WorldWideScience

Sample records for atta sexdens rubropilosa

  1. POPULATION GENETICS OF Atta sexdens rubropilosa (HYMENOPTERA: FORMICIDAE

    Directory of Open Access Journals (Sweden)

    LIRIANA BELIZÁRIO CANTAGALLI

    2013-01-01

    Full Text Available La variabilidad genética de las hormigas Atta sexdens rubropilosa colectadas en cinco lugares distintos de Brasil fueron evaluados por la técnica PCR-RAPD. Un total de 15 primers produjeron 148 fragmentos, de los cuales 123 fueron polimórficos, lo que corresponden al 83,11 %. La estimación de la diversidad genética por el índice de Shannon fue 0,3836 y el desviación estándar fue de ± 0,2335. Estos valores demuestran una alta diversidad genética. El valor de GST fue 0,2372 y ΦPT = 0,184 lo que indica que las poblaciones están moderadamente diferenciadas y que el 82 % de la variación obtenida se produce dentro de las poblaciones. Aunque la prueba de Mantel ha demostrado una correlación entre la distancia genética y geográfica se observó que Ivatuba e Itambé (33,8 km tiene una pequeña distancia geográfica y la mayor distancia genética. La distancia inferior genética fue estimada para Maringá e Ivatuba pero estas localidades cuentan con una distancia geográfica pequeña (42,3 km, lo que indica que no hay barreras para el apareamiento entre los reproductores en estas poblaciones. El alto valor de polimorfismo (83,11 % y la capacidad de emparejamiento entre las poblaciones presentes en las regiones estu- diadas, indican que esta especie de hormiga cortadora está bien adaptada a la región, y deben ser desarrollados programas integrados de control si se convierten en plagas.

  2. Genética de poplaciones de Atta sexdens rubropilosa (Hymenoptera: Formicidae POPULATION GENETICS OF Atta sexdens rubropilosa (HYMENOPTERA: FORMICIDAE

    Directory of Open Access Journals (Sweden)

    LIRIANA BELIZÁRIO CANTAGALLI

    2013-04-01

    Full Text Available La variabilidad genética de las hormigas Atta sexdens rubropilosa colectadas en cinco lugares distintos de Brasil fueron evaluados por la técnica PCR-RAPD. Un total de 15 primers produjeron 148 fragmentos, de los cuales 123 fueron polimórficos, lo que corresponden al 83,11 %. La estimación de la diversidad genética por el índice de Shannon fue 0,3836 y el desviación estándar fue de ± 0,2335. Estos valores demuestran una alta diversidad genética. El valor de G ST fue 0,2372 y ΦPT = 0,184 lo que indica que las poblaciones están moderadamente diferenciadas y que el 82 % de la variación obtenida se produce dentro de las poblaciones. Aunque la prueba de Mantel ha demostrado una correlación entre la distancia genética y geográfica se observó que Ivatuba e Itambé (33,8 km tiene una pequeña distancia geográfica y la mayor distancia genética. La distancia inferior genética fue estimada para Maringá e Ivatuba pero estas localidades cuentan con una distancia geográfica pequeña (42,3 km, lo que indica que no hay barreras para el apareamiento entre los reproductores en estas poblaciones. El alto valor de polimorfismo (83,11 % y la capacidad de emparejamiento entre las poblaciones presentes en las regiones estudiadas, indican que esta especie de hormiga cortadora está bien adaptada a la región, y deben ser desarrollados programas integrados de control si se convierten en plagas.The genetic variability of Atta sexdens rubropilosa leaf-cutting ants collected from five brazilian localities was evaluated with PCR-RAPD technique. We used 15 primers producing 148 fragments of which 123 (83.11 % contained polymorphisms. The estimated Shannon index was 0.3836 ± 0.2335 showing that these ants possess high genetic diversity. The G ST value was 0.2372 and ΦPT = 0.184, indicating that the analyzed populations are moderately differentiated and 82 % of the variation obtained occur within populations. Although Mantel's test had shown correlation

  3. Eficiência de isca formicida aplicada sobre o monte de terra solta de ninhos de Atta sexdens rubropilosa (Hymenoptera: Formicidae Efficiency of a granulated bait applied over the nests of Atta sexdens rubropilosa (Hymenoptera: Formicidae

    Directory of Open Access Journals (Sweden)

    Ronald Zanetti

    2003-06-01

    Full Text Available Avaliou-se a eficiência de uma isca granulada à base de sulfluramida (0,3% aplicada em olheiros situados sobre o monte de terra solta, em comparação com o sistema convencional de aplicação nos olheiros fora desses montes, no combate a Atta sexdens rubropilosa Forel, 1908 (Hymenoptera: Formicidae. Os tratamentos consistiram da aplicação de uma isca granulada à base de sulfluramida (0,3%, a 8 g/m² do formigueiro aparente, em olheiros situados sobre ou fora do monte de terra solta. Foram utilizados 192 formigueiros de A. sexdens rubropilosa, distribuídos nesses dois tratamentos. Foram avaliadas a porcentagem de carregamento e de devolução dessa isca, aos dois dias após sua aplicação, e a eficiência do combate, aos 150 dias após, por sondagem (uma a cada metro quadrado de fomigueiro. A porcentagem de carregamento da isca granulada foi maior quando aplicada fora do monte de terra solta (100,00% do que sobre ele (89,58%, porém a eficiência de controle foi semelhante, com 89,58% para o primeiro e 90,27% para o segundo tratamento, respectivamente. Por isto, em razão do menor custo e facilidade, recomenda-se aplicar esta isca sobre os montes de terra solta de formigueiros de A. sexdens rubropilosa.The efficiency of a granulated bait formulated with sulfluramid (0.3% for the control of Atta sexdens rubropilosa Forel, 1908 (Hymenoptera: Formicidae was evaluated. Treatments consisted of applying this bait at a dose of 8g/m² from the ant nest. This bait was applied near entrances over ant nests (treatment T1 or near those outside these nests (treatment T2. A total of 192 ant nests of A. sexdens rubropilosa were used in the two treatments. Percentage of transport and devolution of the bait by A. sexdens rubropilosa was evaluated two days after its application and control efficiency, 150 days after application. Percentage of bait transport was higher when applied outside the ant nest (100.00% than over it (89.5%. However, control

  4. Aflatoxins produced by Aspergillus nomius ASR3, a pathogen isolated from the leaf-cutter ant Atta sexdens rubropilosa

    Directory of Open Access Journals (Sweden)

    Eduardo Afonso da Silva-Junior

    Full Text Available ABSTRACT Aspergillus spp. cause economic impacts due to aflatoxins production. Although the toxicity of aflatoxins is already known, little information about their ecological roles is available. Here we investigated the compounds produced by Aspergillus nomius ASR3 directly from a dead leaf-cutter queen ant Atta sexdens rubropilosa and the fungal axenic culture. Chemical analyses were carried out by high-resolution mass spectrometry and tandem mass spectrometry techniques. Aflatoxins B1 and G1 were detected in both the axenic culture and in the dead leaf-cutter queen ant. The presence of these mycotoxins in the dead leaf-cutter queen ant suggests that these compounds can be related to the insect pathogenicity of A. nomius against A. sexdens rubropilosa.

  5. Yeasts found on an ephemeral reproductive caste of the leaf-cutting ant Atta sexdens rubropilosa.

    Science.gov (United States)

    Arcuri, Silvio Lovato; Pagnocca, Fernando Carlos; Melo, Weilan Gomes da Paixão; Nagamoto, Nilson Satoru; Komura, Dirce Leimi; Rodrigues, Andre

    2014-09-01

    Winged males of leaf-cutting ants are considered an ephemeral reproductive caste only produced before the mating flight season. Although much is known about the yeast diversity found in fungus gardens of attine ants, no study has focused on the yeasts associated with males of leaf-cutting ants. Here, we surveyed the yeasts on the integuments of males of Atta sexdens rubropilosa and assessed their potential role in the attine ant-microbe symbiosis. Using culture-dependent techniques, we found yeasts to be abundant on the integuments of males (54.5 %, n = 200 alates). A total of 242 yeast strains were obtained representing six orders, ten genera and 25 species. Strains of Aureobasidium, Cryptococcus, Hannaella and Rhodotorula were prevalent on the integuments and likely originated from the fungus garden of the parental nest or from the soil. The majority of strains (87.1 %) produced at least one of the evaluated enzymes: pectinase, polygalacturonase, cellulase, xylanase, ligninases and lipase. Aureobasidium pullulans accounted for the highest number of strains that produced all enzymes. In addition, yeasts showed the ability to assimilate the resulting oligosaccharides, supporting observations of other studies that yeasts may be involved in the plant biomass metabolism in the fungus gardens. Because winged males harbor several yeasts with putative functional roles, these fungi may take part and be beneficial in the microbial consortia of the new incipient nest.

  6. Toxicological and histopathological effects of boric acid on Atta sexdens rubropilosa (Hymenoptera: Formicidae) workers.

    Science.gov (United States)

    Sumida, Simone; Silva-Zacarin, Elaine C M; Decio, Pâmela; Malaspina, Osmar; Bueno, Fabiana C; Bueno, Odair C

    2010-06-01

    The current study compared the toxicity of different concentrations of boric acid in adult workers of Atta sexdens rubropilosa Forel (Hymenoptera: Formicidae), with toxicological bioassays, and examining the dose-dependent and time-dependent histopathological changes, of the midgut, Malpighian tubules, and postpharyngeal glands. Our results revealed the importance of conducting toxicological bioassays combined with morphological analyses of the organs of ants chronically exposed to insecticides used in commercial ant baits. In vitro bioassays showed that boric acid significantly decreases the survivorship of workers regardless of concentration, whereas the morphological data suggested progressive dose-dependent and time-dependent changes in the organs examined, which were evident in the midgut. The midgut is the first organ to be affected, followed by the postpharyngeal gland and Malpighian tubules. This sequence is in agreement with the absorption pathway of this chemical compound in the midgut, its transference to the hemolymph, possibly reaching the postpharyngeal glands, and excretion by the Malpighian tubules. These progressive changes might be due to the cumulative and delayed effect of boric acid. Our findings provide important information for the understanding of the action of boric acid in ant baits in direct and indirect target organs.

  7. Ocurrence of the antibiotic producing bacterium Burkholderia sp. in colonies of the leaf-cutting ant Atta sexdens rubropilosa.

    Science.gov (United States)

    Santos, Adão Valmir; Dillon, Rod J; Dillon, Viv M; Reynolds, Stuart E; Samuels, Richard I

    2004-10-15

    Fungus garden material from recently established Atta sexdens rubropilosa colonies (6-12 months old) was sampled to detect antibiotic producing microorganisms that inhibited the growth of pathogens of insects and of the fungus gardens but did not affect their mutualistic fungus. A bacterium with activity against the entomopathogenic fungus Beauveria bassiana was isolated from 56% of the gardens tested (n=57) and identified from its biochemical profile and from 16S and 23S ribosomal DNA sequences as a member of the genus Burkholderia. The ant-associated Burkholderia isolates secreted a potent, anti-fungal agent that inhibited germination of conidia of the entomopathogenic fungi B. bassiana, Metarhizium anisopliae, of the saprophytic Verticillium lecanii, and also of a specialist fungus garden Escovopsis weberi. Growth of the ant's mutualist fungus was unaffected.

  8. CUSTO COMPARATIVO DE CONTROLE À FORMIGA CORTADEIRA Atta sexdens rubropilosa Forel 1908, EMPREGANDO-SE ISCAS GRANULADAS COMERCIAIS E UMA ISCA EXPERIMENTAL COMPARATIVE COST CONTROL OF Atta sexdens rubropilosa FOREL 1908 USING COMMERCIAL GRAIN BAITS AND AN EXPERIMENTAL BAIT

    Directory of Open Access Journals (Sweden)

    Antônio Lopes da Silva

    2007-09-01

    Full Text Available

    Realizou-se um experimento de controle à formiga cortadeira Atta sexdens rubropilosa FOREL 1908, nos campos da Universidade Federal de Goiás (dezembro de 1972, com a finalidade de comparar o custo de controle por sauveiro, utilizando-se uma isca granulada experimental “EAV-041-A” idealizada pelo autor, com outras iscas existentes no mercado. Foram realizados 4 tratamentos (Mirex, Isca Shell, EAV-041-A e Agroceres na base de 10 g de cada isca por m² de sauveiro, em 5 repetições, constando cada parcela de 3 formigueiros, perfazendo um total de 60. O delineamento foi inteiramente ao acaso. Para a análise econômica dos resultados, foram utilizados os fatores: custo da isca, sua eficiência percentual e o valor da mão-de-obra requerida, para se determinar o custo médio de controle de um sauveiro extinto. Pelos valores calculados, como resultado, obteve-se o custo médio por sauveiro extinto na seguinte ordem: com a isca “EAV-04l-A” custou Cr$ 2,27; com a “Isca Shell” Cr$ 3,41; com “Agroceres” Cr$ 4,29 e com “Mirex” Cr$ 5,44, evidenciando a economia em favor da "EAV-041-A", tendo em vista o seu menor custo por quilograma (Na época em que os cálculos foram realizados, o valor cambial do Dólar era de Cr$ 6,00.

    An Experiment was conducted using a clorimated experimental bait called EAV-041-A. This experiment was conducted to determine the efficiency of EAV-041-A using the leaf-cutting ant Atta sexdens rubropilosa as the test. The experiment was executed in Goiânia, Goiás, comparing it with the commercial baits: Mirex, Isca Shell and Agroceres AG-005. Results obtained showed Mirex was superior giving 93.30% control of the nests, EAV-041-A 80.00% and Isca Shell and Agroceres both qave 73.30% control. Total cost of application was calculated based on price of the bait on

  9. Determinação do fator de conversão em colônias de Atta sexdens rubropilosa (Hymenoptera: Formicidae e sua relação com a qualidade do material vegetal cortado Determination of the conversion factor in colonies of Atta sexdens rubropilosa (Hymenoptera: Formicidae and its relationship with the quality of harvested leaf substrate

    Directory of Open Access Journals (Sweden)

    Leandro Sousa-Sou

    2007-02-01

    Full Text Available As formigas cortadeiras (Atta e Acromyrmex são consideradas importantes pragas na agricultura e silvicultura, mas pouco se sabe sobre os reais danos dessas espécies. Uma forma bastante difundida de avaliação do dano é por meio do cálculo da taxa de conversão, dividindo-se o peso do material cortado pelo peso de lixo produzido pelas colônias. Foi levantada a hipótese de que a qualidade do substrato cortado pode influenciar no forrageamento das operárias, alterando a taxa de conversão e dificultando as estimativas de dano. A taxa de conversão de oito colônias de Atta sexdens rubropilosa Forel (Hymenoptera: Formicidae foi calculada com duas espécies vegetais com diferentes concentrações de lignina e celulose, para testar essa hipótese. Colônias mantidas com folhas de baixa qualidade (razão lignina/celulose elevada tiveram maior forrageamento e produziram mais lixo. Entretanto, a taxa de conversão das colônias foi semelhante com essas duas plantas (média = 1,54. Esse valor está dentro da variação encontrada para outras espécies no campo (1,5-1,8, indicando um fator semelhante de conversão entre os gêneros Atta e Acromyrmex. O consumo médio de material vegetal, em termos de pesos seco e fresco, de uma colônia de A. sexdens rubropilosa com 4.500 operárias, foi estimado em 520 e 1.100 g/ano, respectivamente.Leaf-cutting ants (Atta and Acromyrmex are important pests in agriculture and forestry, although few data exist on the actual damage caused by these species. A model used to evaluate damage by leaf-cutting ants are estimates of the conversion factor, which is the ratio between the weight of material cut by the ants and the refuse produced by the colonies. The hypothesis that substrate quality influences foraging by workers, modifying the conversion factor and impairing damage estimates was put forward. To test this hypothesis, the conversion factor was calculated for eight colonies of Atta sexdens rubropilosa Forel

  10. Desenvolvimento in vitro do fungo simbionte de Atta sexdens rubropilosa Forel, 1908 (Hymenoptera: Formicidae em meio de cultura com diferentes extratos vegetais Development in vitro of the symbiotic fungus of Atta sexdens rubropilosa Forel, 1908 (Hymenoptera: Formicidae in culture medium with different plant extracts

    Directory of Open Access Journals (Sweden)

    Marcelo Dias de Souza

    2012-09-01

    Full Text Available O objetivo deste estudo foi avaliar o desenvolvimento in vitro de Leucoagaricus gongylophorus, fungo simbionte de Atta sexdens rubropilosa, em meio de cultura acrescido com extratos de 24 espécies vegetais. O fungo foi inoculado no meio BDA, acrescido com os extratos vegetais, além de quatro controles, em placas de Petri. As placas foram mantidas em câmaras climatizadas à temperatura de 25±1°C no escuro, por um período de 42 dias. O crescimento do fungo foi avaliado semanalmente através do diâmetro da colônia. Os resultados mostraram que o fungo simbionte dessas formigas apresenta um crescimento diferenciado em relação aos extratos fornecidos nas placas, sendo que o meio acrescido com os extratos de arica (Physocalymma scaberrimum, cerejeira (Amburana acreana, cedro (Cedrela fissilis, timbó (Magonia pubescens, leucena (Leucaena leucocephala e mogno (Swietenia macrophylla prejudicaram o desenvolvimento. No entanto, os extratos de genipapo (Genipa americana, seringueira (Heveaa brasiliensis, ingá (Inga edulis e cambará (Vochysia divergens apresentaram melhores condições de desenvolvimento para o fungo simbionte.The objective of this study was to evaluate the in vitro development of Leucoagaricus gongylophorus, the symbiotic fungus of Atta sexdens rubropilosa in culture medium added with extracts of 24 plant species. The fungus was inoculated in PDA added with vegetables extracts and four controls, in Petri dishes. The dishes were maintained in climate chambers at temperature of 25±1°C in the dark, to period of 42 days. The fungal growth was evaluated weekly by diameter of the colony. The results showed that the symbiotic fungus of these ants has differentiated growth when compared to the extracts provided in the dishes, and the medium supplemented with extracts of aricá (Physocalymma scaberrimum, cerejeira (Amburana acreana, cedro (Cedrela fissilis, timbó (Magonia pubescens, leucena (Leucaena leucocephala e mogno (Swietenia

  11. Efeito de formulações granuladas de diferentes produtos químicos e à base de folhas e de sementes de gergelim, Sesamum indicum, no controle de formigueiros de Atta sexdens rubropilosa Forel, 1908 (Hymenoptera: Formicidae.

    Directory of Open Access Journals (Sweden)

    Otávio Peres Filho

    2010-08-01

    Full Text Available Avaliou-se a eficiência de diferentes iscas formicidas comercializadas e de outras fabricadas artesanalmente à base de gergelim, Sesamum indicum, no controle de formigueiros de saúva-limão, Atta sexdens rubropilosa Forel, 1908. O experimento foi realizado em reflorestamento de Eucalyptus camaldulensis com dez anos de idade e dois de rebrota. Foram empregados dez tratamentos, incluindo a testemunha, tendo como ingredientes ativos: clorpirifós, sulfluramida, fipronil, farinha de folhas de gergelim (15%, farinha de sementes de gergelim (10%, 20% e 30%. A verificação da mortalidade dos formigueiros foram realizadas aos 30, 60, 90 e 150 dias após o tratamento. As iscas mais eficientes foram à base de sulfluramida e fipronil, seguida da formulação à base de farinha de folhas de gergelim (15%. As iscas à base de sulfluramida e de fipronil atingiram o controle máximo na avaliação dos 30 dias enquanto as iscas à base de folhas de gergelim (15% apresentou controle satisfatório só a partir da terceira avaliação, isto é, aos 90 dias. Contudo, os resultados obtidos com a isca à base de folhas de gergelim (15% são encorajadores, mostrando que estudos posteriores deverão ser realizados.

  12. EFEITO DE FORMULAÇÕES GRANULADAS DE DIFERENTES PRODUTOS QUÍMICOS E À BASE DE FOLHAS E DE SEMENTES DE GERGELIM, Sesamum indicum, NO CONTROLE DE FORMIGUEIROS DE Atta sexdens rubropilosa Forel, 1908 (HYMENOPTERA: FORMICIDAE

    Directory of Open Access Journals (Sweden)

    Alberto Dorval

    2003-09-01

    Full Text Available Avaliou-se a eficiência de diferentes iscas formicidas comercializadas e de outras fabricadas artesanalmente à base de gergelim, Sesamum indicum, no controle de formigueiros de saúva-limão, Atta sexdens rubropilosa Forel, 1908. O experimento foi realizado em reflorestamento de Eucalyptus camaldulensis com dez anos de idade e dois de rebrota. Foram empregados dez tratamentos, incluindo a testemunha, tendo como ingredientes ativos: clorpirifós, sulfluramida, fipronil, farinha de folhas de gergelim (15%, farinha de sementes de gergelim (10%, 20% e 30%. A verificação da mortalidade dos formigueiros foram realizadas aos 30, 60, 90 e 150 dias após o tratamento. As iscas mais eficientes foram à base de sulfluramida e fipronil, seguida da formulação à base de farinha de folhas de gergelim (15%. As iscas à base de sulfluramida e de fipronil atingiram o controle máximo na avaliação dos 30 dias enquanto as iscas à base de folhas de gergelim (15% apresentou controle satisfatório só a partir da terceira avaliação, isto é, aos 90 dias. Contudo, os resultados obtidos com a isca à base de folhas de gergelim (15% são encorajadores, mostrando que estudos posteriores deverão ser realizados.

  13. ANÁLISE DE CRESCIMENTO, INCIDÊNCIA DE Rhizoctonia sp. E EFEITO ANTIXENOSE PARA A FORMIGA-CORTADEIRA Atta sexdens rubropilosa F. EM CLONES DE Eucalyptus grandis x Eucalyptus urophylla TRATADOS COM GIBERELINA1

    Directory of Open Access Journals (Sweden)

    Fabio Santos Matos

    2015-10-01

    Full Text Available RESUMO A competitividade do setor florestal brasileiro, fruto das condições climáticas e tecnologia empregada, faz que o país ocupe posição de destaque no cenário mundial. Apesar do elevado crescimento brasileiro no setor florestal, é necessário o desenvolvimento de pesquisas que proporcionem aumento de produtividade. Este estudo objetivou avaliar o efeito fisiológico da aplicação de diferentes concentrações de giberelina (GA3 no acúmulo de biomassa do híbrido de Eucalyptus grandis x Eucalyptus urophylla "E. urograndis GG 100" e, também, verificar o efeito da aplicação de hormônio sobre a incidência de Rhizoctonia sp. e sobre efeito antixenose (não preferência ao corte de folhas pela formiga-cortadeira Atta sexdens rubropilosa. O experimento foi conduzido em bancada a pleno sol, seguindo o delineamento inteiramente casualizado com cinco tratamentos e seis repetições. Mudas clonadas de E. urograndis GG 100, com 120 dias de idade, cultivadas sob bancada a pleno sol em vasos de 12 L, com substrato à base de subsolo, areia e esterco foram tratados com 50 mL de GA3, nas seguintes concentrações: 0; 50; 100; 150; e 200 mg L-1. Aos 40 dias após a imposição dos tratamentos, as análises foram realizadas. A aplicação de giberelina intensificou o crescimento vegetativo das plantas de eucalipto e promoveu o maior acúmulo de biomassa no mesmo período de tempo de plantas não tratadas. As mudas tratadas com giberelina apresentaram vigoroso crescimento vegetativo, principalmente na concentração de 150 mg L-1. Adicionalmente, as mesmas plantas exibiram maior preferência por formigas-cortadeiras e menor área foliar lesionada pelo fungo Rhizoctonia sp.

  14. Patogenicidade de isolados de três fungos entomopatogênicos a soldados de Atta sexdens sexdens (Linnaeus, 1758 (Hymenoptera : Formicidae Pathogenicity of isolates of three entomopathogenic fungi against soldiers of Atta sexdens sexdens (Linnaeus, 1758 (Hymenoptera : Formicidae

    Directory of Open Access Journals (Sweden)

    Elisângela de Souza Loureiro

    2005-08-01

    Full Text Available As formigas cortadeiras atacam diversas culturas agrícolas, pastagens e os reflorestamentos, atuando sobre muitas espécies vegetais. O presente trabalho teve por objetivo avaliar a patogenicidade dos fungos Beauveria bassiana (isolados AM 9 e JAB 06, Metarhizium anisopliae (isolados E 9 e AL e Paecilomyces farinosus (isolados CG 189 e CG 195 a soldados de Atta sexdens sexdens, em condições de laboratório. Após a coleta em formigueiro isento de produtos fitossanitários, exemplares de soldados foram cuidadosamente separados em grupos de oito indivíduos e, a seguir, banhados em suspensões contendo 1,0 x 10(6, 1,0 x 10(7, 1,0 x 10(8 e 1,0 x 10(9 conídios/mL de cada isolado. Em seguida, cada grupo de formigas foi transferido para unidades de câmara úmida e mantido, sem alimentação, a 27 ± 1 ºC. A mortalidade foi verificada diariamente. Os três fungos se mostraram eficientes patógenos, pois provocaram alta mortalidade, matando mais que 80% dos soldados nos quatro primeiros dias após a inoculação. Os melhores isolados foram JAB 06 e AL, na concentração de 1,0 x 10(9 con./mL. Os isolados JAB 06, AL, CG 195 apresentaram maior capacidade de esporular nos cadáveres das formigas e os tempos letais decresceram com o aumento da concentração de conídios usada.Leaf-cutting ants attack several crops, pastures and the planted forests, acting on numerous vegetable species. The present work aimed to evaluate the pathogenicity of the fungi Beauveria bassiana (isolates AM 9 and JAB 06, Metarhizium anisopliae (isolates E 9 and Al and Paecilomyces farinosus (isolates CG 189 and CG 195 against soldiers of Atta sexdens sexdens, in laboratory conditions. These fungi were inoculated on soldiers after collection in nests without pesticides application. Specimens of soldiers were separated in groups of eight insects, which were bathed in suspensions containing 1.0 x 10(6, 1.0 x 10(7, 1.0 x 10(8 and 1.0 x 10(9 conidia/ml. Following the bath, each

  15. ACTIVITY OF LEAF-CUTTING ANT Atta sexdens piriventris SUBMITED TO HIGH DILUTION HOMEOPATHIC PREPARATIONS

    Directory of Open Access Journals (Sweden)

    Alexandre Giesel

    2013-02-01

    Full Text Available The effect of high dilution preparations on the movement and foraging activities of Atta sexdens piriventris was evaluated. Five colonies of ants were located on each of the five experimental areas using a randomized complete block design. Three main forage trails from each colony were selected from where evaluations were made. Ten mL of high dilution preparation of Atta sexdens piriventris nosodes and Belladonna homeopathy solution were sprayed over 0.5 m of each selected trail, 1.0 m far from the nest. The controls were pure water and non treated trails. Applications were made daily during 10 days. The total number of ants moving on each trail one meter away from the nest, carrying or not plant fragments, were assessed before the daily application. Dilution preparations at 30CH (thirtieth centesimal Hahnemannian dilution of A. sexdens piriventris nosodes and Belladonna reduced the activities of ants from the fifth day after the first application. The treatment effect lasted more than 20 days after the last application. The use of preparation at 30CH dilution order to reduce the foraging activity of leaf-cutting ants is a potential non residual method to manage leaf-cutting ants.

  16. Energetic cost of digging behavior in workers of the leaf-cutting ant Atta sexdens (Fabricius

    Directory of Open Access Journals (Sweden)

    Roberto da Silva Camargo

    2013-12-01

    Full Text Available Energetic cost of digging behavior in workers of the leaf-cutting ant Atta sexdens (Fabricius. During nest excavation, leaf-cutting ant workers undergo reduction in their body reserve, particularly carbohydrates. In order to estimate the energetic cost of digging, groups of 30 workers of the leaf-cutting ant Atta sexdens were sealed in a hermetic chamber for 24, 48 and 72 hours, with and without soil for digging, and had the CO2 concentration measured using respirometric chambers as well as volume of soil excavated (g. As expected, the worker groups that carried out soil excavation expelled more carbon dioxide than the groups that did not excavate. Therefore, a worker with body mass of 9.65 ± 1.50 mg dug in average 0.85 ± 0.27 g of soil for 24 hours, consuming ca. 0.58 ± 0.23 J. In this study, we calculate that the energetic cost of excavation per worker per day in the experimental set-up was ca. 0.58 J.

  17. Forager size of the leaf-cutting ant Atta sexdens (Hymenoptera: Formicidae in a mature eucalyptus forest in Brazil

    Directory of Open Access Journals (Sweden)

    Athayde Tonhasca

    2000-12-01

    Full Text Available We determined the size characteristics of foragers of the leaf-cutting ant Atta sexdens in a mature eucalyptus forest in Campos dos Goytacazes, Rio de Janeiro State, Brazil, at daytime (7: 30 to 10: 00 hr and nighttime (19: 00 to 23: 00 hr. There were no significant differences between daytime and nighttime ant mass (Ma, but leaf fragment mass (Ml and burden (B = [Ma + Ml]/Ma, which indicates relative load capacity, were significantly greater at daytime. There was a positive linear relationship between Ma and Ml for the combined daytime and nighttime data, and increases in Ma resulted in lower B. We compared A. sexdens characteristics with published results for Atta cephalotes, a closely related species. A. sexdens is larger and therefore able to carry heavier loads, but its burden is about 72% of the average value for A. cephalotes. We suggest that the lower load capacity of A. sexdens in comparison to A. cephalotes is related to its relatively larger size.Nós determinamos as características de tamanho de forrageiras da saúva Atta sexdens em uma floresta adulta de eucalipto em Campos dos Goytacazes, estado do Rio de Janeiro, Brasil, nos períodos diurno (7: 30 a 10: 00 hr e noturno (19: 00 to 23: 00 hr. Não houve diferença significativa entre o dia e a noite para a massa das formigas (Ma, mas a massa dos fragmentos de folhas (Ml e o esforço ([Ma + Ml]/Ma, o qual indica a capacidade relativa de carga, foram significativamente maiores durante o dia. Houve uma correlação linear positiva entre Ma e Ml para os dados diurnos e noturnos combinados, e o aumento em Ma resultou em esforço menor. Nós comparamos as características de A. sexdens com resultados publicados para Atta cephalotes, uma espécie correlata. A. sexdens é maior e portanto capaz de carregar cargas mais pesadas, mas seu esforço é cerca de 72% do valor médio obtido para A. cephalotes. Nós sugerimos que a menor capacidade de carga de A. sexdens em relação a A

  18. Chemical cuticular signature of leafcutter ant Atta sexdens (Hymenoptera, Formicidae worker subcastes

    Directory of Open Access Journals (Sweden)

    Lohan Valadares

    Full Text Available ABSTRACT In leafcutter ants the division of labour is associated to worker size variation clustered in four subcastes. In this work we used Atta sexdens Forel (1908 as a model to test the hypothesis that each subcaste expresses its own chemical signature comprised of cuticular lipids. To assess it, we extracted epicuticular compounds by using nonpolar solvent hexane and analysed the samples in a combined Gas Chromatography-Mass Spectrometer (GC-MS. We found 24 hydrocarbons with carbon chains ranging from 19 to 39 atoms most of them classified as linear and branched alkanes. No compound occurred in the cuticle of specific worker subcaste, however, the relative proportion pattern varied greatly among them. Our results suggest that although subcastes have similar chemical signatures, significant differences in their relative proportions may play an important role between nestmate and group identification.

  19. Queen influence on workers behavior of the leaf-cutting ant Atta sexdens rubropilosa (Forel, 1908

    Directory of Open Access Journals (Sweden)

    L. Sousa-Souto

    Full Text Available In an ant colony, the queen is the single reproducer and can interact with her workers via pheromones and cuticular compounds. However, in most species queen importance is not restricted to reproduction: in the initial development of the colony, her presence might play a more important role. In this work, we studied the effects of queen absence on workers behavior displayed in the foraging arena. Ant’s mortality and refuse accumulation was also measured daily. The results showed that queen absence did not alter either workers behavior or foraging efficiency. However, we observed increased ant mortality accompanied by a decrease in refuse dumping outside the nest. These results corroborate the hypothesis that environmental factors are more important than intrinsical factors in the allocation of external tasks. Probably, the queen could only influence internal activities of the colony.

  20. Efeito de formulações granuladas de diferentes produtos químicos e à base de folhas e de sementes de gergelim, Sesamum indicum, no controle de formigueiros de Atta sexdens...

    Directory of Open Access Journals (Sweden)

    Otávio Filho Peres

    2003-01-01

    Full Text Available Different baits insecticides commercialized and others artisanly produced with sesame, Sesamum indicum, were evaluated in the control of lemon leaf cutter anthills, Atta sexdens rubropilosa Forel, 1908. The experiment was held in one tem years old Eucalyptus camaldulensis plantation and two of sprout. It was tested ten treatments, including the standard, with the following active ingredients: chlorpyrifos, sulfluramid, fipronil, flour of sesame leaves (15%, flour of sesame seeds (10%, 20% and 30%. The mortality verification of the anthills was held at the 30, 60, 90 and 150 days after the treatment. The most efficient baits were sulfluramid and fipronil, followed by the formulation of flour of sesame leaves (15%. The baits of sulfluramid and of fipronil reached the maximum control in the evaluation of the 30th day, whereas the baits of sesame leaves (15% presented satisfactory control starting from the third evaluation at the 90th day. The results obtained with the bait of sesame leaves (15% were promising encouraging new studies to be held.

  1. Los factores ambientales en relación con la hormiga arriera (Atta sexdens) en el sur del trapecio amazónico, Colombia / The environmental factors related to the leafcutter ant (Atta sexdens) in the south of the Amazon trapezium, Colombia

    OpenAIRE

    Van Gils, Heike Antonia Johanna Anna

    2011-01-01

    La hormiga arriera (Atta y Acromyrmex spp.) juega un papel ecológico importante en la zona neotropical como herbívoro dominante e ingeniero de ecosistemas. Sin embargo, aún poco se entienden los mecanismos fundamentales que determinan la distribución y la densidad de los nidos. Este estudio tuvo como objetivo conocer algunos aspectos demograficos de Atta sexdens en la orilla colombiana del río Amazonas y comprobar que, aparte de la vegetación, existen otros factores ambientales que también lo...

  2. Comparative morpho-physiology of the metapleural glands of two Atta leaf-cutting ant queens nesting in clayish and organic soils.

    Science.gov (United States)

    Vieira, Alexsandro Santana; Camargo-Mathias, Maria Izabel; Roces, Flavio

    2015-09-01

    Queens of leaf-cutting ants found their nests singly, each consisting of a vertical tunnel and a final horizontal chamber. Because of the claustral mode of nest founding, the queen and/or her initial fungus garden are exposed to threats imposed by several soil pathogens, and the antibiotic secretions produced by their metapleural glands are considered a main adaptation to deal with them. Nests of two Atta leaf-cutting ant species, Atta vollenweideri and Atta sexdens rubropilosa, occur in different soil types, alfisols and oxisols. Their queens are known to excavate the initial nest in different soil horizons, clayish and organic, respectively, which differ in their fertility and associated microbiota. The aim of the present study was to comparatively investigate the morpho-physiology of the metapleural glands in queens of A. vollenweideri and A. sexdens rubropilosa, addressing the question whether the distinct selective pressure imposed by the microbiota in the two different soil types led to morpho-physiological differences in the metapleural glands that were consistent with their antiseptic function. The results revealed that metapleural glands of A. sexdens rubropilosa have a larger number of secretory cells, and consequently a higher production of antibiotic secretions, which may have been selected to allow nest founding at the superficial horizon of oxisols rich in organic matter and microorganisms. Glands of A. vollenweideri, on the contrary, presented fewer secretory cells, suggesting less production of antibiotic secretions. We argue that the excavation of deep founding nests in A. vollenweideri was primarily selected for during evolution to avoid the risk posed by flooding, and further hypothesize that a reduced number of cells in their metapleural glands occurred because of a weak pathogen-driven selective pressure at the preferred soil depth. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. Esforço de escavação e teor de lipídios em rainhas da formiga cortadeira Atta sexdens rubropilosa

    Directory of Open Access Journals (Sweden)

    Roberto da Silva Camargo

    2013-08-01

    Full Text Available As formigas cortadeiras, importantes pragas agrícolas, anualmente realizam a fundação de novas colônias. Para o início de novas colônias, é preciso a escavação de túneis e de câmaras no solo, sendo que, para isso, as rainhas recém fecundadas gastam muita energia, no entanto a quantificação dessa energia gasta é desconhecida. Nossa hipótese é que a reserva lipídica, armazenada no corpo da rainha, seja utilizada durante a escavação do ninho. Testamos essa hipótese comparando o aumento do esforço de escavação das rainhas, as quais foram experimentalmente estimuladas a escavar uma, duas ou três vezes consecutivas, em relação ao controle, ou seja, em relação às rainhas que não escavaram. Foram quantificados a massa corporal e o teor de lipídios das rainhas. Os resultados mostraram que, ao contrário de nossas expectativas iniciais, massa e teor de lípideos não foram afetadas pelo aumento do esforço de escavação do ninho. Conclui-se que a escavação pelas rainhas não afetou os percentuais de lipídios em seu corpo, consequentemente, o conteúdo de energia. Provavelmente, os recursos energéticos para a escavação não se originam de fontes lipídicas, mas de outros, provavelmente carboidratos.

  4. Dealing with water deficit in Atta ant colonies: large ants scout for water while small ants transport it

    Directory of Open Access Journals (Sweden)

    Antonio Carlos Da-Silva

    2012-07-01

    Leafcutter ants (Atta sexdens rubropilosa (Forel 1908 have an elaborate social organization, complete with caste divisions. Activities carried out by specialist groups contribute to the overall success and survival of the colony when it is confronted with environmental challenges such as dehydration. Ants detect variations in humidity inside the nest and react by activating several types of behavior that enhance water uptake and decrease water loss, but it is not clear whether or not a single caste collects water regardless of the cost of bringing this resource back to the colony. Accordingly, we investigated water collection activities in three colonies of Atta sexdens rubropilosa experimentally exposed to water stress. Specifically, we analyzed whether or not the same ant caste foraged for water, regardless of the absolute energetic cost (distance of transporting this resource back to the colony. Our experimental design offered water sources at 0 m, 1 m and 10 m from the nest. We studied the body size of ants near the water sources from the initial offer of water (time  =  0 to 120 min, and tested for specialization. We observed a reduction in the average size and variance of ants that corroborated the specialization hypothesis. Although the temporal course of specialization changed with distance, the final outcome was similar among distances. Thus, we conclude that, for this species, a specialist (our use of the word “specialist” does not mean exclusive task force is responsible for collecting water, regardless of the cost of transporting water back to the colony.

  5. Comparative physical mapping of 18S rDNA in the karyotypes of six leafcutter ant species of the genera Atta and Acromyrmex (Formicidae: Myrmicinae).

    Science.gov (United States)

    Teixeira, Gisele Amaro; Barros, Luísa Antônia Campos; de Aguiar, Hilton Jeferson Alves Cardoso; das Graças Pompolo, Silvia

    2017-10-01

    Leafcutter ants of the Atta and Acromyrmex genera are important plagues in different cultures. Cytogenetic data on chromosome number, morphology, and chromosomal banding pattern are only available for 17 species of leafcutter ants. Molecular cytogenetic data for the detection of ribosomal genes by the FISH technique are scarce, and only 15 Neotropical ant species have been studied. This study aimed to physically map the 18S ribosomal RNA genes (rDNA) of six leafcutter ants belonging to the genera Atta and Acromyrmex using FISH. The results were compared with data on the fluorochrome CMA3 currently available for these species. All analyzed species presented the 18S rDNA on one pair of chromosomes. In Acromyrmex subterraneus molestans and Ac. aspersus, FISH signals were observed in the terminal region of the short arm of the largest subtelocentric pair, while in Atta bisphaerica, A. laevigata, and A. sexdens, FISH signals were observed in the interstitial region of the long arm of the fourth metacentric pair. In Acromyrmex striatus, 18S rDNA was located in the interstitial region of the second metacentric pair. The karyotypic formula for Ac. aspersus was 2n = 38 (8m + 10sm + 16st + 4a), representing the first report in this species. The observed 18S rDNA regions in A. laevigata, A. sexdens, A. bisphaerica, Ac. aspersus, and Ac. subterraneus molestans corresponded to the CMA3+ bands, while in Ac. striatus, several GC-rich bands and one pair of 18S rDNA bands were observed. No differential bands were visible using the DAPI fluorochrome. Karyotype uniformity with previously studied Atta spp. was also observed at the level of molecular cytogenetics using 18S rDNA FISH. A difference in the size of the chromosomal pair carrying the 18S rDNA gene was observed in Ac. striatus (2n = 22) and Atta spp. (2n = 22) highlighting the dissimilarity between these species. The results from the present study contribute to the description of 18S rDNA clusters in

  6. Mating activities of Atta texana (Hymenoptera, Formicidae)

    Science.gov (United States)

    John C. Moser

    1967-01-01

    The town ant, Atta texana (Buckley) is the northernmost representative of the most specialized genus of Attini, a New World tribe of fungus-growing myrmicine ants. Colonies are found in central Louisiana; easter, central and southern Texas; and eastern Mexico as far south as Vera Cruz. They are restricted to sandy soils and are usually located on...

  7. Conteúdo energético das operárias da formiga cortadeira, Atta sexdens

    Directory of Open Access Journals (Sweden)

    Roberto da Silva Camargo

    2013-11-01

    Full Text Available O conhecimento do conteúdo energético das operárias é essencial para mensurar a disponibilidade energética, responsável pela manutenção e execução de atividades essenciais para o crescimento da colônia de formigas. Mas pouco se conhece sobre o conteúdo energético das operárias e quanto estará disponível para realizar atividades de, por exemplo, escavar do ninho. O presente estudo determinou o teor de lipídeo e o conteúdo energético das operárias de formigas cortadeiras inativas, antes e pós atividade de escavação. Por meio da determinação do teor de lipídeos, pode-se calcular o conteúdo energético das operárias em repouso (paradas e compará-las com as que escavaram. O teor de lipídeo e conteúdo energético das operárias foram em média 9,1±0,8% e 111,31±54,71J, respectivamente, entretanto, as séries experimentais não diferiram significativamente. Adicionalmente, a taxa do fluxo catabólico, embasado na massa corporal das operárias foi de 14,76±10,11µW. Conclui-se que o recurso energético para a escavação do ninho não é proveniente de reserva de lipídeos corporal e, dessa forma, o conteúdo energético das operárias não alterou antes e pós-atividade de escavação.

  8. Activities of extracts and compounds from Spiranthera odoratissima St. Hil. (Rutaceae) in leaf-cutting ants and their symbiotic fungus

    Energy Technology Data Exchange (ETDEWEB)

    Terezan, Ana Paula; Fernandes, Joao B.; Silva, M. Fatima das Gracas Fernandes da; Vieira, Paulo C. [Universidade Federal de Sao Carlos (UFSCAR), Sao Carlos, SP (Brazil). Dept. de Quimica; Rossi, Raquel Andrade; Almeida, Roberta N.A.; Freitas, Tais Garcia; Bueno, Odair C.; Pagnocca, Fernando C. [Universidade Estadual Paulista (UNESP), Rio Claro, SP (Brazil). Centro de Estudos de Insetos Sociais; Pirani, Jose R., E-mail: djbf@power.ufscar.b [Universidade de Sao Paulo (USP), SP (Brazil). Inst. de Biociencias. Dept. de Botanica

    2010-07-01

    The study of the Spiranthera odoratissima St. Hil (Rutaceae) branches extracts led to the isolation of the furoquinoline (dictamine, gamma-fagarine and skimmianine) and 2-arylquinoli-4-one (1-methyl-2-phenylquinoline-4-one) alkaloids and limonoids (limonexic acid and limonin). The compounds 1-methyl-2-phenylquinoline-4-one and limonexic acid were isolated for the first time from the Spiranthera. These furoquinoline and 2-arylquinoli-4-one alkaloids and limonoids showed insecticidal and/or fungicidal activity in the nest of the Atta sexdens rubropilosa. (author)

  9. Square Van Atta reflector with conducting mounting flame

    DEFF Research Database (Denmark)

    Nielsen, Erik Dragø

    1970-01-01

    by transmission lines of equal electrical length. The dipoles are placed in a plane which is parallel to the conducting plate when this is present. In the theory, each pair of antenna elements with the interconnecting transmission line is represented by an equivalent circuit. The mutual impedance between...... the antenna elements and the reradiation from the elements as well as from the conducting plate have been taken into account. The influence of the conducting plate on the induced dipole currents has been treated using the theory of images. The scattering cross section of Van Atta reflectors with or without......A theoretical and numerical analysis of square Van Atta reflectors has been carried out with or without a conducting plate, used for mounting of the antenna elements. The Van Atta reflector investigated has antenna elements which are parallel half-wave dipoles interconnected in pairs...

  10. A Van Atta reflector consisting of half-wave dipoles

    DEFF Research Database (Denmark)

    Appel-Hansen, Jørgen

    1966-01-01

    The reradiation pattern of a passive Van Atta reflector consisting of half-wave dipoles is investigated. The character of the reradiation pattern first is deduced by qualitative and physical considerations. Various types of array elements are considered and several geometrical configurations...... of these elements are outlined. Following this, an analysis is made of the reradiation pattern of a linear Van Atta array consisting of four equispaced half-wave dipoles. The general form of the reradiation pattern is studied analytically. The influence of scattering and coupling is determined and the dependence...

  11. Extrações de óleos de sementes de citros e suas atividades sobre a formiga cortadeira Atta sexdens e seu fungo simbionte

    Directory of Open Access Journals (Sweden)

    Fernandes João B.

    2002-01-01

    Full Text Available Seeds Citrus oils (C. sinensis, C. limon and C. reticulata extraction with hexane in a soxhlet apparatus and through supercritical fluid (CO2 were done. Besides triglycerides, the oils obtained with hexane comprised volatile compounds such as terpenes and fatty alcohols, esters, and aldehydes. However, the oils obtained by extraction with supercritical fluid presented only triglycerides. These results indicate that the extraction using supercritical fluid presents better selectivity. The activity of the oils on the development of the ant symbiotic fungus, Leucoagaricus gongylophorus, showed week activity and the topic insecticide assay showed better activity for the tangerine seed oil.

