical results of the measured runoff during 1950s to 1980s at outlet hydrological stations of 33 main rivers and climatic data collected from 84 meteorological stations in Xinjiang Autonomous Region are presented.Comparison of hydrological and climatic parameters before and after 1980 shows that the spring runoff for most rivers after 1980s increased obviously at a rate of about 10%, though the spring air temperature did not rise very much. Especially,an increment by 20% for alpine runoff is observed during May when intensive snow melting occurred in the alpine region. To the contrary, the runoff in June decreased about 5%. When the summer or annual runoff is taken into account,direct relationship can be found between the change in runoff and the ratio of glacier-coverage, except the runoff in August when the glacier melting is strong, indicating that climatic warming has an obvious effect on the contribution of glacier melting to the runoff increase.

  13. Influence of a pre-stimulation with chronic low-dose UVB on stress response mechanisms in human skin fibroblasts.

    Science.gov (United States)

    Drigeard Desgarnier, Marie-Catherine; Fournier, Frédéric; Droit, Arnaud; Rochette, Patrick J

    2017-01-01

    Exposure to solar ultraviolet type B (UVB), through the induction of cyclobutane pyrimidine dimer (CPD), is the major risk factor for cutaneous cancer. Cells respond to UV-induced CPD by triggering the DNA damage response (DDR) responsible for signaling DNA repair, programmed cell death and cell cycle arrest. Underlying mechanisms implicated in the DDR have been extensively studied using single acute UVB irradiation. However, little is known concerning the consequences of chronic low-dose of UVB (CLUV) on the DDR. Thus, we have investigated the effect of a CLUV pre-stimulation on the different stress response pathways. We found that CLUV pre-stimulation enhances CPD repair capacity and leads to a cell cycle delay but leave residual unrepaired CPD. We further analyzed the consequence of the CLUV regimen on general gene and protein expression. We found that CLUV treatment influences biological processes related to the response to stress at the transcriptomic and proteomic levels. This overview study represents the first demonstration that human cells respond to chronic UV irradiation by modulating their genotoxic stress response mechanisms.

  14. A fiber optic probe for measurement of an autonomic dysreflexia event on SCI patients

    Science.gov (United States)

    Ramella-Roman, J. C.; Hidler, J. M.

    2008-02-01

    Autonomic Dysreflexia (AD) is an inappropriate response of the sympathetic nervous system that often occurs in individuals with spinal cord injury (SCI ) at or above the sixth thoracic vertebrae (T6) level when a noxius stimulus is applied below the level of injury. An AD event can be put into motion by something as simple as an ingrown toenail or a full bladder, with symptoms such as headache, elevated blood pressure, reduced heart rate, decreases in blood flow below the level of injury, and in extreme cases, stroke. We have developed a quantitative method of measuring skin oxygen levels during AD using a fiber optics based probe. Two such probes were located above and below the injury level (on the patient forearm and thigh respectively) and were connected to a dual channel spectrophotometer. Oxygen saturation was calculated using the reflectance spectra and an algorithm based on melanin and hemoglobin absorption. We found that during an AD event, the amount of oxygen in the skin below the injury level drops by as much as 40%, while above the injury level skin oxygenation remains constant. Additionally, we observed elevated persperation levels below the injury level. We hypothesize that the combination of AD-related ischemia with pressure related ischemia and increased perspiration places individuals with injury level at T6 or above at significant risk for developing a pressure sore below the injury site.

  15. Autonomic nervous system and immune system interactions.

    Science.gov (United States)

    Kenney, M J; Ganta, C K

    2014-07-01

    The present review assesses the current state of literature defining integrative autonomic-immune physiological processing, focusing on studies that have employed electrophysiological, pharmacological, molecular biological, and central nervous system experimental approaches. Central autonomic neural networks are informed of peripheral immune status via numerous communicating pathways, including neural and non-neural. Cytokines and other immune factors affect the level of activity and responsivity of discharges in sympathetic and parasympathetic nerves innervating diverse targets. Multiple levels of the neuraxis contribute to cytokine-induced changes in efferent parasympathetic and sympathetic nerve outflows, leading to modulation of peripheral immune responses. The functionality of local sympathoimmune interactions depends on the microenvironment created by diverse signaling mechanisms involving integration between sympathetic nervous system neurotransmitters and neuromodulators; specific adrenergic receptors; and the presence or absence of immune cells, cytokines, and bacteria. Functional mechanisms contributing to the cholinergic anti-inflammatory pathway likely involve novel cholinergic-adrenergic interactions at peripheral sites, including autonomic ganglion and lymphoid targets. Immune cells express adrenergic and nicotinic receptors. Neurotransmitters released by sympathetic and parasympathetic nerve endings bind to their respective receptors located on the surface of immune cells and initiate immune-modulatory responses. Both sympathetic and parasympathetic arms of the autonomic nervous system are instrumental in orchestrating neuroimmune processes, although additional studies are required to understand dynamic and complex adrenergic-cholinergic interactions. Further understanding of regulatory mechanisms linking the sympathetic nervous, parasympathetic nervous, and immune systems is critical for understanding relationships between chronic disease

  16. Effects of prefrontal rTMS on autonomic reactions to affective pictures.

    Science.gov (United States)

    Berger, Christoph; Domes, Gregor; Balschat, Johannes; Thome, Johannes; Höppner, Jacqueline

    2017-02-01

    Repetitive transcranial magnetic stimulation (rTMS) can modulate the excitability of stimulated cortical areas, such as prefrontal areas involved in emotion regulation. Low frequency (LF) rTMS is expected to have inhibitory effects on prefrontal regions, and thereby should disinhibit limbic activity, resulting in enhanced emotional and autonomic reactions. For high frequency (HF) rTMS, the opposite pattern might be assumed. The objective of this study was to determine the effects of different rTMS frequencies applied to the right dlPFC on autonomic functions and on emotional perception. In a crossover design, two groups of 20 healthy young women were either stimulated with one session of LF rTMS (1 Hz) or one session of HF rTMS (10 Hz), compared to sham stimulation. We assessed phasic cardiac responses (PCR), skin conductance reactions (SCR), and emotional appraisal of emotional pictures as well as recognition memory after each rTMS application. After LF rTMS, PCR (heart rate deceleration) during presentation of pictures with negative and neutral valence was significantly increased compared to the presentation of positive pictures. In contrast, the modulatory effect of picture valence and arousal on the cardiac orienting response was absent after HF rTMS. Our results suggest that frontal LF rTMS indirectly activates the ANS via inhibition of the right dlPFC activity, likely by enhancing the sensory processing or attention to aversive and neutral stimuli.

  17. Hypnotic trait and specific phobia: EEG and autonomic output during phobic stimulation.

    Science.gov (United States)

    Gemignani, Angelo; Sebastiani, Laura; Simoni, Alfredo; Santarcangelo, Enrica L; Ghelarducci, Brunello

    2006-03-31

    In a previous study we showed that healthy highly hypnotizable subjects, during the suggestion of a moderately unpleasant situation administered in awake conditions, exhibited a sympathetic response greatly attenuated with respect to non-hypnotizable individuals. This was interpreted as a natural protection of hypnotizable subjects against the cardiovascular effects of cognitive stress. Aim of the present study was to investigate whether the hypnotic trait is able to modulate the autonomic and cerebral activities also in specific phobic awake hypnotizable (Highs) and non-hypnotizable (Lows) subjects. Electroencephalogram, electrooculogram, electromiogram of corrugator muscle, electrocardiogram, respirogram and tonic electrodermal activity were recorded during a guided mental imagery of an animal phobic object. Phobic stimulation induced in both groups the rise of heart and respiratory frequency and the lowering of skin resistance. These changes are less pronounced in Highs than in Lows and are sustained by a different modulation of the sympatho-vagal balance. During phobic stimulation both groups exhibited a similar significant increase of EEG gamma relative power. At variance, significant stimulation-related decrements of alpha1, theta1 and theta2 activities were found only in Highs that exhibited similar changes during the control and phobic stimulation. Results suggest that hypnotizability is able to modulate cerebral and autonomic responses also in specific phobic subjects. However, the presence of a specific phobia attenuates the effectiveness of hypnotizability as a protective factor against possible stress-related cardiac illness.

  18. Identification of organ-autonomous constituents of the molecular memory conferred by thyroid hormone exposure in cold temperature-arrested metamorphosing Rana (Lithobates) catesbeiana tadpoles.

    Science.gov (United States)

    Austin Hammond, S; Jackman, Kevin W; Partovi, Shireen H; Veldhoen, Nik; Helbing, Caren C

    2016-03-01

    Environmental temperature modulates thyroid hormone (TH)-dependent metamorphosis in some amphibian species. The North American bullfrog--Rana (Lithobates) catesbeiana - tadpole is naturally adapted to a wide range of temperatures over multiple seasons. Cold temperatures delay while warmer temperatures accelerate metamorphosis. Exogenous TH exposure of premetamorphic tadpoles results in a rapid precocious induction of metamorphosis at warm temperatures (20-25 °C). The same exposure at cold temperatures (4-5 °C) does not elicit an overt metamorphic response. However, a molecular memory of TH exposure is established such that cold, TH-exposed tadpoles returned to permissive warm temperatures will rapidly execute TH-induced genetic programs. Previous mRNA profiling has identified TH-regulated transcription factors encoded by thra, thrb, thibz, klf9, and cebp1 as components of the molecular memory after one week post-exposure. However, a further hierarchy may exist within the initiation phase since many gene transcripts demonstrated tissue-specific patterns. Whether the molecular memory is organ autonomous or requires additional modulating factors is unknown. Herein we examine tail fin and back skin and determine that thibz is the only transcript that is TH-responsive after 2 days post-exposure at low temperature in both tissues in the intact animal. In back skin, cebp1 is also TH-responsive under these conditions. Serum-free tail fin organ culture (C-Fin) reveals that the thibz response is organ autonomous whereas cultured back skin (C-Skin) results suggest that thibz and cebp1 require an additional factor for induction from elsewhere within the intact animal. Subsequent investigations are now possible to identify endogenous factors that modulate the molecular memory in intact animals.

