WorldWideScience

Sample records for astatine 210

  1. Radiochemistry of astatine

    Energy Technology Data Exchange (ETDEWEB)

    Ruth, T J; Dombsky, M; D' Auria, J M; Ward, T E

    1988-01-01

    This monograph is a review of the literature through 1987 and covers the methods of producing the radioisotopes of astatine and the inorganic, nuclear, and organic chemistry of astatine. The discussion is limited to chemical and physical chemical properties of astatine. The monograph, after the introduction, is divided into chapters titled: production methods, nuclear spectroscopy, chemistry of astatine, separation and isolation (dry and wet), and selected procedures. 209 refs., 15 figs., 7 tabs. (DLC)

  2. 210

    Science.gov (United States)

    Romańczyk, Grzegorz; Boryło, Alicja

    2017-02-01

    The results of the research indicated that the 210 Po activity concentration in sweat samples was between 0.22 ± 0.03 to 2.10 ± 0.15 mBq·g -1 d.w. The obtained results of the studies showed that smoking and eating fish led to higher activity concentrations of 210 Po in sweat in comparison to the control group. Statistical analysis of 210 Po activity concentrations in sweat samples showed significant differences between control, smoking, fish eating and age groups, while no significant differences was found for 210 Po between volunteers as far as gender is concerned. Copyright © 2016. Published by Elsevier Ltd.

  3. 210

    Science.gov (United States)

    Chuangao, Wang; Ruirui, Liu; Jinfeng, Li; Zhijun, Huang; Jingshun, Pan; Zhiping, Luo; Ling, Chen; Zhongwen, Wang; Ziqiang, Pan

    2017-05-01

    In this paper, the distribution of 210 Po after high temperature processes in six units of coal-fired power plants (CFPs) were evaluated. The coal, bottom ashes, fly ashes from electrostatic precipitators (ESP), and flue gases from stacks were sampled from four CFPs and analyzed for 210 Po contents. The results showed that 210 Po was mainly captured by the ESP, with little left in the bottom ash, and a small fraction of 210 Po was directly discharged into the environment through the stacks, accounting for 0.06%-0.6%, which was consistent with the reported data. It was also found that part of the 210 Po could not be accounted for in the mass balance analysis for the whole combustion process in CFPs, which was also in line with the reported data. The results obtained in this study provided essential basic data for environmental radiological risk analysis for CFPs. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Discovery of the astatine, radon, francium, and radium isotopes

    Energy Technology Data Exchange (ETDEWEB)

    Fry, C.; Thoennessen, M., E-mail: thoennessen@nscl.msu.edu

    2013-09-15

    Thirty-nine astatine, thirty-nine radon, thirty-five francium, and thirty-four radium isotopes have so far been observed; the discovery of these isotopes is described. For each isotope a brief summary of the first refereed publication, including the production and identification method, is presented.

  5. Discovery of the astatine, radon, francium, and radium isotopes

    CERN Document Server

    Fry, C

    2012-01-01

    Currently, thirty-nine astatine, thirty-nine radon, thirty-five francium, and thirty-four radium isotopes have so far been observed; the discovery of these isotopes is discussed. For each isotope a brief summary of the first refereed publication, including the production and identification method, is presented.

  6. Discovery of the astatine, radon, francium, and radium isotopes

    Science.gov (United States)

    Fry, C.; Thoennessen, M.

    2013-09-01

    Thirty-nine astatine, thirty-nine radon, thirty-five francium, and thirty-four radium isotopes have so far been observed; the discovery of these isotopes is described. For each isotope a brief summary of the first refereed publication, including the production and identification method, is presented.

  7. Delayed and In-beam Spectroscopy on Francium and Astatine Nuclei at the Proton Drip Line

    Energy Technology Data Exchange (ETDEWEB)

    Uusitalo, J.; Jakobsson, U. [Department of Physics, University of Jyvaeskylae (Finland); Collaboration: RITU-Gamma Gollaboration

    2011-11-30

    Delayed and in-beam spectroscopy on francium and astatine nuclei at and beyond the proton drip line has been performed. In neutron deficient astatine nuclei a shift to deformed shapes as a function of decreasing neutron has been obtained. In neutron deficient francium isotope the same shift is evident.

  8. Delayed and In-beam Spectroscopy on Francium and Astatine Nuclei at the Proton Drip Line

    Science.gov (United States)

    Uusitalo, J.; Jakobsson, U.

    2011-11-01

    Delayed and in-beam spectroscopy on francium and astatine nuclei at and beyond the proton drip line has been performed. In neutron deficient astatine nuclei a shift to deformed shapes as a function of decreasing neutron has been obtained. In neutron deficient francium isotope the same shift is evident.

  9. Measurement of the first ionization potential of astatine by laser ionization spectroscopy

    CERN Document Server

    Rothe, S; Antalic, S; Borschevsky, A; Capponi, L; Cocolios, T E; De Witte, H; Eliav, E; Fedorov, D V; Fedosseev, V N; Fink, D A; Fritzsche, S; Ghys, L; Huyse, M; Imai, N; Kaldor, U; Kudryavtsev, Yu; Köster, U; Lane, J; Lassen, J; Liberati, V; Lynch, K M; Marsh, B A; Nishio, K; Pauwels, D; Pershina, V; Popescu, L; Procter, T J; Radulov, D; Raeder, S; Rajabali, M M; Rapisarda, E; Rossel, R E; Sandhu, K; Seliverstov, M D; Sjödin, A M; Van den Bergh, P; Van Duppen, P; Venhart, M; Wakabayashi, Y; Wendt K D A

    2013-01-01

    The radioactive element astatine exists only in trace amounts in nature. Its properties can therefore only be explored by study of smallest quantities of artificially produced isotopes or by performing theoretical calculations. One of the most important properties influencing the chemical behaviour is the energy required to remove one electron from the valence shell, referred to as the ionization potential. Here we use laser spectroscopy to probe the optical spectrum of astatine near the ionization threshold. The observed series of Rydberg states enabled the first determination of the ionization potential of the astatine atom, 9.317510(8) eV. New ab initio calculations were performed to support the experimental result. The measured value serves as a benchmark for quantum chemistry calculations of the properties of astatine as well as for the theoretical prediction of the ionization potential of super-heavy element 117, the heaviest homologue of astatine.

  10. Measurement of the first ionization potential of astatine by laser ionization spectroscopy.

    Science.gov (United States)

    Rothe, S; Andreyev, A N; Antalic, S; Borschevsky, A; Capponi, L; Cocolios, T E; De Witte, H; Eliav, E; Fedorov, D V; Fedosseev, V N; Fink, D A; Fritzsche, S; Ghys, L; Huyse, M; Imai, N; Kaldor, U; Kudryavtsev, Yuri; Köster, U; Lane, J F W; Lassen, J; Liberati, V; Lynch, K M; Marsh, B A; Nishio, K; Pauwels, D; Pershina, V; Popescu, L; Procter, T J; Radulov, D; Raeder, S; Rajabali, M M; Rapisarda, E; Rossel, R E; Sandhu, K; Seliverstov, M D; Sjödin, A M; Van den Bergh, P; Van Duppen, P; Venhart, M; Wakabayashi, Y; Wendt, K D A

    2013-01-01

    The radioactive element astatine exists only in trace amounts in nature. Its properties can therefore only be explored by study of the minute quantities of artificially produced isotopes or by performing theoretical calculations. One of the most important properties influencing the chemical behaviour is the energy required to remove one electron from the valence shell, referred to as the ionization potential. Here we use laser spectroscopy to probe the optical spectrum of astatine near the ionization threshold. The observed series of Rydberg states enabled the first determination of the ionization potential of the astatine atom, 9.31751(8) eV. New ab initio calculations are performed to support the experimental result. The measured value serves as a benchmark for quantum chemistry calculations of the properties of astatine as well as for the theoretical prediction of the ionization potential of superheavy element 117, the heaviest homologue of astatine.

  11. Spectroscopy of low-lying states in neutron-deficient astatine and francium nuclei

    Energy Technology Data Exchange (ETDEWEB)

    Jakobsson, U., E-mail: ulrjak@kth.se; Cederwall, B. [KTH, The Division of Nuclear Physics, AlbaNova University Center, SE-10691 Stockholm (Sweden); Uusitalo, J.; Auranen, K.; Badran, H.; Cox, D. M.; Grahn, T.; Greenlees, P. T.; Julin, R.; Juutinen, S.; Herzáň, A.; Konki, J.; Leino, M.; Mallaburn, M.; Pakarinen, J.; Papadakis, P.; Partanen, J.; Rahkila, P.; Sandzelius, M.; Sarén, J. [University of Jyvaskyla, Department of Physics, P.O. Box 35, FI-40014 University of Jyvaskyla (Finland); and others

    2015-10-15

    Low-lying states in neutron-deficient astatine and francium nuclei have been studied by means of in-beam and delayed spectroscopy. The 13/2{sup +} state has been observed in francium nuclei with a similar down-sloping trend as in neighbouring astatine and bismuth isotopes, as a function of decreasing neutron number. A systematic trend can also now be seen for the 1/2{sup +} state both in astatine and francium nuclei, where the level energy decreases steeply as a function of neutron number when moving further away from the neutron shell closure. This trend is very similar between astatine nuclei and their francium isotones. Moreover, shape coexistence has been observed between the 13/2{sup +} state and the spherical 9/2{sup −} ground state in {sup 203}Fr and {sup 205}Fr.

  12. Spectroscopy of low-lying states in neutron-deficient astatine and francium nuclei

    Science.gov (United States)

    Jakobsson, U.; Uusitalo, J.; Auranen, K.; Badran, H.; Cederwall, B.; Cox, D. M.; Grahn, T.; Greenlees, P. T.; Julin, R.; Juutinen, S.; HerzáÅ, A.; Konki, J.; Leino, M.; Mallaburn, M.; Pakarinen, J.; Papadakis, P.; Partanen, J.; Rahkila, P.; Sandzelius, M.; Sarén, J.; Scholey, C.; Sorri, J.; Stolze, S.

    2015-10-01

    Low-lying states in neutron-deficient astatine and francium nuclei have been studied by means of in-beam and delayed spectroscopy. The 13/2+ state has been observed in francium nuclei with a similar down-sloping trend as in neighbouring astatine and bismuth isotopes, as a function of decreasing neutron number. A systematic trend can also now be seen for the 1/2+ state both in astatine and francium nuclei, where the level energy decreases steeply as a function of neutron number when moving further away from the neutron shell closure. This trend is very similar between astatine nuclei and their francium isotones. Moreover, shape coexistence has been observed between the 13/2+ state and the spherical 9/2- ground state in 203Fr and 205Fr.

  13. Automated astatination of biomolecules - a stepping stone towards multicenter clinical trials

    DEFF Research Database (Denmark)

    Aneheim, Emma; Albertsson, Per; Bäck, Tom

    2015-01-01

    To facilitate multicentre clinical studies on targeted alpha therapy, it is necessary to develop an automated, on-site procedure for conjugating rare, short-lived, alpha-emitting radionuclides to biomolecules. Astatine-211 is one of the few alpha-emitting nuclides with appropriate chemical...

  14. Measurement of the first ionization potential of astatine by laser ionization spectroscopy

    NARCIS (Netherlands)

    Rothe, S.; Andreyev, A. N.; Antalic, S.; Borschevsky, A.; Capponi, L.; Cocolios, T. E.; De Witte, H.; Eliav, E.; Fedorov, D. V.; Fedosseev, V. N.; Fink, D. A.; Fritzsche, S.; Ghys, L.; Huyse, M.; Imai, N.; Kaldor, U.; Kudryavtsev, Yuri; Koester, U.; Lane, J. F. W.; Lassen, J.; Liberati, V.; Lynch, K. M.; Marsh, B. A.; Nishio, K.; Pauwels, D.; Pershina, V.; Popescu, L.; Procter, T. J.; Radulov, D.; Raeder, S.; Rajabali, M. M.; Rapisarda, E.; Rossel, R. E.; Sandhu, K.; Seliverstov, M. D.; Sjoedin, A. M.; Van den Bergh, P.; Van Duppen, P.; Venhart, M.; Wakabayashi, Y.; Wendt, K. D. A.

    The radioactive element astatine exists only in trace amounts in nature. Its properties can therefore only be explored by study of the minute quantities of artificially produced isotopes or by performing theoretical calculations. One of the most important properties influencing the chemical

  15. An attempt to explore the production routes of Astatine radionuclides: Theoretical approach

    OpenAIRE

    Maiti, Moumita; Lahiri, Susanta

    2008-01-01

    In order to fulfil the recent thrust of Astatine radionuclides in the field of nuclear medicine various production routes have been explored in the present work. The possible production routes of $^{209-211}$At comprise both light and heavy ion induced reactions at the bombarding energy range starting from threshold to maximum 100 MeV energy. For this purpose, we have used the nuclear reaction model codes TALYS, ALICE91 and PACE-II. Excitation functions of those radionuclides, produced throug...

  16. Synthesis and Evaluation of Astatinated N-[2-(Maleimido)ethyl]-3-(trimethylstannyl)benzamide Immunoconjugates

    DEFF Research Database (Denmark)

    Aneheim, Emma; Gustafsson, Anna; Albertsson, Per

    2016-01-01

    Effective treatment of metastasis is a great challenge in the treatment of different types of cancers. Targeted alpha therapy utilizes the short tissue range (50-100 μm) of α particles, making the method suitable for treatment of disseminated occult cancers in the form of microtumors or even sing...... of the in vivo distribution of the new immunoconjugate with other tin-based immunoconjugates in tumor-bearing mice, the MSB conjugation method was found to be a viable option for successful astatine labeling of different monoclonal antibodies....

  17. Laser photodetachment of radioactive ions: towards the determination of the electronegativity of astatine

    CERN Multimedia

    Rothe, Sebastian; Welander, Jakob Emanuel; Chrysalidis, Katerina; Day Goodacre, Thomas; Fedosseev, Valentine; Fiotakis, Spyridon; Forstner, Oliver; Heinke, Reinhard Matthias; Johnston, Karl; Kron, Tobias; Koester, Ulli; Liu, Yuan; Marsh, Bruce; Ringvall Moberg, Annie; Rossel, Ralf Erik; Seiffert, Christoph; Studer, Dominik; Wendt, Klaus; Hanstorp, Dag

    2017-01-01

    Negatively charged ions are mainly stabilized through the electron correlation effect. A measure of the stability of a negative ion is the electron affinity, which the energy gain by attaching an electron to a neutral atom. This fundamental quantity is, due to the almost general lack of bound excited states, the only atomic property that can be determined with high accuracy for negative ions. We will present the results of the first laser photodetachment studies of radioactive negative ions at CERN-ISOLDE. The photodetachment threshold for the radiogenic iodine isotope 128I was measured successfully, demonstrating the performance of the upgraded GANDALPH experimental beam line. The first detection of photo-detached astatine atoms marks a milestone towards the determination of the EA of this radioactive element.

  18. Complexation study on no-carrier-added astatine with insulin: A candidate radiopharmaceutical

    Energy Technology Data Exchange (ETDEWEB)

    Lahiri, Susanta [Chemical Sciences Division, Saha Institute of Nuclear Physics, 1/AF Bidhannagar, Kolkata 700 064 (India)], E-mail: susanta.lahiri@saha.ac.in; Roy, Kamalika [Chemical Sciences Division, Saha Institute of Nuclear Physics, 1/AF Bidhannagar, Kolkata 700 064 (India); Sen, Souvik [Berhampur Sadar Hospital, Berhampur, Murshidabad 742 101 (India)

    2008-12-15

    No-carrier-added astatine radionuclides produced in the {sup 7}Li-irradiated lead matrix were separated from bulk lead nitrate target by complexing At with insulin, followed by dialysis. The method offers simultaneous separation of At from lead as well as its complexation with insulin. The At-insulin complex might be a potential radiopharmaceutical in the treatment of hepatocellular carcinoma. The stability of At-insulin complex was checked by dialysis against deionized water and Ringer lactate (RL) solution. It has been found that the half-life of At-insulin complex is about {approx}12 h, when dialyzed against deionized water and is only 6 h, when dialyzed against RL solution having the same composition as blood serum. The 6 h half-life of this Insulin-At complex is perfect for killing cancer cells from external cell surfaces as the half-life of internalization of insulin molecule inside the cell is 7-12 h.

  19. Determination of the electron affinity of astatine and polonium by laser photodetachment

    CERN Multimedia

    We propose to conduct the first electron affinity (EA) measurements of the two elements astatine (At) and polonium (Po). Collinear photo-detachment spectroscopy will allow us to measure these quantities with an uncertainty limited only by the spectral line width of the laser. We plan to use negative ion beams of the two radioactive elements At and Po, which are only accessible on-line and at ISOLDE. The feasibility of our proposed method and the functionality of the experimental setup have been demonstrated at ISOLDE in off-line tests by the clear observation of the photo-detachment threshold for stable iodine. This proposal is based on our Letter of Intent I-148.

  20. Adsorption of the astatine species on a gold surface: A relativistic density functional theory study

    Science.gov (United States)

    Demidov, Yuriy; Zaitsevskii, Andréi

    2018-01-01

    We report first-principle based studies of the adsorption interaction of astatine species on a gold surface. These studies are aimed primarily at the support and interpretation of gas chromatographic experiments with superheavy elements, tennessine (Ts, Z = 117), a heavier homologue of At, and possibly its pseudo-homologue nihonium (Nh, Z = 113). We use gold clusters with up to 69 atoms to simulate the adsorption sites and estimate the desorption energies of At & AtOH from a stable gold (1 1 1) surface. To describe the electronic structure of At -Aun and AtOH -Aun complexes, we combine accurate shape-consistent relativistic pseudopotentials and non-collinear two-component relativistic density functional theory. The predicted desorption energies of At and AtOH on gold are 130 ± 10 kJ/mol and 90 ± 10 kJ/mol, respectively. These results confirm the validity of the estimates derived from chromatographic data (147 ± 15 kJ/mol for At, and 100-10+20 kJ/mol for AtOH).

  1. ASTATINE-211 RADIOCHEMISTRY: THE DEVELOPMENT OF METHODOLOGIES FOR HIGH ACTIVITY LEVEL RADIOSYNTHESIS

    Energy Technology Data Exchange (ETDEWEB)

    MICHAEL R. ZALUTSKY

    2012-08-08

    Targeted radionuclide therapy is emerging as a viable approach for cancer treatment because of its potential for delivering curative doses of radiation to malignant cell populations while sparing normal tissues. Alpha particles such as those emitted by 211At are particularly attractive for this purpose because of their short path length in tissue and high energy, making them highly effective in killing cancer cells. The current impact of targeted radiotherapy in the clinical domain remains limited despite the fact that in many cases, potentially useful molecular targets and labeled compounds have already been identified. Unfortunately, putting these concepts into practice has been impeded by limitations in radiochemistry methodologies. A critical problem is that the synthesis of therapeutic radiopharmaceuticals provides additional challenges in comparison to diagnostic reagents because of the need to perform radio-synthesis at high levels of radioactivity. This is particularly important for {alpha}-particle emitters such as 211At because they deposit large amounts of energy in a highly focal manner. The overall objective of this project is to develop convenient and reproducible radiochemical methodologies for the radiohalogenation of molecules with the {alpha}-particle emitter 211At at the radioactivity levels needed for clinical studies. Our goal is to address two problems in astatine radiochemistry: First, a well known characteristic of 211At chemistry is that yields for electrophilic astatination reactions decline as the time interval after radionuclide isolation from the cyclotron target increases. This is a critical problem that must be addressed if cyclotrons are to be able to efficiently supply 211At to remote users. And second, when the preparation of high levels of 211At-labeled compounds is attempted, the radiochemical yields can be considerably lower than those encountered at tracer dose. For these reasons, clinical evaluation of promising 211At

  2. An all-solid state laser system for the laser ion sources RILIS and in-source laser spectroscopy of astatine at ISOLDE/CERN

    Energy Technology Data Exchange (ETDEWEB)

    Rothe, Sebastian

    2012-09-24

    This doctoral thesis describes the extension of the resonance ionization laser ion source RILIS at CERN/ISOLDE by the addition of an all-solid state tunable titanium:sapphire (Ti:Sa) laser system to complement the well-established system of dye lasers. Synchronous operation of the so called Dual RILIS system of Ti:Sa and dye lasers was investigated and the potential for increased ion beam intensity, reliability, and reduced setup time has been demonstrated. In-source resonance ionization spectroscopy was performed at ISOLDE/CERN and at ISAC/TRIUMF radioactive ion beam facilities to develop an efficient and selective three-colour ionization scheme for the purely radioactive element astatine. A LabVIEW based monitoring, control and measurement system was conceived which enabled, in conjunction with Dual RILIS operation, the spectroscopy of high lying Rydberg states, from which the ionization potential of the astatine atom was determined for the first time experimentally.

  3. An all-solid state laser system for the laser ion source RILIS and in-source laser spectroscopy of astatine at ISOLDE, CERN

    CERN Document Server

    Rothe, Sebastian; Nörtershäuser, W

    This doctoral thesis describes the extension of the resonance ionization laser ion source RILIS at ISOLDE, CERN, by the addition of an all-solid state tuneable titanium: sapphire (Ti:Sa) laser system to complement the well-established system of dye lasers. Synchronous operation of the so called Dual RILIS system of Ti:Sa and dye lasers was investigated and the potential for increased ion beam intensity, reliability, and reduced setup time has been demonstrated. In-source resonance ionization spectroscopy was performed at ISOLDE, CERN, and at ISAC, TRIUMF, radioactive ion beam facilities to develop an efficient and selective three-colour ionization scheme for the purely radioactive element astatine. A LabVIEW based monitoring, control and measurement system was conceived which enabled, in conjunction with Dual RILIS operation, the spectroscopy of high lying Rydberg states, from which the ionization potential of the astatine atom was determined for the first time experimentally.

  4. Standardisation of 210Pb

    Science.gov (United States)

    Woods; Bowles; Jerome; de Lavison P; Lineham; Makepeace; Woodman; Woods

    2000-03-01

    The standardisation of 210Pb is complicated by the presence of the daughters, 210Bi and 210Po. In addition, the low energies of the beta emissions from 210Pb make it difficult to obtain high detection efficiencies in an atmospheric proportional counter and hence produce the need for large extrapolations with consequential large uncertainties when extrapolating to unit efficiency with the conventional 4pi(PC)-gamma-coincidence technique. In order to produce a reliable standardisation, it is necessary to remove the daughter products. A solution of 210Pb was therefore chemically separated from its daughters and then standardised using the conventional 4pi(LS)-gamma-coincidence technique. The low energy (46 keV) and low emission probability (4%) of the associated photon emissions effectively rules out the possibility of using ionisation chambers as secondary standard transfer instruments for this nuclide. A germanium spectrometer therefore was calibrated for this purpose using 241Am as a normalising agent. The results of this work are presented together with an analysis of the standardisation uncertainties that can be achieved in practice.

  5. 210Pb dating

    Science.gov (United States)

    Swarzenski, Peter W.

    2014-01-01

    Roughly fifty years ago, a small group of scientists from Belgium and the United States, trying to better constrain ice sheet accumulation rates, attempted to apply what was then know about environmental lead as a potential geochronometer. Thus Goldberg (1963) developed the first principles of the 210Pb dating method, which was soon followed by a paper by Crozaz et al. (1964), who examined accumulation history of Antarctic snow using 210Pb. Shortly thereafter, Koide et al. (1972, 1973) adapted this technique to unravel sediment deposition and accumulation records in deep-sea environments. Serendipitously, they chose to work in a deep basin off California, where an independent and robust age model had already been developed. Krishanswami et al. (1971) extended the use of this technique to lacustrine deposits to reconstruct depositional histories of lake sediment, and maybe more importantly, contaminant inputs and burial. Thus, the powerful tool for dating recent (up to about one century old) sediment deposits was established and soon widely adopted. Today almost all oceanographic or limnologic studies that address recent depositional reconstructions employ 210Pb as one of several possible geochronometers (Andrews et al., 2009; Gale, 2009; Baskaran, 2011; Persson and Helms, 2011). This paper presents a short overview of the principles of 210Pb dating and provides a few examples that illustrate the utility of this tracer in contrasting depositional systems. Potential caveats and uncertainties (Appleby et al., 1986; Binford, 1990; Binford et al., 1993; Smith, 2001; Hancock et al., 2002) inherent to the use and interpretation of 210Pb-derived age-models are also introduced. Recommendations as to best practices for most reliable uses and reporting are presented in the summary.

  6. Final Report for research grant "Development of Methods for High Specific Activity Labeling of Biomolecules Using Astatine-211 in Different Oxidation States"

    Energy Technology Data Exchange (ETDEWEB)

    Wilbur, D. Scott [Univ. of Washington, Seattle, WA (United States)

    2011-12-14

    The overall objective of this research effort was to develop methods for labeling biomolecules with higher oxidation state species of At-211. This was to be done in an effort to develop reagents that had higher in vivo stability than the present carbon-bonded At-211-labeled compounds. We were unsuccessful in that effort, as none of the approaches studied provided reagents that were stable to in vivo deastatination. However, we gained a lot of information about At-211 in higher oxidation states. The studies proved to be very difficult as small changes in pH and other conditions appeared to change the nature of the species that obtained (by HPLC retention time analyses), with many of the species being unidentifiable. The fact that there are no stable isotopes of astatine, and the chemistry of the nearest halogen iodine is quite different, made it very difficult to interpret results of some experiments. With that said, we believe that a lot of valuable information was obtained from the studies. The research effort evaluated: (1) methods for chemical oxidation of At-211, (2) approaches to chelation of oxidized At-211, and (3) approaches to oxidation of astatophenyl compounds. A major hurdle that had to be surmounted to conduct the research was the development of HPLC conditions to separate and identify the various oxidized species formed. Attempts to develop conditions for separation of iodine and astatine species by normal and reversed-phase TLC and ITLC were not successful. However, we were successful in developing conditions (from a large number of attempts) to separate oxidized forms of iodine ([I-125]iodide, [I-125]iodate and [I-125]periodate) and astatine ([At-211]astatide, [At-211]astatate, [At-211]perastatate, and several unidentified At-211 species). Information on the basic oxidation and characterization of At-211 species is provided under Objective 1. Conditions were developed to obtain new At-211 labeling method where At-211 is chelated with the DOTA and

  7. {sup 210}Pb and {sup 210}Po in Finnish cereals

    Energy Technology Data Exchange (ETDEWEB)

    Turtiainen, Tuukka, E-mail: tuukka.turtiainen@stuk.f [STUK, Radiation and Nuclear Safety Authority, P.O. Box 14, 00881 Helsinki (Finland); Kostiainen, Eila, E-mail: eila.kostiainen@stuk.f [STUK, Radiation and Nuclear Safety Authority, P.O. Box 14, 00881 Helsinki (Finland); Hallikainen, Anja, E-mail: anja.hallikainen@evira.f [Finnish Food Safety Authority Evira, Mustialankatu 3, 00790 Helsinki (Finland)

    2011-05-15

    A survey was carried out on the activity concentrations of {sup 210}Pb and {sup 210}Po in cereal grains produced in Finland. The cereal species were wheat (Triticum aestivum), rye (Secale cereale), oats (Avena sativa) and barley (Hordeum vulgare), which account for 90% of the Finnish consumption of cereal products. The survey consisted of 18 flour and 13 unprocessed cereal samples and one hulled grain sample from 22 flour mills. According to the results, the mean {sup 210}Pb/{sup 210}Po concentrations in wheat grains, wheat flour, rye flour, oat grains and barley grains were 0.29, 0.12, 0.29, 0.36 and 0.36 Bq kg{sup -1}, respectively. Combined with the consumption rates of the products, we assess that the mean effective doses from {sup 210}Pb and {sup 210}Po in cereal products for the adult male and female population are 22 and 17 {mu}Sv per year, respectively.

  8. Nuclear Data Sheets for A = 210

    Energy Technology Data Exchange (ETDEWEB)

    Shamsuzzoha Basunia, M.

    2014-09-15

    Evaluated spectroscopic data for {sup 210}Au, {sup 210}Hg, {sup 210}Tl, {sup 210}Pb, {sup 210}Bi, {sup 210}Po, {sup 210}At, {sup 210}Rn, {sup 210}Fr, {sup 210}Ra, {sup 210}Ac, and {sup 210}Th and corresponding level schemes from radioactive decay and reaction studies are presented. This evaluation supersedes the previous evaluation by E. Browne (2003Br13). Highlights of this publication are the identification of new μs isomers of {sup 210}Hg by 2013Go10 and measurement of an excited level energy at 1709 keV 30 of {sup 210}Rn from {sup 214}Rn α decay: 68.6 μs by 2006Ku26 denoted as x+1664.6 in the Adopted Levels. Earlier experimental limits for x≤50 keV was proposed in 1979Po19 and 1982Po03 – (HI,xnγ)

  9. 7 CFR 210.13 - Facilities management.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Facilities management. 210.13 Section 210.13... Participation § 210.13 Facilities management. Link to an amendment published at 74 FR 66216, Dec. 15, 2009. (a..., the added text is set forth as follows: § 210.13 Facilities management. (c) Food safety program. The...

  10. Standardisation of {sup 210}Pb

    Energy Technology Data Exchange (ETDEWEB)

    Woods, D.H. E-mail: denise.woods@npl.co.uk; Bowles, N.E.; Jerome, S.M.; Lavison, P. de; Lineham, S.; Makepeace, J.L.; Woodman, A.P.; Woods, M.J

    2000-03-01

    The standardisation of {sup 210}Pb is complicated by the presence of the daughters, {sup 210}Bi and {sup 210}Po. In addition, the low energies of the beta emissions from {sup 210}Pb make it difficult to obtain high detection efficiencies in an atmospheric proportional counter and hence produce the need for large extrapolations with consequential large uncertainties when extrapolating to unit efficiency with the conventional 4{pi}(PC)-{gamma}-coincidence technique. In order to produce a reliable standardisation, it is necessary to remove the daughter products. A solution of {sup 210}Pb was therefore chemically separated from its daughters and then standardised using the conventional 4{pi}(LS)-{gamma}-coincidence technique. The low energy (46 keV) and low emission probability (4%) of the associated photon emissions effectively rules out the possibility of using ionisation chambers as secondary standard transfer instruments for this nuclide. A germanium spectrometer therefore was calibrated for this purpose using {sup 241}Am as a normalising agent. The results of this work are presented together with an analysis of the standardisation uncertainties that can be achieved in practice.

  11. Studies of the balance 210Pb - 210Po in glasses; Estudios del equilibrio 210Pb - 210Po en vidrios

    Energy Technology Data Exchange (ETDEWEB)

    Torre Pérez, J. de la; Martín Sánchez, A.; Ruano Sánchez, A.B.