  12. Are workers of Atta leafcutter ants capable of reproduction?

    DEFF Research Database (Denmark)

    Dijkstra, Michiel Bendert; Boomsma, Jacobus Jan

    2006-01-01

    . However, all males were tiny (3.5-9 mm long) compared to normal queen sons (16 mm long), and would almost certainly be unable to mate. We also found reproductive eggs, but most of these had no yolk and were thus inviable. We conclude that Atta workers are not completely infertile, but that worker...... ovaries. Workers of Atta leafcutter ants only lay trophic eggs in queenright colonies. Although Atta colonies are commonly kept at universities, museums, and zoos, no reports of worker sons in orphaned colonies exist, suggesting that Atta workers are infertile. To explicitly test this, we created eleven...... to adulthood, but that the importance of worker-laid trophic eggs for queen feeding has precluded the evolutionary loss of worker ovaries....

  13. TOSTADO Y HARINA DE LA HORMIGA SANTANDEREANA 'Atta Laevigata'

    Directory of Open Access Journals (Sweden)

    CLEMENTE GRANADOS C

    Full Text Available La hormiga Atta Laevigata, habita en los departamentos de Santander y Casanare de Colombia donde son utilizadas como alimento por los habitantes, atribuyéndoles propiedades afrodisiacas. Se evaluaron los métodos actuales de recolección, procesados y materiales empleados en la elaboración de hormiga tostada, y de acuerdo a las deficiencias encontradas se propusieron métodos eficaces y nuevos procesos para un mejor aprovechamiento de este recurso. La tecnología propuesta para la obtención de la hormiga tostada y elaboración de la harina aumentaron los rendimientos, la concentración de proteínas y el tiempo de conservación

  14. Traffic dynamics of the leaf-cutting ant, Atta cephalotes.

    Science.gov (United States)

    Burd, Martin; Archer, Debbie; Aranwela, Nuvan; Stradling, David J

    2002-03-01

    Colonies of Atta cephalotes (Myrmicinae: Formicidae) construct cleared paths between their nest and the vegetation sources at which they harvest leaf tissue. Here, we employ ideas from traffic engineering to study streams of laden and unladen ants on these paths. The relationship between average traffic speed and the concentration of workers on the road surface follows a relationship similar to what is expected by analogy to fluid dynamics. Although the traffic is composed of eusocial organisms with a common interest in group success, the coarse-grained behavior of Atta traffic displays little more coordination than a moving fluid. The relationship between speed and concentration implies that maximum flow rates (which are likely to be closely tied to colony-level rates of resource acquisition) occur at a relatively high concentration that keeps individual speeds well below their "free flow" maximum. We predict that this optimal concentration will characterize peak traffic throughout a trail network, and we propose a simple behavioral mechanism that would allow trails to be cleared to the correct width to provide the optimal concentration. Collisions (including encounters for antennation) are common in leaf-cutting ant traffic because traffic is not segregated into unidirectional streams. Nonetheless, we find a counterintuitive suggestion that flow rates (with concentration differences statistically removed) are higher when traffic is near a 50:50 mix of outbound and returning ants than when it contains majority flows in a single direction. Mixed-direction traffic may help disperse laden ants with reduced agility, thereby preventing inhomogeneities in the traffic stream that could clog the trail.

  15. Essential Oils of Hyptis pectinata Chemotypes: Isolation, Binary Mixtures and Acute Toxicity on Leaf-Cutting Ants.

    Science.gov (United States)

    Feitosa-Alcantara, Rosana B; Bacci, Leandro; Blank, Arie F; Alves, Péricles B; Silva, Indira Morgana de A; Soares, Caroline A; Sampaio, Taís S; Nogueira, Paulo Cesar de L; Arrigoni-Blank, Maria de Fátima

    2017-04-12

    Leaf-cutting ants are pests of great economic importance due to the damage they cause to agricultural and forest crops. The use of organosynthetic insecticides is the main form of control of these insects. In order to develop safer technology, the objective of this work was to evaluate the formicidal activity of the essential oils of two Hyptis pectinata genotypes (chemotypes) and their major compounds on the leaf-cutting ants Acromyrmex balzani Emery and Atta sexdens rubropilosa Forel. Bioassays of exposure pathways (contact and fumigation) and binary mixtures of the major compounds were performed. The major compounds identified in the essential oils of H. pectinata were β-caryophyllene, caryophyllene oxide and calamusenone. The essential oils of H. pectinata were toxic to the ants in both exposure pathways. Essential oils were more toxic than their major compounds alone. The chemotype calamusenone was more toxic to A. balzani in both exposure pathways. A. sexdens rubropilosa was more susceptible to the essential oil of the chemotype β-caryophyllene in both exposure pathways. In general, the binary mixtures of the major compounds resulted in additive effect of toxicity. The essential oils of H. pectinata is a raw material of great potential for the development of new insecticides.

  16. Leaf-cutting ants toxicity of limonexic acid and degraded limonoids from Raulinoa echinata: X-ray structure of epoxy-fraxinellone

    Energy Technology Data Exchange (ETDEWEB)

    Biavatti, Maique W.; Westerlon, Rosangela [Universidade do Vale do Itajai, SC (Brazil). Programa de Pos-Graduacao em Ciencias Farmaceuticas]. E-mail: maique@univali.br; Vieira, Paulo C.; Silva, M. Fatima G.F. da; Fernandes, Joao B. [Sao Carlos Univ., SP (Brazil). Dept. de Quimica; Penaflor, M. Fernanda G.V.; Bueno, Odair C. [UNESP, Rio Claro, SP (Brazil). Centro de Estudos de Insetos Sociais; Ellena, Javier [Sao Paulo Univ., Sao Carlos, SP (Brazil). Inst. de Fisica

    2005-11-15

    Phytochemical survey of roots extracts of the South Brazilian endemic plant Raulinoa echinata Cowan, Rutaceae led to the isolation of known degraded limonoids: fraxinellone, fraxinellonone and epoxy-fraxinellone. The latter was previously isolated also from the stems, but the relative configuration could not be solved by NMR experiments. This paper deals with the X-ray diffraction analysis of epoxy-fraxinellone and its toxicity to leaf-cutting ants, describes the isolation of fraxinellonone and fraxinellone for the first time in Raulinoa. Epoxy-fraxinellone showed no toxicity to the leaf-cutting ants (Atta sexdens rubropilosa). The limonoid limonexic acid, isolated from stems, presented high toxicity to the leaf-cutting ants, diminishing considerably their longevity. (author)

  17. Development and validation of a RP-HPLC method to determine the xanthyletin content in biodegradable polymeric nanoparticles

    Directory of Open Access Journals (Sweden)

    Cristiane de Melo Cazal

    2014-01-01

    Full Text Available Xanthyletin is used as an inhibitor of the symbiotic fungus (Leucoagaricus gongylophorus of the leaf-cutting ant (Atta sexdens rubropilosa, one of the most significant agricultural plague insects. The incorporation of this compound into nanoparticles is a promising approach to effectively control leaf-cutting ants. This study presents the development and validation of a specific analytical method using high-performance liquid chromatography (HPLC for quantification of the xanthyletin content in biodegradable polymeric nanoparticles. The analytical methodology developed was specific, linear, accurate, precise, and robust. The absolute recovery of xanthyletin in colloidal suspensions was nearly 100%. The HPLC method proved reliable for the quantification of xanthyletin content in nanoparticle formulations.

  18. Pholeomyia comans (Diptera: Milichiidae) an associate of Atta texana: larval anatomy and notes on biology

    Science.gov (United States)

    John C. Moser; Stuart E. Neff

    1971-01-01

    Adults of Pholeomyia comans enter the nests of Atta texana and lay eggs in the underground detritus cavities, where the maggots feed on exhausted fungus garden substrate and nest refuse recently deposited by workers. The thirdstage larva and the puparium are described. A diapriid wasp was obtained from P. comans puparia. One...

  19. Draft Genome Sequence of the Ant-associated Fungus Phialophora attae (CBS 131958)

    NARCIS (Netherlands)

    de Hoog, S.

    2015-01-01

    The black yeast Phialophora attae was isolated from the cuticle of tropical ant gynes. The ant-fungus association is sustained due to symbiotic evolutionary adaptations that allow fungal assimilation and tolerance of toxic compounds produced by the ant. The genome sequence of the first

  20. Influências de Atta spp. (Hymenoptera: Formicidae na recuperação da vegetação pós-fogo em floresta de transição amazônica Influences of leafcutter ant Atta spp. (Hymenoptera: Formicidae on vegetation recovery after fire in Amazonian transitional forest

    Directory of Open Access Journals (Sweden)

    Karine Santana Carvalho

    2012-03-01

    Full Text Available Este estudo investigou o papel das saúvas na recuperação da vegetação pós-fogo. Foi hipotetizado que a perturbação do fogo aumenta a abundância de ninhos de saúva (1 e as atividades de remoção de sementes (2 e desfolha (3, especialmente no ambiente de borda. Os ninhos de saúva foram inventariados e mapeados e após 17 meses, checados para o registro de sua atividade e de novas colônias emergindo na área. Realizou-se experimentos comparativos de remoção de sementes e desfolha de plântulas em duas parcelas de 50 ha, uma submetida a fogo anual (tratamento e outra sem fogo (controle. A abundância de ninhos de saúva foi maior na parcela tratamento que na parcela controle, especialmente na borda da floresta. As espécies encontradas foram: Atta cephalotes, A. laevigata e A. sexdens , sendo esta última a espécie mais abundante e que mostrou aumento em número de colônias ativas após 17 meses. O aumento na abundância de ninhos na parcela tratamento foi acompanhado por um aumento na atividade dessas formigas. Enquanto mais de duas folhas foram arrancadas por plântula nessa parcela, menos de uma foi registrada na parcela controle. Também a abundância média de galhos desfolhados e de sementes removidas por saúvas foi maior na parcela tratamento que na parcela controle. As saúvas tanto podem diminuir ou retardar o processo de regeneração florestal pós-fogo, quanto acelerá-lo, devido à elevada predação seletiva que favorece as espécies menos palatáveis. Desta forma, suas atividades podem modificador apenas a composição da vegetação recuperando-se do fogo.In this study we investigated the role of leaf-cutting ants in the post-fire vegetation recovery. We hypothesized that a forest plot submitted to annual fire presents: (1 higher abundance of leaf-cutting ant nests; (2 higher removal of seeds; and (3 higher herbivory rates of leaf-cutting ants, when compared to the forest plots without fire (control. The leaf

  1. Diversity and transmission of gut bacteria in Atta and Acromyrmex leaf-cutting ants during development

    DEFF Research Database (Denmark)

    Zhukova, Mariya; Sapountzis, Panagiotis; Schiøtt, Morten

    2017-01-01

    . To elucidate the extent to which metamorphosis interrupts associations between bacteria and hosts, we analyzed changes in gut microbiota during development and traced the transmission routes of dominant symbionts from the egg to adult stage in the leaf-cutting ants Acromyrmex echinatior and Atta cephalotes......The social Hymenoptera have distinct larval and adult stages separated by metamorphosis, which implies striking remodeling of external and internal body structures during the pupal stage. This imposes challenges to gut symbionts as existing cultures are lost and may or may not need to be replaced......, which are both important functional herbivores in the New World tropics. Bacterial density remained similar across the developmental stages of Acromyrmex, but Atta brood had very low bacterial prevalences suggesting that bacterial gut symbionts are not actively maintained. We found that Wolbachia...

  2. Seminal fluid enhances sperm viability in the leafcutter ant Atta colombica

    DEFF Research Database (Denmark)

    Den Boer, Susanne Petronella A; Boomsma, Jacobus Jan; Baer, Boris

    2008-01-01

    The seminal fluid that accompanies sperm in ejaculates has been shown or suggested to affect sperm competition and paternity success of insects by preventing female remating, inducing oviposition, and forming mating plugs. In Atta leafcutter ants, queens have multiple mates but never remate later...... in life, although they may live and produce fertilized eggs for several decades. The mating biology and life history of these ants therefore suggests that the major function of seminal fluid is to maximize sperm viability during copulation, sperm transfer, and initial sperm storage. We tested...

  3. Atividade inseticida de Eugenia uniflora L. e Melia azedarach L. sobre Atta laevigata Smith

    Directory of Open Access Journals (Sweden)

    Paulo Henrique Jung

    Full Text Available As formigas cortadeiras estão entre os principais insetos pragas das florestas plantadas brasileiras, causando danos econômicos desde a implantação até a sua colheita. Em razão das questões ambientais e da exigência da certificação florestal, métodos alternativos estão sendo desenvolvidos para o controle do gênero Atta. Neste sentido, o objetivo deste trabalho foi avaliar a atividade inseticida de pitangueira (Eugenia uniflora L. e cinamomo (Melia azedarach L. sobre soldados de Atta laevigatta Smith. Para tal, a partir de folhas, foram obtidos extratos pelos processos de decocção, infusão, maceração, extrato alcoólico e extração de óleo essencial, em diferentes concentrações. O óleo essencial de E. uniflora, nas concentrações de 1,25, 2,5 e 5%, apresentou potencial inseticida sobre soldados de A. laevigata, quando comparado às demais formas de obtenção. O extrato alcoólico de M. azedarach, a 10%, também apresentou potencial inseticida, podendo estes extratos serem testados em práticas de campo.

  4. Discovering the Giant Nest Architecture of Grass-Cutting Ants, Atta capiguara (Hymenoptera, Formicidae).

    Science.gov (United States)

    Forti, Luiz Carlos; Protti de Andrade, Ana Paula; Camargo, Roberto da Silva; Caldato, Nadia; Moreira, Aldenise Alves

    2017-03-28

    Atta capiguara is a grass-cutting ant species frequently found in Cerrado biome. However, little is known about the giant nest architecture of this ant. In this study, we investigated the architecture of three A. capiguara nests from a fragment of Cerrado in Botucatu, São Paulo, Brazil. Casts were made of the nests by filling them with cement to permit better visualization of internal structures such as chambers and tunnels. After excavation, the depth and dimensions (length, width, and height) of the chambers were measured. The results showed the shape of Atta capiguara nests consisting of mounds of loose soil with unique features resembling a conic section. The fungus chambers were found distant from the mound of loose soil and were spaced apart and distributed laterally at the soil profile. The waste chambers were located beneath the largest mound of loose soil. Both the fungus and waste chambers were separated and distant. Our study contributes to a better understanding of the so far unknown nest architecture of the grass-cutting ant A. capiguara .

  5. Revitalisasi Pendidikan Pemikiran Islam (Studi Kasus Pemikiran Al-Attas dan ISTAC Malaysia

    Directory of Open Access Journals (Sweden)

    Anton Ismunanto

    2016-06-01

    Full Text Available One of impressive definition from education is the art of humandevelopment. Humans are creatures that has many aspects, ormultidimensional. One of human’s potentials that can be developedis their opinion. Because truthfully, a human’s opinion impact on hisbeliefs, attitudes and actions. With right education worldview, aMuslim will be able to reproduce the ideas underlying the realizationof ‘the perfect human’ or ‘universal human’ as a destination for Highlevel of Islamic education. This Papers discuss the profile of SyedMuhammad Naquib al-Attas and the realization of his ideas aboutan Islamic university in the International Institute of Islamic Thoughtand Civilization (ISTAC, it found the superior intellectual of thefounder as well as the mastery in some fields of science, it impactson the quality of educational institutions which he founded. Whenthe idea of al-Attas is adopted to institution, the quality of collegephilosophy is very noticeable, such as in terms of curricula, courses,educator, architectural design both interior and exterior, also to thelibrary and publishing quality.

  6. Spatio-temporal permanence and plasticity of foraging trails in young and mature leaf-cutting ant colonies (Atta spp.)

    NARCIS (Netherlands)

    C. Kost (Christian); E.G. de Oliveira (Evandro); T.A. Knoch (Tobias); R. Wirth (Rainer)

    2005-01-01

    textabstractThe distribution and formation of foraging trails have largely been neglected as factors explaining harvesting patterns of leaf-cutting ants.We applied fractal analysis, circular, and conventional statistics to published and newly recorded trailmaps of seven Atta colonies focusing on

  7. Magnetic anisotropy and organization of nanoparticles in heads and antennae of neotropical leaf-cutter ants, Atta colombica

    Science.gov (United States)

    Oriented magnetic nanoparticles have been suggested as a good candidate for a magnetic sensor in ants. Behavioral evidence for a magnetic compass in Neotropical leafcutter ants, Atta colombica (Formicidae: Attini), motivated a study of the arrangement of magnetic particles in the ants’ four major bo...

  8. Atta (whole wheat flour) with multi-wholegrains: flour characterization, nutritional profiling and evaluation of chapati making quality.

    Science.gov (United States)

    Pande, Sayali; Sakhare, S D; Bhosale, M G; Haware, D J; Inamdar, A A

    2017-10-01

    Non-wheat grains, complementing the nutritional profile of wheat were utilized for the development of atta with multi-whole grains. Based on the dimensions, selected grains were segregated and the grinding techniques were applied for the production of multi whole grains flour. Multi whole grains flour was replaced with whole wheat flour to obtain five different formulations and further compared with control atta. With the increase in incorporation of the multi whole grain flours reduction in brightness (L*) from 79.73 to 78.47 and redness (a*) from 2.47 to 12.12 while the increase in yellowness (b*) was observed (12.10-12.70). Protein content increased from 13.44 to 14.83% while dietary fibre content was also found to be increased in all the formulations compared to control atta. Ash content, an indicator of mineral content showed an increasing trend with the increase in the level of non-wheat grains. Shear force required for tearing the chapatis at 0 h was observed to be in the range of 15.6 and 10.1 N and moisture content between 32.6 and 30.4%. Mineral analysis carried out for the 10% replacement showed an increase in the level of the estimated minerals. An overall eating quality of the chapatis was found to be acceptable up to 10% replacement compared to control atta chapati.

  9. Parasitoids of the endangered leafcutter ant Atta robusta Borgmeier in urban and natural areas

    Directory of Open Access Journals (Sweden)

    Diego S. Gomes

    2013-09-01

    Full Text Available Parasitoids of the endangered leafcutter ant Atta robusta Borgmeier in urban and natural areas. Hosts of parasitoids in urban areas may suffer from a double threat of habitat destruction by urbanization and parasitism pressure. Moreover, the parasitoids themselves might be at risk if they are specialists. Here, we studied whether Atta robusta (Hymenoptera, Formicidae, which is on the red list of Brazilian threatened species, suffers from higher parasitism pressure in an urban area compared to a natural one. In addition, we determined whether their specialist parasitoids, Eibesfeldtphora breviloba and Myrmosicarius exrobusta (Diptera, Phoridae, are in risk and evaluated whether they are influenced by habitat structure, temperature, humidity, ant traffic, and time of the day. The study was carried out in an urban park and in a natural protected area in the city of Rio de Janeiro. In each site we chose an open area and a closed area (forest and sampled nine nests in each area. We found that parasitism pressure was similar in urban and natural areas, with the same two parasitoid species present in both areas. The main difference was related to habitat structure, since M. exrobusta was mainly present in open areas while E. breviloba was almost exclusively found in closed areas. Myrmosicarius exrobusta was not present during the hottest midday times, and its abundance was negatively correlated to vapor pressure deficit. These results suggest that green areas can be an important component in efforts to conserve diversity in urban areas. However, the complexity of the habitats in those areas is a fundamental issue in designing urban parks.

  10. Diversity of Fungi Associated with Atta bisphaerica (Hymenoptera: Formicidae: The Activity of Aspergillus ochraceus and Beauveria bassiana

    Directory of Open Access Journals (Sweden)

    Myriam M. R. Ribeiro

    2012-01-01

    Full Text Available The grass-cutting ant Atta bisphaerica is one of the most serious pests in several pastures and crops in Brazil. Fungal diseases are a constant threat to these large societies composed of millions of closely related individuals. We investigated the occurrence of filamentous fungi associated with the ant A. bisphaerica in a pasture area of Viçosa, Minas Gerais State, Brazil. Several fungi species were isolated from forager ants, and two of them, known as entomopathogenic, Beauveria bassiana and Aspergillus ochraceus, were tested against worker ants in the laboratory. The two species were highly virulent, achieving 50 percent worker mortality within 4-5 days. It is the first time A. ochraceus, a commonly found fungal species, is reported to infect Atta species at a high prevalence. Possible uses for the fungus within biological control are discussed.

  11. Self-restraint and sterility in workers of Acromyrmex and Atta leafcutter ants

    DEFF Research Database (Denmark)

    Dijkstra, Michiel Bendert; Nash, David Richard; Boomsma, Jacobus Jan

    2005-01-01

    eggs, but a few (mostly small and medium workers that form a retinue around the queen) lay many trophic eggs for consumption by the queen. These eggs are large, flaccid, and lacking in yolk compared to queen-laid eggs, and appear to be always inviable. In Acromyrmex, many workers (especially young...... large workers) lay eggs that are similar in size to queen-laid eggs, but mostly with a reduced amount of yolk. Trophic eggs appear to be an important source of food for larvae in Acromyrmex (especially in Ac. echinatior), but not in Atta. Five (0.8) of 616 dissected Ac. echinatior workers but no Ac......Queens of leafcutter ants (Acromyrmex and Atta) are highly multiply mated, resulting in a potential queenworker and worker-worker conflict over who should produce the males in the colony. We studied whether this conflict is expressed, by determining the amount of reproductive egg-laying by workers...

  12. Fungus gardens of the leafcutter ant Atta colombica function as egg nurseries for the snake Leptodeira annulata

    DEFF Research Database (Denmark)

    Baer, Boris; Den Boer, Susanne Petronella A; Kronauer, Daniel

    2009-01-01

    Attine ants are well known for their mutualistic symbiosis with fungus gardens, but many other symbionts and commensals have been described. Here, we report the discovery of two clusters of large snake eggs in neighboring fungus gardens of a mature Atta colombica colony. The eggs were completely...... embedded within the fungus garden and were ignored by the host ants, even when we placed them into another, freshly excavated fungus garden of the same colony. All five eggs contained embryos and two snakes eventually hatched, which we identified as being banded cat eyed snakes Leptodeira annulata L. Ant...... fungus gardens are likely to provide ideal climatic conditions for developing snake eggs and almost complete protection from egg predation. Our observations therefore indicate that mature banded cat eyed snakes are able to enter and oviposit in large and well defended Atta colonies without being attacked...

  13. Expressed sequence tags from Atta laevigata and identification of candidate genes for the control of pest leaf-cutting ants.

    Science.gov (United States)

    Rodovalho, Cynara M; Ferro, Milene; Fonseca, Fernando Pp; Antonio, Erik A; Guilherme, Ivan R; Henrique-Silva, Flávio; Bacci, Maurício

    2011-06-17

    Leafcutters are the highest evolved within Neotropical ants in the tribe Attini and model systems for studying caste formation, labor division and symbiosis with microorganisms. Some species of leafcutters are agricultural pests controlled by chemicals which affect other animals and accumulate in the environment. Aiming to provide genetic basis for the study of leafcutters and for the development of more specific and environmentally friendly methods for the control of pest leafcutters, we generated expressed sequence tag data from Atta laevigata, one of the pest ants with broad geographic distribution in South America. The analysis of the expressed sequence tags allowed us to characterize 2,006 unique sequences in Atta laevigata. Sixteen of these genes had a high number of transcripts and are likely positively selected for high level of gene expression, being responsible for three basic biological functions: energy conservation through redox reactions in mitochondria; cytoskeleton and muscle structuring; regulation of gene expression and metabolism. Based on leafcutters lifestyle and reports of genes involved in key processes of other social insects, we identified 146 sequences potential targets for controlling pest leafcutters. The targets are responsible for antixenobiosis, development and longevity, immunity, resistance to pathogens, pheromone function, cell signaling, behavior, polysaccharide metabolism and arginine kynase activity. The generation and analysis of expressed sequence tags from Atta laevigata have provided important genetic basis for future studies on the biology of leaf-cutting ants and may contribute to the development of a more specific and environmentally friendly method for the control of agricultural pest leafcutters.

  14. An antifungal terpenoid defends a neotropical tree (Hymenaea) against attack by fungus-growing ants (Atta).

    Science.gov (United States)

    Hubbell, Stephen P; Wiemer, David F; Adejare, Adeboye

    1983-12-01

    Foragers of the leafcutting ant, Atta cephalotes L. (Formicidae, Attini) seldom or never attack many of the plant species available to them in nature. In the semideciduous forests of lowland Guanacaste Province, Costa Rica, one of the tree species seldom cut is Hymenaea courbaril L. (Leguminosae, Caesalpinioideae). We tested the hypothesis that this species is avoided by the ants because of the presence of ant-repellent secondary compounds in the leaves. A bioassay to test repellency of leaf extracts was developed to guide the chemical isolation of ant repellents, using a laboratory colony of Atta cephalotes.The presence of one or more extractable ant repellents was quickly demonstrated. Subsequent chemical isolation and identification revealed that there was essentially only one terpenoid responsible for the repellency: caryophyllene epoxide. Tests with a concentration series of the pure compound demonstrated that the natural concentration of this terpenoid in Hymenaea could fully account for the observed repellency of intact leaves. Field bioassays of the terpenoid in Costa Rica confirmed this result; leaves of a preferred species, Spondias purpurea L. (Anacardiaceae), became as repellent as Hymenaea leaves when treated with caryophyllene epoxide at natural Hymenaea leaf concentrations. Repellency of the epoxide was 20 times greater than that of caryophyllene, its sesquiterpene hydrocarbon precursor, which is also found in Hymenaea leaves.Attine ants cut leaves to serve as substrate for culturing a specific fungus for food, principally for their larvae. A reasonable hypothesis is that these ants selectively avoid plant species whose leaves contain compounds which are toxic to their fungus. We tested caryophyllene epoxide for antifungal activity and found that it is an extremely potent compound, not only against the attine fungus, but other fungi as well. We speculate that many of the other plant species avoided by these ants in nature may be similarly protected

  15. Hormigas zompopas (Atta cephalotes influyen positivamente en la biodiversidad vegetal de bosques húmedos tropicales

    Directory of Open Access Journals (Sweden)

    Javier Ruiz

    2010-08-01

    Full Text Available REALIZAMOS OBSERVACIONES DE LA HISTORIA NATURAL DE LA HORMIGA ZOMPOPA (Atta cephalotes en el período de 1995 a 2010. Monitoreamos una población de hormigas zompopas en 2003 y realizamos experimentos de campo en 2006 en el bosque húmedo tropical de la Estación Biológica La Unión en Nicaragua. Los nidos de hormiga zompopa fueron mapeados dentro de una parcela permanente de 6.5 hectáreas. Se estimó lacomposición de especies vegetales en el área del nido de la hormiga, y se realizó un conteo de plántulas dicotiledóneas y plántulas de palmas (monocotiledóneas. Los resultados indican que las hormigas zompopas prefieren defoliar plántulas de especies dicotiledóneas,favoreciendo la regeneración de palmas sobre el nido de las hormigas. Las zompopas favorecen la regeneración de palmas en áreas donde ellas establecen el montículo principal de sus nidos. En el artículo se discuten las implicaciones de estos resultados para la dinámicade la regeneración en bosques húmedos tropicales.

  16. Vegetation Changes in a Native Forest Produced by Atta vollenweideri Forel 1893 (Hymenoptera: Formicidae) Nests.

    Science.gov (United States)

    Sabattini, J A; Sabattini, R A; Cian, J C; Sabattini, I A

    2017-03-31

    Herbivory is an important factor to generate spatial mosaics with variations in a plant community composition and organization. The objective of this work was to determine the impact of Atta vollenweideri Forel 1893 nests on herbaceous and shrub vegetation in a degraded native forest of the Espinal ecoregion. The study was carried out in the Protected Area and Multiple Use Nature Reserve called Estancia "El Carayá" (Entre Ríos, Argentina). Ten A. vollenweideri nests were selected by simple random sampling through internal roads, and two transects were drawn from the center of the nest (0 m) up to 60 m away in opposite directions. The line intercept method was used to quantify the percentage of vegetation cover of herbaceous and shrub species, while the floristic composition was estimated by the Canfield method. Afterwards, a nonparametric test between positions and a conglomerate analysis to evaluated distance were applied. Grass species, legumes, and sedges fell in the adjacent areas to nests, highlighting the bare soil at the crest and base of the nests. Fifteen plant species were identified, and two families correspond to monocotyledonous and dicotyledonous species. In conclusion, the nests of A. vollenweideri affect the community of herbaceous and shrub vegetation of the studied degraded native forest of the Espinal ecoregion since these ants perform a high selection of herbaceous species considered as pioneers of plant successions.

  17. KONSEP PENDIDIKAN ISLAM DAN TANTANGANNYA MENURUT SYED MUHAMMAD NAQUIB AL-ATTAS

    Directory of Open Access Journals (Sweden)

    Andi Wiratama

    2011-06-01

    Full Text Available Pendidikan adalah aspek terpenting bagi kehidupanmanusia. Dengan pendidikan manusia diharapkan menjadi esensiyang beradab, berlaku adil, bijak, dan menjunjung tinggi realitaskebenaran. Sebaliknya, tanpa pendidikan, ia akan menjadi dzalim,arogan dan menentang kebenaran, atau dalam kata lain, tetapdalam ke-insanan-nya yang banyak salah dan lupa. Untuk itu,pendidikan yang dilakukan dengan benar dan tepat yangmerupakan kebutuhan primer manusia akan membawa kepadaperbaikan tatanan kehidupan manusia baik individu maupunkelompok.Akan tetapi pendidikan dewasa ini lebih diorientasikankepada upaya untuk mencetak pekerja yang memiliki intelektualdan skill dalam segala bidang. Sehingga menjadikan pendidikanhanya sebatas proses transfer ilmu dan kemampuan saja tanpamemperhatikan penanaman nilai dalam diri anak didik. Nilai(values yang merupakan esensi pokok dalam proses pendidikanterabaikan begitu saja. Hal tersebut banyak dipengaruhi olehadanya westernisasi ilmu pengetahuan yang dipelopori olehBarat dan telah mengikis system pendidikan yang mengedepankannilai sebagai hasil dari proses pendidikan. Oleh Karena ituulama muslim Syed Naquib Al-Attas menawarkan suatu bentukislamisasi ilmu pengetahuan dengan konsep ta’dib sebagai prosespenempatan anak didik pada tempatnya, yaitu pada puncakmoral, adab, dan etika. Ini merupakan usaha untuk mengembalikanpendidikan kepada tujuannya yang hakiki.

  18. Coffee farm diversity and landscape features influence density of colonies of Atta cephalotes (Hymenoptera: Formicidae).

    Science.gov (United States)

    Varón, Edgar; Eigenbrode, Sanford D; Bosque-Pérez, Nilsa A; Hilje, Luko; Jones, Jeffrey

    2011-02-01

    The density of colonies of leaf-cutting ants, Atta cephalotes L. (Hymenoptera: Formicidae), was measured and compared among coffee (Coffea arabica L.) plantations in five management categories: monoculture conventional, diversified conventional, diversified organic, highly diversified conventional, and highly diversified organic. Twenty-four small farms (farm and off-farm (landscape) variables were measured and tested for their relationship with A. cephalotes colony density. Total ant colony density (colonies per ha) and density of new colonies shortly after a nuptial flight were significantly greater in the coffee monoculture conventional system, compared with all other systems. Total ant colony density and density of new colonies were inversely related to percentage of shade within the farms. Within farms, colony density was greater near edges adjacent to riparian forest than those adjacent to nonforested land. Regardless of edge type, plots closer to the edge (0-30 m) had greater colony density than those furthest from the edge. At the landscape scale, density of new colonies was positively related to fallow land use coverage within a 2,000-m buffer radius and to forest coverage within a 500-m radius. Results indicate that coffee farm management practices and landscape level factors can affect A. cephalotes colony densities. Understanding such practices and factors could assist in the development of better management methods of these injurious insects in coffee farms. Increased diversification in coffee farms, possibly due to the greater shade associated with it, may reduce colonization by the ants, which are considered forest gap specialists.

  19. Expressed sequence tags from Atta laevigata and identification of candidate genes for the control of pest leaf-cutting ants

    Directory of Open Access Journals (Sweden)

    Henrique-Silva Flávio

    2011-06-01

    Full Text Available Abstract Background Leafcutters are the highest evolved within Neotropical ants in the tribe Attini and model systems for studying caste formation, labor division and symbiosis with microorganisms. Some species of leafcutters are agricultural pests controlled by chemicals which affect other animals and accumulate in the environment. Aiming to provide genetic basis for the study of leafcutters and for the development of more specific and environmentally friendly methods for the control of pest leafcutters, we generated expressed sequence tag data from Atta laevigata, one of the pest ants with broad geographic distribution in South America. Results The analysis of the expressed sequence tags allowed us to characterize 2,006 unique sequences in Atta laevigata. Sixteen of these genes had a high number of transcripts and are likely positively selected for high level of gene expression, being responsible for three basic biological functions: energy conservation through redox reactions in mitochondria; cytoskeleton and muscle structuring; regulation of gene expression and metabolism. Based on leafcutters lifestyle and reports of genes involved in key processes of other social insects, we identified 146 sequences potential targets for controlling pest leafcutters. The targets are responsible for antixenobiosis, development and longevity, immunity, resistance to pathogens, pheromone function, cell signaling, behavior, polysaccharide metabolism and arginine kynase activity. Conclusion The generation and analysis of expressed sequence tags from Atta laevigata have provided important genetic basis for future studies on the biology of leaf-cutting ants and may contribute to the development of a more specific and environmentally friendly method for the control of agricultural pest leafcutters.

  20. Metarhizium anisopliae y trichoderma viride controlan colonias de atta cephalotes en campo mejor que un insecticida químico

    OpenAIRE

    López Arismendy, Elkin; Orduz Peralta, Sergio

    2011-01-01

    Las hormigas cortadoras de hojas Atta cephalotes son una plaga economicamente importante en la agricultura. Estas hormigas utilizan el material cortado para cultivar un hongo del cual se alimentan. En este estudio se aplicaron cebos basados en el hongo entorno patógeno Metarhizium anisopliae cepa M-137, Trichoderma uiride cepa T-26 antagonista del hongo simbionte de A. Cephalotes, y una combinación de ambos hongos, para el control de colonias de A. cephalotes en campo. Además, se compare la a...

  1. Chemical and behavioural studies of the trail-following pheromone in the leaf-cutting ant Atta opaciceps, Borgmeier (Hymenoptera: Formicidae)

    Czech Academy of Sciences Publication Activity Database

    Campos, R. S.; Mendonca, A. L.; Cabral Jr, C. R.; Vaníčková, Lucie; do Nascimento, R. R.

    2016-01-01

    Roč. 86, Mar (2016), s. 25-31 ISSN 0022-1910 Institutional support: RVO:61388963 Keywords : venom gland * trail pheromone * two-dimensional gas chromatography * leaf- cutting ants Atta sp. Subject RIV: ED - Physiology Impact factor: 2.227, year: 2016

  2. A new genus and species of Macrochelidae (Acari:Mesostigmata) associated with the Texas leaf cutting ant, Atta texana (Buckley) in Louisiana, USA

    Science.gov (United States)

    Gerald W. Krantz; John Moser

    2012-01-01

    Adults and nymphs of a new genus and species of the family Macrochelidae are described from detritus cavities of the leaf-cutting ant, Atta texana. This new species is notable in having peritremes with no posterior loop, a series of small subterminal teeth on the fixed cheliceral digit rather than the single large tooth typical of other macrochelids...

  3. Effect of the presence of brood and fungus on the nest architecture and digging activity of Acromyrmex subterraneus Forel (Hymenoptera, Formicidae

    Directory of Open Access Journals (Sweden)

    Carlos Magno dos Santos

    Full Text Available ABSTRACT This study investigated the stimuli that trigger digging behavior in Acromyrmex subterraneus during nest building. The hypothesis was that the presence of the fungus garden and/or brood triggers the excavation of tunnels and chambers. For the experiment, the excavation rate of individually marked workers kept in plastic cylinders filled with soil was recorded. Four treatments were applied: (1 30 medium-sized workers, 5 g fungus garden and 30 brood items (larvae and pupae; (2 30 medium-sized workers and 5 g fungus garden; (3 30 medium-sized workers and 30 brood items; (4 30 medium-sized workers without fungus and brood. After 24 h, morphological parameters of nest structure (length and width of the chambers and tunnels in cm and the volume of excavated soil were recorded. In contrast to the expected findings, no change in morphological structure, rate of excavation by workers, or volume of excavated soil was observed between treatments, except for tunnel width, which was greater, when no brood or fungus garden was present. Thus, the results do not support the hypothesis that the fungus garden and/or brood are local stimuli for nest excavation or that they mold the internal architecture of the nest. Although this hypothesis was confirmed for Acromyrmex lundii and Atta sexdens rubropilosa, the same does not apply to A. subterraneus. The digging behavior of workers is probably the result of adaptation during nest building in different habitats.

  4. Rapid shifts in Atta cephalotes fungus-garden enzyme activity after a change in fungal substrate (Attini, Formicidae)

    DEFF Research Database (Denmark)

    Kooij, P W; Schiøtt, M; Boomsma, J J

    2011-01-01

    Fungus gardens of the basidiomycete Leucocoprinus gongylophorus sustain large colonies of leaf-cutting ants by degrading the plant material collected by the ants. Recent studies have shown that enzyme activity in these gardens is primarily targeted toward starch, proteins and the pectin matrix...... associated with cell walls, rather than toward structural cell wall components such as cellulose and hemicelluloses. Substrate constituents are also known to be sequentially degraded in different sections of the fungus garden. To test the plasticity in the extracellular expression of fungus-garden enzymes......, we measured the changes in enzyme activity after a controlled shift in fungal substrate offered to six laboratory colonies of Atta cephalotes. An ant diet consisting exclusively of grains of parboiled rice rapidly increased the activity of endo-proteinases and some of the pectinases attacking...

  5. The mitochondrial genome of the leaf-cutter ant Atta laevigata: a mitogenome with a large number of intergenic spacers.

    Directory of Open Access Journals (Sweden)

    Cynara de Melo Rodovalho

    Full Text Available In this paper we describe the nearly complete mitochondrial genome of the leaf-cutter ant Atta laevigata, assembled using transcriptomic libraries from Sanger and Illumina next generation sequencing (NGS, and PCR products. This mitogenome was found to be very large (18,729 bp, given the presence of 30 non-coding intergenic spacers (IGS spanning 3,808 bp. A portion of the putative control region remained unsequenced. The gene content and organization correspond to that inferred for the ancestral pancrustacea, except for two tRNA gene rearrangements that have been described previously in other ants. The IGS were highly variable in length and dispersed through the mitogenome. This pattern was also found for the other hymenopterans in particular for the monophyletic Apocrita. These spacers with unknown function may be valuable for characterizing genome evolution and distinguishing closely related species and individuals. NGS provided better coverage than Sanger sequencing, especially for tRNA and ribosomal subunit genes, thus facilitating efforts to fill in sequence gaps. The results obtained showed that data from transcriptomic libraries contain valuable information for assembling mitogenomes. The present data also provide a source of molecular markers that will be very important for improving our understanding of genomic evolutionary processes and phylogenetic relationships among hymenopterans.

  6. The genome sequence of the leaf-cutter ant Atta cephalotes reveals insights into its obligate symbiotic lifestyle.

    Directory of Open Access Journals (Sweden)

    Garret Suen

    2011-02-01

    Full Text Available Leaf-cutter ants are one of the most important herbivorous insects in the Neotropics, harvesting vast quantities of fresh leaf material. The ants use leaves to cultivate a fungus that serves as the colony's primary food source. This obligate ant-fungus mutualism is one of the few occurrences of farming by non-humans and likely facilitated the formation of their massive colonies. Mature leaf-cutter ant colonies contain millions of workers ranging in size from small garden tenders to large soldiers, resulting in one of the most complex polymorphic caste systems within ants. To begin uncovering the genomic underpinnings of this system, we sequenced the genome of Atta cephalotes using 454 pyrosequencing. One prediction from this ant's lifestyle is that it has undergone genetic modifications that reflect its obligate dependence on the fungus for nutrients. Analysis of this genome sequence is consistent with this hypothesis, as we find evidence for reductions in genes related to nutrient acquisition. These include extensive reductions in serine proteases (which are likely unnecessary because proteolysis is not a primary mechanism used to process nutrients obtained from the fungus, a loss of genes involved in arginine biosynthesis (suggesting that this amino acid is obtained from the fungus, and the absence of a hexamerin (which sequesters amino acids during larval development in other insects. Following recent reports of genome sequences from other insects that engage in symbioses with beneficial microbes, the A. cephalotes genome provides new insights into the symbiotic lifestyle of this ant and advances our understanding of host-microbe symbioses.

  7. Harsh Working Conditions and Poor Eating Habits: Health-Related Concerns of Female Head Porters (Kayayei in the Mallam Atta Market, Accra, Ghana

    Directory of Open Access Journals (Sweden)

    Samuel Harrenson Nyarko

    2018-01-01

    Full Text Available Background. The kaya business is known to pose significant health-related risks to female migrants. This study sought to explore the health-related concerns of female head porters in the Mallam Atta market, Accra, Ghana. Methods. A qualitative study was conducted in which twenty female head porters at the Mallam Atta market in Accra were interviewed. A thematic analysis was performed and the emerging themes were presented and supported with quotations from the respondents. Results. Poor accommodation and eating habits, harsh working conditions, and lack of knowledge about health conditions exposed the respondents to several health-related concerns like neck pains, skin rashes, malaria, cholera, and stomach ache among other infections. The popular means of seeking health care was through purchasing drugs from pharmacies or drug peddlers instead of health facilities. Financial constraints, lack of faith in the National Health Insurance Scheme, and long waiting periods at the health facilities militated against seeking appropriate health care at the hospitals and clinics. Conclusion. Political willpower needs to be strengthened for poverty reduction strategies such as training of hairdressing, dress and soap making, and shea butter processing for women from the Northern regions in order to ameliorate their livelihoods and/or reduce migration to the south.

  8. Leaf density and a trade-off between load-size selection and recruitment behavior in the ant Atta cephalotes.

    Science.gov (United States)

    Roces, Flavio; Hölldobler, Bert

    1994-02-01

    This study considers the interplay between individual load-size selection and recruitment behavior in the leaf-cutting ant Atta cephalotes. Foraging workers anchor themselves on the leaf edge by their hind legs and pivot around them while cutting arcs from leaves. Since workers not only cut leaves but also lay chemical trails to recruit nestmates, we investigated whether there is conflict of motivation affecting the workers' decision either to quickly inform nestmates about a newly discovered food source, or instead to cut full-load leaf fragments, which could delay recruitment. Workers were presented with leaves of privet of three different grades of toughness (measured as leaf density=mass/area) as sources of different quality, and load-size selection and recruitment behavior by harvesting-satiated and harvesting-deprived workers were measured. The following results were obtained. (1) Leaf density affected individual load-size selection: both harvesting-satiated and harvesting-deprived workers were found to cut smaller leaf fragments from the denser leaves. (2) Harvesting-deprived workers cut smaller fragments than harvesting-satiated workers, and therefore saved cutting time. The fragments cut were smaller only during the initial phases of the recruitment process, when information about the discovery needed to be transferred. (3) Harvesting-deprived workers showed higher recruitment rates than harvesting-satiated workers. A considerable number of ants were observed to return to the nest unladen. During the initial phases, the ratio of laden/unladen workers was lower than that for harvesting-satiated workers, and increased with the development of the tograging process. (4) Scout workers confronted with familiar leaves ran back to the nest laying chemical trails without even contacting the leaves. They relied on olfactory cues to start recruiting nestmates, and leaf density played no role in their decisions. (5) When confronted with unfamiliar leaves, on the other

  9. Espécies de formigas que interagem com as sementes de Mabea fistulifera Mart. (Euphorbiaceae Interaction between ant species and seeds of Mabea fistulifera Mart. (Euphorbiaceae

    Directory of Open Access Journals (Sweden)

    Ethel Fernandes de Oliveira Peternelli

    2004-10-01

    Full Text Available As formigas, quando atraídas por um apêndice nutritivo, produzido na semente de certas plantas, podem exercer o papel de agente predador ou dispersor das sementes. No processo de dispersão, grande número desses insetos pode interagir com sementes de determinada planta. O objetivo deste trabalho foi identificar as espécies de formigas em contato com sementes de Mabea fistulifera Mart. - uma espécie arbórea e colonizadora em áreas antrópicas no Brasil - e o tipo de interação desses insetos com as sementes, bem como determinar as espécies dispersoras. Foram realizadas coletas manuais de formigas em fragmentos de vegetação com alta densidade de M. fistulifera, no município de Viçosa, MG, no momento de sua visitação às sementes. As formigas capturadas foram triadas e identificadas por espécie. Além disso, durante as coletas foram feitas observações quanto ao tipo de comportamento das formigas que se associaram às sementes e ao cálculo da taxa de remoção destas, verificando-se que 16 espécies tiveram contato com estas. Acromyrmex subterraneus subterraneus, Atta sexdens rubropilosa, Ectatomma edentatum, Pachycondyla sp.1 e Pheidole sp. 2 foram, de fato, dispersoras, já que transportaram efetivamente as sementes. Ac. subterraneus subterraneus, Camponotus rufipes, Ectatomma permagnum, Megalomyrmex sp.1, Pachycondyla sp. 1, Pachycondyla sp. 2, Pheidole sp. 4, Pheidole sp. 5 e Pogonomyrmex sp. são, pela primeira vez, relatadas interagindo com sementes. A taxa de remoção das sementes de M. fistulifera pelas formigas foi de 85 a 97%.Ants, when attracted by nutritious corpuscles produced by seeds of certain plant species, can act as predators or dispersing agents. During seed dispersal, a great number of ant species can interact with seeds of a particular plant species. The purpose of this study was to identify the ant species that interact with seeds of Mabea fistulifera Mart., a pioneer tree species in anthropic disturbed

  10. MODELO CONCEPTUAL DEL PAPEL ECOLÓGICO DE LA HORMIGA ARRIERA (Atta laevigata EN LOS ECOSISTEMAS DE SABANA ESTACIONAL (VICHADA, COLOMBIA

    Directory of Open Access Journals (Sweden)

    CORTÉS-PÉREZ FRANCISCO

    2003-12-01

    Full Text Available Se presentan algunos aspectos del ciclo de vida de la hormiga arriera Atta laevigata,en especial el vuelo nupcial, con notas ecológicas de interés, el perfil modal desuelos afectados por la actividad de las arrieras y se analiza su contenido denutrientes. Se detalla el funcionamiento y la estructura de las colonias de arrierascon especial énfasis en el transporte y la acumulación de nutrientes y semillas en lossitios de establecimiento de la colonia; se explica el establecimiento de las matas demonte a partir de estos sitios ricos en nutrientes y semillas. Con base en estosaspectos se plantea un modelo funcional del papel que cumplen las colonias dearrieras en los ecosistemas de sabana estacional.