  19. Behavioral and neural responses of toads to salt solutions correlate with basolateral membrane potential of epidermal cells of the skin

    DEFF Research Database (Denmark)

    Hillyard, Stanley D; Baula, Victor; Tuttle, Wendy

    2007-01-01

    Dehydrated toads initiated water absorption response (WR) behavior and absorbed water from dilute NaCl solutions. With 200-250 mM NaCl, WR behavior and water absorption were both suppressed. With 200-250 mM Na-gluconate, WR initiation was significantly greater than with NaCl but water loss was gr...

  20. Noninvasive evaluation of the vascular response to transplantation of alginate encapsulated islets using the dorsal skin-fold model.

    Science.gov (United States)

    Krishnan, Rahul; Arora, Rajan P; Alexander, Michael; White, Sean M; Lamb, Morgan W; Foster, Clarence E; Choi, Bernard; Lakey, Jonathan R T

    2014-01-01

    Alginate encapsulation reduces the risk of transplant rejection by evading immune-mediated cell injury and rejection; however, poor vascular perfusion results in graft failure. Since existing imaging models are incapable of quantifying the vascular response to biomaterial implants after transplantation, in this study, we demonstrate the use of in vivo laser speckle imaging (LSI) and wide-field functional imaging (WiFI) to monitor the microvascular environment surrounding biomaterial implants. The vascular response to two islet-containing biomaterial encapsulation devices, alginate microcapsules and a high-guluronate alginate sheet, was studied and compared after implantation into the mouse dorsal window chamber (N = 4 per implant group). Images obtained over a 14-day period using LSI and WiFI were analyzed using algorithms to quantify blood flow, hemoglobin oxygen saturation and vascular density. Using our method, we were able to monitor the changes in the peri-implant microvasculature noninvasively without the use of fluorescent dyes. Significant changes in blood flow, hemoglobin oxygen saturation and vascular density were noted as early as the first week post-transplant. The dorsal window chamber model enables comparison of host responses to transplanted biomaterials. Future experiments will study the effect of changes in alginate composition on the vascular and immune responses.

  1. Cell-mediated immunity in the rheumatoid diseases. I. Skin testing and mitogenic responses in sero-negative arthritides.

    Science.gov (United States)

    Froebel, K; Sturrock, R D; Dick, W C; MacSween, R N

    1975-12-01

    Cellular immunity has been investigated in patients with various kinds of sero-negative arthritis. The incidence of cutaneous response to recall antigen streptokinase-streptodornase (SK-SD), and the ability to mount a primary cutaneous response to dinitrochlorobenzene (DNCB) have been examined in patients with ankylosing spondylitis and psoriatic arthritis. The results were not significantly different from normal. In vitro lymphocyte transformation in the presence of phytohaemagglutinin (PHA), concanavalin A (Con A), and pokeweed mitogen (PWM) has been measured using peripheral blood lymphocytes from patients with ankylosing spondylitis, psoriatic arthritis and Reiter's disease. In comparison with a control group, significantly reduced responses were found to a low dose of PHA in the ankylosing spondylitis and Reiter disease patients. Significant increase in response occurred to a high dose of PHA, in patients with psoriatic arthritis and Reiter's disease, and to PWM in Reiter's disease patients. The in vitro results in the ankylosing spondylitis, psoriatic arthritis and Reiter's disease patients suggest some abnormality in the T-cell population in sero-negative arthritis.

  2. Skin Cancer

    Science.gov (United States)

    ... you ever get a bad sunburn that caused blisters when you were a child?Does your skin ... Cancer InstituteMelanoma International FoundationAmerican Cancer Society ResourcesDiagnosis and Management of Malignant Melanoma by BG Goldstein, AO Goldstein( ...

  3. Squamous cell skin cancer

    Science.gov (United States)

    ... that reflect light more, such as water, sand, concrete, and areas that are painted white. The higher ... - skin - squamous cell; Skin cancer - squamous cell; Nonmelanoma skin cancer - squamous ...

  4. Mobile Autonomous Humanoid Assistant

    Science.gov (United States)

    Diftler, M. A.; Ambrose, R. O.; Tyree, K. S.; Goza, S. M.; Huber, E. L.

    2004-01-01

    A mobile autonomous humanoid robot is assisting human co-workers at the Johnson Space Center with tool handling tasks. This robot combines the upper body of the National Aeronautics and Space Administration (NASA)/Defense Advanced Research Projects Agency (DARPA) Robonaut system with a Segway(TradeMark) Robotic Mobility Platform yielding a dexterous, maneuverable humanoid perfect for aiding human co-workers in a range of environments. This system uses stereo vision to locate human team mates and tools and a navigation system that uses laser range and vision data to follow humans while avoiding obstacles. Tactile sensors provide information to grasping algorithms for efficient tool exchanges. The autonomous architecture utilizes these pre-programmed skills to form human assistant behaviors. The initial behavior demonstrates a robust capability to assist a human by acquiring a tool from a remotely located individual and then following the human in a cluttered environment with the tool for future use.

  5. Autonomous Guidance, Navigation and Control

    Science.gov (United States)

    Bordano, A. J.; Mcswain, G. G.; Fernandes, S. T.

    1991-01-01

    The NASA Autonomous Guidance, Navigation and Control (GN&C) Bridging program is reviewed to demonstrate the program plan and GN&C systems for the Space Shuttle. The ascent CN&C system is described in terms of elements such as the general-purpose digital computers, sensors for the navigation subsystem, the guidance-system software, and the flight-control subsystem. Balloon-based and lidar wind soundings are used for operations assessment on the day of launch, and the guidance software is based on dedicated units for atmospheric powered flight, vacuum powered flight, and abort-specific situations. Optimization of the flight trajectories is discussed, and flight-control responses are illustrated for wavelengths of 500-6000 m. Alternate sensors are used for load relief, and adaptive GN&C systems based on alternate gain synthesis are used for systems failures.

  6. Autonomous Undersea Observations

    Science.gov (United States)

    2016-06-13

    less expensive sensor systems for a variety of applications, including measurement of physical characteristics of the ocean, threat detection, and...multiple autonomous environmental sensors within an acoustic modem-based infrastructure capable of communicating to and from the sensors and to and...networks, and telesonar with high speed platforms. This effort is concentrating on the development and demonstration of the two modem- based sensors . We

  7. Autonomous robotic sweeper

    OpenAIRE

    Kržišnik, Domen

    2015-01-01

    There is already a wide range of personal/domestic robots on the market capable of performing various tasks. We haven't however been able to find any commercially available robots designed for effectively performing the task of backyard sweeping. This thesis presents the process and end result of planning, assembly and programming of an autonomous robot, capable of performing the above mentioned task. We first analyze robots with similar functions, including robotic vacuum cleaners and lawn m...

  8. Gene expression in Atlantic salmon skin in response to infection with the parasitic copepod Lepeophtheirus salmonis, cortisol implant, and their combination

    Directory of Open Access Journals (Sweden)

    Krasnov Aleksei

    2012-04-01

    Full Text Available Abstract Background The salmon louse is an ectoparasitic copepod that causes major economic losses in the aquaculture industry of Atlantic salmon. This host displays a high level of susceptibility to lice which can be accounted for by several factors including stress. In addition, the parasite itself acts as a potent stressor of the host, and outcomes of infection can depend on biotic and abiotic factors that stimulate production of cortisol. Consequently, examination of responses to infection with this parasite, in addition to stress hormone regulation in Atlantic salmon, is vital for better understanding of the host pathogen interaction. Results Atlantic salmon post smolts were organised into four experimental groups: lice + cortisol, lice + placebo, no lice + cortisol, no lice + placebo. Infection levels were equal in both treatments upon termination of the experiment. Gene expression changes in skin were assessed with 21 k oligonucleotide microarray and qPCR at the chalimus stage 18 days post infection at 9°C. The transcriptomic effects of hormone treatment were significantly greater than lice-infection induced changes. Cortisol stimulated expression of genes involved in metabolism of steroids and amino acids, chaperones, responses to oxidative stress and eicosanoid metabolism and suppressed genes related to antigen presentation, B and T cells, antiviral and inflammatory responses. Cortisol and lice equally down-regulated a large panel of motor proteins that can be important for wound contraction. Cortisol also suppressed multiple genes involved in wound healing, parts of which were activated by the parasite. Down-regulation of collagens and other structural proteins was in parallel with the induction of proteinases that degrade extracellular matrix (MMP9 and MMP13. Cortisol reduced expression of genes encoding proteins involved in formation of various tissue structures, regulators of cell differentiation and growth factors. Conclusions

  9. Nature's Autonomous Oscillators

    Science.gov (United States)

    Mayr, H. G.; Yee, J.-H.; Mayr, M.; Schnetzler, R.

