WorldWideScience

Sample records for atta sexdens rubropilosa

  1. POPULATION GENETICS OF Atta sexdens rubropilosa (HYMENOPTERA: FORMICIDAE

    Directory of Open Access Journals (Sweden)

    Liriana Belizário Cantagalli

    2013-01-01

    Full Text Available The genetic variability of Atta sexdens rubropilosa leaf-cutting ants collected from five brazilian localities was evaluated with PCR-RAPD technique. We used 15 primers producing 148 fragments of which 123 (83,11 % contained polymorphisms. The estimated Shannon index was 0.3836 ± 0.2335 showing that these ants possess high genetic diversity. The GST value was 0,2372 and PT = 0,184, indicating that the analyzed populations are moderately differentiated and 82 % of the variation obtained occur within populations. Although Mantel’s test had shown correlation between genetic distances and geographic was observed that Ivatuba and Itambé (33,8 km have the small geographical distance and the largest genetic distance. The lower genetic distance was estimated for Maringá and Ivatuba but this localities have a small geographic distance (42,3 km, indicating that there are no barriers for mating among reproducers in these populations. The high degree of polymorphism (83,11 % and the ability to cross among the populations in the studied regions indicate that this species of leaf-cutting ant is well adapted to the region; therefore, integrated control programs can be developed.

  2. Population genetics of Atta sexdens rubropilosa (Hymenoptera: Formicidae)

    International Nuclear Information System (INIS)

    Belizario Cantagalli, Liriana; Aparecida Mangolin, Claudete; Colla Ruvolo Takasusuki, Maria Claudia

    2013-01-01

    The genetic variability of Atta sexdens rubropilosa leaf-cutting ants collected from five Brazilian localities was evaluated with PCR-RAPD technique. we used 15 primers producing 148 fragments of which 123 (83.11 %) contained polymorphisms. the estimated Shannon index was 0.3836 ± 0.2335 showing that these ants possess high genetic diversity. the G S T value was 0.2372 and Φ p t = 0.184, indicating that the analyzed populations are moderately differentiated and 82 % of the variation obtained occur within populations. although mantel's test had shown correlation between genetic distances and geographic was observed that Ivatuba and Itambe (33.8 km) have the small geographical distance and the largest genetic distance. the lower genetic distance was estimated for Maringa and Ivatuba but this localities have a small geographic distance (42.3 km), indicating that there are no barriers for mating among reproducers in these populations. the high degree of polymorphism (83.11 %) and the ability to cross among the populations in the studied regions indicate that this species of leaf-cutting ant is well adapted to the region; therefore, integrated control programs can be developed.

  3. Microbial Communities in Different Tissues of Atta sexdens rubropilosa Leaf-cutting Ants.

    Science.gov (United States)

    Vieira, Alexsandro S; Ramalho, Manuela O; Martins, Cintia; Martins, Vanderlei G; Bueno, Odair C

    2017-10-01

    Bacterial endosymbionts are common in all insects, and symbiosis has played an integral role in ant evolution. Atta sexdens rubropilosa leaf-cutting ants cultivate their symbiotic fungus using fresh leaves. They need to defend themselves and their brood against diseases, but they also need to defend their obligate fungus gardens, their primary food source, from infection, parasitism, and usurpation by competitors. This study aimed to characterize the microbial communities in whole workers and different tissues of A. sexdens rubropilosa queens using Ion Torrent NGS. Our results showed that the microbial community in the midgut differs in abundance and diversity from the communities in the postpharyngeal gland of the queen and in whole workers. The main microbial orders in whole workers were Lactobacillales, Clostridiales, Enterobacteriales, Actinomycetales, Burkholderiales, and Bacillales. In the tissues of the queens, the main orders were Burkholderiales, Clostridiales, Syntrophobacterales, Lactobacillales, Bacillales, and Actinomycetales (midgut) and Entomoplasmatales, unclassified γ-proteobacteria, and Actinomycetales (postpharyngeal glands). The high abundance of Entomoplasmatales in the postpharyngeal glands (77%) of the queens was an unprecedented finding. We discuss the role of microbial communities in different tissues and castes. Bacteria are likely to play a role in nutrition and immune defense as well as helping antimicrobial defense in this ant species.

  4. Aflatoxins produced by Aspergillus nomius ASR3, a pathogen isolated from the leaf-cutter ant Atta sexdens rubropilosa

    Directory of Open Access Journals (Sweden)

    Eduardo Afonso da Silva-Junior

    Full Text Available ABSTRACT Aspergillus spp. cause economic impacts due to aflatoxins production. Although the toxicity of aflatoxins is already known, little information about their ecological roles is available. Here we investigated the compounds produced by Aspergillus nomius ASR3 directly from a dead leaf-cutter queen ant Atta sexdens rubropilosa and the fungal axenic culture. Chemical analyses were carried out by high-resolution mass spectrometry and tandem mass spectrometry techniques. Aflatoxins B1 and G1 were detected in both the axenic culture and in the dead leaf-cutter queen ant. The presence of these mycotoxins in the dead leaf-cutter queen ant suggests that these compounds can be related to the insect pathogenicity of A. nomius against A. sexdens rubropilosa.

  5. Preferência de saúva limão, Atta sexdens rubropilosa Forel, 1908 (Hymenoptera, formicidae a diferentes espécies florestais, em condições de laboratório

    Directory of Open Access Journals (Sweden)

    Otávio Filho Peres

    2002-01-01

    Full Text Available It was evaluated the cutting ant preference of Atta sexdens rubropilosa Forel, 1908, to native and exotic forest tree species, in laboratory conditions. The most preferred species were: gmelina ( Gmelina arborea, leucaena (Leucaena leucocephala, caesalpinia (Caesalpinia ferrea, albizzia (Albizia lebbeck and enterolobium (Enterolobium contortisiliquum and the less preferred ones were: eucalypt (Eucalyptus grandis, jequitiba (Cariniana strellensis and guazuma (Guazuma tomentosa .

  6. Características químicas do lixo de formigueiros de Atta sexdens rubropilosa (Hymenoptera: Formicidae mantidos com diferentes substratos Chemical characteristics of nest refuse of Atta sexdens rubropilosa (Hymenoptera: Formicidae reared with different substrates

    Directory of Open Access Journals (Sweden)

    Marcelo Braga Bueno Guerra

    2007-10-01

    Full Text Available As saúvas (Atta spp. estão amplamente distribuídas pelo continente Sul-Americano e são consideradas importantes componentes do ecossistema neotropical. Diversos estudos têm demonstrado o efeito de formigueiros no enriquecimento do solo e na facilitação ao estabelecimento de espécies vegetais. Possivelmente o enriquecimento do solo seja devido ao acúmulo de matéria orgânica decomposta em câmaras de descarte (lixo no interior das colônias. Entretanto, pouco se sabe sobre a composição química do lixo de formigas cortadeiras. O objetivo do presente trabalho foi comparar os teores de nutrientes do lixo produzido por colônias de Atta sexdens rubropilosa Forel (Hymenoptera: Formicidae, em laboratório, mantidas com folhas de duas espécies de plantas. Os tratamentos foram dois tipos de substrato (Acalypha sp. ou Bauhinia sp., repetidos quatro vezes. Oito colônias foram divididas em dois grupos (n = 4, e cada grupo foi mantido com apenas um tratamento. Após 30 dias de experimento, as amostras de folhas e lixo foram secas em estufa (70 ºC e submetidas à digestão ácida, para determinação das concentrações de N, P, K, S, Ca e Mg. Diferenças nas concentrações dos macronutrientes entre os tratamentos (lixo ou folha foram comparadas por meio de ANOVA e teste T. As concentrações de nutrientes no lixo foram sempre maiores do que nas folhas, independentemente da espécie cortada. Folhas de Acalypha sp. apresentaram concentrações significativamente maiores do que folhas de Bauhinia sp. com relação aos teores de P, Ca, Mg e S; entretanto, as concentrações do lixo em todos os formigueiros foram muito próximas, indicando incorporação adicional de nutrientes por meio do fungo, excreções e, ou, cadáveres no lixo. Esses resultados indicam que, independentemente do substrato cortado, o lixo produzido apresenta maiores concentrações de nutrientes do que as folhas, sendo importante locus de reciclagem de nutrientes no

  7. Determinação do fator de conversão em colônias de Atta sexdens rubropilosa (Hymenoptera: Formicidae e sua relação com a qualidade do material vegetal cortado Determination of the conversion factor in colonies of Atta sexdens rubropilosa (Hymenoptera: Formicidae and its relationship with the quality of harvested leaf substrate

    Directory of Open Access Journals (Sweden)

    Leandro Sousa-Sou

    2007-02-01

    Full Text Available As formigas cortadeiras (Atta e Acromyrmex são consideradas importantes pragas na agricultura e silvicultura, mas pouco se sabe sobre os reais danos dessas espécies. Uma forma bastante difundida de avaliação do dano é por meio do cálculo da taxa de conversão, dividindo-se o peso do material cortado pelo peso de lixo produzido pelas colônias. Foi levantada a hipótese de que a qualidade do substrato cortado pode influenciar no forrageamento das operárias, alterando a taxa de conversão e dificultando as estimativas de dano. A taxa de conversão de oito colônias de Atta sexdens rubropilosa Forel (Hymenoptera: Formicidae foi calculada com duas espécies vegetais com diferentes concentrações de lignina e celulose, para testar essa hipótese. Colônias mantidas com folhas de baixa qualidade (razão lignina/celulose elevada tiveram maior forrageamento e produziram mais lixo. Entretanto, a taxa de conversão das colônias foi semelhante com essas duas plantas (média = 1,54. Esse valor está dentro da variação encontrada para outras espécies no campo (1,5-1,8, indicando um fator semelhante de conversão entre os gêneros Atta e Acromyrmex. O consumo médio de material vegetal, em termos de pesos seco e fresco, de uma colônia de A. sexdens rubropilosa com 4.500 operárias, foi estimado em 520 e 1.100 g/ano, respectivamente.Leaf-cutting ants (Atta and Acromyrmex are important pests in agriculture and forestry, although few data exist on the actual damage caused by these species. A model used to evaluate damage by leaf-cutting ants are estimates of the conversion factor, which is the ratio between the weight of material cut by the ants and the refuse produced by the colonies. The hypothesis that substrate quality influences foraging by workers, modifying the conversion factor and impairing damage estimates was put forward. To test this hypothesis, the conversion factor was calculated for eight colonies of Atta sexdens rubropilosa Forel

  8. Preferência de saúva limão, Atta sexdens rubropilosa Forel, 1908 (Hymenoptera, formicidae a diferentes espécies florestais, em condições de laboratório.

    Directory of Open Access Journals (Sweden)

    Otávio Peres Filho

    2010-08-01

    Full Text Available Avaliou-se a preferência de saúva limão, Atta sexdens rubropilosa Forel, 1908, para 41 espécies florestais nativas e exóticas, em condições de laboratório. As espécies mais transportadas foram gmelina (Gmelina arborea, leucena (Leucaena leucocephala, pau-ferro (Caesalpinia ferrea, albizia (Albizia lebbeck e orelha-de-negro (Enterolobium contortisiliquum e as menos transportadas foram eucalipto (Eucalyptus grandis, jequitibá (Cariniana strellensis e mutamba (Guazuma tomentosa.

  9. PREFERÊNCIA DE SAÚVA LIMÃO, Atta sexdens rubropilosa Forel, 1908 (HYMENOPTERA, FORMICIDAE A DIFERENTES ESPÉCIES FLORESTAIS, EM CONDIÇÕES DE LABORATÓRIO

    Directory of Open Access Journals (Sweden)

    Otávio Peres Filho

    2002-08-01

    Full Text Available Avaliou-se a preferência de saúva limão, Atta sexdens rubropilosa Forel, 1908, para 41 espécies florestais nativas e exóticas, em condições de laboratório. As espécies mais transportadas foram gmelina (Gmelina arborea, leucena (Leucaena leucocephala, pau-ferro (Caesalpinia ferrea, albizia (Albizia lebbeck e orelha-de-negro (Enterolobium contortisiliquum e as menos transportadas foram eucalipto (Eucalyptus grandis, jequitibá (Cariniana strellensis e mutamba (Guazuma tomentosa .

  10. Determinação do território de forrageamento e avaliação do uso de micro porta-iscas para as saúvas Atta sexdens rubropilosa Forel, 1908 e Atta laevigata Fr. Smith, 1858 (Hymenoptera, Formicidae)

    OpenAIRE

    Ramos, Vânia Maria [UNESP

    2002-01-01

    O presente trabalho foi realizado em área de reflorestamento de Eucalyptus spp., localizada na Fazenda Santa Catarina, município de Botucatu, SP, com a finalidade de conhecer o território de forrageamento das saúvas Atta sexdens rubropilosa e Atta laevigata, e investigar a eficiência do método de controle dessas formigas através da aplicação de micro porta-iscas (mipis), distribuídos de forma regular em florestas implantadas com Eucalyptus spp. Utilizando-se a técnica de identificação de olhe...

  11. EFEITO DE FORMULAÇÕES GRANULADAS DE DIFERENTES PRODUTOS QUÍMICOS E À BASE DE FOLHAS E DE SEMENTES DE GERGELIM, Sesamum indicum, NO CONTROLE DE FORMIGUEIROS DE Atta sexdens rubropilosa Forel, 1908 (HYMENOPTERA: FORMICIDAE

    Directory of Open Access Journals (Sweden)

    Alberto Dorval

    2003-09-01

    Full Text Available Avaliou-se a eficiência de diferentes iscas formicidas comercializadas e de outras fabricadas artesanalmente à base de gergelim, Sesamum indicum, no controle de formigueiros de saúva-limão, Atta sexdens rubropilosa Forel, 1908. O experimento foi realizado em reflorestamento de Eucalyptus camaldulensis com dez anos de idade e dois de rebrota. Foram empregados dez tratamentos, incluindo a testemunha, tendo como ingredientes ativos: clorpirifós, sulfluramida, fipronil, farinha de folhas de gergelim (15%, farinha de sementes de gergelim (10%, 20% e 30%. A verificação da mortalidade dos formigueiros foram realizadas aos 30, 60, 90 e 150 dias após o tratamento. As iscas mais eficientes foram à base de sulfluramida e fipronil, seguida da formulação à base de farinha de folhas de gergelim (15%. As iscas à base de sulfluramida e de fipronil atingiram o controle máximo na avaliação dos 30 dias enquanto as iscas à base de folhas de gergelim (15% apresentou controle satisfatório só a partir da terceira avaliação, isto é, aos 90 dias. Contudo, os resultados obtidos com a isca à base de folhas de gergelim (15% são encorajadores, mostrando que estudos posteriores deverão ser realizados.

  12. ANÁLISE DE CRESCIMENTO, INCIDÊNCIA DE Rhizoctonia sp. E EFEITO ANTIXENOSE PARA A FORMIGA-CORTADEIRA Atta sexdens rubropilosa F. EM CLONES DE Eucalyptus grandis x Eucalyptus urophylla TRATADOS COM GIBERELINA1

    Directory of Open Access Journals (Sweden)

    Fabio Santos Matos

    2015-10-01

    Full Text Available RESUMO A competitividade do setor florestal brasileiro, fruto das condições climáticas e tecnologia empregada, faz que o país ocupe posição de destaque no cenário mundial. Apesar do elevado crescimento brasileiro no setor florestal, é necessário o desenvolvimento de pesquisas que proporcionem aumento de produtividade. Este estudo objetivou avaliar o efeito fisiológico da aplicação de diferentes concentrações de giberelina (GA3 no acúmulo de biomassa do híbrido de Eucalyptus grandis x Eucalyptus urophylla "E. urograndis GG 100" e, também, verificar o efeito da aplicação de hormônio sobre a incidência de Rhizoctonia sp. e sobre efeito antixenose (não preferência ao corte de folhas pela formiga-cortadeira Atta sexdens rubropilosa. O experimento foi conduzido em bancada a pleno sol, seguindo o delineamento inteiramente casualizado com cinco tratamentos e seis repetições. Mudas clonadas de E. urograndis GG 100, com 120 dias de idade, cultivadas sob bancada a pleno sol em vasos de 12 L, com substrato à base de subsolo, areia e esterco foram tratados com 50 mL de GA3, nas seguintes concentrações: 0; 50; 100; 150; e 200 mg L-1. Aos 40 dias após a imposição dos tratamentos, as análises foram realizadas. A aplicação de giberelina intensificou o crescimento vegetativo das plantas de eucalipto e promoveu o maior acúmulo de biomassa no mesmo período de tempo de plantas não tratadas. As mudas tratadas com giberelina apresentaram vigoroso crescimento vegetativo, principalmente na concentração de 150 mg L-1. Adicionalmente, as mesmas plantas exibiram maior preferência por formigas-cortadeiras e menor área foliar lesionada pelo fungo Rhizoctonia sp.

  13. ACTIVITY OF LEAF-CUTTING ANT Atta sexdens piriventris SUBMITED TO HIGH DILUTION HOMEOPATHIC PREPARATIONS

    Directory of Open Access Journals (Sweden)

    Alexandre Giesel

    2013-02-01

    Full Text Available The effect of high dilution preparations on the movement and foraging activities of Atta sexdens piriventris was evaluated. Five colonies of ants were located on each of the five experimental areas using a randomized complete block design. Three main forage trails from each colony were selected from where evaluations were made. Ten mL of high dilution preparation of Atta sexdens piriventris nosodes and Belladonna homeopathy solution were sprayed over 0.5 m of each selected trail, 1.0 m far from the nest. The controls were pure water and non treated trails. Applications were made daily during 10 days. The total number of ants moving on each trail one meter away from the nest, carrying or not plant fragments, were assessed before the daily application. Dilution preparations at 30CH (thirtieth centesimal Hahnemannian dilution of A. sexdens piriventris nosodes and Belladonna reduced the activities of ants from the fifth day after the first application. The treatment effect lasted more than 20 days after the last application. The use of preparation at 30CH dilution order to reduce the foraging activity of leaf-cutting ants is a potential non residual method to manage leaf-cutting ants.

  14. Queen influence on workers behavior of the leaf-cutting ant Atta sexdens rubropilosa (Forel, 1908

    Directory of Open Access Journals (Sweden)

    L. Sousa-Souto

    Full Text Available In an ant colony, the queen is the single reproducer and can interact with her workers via pheromones and cuticular compounds. However, in most species queen importance is not restricted to reproduction: in the initial development of the colony, her presence might play a more important role. In this work, we studied the effects of queen absence on workers behavior displayed in the foraging arena. Ant’s mortality and refuse accumulation was also measured daily. The results showed that queen absence did not alter either workers behavior or foraging efficiency. However, we observed increased ant mortality accompanied by a decrease in refuse dumping outside the nest. These results corroborate the hypothesis that environmental factors are more important than intrinsical factors in the allocation of external tasks. Probably, the queen could only influence internal activities of the colony.

  15. Efeito de formulações granuladas de diferentes produtos químicos e à base de folhas e de sementes de gergelim, Sesamum indicum, no controle de formigueiros de Atta sexdens...

    Directory of Open Access Journals (Sweden)

    Otávio Filho Peres

    2003-01-01

    Full Text Available Different baits insecticides commercialized and others artisanly produced with sesame, Sesamum indicum, were evaluated in the control of lemon leaf cutter anthills, Atta sexdens rubropilosa Forel, 1908. The experiment was held in one tem years old Eucalyptus camaldulensis plantation and two of sprout. It was tested ten treatments, including the standard, with the following active ingredients: chlorpyrifos, sulfluramid, fipronil, flour of sesame leaves (15%, flour of sesame seeds (10%, 20% and 30%. The mortality verification of the anthills was held at the 30, 60, 90 and 150 days after the treatment. The most efficient baits were sulfluramid and fipronil, followed by the formulation of flour of sesame leaves (15%. The baits of sulfluramid and of fipronil reached the maximum control in the evaluation of the 30th day, whereas the baits of sesame leaves (15% presented satisfactory control starting from the third evaluation at the 90th day. The results obtained with the bait of sesame leaves (15% were promising encouraging new studies to be held.

  16. Interação entre Atta sexdens e espécie arbórea Copaifera langsdorfii Desf. em remanescente florestal de cerrado

    Directory of Open Access Journals (Sweden)

    Danival José de Souza

    2014-08-01

    Full Text Available A espécie arbórea Copaifera langsdorfii Desf. é muito explorada para extração do seu óleo e para utilização em recuperação de áreas degradadas e de matas ciliares. A comunidade vegetal pode ser beneficiada pela interação entre insetos e plantas sendo a mirmecocoria – dispersão de sementes por formigas – um desses exemplos de interação. O objetivo deste trabalho foi avaliar as interações entre a espécie arbórea C. langsdorffii Desf. e a espécie de formiga Atta sexdens em área de remanescente florestal de cerrado sensu stricto. As sementes forrageadas por formigas e não forrageadas encontradas no chão foram coletadas para análise de testes de germinação e IVG (índice de velocidade de germinação. A terra solta dos ninhos de Atta sexdens também foi coletada para avaliação e comparação com locais de dispersão natural. Os resultados dos testes indicaram germinação e IVG significativamente maiores em sementes forrageadas pelas formigas Atta sexdens e os locais mais favoráveis à germinação foram longe de áreas antropogênicas ao longo das trilhas de forrageamento.

  17. Dealing with water deficit in Atta ant colonies: large ants scout for water while small ants transport it

    Directory of Open Access Journals (Sweden)

    Antonio Carlos Da-Silva

    2012-07-01

    Leafcutter ants (Atta sexdens rubropilosa (Forel 1908 have an elaborate social organization, complete with caste divisions. Activities carried out by specialist groups contribute to the overall success and survival of the colony when it is confronted with environmental challenges such as dehydration. Ants detect variations in humidity inside the nest and react by activating several types of behavior that enhance water uptake and decrease water loss, but it is not clear whether or not a single caste collects water regardless of the cost of bringing this resource back to the colony. Accordingly, we investigated water collection activities in three colonies of Atta sexdens rubropilosa experimentally exposed to water stress. Specifically, we analyzed whether or not the same ant caste foraged for water, regardless of the absolute energetic cost (distance of transporting this resource back to the colony. Our experimental design offered water sources at 0 m, 1 m and 10 m from the nest. We studied the body size of ants near the water sources from the initial offer of water (time  =  0 to 120 min, and tested for specialization. We observed a reduction in the average size and variance of ants that corroborated the specialization hypothesis. Although the temporal course of specialization changed with distance, the final outcome was similar among distances. Thus, we conclude that, for this species, a specialist (our use of the word “specialist” does not mean exclusive task force is responsible for collecting water, regardless of the cost of transporting water back to the colony.

  18. ANÁLISE DE CRESCIMENTO, INCIDÊNCIA DE Rhizoctonia sp. E EFEITO ANTIXENOSE PARA A FORMIGA-CORTADEIRA Atta sexdens rubropilosa F. EM CLONES DE Eucalyptus grandis x Eucalyptus urophylla TRATADOS COM GIBERELINA1

    OpenAIRE

    Fabio Santos Matos; Débora Zacarias da Silva; Brenda Rodrigues de Souza; Dahís Ramalho Moura; Vinícius de Araújo Lopes; Daniel Diego Costa Carvalho; Marcio da Silva Araujo

    2015-01-01

    RESUMO A competitividade do setor florestal brasileiro, fruto das condições climáticas e tecnologia empregada, faz que o país ocupe posição de destaque no cenário mundial. Apesar do elevado crescimento brasileiro no setor florestal, é necessário o desenvolvimento de pesquisas que proporcionem aumento de produtividade. Este estudo objetivou avaliar o efeito fisiológico da aplicação de diferentes concentrações de giberelina (GA3) no acúmulo de biomassa do híbrido de Eucalyptus grandis x Eucalyp...

  19. Limonoids from Cipadessa fruticosa and Cedrela fissilis and their insecticidal activity

    International Nuclear Information System (INIS)

    Leite, Ana C.; Fernandes, Joao B.; Vieira, Paulo C.; Silva, M. Fatima das G. Fernandes da; Bueno, Fabiana C.; Oliveira, Cintia G.; Bueno, Odair C.; Pagnocca, Fernando C.; Hebling, M. Jose A.; Bacci Junior, Mauricio

    2005-01-01

    The chemical investigation of the fruits of Cipadessa fruticosa (Meliaceae) afforded the new limonoid cipadesin B and the known swietemahonolide. From the roots of Cedrela fissilis (Meliaceae) were isolated the limonoid 3β-acetoxycarapin, new as natural product, along with the triterpenes oleanolic and oleanonic acid. These compounds and other six mexicanolide limonoids previously isolated from C. fruticosa showed insecticidal activity against the leaf-cutting ants Atta sexdens rubropilosa. (author)

  20. Limonoids from andiroba oil and Cedrela fissilis and their insecticidal activity

    Directory of Open Access Journals (Sweden)

    Ambrozin Alessandra R. P.

    2006-01-01

    Full Text Available Nine limonoids were isolated from Carapa guianensis and Cedrela fissilis. Among them, 1,2-dihydro-3beta-hydroxy-7-deacetoxy-7-oxogedunin is a new compound. Moreover, the assignments of some chemical shifts of xyloccensin k have been corrected and ¹H NMR data of 7-deacetylgedunin have been assigned for the first time. These isolated limonoids were assayed on Atta sexdens rubropilosa workers showing moderate insecticidal activities.

  1. Limonoids from andiroba oil and Cedrela fissilis and their insecticidal activity

    Energy Technology Data Exchange (ETDEWEB)

    Ambrozin, Alessandra R.P.; Leite, Ana C.; Vieira, Paulo C.; Fernandes, Joao B.; Silva, M. Fatima das G. Fernandes da [Sao Carlos Univ., SP (Brazil). Dept. de Quimica]. E-mail: paulo@dq.ufscar.br; Bueno, Fabiana C.; Bueno, Odair C.; Pagnocca, Fernando C.; Hebling, Jose A.; Bacci Junior, Mauricio [UNESP, Rio Claro, SP (Brazil). Centro de Estudos de Insetos Sociais

    2006-05-15

    Nine limonoids were isolated from Carapa guianensis and Cedrela fissilis. Among them, 1,2-dihydro-3{beta}-hydroxy-7-deacetoxy-7-oxogedunin is a new compound. Moreover, the assignments of some chemical shifts of xyloccensin k have been corrected and {sup 1}H NMR data of 7-deacetylgedunin have been assigned for the first time. These isolated limonoids were assayed on Atta sexdens rubropilosa workers showing moderate insecticidal activities. (author)

  2. Survey of Attini (Hymenoptera, Formicidae) in Eucalyptus plantations in the region of Paraopeba, Minas Gerais, Brasil

    OpenAIRE

    Araújo, Márcio S.; Delia Lucia, Terezinha M.C.; Mayhé-Nunes, Antonio J.

    1997-01-01

    This Work was conducted in Eucalyptus stands at the Itapoã farm of the Mannesmann Fi-El Florestal Ltda. in Paraopeba, MG. The species of fungus growing-ants and leaf-cutting ants found in regrowth areas and in harvesting phase plantings were: Acromyrmex balzani Emery, 1890; Acromyrmex laticeps nigrosetosus Forel 1908; Acromyrmex subterraneus subterraneus Forel, 1893; Atta laevigala (F. Smith, 1858); Alta sexdens rubropilosa Forel, 1908; Mycocepurus goeldii Forel, 1893; Sericomyrmex sp.; Trach...

  3. Comparative physical mapping of 18S rDNA in the karyotypes of six leafcutter ant species of the genera Atta and Acromyrmex (Formicidae: Myrmicinae).

    Science.gov (United States)

    Teixeira, Gisele Amaro; Barros, Luísa Antônia Campos; de Aguiar, Hilton Jeferson Alves Cardoso; das Graças Pompolo, Silvia

    2017-10-01

    Leafcutter ants of the Atta and Acromyrmex genera are important plagues in different cultures. Cytogenetic data on chromosome number, morphology, and chromosomal banding pattern are only available for 17 species of leafcutter ants. Molecular cytogenetic data for the detection of ribosomal genes by the FISH technique are scarce, and only 15 Neotropical ant species have been studied. This study aimed to physically map the 18S ribosomal RNA genes (rDNA) of six leafcutter ants belonging to the genera Atta and Acromyrmex using FISH. The results were compared with data on the fluorochrome CMA 3 currently available for these species. All analyzed species presented the 18S rDNA on one pair of chromosomes. In Acromyrmex subterraneus molestans and Ac. aspersus, FISH signals were observed in the terminal region of the short arm of the largest subtelocentric pair, while in Atta bisphaerica, A. laevigata, and A. sexdens, FISH signals were observed in the interstitial region of the long arm of the fourth metacentric pair. In Acromyrmex striatus, 18S rDNA was located in the interstitial region of the second metacentric pair. The karyotypic formula for Ac. aspersus was 2n = 38 (8m + 10sm + 16st + 4a), representing the first report in this species. The observed 18S rDNA regions in A. laevigata, A. sexdens, A. bisphaerica, Ac. aspersus, and Ac. subterraneus molestans corresponded to the CMA 3 + bands, while in Ac. striatus, several GC-rich bands and one pair of 18S rDNA bands were observed. No differential bands were visible using the DAPI fluorochrome. Karyotype uniformity with previously studied Atta spp. was also observed at the level of molecular cytogenetics using 18S rDNA FISH. A difference in the size of the chromosomal pair carrying the 18S rDNA gene was observed in Ac. striatus (2n = 22) and Atta spp. (2n = 22) highlighting the dissimilarity between these species. The results from the present study contribute to the description of 18S rDNA clusters

  4. Cryptococcus haglerorum, sp. nov., an anamorphic basidiomycetous yeast isolated from nests of the leaf-cutting ant Atta sexdens.

    NARCIS (Netherlands)

    Middelhoven, W.J.; Fonseca, A.; Carreiro, S.C.; Pagnocca, F.C.; Bueno, O.C.

    2003-01-01

    A yeast strain (CBS 8902) was isolated from the nest of a leaf-cutting ant and was shown to be related to Cryptococcus humicola. Sequencing of the D1/D2 region of the 26S ribosomal DNA and physiological characterization revealed a separate taxonomic position. A novel species named Cryptococcus

  5. Are workers of Atta leafcutter ants capable of reproduction?

    DEFF Research Database (Denmark)

    Dijkstra, Michiel Bendert; Boomsma, Jacobus Jan

    2006-01-01

    ovaries. Workers of Atta leafcutter ants only lay trophic eggs in queenright colonies. Although Atta colonies are commonly kept at universities, museums, and zoos, no reports of worker sons in orphaned colonies exist, suggesting that Atta workers are infertile. To explicitly test this, we created eleven...

  6. Square Van Atta reflector with conducting mounting flame

    DEFF Research Database (Denmark)

    Nielsen, Erik Dragø

    1970-01-01

    A theoretical and numerical analysis of square Van Atta reflectors has been carried out with or without a conducting plate, used for mounting of the antenna elements. The Van Atta reflector investigated has antenna elements which are parallel half-wave dipoles interconnected in pairs by transmiss......A theoretical and numerical analysis of square Van Atta reflectors has been carried out with or without a conducting plate, used for mounting of the antenna elements. The Van Atta reflector investigated has antenna elements which are parallel half-wave dipoles interconnected in pairs...

  7. Activities of extracts and compounds from Spiranthera odoratissima St. Hil. (Rutaceae) in leaf-cutting ants and their symbiotic fungus

    Energy Technology Data Exchange (ETDEWEB)

    Terezan, Ana Paula; Fernandes, Joao B.; Silva, M. Fatima das Gracas Fernandes da; Vieira, Paulo C. [Universidade Federal de Sao Carlos (UFSCAR), Sao Carlos, SP (Brazil). Dept. de Quimica; Rossi, Raquel Andrade; Almeida, Roberta N.A.; Freitas, Tais Garcia; Bueno, Odair C.; Pagnocca, Fernando C. [Universidade Estadual Paulista (UNESP), Rio Claro, SP (Brazil). Centro de Estudos de Insetos Sociais; Pirani, Jose R., E-mail: djbf@power.ufscar.b [Universidade de Sao Paulo (USP), SP (Brazil). Inst. de Biociencias. Dept. de Botanica

    2010-07-01

    The study of the Spiranthera odoratissima St. Hil (Rutaceae) branches extracts led to the isolation of the furoquinoline (dictamine, gamma-fagarine and skimmianine) and 2-arylquinoli-4-one (1-methyl-2-phenylquinoline-4-one) alkaloids and limonoids (limonexic acid and limonin). The compounds 1-methyl-2-phenylquinoline-4-one and limonexic acid were isolated for the first time from the Spiranthera. These furoquinoline and 2-arylquinoli-4-one alkaloids and limonoids showed insecticidal and/or fungicidal activity in the nest of the Atta sexdens rubropilosa. (author)

  8. Isolation of xanthyletin, an inhibitor of ants' symbiotic fungus, by high-speed counter-current chromatography.

    Science.gov (United States)

    Cazal, Cristiane de Melo; Domingues, Vanessa de Cássia; Batalhão, Jaqueline Raquel; Bueno, Odair Corrêa; Filho, Edson Rodrigues; da Silva, Maria Fátima G Fernandes; Vieira, Paulo Cezar; Fernandes, João Batista

    2009-05-08

    Xanthyletin, an inhibitor of symbiotic fungus (Leucoagaricus gongylophorus) of leaf-cutting ant (Atta sexdens rubropilosa), as well as suberosin, seselin and xanthoxyletin were isolated from Citrus sinensis grafted on Citrus limonia. A two-phase solvent system composed of hexane/ethanol/acetonitrile/water (10:8:1:1, v/v) was used for the high-speed counter-current chromatographic isolation of xanthyletin with high yield and over 99% purity as determined by liquid and gas chromatography with mass spectrometry detection. Identifications were performed by UV spectra, IR spectra, (1)H NMR and (13)C NMR.

  9. Professor Atta invited to attend WSIS as `eminent scientist'

    CERN Multimedia

    2003-01-01

    Ministry of Science and Technology Prof. Atta-ur-Rahman has been nominated as an "eminent scientist" to attend the roundtables during "World Summit on the Information Society (WSIS)" on December 12 (1 paragraph).

  10. A Van Atta reflector consisting of half-wave dipoles

    DEFF Research Database (Denmark)

    Appel-Hansen, Jørgen

    1966-01-01

    The reradiation pattern of a passive Van Atta reflector consisting of half-wave dipoles is investigated. The character of the reradiation pattern first is deduced by qualitative and physical considerations. Various types of array elements are considered and several geometrical configurations...... of these elements are outlined. Following this, an analysis is made of the reradiation pattern of a linear Van Atta array consisting of four equispaced half-wave dipoles. The general form of the reradiation pattern is studied analytically. The influence of scattering and coupling is determined and the dependence...

  11. Essential Oils of Hyptis pectinata Chemotypes: Isolation, Binary Mixtures and Acute Toxicity on Leaf-Cutting Ants.

    Science.gov (United States)

    Feitosa-Alcantara, Rosana B; Bacci, Leandro; Blank, Arie F; Alves, Péricles B; Silva, Indira Morgana de A; Soares, Caroline A; Sampaio, Taís S; Nogueira, Paulo Cesar de L; Arrigoni-Blank, Maria de Fátima

    2017-04-12

    Leaf-cutting ants are pests of great economic importance due to the damage they cause to agricultural and forest crops. The use of organosynthetic insecticides is the main form of control of these insects. In order to develop safer technology, the objective of this work was to evaluate the formicidal activity of the essential oils of two Hyptis pectinata genotypes (chemotypes) and their major compounds on the leaf-cutting ants Acromyrmex balzani Emery and Atta sexdens rubropilosa Forel. Bioassays of exposure pathways (contact and fumigation) and binary mixtures of the major compounds were performed. The major compounds identified in the essential oils of H. pectinata were β-caryophyllene, caryophyllene oxide and calamusenone. The essential oils of H. pectinata were toxic to the ants in both exposure pathways. Essential oils were more toxic than their major compounds alone. The chemotype calamusenone was more toxic to A. balzani in both exposure pathways. A. sexdens rubropilosa was more susceptible to the essential oil of the chemotype β-caryophyllene in both exposure pathways. In general, the binary mixtures of the major compounds resulted in additive effect of toxicity. The essential oils of H. pectinata is a raw material of great potential for the development of new insecticides.

  12. Evaluation of the Toxicity of Virola sebifera Crude Extracts, Fractions and Isolated Compounds on the Nest of Leaf-Cutting Ants

    Directory of Open Access Journals (Sweden)

    Keylla Utherdyany Bicalho

    2012-01-01

    Full Text Available The phytochemical study of Virola sebifera leaves led to the isolation of three lignans: (+-sesamin, (−-hinokinin, and (−-kusunokinin and three flavonoids: quercetin-3-O-α-L-rhamnoside, quercetin-3-O-β-D-glucoside, and quercetin-3-methoxy-7-O-β-D-glucoside by using techniques as high-speed counter-current chromatography and high-performance liquid chromatography. The crude extracts, fractions, and isolated compounds were evaluated for their insecticidal and fungicidal potential against Atta sexdens rubropilosa and its symbiotic fungus Leucoagaricus gongylophorus. The bioassay results showed a high insecticidal activity for the methanol crude extract of the leaves of V. sebifera and its n-hexane, dichloromethane and ethyl acetate fractions. The fungicidal bioassay revealed high toxicity of the lignans against L. gongylophorus.

  13. Cytogenetic data on the threatened leafcutter ant Atta robusta Borgmeier, 1939 (Formicidae: Myrmicinae: Attini).

    Science.gov (United States)

    Barros, Luísa Antônia Campos; Aguiar, Hilton Jeferson Alves Cardoso de; Teixeira, Gisele Amaro; Mariano, Cléa Dos Santos Ferreira; Teixeira, Marcos da Cunha; Delabie, Jacques Hubert Charles; Pompolo, Silvia das Graças

    2015-10-01

    The karyotype of the threatened ant species Atta robusta is described so as to establish the evolutionary relationships of this taxon with other leafcutter ants. Standard Giemsa staining, C-banding, NOR banding, fluorochromes CMA3/DAPI, Hsc-FA technique and Fluorescence in situ Hybridization (FISH) using 18S rDNA probe were conducted on a population from Aracruz, state of Espírito Santo, Brazil, allowing for comparisons with data available on Atta and other fungus-growing ant species. The diploid chromosome number observed for A. robusta was 2n=22, and the karyotypic formula was 18m+2sm+2st. Heterochromatic blocks were observed in the centromeric region of most chromosomes, where one pair of metacentric chromosomes is characterized by a GC-rich heterochromatic band in the interstitial region of its long arm. The detection of 18S rDNA using FISH confirmed the presence of single NOR for A. robusta. This is the first report of rDNA 18S detection using FISH for leafcutter ants. The cytogenetic results of this study confirm the information available for Atta and allow us to confirm the conserved chromosome number, morphology and banding pattern within the genus for the taxa studied to date, which included species from three out of the four groups of Atta indicated by molecular data. The accumulation of cytogenetic data on fungus-growing ants enhances the understanding of the genomic evolutionary patterns of Atta, since it belongs to a group of recent origin between the most well studied ants. Cytogenetic data does not indicate restrictions in relocation or reintroduction in areas where populations were extinct due to the conserved karyotype. This study allows for cytogenetic comparison of A. robusta with other ants of Atta, emphasizing the importance of chromosomal information for species conservation. Copyright © 2015 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  14. Variation in male body size and reproductive allocation in the leafcutter ant Atta colombica

    DEFF Research Database (Denmark)

    Stürup, M.; den Boer, S. P. A.; Nash, David Richard

    2011-01-01

    species. In 2008 and 2009, we revisited a Panamanian population of Atta colombica leafcutter ants to partially repeat and complement a study of more than 15 years ago. We compared within- and between-colony variation in male body size (mass and width of head, mesosoma and gaster) and sperm characteristics...

  15. The Hymenopterous Poison Apparatus. X. Morphological and Behavioral Changes in Atta texana (Hymenoptera: Formicidae)

    Science.gov (United States)

    Henry R. Hermann; John C. Moser; Allen N. Hunt

    1970-01-01

    Atta texana (Buckley) and other members of this genus no longer utilize the 8th and 9th gonapophyses as part of their defensive system. Although the sclerites that comprise the stinging apparatus in most aculeate Hymenoptera are present in the species, they seem to function only in the deposition of trail pheromones. A mechanical and chemical defense...

  16. Seminal fluid enhances sperm viability in the leafcutter ant Atta colombica

    DEFF Research Database (Denmark)

    Den Boer, Susanne Petronella A; Boomsma, Jacobus Jan; Baer, Boris

    2008-01-01

    The seminal fluid that accompanies sperm in ejaculates has been shown or suggested to affect sperm competition and paternity success of insects by preventing female remating, inducing oviposition, and forming mating plugs. In Atta leafcutter ants, queens have multiple mates but never remate later...

  17. ATTA-3: a State-of-the-Art Instrument for Radio-Krypton Dating

    Science.gov (United States)

    Jiang, W.; Zappala, J. C.; Bailey, K.; Lu, Z.; Müller, P.; O'Connor, T. P.

    2013-12-01

    The ATTA-3 instrument at Argonne has recently enabled routine Kr-81 dating. The instrument is based on Atom Trap Trace Analysis (ATTA), a novel laser based atom counting technique that allows detection of long lived noble gas radioisotopes (Kr-81, Kr-85 and Ar-39) with extremely low abundance (1E-16 to 1E-10). At the center of the instrument is a magneto-optical trap (MOT), which traps and counts only the atoms of the desired isotope. This unique feature makes ATTA free of interference from any other isotopes or molecular species. For Kr-81 dating in the age range of 150 - 1,500 kyr, the required sample size is 5 - 10 micro-L STP of krypton gas, which can be extracted from approximately 100 - 200 kg of water or 40 - 80 kg of ice. Several recent developments in our lab may lead to further improvements to the current ATTA-3 apparatus: 1) The isotopic abundance ratio between the unknown, rare isotope (either Kr-81 or Kr-85) and the stable, abundant isotope (Kr-83) is measured. Here the stable isotope serves as a control isotope. A new method has been developed that allows more accurate measurements of the control isotope Kr-83. Combined with the ability to measure the rare Kr-81 and Kr-85 isotopes, this scheme allows ATTA-3 to directly determine 81Kr/Kr and 85Kr/Kr ratios without other supplemental measurements, to reduce the overall uncertainties of the measured isotope ratios, and also to improve the long term stability of the system. 2) The current capacity of the ATTA-3 instrument is about 120 samples per year. The throughput is mainly limited by the so called 'memory effect', which is caused by the residual samples trapped in the system after each measurement. These residual samples are gradually released in subsequent measurements, causing cross-sample contaminations. In order to mitigate this problem, we wash the system with a xenon discharge for about 36 hours between measurements. This practice limits the overall sample processing speed. Preliminary

  18. Influências de Atta spp. (Hymenoptera: Formicidae na recuperação da vegetação pós-fogo em floresta de transição amazônica Influences of leafcutter ant Atta spp. (Hymenoptera: Formicidae on vegetation recovery after fire in Amazonian transitional forest

    Directory of Open Access Journals (Sweden)

    Karine Santana Carvalho

    2012-03-01

    Full Text Available Este estudo investigou o papel das saúvas na recuperação da vegetação pós-fogo. Foi hipotetizado que a perturbação do fogo aumenta a abundância de ninhos de saúva (1 e as atividades de remoção de sementes (2 e desfolha (3, especialmente no ambiente de borda. Os ninhos de saúva foram inventariados e mapeados e após 17 meses, checados para o registro de sua atividade e de novas colônias emergindo na área. Realizou-se experimentos comparativos de remoção de sementes e desfolha de plântulas em duas parcelas de 50 ha, uma submetida a fogo anual (tratamento e outra sem fogo (controle. A abundância de ninhos de saúva foi maior na parcela tratamento que na parcela controle, especialmente na borda da floresta. As espécies encontradas foram: Atta cephalotes, A. laevigata e A. sexdens , sendo esta última a espécie mais abundante e que mostrou aumento em número de colônias ativas após 17 meses. O aumento na abundância de ninhos na parcela tratamento foi acompanhado por um aumento na atividade dessas formigas. Enquanto mais de duas folhas foram arrancadas por plântula nessa parcela, menos de uma foi registrada na parcela controle. Também a abundância média de galhos desfolhados e de sementes removidas por saúvas foi maior na parcela tratamento que na parcela controle. As saúvas tanto podem diminuir ou retardar o processo de regeneração florestal pós-fogo, quanto acelerá-lo, devido à elevada predação seletiva que favorece as espécies menos palatáveis. Desta forma, suas atividades podem modificador apenas a composição da vegetação recuperando-se do fogo.In this study we investigated the role of leaf-cutting ants in the post-fire vegetation recovery. We hypothesized that a forest plot submitted to annual fire presents: (1 higher abundance of leaf-cutting ant nests; (2 higher removal of seeds; and (3 higher herbivory rates of leaf-cutting ants, when compared to the forest plots without fire (control. The leaf

  19. Diversity and transmission of gut bacteria in Atta and Acromyrmex leaf-cutting ants during development

    DEFF Research Database (Denmark)

    Zhukova, Mariya; Sapountzis, Panagiotis; Schiøtt, Morten

    2017-01-01

    . To elucidate the extent to which metamorphosis interrupts associations between bacteria and hosts, we analyzed changes in gut microbiota during development and traced the transmission routes of dominant symbionts from the egg to adult stage in the leaf-cutting ants Acromyrmex echinatior and Atta cephalotes...... was the absolute dominant bacterial species across developmental stages in Acromyrmex and we confirmed that Atta lacks Wolbachia also in the immature stages, and had mostly Mollicutes bacteria in the adult worker guts. Wolbachia in Acromyrmex appeared to be transovarially transmitted similar to transmission...... in solitary insects. In contrast, Mollicutes were socially transmitted from old workers to newly emerged callows. We found that larval and pupal guts of both ant species contained Pseudomonas and Enterobacter bacteria that are also found in fungus gardens, but hardly or not in adult workers, suggesting...