    2014-07-01

    Retrospective dosimetry requires measurement methods allowing the determination of Radon concentration in the past. One of the such methods is based on the direct measurement of 210Po implanted on the surface of objects, whose activity concentration (Bq/m2), is directly related to the cumulative exposure due to the concentration of 222Rn (Bq/m3) for long time. These determinations are possible taking into consideration the equilibrium between 210Po (T1/2 = 138.378 days) and its parent 210Pb (T1/2 = 22.3 years), being both radionuclides from the 222Rn progeny. In previous works about the determination of the conversion factor (ratio between the concentration of 210Po in objects and the retrospective 222Rn concentration in air), Corresponding equilibria between descendants were assumed. In this work, an experimental study about the equilibrium 210Pb - 210Po in glasses, which were previously exposed to some radon concentrations, has been performed. Two scenarios were studied: a place with, and another place without, continuous cumulative 222Rn concentration. Results were compared with those reached by theoretical calculations from the (Bateman) activity evolution equations. [Spanish] La dosimetría retrospectiva requiere métodos de medida que permitan la determinación de la concentración de radón en el pasado. Uno de estos métodos está basado en la medida directa del 210Po implantado sobre la superficie de objetos, cuya concentración de actividad (Bq/m2), está directamente relacionada con la exposición acumulativa debida a la concentración de 222Rn (Bq/m3) durante largos períodos de tiempo. Estas determinaciones son posibles gracias al equilibrio entre el 210Po (T1/2 = 138,378 días) y su progenitor, el 210Pb (T1/2 = 22,3 años), siendo ambos radionúclidos descendientes del 222Rn. En trabajos anteriores sobre la determinación del factor de conversión (relación entre la concentración de 210Po en los objetos y la concentración de 222Rn retrospectivo en

  12. Multi-year Surface Deposition of {sup 210}Pb and {sup 210}Po at Lisbon - Atmospheric Depositions of {sup 210}Pb and {sup 210}Po in Lisbon, Portugal

    Energy Technology Data Exchange (ETDEWEB)

    Carvalho, Fernando P.; Oliveira, Joao M.; Alberto, G. [Instituto Superior Tecnico/ Campus Tecnologico e Nuclear, Universidade Tecnica de Lisboa, E.N. 10, 2686-953 Sacavem (Portugal)

    2014-07-01

    The long lived radon daughters {sup 210}Pb and {sup 210}Po were determined in samples of total atmospheric depositions obtained with surface collectors continuously operated during 5 years, near Lisbon. The average annual {sup 210}Pb flux was 66±12 Bq m{sup -2}, and the average annual {sup 210}Po flux was 8±3 Bq m{sup -2}, with an overall {sup 210}Po/{sup 210}Pb activity ratio of 0.15±0.06. Direct determination of the {sup 210}Pb atmospheric flux was compared with the {sup 210}Pb excess determined in soil surface layers along with atmospheric depositions of {sup 137}Cs. The deposition of atmospheric {sup 210}Pb was positively correlated with seasonal rainfall, while {sup 210}Po was mainly originated in soil particles re-suspension throughout the year and also in seasonal forest fires. Unusually high {sup 210}Po/{sup 210}Pb activity ratios, higher than unity, were occasionally recorded in atmospheric depositions and the sources and causes are discussed. Long time-series of {sup 210}Pb and {sup 210}Po deposition fluxes, as presented herein are useful to test and constrain parameters of the atmospheric Global Circulation Models. (authors)

  13. Applications of PB-210/RA-226 and PO-210/PB-210 disequilibria in the study of marine geochemical processes

    Energy Technology Data Exchange (ETDEWEB)

    Bacon, M. P.

    1976-02-01

    The distribution of /sup 210/Pb and /sup 210/Po in dissolved (less than 0.4 micron) and particulate (greater than 0.4 micron) phases was measured at ten stations in the tropical and eastern North Atlantic and at two stations in the Pacific. Both radionuclides occur principally in the dissolved phase. Unsupported /sup 210/Pb activities, maintained by flux from the atmosphere, were present in the surface mixed layer and penetrated into the thermocline to depths of about 500 m. Dissolved /sup 210/Po was ordinarily present in the mixed layer at less than equilibrium concentrations, suggesting rapid biological removal of this nuclide. Particulate matter was enriched in /sup 210/Po, with /sup 210/Po//sup 210/Pb activity ratios greater than 1.0, similar to those reported for phytoplankton. Box-model calculations yield a 2-y residence time for /sup 210/Pb and a 0.6-y residence time for /sup 210/Po in the mixed layer. These residence times are considerably longer than the time calculated for turnover of particles in the mixed layer (about 0.1 y). At depths of 100 to 300 m, /sup 210/Po maxima occurred and unsupported /sup 210/Po was frequently present. Calculations indicate that at least 50 percent of the /sup 210/Po removed from the mixed layer is re-cycled within the thermocline. Similar calculations for /sup 210/Pb suggest much lower re-cycling efficiencies.

  14. An automated flow system incorporating in-line acid dissolution of bismuth metal from a cyclotron irradiated target assembly for use in the isolation of astatine-211

    Energy Technology Data Exchange (ETDEWEB)

    O’Hara, Matthew J.; Krzysko, Anthony J.; Niver, Cynthia M.; Morrison, Samuel S.; Owsley, Stanley L.; Hamlin, Donald K.; Dorman, Eric F.; Scott Wilbur, D.

    2017-04-01

    Astatine-211 (211At) is a promising cyclotron-produced radionuclide being investigated for use in targeted alpha therapy of blood borne and metastatic cancers, as well as treatment of tumor remnants after surgical resections. The isolation of trace quantities of 211At, produced within several grams of a Bi metal cyclotron target, involves a complex, multi-step procedure: (1) Bi metal dissolution in strong HNO3, (2) distillation of the HNO3 to yield Bi salts containing 211At, (3) dissolution of the salts in strong HCl, (4) solvent extraction of 211At from bismuth salts with diisopropyl ether (DIPE), and (5) back-extraction of 211At from DIPE into NaOH, leading to a purified 211At product. Step (1) has been addressed first to begin the process of automating the onerous 211At isolation process. A computer-controlled Bi target dissolution system has been designed. The system performs in-line dissolution of Bi metal from the target assembly using an enclosed target dissolution block, routing the resulting solubilized 211At/Bi mixture to the subsequent process step. The primary parameters involved in Bi metal solubilization (HNO3 concentration and influent flow rate) were optimized prior to evaluation of the system performance on replicate cyclotron irradiated targets. The results indicate that the system performs reproducibly, having nearly quantitative release of 211At from irradiated targets, with cumulative 211At recoveries that follow a sigmoidal function. The predictable nature of the 211At release profile allows the user to tune the system to meet target processing requirements.

  15. Reagents for astatination of biomolecules. 2. Conjugation of anionic boron cage pendant groups to a protein provides a method for direct labeling that is stable to in vivo deastatination.

    Science.gov (United States)

    Wilbur, D Scott; Chyan, Ming-Kuan; Hamlin, Donald K; Vessella, Robert L; Wedge, Timothy J; Hawthorne, M Frederick

    2007-01-01

    Cancer-targeting biomolecules labeled with 211At must be stable to in vivo deastatination, as control of the 211At distribution is critical due to the highly toxic nature of alpha-particle emission. Unfortunately, no astatinated aryl conjugates have shown in vivo stability toward deastatination when (relatively) rapidly metabolized proteins, such as monoclonal antibody Fab' fragments, are labeled. As a means of increasing the in vivo stability of 211At-labeled proteins, we have been investigating antibody conjugates of boron cage moieties. In this investigation, protein-reactive derivatives containing a nido-carborane (2), a bis-nido-carborane derivative (Venus Flytrap Complex, 3), and four 2-nonahydro-closo-decaborate(2-) derivatives (4-7) were prepared and conjugated with an antibody Fab' fragment such that subsequent astatination and in vivo tissue distributions could be obtained. To aid in determination of stability toward in vivo deastatination, the Fab'-borane conjugates were also labeled with 125I, and that material was coinjected with the 211At-labeled Fab'. For comparison, direct labeling of the Fab' with 125I and 211At was conducted. Direct labeling with Na[125I]I and Chloramine-T gave an 89% radiochemical yield. However, direct labeling of the Fab' with Na[211At]At and Chloramine-T resulted in a yield of Studies to optimize the closo-decaborate(2-) conjugates for protein labeling are underway.

  16. 7 CFR 210.14 - Resource management.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Resource management. 210.14 Section 210.14 Agriculture... Participation § 210.14 Resource management. (a) Nonprofit school food service. School food authorities shall.... Expenditures of nonprofit school food service revenues shall be in accordance with the financial management...

  17. 46 CFR 132.210 - Classification.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Classification. 132.210 Section 132.210 Shipping COAST... Portable and Semiportable Fire Extinguishers § 132.210 Classification. (a) Each portable fire extinguisher... Classification Type Size Halon 1211, 1301, and 1211-1301 mixtures kgs. (lbs.) Foam, liters (gallons) Carbon...

  18. 12 CFR 347.210 - Asset maintenance.

    Science.gov (United States)

    2010-01-01

    ... 12 Banks and Banking 4 2010-01-01 2010-01-01 false Asset maintenance. 347.210 Section 347.210 Banks and Banking FEDERAL DEPOSIT INSURANCE CORPORATION REGULATIONS AND STATEMENTS OF GENERAL POLICY INTERNATIONAL BANKING Foreign Banks § 347.210 Asset maintenance. (a) An insured branch of a foreign bank shall...

  19. 19 CFR 210.19 - Intervention.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 3 2010-04-01 2010-04-01 false Intervention. 210.19 Section 210.19 Customs Duties UNITED STATES INTERNATIONAL TRADE COMMISSION INVESTIGATIONS OF UNFAIR PRACTICES IN IMPORT TRADE ADJUDICATION AND ENFORCEMENT Motions § 210.19 Intervention. Any person desiring to intervene in an...

  20. 28 CFR 36.210 - Smoking.

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 1 2010-07-01 2010-07-01 false Smoking. 36.210 Section 36.210 Judicial... COMMERCIAL FACILITIES General Requirements § 36.210 Smoking. This part does not preclude the prohibition of, or the imposition of restrictions on, smoking in places of public accommodation. ...

  1. 21 CFR 173.210 - Acetone.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Acetone. 173.210 Section 173.210 Food and Drugs..., Lubricants, Release Agents and Related Substances § 173.210 Acetone. A tolerance of 30 parts per million is established for acetone in spice oleoresins when present therein as a residue from the extraction of spice. ...

  2. 46 CFR 184.210 - Heating equipment.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Heating equipment. 184.210 Section 184.210 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) SMALL PASSENGER VESSELS (UNDER 100 GROSS TONS) VESSEL CONTROL AND MISCELLANEOUS SYSTEMS AND EQUIPMENT Cooking and Heating § 184.210 Heating equipment...

  3. 22 CFR 210.670 - Suspension.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Suspension. 210.670 Section 210.670 Foreign... (FINANCIAL ASSISTANCE) Definitions § 210.670 Suspension. Suspension means an action taken by a Federal agency..., subpart 9.4) and the common rule, Government-wide Debarment and Suspension (Nonprocurement), that...

  4. 7 CFR 210.3 - Administration.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Administration. 210.3 Section 210.3 Agriculture... CHILD NUTRITION PROGRAMS NATIONAL SCHOOL LUNCH PROGRAM General § 210.3 Administration. (a) FNS. FNS will act on behalf of the Department in the administration of the Program. Within FNS, the CND will be...

  5. 40 CFR 211.210 - Requirements.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Requirements. 211.210 Section 211.210 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) NOISE ABATEMENT PROGRAMS PRODUCT NOISE LABELING Hearing Protective Devices § 211.210 Requirements. ...

  6. 42 CFR 93.210 - Good faith.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Good faith. 93.210 Section 93.210 Public Health... MISCONDUCT Definitions § 93.210 Good faith. Good faith as applied to a complainant or witness, means having a... allegation or cooperation with a research misconduct proceeding is not in good faith if made with knowing or...

  7. 32 CFR 210.4 - Responsibilities.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Responsibilities. 210.4 Section 210.4 National Defense Department of Defense (Continued) OFFICE OF THE SECRETARY OF DEFENSE (CONTINUED) MISCELLANEOUS ENFORCEMENT OF STATE TRAFFIC LAWS ON DOD INSTALLATIONS § 210.4 Responsibilities. (a) The Assistant Secretary...

  8. Dicty_cDB: CHB210 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available library) CHB210 (Link to dictyBase) - - - Contig-U15820-1 CHB210P (Link to Original site) CHB210F 128 CHB210Z...CHB210Z 568 CHB210P 676 - - Show CHB210 Library CH (Link to library) Clone ID CHB210 (Link to dictyBase)...biol.tsukuba.ac.jp/CSM/CH/CHB2-A/CHB210Q.Seq.d/ Representative seq. ID CHB210P (Link to Original site)...site) Representative DNA sequence >CHB210 (CHB210Q) /CSM/CH/CHB2-A/CHB210Q.Seq.d/ ACTGTTGGCCTACTGGNAAAAA.../CSM/SL/SLC4-A/SLC418Q.Seq.d/ 1106 0.0 CHB210 (CHB210Q) /CSM/CH/CHB2-A/CHB210Q.Seq.d/ 1106 0.0 CHC647 (CHC647Q)

  9. 17 CFR 210.3A-01 - Application of § 210.3A-01 to § 210.3A-05.

    Science.gov (United States)

    2010-04-01

    ... Financial Statements § 210.3A-01 Application of § 210.3A-01 to § 210.3A-05. Sections 210.3A-01 to 210.3A-05 shall govern the presentation of consolidated and combined financial statements. ... COMMISSION FORM AND CONTENT OF AND REQUIREMENTS FOR FINANCIAL STATEMENTS, SECURITIES ACT OF 1933, SECURITIES...

  10. Carcinogenic risk of lead-210 and polonium-210 in tobacco smoke: a selected, annotated bibliography

    Energy Technology Data Exchange (ETDEWEB)

    Travis, C.C.; Etnier, E.L.; Kirkscey, K.A.

    1978-05-01

    This bibliography is concerned with the possible carcinogenic risk to man from the presence of lead-210 and polonium-210 in tobacco smoke. It includes a data base on such topics as background levels of lead-210 and polonium-210 in tobacco and tobacco smoke, tobacco plant uptake of lead-210 and polonium-210 from soil, metabolic models, and dose estimates. This data base should be of interest to those concerned with assessing the health effects resulting from the emanation of radan-222 from natural and technologically enhanced sources.

  11. Is ecological food also radioecological? - 210Po and 210Pb studies.

    Science.gov (United States)

    Strumińska-Parulska, Dagmara; Olszewski, Grzegorz

    2018-01-01

    Presented are results of a study on accumulation of naturally occurring 210Po and 210Pb in ecological and conventional farming food products in Poland: fruits, vegetables and cereals. The main idea behind this research was to determine the activity concentrations of 210Po and 210Pb in ecological and commercial food as well as calculate and compare the effective dose (radiation) connected to different origin of analyzed food products consumption. The studies showed the majority of all compared food samples contained similar 210Po and 210Pb activities and statistically, the consumption of organic and commercial food would give similar annual effective dose. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. 210Po and 210Pb in Forest Soil and in Wild Berries in Finland

    Science.gov (United States)

    Vaaramaa, Kaisa; Solatie, Dina; Aro, Lasse; Lehto, Jukka

    2008-08-01

    The behaviour of 210Po and 210Pb was investigated in forests in the Southern Finland site and in the Northern Finland site. Sampling sites were in Scots pine (Pinus sylvestris) forests. Maximum activities of 210Po and 210Pb in soil columns were found in organic layers. According to preliminary results of wild berry samples, the lowest 210Po concentrations were found in berries. The highest concentration of 210Po was found in stems of the blueberry (Vaccinium myrtillus) and the lingonberry (Vaccinium vitis-idaea) samples.

  13. Dicty_cDB: SSF210 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SS (Link to library) SSF210 (Link to dictyBase) - - - Contig-U16581-1 SSF210P (Link to Original site) SSF...210F 183 SSF210Z 197 SSF210P 380 - - Show SSF210 Library SS (Link to library) Clone ID SSF... URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SS/SSF2-A/SSF210Q.Seq.d/ Representative seq. ID SSF...210P (Link to Original site) Representative DNA sequence >SSF210 (SSF210Q) /CSM/SS/SSF2-A/SSF2...TA sequence update 1998.10. 1 Translated Amino Acid sequence inkkkkkkikknlisfkmv*

  14. Aspects on the analysis of 210Po

    DEFF Research Database (Denmark)

    Henricsson, F.; Ranebo, Y.; Holm, E.

    2011-01-01

    , no radiochemical yield determinant was used and it was generally supposed that the yield was 100% after two depositions. Counting was often done using ZnS scintillation counter coupled to a photomultiplier tube. However, the use of the yield determinants 208Po and 209Po and the development of alpha spectrometry...... and the waiting time between deposition and measurement of the sample. A further consequence of this is that in the assessment of the 210Pb content in the sample, very often the remaining liquid is stored after deposition for build-up of 210Po. Since some 210Pb is lost on the disc, the result for 210Pb...

  15. 17 CFR 210.9-01 - Application of §§ 210.9-01 to 210.9-07

    Science.gov (United States)

    2010-04-01

    ... COMMISSION FORM AND CONTENT OF AND REQUIREMENTS FOR FINANCIAL STATEMENTS, SECURITIES ACT OF 1933, SECURITIES....9-01 Application of §§ 210.9-01 to 210.9-07 This article is applicable to consolidated financial statements filed for bank holding companies and to any financial statements of banks that are included in...

  16. 210Po and 210Pb disequilibrium at the PN section in the East China Sea.

    Science.gov (United States)

    Su, Kaijun; Du, Jinzhou; Baskaran, Mark; Zhang, Jing

    2017-08-01

    Lead-210 and 210Po have been widely used as tracers for quantifying particulate scavenging in the upper layer of the oceanic water column. In this study, we investigated the 210Po/210Pb disequilibrium in the water column of the PN section in the East China Sea (ECS) during autumn 2013. In most of the water column, a deficiency of 210Po was observed with respect to its parent nuclide 210Pb (i.e., a 210Po/210Pb activity ratio < 1.0). The (210Po/210Pb)dissolved, (210Po/210Pb)particulate and (210Po/210Pb)total activity ratios ranged from 0.29 to 0.71 (average: 0.53 ± 0.13, n = 27), 0.31 to 1.42 (average: 0.70 ± 0.27, n = 27) and 0.22 to 0.62 (average: 0.50 ± 0.12, n = 27), respectively. The distribution coefficients (Kd) of 210Po and 210Pb were 12.1× 104 ml g-1 and 8.8× 104 ml g-1, with an average (210Po/210Pb) total activity ratio of (0.50 ± 0.12, n = 27). However, over the continental shelf, planktonic detritus and fecal pellets appear to be the main carriers for 210Po, which preferentially scavenges 210Po and produces a lower (210Po/210Pb) total activity ratio (0.49 ± 0.12, n = 22) with a Kd for 210Po of 13.8× 104 ml g-1 in the water column. The variations in the fractionation factor (1.48 ± 0.66) of 210Po/210Pb reveal distinct differences between the distribution and scavenging of 210Po and 210Pb by particulate matter in different marine environments: in the estuarine zone (a high turbidity area), terrigenous suspended particulate matter scavenges 210Pb from the water column, while in areas dominated by biogenic particular matter, 210Po is preferentially scavenged from the water column. Using the 210Po/210Pb disequilibrium in the water column, we estimated the removal fluxes of POC from the upper waters downward to be 25.0 mg C m-2 d-1, comparable to those in other marginal seas. Moreover, a decreasing trend of POC removal fluxes was observed with increasing distance offshore. Copyright © 2016 Elsevier Ltd. All rights

  17. Polonium-210 and lead-210 in the terrestrial environment: a historical review.

    Science.gov (United States)

    Persson, Bertil R R; Holm, Elis

    2011-05-01

    The radionuclides (210)Po and (210)Pb widely present in the terrestrial environment are the final long-lived radionuclides in the decay of (238)U in the earth's crust. Their presence in the atmosphere is due to the decay of (222)Rn diffusing from the ground. The range of activity concentrations in ground level air for (210)Po is 0.03-0.3 Bq m(-3) and for (210)Pb 0.2-1.5 Bq m(-3). In drinking water from private wells the activity concentration of (210)Po is in the order of 7-48 mBq l(-1) and for (210)Pb around 11-40 mBq l(-1). From water works, however, the activity concentration for both (210)Po and (210)Pb is only in the order of 3 mBq l(-1). Mosses, lichens and peat have a high efficiency in capturing (210)Po and (210)Pb from atmospheric fallout and exhibit an inventory of both (210)Po and (210)Pb in the order of 0.5-5 kBq m(-2) in mosses and in lichens around 0.6 kBq m(-2). The activity concentrations in lichens lies around 250 Bq kg(-1), dry mass. Reindeer and caribou graze lichen which results in an activity concentration of (210)Po and (210)Pb of about 1-15 Bq kg(-1) in meat from these animals. The food chain lichen-reindeer or caribou, and Man constitutes a unique model for studying the uptake and retention of (210)Po and (210)Pb in humans. The effective annual dose due to (210)Po and (210)Pb in people with high consumption of reindeer/caribou meat is estimated to be around 260 and 132 μSv a(-1) respectively. In soils, (210)Po is adsorbed to clay and organic colloids and the activity concentration varies with soil type and also correlates with the amount of atmospheric precipitation. The average activity concentration levels of (210)Po in various soils are in the range of 20-240 Bq kg(-1). Plants become contaminated with radioactive nuclides both by absorption from the soil (supported Po) and by deposition of radioactive fallout on the plants directly (unsupported Po). In fresh leafy plants the level of (210)Po is particularly high as the result of the

  18. 22 CFR 210.640 - Employee.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Employee. 210.640 Section 210.640 Foreign...) All indirect charge employees, unless their impact or involvement in the performance of work under the.... (b) This definition does not include workers not on the payroll of the recipient (e.g., volunteers...

  19. 13 CFR 134.210 - Intervention.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Intervention. 134.210 Section 134... BEFORE THE OFFICE OF HEARINGS AND APPEALS Rules of Practice for Most Cases § 134.210 Intervention. (a) By... intervention to protect such interest. An interested person is any individual, business entity, or governmental...

  20. 22 CFR 210.650 - Grant.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Grant. 210.650 Section 210.650 Foreign Relations AGENCY FOR INTERNATIONAL DEVELOPMENT GOVERNMENTWIDE REQUIREMENTS FOR DRUG-FREE WORKPLACE... Federal agency and the recipient when carrying out the activity contemplated by the award. ...

  1. 33 CFR 183.210 - Reference areas.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Reference areas. 183.210 Section... of More Than 2 Horsepower General § 183.210 Reference areas. (a) The forward reference area of a boat...) The aft reference area of a boat is the aft most two feet of the top surface of the hull or deck, as...

  2. 31 CFR 210.2 - Definitions.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Definitions. 210.2 Section 210.2 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) FISCAL SERVICE... or received by an agency. (l) Green Book means the manual issued by the Service which provides...

  3. 31 CFR 210.3 - Governing law.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Governing law. 210.3 Section 210.3 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) FISCAL SERVICE... Green Book. The Treasury Financial Manual is available for downloading at the Service's web site at http...

  4. 31 CFR 800.210 - Effective date.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Effective date. 800.210 Section 800.210 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF INVESTMENT SECURITY, DEPARTMENT OF THE TREASURY REGULATIONS PERTAINING TO MERGERS, ACQUISITIONS, AND...

  5. 47 CFR 73.210 - Station classes.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 4 2010-10-01 2010-10-01 false Station classes. 73.210 Section 73.210 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) BROADCAST RADIO SERVICES RADIO BROADCAST SERVICES FM... forth in § 73.211. If a station has an ERP and an antenna HAAT such that it cannot be classified using...

  6. 40 CFR 86.210-94 - [Reserved

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 18 2010-07-01 2010-07-01 false 86.210-94 Section 86.210-94 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) CONTROL OF... Year Gasoline-Fueled New Light-Duty Vehicles, New Light-Duty Trucks and New Medium-Duty Passenger...

  7. 31 CFR 537.210 - Exempt transactions.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 3 2010-07-01 2010-07-01 false Exempt transactions. 537.210 Section 537.210 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) OFFICE OF... personal and household effects set forth in §§ 537.511 and 537.514. ...

  8. 31 CFR 210.11 - Limited liability.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Limited liability. 210.11 Section 210.11 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) FISCAL SERVICE, DEPARTMENT OF THE TREASURY FINANCIAL MANAGEMENT SERVICE FEDERAL GOVERNMENT PARTICIPATION IN THE AUTOMATED...

  9. 31 CFR 210.8 - Financial institutions.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Financial institutions. 210.8 Section 210.8 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) FISCAL SERVICE, DEPARTMENT OF THE TREASURY FINANCIAL MANAGEMENT SERVICE FEDERAL GOVERNMENT PARTICIPATION IN THE AUTOMATED...

  10. 31 CFR 210.10 - RDFI liability.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false RDFI liability. 210.10 Section 210.10 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) FISCAL SERVICE, DEPARTMENT OF THE TREASURY FINANCIAL MANAGEMENT SERVICE FEDERAL GOVERNMENT PARTICIPATION IN THE AUTOMATED...

  11. 31 CFR 210.6 - Agencies.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Agencies. 210.6 Section 210.6 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) FISCAL SERVICE, DEPARTMENT OF THE TREASURY FINANCIAL MANAGEMENT SERVICE FEDERAL GOVERNMENT PARTICIPATION IN THE AUTOMATED...

  12. 41 CFR 101-29.210 - Product.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Product. 101-29.210... FEDERAL PROPERTY MANAGEMENT REGULATIONS SUPPLY AND PROCUREMENT 29-FEDERAL PRODUCT DESCRIPTIONS 29.2-Definitions § 101-29.210 Product. The term product is any end item, either manufactured or produced, and also...

  13. Inhalation of {sup 210}Po and {sup 210}Pb from cigarette smoking in Poland

    Energy Technology Data Exchange (ETDEWEB)

    Skwarzec, B. E-mail: bosk@chemik.chem.univ.gda.pl; Ulatowski, J.; Struminska, D.I.; Borylo, A

    2001-07-01

    The carcinogenic effect of {sup 210}Po and {sup 210}Pb with respect to lung cancer is an important problem in many countries with very high cigarette consumption. Poland has one of the highest consumptions of cigarettes in the world. The results of {sup 210}Po determination on the 14 most frequently smoked brands of cigarettes which constitute over 70% of the total cigarette consumption in Poland are presented and discussed. Moreover, the polonium content in cigarette smoke was estimated on the basis of its activity in fresh tobaccos, ash, fresh filters and post-smoking filters. The annual effective doses were calculated on the basis of {sup 210}Po and {sup 210}Pb inhalation with the cigarette smoke. The results of this work indicate that Polish smokers who smoke one pack (20 cigarettes) per day inhale from 20 to 215 mBq of {sup 210}Po and {sup 210}Pb each. The mean values of the annual effective dose for smokers were estimated to be 35 and 70 {mu}Sv from {sup 210}Po and {sup 210}Pb, respectively. For persons who smoke two packs of cigarettes with higher radionuclide concentrations, the effective dose is much higher (471 {mu}Sv yr{sup -1}) in comparison with the intake in diet. Therefore, cigarettes and the absorption through the respiratory system are the main sources and the principal pathway of {sup 210}Po and {sup 210}Pb intake of smokers in Poland.

  14. Influence of submarine groundwater discharge on (210)Po and (210)Pb bioaccumulation in fish tissues.

    Science.gov (United States)

    Garcia-Orellana, J; López-Castillo, E; Casacuberta, N; Rodellas, V; Masqué, P; Carmona-Catot, G; Vilarrasa, M; García-Berthou, E

    2016-05-01

    This study presents the results of the accumulation of (210)Po and (210)Pb in fish tissues and organs in a brackish-water marshland that is characterized by high concentrations of (222)Rn and (226)Ra supplied by submarine groundwater discharge (SGD). Tissues and organs from Cyprinus carpio, Chelon labrosus and Carassius auratus in the wetland were significantly enriched by both (210)Pb and (210)Po (up to 55 and 66 times, respectively) compared to blanks. The major input route of (210)Pb and (210)Po into the fish body seems to be through ingestion, due to the high levels of (210)Pb and (210)Po found in the gut content as well as in organs involved in digestion and metabolism (i.e. gut, kidney and hepatopancreas). Results showed that (210)Po was more accumulated in all fish tissues and organs except for the spine, which showed a higher affinity for (210)Pb, due to its capacity to replace Ca from apatite in bones. Over all the variables analyzed, fish tissues/organs and, secondarily, fish species were the most important factors explaining the concentration of radionuclides, whereas fish length and the sampling location played a minor role. The relationship of the two radionuclides varied markedly among tissues and their concentration levels were only correlated in gills, gut and, marginally, in spines. In general, the highest values of (210)Pb and (210)Po concentrations in tissues were found on C. labrosus tissues rather C. auratus and C. carpio. This study demonstrates that inputs of natural radionuclides supplied by SGD to coastal semi-enclosed areas (such as marshlands, lagoons or ponds) may significantly increase the contents of (210)Pb and (210)Po in fish tissues/organs. Thus, this study represents one of the first evidences of direct ecological effects derived from SGD. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. Determination of {sup 210}Pb and {sup 210}Po in cigarette tobacco; Determinacao de {sup 210}Pb e {sup 210}Po em tabaco de cigarros nacionais

    Energy Technology Data Exchange (ETDEWEB)

    Peres, Ana Claudia

    1999-07-01

    Cigarette smoking is one of the important pathways that could contribute to enhance the radiation dose to man, due to the relatively large concentrations of {sup 210}Pb and {sup 210}Po found in tobacco leaves. In this work, concentrations of these two radionuclides were determined in eight of the most commercialized cigarette brands produced in Brazil. The samples analyzed were bought randomly in the market. The {sup 210}Pb was determined by counting the beta activity of the {sup 210}Bi in a gas flow proportional detector, after radiochemical separation and precipitation of the PbCr0{sub 4}. The {sup 210}Po was determined by alpha spectrometry, using a surface barrier detector, after radiochemical separation and spontaneous deposition of Po in copper disk. The results showed concentrations ranging from 11,9 to 30,2 mBq per gram of dry tobacco for {sup 210}Pb and from 10,9 to 27,4 mBq per gram of dry tobacco for {sup 210}Po. (author)

  16. 24 CFR 1710.210 - Roads.

    Science.gov (United States)

    2010-04-01

    ... (INTERSTATE LAND SALES REGISTRATION PROGRAM) LAND REGISTRATION Reporting Requirements § 1710.210 Roads. (a) State the estimated cost to the developer of the proposed road system. (b) If the developer is to...

  17. 5 CFR 551.210 - Computer employees.

    Science.gov (United States)

    2010-01-01

    ....210 Administrative Personnel OFFICE OF PERSONNEL MANAGEMENT CIVIL SERVICE REGULATIONS PAY... consist of: (1) The application of systems analysis techniques and procedures, including consulting with users, to determine hardware, software or system functional specifications; (2) The design, development...

  18. 19 CFR 210.16 - Default.

    Science.gov (United States)

    2010-04-01

    ... ADJUDICATION AND ENFORCEMENT Motions § 210.16 Default. (a) Definition of default. (1) A party shall be found in... effect of such order(s) upon the public health and welfare, competitive conditions in the U.S. economy...

  19. 29 CFR 1603.210 - Discovery.

    Science.gov (United States)

    2010-07-01

    ... STATE AND LOCAL GOVERNMENT EMPLOYEE COMPLAINTS OF EMPLOYMENT DISCRIMINATION UNDER SECTION 304 OF THE GOVERNMENT EMPLOYEE RIGHTS ACT OF 1991 Hearings § 1603.210 Discovery. (a) Unless otherwise ordered by the...