    2012-01-01

    Nonlinearity is required to produce autonomous oscillations without external time dependent source, and an example is the pendulum clock. The escapement mechanism of the clock imparts an impulse for each swing direction, which keeps the pendulum oscillating at the resonance frequency. Among nature's observed autonomous oscillators, examples are the quasi-biennial oscillation and bimonthly oscillation of the Earth atmosphere, and the 22-year solar oscillation. The oscillations have been simulated in numerical models without external time dependent source, and in Section 2 we summarize the results. Specifically, we shall discuss the nonlinearities that are involved in generating the oscillations, and the processes that produce the periodicities. In biology, insects have flight muscles, which function autonomously with wing frequencies that far exceed the animals' neural capacity; Stretch-activation of muscle contraction is the mechanism that produces the high frequency oscillation of insect flight, discussed in Section 3. The same mechanism is also invoked to explain the functioning of the cardiac muscle. In Section 4, we present a tutorial review of the cardio-vascular system, heart anatomy, and muscle cell physiology, leading up to Starling's Law of the Heart, which supports our notion that the human heart is also a nonlinear oscillator. In Section 5, we offer a broad perspective of the tenuous links between the fluid dynamical oscillators and the human heart physiology.

  10. Influence of illumination on autonomic thermoregulation and choice of clothing

    Science.gov (United States)

    Kim, Seung Hi; Jeong, Woon Seon

    2002-04-01

    This study was conducted to investigate how different levels of illumination below 1,000 lx would affect the autonomic and behavioral temperature regulation of humans. Seven healthy college-aged women (20+/-0 years) volunteered to participate in this study. They were exposed to a temperature of 26 °C in 320 lx for 30 min ('Equilibrium') followed by 700 lx or 70 lx for 30 min (stage 1). After stage 1, they were exposed to 20 °C for 30 min in the same illumination as in stage 1 (stage 2). In stage 2 the subjects were instructed to select and wear the clothing they needed for their thermal comfort. The data obtained were analyzed by paired t-test and repeated measures of analysis of variance. Forearm skin blood flow tended to remain steady in 700 lx but decreased markedly in 70 lx in stage 1. There were no significant differences between subjective thermal responses of the subjects experiencing 700 lx or 70 lx in both stages although the subjects felt cooler in stage 2 than in stage 1. The subjects were likely to prefer wearing heavier clothing in 70 lx than in 700 lx. It was concluded that vasoconstriction in the upper limbs occurred more strongly in dim light, which might result in different clothing preferences in a cool environment from those associated with brighter light intensity.

  11. Skin Cancer Foundation

    Science.gov (United States)

    ... Host a Fundraising Event | About Us | Store The Skin Cancer Foundation The Skin Cancer Foundation is the ... A "Sunscreen Gene"? Skin Cancer Facts & Statistics The Skin Cancer Foundation's Champions for Change Gala 2016 Learn ...

  12. Skin Pigmentation Disorders

    Science.gov (United States)

    Pigmentation means coloring. Skin pigmentation disorders affect the color of your skin. Your skin gets its color from a pigment called melanin. Special cells in the skin make melanin. When these cells become damaged or ...

  13. Skin Bleaching

    OpenAIRE

    Ahmed, Samira M.

    2015-01-01

    In this project, I aim to investigate the reasoning behind the practice of skin bleaching by analyzing the documentary ”Dark Girls”, to gain a better understanding of race and colorism issues. Also this project tries to see if there is a connection with history and if this has been a part of making the european beauty ideal determine the choices black’s make in regards to beauty.

  14. Autonomic disorders in multiple sclerosis.

    Science.gov (United States)

    Lensch, E; Jost, W H

    2011-01-01

    Multiple sclerosis is an inflammatory disease leading to disseminated lesions of the central nervous system resulting in both somatomotor and autonomic disturbances. These involve the central centers of the autonomic nervous system, as well as the automatic control and pathway systems. All autonomic functions may be disordered individually or in combined form. There is no other disease with a clinical picture so multifaceted. Besides cardiovascular dysfunctions disorders of bladder and rectum have become apparent. Somatomotor and autonomic disturbances occur with similar frequency; however the focused exam often heavily favors somatomotor symptoms. Autonomic disturbances should primarily be taken into account on history taking and clinical examination. Individual diagnosis and treatment is a secondary feature. Impairments of the autonomic nervous systems in multiple sclerosis are frequently overlooked.

  15. Autonomic Disorders in Multiple Sclerosis

    Directory of Open Access Journals (Sweden)

    E. Lensch

    2011-01-01

    Full Text Available Multiple sclerosis is an inflammatory disease leading to disseminated lesions of the central nervous system resulting in both somatomotor and autonomic disturbances. These involve the central centers of the autonomic nervous system, as well as the automatic control and pathway systems. All autonomic functions may be disordered individually or in combined form. There is no other disease with a clinical picture so multifaceted. Besides cardiovascular dysfunctions disorders of bladder and rectum have become apparent. Somatomotor and autonomic disturbances occur with similar frequency; however the focused exam often heavily favors somatomotor symptoms. Autonomic disturbances should primarily be taken into account on history taking and clinical examination. Individual diagnosis and treatment is a secondary feature. Impairments of the autonomic nervous systems in multiple sclerosis are frequently overlooked.

  16. Cooling-sensitive TRPM8 is thermostat of skin temperature against cooling.

    Directory of Open Access Journals (Sweden)

    Koji Tajino

    Full Text Available We have shown that cutaneous cooling-sensitive receptors can work as thermostats of skin temperature against cooling. However, molecule of the thermostat is not known. Here, we studied whether cooling-sensitive TRPM8 channels act as thermostats. TRPM8 in HEK293 cells generated output (y when temperature (T was below threshold of 28.4°C. Output (y is given by two equations: At T >28.4°C, y = 0; At T <28.4°C, y  =  -k(T - 28.4°C. These equations show that TRPM8 is directional comparator to elicits output (y depending on negative value of thermal difference (ΔT  =  T - 28.4°C. If negative ΔT-dependent output of TRPM8 in the skin induces responses to warm the skin for minimizing ΔT recursively, TRPM8 acts as thermostats against cooling. With TRPM8-deficient mice, we explored whether TRPM8 induces responses to warm the skin against cooling. In behavioral regulation, when room temperature was 10°C, TRPM8 induced behavior to move to heated floor (35°C for warming the sole skin. In autonomic regulation, TRPM8 induced activities of thermogenic brown adipose tissue (BAT against cooling. When menthol was applied to the whole trunk skin at neutral room temperature (27°C, TRPM8 induced a rise in core temperature, which warmed the trunk skin slightly. In contrast, when room was cooled from 27 to 10°C, TRPM8 induced a small rise in core temperature, but skin temperature was severely reduced in both TRPM8-deficient and wild-type mice by a large heat leak to the surroundings. This shows that TRPM8-driven endothermic system is less effective for maintenance of skin temperature against cooling. In conclusion, we found that TRPM8 is molecule of thermostat of skin temperature against cooling.

  17. Cutaneous skin tag

    Science.gov (United States)

    Skin tag; Acrochordon; Fibroepithelial polyp ... have diabetes. They are thought to occur from skin rubbing against skin. ... The tag sticks out of the skin and may have a short, narrow stalk connecting it to the surface of the skin. Some skin tags are as long as ...

  18. Jam avoidance with autonomous systems

    CERN Document Server

    Tordeux, Antoine

    2016-01-01

    Many car-following models are developed for jam avoidance in highways. Two mechanisms are used to improve the stability: feedback control with autonomous models and increasing of the interaction within cooperative ones. In this paper, we compare the linear autonomous and collective optimal velocity (OV) models. We observe that the stability is significantly increased by adding predecessors in interaction with collective models. Yet autonomous and collective approaches are close when the speed difference term is taking into account. Within the linear OV models tested, the autonomous models including speed difference are sufficient to maximise the stability.

  19. Robotics and Autonomous Systems Laboratory

    Data.gov (United States)

    Federal Laboratory Consortium — FUNCTION: Provides an environment for developing and evaluating intelligent software for both actual and simulated autonomous vehicles. Laboratory computers provide...

  20. Toward development of an autonomous network of bacteria-based delivery systems (BacteriaBots): spatiotemporally high-throughput characterization of bacterial quorum-sensing response.

    Science.gov (United States)

    Sahari, Ali; Traore, Mahama A; Stevens, Ann M; Scharf, Birgit E; Behkam, Bahareh

    2014-12-02

    Characterization of bacterial innate and engineered cooperative behavior, regulated through chemical signaling in a process known as quorum sensing, is critical to development of a myriad of bacteria-enabled systems including biohybrid drug delivery systems and biohybrid mobile sensor networks. Here, we demonstrate, for the first time, that microfluidic diffusive mixers can be used for spatiotemporally high-throughput characterization of bacterial quorum-sensing response. Using this batch characterization method, the quorum-sensing response in Escherichia coli MG1655, transformed with a truncated lux operon from Vibrio fischeri, in the presence of 1-100 nM exogenous acyl-homoserine lactone molecules has been quantified. This method provides a rapid and facile tool for high-throughput characterization of the quorum-sensing response of genetically modified bacteria in the presence of a wide concentration range of signaling molecules with a precision of ±0.5 nM. Furthermore, the quorum-sensing response of BacteriaBots has been characterized to determine if the results obtained from a large bacterial population can serve as a robust predictive tool for the small bacterial population attached to each BacteriaBot.