  20. An Exploration of Naquib Al-Attas' Theory of Islamic Education as "Ta'Dib" as an 'Indigenous' Educational Philosophy

    Science.gov (United States)

    Ahmed, Farah

    2018-01-01

    This paper explores the 'indigenous' philosophy of education of Syed Muhammad Naquib al-Attas, a Malay-Muslim scholar who's theoretical work culminated in the establishment of a counter-colonial higher education institution. Through presenting al-Attas' life and philosophy and by exploring the arguments of his critics, I aim to shed light on the…

  1. Two castes sizes of leafcutter ants in task partitioning in foraging activity

    Directory of Open Access Journals (Sweden)

    Marcelo Arruda de Toledo

    Full Text Available ABSTRACT: Task partitioning in eusocial animals is most likely an evolutionary adaptation that optimizes the efficiency of the colony to grow and reproduce. It was investigated indirect task partitioning in two castes sizes; this involves task partitioning in which the material transported is not transferred directly from one individual to another, but where it is dropped by one ant to be picked up by another. In two separate approaches, it was confirmed previous results pertaining to leaf caching activities among Atta colombica with task partitioning activities involving leaf dropping among Atta sexdens rubropilosa , in which there is a correlation between the size of an individual ant and the leaf fragment it transports. It was also suggested that this correlation exists only in individual ants that cut and transport (CaT the same fragment to the nest. When task partitioning occurs and individual ants transporting (T leaf fragments cut by other ants, the correlation becomes looser or disappears. We also observed that CaT ants are smaller than T ants.

  2. Avaliação de sauveiros externos em eucaliptais de Minas Gerais

    Directory of Open Access Journals (Sweden)

    Iris Cristiane Magistrali

    2011-06-01

    Full Text Available Existe uma grande dificuldade em aperfeiçoar as técnicas de manejo de formigas cortadeiras, sobretudo no que diz respeito aos sauveiros externos localizados próximos a plantios florestais. Por causa disso, o presente trabalho teve por objetivo caracterizar aspectos como tamanho e distância de sauveiros externos em plantações de eucaliptos. A avaliação foi realizada em aceiros externos de três fazendas localizadas nos municípios de João Pinheiro e Buritizeiro, em Minas Gerais, seis meses após ser realizado o combate convencional às formigas cortadeiras. Foram encontrados nove sauveiros externos, com área média de terra solta de 62,5 ± 11,1 m2, localizados a uma distância média de 33,94 ± 8,68 metros entre a margem do plantio e o local do formigueiro. Constatou-se que tais características podem ser úteis no ajuste da largura da faixa de segurança de combate, a qual deve ser igual a 50 m. O gênero Trachymyrmex e as espécies Atta laevigata e Atta sexdens rubropilosa foram registrados como ocorrências novas no município de Buritizeiro, e o gênero Acromyrmex como uma nova ocorrência nos dois municípios.

  3. Levantamento de Attini (Hymenoptera, Formicidae em povoamento de Eucalyptus na região de Paraopeba, Minas Gerais, Brasil Survey of Attini (Hymenoptera, Formicidae in Eucalyptus plantations in the region of Paraopeba, Minas Gerais, Brasil

    Directory of Open Access Journals (Sweden)

    Márcio S. Araújo

    1997-01-01

    Full Text Available This Work was conducted in Eucalyptus stands at the Itapoã farm of the Mannesmann Fi-El Florestal Ltda. in Paraopeba, MG. The species of fungus growing-ants and leaf-cutting ants found in regrowth areas and in harvesting phase plantings were: Acromyrmex balzani Emery, 1890; Acromyrmex laticeps nigrosetosus Forel 1908; Acromyrmex subterraneus subterraneus Forel, 1893; Atta laevigala (F. Smith, 1858; Alta sexdens rubropilosa Forel, 1908; Mycocepurus goeldii Forel, 1893; Sericomyrmex sp.; Trachymyrmex fuscus Emery, 1894 and three morphospecies of Trachymyrmex Forel, 1893. Taxa belonging to the genus Atta Fabricius, 1804 represented 39.14 and 41.22% of the total number of nests found in the regrowth area and in the harvesting phase plantings, respectively. For Acromyrmex Mayr, 1865 these values were 14.34 and 13.16%; for Trachymyrmex, 40.59 and 30.89%; for Mycocepurus Forel, 1893, 5.34 and 12.50% and Sericomyrmex Mayr, 1865, 0.59 and 2.23% in the regrowth area and in the harvesting phase plantations, respectively.

  4. Mating biology of the leaf-cutting ants Atta colombica and A. cephalotes

    DEFF Research Database (Denmark)

    Baer, Boris; Boomsma, Jacobus J

    2006-01-01

    Copulation behavior has often been shaped by sexually selected sperm competition or cryptic female choice. However, manipulation of previously deposited ejaculates is unknown in the social Hymenoptera and the degree to which sperm competes after insemination or is actively selected by females has...... impossible, so we had to reconstruct the sequential copulation events by morphological analysis of the male and female genitalia and by tracking the process of sperm transfer and sperm storage. We show that Atta male genitalia have two external rows of spiny teeth, which fit into a specialized pouch organ...

  5. Atividade inseticida de Eugenia uniflora L. e Melia azedarach L. sobre Atta laevigata Smith

    Directory of Open Access Journals (Sweden)

    Paulo Henrique Jung

    Full Text Available As formigas cortadeiras estão entre os principais insetos pragas das florestas plantadas brasileiras, causando danos econômicos desde a implantação até a sua colheita. Em razão das questões ambientais e da exigência da certificação florestal, métodos alternativos estão sendo desenvolvidos para o controle do gênero Atta. Neste sentido, o objetivo deste trabalho foi avaliar a atividade inseticida de pitangueira (Eugenia uniflora L. e cinamomo (Melia azedarach L. sobre soldados de Atta laevigatta Smith. Para tal, a partir de folhas, foram obtidos extratos pelos processos de decocção, infusão, maceração, extrato alcoólico e extração de óleo essencial, em diferentes concentrações. O óleo essencial de E. uniflora, nas concentrações de 1,25, 2,5 e 5%, apresentou potencial inseticida sobre soldados de A. laevigata, quando comparado às demais formas de obtenção. O extrato alcoólico de M. azedarach, a 10%, também apresentou potencial inseticida, podendo estes extratos serem testados em práticas de campo.

  6. Fungus gardens of the leafcutter ant Atta colombica function as egg nurseries for the snake Leptodeira annulata

    DEFF Research Database (Denmark)

    Baer, Boris; Den Boer, Susanne Petronella A; Kronauer, Daniel

    2009-01-01

    by ant soldiers and that also newly hatched snakes manage to avoid ant attacks when they leaving their host colony. We speculate that L. annulata might use Atta and Acromyrmex leafcutter ant colonies as egg nurseries by some form of chemical insignificance, but more work is needed to understand...

  7. Self-restraint and sterility in workers of Acromyrmex and Atta leafcutter ants

    DEFF Research Database (Denmark)

    Dijkstra, Michiel Bendert; Nash, David Richard; Boomsma, Jacobus Jan

    2005-01-01

    Queens of leafcutter ants (Acromyrmex and Atta) are highly multiply mated, resulting in a potential queenworker and worker-worker conflict over who should produce the males in the colony. We studied whether this conflict is expressed, by determining the amount of reproductive egg-laying by worker...

  8. Preparation of water and ice samples for 39Ar dating by atom trap trace analysis (ATTA)

    Science.gov (United States)

    Schwefel, R.; Reichel, T.; Aeschbach-Hertig, W.; Wagenbach, D.

    2012-04-01

    Atom trap trace analysis (ATTA) is a new and promising method to measure very rare noble gas radioisotopes in the environment. The applicability of this method for the dating of very old groundwater with 81Kr has already been demonstrated [1]. Recent developments now show its feasibility also for the analysis of 39Ar [2,3], which is an ideal dating tracer for the age range between 50 and 1000 years. This range is of interest in the fields of hydro(geo)logy, oceanography, and glaciology. We present preparation (gas extraction and Ar separation) methods for groundwater and ice samples for later analysis by the ATTA technique. For groundwater, the sample size is less of a limitation than for applications in oceanography or glaciology. Large samples are furthermore needed to enable a comparison with the classical method of 39Ar detection by low-level counting. Therefore, a system was built that enables gas extraction from several thousand liters of water using membrane contactors. This system provides degassing efficiencies greater than 80 % and has successfully been tested in the field. Gas samples are further processed to separate a pure Ar fraction by a gas-chromatographic method based on Li-LSX zeolite as selective adsorber material at very low temperatures. The gas separation achieved by this system is controlled by a quadrupole mass spectrometer. It has successfully been tested and used on real samples. The separation efficiency was found to be strongly temperature dependent in the range of -118 to -130 °C. Since ATTA should enable the analysis of 39Ar on samples of less than 1 ccSTP of Ar (corresponding to about 100 ml of air, 2.5 l of water or 1 kg of ice), a method to separate Ar from small amounts of gas was developed. Titanium sponge was found to absorb 60 ccSTP of reactive gases per g of the getter material with reasonably high absorption rates at high operating temperatures (~ 800 ° C). Good separation (higher than 92 % Ar content in residual gas) was

  9. Parasitoids of the endangered leafcutter ant Atta robusta Borgmeier in urban and natural areas

    Directory of Open Access Journals (Sweden)

    Diego S. Gomes

    2013-09-01

    Full Text Available Parasitoids of the endangered leafcutter ant Atta robusta Borgmeier in urban and natural areas. Hosts of parasitoids in urban areas may suffer from a double threat of habitat destruction by urbanization and parasitism pressure. Moreover, the parasitoids themselves might be at risk if they are specialists. Here, we studied whether Atta robusta (Hymenoptera, Formicidae, which is on the red list of Brazilian threatened species, suffers from higher parasitism pressure in an urban area compared to a natural one. In addition, we determined whether their specialist parasitoids, Eibesfeldtphora breviloba and Myrmosicarius exrobusta (Diptera, Phoridae, are in risk and evaluated whether they are influenced by habitat structure, temperature, humidity, ant traffic, and time of the day. The study was carried out in an urban park and in a natural protected area in the city of Rio de Janeiro. In each site we chose an open area and a closed area (forest and sampled nine nests in each area. We found that parasitism pressure was similar in urban and natural areas, with the same two parasitoid species present in both areas. The main difference was related to habitat structure, since M. exrobusta was mainly present in open areas while E. breviloba was almost exclusively found in closed areas. Myrmosicarius exrobusta was not present during the hottest midday times, and its abundance was negatively correlated to vapor pressure deficit. These results suggest that green areas can be an important component in efforts to conserve diversity in urban areas. However, the complexity of the habitats in those areas is a fundamental issue in designing urban parks.

  10. Internalisasi Konsep Ta’dîb Al-Attas dalam Pengembangan Karakter Peserta Didik

    Directory of Open Access Journals (Sweden)

    M. Arfan Mu’ammar

    2013-11-01

    Full Text Available The ‘character building’ topic starts as the top topics in discussion latterly. Various training holds sporadically for the executives, teachers, and employer’s company in outbound form or workshop. Those activities are good definitely, but it’s not enough to build a character. We have to combine our efforts systematically and integrated, so the character building as we want can be effective, learnable and known by the others. That’s all because the intellectualities and cognitive capability cannot guarantee for someone to be able to erase his mentality of corruption, collusion and nepotism, etc. In the other side, awkward’s morality can override the student’s intellectualities. Al-Attas as a Muslim scholar, offers a concept of Ta’dib that has been offered and nominated in the first time at the First Islamic Conference at Mecca in 1977. Al-Attas has a notion that everyone who learned is good man and the term ‘good’ here is a behavior that includes of someone’s spiritual life and material, who try to implants kindliness that he accepted it. The good man is a human being who has characters and polite. The internalization concept of Ta’dib inside of Character building is a requirement than we need, especially this times that we have to face some thoughtfulness phenomena’s degradation of moral. This Ta’dib concept leads someone to be able to put something in its place. So, we can create some condition which the structuralist’s fungsional called as well regulated society. If this society does not reflects the well regulate society, then this society still uncultured.

  11. Diversity of Fungi Associated with Atta bisphaerica (Hymenoptera: Formicidae: The Activity of Aspergillus ochraceus and Beauveria bassiana

    Directory of Open Access Journals (Sweden)

    Myriam M. R. Ribeiro

    2012-01-01

    Full Text Available The grass-cutting ant Atta bisphaerica is one of the most serious pests in several pastures and crops in Brazil. Fungal diseases are a constant threat to these large societies composed of millions of closely related individuals. We investigated the occurrence of filamentous fungi associated with the ant A. bisphaerica in a pasture area of Viçosa, Minas Gerais State, Brazil. Several fungi species were isolated from forager ants, and two of them, known as entomopathogenic, Beauveria bassiana and Aspergillus ochraceus, were tested against worker ants in the laboratory. The two species were highly virulent, achieving 50 percent worker mortality within 4-5 days. It is the first time A. ochraceus, a commonly found fungal species, is reported to infect Atta species at a high prevalence. Possible uses for the fungus within biological control are discussed.

  12. Expressed sequence tags from Atta laevigata and identification of candidate genes for the control of pest leaf-cutting ants.

    Science.gov (United States)

    Rodovalho, Cynara M; Ferro, Milene; Fonseca, Fernando Pp; Antonio, Erik A; Guilherme, Ivan R; Henrique-Silva, Flávio; Bacci, Maurício

    2011-06-17

    Leafcutters are the highest evolved within Neotropical ants in the tribe Attini and model systems for studying caste formation, labor division and symbiosis with microorganisms. Some species of leafcutters are agricultural pests controlled by chemicals which affect other animals and accumulate in the environment. Aiming to provide genetic basis for the study of leafcutters and for the development of more specific and environmentally friendly methods for the control of pest leafcutters, we generated expressed sequence tag data from Atta laevigata, one of the pest ants with broad geographic distribution in South America. The analysis of the expressed sequence tags allowed us to characterize 2,006 unique sequences in Atta laevigata. Sixteen of these genes had a high number of transcripts and are likely positively selected for high level of gene expression, being responsible for three basic biological functions: energy conservation through redox reactions in mitochondria; cytoskeleton and muscle structuring; regulation of gene expression and metabolism. Based on leafcutters lifestyle and reports of genes involved in key processes of other social insects, we identified 146 sequences potential targets for controlling pest leafcutters. The targets are responsible for antixenobiosis, development and longevity, immunity, resistance to pathogens, pheromone function, cell signaling, behavior, polysaccharide metabolism and arginine kynase activity. The generation and analysis of expressed sequence tags from Atta laevigata have provided important genetic basis for future studies on the biology of leaf-cutting ants and may contribute to the development of a more specific and environmentally friendly method for the control of agricultural pest leafcutters.

  13. Wind-induced ventilation of the giant nests of the leaf-cutting ant Atta vollenweideri

    Science.gov (United States)

    Kleineidam, Christoph; Ernst, Roman; Roces, Flavio

    2001-06-01

    To understand the significance of elaborate nest architecture for the control of nest climate, we investigated the mechanisms governing nest ventilation in a large field nest of Atta vollenweideri. Surface wind, drawing air from the central tunnels of the nest mound, was observed to be the main driving force for nest ventilation during summer. This mechanism of wind-induced ventilation has so far not been described for social insect colonies. Thermal convection, another possible force driving ventilation, contributed very little. According to their predominant airflow direction, two functionally distinct tunnel groups were identified: outflow tunnels in the upper, central region, and inflow tunnels in the lower, peripheral region of the nest mound. The function of the tunnels was independent of wind direction. Outflow of air through the central tunnels was followed by a delayed inflow through the peripheral tunnels. Leaf-cutting ants design the tunnel openings on the top of the nest with turrets which may reinforce wind-induced nest ventilation.

  14. Vegetation Changes in a Native Forest Produced by Atta vollenweideri Forel 1893 (Hymenoptera: Formicidae) Nests.

    Science.gov (United States)

    Sabattini, J A; Sabattini, R A; Cian, J C; Sabattini, I A

    2018-02-01

    Herbivory is an important factor to generate spatial mosaics with variations in a plant community composition and organization. The objective of this work was to determine the impact of Atta vollenweideri Forel 1893 nests on herbaceous and shrub vegetation in a degraded native forest of the Espinal ecoregion. The study was carried out in the Protected Area and Multiple Use Nature Reserve called Estancia "El Carayá" (Entre Ríos, Argentina). Ten A. vollenweideri nests were selected by simple random sampling through internal roads, and two transects were drawn from the center of the nest (0 m) up to 60 m away in opposite directions. The line intercept method was used to quantify the percentage of vegetation cover of herbaceous and shrub species, while the floristic composition was estimated by the Canfield method. Afterwards, a nonparametric test between positions and a conglomerate analysis to evaluated distance were applied. Grass species, legumes, and sedges fell in the adjacent areas to nests, highlighting the bare soil at the crest and base of the nests. Fifteen plant species were identified, and two families correspond to monocotyledonous and dicotyledonous species. In conclusion, the nests of A. vollenweideri affect the community of herbaceous and shrub vegetation of the studied degraded native forest of the Espinal ecoregion since these ants perform a high selection of herbaceous species considered as pioneers of plant successions.

  15. Hormigas zompopas (Atta cephalotes influyen positivamente en la biodiversidad vegetal de bosques húmedos tropicales

    Directory of Open Access Journals (Sweden)

    Javier Ruiz

    2010-08-01

    Full Text Available REALIZAMOS OBSERVACIONES DE LA HISTORIA NATURAL DE LA HORMIGA ZOMPOPA (Atta cephalotes en el período de 1995 a 2010. Monitoreamos una población de hormigas zompopas en 2003 y realizamos experimentos de campo en 2006 en el bosque húmedo tropical de la Estación Biológica La Unión en Nicaragua. Los nidos de hormiga zompopa fueron mapeados dentro de una parcela permanente de 6.5 hectáreas. Se estimó lacomposición de especies vegetales en el área del nido de la hormiga, y se realizó un conteo de plántulas dicotiledóneas y plántulas de palmas (monocotiledóneas. Los resultados indican que las hormigas zompopas prefieren defoliar plántulas de especies dicotiledóneas,favoreciendo la regeneración de palmas sobre el nido de las hormigas. Las zompopas favorecen la regeneración de palmas en áreas donde ellas establecen el montículo principal de sus nidos. En el artículo se discuten las implicaciones de estos resultados para la dinámicade la regeneración en bosques húmedos tropicales.

  16. Effect of the presence of brood and fungus on the nest architecture and digging activity of Acromyrmex subterraneus Forel (Hymenoptera, Formicidae

    Directory of Open Access Journals (Sweden)

    Carlos Magno dos Santos

    Full Text Available ABSTRACT This study investigated the stimuli that trigger digging behavior in Acromyrmex subterraneus during nest building. The hypothesis was that the presence of the fungus garden and/or brood triggers the excavation of tunnels and chambers. For the experiment, the excavation rate of individually marked workers kept in plastic cylinders filled with soil was recorded. Four treatments were applied: (1 30 medium-sized workers, 5 g fungus garden and 30 brood items (larvae and pupae; (2 30 medium-sized workers and 5 g fungus garden; (3 30 medium-sized workers and 30 brood items; (4 30 medium-sized workers without fungus and brood. After 24 h, morphological parameters of nest structure (length and width of the chambers and tunnels in cm and the volume of excavated soil were recorded. In contrast to the expected findings, no change in morphological structure, rate of excavation by workers, or volume of excavated soil was observed between treatments, except for tunnel width, which was greater, when no brood or fungus garden was present. Thus, the results do not support the hypothesis that the fungus garden and/or brood are local stimuli for nest excavation or that they mold the internal architecture of the nest. Although this hypothesis was confirmed for Acromyrmex lundii and Atta sexdens rubropilosa, the same does not apply to A. subterraneus. The digging behavior of workers is probably the result of adaptation during nest building in different habitats.

  17. Nest Digging by Leaf-Cutting Ants: Effect of Group Size and Functional Structures

    Directory of Open Access Journals (Sweden)

    Roberto da Silva Camargo

    2012-01-01

    Full Text Available Leaf-cutting ant workers dig underground chambers, for housing their symbiotic fungus, interconnected by a vast quantity of tunnels whose function is to permit the entrance of food (leaves, gaseous exchanges, and movement of workers, offspring, and the queen. Digging is a task executed by a group of workers, but little is known about the group effect and group-constructed functional structures. Thus, we analyzed the structures formed by worker groups (5, 10, 20, and 40 individuals of the leaf-cutting ant, Atta sexdens rubropilosa, for 2 days of excavation. The digging arena was the same for the 4 groups, with each group corresponding to a different density. Our results verified a pattern of tunneling by the workers, but no chamber was constructed. The group effect is well known, since the 40-worker group dug significantly more than the groups of 5, 10, and 20. These groups did not differ statistically from each other. Analysis of load/worker verified that workers of the smallest group carried the greatest load. Our paper demonstrates the group effect on the digging of nests, namely, that excavation is proportional to group size, but without emergence of a functional structure such as a chamber.

  18. Expressed sequence tags from Atta laevigata and identification of candidate genes for the control of pest leaf-cutting ants

    Directory of Open Access Journals (Sweden)

    Henrique-Silva Flávio

    2011-06-01

    Full Text Available Abstract Background Leafcutters are the highest evolved within Neotropical ants in the tribe Attini and model systems for studying caste formation, labor division and symbiosis with microorganisms. Some species of leafcutters are agricultural pests controlled by chemicals which affect other animals and accumulate in the environment. Aiming to provide genetic basis for the study of leafcutters and for the development of more specific and environmentally friendly methods for the control of pest leafcutters, we generated expressed sequence tag data from Atta laevigata, one of the pest ants with broad geographic distribution in South America. Results The analysis of the expressed sequence tags allowed us to characterize 2,006 unique sequences in Atta laevigata. Sixteen of these genes had a high number of transcripts and are likely positively selected for high level of gene expression, being responsible for three basic biological functions: energy conservation through redox reactions in mitochondria; cytoskeleton and muscle structuring; regulation of gene expression and metabolism. Based on leafcutters lifestyle and reports of genes involved in key processes of other social insects, we identified 146 sequences potential targets for controlling pest leafcutters. The targets are responsible for antixenobiosis, development and longevity, immunity, resistance to pathogens, pheromone function, cell signaling, behavior, polysaccharide metabolism and arginine kynase activity. Conclusion The generation and analysis of expressed sequence tags from Atta laevigata have provided important genetic basis for future studies on the biology of leaf-cutting ants and may contribute to the development of a more specific and environmentally friendly method for the control of agricultural pest leafcutters.

  19. Association between Pseudonocardia symbionts and Atta leaf-cutting ants suggested by improved isolation methods

    DEFF Research Database (Denmark)

    Marsh, Sarah E.; Poulsen, Michael; Gorosito, Norma B.

    2013-01-01

    Fungus-growing ants associate with multiple symbiotic microbes, including Actinobacteria for production of antibiotics. The best studied of these bacteria are within the genus Pseudonocardia, which in most fungus-growing ants are conspicuously visible on the external cuticle of workers. However......, given that fungus-growing ants in the genus Atta do not carry visible Actinobacteria on their cuticle, it is unclear if this genus engages in the symbiosis with Pseudonocardia. Here we explore whether improving culturing techniques can allow for successful isolation of Pseudonocardia from Atta...

  20. Effect of Tithonia diversifolia mulch on Atta cephalotes (Hymenoptera: Formicidae) nests.

    Science.gov (United States)

    Rodríguez, Jonathan; Montoya-Lerma, James; Calle, Zoraida

    2015-01-01

    Recent studies have shown an insecticidal effect of Tithonia diversifolia (Hemsl.) Gray (Asterales: Asteraceae) foliage on workers of Atta cephalotes L. and inhibitory effects of this plant on the growth of the symbiotic fungus Leucoagaricus gongylophorus (A. Müler) Singer. To evaluate the potential of T. diversifolia as a biological control treatment of this important pest, we assessed the effect of green manure (mulch) of this plant on natural nests of A. cephalotes, in Cali, Colombia. Three treatments were randomly assigned to 30 nests: 1) green mulch of T. diversifolia, 2) green mulch of Miconia sp., Ruiz & Pav. and 3) unmulched control. Every 2 wk for 6 mo, the surface of the nests was completely covered with leaves. Physical and chemical parameters of nest soil were assessed before the first and after the last application of the mulch. Ant foraging in T. diversifolia-treated nests decreased by 60% after the initial applications of the mulch, while nest surface area decreased by 40%. When the nests covered with T. diversifolia were opened, it was observed that the superficial fungus chambers had been relocated at a greater depth. In addition, microbial activity and soil pH increased by 84% and 12%, respectively, in nests covered with plant residues. In conclusion, the continued use of T. diversifolia mulch reduces foraging activity and negatively affects the internal conditions of the colonies, thereby inducing the ants to relocate the fungus chambers within the nests. © The Author 2015. Published by Oxford University Press on behalf of the Entomological Society of America.

  1. A new genus and species of Macrochelidae (Acari:Mesostigmata) associated with the Texas leaf cutting ant, Atta texana (Buckley) in Louisiana, USA

    Science.gov (United States)

    Gerald W. Krantz; John Moser

    2012-01-01

    Adults and nymphs of a new genus and species of the family Macrochelidae are described from detritus cavities of the leaf-cutting ant, Atta texana. This new species is notable in having peritremes with no posterior loop, a series of small subterminal teeth on the fixed cheliceral digit rather than the single large tooth typical of other macrochelids...

  2. Chemical and behavioural studies of the trail-following pheromone in the leaf-cutting ant Atta opaciceps, Borgmeier (Hymenoptera: Formicidae)

    Czech Academy of Sciences Publication Activity Database

    Campos, R. S.; Mendonca, A. L.; Cabral Jr, C. R.; Vaníčková, Lucie; do Nascimento, R. R.

    2016-01-01

    Roč. 86, Mar (2016), s. 25-31 ISSN 0022-1910 Institutional support: RVO:61388963 Keywords : venom gland * trail pheromone * two-dimensional gas chromatography * leaf-cutting ants Atta sp. Subject RIV: ED - Physiology Impact factor: 2.227, year: 2016

  3. Eficiência de produtos termonebulígenos no controle de Atta laevigata (Hymenoptera: Formicidae em plantio de eucalipto Efficiency of products for thermonebulization on the control of Atta laevigata (Hymenoptera: Formicidae in eucalypus plantations

    Directory of Open Access Journals (Sweden)

    Ronald Zanetti

    2008-08-01

    Full Text Available Avaliou-se a eficiência de produtos termonebulígenos, a base de clorpirifós ou de extratos vegetais, comparativamente ao uso de isca formicida, a base de sulfluramida, no controle de Atta laevigata (F. Smith, 1858 (Hymenoptera: Formicidae. Foi avaliada a percentagem de paralisação das atividades de corte de folhas e de movimentação de formigas de A. laevigata aos três, 12, 36, 63 e 86 dias após a aplicação dos tratamentos. Na última avaliação, os formigueiros foram abertos para a verificação da eficiência de controle. Todos os produtos testados apresentaram alta percentagem de paralisação das atividades de corte e de movimentação das formigas aos três e 12 dias após a aplicação, respectivamente. Os produtos a base de clorpirifós e um a base de extratos vegetais apresentaram alta eficiência no controle de A. laevigata, sendo mais efetivos que a isca formicida testada.The efficiency of products formulated with chlorpyrifos or plants extracts in thermonebuzation was evaluated and compared to the use of the granulated bait formulated with sulfluramid in the control of Atta laevigata (F. Smith, 1858 (Hymenoptera: Formicidae. The cutting activity and the movement of ants on the colonies were evaluated at three, 12, 36, 63 and 86 days after the application of the treatments. The colonies of these ants were excavated in the last evaluation to obtain the efficiency of each product. All products stopped the cutting activity and movements of the individuals of A. laevigata three and 12 days after their application, respectively. Products formulated with chlorpyrifos and one with plant extracts were more efficient than granulated bait.

  4. Random sperm use and genetic effects on worker caste fate in Atta colombica leaf-cutting ants

    DEFF Research Database (Denmark)

    Holman, Luke; Stürup, Marlene; Trontti, Kalevi

    2011-01-01

    Sperm competition can produce fascinating adaptations with far-reaching evolutionary consequences. Social taxa make particularly interesting models, because the outcome of sexual selection determines the genetic composition of groups, with attendant sociobiological consequences. Here, we use...... molecular tools to uncover some of the mechanisms and consequences of sperm competition in the leaf-cutting ant Atta colombica, a species with extreme worker size polymorphism. Competitive PCR allowed quantification of the relative numbers of sperm stored by queens from different males, and offspring...... genotyping revealed how sperm number translated into paternity of eggs and adult workers. We demonstrate that fertilization success is directly related to sperm numbers, that stored sperm are well-mixed and that egg paternity is constant over time. Moreover, worker size was found to have a considerable...

  5. Genetic diversity and structure of Atta robusta (Hymenoptera, Formicidae, Attini), an endangered species endemic to the restinga ecoregion.

    Science.gov (United States)

    Dos Reis, Evelyze Pinheiro; Fernandes Salomão, Tânia Maria; de Oliveira Campos, Lucio Antonio; Tavares, Mara Garcia

    2014-09-01

    The genetic diversity and structure of the ant Atta robusta were assessed by ISSR (inter-simple sequence repeats) in 72 colonies collected from 10 localities in the Brazilian states of Espírito Santo (48 colonies) and Rio de Janeiro (24 colonies). The ISSR pattern included 67 bands, 51 of them (76.1%) polymorphic. Analysis of molecular variance (AMOVA) revealed a high level (57.4%) of inter-population variation, which suggested a high degree of genetic structure that was confirmed by UPGMA (unweighted pair-group method using an arithmetic average) cluster analysis. The significant correlation between genetic and geographic distances (r = 0.64, p < 0.05) indicated isolation that reflected the distance between locations. Overall, the populations were found to be genetically divergent. This finding indicates the need for management plans to preserve and reduce the risk of extinction of A. robusta.

  6. Rapid shifts in Atta cephalotes fungus-garden enzyme activity after a change in fungal substrate (Attini, Formicidae)

    DEFF Research Database (Denmark)

    Kooij, P W; Schiøtt, M; Boomsma, J J

    2011-01-01

    Fungus gardens of the basidiomycete Leucocoprinus gongylophorus sustain large colonies of leaf-cutting ants by degrading the plant material collected by the ants. Recent studies have shown that enzyme activity in these gardens is primarily targeted toward starch, proteins and the pectin matrix......, we measured the changes in enzyme activity after a controlled shift in fungal substrate offered to six laboratory colonies of Atta cephalotes. An ant diet consisting exclusively of grains of parboiled rice rapidly increased the activity of endo-proteinases and some of the pectinases attacking...... from the rice diet, relative to the leaf diet controls. Enzyme activity in the older, bottom sections of fungus gardens decreased, indicating a faster processing of the rice substrate compared to the leaf diet. These results suggest that leaf-cutting ant fungus gardens can rapidly adjust enzyme...

  7. Genetic diversity and structure of Atta robusta (Hymenoptera, Formicidae, Attini), an endangered species endemic to the restinga ecoregion

    Science.gov (United States)

    dos Reis, Evelyze Pinheiro; Fernandes Salomão, Tânia Maria; de Oliveira Campos, Lucio Antonio; Tavares, Mara Garcia

    2014-01-01

    The genetic diversity and structure of the ant Atta robusta were assessed by ISSR (inter-simple sequence repeats) in 72 colonies collected from 10 localities in the Brazilian states of Espírito Santo (48 colonies) and Rio de Janeiro (24 colonies). The ISSR pattern included 67 bands, 51 of them (76.1%) polymorphic. Analysis of molecular variance (AMOVA) revealed a high level (57.4%) of inter-population variation, which suggested a high degree of genetic structure that was confirmed by UPGMA (unweighted pair-group method using an arithmetic average) cluster analysis. The significant correlation between genetic and geographic distances (r = 0.64, p < 0.05) indicated isolation that reflected the distance between locations. Overall, the populations were found to be genetically divergent. This finding indicates the need for management plans to preserve and reduce the risk of extinction of A. robusta. PMID:25249782

  8. Fungal communities in gardens of the leafcutter ant Atta cephalotes in forest and cabruca agrosystems of southern Bahia State (Brazil).

    Science.gov (United States)

    Reis, Bárbara Monique Dos Santos; Silva, Aline; Alvarez, Martín Roberto; Oliveira, Tássio Brito de; Rodrigues, Andre

    2015-12-01

    Leaf-cutting ants interact with several fungi in addition to the fungal symbiont they cultivate for food. Here, we assessed alien fungal communities in colonies of Atta cephalotes. Fungus garden fragments were sampled from colonies in the Atlantic Rainforest and in a cabruca agrosystem in the state of Bahia (Brazil) in two distinct periods to evaluate whether differences in nest habitat influence the diversity of fungi in the ant colonies. We recovered a total of 403 alien fungi isolates from 628 garden fragments. The prevalent taxa found in these samples were Escovopsis sp. (26 %), Escovopsioides nivea (24 %), and Trichoderma spirale (10.9 %). Fungal diversity was similar between the colonies sampled in both areas suggesting that ants focus on reducing loads of alien fungi in the fungus gardens instead of avoiding specific fungi. However, fungal taxa composition differed between colonies sampled in the two areas and between the sampling periods. These differences are likely explained by the availability of plant substrates available for foraging over habitats and periods. Ordination analysis further supported that sampling period was the main attribute for community structuring but also revealed that additional factors may explain the structuring of fungal communities in colonies of A. cephalotes. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  9. Characterization of the mandible Atta laevigata and the bioinspiration for the development of a biomimetic surgical clamp

    Energy Technology Data Exchange (ETDEWEB)

    Brito, Thays Obando; Elzubair, Amal; Araújo, Leonardo Sales; Camargo, Sergio Alvaro de Souza; Almeida, Luiz Henrique, E-mail: thaysdesigner@hotmail.com [Coordenacao de Pos-Graduacao e Pesquisa de Engenharia (PEMM/COPPE/UFRJ), Rio de Janeiro, RJ (Brazil). Programa de Engenharia Metalúrgica e de Materiais; Souza, Jorge Luiz Pereira [Instituto Nacional de Pesquisas da Amazônia, Manaus, AM (Brazil)

    2017-11-15

    Approximately thousand years ago it was reported the use of mandibles of ants for suture. In this sense, bioinspired components, as absorbable surgical clamps, can be designed. This study is aimed to characterize the mandible of the ant Atta laevigata in order to help the selection of candidate biomaterials for application as surgical clamps. Three pairs of mandibles were used and ten nanoindenations were performed in each pair. The average hardness for the samples in the internal and external regions were 0.36 ± 0.06 GPa and 0.19 ± 0.04 GPa, respectively and the average elastic modulus for the internal and external regions were 6.16 ± 0.23 GPa and 2.74 ± 0.44 GPa, respectively. The morphology of the mandible was observed in detail by scanning electron microscopy, as well as Energy-dispersive X-ray spectroscopy. The average roughnesses on the internal and external regions, measured by atomic force microscopy, were 6.73 ± 0.90 nm and 11.87 ± 1.42 nm, respectively. From these results, it was possible to identify biomaterials that mimic the mandible behaviour for surgical clamp. (author)

  10. The genome sequence of the leaf-cutter ant Atta cephalotes reveals insights into its obligate symbiotic lifestyle.

    Directory of Open Access Journals (Sweden)

    Garret Suen

    2011-02-01

    Full Text Available Leaf-cutter ants are one of the most important herbivorous insects in the Neotropics, harvesting vast quantities of fresh leaf material. The ants use leaves to cultivate a fungus that serves as the colony's primary food source. This obligate ant-fungus mutualism is one of the few occurrences of farming by non-humans and likely facilitated the formation of their massive colonies. Mature leaf-cutter ant colonies contain millions of workers ranging in size from small garden tenders to large soldiers, resulting in one of the most complex polymorphic caste systems within ants. To begin uncovering the genomic underpinnings of this system, we sequenced the genome of Atta cephalotes using 454 pyrosequencing. One prediction from this ant's lifestyle is that it has undergone genetic modifications that reflect its obligate dependence on the fungus for nutrients. Analysis of this genome sequence is consistent with this hypothesis, as we find evidence for reductions in genes related to nutrient acquisition. These include extensive reductions in serine proteases (which are likely unnecessary because proteolysis is not a primary mechanism used to process nutrients obtained from the fungus, a loss of genes involved in arginine biosynthesis (suggesting that this amino acid is obtained from the fungus, and the absence of a hexamerin (which sequesters amino acids during larval development in other insects. Following recent reports of genome sequences from other insects that engage in symbioses with beneficial microbes, the A. cephalotes genome provides new insights into the symbiotic lifestyle of this ant and advances our understanding of host-microbe symbioses.

  11. The Genome Sequence of the Leaf-Cutter Ant Atta cephalotes Reveals Insights into Its Obligate Symbiotic Lifestyle

    Science.gov (United States)

    Suen, Garret; Holt, Carson; Abouheif, Ehab; Bornberg-Bauer, Erich; Bouffard, Pascal; Caldera, Eric J.; Cash, Elizabeth; Cavanaugh, Amy; Denas, Olgert; Elhaik, Eran; Favé, Marie-Julie; Gadau, Jürgen; Gibson, Joshua D.; Graur, Dan; Grubbs, Kirk J.; Hagen, Darren E.; Harkins, Timothy T.; Helmkampf, Martin; Hu, Hao; Johnson, Brian R.; Kim, Jay; Marsh, Sarah E.; Moeller, Joseph A.; Muñoz-Torres, Mónica C.; Murphy, Marguerite C.; Naughton, Meredith C.; Nigam, Surabhi; Overson, Rick; Rajakumar, Rajendhran; Reese, Justin T.; Scott, Jarrod J.; Smith, Chris R.; Tao, Shu; Tsutsui, Neil D.; Viljakainen, Lumi; Wissler, Lothar; Yandell, Mark D.; Zimmer, Fabian; Taylor, James; Slater, Steven C.; Clifton, Sandra W.; Warren, Wesley C.; Elsik, Christine G.; Smith, Christopher D.; Weinstock, George M.; Gerardo, Nicole M.; Currie, Cameron R.

    2011-01-01

    Leaf-cutter ants are one of the most important herbivorous insects in the Neotropics, harvesting vast quantities of fresh leaf material. The ants use leaves to cultivate a fungus that serves as the colony's primary food source. This obligate ant-fungus mutualism is one of the few occurrences of farming by non-humans and likely facilitated the formation of their massive colonies. Mature leaf-cutter ant colonies contain millions of workers ranging in size from small garden tenders to large soldiers, resulting in one of the most complex polymorphic caste systems within ants. To begin uncovering the genomic underpinnings of this system, we sequenced the genome of Atta cephalotes using 454 pyrosequencing. One prediction from this ant's lifestyle is that it has undergone genetic modifications that reflect its obligate dependence on the fungus for nutrients. Analysis of this genome sequence is consistent with this hypothesis, as we find evidence for reductions in genes related to nutrient acquisition. These include extensive reductions in serine proteases (which are likely unnecessary because proteolysis is not a primary mechanism used to process nutrients obtained from the fungus), a loss of genes involved in arginine biosynthesis (suggesting that this amino acid is obtained from the fungus), and the absence of a hexamerin (which sequesters amino acids during larval development in other insects). Following recent reports of genome sequences from other insects that engage in symbioses with beneficial microbes, the A. cephalotes genome provides new insights into the symbiotic lifestyle of this ant and advances our understanding of host–microbe symbioses. PMID:21347285

  12. Magnetic anisotropy and organization of nanoparticles in heads and antennae of neotropical leaf-cutter ants, Atta colombica

    International Nuclear Information System (INIS)

    Alves, Odivaldo C; Srygley, Robert B; Riveros, Andre J; Barbosa, Marcia A; Esquivel, Darci M S; Wajnberg, Eliane

    2014-01-01

    Oriented magnetic nanoparticles have been suggested as a good candidate for a magnetic sensor in ants. Behavioural evidence for a magnetic compass in neotropical leaf-cutter ants, Atta colombica (Formicidae: Attini), motivated a study of the arrangement of magnetic particles in the ants’ four major body parts by measuring the angular dependence of the ferromagnetic resonance spectra at room temperature. Spectra of the thoraces and those of the abdomens showed no significant angular dependence, while those of the antennae and those of the heads exhibited a periodic dependence relative to the magnetic field. Fitting of the angular dependence of the resonant field resulted in an unexpected magnetic anisotropy with uniaxial symmetry. High values of the first order anisotropy constant were observed for the magnetic material in antennae (−2.9  ×  10 5  erg cm −3 ) and heads (−1  ×  10 6  erg   cm −3 ) as compared to body parts of other social insects. In addition, the magnitude of the anisotropy in the heads was comparable to that observed in magnetite nanoparticles of 4–5 nm diameter. For the antennae, the mean angle of the particles’ easy magnetization axis (EA) was estimated to be 41° relative to the straightened antenna’s long axis. For the heads, EA was approximately 60° relative to the head’s axis running from midway between the spines to the clypeus. These physical characteristics indicate organized magnetic nanoparticles with a potential for directional sensitivity, which is an important feature of magnetic compasses. (paper)

  13. Habitat Modification by the Leaf-Cutter Ant, Atta cephalotes, and Patterns of Leaf-Litter Arthropod Communities.

    Science.gov (United States)

    Wells, Rachel L; Murphy, Serena K; Moran, Matthew D

    2017-12-08

    Ecosystem engineers are profoundly important in many biological communities. A Neotropical taxonomic group considered to have engineering effects is the Formicidae (ants). Leaf-cutter ants (LCAs), in particular, which form extensive colonies of millions of individuals, can be important ecosystem engineers in these environments. While the effects of LCAs on plant community structure and soil chemistry are well-studied, their effects on consumers are poorly understood. Therefore, we examined the indirect effects of the LCA Atta cephalotes L. on the leaf-litter arthropod community. We compared abundance and diversity patterns at ant nests to areas distant from nests, utilizing both a factorial design and gradient analysis for both nocturnal and diurnal arthropods. We found that arthropod abundance and diversity was significantly lower for multiple taxonomic groups and trophic levels near leaf-cutter nests, and this pattern was strongest at night. Exceptions to this pattern included two morphospecies of Collembola that were more abundant on nests, suggesting some specialization for these species. For the gradient analysis, abundance increased exponentially for most groups of arthropods. However, for the dominant arthropod species, the amphipod Cerrorchestia hyloraina Lindeman, a quadratic function was the best fit curvilinear model for abundance. It appeared that C. hyloraina had maximal abundance at the transition between nest site and less disturbed forest. These results indicate that LCA activity has a strong effect on the leaf-litter arthropod community, adding to spatial heterogeneity within neotropical forests. These effects may translate into changes in important ecological processes such as nutrient cycling and food web function. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  14. Espécies de formigas que interagem com as sementes de Mabea fistulifera Mart. (Euphorbiaceae Interaction between ant species and seeds of Mabea fistulifera Mart. (Euphorbiaceae

    Directory of Open Access Journals (Sweden)

    Ethel Fernandes de Oliveira Peternelli

    2004-10-01

    Full Text Available As formigas, quando atraídas por um apêndice nutritivo, produzido na semente de certas plantas, podem exercer o papel de agente predador ou dispersor das sementes. No processo de dispersão, grande número desses insetos pode interagir com sementes de determinada planta. O objetivo deste trabalho foi identificar as espécies de formigas em contato com sementes de Mabea fistulifera Mart. - uma espécie arbórea e colonizadora em áreas antrópicas no Brasil - e o tipo de interação desses insetos com as sementes, bem como determinar as espécies dispersoras. Foram realizadas coletas manuais de formigas em fragmentos de vegetação com alta densidade de M. fistulifera, no município de Viçosa, MG, no momento de sua visitação às sementes. As formigas capturadas foram triadas e identificadas por espécie. Além disso, durante as coletas foram feitas observações quanto ao tipo de comportamento das formigas que se associaram às sementes e ao cálculo da taxa de remoção destas, verificando-se que 16 espécies tiveram contato com estas. Acromyrmex subterraneus subterraneus, Atta sexdens rubropilosa, Ectatomma edentatum, Pachycondyla sp.1 e Pheidole sp. 2 foram, de fato, dispersoras, já que transportaram efetivamente as sementes. Ac. subterraneus subterraneus, Camponotus rufipes, Ectatomma permagnum, Megalomyrmex sp.1, Pachycondyla sp. 1, Pachycondyla sp. 2, Pheidole sp. 4, Pheidole sp. 5 e Pogonomyrmex sp. são, pela primeira vez, relatadas interagindo com sementes. A taxa de remoção das sementes de M. fistulifera pelas formigas foi de 85 a 97%.Ants, when attracted by nutritious corpuscles produced by seeds of certain plant species, can act as predators or dispersing agents. During seed dispersal, a great number of ant species can interact with seeds of a particular plant species. The purpose of this study was to identify the ant species that interact with seeds of Mabea fistulifera Mart., a pioneer tree species in anthropic disturbed

  15. Harsh Working Conditions and Poor Eating Habits: Health-Related Concerns of Female Head Porters (Kayayei) in the Mallam Atta Market, Accra, Ghana.