  11. Specificity in chemical profiles of workers, brood and mutualistic fungi in Atta, Acromyrmex, and Sericomyrmex fungus-growing ants

    DEFF Research Database (Denmark)

    Richard, Freddie-Jeanne; Poulsen, Michael; Drijfhout, Falko

    2007-01-01

    Neotropical attine ants live in obligatory symbiosis with a fungus that they grow for food on a substrate of primarily plant material harvested by workers. Nestmate recognition is likely based on chemical cues as in most other social insects, but recent studies have indicated that both the ants...... attine ants: Atta colombica, Acromyrmex echinatior, and Sericomyrmex amabilis. The relative proportions of identified compounds were compared and represented 11 classes: n-alkanes, alkenes, branched methylalkanes, branched dimethylalkanes, trimethylalkanes, branched alkenes, aldehydes, alcohols, acetates...... compounds being derived from the ants, the ant brood, or the fungal symbiont are discussed. We hypothesize that hydrocarbons are particularly important as recognition cues because they appear to simultaneously allow the assessment of developmental stages and the identification of symbiont, colony...

  12. Recognition of endophytic Trichoderma species by leaf-cutting ants and their potential in a Trojan-horse management strategy

    Science.gov (United States)

    Rocha, Silma L.; Evans, Harry C.; Jorge, Vanessa L.; Cardoso, Lucimar A. O.; Pereira, Fernanda S. T.; Rocha, Fabiano B.; Barreto, Robert W.; Hart, Adam G.

    2017-01-01

    Interactions between leaf-cutting ants, their fungal symbiont (Leucoagaricus) and the endophytic fungi within the vegetation they carry into their colonies are still poorly understood. If endophytes antagonistic to Leucoagaricus were found in plant material being carried by these ants, then this might indicate a potential mechanism for plants to defend themselves from leaf-cutter attack. In addition, it could offer possibilities for the management of these important Neotropical pests. Here, we show that, for Atta sexdens rubropilosa, there was a significantly greater incidence of Trichoderma species in the vegetation removed from the nests—and deposited around the entrances—than in that being transported into the nests. In a no-choice test, Trichoderma-infested rice was taken into the nest, with deleterious effects on both the fungal gardens and ant survival. The endophytic ability of selected strains of Trichoderma was also confirmed, following their inoculation and subsequent reisolation from seedlings of eucalyptus. These results indicate that endophytic fungi which pose a threat to ant fungal gardens through their antagonistic traits, such as Trichoderma, have the potential to act as bodyguards of their plant hosts and thus might be employed in a Trojan-horse strategy to mitigate the negative impact of leaf-cutting ants in both agriculture and silviculture in the Neotropics. We posit that the ants would detect and evict such ‘malign’ endophytes—artificially inoculated into vulnerable crops—during the quality-control process within the nest, and, moreover, that the foraging ants may then be deterred from further harvesting of ‘Trichoderma-enriched’ plants. PMID:28484603

  13. Recognition of endophytic Trichoderma species by leaf-cutting ants and their potential in a Trojan-horse management strategy.

    Science.gov (United States)

    Rocha, Silma L; Evans, Harry C; Jorge, Vanessa L; Cardoso, Lucimar A O; Pereira, Fernanda S T; Rocha, Fabiano B; Barreto, Robert W; Hart, Adam G; Elliot, Simon L

    2017-04-01

    Interactions between leaf-cutting ants, their fungal symbiont (Leucoagaricus) and the endophytic fungi within the vegetation they carry into their colonies are still poorly understood. If endophytes antagonistic to Leucoagaricus were found in plant material being carried by these ants, then this might indicate a potential mechanism for plants to defend themselves from leaf-cutter attack. In addition, it could offer possibilities for the management of these important Neotropical pests. Here, we show that, for Atta sexdens rubropilosa, there was a significantly greater incidence of Trichoderma species in the vegetation removed from the nests-and deposited around the entrances-than in that being transported into the nests. In a no-choice test, Trichoderma-infested rice was taken into the nest, with deleterious effects on both the fungal gardens and ant survival. The endophytic ability of selected strains of Trichoderma was also confirmed, following their inoculation and subsequent reisolation from seedlings of eucalyptus. These results indicate that endophytic fungi which pose a threat to ant fungal gardens through their antagonistic traits, such as Trichoderma, have the potential to act as bodyguards of their plant hosts and thus might be employed in a Trojan-horse strategy to mitigate the negative impact of leaf-cutting ants in both agriculture and silviculture in the Neotropics. We posit that the ants would detect and evict such 'malign' endophytes-artificially inoculated into vulnerable crops-during the quality-control process within the nest, and, moreover, that the foraging ants may then be deterred from further harvesting of 'Trichoderma-enriched' plants.

  14. Ants can learn to forage on one-way trails.

    Directory of Open Access Journals (Sweden)

    Pedro Leite Ribeiro

    Full Text Available The trails formed by many ant species between nest and food source are two-way roads on which outgoing and returning workers meet and touch each other all along. The way to get back home, after grasping a food load, is to take the same route on which they have arrived from the nest. In many species such trails are chemically marked by pheromones providing orientation cues for the ants to find their way. Other species rely on their vision and use landmarks as cues. We have developed a method to stop foraging ants from shuttling on two-way trails. The only way to forage is to take two separate roads, as they cannot go back on their steps after arriving at the food or at the nest. The condition qualifies as a problem because all their orientation cues -- chemical, visual or any other -- are disrupted, as all of them cannot but lead the ants back to the route on which they arrived. We have found that workers of the leaf-cutting ant Atta sexdens rubropilosa can solve the problem. They could not only find the alternative way, but also used the unidirectional traffic system to forage effectively. We suggest that their ability is an evolutionary consequence of the need to deal with environmental irregularities that cannot be negotiated by means of excessively stereotyped behavior, and that it is but an example of a widespread phenomenon. We also suggest that our method can be adapted to other species, invertebrate and vertebrate, in the study of orientation, memory, perception, learning and communication.

  15. The Postpharyngeal Gland: Specialized Organ for Lipid Nutrition in Leaf-Cutting Ants.

    Directory of Open Access Journals (Sweden)

    Pâmela Decio

    Full Text Available There are several hypotheses about the possible functions of the postpharyngeal gland (PPG in ants. The proposed functions include roles as cephalic or gastric caeca and diverticulum of the digestive tract, mixing of hydrocarbons, nestmate recognition, feeding larvae, and the accumulation of lipids inside this gland, whose origin is contradictory. The current study aimed to investigate the functions of these glands by examining the protein expression profile of the PPGs of Atta sexdens rubropilosa (Hymenoptera, Formicidae. Mated females received lipid supplementation and their glands were extracted and analyzed using a proteomic approach. The protocol used combined two-dimensional electrophoresis and shotgun strategies, followed by mass spectrometry. We also detected lipid β-oxidation by immunofluorescent marking of acyl-CoA dehydrogenase. Supplying ants with lipids elicited responses in the glandular cells of the PPG; these included increased expression of proteins related to defense mechanisms and signal transduction and reorganization of the cytoskeleton due to cell expansion. In addition, some proteins in PPG were overexpressed, especially those involved in lipid and energy metabolism. Part of the lipids may be reduced, used for the synthesis of fatty alcohol, transported to the hemolymph, or may be used as substrate for the synthesis of acetyl-CoA, which is oxidized to form molecules that drive oxidative phosphorylation and produce energy for cellular metabolic processes. These findings suggest that this organ is specialized for lipid nutrition of adult leaf-cutting ants and characterized like a of diverticulum foregut, with the ability to absorb, store, metabolize, and mobilize lipids to the hemolymph. However, we do not rule out that the PPG may have other functions in other species of ants.

  16. Do leaf cutting ants cut undetected? Testing the effect of ant-induced plant defences on foraging decisions in Atta colombica.

    Science.gov (United States)

    Kost, Christian; Tremmel, Martin; Wirth, Rainer

    2011-01-01

    Leaf-cutting ants (LCAs) are polyphagous, yet highly selective herbivores. The factors that govern their selection of food plants, however, remain poorly understood. We hypothesized that the induction of anti-herbivore defences by attacked food plants, which are toxic to either ants or their mutualistic fungus, should significantly affect the ants' foraging behaviour. To test this "induced defence hypothesis," we used lima bean (Phaseolus lunatus), a plant that emits many volatile organic compounds (VOCs) upon herbivore attack with known anti-fungal or ant-repellent effects. Our results provide three important insights into the foraging ecology of LCAs. First, leaf-cutting by Atta ants can induce plant defences: Lima bean plants that were repeatedly exposed to foraging workers of Atta colombica over a period of three days emitted significantly more VOCs than undamaged control plants. Second, the level to which a plant has induced its anti-herbivore defences can affect the LCAs' foraging behaviour: In dual choice bioassays, foragers discriminated control plants from plants that have been damaged mechanically or by LCAs 24 h ago. In contrast, strong induction levels of plants after treatment with the plant hormone jasmonic acid or three days of LCA feeding strongly repelled LCA foragers relative to undamaged control plants. Third, the LCA-specific mode of damaging leaves allows them to remove larger quantities of leaf material before being recognized by the plant: While leaf loss of approximately 15% due to a chewing herbivore (coccinelid beetle) was sufficient to significantly increase VOC emission levels after 24 h, the removal of even 20% of a plant's leaf area within 20 min by LCAs did not affect its VOC emission rate after 24 h. Taken together, our results support the "induced defence hypothesis" and provide first empirical evidence that the foraging behaviour of LCAs is affected by the induction of plant defence responses.

  17. The construction of ventilation turrets in Atta vollenweideri leaf-cutting ants: Carbon dioxide levels in the nest tunnels, but not airflow or air humidity, influence turret structure.

    Science.gov (United States)

    Halboth, Florian; Roces, Flavio

    2017-01-01

    Nest ventilation in the leaf-cutting ant Atta vollenweideri is driven via a wind-induced mechanism. On their nests, workers construct small turrets that are expected to facilitate nest ventilation. We hypothesized that the construction and structural features of the turrets would depend on the colony's current demands for ventilation and thus might be influenced by the prevailing environmental conditions inside the nest. Therefore, we tested whether climate-related parameters, namely airflow, air humidity and CO2 levels in the outflowing nest air influenced turret construction in Atta vollenweideri. In the laboratory, we simulated a semi-natural nest arrangement with fungus chambers, a central ventilation tunnel providing outflow of air and an aboveground building arena for turret construction. In independent series, different climatic conditions inside the ventilation tunnel were experimentally generated, and after 24 hours, several features of the built turret were quantified, i.e., mass, height, number and surface area (aperture) of turret openings. Turret mass and height were similar in all experiments even when no airflow was provided in the ventilation tunnel. However, elevated CO2 levels led to the construction of a turret with several minor openings and a larger total aperture. This effect was statistically significant at higher CO2 levels of 5% and 10% but not at 1% CO2. The construction of a turret with several minor openings did not depend on the strong differences in CO2 levels between the outflowing and the outside air, since workers also built permeated turrets even when the CO2 levels inside and outside were both similarly high. We propose that the construction of turrets with several openings and larger opening surface area might facilitate the removal of CO2 from the underground nest structure and could therefore be involved in the control of nest climate in leaf-cutting ants.

  18. Leaf processing behaviour in Atta leafcutter ants: 90% of leaf cutting takes place inside the nest, and ants select pieces that require less cutting.

    Science.gov (United States)

    Garrett, Ryan W; Carlson, Katherine A; Goggans, Matthew Scott; Nesson, Michael H; Shepard, Christopher A; Schofield, Robert M S

    2016-01-01

    Leafcutter ants cut trimmings from plants, carry them to their underground nests and cut them into smaller pieces before inoculating them with a fungus that serves as a primary food source for the colony. Cutting is energetically costly, so the amount of cutting is important in understanding foraging energetics. Estimates of the cutting density, metres of cutting per square metre of leaf, were made from samples of transported leaf cuttings and of fungal substrate from field colonies of Atta cephalotes and Atta colombica. To investigate cutting inside the nest, we made leaf-processing observations of our laboratory colony, A. cephalotes. We did not observe the commonly reported reduction of the leaf fragments into a pulp, which would greatly increase the energy cost of processing. Video clips of processing behaviours, including behaviours that have not previously been described, are linked. An estimated 2.9 (±0.3) km of cutting with mandibles was required to reduce a square metre of leaf to fungal substrate. Only about 12% (±1%) of this cutting took place outside of the nest. The cutting density and energy cost is lower for leaf material with higher ratios of perimeter to area, so we tested for, and found that the laboratory ants had a preference for leaves that were pre-cut into smaller pieces. Estimates suggest that the energy required to transport and cut up the leaf material is comparable to the metabolic energy available from the fungus grown on the leaves, and so conservation of energy is likely to be a particularly strong selective pressure for leafcutter ants.

  19. Response of the grass-cutting ant Atta capiguara Gonçalves, 1944 (Hymenoptera: Formicidae to sugars and artificial sweeteners Resposta da saúva Atta capiguara Gonçalves, 1944 (Hymenoptera: Formicidae a açúcares e edulcorantes artificiais

    Directory of Open Access Journals (Sweden)

    Maria Aparecida Castellani Boaretto

    2003-01-01

    Full Text Available Using of toxic baits made of dehydrated citric pulp to control grass-cutting ants can lead to unsatisfactory results because of the low attractiveness of the substrate to worker ants. This work aimed to identify attractive substances, with potential for incorporation in a matrix of granulated baits for grass-cutting ants, among several kinds of sugars and substances used in artificial sweeteners. Experiments were carried out in mature nests of Atta capiguara (Hym.: Formicidae set in pasture. Studied substances were sucrose, fructose, soluble starch, raffinose, maltose, lactose, sorbose, cellobiose, arabinose, xylose, glucose, galactose, rhamnose, arabinose, melezitose, saccharine and cyclamate (at 5.0% w/v. Later, on maltose, xylose, sucrose, fructose and glucose solutions were included at 5.0%, 7.5%, 10.0% and 20.0% w/v, respectively. Cellulose rectangles were used as vehicle and number of rectangles carried into the colonies was evaluated. Carrying rates were very low with maximum means of 9.6% for lactose and 6.0% for arabinose and cyclamate, at the 5.0% concentration. No differences (P > 0.05 were observed relatively to the control (distilled water. No effects were detected for solution, concentration and for the interaction of these factors. Sugars and artificial sweeteners studied were not attractive to Atta capiguara workers, turning their inclusion as attractants in toxic ant baits not viable.O uso de iscas tóxicas, formuladas à base de polpa cítrica desidratada, para o controle de formigas cortadeiras de gramíneas pode levar a resultados insatisfatórios devido à baixa atratividade do substrato às operárias. Este trabalho foi realizado com o objetivo de identificar substâncias atrativas e com potencial para incorporação em matrizes de iscas granuladas para formigas cortadeiras de gramíneas, dentre diversos tipos de açúcares e edulcorantes artificiais. Os experimentos foram realizados em ninhos adultos de Atta capiguara Gon

  20. Improving urban visibility through fractal analysis of street edges: The case of John Evans Atta Mills High Street in Accra, Ghana

    Directory of Open Access Journals (Sweden)

    R.A. Oppong

    2017-06-01

    Full Text Available Streets are a representation of cities, and the image of a city is a reflection of its home country. Although attempts to ensure harmonious spatial and environmental development in Ghanaian settlements date back to the colonial era, these efforts have minimal physical manifestation in the urban fabric of the city of Accra. The Independence Arch of Ghana, an important landmark in the urban fabric and history of Accra, lacks the striking vista and approach it deserves. This paper introduces the use of fractal analysis of street edges to understand the characteristics of the John Evans Atta Mills (JEAM High Street for developing recommendations to improve visibility along its stretch and the overall image of the city. The box-counting method with visual survey was used in research. The pertinent questions this paper seeks to address are as follows: What factors affect the visibility and imageability of JEAM High Street? What design aspects should be considered to improve urban visibility along JEAM High Street? What is the link of fractals to urban design and architecture? The paper recommends various design considerations and qualities to improve the urban visibility and imageability of JEAM High Street.

  1. Evaluación de hongos entomopatógenos como potencial biocontrolador de la hormiga arriera atta colombica (g) del municipio de Lloró – Chocó (Colombia)

    OpenAIRE

    Mena Córdoba, Sandra Victoria

    2011-01-01

    La hormiga arriera ó cortadora de hojas (Atta colombica) son reconocidas como el principal limitante en la producción agrícola, forestal y ornamentales urbanos del departamento del Chocó. Una de las alternativas de manejo es el uso de insecticidas químicos, pero los problemas inherentes a este método, han llevado a buscar otros métodos de manejo. A partir de esto, nace la alternativa de seleccionar aislamientos nativos de hongos entomopatógenos y evaluar su acción sobre las hormigas cortadora...

  2. Soil Moisture and Excavation Behaviour in the Chaco Leaf-Cutting Ant (Atta vollenweideri): Digging Performance and Prevention of Water Inflow into the Nest

    Science.gov (United States)

    Pielström, Steffen; Roces, Flavio

    2014-01-01

    The Chaco leaf-cutting ant Atta vollenweideri is native to the clay-heavy soils of the Gran Chaco region in South America. Because of seasonal floods, colonies are regularly exposed to varying moisture across the soil profile, a factor that not only strongly influences workers' digging performance during nest building, but also determines the suitability of the soil for the rearing of the colony's symbiotic fungus. In this study, we investigated the effects of varying soil moisture on behaviours associated with underground nest building in A. vollenweideri. This was done in a series of laboratory experiments using standardised, plastic clay-water mixtures with gravimetric water contents ranging from relatively brittle material to mixtures close to the liquid limit. Our experiments showed that preference and group-level digging rate increased with increasing water content, but then dropped considerably for extremely moist materials. The production of vibrational recruitment signals during digging showed, on the contrary, a slightly negative linear correlation with soil moisture. Workers formed and carried clay pellets at higher rates in moist clay, even at the highest water content tested. Hence, their weak preference and low group-level excavation rate observed for that mixture cannot be explained by any inability to work with the material. More likely, extremely high moistures may indicate locations unsuitable for nest building. To test this hypothesis, we simulated a situation in which workers excavated an upward tunnel below accumulated surface water. The ants stopped digging about 12 mm below the interface soil/water, a behaviour representing a possible adaptation to the threat of water inflow field colonies are exposed to while digging under seasonally flooded soils. Possible roles of soil water in the temporal and spatial pattern of nest growth are discussed. PMID:24748382

  3. FORMULACIÓN DE GRÁNULOS BASES PARA LA INCORPORACIÓN DE INGREDIENTES ACTIVOS CON EFECTO BIOLÓGICO SOBRE EL HONGO SIMBIÓTICO CULTIVADO POR LAS HORMIGAS FORRAJERAS DEL GÉNERO Atta

    Directory of Open Access Journals (Sweden)

    Ena Edith Herrera

    2013-01-01

    Full Text Available Las hormigas forrajeras (Atta spp. pueden destruir plantaciones completas de hortalizas y de otras plantas de importancia económica en América Tropical y Subtropical. Cortan el tejido de las plantas y lo transportan a nidos subterráneos, donde cultivan un hongo del Phylum basidiomycota, que es su alimento principal. En la actualidad, no se cuenta con una estrategia efectiva de manejo de esta plaga. La mayoría de productos disponibles comercialmente son muy poco efectivos, dejan residuos en el ambiente y tienen un precio alto para los pequeños agricultores. La presente investigación se propuso evaluar diferentes ingredientes en la preparación de granulados que presenten alto nivel de acarreo y potencial para la incorporación de ingredientes activos con efecto biológico contra el hongo simbiótico que cultivan las hormigas forrajeras. Se prepararon gránulos con diferentes combinaciones y concentraciones de excipientes o coadyuvantes. Además se evaluó citropulpa, extracto alcohólico de cáscaras de naranja y aceite de semillas de naranja, como atrayentes. A los mejores formulados se incorporó extracto de Azadirachta indica (neem, 3 cepas de Trichoderma spp., y levaduras en diferentes concentraciones, para comprobar la compatibilidad de las formulaciones con ingredientes activos. Se evaluó diferentes características de los gránulos como indicadores de viabilidad y estabilidad del formulado. Se encontró que los cebos formulados con citropulpa son capaces de mantener estable la acidez y, además, conservan la viabilidad de Trichoderma spp., y levaduras por más tiempo que los formulados elaborados con extracto alcohólico de cáscaras de naranja como atrayente. Además, el gránulo base con citropulpa presentó un costo de producción más bajo. Se concluye que el formulado con citropulpa como atrayente es una base apropiada para la incorporación de ingredientes activos con efecto biológico contra el hongo simbiótico y tiene

  4. 918-IJBCS-Article-Dr Sanoussi Atta

    African Journals Online (AJOL)

    DR GATSING

    Tarawali SA, Singh BB, Gupta SC, Tabo R,. Harris F, Nokoe S, Fernandez-Rivera S,. Bationo A, Manyong VM, Makinde K,. Odion EC. 2002. Cowpea as a key factor for a new approach to integrated crop- livestock systems research in the dry savannas of West Africa. In Challenges and Opportunities for Enhancing.

  5. Diploid male production in a leaf-cutting ant

    DEFF Research Database (Denmark)

    Armitage, S.; Boomsma, J.; Baer, Boris

    2010-01-01

    1. In haplodiploid social insects where males are haploid and females are diploid, inbreeding depression is expressed as the production of diploid males when homozygosity at the sex-determining locus results in the production of diploid individuals with a male phenotype. Diploid males are often...... assumed to have reduced fitness compared with their haploid brothers. 2. While studying the reproductive biology of a leaf-cutting ant, Atta sexdens, in Gamboa, Republic of Panama, we detected the presence of a larger male morph. Using microsatellite markers we were able to confirm that the large male...... would be reduced compared with haploid males if they were able to copulate. 5. We conclude that diploid male production is likely to affect the fitness of A. sexdens queens with a matched mating, as these males are produced at the cost of workers and, if the colony survives to reach mature size, also...

  6. Essential Oil of Aristolochia trilobata: Synthesis, Routes of Exposure, Acute Toxicity, Binary Mixtures and Behavioral Effects on Leaf-Cutting Ants.

    Science.gov (United States)

    de Oliveira, Bruna Maria S; Melo, Carlisson R; Alves, Péricles B; Santos, Abraão A; Santos, Ane Caroline C; Santana, Alisson da S; Araújo, Ana Paula A; Nascimento, Pedro E S; Blank, Arie F; Bacci, Leandro

    2017-02-25

    Plants of the genus Aristolochia have been frequently reported as important medicinal plants. Despite their high bioactive potential, to date, there are no reports of their effects on leaf-cutting ants. Therefore, the present study aimed to evaluate the insecticidal activity of the essential oil of Aristolochia trilobata and its major components on Atta sexdens and Acromyrmex balzani, two species of leaf-cutting ants. The bioassays were performed regarding routes of exposure, acute toxicity, binary mixtures of the major components and behavioral effects. Twenty-five components were identified in the essential oil of A. trilobata using a gas chromatographic system equipped with a mass spectrometer and a flame ionization detector. The components found in higher proportions were sulcatyl acetate, limonene, p-cymene and linalool. The essential oil of A. trilobata and its individual major components were efficient against A. balzani and A. sexdens workers when applied by fumigation. These components showed fast and efficient insecticidal activity on ants. The components acted synergistically and additively on A. balzani and A. sexdens, respectively, and caused a strong repellency/irritability in the ants. Thus, our results demonstrate the great potential of the essential oil of A. trilobata and its major components for the development of new insecticides.

  7. Production Of Vitamin B 12 By Streptomyces Fulvissimus | Atta ...

    African Journals Online (AJOL)

    Fifty five of actinomycete isolates were screened for vitamin B12 production by growing on soybean meal medium fortified with cobalt. Only one AZ-Z-88 among nine actinomycete cultures was found to produce significantly higher yield of the vitamin B12 (64.57 ug/ml). Determination of vitamin B12 production was carried out ...

  8. A Reading of Kwame Nkrumah's Towards Colonial Freedom Atta

    African Journals Online (AJOL)

    imperialism that Lenin develops out of it. Theory. Frederick Engels, in a speech at the graveside of his life-long friend, political comrade and intellectual companion, Karl Marx, affirmed: 'mankind must first of all eat, drink, have shelter and clothing, before it can pursue politics, science, art, religion, etc.' (Engels, 1962, p. 167).

  9. Growth of symbiont fungi of some higher attine ants in mineral medium Crescimento do fungo simbionte de alguns attine superiores em meio mineral

    Directory of Open Access Journals (Sweden)

    Alci Enimar Loeck

    2004-02-01

    Full Text Available Bioassays were conducted to verify the possibility of culturing the symbiont fungus of some higher attine in mineral medium and finding out the optimum pH value for their satisfactory mycelial growth. Three organic media and one mineral medium were inoculated with isolates from Atta sexdens piriventris and Acromyrmex heyeri. In mineral medium different values of pH (4.0, 5.0, 6.0 and 7.0 were tested with isolates from A. laevigata and A. laticeps. The behavior of isolates (colony diameter was different in the mineral medium. However, even the one which grew the least of all provided enough mycelial for RAPD analysis. The best range of pH for fungal growth in mineral medium was between 4.0 and 5.0Foram conduzidos bioensaios para verificar a possibilidade de cultivar o fungo simbionte de alguns attine superiores em meio mineral e obter um valor de pH ótimo para o seu crescimento micelial. Três meios orgânicos e um meio mineral foram testados, avaliando-se o crescimento (diâmetro da colônia de isolados de fungos de Atta sexdens piriventris e Acromyrmex heyeri. No meio mineral, diferentes valores de pH (4,0, 5,0, 6,0 and 7,0 foram avaliados, por meio do mesmo parâmetro anterior, com isolados de fungos de A. laevigata e A. laticeps. No meio mineral, os isolados testados apresentaram crescimento diferenciado, entretanto mesmo aquele que menos cresceu, forneceu material suficiente para as análises de RAPD. No mesmo meio, verificou-se que a melhor faixa de pH para o crescimento micelial está entre 4,0 e 5,0.

  10. Foraging leaf-cutting ants learn to reject Vitis vinifera ssp. vinifera plants that emit herbivore-induced volatiles.

    Science.gov (United States)

    Thiele, Theresa; Kost, Christian; Roces, Flavio; Wirth, Rainer

    2014-06-01

    Leaf-cutting ants (LCAs) are dominant herbivores of the Neotropics, as well as economically important pests. Their foraging ecology and patterns/mechanisms of food selection have received considerable attention. Recently, it has been documented that LCAs exhibit a delayed rejection of previously accepted food plants following treatment with a fungicide that makes the plants unsuitable as substrate for their symbiotic fungus. Here, we investigated whether LCAs similarly reject plants with induced chemical defenses, by combining analysis of volatile emissions with dual-choice bioassays that used LCA subcolonies (Atta sexdens L.). On seven consecutive days, foraging ants were given the choice between leaf disks from untreated control plants and test plants of Vitis vinifera ssp. vinifera L. treated with the phytohormone jasmonic acid (JA) to mimic herbivore attack. Chemical analysis revealed the emission of a characteristic set of herbivore-induced volatile organic compounds (VOC) from JA-induced plants. Dual-choice experiments indicated that workers did not show any preference initially, but that they avoided JA-treated plants from day five onwards. Our finding that A. sexdens foragers learn to avoid VOC-emitting plants, which are likely detrimental to their symbiotic fungus, represents the first evidence for avoidance learning in attine ants toward plants with induced defenses.

  11. Seed dispersal and predation of Buchenavia tomentosa Eichler (Combretaceae in a Cerrado sensu stricto, midwest Brazil

    Directory of Open Access Journals (Sweden)

    J. Farias

    Full Text Available Abstract The ecology of seed dispersal is critical to understand the patterns of distribution and abundance of plant species. We investigated seed dispersal aspects associated with the high abundance of Buchenavia tomentosa in the Serra Azul State Park (PESA. We estimated fruit production and conducted fruit removal experiments. We carried out diurnal and nocturnal observations on frugivory as well as germination tests. Fruiting occurred in the dry season and totaled 1,365,015 ± 762,670 fruits.ha–1. B. tomentosa fruits were utilized by eight animal species. The lowland tapir (Tapirus terrestris was considered the main seed disperser. Leafcutter ants (Atta laevigata and Atta sexdens participated in the seed cleaning and occasionally dispersed seeds. The beetle Amblycerus insuturatus, blue-and-yellow macaw (Ara ararauna and red-and-green macaw (Ara chloropterus were considered pre-dispersal seed predators. The seeds manually cleaned presented higher germination rate (100% and speed index (4.2 seeds.d–1 than that of seeds with pulp. Germination of seeds found in tapirs’feces was 40%, while for the seeds without pulp it was 25%. The high abundance of B. tomentosa in the cerrado of PESA may be due to massive fruit production, low rates of seed predation, and efficient seed dispersal by tapirs, occurring before the rains which promote germination and recruitment of this species.

  12. Secondary seed dispersal of Ricinus communis Linnaeus (Euphorbiaceae by ants in secondary growth vegetation in Minas Gerais Dispersão secundária de sementes de Ricinus communis Linnaeus (Euphorbiaceae por formigas em vegetação secundária em Minas Gerais

    Directory of Open Access Journals (Sweden)

    Mário Marcos do Espírito Santo

    2007-12-01

    Full Text Available In this study, I tested the efficacy of ants as secondary seed dispersers of Ricinus communis in southeastern Brazil. In a natural population of 143 individuals, I determined the ballistic dispersal distance for 62 seeds and 100 additional seeds were experimentally offered to ants in groups of ten seeds along a transect of 50 m. Fifty-three seeds were removed by ants, mainly by the leafcutter Atta sexdens (90.4%. The dispersal distance by ants was high, compared to the global average (4.38 m ± 0.74 m vs. 0.96 m, but was lower than the ballistic distance (7.27 m ± 0.13 m. Ants increased the total dispersal distance (8.66 m ± 0.60 m, but the main benefit for the plant was the directed dispersal, with seed deposition on the enriched soil of ant nests.Este estudo testou a eficiência de formigas como dispersores secundários de Ricinus communis no Brasil. Em uma população natural de 143 indivíduos, a distância de dispersão balística foi determinada para 62 sementes. Além disso, 100 sementes adicionais foram oferecidas a formigas em grupos de 10, ao longo de um transecto de 50 m. Cinqüenta e três sementes foram removidas por formigas, principalmente pela formiga-cortadeira Atta sexdens (90,4%. A distância de dispersão por formigas foi alta se comparada à média global (4,38m ± 0,74 m vs. 0,96 m, porém menor que a distância de dispersão balística (7,27 m ± 0,13 m. As formigas aumentaram a distância de dispersão total (8,66 m ± 0,60 m, mas o principal benefício para a planta foi a dispersão direcionada, com a deposição das sementes no solo enriquecido encontrado nos ninhos das formigas.

  13. Mating biology of the leaf-cutting ants Atta colombica and A. cephalotes

    DEFF Research Database (Denmark)

    Baer, Boris; Boomsma, Jacobus J

    2006-01-01

    Copulation behavior has often been shaped by sexually selected sperm competition or cryptic female choice. However, manipulation of previously deposited ejaculates is unknown in the social Hymenoptera and the degree to which sperm competes after insemination or is actively selected by females has...... in the female sexual tract. Reconstruction of the sperm storage process indicated that sperm is transferred to the spermatheca during or immediately after ejaculation and without being mixed with sperm and seminal fluids from other males. A convergent mechanism of direct sperm transfer to the spermatheca...

  14. Invertebrate enemies and nest associates of the leaf-cutting ant Atta texana (Buckley) (Formicudae, Attini)

    Science.gov (United States)

    D.A. Waller; John C. Moser

    1990-01-01

    The complex nests of leaf-cutting ants (Formicidae; Attini) provide rich habitats for ant associates. These mounds consist of interconnected subterranean cavities that average 0.002 m3 in volume (Waler et al. 1938) and extend to depths of 7 m (Moser 1963). Many cavities contain fungus gardens, cultivated on live plant material, frass and debris....

  15. Crescimento do fungo simbionte de formigas cortadeiras do gênero Acromyrmex em meios de cultura com diferentes extratos Growth of symbiont fungi of cutter ants of the genus Acromyrmex in means of culture with different extracts

    Directory of Open Access Journals (Sweden)

    Regina da Silva Borba

    2006-06-01

    Full Text Available As formigas cortadeiras mostram preferência por algumas espécies vegetais, as quais são constantemente desfolhadas, enquanto outras não são atacadas, embora sejam abundantes e localizadas próximas ao ninho. As formigas dos gêneros Atta e Acromyrmex cortam plantas e transportam pedaços para os formigueiros. O material vegetal é usado para o cultivo do fungo Leucoagaricus gongylophorus, do qual se alimentam. Vários trabalhos utilizando extratos de plantas têm sido realizados para avaliar o efeito sobre o desenvolvimento do fungo simbionte. O objetivo deste trabalho foi avaliar a influência de meios de cultura acrescidos de diferentes extratos sobre o crescimento do fungo L. gongylophorus. Fungos das espécies Acromyrmex ambiguus, Acromyrmex crassispinus, Acromyrmex heyeri e Acromyrmex lundi foram inoculados nos meios Ágar Nutritivo e BDA, ambos acrescidos de melaço e de extratos de azevém (Lolium multiflorum Lam., tifa (Typha angustifolia L. e formiga (Atta sexdens piriventris. O meio Pagnocca foi utilizado como padrão. As placas foram mantidas em câmaras climatizadas à temperatura de 25 + 1°C e escotofase de 24 hs, por um período de 49 dias. O crescimento fúngico foi avaliado com base no diâmetro da colônia, sendo este avaliado em intervalos semanais, totalizando sete avaliações. Também foi avaliado o peso seco do fungo aos 53 dias. Os resultados mostraram que o fungo cultivado por diferentes espécies de formigas tem crescimento diferenciado em meios de cultura com diferentes extratos.The cutter ants show preference for some vegetable species, which are constantly defoliated, while others are not attacked, although they are abundant and located close to the nest. The ants of the goods Atta and Acromyrmex cut plants and they transport pieces to the anthills. The vegetable material is used for the cultivation of the mushroom Leucoagaricus gongylophorus, mushroom from of which theyfeed. Several works using extracts of

  16. Identification and expression of capa gene in the fire ant, Solenopsis invicta.

    Directory of Open Access Journals (Sweden)

    Man-Yeon Choi

    Full Text Available Recent genome analyses suggested the absence of a number of neuropeptide genes in ants. One of the apparently missing genes was the capa gene. Capa gene expression in insects is typically associated with the neuroendocrine system of abdominal ganglia; mature CAPA peptides are known to regulate diuresis and visceral muscle contraction. The apparent absence of the capa gene raised questions about possible compensation of these functions. In this study, we re-examined this controversial issue and searched for a potentially unrecognized capa gene in the fire ant, Solenopsis invicta. We employed a combination of data mining and a traditional PCR-based strategy using degenerate primers designed from conserved amino acid sequences of insect capa genes. Our findings demonstrate that ants possess and express a capa gene. As shown by MALDI-TOF mass spectrometry, processed products of the S. invicta capa gene include three CAPA periviscerokinins and low amounts of a pyrokinin which does not have the C-terminal WFGPRLa motif typical of CAPA pyrokinins in other insects. The capa gene was found with two alternative transcripts in the CNS. Within the ventral nerve cord, two capa neurons were immunostained in abdominal neuromeres 2-5, respectively, and projected into ventrally located abdominal perisympathetic organs (PSOs, which are the major hormone release sites of abdominal ganglia. The ventral location of these PSOs is a characteristic feature and was also found in another ant, Atta sexdens.

  17. Why are there few seedlings beneath the myrmecophyte Triplaris americana?

    Science.gov (United States)

    Larrea-Alcázar, Daniel M.; Simonetti, Javier A.

    2007-07-01

    We compared the relative importance of chemical alellopathy, pruning behaviour of resident ants and other non-related agents to ant-plant mutualism for seedling establishment beneath Triplaris americana L. (Polygonaceae), a myrmecophyte plant. We also included a preliminary analysis of effects of fragmentation on these ecological processes. Seeds and seedlings of Theobroma cacao L. (Sterculiaceae) were used as the target species in all experiments. Leaf-tissue extracts of the myrmecophyte plant did not inhibit germination of cacao seeds. Resident Pseudomyrmex triplarinus Weddell (Pseudomyrmecinae) ants did not remove seeds under the canopy of their host plants. The main seed consumer was the leaf-cutting ant Atta sexdens L. (Myrmicinae). Leaves of cacao seedlings were partially or totally pruned by Pseudomyrmex ants mainly in forest fragments studied. We offer evidence pointing to the possibility that the absence of seedlings beneath Triplaris may result from effects of both ant species. We discuss the benefits of pruning behaviour for the resident ant colony and the effects of ant-ant interactions on seedling establishment beneath this ant-plant system.

  18. Medical Play in Kernel Blitz 󈨥: Findings and Recommendations

    Science.gov (United States)

    1998-01-01

    Atta: HMCM KORBIN KNOCH , MEDICAL ADVISOR 24D2 COMNAVSURFPAC SAN DIEGO CA Atta: FORCE SURGEON Atta: CAPTSNYDER 26A2 COMPHIBGRU THREE SAN DIEGO CA...COMSCPAC OAKLAND CA Atta: CAPT ROBERT T.WILEY 45 A2 CGIMEF Atta: CAPT FREER Atta: CDR KEVIN HANSEN Atta: CAPTEDMONSON Atta: LT MICHAEL E.EBY... MICHAEL L. STEWART, HMCM (SS) FORC Attn: CAPT BOB BRANDT, MED-03 Attn: MED-03B Attn: CAPTDUNDON,MED-32 Attn: CAPTGILEVICH,MED-36 Attn: CAPT ST

  19. Variation in male body size and reproductive allocation in the leafcutter ant Atta colombica

    DEFF Research Database (Denmark)

    Stürup, M.; den Boer, S. P. A.; Nash, David Richard

    2011-01-01

    Remarkably little is known about the traits that determine reproductive success of males in eusocial insects. Their window for mate choice decisions is very short, the actual mating process is very difficult to observe, and their small body sizes have likely prevented systematic studies in many s...

  20. Are ant assemblages of Brazilian veredas characterised by location or habitat type?

    Directory of Open Access Journals (Sweden)

    CB Costa-Milanez

    Full Text Available Wetland areas in the Brazilian Cerrado, known as “veredas”, represent ecosystems formed on sandy soils with high concentrations of peat, and are responsible for the recharge of aquiferous reservoirs. They are currently under threat by various human activities, most notably the clearing of vegetation for Eucalyptus plantations. Despite their ecological importance and high conservation value, little is known about the actual effects of human disturbance on the animal community. To assess how habitat within different veredas, and plantations surrounding them affect ant assemblages, we selected four independent vereda locations, two being impacted by Eucalyptus monoculture (one younger and one mature plantation and two controls, where the wetland was surrounded by cerrado vegetation. Ant sampling was conducted in May 2010 (dry season using three complementary methods, namely baits, pitfall traps, and hand collection, in the wetland and in the surrounding habitats. A total of 7,575 ants were sampled, belonging to seven subfamilies, 32 genera and 124 species. Ant species richness and abundance did not differ between vereda locations, but did between the habitats. When impacted by the monoculture, ant species richness and abundance decreased in wetlands, but were less affected in the cerrado habitat. Ant species composition differed between the three habitats and between vereda locations. Eucalyptus plantations had an ant species composition defined by high dominance of Pheidole sp. and Solenopsis invicta, while natural habitats were defined by Camponotus and Crematogaster species. Atta sexdens was strictly confined to native habitats of non-impacted “veredas”. Eucalyptus monocultures require high quantities of water in the early stages, which may have caused a decrease in groundwater level in the wetland, allowing hypogeic ants such as Labidus praedator to colonise this habitat.

  1. Protein content of leaf-cutting ant queens before the nuptial flight and during the post-claustral phase

    Directory of Open Access Journals (Sweden)

    Edypo Jacob Silva

    2014-12-01

    Full Text Available Protein content of leaf-cutting ant queens before the nuptial flight and during the post-claustral phase. This study evaluated the crude protein content of queens of Atta sexdens before the nuptial flight and after the claustral phase in laboratory and field colonies. The hypothesis was that protein is used for survival of the queen and for early colony growth during the claustral phase. Additionally, the nest morphology, live biomass and adult population of field colonies were evaluated. Crude protein was determined by digestion of the organic material with sulfuric acid at high temperatures. The mean crude protein content was 123.23 ± 11.20 mg for females before the nuptial flight and 70.44 ± 12.21 mg for laboratory-reared queens after the claustral phase. The post-claustral crude protein content of field-collected queen was 55.90 ± 9.18 mg. With respect to the loss of crude protein as a function of duration of the claustral phase, laboratory-reared queens lost 52.79 mg and field-collected queens lost 67.33 mg compared to females before the nuptial flight. A positive linear correlation was observed between the weight of field-collected queens (256.4 ± 36.3 mg and colony biomass (13.02 ± 9.12 g, but there was no correlation between biomass and nest depth (13.11 ± 3.82 cm. As expected, the present results support the hypothesis that protein is used for survival of the queen and for early colony growth, as demonstrated by the reduction in crude protein content as a function of duration of the claustral phase. To our knowledge, this is the first study to provide data of the dynamics of protein reserves in leaf-cutting ant queens during the claustral phase.

  2. Ethnopharmacological survey among migrants living in the Southeast Atlantic Forest of Diadema, São Paulo, Brazil

    Directory of Open Access Journals (Sweden)

    Rodrigues Eliana

    2010-10-01

    Full Text Available Abstract Background Understanding how people of diverse cultural backgrounds have traditionally used plants and animals as medicinal substances during displacements is one of the most important objectives of ethnopharmacological studies. An ethnopharmacological survey conducted among migrants living in the Southeast Atlantic Forest remnants (Diadema, São Paulo, Brazil is presented herein. Methods Ethnographical methods were used to select and interview the migrants, and botanical and zoological techniques were employed to collect the indicated resources. Results We interviewed five migrants who described knowledge on 12 animals and 85 plants. Only 78 plants were present in Diadema, they belong to 37 taxonomic families; 68 were used exclusively for medicinal purposes, whereas 10 were reported to be toxic and/or presented some restriction of use. These taxa were grouped into 12 therapeutic categories (e.g., gastrointestinal disturbances, inflammatory processes or respiratory problems based on the 41 individual complaints cited by the migrants. While the twelve animal species were used by the migrants to treat nine complaints; these were divided into six categories, the largest of which related to respiratory problems. None of the animal species and only 57 of the 78 plant species analysed in the present study were previously reported in the pharmacological literature; the popular knowledge concurred with academic findings for 30 of the plants. The seven plants [Impatiens hawkeri W. Bull., Artemisia canphorata Vill., Equisetum arvensis L., Senna pendula (Humb. & Bonpl. ex Willd. H.S. Irwin & Barneby, Zea mays L., Fevillea passiflora Vell. and Croton fuscescens Spreng] and the two animals (Atta sexdens and Periplaneta americana that showed maintenance of use among migrants during their displacement in Brazilian territory, have not been studied by pharmacologists yet. Conclusions Thus, they should be highlighted and focused in further pharmacology

  3. Some correlations between the foraging behavior of common nighthawks, Cbordeiles minor (Forester), and the swarming behavior of two species of ants, Atta texana (Buckley) and Iridomyrmex pruinosis (Roger)

    Science.gov (United States)

    Stuart L. Warter; John C. Moser; Murray S. Blum

    1962-01-01

    At about 5:30 AM, may 24, 1961, four Common Nighthawks, Chordeiles minor, were collected from a group of nearly a dozen feeding at low level along a roadside in Rapides Parish, west of Alexandria, Louisiana. Upon subsequent examination of the distended stomachs of these birds, it was found that approximately 70% of the contents consisted of winged...

  4. Random sperm use and genetic effects on worker caste fate in Atta colombica leaf-cutting ants

    DEFF Research Database (Denmark)

    Holman, Luke; Stürup, Marlene; Trontti, Kalevi

    2011-01-01

    Sperm competition can produce fascinating adaptations with far-reaching evolutionary consequences. Social taxa make particularly interesting models, because the outcome of sexual selection determines the genetic composition of groups, with attendant sociobiological consequences. Here, we use...... genetic component, despite expectations that genetic effects on caste fate should be minor in species with a low degree of polyandry. Our data suggest that sexual conflict over paternity is largely resolved by the lifetime commitment between mates generated by long-term sperm storage, and show...

  5. Association between Pseudonocardia symbionts and Atta leaf-cutting ants suggested by improved isolation methods

    DEFF Research Database (Denmark)

    Marsh, Sarah E.; Poulsen, Michael; Gorosito, Norma B.

    2013-01-01

    Fungus-growing ants associate with multiple symbiotic microbes, including Actinobacteria for production of antibiotics. The best studied of these bacteria are within the genus Pseudonocardia, which in most fungus-growing ants are conspicuously visible on the external cuticle of workers. However, ...

  6. Distorsión local de campo magnético terrestre como una propuesta de manejo de una especie de hormiga arriera atta spp. (hymenoptera: formicidae)

    OpenAIRE

    Paz Penagos, Hernán; Vargas Rodríguez, Mauricio Alexander; Forero Bermúdez, Oscar; Pabón Caviativa, Juan Francisco; Plaza Martínez, Jovan

    2012-01-01

    Los estudios sobre la orientación espacial de los insectos sociales (abejas, termitas y hormigas) en situaciones de búsqueda, recolección y transporte de alimento han recibido considerable atención en los últimos años. Los propósitos han sido aprender acerca de ellos para aplicarlos a la robótica (multiagentes) y al control ecológico de plagas. Sin embargo, aún se conoce poco sobre los tipos de mecanismos de orientación y su integración en dichos insectos. En este artículo se describen alguno...

  7. Laboratory investigations of the trail-following responses of four species of leaf-cutting ants with notes on the specificity of a trail pheromone of Atta texana (Buckley)

    Science.gov (United States)

    S. W. Robinson; John C. Moser; M. S. Blum; E. Amante

    1974-01-01

    Interspecific trail following activity of poison sac contents from four species of leaf-cutting ants was investigated. with only one exception, all the species teste followed trails made from each others poison sac contents. however when the ants were given a choice of following one of two separate trails, clear differences were shown in the poison sac contents of the...

  8. Fóridos (Díptera: Phoridae) asociados al hábitat de hormigas cortadoras de hojas (Atta cephalotes y Acromyrmex octospinosus) y sus patrones de localización en un bosque seco tropical andino

    OpenAIRE

    Uribe Celis, Soraya

    2013-01-01

    Resumen:Siempre que se escucha hablar de las moscas viene a la mente de las personas las desagradables moscas domesticas o las perturbadoras moscas del establo. Sin embargo existe un grupo de moscas casi imperceptibles por su pequeño tamaño, conocidas como fóridos o moscas jorobadas, este interesante grupo ha sido poco estudiado. La información que se posee sobre éste nos muestra que son de gran importancia ecológica ya que su historia natural es muy variada ésta va desde individuos saprófago...