  1. Autonomic Reactivity to Arousing Stimuli with Social and Non-social Relevance in Alexithymia

    Science.gov (United States)

    Martínez-Velázquez, Eduardo S.; Honoré, Jacques; de Zorzi, Lucas; Ramos-Loyo, Julieta; Sequeira, Henrique

    2017-01-01

    Emotional difficulties in alexithymia and their social consequences have been linked to alterations in autonomic nervous system. However, most of previous studies did not take into account the distinction between the affective and the cognitive dimensions of the alexithymia, leading to inconsistent results. Aim: In this study, we compared the effects of both dimensions of alexithymia on the autonomic arousal to emotional and social visual stimulations. Methods: Skin conductance responses (SCRs) to items of the International Affective Pictures System characterized by emotional (unpleasant, neutral, and pleasant), social (with humans) or non-social (without humans) content were recorded in non-alexithymic (NA), affective (AA) and cognitive alexithymic (CA) participants, selected on the basis of the Toronto Alexithymia Scale and the Bermond-Vorst Alexithymia Questionnaire. All participants responded to questionnaires of empathy, social phobia, depression, and anxiety before the experiment and evaluated the arousal of the pictures after it. Results: Cognitive alexithymic group showed lower amplitudes of SCRs to pictures with social than without social relevance whereas the opposite pattern was observed for the NA group. Arousal emotional effects of the pictures on SCRs did not differ among groups. In addition, CA participants showed lower scores than NA in the Personal Taking sub-scale of the empathy questionnaire, while AA showed lower scores than NA in the fantasy sub-scale. The CA group showed higher social phobia, depression and anxiety scores, than the other two groups. Conclusion: This work has two original outcomes: first, affective alexithymics expressed lower empathic affective scores than other groups; second, alexithymia modulated the impact of the social relevance of the stimuli on the autonomic reactivity, this impact vanishing in affective alexithymics and reversing in cognitive alexithymics. Thus, though the groups could not be distinguished on the basis

  2. Radar based autonomous sensor module

    Science.gov (United States)

    Styles, Tim

    2016-10-01

    Most surveillance systems combine camera sensors with other detection sensors that trigger an alert to a human operator when an object is detected. The detection sensors typically require careful installation and configuration for each application and there is a significant burden on the operator to react to each alert by viewing camera video feeds. A demonstration system known as Sensing for Asset Protection with Integrated Electronic Networked Technology (SAPIENT) has been developed to address these issues using Autonomous Sensor Modules (ASM) and a central High Level Decision Making Module (HLDMM) that can fuse the detections from multiple sensors. This paper describes the 24 GHz radar based ASM, which provides an all-weather, low power and license exempt solution to the problem of wide area surveillance. The radar module autonomously configures itself in response to tasks provided by the HLDMM, steering the transmit beam and setting range resolution and power levels for optimum performance. The results show the detection and classification performance for pedestrians and vehicles in an area of interest, which can be modified by the HLDMM without physical adjustment. The module uses range-Doppler processing for reliable detection of moving objects and combines Radar Cross Section and micro-Doppler characteristics for object classification. Objects are classified as pedestrian or vehicle, with vehicle sub classes based on size. Detections are reported only if the object is detected in a task coverage area and it is classified as an object of interest. The system was shown in a perimeter protection scenario using multiple radar ASMs, laser scanners, thermal cameras and visible band cameras. This combination of sensors enabled the HLDMM to generate reliable alerts with improved discrimination of objects and behaviours of interest.

  3. Being hot-tempered: autonomic, emotional, and behavioral distinctions between childhood reactive and proactive aggression.

    Science.gov (United States)

    Scarpa, Angela; Haden, Sara Chiara; Tanaka, Akiho

    2010-07-01

    Reactive aggression (RA) is an angry response to perceived provocation. Proactive aggression (PA) is a pre-meditated act used to achieve some goal. This study test hypotheses that (1) individuals high in RA and PA will differ in resting levels of autonomic arousal and (2) RA will be related to emotional and behavioral problems, while PA only to behavioral problems. Parents of 68 children (age 6-13) reported on child symptoms, reactive/proactive aggression, and behavior problems. Resting heart rate (HR), skin conductance (SC), and HR variability (HRV) were measured in 42 of the children. RA was significantly related to decreased HRV and a trend for decreased SC, while PA was significantly related to increased SC and HRV. RA was significantly related to increased internalizing behaviors and attention deficits, while PA was significantly related to increased hyperactivity/impulsivity and delinquent behavior problems. Findings support a distinction between child reactive (hot-tempered) and proactive (cold-tempered) aggression in autonomic, emotional (i.e., internalizing problems), and behavioral (i.e., attention deficits, hyperactivity/impulsivity, and delinquent behavior) functioning, and are discussed in relation to theories of antisocial behavior.

  4. Autonomic nervous system dysfunction and their relationship with disease severity in children with atopic asthma.

    Science.gov (United States)

    Emin, Ozkaya; Esra, Gursoy; Aysegül, Demir; Ufuk, Erenberk; Ayhan, Sogut; Rusen, Dundaroz M

    2012-09-30

    The involvement of autonomic imbalance has been reported in the pathogenesis of allergic diseases. The aim of this study was to investigate the association between the clinical severity of childhood asthma with autonomic nervous system (ANS) dysfunction and to define whether the severity of asthma correlates with ANS activity. In this case-control study, we evaluated the ANS activity by testing heart rate variability (HRV) and sympathetic skin response (SRR) in 77 asthmatic children, age 7-12 yrs, who had no co-morbidity and compared them with 40 gender- and age-matched control subjects. According to the severity of their asthma, study subjects were further divided into three groups: I (mild asthmatics), II (moderate asthmatics), and III (severe asthmatics). Inter-group ANS scale scores differed significantly (p<0.01) between Groups I and III and between Groups II and III. Combined use of HRV and SSR provides a higher degree of sensitivity for assessing disease severity in cases of pediatric asthma.

  5. Keratinocyte p38δ loss inhibits Ras-induced tumor formation, while systemic p38δ loss enhances skin inflammation in the early phase of chemical carcinogenesis in mouse skin.

    Science.gov (United States)

    Kiss, Alexi; Koppel, Aaron C; Anders, Joanna; Cataisson, Christophe; Yuspa, Stuart H; Blumenberg, Miroslav; Efimova, Tatiana

    2016-05-01

    p38δ expression and/or activity are increased in human cutaneous malignancies, including invasive squamous cell carcinoma (SCC) and head and neck SCC, but the role of p38δ in cutaneous carcinogenesis has not been well-defined. We have reported that mice with germline loss of p38δ exhibited a reduced susceptibility to skin tumor development compared with wild-type mice in the two-stage 7,12-dimethylbenz(a)anthracene (DMBA)/12-O-tetradecanoylphorbol-13-acetate (TPA) chemical skin carcinogenesis model. Here, we report that p38δ gene ablation inhibited the growth of tumors generated from v-ras(Ha) -transformed keratinocytes in skin orthografts to nude mice, indicating that keratinocyte-intrinsic p38δ is required for Ras-induced tumorigenesis. Gene expression profiling of v-ras(Ha) -transformed p38δ-null keratinocytes revealed transcriptional changes associated with cellular responses linked to tumor suppression, such as reduced proliferation and increased differentiation, cell adhesion, and cell communications. Notably, a short-term DMBA/TPA challenge, modeling the initial stages of chemical skin carcinogenesis treatment, elicited an enhanced inflammation in p38δ-null skin compared with skin of wild-type mice, as assessed by measuring the expression of pro-inflammatory cytokines, including IL-1β, IL-6, IL-17, and TNFα. Additionally, p38δ-null skin and p38δ-null keratinocytes exhibited increased p38α activation and signaling in response to acute inflammatory challenges, suggesting a role for p38α in stimulating the elevated inflammatory response in p38δ-null skin during the initial phases of the DMBA/TPA treatment compared with similarly treated p38δ(+/+) skin. Altogether, our results indicate that p38δ signaling regulates skin carcinogenesis not only by keratinocyte cell-autonomous mechanisms, but also by influencing the interaction between between the epithelial compartment of the developing skin tumor and its stromal microenvironment.

  6. Autonomous mobile robot teams

    Science.gov (United States)

    Agah, Arvin; Bekey, George A.

    1994-01-01

    This paper describes autonomous mobile robot teams performing tasks in unstructured environments. The behavior and the intelligence of the group is distributed, and the system does not include a central command base or leader. The novel concept of the Tropism-Based Cognitive Architecture is introduced, which is used by the robots in order to produce behavior transforming their sensory information to proper action. The results of a number of simulation experiments are presented. These experiments include worlds where the robot teams must locate, decompose, and gather objects, and defend themselves against hostile predators, while navigating around stationary and mobile obstacles.

  7. [Vitamin D and the skin].