  20. Aspects on the analysis of 210Po.

    Science.gov (United States)

    Henricsson, F; Ranebo, Y; Holm, E; Roos, P

    2011-05-01

    There has been little development regarding analysis of polonium (Po) in environmental samples since the 1960 ies. This is due to the straightforward spontaneous deposition of this element on silver (Ag), nickel (Ni) or copper (Cu) without any radiochemical separation. For many years, no radiochemical yield determinant was used and it was generally supposed that the yield was 100% after two depositions. Counting was often done using ZnS scintillation counter coupled to a photomultiplier tube. However, the use of the yield determinants (208)Po and (209)Po and the development of alpha spectrometry showed that the yield was lower. Furthermore, the tendency of Po to volatilize at low temperatures constrains the sample preparation techniques; dry-ashing cannot be used. But during the wet-ashing procedure, there are still some losses. The aim of this study was to evaluate the Po losses during wet-ashing by the use of a double-tracer technique. We have found that the losses were about 30% when open glass beakers were used and about 17% when the samples were digested in microwave oven. When long-necked bottles (Kjeldahl flasks) were used, a loss of about 20% was registered. It has also been observed that (210)Pb to some extent is plating out together with its daughter nuclide Po during the electrochemical deposition. This will result in a systematic error since an unknown amount of supported (210)Po will be produced from the (210)Pb decay depending on the fraction of (210)Pb being deposited on the disc and the waiting time between deposition and measurement of the sample. A further consequence of this is that in the assessment of the (210)Pb content in the sample, very often the remaining liquid is stored after deposition for build-up of (210)Po. Since some (210)Pb is lost on the disc, the result for (210)Pb will be too low. Both these systematic errors give rise to a too high (210)Po/(210)Pb ratio. The fraction of (210)Pb which is plating out has been assessed in this

  1. Dicty_cDB: VHF210 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VH (Link to library) VHF210 (Link to dictyBase) - - - Contig-U12400-1 | Contig-U16431-1 VHF...210P (Link to Original site) VHF210F 613 VHF210Z 636 VHF210P 1229 - - Show VHF210 Library VH (Link to library) Clone ID VHF...400-1 | Contig-U16431-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHF2-A/VHF...210Q.Seq.d/ Representative seq. ID VHF210P (Link to Original site) Representative DNA sequence >VHF210 (VHF...210Q) /CSM/VH/VHF2-A/VHF210Q.Seq.d/ AATAAAATGATAAGATCATCAATAAAAAATAAAATAACAACAACAAAAAGTTTATCATGT

  2. Levels and transfer of {sup 210}Po and {sup 210}Pb in Nordic terrestrial ecosystems

    Energy Technology Data Exchange (ETDEWEB)

    Brown, J.E., E-mail: justin.brown@nrpa.n [Norwegian Radiation Protection Authority, PO Box 55, N-1332, Osteras (Norway); Gjelsvik, R. [Norwegian Radiation Protection Authority, PO Box 55, N-1332, Osteras (Norway); Roos, P. [RISO-DTU P.O. Box 49 DK-4000 Roskilde (Denmark); Kalas, J.A. [Norwegian Institute for Nature Research (NINA), Tungasletta 2, 7485 Trondheim (Norway); Outola, I. [STUK, Laippatie 4/P.O. BOX 14, 00881 Helsinki (Finland); Holm, E. [Norwegian Radiation Protection Authority, PO Box 55, N-1332, Osteras (Norway)

    2011-05-15

    Recent developments regarding environmental impact assessment methodologies for radioactivity have precipitated the need for information on levels of naturally occurring radionuclides within and transfer to wild flora and fauna. The objectives of this study were therefore to determine activity concentrations of the main dose forming radionuclides {sup 210}Po and {sup 210}Pb in biota from terrestrial ecosystems thus providing insight into the behaviour of these radioisotopes. Samples of soil, plants and animals were collected at Dovrefjell, Central Norway and Olkiluoto, Finland. Soil profiles from Dovrefjell exhibited an approximately exponential fall in {sup 210}Pb activity concentrations from elevated levels in humus/surface soils to 'supported' levels at depth. Activity concentrations of {sup 210}Po in fauna (invertebrates, mammals, birds) ranged between 2 and 123 Bq kg{sup -1} d.w. and in plants and lichens between 20 and 138 Bq kg{sup -1} d.w. The results showed that soil humus is an important reservoir for {sup 210}Po and {sup 210}Pb and that fauna in close contact with this media may also exhibit elevated levels of {sup 210}Po. Concentration ratios appear to have limited applicability with regards to prediction of activity concentrations of {sup 210}Po in invertebrates and vertebrates. Biokinetic models may provide a tool to explore in a more mechanistic way the behaviour of {sup 210}Po in this system.

  3. 17 CFR 210.11-03 - Presentation of financial forecast.

    Science.gov (United States)

    2010-04-01

    ... forecast. 210.11-03 Section 210.11-03 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION... Information § 210.11-03 Presentation of financial forecast. (a) A financial forecast may be filed in lieu of the pro forma condensed statements of income required by § 210.11-02(b)(1). (1) The financial forecast...

  4. Radioactive {sup 210}Po in magnesium supplements

    Energy Technology Data Exchange (ETDEWEB)

    Struminska-Parulska, Dagmara Ida [Gdansk Univ. (Poland). Environmental Chemistry and Radiochemistry Chair

    2016-08-01

    The aim of this pioneer study was to determine polonium {sup 210}Po in the most popular magnesium supplements in Poland and estimate the possible related dose assessment to the consumers. The analyzed magnesium pharmaceutics contained organic or inorganic magnesium compounds; some from natural sources. The objectives of this research were to investigate the naturally occurring {sup 210}Po activity concentrations in magnesium supplements, find the correlations between {sup 210}Po concentration in medicament and magnesium chemical form, and calculate the effective radiation dose connected to analyzed magnesium supplement consumption. The highest {sup 210}Po activity concentrations were determined in mineral tablets made from sedimentary rocks, namely dolomite - 3.84 ± 0.15 mBq g{sup -1} (sample Mg17). The highest annual radiation dose from {sup 210}Po taken with 1 tablet of magnesium supplement per day or with 400 mg of pure Mg daily would come from sample Mg17 (dolomite) - 1.35 ± 0.5 and 8.44 ± 0.33 μSv year{sup -1} respectively.

  5. Polonium-210 and lead-210 in the terrestrial environment: a historical review

    Energy Technology Data Exchange (ETDEWEB)

    Persson, Bertil R.R., E-mail: bertil_r.persson@med.lu.s [Dept. of Medical Radiation Physics, Lund University, Barngatan 2, SE-221 85 Lund (Sweden); Holm, Elis [Norwegian Radiation Protection Authority, Osteras (Norway)

    2011-05-15

    The radionuclides {sup 210}Po and {sup 210}Pb widely present in the terrestrial environment are the final long-lived radionuclides in the decay of {sup 238}U in the earth's crust. Their presence in the atmosphere is due to the decay of {sup 222}Rn diffusing from the ground. The range of activity concentrations in ground level air for {sup 210}Po is 0.03-0.3 Bq m{sup -3} and for {sup 210}Pb 0.2-1.5 Bq m{sup -3}. In drinking water from private wells the activity concentration of {sup 210}Po is in the order of 7-48 mBq l{sup -1} and for {sup 210}Pb around 11-40 mBq l{sup -1}. From water works, however, the activity concentration for both {sup 210}Po and {sup 210}Pb is only in the order of 3 mBq l{sup -1}. Mosses, lichens and peat have a high efficiency in capturing {sup 210}Po and {sup 210}Pb from atmospheric fallout and exhibit an inventory of both {sup 210}Po and {sup 210}Pb in the order of 0.5-5 kBq m{sup -2} in mosses and in lichens around 0.6 kBq m{sup -2}. The activity concentrations in lichens lies around 250 Bq kg{sup -1}, dry mass. Reindeer and caribou graze lichen which results in an activity concentration of {sup 210}Po and {sup 210}Pb of about 1-15 Bq kg{sup -1} in meat from these animals. The food chain lichen-reindeer or caribou, and Man constitutes a unique model for studying the uptake and retention of {sup 210}Po and {sup 210}Pb in humans. The effective annual dose due to {sup 210}Po and {sup 210}Pb in people with high consumption of reindeer/caribou meat is estimated to be around 260 and 132 {mu}Sv a{sup -1} respectively. In soils, {sup 210}Po is adsorbed to clay and organic colloids and the activity concentration varies with soil type and also correlates with the amount of atmospheric precipitation. The average activity concentration levels of {sup 210}Po in various soils are in the range of 20-240 Bq kg{sup -1}. Plants become contaminated with radioactive nuclides both by absorption from the soil (supported Po) and by deposition of radioactive

  6. Kidney disease in beagles injected with polonium-210

    Energy Technology Data Exchange (ETDEWEB)

    Bruenger, F.W.; Lloyd, R.D.; Taylor, G.N.; Miller, S.C.; Mays, C.W. (Univ. of Utah School of Medicine, Salt Lake City (USA))

    1990-06-01

    An unusually high incidence of kidney disease (tubular degeneration and necrosis with fibrous replacement) was observed among 24 beagles injected at about 5 years of age with 116 or 329 kBq 226Ra kg-1 but not among an additional 10 beagles given about 39 kBq 226Ra kg-1. This 226Ra solution also contained 210Pb, 210Bi, and 210Po. To determine whether the kidney disease was related to the radiation from 226Ra and its short-lived progeny or to the alpha radiation from 210Po, 2 beagles about 7 years of age were injected with 451 kBq 226Ra kg-1 of 210Po citrate. Measurements of polonium retention in the kidneys of 4 additional beagles given 210Bi citrate enabled us to model the retention of these emitters in the dog kidney and to estimate the kidney dose from the alpha radiation of 210Po following injection of either 226Ra + 210Bi + 210Po or 210Po only. Autoradiography revealed that almost equal concentrations of 210Po were in the tubular epithelium and/or its basement membrane and in the glomeruli, but very little of the 210Bi deposited in kidney tissue was present in the glomeruli. Radiation damage to the kidneys similar to that observed previously in beagles given 226Ra solutions that also contained 210Bi and 210Po was seen among the beagles given 210Po but not in the dogs given purified 226Ra. The analysis of these data indicated that the relatively high incidence of kidney disease among the mature beagles injected with 226Ra and its accompanying 210Bi and 210Po resulted from alpha irradiation of the kidneys by the substantial amount of 210Po that was in the injection solution.

  7. 6 CFR 27.210 - Submissions schedule.

    Science.gov (United States)

    2010-01-01

    ... Domestic Security DEPARTMENT OF HOMELAND SECURITY, OFFICE OF THE SECRETARY CHEMICAL FACILITY ANTI-TERRORISM STANDARDS Chemical Facility Security Program § 27.210 Submissions schedule. (a) Initial Submission. The... of any of the chemicals listed in appendix A at or above the STQ for any applicable Security Issue...

  8. 7 CFR 210.19 - Additional responsibilities.

    Science.gov (United States)

    2010-01-01

    ... reveals that a school food authority's failure to meet the nutrition standards of § 210.10 is... AGRICULTURE CHILD NUTRITION PROGRAMS NATIONAL SCHOOL LUNCH PROGRAM Requirements for State Agency Participation... with School Year 1996-1997, State agencies shall evaluate compliance, over the school week, with the...

  9. 7 CFR 210.18 - Administrative reviews.

    Science.gov (United States)

    2010-01-01

    ... are specified under § 210.29 of this part. (b) Definitions. The following definitions are provided in... Assistance for Needy Families (TANF) office which certifies that the children are currently members of... Households on Indian Reservations (FDPIR) or Temporary Assistance for Needy Families (TANF) benefits. (C...

  10. 5 CFR 430.210 - OPM responsibilities.

    Science.gov (United States)

    2010-01-01

    ... MANAGEMENT Performance Appraisal for General Schedule, Prevailing Rate, and Certain Other Employees § 430.210 OPM responsibilities. (a) OPM shall review and approve an agency's performance appraisal system(s). (b) OPM may evaluate the operation and application of an agency's performance appraisal system(s) and...

  11. Hair and feathers as indicator of internal contamination of 210Po and 210Pb

    Energy Technology Data Exchange (ETDEWEB)

    Holm, E. (ed.); Gwynn, J.; Zaborska, A.; Gaefvert, T. (Norwegian Radiation Protection Authority (Norway)); Roos, P. (Technical Univ. of Denmark, Risoe National Lab. for Sustainable Energy, Roskilde (Denmark)); Henricsson, F. (Lund Univ., Lund (Sweden))

    2010-03-15

    The activities of the NKS-B HAIRPOL project is summarised in this report. The objective was to investigate if hair and feathers were suitable matrices for the estimation of the intake of 210Po. Human hair from people of different sex and age was analysed for 210Po showing concentrations between 0.4 to 11 Bq/kg dry weight. Samples from horses, mane, fur and tail showed concentration from 6 to 17 Bq/kg with no significant difference between the different sample types. Musk ox from Greenland showed much higher concentrations since the animal has to graze a large surface. In fur the concentration was 260 Bq/kg. A considerable fraction of the total 210Po in this animal is contained in the hair. Also different organs were analysed and the highest concentration was found in kidney, 2 700 Bq/kg. The 210Pb concentration in hair was estimated to about 20 Bq/kg. Three different seabirds from Svalbard were analysed. Feathers from all three seabird species show increasing activity concentrations of 210Po and 210Pb from the base to the tip of the feather, but it was difficult to relate feather concentrations to muscle concentrations due to a number of complicating factors. (author)

  12. Dicty_cDB: CHF210 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH (Link to library) CHF210 (Link to dictyBase) - - - Contig-U16313-1 - (Link to Original site) CHF...210F 122 - - - - - - Show CHF210 Library CH (Link to library) Clone ID CHF210 (Link to dicty...iol.tsukuba.ac.jp/CSM/CH/CHF2-A/CHF210Q.Seq.d/ Representative seq. ID - (Link to ...Original site) Representative DNA sequence >CHF210 (CHF210Q) /CSM/CH/CHF2-A/CHF210Q.Seq.d/ AATTATCCCTTAAAATA...3a: 0.00 m3b: 0.00 m_ : 1.00 68.0 %: nuclear 24.0 %: cytoplasmic 4.0 %: mitochondrial 4.0 %: plasma membrane >> prediction for CHF

  13. 8 CFR 210.4 - Status and benefits.

    Science.gov (United States)

    2010-01-01

    ... lawful temporary resident under section 210 of the Act has the right to reside in the United States, to... her inadmissible as an immigrant, unless a waiver is secured pursuant to § 210.3(e)(2) of this part...

  14. Separation of 210Pb, 210Bi and 210Po by ion exchange and their Iiquid scintillation standardization; Separacion del 210Pb, 210Bi y 2I0Po mediante columna de cambio ionico y su calibracion por centelleo liquido

    Energy Technology Data Exchange (ETDEWEB)

    Rodriguez, L.; Jimenez, A.; Grau, A.

    1996-07-01

    We applied the CIEMAT/NIST method and alpha/beta discrimination to ''210Pb samples in equilibrium with its daughters, by preparing homogeneous and gel samples. The stability of samples was tested in different available cocktails, HiSafe''TM II, HiSafe''TM III, Ultima-Gold''TM, Ultima-Gold''TM XR, Ultima-Gold''TM AB, Insta-Gel''R and e Insta-Gel''R lI. Also we analyzed the disequilibrium of the radioactive chain 210Pb+210Bi+210Po, achieving an excellent agreement between the results of the spectrum unfolding method and the experimental values. (Author) 13 refs.

  15. 46 CFR 28.210 - First aid equipment and training.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 1 2010-10-01 2010-10-01 false First aid equipment and training. 28.210 Section 28.210....210 First aid equipment and training. (a) Each vessel must have on board a complete first aid manual... location. (b) First aid and cardiopulmonary resuscitation (CPR) course certification. Certification in...

  16. 7 CFR 3560.210 - Special note rents (SNRs).

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 15 2010-01-01 2010-01-01 false Special note rents (SNRs). 3560.210 Section 3560.210... AGRICULTURE DIRECT MULTI-FAMILY HOUSING LOANS AND GRANTS Rents § 3560.210 Special note rents (SNRs). When a... the borrower to charge an SNR, which is less than note rent but higher than basic rent, to attract or...

  17. 19 CFR 210.31 - Requests for admission.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 3 2010-04-01 2010-04-01 false Requests for admission. 210.31 Section 210.31... TRADE ADJUDICATION AND ENFORCEMENT Discovery and Compulsory Process § 210.31 Requests for admission. (a) Form, content, and service of request for admission. Any party may serve on any other party a written...

  18. 42 CFR 59.210 - Inventions or discoveries.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Inventions or discoveries. 59.210 Section 59.210... PLANNING SERVICES Grants for Family Planning Service Training § 59.210 Inventions or discoveries. Any grant.... Laboratory notes, related technical data, and information pertaining to inventions and discoveries shall be...

  19. 7 CFR 210.16 - Food service management companies.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Food service management companies. 210.16 Section 210... Authority Participation § 210.16 Food service management companies. (a) General. Any school food authority... management company to manage its food service operation in one or more of its schools. However, no school or...

  20. 22 CFR 210.635 - Drug-free workplace.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Drug-free workplace. 210.635 Section 210.635 Foreign Relations AGENCY FOR INTERNATIONAL DEVELOPMENT GOVERNMENTWIDE REQUIREMENTS FOR DRUG-FREE WORKPLACE (FINANCIAL ASSISTANCE) Definitions § 210.635 Drug-free workplace. Drug-free workplace means a site for the...

  1. 22 CFR 210.645 - Federal agency or agency.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Federal agency or agency. 210.645 Section 210.645 Foreign Relations AGENCY FOR INTERNATIONAL DEVELOPMENT GOVERNMENTWIDE REQUIREMENTS FOR DRUG-FREE WORKPLACE (FINANCIAL ASSISTANCE) Definitions § 210.645 Federal agency or agency. Federal agency or agency...

  2. Improved optimum condition for recovery and measurement of 210 ...

    African Journals Online (AJOL)

    The aim of this study was to determine the optimum conditions for deposition of 210Po and evaluate the accuracy and precision of the results for its determination in environmental samples. To improve the technique for measurement of polonium-210(210Po) in environmental samples. The optimization of five factors (volume ...

  3. 20 CFR 637.210 - Incentive bonus program applications.

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Incentive bonus program applications. 637.210 Section 637.210 Employees' Benefits EMPLOYMENT AND TRAINING ADMINISTRATION, DEPARTMENT OF LABOR PROGRAMS UNDER TITLE V OF THE JOB TRAINING PARTNERSHIP ACT Program Planning and Operation § 637.210 Incentive...

  4. 7 CFR 3565.210 - Maximum interest rate.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 15 2010-01-01 2010-01-01 false Maximum interest rate. 3565.210 Section 3565.210... AGRICULTURE GUARANTEED RURAL RENTAL HOUSING PROGRAM Loan Requirements § 3565.210 Maximum interest rate. The interest rate for a guaranteed loan must not exceed the maximum allowable rate specified by the Agency in...

  5. 31 CFR 210.7 - Federal Reserve Banks.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Federal Reserve Banks. 210.7 Section 210.7 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) FISCAL SERVICE... CLEARING HOUSE General § 210.7 Federal Reserve Banks. (a) Fiscal Agents. Each Federal Reserve Bank serves...

  6. Assessment of {sup 210}Po and {sup 210}Pb in marine biota of the Mallipattinam ecosystem of Tamil Nadu, India

    Energy Technology Data Exchange (ETDEWEB)

    Suriyanarayanan, S. [Center for Water and Health, JSS University, SS Nagara, Mysore 570 015, Karnataka (India); Brahmanandhan, G.M., E-mail: brahma_king@yahoo.co [Nagasaki University Radioisotope Research Center, Radio Isotope Center, 1-12-4, Sakamoto, Nagasaki 852-8523 (Japan); Samivel, K. [Environmental Research Lab, P.G. Department of Zoology, Jamal Mohamed College, Tiruchirappalli-620 020, Tamil Nadu (India); Ravikumar, S. [Faculty of Biotechnology, PRIST University, Thanjavur 613 403, Tamil Nadu (India); Hameed, P. Shahul [Environment Research Center, JJ College of Engineering and Technology, Tiruchirappalli 620 009, Tamil Nadu (India)

    2010-11-15

    To provide baseline data on background radiation levels for the future assessment of the impact of nuclear and thermal power stations, a systematic study was carried out in the Mallipattinam ecosystem of Tamil Nadu, India. Mallipattinam is located between the Kudankulam and Kalpakkam nuclear power plants and near to Tuticorin thermal power plant. Water, sediments, seaweeds, crustaceans, molluscs, and fish were collected to measure the concentrations of {sup 210}Po and {sup 210}Pb. The concentrations of {sup 210}Po and {sup 210}Pb in most samples are comparable to values reported worldwide. In fish, the concentrations of {sup 210}Po and {sup 210}Pb are in the range 16-190 Bq kg{sup -1} and 8-153 Bq kg{sup -1}, respectively. The concentration factors of {sup 210}Po and {sup 210}Pb for the biotic components ranges from 10{sup 3} to 10{sup 6}.

  7. Distribution of {sup 210}Pb and {sup 210}Po concentrations in wild berries and mushrooms in boreal forest ecosystems

    Energy Technology Data Exchange (ETDEWEB)

    Vaaramaa, Kaisa, E-mail: Kaisa.Vaaramaa@Helsinki.fi [Laboratory of Radiochemistry, Department of Chemistry, P.O. Box 55, FI-00014 University of Helsinki (Finland); Solatie, Dina [STUK-Radiation and Nuclear Safety Authority, Regional Laboratory in Northern Finland, FI-96500 Rovaniemi (Finland); Aro, Lasse [Finnish Forest Research Institute (METLA), Parkano Research Unit, FI-39700 Parkano (Finland)

    2009-12-15

    The activity concentrations and distribution of {sup 210}Pb and {sup 210}Po in wild berries and edible mushrooms were investigated in Finnish forests. The main study areas were located in Scots pine (Pinus sylvestris L.) forests in southern and northern Finland. The activity concentrations of {sup 210}Pb and {sup 210}Po in blueberry (Vaccinium myrtillus L.) and lingonberry (Vaccinium vitis-idaea L.) samples decreased in the order: stems > leaves > berries (i.e. fruits). The activity ratios of {sup 210}Po/{sup 210}Pb in the wild berry samples were mainly higher than one, indicating elevated activity concentrations of polonium in the samples. In mushrooms the activity concentrations of {sup 210}Pb and especially {sup 210}Po were higher than in fruits of the wild berries. The highest activity concentration of {sup 210}Pb was detected in Cortinarius armillatus L. (16.2 Bq kg{sup -1} d.w.) and the lowest in Leccinum vulpinum L. (1.38 Bq kg{sup -1} d.w.). The {sup 210}Po activity concentrations of the whole fruiting bodies ranged from 7.14 Bq kg{sup -1} d.w. (Russula paludosa L.) to 1174 Bq kg{sup -1} d.w. (L. vulpinum L.). In general, the highest activity concentrations of {sup 210}Po were recorded in boletes. The caps of mushrooms of the Boletaceae family showed higher activity concentrations of {sup 210}Po compared to the stipes. In most of the mushrooms analyzed, the activity concentrations of {sup 210}Po were higher than those of {sup 210}Pb. {sup 210}Po and {sup 210}Pb dominate the radiation doses received via ingestion of wild berries and mushrooms in northern Finland, while in southern Finland the ingested dose is dominated by {sup 137}Cs from the Chernobyl fallout.

  8. Distribution of 210Pb and 210Po concentrations in wild berries and mushrooms in boreal forest ecosystems.

    Science.gov (United States)

    Vaaramaa, Kaisa; Solatie, Dina; Aro, Lasse

    2009-12-15

    The activity concentrations and distribution of 210Pb and 210Po in wild berries and edible mushrooms were investigated in Finnish forests. The main study areas were located in Scots pine (Pinus sylvestris L.) forests in southern and northern Finland. The activity concentrations of 210Pb and 210Po in blueberry (Vaccinium myrtillus L.) and lingonberry (Vaccinium vitis-idaea L.) samples decreased in the order: stems>leaves>berries (i.e. fruits). The activity ratios of 210Po/210Pb in the wild berry samples were mainly higher than one, indicating elevated activity concentrations of polonium in the samples. In mushrooms the activity concentrations of 210Pb and especially 210Po were higher than in fruits of the wild berries. The highest activity concentration of 210Pb was detected in Cortinarius armillatus L. (16.2 Bq kg(-1) d.w.) and the lowest in Leccinum vulpinum L. (1.38 Bq kg(-1) d.w.). The 210Po activity concentrations of the whole fruiting bodies ranged from 7.14 Bq kg(-1) d.w. (Russula paludosa L.) to 1174 Bq kg(-1) d.w. (L. vulpinum L.). In general, the highest activity concentrations of 210Po were recorded in boletes. The caps of mushrooms of the Boletaceae family showed higher activity concentrations of 210Po compared to the stipes. In most of the mushrooms analyzed, the activity concentrations of 210Po were higher than those of 210Pb. 210Po and 210Pb dominate the radiation doses received via ingestion of wild berries and mushrooms in northern Finland, while in southern Finland the ingested dose is dominated by 137Cs from the Chernobyl fallout.

  9. Assessment of soil contamination by (210)Po and (210)Pb around heavy oil and natural gas fired power plants.

    Science.gov (United States)

    Al-Masri, M S; Haddad, Kh; Doubal, A W; Awad, I; Al-Khatib, Y

    2014-06-01

    Soil contamination by (210)Pb and (210)Po around heavy oil and natural gas power plants has been investigated; fly and bottom ash containing enhanced levels of (210)Pb and (210)Po were found to be the main source of surface soil contamination. The results showed that (210)Pb and (210)Po in fly-ash (economizer, superheater) is highly enriched with (210)Pb and (210)Po, while bottom-ash (boiler) is depleted. The highest (210)Pb and (210)Po activity concentrations were found to be in economizer ash, whereas the lowest activity concentration was in the recirculator ash. On the other hand, (210)Pb and (210)Po activity concentrations in soil samples were found to be higher inside the plant site area than those samples collected from surrounding areas. The highest levels were found in the vicinity of Mhardeh and Tishreen power plants; both plants are operated by heavy oil and natural fuels, while the lowest values were found to be in those samples collected from Nasrieh power plant, which is only operated by one type of fuel, viz. natural gas. In addition, the levels of surface soil contamination have decreased as the distance from the power plant site center increased. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. Natural radionuclides (210)Po and (210)Pb in the Delaware and Chesapeake Estuaries: modeling scavenging rates and residence times.

    Science.gov (United States)

    Marsan, D; Rigaud, S; Church, T

    2014-12-01

    During the spring and summer months of 2012, (210)Po and (210)Pb activity were measured in the dissolved and particulate phases from the Delaware and upper Chesapeake estuaries. The upper Delaware estuary, near the freshwater end member, was characterized by high-suspended matter concentrations that scavenged dissolved (210)Po and (210)Pb. Box models were applied using mass balance calculations to assess the nuclides residence times in each estuary. Only 60% of the dissolved (210)Po and 55% of the dissolved (210)Pb from the Delaware estuary were exported to coastal waters. A large fraction of soluble (210)Po and (210)Pb within the estuary was either reversibly adsorbed onto suspended particles, trapped in sediment accumulation zones (such as intertidal marshes), bioaccumulated into phytoplankton and discharged to the coastal ocean. The upper Chesapeake estuary was largely characterized by sub-oxic bottom waters that contained higher concentrations of dissolved (210)Po and (210)Pb, hypothesized to be subjected to redox cycling of manganese. The Delaware and Chesapeake estuary mean residence times for (210)Po differed significantly at 86 ± 7 and 126 ± 10 days respectively, while they were similar for (210)Pb (67 ± 6-55 ± 5 days). The difference in residence times corresponds to the greater extent of biogeochemical scavenging and regeneration processes within the upper Chesapeake. Copyright © 2014 Elsevier Ltd. All rights reserved.

  11. Quantitation of lead-210 (210Pb) using lead-203 (203Pb) as a "Massless" yield tracer.

    Science.gov (United States)

    May, D; Nelson, A N; Schultz, M K

    2017-05-01

    Determination of Pb-210 (210Pb) in aqueous solution is a common radioanalytical challenge in environmental science. Widely used methods for undertaking these analyses (e.g., ASTM D7535) rely on the use of stable lead (Pb) as a yield tracer that takes into account losses of 210Pb that inevitably occur during elemental/radiochemical separations of the procedures. Although effective, these methods introduce technical challenges that can be difficult to track and potentially introduce uncertainty that can be difficult to quantify. Examples of these challenges include interference from endogenous stable Pb in complex sample matrices; contamination of stable Pb carrier with 210Pb; and high detection limits due to counting efficiency limitations. We hypothesized that many of these challenges could be avoided by the use of the electron-capture, gamma-emitting isotope, 203Pb as a chemical yield tracer in the analysis of 210Pb. A series of experiments were performed to evaluate the efficacy of 203Pb as a tracer. Four different matrices were analyzed, including a complex matrix (hydraulic-fracturing produced fluids); and samples comprising less complicated matrices (i.e., river water, deionized water, and tap water). Separation techniques and counting methodologies were also compared and optimized. Due to a relatively short-half life (52 h), 203Pb tracer is effectively massless for the purposes of chemical separations, allowing for reduced chromatography column resin bed volumes. Because 203Pb is a gamma emitter (279 keV; 81% intensity), recovery can be determined non-destructively in a variety of matrices, including liquid scintillation cocktail. The use of liquid scintillation as a counting methodology allowed for determination of 210Pb activities via 210Pb or 210Po; and recoveries of greater than 90% are routinely achievable using this approach. The improved method for the analysis of 210Pb in aqueous matrices allows for the analysis of complex matrices, at reduced cost

  12. Temporal changes of {sup 210}Po in temperate coastal waters

    Energy Technology Data Exchange (ETDEWEB)

    Wildgust, M.A.; White, K.N. [School of Biological Sciences, The University of Manchester, Manchester (United Kingdom); McDonald, P. [Westlakes Research Limited, Westlakes Science and Technology Park, Cumbria (United Kingdom)

    1998-06-18

    The temporal variation of Polonium-210 ({sup 210}Po) was examined in coastal sea water, the mussel Mytilus edulis, the winkle Littorina littorea and green algae Ulva lactuca in order to investigate the entry of {sup 210}Po into the marine food chain. More than 99% of {sup 210}Po in the water column occurred in the particulate phase. Dissolved {sup 210}Po concentrations peaked during the spring phytoplankton bloom and it is suggested this is related to preferential scavenging of {sup 210}Po by the increased numbers of bacteria, viruses and small dissolved particulates. Changes in L. Littorea {sup 210}Po specific activity are thought not to be related to food, but to a drop in body weight following spawning. Much of the {sup 210}Po accumulated by M. edulis was located in the digestive gland. The specific activity of {sup 210}Po in the digestive gland of M. edulis was shown to be strongly correlated with changes in sea water suspended particulate specific activity. Examination of other trace metal (Ag, Al, As, Ca, Cd, Cr, Co, Cu, Fe, Hg, K, Mg, Mn, Na, Ni Sb, Se, Sn and Zn) variations in the digestive gland revealed that class B and borderline metals had a strong positive correlation with {sup 210}Po. On-going work is investigating whether the accumulation and loss of {sup 210}Po is affected by the presence of metallothioneins

  13. {sup 210}Pb and {sup 210}Po as tracers of particle transport mechanisms on continental margins

    Energy Technology Data Exchange (ETDEWEB)

    Radakovitch, O.; Heussner, S. [Perpignan Univ., 66 (France). Lab. de Sedimentologie et Geochimie Marines; Biscaye, P.; Abassi, A. [Columbia Univ., Palisades, NY (United States). Lamont Doherty Earth Observatory

    1997-12-31

    The natural radionuclides {sup 210}Po and {sup 210}Pb, members of the {sup 238}U decay chain, are particularly helpful to the understanding of particle transport processes in the ocean. These isotopes were analysed on sediment trap particles collected during 3 one-year experiments on continental margins. In the Bay of Biscay (Northeastern Atlantic) and in the Gulf of Lion (Northwestern Mediterranean Sea) both as part of the French ECOMARGE programme, and in the Middle Atlantic Bight (Northwestern Atlantic) as part of the SEEP programme. They yielded great insights into scenarios of particle transfer at each site, mainly based on the spatial and temporal distribution of {sup 210}Pb particulate concentrations and fluxes. (author) 11 refs.