  9. Dicty_cDB: VHH618 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available ATTA sequence update 2002.10.25 Translated Amino Acid sequence if*ppyfhthkiqininisiifiyiyf*tlfflynn...Frame A: if*ppyfhthkiqininisiifiyiyf*tlfflynnkifiylfnfnnnn*KMIEGSGSKT PKRNSDEISVKSLSIHEANTLSSEHEHESGNEELTLSQ

  10. Progetto e realizzazione di STAZIONE SPERIMENTALE DI RICERCA nel Comune di Frabosa Soprana (CN) Autorizzazato ai sensi della L.1497/39Nell'ambito della ricerca finanziata da Cassa Risparmio Cuneo "Sperimentazione solare termodinamico a concentrazione integrato con l'architettura"

    OpenAIRE

    Belforte, Silvia; Roatta, Manuela

    2012-01-01

    Il progetto costituisce il prototipo di stazione sperimentale atta a monitorare il funzionamento degli elementi costituenti il sottosistema ricettivo energetico da installare sulle coperture di organismi edilizi

  11. Identificación de las feromonas de trilla de hormigas cortadoras (formicidae: attini)1

    OpenAIRE

    Oscar Marino Mosquera; Joao Sabino de Oliveira

    2010-01-01

    Del extracto en diclorometano de las glándulas de veneno de las hormigas cortadoras: Atta laevigata, Atta bisphaerica, Acromyrmex subterraneus molestans. Fueron analizados por CG y CG-EM e identificados el 4-metilpirrol-2-carboxilato de metilo y el 3-etil-2,5-dimetilpirazina como los compuestos principales de la feromona de trilla (marcación de camino).

  12. Nutrients composition of calyces and seeds of three Roselle ...

    African Journals Online (AJOL)

    Nutrients composition of calyces and seeds of three Roselle (Hibiscus sabdariffa L.) ecotypes from Niger. Sanoussi Atta, Benoît Sarr, Aissa B Diallo, Yacoubou Bakasso, Issaka Lona, Mahamane Saadou ...

  13. Antioxidant benzophenones and xanthones from the root bark of ...

    African Journals Online (AJOL)

    Antioxidant benzophenones and xanthones from the root bark of Garcinia smeathmannii. Alain Meli Lannang, Justin Komguem, Fernande Ngounou Ngninzeko, Jean Gustave Tangmouo, David Lontsi, Asma Ajaz, Muhammad Iqbal Choudhary, Beiban Luc Sondengam, Atta -ur-Rahman ...

  14. Toxicological impact of Amaranth, Sunset Yellow and Curcumin as food coloring agents in albino rats

    Directory of Open Access Journals (Sweden)

    JPMS

    2011-10-01

    Full Text Available Mohamed M.Hashem, Attia H.Atta, Mahmoud S. Arbid, Somaia A. Nada, Samar M. Mouneir and Gihan Farag Asaad (Department of Pharmacology, Faculty of Veterinary Medicine, Cairo University, Giza, Egypt (pages 43-51

  15. Browse Author Index

    African Journals Online (AJOL)

    Items 851 - 900 of 6931 ... Athena, NT · Atibita, Esther Nadine Otiobo · Atibu, EK · Atidegla, C · Atidegla, SC · Atiku, J. Atindehou, E · Atobla, K · Atohoun, YGS · Atse, BC · Atse, Célestin B. Atsin, OG · Atta, K · Atta, S · Attakpa, E · Attakpa, EY · Attanayaka, K · Attindehou, Sabbas · Attingli, A.H. · Attinsounon, Angelo Cossi · Audu, I

  16. Identificación de las feromonas de trilla de hormigas cortadoras (formicidae: attini1

    Directory of Open Access Journals (Sweden)

    Oscar Marino Mosquera

    2010-05-01

    Full Text Available Del extracto en diclorometano de las glándulas de veneno de las hormigas cortadoras: Atta laevigata, Atta bisphaerica, Acromyrmex subterraneus molestans. Fueron analizados por CG y CG-EM e identificados el 4-metilpirrol-2-carboxilato de metilo y el 3-etil-2,5-dimetilpirazina como los compuestos principales de la feromona de trilla (marcación de camino.

  17. Pathogen-induced binding of the soybean zinc finger homeodomain proteins GmZF-HD1 and GmZF-HD2 to two repeats of ATTA homeodomain binding site in the calmodulin isoform 4 (GmCaM4) promoter

    OpenAIRE

    Park, Hyeong Cheol; Kim, Man Lyang; Lee, Sang Min; Bahk, Jeong Dong; Yun, Dae-Jin; Lim, Chae Oh; Hong, Jong Chan; Lee, Sang Yeol; Cho, Moo Je; Chung, Woo Sik

    2007-01-01

    Calmodulin (CaM) is involved in defense responses in plants. In soybean (Glycine max), transcription of calmodulin isoform 4 (GmCaM4) is rapidly induced within 30 min after pathogen stimulation, but regulation of the GmCaM4 gene in response to pathogen is poorly understood. Here, we used the yeast one-hybrid system to isolate two cDNA clones encoding proteins that bind to a 30-nt A/T-rich sequence in the GmCaM4 promoter, a region that contains two repeats of a conserved homeodomain binding si...

  18. Plants use macronutrients accumulated in leaf-cutting ant nests.

    Science.gov (United States)

    da S L Sternberg, Leonel; Pinzon, Maria Camila; Moreira, Marcelo Z; Moutinho, Paulo; Rojas, Enith I; Herre, Edward Allen

    2007-02-07

    Leaf-cutting ants (Atta spp.) are known for their extensive defoliation in neo-tropical forests and savannahs. Debate about the costs and benefits of their activities has been largely dominated by their detrimental effects on agriculture and agroforestry. However, the large accumulation of nutrients and changes in soil properties near their nests might benefit plants growing near them. Here, we test whether trees use nutrients that accumulate in debris piles near, or refuse chambers within, leaf-cutting ant nests. At two tropical sites (a moist tropical forest site in Panama and a savannah site in Brazil), we fed leaves labelled with the stable isotope 15N to two species of leaf-cutting ants (Atta colombica and Atta laevigata) and traced the stable isotope label in plants surrounding the two nests. Thus, we show that plants in both sites access resources associated with Atta nests. In addition, leaf tissue of trees near the nests labelled with 15N had significantly higher calcium concentrations than those of distal, unlabelled conspecifics. It has been documented that calcium is a limiting macronutrient in tropical forests and savannahs. Atta may thus play an important ecological role through their long-distance transport, redistribution and concentration of critical macronutrients.

  19. A colony-level response to disease control in a leaf-cutting ant

    Science.gov (United States)

    Hart, Adam; Bot, A. N. M.; Brown, Mark

    2002-03-01

    Parasites and pathogens often impose significant costs on their hosts. This is particularly true for social organisms, where the genetic structure of groups and the accumulation of contaminated waste facilitate disease transmission. In response, hosts have evolved many mechanisms of defence against parasites. Here we present evidence that Atta colombica, a leaf-cutting ant, may combat Escovopsis, a dangerous parasite of Atta's garden fungus, through a colony-level behavioural response. In A. colombica, garden waste is removed from within the colony and transported to the midden - an external waste dump - where it is processed by a group of midden workers. We found that colonies infected with Escovopsis have higher numbers of workers on the midden, where Escovopsis is deposited. Further, midden workers are highly effective in dispersing newly deposited waste away from the dumping site. Thus, the colony-level task allocation strategies of the Atta superorganism may change in response to the threat of disease to a third, essential party.

  20. Differences in Forage-Acquisition and Fungal Enzyme Activity Contribute to Niche Segregation in Panamanian Leaf-Cutting Ants

    Science.gov (United States)

    Kooij, Pepijn W.; Liberti, Joanito; Giampoudakis, Konstantinos; Schiøtt, Morten; Boomsma, Jacobus J.

    2014-01-01

    The genera Atta and Acromyrmex are often grouped as leaf-cutting ants for pest management assessments and ecological surveys, although their mature colony sizes and foraging niches may differ substantially. Few studies have addressed such interspecific differences at the same site, which prompted us to conduct a comparative study across six sympatric leaf-cutting ant species in Central Panama. We show that foraging rates during the transition between dry and wet season differ about 60 fold between genera, but are relatively constant across species within genera. These differences appear to match overall differences in colony size, especially when Atta workers that return to their nests without leaves are assumed to carry liquid food. We confirm that Panamanian Atta specialize primarily on tree-leaves whereas Acromyrmex focus on collecting flowers and herbal leaves and that species within genera are similar in these overall foraging strategies. Species within genera tended to be spaced out over the three habitat categories that we distinguished (forest, forest edge, open grassland), but each of these habitats normally had only a single predominant Atta and Acromyrmex species. We measured activities of twelve fungus garden decomposition enzymes, belonging to the amylases, cellulases, hemicellulases, pectinases and proteinases, and show that average enzyme activity per unit of fungal mass in Atta gardens is lower than in Acromyrmex gardens. Expression profiles of fungal enzymes in Atta also appeared to be more specialized than in Acromyrmex, possibly reflecting variation in forage material. Our results suggest that species- and genus-level identities of leaf-cutting ants and habitat-specific foraging profiles may give predictable differences in the expression of fungal genes coding for decomposition enzymes. PMID:24718261

  1. Differences in forage-acquisition and fungal enzyme activity contribute to niche segregation in Panamanian leaf-cutting ants.

    Directory of Open Access Journals (Sweden)

    Pepijn W Kooij

    Full Text Available The genera Atta and Acromyrmex are often grouped as leaf-cutting ants for pest management assessments and ecological surveys, although their mature colony sizes and foraging niches may differ substantially. Few studies have addressed such interspecific differences at the same site, which prompted us to conduct a comparative study across six sympatric leaf-cutting ant species in Central Panama. We show that foraging rates during the transition between dry and wet season differ about 60 fold between genera, but are relatively constant across species within genera. These differences appear to match overall differences in colony size, especially when Atta workers that return to their nests without leaves are assumed to carry liquid food. We confirm that Panamanian Atta specialize primarily on tree-leaves whereas Acromyrmex focus on collecting flowers and herbal leaves and that species within genera are similar in these overall foraging strategies. Species within genera tended to be spaced out over the three habitat categories that we distinguished (forest, forest edge, open grassland, but each of these habitats normally had only a single predominant Atta and Acromyrmex species. We measured activities of twelve fungus garden decomposition enzymes, belonging to the amylases, cellulases, hemicellulases, pectinases and proteinases, and show that average enzyme activity per unit of fungal mass in Atta gardens is lower than in Acromyrmex gardens. Expression profiles of fungal enzymes in Atta also appeared to be more specialized than in Acromyrmex, possibly reflecting variation in forage material. Our results suggest that species- and genus-level identities of leaf-cutting ants and habitat-specific foraging profiles may give predictable differences in the expression of fungal genes coding for decomposition enzymes.

  2. Air Force Management of the Defense Acquisition Workforce Development Fund: Opportunities for Improvement

    Science.gov (United States)

    2016-01-01

    document and trademark(s) contained herein are protected by law. This representation of RAND intellectual property is provided for noncommercial use only...unlike the “SMART” approach to management that is frequently discussed in management literature . There are different forms of the acronym, but one is...can go all the way up to $1,000 or $1,500. There is a quarterly budget set aside for this. You can also just give ‘Atta boy!’s’ or ‘Atta girl !’s

  3. Afghanistan: Politics, Elections, and Government Performance

    Science.gov (United States)

    2010-12-16

    Atta Mohammad Noor, who is about 47 years old, has been the governor of Balkh Province, whose capital is the vibrant city of Mazar-e-Sharif, since...that they are too risque , although the programs were restored in August 2008 under a compromise that also brought in some Islamic-oriented programs

  4. Optical characteristics of transparent samarium oxide thin films ...

    Indian Academy of Sciences (India)

    Optical characteristics of transparent samarium oxide thin films deposited by the radio-frequency sputtering technique. A A ATTA M M EL-NAHASS KHALED M ELSABAWY M M ABD EL-RAHEEM A M HASSANIEN A ALHUTHALI ALI BADAWI AMAR MERAZGA. Regular Volume 87 Issue 5 November 2016 Article ID 72 ...

  5. 76 FR 37716 - List of Fisheries for 2012

    Science.gov (United States)

    2011-06-28

    ...: Lisa Van Atta. FOR FURTHER INFORMATION CONTACT: Melissa Andersen, Office of Protected Resources, 301... baited hooks from a moving vessel, using big game-type rods and reels as well as hydraulic haulers... available information (Andersen et al., 2008). As stated above, quantitative information on the level of...

  6. INVESTIR DANS LE SAVOIR : le soutien que le CRDI consent à des ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    agriculture, John Atta Mills, récemment élu président du Ghana, Mohamed Sahnoun, ancien président d'Initiatives et Changement international, et de nombreuses autres personnalités étrangères ont déjà pu profiter de l'appui du ...

  7. Town ants: the beginning of John Moser’s remarkable search for knowledge

    Science.gov (United States)

    J.P. Barnett; D.A. Streett; S.R. Blomquist

    2016-01-01

    John C. Moser’s career spans over 50 years, and his research has focused on understanding the biology of town ants (Atta texana) and phoretic mites and other associates of ants and pine bark beetles. His approach to developing methods for the control of these pests has been to understand more completely the biology of these organisms. This research...

  8. Morphological and anatomical response of Acacia ehrenbergiana ...

    African Journals Online (AJOL)

    ajl user 3

    2012-02-20

    Feb 20, 2012 ... ehrenbergiana Hayne and Acacia tortilis (Forssk). Haynes subspp. raddiana seedlings to induced water stress. Hashim Ali El Atta*, Ibrahim Mohamed Aref, Abdalla Ismail Ahmed and Pervez Rasheed Khan. Department of Plant Production, College of Food and Agricultural Sciences, King Saud University, ...

  9. Automated Vision Test Development and Validation

    Science.gov (United States)

    2016-11-01

    The design of instruments used to measure visual acuity (VA), color vision, and muscle balance in military clinical settings remains unchanged...AFRL-SA-WP-SR-2016-0020 Automated Vision Test Development and Validation Steve Wright, Darrell Rousse, Alex van Atta...James Gaska, Marc Winterbottom, Steven Hadley, Lt Col Dan Lamothe November 2016 Air Force Research Laboratory 711th Human Performance

  10. The Determinants of Inflation in Botswana and Bank of Botswana's ...

    African Journals Online (AJOL)

    while South African prices and US exchange rate pass-through were important in Atta et al's. (1999) study, in the Dlamini et al (2001) for Swaziland, real sector effects (GDP for instance) were more important in influencing inflation than monetary variables like money supply and interest rates. Akinboade et al (2004) who ...

  11. Complete excavation and mapping of a Texas leafcutting ant nest

    Science.gov (United States)

    John C. Moser

    2006-01-01

    A medium-sized nest of the Texas leafcutting ant, Atta texana (Buckley), in northern Louisiana was excavated completely, and a three-dimensional model of its external and subterranean features was constructed. In total, 97 fungus gardens, 27 dormancy cavities, and 45 detritus cavities were located. At the lower center of the funnel-shaped nest was a...

  12. Collecting and Connecting the Dots: Leveraging Technology to Enhance the Collection of Information and the Dissemination of Intelligence

    Science.gov (United States)

    2009-09-01

    policies and practices th at effectively integrate infor mation sharing into all a spects of policing and provide for technological solutions to...need to “prevent and respond to threatened or actual domestic ter rorist atta cks, major disa sters, and other em ergencies by requiring a national dom

  13. Hibiscus sabdariffa L.

    African Journals Online (AJOL)

    Sanoussi

    2013-05-31

    May 31, 2013 ... The Mg and Cu contents in calyces and seeds were similar. Moreover, the concentration of these nutrients is also similar to those of young leaves for the same cultivars (Atta et al., 2010a, 2010b). The mineral content of H. sabdariffa indicates that the potassium was the most abundant inorganic cation in the.

  14. In vitro regeneration from different ages of petioles of physic nut ...

    African Journals Online (AJOL)

    Ezedom Theresa

    2014-01-08

    Jan 8, 2014 ... J. curcas is a drought tolerant plant, growing in the marginal lands (Kheira and Atta,. 2009) and as a hedge plant are not browsed by animals. (Reinhard and Henning, 2004). The plant can survive more than 50 years (Takeda, 1982). The different parts of the plant like shoot, stem, leaves fruit, seed, bark and.

  15. Differences in forage-acquisition and fungal enzyme activity contribute to niche segregation in Panamanian leaf-cutting ants

    DEFF Research Database (Denmark)

    Kooij, Pepijn Wilhelmus; Liberti, Joanito; Giampoudakis, Konstantinos

    2014-01-01

    The genera Atta and Acromyrmex are often grouped as leaf-cutting ants for pest management assessments and ecological surveys, although their mature colony sizes and foraging niches may differ substantially. Few studies have addressed such interspecific differences at the same site, which prompted...

  16. Hashimoto thyroiditis is an independent cardiovascular risk factor in ...

    African Journals Online (AJOL)

    Mohammed N. Atta

    2011-10-22

    Oct 22, 2011 ... Hashimoto thyroiditis is an independent cardiovascular risk factor in clinically hypothyroid patients. Mohammed N. Atta a. , Rawhia Elessawy a. , Akram Deghedy b. ,. Ahmed Hafez c. , Tamer M. Elsherbiny a,. * a Department of Internal Medicine, Endocrinology Unit, Alexandria Faculty of Medicine, Egypt.

  17. DYNAMIC CONDUCTIVITY MEASUREMENTS IN HUMIC AND FULVIC ACID SOLUTIONS. (R828158)

    Science.gov (United States)

    Conductivity changes of dilute aqueous humic and fulvic acids solutions were monitored after the addition of small quantities of Cu, Cd, Pb, and Zn. The solutions were stirred at a constant and reproducible rate, and measurements proceeded until stable conductivities were atta...

  18. Browse Author Index

    African Journals Online (AJOL)

    Santos, Bruna Quara de Carvalho · Santos, Caio Marcio Guimarães · Santos, CMG · Santos, Denise Barbosa · Santos, ESL · Santos, F.R. · Santos, Francianne Oliveira · Santos, JDG ... Saraiva, Henrique César Costa · Saraka, ND · Saran, PL · Saranga, Y · Sarangi, BK · Sarangi, N · Sarangi, SK · Sarangzai, Atta Muhammed

  19. A comprehensive computational mutation structure- function ...

    African Journals Online (AJOL)

    Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Sector H-12, Kashmir. Highway, Islamabad 44000, Pakistan ... reproduction in any medium, provided the original work is properly credited. Tropical Journal of ..... was expressed in yeast [42]. Previously it was reported that ...

  20. Browse Title Index

    African Journals Online (AJOL)

    Items 51 - 100 of 240 ... MTO Ibrahim, TT Ibrahim. Vol 13, No 2 (2010), Frequency of depression among hypertensive patients who developed stroke. Abstract. A Obembe, SA Isezuo, MA Yunusa, AB Atta. Vol 10, No 3 (2007), Gambiense Sleeping Sickness In The Abraka Region Of Delta State, Nigeria: Passive Case Detection ...

  1. Al-Attas’ Philosophy of History on the Arrival and Proliferation of Islam in the Malay World

    Directory of Open Access Journals (Sweden)

    AZMUL FAHIMI KAMARUZAMAN

    2016-12-01

    Full Text Available This article examines the philosophy of history of Syed Muhammad Naquib al-Attas on the theory of the arrival and spread of Islam in the Malay world, particularly in his work ‘Historical Facts and Fictions’. This philosophy of history is consequent to al-Attas' critical research contained in his previous works such as ‘Preliminary Statement on a General Theory of The Islamization of the Malay-Indonesian Archipelago’ (1969, ‘Islam in the Malay History and Culture’ (1972 and ‘The Correct Date of the Terengganu Inscription’ (1972. This study analyses these works and his other works to look into the aspects of history and historiography contained in the philosophy of history of al-Attas on the arrival and spread of Islam in the Malay world in terms of their scope, sources and history methods. This study found that in terms of epistemology al-Attas has contributed in creating a theoretical framework and a novel approach to the philosophy of history of the history of Islam in the Malay world.

  2. complex against Ehrlich Ascites Carcinoma (EAC) cells

    African Journals Online (AJOL)

    Dr gatsin

    Research, Bangladesh (ICDDR'B). For the experiment, male mice of 6–8 weeks of age, having weight 20±5 ... experiment “Cell growth inhibition” but here treatment was continued for 10 days. Tumour growth was ..... Biochem., 99(7): 1526–1531. Atta-ur-Rahman, Choudhury MF, Thomson. WJ. 1999. Manual of Bioassay.

  3. African Journal of Infectious Diseases - Vol 10, No 1 (2016)

    African Journals Online (AJOL)

    Human immunodeficiency virus, hepatitis B virus and syphilis infections among long-distance truck drivers in, a Port city in Ghana · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Andrew A Adjei, Pricilla Boahema Atta, Francis Krampa, Margaret Lartey, Mubarak ...

  4. Alexandria Journal of Medicine - Vol 47, No 4 (2011)

    African Journals Online (AJOL)

    Hashimoto thyroiditis is an independent cardiovascular risk factor in clinically hypothyroid patients · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. MN Atta, R Elessawy, A Deghedy, A Hafez, TM Elsherbiny. http://dx.doi.org/10.1016/j.ajme.2011.09.004 ...

  5. Author Details

    African Journals Online (AJOL)

    Atta, MN. Vol 47, No 4 (2011) - Articles Hashimoto thyroiditis is an independent cardiovascular risk factor in clinically hypothyroid patients. Abstract PDF. ISSN: 2090-2948. AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL · AJOL's Partners · Terms ...

  6. Divergent Thinking in Parkinsonism: A Case–Control Study

    Directory of Open Access Journals (Sweden)

    Margherita Canesi

    2017-10-01

    Full Text Available BackgroundCreativity is a multidimensional phenomenon and an important component of human capacities. This ability is characterized by the involvement of several cognitive functions particularly linked to the prefrontal cortex. We compared divergent thinking, a measure of creativity, in patients affected by progressive supranuclear palsy (PSP, other parkinsonian syndromes, and healthy controls (HCs.MethodsCreativity features were evaluated using the Abbreviated Torrance Test for Adults (ATTA. Consecutive PSP outpatients were screened for inclusion. Then, patients with multiple system atrophy (MSA and Parkinson’s disease (PD and a group of HC were studied. All groups have preserved cognitive functions and were matched for gender, education, disease duration, and age at onset with exception of PD patients who were matched by disease severity rather than disease duration.ResultsPSP patients were characterized by lower values in total ATTA and all subscales than HC and both MSA and PD patients. No differences were found comparing HC versus both MSA and PD patients. PSP patients were characterized by more impaired frontal functioning [assessed by means of Frontal Assessment Battery (FAB] than HC and both PD and MSA patients.ConclusionIn the present study, ATTA was significantly lower in PSP patients than in the other study groups. The worst performance in ATTA-total score and the lower score in FAB in PSP patients support the role of frontal function in creative processes.

  7. Dynamic disease management in trachymyrmex fungus-growing ants (Attini: Formicidae)

    DEFF Research Database (Denmark)

    Fernández-Marín, Hermógenes; Bruner, Gaspar; Gomez, Ernesto B.

    2013-01-01

    Abstract Multipartner mutualisms have potentially complex dynamics, with compensatory responses when one partner is lost or relegated to a minor role. Fungus-growing ants (Attini) are mutualistic associates of basidiomycete fungi and antibiotic-producing actinomycete bacteria; the former are atta...... defenses against the specialized pathogen Escovopsis, but reduced investment in one of these defense modes tends to increase investment in the other....

  8. The ejaculatory biology of leafcutter ants

    DEFF Research Database (Denmark)

    den Boer, Susanne; Stürup, Marlene; Boomsma, Jacobus Jan

    2015-01-01

    understanding of the fundamental biology of ejaculate production, transfer and physiological function remains extremely limited. We studied the ejaculation process in the leafcutter ant Atta colombica and found that it starts with the appearance of a clear pre-ejaculatory fluid (PEF) at the tip...

  9. Chemical releases of social behavior, II. source and specificity of the odor trail substances in four attine genera. (Hymenoptera: Formicidae)

    Science.gov (United States)

    Murray S. Blum; John C. Moser; A.D. Cordero

    1964-01-01

    The higher members of the tribe Attini characteristically lay persistent and extensive odor trails especially in many neotropical areas. Thus, in Acromyrmex and Atta, long columns of foraging workers are frequently present on the odor trails but in the less specialized attine genera, workers may forage either in files or singly. Weber (1958...

  10. On Linear Hulls, Statistical Saturation Attacks, PRESENT and a Cryptanalysis of PUFFIN

    DEFF Research Database (Denmark)

    Leander, Gregor

    2011-01-01

    We discuss complexities of advanced linear attacks. In particular, we argue why it is often more appropriate to examine the median of the complexity than the average value. Moreover, we apply our methods to the block ciphers PUFFIN and PRESENT. For PUFFIN, a 128 bit key cipher, we present an atta...

  11. Strategy as Story: Judgment, Bias, and the Narrative Behind the Decision to Invade Iraq

    Science.gov (United States)

    2011-05-06

    threats precisely why an invasion is necessary? Is there even the slimmest possibility-a one percent chance-that uranium was bought in Niger , that the...aluminum tubes were usable in uranium centrifuges, or that Mohammed Atta managed to meet with an Iraqi, any Iraqi, in Prague?xxiv In both of these

  12. Fungal Adaptations to Mutualistic Life with Ants

    DEFF Research Database (Denmark)

    Kooij, Pepijn Wilhelmus

    the ant gut without being digested, and are excreted by the ants in their fecal fluid which they mix with freshly foraged plant material placed on the top of the fungus garden. The enzymes are still active and have therefore an important role in the biodegradation of the plant material. With this I show...... that forage on crude substrates such as insect frass and dry plant material, to large colonies of the leaf-cutting ants with several thousands to several million workers that provide live plant material to their fungus gardens. Leaf-cutting ants are the dominant herbivores of the Neo-tropics, and have a major......-cutting ant genera forage for rather different plant material, with Atta species specializing on tree-leaves and Acromyrmex focusing more on flower material and herbal plant material. This difference is reflected in the overall enzyme activity patterns in the fungus gardens, with Atta specializing more...

  13. Near field measurements on contrail properties from fuels with different sulfur content

    Energy Technology Data Exchange (ETDEWEB)

    Petzold, A. [Deutsche Forschungsanstalt fuer Luft- und Raumfahrt e.V. (DLR), Wessling (Germany). Inst. fuer Physik der Atmosphaere; Busen, R. [Deutsche Forschungsanstalt fuer Luft- und Raumfahrt e.V. (DLR), Wessling (Germany). Inst. fuer Physik der Atmosphaere; Schroeder, F.P. [Deutsche Forschungsanstalt fuer Luft- und Raumfahrt e.V. (DLR), Wessling (Germany). Inst. fuer Physik der Atmosphaere; Baumann, R. [Deutsche Forschungsanstalt fuer Luft- und Raumfahrt e.V. (DLR), Wessling (Germany). Inst. fuer Physik der Atmosphaere; Kuhn, M. [Deutsche Forschungsanstalt fuer Luft- und Raumfahrt e.V. (DLR), Wessling (Germany). Inst. fuer Physik der Atmosphaere; Stroem, J. [Stockholm Univ. (Sweden). Dept. of Meteorology; Hagen, D.E. [Missouri Univ., Rolla, MO (United States); Whitefield, P.D. [Missouri Univ., Rolla, MO (United States); Baumgardner, D. [National Center for Atmospheric Research, Boulder, Colorado (United States); Arnold, F. [Max-Planck-Institut fuer Kernphysik, Heidelberg (Germany). Bereich Atmosphaerenphysik; Borrmann, S. [Mainz Univ. (Germany). Inst. fuer Physik der Atmosphaere; Schumann, U. [Deutsche Forschungsanstalt fuer Luft- und Raumfahrt e.V. (DLR), Wessling (Germany). Inst. fuer Physik der Atmosphaere

    1997-08-01

    Microphysical properties of jet engine exhaust aerosol and contrails were studied in the near field of the emitting aircraft for different fuel sulfur contents. Measurements were performed behind the research aircraft ATTAS of DLR and an Airbus A310-300 using fuels with different sulfur contents of 6 ppm and 2700 ppm. The major differences in accumulation mode aerosol and microphysical contrail properties between the used aircraft were an increased number concentration of both the accumulation mode aerosol and the contrail particles in the Airbus A310-300 plume compared to the ATTAS plume. Part of the difference in contrail particles may be caused by different ambient conditions, but the major differences are assumed to be caused by different engine properties. (orig.)

  14. Los estados inmaduros de Coelosis biloba (Coleoptera: Melolonthidae: Dynastinae y notas sobre su biología Immature stages of Coelosis biloba (Coleoptera: Melolonthidae: Dynastinae with notes on their biology

    Directory of Open Access Journals (Sweden)

    Luis Carlos Pardo-Locarno

    2006-12-01

    Full Text Available Se describen la larva de tercer estadio y las pupas de macho y hembra de Coelosis biloba (Linné 1767 con ejemplares recolectados en Colombia (Cauca y Valle y en México (Veracruz asociados con los hormigueros de Atta cephalotes (Linné 1750. Se incluyen ilustraciones de las estructuras diagnósticas, una clave para separar las larvas de tercer estadio hasta ahora conocidas de la tribu Oryctini en América, y observaciones sobre la biología de C. biloba como inquilino de los nidos de hormigas.The larva of third instar, male and female pupae of Coelosis biloba obtained inside ant nests of Atta cephalotes in Colombia (Cauca, Valle and Mexico (Veracruz are described. Drawings of diagnostic structures, a key to the known third instar larvae of American Oryctini, and observations on the biology of C. biloba as inquiline of ant nests, are included.

  15. A Survey of Modern Electronic Voting Technologies

    OpenAIRE

    Stenbro, Martine

    2010-01-01

    The last decade, electronic voting has evolved from being a mean of counting votes to also offer the possibility of electronically casting votes. From recording votes using punch cards and optical scan systems, electronic voting has evolved into the use of direct-recording-electronic machines. Voting over the Internet has also become a hot research topic, and some implementation and testing have been done. Internet voting systems are significantly more vulnerable to threats from external atta...

  16. An Examination of the Critical Factors of Store Brand Purchase Intentions

    OpenAIRE

    Zhao, Xiaoqian

    2011-01-01

    Consumer behaviour is very complex interaction of affect, cognition, behaviour and environment activities, which deals with how and why individuals conduct the exchange events of products and service. Brand, as a signal of quality assurance and sometimes a symbol of identity, plays a significant role in consumer decision making process. Thus build up brand assets and improve brand equity is important in brand management. As a main source of consumer packaged goods, store brands should be atta...

  17. CTC Sentinel. Volume 5, Issue 3

    Science.gov (United States)

    2012-03-01

    in the Department of social sciences at the United states Military Academy, West point. The CTC sentinel harnesses the Center’s global network of...36/2005,” pp. 203-211; “Informe ampliatorio de las investigaciones realizadas en torno a las visitas a España de Mohamed Atta y Ramzi Binalshibh...In the course of the exchange, the former amir of the LIFG acknowledged having had what he termed “ social relations” with Fakhet. Separately, on

  18. Browse Author Index - African Journals Online (AJOL)

    African Journals Online (AJOL)

    Items 3201 - 3300 of 3642 ... Atta, Sanoussi · Attama, Anthony Amaechi · Attamah, G N · Attar, A · Attaullah, S · Atteh, JO · Atti, Nashwa M Abdel · Attia, Attia O. Attia, H · Attia, Hamadi · Attia, Houneida · Attia, K · Attioua, Barthélémy · Attioua, Barthelemy Koffi · Attitalla, Idress Hamad · Attitalla, IH · Attou, GS · Attou, S · Atttama, AA

  19. Browse Author Index - African Journals Online

    African Journals Online (AJOL)

    Items 3251 - 3300 of 33180 ... Atta, Sanoussi · Attama, Anthony Amaechi · Attamah, G N · Attar, A · Attaullah, S · Atteh, JO · Atti, Nashwa M Abdel · Attia, Attia O. Attia, H · Attia, Hamadi · Attia, Houneida · Attia, K · Attioua, Barthélémy · Attioua, Barthelemy Koffi · Attitalla, Idress Hamad · Attitalla, IH · Attou, GS · Attou, S · Atttama, AA

  20. Comments on: High fat intake leads to acute postprandial exposure to circulating endotoxin in type 2 diabetic subjects.

    Directory of Open Access Journals (Sweden)

    S Yu Vorotnikova

    2012-06-01

    Full Text Available Comments on: Harte AL, Varma MC, Tripathi G, McGee KC, Al-Daghri NM, Al-Attas OS, Sabico S, O'Hare JP, Ceriello A, Saravanan P, Kumar S, McTernan PG. High fat intake leads to acute postprandial exposure to circulating endotoxin in type 2 diabetic subjects. Diabetes Care. 2012 Feb; 35(2: 375-82

  1. National Evaluation of the Primary Leadership Programme : Research Brief

    OpenAIRE

    Wade, Pauline; McCrone, Tami; Rudd, Peter

    2007-01-01

    This research brief presents the key findings from a national evaluation of the Primary Leadership Programme (PLP) carried out by a team at the National Foundation for Educational Research (NEFER) between 2004 and 2006. The evaluation was commissioned by the Department for Education and Skills (DfES) and included the use of case-study interviews with key personnel, surveys of school leaders and analysis of pupil examination results. KEY FINDINGS • Pupil achievement – With regard to pupil atta...

  2. Total Synthesis of Eleutherobin and Analogs and Study of Anti-Cancer Mechanism

    Science.gov (United States)

    2002-05-01

    instead of a methyl group, was used for the protection of phenol, cf. reference 21S. 33) a) T. Ishiyama , M. Murata, N. Miyaura, J. Org. Chem. 1995, 60...Reactions and Synthesis in Surfactant Syntems John Texter G. Oehme ......................... 517 New Advances in Analytical Chemistry Atta-ur-Rahman U...deprotected with [10] a) T. Ishiyama , M. Murata, N. Miyaura, J Org. Chem. 1995,60, 7508- pyridine-buffered HF/pyridine to afford a mixture of our total

  3. anti-inflammatory and analgesic activities: chemical constituents of ...

    African Journals Online (AJOL)

    a

    Janssen, A.M.; Scheffer, J.J.; Ntezurubanza, L.; Baerheim, S.; Vendsen, A.J. J. Ethnopharmacol. 1987, 21, 57. 7. Godhwani, S.; Godhwani, J.L.; Vyas, D.S. J. Ethnopharmacol. 1987, 21, 153. 8. Singh, S.; Majumdan, D.K.; Rehan, H.M. J. Ethnopharmacol. 1996, 54, 19. 9. Atta, A.H.; Alkofahi, A.; J. Ethnopharmacol. 1998, 60 ...

  4. Gender, Salary and Promotion in the Academic Profession

    OpenAIRE

    Melanie E. Ward

    2000-01-01

    This paper examines the hypothesis that the gender salary gap observed in the academic labour market is predominantly explained by the differing average characteristics of male and female academics and barriers to female promotion. Preliminary analysis reveals that the crowding of women onto the lower rungs of academia is a strong determinant of their lower average salary. This effect should be transitory as young women, now entering the profession, move up its ranks. We construct a rank atta...

  5. Plants use macronutrients accumulated in leaf-cutting ant nests

    OpenAIRE

    da S.L Sternberg, Leonel; Pinzon, Maria Camila; Moreira, Marcelo Z.; Moutinho, Paulo; Rojas, Enith I.; Herre, Edward Allen

    2006-01-01

    Leaf-cutting ants (Atta spp.) are known for their extensive defoliation in neo-tropical forests and savannahs. Debate about the costs and benefits of their activities has been largely dominated by their detrimental effects on agriculture and agroforestry. However, the large accumulation of nutrients and changes in soil properties near their nests might benefit plants growing near them. Here, we test whether trees use nutrients that accumulate in debris piles near, or refuse chambers within, l...

  6. Attachment Style and Internet Addiction: An Online Survey

    OpenAIRE

    Eichenberg, Christiane; Schott, Markus; Decker, Oliver; Sindelar, Brigitte

    2017-01-01

    Background One of the clinically relevant problems of Internet use is the phenomenon of Internet addiction. Considering the fact that there is ample evidence for the relationship between attachment style and substance abuse, it stands to reason that attachment theory can also make an important contribution to the understanding of the pathogenesis of Internet addiction. Objective The aim of this study was to examine people?s tendency toward pathological Internet usage in relation to their atta...

  7. Control Structures in supply chains as a way to manage unpredictable cyber-risks

    OpenAIRE

    Sepúlveda Estay, Daniel Alberto; Khan, Omera

    2016-01-01

    Supply chain growth, and their dependence on Information Technology (IT), is making cyber risks an increasingly unmanageable threat through traditional risk assessment methods. Systemic analysis methods have been identified as alternatives to trad itional methods. This paper analyzes the application of a systemic risk analysis methodology to understand cyber risks in the supply chain. A generic supply chain is analyzed, and information flows, dynamic structures and the influence of cyber-atta...

  8. Environmental Assessment for the Expansion of the Elmendorf AFB Gravel Pit

    Science.gov (United States)

    2008-04-01

    Conservation 333 Raspberry Rd Anchorage AK 99518- 5519 Chris Nahorney Alaska Department of Natural Resources Division of Mining, Land, and Water 550 W...atta6men 1 ). The existing grd\\’e) pi I woultl cxp~tnd eastward to t1le boutldary llc1wcc,..’"l\\ Fori Richardson aud Elmendorf :\\PB, inc:ea.~inp, in si:.rc

  9. Comportamento e dieta alimentar de uma espécie de Latrodectus do grupo Mactans (Araneae, Theridiidae) em cativeiro

    OpenAIRE

    Dias, Maria de Fátima da Rocha; Brazil, Tania Kobler

    1999-01-01

    P. 991 - 996. Latrodectus gr. mactans is responsible for 28% of ali accidents provoked by spiders in state of Bahia, Brazil (1980-1990), which makes necessary the study of its manejament. The spiders were captured in Ondina, Salvador, and in Baxio, Esplanada (Bahia, Brazil); they were mantained in captivity, with food supply weekly (Atta sp., larva of Tenebrio sp. and Drosophila melanogaster) with three hours/ offers observation time, during march/95 to april/96. In captivity, the spiders ...

  10. Comportamento e dieta alimentar de uma espécie de Latrodectus do grupo Mactans (Araneae, Theridiidae) em cativeiro Behavior and diet supply of Latrodectus group Mactans (Araneae, Theridiidae) in captivity

    OpenAIRE

    Maria de Fátima da Rocha Dias; Tania Kobler Brazil

    1999-01-01

    Latrodectus gr. mactans is responsible for 28% of ali accidents provoked by spiders in state of Bahia, Brazil (1980-1990), which makes necessary the study of its manejament. The spiders were captured in Ondina, Salvador, and in Baxio, Esplanada (Bahia, Brazil); they were mantained in captivity, with food supply weekly (Atta sp., larva of Tenebrio sp. and Drosophila melanogaster) with three hours/ offers observation time, during march/95 to april/96. In captivity, the spiders accepted two kind...

  11. Nest architecture, fungus gardens, queen, males and larvae of the fungus-growing ant Mycetagroicus inflatus Brand?o & Mayh?-Nunes

    OpenAIRE

    Jesovnik, A.; Sosa-Calvo, J.; Lopes, C. T.; Vasconcelos, H. L.; Schultz, T. R.

    2013-01-01

    All known fungus-growing ants (tribe Attini) are obligately symbiotic with their cultivated fungi. The fungal cultivars of ?lower? attine ants are facultative symbionts, capable of living apart from ants, whereas the fungal cultivars of ?higher? attine ants, including leaf-cutting genera Atta and Acromyrmex, are highly specialized, obligate symbionts. Since higher attine ants and fungi are derived from lower attine ants and fungi, understanding the evolutionary transition from lower to higher...

  12. Dispersión, viabilidad, germinación y banco de semillas de Bdallophyton bambusarum (Ratllesiaceae) en la costa de Veracruz, México

    OpenAIRE

    García-Franco, José G; Rico-Gray, Victor

    2015-01-01

    Seed dispersors, seed viability, germinatíon and seed presenee in the soil seed bank are unknown aspects for most holoparasitic plants. In the subdeeiduous tropical forest at the CICOLMA field station in Veraeruz, México, seeds of Bdallophyton bambusarum Liebrn. are dispersed by Peromyscus mexicanus mexicanus, and oecasionally by ants (Atta sp.). Fruit is available during the time of lowest resource availability in ¡he forest, when land crabs are abundant (Gecarcinus lateralis Frem.), butseed...

  13. Household Coverage of Fortified Staple Food Commodities in Rajasthan, India.

    Directory of Open Access Journals (Sweden)

    Grant J Aaron

    Full Text Available A spatially representative statewide survey was conducted in Rajasthan, India to assess household coverage of atta wheat flour, edible oil, and salt. An even distribution of primary sampling units were selected based on their proximity to centroids on a hexagonal grid laid over the survey area. A sample of n = 18 households from each of m = 252 primary sampling units PSUs was taken. Demographic data on all members of these households were collected, and a broader dataset was collected about a single caregiver and a child in the first 2 years of life. Data were collected on demographic and socioeconomic status; education; housing conditions; recent infant and child mortality; water, sanitation, and hygiene practices; food security; child health; infant and young child feeding practices; maternal dietary diversity; coverage of fortified staples; and maternal and child anthropometry. Data were collected from 4,627 households and the same number of caregiver/child pairs. Atta wheat flour was widely consumed across the state (83%; however, only about 7% of the atta wheat flour was classified as fortifiable, and only about 6% was actually fortified (mostly inadequately. For oil, almost 90% of edible oil consumed by households in the survey was classified as fortifiable, but only about 24% was fortified. For salt, coverage was high, with almost 85% of households using fortified salt and 66% of households using adequately fortified salt. Iodized salt coverage was also high; however, rural and poor population groups were less likely to be reached by the intervention. Voluntary fortification of atta wheat flour and edible oil lacked sufficient industry consolidation to cover significant portions of the population. It is crucial that appropriate delivery channels are utilized to effectively deliver essential micronutrients to at-risk population groups. Government distribution systems are likely the best means to accomplish this goal.

  14. Not dead yet: the rise, fall and persistence of the BCG Matrix

    OpenAIRE

    Dag Øivind Madsen

    2017-01-01

    The BCG Matrix was introduced almost 50 years ago, and is today considered one of the most iconic strategic planning techniques. Using management fashion theory as a theoretical lens, this paper examines the historical rise, fall and persistence of the BCG Matrix. The analysis highlights the role played by fashion-setting actors (e.g., consultants, business schools and business media) in the rise of the BCG Matrix. However, over time, portfolio planning models such as the BCG Matrix were atta...

  15. Sperm storage induces an immunity cost in ants

    DEFF Research Database (Denmark)

    Baer, Boris; Armitage, Sophie A O; Boomsma, Jacobus J

    2006-01-01

    what selective forces determine the upper limit to sperm storage. Here we show that sperm storage carries a significant cost of reduced immunity during colony founding. Newly mated queens of the leaf-cutting ant Atta colombica upregulate their immune response shortly after completing their nest burrow......-term reproductive success. The immune response was lower when more males contributed to the stored sperm, indicating that there might be an additional cost of mating or storing genetically different ejaculates....

  16. Tracer Applications of Noble Gas Radionuclides in the Geosciences

    CERN Document Server

    Lu, Z -T; Smethie, W M; Sturchio, N C; Fischer, T P; Kennedy, B M; Purtschert, R; Severinghaus, J P; Solomon, D K; Tanhua, T; Yokochi, R

    2013-01-01

    The noble gas radionuclides, including 81Kr (half-life = 229,000 yr), 85Kr (11 yr), and 39Ar (269 yr), possess nearly ideal chemical and physical properties for studies of earth and environmental processes. Recent advances in Atom Trap Trace Analysis (ATTA), a laser-based atom counting method, have enabled routine measurements of the radiokrypton isotopes, as well as the demonstration of the ability to measure 39Ar in environmental samples. Here we provide an overview of the ATTA technique, and a survey of recent progress made in several laboratories worldwide. We review the application of noble gas radionuclides in the geosciences and discuss how ATTA can help advance these fields, specifically determination of groundwater residence times using 81Kr, 85Kr, and 39Ar; dating old glacial ice using 81Kr; and an 39Ar survey of the main water masses of the oceans, to study circulation pathways and estimate mean residence times. Other scientific questions involving deeper circulation of fluids in the Earth's crust ...

  17. Functional role of phenylacetic acid from metapleural gland secretions in controlling fungal pathogens in evolutionarily derived leaf-cutting ants

    Science.gov (United States)

    Fernández-Marín, Hermógenes; Nash, David R.; Higginbotham, Sarah; Estrada, Catalina; van Zweden, Jelle S.; d'Ettorre, Patrizia; Wcislo, William T.; Boomsma, Jacobus J.

    2015-01-01

    Fungus-farming ant colonies vary four to five orders of magnitude in size. They employ compounds from actinomycete bacteria and exocrine glands as antimicrobial agents. Atta colonies have millions of ants and are particularly relevant for understanding hygienic strategies as they have abandoned their ancestors' prime dependence on antibiotic-based biological control in favour of using metapleural gland (MG) chemical secretions. Atta MGs are unique in synthesizing large quantities of phenylacetic acid (PAA), a known but little investigated antimicrobial agent. We show that particularly the smallest workers greatly reduce germination rates of Escovopsis and Metarhizium spores after actively applying PAA to experimental infection targets in garden fragments and transferring the spores to the ants' infrabuccal cavities. In vitro assays further indicated that Escovopsis strains isolated from evolutionarily derived leaf-cutting ants are less sensitive to PAA than strains from phylogenetically more basal fungus-farming ants, consistent with the dynamics of an evolutionary arms race between virulence and control for Escovopsis, but not Metarhizium. Atta ants form larger colonies with more extreme caste differentiation relative to other attines, in societies characterized by an almost complete absence of reproductive conflicts. We hypothesize that these changes are associated with unique evolutionary innovations in chemical pest management that appear robust against selection pressure for resistance by specialized mycopathogens. PMID:25925100

  18. Metagenomic and metaproteomic insights into bacterial communities in leaf-cutter ant fungus gardens

    Energy Technology Data Exchange (ETDEWEB)

    Aylward, Frank O.; Burnum, Kristin E.; Scott, Jarrod J.; Suen, Garret; Tringe, Susannah G.; Adams, Sandra M.; Barry, Kerrie W.; Nicora, Carrie D.; Piehowski, Paul D.; Purvine, Samuel O.; Starrett, Gabriel J.; Goodwin, Lynne A.; Smith, Richard D.; Lipton, Mary S.; Currie, Cameron R.