    Science.gov (United States)

    Libon, F; Cavalier, E; Nikkels, A F

    2013-09-01

    Vitamin D is well known for its beneficial effects on phosphocalcic homeostasis. The discovery of the role of vitamin D in cancers, infections, cardiovascular or autoimmune pathologies have promoted interest for this molecule. Skin and vitamin D are closely related. The skin is not only the site of vitamin D synthesis, but also a target organ as calcitriol plays an important hormonal and regulatory role, acting on cell proliferation, differentiation and immunomodulation. Furthermore, vitamin D influences the incidence and therapeutic response of certain dermatoses. In addition, many medical situations, mainly dermatological, require strict photoprotection and may therefore indirectly be responsible for a vitamin D deficiency in patients. The current role of vitamin D in skin cancers, inflammatory and autoimmune skin diseases is summarized.

  8. Investigation of the H reflexes, F waves and sympathetic skin response with electromyography (EMG) in patients with stroke and the determination of the relationship with functional capacity.

    Science.gov (United States)

    Çakır, Tuncay; Evcik, Fatma Deniz; Subaşı, Volkan; Demirdal, Ümit Seçil; Kavuncu, Vural

    2015-09-01

    The purpose of the study was to evaluate the relationship between sympathetic skin responses (SSR), electrodiagnostic reflex activities (F wave, H reflex), and functional capacity in post-stroke patients. The study comprised 40 hemiplegia patients (mean age 57.8 ± 10.9 years) and 40 healthy volunteers (mean age 557 ± 85 years). In electrophysiological studies, SSR, F wave and H reflex were evaluated and for the functional capacities of patients, FIM scores and Brunnstrom stages were calculated. There was no statistical significant difference between SSR latency and amplitude in the hemiplegic and non-hemiplegic extremities of patients (p > 0.05). SSR latency values of patients were higher than those of controls (p < 0.05). Amplitude values of paretic arms were significantly lower than the control group extremities (p < 0.05). There was a significant correlation between SSR amplitude values and FIM scores. A significant increase in H max/M max amplitude rate was detected in the affected side (p < 0.05) and F-wave mean latency values of the affected side were found to be significantly lower in the control group (p < 0.05).

  9. The optimization of phenolic compounds extraction from cactus pear (Opuntia ficus-indica) skin in a reflux system using response surface methodology

    Institute of Scientific and Technical Information of China (English)

    Aguirre Joya Jorge; De La Garza Toledo Heliodoro; Zugasti Cruz Alejandro; Belmares Cerda Ruth; Aguilar Cristbal No

    2013-01-01

    To extract, quantify, and evaluate the phenolic content in Opuntia ficus-indica skin for their antioxidant capacity with three different methods (ABTS, DPPH, and lipid oxidation) and to optimize the extraction conditions (time, temperature and ethanol concentration) in a reflux system. Methods: The extraction process was done using a reflux system. A San Cristobal II experimental design with three variables and three levels was used. The variables evaluated were time of extraction (h), concentration of ethanol (%, v/v) and temperature (°C). The extraction process was optimized using a response surface methodology. Results: It was observed that at higher temperature more phenolic compounds were extracted, but the antioxidant capacity was decreased. The optimum conditions for phenolic compounds extraction and antioxidant capacity mixing the three methods were as follows: 45% of ethanol, 80 °C and 2 hours of extraction. Values obtained in our results are little higher that other previously reported. Conclusions: It can be concluded the by-products of Opuntia ficus-indica represent a good source of natural antioxidants with possible applications in food, cosmetics or drugs industries.

  10. The optimization of phenolic compounds extraction from cactus pear (Opuntia ficus-indica) skin in a reflux system using response surface methodology

    Science.gov (United States)

    Jorge, Aguirre Joya; Heliodoro, De La Garza Toledo; Alejandro, Zugasti Cruz; Ruth, Belmares Cerda; Noé, Aguilar Cristóbal

    2013-01-01

    Objective To extract, quantify, and evaluate the phenolic content in Opuntia ficus-indica skin for their antioxidant capacity with three different methods (ABTS, DPPH, and lipid oxidation) and to optimize the extraction conditions (time, temperature and ethanol concentration) in a reflux system. Methods The extraction process was done using a reflux system. A San Cristobal II experimental design with three variables and three levels was used. The variables evaluated were time of extraction (h), concentration of ethanol (%, v/v) and temperature (°C). The extraction process was optimized using a response surface methodology. Results It was observed that at higher temperature more phenolic compounds were extracted, but the antioxidant capacity was decreased. The optimum conditions for phenolic compounds extraction and antioxidant capacity mixing the three methods were as follows: 45% of ethanol, 80 °C and 2 hours of extraction. Values obtained in our results are little higher that other previously reported. Conclusions It can be concluded the by-products of Opuntia ficus-indica represent a good source of natural antioxidants with possible applications in food, cosmetics or drugs industries. PMID:23730555

  11. Skin-inspired electronic devices

    Directory of Open Access Journals (Sweden)

    Alex Chortos

    2014-09-01

    Full Text Available Electronic devices that mimic the properties of skin have potential important applications in advanced robotics, prosthetics, and health monitoring technologies. Methods for measuring tactile and temperature signals have progressed rapidly due to innovations in materials and processing methods. Imparting skin-like stretchability to electronic devices can be accomplished by patterning traditional electronic materials or developing new materials that are intrinsically stretchable. The incorporation of sensing methods with transistors facilitates large-area sensor arrays. While sensor arrays have surpassed the properties of human skin in terms of sensitivity, time response, and device density, many opportunities remain for future development.

  12. [Echinococcosis in the Nenets Autonomous Okrug].

    Science.gov (United States)

    Ageeva, N G

    1989-01-01

    The paper presents results of an immunological screening of the population from the Nenets Autonomous Okrug of the Arkhangelsk region for echinococcosis. A high level (8.4 +/- 1.0%) of seropositivity of the population has been found to Echinococcus antigens. Occupational groups, such as reindeer-breeders, domestic servants in the tent of skins, hunters, fur-farmers, furriers) have been identified to be mostly at high risk for Echinococcus infection. Some animal species have been demonstrated to be implicated in the epidemiology of echinococcosis. The most likely source of human granulosus Echinococcus invasion is a dog whose mature Echinococcus infection rate is 5.8 +/- 3.2%, that of multilocularis Echinococcus is a polar fox whose infection rate is 40.3 +/- 4.3%.

  13. The impact of BCG vaccination on tuberculin skin test responses in children is age dependent: evidence to be considered when screening children for tuberculosis infection

    Science.gov (United States)

    Seddon, James A; Paton, James; Nademi, Zohreh; Keane, Denis; Williams, Bhanu; Williams, Amanda; Welch, Steven B; Liebeschutz, Sue; Riddell, Anna; Bernatoniene, Jolanta; Patel, Sanjay; Martinez-Alier, Nuria; McMaster, Paddy; Kampmann, Beate

    2016-01-01

    Background Following exposure to TB, contacts are screened to target preventive treatment at those at high risk of developing TB. The UK has recently revised its recommendations for screening and now advises a 5 mm tuberculin skin test (TST) cut-off irrespective of age or BCG status. We sought to evaluate the impact of BCG on TST responses in UK children exposed to TB and the performance of different TST cut-offs to predict interferon γ release assay (IGRA) positivity. Methods Children vaccination on TST positivity was evaluated in IGRA-negative children, as was the performance of different TST cut-offs to predict IGRA positivity. Results Of 422 children recruited (median age 69 months; IQR: 32–113 months), 300 (71%) had been vaccinated with BCG. BCG vaccination affected the TST response in IGRA-negative children less than 5 years old but not in older children. A 5 mm TST cut-off demonstrated good sensitivity and specificity in BCG-unvaccinated children, and an excellent negative predictive value but was associated with low specificity (62.7%; 95% CI 56.1% to 69.0%) in BCG-vaccinated children. For BCG-vaccinated children, a 10 mm cut-off provided a high negative predictive value (97.7%; 95% CI 94.2% to 99.4%) with the positive predictive value increasing with increasing age of the child. Discussion BCG vaccination had little impact on TST size in children over 5 years of age. The revised TST cut-off recommended in the recent revision to the UK TB guidelines demonstrates good sensitivity but is associated with impaired specificity in BCG-vaccinated children. PMID:27335104

  14. Differential responses of skin cancer-chemopreventive agents silibinin, quercetin, and epigallocatechin 3-gallate on mitogenic signaling and cell cycle regulators in human epidermoid carcinoma A431 cells.

    Science.gov (United States)

    Bhatia, N; Agarwal, C; Agarwal, R

    2001-01-01

    Silibinin, quercetin, and epigallocatechin 3-gallate (EGCG) have been shown to be skin cancer-preventive agents, albeit by several different mechanisms. Here, we assessed whether these agents show their cancer-preventive potential by a differential effect on mitogenic signaling molecules and cell cycle regulators. Treatment of human epidermoid carcinoma A431 cells with these agents inhibited the activation of the epidermal growth factor receptor and the downstream adapter protein Shc, but only silibinin showed a marked inhibition of mitogen-activated protein kinase-extracellular signal-regulated kinase-1 and -2 activation. In terms of cell cycle regulators, silibinin treatment showed an induction of Cip1/p21 and Kip1/p27 together with a significant decrease in cyclin-dependent kinase (CDK)-4, CDK2, and cyclin D1. Quercetin treatment, however, resulted in a moderate increase in Cip1/p21 with no change in Kip1/p27 and a decrease in CDK4 and cyclin D1. EGCG treatment also led to an induction of Cip1/p21 but no change in Kip1/27, CDK2, and cyclin D1 and a decrease in CDK4 only at low doses. Treatment of cells with these agents resulted in a strong dose- and time-dependent cell growth inhibition. A high dose of silibinin and low and high doses of quercetin and EGCG also led to cell death by apoptosis, suggesting that a lack of their inhibitory effect on mitogen-activated protein kinase-extracellular signal-regulated kinase-1 and -2 activation possibly "turns on" an apoptotic cell death response associated with their cancer-preventive and anticarcinogenic effects. Together, these results suggest that silibinin, quercetin, and EGCG exert their cancer-preventive effects by differential responses on mitogenic signaling and cell cycle regulators.