    Science.gov (United States)

    Nyarko, Samuel Harrenson; Tahiru, Abdul Majeed

    2018-01-01

    The kaya business is known to pose significant health-related risks to female migrants. This study sought to explore the health-related concerns of female head porters in the Mallam Atta market, Accra, Ghana. A qualitative study was conducted in which twenty female head porters at the Mallam Atta market in Accra were interviewed. A thematic analysis was performed and the emerging themes were presented and supported with quotations from the respondents. Poor accommodation and eating habits, harsh working conditions, and lack of knowledge about health conditions exposed the respondents to several health-related concerns like neck pains, skin rashes, malaria, cholera, and stomach ache among other infections. The popular means of seeking health care was through purchasing drugs from pharmacies or drug peddlers instead of health facilities. Financial constraints, lack of faith in the National Health Insurance Scheme, and long waiting periods at the health facilities militated against seeking appropriate health care at the hospitals and clinics. Political willpower needs to be strengthened for poverty reduction strategies such as training of hairdressing, dress and soap making, and shea butter processing for women from the Northern regions in order to ameliorate their livelihoods and/or reduce migration to the south.

  16. Harsh Working Conditions and Poor Eating Habits: Health-Related Concerns of Female Head Porters (Kayayei in the Mallam Atta Market, Accra, Ghana

    Directory of Open Access Journals (Sweden)

    Samuel Harrenson Nyarko

    2018-01-01

    Full Text Available Background. The kaya business is known to pose significant health-related risks to female migrants. This study sought to explore the health-related concerns of female head porters in the Mallam Atta market, Accra, Ghana. Methods. A qualitative study was conducted in which twenty female head porters at the Mallam Atta market in Accra were interviewed. A thematic analysis was performed and the emerging themes were presented and supported with quotations from the respondents. Results. Poor accommodation and eating habits, harsh working conditions, and lack of knowledge about health conditions exposed the respondents to several health-related concerns like neck pains, skin rashes, malaria, cholera, and stomach ache among other infections. The popular means of seeking health care was through purchasing drugs from pharmacies or drug peddlers instead of health facilities. Financial constraints, lack of faith in the National Health Insurance Scheme, and long waiting periods at the health facilities militated against seeking appropriate health care at the hospitals and clinics. Conclusion. Political willpower needs to be strengthened for poverty reduction strategies such as training of hairdressing, dress and soap making, and shea butter processing for women from the Northern regions in order to ameliorate their livelihoods and/or reduce migration to the south.

  17. The Postpharyngeal Gland: Specialized Organ for Lipid Nutrition in Leaf-Cutting Ants.

    Science.gov (United States)

    Decio, Pâmela; Vieira, Alexsandro Santana; Dias, Nathalia Baptista; Palma, Mario Sergio; Bueno, Odair Correa

    2016-01-01

    There are several hypotheses about the possible functions of the postpharyngeal gland (PPG) in ants. The proposed functions include roles as cephalic or gastric caeca and diverticulum of the digestive tract, mixing of hydrocarbons, nestmate recognition, feeding larvae, and the accumulation of lipids inside this gland, whose origin is contradictory. The current study aimed to investigate the functions of these glands by examining the protein expression profile of the PPGs of Atta sexdens rubropilosa (Hymenoptera, Formicidae). Mated females received lipid supplementation and their glands were extracted and analyzed using a proteomic approach. The protocol used combined two-dimensional electrophoresis and shotgun strategies, followed by mass spectrometry. We also detected lipid β-oxidation by immunofluorescent marking of acyl-CoA dehydrogenase. Supplying ants with lipids elicited responses in the glandular cells of the PPG; these included increased expression of proteins related to defense mechanisms and signal transduction and reorganization of the cytoskeleton due to cell expansion. In addition, some proteins in PPG were overexpressed, especially those involved in lipid and energy metabolism. Part of the lipids may be reduced, used for the synthesis of fatty alcohol, transported to the hemolymph, or may be used as substrate for the synthesis of acetyl-CoA, which is oxidized to form molecules that drive oxidative phosphorylation and produce energy for cellular metabolic processes. These findings suggest that this organ is specialized for lipid nutrition of adult leaf-cutting ants and characterized like a of diverticulum foregut, with the ability to absorb, store, metabolize, and mobilize lipids to the hemolymph. However, we do not rule out that the PPG may have other functions in other species of ants.

  18. Recognition of endophytic Trichoderma species by leaf-cutting ants and their potential in a Trojan-horse management strategy

    Science.gov (United States)

    Rocha, Silma L.; Evans, Harry C.; Jorge, Vanessa L.; Cardoso, Lucimar A. O.; Pereira, Fernanda S. T.; Rocha, Fabiano B.; Barreto, Robert W.; Hart, Adam G.

    2017-01-01

    Interactions between leaf-cutting ants, their fungal symbiont (Leucoagaricus) and the endophytic fungi within the vegetation they carry into their colonies are still poorly understood. If endophytes antagonistic to Leucoagaricus were found in plant material being carried by these ants, then this might indicate a potential mechanism for plants to defend themselves from leaf-cutter attack. In addition, it could offer possibilities for the management of these important Neotropical pests. Here, we show that, for Atta sexdens rubropilosa, there was a significantly greater incidence of Trichoderma species in the vegetation removed from the nests—and deposited around the entrances—than in that being transported into the nests. In a no-choice test, Trichoderma-infested rice was taken into the nest, with deleterious effects on both the fungal gardens and ant survival. The endophytic ability of selected strains of Trichoderma was also confirmed, following their inoculation and subsequent reisolation from seedlings of eucalyptus. These results indicate that endophytic fungi which pose a threat to ant fungal gardens through their antagonistic traits, such as Trichoderma, have the potential to act as bodyguards of their plant hosts and thus might be employed in a Trojan-horse strategy to mitigate the negative impact of leaf-cutting ants in both agriculture and silviculture in the Neotropics. We posit that the ants would detect and evict such ‘malign’ endophytes—artificially inoculated into vulnerable crops—during the quality-control process within the nest, and, moreover, that the foraging ants may then be deterred from further harvesting of ‘Trichoderma-enriched’ plants. PMID:28484603

  19. Ants can learn to forage on one-way trails.

    Directory of Open Access Journals (Sweden)

    Pedro Leite Ribeiro

    Full Text Available The trails formed by many ant species between nest and food source are two-way roads on which outgoing and returning workers meet and touch each other all along. The way to get back home, after grasping a food load, is to take the same route on which they have arrived from the nest. In many species such trails are chemically marked by pheromones providing orientation cues for the ants to find their way. Other species rely on their vision and use landmarks as cues. We have developed a method to stop foraging ants from shuttling on two-way trails. The only way to forage is to take two separate roads, as they cannot go back on their steps after arriving at the food or at the nest. The condition qualifies as a problem because all their orientation cues -- chemical, visual or any other -- are disrupted, as all of them cannot but lead the ants back to the route on which they arrived. We have found that workers of the leaf-cutting ant Atta sexdens rubropilosa can solve the problem. They could not only find the alternative way, but also used the unidirectional traffic system to forage effectively. We suggest that their ability is an evolutionary consequence of the need to deal with environmental irregularities that cannot be negotiated by means of excessively stereotyped behavior, and that it is but an example of a widespread phenomenon. We also suggest that our method can be adapted to other species, invertebrate and vertebrate, in the study of orientation, memory, perception, learning and communication.

  20. Leaf Cutter Ant (Atta cephalotes) Soil Modification and In Situ CO2 Gas Dynamics in a Neotropical Wet Forest

    Science.gov (United States)

    Fernandez Bou, A. S.; Carrasquillo Quintana, O.; Dierick, D.; Harmon, T. C.; Johnson, S.; Schwendenmann, L.; Zelikova, T. J.

    2016-12-01

    The goal of this work is to advance our understanding of soil carbon cycling in highly productive neotropical wet forests. More specifically, we are investigating the influence of leaf cutter ants (LCA) on soil CO2 gas dynamics in primary and secondary forest soils at La Selva Biological Station, Costa Rica. LCA are the dominant herbivore in tropical Americas, responsible for as much as 50% of the total herbivory. Their presence is increasing and their range is expanding because of forest fragmentation and other human impacts. We installed gas sampling wells in LCA (Atta cephalotes) nest and control sites (non-nests in the same soil and forest settings). The experimental design encompassed land cover (primary and secondary forest) and soil type (residual and alluvial). We collected gas samples monthly over an 18-month period. Several of the LCA nests were abandoned during this period. Nevertheless, we continued to sample these sites for LCA legacy effects. In several of the sites, we also installed sensors to continuously monitor soil moisture content, temperature, and CO2 levels. Within the 18-month period we conducted a 2-month field campaign to collect soil and nest vent CO2 efflux data from 3 of the nest-control pairs. Integrating the various data sets, we observed that for most of the sites nest and control soils behaved similarly during the tropical dry season. However, during the wet season gas well CO2 concentrations increased in the control sites while levels in the nests remained at dry season levels. This outcome suggests that ants modify soil gas transport properties (e.g., tortuosity). In situ time series and efflux sampling campaign data corroborated these findings. Abandoned nest CO2 levels were similar to those of the active nests, supporting the notion of a legacy effect from LCA manipulations. For this work, the period of abandonment was relatively short (several months to 1 year maximum), which appears to be insufficient for estimating the

  1. MODELO CONCEPTUAL DEL PAPEL ECOLÓGICO DE LA HORMIGA ARRIERA (Atta laevigata EN LOS ECOSISTEMAS DE SABANA ESTACIONAL (VICHADA, COLOMBIA

    Directory of Open Access Journals (Sweden)

    CORTÉS-PÉREZ FRANCISCO

    2003-12-01

    Full Text Available Se presentan algunos aspectos del ciclo de vida de la hormiga arriera Atta laevigata,en especial el vuelo nupcial, con notas ecológicas de interés, el perfil modal desuelos afectados por la actividad de las arrieras y se analiza su contenido denutrientes. Se detalla el funcionamiento y la estructura de las colonias de arrierascon especial énfasis en el transporte y la acumulación de nutrientes y semillas en lossitios de establecimiento de la colonia; se explica el establecimiento de las matas demonte a partir de estos sitios ricos en nutrientes y semillas. Con base en estosaspectos se plantea un modelo funcional del papel que cumplen las colonias dearrieras en los ecosistemas de sabana estacional.

  2. The construction of ventilation turrets in Atta vollenweideri leaf-cutting ants: Carbon dioxide levels in the nest tunnels, but not airflow or air humidity, influence turret structure.

    Directory of Open Access Journals (Sweden)

    Florian Halboth

    Full Text Available Nest ventilation in the leaf-cutting ant Atta vollenweideri is driven via a wind-induced mechanism. On their nests, workers construct small turrets that are expected to facilitate nest ventilation. We hypothesized that the construction and structural features of the turrets would depend on the colony's current demands for ventilation and thus might be influenced by the prevailing environmental conditions inside the nest. Therefore, we tested whether climate-related parameters, namely airflow, air humidity and CO2 levels in the outflowing nest air influenced turret construction in Atta vollenweideri. In the laboratory, we simulated a semi-natural nest arrangement with fungus chambers, a central ventilation tunnel providing outflow of air and an aboveground building arena for turret construction. In independent series, different climatic conditions inside the ventilation tunnel were experimentally generated, and after 24 hours, several features of the built turret were quantified, i.e., mass, height, number and surface area (aperture of turret openings. Turret mass and height were similar in all experiments even when no airflow was provided in the ventilation tunnel. However, elevated CO2 levels led to the construction of a turret with several minor openings and a larger total aperture. This effect was statistically significant at higher CO2 levels of 5% and 10% but not at 1% CO2. The construction of a turret with several minor openings did not depend on the strong differences in CO2 levels between the outflowing and the outside air, since workers also built permeated turrets even when the CO2 levels inside and outside were both similarly high. We propose that the construction of turrets with several openings and larger opening surface area might facilitate the removal of CO2 from the underground nest structure and could therefore be involved in the control of nest climate in leaf-cutting ants.

  3. Leaf processing behaviour in Atta leafcutter ants: 90% of leaf cutting takes place inside the nest, and ants select pieces that require less cutting.

    Science.gov (United States)

    Garrett, Ryan W; Carlson, Katherine A; Goggans, Matthew Scott; Nesson, Michael H; Shepard, Christopher A; Schofield, Robert M S

    2016-01-01

    Leafcutter ants cut trimmings from plants, carry them to their underground nests and cut them into smaller pieces before inoculating them with a fungus that serves as a primary food source for the colony. Cutting is energetically costly, so the amount of cutting is important in understanding foraging energetics. Estimates of the cutting density, metres of cutting per square metre of leaf, were made from samples of transported leaf cuttings and of fungal substrate from field colonies of Atta cephalotes and Atta colombica. To investigate cutting inside the nest, we made leaf-processing observations of our laboratory colony, A. cephalotes. We did not observe the commonly reported reduction of the leaf fragments into a pulp, which would greatly increase the energy cost of processing. Video clips of processing behaviours, including behaviours that have not previously been described, are linked. An estimated 2.9 (±0.3) km of cutting with mandibles was required to reduce a square metre of leaf to fungal substrate. Only about 12% (±1%) of this cutting took place outside of the nest. The cutting density and energy cost is lower for leaf material with higher ratios of perimeter to area, so we tested for, and found that the laboratory ants had a preference for leaves that were pre-cut into smaller pieces. Estimates suggest that the energy required to transport and cut up the leaf material is comparable to the metabolic energy available from the fungus grown on the leaves, and so conservation of energy is likely to be a particularly strong selective pressure for leafcutter ants.

  4. Growth and enzymatic activity of Leucoagaricus gongylophorus, a mutualistic fungus isolated from the leaf-cutting ant Atta mexicana, on cellulose and lignocellulosic biomass.

    Science.gov (United States)

    Vigueras, G; Paredes-Hernández, D; Revah, S; Valenzuela, J; Olivares-Hernández, R; Le Borgne, S

    2017-08-01

    A mutualistic fungus of the leaf-cutting ant Atta mexicana was isolated and identified as Leucoagaricus gongylophorus. This isolate had a close phylogenetic relationship with L. gongylophorus fungi cultivated by other leaf-cutting ants as determined by ITS sequencing. A subcolony started with ~500 A. mexicana workers could process 2 g day -1 of plant material and generate a 135 cm 3 fungus garden in 160 days. The presence of gongylidia structures of ~35 μm was observed on the tip of the hyphae. The fungus could grow without ants on semi-solid cultures with α-cellulose and microcrystalline cellulose and in solid-state cultures with grass and sugarcane bagasse, as sole sources of carbon. The maximum CO 2 production rate on grass (V max  = 17·5 mg CO 2  L g -1  day -1 ) was three times higher than on sugarcane bagasse (V max  = 6·6 mg CO 2  L g -1 day -1 ). Recoveries of 32·9 mg glucose  g biomass -1 and 12·3 mg glucose  g biomass -1 were obtained from the fungal biomass and the fungus garden, respectively. Endoglucanase activity was detected on carboxymethylcellulose agar plates. This is the first study reporting the growth of L. gongylophorus from A. mexicana on cellulose and plant material. According to the best of our knowledge, this is the first report about the growth of Leucoagaricus gongylophorus, isolated from the colony of the ant Atta mexicana, on semisolid medium with cellulose and solid-state cultures with lignocellulosic materials. The maximum CO 2 production rate on grass was three times higher than on sugarcane bagasse. Endoglucanase activity was detected and it was possible to recover glucose from the fungal gongylidia. The cellulolytic activity could be used to process lignocellulosic residues and obtain sugar or valuable products, but more work is needed in this direction. © 2017 The Society for Applied Microbiology.

  5. Response of the grass-cutting ant Atta capiguara Gonçalves, 1944 (Hymenoptera: Formicidae to sugars and artificial sweeteners Resposta da saúva Atta capiguara Gonçalves, 1944 (Hymenoptera: Formicidae a açúcares e edulcorantes artificiais

    Directory of Open Access Journals (Sweden)

    Maria Aparecida Castellani Boaretto

    2003-01-01

    Full Text Available Using of toxic baits made of dehydrated citric pulp to control grass-cutting ants can lead to unsatisfactory results because of the low attractiveness of the substrate to worker ants. This work aimed to identify attractive substances, with potential for incorporation in a matrix of granulated baits for grass-cutting ants, among several kinds of sugars and substances used in artificial sweeteners. Experiments were carried out in mature nests of Atta capiguara (Hym.: Formicidae set in pasture. Studied substances were sucrose, fructose, soluble starch, raffinose, maltose, lactose, sorbose, cellobiose, arabinose, xylose, glucose, galactose, rhamnose, arabinose, melezitose, saccharine and cyclamate (at 5.0% w/v. Later, on maltose, xylose, sucrose, fructose and glucose solutions were included at 5.0%, 7.5%, 10.0% and 20.0% w/v, respectively. Cellulose rectangles were used as vehicle and number of rectangles carried into the colonies was evaluated. Carrying rates were very low with maximum means of 9.6% for lactose and 6.0% for arabinose and cyclamate, at the 5.0% concentration. No differences (P > 0.05 were observed relatively to the control (distilled water. No effects were detected for solution, concentration and for the interaction of these factors. Sugars and artificial sweeteners studied were not attractive to Atta capiguara workers, turning their inclusion as attractants in toxic ant baits not viable.O uso de iscas tóxicas, formuladas à base de polpa cítrica desidratada, para o controle de formigas cortadeiras de gramíneas pode levar a resultados insatisfatórios devido à baixa atratividade do substrato às operárias. Este trabalho foi realizado com o objetivo de identificar substâncias atrativas e com potencial para incorporação em matrizes de iscas granuladas para formigas cortadeiras de gramíneas, dentre diversos tipos de açúcares e edulcorantes artificiais. Os experimentos foram realizados em ninhos adultos de Atta capiguara Gon

  6. Improving urban visibility through fractal analysis of street edges: The case of John Evans Atta Mills High Street in Accra, Ghana

    Directory of Open Access Journals (Sweden)

    R.A. Oppong

    2017-06-01

    Full Text Available Streets are a representation of cities, and the image of a city is a reflection of its home country. Although attempts to ensure harmonious spatial and environmental development in Ghanaian settlements date back to the colonial era, these efforts have minimal physical manifestation in the urban fabric of the city of Accra. The Independence Arch of Ghana, an important landmark in the urban fabric and history of Accra, lacks the striking vista and approach it deserves. This paper introduces the use of fractal analysis of street edges to understand the characteristics of the John Evans Atta Mills (JEAM High Street for developing recommendations to improve visibility along its stretch and the overall image of the city. The box-counting method with visual survey was used in research. The pertinent questions this paper seeks to address are as follows: What factors affect the visibility and imageability of JEAM High Street? What design aspects should be considered to improve urban visibility along JEAM High Street? What is the link of fractals to urban design and architecture? The paper recommends various design considerations and qualities to improve the urban visibility and imageability of JEAM High Street.

  7. Soil moisture and excavation behaviour in the Chaco leaf-cutting ant (Atta vollenweideri: digging performance and prevention of water inflow into the nest.

    Directory of Open Access Journals (Sweden)

    Steffen Pielström

    Full Text Available The Chaco leaf-cutting ant Atta vollenweideri is native to the clay-heavy soils of the Gran Chaco region in South America. Because of seasonal floods, colonies are regularly exposed to varying moisture across the soil profile, a factor that not only strongly influences workers' digging performance during nest building, but also determines the suitability of the soil for the rearing of the colony's symbiotic fungus. In this study, we investigated the effects of varying soil moisture on behaviours associated with underground nest building in A. vollenweideri. This was done in a series of laboratory experiments using standardised, plastic clay-water mixtures with gravimetric water contents ranging from relatively brittle material to mixtures close to the liquid limit. Our experiments showed that preference and group-level digging rate increased with increasing water content, but then dropped considerably for extremely moist materials. The production of vibrational recruitment signals during digging showed, on the contrary, a slightly negative linear correlation with soil moisture. Workers formed and carried clay pellets at higher rates in moist clay, even at the highest water content tested. Hence, their weak preference and low group-level excavation rate observed for that mixture cannot be explained by any inability to work with the material. More likely, extremely high moistures may indicate locations unsuitable for nest building. To test this hypothesis, we simulated a situation in which workers excavated an upward tunnel below accumulated surface water. The ants stopped digging about 12 mm below the interface soil/water, a behaviour representing a possible adaptation to the threat of water inflow field colonies are exposed to while digging under seasonally flooded soils. Possible roles of soil water in the temporal and spatial pattern of nest growth are discussed.

  8. Soil Moisture and Excavation Behaviour in the Chaco Leaf-Cutting Ant (Atta vollenweideri): Digging Performance and Prevention of Water Inflow into the Nest

    Science.gov (United States)

    Pielström, Steffen; Roces, Flavio

    2014-01-01

    The Chaco leaf-cutting ant Atta vollenweideri is native to the clay-heavy soils of the Gran Chaco region in South America. Because of seasonal floods, colonies are regularly exposed to varying moisture across the soil profile, a factor that not only strongly influences workers' digging performance during nest building, but also determines the suitability of the soil for the rearing of the colony's symbiotic fungus. In this study, we investigated the effects of varying soil moisture on behaviours associated with underground nest building in A. vollenweideri. This was done in a series of laboratory experiments using standardised, plastic clay-water mixtures with gravimetric water contents ranging from relatively brittle material to mixtures close to the liquid limit. Our experiments showed that preference and group-level digging rate increased with increasing water content, but then dropped considerably for extremely moist materials. The production of vibrational recruitment signals during digging showed, on the contrary, a slightly negative linear correlation with soil moisture. Workers formed and carried clay pellets at higher rates in moist clay, even at the highest water content tested. Hence, their weak preference and low group-level excavation rate observed for that mixture cannot be explained by any inability to work with the material. More likely, extremely high moistures may indicate locations unsuitable for nest building. To test this hypothesis, we simulated a situation in which workers excavated an upward tunnel below accumulated surface water. The ants stopped digging about 12 mm below the interface soil/water, a behaviour representing a possible adaptation to the threat of water inflow field colonies are exposed to while digging under seasonally flooded soils. Possible roles of soil water in the temporal and spatial pattern of nest growth are discussed. PMID:24748382

  9. Branch Width and Height Influence the Incorporation of Branches into Foraging Trails and Travel Speed in Leafcutter Ants Atta cephalotes (L.) (Hymenoptera: Formicidae).

    Science.gov (United States)

    Freeman, B M; Chaves-Campos, J

    2016-06-01

    Fallen branches are often incorporated into Atta cephalotes (L.) foraging trails to optimize leaf tissue transport rates and economize trail maintenance. Recent studies in lowlands show laden A. cephalotes travel faster across fallen branches than on ground, but more slowly ascending or descending a branch. The latter is likely because (1) it is difficult to travel up or downhill and (2) bottlenecks occur when branches are narrower than preceding trail. Hence, both branch height and width should determine whether branches decrease net travel times, but no study has evaluated it yet. Laden A. cephalotes were timed in relation to branch width and height across segments preceding, accessing, across, and departing a fallen branch in the highlands of Costa Rica. Ants traveled faster on branches than on cleared segments of trunk-trail, but accelerated when ascending or descending the branch-likely because of the absence of bottlenecks during the day in the highlands. Branch size did not affect ant speed in observed branches; the majority of which (22/24) varied from 11 to 120 mm in both height and width (average 66 mm in both cases). To determine whether ants exclude branches outside this range, ants were offered the choice between branches within this range and branches that were taller/wider than 120 mm. Ants strongly preferred the former. Our results indicate that A. cephalotes can adjust their speed to compensate for the difficulty of traveling on branch slopes. More generally, branch size should be considered when studying ant foraging efficiency.

  10. FORMULACIÓN DE GRÁNULOS BASES PARA LA INCORPORACIÓN DE INGREDIENTES ACTIVOS CON EFECTO BIOLÓGICO SOBRE EL HONGO SIMBIÓTICO CULTIVADO POR LAS HORMIGAS FORRAJERAS DEL GÉNERO Atta

    Directory of Open Access Journals (Sweden)

    Ena Edith Herrera

    2013-01-01

    Full Text Available Las hormigas forrajeras (Atta spp. pueden destruir plantaciones completas de hortalizas y de otras plantas de importancia económica en América Tropical y Subtropical. Cortan el tejido de las plantas y lo transportan a nidos subterráneos, donde cultivan un hongo del Phylum basidiomycota, que es su alimento principal. En la actualidad, no se cuenta con una estrategia efectiva de manejo de esta plaga. La mayoría de productos disponibles comercialmente son muy poco efectivos, dejan residuos en el ambiente y tienen un precio alto para los pequeños agricultores. La presente investigación se propuso evaluar diferentes ingredientes en la preparación de granulados que presenten alto nivel de acarreo y potencial para la incorporación de ingredientes activos con efecto biológico contra el hongo simbiótico que cultivan las hormigas forrajeras. Se prepararon gránulos con diferentes combinaciones y concentraciones de excipientes o coadyuvantes. Además se evaluó citropulpa, extracto alcohólico de cáscaras de naranja y aceite de semillas de naranja, como atrayentes. A los mejores formulados se incorporó extracto de Azadirachta indica (neem, 3 cepas de Trichoderma spp., y levaduras en diferentes concentraciones, para comprobar la compatibilidad de las formulaciones con ingredientes activos. Se evaluó diferentes características de los gránulos como indicadores de viabilidad y estabilidad del formulado. Se encontró que los cebos formulados con citropulpa son capaces de mantener estable la acidez y, además, conservan la viabilidad de Trichoderma spp., y levaduras por más tiempo que los formulados elaborados con extracto alcohólico de cáscaras de naranja como atrayente. Además, el gránulo base con citropulpa presentó un costo de producción más bajo. Se concluye que el formulado con citropulpa como atrayente es una base apropiada para la incorporación de ingredientes activos con efecto biológico contra el hongo simbiótico y tiene

  11. Atratividade da isca granulada de polpa de fruto do jatobá para saúva-limão, no campo Attractiveness of the granulated bait of jatobá's fruit pulp to the leaf- cutting ant, in the field

    Directory of Open Access Journals (Sweden)

    Maria Lucia França Teixeira

    2008-08-01

    Full Text Available A atratividade da polpa do fruto de jatobá para saúva-limão foi avaliada tendo como parâmetro comparativo a polpa cítrica desidratada, utilizada como veículo por diversas marcas comerciais. O experimento foi conduzido em quatro formigueiros de saúva-limão em canteiros gramados com espécies arbóreas. As iscas de jatobá e de polpa cítrica desidratada, ambas sem princípio ativo, foram confeccionadas em grânulos com formato e diâmetro semelhantes aos das iscas granuladas comerciais. As iscas de jatobá foram mais atrativas para as operárias de saúva-limão, que fizeram o primeiro contato aos 17s, em contraste com os 29s gastos para o primeiro contato com as iscas de polpa cítrica. As iscas de jatobá também começaram a ser carregadas mais cedo, aos 26s, sendo que as iscas de polpa cítrica foram carregadas 48s mais tarde. A grande aceitação do jatobá foi reforçada pelo menor tempo para o encerramento dos testes, 5min 39s, contrastando com os 11min 17s necessários para o encerramento do teste com a polpa cítrica. A polpa do fruto do jatobá foi mais atrativa para saúva-limão do que a polpa cítrica desidratada.Attractiveness of the leaf-cutting ant, Atta sexdens rubropilosa to jatobá's fruit pulp was evaluated, having the dehydrated citrus pulp as comparative parameter, used as vehicle by several commercial brands. The experiment was conducted on four nests of leaf-cutting ants on lawns with arboreal species. Jatobá baits and dehydrated citric pulp both without active principle were made into granules with form and diameter similar to the commercial granulated baits. Jatobá baits were more attractive to the laborers of leaf-cutting ants which made the first contact after 17s, contrasting with 29s before the first contact with citric pulp baits. Jatobá baits were also carried earlier, after 26s, while citric pulp baits were carried 48s later. The great acceptance of jatobá baits was strengthened by the short time to

  12. A Reading of Kwame Nkrumah's Towards Colonial Freedom Atta

    African Journals Online (AJOL)

    trajectory that Kwame Nkrumah, in this work, traces towards colonial freedom. ... propelled against their colonising oppressors also seen as wearing a single classless ... political economy: 'It is not the consciousness of men [and women] that ...

  13. ATTA - A new method of ultrasensitive isotope trace analysis

    International Nuclear Information System (INIS)

    Bailey, K.; Chen, C.Y.; Du, X.; Li, Y.M.; Lu, Z.-T.; O'Connor, T.P.; Young, L.

    2000-01-01

    A new method of ultrasensitive isotope trace analysis has been developed. This method, based on the technique of laser manipulation of neutral atoms, has been used to count individual 85 Kr and 81 Kr atoms present in a natural krypton gas sample with isotopic abundances in the range of 10 -11 and 10 -13 , respectively. This method is free of contamination from other isotopes and elements and can be applied to various different isotope tracers for a wide range of applications. The demonstrated detection efficiency is 1x10 -7 . System improvements could increase the efficiency by many orders of magnitude

  14. Production Of Vitamin B 12 By Streptomyces Fulvissimus | Atta ...

    African Journals Online (AJOL)

    Fifty five of actinomycete isolates were screened for vitamin B12 production by growing on soybean meal medium fortified with cobalt. Only one AZ-Z-88 among nine actinomycete cultures was found to produce significantly higher yield of the vitamin B12 (64.57 ug/ml). Determination of vitamin B12 production was carried out ...

  15. Growth of symbiont fungi of some higher attine ants in mineral medium Crescimento do fungo simbionte de alguns attine superiores em meio mineral

    Directory of Open Access Journals (Sweden)

    Alci Enimar Loeck

    2004-02-01

    Full Text Available Bioassays were conducted to verify the possibility of culturing the symbiont fungus of some higher attine in mineral medium and finding out the optimum pH value for their satisfactory mycelial growth. Three organic media and one mineral medium were inoculated with isolates from Atta sexdens piriventris and Acromyrmex heyeri. In mineral medium different values of pH (4.0, 5.0, 6.0 and 7.0 were tested with isolates from A. laevigata and A. laticeps. The behavior of isolates (colony diameter was different in the mineral medium. However, even the one which grew the least of all provided enough mycelial for RAPD analysis. The best range of pH for fungal growth in mineral medium was between 4.0 and 5.0Foram conduzidos bioensaios para verificar a possibilidade de cultivar o fungo simbionte de alguns attine superiores em meio mineral e obter um valor de pH ótimo para o seu crescimento micelial. Três meios orgânicos e um meio mineral foram testados, avaliando-se o crescimento (diâmetro da colônia de isolados de fungos de Atta sexdens piriventris e Acromyrmex heyeri. No meio mineral, diferentes valores de pH (4,0, 5,0, 6,0 and 7,0 foram avaliados, por meio do mesmo parâmetro anterior, com isolados de fungos de A. laevigata e A. laticeps. No meio mineral, os isolados testados apresentaram crescimento diferenciado, entretanto mesmo aquele que menos cresceu, forneceu material suficiente para as análises de RAPD. No mesmo meio, verificou-se que a melhor faixa de pH para o crescimento micelial está entre 4,0 e 5,0.

  16. Seed dispersal and predation of Buchenavia tomentosa Eichler (Combretaceae in a Cerrado sensu stricto, midwest Brazil

    Directory of Open Access Journals (Sweden)

    J. Farias

    Full Text Available Abstract The ecology of seed dispersal is critical to understand the patterns of distribution and abundance of plant species. We investigated seed dispersal aspects associated with the high abundance of Buchenavia tomentosa in the Serra Azul State Park (PESA. We estimated fruit production and conducted fruit removal experiments. We carried out diurnal and nocturnal observations on frugivory as well as germination tests. Fruiting occurred in the dry season and totaled 1,365,015 ± 762,670 fruits.ha–1. B. tomentosa fruits were utilized by eight animal species. The lowland tapir (Tapirus terrestris was considered the main seed disperser. Leafcutter ants (Atta laevigata and Atta sexdens participated in the seed cleaning and occasionally dispersed seeds. The beetle Amblycerus insuturatus, blue-and-yellow macaw (Ara ararauna and red-and-green macaw (Ara chloropterus were considered pre-dispersal seed predators. The seeds manually cleaned presented higher germination rate (100% and speed index (4.2 seeds.d–1 than that of seeds with pulp. Germination of seeds found in tapirs’feces was 40%, while for the seeds without pulp it was 25%. The high abundance of B. tomentosa in the cerrado of PESA may be due to massive fruit production, low rates of seed predation, and efficient seed dispersal by tapirs, occurring before the rains which promote germination and recruitment of this species.

  17. Secondary seed dispersal of Ricinus communis Linnaeus (Euphorbiaceae by ants in secondary growth vegetation in Minas Gerais Dispersão secundária de sementes de Ricinus communis Linnaeus (Euphorbiaceae por formigas em vegetação secundária em Minas Gerais

    Directory of Open Access Journals (Sweden)

    Mário Marcos do Espírito Santo

    2007-12-01

    Full Text Available In this study, I tested the efficacy of ants as secondary seed dispersers of Ricinus communis in southeastern Brazil. In a natural population of 143 individuals, I determined the ballistic dispersal distance for 62 seeds and 100 additional seeds were experimentally offered to ants in groups of ten seeds along a transect of 50 m. Fifty-three seeds were removed by ants, mainly by the leafcutter Atta sexdens (90.4%. The dispersal distance by ants was high, compared to the global average (4.38 m ± 0.74 m vs. 0.96 m, but was lower than the ballistic distance (7.27 m ± 0.13 m. Ants increased the total dispersal distance (8.66 m ± 0.60 m, but the main benefit for the plant was the directed dispersal, with seed deposition on the enriched soil of ant nests.Este estudo testou a eficiência de formigas como dispersores secundários de Ricinus communis no Brasil. Em uma população natural de 143 indivíduos, a distância de dispersão balística foi determinada para 62 sementes. Além disso, 100 sementes adicionais foram oferecidas a formigas em grupos de 10, ao longo de um transecto de 50 m. Cinqüenta e três sementes foram removidas por formigas, principalmente pela formiga-cortadeira Atta sexdens (90,4%. A distância de dispersão por formigas foi alta se comparada à média global (4,38m ± 0,74 m vs. 0,96 m, porém menor que a distância de dispersão balística (7,27 m ± 0,13 m. As formigas aumentaram a distância de dispersão total (8,66 m ± 0,60 m, mas o principal benefício para a planta foi a dispersão direcionada, com a deposição das sementes no solo enriquecido encontrado nos ninhos das formigas.

  18. Crescimento do fungo simbionte de formigas cortadeiras do gênero Acromyrmex em meios de cultura com diferentes extratos Growth of symbiont fungi of cutter ants of the genus Acromyrmex in means of culture with different extracts

    Directory of Open Access Journals (Sweden)

    Regina da Silva Borba

    2006-06-01

    Full Text Available As formigas cortadeiras mostram preferência por algumas espécies vegetais, as quais são constantemente desfolhadas, enquanto outras não são atacadas, embora sejam abundantes e localizadas próximas ao ninho. As formigas dos gêneros Atta e Acromyrmex cortam plantas e transportam pedaços para os formigueiros. O material vegetal é usado para o cultivo do fungo Leucoagaricus gongylophorus, do qual se alimentam. Vários trabalhos utilizando extratos de plantas têm sido realizados para avaliar o efeito sobre o desenvolvimento do fungo simbionte. O objetivo deste trabalho foi avaliar a influência de meios de cultura acrescidos de diferentes extratos sobre o crescimento do fungo L. gongylophorus. Fungos das espécies Acromyrmex ambiguus, Acromyrmex crassispinus, Acromyrmex heyeri e Acromyrmex lundi foram inoculados nos meios Ágar Nutritivo e BDA, ambos acrescidos de melaço e de extratos de azevém (Lolium multiflorum Lam., tifa (Typha angustifolia L. e formiga (Atta sexdens piriventris. O meio Pagnocca foi utilizado como padrão. As placas foram mantidas em câmaras climatizadas à temperatura de 25 + 1°C e escotofase de 24 hs, por um período de 49 dias. O crescimento fúngico foi avaliado com base no diâmetro da colônia, sendo este avaliado em intervalos semanais, totalizando sete avaliações. Também foi avaliado o peso seco do fungo aos 53 dias. Os resultados mostraram que o fungo cultivado por diferentes espécies de formigas tem crescimento diferenciado em meios de cultura com diferentes extratos.The cutter ants show preference for some vegetable species, which are constantly defoliated, while others are not attacked, although they are abundant and located close to the nest. The ants of the goods Atta and Acromyrmex cut plants and they transport pieces to the anthills. The vegetable material is used for the cultivation of the mushroom Leucoagaricus gongylophorus, mushroom from of which theyfeed. Several works using extracts of

  19. PEMIKIRAN SYED MUHAMMAD NAQUIB AL-ATTAS TENTANG ISLAMISASI BAHASA SEBAGAI LANGKAH AWAL ISLAMISASI SAINS

    Directory of Open Access Journals (Sweden)

    A. Khudori Soleh

    2011-10-01

    Full Text Available Naguib’s Islamization of science is a response to negative impacts of modern science progress (the West which according to him is not based on Islamic world view. This has an impact on epistemological aspects, so that it can not be used as a method of scientific development in Islamic science. Therefore, there should be reformation of ontology and epistemology to get harmony and usefullness for the development of Islamic sciences. According to Naguib, world view of Islam is monotheism, unity, integration between psyche and physical, spiritual and material, even the spiritual aspect is more important. Based on this, the source of knowledge is not just the material of objects but the meaning of the object, so that knowledge does not fall on positivistic, materialistic and empiric. The method of achieving knowledge is done through the power of observation, rational thought, interpretations of revelation and intuition. The methods are not contradictory but complementary. As the first step of Islamization of science, which change the aspect of metaphysics (world view and epistemology, according to Naguib, can be started by Islamization of language

  20. Internalisasi Konsep Ta’dîb Al-Attas dalam Pengembangan Karakter Peserta Didik

    OpenAIRE

    M. Arfan Mu’ammar

    2013-01-01

    The ‘character building’ topic starts as the top topics in discussion latterly. Various training holds sporadically for the executives, teachers, and employer’s company in outbound form or workshop. Those activities are good definitely, but it’s not enough to build a character. We have to combine our efforts systematically and integrated, so the character building as we want can be effective, learnable and known by the others. That’s all because the intellectualities and cognitive capability ...

  1. Protein content of leaf-cutting ant queens before the nuptial flight and during the post-claustral phase

    Directory of Open Access Journals (Sweden)

    Edypo Jacob Silva

    2014-12-01

    Full Text Available Protein content of leaf-cutting ant queens before the nuptial flight and during the post-claustral phase. This study evaluated the crude protein content of queens of Atta sexdens before the nuptial flight and after the claustral phase in laboratory and field colonies. The hypothesis was that protein is used for survival of the queen and for early colony growth during the claustral phase. Additionally, the nest morphology, live biomass and adult population of field colonies were evaluated. Crude protein was determined by digestion of the organic material with sulfuric acid at high temperatures. The mean crude protein content was 123.23 ± 11.20 mg for females before the nuptial flight and 70.44 ± 12.21 mg for laboratory-reared queens after the claustral phase. The post-claustral crude protein content of field-collected queen was 55.90 ± 9.18 mg. With respect to the loss of crude protein as a function of duration of the claustral phase, laboratory-reared queens lost 52.79 mg and field-collected queens lost 67.33 mg compared to females before the nuptial flight. A positive linear correlation was observed between the weight of field-collected queens (256.4 ± 36.3 mg and colony biomass (13.02 ± 9.12 g, but there was no correlation between biomass and nest depth (13.11 ± 3.82 cm. As expected, the present results support the hypothesis that protein is used for survival of the queen and for early colony growth, as demonstrated by the reduction in crude protein content as a function of duration of the claustral phase. To our knowledge, this is the first study to provide data of the dynamics of protein reserves in leaf-cutting ant queens during the claustral phase.

  2. Energy substrate used by workers of leaf-cutting ants during nest excavation

    Directory of Open Access Journals (Sweden)

    Roberto S. Camargo

    2013-12-01

    Full Text Available Energy substrate used by workers of leaf-cutting ants during nest excavation. In this study we aimed to ascertain whether leaf-cutting ant workers lose body reserves (fat or sugars as a function of nest excavation. For each treatment, we isolated 10 workers of Atta sexdens into two experimental groups, Control (C- without excavation and Soil (S- with excavation, which were kept for different time intervals (0, 24, 48 or 72 hours, totaling 700 tested workers. We then determined the concentration of soluble carbohydrates and total lipid content in them. The total carbohydrates were determined colorimetrically, based on the reaction between carbohydrates and sulfuric acid-phenol. For determination of lipids, the insects were immersed in organic solvent until they reached a constant weight. Our results showed that carbohydrates are consumed during nest excavation activities. In the experimental groups S24, S48 and S72, there was an average reduction of 5.82 (20.42%, 14.31 (44.96% and 13.27 (43.96% µ.mg-1 in soluble sugar when compared with the experimental groups that did not excavate. Furthermore, the lipids were not used during this activity. With respect to dry mass of the workers, their values were C0 = 8%, C24 = 10.4%, C48 = 9.2%, C72 = 10%, S24 = 9.2%, S48 = 8.7% and S72 = 8.5%. Our results show experimentally that the source of energy for nest excavation is carbohydrates, whereas lipids are conserved for other activities.