    2012-09-01

    Herbivores gain access to nutrients stored in plant biomass largely by harnessing the metabolic activities of microbes. Leaf-cutter ants of the genus Atta are a hallmark example; these dominant Neotropical herbivores cultivate symbiotic fungus gardens on massive quantities of fresh plant forage. As the external digestive system of the ants, fungus gardens facilitate the production and sustenance of millions of workers in mature Atta colonies. Here we use metagenomic, and metaproteomic techniques to characterize the bacterial diversity and overall physiological potential of fungus gardens from two species of Atta. Our analysis of over 1.2 Gbp of community metagenomic sequence and three 16S pyrotag libraries reveals that, in addition to harboring the dominant fungal crop, these ecosystems contain abundant populations of Enterobacteriaceae, including the genera Enterobacter, Pantoea, Klebsiella, Citrobacter, and Escherichia. We show that these bacterial communities possess genes commonly associated with lignocellulose degradation, and likely participate in the processing of plant biomass. Additionally, we demonstrate that bacteria in these environments encode a diverse suite of biosynthetic pathways, and that they may enrich the nitrogen-poor forage of the ants with B-vitamins, amino acids, and proteins. These results are consistent with the hypothesis that fungus gardens are highly-specialized fungus-bacteria communities that efficiently convert plant material into usable energy for their ant hosts. Together with recent investigations into the microbial symbionts of vertebrates, our work underscores the importance of microbial communities to the ecology and evolution of herbivorous metazoans.

  19. Extended-Range Passive RFID and Sensor Tags

    Science.gov (United States)

    Fink, Patrick W.; Kennedy, Timothy F.; Lin, Gregory Y.; Barton, Richard

    2012-01-01

    Extended-range passive radio-frequency identification (RFID) tags and related sensor tags are undergoing development. A tag of this type incorporates a retroreflective antenna array, so that it reflects significantly more signal power back toward an interrogating radio transceiver than does a comparable passive RFID tag of prior design, which does not incorporate a retroreflective antenna array. Therefore, for a given amount of power radiated by the transmitter in the interrogating transceiver, a tag of this type can be interrogated at a distance greater than that of the comparable passive RFID or sensor tag of prior design. The retroreflective antenna array is, more specifically, a Van Atta array, named after its inventor and first published in a patent issued in 1959. In its simplest form, a Van Atta array comprises two antenna elements connected by a transmission line so that the signal received by each antenna element is reradiated by the other antenna element (see Figure 1). The phase relationships among the received and reradiated signals are such as to produce constructive interference of the reradiated signals; that is, to concentrate the reradiated signal power in a direction back toward the source. Hence, an RFID tag equipped with a Van Atta antenna array automatically tracks the interrogating transceiver. The effective gain of a Van Atta array is the same as that of a traditional phased antenna array having the same number of antenna elements. Additional pairs of antenna elements connected by equal-length transmission lines can be incorporated into a Van Atta array to increase its directionality. Like some RFID tags here-to-fore commercially available, an RFID or sensor tag of the present developmental type includes one-port surface-acoustic-wave (SAW) devices. In simplified terms, the mode of operation of a basic one-port SAW device as used heretofore in an RFID device is the following: An interrogating radio signal is converted, at an input end, from

  20. Monoculture of leafcutter ant gardens.

    Directory of Open Access Journals (Sweden)

    Ulrich G Mueller

    Full Text Available BACKGROUND: Leafcutter ants depend on the cultivation of symbiotic Attamyces fungi for food, which are thought to be grown by the ants in single-strain, clonal monoculture throughout the hundreds to thousands of gardens within a leafcutter nest. Monoculture eliminates cultivar-cultivar competition that would select for competitive fungal traits that are detrimental to the ants, whereas polyculture of several fungi could increase nutritional diversity and disease resistance of genetically variable gardens. METHODOLOGY/PRINCIPAL FINDINGS: Using three experimental approaches, we assessed cultivar diversity within nests of Atta leafcutter ants, which are most likely among all fungus-growing ants to cultivate distinct cultivar genotypes per nest because of the nests' enormous sizes (up to 5000 gardens and extended lifespans (10-20 years. In Atta texana and in A. cephalotes, we resampled nests over a 5-year period to test for persistence of resident cultivar genotypes within each nest, and we tested for genetic differences between fungi from different nest sectors accessed through excavation. In A. texana, we also determined the number of Attamyces cells carried as a starter inoculum by a dispersing queens (minimally several thousand Attamyces cells, and we tested for genetic differences between Attamyces carried by sister queens dispersing from the same nest. Except for mutational variation arising during clonal Attamyces propagation, DNA fingerprinting revealed no evidence for fungal polyculture and no genotype turnover during the 5-year surveys. CONCLUSIONS/SIGNIFICANCE: Atta leafcutter ants can achieve stable, fungal monoculture over many years. Mutational variation emerging within an Attamyces monoculture could provide genetic diversity for symbiont choice (gardening biases of the ants favoring specific mutational variants, an analog of artificial selection.

  1. Dicty_cDB: Contig-U10739-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available Contig-U10739-1 gap included 1017 2 4773038 4772656 MINUS 14 16 U10739 1 4 0 3 2 0 0 0 0 2 0 0 1 1 Show...Contig-U10739-1 Contig ID Contig-U10739-1 Contig update 2002.12.18 Contig sequence >Contig-U10739-1 (Contig-U10739-1Q)...Seq.d CAATACACATTTCAACCTACATTGAAGAATCTCTTGTGAATAAAAAAAAA CTAAATAAAAAAAAAAAAAAAAAAAATTTANTAATTAAAAAATTAAATTA...ATTA AAAAAAAA----------AAAGAGCAAGTTGAAGAAGAGGAGGAAGAAGA AGAAGAGGAAGATTTAAAACCAGCAACACCTGTTAAAAAAACTAAACCAC...AACCAC CACCACCAACTAAACAAAGTAGAGCTAAAAAGGAAGAAATTAAAGTTGAT GATGCAGCTAAAAGTGATAATGATGATAAATATCACACAAAAACAGTTTA

  2. The Other Side of Complexity

    OpenAIRE

    Campbell, Catherine Anne

    2011-01-01

    ABSTRACT OF THESISThe Other Side of ComplexitybyCatherine Anne CampbellMaster of Fine Arts in Theatre and Dance (Acting)University of California, San Diego, 2011Professor Kyle Donnelly, Chair A recurring note that I have received during my time here has been, "Learn to be more simple." What does this mean? I would ask myself. It seemed that the simpler I would try to be, the more boring I would feel. It is no secret that I like to work hard, even incessantly. When I approach a role, I atta...

  3. Cartography past, present and future

    CERN Document Server

    Rhind, DW

    2013-01-01

    Making maps dates back at least four thousand years and it is widely recognised that many maps are of great historical value and present a skilled method of summarising the real world on a sheet of paper. Less well known is the judgement involved in the selection and simplification of features, the complex transformation of space and the exacting standards which are needed in cartography. This book is primarily a tribute to Professor F.J. Ormeling, former President and Secretary/Treasurer of the ICA and gives a wide ranging review of the current status of cartography, how this status was atta

  4. Le CRDI au Ghana

    International Development Research Centre (IDRC) Digital Library (Canada)

    poussée en mathématiques aux spécialistes de demain afin qu'ils puissent relever les défis pressants qui se posent en matière d'environnement, de santé et d'économie. La bourse de chercheur invité que le CRDI a octroyée en 2001 au regretté. John Atta-Mills, qui a par la suite été prési- dent du Ghana de 2009 à 2012, ...

  5. In-situ measurement in aircraft exhaust plumes and in North Atlantic air traffic corridor

    Energy Technology Data Exchange (ETDEWEB)

    Slemr, F.; Giehl, H.; Slemr, J. [Fraunhofer-Institut fuer Atmosphaerische Umweltforschung (IFU), Garmisch-Partenkirchen (Germany)

    1997-12-01

    Concentrations of non-methane hydrocarbons (NMHC) and CO were measured in exhaust plumes of DLR experimental aircraft ATTAS equipped with Rolls Royce M 45H Mk501 engines. The emission indices (EI) of individual light NMHC were determined from ratios of NMHC and CO concentration enhancements measured in grab samples and the concurrent in-flight measurements of EI of CO by FTIR emission spectroscopy. Alkenes and alkynes generated by cracking of larger NMHC molecules and aromatic compounds originating from unburnt fuel constituted a larger and a smaller fraction of the NMHC emissions, respectively. Measurements in North Atlantic air traffic corridor were also made. (orig.) 144 figs., 42 tabs., 497 refs.

  6. Primer reporte de la familia Cheiridiidae (Arachnida: Pseudoscorpionida en Colombia

    Directory of Open Access Journals (Sweden)

    Jorge Alexander Quirós-Rodríguez

    2015-09-01

    Full Text Available Durante un estudio de la fauna de artrópodos asociada a montículos de detritos de hormigas de la especie Atta colombica Guérin-Méneville, 1844 (Hymenoptera: Formicidae en la hacienda Santa Isabel, corregimiento de Patio Bonito en el departamento de Córdoba, se encontraron representantes de la familia Cheiridiidae. Por tanto, estos pseudoescorpiones se convierten en el primer reporte de la familia para Colombia y por primera vez se registra su presencia en detritus de hormigas. Así mismo, este reporte, amplía su distribución conocida para Suramérica.

  7. Linear Stability of Self-Similar Flow: 1. Isothermal Cylindrical Implosion and Expansion.

    Science.gov (United States)

    1978-03-01

    K. A. Gerber, D A. Hammer, D. J. Jenkins, A. E. Robson and P. J. Turchi , in Plasma Physics and Controlled Nuclear Fusion Research International...Kadomtsev E. P. Velikov L. I. Rudakov 8. Laborstoria di Fisica Via Celoria 16 201~~ Milano, Italla Atta: P. Caldirola E. Sindoni 9. Max Planek Institute... Nuclear Physics Institute Novosibirsk, U. S. S. R. Attn: D. D. Byutov 31. University of ~1atal King George V Avenue Durban, South Africa Attn: H. A. Heflberg 10

  8. Novel fungal disease in complex leaf-cutting ant societies

    DEFF Research Database (Denmark)

    Hughes, David Peter; Evans, Harry C.; Hywel-Jones, Nigel

    2009-01-01

    events of Acromyrmex and Atta leaf-cutting ants by Ophiocordyceps fungi, agenus of entomopathogens that is normally highly specific in its host choice. 4. As leaf-cutting ants have been intensively studied, the absence of prior records of Ophiocordyceps suggests that these infections may be a novel event....... Specific fungal diseases of the leaf-cutting ants themselves have not been described, possibly because broad spectrum anti-fungal defences against mycopathogens have reduced their susceptibility to entomopathogens. 3. Using morphological and molecular tools, the present study documents three rare infection...

  9. How Perfect Offline Wallets Can Still Leak Bitcoin Private Keys

    OpenAIRE

    Verbücheln, Stephan

    2015-01-01

    ECDSA has become a popular choice as lightweight alternative to RSA and classic DL based signature algorithms in recent years. As standardized, the signature produced by ECDSA for a pair of a message and a key is not deterministic. This work shows how this non-deterministic choice can be exploited by an attacker to leak private information through the signature without any side channels, an attack first discovered by Young and Yung for classic DL-based cryptosystems in 1997, and how this atta...

  10. Analysis of 85Kr: a comparison at the 10 -14 level using micro-liter samples.

    Science.gov (United States)

    Yang, G-M; Cheng, C-F; Jiang, W; Lu, Z-T; Purtschert, R; Sun, Y-R; Tu, L-Y; Hu, S-M

    2013-01-01

    The isotopic abundance of (85)Kr in the atmosphere, currently at the level of 10(-11), has increased by orders of magnitude since the dawn of nuclear age. With a half-life of 10.76 years, (85)Kr is of great interest as tracers for environmental samples such as air, groundwater and ice. Atom Trap Trace Analysis (ATTA) is an emerging method for the analysis of rare krypton isotopes at isotopic abundance levels as low as 10(-14) using krypton gas samples of a few micro-liters. Both the reliability and reproducibility of the method are examined in the present study by an inter-comparison among different instruments. The (85)Kr/Kr ratios of 12 samples, in the range of 10(-13) to 10(-10), are measured independently in three laboratories: a low-level counting laboratory in Bern, Switzerland, and two ATTA laboratories, one in Hefei, China, and another in Argonne, USA. The results are in agreement at the precision level of 5%.

  11. Alarm Pheromone Composition and Behavioral Activity in Fungus-Growing Ants.

    Science.gov (United States)

    Norman, Victoria C; Butterfield, Thomas; Drijfhout, Falko; Tasman, Kiah; Hughes, William O H

    2017-03-01

    Chemical communication is a dominant method of communication throughout the animal kingdom and can be especially important in group-living animals in which communicating threats, either from predation or other dangers, can have large impacts on group survival. Social insects, in particular, have evolved a number of pheromonal compounds specifically to signal alarm. There is predicted to be little selection for interspecific variation in alarm cues because individuals may benefit from recognizing interspecific as well as conspecific cues and, consequently, alarm cues are not normally thought to be used for species or nestmate recognition. Here, we examine the composition of the alarm pheromones of seven species of fungus-growing ants (Attini), including both basal and derived species and examine the behavioral responses to alarm pheromone of Acromyrmex leaf-cutting ants, the sister genus to the highly studied Atta leaf-cutting ants. We find surprisingly high interspecific variation in alarm pheromone composition across the attine phylogeny. Interestingly, the active component of the alarm pheromone was different between the two leaf-cutting ant genera. Furthermore, in contrast to previous studies on Atta, we found no differences among morphological castes in their responses to alarm pheromone in Acromyrmex but we did find differences in responses among putative age classes. The results suggest that the evolution of alarm communication and signaling within social insect clades can be unexpectedly complex and that further work is warranted to understand whether the evolution of different alarm pheromone compounds is adaptive.

  12. TRADITIONAL USE OF THREE EDIBLE INSECTS IN COFFEE AGROECOSYSTEMS IN THE STATE OF VERACRUZ

    Directory of Open Access Journals (Sweden)

    Esteban Escamilla Prado

    2012-11-01

    Full Text Available Coffee (Coffea arabica L. is one of the most economically, socioculturally and environmentally important crops in Veracruz. Shade-grown coffee plantations provide environmental services and play a key role in biodiversity conservation. In coffee farms in Veracruz insects are an abundant natural resource, and part of the use of this resource is the consumption of some edible insects in certain coffee regions. The objective of this study was to know the traditional use of three species of edible insects in the coffee agroecosystem of Veracruz. During the period 2007-2012, an ethnoentomological study was conducted in coffee regions from central Veracruz. The insect species identified were the ants chicatanas (Atta mexicana Smith and Atta cephalotes Latreille in the municipality of Huatusco, the larva gusano del jonote (Arsenura armida armida Cramer in the municipalities of Zongolica, Tequila and Tezonapa, and the larva gusanillo (Phassus triangularis H.E. in the municipalities of Córdoba, Ixhuatlán del Café, Tepatlaxco, Chocamán and Zongolica. The results showed the traditional knowledge held by coffee growers related to these edible species which are a valuable natural resource in their coffee plantations. Knowledge on agroecological relationships, collection, consumption and marketing was rescued. In conclusion, the insect species studied are used for local consumption and have great economic potential due to their high sell price during the harvest season.

  13. Comportamento e dieta alimentar de uma espécie de Latrodectus do grupo Mactans (Araneae, Theridiidae em cativeiro Behavior and diet supply of Latrodectus group Mactans (Araneae, Theridiidae in captivity

    Directory of Open Access Journals (Sweden)

    Maria de Fátima da Rocha Dias

    1999-01-01

    Full Text Available Latrodectus gr. mactans is responsible for 28% of ali accidents provoked by spiders in state of Bahia, Brazil (1980-1990, which makes necessary the study of its manejament. The spiders were captured in Ondina, Salvador, and in Baxio, Esplanada (Bahia, Brazil; they were mantained in captivity, with food supply weekly (Atta sp., larva of Tenebrio sp. and Drosophila melanogaster with three hours/ offers observation time, during march/95 to april/96. In captivity, the spiders accepted two kinds of food: Atta sp., which seems to be the major item of its diet in natural conditions, and larva of Tenebrio sp., which is not available in natural conditions. Drosophila melanogaster was systematically rejected. The feeding behavior iscomposed by four distinct steps: (1 imrnobilization, (2 inoculation, (3 second immobilization and (4 ingestion. Two kinds of social alimentary behavior are descri-bed. The results indicated that larvae of Tenebrio sp. can be an alternative supply for successfull maintenance of this specie in captivity.

  14. All-optical atom trap trace analysis for rare krypton isotopes

    Energy Technology Data Exchange (ETDEWEB)

    Woelk, Pablo; Kohler, Markus; Sieveke, Carsten; Hebel, Simon; Sahling, Peter [Carl Friedrich von Weizsaecker Centre for Science and Peace Research, University of Hamburg (Germany); Becker, Christoph; Sengstock, Klaus [Institut fuer Laser-Physik, University of Hamburg (Germany)

    2016-07-01

    The isotope Krypton-85 is an excellent indicator for the detection of nuclear reprocessing activities. However, for the analysis of atmospheric air samples, sensitive measuring methods down to the single atom level are required because of the small concentrations. Furthermore, for a practical and effective detection of clandestine reprocessing, small sample sizes and a high sample throughput rate are desirable. Established methods using Atom Trap Trace Analysis (ATTA) allow high sensitivity but have a limited throughput of about 200 samples per year, since the vacuum chambers have to be flushed for several hours after each measurement to avoid cross contamination due to the RF-driven excitation of metastable states. Here we present an enhanced ATTA apparatus, which in contrast to the established methods, produces metastable Kr all-optically. This avoids cross contamination, therefore allowing a much higher throughput rate. The apparatus is based on a self-made VUV-lamp and a 2D-3D magneto-optical trap setup. In the 2D trap metastable krypton is produced and a beam of atoms is formed by Doppler-cooling simultaneously.

  15. Radiometric 81Kr dating identifies 120,000-year-old ice at Taylor Glacier, Antarctica.

    Science.gov (United States)

    Buizert, Christo; Baggenstos, Daniel; Jiang, Wei; Purtschert, Roland; Petrenko, Vasilii V; Lu, Zheng-Tian; Müller, Peter; Kuhl, Tanner; Lee, James; Severinghaus, Jeffrey P; Brook, Edward J

    2014-05-13

    We present successful (81)Kr-Kr radiometric dating of ancient polar ice. Krypton was extracted from the air bubbles in four ∼350-kg polar ice samples from Taylor Glacier in the McMurdo Dry Valleys, Antarctica, and dated using Atom Trap Trace Analysis (ATTA). The (81)Kr radiometric ages agree with independent age estimates obtained from stratigraphic dating techniques with a mean absolute age offset of 6 ± 2.5 ka. Our experimental methods and sampling strategy are validated by (i) (85)Kr and (39)Ar analyses that show the samples to be free of modern air contamination and (ii) air content measurements that show the ice did not experience gas loss. We estimate the error in the (81)Kr ages due to past geomagnetic variability to be below 3 ka. We show that ice from the previous interglacial period (Marine Isotope Stage 5e, 130-115 ka before present) can be found in abundance near the surface of Taylor Glacier. Our study paves the way for reliable radiometric dating of ancient ice in blue ice areas and margin sites where large samples are available, greatly enhancing their scientific value as archives of old ice and meteorites. At present, ATTA (81)Kr analysis requires a 40-80-kg ice sample; as sample requirements continue to decrease, (81)Kr dating of ice cores is a future possibility.

  16. Artistic creativity and DBS: a case report.

    Science.gov (United States)

    Drago, V; Foster, P S; Okun, M S; Haq, I; Sudhyadhom, A; Skidmore, F M; Heilman, K M

    2009-01-15

    Deep brain stimulation (DBS) is a treatment for patients with Parkinson's disease (PD) who are not adequately controlled with medications. An artist reported changes in her artistic creativity and art appreciation when treated with left DBS. We sought to study her artistic productions and her appreciation of art while both "on" and "off" left DBS. A 69-year-old right-handed woman with an approximate 20-year history of PD was referred to us for management of a left subthalamic region nucleus (STN) DBS placed at another institution 4 years prior. In Experiment 1 we had her rate several dimensions (Evocative Impact, Aesthetics, Novelty, Technique, Closure and Representation) of another artist's paintings. In Experiment 2, we tested her with the Abbreviated Torrance Test (of creativity) for Adults (ATTA). During testing the patient remained on her dopaminergic medication, but was tested on and off left DBS. On the judgment task while "on" left DBS, versus "off" DBS, there were significant reductions in her appreciation of artistic Closure and Technique. When "off" DBS her ATTA creativity index was above average, but when switched "on" her creativity index was below average. These results suggest the possibility that left ventral STN/SNR DBS reduces creativity as well as appreciation of art. The reason for these alterations is not known, but might be related to enhanced activation of the left hemisphere and reciprocal deactivation of the right hemisphere which mediates both visuospatial skills and global attention, both of which are important in artistic creativity and appreciation.

  17. PRIMER REPORTE DE LA FAMILIA CHEIRIDIIDAE (ARACHNIDA: PSEUDOSCORPIONIDA EN COLOMBIA

    Directory of Open Access Journals (Sweden)

    Jorge Alexander QUIROZ-RODRÍGUEZ

    2015-07-01

    Full Text Available Durante un estudio de la fauna de artrópodos asociada a montículos de detritos de hormigas de la especie Atta colombica Guérin-Méneville, 1844 (Hymenoptera: Formicidae en la hacienda Santa Isabel, corregimiento de Patio Bonito en el departamento de Córdoba, se encontraron representantes de la familia Cheiridiidae. Por tanto, estos pseudoescorpiones se convierten en el primer reporte de la familia para Colombia y por primera vez se registra su presencia en detritus de hormigas. Así mismo, este reporte, amplía su distribución conocida para Suramérica.First Report of Family Cheiridiidae (Arachnida: Pseudoscorpionida in ColombiaDuring a study of the arthropod fauna associated with mounds of detritus produced by Atta colombica (Hymenoptera: Formicidae in the Santa Isabel estate, locality of Patio Bonito, Department of Córdoba, were found representatives of the family Cheiridiidae. Therefore, these pseudoscorpions becomes in the first report of the family to Colombia and for the first time is recorded its presence in ant detritus. Also, this report extends its known distribution range in South America.   

  18. Development of Myrmeleon brasiliensis (Navas) (Neuroptera, Myrmeleontidae), in laboratory, with different natural diets

    Energy Technology Data Exchange (ETDEWEB)

    Missirian, Giani L.B. [Centro Universitario da Grande Dourados, MS (Brazil). Curso de Ciencias Biologicas; Uchoa-Fernandes, Manoel A. [Universidade Federal da Grande Dourados, MS (Brazil). Faculdade de Ciencias Biologicas e Ambientais]. E-mail: uchoa.fernandes@ufgd.edu.br; Fischer, Erich [Universidade Federal de Mato Grosso do Sul, Campo Grande, MS (Brazil). Dept. de Biologia

    2006-07-01

    Antlions larvae are sit-and-wait predators that capture arthropod prey in conical sand pits. The aim of this paper were to determine the effect of different natural diets [leaf-cutting ants (Atta spp.), fruit fly larvae (Anastrepha spp. and Ceratitis capitata) and mixed diet (Atta spp. plus fruit fly larvae)] on the development of larvae and pupae of M. brasiliensis (Navas, 1914) and to estimate the number and size of prey caught in each instar and on each kind of diet. The average duration (days) of the second and third instars of M. brasiliensis was longer when larvae of antlion were fed with leaf-cutting ants. The diets did not affect the duration of the pupal stage nor the pupae size. The different diets did not affect the mean width of head capsule (mm), the mean weight (mg) or the mean body size (mm) in the different instars of M. brasiliensis. In the second and third instars, the larvae of M. brasiliensis fed with leaf-cutting ants consumed more prey than larvae kept on other diets. Adults whose larvae were fed fruit fly larvae were larger than adults on other diets. Although Myrmeleontidae are few studied in Brazil, these results contribute to knowledge of M. brasiliensis biology, but also suggest the need of studies about the development of larvae and pupae in natural environments. (author)

  19. Laboratory for Radiokrypton Dating

    Science.gov (United States)

    Lu, Z.; Bailey, K.; Jiang, W.; Müller, P.; O'Connor, T. P.; Zappala, J. C.

    2013-12-01

    Due to its simple production and transport processes in the terrestrial environment, the long-lived noble-gas isotope 81Kr (half-life = 230 kyr) is the ideal tracer for studying old water and ice in the age range of 10^5-10^6 years, a range beyond the reach of 14C. 81Kr dating, a concept pursued in the past four decades by numerous laboratories employing a variety of techniques, is now available for the first time to the earth science community at large. This is made possible by the development of ATTA-3 (Jiang et al., GCA 91, 1-6; 2012), an efficient and selective atom counter based on the Atom Trap Trace Analysis method (Chen et al., Science 286, 1139-1141; 1999). The instrument is capable of measuring both 81Kr/Kr and 85Kr/Kr ratios of environmental samples in the range of 10^-14-10^-10. For 81Kr-dating in the age range of 150 - 1,500 kyr, the required sample size is 5 - 10 micro-L STP of krypton gas, which can be extracted from approximately 100 - 200 kg of water or 40 - 80 kg of ice. For 85Kr/Kr analysis, the required sample size is generally smaller by an order of magnitude because of the isotope's higher initial abundance in the atmosphere. The Laboratory for Radiokrypton Dating is currently equipped to analyze up to 120 samples per year. With future equipment upgrades, this limit can be increased as demand grows. In the period since November 2011, the Laboratory has measured both 81Kr/Kr and 85Kr/Kr ratios in over 50 samples that had been extracted by collaborators from six different continents. The samples were from groundwater wells in the Great Artesian Basin (Australia), Guarani Aquifer (Brazil), and Locust Grove (Maryland); from brine wells of the Waste Isolation Pilot Plant (New Mexico); from geothermal steam vents in Yellowstone National Park; from near-surface ice at Taylor Glacier, Antarctica; and from deep mines in South Africa. Sample collection and purification was performed by groups including the University of Illinois at Chicago, University

  20. Raise your defence: a baseline for security

    CERN Multimedia

    Computer Security Team

    2011-01-01

    It is an unfair imbalance: the (computer) security of a system/service is only as strong as the weakest link in the chain of protection. This provides attackers with an incredible advantage: they can choose when to attack, where and with which means. The defence side is permanently under pressure: they must defend at all times all assets against all eventualities. For computer security, this means that every computer system, every account, every web site and every service must be properly protected --- always.   In particular, at CERN, those services visible to the Internet are permanently probed. Web sites and servers are permanently scanned by adversaries for vulnerabilities; attackers repeatedly try to guess user passwords on our remote access gateways like LXPLUS or CERNTS; computing services, e.g. for Grid computing, are analysed again and again by malicious attackers for weaknesses which can be exploited. Thanks to the vigilance of the corresponding system and service experts, these atta...

  1. PLAGAS Y ENFERMEDADES EN PLANTACIONES DE TECA (Tectona grandis L.F EN LA ZONA DE BALZAR, PROVINCIA DEL GUAYAS

    Directory of Open Access Journals (Sweden)

    Tonny Flores Velasteguí

    2010-06-01

    Full Text Available Se diagnosticó las plagas y enfermedades en plantaciones de Tectona grandis L.F (Teca en la zona de Balzar, provincia del Guayas. Los objetivos fueron recolectar e identificar los insectos plagas y los agentes causales de enfermedades que se encuentran presentes en las plantaciones de Teca, determinar el nivel de incidencia y severidad de los problemas fitosanitarios. Se realizaron muestreos al azar mediante recorridos en transeptos y se establecieron parcelas de 500 m2 distribuidas según las superficies de las haciendas. Los insectos se recolectaron en época seca y lluviosa durante seis meses. Las plagas y enfermedades de mayor incidencia y severidad fueron: Hyadaphis erysimi y Hortensia similis (Homóptera; y Colletotrichum sp., Olivea tectonae y Ceratocystis sp. en época lluviosa. Atta sp. (Hymenóptera, Hemileuca maia y Scolytus sp. (Coleóptera; y Olivea tectonae en época seca.

  2. Development of Myrmeleon brasiliensis (Navás (Neuroptera, Myrmeleontidae, in laboratory, with different natural diets Desenvolvimento de Myrmeleon brasiliensis (Navás (Neuroptera, Myrmeleontidae, em laboratório, com diferentes dietas naturais

    Directory of Open Access Journals (Sweden)

    Giani L. B. Missirian

    2006-12-01

    Full Text Available Antlions larvae are sit-and-wait predators that capture arthropod prey in conical sand pits. The aim of this paper were to determine the effect of different natural diets [leaf-cutting ants (Atta spp., fruit fly larvae (Anastrepha spp. and Ceratitis capitata and mixed diet (Atta spp. plus fruit fly larvae] on the development of larvae and pupae of M. brasiliensis (Navás, 1914 and to estimate the number and size of prey caught in each instar and on each kind of diet. The average duration (days of the second and third instars of M. brasiliensis was longer when larvae of antlion were fed with leaf-cutting ants. The diets did not affect the duration of the pupal stage nor the pupae size. The different diets did not affect the mean width of head capsule (mm, the mean weight (mg or the mean body size (mm in the different instars of M. brasiliensis. In the second and third instars, the larvae of M. brasiliensis fed with leaf-cutting ants consumed more prey than larvae kept on other diets. Adults whose larvae were fed fruit fly larvae were larger than adults on other diets. Although Myrmeleontidae are few studied in Brazil, these results contribute to knowledge of M. brasiliensis biology, but also suggest the need of studies about the development of larvae and pupae in natural environments.Larvas de formiga-leão são conhecidas por suas armadilhas ("funis" que constroem em solo arenoso, sob as quais esperam por suas presas. Este trabalho teve como objetivos verificar o efeito de diferentes dietas naturais [formigas-cortadeiras (Atta spp., larvas de moscas-das-frutas (Anastrepha spp. e Ceratitis capitata e dieta mista (Atta spp. e larvas de moscas-das-frutas] sobre o desenvolvimento larval e pupal de M. brasiliensis (Navás, 1914 e estimar o número e tamanho de presas capturadas, por instar larval, em cada dieta. No segundo e terceiro instares, as larvas de M. brasiliensis alimentadas com formigas-cortadeiras consumiram um número maior de presas e a

  3. Co-evolution of enzyme function in the attine ant-fungus symbiosis

    DEFF Research Database (Denmark)

    de Fine Licht, Henrik Hjarvard; Schiøtt, Morten; Boomsma, Jacobus Jan

    have small nests with a fungus garden the size of a table-tennis ball. Only the leaf-cutting ants are specialized on using fresh leaves as substrate for their fungus gardens, whereas the more basal attine genera use substrates such as dry plant material (leaf litter and small twigs) and also insect......Introduction: Fungus-growing ants cultivate specialized fungi in the tribe Leucocoprineae (Lepiotaceae: Basidiomycota) inside their nests. The conspicuous leaf-cutting ants in the genus Atta build huge nests displacing several cubic meters of soil, whereas lower attine genera such as Cyphomyrmex...... the fresh leaf feeding species had a higher activity of amylase. The group of higher attines had a higher activity of proteinase and pectinase. In contrast the lower genera had a non-significant trend towards a higher activity of xylanase compared to the higher attine genera. Cellulase activity was uniform...

  4. Variation in fungal enzyme spectra may affect mutualistic division of labour between ants and fungus gardens

    DEFF Research Database (Denmark)

    de Fine Licht, Henrik Hjarvard; Boomsma, Jacobus Jan

    partners vary in metabolic performance, division of labour may not always be optimized and co-evolutionary trajectories become less predictable. The higher fungus-growing (attine) ants consist of the leafcutter ants (Acromyrmex and Atta), which rear a single fungal species throughout their Latin American...... range, and a paraphyletic assembly of Trachymyrmex and Sericomyrmex species that cultivate more genetically diverse fungal symbionts. Leaf-decomposition productivity of colonies depends on the combined efforts of ant foragers collecting and macerating plant material and fungal enzymes excreted directly...... or indirectly via ant fecal fluid. We determined the interaction specificity between ant species and fungal strains across sympatric populations of six Trachymyrmex and Sericomyrmex species in Panama, and established that these ants jointly reared eight fungal haplotype groups that differed significantly...

  5. Identifying the transition between single and multiple mating of queens in fungus-growing ants

    DEFF Research Database (Denmark)

    Villesen, Palle; Murakami, Takahiro; Schultz, Ted R

    2002-01-01

    Obligate mating of females (queens) with multiple males has evolved only rarely in social Hymenoptera (ants, social bees, social wasps) and for reasons that are fundamentally different from those underlying multiple mating in other animals. The monophyletic tribe of ('attine') fungus-growing ants...... is known to include evolutionarily derived genera with obligate multiple mating (the Acromyrmex and Atta leafcutter ants) as well as phylogenetically basal genera with exclusively single mating (e.g. Apterostigma, Cyphomyrmex, Myrmicocrypta). All attine genera share the unique characteristic of obligate...... dependence on symbiotic fungus gardens for food, but the sophistication of this symbiosis differs considerably across genera. The lower attine genera generally have small, short-lived colonies and relatively non-specialized fungal symbionts (capable of living independently of their ant hosts), whereas...

  6. The Evolutionary Innovation of Nutritional Symbioses in Leaf-Cutter Ants

    Directory of Open Access Journals (Sweden)

    Frank O. Aylward

    2012-01-01

    Full Text Available Fungus-growing ants gain access to nutrients stored in plant biomass through their association with a mutualistic fungus they grow for food. This 50 million-year-old obligate mutualism likely facilitated some of these species becoming dominant Neotropical herbivores that can achieve immense colony sizes. Recent culture-independent investigations have shed light on the conversion of plant biomass into nutrients within ant fungus gardens, revealing that this process involves both the fungal cultivar and a symbiotic community of bacteria including Enterobacter, Klebsiella, and Pantoea species. Moreover, the genome sequences of the leaf-cutter ants Atta cephalotes and Acromyrmex echinatior have provided key insights into how this symbiosis has shaped the evolution of these ants at a genetic level. Here we summarize the findings of recent research on the microbial community dynamics within fungus-growing ant fungus gardens and discuss their implications for this ancient symbiosis.

  7. Endophytic fungi reduce leaf-cutting ant damage to seedlings

    Science.gov (United States)

    Bittleston, L. S.; Brockmann, F.; Wcislo, W.; Van Bael, S. A.

    2011-01-01

    Our study examines how the mutualism between Atta colombica leaf-cutting ants and their cultivated fungus is influenced by the presence of diverse foliar endophytic fungi (endophytes) at high densities in tropical leaf tissues. We conducted laboratory choice trials in which ant colonies chose between Cordia alliodora seedlings with high (Ehigh) or low (Elow) densities of endophytes. The Ehigh seedlings contained 5.5 times higher endophyte content and a greater diversity of fungal morphospecies than the Elow treatment, and endophyte content was not correlated with leaf toughness or thickness. Leaf-cutting ants cut over 2.5 times the leaf area from Elow relative to Ehigh seedlings and had a tendency to recruit more ants to Elow plants. Our findings suggest that leaf-cutting ants may incur costs from cutting and processing leaves with high endophyte loads, which could impact Neotropical forests by causing variable damage rates within plant communities. PMID:20610420

  8. Real & Financial Sectors, ``koq Financenaann..'' & Elbio Dagotto's Interactions

    Science.gov (United States)

    Maksoed, Wh-

    2016-10-01

    In conjunctions between PMRI/Pendidikan Matematika Realistik Indonesia fom Dr. RK Sembiring to ``ASTRANOMICS'': the New Reality in Business Aviation herewith provided `interaction between real & financial sector' and financialisation from Heinrich Bortis: ``the Real & Financial Sector of a Monetary Production Economy in the perspective of classical-Keynesian political economy'' ever specifies ``sector Riil'' from HE. Mr. Ir. Aburizal Bakrie. Instead describes the context of CMR/Colossal Magnetoresistance cq Carlos SLIM, the richest entrepreneur in the world 2014 also obtaines Dagotto & Tokura: ``Strongly correlated Electronic Materials: Present & Future'',MRS Bulletin, Nov, 2008. Ever existed of UN Secretary General Kofie Atta Annan, for Lih-AT TA-ruh di mana?'' are ```koq Financenaann..?'' in-between conjunctions. CMR are other notions of GiantMagnetoresistance from Fert & Grundberg who awarded with Nobel Prize in Physics, 2007. Heartfelt Gratitudes to HE. Mr. Prof. Ir. HANDOJO.

  9. Uninformed sacrifice: Evidence against long-range alarm transmission in foraging ants exposed to localized abduction

    Science.gov (United States)

    Tejera, F.; Reyes, A.; Altshuler, E.

    2016-07-01

    It is well established that danger information can be transmitted by ants through relatively small distances, provoking either a state of alarm when they move away from potentially dangerous stimulus, or charge toward it aggressively. There is almost no knowledge if danger information can be transmitted along large distances. In this paper, we abduct leaf cutting ants of the species Atta insularis while they forage in their natural environment at a certain point of the foraging line, so ants make a "U" turn to escape from the danger zone and go back to the nest. Our results strongly suggest that those ants do not transmit "danger information" to other nestmates marching towards the abduction area. The individualistic behavior of the ants returning from the danger zone results in a depression of the foraging activity due to the systematic sacrifice of non-informed individuals.

  10. Tracing Noble Gas Radionuclides in the Environment

    CERN Document Server

    Collon, P; Lu, Z T

    2004-01-01

    Trace analysis of radionuclides is an essential and versatile tool in modern science and technology. Due to their ideal geophysical and geochemical properties, long-lived noble gas radionuclides, in particular, 39Ar (t1/2 = 269 yr), 81Kr (t1/2 = 2.3x10^5 yr) and 85Kr (t1/2 = 10.8 yr), have long been recognized to have a wide range of important applications in Earth sciences. In recent years, significant progress has been made in the development of practical analytical methods, and has led to applications of these isotopes in the hydrosphere (tracing the flow of groundwater and ocean water). In this article, we introduce the applications of these isotopes and review three leading analytical methods: Low-Level Counting (LLC), Accelerator Mass Spectrometry (AMS) and Atom Trap Trace Analysis (ATTA).

  11. The conversion of SO{sub 2} to SO{sub 3} in gas turbine engines

    Energy Technology Data Exchange (ETDEWEB)

    Miake-Lye, R.C.; Anderson, M.R.; Brown, R.C.; Kolb, C.E. [Aerodyne Research, Inc., Billerica, MA (United States). Center for Chemical and Environmental Physics; Sorokin, A.A.; Buriko, Y.I. [Scientific Research Center `Ecolen`, Moscow (Russian Federation)

    1997-12-31

    The oxidation of fuel sulfur to S(6) (SO{sub 3}+H{sub 2}SO{sub 4}) in a supersonic (Concorde) and a subsonic (ATTAS) aircraft engine is estimated numerically. The results indicate between 2% and 10% of the fuel sulfur is emitted as S(6). It is also shown that conversion in the turbine is limited by the level of atomic oxygen at the combustor exit, resulting in a higher oxidation efficiency as the sulfur mass loading is decreased. SO{sub 2} and SO{sub 3} are the primary sulfur oxidation products, with less than 1% of fuel sulfur converted to H{sub 2}SO{sub 4}. For the Concorde, H{sub 2}SO{sub 4} was primarily formed during the supersonic expansion through the divergent nozzle. (author) 20 refs.

  12. Insetos em presépios e as "formigas vestidas" de Jules Martin (1832-1906: uma curiosa manufatura paulistana do final do século XIX

    Directory of Open Access Journals (Sweden)

    Dante Martins Teixeira

    2008-01-01

    Full Text Available Present in Brazil since the beginning of Portuguese colonization, crèche nativity scenes were soon adapted to local reality, a propitious circumstance for the appearance of heterodox conceptions and the use of exotic elements of the fauna and flora peculiar to each region. As records about insects are very uncommon, it is noteworthy that females of leaf-cutting ants, Atta sp. (Hymenoptera, Formicidae, were used to compose crèche nativity scenes in São Paulo State. Having subsisted at least up to the decade of 1960, the "ant crèches" of cities such as Embu das Artes could be related to the then famous "dressed ants" created by Jules Martin, a curious manufacture of the city of São Paulo in the last quarter of the 19th century.

  13. Penelitian Islam: Dasar dan Filosofi

    Directory of Open Access Journals (Sweden)

    Abu Bakar Marzuki

    2017-03-01

    Full Text Available This article is a continued understanding of some thoughts delivered by the Islamic study experts. Actually, Islamic study orientation is still floating and it does not have a clear goal. Some parts of Islamic study is  model or a similar effort done by  orientalists in studying Islam, and in line with the vision and the mission starting from false conclusion about Islam. Therefore, Islamic study experts in the earlier awakening of Islam such as  Al-banna, al-maududi, Ismail Raji al Faruqi, Ziauddin sardar, and Muhammad Naquib al-Attas have offered various thoughts in implementing the framework of Islamic study in line with the vision and the mission of Islam so that their mindset becomes the basis for development of Islamic study. 

  14. Gnomon una indagine sul numero

    CERN Document Server

    Zellini, Paolo

    1999-01-01

    Lo "gnomone" di cui si parla in questo libro non è quello stilo, più o meno monumentale, la cui ombra indica l'ora solare, ma un semplice strumento matematico: una figura geometrica, piana o solida, che aggiunta a un'altra ne genera una simile. Si tratta quindi di una tecnica, ampiamente diffusa nell'antichità, atta a ingrandire o rimpicciolire una forma conservandone l'aspetto. Lo gnomone non aveva solo importanza geometrica. Dalla semplice operazione di correzione "gnomonica" di una figura sono dipesi infatti la stessa nozione di numero, la definizione di vari concetti dell'Analisi e alcuni tra i principali algoritmi numerici e algebrici della matematica.

  15. Evolutionarily advanced ant farmers rear polyploid fungal crops

    DEFF Research Database (Denmark)

    Kooij, Pepijn Wilhelmus; Aanen, D.K.; Schiøtt, Morten

    2015-01-01

    Innovative evolutionary developments are often related to gene or genome duplications. The crop fungi of attine fungus-growing ants are suspected to have enhanced genetic variation reminiscent of polyploidy, but this has never been quantified with cytological data and genetic markers. We estimated...... the number of nuclei per fungal cell for 42 symbionts reared by 14 species of Panamanian fungus-growing ants. This showed that domesticated symbionts of higher attine ants are polykaryotic with 7-17 nuclei per cell, whereas nonspecialized crops of lower attines are dikaryotic similar to most free...... of the basal higher attine genera Trachymyrmex and Sericomyrmex was only slightly enhanced, but the evolutionarily derived crop fungi of Atta and Acromyrmex leaf-cutting ants had much higher genetic variation. Our opposite ploidy models indicated that the symbionts of Trachymyrmex and Sericomyrmex are likely...

  16. Simulation of Critical Materials Resource Strategies. Volume 2. Appendix D - Data Base through Scenario 23.

    Science.gov (United States)

    1983-09-13

    INTEF ;DICT T[IN .- CA’:?. STRATEI1C 1:0tli-Ek . 7-- A-,W C SEA IELD) I , I ATTA-.. SI’ -,L:C - CAF’RRI ER E.T’"LE. B-f I. MINE WARFARE U- • ;URr...A= � F-15 AIR INTERII I I. f1’_-: 0 5 A-7 AIR INTERDI’"C .T Ir 7525I F-J4 AIR INTEF . ICT>D0: 4. 51:& F-I S AIR INTERDIICTI’N so ’.---: ,=;H-2 ASW...LL f FLU ’EIFAF A : : F-ll4 1,F: It-E:-L CTT’I - 1 F- 16 1 N -EF C TI’’* : * F, r"F INTEF IC:TI"-D ’ :-:-’ - AR- T. A F.: FFFC RAD1-": RLA 9,

  17. Nursery words and hypocorisms among Germanic kinship terms

    DEFF Research Database (Denmark)

    Hansen, Bjarne Simmelkjær Sandgaard

    2018-01-01

    By using Jakobson’s (1960: 127-130) criteria for determining the nursery-word sta-tus of a given lexeme, I argue in this article that, even if we should no longer re-gard PG *aiþīn-/-ōn- ‘mother’ (Goth. aiþei), *aiþma- ‘daughter’s husband’ and *faþōn- ‘father’s sister’ as nursery words...... or hypocorisms (Hansen 2017: 207-220), we should certainly still do so with PG *ammōn- ‘parent’s mother; wet nurse’, *attan- ‘father’ (Goth. atta), *basōn- ‘father’s sister’ and *mōnōn-/mōmōn- ‘moth-er; mother’s sister’....

  18. Faunistic analysis of Formicidae (Hymenoptera: Apocrita in degraded ecosystems of Chapecó town, Santa Catarina, Brazil

    Directory of Open Access Journals (Sweden)

    Flávio Roberto Mello Garcia

    2005-11-01

    Full Text Available Seeking to investigate the ant fauna in degraded environments and to comprehend how this group behaves in such ecosystems, faunistic analysis was initially conducted with the ants collected in an area in Chapecó town that had been subjected to flooding in function of the construction of the mouth of a dam on the Chapecó River (a branch of the larger Uruguay River. The collections were carried out between October 2001 and September 2002. We used pit-fall traps, sweeping nets, entomologic umbrellas and leaf litter collections for fragments covered by bushes and grass. The fauna was characterized through the constancy and dominancy indexes. A number of 34.642 specimens of ants, belonging to 32 species, 19 genera and six subfamilies, were collected. The species Labidus sp., Atta sp. and Ectatomma edentatum stood out as being either accessory or both constant and dominant.