  15. Learning for Autonomous Navigation

    Science.gov (United States)

    Angelova, Anelia; Howard, Andrew; Matthies, Larry; Tang, Benyang; Turmon, Michael; Mjolsness, Eric

    2005-01-01

    Robotic ground vehicles for outdoor applications have achieved some remarkable successes, notably in autonomous highway following (Dickmanns, 1987), planetary exploration (1), and off-road navigation on Earth (1). Nevertheless, major challenges remain to enable reliable, high-speed, autonomous navigation in a wide variety of complex, off-road terrain. 3-D perception of terrain geometry with imaging range sensors is the mainstay of off-road driving systems. However, the stopping distance at high speed exceeds the effective lookahead distance of existing range sensors. Prospects for extending the range of 3-D sensors is strongly limited by sensor physics, eye safety of lasers, and related issues. Range sensor limitations also allow vehicles to enter large cul-de-sacs even at low speed, leading to long detours. Moreover, sensing only terrain geometry fails to reveal mechanical properties of terrain that are critical to assessing its traversability, such as potential for slippage, sinkage, and the degree of compliance of potential obstacles. Rovers in the Mars Exploration Rover (MER) mission have got stuck in sand dunes and experienced significant downhill slippage in the vicinity of large rock hazards. Earth-based off-road robots today have very limited ability to discriminate traversable vegetation from non-traversable vegetation or rough ground. It is impossible today to preprogram a system with knowledge of these properties for all types of terrain and weather conditions that might be encountered.

  16. Towards autonomous vehicular clouds

    Directory of Open Access Journals (Sweden)

    Stephan Olariu

    2011-09-01

    Full Text Available The dawn of the 21st century has seen a growing interest in vehicular networking and its myriad potential applications. The initial view of practitioners and researchers was that radio-equipped vehicles could keep the drivers informed about potential safety risks and increase their awareness of road conditions. The view then expanded to include access to the Internet and associated services. This position paper proposes and promotes a novel and more comprehensive vision namely, that advances in vehicular networks, embedded devices and cloud computing will enable the formation of autonomous clouds of vehicular computing, communication, sensing, power and physical resources. Hence, we coin the term, autonomous vehicular clouds (AVCs. A key feature distinguishing AVCs from conventional cloud computing is that mobile AVC resources can be pooled dynamically to serve authorized users and to enable autonomy in real-time service sharing and management on terrestrial, aerial, or aquatic pathways or theaters of operations. In addition to general-purpose AVCs, we also envision the emergence of specialized AVCs such as mobile analytics laboratories. Furthermore, we envision that the integration of AVCs with ubiquitous smart infrastructures including intelligent transportation systems, smart cities and smart electric power grids will have an enormous societal impact enabling ubiquitous utility cyber-physical services at the right place, right time and with right-sized resources.

  17. Physics Simulation Software for Autonomous Propellant Loading and Gas House Autonomous System Monitoring

    Science.gov (United States)

    Regalado Reyes, Bjorn Constant

    2015-01-01

    1. Kennedy Space Center (KSC) is developing a mobile launching system with autonomous propellant loading capabilities for liquid-fueled rockets. An autonomous system will be responsible for monitoring and controlling the storage, loading and transferring of cryogenic propellants. The Physics Simulation Software will reproduce the sensor data seen during the delivery of cryogenic fluids including valve positions, pressures, temperatures and flow rates. The simulator will provide insight into the functionality of the propellant systems and demonstrate the effects of potential faults. This will provide verification of the communications protocols and the autonomous system control. 2. The High Pressure Gas Facility (HPGF) stores and distributes hydrogen, nitrogen, helium and high pressure air. The hydrogen and nitrogen are stored in cryogenic liquid state. The cryogenic fluids pose several hazards to operators and the storage and transfer equipment. Constant monitoring of pressures, temperatures and flow rates are required in order to maintain the safety of personnel and equipment during the handling and storage of these commodities. The Gas House Autonomous System Monitoring software will be responsible for constantly observing and recording sensor data, identifying and predicting faults and relaying hazard and operational information to the operators.

  18. Prevalence of diabetic autonomic neuropathy measured by simple bedside tests

    DEFF Research Database (Denmark)

    Dyrberg, Torben Bech; Benn, Jette; Christiansen, J S

    1981-01-01

    To investigate the prevalence of diabetic autonomic neuropathy, five simple bedside tests, beat-to-beat variation during quiet respiration, beat-to-beat variation during forced respiration, heart rate and blood pressure response to standing, heart rate response to exercise, and heart rate response....... The prevalence of diabetic autonomic neuropathy in the whole diabetic population indicated by abnormal response in beat-to-beat variation during forced respiration was 27%. Diabetic autonimic neuropathy increased in frequency with duration of disease. Patients with nephropathy or proliferative retinopathy had...... a significantly higher prevalence of diabetic autonomic neuropathy as indicated by abnormal beat-to-beat variation during forced respirations (p less than 0.01) than patients without these complications....

  19. Skin Keratins.

    Science.gov (United States)

    Wang, Fengrong; Zieman, Abigail; Coulombe, Pierre A

    2016-01-01

    Keratins comprise the type I and type II intermediate filament-forming proteins and occur primarily in epithelial cells. They are encoded by 54 evolutionarily conserved genes (28 type I, 26 type II) and regulated in a pairwise and tissue type-, differentiation-, and context-dependent manner. Keratins serve multiple homeostatic and stress-enhanced mechanical and nonmechanical functions in epithelia, including the maintenance of cellular integrity, regulation of cell growth and migration, and protection from apoptosis. These functions are tightly regulated by posttranslational modifications as well as keratin-associated proteins. Genetically determined alterations in keratin-coding sequences underlie highly penetrant and rare disorders whose pathophysiology reflects cell fragility and/or altered tissue homeostasis. Moreover, keratin mutation or misregulation represents risk factors or genetic modifiers for several acute and chronic diseases. This chapter focuses on keratins that are expressed in skin epithelia, and details a number of basic protocols and assays that have proven useful for analyses being carried out in skin.

  20. White matter abnormalities in skin picking disorder

    DEFF Research Database (Denmark)

    Grant, Jon E; Odlaug, Brian Lawrence; Hampshire, Adam

    2013-01-01

    Skin picking disorder (SPD) is characterized by the repetitive and compulsive picking of skin, resulting in tissue damage. Neurocognitive findings in SPD implicate difficulty with response inhibition (suppression of pre-potent motor responses). This function is dependent on the integrity...

  1. Proportionality and Autonomous Weapons Systems

    NARCIS (Netherlands)

    van den Boogaard, J.

    2015-01-01

    Given the swift technologic development, it may be expected that the availability of the first truly autonomous weapons systems is fast approaching. Once they are deployed, these weapons will use artificial intelligence to select and attack targets without further human intervention. Autonomous weap

  2. Autonomous Learner Model Resource Book

    Science.gov (United States)

    Betts, George T.; Carey, Robin J.; Kapushion, Blanche M.

    2016-01-01

    "Autonomous Learner Model Resource Book" includes activities and strategies to support the development of autonomous learners. More than 40 activities are included, all geared to the emotional, social, cognitive, and physical development of students. Teachers may use these activities and strategies with the entire class, small groups, or…

  3. Characterization of CD8+ T-Cell Responses in the Peripheral Blood and Skin Injection Sites of Melanoma Patients Treated with mRNA Electroporated Autologous Dendritic Cells (TriMixDC-MEL

    Directory of Open Access Journals (Sweden)

    Daphné Benteyn

    2013-01-01

    Full Text Available Treatment of melanoma patients with mRNA electroporated dendritic cells (TriMixDC-MEL stimulates T-cell responses against the presented tumor-associated antigens (TAAs. In the current clinical trials, melanoma patients with systemic metastases are treated, requiring priming and/or expansion of preexisting TAA-specific T cells that are able to migrate to both the skin and internal organs. We monitored the presence of TAA-specific CD8+ T cells infiltrating the skin at sites of intradermal TriMixDC-MEL injection (SKILs and within the circulation of melanoma patients treated in two clinical trials. In 10 out of fourteen (71% patients screened, CD8+ T cells recognizing any of the four TAA presented by TriMixDC-MEL cellular vaccine were found in both compartments. In total, 30 TAA-specific T-cell responses were detected among the SKILs and 29 among peripheral blood T cells, of which 24 in common. A detailed characterization of the antigen specificity of CD8+ T-cell populations in four patients indicates that the majority of the epitopes detected were only recognized by CD8+ T cells derived from either skin biopsies or peripheral blood, indicating that some compartmentalization occurs after TriMix-DC therapy. To conclude, functional TAA-specific CD8+ T cells distribute both to the skin and peripheral blood of patients after TriMixDC-MEL therapy.