  14. Behaviour of 210Po in the marine environment

    Science.gov (United States)

    Wildgust, Mark Antony

    The naturally occurring alpha-emitter polonium-210 (210Po) is one of the most radiotoxic elements in the environment. Moreover, it contributes more than 150 times towards the effective radiation dosage received by humans from the consumption of fish and shellfish than from anthropogenic 137Cs. Polonium-210 is known to be strongly accumulated by marine organisms but its biochemistry is poorly understood. The research described here had two main aims: first, to investigate the factors causing temporal variations of 210Po in the temperate coastal waters and marine biota and second, to examine the biokinetics of 210Po in the marine mussel Mytilus edulis. These questions were investigated by a field study and a series of laboratory experiments. In the field study more than 99% of 210Po in the water column occurred in the particulate phase. Dissolved 210Po levels peaked during the phytoplankton bloom and I proposed that this was related to preferential scavenging of 210Po by increased numbers of bacteria, viruses and small dissolved particulates. Changes in 210Po specific activity in the winkle Liittorina littorea are thought to be related to a fall in body weight following spawning. The specific activity of 210Po in the digestive gland of M. edulis was strongly correlated with changes in seawater suspended particulate specific activity. Examination of other trace metals revealed correlations between class B and Borderline metals. In the laboratory digestion of 210Po-labelled Isochrysis galbana occurred via a biphasic process, characteristic of a rapid (extracellular) and slow (intracellular) digestion typical of marine bivalves. The mantle/gill and foot have no known digestive role, yet their 210Po specific activities increased after 24 hours. I proposed that this increase in 210Po specific activity was related to 210Po incorporated into these tissues from that assimilated from I. galbana during extracellular digestion. I also propose that the linear loss of 210Po

  15. Polonium ({sup 210}Po) and lead ({sup 210}Pb) in marine organisms and their transfer in marine food chains

    Energy Technology Data Exchange (ETDEWEB)

    Carvalho, Fernando P., E-mail: carvalho@itn.p [Instituto Tecnologico e Nuclear, Departamento de Proteccao Radiologica e Seguranca Nuclear, E.N. 10, 2686-953 Sacavem (Portugal)

    2011-05-15

    The determination of {sup 210}Po and {sup 210}Pb was performed in marine organisms from the seashore to abyssal depths, encompassing a plethora of species from the microscopic plankton to the sperm whale. Concentrations of those radionuclides ranged from low values of about 5 x 10{sup -1} Bq kg{sup -1} (wet wt.) in jellyfish, to very high values of about of 3 x 10{sup 4} Bq kg{sup -1} (wet wt.) in the gut walls of sardines, with a common pattern of {sup 210}Po > {sup 210}Pb.These radionuclides are primarily absorbed from water and concentrated by phyto- and microzooplankton, and then are transferred to the next trophic level along marine food chains. Investigation in epipelagic, mesopelagic, bathypelagic and abyssobenthic organisms revealed that {sup 210}Po is transferred in the marine food webs with transfer factors ranging from 0.1 to 0.7, and numerically similar to those of the energy transfer in the marine food chains. As {sup 210}Po preferentially binds to amino acids and proteins, its transfer in food chains likely traces protein transfer and, thus, {sup 210}Po transfer factors are similar to ecotrophic coefficients. {sup 210}Pb is transferred less efficiently in marine food chains and this contributes to increased {sup 210}Po:{sup 210}Pb activity ratios in some trophic levels.

  16. 210Po and 210Pb Activity Concentrations in Cigarettes Produced in Vietnam and Their Estimated Dose Contribution Due to Smoking

    Science.gov (United States)

    Tran, Thuy-Ngan N.; Le, Cong-Hao; Chau, Van-Tao

    Smoking cigarettes contributes significantly to the increase of radiation in human body because 210Po and 210Pb exist relatively high in tobacco leaves. Therefore, these two radioisotopes in eighteen of the most frequently sold cigarette brands produced in Vietnam were examined in this study. 210Po was determined by alpha spectroscopy using a passivated implanted planar silicon (PIPS) detector after a procedure including radiochemical separation and spontaneous deposition of polonium on a copper disc (the deposition efficiency of 210Po on a copper disc was approximately 94%). Sequentially, 210Pb was determined through the ingrowth of 210Po after storing the sample solutions for approximately six months. The activity concentrations of 210Po in cigarettes ranged from 13.8 to 82.6 mBq/cigarette (the mean value was 26.4 mBq/cigarette) and the activity concentrations of 210Pb in cigarettes ranged from 13.9 to 78.8 mBq/cigarette (the mean value was 25.8 mBq/cigarette). The annual committed effective dose for smokers who smoke one pack per day was also estimated to be 295.4 µSv/year (223.0 µSv/year and 72.4 µSv/year from 210Po and 210Pb, respectively). These indicated that smoking increased the risk of developing lung cancer was approximately 60 times greater for smokers than for non-smokers.

  17. Association between radionuclides (210Po and 210Pb) and antioxidant enzymes in oak (Quercus coccifera) and mastic tree (Pistacia lentiscus).

    Science.gov (United States)

    Uğur Görgün, A; Aslan, E; Kül, M; İlhan, S; Dimlioğlu, G; Bor, M; Özdemir, F

    2017-08-01

    The activity levels of naturally occurring radionuclides Polonium-210 and lead-210 in different subjects including plant species have direct or indirect impact on human beings. High levels of ionising radiation cause oxidative stress and the interaction between antioxidative defense and radionuclides is not well established in plant systems. In this study, we aimed to understand the impact of oxidative stress caused by 210Po and 210Pb in two Mediterranean plants; Quercus coccifera and Pistacia lentiscus. We analysed the constitutive and seasonal levels of 210Po, 210Pb, lipid peroxidation levels, superoxide dismutase (SOD) and ascorbate peroxidase (APX) activities in the field-collected samples. The highest activity concentrations of 210Po and 210Pb were detected in both plants in summer and Q. coccifera had higher levels than that of P. lentiscus. SOD and APX activity trends were different between oak and mastic; as compared to P. lentiscus, Q. coccifera efficiently used the two major components of antioxidative defense. Lipid peroxidation levels were low in both plants in all seasons except that of spring which were in good agreement with high antioxidant enzyme activities. In conclusion, we found that high 210Po and 210Pb activity concentrations in oak and mastic did not interfere with their growth and life cycles. The ability of both plants for survival and adaptation to Mediterranean environmental constraints provided an additional advantage for coping radionuclide induced oxidative stress as well. Copyright © 2016 Elsevier Ltd. All rights reserved.

  18. Mobility indices and doses from 210Po and 210Pb activity concentrations data in Brazilian spas groundwaters.

    Science.gov (United States)

    Bonotto, Daniel Marcos; Oliveira, Ana Maria Marinello Assis de

    2017-06-01

    210Po and 210Pb activity concentrations in spas groundwaters occurring at São Paulo (SP) and Minas Gerais (MG) states, Brazil, have been reported in this paper with a dual purpose: to compare different indices for evaluating the radionuclides mobility into waters and to evaluate the drinking water quality from dose calculations. The waters (75 sampling points) are extensively used for drinking in public places, bottling and bathing purposes, among other. The samples were taken from springs and wells drilled at different aquifer systems inserted in Paraná and Southeastern Shield hydrogeological provinces. The WHO guideline reference value for 210Pb and 210Po of 0.1 Bq/L in drinking water was not reached for 210Pb but the 210Po levels were equal or above it in four spas groundwaters from MG State. The maximum WHO guidance dose level of 0.1 mSv/yr was also reached or surpassed in them. The 210Pb "mobility index" taking into account the ratio of the weight of the dissolved 210Pb per unit volume of solution to its weight per unit weight of the rock matrix yielded values in the range of 0.01-5.2 kg/m3. Another "mobility index" (Preference Ratio) expressing the ratio of 210Pb and 238U in the waters divided by the ratio of 210Pb and 238U in the rock matrices provided values between 0.004 and 7994. The 210Pb/238U activity ratios of some spas groundwaters suggested preferential 238U transport relative to 210Pb into the liquid phase, whereas the ratio of the 210Pb to 238U mobility indices indicated the opposite. Such finding showed a better usefulness of the mobility indices for evaluating processes affecting the radionuclides release into the liquid phase during the water/rock interactions. Copyright © 2017 Elsevier Ltd. All rights reserved.

  19. Human skeletal uptake of natural alpha radioactivity from {sup 210}Pb-supported {sup 210}Po

    Energy Technology Data Exchange (ETDEWEB)

    Oyedepo, A.C

    1998-06-01

    This thesis contributes to increasing knowledge on the dosimetry of natural alpha-particle radiation in skeletal tissues, particularly in utero, and associated risks of malignancy. Alpha-particle radiation is an established aetiological factor of cancer. In the human body, polonium-210 decayed from skeletal lead-210 ({sup 210}Pb/{sup 210}Po) is the predominant natural alpha-emitter. {sup 210}Pb displaces calcium (Ca) in mineral hydroxyapatite, especially during periods of rapid bone growth and remodelling when Ca is laid down. It was therefore necessary to study alpha activity uptake and calcification concurrently within bone. Human studies were undertaken on: fetal vertebrae, 17 - 42 weeks of gestation, 74 samples; adult vertebrae, 40 - 95 years, 40 samples; and adult ribs, 20 - 95 years, 51 samples. Specimens were unconcentrated and weighed <5 g each. TASTRAK alpha-particle autoradiography was used to assess the bone activity concentration and spatial microdistribution of {sup 210}Pb/{sup 210}Po. Alpha track data were resolved by specially written software named SPATS (Selection Program for Analysing Track Structures). Ca and phosphorus (P) were biochemically determined. Results were examined for trends in bone type, gender and chronological ageing in humans. The main research findings were: 1) The Ca content of fetal vertebrae increased linearly at a weekly rate of 0.2g Ca 100 g{sup -1} wet bone (typical values of 2, 4, 6 g 100 g{sup -1} at 16, 26 and 36 weeks). 2) The P concentration also increased with advancing fetal age. 3) The Ca:P bone weight ratio rose from 1.7 to 2.2 by 32 gestational weeks. 4) The overall range in bone {sup 210}Pb/{sup 210}Po alpha activity was 0.25 - 1.1 Bq kg{sup -1} with correlation between activity concentration and fetal age (0.47 {+-} 0.05 Bq kg{sup -1} for 17 - 26 weeks, 0.67 {+-} 0.04 Bq kg{sup -1} for 32 - 42 weeks). 5) The correlation between increased alpha radioactivity and increased Ca concentration approximating to 0

  20. Distribution and biokinetic analysis of {sup 210}Pb and {sup 210}Po in poultry due to ingestion of dicalcium phosphate

    Energy Technology Data Exchange (ETDEWEB)

    Casacuberta, N., E-mail: Nuria.Casacuberta@uab.es [Departament de Fisica and Institut de Ciencia i Tecnologia Ambientals, Universitat Autonoma de Barcelona, 08193 Bellaterra (Spain); Traversa, F.L. [Departament d' Electronica, Escola Tecnica Superior d' Enginyeria, Universitat Autonoma de Barcelona, 08193 Bellaterra (Spain); Masque, P.; Garcia-Orellana, J. [Departament de Fisica and Institut de Ciencia i Tecnologia Ambientals, Universitat Autonoma de Barcelona, 08193 Bellaterra (Spain); Anguita, M.; Gasa, J. [Departament de Ciencia Animal i dels Aliments, Universitat Autonoma de Barcelona, 08193 Bellaterra (Spain); Garcia-Tenorio, R. [Universidad de Sevilla, Avda. Reina Mercedes s/n, 41012 Sevilla (Spain)

    2010-09-15

    Dicalcium phosphate (DCP) is used as a calcium supplement for food producing animals (i.e., cattle, poultry and pig). When DCP is produced via wet acid digestion of the phosphate rock and depending on the acid used in the industrial process, the final product can result in enhanced {sup 210}Pb and {sup 210}Po specific activities ({approx} 2000 Bq.kg{sup -1}). Both {sup 210}Pb and {sup 210}Po are of great interest because their contribution to the dose received by ingestion is potentially large. The aims of this work are to examine the accumulation of {sup 210}Pb and {sup 210}Po in chicken tissues during the first 42 days of life and to build a suitable single-compartment biokinetic model to understand the behavior of both radionuclides within the entire animal using the experimental results. Three commercial corn-soybean-based diets containing different amounts and sources of DCP were fed to broilers during a period of 42 days. The results show that diets containing enhanced concentrations of {sup 210}Pb and {sup 210}Po lead to larger specific accumulation in broiler tissues compared to the blank diet. Radionuclides do not accumulate homogeneously within the animal body: {sup 210}Pb follows the calcium pathways to some extent and accumulates largely in bones, while {sup 210}Po accumulates to a large extent in liver and kidneys. However, the total amount of radionuclide accumulation in tissues is small compared to the amounts excreted in feces. The single-compartment non-linear biokinetic model proposed here for {sup 210}Pb and {sup 210}Po in the whole animal takes into account the size evolution and is self-consistent in that no fitting parameterization of intake and excretions rates is required.

  1. Compact Miniaturized Antenna for 210 MHz RFID

    Science.gov (United States)

    Lee, Richard Q.; Chun, Kue

    2008-01-01

    This paper describes the design and simulation of a miniaturized square-ring antenna. The miniaturized antenna, with overall dimensions of approximately one tenth of a wavelength (0.1 ), was designed to operate at around 210 MHz, and was intended for radio-frequency identification (RFID) application. One unique feature of the design is the use of a parasitic element to improve the performance and impedance matching of the antenna. The use of parasitic elements to enhance the gain and bandwidth of patch antennas has been demonstrated and reported in the literature, but such use has never been applied to miniaturized antennas. In this work, we will present simulation results and discuss design parameters and their impact on the antenna performance.

  2. Separation and electrodeposited of {sup 210} Po; Separacion y electrodeposito de {sup 210} Po

    Energy Technology Data Exchange (ETDEWEB)

    Ordonez R, E.; Iturbe G, J.L

    1991-12-15

    Presently work it was determined the selective separation of the {sup 210} Po that is in an uraniferous mineral, by means of acid leaching of the mineral and the purification was carried out by means of partition chromatography whose stationary phase is 2-ethylhexyl phosphoric acid (D{sub 2}EHPA), it has been possible to isolate the {sup 210} Po of the rest of the radioactive elements that conform the family 4 N{sup +2}, the optimal elutriation conditions of this element were settled down of manner of not dragging other radioelements. Another of the achievements presented in this communication has been the electrodeposition of this element has more than enough stainless steel discs with a superior yield to 95%. (Author)

  3. 48 CFR 2152.210-70 - Investment income.

    Science.gov (United States)

    2010-10-01

    ... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Investment income. 2152.210... CONTRACT CLAUSES Text of Provisions and Clauses 2152.210-70 Investment income. As prescribed in 2110.7004(a), insert the following clause: Investment Income (OCT 2005) (a) The Contractor must invest and reinvest all...

  4. 46 CFR 197.210 - Designation of diving supervisor.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Designation of diving supervisor. 197.210 Section 197... HEALTH STANDARDS GENERAL PROVISIONS Commercial Diving Operations General § 197.210 Designation of diving supervisor. The name of the diving supervisor for each commercial diving operation shall be— (a) Designated...

  5. 42 CFR 403.210 - NAIC model standards.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 2 2010-10-01 2010-10-01 false NAIC model standards. 403.210 Section 403.210... model standards. (a) NAIC model standards means the National Association of Insurance Commissioners (NAIC) “Model Regulation to Implement the Individual Accident and Insurance Minimum Standards Act” (as...

  6. 41 CFR 50-210.0 - General enforcement policy.

    Science.gov (United States)

    2010-07-01

    ... 41 Public Contracts and Property Management 1 2010-07-01 2010-07-01 true General enforcement policy. 50-210.0 Section 50-210.0 Public Contracts and Property Management Other Provisions Relating to... for strict compliance with the provisions thereof and the regulations issued pursuant thereto. (c) Any...

  7. 19 CFR 210.72 - Confidentiality of information.

    Science.gov (United States)

    2010-04-01

    ... 19 Customs Duties 3 2010-04-01 2010-04-01 false Confidentiality of information. 210.72 Section 210.72 Customs Duties UNITED STATES INTERNATIONAL TRADE COMMISSION INVESTIGATIONS OF UNFAIR PRACTICES IN... Confidentiality of information. Confidential information (as defined in § 201.6(a) of this chapter) that is...

  8. 5 CFR 930.210 - Reduction in force.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 2 2010-01-01 2010-01-01 false Reduction in force. 930.210 Section 930... § 930.210 Reduction in force. (a) Retention preference regulations. Except as modified by this section, the reduction in force regulations in part 351 of this chapter apply to administrative law judges. (b...

  9. 17 CFR 210.4-07 - Discount on shares.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Discount on shares. 210.4-07... 1940, AND ENERGY POLICY AND CONSERVATION ACT OF 1975 Rules of General Application § 210.4-07 Discount on shares. Discount on shares, or any unamortized balance thereof, shall be shown separately as a...

  10. MicroRNA-210 and its theranostic potential.

    Science.gov (United States)

    Ren, Chun-Xia; Leng, Rui-Xue; Fan, Yin-Guang; Pan, Hai-Feng; Wu, Chang-Hao; Ye, Dong-Qing

    2016-11-01

    MicroRNAs (miRNAs) are a set of small single-stranded noncoding RNAs with diverse biological functions. As a prototypical hypoxamir, human microRNA-210 (hsa-miR-210) is one of the most widely studied miRNAs thus far. In addition to its involvement in sophisticated regulation of numerous biological processes, miR-210 has also been shown to be associated with the development of different human diseases including various types of cancers, cardiovascular and cerebrovascular diseases, and immunological diseases. Given its multi-faceted functions, miR-210 may serve as a novel and promising theranostic target for prevention and treatment of diseases. Areas covered: This review aims to provide a comprehensive overview of miR-210, the regulation of its expression, biological functions and molecular mechanisms, with particular emphasis on its diagnostic and therapeutic potential. Expert opinion: Although the exact roles of miR-210 in various diseases have not been fully clarified, targeting miR-210 may be a promising therapeutic strategy. Further investigations are also needed to facilitate therapeutic-clinical applications of miR-210 in human diseases.

  11. 17 CFR 210.9-04 - Income statements.

    Science.gov (United States)

    2010-04-01

    ... on loans which are related to or are an adjustment of the loan interest rate. 2. Interest and... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Income statements. 210.9-04 Section 210.9-04 Commodity and Securities Exchanges SECURITIES AND EXCHANGE COMMISSION FORM AND CONTENT OF...

  12. 31 CFR 210.13 - Notice to account owners.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Notice to account owners. 210.13 Section 210.13 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) FISCAL... any notice required by the Service to be provided to account owners as specified in the Green Book...

  13. Development of instrumentation for {sup 210} Pb dating method

    Energy Technology Data Exchange (ETDEWEB)

    Reinikainen, P.; Rekikoski, I.; Virtanen, A.; Aeystoe, J. [Institute for Environmental Research, Jyvaeskylae Univ. (Finland); Merilaeinen, J.; Witick, A. [Department of Physics, Jyvaeskylae Univ. (Finland)

    1998-08-01

    The presentation reviews shortly the project started in 1993 developing alpha- and gamma-ray spectroscopy systems and routines for a study of environmental samples. Particular interest has been focused to the {sup 210}Pb dating for lake sediments. So far, about 40 sediment profiles from all around Finland have been analysed and dated using the {sup 210}Pb method

  14. 46 CFR 16.210 - Pre-employment testing requirements.

    Science.gov (United States)

    2010-10-01

    ... test for dangerous drugs for that employer. (b) An employer may waive a pre-employment test required... 46 Shipping 1 2010-10-01 2010-10-01 false Pre-employment testing requirements. 16.210 Section 16... TESTING Required Chemical Testing § 16.210 Pre-employment testing requirements. (a) No marine employer...

  15. 24 CFR 91.210 - Housing market analysis.

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Housing market analysis. 91.210...; Contents of Consolidated Plan § 91.210 Housing market analysis. (a) General characteristics. Based on... identified, either in a narrative or on one or more maps. (b) Public and assisted housing. (1) The plan must...

  16. 31 CFR 210.12 - RDFI's rights of recovery.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false RDFI's rights of recovery. 210.12 Section 210.12 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) FISCAL SERVICE, DEPARTMENT OF THE TREASURY FINANCIAL MANAGEMENT SERVICE FEDERAL GOVERNMENT PARTICIPATION IN THE...

  17. 31 CFR 210.5 - Account requirements for Federal payments.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Account requirements for Federal payments. 210.5 Section 210.5 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) FISCAL SERVICE, DEPARTMENT OF THE TREASURY FINANCIAL MANAGEMENT SERVICE FEDERAL GOVERNMENT...

  18. 31 CFR 210.1 - Scope; relation to other regulations.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Scope; relation to other regulations. 210.1 Section 210.1 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) FISCAL SERVICE, DEPARTMENT OF THE TREASURY FINANCIAL MANAGEMENT SERVICE FEDERAL GOVERNMENT PARTICIPATION...

  19. 31 CFR 210.9 - Parties to the reclamation.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Parties to the reclamation. 210.9 Section 210.9 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) FISCAL SERVICE, DEPARTMENT OF THE TREASURY FINANCIAL MANAGEMENT SERVICE FEDERAL GOVERNMENT PARTICIPATION IN THE...

  20. 31 CFR 210.14 - Erroneous death information.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Erroneous death information. 210.14 Section 210.14 Money and Finance: Treasury Regulations Relating to Money and Finance (Continued) FISCAL SERVICE, DEPARTMENT OF THE TREASURY FINANCIAL MANAGEMENT SERVICE FEDERAL GOVERNMENT PARTICIPATION IN THE...

  1. 21 CFR 175.210 - Acrylate ester copolymer coating.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Acrylate ester copolymer coating. 175.210 Section 175.210 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) INDIRECT FOOD ADDITIVES: ADHESIVES AND COMPONENTS OF COATINGS Substances for Use as Components of Coatings...

  2. 7 CFR 210.12 - Student, parent and community involvement.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Student, parent and community involvement. 210.12... School Food Authority Participation § 210.12 Student, parent and community involvement. (a) General. School food authorities shall promote activities to involve students and parents in the Program. Such...

  3. 21 CFR 1311.210 - Archiving the initial record.

    Science.gov (United States)

    2010-04-01

    ... 1311.210 Food and Drugs DRUG ENFORCEMENT ADMINISTRATION, DEPARTMENT OF JUSTICE REQUIREMENTS FOR ELECTRONIC ORDERS AND PRESCRIPTIONS (Eff. 6-1-10) Electronic Prescriptions § 1311.210 Archiving the initial record. (a) Except as provided in paragraph (c) of this section, a copy of each electronic controlled...

  4. Sinking fluxes of210Pb and210Po in the deep basin of the northern South China Sea.

    Science.gov (United States)

    Wei, Ching-Ling; Chia, Chao-Yuan; Chou, Wen-Chen; Lee, Wen-Huei

    2017-08-01

    Vertical fluxes of total mass (F mass ), particulate organic carbon (F POC ), particulate inorganic carbon (F PIC ), 210 Pb (F Pb-210 ), and 210 Po (F Po-210 ) were determined by sediment traps deployed at two depths, 2000 m and 3500 m, at SEATS (South East Asian Time-series Study, 116°00°E, 18°00°N) in the northern South China Sea during June 2008-June 2009. The F mass ranges from 12.2 to 55.1 mg m -2  d -1 and from 89.3 to 250.8 mg m -2  d -1 , at 2000 m and 3500 m, respectively, and shows seasonal and inter-annul variation. The temporal variation of F POC , F PIC , and F Pb-210 were in phase with the F mass , which was coupled with the seasonal cycles of primary production in the euphotic layer. The F Pb-210 ranges from 5 to 48 dpm m -2 d -1 and from 38 to 105 dpm m -2 d -1 , at 2000 m and 3500 m, respectively. Contrasting with 210 Pb, the F Po-210 shows poor correlation with F mass . The F Po-210 ranges from 3 to 146 dpm m -2 d -1 and from 50 to 309 dpm m -2 d -1 , at 2000 m and 3500 m, respectively. Episodic events of the settling of biological particles from the surface layer and the regeneration processes the deep layer control the 210 Po removal in the water column of the South China Sea. Strong correlations of the flux and source ratio of 210 Pb, (F/P) Pb-210 , and the particulate carbon fluxes were found, which give relationships of F POC (μg cm -2 y -1 ) = 26.8 + 371.0 (F/P) Pb-210 and F PIC (μg cm -2 y -1 ) = -1.4 + 533.1 (F/P) Pb-210 . Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Determination of {sup 210}Pb via {sup 210}Bi using a hydride generation technique combined with {beta}-spectrometry

    Energy Technology Data Exchange (ETDEWEB)

    Gogrewe, D. [Fachbereich 14 - Kernchemie, Univ. Marburg (Germany); Puetz, M. [Fachbereich 14 - Kernchemie, Univ. Marburg (Germany); Weber, R. [Fachbereich 14 - Kernchemie, Univ. Marburg (Germany); Siemon, K. [Fachbereich 14 - Kernchemie, Univ. Marburg (Germany); Esterlund, R.A. [Fachbereich 14 - Kernchemie, Univ. Marburg (Germany); Patzelt, P. [Fachbereich 14 - Kernchemie, Univ. Marburg (Germany)

    1996-10-01

    A procedure for the determination of {sup 210}Pb is presented, which is based upon the {beta}-spectrometric assay (utilizing a liquid-scintillation counter) of {sup 210}Bi in radioactive equilibrium. Separation of {sup 210}Bi from the sample matrix as well as from other {beta}-emitters is achieved quickly, simply and selectively using a purge and trap technique based upon the generation and subsequent absorption of BiH{sub 3} on a prepared filter paper. Advantages of this method include: 1. radioactive equilibrium between {sup 210}Pb and {sup 210}Bi is relatively quickly attained; 2. the external background signal in liquid-scintillation counting is very low; 3. no quenching corrections are necessary, as the sample matrix is invariant; and 4. because of the high counting efficiency, only short measuring times are required. (orig.)

  6. Recoil-deposited Po-210 in radon dwellings

    Energy Technology Data Exchange (ETDEWEB)

    Samuelsson, C.

    1990-12-31

    Short-lived decay products of Rn-222 plate out on all surfaces in a house containing radon gas. Following the subsequent alpha decays of the mother nuclei, the daughter products Pb-214 and Pb-210 are superficially and permanently absorbed. Due to its long half-life (22 y) the activity of absorbed Pb-210 accumulates in the surface. The activity of Pb-210, or its decay products, can thus reflect the past randon daughter and plate-out history of a house over several decades. Our results and experience from measurements of Po-210 and Rn-222 in 22 dwellings will be presented. In these studies the Po-210 surface activity of one plane glass sheet per dwelling (window panes were not used) has been determined and compared with the period of exposure times the mean radon concentration measured over a two-month period. Considering the large uncertainty in the integrated radon exposure estimate the surface {sup 210}Po correlates well (r=0.73) with the accumulated radon exposure. The {sup 210}Po activity of the glass samples has been measured non-destructively using an open-flow pulse ionization chamber and this detector has also been successfully applied in field exercises.

  7. Recoil-deposited Po-210 in radon dwellings

    Energy Technology Data Exchange (ETDEWEB)

    Samuelsson, C.

    1990-01-01

    Short-lived decay products of Rn-222 plate out on all surfaces in a house containing radon gas. Following the subsequent alpha decays of the mother nuclei, the daughter products Pb-214 and Pb-210 are superficially and permanently absorbed. Due to its long half-life (22 y) the activity of absorbed Pb-210 accumulates in the surface. The activity of Pb-210, or its decay products, can thus reflect the past randon daughter and plate-out history of a house over several decades. Our results and experience from measurements of Po-210 and Rn-222 in 22 dwellings will be presented. In these studies the Po-210 surface activity of one plane glass sheet per dwelling (window panes were not used) has been determined and compared with the period of exposure times the mean radon concentration measured over a two-month period. Considering the large uncertainty in the integrated radon exposure estimate the surface {sup 210}Po correlates well (r=0.73) with the accumulated radon exposure. The {sup 210}Po activity of the glass samples has been measured non-destructively using an open-flow pulse ionization chamber and this detector has also been successfully applied in field exercises.

  8. 210Po in the human food chain; El 210Po en la cadena alimenticia humana

    Energy Technology Data Exchange (ETDEWEB)

    Diaz-Frances, I.

    2010-07-01

    210 Po is a natural ocurring radionuclide, belonging to the Uranium series, which is present in minute amounts in the different environmental compartments (water, soil, biota) and that through its route along the trophic chain can finish incorporated in the human body via ingestion of waters and or food. This radionucleid is highly radiotoxic, being one of the main contributors to the committed effective dose received by the population of Seville via consumption of bottled waters and via ingestion of typical diets is evaluated. The mentioned contribution is also compared with the contributions of other natural and and artificial radionuclides. (Author). 23 refs.

  9. Determination of lead 210 in scales from industrial processes

    Energy Technology Data Exchange (ETDEWEB)

    Faria, Lígia S.; Moreira, Rubens M.; Kastner, Geraldo F.; Barbosa, João B.S., E-mail: ligsfaria@gmail.com, E-mail: rubens@cdtn.br, E-mail: gfk@cdtn.br, E-mail: jbsb@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil)

    2017-11-01

    Industrial processes such as oil and gas extraction and groundwater exploitation are examples of installations that can accumulate naturally occurring radioactive materials (NORM) during the extraction and production. Lead-210 deposits in the production can be formed by the same mechanisms that occur in the environment through the support of Radon-222, (where {sup 210}Pb is produced at {sup 222}Rn decay) or without support, as {sup 210}Pb. The objective of this work is to evaluate the mineralogical characteristics and determine the activity of lead-210 in the scales using the X-Ray Diffraction and Gamma Spectrometry techniques. Were analyzed fifteen samples, four scales from oil industry, ten scales from groundwater conductors and one for groundwater supply pipe. The highest activity found in the oil scale and groundwater conductors scale was 0.30 ± 0.06 Bq g{sup -1} and 3.80 ± 0.20 Bq g{sup -1}, respectively. (author)

  10. 17 CFR 210.9-03 - Balance sheets.

    Science.gov (United States)

    2010-04-01

    ... 1940, AND ENERGY POLICY AND CONSERVATION ACT OF 1975 Bank Holding Companies § 210.9-03 Balance sheets... (such as loans, investments, operations, administration or finance), and any other officer or person who...

  11. Pb-210 and Po-210 atmospheric releases via fly ash from oil shale-fired power plants.

    Science.gov (United States)

    Vaasma, Taavi; Loosaar, Jüri; Gyakwaa, Francis; Kiisk, Madis; Özden, Banu; Tkaczyk, Alan H

    2017-03-01

    During high temperature processes in the furnace volatile and semi-volatile elements and radionuclides are partially emitted to the environment, depending on their chemical form in the original fuel, the technological set-up of the combustion system, and the prevailing combustion conditions. Two of the world's largest oil shale-fired power plants (PPs) have been operational in Estonia from the 1960s, during which time creation of significant environmental emissions and waste containing naturally occurring radionuclides has occurred. Pb-210 and 210 Po are considered natural radionuclides with the highest emission rates from PPs and possess elevated potential radiation exposure risks to humans and the environment. These radionuclides have the highest activity concentration values in fine ash fractions, especially in fractions remaining below 2.5 μm. To determine the activity concentrations of 210 Pb and 210 Po in the PPs' outlet, sampling was conducted from boilers operating on pulverized fuel (PF) technology with novel integrated desulphurization (NID) system and bag filters as well as with electrostatic precipitators (ESPs). The 210 Pb and 210 Po activity concentrations remained around 300 Bq kg -1 for the NID system compared to 60-80 Bq kg -1 in the ESP system. The dominant ash fraction in both systems was PM2.5, constituting over 50% of the fly ash mass collected from the outlet. The authors estimate that the total atmospherically emitted activity for the modernized PPs remains dominantly below 1% of the activity that is inserted via fuel. The implementation of higher efficiency purifications systems has significantly reduced the negative effect of these PPs. Based on annually emitted fly ash and boilers' working hours, the 210 Pb and 210 Po activity released relative to energy production were up to 68.3 kBq GWh el -1 for 210 Pb and 64.6 kBq GWh el -1 for 210 Po. These values are 1 to 2 orders of magnitude lower compared to the situation in the 1980s. These

  12. Pb-210-in-vivo measurements in the human skeleton; Pb-210-in-vivo-Messungen am menschlichen Skelett

    Energy Technology Data Exchange (ETDEWEB)

    Scheler, R.; Dettmann, K. [Bundesamt fuer Strahlenschutz, Berlin (Germany)

    1998-12-31

    A suitable method for the retrospective estimation of the exposure to short-lived radon progeny is the in-vivo measurement of the decay product Pb-210. The deposited Pb-210 is estimated at the skull by measurements with a low-energy Ge-detector-array. Because the decision limit resp. minimal detectable activity of 24 Bq resp. 48 Bq the quantitative assessment of cumulated exposure is possible for long-time exposure at levels of the equilibrium equivalent radon-concentration above 500 Bqm{sup -3}. It seems that the average value of Pb-210-activity in the skeleton of individuals living in regions with increased radon-concentration exceeds the mean value of 15 Bq. A correlation with the exposure may be possible. (orig.) [Deutsch] Eine der pinzipiellen Moeglichkeiten zur retrospektiven Ermittlung der Exposition durch die kurzlebigen Rn-222-Folgeprodukte besteht in der in-vivo-Messung des Folgeproduktes Pb-210. Die Bestimmung des Pb-210 erfolgt am Schaedel mit einer Low-Energy-Ge-Detektoranordnung, deren Erkennungs- bzw. Nachweisgrenze bei Messzeiten von 7200 s fuer das Gesamtskelett 17 Bq bzw. 34 Bq Pb-210 betraegt. Die entsprechenden Grenzen von 24 bzw. 48 Bq fuer das durch Exposition entstandene Pb-210 lassen eine vernuenftige quantitative Bestimmung der kumulierten Exposition erst nach langjaehrigen Expositionen bei gleichgewichtsaequivalenten Radonkonzentrationen von mehr als 500 Bqm{sup -3} zu. Schaedelmessungen an Probanden aus Regionen mit erhoehtem Radonvorkommen deuten auf ein im Mittel hoeheres Niveau der Pb-210-Skelettaktivitaet gegenueber dem vom angegebenen Mittelwert von 15 Bq hin. Ein Zusammenhang zur Exposition ist nicht auszuschliessen. (orig.)