  19. Exposure of Workers of Ectatomma brunneum Smith (Hymenoptera: Formicidae: Ectatomminae to ant Baits Containing Different Active Ingredients under Laboratory Conditions

    Directory of Open Access Journals (Sweden)

    Viviane Tofolo

    2015-03-01

    Resumo. Este trabalho avaliou a mortalidade a curto prazo de operárias de Ectatomma brunneum Smith expostas a iscas formicidas em laboratório, a fim de verificar se a capacidade de atração desta espécie não-alvo a formicidas destinadas ao controle de formigas cortadeiras (alvo pode ser prejudicial para a população estudada. As operárias foram expostas em laboratório por 48 horas a iscas formicidas utilizadas em pastagens para controlar as formigas cortadeiras Atta capiguara Gonçalves (Formicidae: Attini e Atta bisphaerica Forel (Formicidae: Attini, as principais espécies que causam danos às pastagens. Foram utilizados os seguintes ingredientes ativos: sulfluramida 0,3%, fipronil 0,003% e clorpirifos 0,45%. O experimento foi composto por grupos de 30 operárias expostas a 10g de formicidas, usando três repetições. Foi realizado o acompanhamento diário da mortalidade durante 20 dias, registrando-se o número de operárias mortas e intoxicadas. O grupo controle recebeu apenas 10g de polpa cítrica umedecida. A partir de resultados obtidos, as curvas de sobrevivência em função do tempo de observação foram plotadas usando o método de Kaplan-Meier, e comparadas com aplicação do Logrank test (teste não-paramétrico em nível de significância de 5%. Os resultados revelaram que os três ingredientes ativos testados foram tóxicos e a população reduzida em 35.56% no tratamento com clorpirifós, 31,11% com sulfluramida e 30% com fipronil.

  20. Underground anemotactic orientation in leaf-cutting ants: perception of airflow and experience-dependent choice of airflow direction during digging

    Science.gov (United States)

    Halboth, Florian; Roces, Flavio

    2017-10-01

    Air exchange between the large nests of Atta vollenweideri leaf-cutting ants and the environment strongly relies on a passive, wind-induced ventilation mechanism. Air moves through nest tunnels and airflow direction depends on the location of the tunnel openings on the nest mound. We hypothesized that ants might use the direction of airflow along nest tunnels as orientation cue in the context of climate control, as digging workers might prefer to broaden or to close tunnels with inflowing or outflowing air in order to regulate nest ventilation. To investigate anemotactic orientation in Atta vollenweideri, we first tested the ants' ability to perceive air movements by confronting single workers with airflow stimuli in the range 0 to 20 cm/s. Workers responded to airflow velocities ≥ 2 cm/s, and the number of ants reacting to the stimulus increased with increasing airflow speed. Second, we asked whether digging workers use airflow direction as an orientation cue. Workers were exposed to either inflow or outflow of air while digging in the nest and could subsequently choose between two digging sites providing either inflow or outflow of air, respectively. Workers significantly chose the side with the same airflow direction they experienced before. When no airflow was present during initial digging, workers showed no preference for airflow directions. Workers developed preferences for airflow direction only after previous exposure to a given airflow direction. We suggest that experience-modified anemotaxis might help leaf-cutting ants spatially organize their digging activity inside the nest during tasks related to climate control.

  1. Biogeography of mutualistic fungi cultivated by leafcutter ants.

    Science.gov (United States)

    Mueller, Ulrich G; Ishak, Heather D; Bruschi, Sofia M; Smith, Chad C; Herman, Jacob J; Solomon, Scott E; Mikheyev, Alexander S; Rabeling, Christian; Scott, Jarrod J; Cooper, Michael; Rodrigues, Andre; Ortiz, Adriana; Brandão, Carlos R F; Lattke, John E; Pagnocca, Fernando C; Rehner, Stephen A; Schultz, Ted R; Vasconcelos, Heraldo L; Adams, Rachelle M M; Bollazzi, Martin; Clark, Rebecca M; Himler, Anna G; LaPolla, John S; Leal, Inara R; Johnson, Robert A; Roces, Flavio; Sosa-Calvo, Jeffrey; Wirth, Rainer; Bacci, Maurício

    2017-12-01

    Leafcutter ants propagate co-evolving fungi for food. The nearly 50 species of leafcutter ants (Atta, Acromyrmex) range from Argentina to the United States, with the greatest species diversity in southern South America. We elucidate the biogeography of fungi cultivated by leafcutter ants using DNA sequence and microsatellite-marker analyses of 474 cultivars collected across the leafcutter range. Fungal cultivars belong to two clades (Clade-A and Clade-B). The dominant and widespread Clade-A cultivars form three genotype clusters, with their relative prevalence corresponding to southern South America, northern South America, Central and North America. Admixture between Clade-A populations supports genetic exchange within a single species, Leucocoprinus gongylophorus. Some leafcutter species that cut grass as fungicultural substrate are specialized to cultivate Clade-B fungi, whereas leafcutters preferring dicot plants appear specialized on Clade-A fungi. Cultivar sharing between sympatric leafcutter species occurs frequently such that cultivars of Atta are not distinct from those of Acromyrmex. Leafcutters specialized on Clade-B fungi occur only in South America. Diversity of Clade-A fungi is greatest in South America, but minimal in Central and North America. Maximum cultivar diversity in South America is predicted by the Kusnezov-Fowler hypothesis that leafcutter ants originated in subtropical South America and only dicot-specialized leafcutter ants migrated out of South America, but the cultivar diversity becomes also compatible with a recently proposed hypothesis of a Central American origin by postulating that leafcutter ants acquired novel cultivars many times from other nonleafcutter fungus-growing ants during their migrations from Central America across South America. We evaluate these biogeographic hypotheses in the light of estimated dates for the origins of leafcutter ants and their cultivars. © 2017 John Wiley & Sons Ltd.

  2. Representation of thermal information in the antennal lobe of leaf-cutting ants

    Directory of Open Access Journals (Sweden)

    Markus eRuchty

    2010-11-01

    Full Text Available Insects are equipped with various types of antennal sensilla, which house thermosensitive neurons adapted to receive different parameters of the thermal environment for a variety of temperature-guided behaviors. In the leaf-cutting ant Atta vollenweideri, the physiology and the morphology of the thermosensitive sensillum coeloconicum (Sc has been thoroughly investigated. However, the central projections of its receptor neurons are unknown. Here we selectively stained the three neurons found in single Sc and tracked their axons into the brain of Atta vollenweideri workers. Each of the three axons terminates in a single glomerulus of the antennal lobe (Sc-glomeruli. Two of the innervated glomeruli are adjacent to each other and are located laterally, while the third one is clearly separated and located medially in the antennal lobe. Using two-photon Ca2+ imaging of antennal lobe projection neurons, we studied where in the antennal lobe thermal information is represented. In the 11 investigated antennal lobes, we found up to 10 different glomeruli in a single specimen responding to temperature stimulation. Both, warm- and cold-sensitive glomeruli could be identified. The thermosensitive glomeruli were mainly located in the medial part of the antennal lobe. Based on the general representation of thermal information in the antennal lobe and functional data on the Sc-glomeruli we conclude that temperature stimuli received by Sc are processed in the medial of the three target glomeruli. The present study reveals an important role of the antennal lobe in temperature processing and links a specific thermosensitive neuron to its central target glomerulus.

  3. SYED MUHAMMAD NAQUIB AL-ATTAS’ SEMANTIC READING OF ISLAM AS DIN

    Directory of Open Access Journals (Sweden)

    Aris Widodo

    2009-02-01

    Full Text Available This article presents Syed Muhammad Naquib Al-Attas’ opinion on the scope of Islam—a discourse that has become a hot issue among Muslim scholars since fourteen centuries ago and strongly reappeared along with the presence of a work of an orientalist, H.A.R. Gibb. According to Al-Attas, semantic approach is the best way to figure out whether Islam only touches upon religious matters or also includes a notion of civilization, because it is through this approach that the connotation of Islam will become clearer. As Islam is explicitly mentioned in the Qur’an as din, so the best way to identify the scope of Islam is to study the word-focus of di>n from semantic approach. From this approach, Al-Attas concludes that Islam as di>n includes the connotation of civilization, as the word di>n is closely related to the word madinah, a word that is also closely related to the word tamaddun (civilization. In addition to presenting Al-Attas’ ideas, the writer of this article also gives a critical remark on Al-Attas’ contention that din (religion and dayn (debt are closely related as the two words have the same root: dana. According to the writer, this opinion is not even supported by Qur’anic verses, which become the basis for Al- Attas’ semantic construction. Qur’an itself speaks of the two words, din and dayn, in clearly two different connotations. 

  4. Evolution Analysis of Simple Sequence Repeats in Plant Genome.

    Science.gov (United States)

    Qin, Zhen; Wang, Yanping; Wang, Qingmei; Li, Aixian; Hou, Fuyun; Zhang, Liming

    2015-01-01

    Simple sequence repeats (SSRs) are widespread units on genome sequences, and play many important roles in plants. In order to reveal the evolution of plant genomes, we investigated the evolutionary regularities of SSRs during the evolution of plant species and the plant kingdom by analysis of twelve sequenced plant genome sequences. First, in the twelve studied plant genomes, the main SSRs were those which contain repeats of 1-3 nucleotides combination. Second, in mononucleotide SSRs, the A/T percentage gradually increased along with the evolution of plants (except for P. patens). With the increase of SSRs repeat number the percentage of A/T in C. reinhardtii had no significant change, while the percentage of A/T in terrestrial plants species gradually declined. Third, in dinucleotide SSRs, the percentage of AT/TA increased along with the evolution of plant kingdom and the repeat number increased in terrestrial plants species. This trend was more obvious in dicotyledon than monocotyledon. The percentage of CG/GC showed the opposite pattern to the AT/TA. Forth, in trinucleotide SSRs, the percentages of combinations including two or three A/T were in a rising trend along with the evolution of plant kingdom; meanwhile with the increase of SSRs repeat number in plants species, different species chose different combinations as dominant SSRs. SSRs in C. reinhardtii, P. patens, Z. mays and A. thaliana showed their specific patterns related to evolutionary position or specific changes of genome sequences. The results showed that, SSRs not only had the general pattern in the evolution of plant kingdom, but also were associated with the evolution of the specific genome sequence. The study of the evolutionary regularities of SSRs provided new insights for the analysis of the plant genome evolution.

  5. First dating of groundwater with Atom Trap Trace Analysis of 39Ar - application

    Science.gov (United States)

    Reichel, Thomas; Kersting, Arne; Ritterbusch, Florian; Ebser, Sven; Bender, Klaus; Purtschert, Roland; Oberthaler, Markus; Aeschbach-Hertig, Werner

    2013-04-01

    Groundwater from the intermediate aquifer layers of the Rhine Graben sediments in the Rhein-Neckar metropolitan region is strongly exploited for the purpose of drinking water supply. Isotope hydrological investigations of the regional groundwater dynamics have been initiated with the ultimate goal of improving the protection of this important water resource. However, these studies are hampered by the fact that the groundwater falls in the age dating gap of classical isotope methods between about 50 and 1000 years of water age, which can only be bridged by the extremely rare isotope 39Ar. Here we report and discuss the first 39Ar groundwater ages obtained by the new analytical method Atom Trap Trace Analysis (ATTA). Groundwater samples from the Upper Rhine Graben aquifers were collected and analysed by established methods for a large range of tracers, including tritium, stable isotopes, noble gases, and 14C. For 39Ar analysis, several tons of water were degassed in the field using a membrane contactor. In the laboratory, a gas-chromatographic system at cryogenic temperatures was used to separate pure argon from the extracted gas. ATTA was then used to isolate and count 39Ar atoms from these samples. In parallel, samples for 39Ar analysis by low-level counting at the University of Bern were taken to enable comparison of the two analytical techniques. The resulting 39Ar groundwater ages in the range of several hundred years are in accordance with the indications obtained from the classical dating tracers. They provide quantitative information on the groundwater travel time for an important, strongly exploited part of the investigated aquifer system, which could not be obtained from the other tracers. These results significantly improve the knowledge of the time scale of groundwater renewal in the aquifer layers of intermediate depth. Furthermore, the combination of the 39Ar age scale with noble gas recharge temperatures and stable isotope data has the potential to

  6. Effects of substrate, ant and fungal species on plant fiber degradation in a fungus-gardening ant symbiosis.

    Science.gov (United States)

    DeMilto, Alexandria M; Rouquette, Monte; Mueller, Ulrich G; Kellner, Katrin; Seal, Jon N

    2017-04-01

    Fungus-gardening or attine ants have outsourced most of their digestive function to a symbiotic fungus. The ants feed their fungus - essentially an external digestive organ - a variety of substrates of botanical origin, including fresh and dried flowers, leaves and insect frass (processed leaves). Although plant tissues are rich in fibers (lignocelluloses, hemicelluloses, pectins and starches) and the symbiotic fungus possesses the genetic and enzymatic machinery to metabolize these compounds, the highly derived attines, the leaf-cutters (Atta and Acromyrmex), are known to produce fiber-rich waste. While leaf-cutting ants are important consumers of primary plant tissue, there have been fewer studies on physiological activity of fungi grown by closely related ant species in the genus Trachymyrmex, which generally grow related species of fungi, have smaller colonies and consume a wider variety of fungal substrates in addition to fresh leaves and flowers. In this study, we measured the cellulase activity of the fungus-gardening ants Atta texana, Trachymyrmex arizonensis and T. septentrionalis. We then quantified fiber consumption of the fungus-gardening ants Trachymyrmex septentrionalis and Trachymyrmex arizonensis by comparing the amounts and percentages present in their food and in fungus garden refuse during a controlled feeding experiment over the span of several months. Finally, we compared waste composition of T. arizonensis colonies growing different fungal strains, because this species is known to cultivate multiple strains of Leucoagaricus in its native range. The leaf-cutting ant A. texana was found to have lower cellulytic activity than T. arizonensis or T. septentrionalis. Total lignocellulose and hemicellulose amounts were significantly lower in refuse piles than in the substrates fed to the Trachymyrmex colonies, thus these fibers were consumed by the fungal symbionts of these ant species. Although lignocellulose utilization was similar in two distinct

  7. Variation in nestmate recognition ability among polymorphic leaf-cutting ant workers.

    Science.gov (United States)

    Larsen, Janni; Fouks, Bertrand; Bos, Nick; d'Ettorre, Patrizia; Nehring, Volker

    2014-11-01

    A key feature for the success of social insects is division of labour, allowing colony members to specialize on different tasks. Nest defence is a defining task for social insects since it is crucial for colony integrity. A particularly impressive and well-known case of worker specialization in complex hymenopteran societies is found in leaf-cutting ants of the genera Atta and Acromyrmex. We hypothesized that three morphological worker castes of Acromyrmex echinatior differ in their likelihood to attack intruders, and show that major workers are more aggressive towards non-nestmate workers than medium and minor workers. Moreover, minors do not discriminate between nestmate and non-nestmate brood, while larger workers do. We further show that A. echinatior ants use cuticular chemical compounds for nestmate recognition. We took advantage of the natural variation in the cuticular compounds between colonies to investigate the proximate factors that may have led to the observed caste differences in aggression. We infer that major workers differ from medium workers in their general propensity to attack intruders (the "action component" of the nestmate recognition system), while minors seem to be less sensitive to foreign odours ("perception component"). Our results highlight the importance of proximate mechanisms underlying social insect behaviour, and encourage an appreciation of intra-colony variation when analysing colony-level traits such as nest defence. Copyright © 2014 Elsevier Ltd. All rights reserved.

  8. Study of pulmonary (lung) functioning of commercial wheat grinding machine operators in India using spirometric testing.

    Science.gov (United States)

    Agashe, Abhijeet; Deshpande, V S

    2010-04-01

    In ancient times, in India each household had a chakki to mill the wheat. There was no concept of getting wheat grounded from outside. With the fast changing lifestyle, this tradition has almost disappeared now. Today every city of India has numerous commercial wheat grinding machine shops located at various places. Other than states like Punjab, this occupation is mostly unorganized and little has been done to look into the welfare and health of these machine operators. Like most of the occupations, this occupation of wheat grinding also has several occupational hazards and injuries associated with it. The most obvious of them all in this case is due to the continuous exposure of the operators to the rising dust wheat particles, commonly called atta). This perpetual inhaling ofpollutants exposes the operators to risks of pulmonary malfunctioning. Therefore, this paper attempts to determine the pulmonary functioning of the commercial wheat grinding machine operators in India using spirometric testing. On the basis of the anthropometric data, effort has been done to develop the expected lung performance. Further, the actual lung performance of the operators is measured and compared with expected performance.

  9. Genome-Wide Characterization of Simple Sequence Repeat (SSR) Loci in Chinese Jujube and Jujube SSR Primer Transferability.

    Science.gov (United States)

    Xiao, Jing; Zhao, Jin; Liu, Mengjun; Liu, Ping; Dai, Li; Zhao, Zhihui

    2015-01-01

    Chinese jujube (Ziziphus jujuba), an economically important species in the Rhamnaceae family, is a popular fruit tree in Asia. Here, we surveyed and characterized simple sequence repeats (SSRs) in the jujube genome. A total of 436,676 SSR loci were identified, with an average distance of 0.93 Kb between the loci. A large proportion of the SSRs included mononucleotide, dinucleotide and trinucleotide repeat motifs, which accounted for 64.87%, 24.40%, and 8.74% of all repeats, respectively. Among the mononucleotide repeats, A/T was the most common, whereas AT/TA was the most common dinucleotide repeat. A total of 30,565 primer pairs were successfully designed and screened using a series of criteria. Moreover, 725 of 1,000 randomly selected primer pairs were effective among 6 cultivars, and 511 of these primer pairs were polymorphic. Sequencing the amplicons of two SSRs across three jujube cultivars revealed variations in the repeats. The transferability of jujube SSR primers proved that 35/64 SSRs could be transferred across family boundary. Using jujube SSR primers, clustering analysis results from 15 species were highly consistent with the Angiosperm Phylogeny Group (APGIII) System. The genome-wide characterization of SSRs in Chinese jujube is very valuable for whole-genome characterization and marker-assisted selection in jujube breeding. In addition, the transferability of jujube SSR primers could provide a solid foundation for their further utilization.

  10. Enrichment and Broad Representation of Plant Biomass-Degrading Enzymes in the Specialized Hyphal Swellings of Leucoagaricus gongylophorus, the Fungal Symbiont of Leaf-Cutter Ants

    Energy Technology Data Exchange (ETDEWEB)

    Aylward, Frank O.; Khadempour, Lily; Tremmel, Daniel; McDonald, Bradon R.; Nicora, Carrie D.; Wu, Si; Moore, Ronald J.; Orton, Daniel J.; Monroe, Matthew E.; Piehowski, Paul D.; Purvine, Samuel O.; Smith, Richard D.; Lipton, Mary S.; Burnum-Johnson, Kristin E.; Currie, Cameron R.

    2015-08-28

    Leaf-cutter ants are prolific and conspicuous Neotropical herbivores that derive energy from specialized fungus gardens they cultivate using foliar biomass. The basidiomycetous cultivar of the ants, Leucoagaricus gongylophorus, produces specialized hyphal swellings called gongylidia that serve as the primary food source of ant colonies. Gongylidia also contain lignocellulases that become concentrated in ant digestive tracts and are deposited within fecal droplets onto fresh foliar material as it is foraged by the ants. Although the enzymes concentrated by L. gongylophorus within gongylidia are thought to be critical to the initial degradation of plant biomass, only a few enzymes present in these hyphal swellings have been identified. Here we use proteomic methods to identify proteins present in the gongylidia of three Atta cephalotes colonies. Our results demonstrate that a diverse but consistent set of enzymes is present in gongylidia, including numerous lignocellulases likely involved in the degradation of polysaccharides, plant toxins, and proteins. Overall, gongylidia contained over three-quarters of all lignocellulases identified in the L. gongylophorus genome, demonstrating that the majority of the enzymes produced by this fungus for biomass breakdown are ingested by the ants. We also identify a set of 23 lignocellulases enriched in gongylidia compared to whole fungus garden samples, suggesting that certain enzymes may be particularly important in the initial degradation of foliar material. Our work sheds light on the complex interplay between leaf-cutter ants and their fungal symbiont that allows for the host insects to occupy an herbivorous niche by indirectly deriving energy from plant biomass.

  11. Thermal constraints on foraging of tropical canopy ants.

    Science.gov (United States)

    Spicer, Michelle Elise; Stark, Alyssa Y; Adams, Benjamin J; Kneale, Riley; Kaspari, Michael; Yanoviak, Stephen P

    2017-04-01

    Small cursorial ectotherms risk overheating when foraging in the tropical forest canopy, where the surfaces of unshaded tree branches commonly exceed 50 °C. We quantified the heating and subsequent cooling rates of 11 common canopy ant species from Panama and tested the hypothesis that ant workers stop foraging at temperatures consistent with the prevention of overheating. We created hot experimental "sunflecks" on existing foraging trails of four ant species from different clades and spanning a broad range of body size, heating rate, and critical thermal maxima (CTmax). Different ant species exhibited very different heating rates in the lab, and these differences did not follow trends predicted by body size alone. Experiments with ant models showed that heating rates are strongly affected by color in addition to body size. Foraging workers of all species showed strong responses to heating and consistently abandoned focal sites between 36 and 44 °C. Atta colombica and Azteca trigona workers resumed foraging shortly after heat was removed, but Cephalotes atratus and Dolichoderus bispinosus workers continued to avoid the heated patch even after >5 min of cooling. Large foraging ants (C. atratus) responded slowly to developing thermal extremes, whereas small ants (A. trigona) evacuated sunflecks relatively quickly, and at lower estimated body temperatures than when revisiting previously heated patches. The results of this study provide the first field-based insight into how foraging ants respond behaviorally to the heterogeneous thermal landscape of the tropical forest canopy.

  12. Genome-Wide Characterization of Simple Sequence Repeat (SSR Loci in Chinese Jujube and Jujube SSR Primer Transferability.

    Directory of Open Access Journals (Sweden)

    Jing Xiao

    Full Text Available Chinese jujube (Ziziphus jujuba, an economically important species in the Rhamnaceae family, is a popular fruit tree in Asia. Here, we surveyed and characterized simple sequence repeats (SSRs in the jujube genome. A total of 436,676 SSR loci were identified, with an average distance of 0.93 Kb between the loci. A large proportion of the SSRs included mononucleotide, dinucleotide and trinucleotide repeat motifs, which accounted for 64.87%, 24.40%, and 8.74% of all repeats, respectively. Among the mononucleotide repeats, A/T was the most common, whereas AT/TA was the most common dinucleotide repeat. A total of 30,565 primer pairs were successfully designed and screened using a series of criteria. Moreover, 725 of 1,000 randomly selected primer pairs were effective among 6 cultivars, and 511 of these primer pairs were polymorphic. Sequencing the amplicons of two SSRs across three jujube cultivars revealed variations in the repeats. The transferability of jujube SSR primers proved that 35/64 SSRs could be transferred across family boundary. Using jujube SSR primers, clustering analysis results from 15 species were highly consistent with the Angiosperm Phylogeny Group (APGIII System. The genome-wide characterization of SSRs in Chinese jujube is very valuable for whole-genome characterization and marker-assisted selection in jujube breeding. In addition, the transferability of jujube SSR primers could provide a solid foundation for their further utilization.

  13. Genome-Wide Characterization of Simple Sequence Repeat (SSR) Loci in Chinese Jujube and Jujube SSR Primer Transferability

    Science.gov (United States)

    Xiao, Jing; Zhao, Jin; Liu, Mengjun; Liu, Ping; Dai, Li; Zhao, Zhihui

    2015-01-01

    Chinese jujube (Ziziphus jujuba), an economically important species in the Rhamnaceae family, is a popular fruit tree in Asia. Here, we surveyed and characterized simple sequence repeats (SSRs) in the jujube genome. A total of 436,676 SSR loci were identified, with an average distance of 0.93 Kb between the loci. A large proportion of the SSRs included mononucleotide, dinucleotide and trinucleotide repeat motifs, which accounted for 64.87%, 24.40%, and 8.74% of all repeats, respectively. Among the mononucleotide repeats, A/T was the most common, whereas AT/TA was the most common dinucleotide repeat. A total of 30,565 primer pairs were successfully designed and screened using a series of criteria. Moreover, 725 of 1,000 randomly selected primer pairs were effective among 6 cultivars, and 511 of these primer pairs were polymorphic. Sequencing the amplicons of two SSRs across three jujube cultivars revealed variations in the repeats. The transferability of jujube SSR primers proved that 35/64 SSRs could be transferred across family boundary. Using jujube SSR primers, clustering analysis results from 15 species were highly consistent with the Angiosperm Phylogeny Group (APGIII) System. The genome-wide characterization of SSRs in Chinese jujube is very valuable for whole-genome characterization and marker-assisted selection in jujube breeding. In addition, the transferability of jujube SSR primers could provide a solid foundation for their further utilization. PMID:26000739

  14. I cataloghi nella letteratura americana della Grande Depressione

    Directory of Open Access Journals (Sweden)

    Cinzia Scarpino

    2011-07-01

    Full Text Available Il presente saggio si propone di analizzare alcune opere letterarie in senso lato (poesie, libri-documentario, script di film-documetario scritte negli Stati Uniti negli anni della Grande Depressione (1929-1941 alla luce della presenza ricorrente di cataloghi, liste e inventari. Partendo da un excursus storico circa la centralità del catalogo come forma narrativa atta a rendere l’abbondanza del Nuovo Mondo nella cultura e nella letteratura dell’Ottocento (dai diari dei primi esploratori agli scritti di Thomas Jefferson, dalle geremiadi puritane agli almanacchi e ai diari rurali, dalle teorizzazioni estetiche di Ralph Waldo Emerson al «poeta catalogatore» Walt Whitman e al Walden di H. D. Thoreau, il saggio si sofferma su alcune opere-documentario degli anni Trenta del Novecento; un periodo che, segnato profondamente dalla crisi economica e testimone di una riconfigurazione della geografia reale e simbolica del territorio nazionale, punta nuovamente a cataloghi e inventari, secondo una scelta retorica funzionale alla rappresentazione del rovescio del mito di abbondanza delle origini.

  15. Aircraft exhaust aerosol formation and growth

    Energy Technology Data Exchange (ETDEWEB)

    Brown, R.C.; Miake-Lye, R.C.; Anderson, M.R.; Kolb, C.E. [Aerodyne Research, Inc., Billerica, MA (United States). Center for Chemical and Environmental Physics

    1997-12-31

    Aerosol formation and growth in the exhaust plume of the ATTAS aircraft at an altitude of approximately 9 km, burning fuels with 2 ppmm sulfur (`low`) and 266 ppmm (`high`) sulfur has been modeled using an aerosol dynamics model for nucleation, vapor condensation and coagulation, coupled to a 2-dimensional, axisymmetric flow code to treat plume dilution and turbulent mixing. For both the `low` and `high` sulfur fuels, approximately 60% of the available water had condensed within the first 200 m downstream of the exhaust exit. The contrail particle diameters ranged between 0.4 to 1.6 {mu}m. However, the size distributions as a function of radial position for the `low` sulfur plume were broader than the corresponding distributions for the `high` sulfur plume. The model results indicate for a fuel sulfur mass loading of 2 ppmm, sulfuric acid remains a viable activating agent and that the differences in the contrail particle size distributions for sulfur mass loadings between 2 ppmm and 260 ppmm would be difficult to detect. (author) 12 refs.

  16. Carbohydrate-rich foods: glycaemic indices and the effect of constituent macronutrients.

    Science.gov (United States)

    Widanagamage, Rahal D; Ekanayake, Sagarika; Welihinda, Jayantha

    2009-01-01

    The glycaemic index (GI) ranks foods according to their acute glycaemic impact and is used in planning meals for patients invoking glycaemic control through diet. Kurakkan (Eleusine coracana) flour roti, rice flour roti, atta flour roti, boiled breadfruit (Artocarpus altilis/Artocarpus communis) and boiled legumes (mungbean, cowpea and chickpea) were categorized as low-GI foods (relative to white bread; Prima Crust Top), and the corresponding GI (+/- standard error of the mean) values were 70+/-8, 69+/-7, 67+/-9, 64+/-7, 57+/-6, 49+/-8 and 29+/-5, respectively. Kurakkan flour pittu and wheat flour roti were classified as medium-GI foods with GI values of 85+/-6 and 72+/-6. Hoppers, rice flour pittu, wheat flour pittu and Olu-milk rice (seeds of Nymphaea lotus) were categorized as high-GI foods, and the corresponding GI (+/- standard error of the mean) values were 120+/-8, 103+/-7, 101+/-8 and 91+/-8, respectively. The GI values significantly (P<0.01) and negatively correlated with the insoluble dietary fibre (rho = - 0.780), soluble dietary fibre (rho = - 0.712) and protein (rho = - 0.738) contents in grams per 100 g digestible starch containing foods.

  17. Ultrastructural and microbial analyses of cellulose degradation in leaf-cutter ant colonies.

    Science.gov (United States)

    Moreira-Soto, Rolando Daniel; Sanchez, Ethel; Currie, Cameron R; Pinto-Tomás, Adrian A

    2017-11-01

    Leaf-cutter ants (Atta and Acromyrmex) use fresh leaves to cultivate a mutualistic fungus (Leucoagaricus gongylophorus) for food in underground gardens. A new ant queen propagates the cultivar by taking a small fragment of fungus from her parent colony on her nuptial flight and uses it to begin her own colony. Recent research has shown that the ants' fungus gardens are colonized by symbiotic bacteria that perform important functions related to nitrogen fixation and have been implicated in contributing to plant biomass degradation. Here, we combine bacterial culturing in several media for counts and identification using the 16S rRNA gene with electron microscopy to investigate the process of cellulose degradation in the fungus garden and refuse dumps, and to assess the potential role of symbiotic bacteria. We show through electron microscopy that plant cell walls are visibly degraded in the bottom section of fungus gardens and refuse dumps, and that bacteria are more abundant in these sections. We also consistently isolated cellulolytic bacteria from all sections of fungus gardens. Finally, we show by culture-dependent and electron microscopy analysis that the fungus garden pellets carried by recently mated queens are colonized by fungus garden-associated bacteria. Taken together, our results indicate that cellulose is degraded in fungus gardens, and that fungus garden bacteria that may contribute to this deconstruction are vertically transmitted by new queens.

  18. [Creativity and Character Traits of University Students: Transversal Association Study].

    Science.gov (United States)

    Santamaría, Hernando; Sánchez, Ricardo

    2012-06-01

    This study was carried out to assess the relationship between character traits and creativity in a sample of students from a public university in Bogotá. A random sample of 157 students from the Universidad Nacional de Colombia. The two instruments used for measuring character traits and creativity were the International Personality Disorder Examination (IPDE) and the Abbreviated Torrance Test for Adults (ATTA). Additional information about gender, psychopathological antecedents, current academic period and academic average have been recorded. Robust regression methods have been used to analyze the relationship between creativity and character traits. Creativity and narcissistic traits were associated. In a multivariate model, other variables showing a relationship with creativity were found, i.e., male gender, mental illness family antecedents, number of academic periods completed, and a high academic average. Relationship between creativity and narcissistic traits had not been reported in previous. Longitudinal studies using more accurate scales should be undertaken to determine the validity of these findings. Copyright © 2012 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.

  19. Evolution of cold-tolerant fungal symbionts permits winter fungiculture by leafcutter ants at the northern frontier of a tropical ant-fungus symbiosis.

    Science.gov (United States)

    Mueller, Ulrich G; Mikheyev, Alexander S; Hong, Eunki; Sen, Ruchira; Warren, Dan L; Solomon, Scott E; Ishak, Heather D; Cooper, Mike; Miller, Jessica L; Shaffer, Kimberly A; Juenger, Thomas E

    2011-03-08

    The obligate mutualism between leafcutter ants and their Attamyces fungi originated 8 to 12 million years ago in the tropics, but extends today also into temperate regions in South and North America. The northernmost leafcutter ant Atta texana sustains fungiculture during winter temperatures that would harm the cold-sensitive Attamyces cultivars of tropical leafcutter ants. Cold-tolerance of Attamyces cultivars increases with winter harshness along a south-to-north temperature gradient across the range of A. texana, indicating selection for cold-tolerant Attamyces variants along the temperature cline. Ecological niche modeling corroborates winter temperature as a key range-limiting factor impeding northward expansion of A. texana. The northernmost A. texana populations are able to sustain fungiculture throughout winter because of their cold-adapted fungi and because of seasonal, vertical garden relocation (maintaining gardens deep in the ground in winter to protect them from extreme cold, then moving gardens to warmer, shallow depths in spring). Although the origin of leafcutter fungiculture was an evolutionary breakthrough that revolutionized the food niche of tropical fungus-growing ants, the original adaptations of this host-microbe symbiosis to tropical temperatures and the dependence on cold-sensitive fungal symbionts eventually constrained expansion into temperate habitats. Evolution of cold-tolerant fungi within the symbiosis relaxed constraints on winter fungiculture at the northern frontier of the leafcutter ant distribution, thereby expanding the ecological niche of an obligate host-microbe symbiosis.

  20. Infidelity of leafcutting ants to host plants: resource heterogeneity or defense induction?

    Science.gov (United States)

    Howard, Jerome J

    1990-03-01

    Leafcutting ants have strong among- and within-plant preferences, and generally abandon plants long before they are completely defoliated. Two tropical deciduous forest tree species preferred by the leafcutting ant Atta colombica were studied to determine how variation in resource quality affects ant selectivity and partial defoliation of plants. Significant differences in palatability and leaf characteristics of Spondias mombin and Bursera simaruba were found among trees and among leaf types within trees, but not among branches within trees. No short-term responses to experimental defoliation of up to 50% of total canopy were found in either species. Leaf nutrient and poisture content were positively correlated, and phenolic content negatively correlated, with the palatability of Spondias mombin, a species containing hydrolyzable tannins. Leaf moisture and phenolic content were both positively correlated with the palatability of Bursera simaruba, which contains predominantly condensed tannins. The results suggest that variation in leaf quality among and within plants is at least a partial explanation for ant selectivity and partial defoliation of preferred species. There is no evidence that rapidly induced changes in plant chemistry affect ant decisions to abandon these plants. Instead, it appears likely that ants abandon plants once high-quality leaf patches are exhausted. Quantitative variation in leaf nutrients, moisture, and secondary chemicals all appear to contribute to ant preferences for individuals and tissues of highly palatable plants.

  1. Exhaust jet mixing and condensation effects in the near field of aircraft wakes; Melange des jets propulsifs et trainees de condensation dans le sillage proche d'avions

    Energy Technology Data Exchange (ETDEWEB)

    Garnier, F.; Laverdant, A. [Office National d' Etudes et de Recherches Aerospatiales (ONERA), 92 - Chatillon (France)

    1999-07-01

    In order to investigate the process of contrail formation, an integral model and a two-dimensional direct numerical simulation have been used to analyse the mixing and entrainment processes of the engine exhaust through their interaction with the vortex wake of various aircraft. The objective of this study is to evaluate the partial vapour pressure of water and temperature in the near field of subsonic and supersonic aircraft. Results are presented involving the saturation calculation by post-processing solution fields which provide a qualitative indicator of the condensation process. After testing the numerical algorithm with some success, this study was performed for three transport subsonic aircraft: A-330, B-737 and DC-9; for the twin-engine ATTAS of DLR and for the Anglo-French supersonic Concorde. For subsonic aircraft, in the early wake, the distance where saturation is reached depends only upon the engine jet characteristics. The engine jet location with respect to the vortex axis has an important influence on the mixing rate and on the saturation evolution. For the supersonic aircraft, a low saturation ratio has been shown along the plume centerline. The wing-tip vortices contribute largely to increase the mixing and dispersion of the exhaust plume. Consequently, the water saturation profiles are clearly changed by the vortical structure. Effects of the aerodynamic parameters are analysed and discussed. (authors)

  2. Efficient visible and near-infrared photoluminescent attapulgite-based lanthanide one-dimensional nanomaterials assembled by ion-pairing interactions.

    Science.gov (United States)

    Xu, Jun; Zhang, Ye; Chen, Hao; Liu, Weisheng; Tang, Yu

    2014-06-07

    Attapulgite, a one-dimensional fibrillar nanomaterial present in nature, with its extreme stability, is a promising material to act as a new carrier of luminescent lanthanide complexes for further applications. Herein, a series of lanthanide complexes Na[Ln(TTA)4] have been attached to attapulgite (Atta) via ion-pairing interactions, generating the first example of attapulgite-based visible and near-infrared (NIR) luminescent lanthanide one-dimensional nanomaterials, where TTA is 2-thenoyltrifluoroacetonate and Ln is Eu, Sm, Nd, Er or Yb. The hybrid materials were characterized by CHN elemental analysis, inductively coupled plasma-atomic emission spectroscopy (ICP), powder X-ray diffraction (PXRD), thermogravimetry (TG), transmission electron microscopy (TEM), and UV-vis absorption spectra. In order to investigate the photophysical behaviours of these materials, the visible and NIR luminescent spectra and the energy transfer process have been systematically investigated. Moreover, efforts have been made to produce Eu- and Sm-based plastic attapulgite materials by utilizing poly(methyl methacrylate) (PMMA) matrices, and the dispersibility of the lanthanide-doped hybrids in PMMA provides them with a high mechanical strength. The lanthanide-doped attapulgite appears to be an interesting material for photophysical applications. The results of this work would have potential significance for the design and assembly of luminescent lanthanide materials for light-emitting diodes (LED), sunlight-conversion films, optical amplifiers, solar concentrators, and lasers.

  3. Airborne measurement of aircraft emissions using passive infrared FT spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Haschberger, P.; Lindermeir, E.; Tank, V. [Deutsche Forschungsanstalt fuer Luft- und Raumfahrt e.V. (DLR), Wessling (Germany). Inst. fuer Optoelektronik

    1997-12-01

    For the first time emissions from aircraft jet engines where measured inflight by use of a Fourier transform infrared spectrometer. The instrument works in a non-intrusive mode observing the plume from the cabin and detecting the emitted infrared radiation. Applying nonlinear inversion techniques the concentrations and emission indices of the infrared active gas components are calculated. Besides CO, CO{sub 2}, and water vapor the separate acquisition of NO and NO{sub 2} is of special interest. For the ATTAS research aircraft as a first carrier the emission index of NO{sub x}, EI(NO{sub x}), is in the range of 5-7.5 g(NO{sub 2})/(kg fuel) with a ratio NO{sub 2}/NO{sub x} of 12-22%. The precision of the measurement system is better than 5%, the estimated accuracy depends on the species and ranges between 5-25%. This report presents a summary of the results including a comparison of measured data and ground-to-altitude correlation models. (orig.) 144 figs., 42 tabs., 497 refs.

  4. Involvement of Relish gene from Macrobrachium rosenbergii in the expression of anti-microbial peptides.

    Science.gov (United States)

    Shi, Yan-Ru; Jin, Min; Ma, Fu-Tong; Huang, Ying; Huang, Xin; Feng, Jin-Ling; Zhao, Ling-Ling; Chen, Yi-Hong; Ren, Qian

    2015-10-01

    Relish is an NF-kB transcription factor involved in immune-deficiency (IMD) signal pathway. In this study, a Relish gene (MrRelish) was identified from Macrobrachium rosenbergii. The full length of MrRelish comprises 5072 bp, including a 3510 bp open reading frame encoding a 1169 bp amino acid protein. MrRelish contains a Rel homology domain (RHD), a nucleus localization signal, an IκB-like domain (6 ankyrin repeats), and a death domain. Phylogenetic analysis showed that MrRelish and other Relish from crustaceans belong to one group. MrRelish was expressed in all detected tissues, with the highest expression level in hemocytes and intestines. MrRelish was also upregulated in hepatopancreas at 6 h after Vibrio anguillarum challenge. The over-expression of MrRelish could induce the expression of antimicrobial peptides (AMPs), such as Drosophila Metchnikowin (Mtk), Attacin (Atta), Drosomycin (Drs), and Cecropin (CecA) and shrimp Penaeidin (Pen4). The RNAi of MrRelish in gills showed that the expression of crustin (cru) 2, Cru5, Cru8, lysozyme (Lyso) 1, and Lyso2 was inhibited. However, the expression of anti-lipopolysaccharide factor (ALF) 1 and ALF3 did not change when MrRelish was knocked down. These results indicate that MrRelish may play an important role in innate immune defense against V. anguillarum in M. rosenbergii. Copyright © 2015 Elsevier Ltd. All rights reserved.

  5. Emission of ions and charged soot particles by aircraft engines

    Directory of Open Access Journals (Sweden)

    A. Sorokin

    2003-01-01

    Full Text Available In this article, a model which examines the formation and evolution of chemiions in an aircraft engine is proposed. This model which includes chemiionisation, electron thermo-emission, electron attachment to soot particles and to neutral molecules, electron-ion and ion-ion recombination, ion-soot interaction, allows the determination of the ion concentration at the exit of the combustor and at the nozzle exit of the engine. It also allows the determination of the charge of the soot particles. For the engine considered, the upper limit for the ion emission index EIi is of the order of (2-5 x1016 ions/kg-fuel if ion-soot interactions are ignored and the introduction of ion-soot interactions lead about to a 50% reduction. The results also show that most of the soot particles are either positively or negatively charged, the remaining neutral particles representing approximately 20% of the total particles. A comparison of the model results with the available ground-based experimental data obtained on the ATTAS research aircraft engines during the SULFUR experiments (Schumann, 2002 shows an excellent agreement.

  6. Identification and functional characterization of a novel Spätzle gene in Litopenaeus vannamei.

    Science.gov (United States)

    Yuan, Kai; Yuan, Feng-Hua; Weng, Shao-Ping; He, Jian-Guo; Chen, Yi-Hong

    2017-03-01

    Shrimp innate immunity is the first line of resistance against pathogenic bacteria. The Toll-like receptor (TLR)-NF-κB pathway is vital in this immunity process. In this study, a novel Spätzle gene (LvSpz4) of Litopenaeus vannamei was cloned and functionally characterized. The open reading frame of LvSpz4 was 918 bp, which encoded a putative protein with 305 amino acids. LvSpz4 was most expressed in the gills of L. vannamei. This expression was induced by Vibrio alginolyticus or Staphylococcus aureus infection or lipopolysaccharide stimulation. The reporter gene assay showed that LvSpz4 could activate the promoters of Pen4, Drs, AttA, Mtk, and white spot syndrome virus immediate early gene1 in Drosophila Schneider 2 (S2) cells. Knockdown LvSpz4 increased the cumulative mortality of L. vannamei upon V. alginolyticus infection. The unfolded protein response (UPR) induced the expression of LvSpz4 in L. vannamei. Moreover, the promoter of LvSpz4 was activated by L. vannamei X-Box binding protein 1 and activating transcription factor 4 in S2 cells. These results suggested that LvSpz4 was involved in L. vannamei innate immunity and caused the crosstalk between the TLR-NF-κB pathway and UPR. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Identification and functional characterization of a solute carrier family 15, member 4 gene in Litopenaeus vannamei.

    Science.gov (United States)

    Chen, Yong-Gui; Yuan, Kai; Zhang, Ze-Zhi; Yuan, Feng-Hua; Weng, Shao-Ping; Yue, Hai-Tao; He, Jian-Guo; Chen, Yi-Hong

    2016-04-01

    Innate immunity in shrimp is important in resisting bacterial infection. The NF-κB pathway is pivotal in such an immune response. This study cloned and functionally characterized the solute carrier family (SLC) 15 member A 4 (LvSLC15A4) gene in Litopenaeus vannamei. The open reading frame of LvSLC15A4 is 1, 902 bp long and encodes a putative 633-amino acid protein, which is localized in the plasma membrane and intracellular vesicular compartments. Results of the reporter gene assay showed that LvSLC15A4 upregulated NF-κB target genes, including the immediate-early gene 1 of white spot syndrome virus, as well as several antimicrobial peptide genes, such as pen4, CecA, AttA, and Mtk in S2 cells. Moreover, knocked-down expression of LvSLC15A4 reduced pen4 expression in L. vannamei. LvSLC15A4 down-regulation also increased the cumulative mortality of Vibrio parahemolyticus-infected L. vannamei. Furthermore, LvSLC15A4 expression was induced by unfolded protein response (UPR) in L. vannamei hematocytes. These results suggest that LvSLC15A4 participates in L. vannamei innate immunity via the NF-κB pathway and thus may be related to UPR. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. Identification and Mapping of Simple Sequence Repeat Markers from Common Bean (Phaseolus vulgaris L. Bacterial Artificial Chromosome End Sequences for Genome Characterization and Genetic–Physical Map Integration

    Directory of Open Access Journals (Sweden)

    Juana M. Córdoba

    2010-11-01

    Full Text Available Microsatellite markers or simple sequence repeat (SSR loci are useful for diversity characterization and genetic–physical mapping. Different in silico microsatellite search methods have been developed for mining bacterial artificial chromosome (BAC end sequences for SSRs. The overall goal of this study was genome characterization based on SSRs in 89,017 BAC end sequences (BESs from the G19833 common bean ( L. library. Another objective was to identify new SSR taking into account three tandem motif identification programs (Automated Microsatellite Marker Development [AMMD], Tandem Repeats Finder [TRF], and SSRLocator [SSRL]. Among the microsatellite search engines, SSRL identified the highest number of SSRs; however, when primer design was attempted, the number dropped due to poor primer design regions. Automated Microsatellite Marker Development software identified many SSRs with valuable AT/TA or AG/TC motifs, while TRF found fewer SSRs and produced no primers. A subgroup of 323 AT-rich, di-, and trinucleotide SSRs were selected from the AMMD results and used in a parental survey with DOR364 and G19833, of which 75 could be mapped in the corresponding population; these represented 4052 BAC clones. Together with 92 previously mapped BES- and 114 non-BES-derived markers, a total of 280 SSRs were included in the polymerase chain reaction (PCR-based map, integrating a total of 8232 BAC clones in 162 contigs from the physical map.

  9. Creativity in Parkinson's disease as a function of right versus left hemibody onset.

    Science.gov (United States)

    Drago, V; Foster, P S; Skidmore, F M; Heilman, K M

    2009-01-15

    Creativity is heavily dependent on divergent thinking and divergent thinking appears to be strongly dependent on fontal lobe function. Since patients with Parkinson's disease (PD) often have evidence of frontal lobe dysfunction we wanted to learn if these patients have a reduction of creativity, as well as learning if the side of onset (right versus left) influences the type (verbal versus visuospatial) of decrement in creativity. Participants of this study were patients with right (RHO) or left (LHO) onset PD as well as matched controls. All subjects were given the Abbreviated Torrance Test of Creative Thinking for Adults (ATTA), a widely used test to assess creativity that examines Fluency, Originality, Flexibility and Elaboration. Subjects were also assessed with the Controlled Word Association Test (COWAT). When compared to controls the patients with RHO, but not LHO, had a decrease of verbal creative fluency. Patients with PD often have a decrease on the COWAT, but performance on the COWAT did not differ between the RHO and the LHO patients. This suggests that patients with PD who have RHO have a decrease in verbal creativity and this decrement does not appear to be related to decreased fluency.