  4. Abnormal Cardiac Autonomic Regulation in Mice Lacking ASIC3

    Directory of Open Access Journals (Sweden)

    Ching-Feng Cheng

    2014-01-01

    Full Text Available Integration of sympathetic and parasympathetic outflow is essential in maintaining normal cardiac autonomic function. Recent studies demonstrate that acid-sensing ion channel 3 (ASIC3 is a sensitive acid sensor for cardiac ischemia and prolonged mild acidification can open ASIC3 and evoke a sustained inward current that fires action potentials in cardiac sensory neurons. However, the physiological role of ASIC3 in cardiac autonomic regulation is not known. In this study, we elucidate the role of ASIC3 in cardiac autonomic function using Asic3−/− mice. Asic3−/− mice showed normal baseline heart rate and lower blood pressure as compared with their wild-type littermates. Heart rate variability analyses revealed imbalanced autonomic regulation, with decreased sympathetic function. Furthermore, Asic3−/− mice demonstrated a blunted response to isoproterenol-induced cardiac tachycardia and prolonged duration to recover to baseline heart rate. Moreover, quantitative RT-PCR analysis of gene expression in sensory ganglia and heart revealed that no gene compensation for muscarinic acetylcholines receptors and beta-adrenalin receptors were found in Asic3−/− mice. In summary, we unraveled an important role of ASIC3 in regulating cardiac autonomic function, whereby loss of ASIC3 alters the normal physiological response to ischemic stimuli, which reveals new implications for therapy in autonomic nervous system-related cardiovascular diseases.

  5. Forced synchronization of autonomous dynamical Boolean networks.

    Science.gov (United States)

    Rivera-Durón, R R; Campos-Cantón, E; Campos-Cantón, I; Gauthier, Daniel J

    2015-08-01

    We present the design of an autonomous time-delay Boolean network realized with readily available electronic components. Through simulations and experiments that account for the detailed nonlinear response of each circuit element, we demonstrate that a network with five Boolean nodes displays complex behavior. Furthermore, we show that the dynamics of two identical networks display near-instantaneous synchronization to a periodic state when forced by a common periodic Boolean signal. A theoretical analysis of the network reveals the conditions under which complex behavior is expected in an individual network and the occurrence of synchronization in the forced networks. This research will enable future experiments on autonomous time-delay networks using readily available electronic components with dynamics on a slow enough time-scale so that inexpensive data collection systems can faithfully record the dynamics.

  6. Forced synchronization of autonomous dynamical Boolean networks

    Energy Technology Data Exchange (ETDEWEB)

    Rivera-Durón, R. R., E-mail: roberto.rivera@ipicyt.edu.mx; Campos-Cantón, E., E-mail: eric.campos@ipicyt.edu.mx [División de Matemáticas Aplicadas, Instituto Potosino de Investigación Científica y Tecnológica A. C., Camino a la Presa San José 2055, Col. Lomas 4 Sección, C.P. 78216, San Luis Potosí, S.L.P. (Mexico); Campos-Cantón, I. [Facultad de Ciencias, Universidad Autónoma de San Luis Potosí, Álvaro Obregón 64, C.P. 78000, San Luis Potosí, S.L.P. (Mexico); Gauthier, Daniel J. [Department of Physics and Center for Nonlinear and Complex Systems, Duke University, Box 90305, Durham, North Carolina 27708 (United States)

    2015-08-15

    We present the design of an autonomous time-delay Boolean network realized with readily available electronic components. Through simulations and experiments that account for the detailed nonlinear response of each circuit element, we demonstrate that a network with five Boolean nodes displays complex behavior. Furthermore, we show that the dynamics of two identical networks display near-instantaneous synchronization to a periodic state when forced by a common periodic Boolean signal. A theoretical analysis of the network reveals the conditions under which complex behavior is expected in an individual network and the occurrence of synchronization in the forced networks. This research will enable future experiments on autonomous time-delay networks using readily available electronic components with dynamics on a slow enough time-scale so that inexpensive data collection systems can faithfully record the dynamics.

  7. Periostin in Skin Tissue Skin-Related Diseases

    Directory of Open Access Journals (Sweden)

    Yukie Yamaguchi

    2014-01-01

    Recently, periostin—a matricellular protein—has been highlighted for its pivotal functions in the skin. Analysis of periostin null mice has revealed that periostin contributes to collagen fibrillogenesis, collagen cross-linking, and the formation of ECM meshwork via interactions with other ECM components. Periostin expression is enhanced by mechanical stress or skin injury; this is indicative of the physiologically protective functions of periostin, which promotes wound repair by acting on keratinocytes and fibroblasts. Along with its physiological functions, periostin plays pathogenic roles in skin fibrosis and chronic allergic inflammation. In systemic sclerosis (SSc patients, periostin levels reflect the severity of skin fibrosis. Periostin null mice have shown reduced skin fibrosis in a bleomycin-induced SSc mouse model, indicating a key role of periostin in fibrosis. Moreover, in atopic dermatitis (AD, attenuated AD phenotype has been observed in periostin null mice in a house dust mite extract-induced AD mouse model. Th2 cytokine-induced periostin acts on keratinocytes to produce inflammatory cytokines that further enhance the Th2 response, thereby sustaining and amplifying chronic allergic inflammation. Thus, periostin is deeply involved in the pathogenesis of AD and other inflammation-related disorders affecting the skin. Understanding the dynamic actions of periostin would be key to dissecting pathogenesis of skin-related diseases and to developing novel therapeutic strategies.

  8. Evolutionary Autonomous Health Monitoring System (EAHMS) Project

    Data.gov (United States)

    National Aeronautics and Space Administration — For supporting NASA's Robotics, Tele-Robotics and Autonomous Systems Roadmap, we are proposing the "Evolutionary Autonomous Health Monitoring System" (EAHMS) for...

  9. Autonomic neuropathy-in its many guises-as the initial manifestation of the antiphospholipid syndrome.

    Science.gov (United States)

    Schofield, Jill R

    2017-01-24

    Autonomic disorders have previously been described in association with the antiphospholipid syndrome. The present study aimed to determine the clinical phenotype of patients in whom autonomic dysfunction was the initial manifestation of the antiphospholipid syndrome and to evaluate for autonomic neuropathy in these patients. This was a retrospective study of 22 patients evaluated at the University of Colorado who were found to have a disorder of the autonomic nervous system as the initial manifestation of antiphospholipid syndrome. All patients had persistent antiphospholipid antibody positivity and all patients who underwent skin biopsy were found to have reduced sweat gland nerve fiber density suggestive of an autonomic neuropathy. All patients underwent an extensive evaluation to rule out other causes for their autonomic dysfunction. Patients presented with multiple different autonomic disorders, including postural tachycardia syndrome, gastrointestinal dysmotility, and complex regional pain syndrome. Despite most having low-titer IgM antiphospholipid antibodies, 13 of the 22 patients (59%) suffered one or more thrombotic event, but pregnancy morbidity was minimal. Prothrombin-associated antibodies were helpful in confirming the diagnosis of antiphospholipid syndrome. We conclude that autonomic neuropathy may occur in association with antiphospholipid antibodies and may be the initial manifestation of the syndrome. Increased awareness of this association is important, because it is associated with a significant thrombotic risk and a high degree of disability. In addition, anecdotal experience has suggested that antithrombotic therapy and intravenous immunoglobulin therapy may result in significant clinical improvement in these patients.

  10. Diastolic and autonomic dysfunction in early cirrhosis

    DEFF Research Database (Denmark)

    Dahl, Emilie Kristine; Møller, Søren; Kjær, Andreas

    2014-01-01

    cirrhosis during maximal β-adrenergic drive. MATERIAL AND METHODS. Nineteen patients with Child A (n = 12) and Child B cirrhosis (n = 7) and seven matched controls were studied during cardiac stress induced by increasing dosages of dobutamine and atropine. RESULTS. Pharmacological responsiveness was similar...... indicate that patients with early stage cirrhosis exhibit early diastolic and autonomic dysfunction as well as elevated pro-ANP. However, the cardiac chronotropic and inotropic responses to dobutamine stress were normal. The dynamics of ventricular repolarization appears normal in patients with early stage...

  11. Biothermomechanical behavior of skin tissue

    Institute of Scientific and Technical Information of China (English)

    F.Xu; T.J.Lu; K.A.Seffen

    2008-01-01

    Advances in laser,microwave and similar tech nologies have led to recent developments of thermal treatments involving skin tissue.The effectiveness of these treatments is governed by the coupled thermal,mechanical,biological and neural responses of the affected tissue:a favorable interaction results in a procedure with relatively little pain and no lasting side effects.Currently,even though each behavioral facet is to a certain extent established and understood,none exists to date in the interdisciplinarv area.A highly interdisciplinary approach is required for studying the biothermomechanical behavior of skin,involving bioheat transfer.biomechanics and physiology.A comprehensive literature review penrtinent to the subject is presented in this paper,covering four subject areas:(a)skin structure,(b)skin bioheat transfer and thermal damage,(c)skin biomechanics,and(d)skin biothermomechanics.The major problems,issues,and topics for further studies are also outlined.This review finds that significant advances in each of these aspects have been achieved in recent years.Although focus is placed upon the biothermomechanical behavior of skin tissue,the fundamental concepts and methodologies reviewed in this paper may also be applicable for studying other soft tissues.