  3. Ethnopharmacological survey among migrants living in the Southeast Atlantic Forest of Diadema, São Paulo, Brazil

    Directory of Open Access Journals (Sweden)

    Rodrigues Eliana

    2010-10-01

    Full Text Available Abstract Background Understanding how people of diverse cultural backgrounds have traditionally used plants and animals as medicinal substances during displacements is one of the most important objectives of ethnopharmacological studies. An ethnopharmacological survey conducted among migrants living in the Southeast Atlantic Forest remnants (Diadema, São Paulo, Brazil is presented herein. Methods Ethnographical methods were used to select and interview the migrants, and botanical and zoological techniques were employed to collect the indicated resources. Results We interviewed five migrants who described knowledge on 12 animals and 85 plants. Only 78 plants were present in Diadema, they belong to 37 taxonomic families; 68 were used exclusively for medicinal purposes, whereas 10 were reported to be toxic and/or presented some restriction of use. These taxa were grouped into 12 therapeutic categories (e.g., gastrointestinal disturbances, inflammatory processes or respiratory problems based on the 41 individual complaints cited by the migrants. While the twelve animal species were used by the migrants to treat nine complaints; these were divided into six categories, the largest of which related to respiratory problems. None of the animal species and only 57 of the 78 plant species analysed in the present study were previously reported in the pharmacological literature; the popular knowledge concurred with academic findings for 30 of the plants. The seven plants [Impatiens hawkeri W. Bull., Artemisia canphorata Vill., Equisetum arvensis L., Senna pendula (Humb. & Bonpl. ex Willd. H.S. Irwin & Barneby, Zea mays L., Fevillea passiflora Vell. and Croton fuscescens Spreng] and the two animals (Atta sexdens and Periplaneta americana that showed maintenance of use among migrants during their displacement in Brazilian territory, have not been studied by pharmacologists yet. Conclusions Thus, they should be highlighted and focused in further pharmacology

  4. Are ant assemblages of Brazilian veredas characterised by location or habitat type?

    Directory of Open Access Journals (Sweden)

    CB Costa-Milanez

    Full Text Available Wetland areas in the Brazilian Cerrado, known as “veredas”, represent ecosystems formed on sandy soils with high concentrations of peat, and are responsible for the recharge of aquiferous reservoirs. They are currently under threat by various human activities, most notably the clearing of vegetation for Eucalyptus plantations. Despite their ecological importance and high conservation value, little is known about the actual effects of human disturbance on the animal community. To assess how habitat within different veredas, and plantations surrounding them affect ant assemblages, we selected four independent vereda locations, two being impacted by Eucalyptus monoculture (one younger and one mature plantation and two controls, where the wetland was surrounded by cerrado vegetation. Ant sampling was conducted in May 2010 (dry season using three complementary methods, namely baits, pitfall traps, and hand collection, in the wetland and in the surrounding habitats. A total of 7,575 ants were sampled, belonging to seven subfamilies, 32 genera and 124 species. Ant species richness and abundance did not differ between vereda locations, but did between the habitats. When impacted by the monoculture, ant species richness and abundance decreased in wetlands, but were less affected in the cerrado habitat. Ant species composition differed between the three habitats and between vereda locations. Eucalyptus plantations had an ant species composition defined by high dominance of Pheidole sp. and Solenopsis invicta, while natural habitats were defined by Camponotus and Crematogaster species. Atta sexdens was strictly confined to native habitats of non-impacted “veredas”. Eucalyptus monocultures require high quantities of water in the early stages, which may have caused a decrease in groundwater level in the wetland, allowing hypogeic ants such as Labidus praedator to colonise this habitat.

  5. Are ant assemblages of Brazilian veredas characterised by location or habitat type?

    Science.gov (United States)

    Costa-Milanez, C B; Lourenço-Silva, G; Castro, P T A; Majer, J D; Ribeiro, S P

    2014-02-01

    Wetland areas in the Brazilian Cerrado, known as "veredas", represent ecosystems formed on sandy soils with high concentrations of peat, and are responsible for the recharge of aquiferous reservoirs. They are currently under threat by various human activities, most notably the clearing of vegetation for Eucalyptus plantations. Despite their ecological importance and high conservation value, little is known about the actual effects of human disturbance on the animal community. To assess how habitat within different veredas, and plantations surrounding them affect ant assemblages, we selected four independent vereda locations, two being impacted by Eucalyptus monoculture (one younger and one mature plantation) and two controls, where the wetland was surrounded by cerrado vegetation. Ant sampling was conducted in May 2010 (dry season) using three complementary methods, namely baits, pitfall traps, and hand collection, in the wetland and in the surrounding habitats. A total of 7,575 ants were sampled, belonging to seven subfamilies, 32 genera and 124 species. Ant species richness and abundance did not differ between vereda locations, but did between the habitats. When impacted by the monoculture, ant species richness and abundance decreased in wetlands, but were less affected in the cerrado habitat. Ant species composition differed between the three habitats and between vereda locations. Eucalyptus plantations had an ant species composition defined by high dominance of Pheidole sp. and Solenopsis invicta, while natural habitats were defined by Camponotus and Crematogaster species. Atta sexdens was strictly confined to native habitats of non-impacted "veredas". Eucalyptus monocultures require high quantities of water in the early stages, which may have caused a decrease in groundwater level in the wetland, allowing hypogeic ants such as Labidus praedator to colonise this habitat.

  6. Improving urban visibility through fractal analysis of street edges: The case of John Evans Atta Mills High Street in Accra, Ghana

    OpenAIRE

    R.A. Oppong; A.B. Marful; E.S. Asare

    2017-01-01

    Streets are a representation of cities, and the image of a city is a reflection of its home country. Although attempts to ensure harmonious spatial and environmental development in Ghanaian settlements date back to the colonial era, these efforts have minimal physical manifestation in the urban fabric of the city of Accra. The Independence Arch of Ghana, an important landmark in the urban fabric and history of Accra, lacks the striking vista and approach it deserves. This paper introduces the...

  7. Specificity in chemical profiles of workers, brood and mutualistic fungi in Atta, Acromyrmex, and Sericomyrmex fungus-growing ants

    DEFF Research Database (Denmark)

    Richard, Freddie-Jeanne; Poulsen, Michael; Drijfhout, Falko

    2007-01-01

    , acids, and esters. The chemical profiles in all three species are likely to be sufficiently different to allow discrimination at the species and colony level and sufficiently similar within colonies to generate a relatively constant colony-specific chemical gestalt. The relative likelihood of individual...

  8. Local distortion of the earth’s magnetic field as a proposal for handling the leafcutter ant species Atta spp. (Hymenoptera: Formicidae

    Directory of Open Access Journals (Sweden)

    Hernán Paz Penagos

    2012-05-01

    Full Text Available Studies regarding the spatial orientation of social insects (bees, termites and ants concerning their search for food, foraging and transporting it have received considerable attention during the last few years. Such studies have been aimed at learning so as to apply it to robotics (multiagents and ecological pest control. However, little is known about the types of orientation mechanism and their integration in such insects. This article presents some geomagnetic field detection studies dealing with controlling them by magnetotaxis or orientation experiments in Sasaima (Cundinamarca to formulate an ecological management proposal for ants from this species which greatly affect Colombian agriculture.

  9. Fluid intake rates in ants correlate with their feeding habits.

    Science.gov (United States)

    Paul, J; Roces, F

    2003-04-01

    This study investigates the techniques of nectar feeding in 11 different ant species, and quantitatively compares fluid intake rates over a wide range of nectar concentrations in four species that largely differ in their feeding habits. Ants were observed to employ two different techniques for liquid food intake, in which the glossa works either as a passive duct-like structure (sucking), or as an up- and downwards moving shovel (licking). The technique employed for collecting fluids at ad libitum food sources was observed to be species-specific and to correlate with the presence or absence of a well-developed crop in the species under scrutiny. Workers of ponerine ants licked fluid food during foraging and transported it as a droplet between their mandibles, whereas workers of species belonging to phylogenetically more advanced subfamilies, with a crop capable of storing liquids, sucked the fluid food, such as formicine ants of the genus Camponotus. In order to evaluate the performance of fluid collection during foraging, intake rates for sucrose solutions of different concentrations were measured in four ant species that differ in their foraging ecology. Scaling functions between fluid intake rates and ant size were first established for the polymorphic species, so as to compare ants of different size across species. Results showed that fluid intake rate depended, as expected and previously reported in the literature, on sugar concentration and the associated fluid viscosity. It also depended on both the species-specific feeding technique and the extent of specialization on foraging on liquid food. For similarly-sized ants, workers of two nectar-feeding ant species, Camponotus rufipes (Formicinae) and Pachycondyla villosa (Ponerinae), collected fluids with the highest intake rates, while workers of the leaf-cutting ant Atta sexdens (Myrmicinae) and a predatory ant from the Rhytidoponera impressa-complex (Ponerinae) did so with the lowest rate. Calculating the

  10. Differences in forage-acquisition and fungal enzyme activity contribute to niche segregation in Panamanian leaf-cutting ants

    DEFF Research Database (Denmark)

    Kooij, Pepijn Wilhelmus; Liberti, Joanito; Giampoudakis, Konstantinos

    2014-01-01

    activities of twelve fungus garden decomposition enzymes, belonging to the amylases, cellulases, hemicellulases, pectinases and proteinases, and show that average enzyme activity per unit of fungal mass in Atta gardens is lower than in Acromyrmex gardens. Expression profiles of fungal enzymes in Atta also...... for decomposition enzymes....

  11. Antioxidant benzophenones and xanthones from the root bark of ...

    African Journals Online (AJOL)

    Antioxidant benzophenones and xanthones from the root bark of Garcinia smeathmannii. Alain Meli Lannang, Justin Komguem, Fernande Ngounou Ngninzeko, Jean Gustave Tangmouo, David Lontsi, Asma Ajaz, Muhammad Iqbal Choudhary, Beiban Luc Sondengam, Atta -ur-Rahman ...

  12. Functional role of phenylacetic acid from metapleural gland secretions in controlling fungal pathogens in evolutionarily derived leaf-cutting ants

    DEFF Research Database (Denmark)

    Fernández-Marín, Hermógenes; Nash, David Richard; Higginbotham, Sarah

    2015-01-01

    Fungus-farming ant colonies vary four to five orders of magnitude in size. They employ compounds from actinomycete bacteria and exocrine glands as antimicrobial agents. Atta colonies have millions of ants and are particularly relevant for understanding hygienic strategies as they have abandoned...... their ancestors’ prime dependence on antibiotic-based biological control in favour of using metapleural gland (MG) chemical secretions. Atta MGs are unique in synthesizing large quantities of phenylacetic acid (PAA), a known but little investigated antimicrobial agent.We showthat particularly the smallestworkers...... derived leaf-cutting ants are less sensitive to PAA than strains from phylogenetically more basal fungus-farming ants, consistent with the dynamics of an evolutionary arms race between virulence and control for Escovopsis, but not Metarhizium. Atta ants form larger colonies with more extreme caste...

  13. TANGR2015 Heidelberg. Second international workshop on tracer applications of noble gas radionuclides in the geosciences

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2015-07-01

    TANGR2015 is a workshop on the progress in the technique and application of Atom Trap Trace Analyis (ATTA). It is a follow-up to the first TANGR workshop, TANGR2012, which was held at the Argonne National Laboratory, Argonne, USA, in June 2012. It is organized in response to recent technical advances and new applications of Atom Trap Trace Analysis (ATTA), an analytical method for measuring the isotopes {sup 81}Kr, {sup 85}Kr, and {sup 39}Ar. The primary aim of the workshop is to discuss the technical progress of ATTA and thereby enable innovative and timely applications of the noble gas radionuclides to important scientific problems in earth and environmental sciences, e.g. in the fields of groundwater hydrology, glaciology, oceanography, and paleoclimatology.

  14. Differences in forage-acquisition and fungal enzyme activity contribute to niche segregation in Panamanian leaf-cutting ants.

    Directory of Open Access Journals (Sweden)

    Pepijn W Kooij

    Full Text Available The genera Atta and Acromyrmex are often grouped as leaf-cutting ants for pest management assessments and ecological surveys, although their mature colony sizes and foraging niches may differ substantially. Few studies have addressed such interspecific differences at the same site, which prompted us to conduct a comparative study across six sympatric leaf-cutting ant species in Central Panama. We show that foraging rates during the transition between dry and wet season differ about 60 fold between genera, but are relatively constant across species within genera. These differences appear to match overall differences in colony size, especially when Atta workers that return to their nests without leaves are assumed to carry liquid food. We confirm that Panamanian Atta specialize primarily on tree-leaves whereas Acromyrmex focus on collecting flowers and herbal leaves and that species within genera are similar in these overall foraging strategies. Species within genera tended to be spaced out over the three habitat categories that we distinguished (forest, forest edge, open grassland, but each of these habitats normally had only a single predominant Atta and Acromyrmex species. We measured activities of twelve fungus garden decomposition enzymes, belonging to the amylases, cellulases, hemicellulases, pectinases and proteinases, and show that average enzyme activity per unit of fungal mass in Atta gardens is lower than in Acromyrmex gardens. Expression profiles of fungal enzymes in Atta also appeared to be more specialized than in Acromyrmex, possibly reflecting variation in forage material. Our results suggest that species- and genus-level identities of leaf-cutting ants and habitat-specific foraging profiles may give predictable differences in the expression of fungal genes coding for decomposition enzymes.

  15. U.S. Security Cooperation with India and Pakistan: A Comparative Study

    Science.gov (United States)

    2013-06-01

    news_and_features/. /07indicipline_force.htm. 284 Richard Van Atta et al ., “Export Controls and the U.S. Defense Industrial Base,” Institute for Defense...Kargil War,” Indian Defense and Strategic Analysis, November 17, 2012. Available at defenceforumindia.com › Opinion › History. Atta, Richard Van et al ...This document was downloaded on August 22, 2013 at 10:36:47 Author(s) Bajwa, Shahid Latif Title U.S. security cooperation with India and Pakistan

  16. Ar-39 Detection at the 10^-16 Isotopic Abundance Level with Atom Trap Trace Analysis

    OpenAIRE

    Jiang, W.; Williams, W. D.; Bailey, K.; Davis, A. M.; Hu, S. -M.; Lu, Z. -T.; O'Connor, T. P.; Purtschert, R.; Sturchio, N. C.; Sun, Y. R.; Mueller, P.

    2011-01-01

    Atom Trap Trace Analysis (ATTA), a laser-based atom counting method, has been applied to analyze atmospheric Ar-39 (half-life = 269 yr), a cosmogenic isotope with an isotopic abundance of 8x10^-16. In addition to the superior selectivity demonstrated in this work, counting rate and efficiency of ATTA have been improved by two orders of magnitude over prior results. Significant applications of this new analytical capability lie in radioisotope dating of ice and water samples and in the develop...

  17. African Journal of Biotechnology - Vol 13, No 11 (2014)

    African Journals Online (AJOL)

    Effect of road side dust pollution on the growth and total chlorophyll contents in Vitis vinifera L. (grape) · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Saadullah Khan Leghari, Mudassir Asrar Zaid, Atta Muhammed Sarangzai, Muhammed Faheem, Gulam Razaq ...

  18. The ejaculatory biology of leafcutter ants

    DEFF Research Database (Denmark)

    den Boer, Susanne; Stürup, Marlene; Boomsma, Jacobus Jan

    2015-01-01

    understanding of the fundamental biology of ejaculate production, transfer and physiological function remains extremely limited. We studied the ejaculation process in the leafcutter ant Atta colombica and found that it starts with the appearance of a clear pre-ejaculatory fluid (PEF) at the tip...

  19. Plant transcriptomics and responses to environmental stress

    Indian Academy of Sciences (India)

    Atta-ur-Rehman School of Applied Biosciences, National University of Sciences and Technology, H-12 Campus, Islamabad 25000, Pakistan; Stress Physiology Lab Department of Botany, Jiwaji University, Gwalior 474 011, India; Centre for Environmental Research, Near East University, 33010, Lefkosha, Turkish Republic ...

  20. evaluation of growth of young coconut and nut yield of old coconut

    African Journals Online (AJOL)

    User

    using ANOVA contrast. Comparisons with F- ... F. Prob. Cropping system: leaf N. 3 0.3404. 0.1135 0.92. 0.481ns. Contrast. C1: CCsole (2.160%) ..... Richard Nkrumah, Kenneth Atta-Peters and ... Begon, M., Townsend, C. R. and Harper, J. L.. 8.

  1. Eye size and behaviour of day- and night-flying leafcutting ant alates

    Science.gov (United States)

    John C. Moser; John D. Reeve; José Maunício S. Bento; Terezinha M.C. Della Lucia; R. Scott Cameron; Natalie M. Heck

    2004-01-01

    The morphology of insect eyes often seems to be shaped by evolution to match their behaviour and lifestyle. Here the relationship between the nuptial flight behaviour of 10 Atta species (Hymenoptera: Fonnicidae) and the eye size of male and female alates, including the compound eyes, ommatidia facets, and ocelli were examined. These species can be...

  2. Chemical releases of social behavior, II. source and specificity of the odor trail substances in four attine genera. (Hymenoptera: Formicidae)

    Science.gov (United States)

    Murray S. Blum; John C. Moser; A.D. Cordero

    1964-01-01

    The higher members of the tribe Attini characteristically lay persistent and extensive odor trails especially in many neotropical areas. Thus, in Acromyrmex and Atta, long columns of foraging workers are frequently present on the odor trails but in the less specialized attine genera, workers may forage either in files or singly. Weber (1958...

  3. The Antiaircraft Journal. Volume 94, Number 4, July-August 1953

    Science.gov (United States)

    1953-08-01

    JOHN A. 1\\lATTAS TIle writer of the following received _his commissioll from Virgillia Polytech- nic Institllte in 1939. Dllrillg "Varld \\Var II he...officer of Leaders Course. Other members of the staff include Lt. Robert G. Mangum, S3 officer, and Lt. Sam H. Biddle , Ad- jutant. Lt. Mangum has the

  4. Outdoor Recreation and Adventure Tourism: Unique but Allied Industries

    Science.gov (United States)

    Bailey, Andrew W.; Kang, H. K.; Lewis, T. Grant

    2017-01-01

    Outdoor recreation and adventure tourism are overlapping industries serving similar clientele. While descriptive marketing research exists for both industries (George Washington University School of Business [GW], Adventure Travel Trade Association [ATTA], & Xola Consulting [XC], 2010; Outdoor Foundation [OF], 2014), there is no clear…

  5. Dynamic disease management in trachymyrmex fungus-growing ants (Attini: Formicidae)

    DEFF Research Database (Denmark)

    Fernández-Marín, Hermógenes; Bruner, Gaspar; Gomez, Ernesto B.

    2013-01-01

    Abstract Multipartner mutualisms have potentially complex dynamics, with compensatory responses when one partner is lost or relegated to a minor role. Fungus-growing ants (Attini) are mutualistic associates of basidiomycete fungi and antibiotic-producing actinomycete bacteria; the former are atta...

  6. Has substrate-dependent co-evolution of enzyme function occured in the attine ant-fungus symbiosis

    DEFF Research Database (Denmark)

    de Fine Licht, Henrik Hjarvard; Schiøtt, Morten; Boomsma, Jacobus Jan

    The conspicuous leaf-cutter ants in the genus Atta build huge nests displacing several cubic meters of soil, whereas lower attine genera such as Cyphomyrmex have small nests with a fungus garden the size of a table-tennis ball. Only the leaf-cutter ants are specialized on using fresh leaves as su...

  7. Expresssing culture through drama: a reading of Anowa and the ...

    African Journals Online (AJOL)

    This paper examines the relationship between literature and culture through seminal effort exhibited in two plays; Anowa and The Marriage of Anansewa by Ama Atta Aidoo and Efua Sutherland respectively. With various discourse in the plays, we strive to analyse the link between literature and culture. The paper begins

  8. Al-Attas’ Philosophy of History on the Arrival and Proliferation of Islam in the Malay World

    Directory of Open Access Journals (Sweden)

    AZMUL FAHIMI KAMARUZAMAN

    2016-12-01

    Full Text Available This article examines the philosophy of history of Syed Muhammad Naquib al-Attas on the theory of the arrival and spread of Islam in the Malay world, particularly in his work ‘Historical Facts and Fictions’. This philosophy of history is consequent to al-Attas' critical research contained in his previous works such as ‘Preliminary Statement on a General Theory of The Islamization of the Malay-Indonesian Archipelago’ (1969, ‘Islam in the Malay History and Culture’ (1972 and ‘The Correct Date of the Terengganu Inscription’ (1972. This study analyses these works and his other works to look into the aspects of history and historiography contained in the philosophy of history of al-Attas on the arrival and spread of Islam in the Malay world in terms of their scope, sources and history methods. This study found that in terms of epistemology al-Attas has contributed in creating a theoretical framework and a novel approach to the philosophy of history of the history of Islam in the Malay world.

  9. Variation in fungal enzyme spectra may affect mutualistic division of labour between ants and fungus gardens

    DEFF Research Database (Denmark)

    de Fine Licht, Henrik Hjarvard; Boomsma, Jacobus Jan

    partners vary in metabolic performance, division of labour may not always be optimized and co-evolutionary trajectories become less predictable. The higher fungus-growing (attine) ants consist of the leafcutter ants (Acromyrmex and Atta), which rear a single fungal species throughout their Latin American...

  10. Atom Trap Trace Analysis for radiokrypton and radioargon dating

    Science.gov (United States)

    Williams, William; Jiang, Wei; Sun, Yun; Bailey, Kevin; Davis, Andrew; Hu, Shuiming; Lu, Zheng-Tian; Mueller, Peter; O'Connor, Thomas; Purtschert, Roland; Sturchio, Neil

    2011-05-01

    Atom Trap Trace Analysis (ATTA), a MOT-based atom counting method, is used to analyze three noble gas radioisotopes (81Kr, 85Kr, 39Ar) covering a wide range of geological ages and applications in the earth sciences. Their isotopic abundances are extremely low, in the range of 10-16 - 10-11. Yet, ATTA can trap and unmistakably detect these rare isotopes one atom at a time. The system is currently limited by the excitation efficiency of the RF discharge that produces the metastable atoms (Kr* & Ar*) needed for laser trapping. To further improve the MOT loading rate, we plan to replace the RF discharge with a photon excitation scheme that employs a VUV light source at 124 nm. The VUV source can be a lamp or a free electron laser. This work is supported by DOE, Office of Nuclear Physics and by NSF, Division of Earth Sciences.

  11. A pest is a pest is a pest? The dilemma of neotropical leaf-cutting ants: Keystone taxa of natural ecosystems

    Science.gov (United States)

    Fowler, Harold G.; Pagani, Maria Inez; da Silva, Osvaldo Aulino; Forti, Luis Carlos; da Silva, Virgilio Pereira; de Vasconcelos, Heraldo Luis

    1989-11-01

    Leaf-cutting ants of the genera Acromyrmex and Atta are considered the principal polyphagous pests of the Neotropics Although some members of these genera are of economic importance, have a broad geographic distribution, and are extremely good colonizers, others are endemic and closely interact with native ecosystems. Control is generally practiced against any colony, irrespective of its taxonomic status. Indiscriminate control coupled with habitat destruction threatens endemic species with extinction, and, through habitat simplification, favors other pest species. As nests of Atta are large, having several square meters of nest surface, the endemic taxa can be easily used as environmental indicators for natural ecosystems Likewise, the pest species can be used to detect environmental disturbance As these ants are keystone species and easily identified by nonspecialists, efforts should be made to integrate these into viable conservation programs

  12. Los estados inmaduros de Coelosis biloba (Coleoptera: Melolonthidae: Dynastinae y notas sobre su biología Immature stages of Coelosis biloba (Coleoptera: Melolonthidae: Dynastinae with notes on their biology

    Directory of Open Access Journals (Sweden)

    Luis Carlos Pardo-Locarno

    2006-12-01

    Full Text Available Se describen la larva de tercer estadio y las pupas de macho y hembra de Coelosis biloba (Linné 1767 con ejemplares recolectados en Colombia (Cauca y Valle y en México (Veracruz asociados con los hormigueros de Atta cephalotes (Linné 1750. Se incluyen ilustraciones de las estructuras diagnósticas, una clave para separar las larvas de tercer estadio hasta ahora conocidas de la tribu Oryctini en América, y observaciones sobre la biología de C. biloba como inquilino de los nidos de hormigas.The larva of third instar, male and female pupae of Coelosis biloba obtained inside ant nests of Atta cephalotes in Colombia (Cauca, Valle and Mexico (Veracruz are described. Drawings of diagnostic structures, a key to the known third instar larvae of American Oryctini, and observations on the biology of C. biloba as inquiline of ant nests, are included.

  13. Using Decision Analysis to Select Facility Maintenance Management Information Systems

    Science.gov (United States)

    2010-03-01

    Hart, A., & Ratnieks, F. L. (2002). Waste management in the leaf-cutting ant Atta colombica. Behavioral Ecology , 224-231. Heintz, J., Pollin ... Pollin , & Garret-Peltier, 2009). Maintenance departments can help themselves by implementing an information system to help better manage personnel...Wastewater collection system infrastructure research needs in the USA. Urban Water , 21-29. Takata, S., Kimura, F., van Houten, F., Westkamper, E

  14. An Examination of the Critical Factors of Store Brand Purchase Intentions

    OpenAIRE

    Zhao, XiaoQian

    2011-01-01

    Consumer behaviour is very complex interaction of affect, cognition, behaviour and environment activities, which deals with how and why individuals conduct the exchange events of products and service. Brand, as a signal of quality assurance and sometimes a symbol of identity, plays a significant role in consumer decision making process. Thus build up brand assets and improve brand equity is important in brand management. As a main source of consumer packaged goods, store brands should be atta...

  15. New Isotope Analysis Method: Atom Trap Mass Spectrometry

    International Nuclear Information System (INIS)

    Ko, Kwang Hoon; Park, Hyun Min; Han, Jae Min; Kim, Taek Soo; Cha, Yong Ho; Lim, Gwon; Jeong, Do Young

    2011-01-01

    Trace isotope analysis has been an important role in science, archaeological dating, geology, biology and nuclear industry. Some fission products such as Sr-90, Cs-135 and Kr-85 can be released to the environment when nuclear accident occurs and the reprocessing factory operates. Thus, the analysis of artificially produced radioactive isotopes has been of interest in nuclear industry. But it is difficult to detect them due to low natural abundance less then 10 -10 . In general, radio-chemical method has been applied to detect ultra-trace radio isotopes. But this method has disadvantages of long measurement time for long lived radioisotopes and toxic chemical process for the purification. The Accelerator Mass Spectrometer has high isotope selectivity, but the system is huge and its selectivity is affected by isobars. The laser based method, such as RIMS (Resonance Ionization Mass Spectrometry) has the advantage of isobar-effect free characteristics. But the system size is still huge for high isotope selective system. Recently, ATTA (Atom Trap Trace Analysis) has been successfully applied to detect ultra-trace isotope, Kr-81 and Kr-85. ATTA is the isobar-effect free detection with high isotope selectivity and the system size is small. However, it requires steady atomic beam source during detection, and is not allowed simultaneous detection of several isotopes. In this presentation, we introduce new isotope detection method which is a coupled method of Atom Trap Mass Spectrometry (ATMS). We expect that it can overcome the disadvantage of ATTA while it has both advantages of ATTA and mass spectrometer. The basic concept and the system design will be presented. In addition, the experimental status of ATMS will also be presented

  16. Response of wheat varieties to different nitrogen levels under agro-climatic conditions of mansehra

    International Nuclear Information System (INIS)

    Shahzad, K.; Khan, A.

    2013-01-01

    A field experiment, comprising of three Nitrogen levels viz.0, 60, 120 and 180 kg/ha and five wheat varieties, viz., Pir Sabak-04 (P.S), P.S-05, P.S-08, Atta Habib and Siran, was conducted at Agricultural Research Station, Baffa, Mansehra, in 2011. The experiment was laid out in randomised complete block design with split-plot arrangement. The results indicated that varieties and nitrogen levels were significantly different for tillers per m2, days to physiological maturity, plant height (cm), spike length, grains per spike, 1000 grains weight (gm), biological yield (kg/ha) and grain yield (kg/ha), while harvest index (%) was significantly affected by varieties only. Maximum tillers per m2 were produced in varieties P.S-2008, P.S-2004 and P.S-2005. Maximum days to physiological maturity and grains per spike were observed in variety P.S-2008. Taller plants were produced by variety P.S. 2005. Longer spikes, maximum thousand grains weight and grain yield (kg/ha) were obtained in varieties P.S-2008 and Atta Habib, respectively. Maximum biological yield (kg/ha) was recorded in Atta Habib. Among nitrogen levels, maximum tillers per m2, days to physiological maturity, longer spikes, number of grains per spike, thousand grains weight, biological yield and grain yield were maximum when N was applied at the rate of 120 kg/ha. Similarly the interactive response of varieties and nitrogen was significantly affected for days to emergence, grains per spike, biological yield, grain yield and harvest index (%). From the study, it was concluded that the varieties, Pir Sabak-2008 and Atta Habib, produced maximum seed yield whereas nitrogen applied at the rate of 120 kg/ha performed better in productivity than other treatments. (author)

  17. Not dead yet: the rise, fall and persistence of the BCG Matrix

    OpenAIRE

    Madsen, Dag Øivind

    2017-01-01

    The BCG Matrix was introduced almost 50 years ago, and is today considered one of the most iconic strategic planning techniques. Using management fashion theory as a theoretical lens, this paper examines the historical rise, fall and persistence of the BCG Matrix. The analysis highlights the role played by fashion-setting actors (e.g., consultants, business schools and business media) in the rise of the BCG Matrix. However, over time, portfolio planning models such as the BCG Matrix were atta...

  18. Developing geometrical reasoning

    OpenAIRE

    Brown, Margaret; Jones, Keith; Taylor, Ron; Hirst, Ann

    2004-01-01

    This paper summarises a report (Brown, Jones & Taylor, 2003) to the UK Qualifications and Curriculum Authority of the work of one geometry group. The group was charged with developing and reporting on teaching ideas that focus on the development of geometrical reasoning at the secondary school level. The group was encouraged to explore what is possible both within and beyond the current requirements of the UK National Curriculum and the Key Stage 3 strategy, and to consider the whole atta...

  19. Leukotriene C4 synthase and ischemic cardiovascular disease and obstructive pulmonary disease in 13,000 individuals

    DEFF Research Database (Denmark)

    Freiberg, Jacob J; Dahl, Morten; Tybjaerg-Hansen, Anne

    2009-01-01

    Ischemic cardiovascular disease and obstructive pulmonary disease involve inflammation. Leukotrienes may be important pro-inflammatory mediators. We tested the hypothesis that the (-1072)G > A and (-444)A > C promoter polymorphisms of leukotriene C4 synthase confer risk of transient ischemic atta...... with risk of asthma or COPD. Leukotriene C4 synthase promoter genotypes influence risk of TIA and ischemic stroke, but not risk of IHD/coronary atherosclerosis, asthma, or COPD....

  20. Household Coverage of Fortified Staple Food Commodities in Rajasthan, India.

    Directory of Open Access Journals (Sweden)

    Grant J Aaron

    Full Text Available A spatially representative statewide survey was conducted in Rajasthan, India to assess household coverage of atta wheat flour, edible oil, and salt. An even distribution of primary sampling units were selected based on their proximity to centroids on a hexagonal grid laid over the survey area. A sample of n = 18 households from each of m = 252 primary sampling units PSUs was taken. Demographic data on all members of these households were collected, and a broader dataset was collected about a single caregiver and a child in the first 2 years of life. Data were collected on demographic and socioeconomic status; education; housing conditions; recent infant and child mortality; water, sanitation, and hygiene practices; food security; child health; infant and young child feeding practices; maternal dietary diversity; coverage of fortified staples; and maternal and child anthropometry. Data were collected from 4,627 households and the same number of caregiver/child pairs. Atta wheat flour was widely consumed across the state (83%; however, only about 7% of the atta wheat flour was classified as fortifiable, and only about 6% was actually fortified (mostly inadequately. For oil, almost 90% of edible oil consumed by households in the survey was classified as fortifiable, but only about 24% was fortified. For salt, coverage was high, with almost 85% of households using fortified salt and 66% of households using adequately fortified salt. Iodized salt coverage was also high; however, rural and poor population groups were less likely to be reached by the intervention. Voluntary fortification of atta wheat flour and edible oil lacked sufficient industry consolidation to cover significant portions of the population. It is crucial that appropriate delivery channels are utilized to effectively deliver essential micronutrients to at-risk population groups. Government distribution systems are likely the best means to accomplish this goal.

  1. Asynchronous Discrete Control of Continuous Processes.

    Science.gov (United States)

    1986-02-24

    Input. When 40-lead dual-in-line ceramic packages (D suffix) and in the mode input is high IMOOE=1), the CDPIS54A is 40-lead dual-in-line plastic ...DYNAIC U ThIi. CA~ YRi5iC5 TACDPI8541 CDPI854C DYNAMC LECRICL CARA ERITIC atTA 40 o +UC. DD M W O 1110 VlH’& 7 VDD. VIL, 3 . LIIMTS ’.- CARACTERISTIC

  2. Gender v armádě

    OpenAIRE

    MLČOCHOVÁ, Vlasta

    2014-01-01

    The theoretical part of bachelor's thesis is focused on the explanation of basic concepts gender, gender stereotypes, principle of equal opportunities for men and women, discrimination based on sex, harassment in the workplace and sexual harassment in the workplace. Furthermore, first chapter describes how woman or man may be recruited into Czech army. Joining the army is described in details, there are shown differences and the course itself, whose goal is to teach basic military skills.Atta...

  3. Ultra-Trace Analysis of Krypton-85

    International Nuclear Information System (INIS)

    Daerr, H.; Kalinowski, M.; Kohler, M.; Sahling, P.

    2010-01-01

    To strengthen the efficiency and effectiveness of nuclear safeguards for detecting undeclared nuclear material and activities we propose to use the radioactive krypton isotope Krypton-85 as a tracer for clandestine plutonium production. The main idea is to detect inexplicable atmospheric Kr85 concentration using the novel technology atom trap trace analysis (ATTA) in order to detect an undeclared reprocessing facility. The Additional Protocol (INFCIRC/540, 1997) establishes the possibility to take environmental samples. Krypton-85 has a combination of unique features which makes it an ideal tracer for plutonium separation activities anywhere in the world. It is always generated along with plutonium and 99.9% remains within the fuel cladding. Due to its half-life of 10.76 years, significant amounts of krypton-85 still remain in the spent fuel even after long cooling times. Krypton is not removed from the atmosphere by any processes like chemical reactions or wash-out. Furthermore, there are no other relevant sources of krypton-85 besides of reprocessing. The novel technology of atom trap trace analysis (ATTA) has been demonstrated by the physics group at Argonne National Laboratory in 1999. This is an ultra-sensitive trace analysis technique able to detect single krypton atoms. We are setting up an ATTA apparatus in our laboratory, which is designed to fulfill all requirements to detect clandestine plutonium production. Our goal is to determine Krypton-85 concentration of one liter samples of atmospheric air with an analysis time of 3 hours. This sample volume reduction is a significant step, since one liter can be taken as a grab sample by sucking it directly into pre-evacuated bottles at atmospheric pressure. The small samples size and the short analysis time of ATTA will make it possible to use krypton-85 as a tracer for clandestine plutonium production with routine operation. (author)

  4. Hidden Dragon, Crouching Lion: How China’s Advance in Africa is Underestimated and Africa’s Potential Underappreciated

    Science.gov (United States)

    2012-09-01

    cocoa exports.126 During President John Atta Mills’s state visit to China in September 2010, an agreement was signed with Chinese financial institu...China surpassed the United States in 2010, according to the International Energy Agency [IEA]; in 2000, its energy consumption was half that of the...Egypt, wine from South Africa, cocoa beans from Ghana, coffee from Uganda, olive oil from Tunisia, and sesame from Ethiopia and Senegal have become

  5. The status of the fungi-grower ants (Hymenoptera: Formicidae) in Puerto Rico and adjacent islands

    Science.gov (United States)

    J.A. Torres

    1989-01-01

    Ants of the tribe Attini (fungus grower) collect different organic materials that are used to grow a fungus. It was thought that the fungus mycelium was the only source of nutrition for these ants, but Quinlan and Cherrett found that Atta cephalotes (L.) squeezes oils from fresh leaves and uses them as food.  These oils supplement the fungus material eaten by this...

  6. Extended-Range Passive RFID and Sensor Tags

    Science.gov (United States)

    Fink, Patrick W.; Kennedy, Timothy F.; Lin, Gregory Y.; Barton, Richard

    2012-01-01

    Extended-range passive radio-frequency identification (RFID) tags and related sensor tags are undergoing development. A tag of this type incorporates a retroreflective antenna array, so that it reflects significantly more signal power back toward an interrogating radio transceiver than does a comparable passive RFID tag of prior design, which does not incorporate a retroreflective antenna array. Therefore, for a given amount of power radiated by the transmitter in the interrogating transceiver, a tag of this type can be interrogated at a distance greater than that of the comparable passive RFID or sensor tag of prior design. The retroreflective antenna array is, more specifically, a Van Atta array, named after its inventor and first published in a patent issued in 1959. In its simplest form, a Van Atta array comprises two antenna elements connected by a transmission line so that the signal received by each antenna element is reradiated by the other antenna element (see Figure 1). The phase relationships among the received and reradiated signals are such as to produce constructive interference of the reradiated signals; that is, to concentrate the reradiated signal power in a direction back toward the source. Hence, an RFID tag equipped with a Van Atta antenna array automatically tracks the interrogating transceiver. The effective gain of a Van Atta array is the same as that of a traditional phased antenna array having the same number of antenna elements. Additional pairs of antenna elements connected by equal-length transmission lines can be incorporated into a Van Atta array to increase its directionality. Like some RFID tags here-to-fore commercially available, an RFID or sensor tag of the present developmental type includes one-port surface-acoustic-wave (SAW) devices. In simplified terms, the mode of operation of a basic one-port SAW device as used heretofore in an RFID device is the following: An interrogating radio signal is converted, at an input end, from

  7. Effect of dietary curries on the glycaemic index.

    Science.gov (United States)

    Pirasath, S; Thayaananthan, K; Balakumar, S; Arasaratnam, V

    2010-12-01

    Determination of the glycaemic index (GI) of different basic foods in combination with different curries. METHODS; Healthy volunteers (n = 20) of 21.05 (+/- 0.92) years old, 53.90 (+/- 9.36) kg in body weight, 153.92 (+/- 9.15) cm in height and 20.55 (+/- 2.22) kgm(-2) of body mass index were included. After overnight fasting, 75g of glucose and each test food containing 75g of digestible carbohydrate were administered and blood glucose level measured half hourly for two hours. The GI was calculated and analysed by randomised complete block design using SAS analytical package. The mean GI values of parboiled rice ('Mottaikarupan') either with green leaf curry (Amaranthus) or gravy (soya meat) or green leaf curry and gravy were 47.47 (+/- 11.21), 56.30 (+/- 9.31) and 54.67 (+/- 10.03) % respectively. The mean GI of 'kurakkan pittu' (Eleucine coracana) with the above curries were 57.51 (+/- 5.52), 63.25 (+/- 8.86) and 59.25 (+/- 5.49) % respectively. The mean GI of 'atta pittu' (whole wheat grain flour) with the above curries were 44.40 (+/-14.27), 50.80 (+/- 9.35) and 46.29 (+/- 8.90) % respectively. The GI of parboiled rice or 'kurakkan pittu' or 'atta pittu' with green leaf curry differed significantly (p gravy or green leaf curry and gravy did not differ significantly (p > 0.05) among them. 'Kurakkan pittu' is inferior to 'atta pittu' and parboiled rice. Including curries to basic foods altered the GI. Therefore, when dietary advice is given to diabetic patients, not only the basic foods, but also the curries to be consumed have to be considered.

  8. Molecular phylogenetic reconstruction and localization of the (TTAGGn telomeric repeats in the chromosomes of Acromyrmex striatus (Roger, 1863 suggests a lower ancestral karyotype for leafcutter ants (Hymenoptera

    Directory of Open Access Journals (Sweden)

    Tássia Tatiane Pontes Pereira

    2018-01-01

    Full Text Available Chromosome counts and karyotype characterization have proved to be important features of a genome. Chromosome changes during the diversification of ants might play an important role, given the diversity and success of Formicidae. Comparative karyotype analyses on ants have enriched and helped ant systematics. Among leafcutter ants, two major chromosome counts have been described, one frequent in Atta Fabricius, 1804 (2n = 22 in all Atta spp. whose karyotype is known and the other frequent in Acromyrmex Mayr, 1865 (2n = 38 in the majority of species whose karyotype is known. The main exception is Acromyrmex striatus (Roger, 1863, which harbors a diploid chromosome set of 22. Here we describe the use of fluorescence in situ hybridization (FISH with telomeric probes with (TTAGG6 repeats to describe the telomere composition of A. striatus and to recover potential interstitial non-telomeric signals that may reflect fusion events during the evolution of leafcutter lineage from 38 to 22 chromosomes. Further, we reconstruct the ancestral chromosome numbers of the leafcutter clade based on a recently proposed molecular phylogenetic hypothesis and phylogenomic tree. Distinct signals have been observed in both extremities on the telomere chromosomes of A. striatus. Non-telomeric signals have not been retrieved in our analysis. It could be supposed that the low-numbered karyotype indeed represents the ancestral chromosome number of leafcutters. The phylogenetic reconstruction also recovered a low chromosome number from the diverse approaches implemented, suggesting that n = 11 is the most likely ancestral karyotype of the leafcutter ants and is a plesiomorphic feature shared between A. striatus and Atta spp.

  9. Low variation in ribosomal DNA and internal transcribed spacers of the symbiotic fungi of leaf-cutting ants (Attini: Formicidae

    Directory of Open Access Journals (Sweden)

    Silva-Pinhati A.C.O.

    2004-01-01

    Full Text Available Leaf-cutting ants of the genera Atta and Acromyrmex (tribe Attini are symbiotic with basidiomycete fungi of the genus Leucoagaricus (tribe Leucocoprineae, which they cultivate on vegetable matter inside their nests. We determined the variation of the 28S, 18S, and 5.8S ribosomal DNA (rDNA gene loci and the rapidly evolving internal transcribed spacers 1 and 2 (ITS1 and ITS2 of 15 sympatric and allopatric fungi associated with colonies of 11 species of leafcutter ants living up to 2,600 km apart in Brazil. We found that the fungal rDNA and ITS sequences from different species of ants were identical (or nearly identical to each other, whereas 10 GenBank Leucoagaricus species showed higher ITS variation. Our findings suggest that Atta and Acromyrmex leafcutters living in geographic sites that are very distant from each other cultivate a single fungal species made up of closely related lineages of Leucoagaricus gongylophorus. We discuss the strikingly high similarity in the ITS1 and ITS2 regions of the Atta and Acromyrmex symbiotic L. gongylophorus studied by us, in contrast to the lower similarity displayed by their non-symbiotic counterparts. We suggest that the similarity of our L. gongylophorus isolates is an indication of the recent association of the fungus with these ants, and propose that both the intense lateral transmission of fungal material within leafcutter nests and the selection of more adapted fungal strains are involved in the homogenization of the symbiotic fungal stock.

  10. Molecular phylogenetic reconstruction and localization of the (TTAGG)n telomeric repeats in the chromosomes of Acromyrmex striatus (Roger, 1863) suggests a lower ancestral karyotype for leafcutter ants (Hymenoptera).

    Science.gov (United States)

    Pereira, Tássia Tatiane Pontes; Dos Reis, Ana Caroline Coelho Corrêa; Cardoso, Danon Clemes; Cristiano, Maykon Passos

    2018-01-01

    Chromosome counts and karyotype characterization have proved to be important features of a genome. Chromosome changes during the diversification of ants might play an important role, given the diversity and success of Formicidae. Comparative karyotype analyses on ants have enriched and helped ant systematics. Among leafcutter ants, two major chromosome counts have been described, one frequent in Atta Fabricius, 1804 (2n = 22 in all Atta spp. whose karyotype is known) and the other frequent in Acromyrmex Mayr, 1865 (2n = 38 in the majority of species whose karyotype is known). The main exception is Acromyrmex striatus (Roger, 1863), which harbors a diploid chromosome set of 22. Here we describe the use of fluorescence in situ hybridization (FISH) with telomeric probes with (TTAGG) 6 repeats to describe the telomere composition of A. striatus and to recover potential interstitial non-telomeric signals that may reflect fusion events during the evolution of leafcutter lineage from 38 to 22 chromosomes. Further, we reconstruct the ancestral chromosome numbers of the leafcutter clade based on a recently proposed molecular phylogenetic hypothesis and phylogenomic tree. Distinct signals have been observed in both extremities on the telomere chromosomes of A. striatus . Non-telomeric signals have not been retrieved in our analysis. It could be supposed that the low-numbered karyotype indeed represents the ancestral chromosome number of leafcutters. The phylogenetic reconstruction also recovered a low chromosome number from the diverse approaches implemented, suggesting that n = 11 is the most likely ancestral karyotype of the leafcutter ants and is a plesiomorphic feature shared between A. striatus and Atta spp.

  11. Monoculture of leafcutter ant gardens.

    Directory of Open Access Journals (Sweden)

    Ulrich G Mueller

    2010-09-01

    Full Text Available Leafcutter ants depend on the cultivation of symbiotic Attamyces fungi for food, which are thought to be grown by the ants in single-strain, clonal monoculture throughout the hundreds to thousands of gardens within a leafcutter nest. Monoculture eliminates cultivar-cultivar competition that would select for competitive fungal traits that are detrimental to the ants, whereas polyculture of several fungi could increase nutritional diversity and disease resistance of genetically variable gardens.Using three experimental approaches, we assessed cultivar diversity within nests of Atta leafcutter ants, which are most likely among all fungus-growing ants to cultivate distinct cultivar genotypes per nest because of the nests' enormous sizes (up to 5000 gardens and extended lifespans (10-20 years. In Atta texana and in A. cephalotes, we resampled nests over a 5-year period to test for persistence of resident cultivar genotypes within each nest, and we tested for genetic differences between fungi from different nest sectors accessed through excavation. In A. texana, we also determined the number of Attamyces cells carried as a starter inoculum by a dispersing queens (minimally several thousand Attamyces cells, and we tested for genetic differences between Attamyces carried by sister queens dispersing from the same nest. Except for mutational variation arising during clonal Attamyces propagation, DNA fingerprinting revealed no evidence for fungal polyculture and no genotype turnover during the 5-year surveys.Atta leafcutter ants can achieve stable, fungal monoculture over many years. Mutational variation emerging within an Attamyces monoculture could provide genetic diversity for symbiont choice (gardening biases of the ants favoring specific mutational variants, an analog of artificial selection.