  13. {sup 210}Po and {sup 210}Pb concentration of cigarettes traded in Hungary and their estimated dose contribution due to smoking

    Energy Technology Data Exchange (ETDEWEB)

    Kovacs, Tibor [Department of Radiochemistry, University of Pannonia, P.O. Box 158, H-8201 Veszprem (Hungary)], E-mail: kt@almos.vein.hu; Somlai, Janos [Department of Radiochemistry, University of Pannonia, P.O. Box 158, H-8201 Veszprem (Hungary); Nagy, Katalin [Department of Rheumatology, Markhot F. Heves County Hospital, Szechenyi ut 27, H-3300 Eger (Hungary); Szeiler, Gabor [Department of Radiochemistry, University of Pannonia, P.O. Box 158, H-8201 Veszprem (Hungary)

    2007-11-15

    It is known that tobacco leaves may contain {sup 210}Pb and {sup 210}Po in significant concentrations. The cumulative alpha-radiation dose due to the radioactive content of inhaled cigarette smoke and the increasing number of lung cancer cases explain the importance of the investigation. The present study investigated the activity concentrations of these two radionuclides in 29 Hungarian cigarette samples. The relation between {sup 210}Po/{sup 210}Pb activity and nicotine/tar content of these cigarettes was also examined. {sup 210}Po was determined by alpha spectrometry using a PIPS detector after chemical leaching and spontaneous deposition of {sup 210}Po on a high nickel-content (25%) stainless steel disk. The {sup 210}Pb activity was calculated from the {sup 210}Po originated from the decay of {sup 210}Pb after a waiting period of eight months. The {sup 210}Po activity concentrations of the measured types of cigarettes ranged from 10.0 to 33.5 mBq/cigarette, and the activity of {sup 210}Pb varied from 9.6 to 32.5 mBq/cigarette. The average annual committed effective dose is estimated to be 185.6{+-}70.6{mu}Sv/y and 58.7{+-}22.7{mu}Sv/y due to cigarette smoking (20 cigarettes/day) for {sup 210}Po and {sup 210}Pb, respectively.

  14. 17 CFR 210.6A-01 - Application of §§ 210.6A-01 to 210.6A-05.

    Science.gov (United States)

    2010-04-01

    ... EXCHANGE ACT OF 1934, PUBLIC UTILITY HOLDING COMPANY ACT OF 1935, INVESTMENT COMPANY ACT OF 1940, INVESTMENT ADVISERS ACT OF 1940, AND ENERGY POLICY AND CONSERVATION ACT OF 1975 Employee Stock Purchase... 210.6A-05 shall be applicable to financial statements filed for employee stock purchase, savings and...

  15. Po-210 and other radionuclides in terrestrial and freshwater environments

    Energy Technology Data Exchange (ETDEWEB)

    Gjelsvik, Runhild; Brown, Justin (eds.) (Norwegian Radiation Protection Authority (Norway)); Holm, Elis (Univ. of Lund (Sweden)); Roos, Per (Risoe DTU (Denmark)); Saxen, Ritva; Outola, Iisa (STUK - Radiation and Nuclear Safety Authority (Finland))

    2009-01-15

    This report provides new information on Po-210 (and where appropriate its grandparent Pb-210) behaviour in environmental systems including humans. This has primarily been achieved through measurements of Po-210 in aquatic and terrestrial environments that has led to the derivation of information on the levels of this radioisotope in plants, animals and the biotic components of their habitat (i.e. water, soil) providing basic information on transfer where practicable. For freshwater environments, Po-210 concentration ratios derived for freshwater benthic fish and bivalve mollusc were substantially different to values collated from earlier review work. For terrestrial environments, activity concentrations of Po-210 in small mammals (although of a preliminary nature because no correction was made for ingrowth from Pb-210) were considerably higher than values derived from earlier data compilations. It was envisaged that data on levels of naturally occurring radionuclides would render underpinning data sets more comprehensive and would thus allow more robust background dose calculations to be performed subsequently. By way of example, unweighted background dose-rates arising from internal distributions of Po-210 were calculated for small mammals in the terrestrial study. The biokinetics of polonium in humans has been studied following chronic and acute oral intakes of selected Po radioisotopes. This work has provided information on gastrointestinal absorption factors and biological retention times thus improving the database upon which committed effective doses to humans are derived. The information generated in the report, in its entirety, should be of direct relevance for both human and non-human impact assessments. (au)

  16. The Radiological Impact of 210Pb and 210Po Released from the Iron- and Steel-Making Plant ILVA in Taranto (Italy on the Environment and the Public

    Directory of Open Access Journals (Sweden)

    Guogang Jia

    2013-01-01

    Full Text Available Lead-210 and 210Po are naturally occurring radionuclides. Due to volatile characteristic of lead and polonium, environmental pollution of 210Pb and 210Po released from the coal power plant, steel-making industry and refractory material industry has been an exposure problem for the members of public. In this paper studies on the activity concentrations of 210Po and 210Pb in the raw materials, dust particles, surficial soils and atmospheric particulate samples collected in the area of the Iron- and Steel-Making Plant ILVA Taranto (Italy were made. These data have been used to evaluate the source-term, distributions, inventories, mass balance, biological availability, ecological migration processes and public exposure risk of 210Pb and 210Po in the concerned environment.

  17. Natural levels of {sup 210}Po in human urine

    Energy Technology Data Exchange (ETDEWEB)

    Diaz-Frances, I.; Manjon, G.; Mantero, J.; Diaz, J. [Departament of Applied Phisic II, University of Seville, P.O. Box 41012 Seville (Spain); Garcia-Tenorio, R. [Departament of Applied Phisic II, University of Seville, P.O. Box 41012 Seville (Spain); National Accelerator Centre, P.O. Box 41092 Seville (Spain)

    2014-07-01

    Since the secret agent Alexander Litvinenko was murdered in 2006 by a {sup 210}Po lethal dose, presumably ingested, there is renovated interest on the toxicity of this radionuclide in humans. {sup 210}Po is a radioactive isotope naturally found in nature, mainly incorporated by humans via food and water ingestion, as well as inhaled through its progenitor, the {sup 222}Rn. The total amount of natural {sup 210}Po in the human body can vary from person to person depending on their lifestyle: dietary habits, drinking water source, place of residence (associated with exposure to {sup 222}Rn), etc- and therefore in the concentrations of this element to be found in urine. To analyze the influence of dietary habits on the amount of {sup 210}Po excreted in urine, two volunteers in Seville had a well-defined and time-varying diet for a month, following a daily collection of their urine and determination of the concentrations therein of this radionuclide. The results obtained and the conclusions derived from them form the core of this communication. {sup 210}Po determinations were performed daily in 200 ml aliquots of urine using the technique of high resolution alpha spectrometry. This has involved the application of a single radiochemical method for the concentration and isolation {sup 210}Po, followed by its auto-deposition on copper planchets for proper measure. Daily {sup 210}Po activity concentrations in voluntary urine analyzed during the month of study show high variability with a difference of up to an order of magnitude between maximum and minimum values obtained, and a clear dependence on the diet type followed in the various stages of the experiment. The lowest concentrations obtained are associated with a diet rich in carbohydrates and proteins 'terrestrial' (pork, beef,...), while the highest concentrations were obtained in the final phase of the experiment when the diet was enriched with presence of marine products in fair correspondence with the

  18. 210Po and 210Pb trophic transfer within the phytoplankton-zooplankton-anchovy/sardine food web: a case study from the Gulf of Lion (NW Mediterranean Sea).

    Science.gov (United States)

    Strady, Emilie; Harmelin-Vivien, Mireille; Chiffoleau, Jean François; Veron, Alain; Tronczynski, Jacek; Radakovitch, Olivier

    2015-05-01

    The transfer of (210)Po and (210)Pb in the food web of small pelagic fishes (from phytoplankton and zooplankton to anchovy Engraulis encrasicolus and sardine Sardina pilchardus) is investigated in the Gulf of Lion (GoL). We present original data of (210)Po and (210)Pb activity concentrations, C and N stable isotope ratios, measured (i) from different size classes of phytoplankton and zooplankton during spring and winter in different environments of the GoL, and (ii) in two fish species. Significant spatial patterns based on (210)Po, (210)Pb activity concentrations and (210)Po/(210)Pb ratios in the different plankton size classes are evidenced by hierarchical clustering, both in spring and winter. This variability, also observed for C and N stable isotopes ratios, is connected to local specific pelagic habitats and hydrodynamics. The sampling strategy suggests that (210)Po bioaccumulation in the GoL remains at a constant level from the first (dominated by phytoplankton) to the second trophic level (zooplankton), while (210)Pb bioaccumulation shows an increase in winter. Based on stable N isotope ratios and (210)Po activity concentrations measured in anchovies and sardines, we evidence (210)Po bio-magnification along the trophic food web of these two planktivorous pelagic fishes. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Exposed proliferation antigen 210 (XPA-210) in renal cell carcinoma (RCC) and oncocytoma: clinical utility and biological implications.

    Science.gov (United States)

    Kruck, Stephan; Hennenlotter, Joerg; Vogel, Ulrich; Schilling, David; Gakis, Georgios; Hevler, Joachim; Kuehs, Ursula; Stenzl, Arnulf; Schwentner, Christian

    2012-02-01

    •  To determine the clinical role of the exposed proliferation antigen 210 (XPA-210) of the proliferation marker thymidine kinase 1 (TK1) in a large cohort of different renal cell carcinoma (RCC) types, oncocytomas and normal renal tissues samples, as TK1 is reported to be of clinical significance in several cancer entities and is suggested as a prognostic serum biomarker for RCC. •  Expressions of XPA-210 were determined immunohistochemically in 40 clear cell RCCs (ccRCC), 25 papillary RCCs (papRCC), 17 chromophobe RCC (chRCC), 27 oncocytomas and 64 normal renal parenchyma paraffin-embedded specimens. •  Immunohistochemistry was performed with a monoclonal anti-XPA-210 antibody. Staining was measured by the percentage of positive cells. •  Expression was compared between subgroups and correlated with respective clinical data using one-way analysis of variance with post hoc Tukey-Kramer analyses. •  XPA-210 staining in the RCC subgroup was significantly different from the oncocytomas (mean [sem] 4.1 [0.4] vs 2.2 [0.4]; P = 0.004) and from normal renal tissue (1.0 [0.1]; P oncocytomas did not differ from normal renal parenchyma staining (P = 0.18). •  Subdivided into RCC groups, only ccRCC (mean [sem] 5.1 [0.6]; P renal parenchyma, whereas chRCC (1.4 [0.3]; P = 0.99) did not. •  RCC XPA-210 staining was significantly associated with higher tumour stage (T = 3, P = 0.002) and grade (G = 3, P = 0.001). •  The malignant character of RCC is reflected by higher XPA-210 expression as compared with oncocytomas and normal kidney. •  The ccRCC and papRCC subgroups had higher XPA-210 levels. •  XPA-210 could be considered a potential marker for the assessment of the proliferative activity in primary RCC. © 2011 THE AUTHORS. BJU INTERNATIONAL © 2011 BJU INTERNATIONAL.

  20. Solid partitioning and solid-liquid distribution of {sup 210}Po and {sup 210}Pb in marine anoxic sediments: roads of Cherbourg at the northwestern France

    Energy Technology Data Exchange (ETDEWEB)

    Connan, O. [Laboratoire de Radioecologie de Cherbourg-Octeville, Institut de Radioprotection et de Surete nucleaire (IRSN), Service d' Etudes et du Comportement des Radionucleides dans l' Environnement (SECRE), rue Max Pol Fouchet, 50130 Cherbourg-Octeville (France)], E-mail: olivier.connan@irsn.fr; Boust, D. [Laboratoire de Radioecologie de Cherbourg-Octeville, Institut de Radioprotection et de Surete nucleaire (IRSN), Service d' Etudes et du Comportement des Radionucleides dans l' Environnement (SECRE), rue Max Pol Fouchet, 50130 Cherbourg-Octeville (France); Billon, G. [Laboratoire de Chimie Analytique et Marine, Universite des sciences et technologies de Lille, 59655 Villeneuve d' Ascq Cedex (France); Solier, L.; Rozet, M.; Bouderbala, S. [Laboratoire de Radioecologie de Cherbourg-Octeville, Institut de Radioprotection et de Surete nucleaire (IRSN), Service d' Etudes et du Comportement des Radionucleides dans l' Environnement (SECRE), rue Max Pol Fouchet, 50130 Cherbourg-Octeville (France)

    2009-10-15

    A sequential extraction protocol has been used to determine the solid-phase partition of {sup 210}Po and {sup 210}Pb in anoxic marine sediment from the roads of Cherbourg (France) in the central English Channel. Measurements were also obtained in pore waters, in which {sup 210}Po activities range between 1 and 20 mBq L{sup -1} and {sup 210}Pb activities between 2.4 and 3.8 mBq L{sup -1}, with highest activities in the topmost layer. These activities are higher than in seawater, suggesting that sediment act as a source of both {sup 210}Po and {sup 210}Pb for overlying water. The {sup 210}Po profile in the pore waters is apparently correlated with those obtained for Fe, Mn and SO{sub 4}{sup 2-}, suggesting an influence of early diagenetic processes on the {sup 210}Po solid-liquid distribution. In the sediment, {sup 210}Po is predominantly bound to organic matter or chromium reducible sulphides, and residuals (clay minerals and refractory oxides). Our results indicate that {sup 210}Po is not significantly bound to AVS, i.e. acid volatile sulphides: bioturbation could play a role by the early redistribution of {sup 210}Po bound to acid volatile sulphides in the sediment. {sup 210}Po, {sup 210}Pb and Pb exhibit differences in terms of distribution, probably due to a different mode of penetration in the sediment. This work provides information on solid and liquid distribution of {sup 210}Po and {sup 210}Pb in marine sediment. These data are very scarce in the litterature.

  1. Concentrations of {sup 210}Po in fish and shellfish from southern region of Japan and evaluation of {sup 210}Po intake from seafood for Japanese people

    Energy Technology Data Exchange (ETDEWEB)

    Momoshima, N.; Sugihara, S. [Kyushu Univ., Fukuoka (Japan). Radioisotope Center; Nakao, H. [Kyushu Univ., Fukuoka (Japan). Graduate School of Sciences

    2012-07-01

    Concentrations of {sup 210}Po in fish and shellfish, mostly collected from southern region of Japan were analyzed. Values ranged from 0.2 to 229 Bq/kg fresh weight and higher concentrations were observed in samples analyzed with viscera. Intake of {sup 210}Po through fish and shellfish was evaluated at different Japanese cities based on statistical consumption data. Phytoplankton, Heterosigma akashiwo was collected during a harmful algal bloom and {sup 210}Po was analyzed. The phytoplankton occupied only 4.4% of {sup 210}Po in seawater and a large fraction of {sup 210}Po was observed in the particulate form. (orig.)

  2. Variations of {sup 210}Po and {sup 210}Pb in various marine organisms from Western English Channel: contribution of {sup 210}Po to the radiation dose

    Energy Technology Data Exchange (ETDEWEB)

    Connan, O. [Institut de Radioprotection et de Surete Nucleaire, Laboratoire de Radioecologie de Cherbourg-Octeville, IRSN/DEI/SECRE/LRC, Rue Max Pol Fouchet, 50130 Cherbourg-Octeville (France)], E-mail: olivier.connan@irsn.fr; Germain, P.; Solier, L.; Gouret, G. [Institut de Radioprotection et de Surete Nucleaire, Laboratoire de Radioecologie de Cherbourg-Octeville, IRSN/DEI/SECRE/LRC, Rue Max Pol Fouchet, 50130 Cherbourg-Octeville (France)

    2007-10-15

    Measurements of {sup 210}Po were carried out in various marine matrices (mussels, oysters, seaweed, fish, and abalones) and in seawater at several points along the French coast, over a period of 2 years (2003-2005). These measurements contribute to a better knowledge of this element, since few recent data exist for the French coast. Marked seasonal variations have been revealed in some species and there are differences according to the way of life of these species. Activities in mussels (Mytilus edulis) and oysters (Crassostrea gigas) are similar and varying between 90 and 600 Bq kg{sup -1} (d.w.). Activities in macroalgae (Fucus serratus) are lowest, between 4 and 16 Bq kg{sup -1} (d.w.). In oyster, abalone (Haliotis tuberculata) and fish (Solea solea, Sparus sp.), the strongest activities are measured in the digestive glands, the gills and the gonads. {sup 210}Po/{sup 210}Pb ratios in all cases have values of more than one for all species. From a significant number of measurements, CFs were calculated for seaweed (between 4.6 x 10{sup 3} and 5.0 x 10{sup 3}) and for molluscs, with highest CFs (>10{sup 5}) found for the digestive gland and gills of the oysters, the digestive gland of the abalones and the liver of fish. Finally, the activities measured have made it possible to estimate the internal dose from chronic exposure due to {sup 210}Po received by the marine organisms (0.05 {mu}G h{sup -1} for macroalgae, between 0.70 and 1.5 {mu}G h{sup -1} for mussels and oyster), and the contribution of seafood to the dose received by humans (46-129 {mu}Sv y{sup -1})

  3. 17 CFR 210.8-03 - Interim financial statements.

    Science.gov (United States)

    2010-04-01

    ... ACT OF 1934, PUBLIC UTILITY HOLDING COMPANY ACT OF 1935, INVESTMENT COMPANY ACT OF 1940, INVESTMENT ADVISERS ACT OF 1940, AND ENERGY POLICY AND CONSERVATION ACT OF 1975 Article 8 Financial Statements of... cumulative financial information from inception. Instruction 1 to § 210.8-03: Where Article 8 is applicable...

  4. 19 CFR 210.55 - Content of service copies.

    Science.gov (United States)

    2010-04-01

    ... Customs Duties UNITED STATES INTERNATIONAL TRADE COMMISSION INVESTIGATIONS OF UNFAIR PRACTICES IN IMPORT TRADE ADJUDICATION AND ENFORCEMENT Temporary Relief § 210.55 Content of service copies. (a) Any... information about each element of the violation alleged in the complaint and the motion to enable each...

  5. Pb-210 in beans grown in normal background environments

    Energy Technology Data Exchange (ETDEWEB)

    Mingote, Raquel M.; Nogueira, Regina A., E-mail: mingote@cnen.gov.br, E-mail: rnogueira@cnen.gov.br [Centro Regional de Ciencias Nucleares do Centro-Oeste (CRCN-CO/CNEN-GO), Abadia de Goias, GO (Brazil)

    2013-07-01

    A survey was carried out on the activity concentration of {sup 210}Pb in common beans (Phaseolus vulgaris L.) grown in normal background environments in Brazil. The Carioca beans and the black type were analyzed, which contribute with 90% of the Brazilian market share of the common beans. To this study 18 bean samples sowing in the Middle-Western and Southern regions of Brazil during the years 2010-2011 were analyzed. The proportion per bean type was similar to the national production: most of the Carioca beans (n=13; 72%) and black beans (n=5; 28%). Other 17 values of {sup 210}Pb activity concentration in beans grown in Southeastern region available in the GEORAD, a dataset of radioactivity in Brazil, were added to the statistic analysis of the data. Considering the information contained in censored observations (60%), representative value of {sup 210}Pb activity concentration in beans was estimated by using robust ROS, a censored data analysis method. The value 0.047 Bq kg{sup -1} fresh wt. obtained here is according to {sup 210}Pb activity concentration in grains reported by UNSCEAR 0.05 Bq kg{sup -1}. (author)

  6. 17 CFR 210.6-05 - Statements of net assets.

    Science.gov (United States)

    2010-04-01

    ... 1934, PUBLIC UTILITY HOLDING COMPANY ACT OF 1935, INVESTMENT COMPANY ACT OF 1940, INVESTMENT ADVISERS ACT OF 1940, AND ENERGY POLICY AND CONSERVATION ACT OF 1975 Registered Investment Companies § 210.6-05... assets are represented by investments in securities of unaffiliated issuers. If presented in such...

  7. 50 CFR 216.210 - Modifications to Letters of Authorization.

    Science.gov (United States)

    2010-10-01

    ... ATMOSPHERIC ADMINISTRATION, DEPARTMENT OF COMMERCE MARINE MAMMALS REGULATIONS GOVERNING THE TAKING AND IMPORTING OF MARINE MAMMALS Taking of Marine Mammals Incidental to Construction and Operation of Offshore Oil and Gas Facilities in the U.S. Beaufort Sea § 216.210 Modifications to Letters of Authorization...

  8. 21 CFR 2.10 - Examination and investigation samples.

    Science.gov (United States)

    2010-04-01

    ... each person named on the label of the article and owner thereof, who has not exercised his right under... GENERAL ADMINISTRATIVE RULINGS AND DECISIONS General Provisions § 2.10 Examination and investigation... shipment or other lot of the article from which such sample was collected was introduced or delivered for...

  9. 17 CFR 210.8-08 - Age of financial statements.

    Science.gov (United States)

    2010-04-01

    ... not yet available, the smaller reporting company reasonably and in good faith expects to report income... ACT OF 1934, PUBLIC UTILITY HOLDING COMPANY ACT OF 1935, INVESTMENT COMPANY ACT OF 1940, INVESTMENT... Smaller Reporting Companies § 210.8-08 Age of financial statements. At the date of filing, financial...

  10. 20 CFR 663.210 - How are intensive services delivered?

    Science.gov (United States)

    2010-04-01

    ... Section 663.210 Employees' Benefits EMPLOYMENT AND TRAINING ADMINISTRATION, DEPARTMENT OF LABOR ADULT AND... delivery system, including specialized One-Stop centers. Intensive services may be provided directly by the..., private for-profit, and private non-profit service providers (including specialized service providers...

  11. 7 CFR 210.17 - Matching Federal funds.

    Science.gov (United States)

    2010-01-01

    ... individual school food authorities. (f) Failure to match. If, in any school year, a State fails to meet the... AGRICULTURE CHILD NUTRITION PROGRAMS NATIONAL SCHOOL LUNCH PROGRAM Requirements for State Agency Participation § 210.17 Matching Federal funds. (a) State revenue matching. For each school year, the amount of State...

  12. 17 CFR 210.6-02 - Definition of certain terms.

    Science.gov (United States)

    2010-04-01

    ... ACT OF 1934, PUBLIC UTILITY HOLDING COMPANY ACT OF 1935, INVESTMENT COMPANY ACT OF 1940, INVESTMENT ADVISERS ACT OF 1940, AND ENERGY POLICY AND CONSERVATION ACT OF 1975 Registered Investment Companies § 210... affiliate means an affiliated person as defined in section 2(a)(3) of the Investment Company Act of 1940...

  13. 36 CFR 2.10 - Camping and food storage.

    Science.gov (United States)

    2010-07-01

    ... 36 Parks, Forests, and Public Property 1 2010-07-01 2010-07-01 false Camping and food storage. 2... RESOURCE PROTECTION, PUBLIC USE AND RECREATION § 2.10 Camping and food storage. (a) The superintendent may... revocation of the permit. (d) Food storage. The superintendent may designate all or a portion of a park area...

  14. 20 CFR 628.210 - State Job Training Coordinating Council.

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false State Job Training Coordinating Council. 628... PROGRAMS UNDER TITLE II OF THE JOB TRAINING PARTNERSHIP ACT State Planning § 628.210 State Job Training Coordinating Council. (a) The Governor shall appoint a State Job Training Coordinating Council (SJTCC) pursuant...

  15. 48 CFR 2152.210-71 - Notice of significant events.

    Science.gov (United States)

    2010-10-01

    ... Standards or other requirements issued by OPM. (b) Upon learning of a significant event, OPM may institute... 48 Federal Acquisition Regulations System 6 2010-10-01 2010-10-01 true Notice of significant... PRECONTRACT PROVISIONS AND CONTRACT CLAUSES Text of Provisions and Clauses 2152.210-71 Notice of significant...

  16. 40 CFR 1065.210 - Work input and output sensors.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 32 2010-07-01 2010-07-01 false Work input and output sensors. 1065... Ambient Conditions § 1065.210 Work input and output sensors. (a) Application. Use instruments as specified... sensors, transducers, and meters that meet the specifications in Table 1 of § 1065.205. Note that your...

  17. 50 CFR 600.210 - Terms of Council members.

    Science.gov (United States)

    2010-10-01

    ... 50 Wildlife and Fisheries 8 2010-10-01 2010-10-01 false Terms of Council members. 600.210 Section... Council members. Link to an amendment published at 75 FR 59151, Sept. 27, 2010. (a) Voting members (other.... A voting member's Council service of 18 months or more during a term of office will be counted as...

  18. 50 CFR 665.210 - Hawaii restricted bottomfish species.

    Science.gov (United States)

    2010-10-01

    ... 50 Wildlife and Fisheries 9 2010-10-01 2010-10-01 false Hawaii restricted bottomfish species. 665... Fisheries § 665.210 Hawaii restricted bottomfish species. Hawaii restricted bottomfish species means the following species: Local name English common name Scientific name lehi silver jaw jobfish Aphareus rutilans...

  19. 17 CFR 210.9-05 - Foreign activities.

    Science.gov (United States)

    2010-04-01

    ..., PUBLIC UTILITY HOLDING COMPANY ACT OF 1935, INVESTMENT COMPANY ACT OF 1940, INVESTMENT ADVISERS ACT OF 1940, AND ENERGY POLICY AND CONSERVATION ACT OF 1975 Bank Holding Companies § 210.9-05 Foreign... assets (net of valuation allowances) associated with foreign activities. (2) For each period for which an...

  20. 17 CFR 210.12-09 - Valuation and qualifying accounts.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Valuation and qualifying... EXCHANGE ACT OF 1934, PUBLIC UTILITY HOLDING COMPANY ACT OF 1935, INVESTMENT COMPANY ACT OF 1940... § 210.12-09 Valuation and qualifying accounts. Column A—Description 1 Column B—Balance at beginning of...

  1. 22 CFR 1203.735-210 - Gambling, betting, and lotteries.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Gambling, betting, and lotteries. 1203.735-210..., betting, and lotteries. An employee shall not participate, while on Government-owned or leased property or..., in conducting a lottery or pool, in a game for money or property, or in selling or purchasing a...

  2. 17 CFR 210.3-01 - Consolidated balance sheets.

    Science.gov (United States)

    2010-04-01

    ... AND CONTENT OF AND REQUIREMENTS FOR FINANCIAL STATEMENTS, SECURITIES ACT OF 1933, SECURITIES EXCHANGE... Statements § 210.3-01 Consolidated balance sheets. (a) There shall be filed, for the registrant and its... registrant's fiscal year and audited financial statements for the most recent fiscal year are not available...

  3. 210Po, 210Pb, 40K and 137Cs in edible wild berries and mushrooms and ingestion doses to man from high consumption rates of these wild foods.

    Science.gov (United States)

    Gwynn, Justin P; Nalbandyan, Anna; Rudolfsen, Geir

    2013-02-01

    This paper discusses activity concentrations of (210)Po, (210)Pb, (40)K and (137)Cs in edible wild berries and mushrooms collected from Øvre Dividalen national park, Northern Norway and derives committed effective ingestion doses to man based on high consumption rates of these wild foods. Edible wild berries and mushrooms accumulated similar levels of (210)Pb, but mushrooms accumulated higher levels of (210)Po and (40)K than berries. There appears to be a clear difference in the ability of Leccinum spp. of fungi to accumulate (210)Po and/or translocate (210)Po to mushrooms compared to Russula spp. of fungi. Activity concentrations of (137)Cs in edible wild berries and mushrooms from Øvre Dividalen national park reflected the lower levels of fallout of this radionuclide in Northern Norway compared to more central areas following the Chernobyl accident. For mushrooms, ingestion doses are dominated by (210)Po, while for berries, (40)K is typically the main contributor to dose. Based on high consumption rates, ingestion doses arising from the combination of (210)Po, (210)Pb and (40)K were up to 0.05 mSv/a for berries and 0.50 mSv/a for mushrooms. Consumption of such wild foods may result in a significant contribution to total annual doses when consumed in large quantities, particularly when selecting mushrooms species that accumulate high activity concentrations of (210)Po. Copyright © 2012 Elsevier Ltd. All rights reserved.

  4. Studies on the distribution of {sup 210}Po and {sup 210}Pb in the ecosystem of Point Calimere Coast (Palk Strait), India

    Energy Technology Data Exchange (ETDEWEB)

    Suriyanarayanan, S. [Environmental Research Lab, P.G. Department of Zoology, Jamal Mohamed College, Tiruchirappalli 620020, Tamil Nadu (India); Department of Environmental Sciences, Bharathiar University, Coimbatore 641046, Tamil Nadu (India); Brahmanandhan, G.M. [Solid State and Radiation Physics Laboratory, Department of Physics, Bharathiar University, Coimbatore 641046, Tamil Nadu (India)], E-mail: brahma_king@yahoo.com; Malathi, J. [Solid State and Radiation Physics Laboratory, Department of Physics, Bharathiar University, Coimbatore 641046, Tamil Nadu (India); Ravi Kumar, S.; Masilamani, V.; Shahul Hameed, P. [Environmental Research Lab, P.G. Department of Zoology, Jamal Mohamed College, Tiruchirappalli 620020, Tamil Nadu (India); Selvasekarapandian, S. [Solid State and Radiation Physics Laboratory, Department of Physics, Bharathiar University, Coimbatore 641046, Tamil Nadu (India)

    2008-04-15

    A systematic study on the natural radionuclides such as {sup 210}Po and {sup 210}Pb in the environmental matrices of Point Calimere ecosystem has been undertaken to establish a baseline data on the radiation profile of Point Calimere environment. The environmental samples such as water, sediment and biota (seaweeds, crustaceans, molluscs and fish) have been subjected to analyses. It has been observed that the concentration of {sup 210}Po and {sup 210}Pb in the water samples of Point Calimere to be 0.5 mBq/l and 1.3 mBq/l, respectively. The soft tissues of the organisms accumulated higher {sup 210}Po content while shells and bones contained more {sup 210}Pb. The bivalve molluscs Meretrix casta have been identified to accumulate higher concentration of {sup 210}Po suggesting that they could serve as bio-indicator of radionuclides like {sup 210}Po in the Point Calimere ecosystem. The concentration factor of {sup 210}Po for the biotic components ranged from {approx}10{sup 3} to 10{sup 6} while for {sup 210}Pb it ranged from {approx}10{sup 3} to 10{sup 5}.