  10. Leucoagaricus gongylophorus Produces Diverse Enzymes for the Degradation of Recalcitrant Plant Polymers in Leaf-Cutter Ant Fungus Gardens

    Energy Technology Data Exchange (ETDEWEB)

    Aylward, Frank O. [Univ. of Wisconsin, Madison, WI (United States); Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Burnum-Johnson, Kristin E. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Tringe, Susannah G. [Dept. of Energy Joint Genome Inst., Walnut Creek, CA (United States); Teiling, Clotilde [Roche Diagnostics, Indianapolis, IN (United States); Tremmel, Daniel [Univ. of Wisconsin, Madison, WI (United States); Moeller, Joseph [Univ. of Wisconsin, Madison, WI (United States); Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Scott, Jarrod J. [Univ. of Wisconsin, Madison, WI (United States); Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Barry, Kerrie W. [Dept. of Energy Joint Genome Inst., Walnut Creek, CA (United States); Piehowski, Paul D. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Nicora, Carrie D. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Malfatti, Stephanie [Dept. of Energy Joint Genome Inst., Walnut Creek, CA (United States); Monroe, Matthew E. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Purvine, Samuel O. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Goodwin, Lynne A. [Dept. of Energy Joint Genome Inst., Walnut Creek, CA (United States); Smith, Richard D. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Weinstock, George [Washington Univ. School of Medicine, St. Louis, MS (United States); Gerardo, Nicole [Emory Univ., Atlanta, GA (United States); Suen, Garret [Dept. of Energy Joint Genome Inst., Walnut Creek, CA (United States); Lipton, Mary S. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Currie, Cameron R. [Univ. of Wisconsin, Madison, WI (United States); Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Smothsonian Tropical Research Inst., Balboa (Panama)

    2013-06-12

    Plants represent a large reservoir of organic carbon comprised largely of recalcitrant polymers that most metazoans are unable to deconstruct. Many herbivores gain access to nutrients in this material indirectly by associating with microbial symbionts, and leaf-cutter ants are a paradigmatic example. These ants use fresh foliar biomass as manure to cultivate fungus gardens composed primarily of Leucoagaricus gongylophorus, a basidiomycetous symbiont that produces specialized hyphal swellings that serve as a food source for the host ant colony. Although leaf-cutter ants are conspicuous herbivores that contribute substantially to carbon turnover in Neotropical ecosystems, the process through which plant biomass is degraded in their fungus gardens is not well understood. Here we present the first draft genome of L. gongylophorus, and using genomic, metaproteomic, and phylogenetic tools we investigate its role in lignocellulose degradation in the fungus gardens of both Atta cephalotes and Acromyrmex echinatior leaf-cutter ants. We show that L. gongylophorus produces a diversity of lignocellulases in fungus gardens, and is likely the primary driver of plant biomass degradation in these ecosystems. We also show that this fungus produces distinct sets of lignocellulases throughout the different stages of biomass degradation, including numerous cellulases and laccases that may be playing an important but previously uncharacterized role in lignocellulose degradation. Our study provides a comprehensive analysis of plant biomass degradation in leaf-cutter ant fungus gardens and provides insight into the molecular dynamics underlying the symbiosis between these dominant herbivores and their obligate fungal cultivar.

  11. Prudent sperm use by leaf-cutter ant queens

    DEFF Research Database (Denmark)

    Den Boer, Susanne Petronella A; Baer, Boris; Dreier, Stéphanie Agnès Jeanine

    2009-01-01

    In many species, females store sperm between copulation and egg fertilization, but the consequences of sperm storage and patterns of sperm use for female life history and reproductive success have not been investigated in great detail. In hymenopteran insect societies (ants, bees, wasps), reprodu......In many species, females store sperm between copulation and egg fertilization, but the consequences of sperm storage and patterns of sperm use for female life history and reproductive success have not been investigated in great detail. In hymenopteran insect societies (ants, bees, wasps......), reproduction is usually monopolized by one or relatively few queens, who mate only during a brief period early in life and store sperm for later use. The queens of some ants are particularly long-lived and have the potential to produce millions of offspring during their life. To do so, queens store many sperm...... cells, and this sperm must remain viable throughout the years of storage. Queens should also be under strong selection to use stored sperm prudently when fertilizing eggs. We used the leaf-cutter ant Atta colombica to investigate the dynamics of sperm use during egg fertilization. We show that queens...

  12. Creative thinking in prospective teachers: the status quo and the impact of contextual factors

    Directory of Open Access Journals (Sweden)

    Hannetjie Meintjes

    2010-01-01

    Full Text Available To create unique and appropriate learning opportunities and environments and to nurture the development of creative thinking abilities among learners are some of the demands for creative thinking currently expected of teachers globally and also in South Africa. Creative thinking in academic context assumes, among other things, the ability to generate a variety of original ideas, to see different viewpoints and elaborate on ideas. We report on the findings of a quantitative pilot investigation by means of experimental research utilizing an ex post facto design to determine the status quo regarding the creative thinking abilities of a hetrogeneous group of 207 pre-service teachers studying at a South African university, using the Abbreviated Torrance Test for Adults (ATTA and a Partial Least Squares (PLS exploration into the relationship between contextual factors and the students' creative thinking abilities. Strong correlations were found among a variety of contextual factors such as the type of school model and culture and creative thinking abilities and also between specific contextual factors such as the choice of role model and socio economic and acculturation factors and certain creative thinking abilities. This research explores a largely unknown field, namely, the creative thinking abilities of a group of South African pre-service teachers of different cultural groups and creates an awareness of the need for the development of creative thinking abilities among these prospective teachers.

  13. Radiometric 81Kr dating identifies 120,000 year old ice at Taylor Glacier, Antarctica

    CERN Document Server

    Buizert, Christo; Jiang, Wei; Purtschert, Roland; Petrenko, Vasilii V; Lu, Zheng-Tian; Mueller, Peter; Kuhl, Tanner; Lee, James; Severinghaus, Jeffrey P; Brook, Edward J

    2014-01-01

    We present the first successful 81Kr-Kr radiometric dating of ancient polar ice. Krypton was extracted from the air bubbles in four ~350 kg polar ice samples from Taylor Glacier in the McMurdo Dry Valleys, Antarctica, and dated using Atom Trap Trace Analysis (ATTA). The 81Kr radiometric ages agree with independent age estimates obtained from stratigraphic dating techniques with a mean absolute age offset of 6 +/- 2.5 ka. Our experimental methods and sampling strategy are validated by 1) 85Kr and 39Ar analyses that show the samples to be free of modern air contamination, and 2) air content measurements that show the ice did not experience gas loss. We estimate the error in the 81Kr ages due to past geomagnetic variability to be below 3 ka. We show that ice from the previous interglacial period (MIS 5e, 130-115 ka before present) can be found in abundance near the surface of Taylor Glacier. Our study paves the way for reliable radiometric dating of ancient ice in blue ice areas and margin sites where large samp...

  14. Hereditary truncating mutations of DNA repair and other genes in BRCA1/BRCA2/PALB2-negatively tested breast cancer patients.

    Science.gov (United States)

    Lhota, F; Zemankova, P; Kleiblova, P; Soukupova, J; Vocka, M; Stranecky, V; Janatova, M; Hartmannova, H; Hodanova, K; Kmoch, S; Kleibl, Z

    2016-10-01

    Hereditary breast cancer comprises a minor but clinically meaningful breast cancer (BC) subgroup. Mutations in the major BC-susceptibility genes are important prognostic and predictive markers; however, their carriers represent only 25% of high-risk BC patients. To further characterize variants influencing BC risk, we performed SOLiD sequencing of 581 genes in 325 BC patients (negatively tested in previous BRCA1/BRCA2/PALB2 analyses). In 105 (32%) patients, we identified and confirmed 127 truncating variants (89 unique; nonsense, frameshift indels, and splice site), 19 patients harbored more than one truncation. Forty-six (36 unique) truncating variants in 25 DNA repair genes were found in 41 (12%) patients, including 16 variants in the Fanconi anemia (FA) genes. The most frequent variant in FA genes was c.1096_1099dupATTA in FANCL that also show a borderline association with increased BC risk in subsequent analysis of enlarged groups of BC patients and controls. Another 81 (53 unique) truncating variants were identified in 48 non-DNA repair genes in 74 patients (23%) including 16 patients carrying variants in genes coding proteins of estrogen metabolism/signaling. Our results highlight the importance of mutations in the FA genes' family, and indicate that estrogen metabolism genes may reveal a novel candidate genetic component for BC susceptibility. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  15. Method for Extraction of Dissolved Gases From Groundwater for Radiokrypton Analysis

    Science.gov (United States)

    Probst, P.; Yokochi, R.; Sturchio, N. C.

    2006-12-01

    Two radioactive isotopes of krypton (Kr) have proven to be valuable tools for dating groundwater. ^{81}Kr (half life of 229,000 years) is an excellent tracer for groundwater flow on the 50,000 to 1,000,000 year time scale. ^{85}Kr (half life of 10.8 years) can be used to study groundwater less than 50 years old. The recent application of Atom Trap Trace Analysis (ATTA) on Kr at Argonne National Laboratory enabled the quantification of those low abundance isotopes (~ 10^{-12} for ^{81}Kr)in natural samples. ATTA analyses currently need 50 μL of krypton, which requires over 700 L of groundwater to be processed. A new system, EDGAR (Extraction of Dissolved Gases for Analysis of Radiokrypton), has been developed at the University of Illinois at Chicago for a simple and rapid extraction of dissolved gases from groundwater. The key component of EDGAR is a hydrophobic semi-permeable membrane contactor that transports gases across the membrane material as water flows through it. A vacuum compressor applies vacuum to the outer side of the membrane and then compresses the extracted gas into a size 80 gas cylinder. The extraction apparatus is housed in a rolling steel-frame cart that weighs about 180 kg and requires a 120VAC/20 amp power source. Electronic sensors monitor the membrane vacuum, sample tank pressure, water temperature and total water flow. A data logger records all of the sensor signals. Laboratory testing of the membrane extraction was conducted using tap water derived from Lake Michigan. Dissolved oxygen (DO_2) measurements before and after the membrane were used as a benchmark. DO_2 dropped from the initial value of 12-15 mg/L to 1.6-3.7 mg/L after the membrane extraction, indicating an extraction of 67 to 88 % of dissolved oxygen. The amount of oxygen removed from the water was proportional to the vacuum applied to the membrane. Field testing of EDGAR was performed on a local anoxic groundwater well. The compositions of the extracted gas and the dissolved

  16. Combate sistemático de formigas-cortadeiras com iscas granuladas, em eucaliptais com cultivo mínimo Systematic control of leaf-cutting ants in areas with eucalyptus stands under minimum cultivation system

    Directory of Open Access Journals (Sweden)

    Ronald Zanetti

    2003-06-01

    Full Text Available Avaliou-se a eficiência do combate sistemático de formigas-cortadeiras em áreas de reforma de eucalipto com cultivo mínimo, na Celulose Nipo-Brasileira S.A., em Belo Oriente, Minas Gerais, de setembro a dezembro de 1996. Os tratamentos consistiram na aplicação de uma isca granulada com sulfluramida (0,3% de forma sistemática, a granel ou com microporta-iscas, na dosagem de 5 g a cada 6 m² e 10 g a cada 12 m², respectivamente. A mortalidade das colônias de formigas-cortadeiras foi avaliada 30 dias após a aplicação da isca. Foram encontradas até 396,3, 285,2, 59,3, 55,6, 29,6 e 14,8 colônias de Mycocepurus goeldii, Sericomyrmex sp., Acromyrmex subterraneus molestans, Atta spp., Acromyrmex balzani e Acromyrmex niger (Hymenoptera: Formicidae por hectare, respectivamente. A eficiência da isca granulada no combate sistemático variou com o método empregado e com a espécie de formiga-cortadeira. A maior eficiência foi obtida para A. subterraneus molestans, com 69,2% de suas colônias mortas com a isca aplicada a granel e 62,5% com microporta-iscas, o que indica que a distribuição entre dois pontos com isca nos plantios de eucalipto foi maior que a área de forrageamento das formigas-cortadeiras encontradas e, ou, que a dosagem aplicada por ponto foi insuficiente.The efficiency of a systematic application of baits against leaf-cutting ants was evaluated in a eucalypus plantation under a minimum cultivation system, in areas owned by Celulose Nipo-Brasileira S.A. (CENIBRA, in Belo Oriente, Minas Gerais, Brazil, from September to December 1996. Treatments consisted of applying a granulated bait with sulfluramide (0.3% in a systematic manner in bulk and plastic bags at a dose of five grams every 6 m² (T1 and 10 grams at each 12 m² (T2. Mortality of colonies of leaf-cutting ants was evaluated 30 days after bait application. A. maximum of 396.3; 285.2; 59.3; 55.6; 29.6 and 14.8 colonies of Mycocepurus goeldii, Sericomyrmex sp

  17. Patterns of diversity and abundance of fungus-growing ants (Formicidae: Attini in areas of the Brazilian Cerrado Padrões de diversidade e abundância de formigas cultivadoras de fungo (Formicidade: Attini em áreas do Cerrado Brasileiro

    Directory of Open Access Journals (Sweden)

    Heraldo L. Vasconcelos

    2008-09-01

    Full Text Available Fungus-growing ants (tribe Attini are characteristic elements of the New World fauna. However, there is little information on the patterns of diversity, abundance, and distribution of attine species in their native ecosystems, especially for the so-called "lower" genera of the tribe. A survey of attine ant nests (excluding Atta Fabricus, 1804 and Acromyrmex Mayr, 1865 was conducted in a variety of savanna and forest habitats of the Cerrado biome near Uberlândia, Brazil. In total, 314 nests from 21 species of nine genera were found. Trachymyrmex Forel, 1893 was the most diverse genus with 10 species. Eighteen species were found in the savannas, including Mycetagroicus cerradensis Brandão & Mayhé-Nunes, 2001, a species from a recently-described genus of Attini, whereas in the forests only 12 species were found. Forest and savannas support relatively distinct faunas, each with a number of unique species; the species present in the forest habitats did not represent a nested subset of the species found in the savannas. Furthermore, although many species were common to both types of vegetation, their abundances were quite different. The density of attine nests is relatively high at some sites, exceeding an estimated 4,000 nests per hectare. In this sense, attine ants can be regarded as prevalent invertebrate taxa in the Brazilian Cerrado.As formigas cultivadoras de fungos (tribo Attini são exclusivas da fauna do Novo Mundo. Entretanto, existem poucas informações sobre os padrões de diversidade, abundância e distribuição das espécies de Attini em seus ecossistemas nativos, em especial para os gêneros menos derivados desta tribo. Um levantamento de ninhos de Attini (excluindo Atta Fabricius, 1804 e Acromyrmex Mayr, 1865 foi realizado em diversos ambientes savânicos e de floresta do bioma Cerrado próximos à Uberlândia, Brasil. Encontramos 314 ninhos de 21 espécies pertencentes a nove gêneros da tribo. Trachymyrmex Forel, 1893 foi o g

  18. O jardim de fungo atua como um molde para a construção das câmaras em formigas cortadeiras? Fungus garden acts as a template for the construction of chambers in ants?

    Directory of Open Access Journals (Sweden)

    Roberto da Silva Camargo

    2013-04-01

    Full Text Available Os ninhos adultos das formigas cortadeiras (gênero Atta e Acromyrmex são compostos de milhares de câmaras subterrâneas, as quais abrigam o jardim de fungo, lixo e a população desses insetos. Entretanto, como as câmaras são construídas? Para responder essa questão, nós hipotetizamos que o jardim de fungo atua como um molde para a construção das câmaras. Assim, foram utilizadas 20 colônias de 6 meses de idade, divididas em quatro séries experimentais: padrão (quantidade normal de jardim de fungo; metade de jardim de fungo; dobro de jardim de fungo e sem jardim de fungo (Testemunha. As variáveis estudadas foram: parâmetros morfológicos das estruturas (túneis e câmara formada; fluxo das atividades das operárias; volume de solo escavado. Como se esperava, o jardim de fungo atua como um molde para a construção das câmaras em formigas cortadeiras. Os resultados foram: o tratamento sem jardim de fungo não apresentou nenhuma câmara, apenas túneis, em contraposição às demais séries experimentais que apresentaram no mínimo 2 câmaras, com dimensões similares; o fluxo das operárias carregando pellet de solo por minuto durante as 72 horas diferiu estatisticamente entre as séries experimentais e, finalmente, o volume do solo escavado foi resultado da taxa de escavação das operárias, diferindo estatisticamente entre as séries experimentais. Os resultados corroboram a hipótese de que o jardim de fungo atua como um molde para a construção da câmara. A ausência de uma estrutura funcional como uma câmara, quando o jardim de fungo está ausente, comprova a hipótese.Adult nests of leaf cutting ants (genus Atta and Acromyrmex are composed of thousands of underground chambers, which harbor the fungus garden, garbage and their population. However, how the chambers are constructed? To answer this question, we hypothesized that the fungus garden acts as a template for the chambers construction. Thus, we used 20 colonies of

  19. Krypton-81 in groundwater of the Culebra Dolomite near the Waste Isolation Pilot Plant, New Mexico.

    Science.gov (United States)

    Sturchio, Neil C; Kuhlman, Kristopher L; Yokochi, Reika; Probst, Peter C; Jiang, Wei; Lu, Zheng-Tian; Mueller, Peter; Yang, Guo-Min

    2014-05-01

    The Waste Isolation Pilot Plant (WIPP) in New Mexico is the first geologic repository for disposal of transuranic nuclear waste from defense-related programs of the US Department of Energy. It is constructed within halite beds of the Permian-age Salado Formation. The Culebra Dolomite, confined within Rustler Formation evaporites overlying the Salado Formation, is a potential pathway for radionuclide transport from the repository to the accessible environment in the human-disturbed repository scenario. Although extensive subsurface characterization and numerical flow modeling of groundwater has been done in the vicinity of the WIPP, few studies have used natural isotopic tracers to validate the flow models and to better understand solute transport at this site. The advent of Atom-Trap Trace Analysis (ATTA) has enabled routine measurement of cosmogenic (81)Kr (half-life 229,000 yr), a near-ideal tracer for long-term groundwater transport. We measured (81)Kr in saline groundwater sampled from two Culebra Dolomite monitoring wells near the WIPP site, and compared (81)Kr model ages with reverse particle-tracking results of well-calibrated flow models. The (81)Kr model ages are ~130,000 and ~330,000 yr for high-transmissivity and low-transmissivity portions of the formation, respectively. Compared with flow model results which indicate a relatively young mean hydraulic age (~32,000 yr), the (81)Kr model ages imply substantial physical attenuation of conservative solutes in the Culebra Dolomite and provide limits on the effective diffusivity of contaminants into the confining aquitards. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. A system for field gas-extraction of 85Kr, 39Ar and 81Kr using SuperPhobic membrane contactors

    Science.gov (United States)

    Burk, L.; Suckow, A.; Cook, P.; Mathouchanh, E.

    2013-12-01

    Radioactive noble gas isotopes are established tools for assessing groundwater movement and transport processes on time scales of decades (85Kr), centuries (39Ar) and many millenia (81Kr). While the atomic trap trace analysis (ATTA) technology promises small sample sizes for these isotopes, field gas extraction will remain the method of choice for several years to come. Recently CSIRO obtained decommissioned radiocarbon gas proportional counters and targets to use them for 85Kr. We aim for a sample size of 50μL Kr corresponding to the gas extracted from 500-1000L water. Flinders University and CSIRO have developed a field-deployable extraction system for large volume gas-extraction in the field. It uses two membrane contactors (MEMBRANA SuperPhobic 4x13) allowing flow rates of up to 50L/min in serial mode. Switching to parallel flow through both contactors is possible, allowing even higher water flow rates. The system automatically logs water temperature, water pressure, water flow rate, gas pressure of the sample, vacuum pressure at the contactor and all valve states, using an Endress + Hauser RSG40 Memograph M. The use of SuperPhobic contactors results in ten times less water in the gas fraction than reported for earlier systems. With the two contactors in serial configuration, gas extraction efficiencies, determined for O2, N2 and Ar, are better than 95% at 5L/min water flow. They are still above 80% for flow rates up to 20L/min in parallel configuration for O2, N2 and Ar. No measurable isotopic fractionation of the target isotope ratios of argon and krypton is to be expected at these high extraction efficiencies.

  1. MENGKRITISI KONSEP ISLAMISASI ILMU ISMAIL RAJI AL-FARUQI: Telaah Pemikiran Ziauddin Sardar

    Directory of Open Access Journals (Sweden)

    Muhammad Taufik

    2017-12-01

    ilmu. Konsep ilm meniscayakan umat Islam untuk memahami realitas secara utuh. Hal ini telah dilakukan oleh sarjana dan intelektual Muslim klasik, seperti al-Kindi, al-Farabi, al-Ghazali, Ibnu Rusyd dan sarjana klasik lainnya. Akan tetapi, sarjana Muslim kontemporer tampak mengesampingkan peranan epistemologi ini. Sehingga yang terjadi kemudian adalah justru Islam kehilangan jati diri sebagai kekuatan yang punya orientasi epistemologis yang sebenarnya sudah mapan di era klasik. Konsep Islamisasi ilmu populer di tangan al-Faruqi dan juga Naquib al- Attas. Bagi al-Faruqi, Islamisasi ilmu pengetahuan adalah mengislamkan disiplin-disiplin ilmu atau tepatnya menghasilkan buku-buku pegangan (buku dasar di perguruan tinggi, dengan menuangkan kembali disiplin ilmu modern ke dalam wawasan Islam, setelah dilakukan kajian kritis terhadap kedua sistem pengetahuan Islam dan Barat. Selain itu, al-Faruqi juga memberikan langkah-langkah prosedural bagi terlaksanya program Islamisasi ilmu. Penulis menemukan poin penting dari kajian ini bahwa pemikiran Islamisasi ilmu al-Faruqi inilah yang dikritisi oleh Sardar, menurutnya perumusan epistemologi Islam kontemporer tidak dapat dimulai dengan menitikberatkan pada disiplin ilmu yang sudah ada. Sardar mengungkapkan bahwa epistemologi Islam kontemporer dapat dirumuskan dengan dengan mengembangkan paradigma-paradigma di dalam ekspresi-ekspresi eksternal peradaban Muslim yang meliputi sains dan teknologi, politik dan hubungan-hubungan internasional, struktur-struktur sosial dan kegiatan ekonomi, pembangunan desa dan kota. Semua aspek ekspesi eksternal peradaban Muslim tersebut dapat dipelajari dan dikembangan dalam kaitannya dengan kebutuhan-kebutuhan dan realitas kontemporer. Dari sini Sardar sekali lagi menolak Islamisasi ilmu pengetahuan dimulai dari disiplin ilmu yang sudah ada. Hal ini karena disiplin ilmu tersebut tidak sesuai dengan nilai-nilai Islam

  2. Nanomedicine and cancer immunotherapy: focus on indoleamine 2,3-dioxygenase inhibitors

    Directory of Open Access Journals (Sweden)

    Zulfiqar B

    2017-01-01

    Full Text Available Bilal Zulfiqar,1 Amnah Mahroo,1 Kaenat Nasir,1 Rai Khalid Farooq,2 Nasir Jalal,3 Muhammad Usman Rashid,4 Kashif Asghar1,4 1Healthcare Biotechnology Department, Atta-ur-Rahman School of Applied Biosciences (ASAB, National University of Sciences and Technology (NUST, Islamabad, 2Department of Physiology, Army Medical College, National University of Medical Sciences, Rawalpindi, Pakistan; 3Department of Molecular and Cellular Pharmacology, Health Sciences Platform, Tianjin University, Tianjin, People’s Republic of China; 4Basic Sciences Research, Shaukat Khanum Memorial Cancer Hospital and Research Centre (SKMCH&RC, Lahore, Pakistan Abstract: Nanomedicine application in cancer immunotherapy is currently one of the most challenging areas in cancer therapeutic intervention. Innovative solutions have been provided by nanotechnology to deliver cytotoxic agents to the cancer cells partially affecting the healthy cells of the body during the process. Nanoparticle-based drug delivery is an emerging approach to stimulate the immune responses against cancer. The inhibition of indoleamine 2,3-dioxygenase (IDO is a pivotal area of research in cancer immunotherapy. IDO is a heme-containing immunosuppressive enzyme, which is responsible for the degradation of tryptophan while increasing the concentration of kynurenine metabolites. Various preclinical studies showed that IDO inhibition in certain diseases may result in significant therapeutic effects. Here, we provide a review of the natural and synthetic inhibitors of IDO. These inhibitors are classified according to their source, inhibitory concentrations, the chemical structure, and the mechanism of action. Tumor-targeted chemotherapy is an advanced technique and has more advantages as compared to the conventional chemotherapy. Search for more efficient and less toxic nanoparticles in conjunction with compounds to inhibit IDO is still an area of interest for several research groups worldwide, especially

  3. Bystander signaling via oxidative metabolism

    Directory of Open Access Journals (Sweden)

    Sawal HA

    2017-08-01

    Full Text Available Humaira Aziz Sawal,1 Kashif Asghar,2 Matthias Bureik,3 Nasir Jalal4 1Healthcare Biotechnology Department, Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, 2Basic Sciences Research, Shaukat Khanum Memorial Cancer Hospital and Research Centre, Lahore, Pakistan; 3Health Science Platform, School of Pharmaceutical Science and Technology, Tianjin University, Tianjin, China; 4Health Science Platform, Department of Molecular and Cellular Pharmacology, Tianjin University, Tianjin, China Abstract: The radiation-induced bystander effect (RIBE is the initiation of biological end points in cells (bystander cells that are not directly traversed by an incident-radiation track, but are in close proximity to cells that are receiving the radiation. RIBE has been indicted of causing DNA damage via oxidative stress, besides causing direct damage, inducing tumorigenesis, producing micronuclei, and causing apoptosis. RIBE is regulated by signaling proteins that are either endogenous or secreted by cells as a means of communication between cells, and can activate intracellular or intercellular oxidative metabolism that can further trigger signaling pathways of inflammation. Bystander signals can pass through gap junctions in attached cell lines, while the suspended cell lines transmit these signals via hormones and soluble proteins. This review provides the background information on how reactive oxygen species (ROS act as bystander signals. Although ROS have a very short half-life and have a nanometer-scale sphere of influence, the wide variety of ROS produced via various sources can exert a cumulative effect, not only in forming DNA adducts but also setting up signaling pathways of inflammation, apoptosis, cell-cycle arrest, aging, and even tumorigenesis. This review outlines the sources of the bystander effect linked to ROS in a cell, and provides methods of investigation for researchers who would like to

  4. Comportamento espectral de materiais de solos e de estruturas biogênicas associadas

    Directory of Open Access Journals (Sweden)

    J. A. M. Demattê

    1998-12-01

    Full Text Available No presente estudo, verificou-se a interferência da macrofauna edáfica sobre os atributos físicos e químicos e sua relação com a reflectância espectral de um Latossolo Vermelho-Amarelo (LV, Terra Roxa Estruturada latossólica (TR e Vertissolo (V. Esses solos localizam-se em três pontos ao longo de uma toposseqüência da região de Piracicaba (SP. As amostras foram direcionadas para os agregados formados pelas formigas cortadeiras (Atta sp., cupins (Cornitermes cumulans e minhocas (Pontoscolex corethrurus, os quais foram comparados com o solo-controle sem atividade visível e recente dos animais (testemunha. Foram avaliadas a granulometria e a composição química das amostras de solo. O comportamento espectral do solo foi obtido em laboratório, utilizando espectroradiômetro entre 400 e 2.500 nm. Os coprólitos de minhoca apresentaram 2 a 3 vezes mais fósforo e um incremento de 30 a 50% na matéria orgânica em relação ao horizonte superficial do solo. Os agregados de cupins e formigas apresentaram composição química semelhante à dos horizontes subsuperficiais dos solos. O comportamento espectral dos agregados biológicos variou conforme sua composição química e profundidade de ação dos animais. No caso da minhoca, as curvas de reflectância foram semelhantes às do horizonte superficial para os três solos. Para as estruturas de cupim e formiga, tanto a composição química como o comportamento espectral corresponderam ao horizonte subsuperficial no LV e TR.

  5. Effects of dating errors on nonparametric trend analyses of speleothem time series

    Directory of Open Access Journals (Sweden)

    M. Mudelsee

    2012-10-01

    Full Text Available A fundamental problem in paleoclimatology is to take fully into account the various error sources when examining proxy records with quantitative methods of statistical time series analysis. Records from dated climate archives such as speleothems add extra uncertainty from the age determination to the other sources that consist in measurement and proxy errors. This paper examines three stalagmite time series of oxygen isotopic composition (δ18O from two caves in western Germany, the series AH-1 from the Atta Cave and the series Bu1 and Bu4 from the Bunker Cave. These records carry regional information about past changes in winter precipitation and temperature. U/Th and radiocarbon dating reveals that they cover the later part of the Holocene, the past 8.6 thousand years (ka. We analyse centennial- to millennial-scale climate trends by means of nonparametric Gasser–Müller kernel regression. Error bands around fitted trend curves are determined by combining (1 block bootstrap resampling to preserve noise properties (shape, autocorrelation of the δ18O residuals and (2 timescale simulations (models StalAge and iscam. The timescale error influences on centennial- to millennial-scale trend estimation are not excessively large. We find a "mid-Holocene climate double-swing", from warm to cold to warm winter conditions (6.5 ka to 6.0 ka to 5.1 ka, with warm–cold amplitudes of around 0.5‰ δ18O; this finding is documented by all three records with high confidence. We also quantify the Medieval Warm Period (MWP, the Little Ice Age (LIA and the current warmth. Our analyses cannot unequivocally support the conclusion that current regional winter climate is warmer than that during the MWP.

  6. Mesenchymal stem cell therapy for osteoarthritis: current perspectives

    Directory of Open Access Journals (Sweden)

    Wyles CC

    2015-08-01

    Full Text Available Cody C Wyles,1 Matthew T Houdek,2 Atta Behfar,3 Rafael J Sierra,21Mayo Medical School, 2Department of Orthopedic Surgery, 3Division of Cardiovascular Diseases, Mayo Clinic, Rochester, MN, USAAbstract: Osteoarthritis (OA is a painful chronic condition with a significant impact on quality of life. The societal burden imposed by OA is increasing in parallel with the aging population; however, no therapies have demonstrated efficacy in preventing the progression of this degenerative joint disease. Current mainstays of therapy include activity modification, conservative pain management strategies, weight loss, and if necessary, replacement of the affected joint. Mesenchymal stem cells (MSCs are a multipotent endogenous population of progenitors capable of differentiation to musculoskeletal tissues. MSCs have a well-documented immunomodulatory role, managing the inflammatory response primarily through paracrine signaling. Given these properties, MSCs have been proposed as a potential regenerative cell therapy source for patients with OA. Research efforts are focused on determining the ideal source for derivation, as MSCs are native to several tissues. Furthermore, optimizing the mode of delivery remains a challenge both for appropriate localization of MSCs and for directed guidance toward stemming the local inflammatory process and initiating a regenerative response. Scaffolds and matrices with growth factor adjuvants may prove critical in this effort. The purpose of this review is to summarize the current state of MSC-based therapeutics for OA and discuss potential barriers that must be overcome for successful implementation of cell-based therapy as a routine treatment strategy in orthopedics.Keywords: mesenchymal stem cell, osteoarthritis, treatment, regenerative medicine, cell therapy

  7. Yeasts and filamentous fungi carried by the gynes of leaf-cutting ants.

    Science.gov (United States)

    Pagnocca, Fernando C; Rodrigues, André; Nagamoto, Nilson S; Bacci, Maurício

    2008-11-01

    Insect-associated microbes exhibit a wide range of interactions with their hosts. One example of such interactions is the insect-driven dispersal of microorganisms, which plays an essential role in the ecology of several microbes. To study dispersal of microorganisms by leaf-cutting ants (Formicidae: Attini), we applied culture-dependent methods to identify the filamentous fungi and yeasts found in two different body parts of leaf-cutting ant gynes: the exoskeleton and the infrabuccal pocket. The gynes use the latter structure to store a pellet of the ants' symbiotic fungus during nest founding. Many filamentous fungi (n = 142) and yeasts (n = 19) were isolated from the gynes' exoskeleton. In contrast, only seven filamentous fungi and three yeasts isolates were recovered from the infrabuccal pellets, suggesting an efficient mechanism utilized by the gynes to prevent contamination of the symbiotic fungus inoculum. The genus Cladosporium prevailed (78%) among filamentous fungi whereas Aureobasidium, Candida and Cryptococcus prevailed among yeasts associated with gynes. Interestingly, Escovopsis, a specialized fungal pathogen of the leaf-cutting ant-fungus symbiosis, was not isolated from the body parts or from infrabuccal pellets of any gynes sampled. Our results suggest that gynes of the leaf-cutter ants Atta laevigata and A. capiguara do not vertically transmit any particular species of yeasts or filamentous fungi during the foundation of a new nest. Instead, fungi found in association with gynes have a cosmopolitan distribution, suggesting they are probably acquired from the environment and passively dispersed during nest foundation. The possible role of these fungi for the attine ant-microbial symbiosis is discussed.

  8. In-situ studies on volatile jet exhaust particle emissions - impacts of fuel sulfur content and environmental conditions on nuclei-mode aerosols

    Energy Technology Data Exchange (ETDEWEB)

    Schroeder, F.; Baumann, R.; Petzold, A.; Busen, R.; Schulte, P.; Fiebig, M. [DLR Deutsches Zentrum fuer Luft- und Raumfahrt e.V., Wessling (Germany). Inst. fuer Physik der Atmosphaere; Brock, C.A. [Denver Univ., CO (United States). Dept. of Engineering

    2000-02-01

    In-situ measurements of ultrafine aerosol particle emissions were performed at cruise altitudes behind the DLR ATTAS research jet (RR M45H M501 engines) and a B737-300 aircraft (CFM56-3B1 engines). Measurements were made 0.15-20 seconds after emission as the source aircraft burned fuel with sulfur contents (FSC) of 2.6, 56 or 118 mg kg{sup -1}. Particle size distributions of from 3 to 60 nm diameter were determined using CN-counters with varying lower size detection limits. Volatile particle concentrations in the aircraft plumes strongly increased as diameter decreased toward the sizes of large molecular clusters, illustrating that apparent particle emissions are extremely sensitive to the smallest particle size detectable by the instrument used. Environmental conditions and plume age alone could influence the number of detected ultrafine (volatile) aerosols within an order of magnitude, as well. The observed volatile particle emissions decreased nonlinearly as FSC decreased to 60 mg kg{sup -1}, reaching minimum values of about 2 x 10{sup 17} kg{sup -1} and 2 x 10{sup 16} kg{sup -1} for particles >3 nm and >5 nm, respectively. Volatile particle emissions did not change significantly as FSCs were further reduced below 60 mg kg{sup -1}. Volatile particle emissions did not differ significantly between the two studied engine types. In contrast, soot particle emissions from the modern CFM56-3B1 engines were 4-5 times less (4 x 10{sup 14} kg{sup -1}) than from the older RR M45H M501 engines (1.8 x 10{sup 15} kg{sup -1}). Contrail processing has been identified as an efficient sink/quenching parameter for ultrafine particles and reduces the remaining interstitial aerosol by factors 2-10 depending on particle size.

  9. Identification and functional characterization of heat shock transcription factor1 in Litopenaeus vannamei.

    Science.gov (United States)

    Yan, Hui; Zhang, Shuang; Li, Xiao-Yun; Yuan, Feng-Hua; Qiu, Wei; Chen, Yong-Gui; Weng, Shao-Ping; He, Jian-Guo; Chen, Yi-Hong

    2014-03-01

    Heat shock transcription factors belong to the heat shock factor (HSF) protein family, which are involved in heat shock protein (HSP) gene regulation. They are critical for cell survival upon exposure to harmful conditions. In this study, we identified and characterized a HSF1 (LvHSF1) gene in Litopenaeus vannamei, with a full-length cDNA of 2841 bp and an open reading frame encoding a putative protein of 632 amino acids. Through multiple sequence alignment and phylogenetic analysis, it was revealed that LvHSF1 was closed to insect HSF family, which contained a highly conserved DNA-binding domain, oligomerization domains with HR-A/B, and a nuclear localization signal. Tissues distribution showed that LvHSF1 was widely expressed in all tissues tested. And it was upregulated in hemocytes and gills after Vibrio alginolyticus or Staphylococcus aureus infection. Dual-luciferase reporter assays indicated that LvHSF1 activated the promoters of L. vannamei HSP70 (LvHSP70) and L. vannamei Cactus (LvCactus), while inhibited the expressions of Drosophila antimicrobial peptide (AMP) Atta, Mtk, and L. vannamei AMP PEN4 through NF-κB signal transduction pathway modification. Knocked-down expression of LvHSF1 by dsRNA resulted in downregulations of LvHSP70 and LvCactus, as well as cumulative mortality decreasing under V. alginolyticus or S. aureus infection in L. vannamei. Taken together, our data strongly suggest that LvHSF1 is involved in LvHSP70 regulation, therefore plays a great role in stress resistance. And it also takes part in LvCactus/LvDorsal feedback regulatory pathway modification of L. vannamei, which is in favor of V. alginolyticus or S. aureus infection. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. Pharmacoinformatics approach for investigation of alternative potential hepatitis C virus nonstructural protein 5B inhibitors

    Directory of Open Access Journals (Sweden)

    Mirza MU

    2015-03-01

    Full Text Available Muhammad Usman Mirza,1 Noor-Ul-Huda Ghori,2 Nazia Ikram,3 Abdur Rehman Adil,4 Sadia Manzoor3 1Centre for Research in Molecular Medicine (CRiMM, The University of Lahore, Lahore, 2Atta-ur-Rehman School of Applied Biosciences (ASAB, National University of Science and Technology, Islamabad, 3Institute of Molecular Biology and Biotechnology (IMBB, The University of Lahore, Lahore, Pakistan; 4Centre for Excellence in Molecular Biology (CEMB, The University of Punjab, Lahore, Pakistan Abstract: Hepatitis C virus (HCV is one of the major viruses affecting the world today. It is a highly variable virus, having a rapid reproduction and evolution rate. The variability of genomes is due to hasty replication catalyzed by nonstructural protein 5B (NS5B which is also a potential target site for the development of anti-HCV agents. Recently, the US Food and Drug Administration approved sofosbuvir as a novel oral NS5B inhibitor for the treatment of HCV. Unfortunately, it is much highlighted for its pricing issues. Hence, there is an urgent need to scrutinize alternate therapies against HCV that are available at affordable price and do not have associated side effects. Such a need is crucial especially in underdeveloped countries. The search for various new bioactive compounds from plants is a key part of pharmaceutical research. In the current study, we applied a pharmacoinformatics-based approach for the identification of active plant-derived compounds against NS5B. The results were compared to docking results of sofosbuvir. The lead compounds with high-binding ligands were further analyzed for pharmacokinetic and pharmacodynamic parameters based on in silico absorption, distribution, metabolism, excretion, and toxicity (ADMET profile. The results showed the potential alternative lead compounds that can be developed into commercial drugs having high binding energy and promising ADMET properties. Keywords: hepatitis C, NS5B inhibitors, molecular docking, Auto

  11. Cyclic alternating pattern in sleep and its relationship to creativity.

    Science.gov (United States)

    Drago, Valeria; Foster, Paul S; Heilman, Kenneth M; Aricò, Debora; Williamson, John; Montagna, Pasquale; Ferri, Raffaele

    2011-04-01

    Sleep has been shown to enhance creativity, but the reason for this enhancement is not entirely known. There are several different physiologic states associated with sleep. In addition to rapid (REM) and non-rapid eye movement (NREM) sleep, NREM sleep can be broken down into Stages (1-4) that are characterized by the degree of EEG slow-wave activity. In addition, during NREM sleep the cyclic alternating pattern (CAPs) of EEG activity has been described which can also be divided into three subtypes (A1-A3) according to the frequency of the EEG waves. Differences in CAP subtype ratios have been previously linked to cognitive performances. The purpose of this study was to asses the relationship between CAP activity during sleep and creativity. The participants were eight healthy young adults (four women) who underwent three consecutive nights of polysomnographic recording and took the Abbreviated Torrance Test for Adults (ATTA) on the second and third mornings after the recordings. There were positive correlations between Stage 1 of NREM sleep and some measures of creativity such as fluency (R=.797; p=.029) and flexibility (R=.43; p=.002), between Stage 4 of NREM sleep and originality (R=.779; p=.034) and a global measure of figural creativity (R=.758; p=.040). There was also a negative correlation between REM sleep and originality (R=-.827; p=.042). During NREM sleep the CAP rate, which in young people reflects primarily the A1 subtype, also correlated with originality (R=.765; p=.038). NREM sleep is associated with low levels of cortical arousal, and low cortical arousal may enhance the ability of people to access to the remote associations that are critical for creative innovations. In addition, A1 CAP subtypes reflect frontal activity, and the frontal lobes are important for divergent thinking, also a critical aspect of creativity. Copyright © 2011 Elsevier B.V. All rights reserved.

  12. Major changes in microbial diversity and community composition across gut sections of a juvenile Panchlora cockroach.

    Science.gov (United States)

    Gontang, Erin A; Aylward, Frank O; Carlos, Camila; Glavina Del Rio, Tijana; Chovatia, Mansi; Fern, Alison; Lo, Chien-Chi; Malfatti, Stephanie A; Tringe, Susannah G; Currie, Cameron R; Kolter, Roberto

    2017-01-01

    Investigations of gut microbiomes have shed light on the diversity and genetic content of these communities, and helped shape our understanding of how host-associated microorganisms influence host physiology, behavior, and health. Despite the importance of gut microbes to metazoans, our understanding of the changes in diversity and composition across the alimentary tract, and the source of the resident community are limited. Here, using community metagenomics and 16S rRNA gene sequencing, we assess microbial community diversity and coding potential in the foregut, midgut, and hindgut of a juvenile Panchlora cockroach, which resides in the refuse piles of the leaf-cutter ant species Atta colombica. We found a significant shift in the microbial community structure and coding potential throughout the three gut sections of Panchlora sp., and through comparison with previously generated metagenomes of the cockroach's food source and niche, we reveal that this shift in microbial community composition is influenced by the ecosystems in which Panchlora sp. occurs. While the foregut is composed of microbes that likely originate from the symbiotic fungus gardens of the ants, the midgut and hindgut are composed of a microbial community that is likely cockroach-specific. Analogous to mammalian systems, the midgut and hindgut appear to be dominated by Firmicutes and Bacteroidetes with the capacity for polysaccharide degradation, suggesting they may assist in the degradation of dietary plant material. Our work underscores the prominence of community changes throughout gut microbiomes and highlights ecological factors that underpin the structure and function of the symbiotic microbial communities of metazoans.

  13. CARACTERIZACIÓN AGRONÓMICA DE GERMOPLASMA DE CAMOTE (Ipomoea batatas L. EN MANABÍ

    Directory of Open Access Journals (Sweden)

    Carmen Mariuxi Macías Figueroa

    2011-06-01

    Full Text Available La investigación tuvo como objetivo identificar genotipos de camote de alto rendimientos en raíces frescas y follaje. Se evaluaron 4 materiales locales y 11 introducidos del Centro Internacional de la Papa, CIP-Perú. El manejo del cultivo estuvo acorde a las recomendaciones del Programa Yuca-Camote del INIAP. Se evaluaron variables del follaje y raíces. Para el follaje fueron: numero de guías, peso a los 120 y 140 días después de la siembra y en la cosecha. En las raíces se evaluaron: numero de raíces y peso tanto en las comerciales y no comerciales, y rendimiento. Además, se identifico las principales plagas y benéficos que se presentaron en el cultivo. Los resultados de la caracterización agronómica permitieron observar gran variabilidad genética y del potencial productivo. Zapallo, Philipino y Morado-Ecuador mostraron un comportamiento de doble propósito al tener los mejores rendimientos en follaje y raíces a diferencia de Toquecita que se destaco solo en producción de raíces. Se identificaron artrópodos plagas y benéficos. Las principales especies de plagas estuvieron los de los generos : Omophoeta sp, Empoasca sp, Atta sp, Frankliniella sp, Dysdercus sp, Hedylepta sp, Aphis sp y Tetranychus sp. De los benéficos se identificaron cuatro a nivel de género y cinco a nivel de familia. La caracterización agronómica demostró la amplia variabilidad genética de los materiales en la zona en estudio identificándose cuatro materiales con potencial productivo.

  14. Major changes in microbial diversity and community composition across gut sections of a juvenile Panchlora cockroach.

    Directory of Open Access Journals (Sweden)

    Erin A Gontang

    Full Text Available Investigations of gut microbiomes have shed light on the diversity and genetic content of these communities, and helped shape our understanding of how host-associated microorganisms influence host physiology, behavior, and health. Despite the importance of gut microbes to metazoans, our understanding of the changes in diversity and composition across the alimentary tract, and the source of the resident community are limited. Here, using community metagenomics and 16S rRNA gene sequencing, we assess microbial community diversity and coding potential in the foregut, midgut, and hindgut of a juvenile Panchlora cockroach, which resides in the refuse piles of the leaf-cutter ant species Atta colombica. We found a significant shift in the microbial community structure and coding potential throughout the three gut sections of Panchlora sp., and through comparison with previously generated metagenomes of the cockroach's food source and niche, we reveal that this shift in microbial community composition is influenced by the ecosystems in which Panchlora sp. occurs. While the foregut is composed of microbes that likely originate from the symbiotic fungus gardens of the ants, the midgut and hindgut are composed of a microbial community that is likely cockroach-specific. Analogous to mammalian systems, the midgut and hindgut appear to be dominated by Firmicutes and Bacteroidetes with the capacity for polysaccharide degradation, suggesting they may assist in the degradation of dietary plant material. Our work underscores the prominence of community changes throughout gut microbiomes and highlights ecological factors that underpin the structure and function of the symbiotic microbial communities of metazoans.

  15. Characterization of N2O emissions and associated microbial communities from the ant mounds in soils of a humid tropical rainforest.