  12. An Overview of Integrated Management of Leaf-Cutting Ants (Hymenoptera: Formicidae in Brazilian Forest Plantations

    Directory of Open Access Journals (Sweden)

    Ronald Zanetti

    2014-03-01

    Full Text Available Brazilian forest producers have developed integrated management programs to increase the effectiveness of the control of leaf-cutting ants of the genera Atta and Acromyrmex. These measures reduced the costs and quantity of insecticides used in the plantations. Such integrated management programs are based on monitoring the ant nests, as well as the need and timing of the control methods. Chemical control employing baits is the most commonly used method, however, biological, mechanical and cultural control methods, besides plant resistance, can reduce the quantity of chemicals applied in the plantations.

  13. The 9/11 Commission Report

    Science.gov (United States)

    2004-07-17

    at a COUNTERTERRORISM EVOLVES 97 Final1-4.4pp 7/17/04 9:12 AM Page 97 disco in Berlin, killing two American soldiers. Intelligence clearly linked...knowing where to find the best discos and beaches in Beirut, and in Greifswald was known to enjoy student parties and drinking beer. Although he continued...easier to fly than Airbus aircraft, which he understood had an autopilot feature that did not allow them to be crashed into the ground.149 Finally,Atta

  14. Sperm storage induces an immunity cost in ants

    DEFF Research Database (Denmark)

    Baer, Boris; Armitage, Sophie A O; Boomsma, Jacobus J

    2006-01-01

    Ant queens are among the most long-lived insects known. They mate early in adult life and maintain millions of viable sperm in their sperm storage organ until they die many years later. Because they never re-mate, the reproductive success of queens is ultimately sperm-limited, but it is not known...... what selective forces determine the upper limit to sperm storage. Here we show that sperm storage carries a significant cost of reduced immunity during colony founding. Newly mated queens of the leaf-cutting ant Atta colombica upregulate their immune response shortly after completing their nest burrow...

  15. Climate Change Effects: Issues for International and US National Security

    Science.gov (United States)

    2009-07-01

    Philip Meade, Mr. Michael Nash, Ms. Vanessa Pena, Mr. Ronald Rolph, Dr. Jocelyn Seng, Mr. Mark Tillman, Dr. Richard Van Atta, Mr. Ryan Wagner, Gen...DeRiggi, Dr. Tony Fainberg, Mr. Keith Green, Mr. Frederick Hartman, Mr. Edward Kenschaft, Dr. Gregory Larsen, Dr. Jamie Link, Mr. Frank Mahncke, Mr...Worst-case Scenario of Climate Change in the South-west Pacific, study by Edwards . Study   Appendix B:   Recommendations for DoD – Response to

  16. Cartography past, present and future

    CERN Document Server

    Rhind, DW

    2013-01-01

    Making maps dates back at least four thousand years and it is widely recognised that many maps are of great historical value and present a skilled method of summarising the real world on a sheet of paper. Less well known is the judgement involved in the selection and simplification of features, the complex transformation of space and the exacting standards which are needed in cartography. This book is primarily a tribute to Professor F.J. Ormeling, former President and Secretary/Treasurer of the ICA and gives a wide ranging review of the current status of cartography, how this status was atta

  17. FEMINIST LITERARY NOTES: Questions of Identity in Everything Good Will Come and We Need New Names.

    Directory of Open Access Journals (Sweden)

    Ruan Nunes

    2016-07-01

    Full Text Available Feminism as a movement has adapted/changed as time goes by and contemporary literature produced by female African writers has recently offered a locus to assess how the movement has favoured the field. Two novels are briefly investigated in this article, namely Everything Good Will Come by Nigerian Sefi Atta and We Need New Namesby Zimbabwan NoViolet Bulwayo. My aim is to discuss how feminism, in its close-knit relationship with postcolonialism, dialogues with the aforementioned literature to offer some reflection upon the position of the woman as a doubly colonised subject, with special attention to questions of identity.

  18. The Dynamic Terrorist Threat: An Assessment of Group Motivations and Capabilities in a Changing World

    Science.gov (United States)

    2004-01-01

    Liberty and Disneyland ,15 and some of the hijackers, such as Mohammad Atta, enrolled in flight schools in preparation for the attack.16 Although al...Tower, the Golden Gate Bridge, Disneyland , and Universal Studios. The tapes were allegedly shot by Ghasoub Abrash Ghalyoun in 1997. See Walter Pincus...information on the finances of FARC, see “Los Costos del Cese al Fuego,” El País, July 6, 2000; “El Otro Plan Colombia,” Cambio, March 20, 2000, pp. 25–26

  19. A chimeric protein of aluminum-activated malate transporter generated from wheat and Arabidopsis shows enhanced response to trivalent cations.

    Science.gov (United States)

    Sasaki, Takayuki; Tsuchiya, Yoshiyuki; Ariyoshi, Michiyo; Ryan, Peter R; Yamamoto, Yoko

    2016-07-01

    TaALMT1 from wheat (Triticum aestivum) and AtALMT1 from Arabidopsis thaliana encode aluminum (Al)-activated malate transporters, which confer acid-soil tolerance by releasing malate from roots. Chimeric proteins from TaALMT1 and AtALMT1 (Ta::At, At::Ta) were previously analyzed in Xenopus laevis oocytes. Those studies showed that Al could activate malate efflux from the Ta::At chimera but not from At::Ta. Here, functions of TaALMT1, AtALMT1 and the chimeric protein Ta::At were compared in cultured tobacco BY-2 cells. We focused on the sensitivity and specificity of their activation by trivalent cations. The activation of malate efflux by Al was at least two-fold greater in the chimera than the native proteins. All proteins were also activated by lanthanides (erbium, ytterbium, gadolinium, and lanthanum), but the chimera again released more malate than TaALMT1 or AtALMT1. In Xenopus oocytes, Al, ytterbium, and erbium activated inward currents from the native TaALMT1 and the chimeric protein, but gadolinium only activated currents from the chimera. Lanthanum inhibited currents from both proteins. These results demonstrated that function of the chimera protein was altered compared to the native proteins and was more responsive to a range of trivalent cations when expressed in plant cells. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Development of Myrmeleon brasiliensis (Navas) (Neuroptera, Myrmeleontidae), in laboratory, with different natural diets

    Energy Technology Data Exchange (ETDEWEB)

    Missirian, Giani L.B. [Centro Universitario da Grande Dourados, MS (Brazil). Curso de Ciencias Biologicas; Uchoa-Fernandes, Manoel A. [Universidade Federal da Grande Dourados, MS (Brazil). Faculdade de Ciencias Biologicas e Ambientais]. E-mail: uchoa.fernandes@ufgd.edu.br; Fischer, Erich [Universidade Federal de Mato Grosso do Sul, Campo Grande, MS (Brazil). Dept. de Biologia

    2006-07-01

    Antlions larvae are sit-and-wait predators that capture arthropod prey in conical sand pits. The aim of this paper were to determine the effect of different natural diets [leaf-cutting ants (Atta spp.), fruit fly larvae (Anastrepha spp. and Ceratitis capitata) and mixed diet (Atta spp. plus fruit fly larvae)] on the development of larvae and pupae of M. brasiliensis (Navas, 1914) and to estimate the number and size of prey caught in each instar and on each kind of diet. The average duration (days) of the second and third instars of M. brasiliensis was longer when larvae of antlion were fed with leaf-cutting ants. The diets did not affect the duration of the pupal stage nor the pupae size. The different diets did not affect the mean width of head capsule (mm), the mean weight (mg) or the mean body size (mm) in the different instars of M. brasiliensis. In the second and third instars, the larvae of M. brasiliensis fed with leaf-cutting ants consumed more prey than larvae kept on other diets. Adults whose larvae were fed fruit fly larvae were larger than adults on other diets. Although Myrmeleontidae are few studied in Brazil, these results contribute to knowledge of M. brasiliensis biology, but also suggest the need of studies about the development of larvae and pupae in natural environments. (author)

  1. Developmental Regulation of Gonadotropin-releasing Hormone Gene Expression by the MSX and DLX Homeodomain Protein Families*

    Science.gov (United States)

    Givens, Marjory L.; Rave-Harel, Naama; Goonewardena, Vinodha D.; Kurotani, Reiko; Berdy, Sara E.; Swan, Christo H.; Rubenstein, John L. R.; Robert, Benoit; Mellon, Pamela L.

    2010-01-01

    Gonadotropin-releasing hormone (GnRH) is the central regulator of the hypothalamic-pituitary-gonadal axis, controlling sexual maturation and fertility in diverse species from fish to humans. GnRH gene expression is limited to a discrete population of neurons that migrate through the nasal region into the hypothalamus during embryonic development. The GnRH regulatory region contains four conserved homeodomain binding sites (ATTA) that are essential for basal promoter activity and cell-specific expression of the GnRH gene. MSX and DLX are members of the Antennapedia class of non-Hox homeodomain transcription factors that regulate gene expression and influence development of the craniofacial structures and anterior forebrain. Here, we report that expression patterns of the Msx and Dlx families of homeodomain transcription factors largely coincide with the migratory route of GnRH neurons and co-express with GnRH in neurons during embryonic development. In addition, MSX and DLX family members bind directly to the ATTA consensus sequences and regulate transcriptional activity of the GnRH promoter. Finally, mice lacking MSX1 or DLX1 and 2 show altered numbers of GnRH-expressing cells in regions where these factors likely function. These findings strongly support a role for MSX and DLX in contributing to spatiotemporal regulation of GnRH transcription during development. PMID:15743757

  2. Developmental regulation of gonadotropin-releasing hormone gene expression by the MSX and DLX homeodomain protein families.

    Science.gov (United States)

    Givens, Marjory L; Rave-Harel, Naama; Goonewardena, Vinodha D; Kurotani, Reiko; Berdy, Sara E; Swan, Christo H; Rubenstein, John L R; Robert, Benoit; Mellon, Pamela L

    2005-05-13

    Gonadotropin-releasing hormone (GnRH) is the central regulator of the hypothalamic-pituitary-gonadal axis, controlling sexual maturation and fertility in diverse species from fish to humans. GnRH gene expression is limited to a discrete population of neurons that migrate through the nasal region into the hypothalamus during embryonic development. The GnRH regulatory region contains four conserved homeodomain binding sites (ATTA) that are essential for basal promoter activity and cell-specific expression of the GnRH gene. MSX and DLX are members of the Antennapedia class of non-Hox homeodomain transcription factors that regulate gene expression and influence development of the craniofacial structures and anterior forebrain. Here, we report that expression patterns of the Msx and Dlx families of homeodomain transcription factors largely coincide with the migratory route of GnRH neurons and co-express with GnRH in neurons during embryonic development. In addition, MSX and DLX family members bind directly to the ATTA consensus sequences and regulate transcriptional activity of the GnRH promoter. Finally, mice lacking MSX1 or DLX1 and 2 show altered numbers of GnRH-expressing cells in regions where these factors likely function. These findings strongly support a role for MSX and DLX in contributing to spatiotemporal regulation of GnRH transcription during development.

  3. TRADITIONAL USE OF THREE EDIBLE INSECTS IN COFFEE AGROECOSYSTEMS IN THE STATE OF VERACRUZ

    Directory of Open Access Journals (Sweden)

    Esteban Escamilla Prado

    2012-11-01

    Full Text Available Coffee (Coffea arabica L. is one of the most economically, socioculturally and environmentally important crops in Veracruz. Shade-grown coffee plantations provide environmental services and play a key role in biodiversity conservation. In coffee farms in Veracruz insects are an abundant natural resource, and part of the use of this resource is the consumption of some edible insects in certain coffee regions. The objective of this study was to know the traditional use of three species of edible insects in the coffee agroecosystem of Veracruz. During the period 2007-2012, an ethnoentomological study was conducted in coffee regions from central Veracruz. The insect species identified were the ants chicatanas (Atta mexicana Smith and Atta cephalotes Latreille in the municipality of Huatusco, the larva gusano del jonote (Arsenura armida armida Cramer in the municipalities of Zongolica, Tequila and Tezonapa, and the larva gusanillo (Phassus triangularis H.E. in the municipalities of Córdoba, Ixhuatlán del Café, Tepatlaxco, Chocamán and Zongolica. The results showed the traditional knowledge held by coffee growers related to these edible species which are a valuable natural resource in their coffee plantations. Knowledge on agroecological relationships, collection, consumption and marketing was rescued. In conclusion, the insect species studied are used for local consumption and have great economic potential due to their high sell price during the harvest season.

  4. All-optical atom trap trace analysis for rare krypton isotopes

    Energy Technology Data Exchange (ETDEWEB)

    Woelk, Pablo; Kohler, Markus; Sieveke, Carsten; Hebel, Simon; Sahling, Peter [Carl Friedrich von Weizsaecker Centre for Science and Peace Research, University of Hamburg (Germany); Becker, Christoph; Sengstock, Klaus [Institut fuer Laser-Physik, University of Hamburg (Germany)

    2016-07-01

    The isotope Krypton-85 is an excellent indicator for the detection of nuclear reprocessing activities. However, for the analysis of atmospheric air samples, sensitive measuring methods down to the single atom level are required because of the small concentrations. Furthermore, for a practical and effective detection of clandestine reprocessing, small sample sizes and a high sample throughput rate are desirable. Established methods using Atom Trap Trace Analysis (ATTA) allow high sensitivity but have a limited throughput of about 200 samples per year, since the vacuum chambers have to be flushed for several hours after each measurement to avoid cross contamination due to the RF-driven excitation of metastable states. Here we present an enhanced ATTA apparatus, which in contrast to the established methods, produces metastable Kr all-optically. This avoids cross contamination, therefore allowing a much higher throughput rate. The apparatus is based on a self-made VUV-lamp and a 2D-3D magneto-optical trap setup. In the 2D trap metastable krypton is produced and a beam of atoms is formed by Doppler-cooling simultaneously.

  5. Automated Sampling and Extraction of Krypton from Small Air Samples for Kr-85 Measurement Using Atom Trap Trace Analysis

    International Nuclear Information System (INIS)

    Hebel, S.; Hands, J.; Goering, F.; Kirchner, G.; Purtschert, R.

    2015-01-01

    Atom-Trap-Trace-Analysis (ATTA) provides the capability of measuring the Krypton-85 concentration in microlitre amounts of krypton extracted from air samples of about 1 litre. This sample size is sufficiently small to allow for a range of applications, including on-site spot sampling and continuous sampling over periods of several hours. All samples can be easily handled and transported to an off-site laboratory for ATTA measurement, or stored and analyzed on demand. Bayesian sampling methodologies can be applied by blending samples for bulk measurement and performing in-depth analysis as required. Prerequisite for measurement is the extraction of a pure krypton fraction from the sample. This paper introduces an extraction unit able to isolate the krypton in small ambient air samples with high speed, high efficiency and in a fully automated manner using a combination of cryogenic distillation and gas chromatography. Air samples are collected using an automated smart sampler developed in-house to achieve a constant sampling rate over adjustable time periods ranging from 5 minutes to 3 hours per sample. The smart sampler can be deployed in the field and operate on battery for one week to take up to 60 air samples. This high flexibility of sampling and the fast, robust sample preparation are a valuable tool for research and the application of Kr-85 measurements to novel Safeguards procedures. (author)

  6. METODE PEMBELAJARAN SAINS DALAM PERSPEKTIF PENDIDIKAN ISLAM

    Directory of Open Access Journals (Sweden)

    Suardi Ishak

    2015-08-01

    Full Text Available Secularization of science and technology with religious values have been wrapped so neatly by the nature of Western thoughts which is then transmitted to the various facets of life including general education. Secular science claim to be objective, value-free, and free of other interests, including religion. Even science has been positioned as a replacement for the position of Allah’s revelation (Qur'an as a hint of modern life. Islam considers rational sciences are supporting the implementation of worship that are mahdah. Islam considers that the source of knowledge is a revelation, a revelation further demands that humans use ratio for the development of the verses kauniyah and 'am. The results show that Al-Attas view that science is the result of engineering and development ratio. Basic resource (nas does not see the dualism between secular science with hereafter science, but the results of ijtihad is man who produce various schools and understand the science that led to varying perspectives. Secularism, atheism and others led to the development of science adapted to the mindset of developers. At-Attas view that science serves to carry out the obligations both to Allah and to mankind is mandatory required and held as well, and vice versa. Various development science and science must be in a way or means to carry out worship.

  7. Relationship between population growth of the red flour beetle Tribolium castaneum and protein and carbohydrate content in flour and starch.

    Science.gov (United States)

    Wong, Nellie; Lee, Chow-Yang

    2011-12-01

    The effects of eight diets (atta flour, wheat flour, self-rising flour, rice flour, custard powder, corn flour, tapioca starch, and potato starch) on the development of the red flour beetle, Tribolium castaneum (Herbst), reared at 29-31 degrees C and 66-70% RH were assessed. Five pairs of male and female T. castaneum were reared on the respective diets for 28 d before the experimental setup was dismantled and adult counts were recorded. In another experiment, the insects were allowed to mate and oviposit in each flour or starch type over a period of 7 d before being removed. The counting of pupae and adult emergence began on the day of emergence and was continued on a daily basis until day 140. Proximate analysis was performed for chemical composition of each diet, and the numbers of new adults that developed were found to be positively correlated (r2 = 0.97; P flour > wheat flour > self-rising flour > rice flour > custard powder > corn flour > tapioca starch > potato starch. T. castaneum larval development to the pupal and adult stages developed significantly faster in atta flour (P flour. Fewer adults emerged from wheat flour, self-rising flour, and rice flour, and no new emergences were recorded for the remaining diets. Developmental rate was much slower in beetles reared on diets in which a low number in progeny was produced. These data illustrate that different diets can influence the sustainability of these insects and affect their development and growth.

  8. Identification, characterization, and utilization of genome-wide simple sequence repeats to identify a QTL for acidity in apple

    Science.gov (United States)

    2012-01-01

    Background Apple is an economically important fruit crop worldwide. Developing a genetic linkage map is a critical step towards mapping and cloning of genes responsible for important horticultural traits in apple. To facilitate linkage map construction, we surveyed and characterized the distribution and frequency of perfect microsatellites in assembled contig sequences of the apple genome. Results A total of 28,538 SSRs have been identified in the apple genome, with an overall density of 40.8 SSRs per Mb. Di-nucleotide repeats are the most frequent microsatellites in the apple genome, accounting for 71.9% of all microsatellites. AT/TA repeats are the most frequent in genomic regions, accounting for 38.3% of all the G-SSRs, while AG/GA dimers prevail in transcribed sequences, and account for 59.4% of all EST-SSRs. A total set of 310 SSRs is selected to amplify eight apple genotypes. Of these, 245 (79.0%) are found to be polymorphic among cultivars and wild species tested. AG/GA motifs in genomic regions have detected more alleles and higher PIC values than AT/TA or AC/CA motifs. Moreover, AG/GA repeats are more variable than any other dimers in apple, and should be preferentially selected for studies, such as genetic diversity and linkage map construction. A total of 54 newly developed apple SSRs have been genetically mapped. Interestingly, clustering of markers with distorted segregation is observed on linkage groups 1, 2, 10, 15, and 16. A QTL responsible for malic acid content of apple fruits is detected on linkage group 8, and accounts for ~13.5% of the observed phenotypic variation. Conclusions This study demonstrates that di-nucleotide repeats are prevalent in the apple genome and that AT/TA and AG/GA repeats are the most frequent in genomic and transcribed sequences of apple, respectively. All SSR motifs identified in this study as well as those newly mapped SSRs will serve as valuable resources for pursuing apple genetic studies, aiding the apple breeding

  9. Real & Financial Sectors, ``koq Financenaann..'' & Elbio Dagotto's Interactions

    Science.gov (United States)

    Maksoed, Wh-

    2016-10-01

    In conjunctions between PMRI/Pendidikan Matematika Realistik Indonesia fom Dr. RK Sembiring to ``ASTRANOMICS'': the New Reality in Business Aviation herewith provided `interaction between real & financial sector' and financialisation from Heinrich Bortis: ``the Real & Financial Sector of a Monetary Production Economy in the perspective of classical-Keynesian political economy'' ever specifies ``sector Riil'' from HE. Mr. Ir. Aburizal Bakrie. Instead describes the context of CMR/Colossal Magnetoresistance cq Carlos SLIM, the richest entrepreneur in the world 2014 also obtaines Dagotto & Tokura: ``Strongly correlated Electronic Materials: Present & Future'',MRS Bulletin, Nov, 2008. Ever existed of UN Secretary General Kofie Atta Annan, for Lih-AT TA-ruh di mana?'' are ```koq Financenaann..?'' in-between conjunctions. CMR are other notions of GiantMagnetoresistance from Fert & Grundberg who awarded with Nobel Prize in Physics, 2007. Heartfelt Gratitudes to HE. Mr. Prof. Ir. HANDOJO.

  10. Insetos em presépios e as "formigas vestidas" de Jules Martin (1832-1906: uma curiosa manufatura paulistana do final do século XIX

    Directory of Open Access Journals (Sweden)

    Dante Martins Teixeira

    2008-01-01

    Full Text Available Present in Brazil since the beginning of Portuguese colonization, crèche nativity scenes were soon adapted to local reality, a propitious circumstance for the appearance of heterodox conceptions and the use of exotic elements of the fauna and flora peculiar to each region. As records about insects are very uncommon, it is noteworthy that females of leaf-cutting ants, Atta sp. (Hymenoptera, Formicidae, were used to compose crèche nativity scenes in São Paulo State. Having subsisted at least up to the decade of 1960, the "ant crèches" of cities such as Embu das Artes could be related to the then famous "dressed ants" created by Jules Martin, a curious manufacture of the city of São Paulo in the last quarter of the 19th century.

  11. Identifying the transition between single and multiple mating of queens in fungus-growing ants

    DEFF Research Database (Denmark)

    Villesen, Palle; Murakami, Takahiro; Schultz, Ted R

    2002-01-01

    Obligate mating of females (queens) with multiple males has evolved only rarely in social Hymenoptera (ants, social bees, social wasps) and for reasons that are fundamentally different from those underlying multiple mating in other animals. The monophyletic tribe of ('attine') fungus-growing ants...... is known to include evolutionarily derived genera with obligate multiple mating (the Acromyrmex and Atta leafcutter ants) as well as phylogenetically basal genera with exclusively single mating (e.g. Apterostigma, Cyphomyrmex, Myrmicocrypta). All attine genera share the unique characteristic of obligate...... dependence on symbiotic fungus gardens for food, but the sophistication of this symbiosis differs considerably across genera. The lower attine genera generally have small, short-lived colonies and relatively non-specialized fungal symbionts (capable of living independently of their ant hosts), whereas...

  12. The conversion of SO{sub 2} to SO{sub 3} in gas turbine engines

    Energy Technology Data Exchange (ETDEWEB)

    Miake-Lye, R C; Anderson, M R; Brown, R C; Kolb, C E [Aerodyne Research, Inc., Billerica, MA (United States). Center for Chemical and Environmental Physics; Sorokin, A A; Buriko, Y I [Scientific Research Center ` Ecolen` , Moscow (Russian Federation)

    1998-12-31

    The oxidation of fuel sulfur to S(6) (SO{sub 3}+H{sub 2}SO{sub 4}) in a supersonic (Concorde) and a subsonic (ATTAS) aircraft engine is estimated numerically. The results indicate between 2% and 10% of the fuel sulfur is emitted as S(6). It is also shown that conversion in the turbine is limited by the level of atomic oxygen at the combustor exit, resulting in a higher oxidation efficiency as the sulfur mass loading is decreased. SO{sub 2} and SO{sub 3} are the primary sulfur oxidation products, with less than 1% of fuel sulfur converted to H{sub 2}SO{sub 4}. For the Concorde, H{sub 2}SO{sub 4} was primarily formed during the supersonic expansion through the divergent nozzle. (author) 20 refs.

  13. Faunistic analysis of Formicidae (Hymenoptera: Apocrita in degraded ecosystems of Chapecó town, Santa Catarina, Brazil

    Directory of Open Access Journals (Sweden)

    Flávio Roberto Mello Garcia

    2005-11-01

    Full Text Available Seeking to investigate the ant fauna in degraded environments and to comprehend how this group behaves in such ecosystems, faunistic analysis was initially conducted with the ants collected in an area in Chapecó town that had been subjected to flooding in function of the construction of the mouth of a dam on the Chapecó River (a branch of the larger Uruguay River. The collections were carried out between October 2001 and September 2002. We used pit-fall traps, sweeping nets, entomologic umbrellas and leaf litter collections for fragments covered by bushes and grass. The fauna was characterized through the constancy and dominancy indexes. A number of 34.642 specimens of ants, belonging to 32 species, 19 genera and six subfamilies, were collected. The species Labidus sp., Atta sp. and Ectatomma edentatum stood out as being either accessory or both constant and dominant.

  14. Evolutionary patterns of proteinase activity in attine ant fungus gardens

    DEFF Research Database (Denmark)

    Semenova, Tatyana; Hughes, David Peter; Boomsma, Jacobus Jan

    2011-01-01

    hypothesized that fungal proteinase activity may have been under selection for efficiency and that different classes of proteinases might be involved. Results: We determined proteinase activity profiles across a wide pH range for fungus gardens of 14 Panamanian species of fungus-growing ants, representing...... classes. Remarkably, the single symbiont that is shared by species of the crown group of Atta and Acromyrmex leaf-cutting ants mostly showed metalloproteinase activity, suggesting that recurrent changes in enzyme production may have occurred throughout the domestication history of fungus-garden symbionts......Background: Attine ants live in symbiosis with a basidiomycetous fungus that they rear on a substrate of plant material. This indirect herbivory implies that the symbiosis is likely to be nitrogen deprived, so that specific mechanisms may have evolved to enhance protein availability. We therefore...

  15. Gnomon una indagine sul numero

    CERN Document Server

    Zellini, Paolo

    1999-01-01

    Lo "gnomone" di cui si parla in questo libro non è quello stilo, più o meno monumentale, la cui ombra indica l'ora solare, ma un semplice strumento matematico: una figura geometrica, piana o solida, che aggiunta a un'altra ne genera una simile. Si tratta quindi di una tecnica, ampiamente diffusa nell'antichità, atta a ingrandire o rimpicciolire una forma conservandone l'aspetto. Lo gnomone non aveva solo importanza geometrica. Dalla semplice operazione di correzione "gnomonica" di una figura sono dipesi infatti la stessa nozione di numero, la definizione di vari concetti dell'Analisi e alcuni tra i principali algoritmi numerici e algebrici della matematica.

  16. Raise your defence: a baseline for security

    CERN Multimedia

    Computer Security Team

    2011-01-01

    It is an unfair imbalance: the (computer) security of a system/service is only as strong as the weakest link in the chain of protection. This provides attackers with an incredible advantage: they can choose when to attack, where and with which means. The defence side is permanently under pressure: they must defend at all times all assets against all eventualities. For computer security, this means that every computer system, every account, every web site and every service must be properly protected --- always.   In particular, at CERN, those services visible to the Internet are permanently probed. Web sites and servers are permanently scanned by adversaries for vulnerabilities; attackers repeatedly try to guess user passwords on our remote access gateways like LXPLUS or CERNTS; computing services, e.g. for Grid computing, are analysed again and again by malicious attackers for weaknesses which can be exploited. Thanks to the vigilance of the corresponding system and service experts, these atta...

  17. Penelitian Islam: Dasar dan Filosofi

    Directory of Open Access Journals (Sweden)

    Abu Bakar Marzuki

    2017-03-01

    Full Text Available This article is a continued understanding of some thoughts delivered by the Islamic study experts. Actually, Islamic study orientation is still floating and it does not have a clear goal. Some parts of Islamic study is  model or a similar effort done by  orientalists in studying Islam, and in line with the vision and the mission starting from false conclusion about Islam. Therefore, Islamic study experts in the earlier awakening of Islam such as  Al-banna, al-maududi, Ismail Raji al Faruqi, Ziauddin sardar, and Muhammad Naquib al-Attas have offered various thoughts in implementing the framework of Islamic study in line with the vision and the mission of Islam so that their mindset becomes the basis for development of Islamic study. 

  18. Development of Myrmeleon brasiliensis (Navás (Neuroptera, Myrmeleontidae, in laboratory, with different natural diets Desenvolvimento de Myrmeleon brasiliensis (Navás (Neuroptera, Myrmeleontidae, em laboratório, com diferentes dietas naturais

    Directory of Open Access Journals (Sweden)

    Giani L. B. Missirian

    2006-12-01

    Full Text Available Antlions larvae are sit-and-wait predators that capture arthropod prey in conical sand pits. The aim of this paper were to determine the effect of different natural diets [leaf-cutting ants (Atta spp., fruit fly larvae (Anastrepha spp. and Ceratitis capitata and mixed diet (Atta spp. plus fruit fly larvae] on the development of larvae and pupae of M. brasiliensis (Navás, 1914 and to estimate the number and size of prey caught in each instar and on each kind of diet. The average duration (days of the second and third instars of M. brasiliensis was longer when larvae of antlion were fed with leaf-cutting ants. The diets did not affect the duration of the pupal stage nor the pupae size. The different diets did not affect the mean width of head capsule (mm, the mean weight (mg or the mean body size (mm in the different instars of M. brasiliensis. In the second and third instars, the larvae of M. brasiliensis fed with leaf-cutting ants consumed more prey than larvae kept on other diets. Adults whose larvae were fed fruit fly larvae were larger than adults on other diets. Although Myrmeleontidae are few studied in Brazil, these results contribute to knowledge of M. brasiliensis biology, but also suggest the need of studies about the development of larvae and pupae in natural environments.Larvas de formiga-leão são conhecidas por suas armadilhas ("funis" que constroem em solo arenoso, sob as quais esperam por suas presas. Este trabalho teve como objetivos verificar o efeito de diferentes dietas naturais [formigas-cortadeiras (Atta spp., larvas de moscas-das-frutas (Anastrepha spp. e Ceratitis capitata e dieta mista (Atta spp. e larvas de moscas-das-frutas] sobre o desenvolvimento larval e pupal de M. brasiliensis (Navás, 1914 e estimar o número e tamanho de presas capturadas, por instar larval, em cada dieta. No segundo e terceiro instares, as larvas de M. brasiliensis alimentadas com formigas-cortadeiras consumiram um número maior de presas e a

  19. Evolutionarily advanced ant farmers rear polyploid fungal crops

    DEFF Research Database (Denmark)

    Kooij, Pepijn Wilhelmus; Aanen, D.K.; Schiøtt, Morten

    2015-01-01

    to be lowly and facultatively polyploid (just over two haplotypes on average), whereas Atta and Acromyrmex symbionts are highly and obligatorily polyploid (ca. 5-7 haplotypes on average). This stepwise transition appears analogous to ploidy variation in plants and fungi domesticated by humans and in fungi...... the number of nuclei per fungal cell for 42 symbionts reared by 14 species of Panamanian fungus-growing ants. This showed that domesticated symbionts of higher attine ants are polykaryotic with 7-17 nuclei per cell, whereas nonspecialized crops of lower attines are dikaryotic similar to most free...... domesticated by termites and plants, where gene or genome duplications were typically associated with selection for higher productivity, but allopolyploid chimerism was incompatible with sexual reproduction....

  20. Co-evolution of enzyme function in the attine ant-fungus symbiosis

    DEFF Research Database (Denmark)

    de Fine Licht, Henrik Hjarvard; Schiøtt, Morten; Boomsma, Jacobus Jan

    Introduction: Fungus-growing ants cultivate specialized fungi in the tribe Leucocoprineae (Lepiotaceae: Basidiomycota) inside their nests. The conspicuous leaf-cutting ants in the genus Atta build huge nests displacing several cubic meters of soil, whereas lower attine genera such as Cyphomyrmex ...... garden. This system can be viewed as ant induced crop optimization similar to human agricultural practices....... have small nests with a fungus garden the size of a table-tennis ball. Only the leaf-cutting ants are specialized on using fresh leaves as substrate for their fungus gardens, whereas the more basal attine genera use substrates such as dry plant material (leaf litter and small twigs) and also insect...... feces and insect carcasses. This diverse array of fungal substrates across the attine lineage implies that the symbiotic fungus needs different enzymes to break down the plant material that the ants provide or different efficiencies of enzyme function. Methods: (1.) We made a literature survey...

  1. Endophytic fungi reduce leaf-cutting ant damage to seedlings

    Science.gov (United States)

    Bittleston, L. S.; Brockmann, F.; Wcislo, W.; Van Bael, S. A.

    2011-01-01

    Our study examines how the mutualism between Atta colombica leaf-cutting ants and their cultivated fungus is influenced by the presence of diverse foliar endophytic fungi (endophytes) at high densities in tropical leaf tissues. We conducted laboratory choice trials in which ant colonies chose between Cordia alliodora seedlings with high (Ehigh) or low (Elow) densities of endophytes. The Ehigh seedlings contained 5.5 times higher endophyte content and a greater diversity of fungal morphospecies than the Elow treatment, and endophyte content was not correlated with leaf toughness or thickness. Leaf-cutting ants cut over 2.5 times the leaf area from Elow relative to Ehigh seedlings and had a tendency to recruit more ants to Elow plants. Our findings suggest that leaf-cutting ants may incur costs from cutting and processing leaves with high endophyte loads, which could impact Neotropical forests by causing variable damage rates within plant communities. PMID:20610420

  2. The conversion of SO{sub 2} to SO{sub 3} in gas turbine engines

    Energy Technology Data Exchange (ETDEWEB)

    Miake-Lye, R.C.; Anderson, M.R.; Brown, R.C.; Kolb, C.E. [Aerodyne Research, Inc., Billerica, MA (United States). Center for Chemical and Environmental Physics; Sorokin, A.A.; Buriko, Y.I. [Scientific Research Center `Ecolen`, Moscow (Russian Federation)

    1997-12-31

    The oxidation of fuel sulfur to S(6) (SO{sub 3}+H{sub 2}SO{sub 4}) in a supersonic (Concorde) and a subsonic (ATTAS) aircraft engine is estimated numerically. The results indicate between 2% and 10% of the fuel sulfur is emitted as S(6). It is also shown that conversion in the turbine is limited by the level of atomic oxygen at the combustor exit, resulting in a higher oxidation efficiency as the sulfur mass loading is decreased. SO{sub 2} and SO{sub 3} are the primary sulfur oxidation products, with less than 1% of fuel sulfur converted to H{sub 2}SO{sub 4}. For the Concorde, H{sub 2}SO{sub 4} was primarily formed during the supersonic expansion through the divergent nozzle. (author) 20 refs.

  3. Novel fungal disease in complex leaf-cutting ant societies

    DEFF Research Database (Denmark)

    Hughes, David Peter; Evans, Harry C.; Hywel-Jones, Nigel

    2009-01-01

    1. The leaf-cutting ants practise an advanced system of mycophagy where they grow a fungus as a food source. As a consequence of parasite threats to their crops, they have evolved a system of morphological, behavioural, and chemical defences, particularly against fungal pathogens (mycopathogens). 2....... Specific fungal diseases of the leaf-cutting ants themselves have not been described, possibly because broad spectrum anti-fungal defences against mycopathogens have reduced their susceptibility to entomopathogens. 3. Using morphological and molecular tools, the present study documents three rare infection...... events of Acromyrmex and Atta leaf-cutting ants by Ophiocordyceps fungi, agenus of entomopathogens that is normally highly specific in its host choice. 4. As leaf-cutting ants have been intensively studied, the absence of prior records of Ophiocordyceps suggests that these infections may be a novel event...

  4. Ciudades soñadas y ciudades en las que es imposible soñar: la narrativa de Guinea Ecuatorial

    Directory of Open Access Journals (Sweden)

    Dorothy Odartey-Wellington

    2012-11-01

    Full Text Available Este trabajo examina las contribuciones de los escritores contemporáneos de Guinea Ecuatorial a la construcción de nociones de ciudades y sus habitantes en la narrativa africana contemporánea. Aunque el documento se basa principalmente en obras de María Nsue Angüe, Maximiliano Nkogo Esono, Juan Tomás Ávila Laurel, Donato Ndongo-Bidyogo y César Mba Abogo, la interpretación de estos escritores de las ciudades se examina en relación con un contexto más amplio de la escritura africana representada por los siguientes autores anglófonos, Ama Ata Aidoo, Sefi Atta, Kojo Laing y Sinyangwe Binwell así como la francófona Calixthe Beyala. El tratamiento particular de ciudades por parte de los escritores guineoecuatorianos, en comparación con las tendencias en otros ejemplos de la literatura y crítica africanas, tiene su origen en las preocupaciones socio-políticas en el contexto de la petroeconomía de su país. This paper examines the contributions of contemporary Equatoguinean writers to the construction of ideas of cities and their inhabitants in contemporary African narrative. Although the paper draws mainly on works by María Nsue Angüe, Maximiliano Nkogo Esono, Juan Tomás Ávila Laurel, Donato Ndongo-Bidyogo and César Mba Abogo, these writers’ rendition of cities is examined with reference to a wider context of African writing represented by Anglophone and Francophone writers Ama Ata Aidoo, Sefi Atta, Kojo Laing, Binwell Sinyangwe and Calixthe Beyala. The particular treatment of Equatoguinean cities in comparison to trends in other examples of African literature and criticism, are traced to the socio-political concerns in the context of Equatorial Guinean new petro-economy.

  5. Recent developments on field gas extraction and sample preparation methods for radiokrypton dating of groundwater

    Science.gov (United States)

    Yokochi, Reika

    2016-09-01

    Current and foreseen population growths will lead to an increased demand in freshwater, large quantities of which is stored as groundwater. The ventilation age is crucial to the assessment of groundwater resources, complementing the hydrological model approach based on hydrogeological parameters. Ultra-trace radioactive isotopes of Kr (81 Kr and 85 Kr) possess the ideal physical and chemical properties for groundwater dating. The recent advent of atom trap trace analyses (ATTA) has enabled determination of ultra-trace noble gas radioisotope abundances using 5-10 μ L of pure Kr. Anticipated developments will enable ATTA to analyze radiokrypton isotope abundances at high sample throughput, which necessitates simple and efficient sample preparation techniques that are adaptable to various sample chemistries. Recent developments of field gas extraction devices and simple and rapid Kr separation method at the University of Chicago are presented herein. Two field gas extraction devices optimized for different sampling conditions were recently designed and constructed, aiming at operational simplicity and portability. A newly developed Kr purification system enriches Kr by flowing a sample gas through a moderately cooled (138 K) activated charcoal column, followed by a gentle fractionating desorption. This simple process uses a single adsorbent and separates 99% of the bulk atmospheric gases from Kr without significant loss. The subsequent two stages of gas chromatographic separation and a hot Ti sponge getter further purify the Kr-enriched gas. Abundant CH4 necessitates multiple passages through one of the gas chromatographic separation columns. The presented Kr separation system has a demonstrated capability of extracting Kr with > 90% yield and 99% purity within 75 min from 1.2 to 26.8 L STP of atmospheric air with various concentrations of CH4. The apparatuses have successfully been deployed for sampling in the field and purification of groundwater samples.

  6. Representation of thermal information in the antennal lobe of leaf-cutting ants

    Directory of Open Access Journals (Sweden)

    Markus eRuchty

    2010-11-01

    Full Text Available Insects are equipped with various types of antennal sensilla, which house thermosensitive neurons adapted to receive different parameters of the thermal environment for a variety of temperature-guided behaviors. In the leaf-cutting ant Atta vollenweideri, the physiology and the morphology of the thermosensitive sensillum coeloconicum (Sc has been thoroughly investigated. However, the central projections of its receptor neurons are unknown. Here we selectively stained the three neurons found in single Sc and tracked their axons into the brain of Atta vollenweideri workers. Each of the three axons terminates in a single glomerulus of the antennal lobe (Sc-glomeruli. Two of the innervated glomeruli are adjacent to each other and are located laterally, while the third one is clearly separated and located medially in the antennal lobe. Using two-photon Ca2+ imaging of antennal lobe projection neurons, we studied where in the antennal lobe thermal information is represented. In the 11 investigated antennal lobes, we found up to 10 different glomeruli in a single specimen responding to temperature stimulation. Both, warm- and cold-sensitive glomeruli could be identified. The thermosensitive glomeruli were mainly located in the medial part of the antennal lobe. Based on the general representation of thermal information in the antennal lobe and functional data on the Sc-glomeruli we conclude that temperature stimuli received by Sc are processed in the medial of the three target glomeruli. The present study reveals an important role of the antennal lobe in temperature processing and links a specific thermosensitive neuron to its central target glomerulus.

  7. Underground anemotactic orientation in leaf-cutting ants: perception of airflow and experience-dependent choice of airflow direction during digging

    Science.gov (United States)

    Halboth, Florian; Roces, Flavio

    2017-10-01

    Air exchange between the large nests of Atta vollenweideri leaf-cutting ants and the environment strongly relies on a passive, wind-induced ventilation mechanism. Air moves through nest tunnels and airflow direction depends on the location of the tunnel openings on the nest mound. We hypothesized that ants might use the direction of airflow along nest tunnels as orientation cue in the context of climate control, as digging workers might prefer to broaden or to close tunnels with inflowing or outflowing air in order to regulate nest ventilation. To investigate anemotactic orientation in Atta vollenweideri, we first tested the ants' ability to perceive air movements by confronting single workers with airflow stimuli in the range 0 to 20 cm/s. Workers responded to airflow velocities ≥ 2 cm/s, and the number of ants reacting to the stimulus increased with increasing airflow speed. Second, we asked whether digging workers use airflow direction as an orientation cue. Workers were exposed to either inflow or outflow of air while digging in the nest and could subsequently choose between two digging sites providing either inflow or outflow of air, respectively. Workers significantly chose the side with the same airflow direction they experienced before. When no airflow was present during initial digging, workers showed no preference for airflow directions. Workers developed preferences for airflow direction only after previous exposure to a given airflow direction. We suggest that experience-modified anemotaxis might help leaf-cutting ants spatially organize their digging activity inside the nest during tasks related to climate control.

  8. Association of polymorphisms in microRNA machinery genes (DROSHA, DICER1, RAN, and XPO5) with risk of idiopathic primary ovarian insufficiency in Korean women.

    Science.gov (United States)

    Rah, HyungChul; Jeon, Young Joo; Lee, Bo Eun; Kim, Jung O; Shim, Sung Han; Lee, Woo Sik; Choi, Dong Hee; Kim, Ji Hyang; Kim, Nam Keun

    2013-10-01

    The aim of our study was to investigate whether polymorphisms in microRNA machinery genes are associated with the risk of primary ovarian insufficiency (POI). We genotyped 136 POI patients and 236 controls among Korean women for nine single nucleotide polymorphisms (SNPs; DROSHA rs6877842 and rs10719; DICER1 rs13078 and rs3742330; RAN rs14035; and XPO5 rs34324334, rs2257082, rs11544382, and rs11077) by polymerase chain reaction-restriction fragment length polymorphism analysis. Differences in genotype frequencies between patients and controls were compared, and odds ratios (ORs) and 95% CIs were determined as measures of the strength of the association between genotype and POI. Of the nine SNPs, XPO5 rs34324334 and rs11544382 were monomorphic and were not analyzed further. The XPO5 rs2257082 CT and CT + TT variant genotypes were more frequent in patients (OR, 2.097; 95% CI, 1.207-3.645) than in controls (OR, 2.030; 95% CI, 1.196-3.445). The combined frequencies of XPO5 rs2257082 CT + TT and rs11077 AC + CC genotypes were higher in patients than in controls (OR, 2.526; 95% CI, 1.088-5.865). An association of POI risk with other polymorphisms was not found. A haplotype-based analysis of seven polymorphisms of the microRNA machinery genes for gene-gene interactions suggests that ***ACTA, ***GCCA, ***G*C*, *T*ATTA, and ***ACT* haplotypes (asterisk indicates SNP locus not included; DROSHA rs6877842 and rs10719, DICER1 rs13078 and rs3742330, RAN rs14035, and XPO5 rs2257082 and rs11077 polymorphisms) are associated with higher POI prevalence, and that ***GCTA, ***ACCA, *C*ATTA, and *C*ATT* haplotypes are associated with lower POI prevalence. Our data demonstrate that the XPO5 rs2257082 T variant allele occurs more frequently in POI patients than in controls, suggesting that this allele may be associated with increased POI risk.