  5. Biomonitoring of Po-210 and Pb-210 using lichens and mosses around a uraniferous coal-fired power plant in western Turkey

    Energy Technology Data Exchange (ETDEWEB)

    Ugur, A.; Ozden, B.; Sac, M.M.; Yener, G. [Ege University, Izmir (Turkey). Inst. of Nuclear Science

    2003-05-01

    Studies were realized over a wide area around the coal-fired power plant (CPP) located at Yatagan , Gokova, Turkey, to evaluate the possible increase of natural radioactivity level due to the operation of the plant. The lichens Rhizoplaca melanophthalma, Cladonia convoluta, Cladonia pyxidata and the mosses Grimmia pulvinata, Hypnum cupressiforme were investigated for potential use as bioindicators for Po-210 and Pb-210 deposition. The maximum Po-210 and Pb-210 activities were observed around the hill close to ash stacks. The capture efficiency was the highest in one of the moss species, G. pulvinata with the activity concentration ranges of 600 {+-} 19 - 1228 {+-} 36 and 446 {+-} 15 - 650 {+-} 21 Bq kg{sup -1} for Po-210 and Pb-210, respectively. Soil samples were also collected and analysed in order to investigate any possible contamination in soil profiles due to CPPs and to determine unsupported Pb-210 flux. The Pb-210 and Ra-226 concentrations in uncultivated soil profiles varied between 58 {+-} 2 and 258 {+-} 6 Bq kg{sup -1}, 50 {+-} 5 and 58 {+-} 5 Bq kg{sup -1}, respectively. The unsupported Pb-210 inventory in the core was calculated to be 3312 Bq m{sup 2}. The corresponding annual Pb-210 flux of 103 Bq m{sup -2} yr{sup -1} is high with compare to estimates of the atmospheric flux given in literature for the same region.

  6. Particle-reactive radionuclides (234Th, 210Pb, 210 as tracers for the estimation of export production in the South China Sea

    Directory of Open Access Journals (Sweden)

    P. H. Santschi

    2011-12-01

    Full Text Available The time-series station, SEATS (18° N, 116° E in the South China Sea was visited six times during October 2006–December 2008 to carry out seawater sampling and floating trap deployments for the determination of distributions and fluxes of POC, PIC, PN, 234Th, 210Pb, and 210Po in the upper 200 m of the water column. Radionuclide deficiencies resulted in removal fluxes from the euphotic layer of 1.1×103–1.8×103 dpm m−2d−1 and 7.1–40.2 dpm m−2d−1 for 234Th and 210Po, respectively. Due to atmospheric input, an excess of 210Pb relative to 226Ra is commonly observed in the upper water column. Sinking fluxes of total mass, POC, PIC, PN, 234Th, 210Pb, and 210Po measured at the euphotic depth were low in summer-fall and high in winter-spring, reflecting the seasonal variability of biological pumping. Excluding the suspiciously low primary productivity data point in July 2007, a relatively high e-ratio of 0.28–0.69 was estimated by the ratio of the POC flux at the euphotic depth and the integrated primary productivity. The ratios of 234Th, 210Pb, and 210Po to organic carbon, inorganic carbon, and nitrogen in the sinking particles were combined with the disequilibria of 234Th–238U, 210Pb–226Ra, and 210Po–210Pb to estimate export fluxes of POC, PIC, and PN from the euphotic layer. Compared with measured fluxes by the sediment trap and estimated fluxes by other approaches, it is concluded that the export production in the South China Sea, ranging from 1.8 to 21.3 mmol-C m−2d−1, can be reasonably estimated using 234Th, 210Pb, and 210Po as carbon proxies.

  7. 46 CFR 183.210 - Protection from wet and corrosive environments.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Protection from wet and corrosive environments. 183.210... (UNDER 100 GROSS TONS) ELECTRICAL INSTALLATION General Requirements § 183.210 Protection from wet and... corrosion-resistant. ...

  8. 40 CFR 1068.210 - What are the provisions for exempting test engines/equipment?

    Science.gov (United States)

    2010-07-01

    ... CONTROL INFORMATION”. (ii) Your corporate name and trademark. (iii) Engine displacement, family... test engines/equipment? 1068.210 Section 1068.210 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR POLLUTION CONTROLS GENERAL COMPLIANCE PROVISIONS FOR ENGINE PROGRAMS Exemptions...

  9. 210Po in Nevada groundwater and its relation to gross alpha radioactivity

    Science.gov (United States)

    Seiler, R.L.

    2011-01-01

    Polonium-210 (210Po) is a highly toxic alpha emitter that is rarely found in groundwater at activities exceeding 1 pCi/L. 210Po activities in 63 domestic and public-supply wells in Lahontan Valley in Churchill County in northern Nevada, United States, ranged from 0.01 ± 0.005 to 178 ± 16 pCi/L with a median activity of 2.88 pCi/L. Wells with high 210Po activities had low dissolved oxygen concentrations (less than 0.1 mg/L) and commonly had pH greater than 9. Lead-210 activities are low and aqueous 210Po is unsupported by 210Pb, indicating that the 210Po is mobilized from aquifer sediments. The only significant contributors to alpha particle activity in Lahontan Valley groundwater are 234/238U, 222Rn, and 210Po. Radon-222 activities were below 1000 pCi/L and were uncorrelated with 210Po activity. The only applicable drinking water standard for 210Po in the United States is the adjusted gross alpha radioactivity (GAR) standard of 15 pCi/L. 210Po was not volatile in a Nevada well, but volatile 210Po has been reported in a Florida well. Additional information on the volatility of 210Po is needed because GAR is an inappropriate method to screen for volatile radionuclides. About 25% of the samples had 210Po activities that exceed the level associated with a lifetime total cancer risk of 1× 10−4 (1.1 pCi/L) without exceeding the GAR standard. In cases where the 72-h GAR exceeds the uranium activity by more than 5 to 10 pCi/L, an analysis to rule out the presence of 210Po may be justified to protect human health even though the maximum contaminant level for adjusted GAR is not exceeded.

  10. 28 CFR 54.210 - Military and merchant marine educational institutions.

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Military and merchant marine educational institutions. 54.210 Section 54.210 Judicial Administration DEPARTMENT OF JUSTICE (CONTINUED) NONDISCRIMINATION... Coverage § 54.210 Military and merchant marine educational institutions. These Title IX regulations do not...

  11. 17 CFR 210.8-06 - Real estate operations acquired or to be acquired.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Real estate operations acquired or to be acquired. 210.8-06 Section 210.8-06 Commodity and Securities Exchanges SECURITIES AND... Statements of Smaller Reporting Companies § 210.8-06 Real estate operations acquired or to be acquired. If...

  12. 17 CFR 210.2-05 - Examination of financial statements by more than one accountant.

    Science.gov (United States)

    2010-04-01

    ... statements by more than one accountant. 210.2-05 Section 210.2-05 Commodity and Securities Exchanges... Qualifications and Reports of Accountants § 210.2-05 Examination of financial statements by more than one accountant. If, with respect to the examination of the financial statements, part of the examination is made...

  13. 17 CFR 210.8-01 - Preliminary Notes to Article 8.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Preliminary Notes to Article 8... ADVISERS ACT OF 1940, AND ENERGY POLICY AND CONSERVATION ACT OF 1975 Article 8 Financial Statements of Smaller Reporting Companies § 210.8-01 Preliminary Notes to Article 8. Sections 210.8-01 to 210.8-08 shall...

  14. 20 CFR 404.210 - Average-indexed-monthly-earnings method.

    Science.gov (United States)

    2010-04-01

    ....210 Section 404.210 Employees' Benefits SOCIAL SECURITY ADMINISTRATION FEDERAL OLD-AGE, SURVIVORS AND DISABILITY INSURANCE (1950- ) Computing Primary Insurance Amounts Average-Indexed-Monthly-Earnings Method of Computing Primary Insurance Amounts § 404.210 Average-indexed-monthly-earnings method. (a) Who is eligible...

  15. 22 CFR 210.105 - Does this part apply to me?

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Does this part apply to me? 210.105 Section 210.105 Foreign Relations AGENCY FOR INTERNATIONAL DEVELOPMENT GOVERNMENTWIDE REQUIREMENTS FOR DRUG-FREE WORKPLACE (FINANCIAL ASSISTANCE) Purpose and Coverage § 210.105 Does this part apply to me? (a) Portions of...

  16. 17 CFR 210.6A-04 - Statements of income and changes in plan equity.

    Science.gov (United States)

    2010-04-01

    ... changes in plan equity. 210.6A-04 Section 210.6A-04 Commodity and Securities Exchanges SECURITIES AND..., Savings and Similar Plans § 210.6A-04 Statements of income and changes in plan equity. Statements of income and changes in plan equity filed under this rule shall comply with the following provisions: 1...

  17. 17 CFR 210.3-14 - Special instructions for real estate operations to be acquired.

    Science.gov (United States)

    2010-04-01

    ... General Instructions As to Financial Statements § 210.3-14 Special instructions for real estate operations... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Special instructions for real estate operations to be acquired. 210.3-14 Section 210.3-14 Commodity and Securities Exchanges SECURITIES...

  18. 17 CFR 210.12-28 - Real estate and accumulated depreciation. 1

    Science.gov (United States)

    2010-04-01

    ... depreciation. 1 210.12-28 Section 210.12-28 Commodity and Securities Exchanges SECURITIES AND EXCHANGE... § 210.12-28 Real estate and accumulated depreciation. 1 Column A—Description 2 Column B—Encumbrances... Land Buildings and improvements Total Column F—Accumulated depreciation Column G—Date of construction...

  19. 9 CFR 354.210 - Minimum standards for sanitation, facilities, and operating procedures in official plants.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Minimum standards for sanitation, facilities, and operating procedures in official plants. 354.210 Section 354.210 Animals and Animal Products... sanitation, facilities, and operating procedures in official plants. The provisions of §§ 354.210 to 354.247...

  20. 40 CFR 92.210 - Amending the application and certificate of conformity.

    Science.gov (United States)

    2010-07-01

    ... certificate of conformity. 92.210 Section 92.210 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Certification Provisions § 92.210 Amending the application and certificate of conformity. (a) The manufacturer... covered by a certificate of conformity. This notification must include a request to amend the application...

  1. 40 CFR 94.210 - Amending the application and certificate of conformity.

    Science.gov (United States)

    2010-07-01

    ... certificate of conformity. 94.210 Section 94.210 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... Certification Provisions § 94.210 Amending the application and certificate of conformity. (a) The manufacturer... for certification are to be made to a product line covered by a certificate of conformity. This...

  2. 27 CFR 24.210 - Classes of wine other than standard wine.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Classes of wine other than standard wine. 24.210 Section 24.210 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS WINE Production of Other Than Standard Wine § 24.210...

  3. 25 CFR 171.210 - Where will BIA provide my irrigation service?

    Science.gov (United States)

    2010-04-01

    ... 25 Indians 1 2010-04-01 2010-04-01 false Where will BIA provide my irrigation service? 171.210 Section 171.210 Indians BUREAU OF INDIAN AFFAIRS, DEPARTMENT OF THE INTERIOR LAND AND WATER IRRIGATION OPERATION AND MAINTENANCE Irrigation Service § 171.210 Where will BIA provide my irrigation service? (a) We...

  4. 33 CFR 155.210 - Discharge removal equipment for vessels less than 400 feet in length.

    Science.gov (United States)

    2010-07-01

    ... vessels less than 400 feet in length. 155.210 Section 155.210 Navigation and Navigable Waters COAST GUARD... REGULATIONS FOR VESSELS Vessel Equipment § 155.210 Discharge removal equipment for vessels less than 400 feet in length. (a) Oil tankers and offshore oil barges with an overall length of less than 400 feet must...

  5. 210Po and 210Pb distribution, dissolved-particulate exchange rates, and particulate export along the North Atlantic US GEOTRACES GA03 section

    Science.gov (United States)

    Rigaud, S.; Stewart, G.; Baskaran, M.; Marsan, D.; Church, T.

    2015-06-01

    Vertical profiles of 210Po and 210Pb in the water column were measured in the dissolved phase (51 μm) particles at seven stations along the US GEOTRACES North Atlantic Zonal Transect (GA03). Mass balance calculations were employed to assess nuclide exchange rates at the dissolved-small particle interface and between small and large particles, and to quantify export with settling large particles. In the surface ocean, 210Po scavenging is linearly correlated with the concentration of particulate organic carbon (POC) in large particles, supporting the role of biogenic particle in 210Po bioaccumulation and export. In stations near the coast, this link is more complex due to the variable source of biogenic material and temporal changes in the surface biogeochemical and physical conditions. At depth, 210Po exhibits significant widespread deficit with respect to 210Pb that could in part be attributed to in situ 210Po scavenging and may be related to surface biological productivity. As previously reported the 210Pb scavenging rates in the surface ocean were higher at ocean margins. At depth, 210Pb scavenging increases with depth and eastward due to the increase of adsorption sites available in the benthic layers and to a regional contribution of benthic 210Pb scavenging and/or particle flux, respectively. The benthic nepheloid layer (BNL) and the Hydrothermal TAG plume distinctly enhance 210Pb scavenging due to increased surface adsorption in association with resuspended or freshly formed particles. In contrast, 210Po is not seen to be significantly scavenged in these environments due to its relatively short half-life and the long residence time of particles.

  6. Biomonitoring of {sup 210}Po and {sup 210}Pb using lichens and mosses around coal-fired power plants in Western Turkey

    Energy Technology Data Exchange (ETDEWEB)

    Sert, Emel, E-mail: emel.sert@mail.ege.edu.tr [Ege University, Institute of Nuclear Sciences, 35100 Bornova, Izmir (Turkey); Ugur, Aysun, E-mail: aysun.ugur@ege.edu.tr [Ege University, Institute of Nuclear Sciences, 35100 Bornova, Izmir (Turkey); Ozden, Banu, E-mail: banu.ozden@ege.edu.tr [Ege University, Institute of Nuclear Sciences, 35100 Bornova, Izmir (Turkey); Sac, Mueslim Murat, E-mail: muslum.murat.sac@ege.edu.tr [Ege University, Institute of Nuclear Sciences, 35100 Bornova, Izmir (Turkey); Camgoez, Berkay, E-mail: berkay.camgoz@ege.edu.tr [Ege University, Institute of Nuclear Sciences, 35100 Bornova, Izmir (Turkey)

    2011-06-15

    Mosses and lichens are useful biological indicators of environmental contamination for a variety of metals and radionuclides of both natural and artificial origin. These plants lack a well-developed root system and rely largely on atmospheric deposition for nourishment. Therefore in the study, different lichens (Cladonia convoluta, Cladonia foliacea) and mosses (Homalothecium sericeum, Hypnum lacunosum, Hypnum cupressiforme, Tortella tortuosa, Didymodon acutus, Syntrichia ruralis, Syntrichia intermedia, Pterogonium graciale, Isothecium alopecuroides, Pleurochatae squarrosa) were collected around the Yatagan (Mugla), Soma (Manisa), Seyitoemer - Tuncbilek (Kuetahya) coal-fired power plants and investigated for potential use as biomonitors for {sup 210}Po and {sup 210}Pb deposition. While the activity concentrations of {sup 210}Po and {sup 210}Pb in lichens are in the ranges of 151 {+-} 7-593 {+-} 21 and 97 {+-} 5-364 {+-} 13 Bq kg{sup -1}, for mosses the ranges for {sup 210}Po and {sup 210}Pb are 124 {+-} 5-1125 {+-} 38 and 113 {+-} 4-490 {+-} 17 Bq kg{sup -1}, respectively. In the study, the moss samples were observed to accumulate more {sup 210}Po and {sup 210}Pb compared to lichens. While the most suitable biomonitor was a moss species (H. lacunosum) for Yatagan (Mugla), it was another moss species (S. intermedia) for Soma (Manisa) and Seyitoemer - Tuncbilek (Kuetahya) sites. {sup 210}Po concentrations were found higher than {sup 210}Pb concentrations at the all sampling stations. - Highlights: > Lichens and mosses have been used as biomonitors of 210Po and 210Pb deposition. > The morphology of lichens and mosses does not vary with seasons. > Lichens and mosses retain and accumulate pollutants deposited from the atmosphere. > Canopy is an important factor causing differences in the concentrations of radionuclides.

  7. A record of atmospheric 210Pb accumulation in the industrial city

    CERN Document Server

    Buraeva, E A; Stasov, V V; Zorina, L V; Shramenko, B I

    2013-01-01

    The deposition flux of total atmospheric 210Pb in the industrial city Rostov-on-Don, Russia from 2002 to 2010 has been measured. The variations in annual 210Pb deposition flux appear to be mainly correlated with the number of rains and significant amount of anthropogenic 210Pb, polluted into the surface layer of air in the home-heating period. The average 210Pb deposition is 1.75 mBq/m3. Several meteorological parameters which are strongly associated with the fluctuations of concentrations of 210Pb are identified. These results are useful to provide typical information on the atmosphere radioactivity in an industrial city.

  8. 210Po concentration analysis on tobacco and cigarettes in Malaysia

    Science.gov (United States)

    Azman, Muhammad Azfar; Rahman, Irman Abdul; Yasir, Muhammad Samudi

    2013-05-01

    Tobacco or better known as the cigarette was smoked since ages. Although many efforts had been made by the Ministry of Health to prevent or reduce the cigarette problem, the smokers still consider that cigarette are not harmful to health. This work is conducted to study the concentration of radionuclides alpha in tobacco and tobacco products in Malaysia. The radionuclide sought in this study is 210Po which is an alpha emitter. The sample used are tobacco and cigarettes, the tobacco samples were taken from tobacco farms in Malaysia while the sample branded cigarettes Marlboro and Gudang Garam were bought in the supermarket. The objectives of this study are to determine the concentration of radionuclides 210Po in tobacco and tobacco products as well as to estimate the radioactivity doses contributing to the smokers in Malaysia. The results for Marlboro cigarettes and Gudang Garam were found to be on the average radionuclide concentration of 210Po is 13.3 mBq/g (Marlboro cigarettes) and 11.9 mBq/g (Gudang Garam). From the total concentration of the cigarette, the estimated annual contribution dose to smokers for every 20 cigarettes smoked per day are 111.9 ± 14.7 μSv/year for Marlboro cigarettes and 100.2 ± 3.3 μSv/year for Gudang Garam cigarettes. The average concentration of radionuclides for tobacco leaf tobacco for each area taken is 3.6 mBq / g for Bachok, 2.4 mBq / g for Tumpat and 3.1 mBq / g for Semerak district.

  9. Polonium-210 and lead-210 in the Southern Polar Ocean: Naturally occurring tracers of biological and hydrographical processes in the surface waters of the Antarctic Circumpolar Current and the Weddell Sea; Polonium-210 und Blei-210 im Suedpolarmeer: Natuerliche Tracer fuer biologische und hydrographische Prozesse im Oberflaechenwasser des Antarktischen Zirkumpolarstroms und des Weddellmeeres

    Energy Technology Data Exchange (ETDEWEB)

    Friedrich, J.

    1997-11-01

    In this thesis the distribution of {sup 210}Po and {sup 210}Pb in the upper 600 m of the Antarctic Circumpolar Current and the Weddell Sea was investigated along north-south transects in austral spring and autumn. {sup 210}Po and {sup 210}Pb can serve as sensitive tracers for the special hydrographic conditions of the Antarctic Circumpolar Current and the Weddell Sea as well as for biological processes during phytoplankton blooms. The {sup 210}Po/{sup 210}Pb disequilibrium was used as a tracer for particle export. This tracer integrates export on a timescale of 276 days because of the 138 day half-life of {sup 210}Po and complements the {sup 234}Th/{sup 238}U disequilibrium as another tracer for plankton production and export on a shorter timescale of several weeks. (orig.) [Deutsch] In der vorliegenden Arbeit wurde die Verteilung von Blei-210 und seinem Enkelnuklid Polonium-210 im Antarktischen Zirkumpolarstrom und im Weddellmeer bis 600 m Tiefe in mehreren meridionalen Transekten im australen Fruehjahr und Herbst waehrend der `Polarstern`-Expeditionen ANT-X/6 und ANT-XI/4 untersucht. Die Verteilung von {sup 210}Pb und {sup 210}Po wird von mehreren Faktoren beeinflusst, sowohl durch die Advektion von Wassermassen im Antarktischen Zirkumpolarstrom und im Weddellmeer als auch von biologischen Prozessen z.B. innerhalb einer Planktonbluete. Bevor die Verteilungsmuster von {sup 210}Pb und {sup 210}Po jedoch als Tracer fuer einen Prozess genutzt werden koennen, muss der Effekt der einzelnen Faktoren auf die Verteilung betrachtet werden. (orig.)

  10. Distribution of some chemical elements between dissolved and particulate phases in the ocean. Research period: August 1, 1975--July 31, 1976. [Fallout /sup 210/Po and /sup 210/Pb diffusion in oceans

    Energy Technology Data Exchange (ETDEWEB)

    1976-01-01

    Progress is reported on studies on the distributions of fallout /sup 210/Pb and /sup 210/Po in dissolved and particulate states in the Gulf of Maine and a transect of the equatorial North Atlantic Ocean. The ratio of /sup 210/Pb//sup 226/Ra and /sup 210/Po//sup 210/Pb in seawater and suspended particulate matter in samples collected from 10 stations in the tropical and eastern North Atlantic and two stations in the Pacific was also determined. (CH)

  11. Particle-reactive radionuclides ({sup 234}Th, {sup 210}Pb, {sup 210}Po) as tracers for the estimation of export production in the South China Sea

    Energy Technology Data Exchange (ETDEWEB)

    Wei, C.L.; Lin, S.Y.; Yi, M.C.; Wen, L.S. [National Taiwan Univ., Taipei (China). Inst. of Oceanography; Sheu, D.D.D. [National Sun Yat-sen Univ., Kaohsiung, Taiwan (China). Inst. of Marine Geology and Chemistry; Chou, W.C. [National Taiwan Ocean Univ., Keelung (China). Inst. of Marine Environmental Chemistry and Ecology; Santschi, P.H. [Texas A and M Univ., Galveston, TX (United States). Dept. of Oceanography and Marine Sciences

    2011-07-01

    The time-series station, SEATS (18 N, 116 E) in the South China Sea was visited six times during October 2006-December 2008 to carry out seawater sampling and floating trap deployments for the determination of distributions and fluxes of POC, PIC, PN, {sup 234}Th, {sup 210}Pb, and {sup 210}Po in the upper 200 m of the water column. Radionuclide deficiencies resulted in removal fluxes from the euphotic layer of 1.1 x 10{sup 3}-1.8 x 10{sup 3} dpm m{sup -2}d{sup -1} and 7.1-40.2 dpm m{sup -2}d{sup -1} for {sup 234}Th and {sup 210}Po, respectively. Due to atmospheric input, an excess of {sup 210}Pb relative to {sup 226}Ra is commonly observed in the upper water column. Sinking fluxes of total mass, POC, PIC, PN, {sup 234}Th, {sup 210}Pb, and {sup 210}Po measured at the euphotic depth were low in summer-fall and high in winter-spring, reflecting the seasonal variability of biological pumping. Excluding the suspiciously low primary productivity data point in July 2007, a relatively high e-ratio of 0.28-0.69 was estimated by the ratio of the POC flux at the euphotic depth and the integrated primary productivity. The ratios of {sup 234}Th, {sup 210}Pb, and {sup 210}Po to organic carbon, inorganic carbon, and nitrogen in the sinking particles were combined with the disequilibria of {sup 234}Th-{sup 238}U, {sup 210}Pb-{sup 226}Ra, and {sup 210}Po-{sup 210}Pb to estimate export fluxes of POC, PIC, and PN from the euphotic layer. Compared with measured fluxes by the sediment trap and estimated fluxes by other approaches, it is concluded that the export production in the South China Sea, ranging from 1.8 to 21.3 mmol-C m{sup -2}d{sup -1}, can be reasonably estimated using {sup 234}Th, {sup 210}Pb, and {sup 210}Po as carbon proxies.

  12. Transfer of {sup 40}K, {sup 238}U, {sup 210}Pb, and {sup 210}Po from soil to plant in various locations in south of Syria

    Energy Technology Data Exchange (ETDEWEB)

    Al-Masri, M.S. [Atomic Energy Commission of Syria, Damascus, P.O. Box 6091 (Syrian Arab Republic)], E-mail: scientific1@aec.org.sy; Al-Akel, B.; Nashawani, A.; Amin, Y.; Khalifa, K.H.; Al-Ain, F. [Atomic Energy Commission of Syria, Damascus, P.O. Box 6091 (Syrian Arab Republic)

    2008-02-15

    Transfer factors of {sup 40}K, {sup 238}U, {sup 210}Pb, and {sup 210}Po from soil to some agriculture crops in various locations in south of Syria (Dara'a and Assuwaydaa districts) have been determined. Soil and vegetable crops (green pepper, cucumber, tomato, and eggplant), legumes crops (lentil, chickpea, and broad bean), fruit trees (apple, grape, and olives) and cereals (barley and wheat) were collected and analyzed for {sup 238}U, {sup 210}Pb, and {sup 210}Po. The results have shown that higher transfer factors (calculated as Bq kg{sup -1} dry wt. plant material per Bq kg{sup -1} dry wt. soil) for {sup 210}Po, {sup 210}Pb and {sup 238}U were observed in vegetable leaves than fruits and cereals leaves; the highest values of transfer factor (TF) for {sup 238}U were found to be 0.1 for straw of chickpea. Transfer factors for {sup 210}Po varied between 2.8 x 10{sup -2} and 2 in fruits of eggplant and grain of barley, respectively. In addition, several parameters affecting transfer factors of the radionuclides were evaluated. The results can be considered as base values for TF of natural radionuclides in the region.

  13. Administration of microRNA-210 promotes spinal cord regeneration in mice.

    Science.gov (United States)

    Ujigo, Satoshi; Kamei, Naosuke; Hadoush, Hikmat; Fujioka, Yuki; Miyaki, Shigeru; Nakasa, Tomoyuki; Tanaka, Nobuhiro; Nakanishi, Kazuyoshi; Eguchi, Akiko; Sunagawa, Toru; Ochi, Mitsuo

    2014-06-15

    Experimental animal study of treatment of spinal cord injury (SCI). To investigate the therapeutic effects of administering microRNA-210 (miR-210) to promote angiogenesis in a mouse SCI model. Despite many previous studies regarding SCI, there is no established treatment in clinical practice. miRNAs have attracted immense attention because of their crucial role in human disease, and they have been proposed as potential new therapeutic targets for SCI. At specific times after administration, mice were analyzed by several methods to examine the distribution of miR-210, histological angiogenesis and neurogenesis, functional recovery from SCI, and the expression levels of target genes of miR-210. After injection of miR-210 into the lesion of the injured spinal cord, expression of endogenous miR-210 increased until 6 days after injection. The administration of miR-210 promoted angiogenesis and astrogliosis, and improved functional recovery after SCI compared with the noninjected controls. Furthermore, the area made up of axons and myelin in the spinal cord tissues caudal to the injury site was larger in mice injected with miR-210 than those of the controls. Apoptotic cell death was lower in mice administered miR-210. After administration of miR-210, the expressions of protein-tyrosine phosphate 1B and ephrin-A3, both gene targets of miR-210, were downregulated at the protein level and protein-tyrosine phosphate 1B expression was also downregulated at the transcriptional level. MiR-210 might contribute to spinal cord repair by promoting angiogenesis via the inhibition of protein-tyrosine phosphate 1B and ephrin-A3. N/A.

  14. Analysis of {sup 210}Pb in water samples with plastic scintillation resins

    Energy Technology Data Exchange (ETDEWEB)

    Lluch, E.; Barrera, J. [Department of Analytical Chemistry, University of Barcelona, Martí i Franqués, 1-11, E-08028, Barcelona (Spain); Tarancón, A., E-mail: alex.tarancon@ub.edu [Department of Analytical Chemistry, University of Barcelona, Martí i Franqués, 1-11, E-08028, Barcelona (Spain); Bagán, H. [Department of Pure and Applied Biochemistry, Lund University, Getingevägen 60, Hus II, 22100 SE, Lund (Sweden); García, J.F. [Department of Analytical Chemistry, University of Barcelona, Martí i Franqués, 1-11, E-08028, Barcelona (Spain)

    2016-10-12

    {sup 210}Pb is a radioactive lead isotope present in the environment as member of the {sup 238}U decay chain. Since it is a relatively long-lived radionuclide (T{sub 1/2} = 22.2 years), its analysis is of interest in radiation protection and the geochronology of sediments and artwork. Here, we present a method for analysing {sup 210}Pb using plastic scintillation resins (PSresins) packaged in solid-phase extraction columns (SPE cartridge). The advantages of this method are its selectivity, the low limit of detection, as well as reductions in the amount of time and reagents required for analysis and the quantity of waste generated. The PSresins used in this study were composed of a selective extractant (4′,4″(5″)-Di-tert-butyldicyclohexano-18-crown-6 in 1-octanol) covering the surface of plastic scintillation microspheres. Once the amount of extractant (1:1/4) and medium of separation (2 M HNO{sub 3}) were optimised, PSresins in SPE cartridges were calibrated with a standard solution of {sup 210}Pb. {sup 210}Pb could be fully separated from its daughters, {sup 210}Bi and {sup 210}Po, with a recovery value of 91(3)% and detection efficiency of 44(3)%. Three spiked water samples (one underground and two river water samples) were analysed in triplicates with deviations lower than 10%, demonstrating the validity of the PS resin method for {sup 210}Pb analysis. - Highlights: • A plastic scintillation resin for selective analysis of {sup 210}Pb has been developed. • A commercial SPE cartridge has been use for separation and scintillation counting. • {sup 210}Pb separation from {sup 210}Bi and {sup 210}Po is achieved with a 91(3)% of recovery. • The method is valid for analysis of {sup 210}Pb in river water samples.

  15. Partitioning and Fractionation of 210Pb, 210Po and 7Be During Their Interactions With Inorganic and Organic Nanoparticles in Seawater

    Science.gov (United States)

    Guo, L.; Yang, W.; Chuang, C.; Santschi, P. H.; Schumann, D.; Ayranov, M.

    2012-12-01

    Controlled laboratory experiments were carried out to examine the role of natural organic matter in regulating the partitioning and fractionation of particle-reactive radionuclides 210Pb(II), 210Po(-II, II, IV) and 7Be(II) during their interactions with colloidal or nanoparticles in seawater. Selected nanoparticles with similar sizes (20 nm), including SiO2, CaCO3, Al2O3, TiO2, and Fe2O3, and macromolecular organic matter including humic acids (HA), acid polysaccharides (APS, carrageenan type V), proteins (bovine serum albumin, BSA), and extracellular polymeric substances (EPS) were used to examine the partition coefficients (Kd) of 210Pb, 210Po and 7Be between dissolved and colloidal phases in the treatment, with 1-2 orders of magnitude difference in Kd values following the order of Po > Pb > Be. For inorganic nanoparticles, SiO2 and CaCO3 had lower affinity for both 210Po and 210Pb, while TiO2 or Fe2O3 had the highest affinity for 210Pb with an overall high Kd value. Fe2O3 also had the highest affinity for 7Be with a Kd value 400 times higher than that of CaCO3. In binary systems with both inorganic and organic nanoparticles, except for Fe2O3, the Kd values for 210Pb, 210Po and 7Be all increased by varying degrees compared to pure inorganic sorbents, implying that the interactions between organic and inorganic particles in most cases promote stronger sorption of these nuclides on nanoparticles. In contrast, experimental treatments with Fe2O3 and model organic compounds decreased the Kd values for 210Pb and 7Be, suggesting the coating of organic matter on high affinity sorbents would depress the sorption of trace elements on nanoparticle surfaces. These results highlight the importance of chemical composition and functionalities in the scavenging and fractionation of 210Pb, 210Po and 7Be in marine environments.

  16. Geochemistry of /sup 210/Pb in the southeastern, US estuarine system

    Energy Technology Data Exchange (ETDEWEB)

    Storti, F.W.