  12. Human skin volatiles: a review.

    Science.gov (United States)

    Dormont, Laurent; Bessière, Jean-Marie; Cohuet, Anna

    2013-05-01

    Odors emitted by human skin are of great interest to biologists in many fields; applications range from forensic studies to diagnostic tools, the design of perfumes and deodorants, and the ecology of blood-sucking insect vectors of human disease. Numerous studies have investigated the chemical composition of skin odors, and various sampling methods have been used for this purpose. The literature shows that the chemical profile of skin volatiles varies greatly among studies, and the use of different sampling procedures is probably responsible for some of these variations. To our knowledge, this is the first review focused on human skin volatile compounds. We detail the different sampling techniques, each with its own set of advantages and disadvantages, which have been used for the collection of skin odors from different parts of the human body. We present the main skin volatile compounds found in these studies, with particular emphasis on the most frequently studied body regions, axillae, hands, and feet. We propose future directions for promising experimental studies on odors from human skin, particularly in relation to the chemical ecology of blood-sucking insects.

  13. Autonomous Gaussian Decomposition

    CERN Document Server

    Lindner, Robert R; Murray, Claire E; Stanimirović, Snežana; Babler, Brian L; Heiles, Carl; Hennebelle, Patrick; Goss, W M; Dickey, John

    2014-01-01

    We present a new algorithm, named Autonomous Gaussian Decomposition (AGD), for automatically decomposing spectra into Gaussian components. AGD uses derivative spectroscopy and machine learning to provide optimized guesses for the number of Gaussian components in the data, and also their locations, widths, and amplitudes. We test AGD and find that it produces results comparable to human-derived solutions on 21cm absorption spectra from the 21cm SPectral line Observations of Neutral Gas with the EVLA (21-SPONGE) survey. We use AGD with Monte Carlo methods to derive the HI line completeness as a function of peak optical depth and velocity width for the 21-SPONGE data, and also show that the results of AGD are stable against varying observational noise intensity. The autonomy and computational efficiency of the method over traditional manual Gaussian fits allow for truly unbiased comparisons between observations and simulations, and for the ability to scale up and interpret the very large data volumes from the up...

  14. Female Listeners’ Autonomic Responses to Dramatic Shifts Between Loud and Soft Music/Sound Passages: A Study of Heavy Metal Songs

    Science.gov (United States)

    Cheng, Tzu-Han; Tsai, Chen-Gia

    2016-01-01

    Although music and the emotion it conveys unfold over time, little is known about how listeners respond to shifts in musical emotions. A special technique in heavy metal music utilizes dramatic shifts between loud and soft passages. Loud passages are penetrated by distorted sounds conveying aggression, whereas soft passages are often characterized by a clean, calm singing voice and light accompaniment. The present study used heavy metal songs and soft sea sounds to examine how female listeners’ respiration rates and heart rates responded to the arousal changes associated with auditory stimuli. The high-frequency power of heart rate variability (HF-HRV) was used to assess cardiac parasympathetic activity. The results showed that the soft passages of heavy metal songs and soft sea sounds expressed lower arousal and induced significantly higher HF-HRVs than the loud passages of heavy metal songs. Listeners’ respiration rate was determined by the arousal level of the present music passage, whereas the heart rate was dependent on both the present and preceding passages. Compared with soft sea sounds, the loud music passage led to greater deceleration of the heart rate at the beginning of the following soft music passage. The sea sounds delayed the heart rate acceleration evoked by the following loud music passage. The data provide evidence that sound-induced parasympathetic activity affects listeners’ heart rate in response to the following music passage. These findings have potential implications for future research on the temporal dynamics of musical emotions. PMID:26925009

  15. Female Listeners' Autonomic Responses to Dramatic Shifts Between Loud and Soft Music/Sound Passages: A Study of Heavy Metal Songs.

    Science.gov (United States)

    Cheng, Tzu-Han; Tsai, Chen-Gia

    2016-01-01

    Although music and the emotion it conveys unfold over time, little is known about how listeners respond to shifts in musical emotions. A special technique in heavy metal music utilizes dramatic shifts between loud and soft passages. Loud passages are penetrated by distorted sounds conveying aggression, whereas soft passages are often characterized by a clean, calm singing voice and light accompaniment. The present study used heavy metal songs and soft sea sounds to examine how female listeners' respiration rates and heart rates responded to the arousal changes associated with auditory stimuli. The high-frequency power of heart rate variability (HF-HRV) was used to assess cardiac parasympathetic activity. The results showed that the soft passages of heavy metal songs and soft sea sounds expressed lower arousal and induced significantly higher HF-HRVs than the loud passages of heavy metal songs. Listeners' respiration rate was determined by the arousal level of the present music passage, whereas the heart rate was dependent on both the present and preceding passages. Compared with soft sea sounds, the loud music passage led to greater deceleration of the heart rate at the beginning of the following soft music passage. The sea sounds delayed the heart rate acceleration evoked by the following loud music passage. The data provide evidence that sound-induced parasympathetic activity affects listeners' heart rate in response to the following music passage. These findings have potential implications for future research on the temporal dynamics of musical emotions.

  16. Female listeners’ autonomic responses to dramatic shifts between loud and soft music/sound passages: a study of heavy metal songs

    Directory of Open Access Journals (Sweden)

    Tzu-Han eCheng

    2016-02-01

    Full Text Available Although music and the emotion it conveys unfold over time, little is known about how listeners respond to shifts in musical emotions. A special technique in heavy metal music utilizes dramatic shifts between loud and soft passages. Loud passages are penetrated by distorted sounds conveying aggression, whereas soft passages are often characterized by a clean, calm singing voice and light accompaniment. The present study used heavy metal songs and soft sea sounds to examine how female listeners’ respiration rates and heart rates responded to the arousal changes associated with auditory stimuli. The high-frequency power of heart rate variability (HF-HRV was used to assess cardiac parasympathetic activity. The results showed that the soft passages of heavy metal songs and soft sea sounds expressed lower arousal and induced significantly higher HF-HRVs than the loud passages of heavy metal songs. Listeners’ respiration rate was determined by the arousal level of the present music passage, whereas the heart rate was dependent on both the present and preceding passages. Compared with soft sea sounds, the loud music passage led to greater deceleration of the heart rate at the beginning of the following soft music passage. The sea sounds delayed the heart rate acceleration evoked by the following loud music passage. The data provide evidence that sound-induced parasympathetic activity affects listener’s heart rate in response to the following music passage. These findings have potential implications for future research of the temporal dynamics of musical emotions.

  17. Mobile Intelligent Autonomous Systems

    Directory of Open Access Journals (Sweden)

    Jitendra R. Raol

    2010-01-01

    Full Text Available Mobile intelligent autonomous systems (MIAS is a fast emerging research area. Although it can be regarded as a general R&D area, it is mainly directed towards robotics. Several important subtopics within MIAS research are:(i perception and reasoning, (ii mobility and navigation,(iii haptics and teleoperation, (iv image fusion/computervision, (v modelling of manipulators, (vi hardware/software architectures for planning and behaviour learning leadingto robotic architecture, (vii vehicle-robot path and motionplanning/control, (viii human-machine interfaces for interaction between humans and robots, and (ix application of artificial neural networks (ANNs, fuzzy logic/systems (FLS,probabilistic/approximate reasoning (PAR, Bayesian networks(BN and genetic algorithms (GA to the above-mentioned problems. Also, multi-sensor data fusion (MSDF playsvery crucial role at many levels of the data fusion process:(i kinematic fusion (position/bearing tracking, (ii imagefusion (for scene recognition, (iii information fusion (forbuilding world models, and (iv decision fusion (for tracking,control actions. The MIAS as a technology is useful for automation of complex tasks, surveillance in a hazardousand hostile environment, human-assistance in very difficultmanual works, medical robotics, hospital systems, autodiagnosticsystems, and many other related civil and military systems. Also, other important research areas for MIAScomprise sensor/actuator modelling, failure management/reconfiguration, scene understanding, knowledge representation, learning and decision-making. Examples ofdynamic systems considered within the MIAS would be:autonomous systems (unmanned ground vehicles, unmannedaerial vehicles, micro/mini air vehicles, and autonomousunder water vehicles, mobile/fixed robotic systems, dexterousmanipulator robots, mining robots, surveillance systems,and networked/multi-robot systems, to name a few.Defence Science Journal, 2010, 60(1, pp.3-4,

  18. Nociceptive Sensory Neurons Drive Interleukin-23 Mediated Psoriasiform Skin Inflammation

    OpenAIRE

    Riol-Blanco, Lorena; Ordovas-Montanes, Jose; Perro, Mario; Naval, Elena; Thiriot, Aude; Alvarez, David; Wood, John N.; von Andrian, Ulrich H.

    2014-01-01

    The skin has a dual function as a barrier and a sensory interface between the body and the environment. To protect against invading pathogens, the skin harbors specialized immune cells, including dermal dendritic cells (DDCs) and interleukin (IL)-17 producing γδ T cells (γδT17), whose aberrant activation by IL-23 can provoke psoriasis-like inflammation1–4. The skin is also innervated by a meshwork of peripheral nerves consisting of relatively sparse autonomic and abundant sensory fibers. Inte...

  19. Nociceptive Sensory Neurons Drive Interleukin-23 Mediated Psoriasiform Skin Inflammation