  9. Mutagenic potency of MMS-induced 1meA/3meC lesions in E. coli.

    Science.gov (United States)

    Nieminuszczy, Jadwiga; Mielecki, Damian; Sikora, Anna; Wrzesiński, Michał; Chojnacka, Aleksandra; Krwawicz, Joanna; Janion, Celina; Grzesiuk, Elzbieta

    2009-12-01

    The mutagenic activity of MMS in E. coli depends on the susceptibility of DNA bases to methylation and their repair by cellular defense systems. Among the lesions in methylated DNA is 1meA/3meC, which is recently recognized as being mutagenic. In this report, special attention is focused on the mutagenic properties of 1meA/3meC which, by the activity of AlkB-dioxygenase, are quickly and efficiently converted to natural A/C bases in the DNA of E. coli alkB(+) strains, preventing 1meA/3meC-induced mutations. We have found that in the absence of AlkB-mediated repair, MMS treatment results in an increased frequency of four types of base substitutions: GC-->CG, GC-->TA, AT-->CG, and AT-->TA, whereas overproduction of PolV in CC101-106 alkB(-)/pRW134 strains leads to a markedly elevated level of GC-->TA, GC-->CG, and AT-->TA transversions. It has been observed that in the case of AB1157 alkB(-) strains, the MMS-induced and 1meA/3meC-dependent argE3-->Arg(+) reversion occurs efficiently, whereas lacZ(-)--> Lac(+) reversion in a set of CC101-106 alkB(-) strains occurs with much lower frequency. We considered several reasons for this discrepancy, namely, the possible variance in the level of the PolV activity, the effect of the PolIV contents that is higher in CC101-106 than in AB1157 strains and the different genetic cell backgrounds in CC101-106 alkB(-) and AB1157 alkB(-) strains, respectively. We postulate that the difference in the number of targets undergoing mutation and different reactivity of MMS with ssDNA and dsDNA are responsible for the high (argE3-->Arg(+)) and low (lacZ(-) --> Lac(+)) frequency of MMS-induced mutations.

  10. A domain-based approach for analyzing the function of aluminum-activated malate transporters from wheat (Triticum aestivum) and Arabidopsis thaliana in Xenopus oocytes.

    Science.gov (United States)

    Sasaki, Takayuki; Tsuchiya, Yoshiyuki; Ariyoshi, Michiyo; Ryan, Peter R; Furuichi, Takuya; Yamamoto, Yoko

    2014-12-01

    Wheat and Arabidopsis plants respond to aluminum (Al) ions by releasing malate from their root apices via Al-activated malate transporter. Malate anions bind with the toxic Al ions and contribute to the Al tolerance of these species. The genes encoding the transporters in wheat and Arabidopsis, TaALMT1 and AtALMT1, respectively, were expressed in Xenopus laevis oocytes and characterized electrophysiologically using the two-electrode voltage clamp system. The Al-activated currents generated by malate efflux were detected for TaALMT1 but not for AtALMT1. Chimeric proteins were generated by swapping the N- and C-terminal halves of TaALMT1 and AtALMT1 (Ta::At and At::Ta). When these chimeras were characterized in oocytes, Al-activated malate efflux was detected for the Ta::At chimera but not for At::Ta, suggesting that the N-terminal half of TaALMT1 is necessary for function in oocytes. An additional chimera, Ta(48)::At, generated by swapping 17 residues from the N-terminus of AtALMT1 with the equivalent 48 residues from TaALMT1, was sufficient to support transport activity. This 48 residue region includes a helical region with a putative transmembrane domain which is absent in AtALMT1. The deletion of this domain from Ta(48)::At led to the complete loss of transport activity. Furthermore, truncations and a deletion at the C-terminal end of TaALMT1 indicated that a putative helical structure in this region was also required for transport function. This study provides insights into the structure-function relationships of Al-activated ALMT proteins by identifying specific domains on the N- and C-termini of TaALMT1 that are critical for basal transport function and Al responsiveness in oocytes. © The Author 2014. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  11. Creative thinking in prospective teachers: the status quo and the impact of contextual factors

    Directory of Open Access Journals (Sweden)

    Hannetjie Meintjes

    2010-01-01

    Full Text Available To create unique and appropriate learning opportunities and environments and to nurture the development of creative thinking abilities among learners are some of the demands for creative thinking currently expected of teachers globally and also in South Africa. Creative thinking in academic context assumes, among other things, the ability to generate a variety of original ideas, to see different viewpoints and elaborate on ideas. We report on the findings of a quantitative pilot investigation by means of experimental research utilizing an ex post facto design to determine the status quo regarding the creative thinking abilities of a hetrogeneous group of 207 pre-service teachers studying at a South African university, using the Abbreviated Torrance Test for Adults (ATTA and a Partial Least Squares (PLS exploration into the relationship between contextual factors and the students' creative thinking abilities. Strong correlations were found among a variety of contextual factors such as the type of school model and culture and creative thinking abilities and also between specific contextual factors such as the choice of role model and socio economic and acculturation factors and certain creative thinking abilities. This research explores a largely unknown field, namely, the creative thinking abilities of a group of South African pre-service teachers of different cultural groups and creates an awareness of the need for the development of creative thinking abilities among these prospective teachers.

  12. Methodology to evaluate the insecticide potential of forest tree species

    International Nuclear Information System (INIS)

    Morales Soto, Leon; Garcia P, Carlos Mario

    2000-01-01

    The flora diversity of Colombia has an enormous potential in the rational use of its forest resources. Trees with biocidal effects to control pests and diseases need to be investigated. The objective of this research was to develop a methodology with low costs, easy application and quick results. The methodology employed was as follows: selection of tree species based on bibliography, ancestral reports and personal observations. The process was as follows: field collection of plants, preparation of plants extracts and test with Artemia salina Leach to detect biological activity of the extracts using LC50. Bioassays with those extract more promising (LC50 less than 1000 ppm) Determination of active compounds. The methodology was employed with 5 forest tree species: guarea guidonia (L) Sleumer and trichia hirta L. (Meliaceae), Machaerium Moritzianum Benth. (Fabaceae), Swinglea glutinosa Merrill (rutaceae) and Mammea americana L. (Clusiaceae). Using Artemia salina Leach as indicator of biocidal potential, two species were selected as the most promising, those were: Swinglea glutinosa Merril and Machaerium moritzianum Benth. In addition bioassays were made to evaluate fagoinhibition on Atta cephalotes (L.) (Hym: Formicidae) and control of Alconeura. This methodology is recommended for this kind of research

  13. Methodology for the insecticide potential evaluation of forest species

    International Nuclear Information System (INIS)

    Morales Soto, Leon; Garcia P, Carlos Mario

    2000-01-01

    The flora diversity of Colombia has an enormous potential in the rational use of its forest resources. Trees with biocides effects to pest control and diseases need to be investigated. The objective of this research was to develop a methodology with low costs, easy application and quick results. The methodology employed was as follows: selection of tree species based on bibliography, ancestral reports and personal observations. The process was as follows: field collection of plants, preparation of plants extracts, and test with Artemia Salina, leach to detect biological activity of the extracts using LC50. Bioassays with those extract more promising (LC50 less than 1000 ppm). The methodology was employed with 5 forest tree species: Guarea guidonia (L.) Sleumer and Trichia hirta L. (Meliaceae), machaerium moritzianum Benth. (Fabaceae), Swinglea glutinosa Merrill. (Rutaceae) and Mammea americana L. (Clusiaceae). Using Artemia salina Leach as indicator of biocidal potential, two species were selected as the most promising, those were: Swinglea glutinosa Merril and Machaerium moritzianum Benth. In addition bioassays were made to evaluate fagoinhibition on Atta cephalotes (L.) and control of Alconeura. This methodology is recommended for this kind of research

  14. [Creativity and Character Traits of University Students: Transversal Association Study].

    Science.gov (United States)

    Santamaría, Hernando; Sánchez, Ricardo

    2012-06-01

    This study was carried out to assess the relationship between character traits and creativity in a sample of students from a public university in Bogotá. A random sample of 157 students from the Universidad Nacional de Colombia. The two instruments used for measuring character traits and creativity were the International Personality Disorder Examination (IPDE) and the Abbreviated Torrance Test for Adults (ATTA). Additional information about gender, psychopathological antecedents, current academic period and academic average have been recorded. Robust regression methods have been used to analyze the relationship between creativity and character traits. Creativity and narcissistic traits were associated. In a multivariate model, other variables showing a relationship with creativity were found, i.e., male gender, mental illness family antecedents, number of academic periods completed, and a high academic average. Relationship between creativity and narcissistic traits had not been reported in previous. Longitudinal studies using more accurate scales should be undertaken to determine the validity of these findings. Copyright © 2012 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.

  15. Leucoagaricus gongylophorus produces diverse enzymes for the degradation of recalcitrant plant polymers in leaf-cutter ant fungus gardens.

    Science.gov (United States)

    Aylward, Frank O; Burnum-Johnson, Kristin E; Tringe, Susannah G; Teiling, Clotilde; Tremmel, Daniel M; Moeller, Joseph A; Scott, Jarrod J; Barry, Kerrie W; Piehowski, Paul D; Nicora, Carrie D; Malfatti, Stephanie A; Monroe, Matthew E; Purvine, Samuel O; Goodwin, Lynne A; Smith, Richard D; Weinstock, George M; Gerardo, Nicole M; Suen, Garret; Lipton, Mary S; Currie, Cameron R

    2013-06-01

    Plants represent a large reservoir of organic carbon comprised primarily of recalcitrant polymers that most metazoans are unable to deconstruct. Many herbivores gain access to nutrients in this material indirectly by associating with microbial symbionts, and leaf-cutter ants are a paradigmatic example. These ants use fresh foliar biomass as manure to cultivate gardens composed primarily of Leucoagaricus gongylophorus, a basidiomycetous fungus that produces specialized hyphal swellings that serve as a food source for the host ant colony. Although leaf-cutter ants are conspicuous herbivores that contribute substantially to carbon turnover in Neotropical ecosystems, the process through which plant biomass is degraded in their fungus gardens is not well understood. Here we present the first draft genome of L. gongylophorus, and, using genomic and metaproteomic tools, we investigate its role in lignocellulose degradation in the gardens of both Atta cephalotes and Acromyrmex echinatior leaf-cutter ants. We show that L. gongylophorus produces a diversity of lignocellulases in ant gardens and is likely the primary driver of plant biomass degradation in these ecosystems. We also show that this fungus produces distinct sets of lignocellulases throughout the different stages of biomass degradation, including numerous cellulases and laccases that likely play an important role in lignocellulose degradation. Our study provides a detailed analysis of plant biomass degradation in leaf-cutter ant fungus gardens and insight into the enzymes underlying the symbiosis between these dominant herbivores and their obligate fungal cultivar.

  16. The effect of relativity on stability of Copernicium phases, their electronic structure and mechanical properties

    Science.gov (United States)

    Čenčariková, Hana; Legut, Dominik

    2018-05-01

    The phase stability of the various crystalline structures of the super-heavy element Copernicium was determined based on the first-principles calculations with different levels of the relativistic effects. We utilized the Darwin term, mass-velocity, and spin-orbit interaction with the single electron framework of the density functional theory while treating the exchange and correlation effects using local density approximations. It is found that the spin-orbit coupling is the key component to stabilize the body-centered cubic (bcc) structure over the hexagonal closed packed (hcp) structure, which is in accord with Sol. Stat. Comm. 152 (2012) 530, but in contrast to Atta-Fynn and Ray (2015) [11], Gaston et al. (2007) [10], Papaconstantopoulos (2015) [9]. It seems that the main role here is the correct description of the semi-core relativistic 6p1/2 orbitals. The all other investigated structures, i.e. face-centered cubic (fcc) , simple cubic (sc) as well as rhombohedral (rh) structures are higher in energy. The criteria of mechanical stability were investigated based on the calculated elastic constants, identifying the phase instability of fcc and rh structures, but surprisingly confirm the stability of the energetically higher sc structure. In addition, the pressure-induced structural transition between two stable sc and bcc phases has been detected. The ground-state bcc structure exhibits the highest elastic anisotropy from single elements of the Periodic table. At last, we support the experimental findings that Copernicium is a metal.

  17. Leaf-Cutter Ant Fungus Gardens Are Biphasic Mixed Microbial Bioreactors That Convert Plant Biomass to Polyols with Biotechnological Applications

    Science.gov (United States)

    Somera, Alexandre F.; Lima, Adriel M.; dos Santos-Neto, Álvaro J.; Lanças, Fernando M.

    2015-01-01

    Leaf-cutter ants use plant matter to culture the obligate mutualistic basidiomycete Leucoagaricus gongylophorus. This fungus mediates ant nutrition on plant resources. Furthermore, other microbes living in the fungus garden might also contribute to plant digestion. The fungus garden comprises a young sector with recently incorporated leaf fragments and an old sector with partially digested plant matter. Here, we show that the young and old sectors of the grass-cutter Atta bisphaerica fungus garden operate as a biphasic solid-state mixed fermenting system. An initial plant digestion phase occurred in the young sector in the fungus garden periphery, with prevailing hemicellulose and starch degradation into arabinose, mannose, xylose, and glucose. These products support fast microbial growth but were mostly converted into four polyols. Three polyols, mannitol, arabitol, and inositol, were secreted by L. gongylophorus, and a fourth polyol, sorbitol, was likely secreted by another, unidentified, microbe. A second plant digestion phase occurred in the old sector, located in the fungus garden core, comprising stocks of microbial biomass growing slowly on monosaccharides and polyols. This biphasic operation was efficient in mediating symbiotic nutrition on plant matter: the microbes, accounting for 4% of the fungus garden biomass, converted plant matter biomass into monosaccharides and polyols, which were completely consumed by the resident ants and microbes. However, when consumption was inhibited through laboratory manipulation, most of the plant polysaccharides were degraded, products rapidly accumulated, and yields could be preferentially switched between polyols and monosaccharides. This feature might be useful in biotechnology. PMID:25911490

  18. Aircraft exhaust aerosol formation and growth

    Energy Technology Data Exchange (ETDEWEB)

    Brown, R C; Miake-Lye, R C; Anderson, M R; Kolb, C E [Aerodyne Research, Inc., Billerica, MA (United States). Center for Chemical and Environmental Physics

    1998-12-31

    Aerosol formation and growth in the exhaust plume of the ATTAS aircraft at an altitude of approximately 9 km, burning fuels with 2 ppmm sulfur (`low`) and 266 ppmm (`high`) sulfur has been modeled using an aerosol dynamics model for nucleation, vapor condensation and coagulation, coupled to a 2-dimensional, axisymmetric flow code to treat plume dilution and turbulent mixing. For both the `low` and `high` sulfur fuels, approximately 60% of the available water had condensed within the first 200 m downstream of the exhaust exit. The contrail particle diameters ranged between 0.4 to 1.6 {mu}m. However, the size distributions as a function of radial position for the `low` sulfur plume were broader than the corresponding distributions for the `high` sulfur plume. The model results indicate for a fuel sulfur mass loading of 2 ppmm, sulfuric acid remains a viable activating agent and that the differences in the contrail particle size distributions for sulfur mass loadings between 2 ppmm and 260 ppmm would be difficult to detect. (author) 12 refs.

  19. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Directory of Open Access Journals (Sweden)

    Muhammad I. Ullah

    2017-12-01

    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  20. Discovery of defense- and neuropeptides in social ants by genome-mining.

    Directory of Open Access Journals (Sweden)

    Christian W Gruber

    Full Text Available Natural peptides of great number and diversity occur in all organisms, but analyzing their peptidome is often difficult. With natural product drug discovery in mind, we devised a genome-mining approach to identify defense- and neuropeptides in the genomes of social ants from Atta cephalotes (leaf-cutter ant, Camponotus floridanus (carpenter ant and Harpegnathos saltator (basal genus. Numerous peptide-encoding genes of defense peptides, in particular defensins, and neuropeptides or regulatory peptide hormones, such as allatostatins and tachykinins, were identified and analyzed. Most interestingly we annotated genes that encode oxytocin/vasopressin-related peptides (inotocins and their putative receptors. This is the first piece of evidence for the existence of this nonapeptide hormone system in ants (Formicidae and supports recent findings in Tribolium castaneum (red flour beetle and Nasonia vitripennis (parasitoid wasp, and therefore its confinement to some basal holometabolous insects. By contrast, the absence of the inotocin hormone system in Apis mellifera (honeybee, another closely-related member of the eusocial Hymenoptera clade, establishes the basis for future studies on the molecular evolution and physiological function of oxytocin/vasopressin-related peptides (vasotocin nonapeptide family and their receptors in social insects. Particularly the identification of ant inotocin and defensin peptide sequences will provide a basis for future pharmacological characterization in the quest for potent and selective lead compounds of therapeutic value.

  1. Mining and gene ontology based annotation of SSR markers from expressed sequence tags of Humulus lupulus

    Science.gov (United States)

    Singh, Swati; Gupta, Sanchita; Mani, Ashutosh; Chaturvedi, Anoop

    2012-01-01

    Humulus lupulus is commonly known as hops, a member of the family moraceae. Currently many projects are underway leading to the accumulation of voluminous genomic and expressed sequence tag sequences in public databases. The genetically characterized domains in these databases are limited due to non-availability of reliable molecular markers. The large data of EST sequences are available in hops. The simple sequence repeat markers extracted from EST data are used as molecular markers for genetic characterization, in the present study. 25,495 EST sequences were examined and assembled to get full-length sequences. Maximum frequency distribution was shown by mononucleotide SSR motifs i.e. 60.44% in contig and 62.16% in singleton where as minimum frequency are observed for hexanucleotide SSR in contig (0.09%) and pentanucleotide SSR in singletons (0.12%). Maximum trinucleotide motifs code for Glutamic acid (GAA) while AT/TA were the most frequent repeat of dinucleotide SSRs. Flanking primer pairs were designed in-silico for the SSR containing sequences. Functional categorization of SSRs containing sequences was done through gene ontology terms like biological process, cellular component and molecular function. PMID:22368382

  2. I cataloghi nella letteratura americana della Grande Depressione

    Directory of Open Access Journals (Sweden)

    Cinzia Scarpino

    2011-07-01

    Full Text Available Il presente saggio si propone di analizzare alcune opere letterarie in senso lato (poesie, libri-documentario, script di film-documetario scritte negli Stati Uniti negli anni della Grande Depressione (1929-1941 alla luce della presenza ricorrente di cataloghi, liste e inventari. Partendo da un excursus storico circa la centralità del catalogo come forma narrativa atta a rendere l’abbondanza del Nuovo Mondo nella cultura e nella letteratura dell’Ottocento (dai diari dei primi esploratori agli scritti di Thomas Jefferson, dalle geremiadi puritane agli almanacchi e ai diari rurali, dalle teorizzazioni estetiche di Ralph Waldo Emerson al «poeta catalogatore» Walt Whitman e al Walden di H. D. Thoreau, il saggio si sofferma su alcune opere-documentario degli anni Trenta del Novecento; un periodo che, segnato profondamente dalla crisi economica e testimone di una riconfigurazione della geografia reale e simbolica del territorio nazionale, punta nuovamente a cataloghi e inventari, secondo una scelta retorica funzionale alla rappresentazione del rovescio del mito di abbondanza delle origini.

  3. Generation of Nutrients and Detoxification: Possible Roles of Yeasts in Leaf-Cutting Ant Nests

    Directory of Open Access Journals (Sweden)

    Fernando C. Pagnocca

    2012-02-01

    Full Text Available The possible roles played by yeasts in attine ant nests are mostly unknown. Here we present our investigations on the plant polysaccharide degradation profile of 82 yeasts isolated from fungus gardens of Atta and Acromyrmex species to demonstrate that yeasts found in ant nests may play the role of making nutrients readily available throughout the garden and detoxification of compounds that may be deleterious to the ants and their fungal cultivar. Among the yeasts screened, 65% exhibited cellulolytic enzymes, 44% exhibited pectinolytic activity while 27% and 17% possess enzyme systems for the degradation of protease and amylase, respectively. Galacturonic acid, which had been reported in previous work to be poorly assimilated by the ant fungus and also to have a negative effect on ants’ survival, was assimilated by 64% and 79% of yeasts isolated from nests of A. texana and Acromyrmex respectively. Our results suggest that yeasts found in ant nests may participate in generation of nutrients and removal of potentially toxic compounds, thereby contributing to the stability of the complex microbiota found in the leaf-cutting ant nests.

  4. Identification and Mapping of Simple Sequence Repeat Markers from Common Bean (Phaseolus vulgaris L. Bacterial Artificial Chromosome End Sequences for Genome Characterization and Genetic–Physical Map Integration

    Directory of Open Access Journals (Sweden)

    Juana M. Córdoba

    2010-11-01

    Full Text Available Microsatellite markers or simple sequence repeat (SSR loci are useful for diversity characterization and genetic–physical mapping. Different in silico microsatellite search methods have been developed for mining bacterial artificial chromosome (BAC end sequences for SSRs. The overall goal of this study was genome characterization based on SSRs in 89,017 BAC end sequences (BESs from the G19833 common bean ( L. library. Another objective was to identify new SSR taking into account three tandem motif identification programs (Automated Microsatellite Marker Development [AMMD], Tandem Repeats Finder [TRF], and SSRLocator [SSRL]. Among the microsatellite search engines, SSRL identified the highest number of SSRs; however, when primer design was attempted, the number dropped due to poor primer design regions. Automated Microsatellite Marker Development software identified many SSRs with valuable AT/TA or AG/TC motifs, while TRF found fewer SSRs and produced no primers. A subgroup of 323 AT-rich, di-, and trinucleotide SSRs were selected from the AMMD results and used in a parental survey with DOR364 and G19833, of which 75 could be mapped in the corresponding population; these represented 4052 BAC clones. Together with 92 previously mapped BES- and 114 non-BES-derived markers, a total of 280 SSRs were included in the polymerase chain reaction (PCR-based map, integrating a total of 8232 BAC clones in 162 contigs from the physical map.

  5. Leafcutter Ant Nests Inhibit Low-Intensity Fire Spread in the Understory of Transitional Forests at the Amazon's Forest-Savanna Boundary

    Directory of Open Access Journals (Sweden)

    Karine S. Carvalho

    2012-01-01

    Full Text Available Leaf-cutter ants (Atta spp. remove leaf litter and woody debris—potential fuels—in and around their nests and foraging trails. We conducted single and three annual experimental fires to determine the effects of this leaf-cutter ant activity on the behavior of low-intensity, slow-moving fires. In a transitional forest, where the southern Amazon forest meets the Brazilian savanna, we tested whether leaf-cutter ant nests and trails (i inhibit fire spread due to a lack of fuels, and (ii, thereby, reduce the total burned area during these experimental low-intensity fires, particularly at forest edges where leaf-cutter ant abundance was higher. Fine-medium fuel mass increased with an increase in distance from ant nest, and the mean area of bare soil was greater on nests than on the forest floor. Between 60 to 90 percent of the unburned area was within 30 m of ant nests, and burned area significantly increased with increasing distance to ant nests. In addition, the number of ant nests declined with increasing distance from the forest edge, and, with exception of the first experimental fire, burned area also increased with increasing distance from the edge. The present study provides new insight to fire ecology in Amazon environments.

  6. Konsep Ilmu dalam Islam

    Directory of Open Access Journals (Sweden)

    Achmad Reza Hutama al-Faruqi

    2015-09-01

    Full Text Available Concept of science in Islam has its own universal dimension, metaphysic and empiric, and diffenrent from sciences came from Western worldview which limited in empiric dimension. It will be in the case that the concept of science in Islam is one of integral part of Islamic worldview; so that it has its own characteristics differed from another concept of science in other civilizations. Science according to Islamic worldview is not only cover substance of knowledge, but becomes important element in civilization as well. Related to the important of position of science, number of scholar such as Ibnu Khaldun, Imam al Ghazali, or Syed Muhammad Naquib al-Attas gave several features of science to know which one has higher priority, to be associated with how the concept of science in Islam decided later. From the discussion offered by the scholars, it will be understood that science in Islam not only encompasses theology and law, but also there is a row of other sciences such as physics, biology, and so forth need to be studied. The acquisition method of each branch of sciences have their own approach, both of internal and external sense, khabar s}a>diq, and the third is intellect. A Muslim should solidly hold the Islamic tradition and not too impressed with the tradition of Western scholarly even it looks more attractive.

  7. Adenine radicals generated in alternating AT duplexes by direct absorption of low-energy UV radiation.

    Science.gov (United States)

    Banyasz, Akos; Ketola, Tiia; Martínez-Fernández, Lara; Improta, Roberto; Markovitsi, Dimitra

    2018-04-17

    There is increasing evidence that the direct absorption of photons with energies that are lower than the ionization potential of nucleobases may result in oxidative damage to DNA. The present work, which combines nanosecond transient absorption spectroscopy and quantum mechanical calculations, studies this process in alternating adenine-thymine duplexes (AT)n. We show that the one-photon ionization quantum yield of (AT)10 at 266 nm (4.66 eV) is (1.5 ± 0.3) × 10-3. According to our PCM/TD-DFT calculations carried out on model duplexes composed of two base pairs, (AT)1 and (TA)1, simultaneous base pairing and stacking does not induce important changes in the absorption spectra of the adenine radical cation and deprotonated radical. The adenine radicals, thus identified in the time-resolved spectra, disappear with a lifetime of 2.5 ms, giving rise to a reaction product that absorbs at 350 nm. In parallel, the fingerprint of reaction intermediates other than radicals, formed directly from singlet excited states and assigned to AT/TA dimers, is detected at shorter wavelengths. PCM/TD-DFT calculations are carried out to map the pathways leading to such species and to characterize their absorption spectra; we find that, in addition to the path leading to the well-known TA* photoproduct, an AT photo-dimerization path may be operative in duplexes.

  8. Insects associated with tropical foliage produced in the coffee growing region of Colombia

    Directory of Open Access Journals (Sweden)

    Luis F. Aristizábal

    2013-09-01

    Full Text Available We conducted a survey of insects and pest management practices on 34 farms growing ornamental tropical foliage plants in the central coffee region of Colombia over two years. Tropical foliage provided habitat for a diverse range of insects. In total, phytophagous or detritivorous insects from six orders, 40 families and 62 genera were collected. The most common were Hemiptera (29 genera from 16 families, followed by Coleoptera (17 genera from 4 families, Diptera (5 genera from 5 families, Lepidoptera (5 genera from 4 families, Hymenoptera (3 genera from 2 families and Orthoptera (2 genera from 2 families. The most common phytophagous species were leaf cutting ants (Atta and Acromyrmex spp., leaf beetles (Chrysomelidae, leafhoppers (Cicadellidae, stinkbugs (Pentatomidae, squash bugs (Coreidae, tree hoppers (Membracidae and plant hoppers (Fulgoridae. Beneficial insects identified from tropical foliage included predators and parasitoids amongst 5 orders, 12 families and 22 genera. The most abundant were predators among the Coccinellidae, Chrysopidae, Reduviidae, Lycidae and Formicidae but only low numbers of parasitoids (Ichneumonidae, Braconidae and Tachinidae were collected. A pest management questionnaire given to growers revealed a preponderance of reliance on broad spectrum insecticides with a smaller number of growers (approximately one third also using some biological control methods. Our survey contributes basic information regarding diversity of Neotropical insects associated with ornamental foliage plants.

  9. Identification and functional characterization of a solute carrier family 15, member 4 gene in Litopenaeus vannamei.

    Science.gov (United States)

    Chen, Yong-Gui; Yuan, Kai; Zhang, Ze-Zhi; Yuan, Feng-Hua; Weng, Shao-Ping; Yue, Hai-Tao; He, Jian-Guo; Chen, Yi-Hong

    2016-04-01

    Innate immunity in shrimp is important in resisting bacterial infection. The NF-κB pathway is pivotal in such an immune response. This study cloned and functionally characterized the solute carrier family (SLC) 15 member A 4 (LvSLC15A4) gene in Litopenaeus vannamei. The open reading frame of LvSLC15A4 is 1, 902 bp long and encodes a putative 633-amino acid protein, which is localized in the plasma membrane and intracellular vesicular compartments. Results of the reporter gene assay showed that LvSLC15A4 upregulated NF-κB target genes, including the immediate-early gene 1 of white spot syndrome virus, as well as several antimicrobial peptide genes, such as pen4, CecA, AttA, and Mtk in S2 cells. Moreover, knocked-down expression of LvSLC15A4 reduced pen4 expression in L. vannamei. LvSLC15A4 down-regulation also increased the cumulative mortality of Vibrio parahemolyticus-infected L. vannamei. Furthermore, LvSLC15A4 expression was induced by unfolded protein response (UPR) in L. vannamei hematocytes. These results suggest that LvSLC15A4 participates in L. vannamei innate immunity via the NF-κB pathway and thus may be related to UPR. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. Aircraft exhaust aerosol formation and growth

    Energy Technology Data Exchange (ETDEWEB)

    Brown, R.C.; Miake-Lye, R.C.; Anderson, M.R.; Kolb, C.E. [Aerodyne Research, Inc., Billerica, MA (United States). Center for Chemical and Environmental Physics

    1997-12-31

    Aerosol formation and growth in the exhaust plume of the ATTAS aircraft at an altitude of approximately 9 km, burning fuels with 2 ppmm sulfur (`low`) and 266 ppmm (`high`) sulfur has been modeled using an aerosol dynamics model for nucleation, vapor condensation and coagulation, coupled to a 2-dimensional, axisymmetric flow code to treat plume dilution and turbulent mixing. For both the `low` and `high` sulfur fuels, approximately 60% of the available water had condensed within the first 200 m downstream of the exhaust exit. The contrail particle diameters ranged between 0.4 to 1.6 {mu}m. However, the size distributions as a function of radial position for the `low` sulfur plume were broader than the corresponding distributions for the `high` sulfur plume. The model results indicate for a fuel sulfur mass loading of 2 ppmm, sulfuric acid remains a viable activating agent and that the differences in the contrail particle size distributions for sulfur mass loadings between 2 ppmm and 260 ppmm would be difficult to detect. (author) 12 refs.

  11. A Prospective Randomized Controlled Trial to Study the Impact of a Nutrition-Sensitive Intervention on Adult Women With Cancer Cachexia Undergoing Palliative Care in India.

    Science.gov (United States)

    Kapoor, Neha; Naufahu, Jane; Tewfik, Sundus; Bhatnagar, Sushma; Garg, Rakesh; Tewfik, Ihab

    2017-03-01

    Advanced cancer patients with disease progression develop cachexia. Nevertheless, cancer patients at nutritional risk have shown improved body weight and quality of life with oral nutritional supplements. This was a randomized controlled trial in adult female cancer patients (n = 63) attending palliative clinics, with symptoms of cachexia. Eligible patients were randomly distributed into control (n = 33) and intervention (n = 30) groups. Both groups were provided with nutritional and physical activity counseling, but the intervention group received an additional 100 g of Improved Atta (IAtta) for 6 months daily consumption. This study was designed to assess the efficacy of IAtta (with counseling) in enhancing the health status of cachexic patients. Anthropometric measurements, dietary intake, physical activity level and quality of life parameters were assessed at baseline, after 3 months, and at the end of 6 months. Patients in the control group (n = 15) had significantly decreased body weight ( P = .003), mid-upper-arm circumference ( P = .002), and body fat ( P = .002) by the end of intervention. A trend of body weight gain in the intervention group (n = 17; P = .08) and significant increase of body fat ( P = .002) was observed; moreover, patients reported a significant improvement in fatigue ( P = .002) and appetite scores ( P = .006) under quality-of-life domains at the end of intervention. Embedding a nutrition-sensitive intervention ( IAtta ) within Indian palliative care therapy may improve quality of life and stabilize body weight in cancer cachexia patients.

  12. CONTINUING EDUCATION AND SCHOOL INCLUSION: POTENTIALITIES FOR THE CONSTRUCTION OF NEW POSTURES AND PRACTICES OF EDUCATORS FROM THE MUNICIPAL TEACHING NETWORK OF PRESIDENTE PRUDENTE

    Directory of Open Access Journals (Sweden)

    Simone Maria Carlos Gakiya

    2013-07-01

    Full Text Available The present work is a part of a research master's concerns continued training of teachers and school enrollment and consisted in analyzing the manifestations of educators articipating in the Continuing Education Course in Assistive Technology (AT-TA about their understandings, attitudes and practices regarding school inclusion of people with disabilities in municipal schools of Presidente Prudente/SP. The methodology adopted for data acquisition involved the reading of the documents produced by participants in the virtual learning environment (VLE-AVA TelEduc, because it is a course conducted through the modality of Distance Education (DE-EaD, and the application questionnaire and interview. The results revealed the personal dilemmas experienced with the process of inclusion expressed by feelings of insecurity, distrust, lack of professional training, fear of the new, the different, the influence of cultural, social and historical in conceptions, beliefs, values and pedagogical relationships; initial training that did not include the dilemmas experienced in the classroom; Public Policies, laws, guidelines not mobilized the occurrence of new attitudes and practices. In this study we sought to highlight the potential for the occurrence of the formation of new attitudes of educators face in the process of school inclusion.

  13. Leucoagaricus gongylophorus Produces Diverse Enzymes for the Degradation of Recalcitrant Plant Polymers in Leaf-Cutter Ant Fungus Gardens

    Energy Technology Data Exchange (ETDEWEB)

    Aylward, Frank O. [Univ. of Wisconsin, Madison, WI (United States); Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Burnum-Johnson, Kristin E. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Tringe, Susannah G. [Dept. of Energy Joint Genome Inst., Walnut Creek, CA (United States); Teiling, Clotilde [Roche Diagnostics, Indianapolis, IN (United States); Tremmel, Daniel [Univ. of Wisconsin, Madison, WI (United States); Moeller, Joseph [Univ. of Wisconsin, Madison, WI (United States); Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Scott, Jarrod J. [Univ. of Wisconsin, Madison, WI (United States); Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Barry, Kerrie W. [Dept. of Energy Joint Genome Inst., Walnut Creek, CA (United States); Piehowski, Paul D. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Nicora, Carrie D. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Malfatti, Stephanie [Dept. of Energy Joint Genome Inst., Walnut Creek, CA (United States); Monroe, Matthew E. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Purvine, Samuel O. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Goodwin, Lynne A. [Dept. of Energy Joint Genome Inst., Walnut Creek, CA (United States); Smith, Richard D. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Weinstock, George [Washington Univ. School of Medicine, St. Louis, MS (United States); Gerardo, Nicole [Emory Univ., Atlanta, GA (United States); Suen, Garret [Dept. of Energy Joint Genome Inst., Walnut Creek, CA (United States); Lipton, Mary S. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Currie, Cameron R. [Univ. of Wisconsin, Madison, WI (United States); Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Smothsonian Tropical Research Inst., Balboa (Panama)

    2013-06-12

    Plants represent a large reservoir of organic carbon comprised largely of recalcitrant polymers that most metazoans are unable to deconstruct. Many herbivores gain access to nutrients in this material indirectly by associating with microbial symbionts, and leaf-cutter ants are a paradigmatic example. These ants use fresh foliar biomass as manure to cultivate fungus gardens composed primarily of Leucoagaricus gongylophorus, a basidiomycetous symbiont that produces specialized hyphal swellings that serve as a food source for the host ant colony. Although leaf-cutter ants are conspicuous herbivores that contribute substantially to carbon turnover in Neotropical ecosystems, the process through which plant biomass is degraded in their fungus gardens is not well understood. Here we present the first draft genome of L. gongylophorus, and using genomic, metaproteomic, and phylogenetic tools we investigate its role in lignocellulose degradation in the fungus gardens of both Atta cephalotes and Acromyrmex echinatior leaf-cutter ants. We show that L. gongylophorus produces a diversity of lignocellulases in fungus gardens, and is likely the primary driver of plant biomass degradation in these ecosystems. We also show that this fungus produces distinct sets of lignocellulases throughout the different stages of biomass degradation, including numerous cellulases and laccases that may be playing an important but previously uncharacterized role in lignocellulose degradation. Our study provides a comprehensive analysis of plant biomass degradation in leaf-cutter ant fungus gardens and provides insight into the molecular dynamics underlying the symbiosis between these dominant herbivores and their obligate fungal cultivar.

  14. Chemical composition of metapleural gland secretions of fungus-growing and non-fungus-growing ants.

    Science.gov (United States)

    Vieira, Alexsandro S; Morgan, E David; Drijfhout, Falko P; Camargo-Mathias, Maria I

    2012-10-01

    The metapleural gland is exclusive to ants, and unusual among exocrine glands in having no mechanism for closure and retention of secretion. As yet, no clear conclusion has been reached as to the function of metapleural gland secretion. Metapleural gland secretions were investigated for fungus-growing ants representing the derived attines Trachymyrmex fuscus, Atta laevigata, and Acromyrmex coronatus, the basal attines Apterostigma pilosum and Mycetarotes parallelus, and non-fungus-growing ants of the tribes Ectatommini (Ectatomma brunneum) and Myrmicini (Pogonomyrmex naegeli). Our results showed that the secretions of leaf-cutting ants (A. laevigata and A. coronatus) and the derived attine, T. fuscus, contain a greater variety and larger quantities of volatile compounds than those of myrmicine and ectatommine ants. The most abundant compounds found in the metapleural glands of A. laevigata and A. coronatus were hydroxyacids, and phenylacetic acid (only in A. laevigata). Indole was present in all groups examined, while skatole was found in large quantities only in attines. Ketones and aldehydes are present in the secretion of some attines. Esters are present in the metapleural gland secretion of all species examined, although mainly in A. laevigata, A. coronatus, and T. fuscus. Compared with basal attines and non-fungus-growing ants, the metapleural glands of leaf-cutting ants produce more acidic compounds that may have an antibiotic or antifungal function.

  15. Ocorrência de insetos na pitaia no município de Lavras-MG

    Directory of Open Access Journals (Sweden)

    Virna Braga Marques

    2012-04-01

    Full Text Available Devido às suas características de sabor doce e suave, polpa firme e repleta de sementes com ação laxante, as pitaias têm despertado interesse nos produtores por sua grande aceitação nos mercados consumidores. Diante do exposto, este trabalho visou identificar os visitantes florais, polinizadores e os insetos que causam danos aos cladódios e aos frutos de pitaia (Hylocereus undatus, no município de Lavras, MG. O trabalho foi conduzido em um pomar experimental e na coleção de frutas exóticas. As coletas foram realizadas duas etapas (diurna e noturna. Foi observado que a polinização cruzada de pitaia é realizada por abelha (Apis mellifera durante o dia e os insetos que causam maiores danos são formigas (Atta e Solenopsis e irapuá (Trigona spinipes no município de Lavras, MG.  É necessário que o produtor tenha cautela antes de utilizar medidas de controle, pois alguns insetos são benéficos para a polinização cruzada das plantas de pitaia e outros podem causar sérios danos nos cladódios, flores e frutos.

  16. Genome-Wide Characterization of Simple Sequence Repeat (SSR) Loci in Chinese Jujube and Jujube SSR Primer Transferability

    Science.gov (United States)

    Xiao, Jing; Zhao, Jin; Liu, Mengjun; Liu, Ping; Dai, Li; Zhao, Zhihui

    2015-01-01

    Chinese jujube (Ziziphus jujuba), an economically important species in the Rhamnaceae family, is a popular fruit tree in Asia. Here, we surveyed and characterized simple sequence repeats (SSRs) in the jujube genome. A total of 436,676 SSR loci were identified, with an average distance of 0.93 Kb between the loci. A large proportion of the SSRs included mononucleotide, dinucleotide and trinucleotide repeat motifs, which accounted for 64.87%, 24.40%, and 8.74% of all repeats, respectively. Among the mononucleotide repeats, A/T was the most common, whereas AT/TA was the most common dinucleotide repeat. A total of 30,565 primer pairs were successfully designed and screened using a series of criteria. Moreover, 725 of 1,000 randomly selected primer pairs were effective among 6 cultivars, and 511 of these primer pairs were polymorphic. Sequencing the amplicons of two SSRs across three jujube cultivars revealed variations in the repeats. The transferability of jujube SSR primers proved that 35/64 SSRs could be transferred across family boundary. Using jujube SSR primers, clustering analysis results from 15 species were highly consistent with the Angiosperm Phylogeny Group (APGIII) System. The genome-wide characterization of SSRs in Chinese jujube is very valuable for whole-genome characterization and marker-assisted selection in jujube breeding. In addition, the transferability of jujube SSR primers could provide a solid foundation for their further utilization. PMID:26000739

  17. Patterns of diversity and abundance of fungus-growing ants (Formicidae: Attini in areas of the Brazilian Cerrado Padrões de diversidade e abundância de formigas cultivadoras de fungo (Formicidade: Attini em áreas do Cerrado Brasileiro

    Directory of Open Access Journals (Sweden)

    Heraldo L. Vasconcelos

    2008-09-01

    Full Text Available Fungus-growing ants (tribe Attini are characteristic elements of the New World fauna. However, there is little information on the patterns of diversity, abundance, and distribution of attine species in their native ecosystems, especially for the so-called "lower" genera of the tribe. A survey of attine ant nests (excluding Atta Fabricus, 1804 and Acromyrmex Mayr, 1865 was conducted in a variety of savanna and forest habitats of the Cerrado biome near Uberlândia, Brazil. In total, 314 nests from 21 species of nine genera were found. Trachymyrmex Forel, 1893 was the most diverse genus with 10 species. Eighteen species were found in the savannas, including Mycetagroicus cerradensis Brandão & Mayhé-Nunes, 2001, a species from a recently-described genus of Attini, whereas in the forests only 12 species were found. Forest and savannas support relatively distinct faunas, each with a number of unique species; the species present in the forest habitats did not represent a nested subset of the species found in the savannas. Furthermore, although many species were common to both types of vegetation, their abundances were quite different. The density of attine nests is relatively high at some sites, exceeding an estimated 4,000 nests per hectare. In this sense, attine ants can be regarded as prevalent invertebrate taxa in the Brazilian Cerrado.As formigas cultivadoras de fungos (tribo Attini são exclusivas da fauna do Novo Mundo. Entretanto, existem poucas informações sobre os padrões de diversidade, abundância e distribuição das espécies de Attini em seus ecossistemas nativos, em especial para os gêneros menos derivados desta tribo. Um levantamento de ninhos de Attini (excluindo Atta Fabricius, 1804 e Acromyrmex Mayr, 1865 foi realizado em diversos ambientes savânicos e de floresta do bioma Cerrado próximos à Uberlândia, Brasil. Encontramos 314 ninhos de 21 espécies pertencentes a nove gêneros da tribo. Trachymyrmex Forel, 1893 foi o g

  18. Seasonality, age structure and reproduction of Leptodactylus (Lithodytes lineatus (Anura, Leptodactylidae in Rondônia state, southwestern Amazon, Brazil Sazonalidade, estrutura etária e reprodução de Leptodactylus (Lithodytes lineatus (Anura, Leptodactylidae no estado de Rondônia, Brasil

    Directory of Open Access Journals (Sweden)

    Paulo Sérgio Bernarde

    2009-12-01

    Full Text Available Leptodactylus(Lithodytes lineatus (Schneider, 1799 is an Amazonian leaf litter frog considered rare or uncommon in several studies on anuran communities. Despite being a widely distributed frog in Amazonian forests, knowledge of the biology and ecology of this species is relatively scarce. This species has been reported to live in association with leaf-cutter ant nests (Atta spp. during the breeding period. In this paper we present data on the seasonality of this species and some reproductive information gathered at a locality of Rondônia state, northwestern Brazil. Field work was carried out between April 2001 and March 2002, with the use of pitfall traps with drift fences as a survey method. Leptodactylus (L. lineatus had a higher capture frequency in this locality compared to that of other studies carried out in other Amazonian localities, possibly because this species has secretive habits, such as calling and breeding from nests of leaf-cutting ants, and are difficult to find during visual encounter surveys. The breeding period occurs between October and March. Calling males and egg-bearing females were found between September and February and juvenile recruitment occurred mainly from the end of the rainy season to the beginning of the dry season (February to June. Males and females show sexual dimorphism in SVL, females being significantly larger than males. The number of ovarian eggs per female varies from 110 to 328 and analyses indicate that there is a significant correlation with SVL.Leptodactylus(Lithodytes lineatus (Schneider, 1799 é uma espécie de anuro amazônico considerado raro ou incomum em diversos estudos de comunidades de anfíbios. Embora apresente ampla distribuição na Floresta Amazônica, conhecimento sobre a sua biologia e ecologia são escassos. Esta espécie tem sido relatada por viver em associação com ninhos de formigas cortadeiras (Atta spp. durante o período reprodutivo. Neste trabalho, nós apresentamos

  19. O jardim de fungo atua como um molde para a construção das câmaras em formigas cortadeiras? Fungus garden acts as a template for the construction of chambers in ants?