    1980-11-01

    This study was an attempt to determine the geochemical behavior of /sup 210/Pb in southeastern salt marsh estuaries. As a part of this study the /sup 210/Pb dating technique was applied to natural and anthropogenic deposits of the region. /sup 210/Pb activity of sediment and water from the Georgia coastal area was measured by alpha spectroscopy. The effects of grain size and carbon content of the sediment on /sup 210/Pb concentrations was evaluated and the activity of /sup 210/Pb in dissolved and particulate phases of rivers was measured as a function of salinity. Ages and sedimentation rates of sedimentary deposits were also determined for some deposits. /sup 210/Pb activity in dissolved and particulate phases of rivers showed no clear trends as functions of salinity. River particulate activities were three to four times higher than dissolved activities. The relationship between /sup 210/Pb activity in salt marsh sediments and grain size was highly significant. Direct application of the /sup 210/Pb method to date and determine sedimentation rates of natural and anthropogenic deposits was partially successful. The anthropogenic deposits, however, had to be dated on the basis of normalizing /sup 210/Pb activities to grain size (% silt and clay) and carbon content (% carbon).

  17. Annual effective dose of {sup 210}Po from sea food origin (Oysters and Mussels) in Korea

    Energy Technology Data Exchange (ETDEWEB)

    Cho, Bo Eum; Hong, Gi Hoon; Kim, Suk Hyun; Lee, Hyun Mi [Korea Institute of Ocean Science and Technology, Ansan (Korea, Republic of)

    2016-09-15

    Ingestion of {sup 210}Po laden seafood accounts for a substantial amount of the effective dose of {sup 210}Po. Among seafood items, mollusks, especially domestically produced oysters and mussels, are highly enriched in {sup 210}Po and are consumed in large quantities in Korea. Oysters and mussels around the Korean coasts were collected from major farm areas in November 2013. Samples were spiked with an aliquot of {sup 210}Po as a yield tracer, and they were digested with 6 mol·L{sup -1} HNO{sub 3} and H{sub 2}O{sub 2}. The {sup 210}Po and {sup 209}Po were spontaneously deposited onto a silver disc in an acidic solution of 0.5 mol·L{sup -1} HCl and measured using an alpha spectrometer. The activity concentrations of {sup 210}Pb and {sup 210}Po were decay corrected to the sampling date, accounting for the possible in-growth and decay of {sup 210}Po. {sup 210}Po activity concentrations in oysters were in a range from 41.3 to 206 Bq·(kg-ww{sup -1} and mussels in a range from 42.9 to 46.7 Bq·(kg-ww){sup -1}. The {sup 210}Po activity concentration of oysters in the turbid Western coast was higher than the Southern coast. The {sup 210}Po activity concentration of the oysters was positively correlated (R2=0.89) with those of the suspended particulate matter in the surface water. The calculated annual effective dose of {sup 210}Po from oysters and mussels consumed by the Korean population was 21-104 and 5.01-5.46 μSv·y{sup -1}. The combined effective dose due to the consumption of oysters and mussels appears to account for about 35±19% of that arising from seafood consumption in the Korean population. The annual effective dose of {sup 210}Po for oysters in the Korean population was found to be higher than other countries. The total annual effective dose of 210Po{sup 210}Po due to consumption of oysters and mussels consumed in Korea was found to be 76±42 μSv·y{sup -1}, accounting for 28±16% of the total effective dose of {sup 210}Po from food in Korea.

  18. Behavior of Po-210 in molten Pb-17Li

    Energy Technology Data Exchange (ETDEWEB)

    Feuerstein, H.; Oschinski, J.; Horn, S. (Kernforschungszentrum Karlsruhe GmbH (Germany). Hauptabt. Ingenieurtechnik)

    1992-09-01

    The behavior of Po-210 in molten Pb-17Li was investigated in evaporation experiments. It was found that polonium evaporates in form of an intermetallic compound PbPo. Because of the low vapor pressure of this polonide, evaporation rates are small. The activity coefficient for Po in Pb-17Li is given by 1n [gamma] = -4.77-(1329/T). Under conditions of a fusion reactor blanket with helium as cover gas, the evaporating fraction will be 10[sup 6] times smaller than that estimated assuming ideal solution and vacuum. In agreement with observations at a Bi-inpile loop, only a very small fraction of the total polonium will be found in cover gas spaces. (orig.).

  19. CPLOAS_2 V2.10 verification report.

    Energy Technology Data Exchange (ETDEWEB)

    Groth, Katrina M. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2014-07-01

    A series of test cases designed to verify the correct implementation of several features of the CPLOAS_2 program are documented. CPLOAS_2 is used to calculate the probability of loss of assured safety (PLOAS) for a weak link (WL)/strong link (SL) system. CPLOAS_2 takes physical properties (e.g., temperature, pressure, etc.) of a WL/SL system and uses these properties and definitions of link failure properties in probabilistic calculations to determine PLOAS. The features being tested include (i) six aleatory distribution forms, (ii) five numerical procedures for the determination of PLOAS (i.e., one quadrature procedure, two simple random sampling procedures, and two importance sampling procedures), and (iii) time and environmental margin calculations. All tests were performed with CPLOAS_2 version 2.10.

  20. MD210 Note: Creation of Hollow Bunches in the PSB

    CERN Document Server

    Oeftiger, Adrian; Findlay, Alan James; Hancock, Steven; Rumolo, Giovanni; CERN. Geneva. ATS Department

    2016-01-01

    MD210 aims for the creation of longitudinally hollow bunches in the CERN PS Booster. The first three sessions have been carried out using the radial loop feedback system in order to drive the beam on a dipolar parametric resonance (instead of the phase loop). It has been found that the damping by the phase loop inhibits the excitation of the resonance to a major extent. The hollow distributions generated under these circumstances fail to reach a satisfying bunching factor. Nonetheless, proving the principally successful application of this technique to the PS Booster promises good results once the phase loop system supports trim functions. The approach, actions and detailed results of the first three MD sessions are presented in this paper.

  1. Baseline concentration of {sup 210}Po in Sargassum from the Northern Gulf

    Energy Technology Data Exchange (ETDEWEB)

    Uddin, S.; Bebhehani, M.; Talebi, L. [Kuwait Institute for Scientific Research (Kuwait)

    2014-07-01

    The concentration of the {sup 210}Po is of enormous interest because of its large contribution to the natural radiation dose received by marine organisms and human populations consuming seafood. In fact natural {sup 210}Po is responsible for higher radiation doses to humans consuming marine products than is plutonium and other man-made radionuclides. Many marine organisms are capable of concentrating {sup 210}Po in their tissues. {sup 210}Po is an alpha emitter in the {sup 238}U series, with 138-d half-life, that is supplied to seawater from atmospheric inputs and river runoff, however, the main source of {sup 210}Po in the environment is {sup 222}Rn exhalation from the ground. Assessing the impact of radionuclides in the environment requires the establishment of baseline levels in the environmental compartments. The objective of this study was to establish baseline levels in Sargassum. Two most common species of Sargassum found in the northern Gulf were analysed for {sup 210}Po. These macro-algae were collected from three different locations during January 2013. This study sets the baseline for {sup 210}Po concentration in northern Gulf, {sup 210}Po is absorbed from water and concentrated by Phytoplankton and macro-algae. This concentrated {sup 210}Po can then be passed along to the next trophic level of the marine food web. The {sup 210}Po concentration measured in Sargassum boveanum (4.405 - 4.952 BqKg{sup -1}) was significantly higher (p>0.084) than Sargassum oligocystum (3.838 - 4.358 BqKg{sup -1}). The {sup 210}Po concentration in these seaweeds from the Arabian/Persian Gulf were substantially lower than those found in various Phytoplankton and macro-algae species from other regions; this may be due to the lower background {sup 210}Po concentration in the Kuwait marine waters (0.282 - 0.382 mBq l{sup -1}). The {sup 210}Po concentrations in seawater measured at the 3 stations during January 2013 were less than those reported previously from the same region

  2. Polonium-210 and lead-210 in food and tobacco products: a review of parameters and an estimate of potential exposure and dose

    Energy Technology Data Exchange (ETDEWEB)

    Watson, A.P.

    1983-07-01

    Food-chain transport of Pb-210 and Po-210 from soil to edible plant parts and from animal feed to meat and milk were evaluated from a review of literature. The degree of transfer was characterized by estimating concentration factors (unweighted arithmetic means) as well as the transfer coefficients B/sub v/, B/sub r/ (unweighted geometric means, f/sub m/ and f/sub f/ (unweighted arithmetic means). Global dietary intake of Pb-210 and Po-210 was also summarized, and 50-year dose estimates to target organs calculated. The greatest estimated ingestion doses were those to populations with large dietary complements of animal protein in the form of seafood (Japan) or caribou/reindeer muscle and organ meats (Arctic Eskimos and Lapps). The magnitude of this latter source illustrates the importance of simple food chains in generating significant exposures to populations dependent upon them. The origin and magnitude of inhalation exposure and dose from tobacco products was also assessed. For the majority of internal organs evaluated, the dose resulting from smoking commercially available tobacco products is comparable to or greater than the dose estimates for ingestion of naturally occurring dietary Pb-210 and Po-210.

  3. 17 CFR 210.6-03 - Special rules of general application to registered investment companies.

    Science.gov (United States)

    2010-04-01

    ... application to registered investment companies. 210.6-03 Section 210.6-03 Commodity and Securities Exchanges... ACT OF 1933, SECURITIES EXCHANGE ACT OF 1934, PUBLIC UTILITY HOLDING COMPANY ACT OF 1935, INVESTMENT COMPANY ACT OF 1940, INVESTMENT ADVISERS ACT OF 1940, AND ENERGY POLICY AND CONSERVATION ACT OF 1975...

  4. 9 CFR 205.210 - Effect of EFS outside State in which filed.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Effect of EFS outside State in which filed. 205.210 Section 205.210 Animals and Animal Products GRAIN INSPECTION, PACKERS AND STOCKYARDS... system subject to the security interest in that product whether or not they know about it, even if they...

  5. 30 CFR 210.353 - Monthly report of sales and royalty.

    Science.gov (United States)

    2010-07-01

    ... MANAGEMENT FORMS AND REPORTS Geothermal Resources § 210.353 Monthly report of sales and royalty. A completed... sold or utilized, together with the royalties due the United States. ... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Monthly report of sales and royalty. 210.353...

  6. 13 CFR 120.210 - What percentage of a loan may SBA guarantee?

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false What percentage of a loan may SBA guarantee? 120.210 Section 120.210 Business Credit and Assistance SMALL BUSINESS ADMINISTRATION BUSINESS... percent, except as otherwise authorized by law. ...

  7. 31 CFR 538.210 - Prohibited transactions relating to petroleum and petrochemical industries.

    Science.gov (United States)

    2010-07-01

    ... petroleum and petrochemical industries. 538.210 Section 538.210 Money and Finance: Treasury Regulations... relating to the petroleum or petrochemical industries in Sudan, including, but not limited to, oilfield... relating to the petroleum or petrochemical industries in Sudan is prohibited. ...

  8. Root uptake of lead by Norway spruce grown on Pb-210 spiked soils

    DEFF Research Database (Denmark)

    Hovmand, M.F.; Nielsen, Sven Poul; Johnsen, I.

    2009-01-01

    The root uptake of lead (Pb) by trees and the transfer of Pb by leaf litter deposition to the forest floor were investigated through a pot experiment with Norway spruce. Natural Pb and radio isotopic lead (210Pb) were determined in needles and twigs and in the pot soil spiked with 210Pb...

  9. 23 CFR 973.210 - Indian lands bridge management system (BMS).

    Science.gov (United States)

    2010-04-01

    ... 23 Highways 1 2010-04-01 2010-04-01 false Indian lands bridge management system (BMS). 973.210... HIGHWAYS MANAGEMENT SYSTEMS PERTAINING TO THE BUREAU OF INDIAN AFFAIRS AND THE INDIAN RESERVATION ROADS PROGRAM Bureau of Indian Affairs Management Systems § 973.210 Indian lands bridge management system (BMS...

  10. 17 CFR 210.2-03 - Examination of financial statements by foreign government auditors.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Examination of financial statements by foreign government auditors. 210.2-03 Section 210.2-03 Commodity and Securities Exchanges... auditors. Notwithstanding any requirements as to examination by independent accountants, the financial...

  11. 40 CFR 158.210 - Experimental use permit data requirements for product chemistry.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Experimental use permit data requirements for product chemistry. 158.210 Section 158.210 Protection of Environment ENVIRONMENTAL PROTECTION... Experimental use permit data requirements for product chemistry. All product chemistry data, as described in...

  12. 31 CFR 20.210 - To whom must I distribute my drug-free workplace statement?

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 1 2010-07-01 2010-07-01 false To whom must I distribute my drug-free workplace statement? 20.210 Section 20.210 Money and Finance: Treasury Office of the Secretary of the Treasury GOVERNMENTWIDE REQUIREMENTS FOR DRUG-FREE WORKPLACE (FINANCIAL ASSISTANCE) Requirements...

  13. 46 CFR 120.210 - Protection from wet and corrosive environments.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Protection from wet and corrosive environments. 120.210... INSTALLATION General Requirements § 120.210 Protection from wet and corrosive environments. (a) Electrical... environments must be of suitable construction and corrosion-resistant. ...

  14. 46 CFR 129.210 - Protection from wet and corrosive environments.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Protection from wet and corrosive environments. 129.210... ELECTRICAL INSTALLATIONS General Requirements § 129.210 Protection from wet and corrosive environments. (a... exposed to corrosive environments must be of suitable construction and must be resistant to corrosion. ...

  15. 23 CFR 970.210 - Federal lands bridge management system (BMS).

    Science.gov (United States)

    2010-04-01

    ... Section 970.210 Highways FEDERAL HIGHWAY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION FEDERAL LANDS HIGHWAYS NATIONAL PARK SERVICE MANAGEMENT SYSTEMS National Park Service Management Systems § 970.210... needs using, as a minimum, the following components: (1) A database and an ongoing program for the...

  16. 23 CFR 971.210 - Federal lands bridge management system (BMS).

    Science.gov (United States)

    2010-04-01

    ... Section 971.210 Highways FEDERAL HIGHWAY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION FEDERAL LANDS HIGHWAYS FOREST SERVICE MANAGEMENT SYSTEMS Forest Highway Program Management Systems § 971.210 Federal... components, as a minimum, as a basic framework for a BMS: (1) A database and an ongoing program for the...

  17. 19 CFR 210.33 - Failure to make or cooperate in discovery; sanctions.

    Science.gov (United States)

    2010-04-01

    ...; sanctions. 210.33 Section 210.33 Customs Duties UNITED STATES INTERNATIONAL TRADE COMMISSION INVESTIGATIONS OF UNFAIR PRACTICES IN IMPORT TRADE ADJUDICATION AND ENFORCEMENT Discovery and Compulsory Process... other non-monetary sanction available under Rule 37(b) of the Federal Rules of Civil Procedure. Any such...

  18. 17 CFR 210.3-20 - Currency for financial statements of foreign private issuers.

    Science.gov (United States)

    2010-04-01

    ... statements of foreign private issuers. 210.3-20 Section 210.3-20 Commodity and Securities Exchanges... private issuers. (a) A foreign private issuer, as defined in § 230.405 of this chapter, shall state... the financial statements. If dividends on publicly-held equity securities will be declared in a...

  19. 45 CFR 170.210 - Standards for health information technology to protect electronic health information created...

    Science.gov (United States)

    2010-10-01

    ... 45 Public Welfare 1 2010-10-01 2010-10-01 false Standards for health information technology to protect electronic health information created, maintained, and exchanged. 170.210 Section 170.210 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES HEALTH INFORMATION TECHNOLOGY HEALTH INFORMATION TECHNOLOGY STANDARDS, IMPLEMENTATION SPECIFICATION...

  20. 7 CFR Appendix C to Part 210 - Child Nutrition Labeling Program

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 4 2010-01-01 2010-01-01 false Child Nutrition Labeling Program C Appendix C to Part..., DEPARTMENT OF AGRICULTURE CHILD NUTRITION PROGRAMS NATIONAL SCHOOL LUNCH PROGRAM Pt. 210, App. C Appendix C to Part 210—Child Nutrition Labeling Program 1. The Child Nutrition (CN) Labeling Program is a...

  1. MicroRNA-210 alleviates oxidative stress-associated cardiomyocyte apoptosis by regulating BNIP3.

    Science.gov (United States)

    Diao, Hongying; Liu, Bin; Shi, Yongfeng; Song, Chunli; Guo, Ziyuan; Liu, Ning; Song, Xianjing; Lu, Yang; Lin, Xiaoye; Li, Zhuoran

    2017-09-01

    Oxidative stress-induced myocardial apoptosis and necrosis are involved in ischemia/reperfusion (I/R) injury. This study was performed to investigate microRNA (miR)-210's role in oxidative stress-related myocardial damage. The expression of miR-210 was upregulated in myocardial tissues of I/R rats, while that of Bcl-2 adenovirus E1B 19kDa-interacting protein 3 (BNIP3) was downregulated. To simulate in vivo oxidative stress, H9c2 cells were treated with H2O2 for 48 h. MiR-210 level was increased upon H2O2 stimulation, peaked at 8 h, and then decreased. An opposite expression pattern of BNIP3 was observed. BNIP3 was demonstrated as a direct target of miR-210 via luciferase reporter assay. H2O2-induced cell apoptosis was attenuated by miR-210 mimics, whereas aggravated by miR-210 inhibitor. MiR-210 knockdown-induced cell apoptosis in presence of H2O2 was attenuated by BNIP3 siRNA. Our work demonstrates that miR-210 plays a protective role in H2O2-induced cardiomyocyte apoptosis at least by regulating the pro-apoptotic BNIP3.

  2. 33 CFR 150.210 - What are the restrictions on serving in more than one position?

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false What are the restrictions on serving in more than one position? 150.210 Section 150.210 Navigation and Navigable Waters COAST GUARD... What are the restrictions on serving in more than one position? No person may serve in more than one of...

  3. PAC-1 and its derivative WF-210 Inhibit Angiogenesis by inhibiting VEGF/VEGFR pathway.

    Science.gov (United States)

    Wang, Fangyang; Wang, Lihui; Li, Yi; Wang, Nannan; Wang, Yating; Cao, Qi; Gong, Ping; Yang, Jingyu; Wu, Chunfu

    2017-12-19

    Procaspase Activating Compound-1 (PAC-1) and its derivative WF-210 induce apoptosis in cancer cells by activating procaspase-3 to caspase-3. The aim of this study was to extend current knowledge about the mechanisms of PAC-1 and WF-210, particularly about their effects on tumor angiogenesis. PAC-1 and WF-210 restrained VEGF-induced human umbilical vascular endothelial cells (HUVECs) proliferation, invasion, and tube formation. PAC-1 and WF-210 abrogated VEGF-induced vessel sprouting from rat aortic rings and inhibited vascular formation in the Matrigel plug assay. PAC-1 and WF-210 suppressed phosphorylation of VEGFR2 and its downstream protein kinases c-Src, FAK, and AKT in both HUVECs and U-87 cells. When given to mice bearing subcutaneous or orthotopic xenograft, PAC-1 and WF-210 inhibited the tumor growth and tumor angiogenesis. Further tests showed that PAC-1 and WF-210 inhibited stemness and induced autophagy flux of U-87 cells. This study revealed mechanisms of PAC-1 and WF-210 other than inducing apoptosis, which provides additional support for their using in the clinic. Copyright © 2017. Published by Elsevier B.V.

  4. Polonium-210 in mussels and fish from the Baltic-North Sea estuary

    DEFF Research Database (Denmark)

    Dahlgaard, H.

    1996-01-01

    Polonium-210 has been measured in Danish fish meat caught in the North Sea, the Kattegat and the Baltic in 1991-1994. Average values of 0.35, 0.65 and 0.96 Bq Po-210 kg(-1) fresh weight were observed for cod, herring and plaice fillets, respectively. The difference between species is statisticall...

  5. Using natural radionuclides 210Po and 210Pb in GEOTRACES data from the North Atlantic to estimate particulate and biologically reactive trace element scavenging and regeneration

    Science.gov (United States)

    Rigaud, Sylvain; Church, Thomas

    2016-04-01

    Central to understanding the coupling of oceanic carbon and nutrient cycles are trace elements that can limit ocean production and ultimately climate change. These include elements that are both lithogenic (particle reactive) and biogenic (biologically reactive) central to particle scavenging, exchange and bioavailability. The natural 210Po and 210Pb radionuclide (granddaughter/parent) pair provides the radiometric means to model particle scavenging and exchange in the ocean on monthly to annual time scales. Data on dissolved (0.2 μm, >53μm) 210Po (t1/2= 138.4 d) and 210Pb (T1/2 = 22.3 y) are available from seven complete water profiles during two U.S. GEOTRACES cruises that transited the North Atlantic during fall 2010 and 2011. The transects correspond to a wide range of marine environments: coastal slopes at the western and eutrophic up-welling at the eastern margins, Saharan dust sources from the east, hydro-thermal vents in the TAG plume on the Mid-Atlantic Ridge, and oligotrophic gyres in both the western and eastern basins. Steady state box modeling at each depth interval was employed to estimate radionuclide exchange rates at the fine-large particle and fine particulate-dissolved interface, in terms of biological uptake, and net of radioactive support or decay. By proxy, the results should predict the rates of biological (210Po) and particle reactive (210Pb) trace element adsorption and resorption, vertical particulate and carbon export, and respective residence times. The model results show the contrasting chemical behaviour of the two nuclides over the large range of oceanic conditions encountered in the North Atlantic. In the surface ocean, 210Po scavenging is linearly correlated with the concentration of particulate organic carbon (POC) in large particles, supporting the role of biogenic particles in 210Po bioaccumulation and export. At depth, 210Po exhibits significant widespread deficit with respect to 210Pb, which could in part be attributed to in

  6. SP-R210 (Myo18A Isoforms as Intrinsic Modulators of Macrophage Priming and Activation.

    Directory of Open Access Journals (Sweden)

    Linlin Yang

    Full Text Available The surfactant protein (SP-A receptor SP-R210 has been shown to increase phagocytosis of SP-A-bound pathogens and to modulate cytokine secretion by immune cells. SP-A plays an important role in pulmonary immunity by enhancing opsonization and clearance of pathogens and by modulating macrophage inflammatory responses. Alternative splicing of the Myo18A gene results in two isoforms: SP-R210S and SP-R210L, with the latter predominantly expressed in alveolar macrophages. In this study we show that SP-A is required for optimal expression of SP-R210L on alveolar macrophages. Interestingly, pre-treatment with SP-A prepared by different methods either enhances or suppresses responsiveness to LPS, possibly due to differential co-isolation of SP-B or other proteins. We also report that dominant negative disruption of SP-R210L augments expression of receptors including SR-A, CD14, and CD36, and enhances macrophages' inflammatory response to TLR stimulation. Finally, because SP-A is known to modulate CD14, we used a variety of techniques to investigate how SP-R210 mediates the effect of SP-A on CD14. These studies revealed a novel physical association between SP-R210S, CD14, and SR-A leading to an enhanced response to LPS, and found that SP-R210L and SP-R210S regulate internalization of CD14 via distinct macropinocytosis-like mechanisms. Together, our findings support a model in which SP-R210 isoforms differentially regulate trafficking, expression, and activation of innate immune receptors on macrophages.

  7. POC export from ocean surface waters by means of 234Th/ 238U and 210Po/ 210Pb disequilibria: A review of the use of two radiotracer pairs

    Science.gov (United States)

    Verdeny, Elisabet; Masqué, Pere; Garcia-Orellana, Jordi; Hanfland, Claudia; Kirk Cochran, J.; Stewart, Gillian M.

    2009-08-01

    234Th ( T1/2=24.1 d) and 210Po ( T1/2=138.4 d) are particle reactive radioisotopes that are used as tracers for particle cycling in the upper ocean. Particulate organic carbon (POC) export has frequently been estimated using 234Th/ 238U disequilibrium. Recent evidence suggests that 210Po/ 210Pb disequilibrium may be used as an additional tool to examine particle export, given the direct biological uptake of 210Po into cellular material. Differences in these two radioisotope pairs with regard to their half-lives, particle reactivity and scavenging affinity in seawater should provide complementary information to be obtained on the processes occurring in the water column. Here, we review eight different studies that have simultaneously used both approaches to estimate POC export fluxes from the surface ocean. Our aim is to provide a complete "dataset" of all the existing POC flux data derived from the coupled use of both 234Th and 210Po and to evaluate the advantages and limitations of each tracer pair. Our analysis suggests that the simultaneous use of both radiotracers provides more useful comparative data than can be derived from the use of a single tracer alone. The difference in half-lives of 234Th and 210Po enables the study of export production rates over different time scales. In addition, their different biogeochemical behaviour and preferred affinity for specific types of particles leads to the conclusion that 234Th is a better tracer of total mass flux, whereas 210Po tracks POC export more specifically. The synthesis presented here is also intended to provide a basis for planning future sampling strategies and promoting further work in this field to help reveal the more specific application of each tracer under specific water column biogeochemistries.

  8. 210Po in the marine environment with emphasis on its behaviour within the biosphere.

    Science.gov (United States)

    Fowler, Scott W

    2011-05-01

    The distribution and behaviour of the natural-series alpha-emitter polonium-210 in the marine environment has been under study for many years primarily due to its enhanced bioaccumulation, its strong affinity for binding with certain internal tissues, and its importance as a contributor to the natural radiation dose received by marine biota as well as humans consuming seafoods. Results from studies spanning nearly 5 decades show that (210)Po concentrations in organisms vary widely among the different phylogenic groups as well as between the different tissues of a given species. Such variation results in (210)Po concentration factors ranging from approximately 10(3) to over 10(6) depending upon the organism or tissue considered. (210)Po/(210)Pb ratios in marine species are generally greater than unity and tend to increase up the food chain indicating that (210)Po is preferentially taken up by organisms compared to its progenitor (210)Pb. The effective transfer of (210)Po up the food chain is primarily due to the high degree of assimilation of the radionuclide from ingested food and its subsequent strong retention in the organisms. In some cases this mechanism may lead to an apparent biomagnification of (210)Po at the higher trophic level. Various pelagic species release (210)Po and (210)Pb packaged in organic biodetrital particles that sink and remove these radionuclides from the upper water column, a biogeochemical process which, coupled with scavenging rates of this radionuclide pair, is being examined as a possible proxy for estimating downward organic carbon fluxes in the sea. Data related to preferential bioaccumulation in various organisms, their tissues, resultant radiation doses to these species, and the processes by which (210)Po is transferred and recycled through the food web are discussed. In addition, the main gaps in our present knowledge and proposed areas for future studies on the biogeochemical behaviour of (210)Po and its use as a tracer of

  9. Etiology of epilepsy a prospective study of 210 cases

    Directory of Open Access Journals (Sweden)

    Walter Oleschko Arruda

    1991-09-01

    Full Text Available The objective of this study was to establish the etiology of epilepsy in 210 chronic epileptics (110 female, 100 male, aged 14-82 years (34.2±13.3. Patients less than 10 years-old and alcoholism were excluded. All underwent neurological examination, routine blood tests, EEG and CT-scan. Twenty patients (10.5% were submitted to spinal tap for CSF examination. Neurological examination was abnormal in 26 (12.4%, the EEG in 68 (45.5%, and CT-scan in 93 (44.3%. According to the International Classification of Epileptic Seizures (1981, 101 (48.1% have generalized seizures, 66 (31.4% partial seizures secondarily generalized, 25 (11.8% simple partial and complex partial seizures, and 14 (6.6% generalized and partial seizures. Four patients (2.0% could not be classified. In 125 (59.5% patients the etiology was unknown. Neurocysticercosis accounted for 57 (27.1% of cases, followed by cerebrovascular disease 8 (3.8%, perinatal damage 5 (2.4%, familial epilepsy 4 (1.9%, head injury 4 (1.9%, infective 1 (0.5%, and miscelanea 6 (2.8%.

  10. 210Po in Human Saliva of Smokeless Tobacco Users.

    Science.gov (United States)

    Meli, Maria Assunta; Desideri, Donatella; Roselli, Carla; Feduzi, Laura

    2017-01-01

    The occurrence and mobility of Po in oral smokeless tobacco products (STPs) were determined because its effects on human health must be taken into account. This research was subdivided into two parts: determination by alpha spectrometry of the Po activity concentration in 16 oral smokeless tobacco products of different brands purchased in local specialty stores in Europe and evaluation of its percent extraction into an artificial salivary gland during sucking or chewing operations. Polonium-210 was detected in all samples, and its concentrations ranged from 3.46 to 14.8 Bq kg (mean value of 7.45 ± 3.82 Bq kg). The highest concentration was found in chewing tobacco. The samples showed no significant difference in the content of Po level. The data obtained in this study show that the polonium, although poorly extracted (12.8 ± 8.96%) by artificial saliva, is not totally retained within the smokeless tobacco products, with a consequent potential health hazard associated with oral use of these products.

  11. Primary electron transfer in reaction centers of YM210L and YM210L/HL168L mutants of Rhodobacter sphaeroides.

    Science.gov (United States)

    Yakovlev, A G; Vasilieva, L G; Khmelnitskaya, T I; Shkuropatova, V A; Shkuropatov, A Ya; Shuvalov, V A

    2010-07-01

    The role of tyrosine M210 in charge separation and stabilization of separated charges was studied by analyzing of the femtosecond oscillations in the kinetics of decay of stimulated emission from P* and of a population of the primary charge separated state P(+)B(A)(-) in YM210L and YM210L/HL168L mutant reaction centers (RCs) of Rhodobacter sphaeroides in comparison with those in native Rba. sphaeroides RCs. In the mutant RCs, TyrM210 was replaced by Leu. The HL168L mutation placed the redox potential of the P(+)/P pair 123 mV below that of native RCs, thus creating a theoretical possibility of P(+)B(A)(-) stabilization. Kinetics of P* decay at 940 nm of both mutants show a significant slowing of the primary charge separation reaction in comparison with native RCs. Distinct damped oscillations in these kinetics with main frequency bands in the range of 90-150 cm(-1) reflect mostly nuclear motions inside the dimer P. Formation of a very small absorption band of B(A)(-) at 1020 nm is registered in RCs of both mutants. The formation of the B(A)(-) band is accompanied by damped oscillations with main frequencies from ~10 to ~150 cm(-1). Only a partial stabilization of the P(+)B(A)(-) state is seen in the YM210L/HL168L mutant in the form of a small non-oscillating background of the 1020-nm kinetics. A similar charge stabilization is absent in the YM210L mutant. A model of oscillatory reorientation of the OH-group of TyrM210 in the electric fields of P(+) and B(A)(-) is proposed to explain rapid stabilization of the P(+)B(A)(-) state in native RCs. Small oscillatory components at ~330-380 cm(-1) in the 1020-nm kinetics of native RCs are assumed to reflect this reorientation. We conclude that the absence of TyrM210 probably cannot be compensated by lowering of the P(+)B(A)(-) free energy that is expected for the double YM210L/HL168L mutant. An oscillatory motion of the HOH55 water molecule under the influence of P(+) and B(A)(-) is assumed to be another potential

  12. Orientating investigation to Polonium-210 and other radionuclides in Dutch aquatic ecosystems. Orienterend onderzoek naar Polonium-210 en andere radionucliden in Nederlandse aquatische ecosystemen

    Energy Technology Data Exchange (ETDEWEB)

    Koester, H.W.; Marwitz, P.A. (Rijksinstituut voor Volksgezondheid en Milieuhygiene, Bilthoven (Netherlands)); Berger, G.W. (Netherlands Inst. for Sea Research, Den Burg (Netherlands)); Weers, A.W. van (Netherlands Energy Research Foundation, Petten (Netherlands)); Hagel, P. (RIVO (Netherlands)); Nieuwenhuize, J. (DIHO (Netherlands))

    1990-08-01

    In 1985/86 reconnaissance investigations were carried out of Po-210, Pb-210, Ra-226, Th-230 of the U-238 series, and of Th-232 and its daughter Th-228. In the lower reaches of the Rhine, Westerschelde, and Hoogoven(furnace)-channel concentrations were markedly elevated. The average Po-210 concentrations of these waters were between 3-4 Bq.m{sup -3} dissolved in water, between 200-500 Bq.kg{sup -1} in dry suspended matter, between 300-400 Bq.kg{sup -1} in mussels dry matter. These elevated levels could be ascribed to emissions on these waters by the phosphate rock and iron-ore-processing industries. In bottom sediment of waterways or of docks close to these industries Pb-210 and Po-210 concentrations varied from 150 to 750 Bq.kg{sup -1} dry sediment. The lowest average Po-210 concentrations were found in the Oosterschelde: 0.8 Bq.m{sup -3} dissolved in water, 70 Bq.kg{sup -1} in dry suspended matter, 100 Bq.kg{sup -1} in mussels dry matter. It was found that several organisms incorporate Po-210 more strongly than the other natural radionuclides. Po-210 also contributes most to the radiation burden caused by the consumption of fish products, in particular mussels and shrimps. Consumption of 1 kg. a{sup -1} of shrimps from the Oosterschelde or from the coastal area causes respectively a radiation exposure of 10 {mu}Sv.a{sup -1} or 30 {mu}Sv.a{sup -1}. This study points out the necessity for further studies of the emissions of Po-210 and other U-238 daughters and their dispersal and/or accumulation in the aquatic environment. Furthermore it is important to identify critical groups with respect to the radiation exposure caused by the consumption of mussels and other fish products, and the contribution to this radiation exposure by the industries. (author). 43 refs.; 58 figs.; 52 tabs.