    Science.gov (United States)

    Majeed, M Z; Miambi, E; Barois, I; Bernoux, M; Brauman, A

    2017-12-19

    Tropical rainforest soils harbor a considerable diversity of soil fauna that contributes to emissions of N2O. Despite their ecological dominance, there is limited information available about the contribution of epigeal ant mounds to N2O emissions in these tropical soils. This study aimed to determine whether ant mounds contribute to local soil N emissions in the tropical humid rainforest. N2O emission was determined in vitro from individual live ants, ant-processed mound soils, and surrounding reference soils for two trophically distinct and abundant ant species: the leaf-cutting Atta mexicana and omnivorous Solenopsis geminata. The abundance of total bacteria, nitrifiers (AOA and AOB), and denitrifiers (nirK, nirS, and nosZ) was estimated in these soils using quantitative PCR, and their respective mineral N contents determined. There was negligible N2O emission detected from live ant individuals. However, the mound soils of both species emitted significantly greater (3-fold) amount of N2O than their respective surrounding reference soils. This emission increased significantly up to 6-fold in the presence of acetylene, indicating that, in addition to N2O, dinitrogen (N2) is also produced from these mound soils at an equivalent rate (N2O/N2 = 0.57). Functional gene abundance (nitrifiers and denitrifiers) and mineral N pools (ammonium and nitrate) were significantly greater in mound soils than in their respective reference soils. Furthermore, in the light of the measured parameters and their correlation trends, nitrification and denitrification appeared to represent the major N2O-producing microbial processes in ant mound soils. The ant mounds were estimated to contribute from 0.1 to 3.7% of the total N2O emissions of tropical rainforest soils.

  16. Especies de hormigas del suelo en el Parque Nacional Natural Gorgona, Pacífico Colombiano

    Directory of Open Access Journals (Sweden)

    Stephany Valdés-Rodríguez

    2014-02-01

    Full Text Available Este trabajo compila registros publicados (1991 y no publicados (2006 sobre las especies de hormigas del PNN Gorgona y aporta nuevos registros de especies recolectadas en 2010. Se recopiló información de 15 diferentes sitios de isla Gorgona (13.82km², incluyendo la pequeña isla de Gorgonilla (0.4899km². Los métodos de recolecta incluyeron trampas de caída, cebos de atún, sacos Winkler, trampas Malaise, red entomológica y captura directa. El inventario de hormigas de suelo y sotobosque resultó en 107 especies y morfoespecies, 46 géneros y 12 subfamilias. Myrmicinae reunió la mayor riqueza (37 especies seguida de Ponerinae (27 y Formicinae (12. Los géneros más ricos fueron Pachycondyla (15 especies, Camponotus (nueve y Pheidole (ocho, mientras que 30 géneros solo presentaron una especie. Doce especies fueron muy comunes: Azteca sp., Atta cephalotes, Camponotus sericeiventris, Eciton vagans, Ectatomma goninion, Gnamptogenys annulata, Odontomachus bauri, Pachycondyla bugabensis, P. harpax, P. verenae, Paraponera clavata y Wasmannia auropunctata. En comparación con otras islas neotropicales, Gorgona tiene un número sorprendentemente elevado de especies de hormigas, ninguna de ellas invasivas. Por tanto, estos resultados sugieren que, mecanismos ecológicos y procesos de recuperación natural en el ecosistema han generado disponibilidad de microhábitats permitiendo la coexistencia una gran riqueza de especies.

  17. Relationship between Workplace Incivility, Job Attitudes and Muslim Religiosity Personality among Trade Union Members

    Directory of Open Access Journals (Sweden)

    Azizan H. M.

    2016-12-01

    Full Text Available In reality, workplace incivility has its fair share of attention in organizational research dealing with its causes and effect relationships. In Islam, incivility equates the negative character (akhlak of ridiculing others. Consequently, the purpose of this study is to investigate relationship between the experience of workplace incivility and job attitudes as well as the moderating effect of Muslim religiosity personality, which is measured by Muslim Religiosity-Personality Inventory (MRPI, on the relationships. In other words, this study plans to analyze whether Muslim employees, who possess religiosity personality would be able to endure workplace incivility experiences. Basically, literature by Al-Ghazali, Al-Attas and Al-Raiya on Islamic personality serve as the main foundation of the study. In addition, the works of Baron and Neuman (1998, Andersson & Pearson (1999 and Schilpzand, et. al (2014 were reviewed and a research framework was developed. The quantitative survey consisted of five sections used to measure the experience of workplace incivility, job attitudes, religiosity personality and demographics. A sample of 163 Malaysian Muslim bank workers completed the survey. Four main variables have been analyzed and their descriptive analyses are as the following. Scores for Workplace Incivility variable (M=3.34, SD=.27; Job Satisfaction variable (M=1.79, SD=.65; Organizational Commitment variable (M=2.74, SD=.34 and Muslim Religiosity Personality (M=3.60, SD=.42. As for the Pearson’s Correlation test, the result indicates that Workplace Incivility variable has inverse correlations with both job attitude variables (Job Satisfaction, R=-.611, p=.01; Organizational Commitment, R=.731,p=.01. Meanwhile, the overall model was significant, R2 = .401, F(3, 159 = 24.06, p= .01. Tests to see if the data met the assumption of collinearity indicate that multicollinearity was not a concern (Job Satisfaction, Tolerance = .96, VIF = 1

  18. Measurements of Nucleation-Mode Particle Size Distributions in Aircraft Plumes during SULFUR 6

    Science.gov (United States)

    Brock, Charles A.; Bradford, Deborah G.

    1999-01-01

    This report summarizes the participation of the University of Denver in an airborne measurement program, SULFUR 6, which was undertaken in late September and early October of 1998 by the Deutsches Zentrum fur Luft und Raumfahrt (DLR). Scientific findings from two papers that have been published or accepted and from one manuscript that is in preparation are presented. The SULFUR 6 experiment was designed to investigate the emissions from subsonic aircraft to constrain calculations of possible atmospheric chemical and climatic effects. The University of Denver effort contributed toward the following SULFUR 6 goals: (1) To investigate the relationship between fuel sulfur content (FSC--mass of sulfur per mass of fuel) and particle number and mass emission index (El--quantity emitted per kg of fuel burned); (2) To provide upper and lower limits for the mass conversion efficiency (nu) of fuel sulfur to gaseous and particulate sulfuric acid; (3) To constrain models of volatile particle nucleation and growth by measuring the particle size distribution between 3 and 100 nm at aircraft plume ages ranging from 10(exp -1) to 10(exp 3) s; (4) To determine microphysical and optical properties and bulk chemical composition of soot particles in aircraft exhaust; and (5) To investigate the differences in particle properties between aircraft plumes in contrail and non-contrail situations. The experiment focused on emissions from the ATTAS research aircraft (a well characterized, but older technology turbojet) and from an in-service Boeing 737-300 aircraft provided by Lufthansa, with modem, high-bypass turbofan engines. Measurements were made from the DLR Dassault Falcon 900 aircraft, a modified business jet. The Atmospheric Effects of Aviation Program (AEAP) provided funding to operate an instrument, the nucleation-mode aerosol size spectrometer (N-MASS), during the SULFUR 6 campaign and to analyze the data. The N-MASS was developed at the University of Denver with the support of

  19. Image-enhanced bronchoscopic evaluation of bronchial mucosal microvasculature in COPD

    Directory of Open Access Journals (Sweden)

    Fathy EM

    2016-09-01

    Full Text Available Eman Mahmoud Fathy,1 Hanaa Shafiek,1 Tamer S Morsi,1,† Bassma El Sabaa,2 Abdelaziz Elnekidy,3 Mohamed Elhoffy,1 Mohamed Samy Atta1 1Chest Diseases Department, 2Pathology Department, 3Radiology Department, Faculty of Medicine, Alexandria University, Alexandria, Egypt †Doctor Tamer Morsi passed away on August 15, 2014 Background: Bronchial vascular remodeling is an underresearched component of airway remodeling in COPD. Image-enhanced bronchoscopy may offer a less invasive method for studying bronchial microvasculature in COPD. Objectives: To evaluate endobronchial mucosal vasculature and changes in COPD by image-enhanced i-scan3 bronchoscopy and correlate them pathologically by analyzing bronchial mucosal biopsies. Methods: This case–control study analyzed 29 COPD patients (41.4% Global initiative for chronic Obstructive Lung Disease B [GOLD B] and 58.6% GOLD D and ten healthy controls admitted at Alexandria Main University Hospital, Egypt. Combined high-definition white light bronchoscopy (HD WLB with i-scan3 was used to evaluate endobronchial mucosal microvasculature. The vascularity was graded according to the level of mucosal red discoloration (ie, endobronchial erythema from decreased discoloration to normal, mild, moderate, and severe increased red discoloration (G-1, G0, G+1, G+2, and G+3, respectively and scored by three bronchoscopists independently. Bronchial mucosal biopsies were taken for microvascular density counting using anti-CD34 antibody as angiogenesis marker. Results: Different grades of endobronchial erythema were observed across/within COPD patients using combined HD WLB + i-scan3, with significant agreement among scorers (P=0.031; median score of G+1 [G-1–G+2] being higher in GOLD D (P=0.001. Endobronchial erythema significantly correlated with COPD duration, exacerbation frequency, and body mass index (P<0.05. Angiogenesis was significantly decreased among COPD patients versus controls (10.6 [8–13.3] vs 14 [11

  20. Parallel-stranded DNA with mixed AT/GC composition: role of trans G.C base pairs in sequence dependent helical stability.

    Science.gov (United States)

    Shchyolkina, A K; Borisova, O F; Livshits, M A; Pozmogova, G E; Chernov, B K; Klement, R; Jovin, T M

    2000-08-22

    Parallel-stranded (ps) DNAs with mixed AT/GC content comprising G.C pairs in a varying sequence context have been investigated. Oligonucleotides were devised consisting of two 10-nt strands complementary either in a parallel or in an antiparallel orientation and joined via nonnucleotide linkers so as to form 10-bp ps or aps hairpins. A predominance of intramolecular hairpins over intermolecular duplexes was achieved by choice of experimental conditions and verified by fluorescence determinations yielding estimations of rotational relaxation times and fractional base pairing. A multistate mode of ps hairpin melting was revealed by temperature gradient gel electrophoresis (TGGE). The thermal stability of the ps hairpins with mixed AT/GC content depends strongly on the specific sequence in a manner peculiar to the ps double helix. The thermodynamic effects of incorporating trans G.C base pairs into an AT sequence are context-dependent: an isolated G. C base pair destabilizes the duplex whereas a block of > or =2 consecutive G.C base pairs exerts a stabilizing effect. A multistate heterogeneous zipper model for the thermal denaturation of the hairpins was derived and used in a global minimization procedure to compute the thermodynamic parameters of the ps hairpins from experimental melting data. In 0.1 M LiCl at 3 degrees C, the formation of a trans G.C pair in a GG/CC sequence context is approximately 3 kJ mol(-)(1) more favorable than the formation of a trans A.T pair in an AT/TA sequence context. However, GC/AT contacts contribute a substantial unfavorable free energy difference of approximately 2 kJ mol(-)(1). As a consequence, the base composition and fractional distribution of isolated and clustered G.C base pairs determine the overall stability of ps-DNA with mixed AT/GC sequences. Thus, the stability of ps-DNA comprising successive > or =2 G.C base pairs is greater than that of ps-DNA with an alternating AT sequence, whereas increasing the number of AT

  1. Representación odotópica de la organización glomerular del lóbulo antenal en los cuerpos fungiformes de las hormigas (Hymenoptera: Formicidae: Comparaciones entre dos especies

    Directory of Open Access Journals (Sweden)

    Germán Octavio López-Riquelme

    2014-01-01

    Full Text Available En este trabajo se ha comparado la organización de los lóbulos antenales (LAs y su representación topográfica en los cuerpos fungiformes (CFs en soldados de dos especies de hormigas, Atta mexicana y Camponotus ocreatus. La comparación morfológica sugiere que los LAs de A. mexicana podrían ser más especializados que los de C. ocreatus a expensas de capacidades más generales. En ambas especies, el LA está organizado en seis grupos de glomérulos, cada uno inervado por su propio tracto. La inervación de las neuronas de proyección (NP, las cuales conectan los LAs con los CFs a través de los tractos antenoprotocerebrales (TAP, divide el LA en dos regiones, anterior y posterior. Los cálices de los CFs tienen varias capas que reciben información olfativa segregada: NP que inervan los grupos anteriores de glomérulos envían axones a través del TAP-lateral hacia el cuerno lateral (CL y después hacia la capa interna del cáliz, mientras que las NP que inervan los grupos posteriores de glomérulos envían axones a través del TAP-medial a la capa externa del cáliz y después al CL. Estos resultados muestran que la organización del LA está representada topográficamente en los CFs formando un mapa odotópico. Las dos vías que conectan los LAs con los CFs podrían representar dos canales para el procesamiento de diferentes clases de olores o diferentes propiedades de los estímulos olfativos. Los resultados neuroanatómicos sugieren una organización funcional conservada en los himenópteros sociales.

  2. How can AN Approach to Steam BE Authentic to both Science and Art?

    Science.gov (United States)

    LaFayette, C. J.; Parke, Ph D., F. I.; Pierce, C.; Nakamura, T.

    2015-12-01

    A collaborative project engaged a team of geophysicists, engineers, entomologists, and artists to visualize tunnels and chambers of a vast, leafcutting ant colony in rural Texas. Part of the plan was to test the nature of significant outcomes in different domains and contexts. Our team used Ground Penetrating Radar to scan part of the nest, then translate the data into 3D geometry to be experienced on an immersive visualization system. This provided the ability to zoom out of and into the model. The tunnel fragment could appear like a tiny crumb floating in air, or one could move inside it to view details and tunnel architecture. Exterior and interior structure could thus be perceived in a seamless way. The system enabled a kinesthetic sense — one both saw and felt surrounded by the scene. This was the first time GPR had been used to map a living ant colony. Due to this project, entomologists have begun to use GPR with encouraging results. The Atta project inspired in us an enjoyment of experimentation and collaboration. Results were exhibited in international art venues, published in scientific journals, and demonstrated at hybrid venues for art and science. Each form of dissemination was suited to the host. Whether the result can be called art, science, or a blend is determined by its reception in a larger community. Like the species name and the pathway worn from tree to nest, the process of mapping the colony took the form of a palindrome: we pulled something out of the ground, passed it back and forth, and hoisted it out into the world. The role of art in collaboration with science can take many forms. Art can enhance science understanding for non-scientists. Artists and scientists can co-invent new tools for inquiry. Artists are adept at creating ways to experience and understand data or phenomena through multi-modal experiences, for example, aural, haptic, or olfactory. Artists are trained to foreground the process of making as part of the "performance

  3. Metodología para la evaluación del potencial insecticida de especies forestales.

    Directory of Open Access Journals (Sweden)

    Morales Soto León

    2000-06-01

    Full Text Available La diversidad florística de Colombia plantea enormes retos de investigación, con miras a una utilización racional e integral de sus recursos forestales. Las plantas con efectos biocidas utilizables en el control de plagas o enfermedades revisten una singular importancia. El objetivo de este trabajo es plantear una metodología de fácil aplicación, bajo costo y rápidos resultados, que permita acopiar la información necesaria sobre el mayor número de especies con potencial en este sentido. La metodología plantea la siguiente secuencia: selección de las especies vegetales de interés, apoyada en los reportes bibliográficos, conocimiento ancestral y observaciones personales; recolección del material en el campo; preparación del extracto total a partir del material seco; pruebas iniciales con Artemia salina Lech. para detectar actividad biológica, a través de la determinación de la LC50 (las especies con LC50 menores de 1000 ppm se consideran promisorias y ameritan procesos posteriores de fraccionamiento químico, bioensayos con las sustancias más promisorias sobre algún organismo de interés particular y determinación final de los compuestos activos en la planta. La metodología descrita fue empleada en la evaluación del potencial de acción biocida de 5 especies arbóreas o arbustivas, Guarea guidonia (L. Sleumer y Trichia hirta L. (Meliaceae, Machaerium moritzianum Benth. (Fabaceae, Swinglea glutinosa Merrill. (Rutaceae y Mammea americana L. (Clusiaceae. Se utilizó para los bioensayos iniciales el microcrustáceo Artemia salina Leach como indicador del potencial biocida con el fin de seleccionar las dos especies más promisorias a partir de las LC50 obtenidas. Con las dos se realizaron los bioensayos para evaluar la acción fagoinhibidora en la hormiga arriera Atta cephalotes (L., y el posible control de Alconeura sp. (Homoptera: Cicadellidae, insecto chupador que afecta la ceiba verde Pseudobombax septenatum (Jacq. Dugand

  4. Identification, evaluation, and application of the genomic-SSR loci in ramie

    Directory of Open Access Journals (Sweden)

    Ming-Bao Luan

    2016-09-01

    Full Text Available To provide a theoretical and practical foundation for ramie genetic analysis, simple sequence repeats (SSRs were identified in the ramie genome and employed in this study. From the 115 369 sequences of a specific-locus amplified fragment library, a type of reduced representation library obtained by high-throughput sequencing, we identified 4774 sequences containing 5064 SSR motifs. SSRs of ramie included repeat motifs with lengths of 1 to 6 nucleotides, and the abundance of each motif type varied greatly. We found that mononucleotide, dinucleotide, and trinucleotide repeat motifs were the most prevalent (95.91%. A total of 98 distinct motif types were detected in the genomic-SSRs of ramie. Of them, The A/T mononucleotide motif was the most abundant, accounting for 41.45% of motifs, followed by AT/TA, accounting for 20.30%. The number of alleles per locus in 31 polymorphic microsatellite loci ranged from 2 to 7, and observed and expected heterozygosities ranged from 0.04 to 1.00 and 0.04 to 0.83, respectively. Furthermore, molecular identity cards (IDs of the germplasms were constructed employing the ID Analysis 3.0 software. In the current study, the 26 germplasms of ramie can be distinguished by a combination of five SSR primers including Ibg5-5, Ibg3-210, Ibg1-11, Ibg6-468, and Ibg6-481. The allele polymorphisms produced by all SSR primers were used to analyze genetic relationships among the germplasms. The similarity coefficients ranged from 0.41 to 0.88. We found that these 26 germplasms were clustered into five categories using UPGMA, with poor correlation between germplasm and geographical distribution. Our study is the first large-scale SSR identification from ramie genomic sequences. We have further studied the SSR distribution pattern in the ramie genome, and proposed that it is possible to develop SSR loci from genomic data for population genetics studies, linkage mapping, quantitative trait locus mapping, cultivar fingerprinting

  5. Glycyrrhetinic acid and E.resveratroloside act as potential plant derived compounds against dopamine receptor D3 for Parkinson’s disease: a pharmacoinformatics study

    Directory of Open Access Journals (Sweden)

    Mirza MU

    2014-12-01

    Full Text Available Muhammad Usman Mirza,1 A Hammad Mirza,2 Noor-Ul-Huda Ghori,3 Saba Ferdous4 1Centre for Research in Molecular Medicine, The University of Lahore, Lahore, Pakistan; 2Department of Bioscience, COMSATS Institute of Information Technology, Sahiwal, Pakistan; 3Atta-ur-Rehman School of Applied Biosciences, National University of Science and Technology, Islamabad, Pakistan; 4Institute of Structural and Molecular Biology, University College London, UK Abstract: Parkinson’s disease (PD is caused by loss in nigrostriatal dopaminergic neurons and is ranked as the second most common neurodegenerative disorder. Dopamine receptor D3 is considered as a potential target in drug development against PD because of its lesser side effects and higher degree of neuro-protection. One of the prominent therapies currently available for PD is the use of dopamine agonists which mimic the natural action of dopamine in the brain and stimulate dopamine receptors directly. Unfortunately, use of these pharmacological therapies such as bromocriptine, apomorphine, and ropinirole provides only temporary relief of the disease symptoms and is frequently linked with insomnia, anxiety, depression, and agitation. Thus, there is a need for an alternative treatment that not only hinders neurodegeneration, but also has few or no side effects. Since the past decade, much attention has been given to exploitation of phytochemicals and their use in alternative medicine research. This is because plants are a cheap, indispensable, and never ending resource of active compounds that are beneficial against various diseases. In the current study, 40 active phytochemicals against PD were selected through literature survey. These ligands were docked with dopamine receptor D3 using AutoDock and AutoDockVina. Binding energies were compared to docking results of drugs approved by the US Food and Drug Administration against PD. The compounds were further analyzed for their absorption, distribution

  6. An overview of the Phalaenopsis orchid genome through BAC end sequence analysis

    Directory of Open Access Journals (Sweden)

    Hsiao Yu-Yun

    2011-01-01

    Full Text Available Abstract Background Phalaenopsis orchids are popular floral crops, and development of new cultivars is economically important to floricultural industries worldwide. Analysis of orchid genes could facilitate orchid improvement. Bacterial artificial chromosome (BAC end sequences (BESs can provide the first glimpses into the sequence composition of a novel genome and can yield molecular markers for use in genetic mapping and breeding. Results We used two BAC libraries (constructed using the BamHI and HindIII restriction enzymes of Phalaenopsis equestris to generate pair-end sequences from 2,920 BAC clones (71.4% and 28.6% from the BamHI and HindIII libraries, respectively, at a success rate of 95.7%. A total of 5,535 BESs were generated, representing 4.5 Mb, or about 0.3% of the Phalaenopsis genome. The trimmed sequences ranged from 123 to 1,397 base pairs (bp in size, with an average edited read length of 821 bp. When these BESs were subjected to sequence homology searches, it was found that 641 (11.6% were predicted to represent protein-encoding regions, whereas 1,272 (23.0% contained repetitive DNA. Most of the repetitive DNA sequences were gypsy- and copia-like retrotransposons (41.9% and 12.8%, respectively, whereas only 10.8% were DNA transposons. Further, 950 potential simple sequence repeats (SSRs were discovered. Dinucleotides were the most abundant repeat motifs; AT/TA dimer repeats were the most frequent SSRs, representing 253 (26.6% of all identified SSRs. Microsynteny analysis revealed that more BESs mapped to the whole-genome sequences of poplar than to those of grape or Arabidopsis, and even fewer mapped to the rice genome. This work will facilitate analysis of the Phalaenopsis genome, and will help clarify similarities and differences in genome composition between orchids and other plant species. Conclusion Using BES analysis, we obtained an overview of the Phalaenopsis genome in terms of gene abundance, the presence of repetitive

  7. Characterization and development of EST-derived SSR markers in cultivated sweetpotato (Ipomoea batatas

    Directory of Open Access Journals (Sweden)

    Li Yujun

    2011-10-01

    Full Text Available Abstract Background Currently there exists a limited availability of genetic marker resources in sweetpotato (Ipomoea batatas, which is hindering genetic research in this species. It is necessary to develop more molecular markers for potential use in sweetpotato genetic research. With the newly developed next generation sequencing technology, large amount of transcribed sequences of sweetpotato have been generated and are available for identifying SSR markers by data mining. Results In this study, we investigated 181,615 ESTs for the identification and development of SSR markers. In total, 8,294 SSRs were identified from 7,163 SSR-containing unique ESTs. On an average, one SSR was found per 7.1 kb of EST sequence with tri-nucleotide motifs (42.9% being the most abundant followed by di- (41.2%, tetra- (9.2%, penta- (3.7% and hexa-nucleotide (3.1% repeat types. The top five motifs included AG/CT (26.9%, AAG/CTT (13.5%, AT/TA (10.6%, CCG/CGG (5.8% and AAT/ATT (4.5%. After removing possible duplicate of published EST-SSRs of sweetpotato, a total of non-repeat 7,958 SSR motifs were identified. Based on these SSR-containing sequences, 1,060 pairs of high-quality SSR primers were designed and used for validation of the amplification and assessment of the polymorphism between two parents of one mapping population (E Shu 3 Hao and Guang 2k-30 and eight accessions of cultivated sweetpotatoes. The results showed that 816 primer pairs could yield reproducible and strong amplification products, of which 195 (23.9% and 342 (41.9% primer pairs exhibited polymorphism between E Shu 3 Hao and Guang 2k-30 and among the 8 cultivated sweetpotatoes, respectively. Conclusion This study gives an insight into the frequency, type and distribution of sweetpotato EST-SSRs and demonstrates successful development of EST-SSR markers in cultivated sweetpotato. These EST-SSR markers could enrich the current resource of molecular markers for the sweetpotato community and would

  8. O jardim de fungo atua como um molde para a construção das câmaras em formigas cortadeiras?

    Directory of Open Access Journals (Sweden)

    Roberto da Silva Camargo

    Full Text Available Os ninhos adultos das formigas cortadeiras (gênero Atta e Acromyrmex são compostos de milhares de câmaras subterrâneas, as quais abrigam o jardim de fungo, lixo e a população desses insetos. Entretanto, como as câmaras são construídas? Para responder essa questão, nós hipotetizamos que o jardim de fungo atua como um molde para a construção das câmaras. Assim, foram utilizadas 20 colônias de 6 meses de idade, divididas em quatro séries experimentais: padrão (quantidade normal de jardim de fungo; metade de jardim de fungo; dobro de jardim de fungo e sem jardim de fungo (Testemunha. As variáveis estudadas foram: parâmetros morfológicos das estruturas (túneis e câmara formada; fluxo das atividades das operárias; volume de solo escavado. Como se esperava, o jardim de fungo atua como um molde para a construção das câmaras em formigas cortadeiras. Os resultados foram: o tratamento sem jardim de fungo não apresentou nenhuma câmara, apenas túneis, em contraposição às demais séries experimentais que apresentaram no mínimo 2 câmaras, com dimensões similares; o fluxo das operárias carregando pellet de solo por minuto durante as 72 horas diferiu estatisticamente entre as séries experimentais e, finalmente, o volume do solo escavado foi resultado da taxa de escavação das operárias, diferindo estatisticamente entre as séries experimentais. Os resultados corroboram a hipótese de que o jardim de fungo atua como um molde para a construção da câmara. A ausência de uma estrutura funcional como uma câmara, quando o jardim de fungo está ausente, comprova a hipótese.

  9. Discovery of protein complexes with core-attachment structures from Tandem Affinity Purification (TAP) data.

    Science.gov (United States)

    Wu, Min; Li, Xiao-Li; Kwoh, Chee-Keong; Ng, See-Kiong; Wong, Limsoon

    2012-09-01

    Many cellular functions involve protein complexes that are formed by multiple interacting proteins. Tandem Affinity Purification (TAP) is a popular experimental method for detecting such multi-protein interactions. However, current computational methods that predict protein complexes from TAP data require converting the co-complex relationships in TAP data into binary interactions. The resulting pairwise protein-protein interaction (PPI) network is then mined for densely connected regions that are identified as putative protein complexes. Converting the TAP data into PPI data not only introduces errors but also loses useful information about the underlying multi-protein relationships that can be exploited to detect the internal organization (i.e., core-attachment structures) of protein complexes. In this article, we propose a method called CACHET that detects protein complexes with Core-AttaCHment structures directly from bipartitETAP data. CACHET models the TAP data as a bipartite graph in which the two vertex sets are the baits and the preys, respectively. The edges between the two vertex sets represent bait-prey relationships. CACHET first focuses on detecting high-quality protein-complex cores from the bipartite graph. To minimize the effects of false positive interactions, the bait-prey relationships are indexed with reliability scores. Only non-redundant, reliable bicliques computed from the TAP bipartite graph are regarded as protein-complex cores. CACHET constructs protein complexes by including attachment proteins into the cores. We applied CACHET on large-scale TAP datasets and found that CACHET outperformed existing methods in terms of prediction accuracy (i.e., F-measure and functional homogeneity of predicted complexes). In addition, the protein complexes predicted by CACHET are equipped with core-attachment structures that provide useful biological insights into the inherent functional organization of protein complexes. Our supplementary material can

  10. Citotossicity in immune system's cells exposed in vitro to a microwave electromagnetic field in two different exposure systems operating at mobile telephones frequencies; Citotossicita' in cellule del sistema immunitario esposte in vitro al campo elettromagnetico a microonde in due diversi sistemi espositivi operanti alle frequenze della telefonia mobile

    Energy Technology Data Exchange (ETDEWEB)

    Scarcella, E.; Ardoino, L.; Galloni, P.; Mancini, S.; Marino, C. [ENEA, Divisione Protezione dell' Uomo e degli Ecosistemi, Centro Ricerche Casaccia, Rome (Italy)

    2001-07-01

    funzionamento di cellule macrofagiche stabilizzate e coltivate in vitro (RAW 264.7) responsabili dei meccanismi di difesa specifica e aspecifica del sistema immunitario. Sono stati, inoltre, standardizzati due diversi sistemi espositivi operanti a 900 MHz a differenti livelli di densita' di potenza (da 1 a 100 W/m{sup 2}) per garantire condizioni elettromagnetiche omogenee, idonee condizioni di incubazione delle cellule e la riproducibilita' degli esperimenti. Il lavoro di standardizzazione dei sistemi espositivi e i risultati sperimentali di questa ricerca, che hanno evidenziato differenze significative della crescita e della funzionalita' macrofagica solo al livello di densita' di potenza piu' elevato (100 W/m{sup 2}), ma recuperare dopo 48 ore dall'esposizione, risultano essere preliminari e propedeutici per una programmazione sperimentale futura atta ad approfondire una valutazione bio-tossicologica in vitro.

  11. EDITORIAL: A support for prospective nanomaterials A support for prospective nanomaterials

    Science.gov (United States)

    Demming, Anna

    2011-01-01

    , often touted as a pioneer of a 'bottom-up' approach to nanotechnology, once said 'I was born not knowing and have had only a little time to change that here and there'. In a similar sense, what we do not yet know and understand about the ability to create and manipulate nanosystems is apparently infinite, but as can also be acceded in the case of Richard Feynman, the 'little' we have had time learn so far holds more than a little promise. References [1] Glass R, Möller M and Spatz J P 2003 Nanotechnology 14 314 [2] Kuzyk A, Laitinen K T and Törmä P 2009 Nanotechnology 20 235305 [3] Williams S M, Rodriguez K R, Teeters-Kennedy S, Shah S, Rogers T M, Stafford A D and Coe J V 2004 Nanotechnology 15 S495 [4] Bini T B, Gao S, Tan T C, Wang S, Lim, A, Hai L B and Ramakrishna S 2004 Nanotechnology 15 1459 [5] Yang F, Murugan R, Wang S and Ramakrishna S 2005 Biomaterials 26 2603-10 [6] Tampieri A, Landi E, Valentini F, Sandri M, D'Alessandro T, Dediu V and Marcacci M 2011 Nanotechnology 22 015104 [7] Gross A F, Ahn C C, Van Atta S L, Liu P and Vajo J J 2009 Nanotechnology 20 204005 [8] Zhang S, Gross A F, Van Atta S L, Lopez M, Liu P, Ahn C C, Vajo J J and Jensen C M 2009 Nanotechnology 20 204027

  12. Effect of dietary fiber in lowering serum glucose and body weight in sprague dawley rats

    Directory of Open Access Journals (Sweden)

    Muhammad Imran Chohan

    2011-08-01

    Full Text Available Introduction:The present study evaluated the hypoglycemic perspectives and weight loss significance of dietary fiber. Dietary fiber was supplemented in commercial wheat flour (atta for the preparation of chapaties, a staple diet of South Asia. Male Sprague Dawley rats (n = 100 were randomly divided into 4 diet groups (n = 25 per group. The control group was fed basal diet that included commercial wheat flour chapati, cornstarch, corn oil, salt and vitamin mixture in such a way that 10% of the protein was available from the final diet. To the basal diet of other 3 groups, chapaties supplemented with 2% guar gum (GG 2%, 3% guar gum (GG 3% and 5% chickpea + 1% guar gum (CP5%+GG1% were added, respectively. All diets were fed to the rats for a period of 8 weeks to perceive the impact of respective compositions. Rats fed on CP 5% + GG1%, showed maximum glucose reduction (14.57% followed by GG 3% (11.64% and GG 2% (9.60% as compared to control diet. Likewise, rats fed on 3% GG showed maximum decline (7.90% in body weight. It was concluded that chapaties prepared from selected treatments provide an additional dietary fiber that could be supportive for diabetic and obese individuals.Results:The results indicated that addition of dietary fiber influenced the physical characteristics of chapati non-significantly. Maximum glucose concentration was found to be 112.50 mg/dL in control group followed by 101.70 and 99.41 mg/dL in groups fed on guar gum 2% and guar gum 3%, respectively. Lowest glucose concentration (96.11 mg/dL was observed in rats fed on the combination of chickpea 5 %+ guar gum 1%. Maximum serum protein concentration was found to be 6.39 g/dL in rats fed on combination of chickpea 5 % + guar gum 1% whilst the remaining three groups showed non significant variations with respect to each other. Means for serum Functional Foods in Health and Disease 2011; 8:261-278 protein were 6.33, 6.30 and 6.32 g/dL for control, guar gum 3%, and guar gum 2

  13. Iš lietuvių kalbos žodžių istorijos: I. Lie. gáirė; II. Lie. tóbulas, tóbūlas

    Directory of Open Access Journals (Sweden)

    Birutė Kabašinskaitė

    2011-11-01

    ärung besteht darin, daß bei der Deutung in bewährter, herkömmlicher Weise vorgegangen und mit einer geradlinig verlaufenen Bedeutungsentwicklung gerechnet wird. Im ersten Falle könnte lit. tóbulas als Ableitung einer zu postulierenden Wurzelform *teh2-bh- ‘heranreifen’ (Erweiterung der Wurzel *teh2- aufgefaßt werden. Die Bedeutung ‘vollkommen’ wäre dann aus einem ‘zur Reife gelangt, bis zur vollen Reife und der damit verbundenen Ausbildung seiner idealen Beschaffenheit herangewachsen’ hervorgegangen. Das Material, das den Ansatz einer bisher nicht registrierten Wurzel *teh2- ‘zur Reife heranwachsen, heranreifen’ nahelegt, ist folgendes: 1. lit. atólas, lett. atāls, attals, preuß. attolis ‘Grummet’ < urbalt. *attā́la-s; nbulg. otáva, skr. òtava, russ. otáva u. a. ‘Grummet’ < urslav. *oˈtava; den baltischen und slavischen Wörtern liegen die Adjektiva *at+ˈtā́-la-s bzw. *at + ˈtā́-u̯a-s ‘wieder nachgewachsen, sich wieder erholt habend’ < ‘wieder zur Reife herangewachsen’ zugrunde; 2. gr. τα̃λις‘junges heiratsfähiges Mädchen’ < *táh2-li- und lit. talõkas ‘geschlechtsreifer junger Mann; mannbares Mädchen’ Weiterbildung von *tala- < *tǝ2-lo- ‘zur Reife herangewachsen’. Mit größeren Schwierigkeiten behaftet ist und weniger orthodox wirkt eine zweite Möglichkeit der Deutung von tóbulas. Es könnte als Zusammenrückung *tā́+būla-s ‘so (nämlich zu dem, worauf die Bezeichnung des durch das jeweilige Bezugswort zum Ausdruck gebrachten Begriffes wirklich zutrifft geworden’ = ‘die ideale Beschaffenheit des jeweiligen Begriffes erreicht habend, vollkommen’ erklärt werden. Tóbulas müßte in diesem Fall durch Suffixwechsel mit Austausch des vermeintlichen Suffixes -ūla- in analogischem Anschluß an das geläufigere -ula- aus *tābūla-s entstanden sein. Für das Verbaladjektiv *bū́-la- wäre dabei noch eine ältere, in slavisch byti neben ‘sein’ erhaltene Bedeutung

  14. Meliponini neotropicais: o gênero Partamona Schwarz, 1939 (Hymenoptera, Apidae, Apinae - bionomia e biogeografia

    Directory of Open Access Journals (Sweden)

    Camargo João M. F.

    2003-01-01

    termitaria, such as cavities and crevices in walls, among roots of epiphytes and in bases of palm leaves, in abandoned bird nests, under bridges, and in other protected places, except P. peckolti that occasionally occupies termite nests. In South America, on the eastern side of the Andes, only P. epiphytophila and P. helleri nest among roots of epiphytes and other substrates, non-associated with termitaria. All other species studied (P. batesi, P. gregaria, P. pearsoni, P. ferreirai, P. chapadicola, P. nhambiquara, P. vicina, P. mourei, P. auripennis, P. combinata, P. cupira, P. mulata, P. ailyae, P. seridoensis, P. criptica and P. rustica nest inside active termite nests, whether epigeous or arboreous. The only species that builds obligate subterranean nests, associated or not with termite or ant nests (Atta spp. is P. testacea. Nests of Partamona have one vestibular chamber (autapomorphic for the genus closely adjacent to the entrance, filled with a labyrinth of anastomosing pillars and connectives, made of earth and resins. One principal chamber exists for food and brood, but in some species one or more additional chambers are filled with food storage pots. In nests of P. vicina, there is one atrium or "false nest", between the vestibule and the brood chamber, which contains involucral sheaths, cells and empty pots. All structures of the nest are supported by permanent pillars made of earth and resins (another autapomorphy of the genus. The characters concerning nesting habits were coded and combined with morphological and biogeographic data, in order to hypothesize the evolutive scenario of the genus using cladistic methodology. The phylogenetic hypothesis presented is the following: (((((P. bilineata (P. grandipennis, P. xanthogastra (P. orizabaensis, P. peckolti (P. aequatoriana, P. musarum P. epiphytophila, P. yungarum, P. subtilis, P. vitae (((((P. testacea (P. mourei, P. vicina (P. nigrior (P. auripennis, P. combinata (P. ferreirai (P. pearsoni (P. gregaria (P

  15. MEMORIAS III Encuentro Científico de Estudiantes de Biología

    Directory of Open Access Journals (Sweden)

    Acta Biológica Colombiana

    2003-12-01

    de biomasa por una colonia de atta laevigatasmith 1958 (hymenoptera: formicidae en los Llanos Orientales (Puerto López, Meta, Colombia / Manejo ex situde crías de crocodylus intermedius(crocodylidae, una experiencia como estudiante de práctica académica / Caracterización del llamado de advertencia de colostethus bocagei(amphibia: dendrobatidae en el municipio de Ibagué, Colombia / Caracterización del llamado de advertencia de colostethus bocagei(amphibia: dendrobatidae en el municipio de Ibagué, Colombia / Uso etnomédico de algunas especies vegetales del departamento del Chocó, Colombia / Morfología y herbivoría en las especies del género tococa(melastomataceae con mirmecomacios / Fauna Asociada a la Medicina Tradicional del Departamento Del Chocó, Colombia / Hongos alucinógenos: el desconocimiento cultural de su consumo / Relación insecto-hongo: desarrollo de dípteros en panaeolus foenisecii (basidiomycotina-agariclaes / Estudio preliminar de algunos aspectos biológicos de hoplias malabaricusbloch 1794 (Quicharo en la microcuenca de Cabí, Chocó, Colomba / Composición y estructura de la vegetación terrestre aledaña al Río Gaira (Departamento Del Magdalena, Colombia / Relaciones de herbivoría por insectos sobre Lantana sp. (Verbenacea, Piper sp.(Piperaceae y Miconia sp.(Asteraceae en Moniquirá (Boyacá, Colombia.

  16. The 15th Biannual National Congress of the South African Society of Psychiatrists, 10-14 August 2008, Fancourt, George, W Cape

    Directory of Open Access Journals (Sweden)

    Eugene Allers

    2008-08-01

    and body Oye Gureje 15. Child and adolescent psychopharmacology: Current trends and complexities S M Hawkridge 16. Integrating mental illness, suicide and religion Volker Hitzeroth 17. Cost of acute inpatient mental health care in a 72-hour assessment uniy A B R Janse van Rensburg, W Jassat 18. Management of Schizophrenia according to South African standard treatment guidelines A B R Janse van Rensburg 19. Structural brain imaging in the clinical management of psychiatric illness F Y Jeenah 20. ADHD: Change in symptoms from child to adulthood S A Jeeva, A Turgay 21. HIV-Positive psychiatric patients in antiretrovirals G Jonsson, F Y Jeenah, M Y H Moosa 22. A one year review of patients admitted to tertiary HIV/Neuropsychiatry beds in the Western Cape John Joska, Paul Carey, Ian Lewis, Paul Magni, Don Wilson, Dan J Stein 23. Star'd - Critical review and treatment implications Andre Joubert 24. Options for treatment-resistent depression: Lessons from Star'd; an interactive session Andre Joubert 25. My brain made me do it: How Neuroscience may change the insanity defence Sean Kaliski 26. Child andadolescent mental health services in four African countries Sharon Kleintjies, Alan Flisher, Victoruia Campbell-Hall, Arvin Bhana, Phillippa Bird, Victor Doku, Natalie, Drew, Michelle Funk, Andrew Green, Fred Kigozi, Crick Lund, Angela Ofori-Atta, Mayeh Omar, Inge Petersen, Mental Health and Poverty Research Programme Consortium 27. Individualistic theories of risk behaviour Liezl Kramer, Volker Hitzeroth 28. Development and implementation of mental health poliy and law in South Africa: What is the impact of stigma? Ritsuko Kakuma, Sharon Kleintjes, Crick Lund, Alan J Flisher, Paula Goering, MHaPP Research Programme Consortium 29. Factors contributing to community reintegration of long-term mental health crae users of Weskoppies Hospital Carri Lewis, Christa Kruger 30. Mental health and poverty: A systematic review of the research in low- and middle-income countries Crick Lund

  17. Comunicólogo que brinca comunica mais?

    Directory of Open Access Journals (Sweden)

    Ivany Câmara Neiva

    2015-09-01

    CINECLICK (sobre filme Tarja Branca. Disponível em http://www.cineclick.com.br/tarja-branca-a-revolucao-que-faltava. Acesso em 02.08.2015. COMISSÃO DE PROFESSORES. Carta aberta ao Ministro Cid Gomes. Correio Braziliense, Brasília, 10.02.2015. p.3. CORTELLA, Mário Sérgio. Os alunos não são mais os mesmos. In Novos Paradigmas da Educação (vídeo. São Paulo: Atta Mídia e Educação, 2003. D´ÁVILA, Cristina e VEIGA, Ilma Passos Alencastro (orgs.. Didática e docência na educação superior: implicações para a formação de professores. Campinas, SP: Papirus, 2012. DUARTE, Mauricio. O básico do básico. Disponível em http://www.revistadacultura.com.br/revistadacultura/detalhe/14-09-04/A_base_do_b%C3%A1sico.aspx. Acesso em 02.08.2015. DUARTE JUNIOR, João-Francisco. O que é realidade. 10.ed., 5.reimpr. São Paulo: Brasiliense, 2004. (1ª edição: 1984. ______. O sentido dos sentidos: a educação (do sensível. Disponível em http://www.bibliotecadigital.unicamp.br/document/?code=vtls000211363. Acesso em 02.08.2015. ECO, Umberto. O nome da rosa. Rio de Janeiro: Record, 2009. FERNANDES, Florestan. As Trocinhas do Bom Retiro: contribuição ao estudo folclórico e sociológico dos grupos infantis. In: ______. Folclore e mudança social na cidade de São Paulo. 2.ed. Petrópolis/RJ: Vozes, 1979. FREIRE, Paulo. Ação Cultural para a Liberdade e Outros Escritos. São Paulo: Paz e Terra, 2011. ______. Pedagogia da Autonomia - saberes necessários à prática educativa. São Paulo: Paz e Terra, 1996. FREITAS, Fidalgo de. O esgotamento (burnout nos professores. Millenium on line n0 15. Jul. 1999. Disponível em http://www.ipv.pt/millenium/15_spec1.htm. Acesso em 02.08.2015. GOMES, Patrícia. Professor precisa abrir a cabeça, diz José Pacheco. Disponível em http://porvir.org/porpessoas/para-inovar-e-preciso-professor-abra-cabeca-diz-jose-pacheco/20120522. Acesso em 02.08.2015. GUIMARÃES, Renato S.. Como as escolas transformam crianças em adultos med

  18. MFGA-IDT2 workshop: Astrophysical and geophysical fluid mechanics: the impact of data on turbulence theories

    Science.gov (United States)

    Schertzer, D.; Falgarone, E.

    very large scale of the Universe. The presentations and the round table at the end of the workshop pointed out the following: - the necessity of this type of confrontation which makes intervene numerical simulations, laboratory experiments, phenomenology as well as a very large diversity of geophysical and astrophysical data, - presumably a relative need for new geophysical data, whereas there have been recent astrophysical experiments which yield interesting data and exciting questions; - the need to develop a closer intercomparison between various intermittency models (in particular Log-Poisson /Log Levy models). Two main questions were underlined, in particular during the round table: - the behaviour of the extremes of intermittency, in particular the question of divergence or convergence of the highest statistical moments (equivalently, do the probability distributions have algebraic or more rapid falloffs?); - the extension of scaling ranges; in other words do we need to divide geophysics and astrophysics in many small (nearly) isotropic subranges or is it sufficient to use anisotropic scaling notions over wider ranges? 4 The contributions in this special issue Recalling that some of the most useful insights into the nature of turbulence in fluids have come from observations of geophysical flows, Van Atta gives a review of the impacts of geophysical turbulence data into theories. His paper starts from Taylor's inference of the nearly isotropy of atmospheric turbulence and the corresponding elegant theoretical developments by von Karman of the theory of isotropic turbulence, up to underline the fact that the observed extremely large intermittency in geophysical turbulence also raised new fundamental questions for turbulence theory. The paper discusses the potential contribution to theoretical development from the available or currently being made geophysical turbulence measurements, as well as from some recent laboratory measurements and direct numerical

  19. MFGA-IDT2 workshop: Astrophysical and geophysical fluid mechanics: the impact of data on turbulence theories

    Directory of Open Access Journals (Sweden)

    D. Schertzer

    1996-01-01

    ... up to the very large scale of the Universe. The presentations and the round table at the end of the workshop pointed out the following: - the necessity of this type of confrontation which makes intervene numerical simulations, laboratory experiments, phenomenology as well as a very large diversity of geophysical and astrophysical data, - presumably a relative need for new geophysical data, whereas there have been recent astrophysical experiments which yield interesting data and exciting questions; - the need to develop a closer intercomparison between various intermittency models (in particular Log-Poisson /Log Levy models. Two main questions were underlined, in particular during the round table: - the behaviour of the extremes of intermittency, in particular the question of divergence or convergence of the highest statistical moments (equivalently, do the probability distributions have algebraic or more rapid falloffs?; - the extension of scaling ranges; in other words do we need to divide geophysics and astrophysics in many small (nearly isotropic subranges or is it sufficient to use anisotropic scaling notions over wider ranges? 4 The contributions in this special issue Recalling that some of the most useful insights into the nature of turbulence in fluids have come from observations of geophysical flows, Van Atta gives a review of the impacts of geophysical turbulence data into theories. His paper starts from Taylor's inference of the nearly isotropy of atmospheric turbulence and the corresponding elegant theoretical developments by von Karman of the theory of isotropic turbulence, up to underline the fact that the observed extremely large intermittency in geophysical turbulence also raised new fundamental questions for turbulence theory. The paper discusses the potential contribution to theoretical development from the available or currently being made geophysical turbulence measurements, as well as from some recent laboratory measurements and direct numerical