    Directory of Open Access Journals (Sweden)

    Roberto da Silva Camargo

    2013-04-01

    Full Text Available Os ninhos adultos das formigas cortadeiras (gênero Atta e Acromyrmex são compostos de milhares de câmaras subterrâneas, as quais abrigam o jardim de fungo, lixo e a população desses insetos. Entretanto, como as câmaras são construídas? Para responder essa questão, nós hipotetizamos que o jardim de fungo atua como um molde para a construção das câmaras. Assim, foram utilizadas 20 colônias de 6 meses de idade, divididas em quatro séries experimentais: padrão (quantidade normal de jardim de fungo; metade de jardim de fungo; dobro de jardim de fungo e sem jardim de fungo (Testemunha. As variáveis estudadas foram: parâmetros morfológicos das estruturas (túneis e câmara formada; fluxo das atividades das operárias; volume de solo escavado. Como se esperava, o jardim de fungo atua como um molde para a construção das câmaras em formigas cortadeiras. Os resultados foram: o tratamento sem jardim de fungo não apresentou nenhuma câmara, apenas túneis, em contraposição às demais séries experimentais que apresentaram no mínimo 2 câmaras, com dimensões similares; o fluxo das operárias carregando pellet de solo por minuto durante as 72 horas diferiu estatisticamente entre as séries experimentais e, finalmente, o volume do solo escavado foi resultado da taxa de escavação das operárias, diferindo estatisticamente entre as séries experimentais. Os resultados corroboram a hipótese de que o jardim de fungo atua como um molde para a construção da câmara. A ausência de uma estrutura funcional como uma câmara, quando o jardim de fungo está ausente, comprova a hipótese.Adult nests of leaf cutting ants (genus Atta and Acromyrmex are composed of thousands of underground chambers, which harbor the fungus garden, garbage and their population. However, how the chambers are constructed? To answer this question, we hypothesized that the fungus garden acts as a template for the chambers construction. Thus, we used 20 colonies of

  20. Combate sistemático de formigas-cortadeiras com iscas granuladas, em eucaliptais com cultivo mínimo Systematic control of leaf-cutting ants in areas with eucalyptus stands under minimum cultivation system

    Directory of Open Access Journals (Sweden)

    Ronald Zanetti

    2003-06-01

    Full Text Available Avaliou-se a eficiência do combate sistemático de formigas-cortadeiras em áreas de reforma de eucalipto com cultivo mínimo, na Celulose Nipo-Brasileira S.A., em Belo Oriente, Minas Gerais, de setembro a dezembro de 1996. Os tratamentos consistiram na aplicação de uma isca granulada com sulfluramida (0,3% de forma sistemática, a granel ou com microporta-iscas, na dosagem de 5 g a cada 6 m² e 10 g a cada 12 m², respectivamente. A mortalidade das colônias de formigas-cortadeiras foi avaliada 30 dias após a aplicação da isca. Foram encontradas até 396,3, 285,2, 59,3, 55,6, 29,6 e 14,8 colônias de Mycocepurus goeldii, Sericomyrmex sp., Acromyrmex subterraneus molestans, Atta spp., Acromyrmex balzani e Acromyrmex niger (Hymenoptera: Formicidae por hectare, respectivamente. A eficiência da isca granulada no combate sistemático variou com o método empregado e com a espécie de formiga-cortadeira. A maior eficiência foi obtida para A. subterraneus molestans, com 69,2% de suas colônias mortas com a isca aplicada a granel e 62,5% com microporta-iscas, o que indica que a distribuição entre dois pontos com isca nos plantios de eucalipto foi maior que a área de forrageamento das formigas-cortadeiras encontradas e, ou, que a dosagem aplicada por ponto foi insuficiente.The efficiency of a systematic application of baits against leaf-cutting ants was evaluated in a eucalypus plantation under a minimum cultivation system, in areas owned by Celulose Nipo-Brasileira S.A. (CENIBRA, in Belo Oriente, Minas Gerais, Brazil, from September to December 1996. Treatments consisted of applying a granulated bait with sulfluramide (0.3% in a systematic manner in bulk and plastic bags at a dose of five grams every 6 m² (T1 and 10 grams at each 12 m² (T2. Mortality of colonies of leaf-cutting ants was evaluated 30 days after bait application. A. maximum of 396.3; 285.2; 59.3; 55.6; 29.6 and 14.8 colonies of Mycocepurus goeldii, Sericomyrmex sp

  1. Especies de hormigas del suelo en el Parque Nacional Natural Gorgona, Pacífico Colombiano

    Directory of Open Access Journals (Sweden)

    Stephany Valdés-Rodríguez

    2014-02-01

    Full Text Available Este trabajo compila registros publicados (1991 y no publicados (2006 sobre las especies de hormigas del PNN Gorgona y aporta nuevos registros de especies recolectadas en 2010. Se recopiló información de 15 diferentes sitios de isla Gorgona (13.82km², incluyendo la pequeña isla de Gorgonilla (0.4899km². Los métodos de recolecta incluyeron trampas de caída, cebos de atún, sacos Winkler, trampas Malaise, red entomológica y captura directa. El inventario de hormigas de suelo y sotobosque resultó en 107 especies y morfoespecies, 46 géneros y 12 subfamilias. Myrmicinae reunió la mayor riqueza (37 especies seguida de Ponerinae (27 y Formicinae (12. Los géneros más ricos fueron Pachycondyla (15 especies, Camponotus (nueve y Pheidole (ocho, mientras que 30 géneros solo presentaron una especie. Doce especies fueron muy comunes: Azteca sp., Atta cephalotes, Camponotus sericeiventris, Eciton vagans, Ectatomma goninion, Gnamptogenys annulata, Odontomachus bauri, Pachycondyla bugabensis, P. harpax, P. verenae, Paraponera clavata y Wasmannia auropunctata. En comparación con otras islas neotropicales, Gorgona tiene un número sorprendentemente elevado de especies de hormigas, ninguna de ellas invasivas. Por tanto, estos resultados sugieren que, mecanismos ecológicos y procesos de recuperación natural en el ecosistema han generado disponibilidad de microhábitats permitiendo la coexistencia una gran riqueza de especies.

  2. Pharmacoinformatics approach for investigation of alternative potential hepatitis C virus nonstructural protein 5B inhibitors

    Directory of Open Access Journals (Sweden)

    Mirza MU

    2015-03-01

    Full Text Available Muhammad Usman Mirza,1 Noor-Ul-Huda Ghori,2 Nazia Ikram,3 Abdur Rehman Adil,4 Sadia Manzoor3 1Centre for Research in Molecular Medicine (CRiMM, The University of Lahore, Lahore, 2Atta-ur-Rehman School of Applied Biosciences (ASAB, National University of Science and Technology, Islamabad, 3Institute of Molecular Biology and Biotechnology (IMBB, The University of Lahore, Lahore, Pakistan; 4Centre for Excellence in Molecular Biology (CEMB, The University of Punjab, Lahore, Pakistan Abstract: Hepatitis C virus (HCV is one of the major viruses affecting the world today. It is a highly variable virus, having a rapid reproduction and evolution rate. The variability of genomes is due to hasty replication catalyzed by nonstructural protein 5B (NS5B which is also a potential target site for the development of anti-HCV agents. Recently, the US Food and Drug Administration approved sofosbuvir as a novel oral NS5B inhibitor for the treatment of HCV. Unfortunately, it is much highlighted for its pricing issues. Hence, there is an urgent need to scrutinize alternate therapies against HCV that are available at affordable price and do not have associated side effects. Such a need is crucial especially in underdeveloped countries. The search for various new bioactive compounds from plants is a key part of pharmaceutical research. In the current study, we applied a pharmacoinformatics-based approach for the identification of active plant-derived compounds against NS5B. The results were compared to docking results of sofosbuvir. The lead compounds with high-binding ligands were further analyzed for pharmacokinetic and pharmacodynamic parameters based on in silico absorption, distribution, metabolism, excretion, and toxicity (ADMET profile. The results showed the potential alternative lead compounds that can be developed into commercial drugs having high binding energy and promising ADMET properties. Keywords: hepatitis C, NS5B inhibitors, molecular docking, Auto

  3. Fidelity and mutational spectrum of Pfu DNA polymerase on a human mitochondrial DNA sequence.

    Science.gov (United States)

    André, P; Kim, A; Khrapko, K; Thilly, W G

    1997-08-01

    The study of rare genetic changes in human tissues requires specialized techniques. Point mutations at fractions at or below 10(-6) must be observed to discover even the most prominent features of the point mutational spectrum. PCR permits the increase in number of mutant copies but does so at the expense of creating many additional mutations or "PCR noise". Thus, each DNA sequence studied must be characterized with regard to the DNA polymerase and conditions used to avoid interpreting a PCR-generated mutation as one arising in human tissue. The thermostable DNA polymerase derived from Pyrococcus furiosus designated Pfu has the highest fidelity of any DNA thermostable polymerase studied to date, and this property recommends it for analyses of tissue mutational spectra. Here, we apply constant denaturant capillary electrophoresis (CDCE) to separate and isolate the products of DNA amplification. This new strategy permitted direct enumeration and identification of point mutations created by Pfu DNA polymerase in a 96-bp low melting domain of a human mitochondrial sequence despite the very low mutant fractions generated in the PCR process. This sequence, containing part of the tRNA glycine and NADH dehydrogenase subunit 3 genes, is the target of our studies of mitochondrial mutagenesis in human cells and tissues. Incorrectly synthesized sequences were separated from the wild type as mutant/wild-type heteroduplexes by sequential enrichment on CDCE. An artificially constructed mutant was used as an internal standard to permit calculation of the mutant fraction. Our study found that the average error rate (mutations per base pair duplication) of Pfu was 6.5 x 10(-7), and five of its more frequent mutations (hot spots) consisted of three transversions (GC-->TA, AT-->TA, and AT-->CG), one transition (AT-->GC), and one 1-bp deletion (in an AAAAAA sequence). To achieve an even higher sensitivity, the amount of Pfu-induced mutants must be reduced.

  4. Krypton-81, Helium-4 and Carbon-14 based estimation of groundwater ages in the Guarani Aquifer System: implications for the He-4 geochronometer

    Science.gov (United States)

    Aggarwal, P. K.; Chang, H. K.; Gastmans, D.; Sturchio, N. C.; Araguas, L.; Matsumoto, T.; Lu, Z.; Jiang, W.; Yokochi, R.; Mueller, P.

    2012-12-01

    Characterization of aquifer systems remains a challenge, particularly for large aquifers with limited hydrogeological information. Groundwater age is an important parameter that integrates aquifer recharge and flow dynamics and provides the ability to reliably constrain groundwater models. We have used multiple isotope tracers (C-14, He-4, and Kr-81) to estimate the age of groundwater along a 400-km transect in the north-eastern part of the Guarani Aquifer System (GAS) in Brazil. Carbon-14 measurements were made with an AMS, He-4 by mass-spectrometry, and Kr-81 by atom trap trace analysis (ATTA). Groundwater samples were collected along a groundwater flow path that runs from the outcrop area in the east to the deep confined section in the west, where the aquifer is up to about 1000 m deep. Present groundwater recharge occurs in the outcrop areas, as indicated by the presence of tritium and modern 14C. Carbon-14 activities reach values below detection limit at relatively short distances (a few km) from the outcrop. Abundance of 81Kr (half-life 229 Ka), in samples free of C-14, decreases from 0.81±0.11 (expressed as (81Kr/Kr)sample/(81Kr/Kr)air) in the east to 0.18±0.03 in the western-most sample (estimated age = 566±60 ka). Measured 4He-excess is far above that expected from in-situ production rates in sandstone aquifers and overestimates the age by several orders of magnitude. We used 81Kr ages to calibrate the 4He geochronometer which indicates a basal flux of about 2.8 x10-11 cm3STP He/cm2/a. This flux is lower than most estimates of basal flux in previous studies and will allow a wider use of 4He for groundwater dating and aquifer characterization.

  5. Major changes in microbial diversity and community composition across gut sections of a juvenile Panchlora cockroach.

    Directory of Open Access Journals (Sweden)

    Erin A Gontang

    Full Text Available Investigations of gut microbiomes have shed light on the diversity and genetic content of these communities, and helped shape our understanding of how host-associated microorganisms influence host physiology, behavior, and health. Despite the importance of gut microbes to metazoans, our understanding of the changes in diversity and composition across the alimentary tract, and the source of the resident community are limited. Here, using community metagenomics and 16S rRNA gene sequencing, we assess microbial community diversity and coding potential in the foregut, midgut, and hindgut of a juvenile Panchlora cockroach, which resides in the refuse piles of the leaf-cutter ant species Atta colombica. We found a significant shift in the microbial community structure and coding potential throughout the three gut sections of Panchlora sp., and through comparison with previously generated metagenomes of the cockroach's food source and niche, we reveal that this shift in microbial community composition is influenced by the ecosystems in which Panchlora sp. occurs. While the foregut is composed of microbes that likely originate from the symbiotic fungus gardens of the ants, the midgut and hindgut are composed of a microbial community that is likely cockroach-specific. Analogous to mammalian systems, the midgut and hindgut appear to be dominated by Firmicutes and Bacteroidetes with the capacity for polysaccharide degradation, suggesting they may assist in the degradation of dietary plant material. Our work underscores the prominence of community changes throughout gut microbiomes and highlights ecological factors that underpin the structure and function of the symbiotic microbial communities of metazoans.

  6. Major changes in microbial diversity and community composition across gut sections of a juvenile Panchlora cockroach.

    Science.gov (United States)

    Gontang, Erin A; Aylward, Frank O; Carlos, Camila; Glavina Del Rio, Tijana; Chovatia, Mansi; Fern, Alison; Lo, Chien-Chi; Malfatti, Stephanie A; Tringe, Susannah G; Currie, Cameron R; Kolter, Roberto

    2017-01-01

    Investigations of gut microbiomes have shed light on the diversity and genetic content of these communities, and helped shape our understanding of how host-associated microorganisms influence host physiology, behavior, and health. Despite the importance of gut microbes to metazoans, our understanding of the changes in diversity and composition across the alimentary tract, and the source of the resident community are limited. Here, using community metagenomics and 16S rRNA gene sequencing, we assess microbial community diversity and coding potential in the foregut, midgut, and hindgut of a juvenile Panchlora cockroach, which resides in the refuse piles of the leaf-cutter ant species Atta colombica. We found a significant shift in the microbial community structure and coding potential throughout the three gut sections of Panchlora sp., and through comparison with previously generated metagenomes of the cockroach's food source and niche, we reveal that this shift in microbial community composition is influenced by the ecosystems in which Panchlora sp. occurs. While the foregut is composed of microbes that likely originate from the symbiotic fungus gardens of the ants, the midgut and hindgut are composed of a microbial community that is likely cockroach-specific. Analogous to mammalian systems, the midgut and hindgut appear to be dominated by Firmicutes and Bacteroidetes with the capacity for polysaccharide degradation, suggesting they may assist in the degradation of dietary plant material. Our work underscores the prominence of community changes throughout gut microbiomes and highlights ecological factors that underpin the structure and function of the symbiotic microbial communities of metazoans.

  7. Especies promisorias para el ecoturismo en “Campo Aventura Roca Madre”, Toluviejo-Sucre, Colombia

    Directory of Open Access Journals (Sweden)

    Alcides Sampedro-M

    2013-03-01

    Full Text Available Objetivo. Determinar las especies de flora y fauna más importantes para el desarrollo del ecoturismo, en una localidad del departamento de Sucre, Colombia. Materiales y métodos. Se hizo un listado de las especies de flora y fauna observadas en el sendero ecológico de un centro de ecoturismo en Toluviejo, Sucre y se calculó su abundancia, importancia económica, estado de conservación y adaptaciones, que fueron evaluadas mediante un índice de importancia potencial para el ecoturismo, que suma los valores que se asignan a las variables consideradas de interés. Resultados. Se detectaron 18 especies promisorias de fauna, de 91 especies observadas y 16 especies vegetales de 53 observadas. Los animales de mayor potencial ecoturístico resultantes, fueron: Dendrobates truncatus y Saguinus oedipus, especies endémicas de Colombia, seguidas por Basiliscus basiliscus, Atta sp., Morpho peleides, Lycorea halia y Ara ararauna; todas estas con una alta abundancia y fácil detección. Dentro de las plantas, Anacardium excelsum obtuvo el mayor índice de importancia, como resultado de su endemismo y sus adaptaciones. Las especies Piper auritum, Matayba escrobiculata, Tabernaemontana cymosa y la comúnmente conocida como jazmín de monte, fueron fácilmente detectables y abundantes, además Brownea ariza y Tabebuia rosea resultaron las más representativas por la belleza de sus flores. Conclusiones. Se determinaron las especies que pueden ser de interés para los ecoturistas y esto hace posible mejorar el producto que se oferta a partir de profundizar en su conocimiento.

  8. In-situ studies on volatile jet exhaust particle emissions - impacts of fuel sulfur content and environmental conditions on nuclei-mode aerosols

    Energy Technology Data Exchange (ETDEWEB)

    Schroeder, F.; Baumann, R.; Petzold, A.; Busen, R.; Schulte, P.; Fiebig, M. [DLR Deutsches Zentrum fuer Luft- und Raumfahrt e.V., Wessling (Germany). Inst. fuer Physik der Atmosphaere; Brock, C.A. [Denver Univ., CO (United States). Dept. of Engineering

    2000-02-01

    In-situ measurements of ultrafine aerosol particle emissions were performed at cruise altitudes behind the DLR ATTAS research jet (RR M45H M501 engines) and a B737-300 aircraft (CFM56-3B1 engines). Measurements were made 0.15-20 seconds after emission as the source aircraft burned fuel with sulfur contents (FSC) of 2.6, 56 or 118 mg kg{sup -1}. Particle size distributions of from 3 to 60 nm diameter were determined using CN-counters with varying lower size detection limits. Volatile particle concentrations in the aircraft plumes strongly increased as diameter decreased toward the sizes of large molecular clusters, illustrating that apparent particle emissions are extremely sensitive to the smallest particle size detectable by the instrument used. Environmental conditions and plume age alone could influence the number of detected ultrafine (volatile) aerosols within an order of magnitude, as well. The observed volatile particle emissions decreased nonlinearly as FSC decreased to 60 mg kg{sup -1}, reaching minimum values of about 2 x 10{sup 17} kg{sup -1} and 2 x 10{sup 16} kg{sup -1} for particles >3 nm and >5 nm, respectively. Volatile particle emissions did not change significantly as FSCs were further reduced below 60 mg kg{sup -1}. Volatile particle emissions did not differ significantly between the two studied engine types. In contrast, soot particle emissions from the modern CFM56-3B1 engines were 4-5 times less (4 x 10{sup 14} kg{sup -1}) than from the older RR M45H M501 engines (1.8 x 10{sup 15} kg{sup -1}). Contrail processing has been identified as an efficient sink/quenching parameter for ultrafine particles and reduces the remaining interstitial aerosol by factors 2-10 depending on particle size.

  9. Water and environment news. No. 26, February 2010

    International Nuclear Information System (INIS)

    2010-02-01

    In the 2010-2011 biennium, one major focal area for the Isotope Hydrology Section will be groundwater assessment - particularly regional and/or transboundary aquifers. These are geographically large aquifers, and assessments using physical hydrology are fraught with complexities and uncertainties. As these aquifers generally contain fossil water which is tens to hundreds of thousands of years old, isotopic age determination provides a cost and time effective means of aquifer assessment and modeling. Recent developments in sampling and measuring Kr-81 from researchers at the Argonne National Laboratory and University of Illinois, Chicago have made it possible to more easily use isotopes of krypton - a dissolved gas in groundwater - for dating groundwater up to about a million years old. In particular, these developments include a new technique called Atom Trap Trace Analysis (ATTA) for measuring small concentration of Kr-81 using about 50-100 litres of water sample, rather than the thousands of litres required before. Kr-81 ages allow us to go beyond the age range of about 40 000 years previously possible using carbon-14, and help build better groundwater models. This approach was recently implemented in the Nubian aquifer in northern Africa. Aquifer systems targeted for 2010 include parts of the Nubian aquifer in Libya, the Guarani in Latin America, and possibly the Northwestern Sahara and Mekong aquifers. In 50 years, the global network of isotopes in precipitation (GNIP) has gathered around 120 000 monthly isotope records from more than 900 meteorological stations. This and related work using stable isotopes is becoming much easier with laser spectroscopy machines, which mark the dawn of a new era in stable isotope hyrology. The IAEA has assisted more than 20 developing countries in acquiring a machine, and trained over 40 technicians in its use

  10. Simple sequence repeat marker development from bacterial artificial chromosome end sequences and expressed sequence tags of flax (Linum usitatissimum L.).

    Science.gov (United States)

    Cloutier, Sylvie; Miranda, Evelyn; Ward, Kerry; Radovanovic, Natasa; Reimer, Elsa; Walichnowski, Andrzej; Datla, Raju; Rowland, Gordon; Duguid, Scott; Ragupathy, Raja

    2012-08-01

    Flax is an important oilseed crop in North America and is mostly grown as a fibre crop in Europe. As a self-pollinated diploid with a small estimated genome size of ~370 Mb, flax is well suited for fast progress in genomics. In the last few years, important genetic resources have been developed for this crop. Here, we describe the assessment and comparative analyses of 1,506 putative simple sequence repeats (SSRs) of which, 1,164 were derived from BAC-end sequences (BESs) and 342 from expressed sequence tags (ESTs). The SSRs were assessed on a panel of 16 flax accessions with 673 (58 %) and 145 (42 %) primer pairs being polymorphic in the BESs and ESTs, respectively. With 818 novel polymorphic SSR primer pairs reported in this study, the repertoire of available SSRs in flax has more than doubled from the combined total of 508 of all previous reports. Among nucleotide motifs, trinucleotides were the most abundant irrespective of the class, but dinucleotides were the most polymorphic. SSR length was also positively correlated with polymorphism. Two dinucleotide (AT/TA and AG/GA) and two trinucleotide (AAT/ATA/TAA and GAA/AGA/AAG) motifs and their iterations, different from those reported in many other crops, accounted for more than half of all the SSRs and were also more polymorphic (63.4 %) than the rest of the markers (42.7 %). This improved resource promises to be useful in genetic, quantitative trait loci (QTL) and association mapping as well as for anchoring the physical/genetic map with the whole genome shotgun reference sequence of flax.

  11. MENGKRITISI KONSEP ISLAMISASI ILMU ISMAIL RAJI AL-FARUQI: Telaah Pemikiran Ziauddin Sardar

    Directory of Open Access Journals (Sweden)

    Muhammad Taufik

    2017-12-01

    ilmu. Konsep ilm meniscayakan umat Islam untuk memahami realitas secara utuh. Hal ini telah dilakukan oleh sarjana dan intelektual Muslim klasik, seperti al-Kindi, al-Farabi, al-Ghazali, Ibnu Rusyd dan sarjana klasik lainnya. Akan tetapi, sarjana Muslim kontemporer tampak mengesampingkan peranan epistemologi ini. Sehingga yang terjadi kemudian adalah justru Islam kehilangan jati diri sebagai kekuatan yang punya orientasi epistemologis yang sebenarnya sudah mapan di era klasik. Konsep Islamisasi ilmu populer di tangan al-Faruqi dan juga Naquib al- Attas. Bagi al-Faruqi, Islamisasi ilmu pengetahuan adalah mengislamkan disiplin-disiplin ilmu atau tepatnya menghasilkan buku-buku pegangan (buku dasar di perguruan tinggi, dengan menuangkan kembali disiplin ilmu modern ke dalam wawasan Islam, setelah dilakukan kajian kritis terhadap kedua sistem pengetahuan Islam dan Barat. Selain itu, al-Faruqi juga memberikan langkah-langkah prosedural bagi terlaksanya program Islamisasi ilmu. Penulis menemukan poin penting dari kajian ini bahwa pemikiran Islamisasi ilmu al-Faruqi inilah yang dikritisi oleh Sardar, menurutnya perumusan epistemologi Islam kontemporer tidak dapat dimulai dengan menitikberatkan pada disiplin ilmu yang sudah ada. Sardar mengungkapkan bahwa epistemologi Islam kontemporer dapat dirumuskan dengan dengan mengembangkan paradigma-paradigma di dalam ekspresi-ekspresi eksternal peradaban Muslim yang meliputi sains dan teknologi, politik dan hubungan-hubungan internasional, struktur-struktur sosial dan kegiatan ekonomi, pembangunan desa dan kota. Semua aspek ekspesi eksternal peradaban Muslim tersebut dapat dipelajari dan dikembangan dalam kaitannya dengan kebutuhan-kebutuhan dan realitas kontemporer. Dari sini Sardar sekali lagi menolak Islamisasi ilmu pengetahuan dimulai dari disiplin ilmu yang sudah ada. Hal ini karena disiplin ilmu tersebut tidak sesuai dengan nilai-nilai Islam

  12. Bystander signaling via oxidative metabolism

    Directory of Open Access Journals (Sweden)

    Sawal HA

    2017-08-01

    Full Text Available Humaira Aziz Sawal,1 Kashif Asghar,2 Matthias Bureik,3 Nasir Jalal4 1Healthcare Biotechnology Department, Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, 2Basic Sciences Research, Shaukat Khanum Memorial Cancer Hospital and Research Centre, Lahore, Pakistan; 3Health Science Platform, School of Pharmaceutical Science and Technology, Tianjin University, Tianjin, China; 4Health Science Platform, Department of Molecular and Cellular Pharmacology, Tianjin University, Tianjin, China Abstract: The radiation-induced bystander effect (RIBE is the initiation of biological end points in cells (bystander cells that are not directly traversed by an incident-radiation track, but are in close proximity to cells that are receiving the radiation. RIBE has been indicted of causing DNA damage via oxidative stress, besides causing direct damage, inducing tumorigenesis, producing micronuclei, and causing apoptosis. RIBE is regulated by signaling proteins that are either endogenous or secreted by cells as a means of communication between cells, and can activate intracellular or intercellular oxidative metabolism that can further trigger signaling pathways of inflammation. Bystander signals can pass through gap junctions in attached cell lines, while the suspended cell lines transmit these signals via hormones and soluble proteins. This review provides the background information on how reactive oxygen species (ROS act as bystander signals. Although ROS have a very short half-life and have a nanometer-scale sphere of influence, the wide variety of ROS produced via various sources can exert a cumulative effect, not only in forming DNA adducts but also setting up signaling pathways of inflammation, apoptosis, cell-cycle arrest, aging, and even tumorigenesis. This review outlines the sources of the bystander effect linked to ROS in a cell, and provides methods of investigation for researchers who would like to

  13. Genome-wide distribution comparative and composition analysis of the SSRs in Poaceae.

    Science.gov (United States)

    Wang, Yi; Yang, Chao; Jin, Qiaojun; Zhou, Dongjie; Wang, Shuangshuang; Yu, Yuanjie; Yang, Long

    2015-02-15

    The Poaceae family is of great importance to human beings since it comprises the cereal grasses which are the main sources for human food and animal feed. With the rapid growth of genomic data from Poaceae members, comparative genomics becomes a convinent method to study genetics of diffierent species. The SSRs (Simple Sequence Repeats) are widely used markers in the studies of Poaceae for their high abundance and stability. In this study, using the genomic sequences of 9 Poaceae species, we detected 11,993,943 SSR loci and developed 6,799,910 SSR primer pairs. The results show that SSRs are distributed on all the genomic elements in grass. Hexamer is the most frequent motif and AT/TA is the most frequent motif in dimer. The abundance of the SSRs has a positive linear relationship with the recombination rate. SSR sequences in the coding regions involve a higher GC content in the Poaceae than that in the other species. SSRs of 70-80 bp in length showed the highest AT/GC base ratio among all of these loci. The result shows the highest polymorphism rate belongs to the SSRs ranged from 30 bp to 40 bp. Using all the SSR primers of Japonica, nineteen universal primers were selected and located on the genome of the grass family. The information of SSR loci, the SSR primers and the tools of mining and analyzing SSR are provided in the PSSRD (Poaceae SSR Database, http://biodb.sdau.edu.cn/pssrd/). Our study and the PSSRD database provide a foundation for the comparative study in the Poaceae and it will accelerate the study on markers application, gene mapping and molecular breeding.

  14. All-Optical Atom Trap Trace Analysis: Potential Use of 85Kr in Safeguards Activities

    International Nuclear Information System (INIS)

    Kohler, M.; Sahling, P.; Sieveke, C.; Kirchner, G.

    2015-01-01

    Sensitive measurement techniques for the detection of anthropogenic tracers demand measurement resolutions down to single atoms, as it has been demonstrated by the first atom trap trace analysis experiments. However, technical limitations had lowered the sample throughput to about 200 per year per machine. We have developed an all-optical apparatus which allows higher sample throughput and small sample sizes at the same time. Krypton-85 as anthropogenic isotope is an ideal tracer for nuclear activities since the only relevant source term is fission. An increased 85Kr concentration in an air sample indicates, that a plume was passing by during sampling. In practice, however, its applicability may be limited by the global and regional background concentrations caused by the emissions of nuclear fuel reprocessing plants. The potential of 85Kr monitoring for safeguards applications has been discussed extensively. Among these is the short range detection of elevated concentrations of 85Kr in the vicinity of reprocessing plants. Our ATTA technique needs sample sizes of about 1 l of air only and thus for the first time will allow simple environmental sampling of 85Kr with high spatial and temporal resolution. The design of such a study including local sampling and tracer transport modelling in proximity to a reprocessing plants is outlined. In addition, such a study could be used also for validating near-field atmospheric dispersion models if the 85Kr source term is known. The potential of environmental analyzes of 85Kr during an IAEA short-notice access is discussed. It is shown that it crucially depends on the emission dynamics after shut-down of fuel dissolution which needs further study. (author)

  15. Krypton-81 in groundwater of the Culebra Dolomite near the Waste Isolation Pilot Plant, New Mexico.

    Science.gov (United States)

    Sturchio, Neil C; Kuhlman, Kristopher L; Yokochi, Reika; Probst, Peter C; Jiang, Wei; Lu, Zheng-Tian; Mueller, Peter; Yang, Guo-Min

    2014-05-01

    The Waste Isolation Pilot Plant (WIPP) in New Mexico is the first geologic repository for disposal of transuranic nuclear waste from defense-related programs of the US Department of Energy. It is constructed within halite beds of the Permian-age Salado Formation. The Culebra Dolomite, confined within Rustler Formation evaporites overlying the Salado Formation, is a potential pathway for radionuclide transport from the repository to the accessible environment in the human-disturbed repository scenario. Although extensive subsurface characterization and numerical flow modeling of groundwater has been done in the vicinity of the WIPP, few studies have used natural isotopic tracers to validate the flow models and to better understand solute transport at this site. The advent of Atom-Trap Trace Analysis (ATTA) has enabled routine measurement of cosmogenic (81)Kr (half-life 229,000 yr), a near-ideal tracer for long-term groundwater transport. We measured (81)Kr in saline groundwater sampled from two Culebra Dolomite monitoring wells near the WIPP site, and compared (81)Kr model ages with reverse particle-tracking results of well-calibrated flow models. The (81)Kr model ages are ~130,000 and ~330,000 yr for high-transmissivity and low-transmissivity portions of the formation, respectively. Compared with flow model results which indicate a relatively young mean hydraulic age (~32,000 yr), the (81)Kr model ages imply substantial physical attenuation of conservative solutes in the Culebra Dolomite and provide limits on the effective diffusivity of contaminants into the confining aquitards. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. Effects of dating errors on nonparametric trend analyses of speleothem time series

    Directory of Open Access Journals (Sweden)

    M. Mudelsee

    2012-10-01

    Full Text Available A fundamental problem in paleoclimatology is to take fully into account the various error sources when examining proxy records with quantitative methods of statistical time series analysis. Records from dated climate archives such as speleothems add extra uncertainty from the age determination to the other sources that consist in measurement and proxy errors. This paper examines three stalagmite time series of oxygen isotopic composition (δ18O from two caves in western Germany, the series AH-1 from the Atta Cave and the series Bu1 and Bu4 from the Bunker Cave. These records carry regional information about past changes in winter precipitation and temperature. U/Th and radiocarbon dating reveals that they cover the later part of the Holocene, the past 8.6 thousand years (ka. We analyse centennial- to millennial-scale climate trends by means of nonparametric Gasser–Müller kernel regression. Error bands around fitted trend curves are determined by combining (1 block bootstrap resampling to preserve noise properties (shape, autocorrelation of the δ18O residuals and (2 timescale simulations (models StalAge and iscam. The timescale error influences on centennial- to millennial-scale trend estimation are not excessively large. We find a "mid-Holocene climate double-swing", from warm to cold to warm winter conditions (6.5 ka to 6.0 ka to 5.1 ka, with warm–cold amplitudes of around 0.5‰ δ18O; this finding is documented by all three records with high confidence. We also quantify the Medieval Warm Period (MWP, the Little Ice Age (LIA and the current warmth. Our analyses cannot unequivocally support the conclusion that current regional winter climate is warmer than that during the MWP.

  17. Geochemical and isotopic determination of deep groundwater contributions and salinity to the shallow groundwater and surface water systems, Mesilla Basin, New Mexico, Texas, and Mexico

    Science.gov (United States)

    Robertson, A.; Carroll, K. C.; Kubicki, C.; Purtshert, R.

    2017-12-01

    The Mesilla Basin/Conejos-Médanos aquifer system, extending from southern New Mexico to Chihuahua, Mexico, is a priority transboundary aquifer under the 2006 United States­-Mexico Transboundary Aquifer Assessment Act. Declining water levels, deteriorating water quality, and increasing groundwater use by municipal, industrial, and agricultural users on both sides of the international border raise concerns about long-term aquifer sustainability. Relative contributions of present-day and "paleo" recharge to sustainable fresh groundwater yields has not been determined and evidence suggests that a large source of salinity at the distal end of the Mesilla Basin is saline discharge from deep groundwater flow. The magnitude and distribution of those deep saline flow paths are not determined. The contribution of deep groundwater to discharge and salinity in the shallow groundwater and surface water of the Mesilla Basin will be determined by collecting discrete groundwater samples and analyzing for aqueous geochemical and isotopic tracers, as well as the radioisotopes of argon and krypton. Analytes include major ions, trace elements, the stable isotopes of water, strontium and boron isotopes, uranium isotopes, the carbon isotopes of dissolved inorganic carbon, noble gas concentrations and helium isotope ratios. Dissolved gases are extracted and captured from groundwater wells using membrane contactors in a process known as ultra-trace sampling. Gas samples are analyzed for radioisotope ratios of krypton by the ATTA method and argon by low-level counting. Effectiveness of the ultra-trace sampling device and method was evaluated by comparing results of tritium concentrations to the krypton-85 content. Good agreement between the analyses, especially in samples with undetectable tritium, indicates that the ultra-trace procedure is effective and confirms that introduction of atmospheric air has not occurred. The geochemistry data indicate a complex system of geochemical

  18. Calcium Atom Trap for Atom Trap Mass Spectrometer

    Energy Technology Data Exchange (ETDEWEB)

    Ko, Kwang Hoon; Park, Hyun Min; Han, Jae Min; Kim, Taek Soo; Cha, Yong Ho; Lim, Gwon; Jeong, Do Young [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2012-05-15

    Trace isotope analysis has been an important role in science, archaeological dating, geology, biology and nuclear industry. Artificially produced fission products such as Sr-90, Cs-135 and Kr-85 can be released to the environment when nuclear accident occurs and the reprocessing factory operates. Thus, the analysis of them has been of interest in nuclear industry. But it is difficult to detect them due to low natural abundance less then 10-10. The ultra-trace radio isotopes have been analyzed by the radio-chemical method, accelerator mass spectrometer, and laser based method. The radiochemical method has been used in the nuclear industry. But this method has disadvantages of long measurement time for long lived radioisotopes and toxic chemical process for the purification. The accelerator mass spectrometer has high isotope selectivity, but the system is huge and it has the isobar effects. The laser based method, such as RIMS (Resonance Ionization Mass Spectrometry) is a basically isobar-effect free method. Recently, ATTA (Atom Trap Trace Analysis), one of the laser based method, has been successfully demonstrated sufficient isotope selectivity with small system size. It has been applied for the detection of Kr-81 and Kr-85. However, it is not suitable for real sample detection, because it requires steady atomic beam generation during detection and is not allowed simultaneous detection of other isotopes. Therefore, we proposed the coupled method of Atom Trap and Mass Spectrometer. It consists of three parts, neutral atom trap, ionization and mass spectrometer. In this paper, we present the demonstration of the magneto-optical trap of neutral calcium. We discuss the isotope selective characteristics of the MOT (Magneto Optical Trap) of calcium by the fluorescence measurement. In addition, the frequency stabilization of the trap beam will be presented

  19. Comportamento espectral de materiais de solos e de estruturas biogênicas associadas

    Directory of Open Access Journals (Sweden)

    J. A. M. Demattê

    1998-12-01

    Full Text Available No presente estudo, verificou-se a interferência da macrofauna edáfica sobre os atributos físicos e químicos e sua relação com a reflectância espectral de um Latossolo Vermelho-Amarelo (LV, Terra Roxa Estruturada latossólica (TR e Vertissolo (V. Esses solos localizam-se em três pontos ao longo de uma toposseqüência da região de Piracicaba (SP. As amostras foram direcionadas para os agregados formados pelas formigas cortadeiras (Atta sp., cupins (Cornitermes cumulans e minhocas (Pontoscolex corethrurus, os quais foram comparados com o solo-controle sem atividade visível e recente dos animais (testemunha. Foram avaliadas a granulometria e a composição química das amostras de solo. O comportamento espectral do solo foi obtido em laboratório, utilizando espectroradiômetro entre 400 e 2.500 nm. Os coprólitos de minhoca apresentaram 2 a 3 vezes mais fósforo e um incremento de 30 a 50% na matéria orgânica em relação ao horizonte superficial do solo. Os agregados de cupins e formigas apresentaram composição química semelhante à dos horizontes subsuperficiais dos solos. O comportamento espectral dos agregados biológicos variou conforme sua composição química e profundidade de ação dos animais. No caso da minhoca, as curvas de reflectância foram semelhantes às do horizonte superficial para os três solos. Para as estruturas de cupim e formiga, tanto a composição química como o comportamento espectral corresponderam ao horizonte subsuperficial no LV e TR.

  20. Nest architecture, fungus gardens, queen, males and larvae of the fungus-growing ant Mycetagroicus inflatus Brandão & Mayhé-Nunes.

    Science.gov (United States)

    Jesovnik, A; Sosa-Calvo, J; Lopes, C T; Vasconcelos, H L; Schultz, T R

    2013-01-01

    All known fungus-growing ants (tribe Attini) are obligately symbiotic with their cultivated fungi. The fungal cultivars of "lower" attine ants are facultative symbionts, capable of living apart from ants, whereas the fungal cultivars of "higher" attine ants, including leaf-cutting genera Atta and Acromyrmex , are highly specialized, obligate symbionts. Since higher attine ants and fungi are derived from lower attine ants and fungi, understanding the evolutionary transition from lower to higher attine agriculture requires understanding the historical sequence of change in both ants and fungi. The biology of the poorly known ant genus Mycetagroicus is of special interest in this regard because it occupies a phylogenetic position intermediate between lower and higher ant agriculture. Here, based on the excavations of four nests in Pará, Brazil, we report the first biological data for the recently described species Mycetagroicus inflatus , including the first descriptions of Mycetagroicus males and larvae. Like M. cerradensis , the only other species in the genus for which nesting biology is known, the garden chambers of M. inflatus are unusually deep and the garden is most likely relocated vertically in rainy and dry seasons. Due to the proximity of nests to the Araguaia River, it is likely that even the uppermost chambers and nest entrances of M. inflatus are submerged during the rainy season. Most remarkably, all three examined colonies of M. inflatus cultivate the same fungal species as their congener, M. cerradensis , over 1,000 km away, raising the possibility of long-term symbiont fidelity spanning speciation events within the genus.

  1. Kidney function and mortality post-liver transplant in the Model for End-Stage Liver Disease era

    Directory of Open Access Journals (Sweden)

    Sethi A

    2011-11-01

    Full Text Available Aastha Sethi1, Michelle M Estrella1, Richard Ugarte2, Mohamed G Atta1 1Johns Hopkins University School of Medicine, Department of Medicine, Baltimore, MD, USA; 2University of Maryland Medical Center, Department of Medicine, Baltimore, MD, USA Abstract: The Model for End-Stage Liver Disease (MELD score incorporates serum creatinine and was introduced to facilitate allocation of orthotopic liver transplantation (LT. The objective is to determine the impact of MELD and kidney function on all-cause mortality. Among LTs performed in a tertiary referral hospital between 1995 and 2009, 419 cases were studied. Cox proportional hazards models were constructed to estimate the hazard ratios (HR and 95% confidence intervals (CI for death. Over mean follow-ups of 8.4 and 3.1 years during the pre-MELD and MELD era, 57 and 63 deaths were observed, respectively. Those transplanted during the MELD era had a higher likelihood of hepatorenal syndrome (8% vs 2%, P < 0.01, lower kidney function (median estimated glomerular filtration rate [eGFR] 77.8 vs 92.6 mL/min/1.73 m2, P < 0.01, and more pretransplantation renal replacement therapy (RRT (5% vs 1%; P < 0.01. All-cause mortality risk was similar in the MELD vs the pre-MELD era (HR: 0.98, 95% CI: 0.58–1.65. The risk of death, however, was nearly 3-fold greater (95% CI: 1.14–6.60 among those requiring pre-transplant RRT. Similarly, eGFR < 60 mL/min/1.73 m2 post-transplant was associated with a 2.5-fold higher mortality (95% CI: 1.48–4.11. The study suggests that MELD implementation had no impact on all-cause mortality post-LT. However, the need for pre-transplant RRT and post-transplant kidney dysfunction was associated with a more than 2-fold greater risk of subsequent death. Keywords: eGFR, mortality, MELD, liver transplant

  2. Representación odotópica de la organización glomerular del lóbulo antenal en los cuerpos fungiformes de las hormigas (Hymenoptera: Formicidae: Comparaciones entre dos especies

    Directory of Open Access Journals (Sweden)

    Germán Octavio López-Riquelme

    2014-01-01

    Full Text Available En este trabajo se ha comparado la organización de los lóbulos antenales (LAs y su representación topográfica en los cuerpos fungiformes (CFs en soldados de dos especies de hormigas, Atta mexicana y Camponotus ocreatus. La comparación morfológica sugiere que los LAs de A. mexicana podrían ser más especializados que los de C. ocreatus a expensas de capacidades más generales. En ambas especies, el LA está organizado en seis grupos de glomérulos, cada uno inervado por su propio tracto. La inervación de las neuronas de proyección (NP, las cuales conectan los LAs con los CFs a través de los tractos antenoprotocerebrales (TAP, divide el LA en dos regiones, anterior y posterior. Los cálices de los CFs tienen varias capas que reciben información olfativa segregada: NP que inervan los grupos anteriores de glomérulos envían axones a través del TAP-lateral hacia el cuerno lateral (CL y después hacia la capa interna del cáliz, mientras que las NP que inervan los grupos posteriores de glomérulos envían axones a través del TAP-medial a la capa externa del cáliz y después al CL. Estos resultados muestran que la organización del LA está representada topográficamente en los CFs formando un mapa odotópico. Las dos vías que conectan los LAs con los CFs podrían representar dos canales para el procesamiento de diferentes clases de olores o diferentes propiedades de los estímulos olfativos. Los resultados neuroanatómicos sugieren una organización funcional conservada en los himenópteros sociales.

  3. RESISTÊNCIA DE ISCAS GRANULADAS, DISTRIBUÍDAS A GRANEL E EM MICROPORTA-ISCAS, À AÇÃO DA UMIDADE EM PLANTIO DE Pinus taeda NO PLANALTO SUL-CATARINENSE

    Directory of Open Access Journals (Sweden)

    David Alexandre Buratto

    2017-01-01

    Full Text Available Control programs for leaf-cutting ants of the genus Acromyrmex in southern Brazil are poorly studied and the information comes from the control of the genus Atta and the damage caused by leaf-cutting ants in Eucalyptus spp. This lack of information about this ant makes some forest companies of Santa Catarina repeat patterns that are not suitable for infestations and for the species of leaf-cutting ants that occur in this state. Along with this, an inadequate distribution of bulk granular baits, in the four seasons, which end up degraded by excessive moisture caused by fog and by constant rainfall occurring in the region. Given this context, the experiments of this work had the following objectives: identify the species of leaf-cutting ants; determine the nest density per unit area; analyze and evaluate the influence of the year and the rainfall stations in each season, about the conservation and degradation of granulated baits based on sulfluramide (0.3% in bulk and distributed in the form of bait holder. To do so, experiments in Dois Irmãos Farm, owned by Florestal Rio Marombas company in areas of Pinus taeda L., located in the municipality of São Cristóvão do Sul, in the southern highlands of Santa Catarina state were installed. It was concluded that: the only species found in the leaf-cutting ant Acromyrmex crassispinus area is assessed (FOREL, 1909. At the experimental site there are 17 nests, the average is 0.94 nests per hectare, less than 1 m² each apparent area; moisture from southern Santa Catarina plateau region degrades the granulated baits distributed in bulk; the granulated baits distributed in bulk remain conserved seven days in the spring and three days in other seasons; the granulated baits distributed in bait holder remain preserved 15 days in the summer and 30 days in other seasons; the bait holder presents greater resistance to moisture in the field in relation to granulated baits distributed in bulk; the opening of the

  4. Citotossicity in immune system's cells exposed in vitro to a microwave electromagnetic field in two different exposure systems operating at mobile telephones frequencies; Citotossicita' in cellule del sistema immunitario esposte in vitro al campo elettromagnetico a microonde in due diversi sistemi espositivi operanti alle frequenze della telefonia mobile

    Energy Technology Data Exchange (ETDEWEB)

    Scarcella, E.; Ardoino, L.; Galloni, P.; Mancini, S.; Marino, C. [ENEA, Divisione Protezione dell' Uomo e degli Ecosistemi, Centro Ricerche Casaccia, Rome (Italy)

    2001-07-01

    funzionamento di cellule macrofagiche stabilizzate e coltivate in vitro (RAW 264.7) responsabili dei meccanismi di difesa specifica e aspecifica del sistema immunitario. Sono stati, inoltre, standardizzati due diversi sistemi espositivi operanti a 900 MHz a differenti livelli di densita' di potenza (da 1 a 100 W/m{sup 2}) per garantire condizioni elettromagnetiche omogenee, idonee condizioni di incubazione delle cellule e la riproducibilita' degli esperimenti. Il lavoro di standardizzazione dei sistemi espositivi e i risultati sperimentali di questa ricerca, che hanno evidenziato differenze significative della crescita e della funzionalita' macrofagica solo al livello di densita' di potenza piu' elevato (100 W/m{sup 2}), ma recuperare dopo 48 ore dall'esposizione, risultano essere preliminari e propedeutici per una programmazione sperimentale futura atta ad approfondire una valutazione bio-tossicologica in vitro.

  5. The evolution of genome size in ants

    Directory of Open Access Journals (Sweden)

    Spagna Joseph C

    2008-02-01

    Full Text Available Abstract Background Despite the economic and ecological importance of ants, genomic tools for this family (Formicidae remain woefully scarce. Knowledge of genome size, for example, is a useful and necessary prerequisite for the development of many genomic resources, yet it has been reported for only one ant species (Solenopsis invicta, and the two published estimates for this species differ by 146.7 Mb (0.15 pg. Results Here, we report the genome size for 40 species of ants distributed across 10 of the 20 currently recognized subfamilies, thus making Formicidae the 4th most surveyed insect family and elevating the Hymenoptera to the 5th most surveyed insect order. Our analysis spans much of the ant phylogeny, from the less derived Amblyoponinae and Ponerinae to the more derived Myrmicinae, Formicinae and Dolichoderinae. We include a number of interesting and important taxa, including the invasive Argentine ant (Linepithema humile, Neotropical army ants (genera Eciton and Labidus, trapjaw ants (Odontomachus, fungus-growing ants (Apterostigma, Atta and Sericomyrmex, harvester ants (Messor, Pheidole and Pogonomyrmex, carpenter ants (Camponotus, a fire ant (Solenopsis, and a bulldog ant (Myrmecia. Our results show that ants possess small genomes relative to most other insects, yet genome size varies three-fold across this insect family. Moreover, our data suggest that two whole-genome duplications may have occurred in the ancestors of the modern Ectatomma and Apterostigma. Although some previous studies of other taxa have revealed a relationship between genome size and body size, our phylogenetically-controlled analysis of this correlation did not reveal a significant relationship. Conclusion This is the first analysis of genome size in ants (Formicidae and the first across multiple species of social insects. We show that genome size is a variable trait that can evolve gradually over long time spans, as well as rapidly, through processes that may

  6. A novel educational tool for teaching ocular ultrasound

    Directory of Open Access Journals (Sweden)

    Mustafa MS

    2011-06-01

    Full Text Available MS Mustafa1, J Montgomery2, HR Atta11Department of Ophthalmology, Aberdeen Royal Infirmary, UK; 2Medi-CAL, College of Life Sciences and Medicine, University of Aberdeen, Foresterhill, Aberdeen, UKAbstract: Ocular ultrasound is now in increasing demand in routine ophthalmic clinical practice not only because it is noninvasive but also because of ever-advancing technology providing higher resolution imaging. It is however a difficult branch of ophthalmic investigations to grasp, as it requires a high skill level to interface with the technology and provide accurate interpretation of images for ophthalmic diagnosis and management. It is even more labor intensive to teach ocular ultrasound to another fellow clinician. One of the fundamental skills that proved difficult to learn and teach is the need for the examiner to “mentally convert” 2-dimensional B-scan images into 3-dimensional (3D interpretations. An additional challenge is the requirement to carry out this task in real time. We have developed a novel approach to teach ocular ultrasound by using a novel 3D ocular model. A 3D virtual model is built using widely available, open source, software. The model is then used to generate movie clips simulating different movements and orientations of the scanner head. Using Blender, Quicktime motion clips are choreographed and collated into interactive quizzes and other pertinent pedagogical media. The process involves scripting motion vectors, rotation, and tracking of both the virtual stereo camera and the model. The resulting sequence is then rendered for twinned right- and left-eye views. Finally, the twinned views are synchronized and combined in a format compatible with the stereo projection apparatus. This new model will help the student with spatial awareness and allow for assimilation of this awareness into clinical practice. It will also help with grasping the nomenclature used in ocular ultrasound as well as helping with localization of

  7. Glycyrrhetinic acid and E.resveratroloside act as potential plant derived compounds against dopamine receptor D3 for Parkinson’s disease: a pharmacoinformatics study

    Directory of Open Access Journals (Sweden)

    Mirza MU

    2014-12-01

    Full Text Available Muhammad Usman Mirza,1 A Hammad Mirza,2 Noor-Ul-Huda Ghori,3 Saba Ferdous4 1Centre for Research in Molecular Medicine, The University of Lahore, Lahore, Pakistan; 2Department of Bioscience, COMSATS Institute of Information Technology, Sahiwal, Pakistan; 3Atta-ur-Rehman School of Applied Biosciences, National University of Science and Technology, Islamabad, Pakistan; 4Institute of Structural and Molecular Biology, University College London, UK Abstract: Parkinson’s disease (PD is caused by loss in nigrostriatal dopaminergic neurons and is ranked as the second most common neurodegenerative disorder. Dopamine receptor D3 is considered as a potential target in drug development against PD because of its lesser side effects and higher degree of neuro-protection. One of the prominent therapies currently available for PD is the use of dopamine agonists which mimic the natural action of dopamine in the brain and stimulate dopamine receptors directly. Unfortunately, use of these pharmacological therapies such as bromocriptine, apomorphine, and ropinirole provides only temporary relief of the disease symptoms and is frequently linked with insomnia, anxiety, depression, and agitation. Thus, there is a need for an alternative treatment that not only hinders neurodegeneration, but also has few or no side effects. Since the past decade, much attention has been given to exploitation of phytochemicals and their use in alternative medicine research. This is because plants are a cheap, indispensable, and never ending resource of active compounds that are beneficial against various diseases. In the current study, 40 active phytochemicals against PD were selected through literature survey. These ligands were docked with dopamine receptor D3 using AutoDock and AutoDockVina. Binding energies were compared to docking results of drugs approved by the US Food and Drug Administration against PD. The compounds were further analyzed for their absorption, distribution

  8. IL LINGUAGGIO DEL DIRITTO E DELLA BUROCRAZIA NEL XIX SECOLO TRA APERTURE E ISTANZE PURISTICHE

    Directory of Open Access Journals (Sweden)

    Francesca Fusco

    2016-09-01

    Full Text Available L’articolo prende in esame la produzione lessicografica dell’Ottocento dedicata alla lingua degli uffici. Il linguaggio del diritto e quello dell’amministrazione (considerato una derivazione meno prestigiosa del primo hanno da sempre costituito una lingua distinta da quella parlata comunemente. Tale lingua, ancorata alla tradizione latina fino al XVIII secolo, a partire dagli ultimi anni del Settecento subisce un forte rinnovamento in virtù dell’influenza francese, giunta prima attraverso le idee rivoluzionarie e poi con la dominazione napoleonica. Ulteriori innovazioni nella lingua giuridico-amministrativa sono portate dall’unificazione nazionale e dalla conseguente necessità di avere una lingua comune atta a esprimere i concetti tecnici richiesti dalle istituzioni. Tutto ciò fa sì che la lingua degli uffici diventi un coacervo di arcaismi, neologismi, dialettismi e stranierismi, spesso oggetto di critica da parte dei puristi più intransigenti. Da qui i numerosi i repertori lessicali e i dizionari che, a partire dall’Elenco del Bernardoni e dalle Voci ammissibili del Gherardini, si occupano della lingua delle leggi e dell’amministrazione su posizioni più o meno puristiche, nel più ampio contesto di costruzione di un italiano lingua nazionale. The language of law and bureaucracy in the  19th century, from innovation to purism The article examines nineteenth century lexicographical production dedicated to language used in offices. The language of law and administration (the latter considered a less prestigious derivation of the former has always been a distinct language from that commonly spoken. This type of language, anchored to the Latin tradition until the eighteenth century, underwent a major change due to French influence, first through revolutionary ideas and then with Napoleonic domination. Further innovations in legal and administrative language were brought about by national unification and the consequent need for

  9. Relationship between Workplace Incivility, Job Attitudes and Muslim Religiosity Personality among Trade Union Members

    Directory of Open Access Journals (Sweden)

    Azizan H. M.

    2016-12-01

    Full Text Available In reality, workplace incivility has its fair share of attention in organizational research dealing with its causes and effect relationships. In Islam, incivility equates the negative character (akhlak of ridiculing others. Consequently, the purpose of this study is to investigate relationship between the experience of workplace incivility and job attitudes as well as the moderating effect of Muslim religiosity personality, which is measured by Muslim Religiosity-Personality Inventory (MRPI, on the relationships. In other words, this study plans to analyze whether Muslim employees, who possess religiosity personality would be able to endure workplace incivility experiences. Basically, literature by Al-Ghazali, Al-Attas and Al-Raiya on Islamic personality serve as the main foundation of the study. In addition, the works of Baron and Neuman (1998, Andersson & Pearson (1999 and Schilpzand, et. al (2014 were reviewed and a research framework was developed. The quantitative survey consisted of five sections used to measure the experience of workplace incivility, job attitudes, religiosity personality and demographics. A sample of 163 Malaysian Muslim bank workers completed the survey. Four main variables have been analyzed and their descriptive analyses are as the following. Scores for Workplace Incivility variable (M=3.34, SD=.27; Job Satisfaction variable (M=1.79, SD=.65; Organizational Commitment variable (M=2.74, SD=.34 and Muslim Religiosity Personality (M=3.60, SD=.42. As for the Pearson’s Correlation test, the result indicates that Workplace Incivility variable has inverse correlations with both job attitude variables (Job Satisfaction, R=-.611, p=.01; Organizational Commitment, R=.731,p=.01. Meanwhile, the overall model was significant, R2 = .401, F(3, 159 = 24.06, p= .01. Tests to see if the data met the assumption of collinearity indicate that multicollinearity was not a concern (Job Satisfaction, Tolerance = .96, VIF = 1

  10. A small population of hypothalamic neurons govern fertility: the critical role of VAX1 in GnRH neuron development and fertility maintenance.

    Science.gov (United States)

    Hoffmann, Hanne M; Mellon, Pamela L

    2016-01-01

    GT1-7, we show that VAX1 is a direct regulator of Gnrh1 transcription by binding key ATTA sites within the Gnrh1 promoter. This study identifies VAX1 as a key transcription factor regulating GnRH expression and establishes VAX1 as a novel candidate gene implicated in heritable infertility.

  11. Characterization and development of EST-derived SSR markers in cultivated sweetpotato (Ipomoea batatas

    Directory of Open Access Journals (Sweden)

    Li Yujun

    2011-10-01

    Full Text Available Abstract Background Currently there exists a limited availability of genetic marker resources in sweetpotato (Ipomoea batatas, which is hindering genetic research in this species. It is necessary to develop more molecular markers for potential use in sweetpotato genetic research. With the newly developed next generation sequencing technology, large amount of transcribed sequences of sweetpotato have been generated and are available for identifying SSR markers by data mining. Results In this study, we investigated 181,615 ESTs for the identification and development of SSR markers. In total, 8,294 SSRs were identified from 7,163 SSR-containing unique ESTs. On an average, one SSR was found per 7.1 kb of EST sequence with tri-nucleotide motifs (42.9% being the most abundant followed by di- (41.2%, tetra- (9.2%, penta- (3.7% and hexa-nucleotide (3.1% repeat types. The top five motifs included AG/CT (26.9%, AAG/CTT (13.5%, AT/TA (10.6%, CCG/CGG (5.8% and AAT/ATT (4.5%. After removing possible duplicate of published EST-SSRs of sweetpotato, a total of non-repeat 7,958 SSR motifs were identified. Based on these SSR-containing sequences, 1,060 pairs of high-quality SSR primers were designed and used for validation of the amplification and assessment of the polymorphism between two parents of one mapping population (E Shu 3 Hao and Guang 2k-30 and eight accessions of cultivated sweetpotatoes. The results showed that 816 primer pairs could yield reproducible and strong amplification products, of which 195 (23.9% and 342 (41.9% primer pairs exhibited polymorphism between E Shu 3 Hao and Guang 2k-30 and among the 8 cultivated sweetpotatoes, respectively. Conclusion This study gives an insight into the frequency, type and distribution of sweetpotato EST-SSRs and demonstrates successful development of EST-SSR markers in cultivated sweetpotato. These EST-SSR markers could enrich the current resource of molecular markers for the sweetpotato community and would

  12. An overview of the Phalaenopsis orchid genome through BAC end sequence analysis

    Directory of Open Access Journals (Sweden)

    Hsiao Yu-Yun

    2011-01-01

    Full Text Available Abstract Background Phalaenopsis orchids are popular floral crops, and development of new cultivars is economically important to floricultural industries worldwide. Analysis of orchid genes could facilitate orchid improvement. Bacterial artificial chromosome (BAC end sequences (BESs can provide the first glimpses into the sequence composition of a novel genome and can yield molecular markers for use in genetic mapping and breeding. Results We used two BAC libraries (constructed using the BamHI and HindIII restriction enzymes of Phalaenopsis equestris to generate pair-end sequences from 2,920 BAC clones (71.4% and 28.6% from the BamHI and HindIII libraries, respectively, at a success rate of 95.7%. A total of 5,535 BESs were generated, representing 4.5 Mb, or about 0.3% of the Phalaenopsis genome. The trimmed sequences ranged from 123 to 1,397 base pairs (bp in size, with an average edited read length of 821 bp. When these BESs were subjected to sequence homology searches, it was found that 641 (11.6% were predicted to represent protein-encoding regions, whereas 1,272 (23.0% contained repetitive DNA. Most of the repetitive DNA sequences were gypsy- and copia-like retrotransposons (41.9% and 12.8%, respectively, whereas only 10.8% were DNA transposons. Further, 950 potential simple sequence repeats (SSRs were discovered. Dinucleotides were the most abundant repeat motifs; AT/TA dimer repeats were the most frequent SSRs, representing 253 (26.6% of all identified SSRs. Microsynteny analysis revealed that more BESs mapped to the whole-genome sequences of poplar than to those of grape or Arabidopsis, and even fewer mapped to the rice genome. This work will facilitate analysis of the Phalaenopsis genome, and will help clarify similarities and differences in genome composition between orchids and other plant species. Conclusion Using BES analysis, we obtained an overview of the Phalaenopsis genome in terms of gene abundance, the presence of repetitive

  13. Contribution of transcription-coupled DNA repair to MMS-induced mutagenesis in E. coli strains deficient in functional AlkB protein.

    Science.gov (United States)

    Wrzesiński, Michał; Nieminuszczy, Jadwiga; Sikora, Anna; Mielecki, Damian; Chojnacka, Aleksandra; Kozłowski, Marek; Krwawicz, Joanna; Grzesiuk, Elzbieta

    2010-06-01

    In Escherichia coli the alkylating agent methyl methanesulfonate (MMS) induces defense systems (adaptive and SOS responses), DNA repair pathways, and mutagenesis. We have previously found that AlkB protein induced as part of the adaptive (Ada) response protects cells from the genotoxic and mutagenic activity of MMS. AlkB is a non-heme iron (II), alpha-ketoglutarate-dependent dioxygenase that oxidatively demethylates 1meA and 3meC lesions in DNA, with recovery of A and C. Here, we studied the impact of transcription-coupled DNA repair (TCR) on MMS-induced mutagenesis in E. coli strain deficient in functional AlkB protein. Measuring the decline in the frequency of MMS-induced argE3-->Arg(+) revertants under transient amino acid starvation (conditions for TCR induction), we have found a less effective TCR in the BS87 (alkB(-)) strain in comparison with the AB1157 (alkB(+)) counterpart. Mutation in the mfd gene encoding the transcription-repair coupling factor Mfd, resulted in weaker TCR in MMS-treated and starved AB1157 mfd-1 cells in comparison to AB1157 mfd(+), and no repair in BS87 mfd(-) cells. Determination of specificity of Arg(+) revertants allowed to conclude that MMS-induced 1meA and 3meC lesions, unrepaired in bacteria deficient in AlkB, are the source of mutations. These include AT-->TA transversions by supL suppressor formation (1meA) and GC-->AT transitions by supB or supE(oc) formation (3meC). The repair of these lesions is partly Mfd-dependent in the AB1157 mfd-1 and totally Mfd-dependent in the BS87 mfd-1 strain. The nucleotide sequence of the mfd-1 allele shows that the mutated Mfd-1 protein, deprived of the C-terminal translocase domain, is unable to initiate TCR. It strongly enhances the SOS response in the alkB(-)mfd(-) bacteria but not in the alkB(+)mfd(-) counterpart. Copyright 2010 Elsevier B.V. All rights reserved.

  14. Metodología para la evaluación del potencial insecticida de especies forestales.

    Directory of Open Access Journals (Sweden)

    Morales Soto León

    2000-06-01

    Full Text Available La diversidad florística de Colombia plantea enormes retos de investigación, con miras a una utilización racional e integral de sus recursos forestales. Las plantas con efectos biocidas utilizables en el control de plagas o enfermedades revisten una singular importancia. El objetivo de este trabajo es plantear una metodología de fácil aplicación, bajo costo y rápidos resultados, que permita acopiar la información necesaria sobre el mayor número de especies con potencial en este sentido. La metodología plantea la siguiente secuencia: selección de las especies vegetales de interés, apoyada en los reportes bibliográficos, conocimiento ancestral y observaciones personales; recolección del material en el campo; preparación del extracto total a partir del material seco; pruebas iniciales con Artemia salina Lech. para detectar actividad biológica, a través de la determinación de la LC50 (las especies con LC50 menores de 1000 ppm se consideran promisorias y ameritan procesos posteriores de fraccionamiento químico, bioensayos con las sustancias más promisorias sobre algún organismo de interés particular y determinación final de los compuestos activos en la planta. La metodología descrita fue empleada en la evaluación del potencial de acción biocida de 5 especies arbóreas o arbustivas, Guarea guidonia (L. Sleumer y Trichia hirta L. (Meliaceae, Machaerium moritzianum Benth. (Fabaceae, Swinglea glutinosa Merrill. (Rutaceae y Mammea americana L. (Clusiaceae. Se utilizó para los bioensayos iniciales el microcrustáceo Artemia salina Leach como indicador del potencial biocida con el fin de seleccionar las dos especies más promisorias a partir de las LC50 obtenidas. Con las dos se realizaron los bioensayos para evaluar la acción fagoinhibidora en la hormiga arriera Atta cephalotes (L., y el posible control de Alconeura sp. (Homoptera: Cicadellidae, insecto chupador que afecta la ceiba verde Pseudobombax septenatum (Jacq. Dugand

  15. How can AN Approach to Steam BE Authentic to both Science and Art?

    Science.gov (United States)

    LaFayette, C. J.; Parke, Ph D., F. I.; Pierce, C.; Nakamura, T.

    2015-12-01

    A collaborative project engaged a team of geophysicists, engineers, entomologists, and artists to visualize tunnels and chambers of a vast, leafcutting ant colony in rural Texas. Part of the plan was to test the nature of significant outcomes in different domains and contexts. Our team used Ground Penetrating Radar to scan part of the nest, then translate the data into 3D geometry to be experienced on an immersive visualization system. This provided the ability to zoom out of and into the model. The tunnel fragment could appear like a tiny crumb floating in air, or one could move inside it to view details and tunnel architecture. Exterior and interior structure could thus be perceived in a seamless way. The system enabled a kinesthetic sense — one both saw and felt surrounded by the scene. This was the first time GPR had been used to map a living ant colony. Due to this project, entomologists have begun to use GPR with encouraging results. The Atta project inspired in us an enjoyment of experimentation and collaboration. Results were exhibited in international art venues, published in scientific journals, and demonstrated at hybrid venues for art and science. Each form of dissemination was suited to the host. Whether the result can be called art, science, or a blend is determined by its reception in a larger community. Like the species name and the pathway worn from tree to nest, the process of mapping the colony took the form of a palindrome: we pulled something out of the ground, passed it back and forth, and hoisted it out into the world. The role of art in collaboration with science can take many forms. Art can enhance science understanding for non-scientists. Artists and scientists can co-invent new tools for inquiry. Artists are adept at creating ways to experience and understand data or phenomena through multi-modal experiences, for example, aural, haptic, or olfactory. Artists are trained to foreground the process of making as part of the "performance

  16. EDITORIAL: A support for prospective nanomaterials A support for prospective nanomaterials

    Science.gov (United States)

    Demming, Anna

    2011-01-01

    , often touted as a pioneer of a 'bottom-up' approach to nanotechnology, once said 'I was born not knowing and have had only a little time to change that here and there'. In a similar sense, what we do not yet know and understand about the ability to create and manipulate nanosystems is apparently infinite, but as can also be acceded in the case of Richard Feynman, the 'little' we have had time learn so far holds more than a little promise. References [1] Glass R, Möller M and Spatz J P 2003 Nanotechnology 14 314 [2] Kuzyk A, Laitinen K T and Törmä P 2009 Nanotechnology 20 235305 [3] Williams S M, Rodriguez K R, Teeters-Kennedy S, Shah S, Rogers T M, Stafford A D and Coe J V 2004 Nanotechnology 15 S495 [4] Bini T B, Gao S, Tan T C, Wang S, Lim, A, Hai L B and Ramakrishna S 2004 Nanotechnology 15 1459 [5] Yang F, Murugan R, Wang S and Ramakrishna S 2005 Biomaterials 26 2603-10 [6] Tampieri A, Landi E, Valentini F, Sandri M, D'Alessandro T, Dediu V and Marcacci M 2011 Nanotechnology 22 015104 [7] Gross A F, Ahn C C, Van Atta S L, Liu P and Vajo J J 2009 Nanotechnology 20 204005 [8] Zhang S, Gross A F, Van Atta S L, Lopez M, Liu P, Ahn C C, Vajo J J and Jensen C M 2009 Nanotechnology 20 204027

  17. Effect of dietary fiber in lowering serum glucose and body weight in sprague dawley rats

    Directory of Open Access Journals (Sweden)

    Muhammad Imran Chohan

    2011-08-01

    Full Text Available Introduction:The present study evaluated the hypoglycemic perspectives and weight loss significance of dietary fiber. Dietary fiber was supplemented in commercial wheat flour (atta for the preparation of chapaties, a staple diet of South Asia. Male Sprague Dawley rats (n = 100 were randomly divided into 4 diet groups (n = 25 per group. The control group was fed basal diet that included commercial wheat flour chapati, cornstarch, corn oil, salt and vitamin mixture in such a way that 10% of the protein was available from the final diet. To the basal diet of other 3 groups, chapaties supplemented with 2% guar gum (GG 2%, 3% guar gum (GG 3% and 5% chickpea + 1% guar gum (CP5%+GG1% were added, respectively. All diets were fed to the rats for a period of 8 weeks to perceive the impact of respective compositions. Rats fed on CP 5% + GG1%, showed maximum glucose reduction (14.57% followed by GG 3% (11.64% and GG 2% (9.60% as compared to control diet. Likewise, rats fed on 3% GG showed maximum decline (7.90% in body weight. It was concluded that chapaties prepared from selected treatments provide an additional dietary fiber that could be supportive for diabetic and obese individuals.Results:The results indicated that addition of dietary fiber influenced the physical characteristics of chapati non-significantly. Maximum glucose concentration was found to be 112.50 mg/dL in control group followed by 101.70 and 99.41 mg/dL in groups fed on guar gum 2% and guar gum 3%, respectively. Lowest glucose concentration (96.11 mg/dL was observed in rats fed on the combination of chickpea 5 %+ guar gum 1%. Maximum serum protein concentration was found to be 6.39 g/dL in rats fed on combination of chickpea 5 % + guar gum 1% whilst the remaining three groups showed non significant variations with respect to each other. Means for serum Functional Foods in Health and Disease 2011; 8:261-278 protein were 6.33, 6.30 and 6.32 g/dL for control, guar gum 3%, and guar gum 2

  18. A new approach to constrain basal helium flux into aquifers for better estimation of groundwater ages by Helium 4

    Science.gov (United States)

    Matsumoto, Takuya; Sturchio, Neil C.; Chang, Hung K.; Gastmans, Didier; Araguas-Araguas, Luis J.; Jiang, Wei; Lu, Zheng-Tian; Mueller, Peter; Yokochi, Reika; Purtschert, Roland; Zongyu, Chen; Shuiming, Hu; Aggarwal, Pradeep K.

    2016-04-01

    Estimation of groundwater age through the combined use of isotope methods and groundwater flow modelling is the common approach used for developing the required level of knowledge in the case of groundwater pumped from deep aquifers. For more than 50 years radiocarbon and tritium have been the common tools used in isotope hydrology studies to provide first estimates of groundwater age and dynamics. The half-life of carbon-14 (5730 years) and the complex geochemistry of carbon species in most environments have limited the proper characterization of groundwater flow patterns in large sedimentary basins and deep aquifers to ages more recent than about 40 000 years. Over the last years, a number of long-live radionuclides and other isotopes have been tested as more reliable age indicators by specialised laboratories. Among these methods, chlorine-36 (half-life of 300 000 yr) has been used with mixed results, mainly due to problems derived from in-situ production of this radionuclide. Uranium isotopes have also been used in a few instances, but never became a routine tool. Accumulation of helium-4 in deep groundwaters has also been proposed and used in a few instance, but one major obstacle in the 4He dating method is a difficulty in assessing a rate constant of 4He input into aquifers (namely, the entering basal 4He flux). In this context, recent breakthrough developments in analytical methods allow the precise determination of dissolved noble gases in groundwater as well as trace-level noble gas radionuclides present in very old groundwaters. Atom trap trace analysis, or ATTA, has dramatically improved over the last years the processing of very small amount of noble gases, providing now real possibilities for routine measurements of extremely low concentration of exotic radionuclides dissolved in groundwater, such as krypton-81 (half-life 229 000 years). Atom trap trace analysis involves the selective capture of individual atoms of a given isotope using six laser

  19. Iš lietuvių kalbos žodžių istorijos: I. Lie. gáirė; II. Lie. tóbulas, tóbūlas

    Directory of Open Access Journals (Sweden)

    Birutė Kabašinskaitė

    2011-11-01

    ärung besteht darin, daß bei der Deutung in bewährter, herkömmlicher Weise vorgegangen und mit einer geradlinig verlaufenen Bedeutungsentwicklung gerechnet wird. Im ersten Falle könnte lit. tóbulas als Ableitung einer zu postulierenden Wurzelform *teh2-bh- ‘heranreifen’ (Erweiterung der Wurzel *teh2- aufgefaßt werden. Die Bedeutung ‘vollkommen’ wäre dann aus einem ‘zur Reife gelangt, bis zur vollen Reife und der damit verbundenen Ausbildung seiner idealen Beschaffenheit herangewachsen’ hervorgegangen. Das Material, das den Ansatz einer bisher nicht registrierten Wurzel *teh2- ‘zur Reife heranwachsen, heranreifen’ nahelegt, ist folgendes: 1. lit. atólas, lett. atāls, attals, preuß. attolis ‘Grummet’ < urbalt. *attā́la-s; nbulg. otáva, skr. òtava, russ. otáva u. a. ‘Grummet’ < urslav. *oˈtava; den baltischen und slavischen Wörtern liegen die Adjektiva *at+ˈtā́-la-s bzw. *at + ˈtā́-u̯a-s ‘wieder nachgewachsen, sich wieder erholt habend’ < ‘wieder zur Reife herangewachsen’ zugrunde; 2. gr. τα̃λις‘junges heiratsfähiges Mädchen’ < *táh2-li- und lit. talõkas ‘geschlechtsreifer junger Mann; mannbares Mädchen’ Weiterbildung von *tala- < *tǝ2-lo- ‘zur Reife herangewachsen’. Mit größeren Schwierigkeiten behaftet ist und weniger orthodox wirkt eine zweite Möglichkeit der Deutung von tóbulas. Es könnte als Zusammenrückung *tā́+būla-s ‘so (nämlich zu dem, worauf die Bezeichnung des durch das jeweilige Bezugswort zum Ausdruck gebrachten Begriffes wirklich zutrifft geworden’ = ‘die ideale Beschaffenheit des jeweiligen Begriffes erreicht habend, vollkommen’ erklärt werden. Tóbulas müßte in diesem Fall durch Suffixwechsel mit Austausch des vermeintlichen Suffixes -ūla- in analogischem Anschluß an das geläufigere -ula- aus *tābūla-s entstanden sein. Für das Verbaladjektiv *bū́-la- wäre dabei noch eine ältere, in slavisch byti neben ‘sein’ erhaltene Bedeutung

  20. MEMORIAS III Encuentro Científico de Estudiantes de Biología

    Directory of Open Access Journals (Sweden)

    Biológica Colombiana Acta

    2003-07-01

    de regeneración en un bosque intervenido de la Amazonía Colombiana / Estudio preliminar de la comunidad macrobentónica del mesolitoral rocoso de bahía Concha (Parque Nacional Natural Tayrona,Magdalena, Colombia / Caracterización florística de un bosque pluvial tropical en el corregimiento de Pacurita, Quibdó, Chocó (Colombia / Revisión preliminar de la familia procyonidaeen Colombia / Evaluación y dinámica de uso del recurso hídrico en el corregimiento de Barú (Cartagena, Bolívar, Colombia / Viabilidad de la liberación de ardillas cola roja sciurus granatensisen el arboretum Francisco Bayón - Universidad Nacional de Colombia / Los rastros del megaterio comparación anatómica entre eremotherium rusconiiy bradypus variegatus / Comportamiento reproductivo de chiroxiphia lanceolata(pipridae:aves en un bosque intervenido del Tolima, Colombia / índice de agresividad en apis mellifera(hymenoptera: aapidae / Inserción de proteínas en membrana: algunas características del proceso / Comportamiento de félidos en cautiverio en el Zoológico de Santa Cruz, Colombia / Efecto de la forma tridimensional y el fenómeno de iluminación mutua en la percepción del color en el hombre / Tasa de hidratación de Physalaemus pustulosusR / Algunas serpientes venenosas presentes en la cuenca hidrográfica del Río Cabí, Chocó, Colombia / Embriogénesis somática y regeneración de plantas enepidendrum ruizianum (Orchidaceae / Germinación y crecimiento de una planta foránea, satureja sp.(labiaceae sobre tres sustratos orgánicos bajo condiciones controladas en la Sabana de Bogotá, Colombia / Caracterización de la comunidad de arañas (arachnida: aranae presente en bosque alto andino y en frailejonal del Parque Nacional Natural Chingaza, Colombia / Transporte de biomasa por una colonia de atta laevigatasmith 1958 (hymenoptera: formicidae en los Llanos Orientales (Puerto López, Meta, Colombia / Manejo ex situde crías de crocodylus intermedius(crocodylidae, una

  1. Meliponini neotropicais: o gênero Partamona Schwarz, 1939 (Hymenoptera, Apidae, Apinae - bionomia e biogeografia

    Directory of Open Access Journals (Sweden)

    Camargo João M. F.

    2003-01-01

    termitaria, such as cavities and crevices in walls, among roots of epiphytes and in bases of palm leaves, in abandoned bird nests, under bridges, and in other protected places, except P. peckolti that occasionally occupies termite nests. In South America, on the eastern side of the Andes, only P. epiphytophila and P. helleri nest among roots of epiphytes and other substrates, non-associated with termitaria. All other species studied (P. batesi, P. gregaria, P. pearsoni, P. ferreirai, P. chapadicola, P. nhambiquara, P. vicina, P. mourei, P. auripennis, P. combinata, P. cupira, P. mulata, P. ailyae, P. seridoensis, P. criptica and P. rustica nest inside active termite nests, whether epigeous or arboreous. The only species that builds obligate subterranean nests, associated or not with termite or ant nests (Atta spp. is P. testacea. Nests of Partamona have one vestibular chamber (autapomorphic for the genus closely adjacent to the entrance, filled with a labyrinth of anastomosing pillars and connectives, made of earth and resins. One principal chamber exists for food and brood, but in some species one or more additional chambers are filled with food storage pots. In nests of P. vicina, there is one atrium or "false nest", between the vestibule and the brood chamber, which contains involucral sheaths, cells and empty pots. All structures of the nest are supported by permanent pillars made of earth and resins (another autapomorphy of the genus. The characters concerning nesting habits were coded and combined with morphological and biogeographic data, in order to hypothesize the evolutive scenario of the genus using cladistic methodology. The phylogenetic hypothesis presented is the following: (((((P. bilineata (P. grandipennis, P. xanthogastra (P. orizabaensis, P. peckolti (P. aequatoriana, P. musarum P. epiphytophila, P. yungarum, P. subtilis, P. vitae (((((P. testacea (P. mourei, P. vicina (P. nigrior (P. auripennis, P. combinata (P. ferreirai (P. pearsoni (P. gregaria (P

  2. The 15th Biannual National Congress of the South African Society of Psychiatrists, 10-14 August 2008, Fancourt, George, W Cape

    Directory of Open Access Journals (Sweden)

    Eugene Allers

    2008-08-01

    and body Oye Gureje 15. Child and adolescent psychopharmacology: Current trends and complexities S M Hawkridge 16. Integrating mental illness, suicide and religion Volker Hitzeroth 17. Cost of acute inpatient mental health care in a 72-hour assessment uniy A B R Janse van Rensburg, W Jassat 18. Management of Schizophrenia according to South African standard treatment guidelines A B R Janse van Rensburg 19. Structural brain imaging in the clinical management of psychiatric illness F Y Jeenah 20. ADHD: Change in symptoms from child to adulthood S A Jeeva, A Turgay 21. HIV-Positive psychiatric patients in antiretrovirals G Jonsson, F Y Jeenah, M Y H Moosa 22. A one year review of patients admitted to tertiary HIV/Neuropsychiatry beds in the Western Cape John Joska, Paul Carey, Ian Lewis, Paul Magni, Don Wilson, Dan J Stein 23. Star'd - Critical review and treatment implications Andre Joubert 24. Options for treatment-resistent depression: Lessons from Star'd; an interactive session Andre Joubert 25. My brain made me do it: How Neuroscience may change the insanity defence Sean Kaliski 26. Child andadolescent mental health services in four African countries Sharon Kleintjies, Alan Flisher, Victoruia Campbell-Hall, Arvin Bhana, Phillippa Bird, Victor Doku, Natalie, Drew, Michelle Funk, Andrew Green, Fred Kigozi, Crick Lund, Angela Ofori-Atta, Mayeh Omar, Inge Petersen, Mental Health and Poverty Research Programme Consortium 27. Individualistic theories of risk behaviour Liezl Kramer, Volker Hitzeroth 28. Development and implementation of mental health poliy and law in South Africa: What is the impact of stigma? Ritsuko Kakuma, Sharon Kleintjes, Crick Lund, Alan J Flisher, Paula Goering, MHaPP Research Programme Consortium 29. Factors contributing to community reintegration of long-term mental health crae users of Weskoppies Hospital Carri Lewis, Christa Kruger 30. Mental health and poverty: A systematic review of the research in low- and middle-income countries Crick Lund

  3. Comunicólogo que brinca comunica mais?

    Directory of Open Access Journals (Sweden)

    Ivany Câmara Neiva

    2015-09-01

    CINECLICK (sobre filme Tarja Branca. Disponível em http://www.cineclick.com.br/tarja-branca-a-revolucao-que-faltava. Acesso em 02.08.2015. COMISSÃO DE PROFESSORES. Carta aberta ao Ministro Cid Gomes. Correio Braziliense, Brasília, 10.02.2015. p.3. CORTELLA, Mário Sérgio. Os alunos não são mais os mesmos. In Novos Paradigmas da Educação (vídeo. São Paulo: Atta Mídia e Educação, 2003. D´ÁVILA, Cristina e VEIGA, Ilma Passos Alencastro (orgs.. Didática e docência na educação superior: implicações para a formação de professores. Campinas, SP: Papirus, 2012. DUARTE, Mauricio. O básico do básico. Disponível em http://www.revistadacultura.com.br/revistadacultura/detalhe/14-09-04/A_base_do_b%C3%A1sico.aspx. Acesso em 02.08.2015. DUARTE JUNIOR, João-Francisco. O que é realidade. 10.ed., 5.reimpr. São Paulo: Brasiliense, 2004. (1ª edição: 1984. ______. O sentido dos sentidos: a educação (do sensível. Disponível em http://www.bibliotecadigital.unicamp.br/document/?code=vtls000211363. Acesso em 02.08.2015. ECO, Umberto. O nome da rosa. Rio de Janeiro: Record, 2009. FERNANDES, Florestan. As Trocinhas do Bom Retiro: contribuição ao estudo folclórico e sociológico dos grupos infantis. In: ______. Folclore e mudança social na cidade de São Paulo. 2.ed. Petrópolis/RJ: Vozes, 1979. FREIRE, Paulo. Ação Cultural para a Liberdade e Outros Escritos. São Paulo: Paz e Terra, 2011. ______. Pedagogia da Autonomia - saberes necessários à prática educativa. São Paulo: Paz e Terra, 1996. FREITAS, Fidalgo de. O esgotamento (burnout nos professores. Millenium on line n0 15. Jul. 1999. Disponível em http://www.ipv.pt/millenium/15_spec1.htm. Acesso em 02.08.2015. GOMES, Patrícia. Professor precisa abrir a cabeça, diz José Pacheco. Disponível em http://porvir.org/porpessoas/para-inovar-e-preciso-professor-abra-cabeca-diz-jose-pacheco/20120522. Acesso em 02.08.2015. GUIMARÃES, Renato S.. Como as escolas transformam crianças em adultos med

  4. Δοκίμιο για την κοινωνική εξέλιξη στη διάρκεια των λεγόμενων «σκοτεινών αιώνων»

    Directory of Open Access Journals (Sweden)

    Τηλέμαχος Κ. ΛΟΥΓΓΗΣ

    1985-09-01

    èmes; la soi-disante rébellion des Arméniaques en 793 ; l'apparition de la nouvelle aristocratie dans la Chronique de l'an 811; le rôle des mouvements populaires (Thomas le Slave et, dans une certaine mesure, les Pauliciens; les relations entre l'armée et le clergé à tout moment donné; la destinée des officiers moyens de l'armée après la capitulation idéologique de leurs chefs; les initiatives politiques de la nouvelle aristocratie; l'attitude de Michel II le Bègue en tant que premier empereur qui s'appuie consciemment sur la nou­velle aristocratie; la révolte avortée de Bardanès Tourcos etc.L'étude vise à démontrer que toutes les transformations politiques, institutionnelles etc. qui ont dû avoir lieu pendant les «siècles obscurs» sont des produits concrets et directs ou indirects d'une lutte sociale très réelle et très profonde à la fois qui a mené à de changements de structures, à de changements qualitatifs. Tandis que la noblesse proto­byzantine était composée par la noblesse sénatoriale, la noblesse des villes de province et le clergé, la noblesse mésobyzantine est composée principalement par l'armée et le clergé (vu que m. A. Guillou a déjà re­marqué en ce qui concerne l'exarchat de Ravenne au VIIe siècle. Une attention particulière est accordée aux vicissitudes du rôle des militaires, depuis la «terreur» de Phocas jusqu'à l'avènement de Basile Ier. Quelques empereurs, tel Constantin IV ou Anastase II perdent quelque chose de leur auréole, tandis que d'autres, tel Constant II et Justinien II sont placés sans louanges dans le vrai contexte politique de leur époque. Toute la structure de l'étude, en dernière analyse, tend à soutenir que des affirmations comme «Héraclius s'est trompé d'ennemi (au lieu d'atta­quer les Arabes, il a détruit la Perse!!!, ou «tel empereur est mort très jeune» ou encore «Michel III était bon ou mauvais empereur» n'ont au­cune place dans la science de l'Histoire et doivent

  5. MFGA-IDT2 workshop: Astrophysical and geophysical fluid mechanics: the impact of data on turbulence theories

    Science.gov (United States)

    Schertzer, D.; Falgarone, E.

    very large scale of the Universe. The presentations and the round table at the end of the workshop pointed out the following: - the necessity of this type of confrontation which makes intervene numerical simulations, laboratory experiments, phenomenology as well as a very large diversity of geophysical and astrophysical data, - presumably a relative need for new geophysical data, whereas there have been recent astrophysical experiments which yield interesting data and exciting questions; - the need to develop a closer intercomparison between various intermittency models (in particular Log-Poisson /Log Levy models). Two main questions were underlined, in particular during the round table: - the behaviour of the extremes of intermittency, in particular the question of divergence or convergence of the highest statistical moments (equivalently, do the probability distributions have algebraic or more rapid falloffs?); - the extension of scaling ranges; in other words do we need to divide geophysics and astrophysics in many small (nearly) isotropic subranges or is it sufficient to use anisotropic scaling notions over wider ranges? 4 The contributions in this special issue Recalling that some of the most useful insights into the nature of turbulence in fluids have come from observations of geophysical flows, Van Atta gives a review of the impacts of geophysical turbulence data into theories. His paper starts from Taylor's inference of the nearly isotropy of atmospheric turbulence and the corresponding elegant theoretical developments by von Karman of the theory of isotropic turbulence, up to underline the fact that the observed extremely large intermittency in geophysical turbulence also raised new fundamental questions for turbulence theory. The paper discusses the potential contribution to theoretical development from the available or currently being made geophysical turbulence measurements, as well as from some recent laboratory measurements and direct numerical

  6. MFGA-IDT2 workshop: Astrophysical and geophysical fluid mechanics: the impact of data on turbulence theories

    Directory of Open Access Journals (Sweden)

    D. Schertzer

    1996-01-01

    ... up to the very large scale of the Universe. The presentations and the round table at the end of the workshop pointed out the following: - the necessity of this type of confrontation which makes intervene numerical simulations, laboratory experiments, phenomenology as well as a very large diversity of geophysical and astrophysical data, - presumably a relative need for new geophysical data, whereas there have been recent astrophysical experiments which yield interesting data and exciting questions; - the need to develop a closer intercomparison between various intermittency models (in particular Log-Poisson /Log Levy models. Two main questions were underlined, in particular during the round table: - the behaviour of the extremes of intermittency, in particular the question of divergence or convergence of the highest statistical moments (equivalently, do the probability distributions have algebraic or more rapid falloffs?; - the extension of scaling ranges; in other words do we need to divide geophysics and astrophysics in many small (nearly isotropic subranges or is it sufficient to use anisotropic scaling notions over wider ranges? 4 The contributions in this special issue Recalling that some of the most useful insights into the nature of turbulence in fluids have come from observations of geophysical flows, Van Atta gives a review of the impacts of geophysical turbulence data into theories. His paper starts from Taylor's inference of the nearly isotropy of atmospheric turbulence and the corresponding elegant theoretical developments by von Karman of the theory of isotropic turbulence, up to underline the fact that the observed extremely large intermittency in geophysical turbulence also raised new fundamental questions for turbulence theory. The paper discusses the potential contribution to theoretical development from the available or currently being made geophysical turbulence measurements, as well as from some recent laboratory measurements and direct numerical