  13. Impact of northern and southern air mass transport on the temporal distribution of atmospheric (210)Po and (210)Pb in the east coast of Johor, Malaysia.

    Science.gov (United States)

    Sabuti, Asnor Azrin; Mohamed, Che Abd Rahim

    2016-09-01

    Concentration activities of (210)Pb and (210)Po in the PM10 were determined to discuss their distribution and chemical behavior in relation to meteorological parameters especially in air mass transport during monsoon events. Marine aerosol samples were collected between January 2009 and December 2010 at the coastal region of Mersing, which is located in the southern South China Sea and is about 160 km northeast of Johor Bahru, as part of the atmosphere-ocean interaction program in Malaysia. About 47 PM10 samples were collected using the Sierra-Andersen model 1200 PM10 sampler over a 2-year sampling campaign between January 2009 and December 2010. Samples were processed using acid digestion sequential extraction techniques to analyze various fractions such as Fe and Mn oxides, organic matter, and residual fractions. While, (210)Pb and (210)Po activities were measured with the Gross Alpha/Beta Counting System model XLB-5 Tennelec® Series 5 and the Alpha Spectrometry (model Alpha Analyst Spectroscopy system with a silicon-surface barrier detector), respectively. The distribution activities of (210)Pb and (210)Po in the PM10 samples were varied from 162 to 881 μBq/m(3) with mean value of 347 ± 170 μBq/m(3) and from 85 to 1009 μBq/m(3) with mean value of 318 ± 202 μBq/m(3), respectively. The analysis showed that (210)Po activity in our samples lies in a border and higher range than global distribution values due to contributions from external sources injected to the atmosphere. The speciation of (210)Pb and (210)Po in marine aerosol corresponds to transboundary haze; e.g., biomass burning especially forest fires and long-range air mass transport of terrestrial dust has enriched concentrations of particle mass in the local atmosphere. The monsoon seems to play an important role in transporting terrestrial dust from Indo-China and northern Asia especially during the northeast monsoon, as well as biogenic pollutants originating from Sumatra and the southern

  14. A record of atmospheric {sup 210}Pb deposition in The Netherlands

    Energy Technology Data Exchange (ETDEWEB)

    Beks, J.P.; Eisma, D. [Netherlands Institute for Sea Research (NIOZ), PO box 59, 1790 AB Den Burg Texel (Netherlands); Plicht, J. van der [Isotope Research Centre (CIO), University Groningen, Nijenborgh 4, 9747 AG Groningen (Netherlands)

    1998-10-15

    The deposition flux of total atmospheric {sup 210}Pb has been measured at two sites in The Netherlands: Texel from 1992 to 1996 and Groningen from 1989 to 1994. With predominant westerly oceanic winds, the annual {sup 210}Pb deposition is relatively low as {sup 222}Rn, the source for atmospheric {sup 210}Pb, is mainly exhaled by the continents. The daily fluctuations in {sup 210}Pb deposition are determined by the almost random daily fluctuations in precipitation and the concentration in groundlevel air. The variations in annual {sup 210}Pb deposition flux appear to be mainly correlated with the number of heavy rains or thunder storms. This explains the variations in annual deposition at short distance. The average {sup 210}Pb deposition at Groningen (1987-1994) is 200 mBq m{sup -2} day{sup -1}. The {sup 210}Pb deposition over the North Sea is estimated to be 115 mBq m{sup -2} day{sup -1} in the same period. The deposition velocity in Groningen is 1.0 cm s{sup -1}, which is similar to measurements in Virginia and Connecticut. (Copyright (c) 1998 Elsevier Science B.V., Amsterdam. All rights reserved.)

  15. A record of atmospheric {sup 210}Pb deposition in The Netherlands

    Energy Technology Data Exchange (ETDEWEB)

    Beks, J.P.; Eisma, D. [Netherlands Institute for Sea Research (NIOZ), PO box 59, 1790 AB Den Burg, Texel (Netherlands); Van der Plicht, J. [Isotope Research Centre (CIO), University Groningen, Nijenborgh 4, 9747 AG Groningen (Netherlands)

    1998-10-15

    The deposition flux of total atmospheric {sup 210}Pb has been measured at two sites in The Netherlands: Texel from 1992 to 1996 and Groningen from 1989 to 1994. With predominant westerly oceanic winds, the annual {sup 210}Pb deposition is relatively low as {sup 222}Rn, the source for atmospheric {sup 210}Pb, is mainly exhaled by the continents. The daily fluctuations in {sup 210}Pb deposition are determined by the almost random daily fluctuations in precipitation and the concentration in groundlevel air. The variations in annual {sup 210}Pb deposition flux appear to be mainly correlated with the number of heavy rains or thunder storms. This explains the variations in annual deposition at short distance. The average {sup 210}Pb deposition at Groningen (1987-1994) is 200 mBq m{sup -2} day{sup -1}. The {sup 210}Pb deposition over the North Sea is estimated to be 115 mBq m{sup -2} day{sup -1} in the same period. The deposition velocity in Groningen is 1.0 cm s{sup -1}, which is similar to measurements in Virginia and Connecticut

  16. Distributions of 210Pb around a uraniferous coal-fired power plant in Western Turkey.

    Science.gov (United States)

    Uğur, A; Ozden, B; Yener, G; Saç, M M; Kurucu, Y; Altinbaş, U; Bolca, M

    2009-02-01

    In the present study the spatial and the vertical distributions of 210Pb were investigated in the soils around a uranifereous coal fired power plant (CPP) in Yatagan Basin, in Western Turkey. The variation of 226Ra activity along the soil profiles was studied to assess the unsupported 210Pb distribution in the same samples. 226Ra was measured by gamma spectroscopy and 210Pb activities were determined from 210Po activities using radiochemical deposition and alpha spectroscopy. The total 210Pb activity concentrations in bulk core samples varied in the range of 38-250 Bq kg(-1) in the study sites and of 22-78 Bq kg(-1) in reference site. In the sectioned cores sampled from the study areas the ranges for activity concentrations of 226Ra, total 210Pb and unsupported 210Pb are 24-77; 39-344 and 4-313 Bq kg(-1), respectively. Corresponding ranges for reference site are 37-39; 39-122 and 1-83 Bq kg(-1).

  17. 17 CFR 210.6A-02 - Special rules applicable to employee stock purchase, savings and similar plans.

    Science.gov (United States)

    2010-04-01

    ... employee stock purchase, savings and similar plans. 210.6A-02 Section 210.6A-02 Commodity and Securities..., INVESTMENT COMPANY ACT OF 1940, INVESTMENT ADVISERS ACT OF 1940, AND ENERGY POLICY AND CONSERVATION ACT OF 1975 Employee Stock Purchase, Savings and Similar Plans § 210.6A-02 Special rules applicable to...

  18. 22 CFR 210.300 - What must I do to comply with this part if I am an individual recipient?

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false What must I do to comply with this part if I am an individual recipient? 210.300 Section 210.300 Foreign Relations AGENCY FOR INTERNATIONAL... Recipients Who Are Individuals § 210.300 What must I do to comply with this part if I am an individual...

  19. 28 CFR 5.210 - Amount of detail required in information relating to registrant's activities and expenditures.

    Science.gov (United States)

    2010-07-01

    ... 28 Judicial Administration 1 2010-07-01 2010-07-01 false Amount of detail required in information relating to registrant's activities and expenditures. 5.210 Section 5.210 Judicial Administration... § 5.210 Amount of detail required in information relating to registrant's activities and expenditures...

  20. 33 CFR 334.210 - Chesapeake Bay, in vicinity of Tangier Island; naval guided missiles test operations area.

    Science.gov (United States)

    2010-07-01

    ... Tangier Island; naval guided missiles test operations area. 334.210 Section 334.210 Navigation and... RESTRICTED AREA REGULATIONS § 334.210 Chesapeake Bay, in vicinity of Tangier Island; naval guided missiles test operations area. (a) The danger zone—(1) Prohibited area. A circle 1,000 yards in radius with its...

  1. 17 CFR 210.2-02T - Accountants' reports and attestation reports on internal control over financial reporting.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Accountants' reports and attestation reports on internal control over financial reporting. 210.2-02T Section 210.2-02T Commodity and... attestation reports on internal control over financial reporting. (a) The requirements of § 210.2-02(f) shall...

  2. 20 CFR 30.210 - What are the criteria for eligibility for benefits relating to radiogenic cancer?

    Science.gov (United States)

    2010-04-01

    ... benefits relating to radiogenic cancer? 30.210 Section 30.210 Employees' Benefits OFFICE OF WORKERS... Cancer Under Parts B and E of Eeoicpa § 30.210 What are the criteria for eligibility for benefits relating to radiogenic cancer? (a) To establish eligibility for benefits for radiogenic cancer under Part B...

  3. Elevation of circulating miR-210-3p in high-altitude hypoxic environment

    Directory of Open Access Journals (Sweden)

    Yan eYan

    2016-03-01

    Full Text Available Background: The induction of miR-210-3p, a master hypoxamir, is a consistent feature of the hypoxic response in both normal and malignant cells. However, whether miR-210-3p acts as a circulating factor in response to a hypoxic environment remains unknown. The current study aimed to examine the effect of a high-altitude hypoxic environment on circulating miR-210-3p.Methods: We examined and compared the levels of miR-210-3p using TaqMan-based qRT-PCR in both peripheral blood cells and plasma from 84 ethnic Chinese Tibetans residing at 3560 m, 46 newly arrived migrant Han Chinese (Tibet Han and 82 Han Chinese residing at 8.9 m (Nanjing Han. Furthermore, we analyzed the correlations of miR-210-3p with hematological indices. Results: The relative concentrations of miR-210-3p to internal reference U6 in blood cells were significantly higher in the Tibet Han group (1.01±0.11, P<0.001 and in the Tibetan group (1.17±0.09, P<0.001 than in the Nanjing Han group (0.51±0.04. The absolute concentrations of plasma miR-210-3p were also markedly elevated in the Tibet Han group (503.54±42.95 fmol/L, P=0.004 and in the Tibetan group (557.78±39.84 fmol/L, P<0.001 compared to the Nanjing Han group (358.39±16.16 fmol/L. However, in both blood cells and plasma, miR-210-3p levels were not significantly different between the Tibet Han group and the Tibetan group (P=0.280, P=0.620, respectively. Plasma miR-210-3p concentrations were positively correlated with miR-210-3p levels in blood cells (r=0.192, P=0.005. Furthermore, miR-210-3p levels in both blood cells and plasma showed strong positive correlations with red blood cell counts and hemoglobin and hematocrit values. Conclusion: These data demonstrated, for the first time, that miR-210-3p might act as a circulating factor in response to hypoxic environments and could be associated with human adaptation to life at high altitudes.

  4. Scientific Opinion on Flavouring Group Evaluation 210 Revision 2 (FGE.210Rev2): Consideration of genotoxic potential for α,β-unsaturated alicyclic ketones and precursors from chemical subgroup 2.4 of FGE.19

    DEFF Research Database (Denmark)

    Beltoft, Vibe Meister; Nørby, Karin Kristiane

    Safety Authority was requested to evaluate the genotoxic potential of 14 flavouring substances in Flavouring Group Evaluation 210 (FGE.210). In FGE.210, the Panel concluded that the genotoxic potential could not be ruled out for any of the flavouring substances. In FGE.210 Revision1, the Panel.......226 and 07.231] the concern for genotoxicity remains and additional data were requested. The Flavour Industry has submitted additional genotoxicity data for allyl a-ionone [FL-no: 07.061], that are evaluated in the present revision of FGE.210 (Revision 2). Based on these new data the Panel concluded...

  5. Concentration of {sup 210}Po in the hair of Brazilian population; Teores de {sup 210}Po no cabelo da populacao brasileira

    Energy Technology Data Exchange (ETDEWEB)

    Kelecom, Alphonse; Gouvea, Rita C.S.; Santos, Pedro L. [Universidade Federal Fluminense, Niteroi, RJ (Brazil). Dept. de Biologia Geral. Lab. de Radiobiologia e Radiometria

    2000-07-01

    {sup 210}Po concentrations have been determined in the hair of 118 people (57 women and 61 men), whose ages ranged from 8 to 90 years (mean: 39y). {sup 210}Po levels varied from 2,15 mBq.g{sup -1} for a medium long-haired female nonsmoker to 38,33 mBq.g{sup -1} for a 65 cigarettes-a-day male smoker (66 years old) whose diet is rich in fish. The overall mean concentration of {sup 210}Po in hair was of 7,39{+-}5,13 mBq.g{sup -1}, and was slightly higher for men (8,37{+-}6,11 mBq.g{sup -1}) than for women (6,34{+-}3,57 mBq.g{sup -1}). (author)

  6. 210Po and 210Pb distribution,dissolved-particulate exchangerates, and particulate export along the North Atlantic US GEOTRACES GA03 section

    OpenAIRE

    RIGAUD, Sylvain; Stewart, Gillian; Baskaran, Mark; Marsan, D; Church, Thomas

    2015-01-01

    International audience; North Atlantic Ocean Hydrothermal plume Benthic nepheloid layer GEOTRACES a b s t r a c t Vertical profiles of 210 Po and 210 Pb in the water column were measured in the dissolved phase (o0.45 mm), and small (0.8–51 mm) and large (4 51 mm) particles at seven stations along the US GEOTRACES North Atlantic Zonal Transect (GA03). Mass balance calculations were employed to assess nuclide exchange rates at the dissolved-small particle interface and between small and large p...

  7. 44 CFR 19.210 - Military and merchant marine educational institutions.

    Science.gov (United States)

    2010-10-01

    ... 44 Emergency Management and Assistance 1 2010-10-01 2010-10-01 false Military and merchant marine... the merchant marine. ... PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Coverage § 19.210 Military and merchant...

  8. 30 CFR 210.54 - Must I submit this royalty report electronically?

    Science.gov (United States)

    2010-07-01

    ... MINERALS REVENUE MANAGEMENT FORMS AND REPORTS Royalty Reports-Oil, Gas, and Geothermal Resources § 210.54... media types, unless MMS instructs you differently: (1) Electronic Data Interchange (EDI)—The direct...

  9. 20 CFR 665.210 - What are allowable Statewide workforce investment activities?

    Science.gov (United States)

    2010-04-01

    ... five percent administrative cost limitation at 20 CFR 667.210(a)(1). (b) Providing capacity building... assist in skills upgrading; and (2) Programs targeted to Empowerment Zones and Enterprise Communities. (e...

  10. Rapid determination of 210Po in water samples

    Energy Technology Data Exchange (ETDEWEB)

    Maxwell, Sherrod L.; Culligan, Brian K.; Hutchison, Jay B.; Utsey, Robin C.; McAlister, Daniel R.

    2013-08-02

    A new rapid method for the determination of 210Po in water samples has been developed at the Savannah River National Laboratory (SRNL) that can be used for emergency response or routine water analyses. If a radiological dispersive device (RDD) event or a radiological attack associated with drinking water supplies occurs, there will be an urgent need for rapid analyses of water samples, including drinking water, ground water and other water effluents. Current analytical methods for the assay of 210Po in water samples have typically involved spontaneous auto-deposition of 210Po onto silver or other metal disks followed by counting by alpha spectrometry. The auto-deposition times range from 90 minutes to 24 hours or more, at times with yields that may be less than desirable. If sample interferences are present, decreased yields and degraded alpha spectrums can occur due to unpredictable thickening in the deposited layer. Separation methods have focused on the use of Sr Resin, often in combination with 210Pb analysis. A new rapid method for 210Po in water samples has been developed at the Savannah River National Laboratory (SRNL) that utilizes a rapid calcium phosphate co-precipitation method, separation using DGA Resin (N,N,N,N-tetraoctyldiglycolamide extractant-coated resin, Eichrom Technologies or Triskem-International), followed by rapid microprecipitation of 210Po using bismuth phosphate for counting by alpha spectrometry. This new method can be performed quickly with excellent removal of interferences, high chemical yields and very good alpha peak resolution, eliminating any potential problems with the alpha source preparation for emergency or routine samples. A rapid sequential separation method to separate 210Po and actinide isotopes was also developed. This new approach, rapid separation with DGA Resin plus microprecipitation for alpha source preparation, is a significant advance in

  11. Small Molecule Inhibition of microRNA-210 Reprograms an Oncogenic Hypoxic Circuit.

    Science.gov (United States)

    Costales, Matthew G; Haga, Christopher L; Velagapudi, Sai Pradeep; Childs-Disney, Jessica L; Phinney, Donald G; Disney, Matthew D

    2017-03-08

    A hypoxic state is critical to the metastatic and invasive characteristics of cancer. Numerous pathways play critical roles in cancer maintenance, many of which include noncoding RNAs such as microRNA (miR)-210 that regulates hypoxia inducible factors (HIFs). Herein, we describe the identification of a small molecule named Targapremir-210 that binds to the Dicer site of the miR-210 hairpin precursor. This interaction inhibits production of the mature miRNA, derepresses glycerol-3-phosphate dehydrogenase 1-like enzyme (GPD1L), a hypoxia-associated protein negatively regulated by miR-210, decreases HIF-1α, and triggers apoptosis of triple negative breast cancer cells only under hypoxic conditions. Further, Targapremir-210 inhibits tumorigenesis in a mouse xenograft model of hypoxic triple negative breast cancer. Many factors govern molecular recognition of biological targets by small molecules. For protein, chemoproteomics and activity-based protein profiling are invaluable tools to study small molecule target engagement and selectivity in cells. Such approaches are lacking for RNA, leaving a void in the understanding of its druggability. We applied Chemical Cross-Linking and Isolation by Pull Down (Chem-CLIP) to study the cellular selectivity and the on- and off-targets of Targapremir-210. Targapremir-210 selectively recognizes the miR-210 precursor and can differentially recognize RNAs in cells that have the same target motif but have different expression levels, revealing this important feature for selectively drugging RNAs for the first time. These studies show that small molecules can be rapidly designed to selectively target RNAs and affect cellular responses to environmental conditions, resulting in favorable benefits against cancer. Further, they help define rules for identifying druggable targets in the transcriptome.

  12. Enhanced Atomic Desorption of 209 and 210 Francium from Organic Coating

    OpenAIRE

    2017-01-01

    Controlled atomic desorption from organic Poly-DiMethylSiloxane coating is demonstrated for improving the loading efficiency of 209,210Fr magneto-optical traps. A three times increase in the cold atoms population is obtained with contact-less pulsed light-induced desorption, applied to different isotopes, either bosonic or fermionic, of Francium. A six times increase of 210Fr population is obtained with a desorption mechanism based on direct charge transfer from a triboelectric probe to the a...

  13. Plasma autoantibodies against apolipoprotein B-100 peptide 210 in subclinical atherosclerosis.

    Science.gov (United States)

    McLeod, Olga; Silveira, Angela; Fredrikson, Gunilla N; Gertow, Karl; Baldassarre, Damiano; Veglia, Fabrizio; Sennblad, Bengt; Strawbridge, Rona J; Larsson, Malin; Leander, Karin; Gigante, Bruna; Kauhanen, Jussi; Rauramaa, Rainer; Smit, Andries J; Mannarino, Elmo; Giral, Philippe; Humphries, Steve E; Tremoli, Elena; de Faire, Ulf; Ohrvik, John; Nilsson, Jan; Hamsten, Anders

    2014-01-01

    Experimental studies have suggested that autoimmunity is involved in atherosclerosis and provided evidence that both protective and pro-atherogenic immune responses exist. This concept has received support from small clinical studies implicating autoantibodies directed against apolipoprotein B-100 (apoB-100) in human atherosclerosis. We examined circulating autoantibodies directed against native and malondialdehyde (MDA)-modified epitope p210 of apoB-100 (IgG-p210nat and IgM-p210MDA) in relation to early atherosclerosis in a large, European longitudinal cohort study of healthy high-risk individuals. IgG-p210nat and IgM-p210MDA were quantified in baseline plasma samples of 3430 participants in the IMPROVE study and related to composite and segment-specific measures of severity and rate of progression of carotid intima-media thickness (cIMT) determined at baseline and after 30 months. IgM-p210MDA autoantibody levels were independently related to several cIMT measures both in the common carotid artery and in the carotid bulb, including measures of cIMT progression, higher levels being associated with lower cIMT or slower cIMT progression. Consistent inverse relationships were also found between plasma levels of IgG-p210nat and baseline composite measures of cIMT. These associations disappeared when adjusting for established and emerging risk factors, and there were no associations with rate of cIMT progression besides in certain secondary stratified analyses. The present study provides further evidence of involvement of autoantibodies against native and MDA-modified apoB-100 peptide 210 in cardiovascular disease in humans and demonstrates that these associations are present already at a subclinical stage of the disease. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  14. Removal of 210Po from aqueous media and its thermodynamics and kinetics.

    Science.gov (United States)

    Erenturk, S Akyil; Kaygun, A Kilincarslan

    2017-08-01

    In this study, the composite adsorbent as granule was prepared by mixing of polyacrylonitrile (PAN) and a natural zeolite (clinoptilolite) in specific conditions. The prepared composite adsorbent was used for investigating the adsorption behaviour of 210Po. Adsorption of 210Po was studied in a column system. The effective parameters such as initial activity concentration of 210Po, pH of the aqueous solution, contact time and temperature of solution for adsorption behaviour of 210Po were studied. Adsorption yield of 210Po on composite adsorbent from aqueous solution in optimum conditions were determined as 75.00 ± 0.15%. The adsorption equilibrium data was examined using various well-known isotherm models such as Freundlich, Langmuir, Dubinin and Radushkevish and Tempkin, and it was observed that the experimental equilibrium data well fitted and found to be in good agreement with the Tempkin model. Adsorption thermodynamics and kinetics of the polonium were studied. It was found that the processes for 210Po were exothermic and spontaneous. The kinetic data conformed better to the pseudo-second order equation. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Calibration and measurement of {sup 210}Pb using two independent techniques

    Energy Technology Data Exchange (ETDEWEB)

    Villa, M. [Centro de Investigacion, Tecnologia e Innovacion, CITIUS, Universidad de Sevilla, Av. Reina Mercedes 4B, 41012 Sevilla (Spain)], E-mail: mvilla@us.es; Hurtado, S. [Centro de Investigacion, Tecnologia e Innovacion, CITIUS, Universidad de Sevilla, Av. Reina Mercedes 4B, 41012 Sevilla (Spain); Manjon, G.; Garcia-Tenorio, R. [Departamento de Fisica Aplicada II, E.T.S. Arquitectura, Universidad de Sevilla, Av. Reina Mercedes 2, 41012 Sevilla (Spain)

    2007-10-15

    An experimental procedure has been developed for a rapid and accurate determination of the activity concentration of {sup 210}Pb in sediments by liquid scintillation counting (LSC). Additionally, an alternative technique using {gamma}-spectrometry and Monte Carlo simulation has been developed. A radiochemical procedure, based on radium and barium sulphates co-precipitation have been applied to isolate the Pb-isotopes. {sup 210}Pb activity measurements were done in a low background scintillation spectrometer Quantulus 1220. A calibration of the liquid scintillation spectrometer, including its {alpha}/{beta} discrimination system, has been made, in order to minimize background and, additionally, some improvements are suggested for the calculation of the {sup 210}Pb activity concentration, taking into account that {sup 210}Pb counting efficiency cannot be accurately determined. Therefore, the use of an effective radiochemical yield, which can be empirically evaluated, is proposed. {sup 210}Pb activity concentration in riverbed sediments from an area affected by NORM wastes has been determined using both the proposed method. Results using {gamma}-spectrometry and LSC are compared to the results obtained following indirect {alpha}-spectrometry ({sup 210}Po) method.

  16. Variation of {sup 210}Po daily urinary excretion for male subjects at environmental level

    Energy Technology Data Exchange (ETDEWEB)

    Hoelgye, Z.; Hyza, M.; Mihalik, J.; Rulik, P.; Skrkal, J. [National Radiation Protection Institute, Prague (Czech Republic)

    2015-05-15

    {sup 210}Po was determined in 24-h urine of seven healthy males from Prague, Czech Republic, for ten consecutive days. The results show that for each volunteer, the urinary excretion of {sup 210}Po changed only little from day to day in the studied time period. For two volunteers, the difference in the daily excreted {sup 210}Po activity for two consecutive days was not significant, given the 95 % confidence interval (two sigma) of the activity measurements. The same is valid for the excretion data of the other volunteers, except for some days where the differences were slightly higher. The range of daily urinary excretion of {sup 210}Po of each volunteer in the studied time period was quite narrow. Among the volunteers, the maximum daily urinary excretion value of {sup 210}Po was at most about a factor of 2.5 higher than the lowest excretion value. An attempt to explain the observed small inter-individual variability of {sup 210}Po excretion in daily urine is made. (orig.)

  17. The Golgin GMAP210/TRIP11 anchors IFT20 to the Golgi complex.

    Directory of Open Access Journals (Sweden)

    John A Follit

    2008-12-01

    Full Text Available Eukaryotic cells often use proteins localized to the ciliary membrane to monitor the extracellular environment. The mechanism by which proteins are sorted, specifically to this subdomain of the plasma membrane, is almost completely unknown. Previously, we showed that the IFT20 subunit of the intraflagellar transport particle is localized to the Golgi complex, in addition to the cilium and centrosome, and hypothesized that the Golgi pool of IFT20 plays a role in sorting proteins to the ciliary membrane. Here, we show that IFT20 is anchored to the Golgi complex by the golgin protein GMAP210/Trip11. Mice lacking GMAP210 die at birth with a pleiotropic phenotype that includes growth restriction, ventricular septal defects of the heart, omphalocele, and lung hypoplasia. Cells lacking GMAP210 have normal Golgi structure, but IFT20 is no longer localized to this organelle. GMAP210 is not absolutely required for ciliary assembly, but cilia on GMAP210 mutant cells are shorter than normal and have reduced amounts of the membrane protein polycystin-2 localized to them. This work suggests that GMAP210 and IFT20 function together at the Golgi in the sorting or transport of proteins destined for the ciliary membrane.

  18. Excess of polonium-210 activity in the surface urban atmosphere. Part 2: origin of ²¹⁰Po excess.

    Science.gov (United States)

    Długosz-Lisiecka, Magdalena

    2015-02-01

    The presence of significant (210)Po activity, unsupported by its grandparent radionuclide (210)Pb, in the surface atmosphere of industrialized regions can originate from human technical activities. In urban air, the activity ratio of (210)Po to (210)Pb might increase as a result of natural condensation and coagulation processes of relatively volatile (210)Po-containing species emitted during coal combustion processes. The presence of excess of (210)Po cannot be explained by its in-growth from radioactive decay of (210)Bi. About 50% of (210)Po radionuclide released during coal combustion processes can be emitted into air as gaseous or ultrafine products. Subsequently, these products are quickly attached to the surface of fine particles suspended in the air. As a result, an excess of (210)Po activity in aerosols has been reported. However, in this manner, As much as 11 GBq of (210)Po per year can enter the urban air from the local coal power plants in Lodz city, Poland.

  19. Accurate measurements of {sup 210}Pb in industrial wastes for environmental radiation risk assessment purpose

    Energy Technology Data Exchange (ETDEWEB)

    Bonczyk, Michal; Michalik, Boguslaw [Central Mining Institute, Silesian Centre for Environmental Radioactivity, Plac Gwarkow 1, 40-166 Katowice (Poland)

    2014-07-01

    Lead {sup 210}Pb is a naturally occurring radioactive nuclide element of the uranium ({sup 238}U) radioactive series. It is produced as a result of the decay of so-called short-lived progenies of {sup 222}Rn, i.e. {sup 214}Po (99.98%) and {sup 214}Bi by {sup 219}Tl (0.02%). Activity concentration of lead {sup 210}Pb could vary independently from parent radionuclides due to its physical and chemical properties, especially, due to its half-life (T{sub 1/2} = 22,3 years). Hence, its behaviour in natural environment is very complex and difficult in forecasting. Lead {sup 210}Pb in substantial amount occurs in mining, gas and oil extraction industry wastes, which are deposited in natural environment very often. Due to lack of secular equilibrium proper radiation risk assessment requires accurate concentration of {sup 210}Pb in such materials. The laboratory measurements seem to be the only reliable method in environmental radioactivity monitoring. One of the methods is gamma-ray spectrometry, which is very fast and cost-effective method to determine {sup 210}Pb concentration. On the other hand, the self-attenuation of gamma ray from {sup 210}Pb (46,5 keV) is significant and not depends only on sample density as well the chemical composition (sample matrix) is crucial. Current work describes how the self-attenuation correction factors in the case of {sup 210}Pb concentration analysis in mining wastes are important when environmental radiation risk assessment is carried out. The measurements were done for such industrial wastes as mine sediments which contain significant amount of elements with high Z-number (Barium, Lead, etc.) Experimentally obtained correction factors range between 0.51-6.96 cm{sup 2}/g. Neglecting this factor can cause a significant error or underestimations in radiological risk assessment. (authors)

  20. Variants of the Plasmodium vivax circumsporozoite protein (VK210 and VK247 in Colombian isolates

    Directory of Open Access Journals (Sweden)

    JM González

    2001-07-01

    Full Text Available Phenotypic diversity has been described in the central repeated region of the circumsporozoite protein (CSP from Plasmodium vivax. Two sequences VK210 (common and VK247 (variant have been found widely distributed in P. vivax isolates from several malaria endemic areas around the world. A third protein variant called P. vivax-like showing a sequence similar to the simian parasite P. simio-ovale has also been described. Here, using an immunofluorescent test and specific monoclonal antibodies, we assessed the presence of two of these protein variants (VK210 and VK247 in laboratory produced sporozoite. Both sequences were found in parasite isolates coming from different geographic regions of Colombia. Interestingly, sporozoites carrying the VK247 sequence were more frequently produced in Anopheles albimanus than sporozoites with the VK210 sequence. This difference in sporozoites production was statistically significant (p <0.05, Kruskal-Wallis; not correlation was found with parameters as the total number of parasites or gametocytes in blood from human donors used to feed mosquitoes. Previous studies in the same region have shown a higher prevalence of anti-VK210 antibodies which in theory may suggest their role in blocking the development of sporozoites carrying the CSP VK210 sequence.

  1. Increase of {sup 210}Po levels in human semen fluid after mussel ingestion

    Energy Technology Data Exchange (ETDEWEB)

    Kelecom, Alphonse, E-mail: lararapls@hotmail.co [Laboratory of Radiobiology and Radiometry-LARARA-PLS, Universidade Federal Fluminense, P.O.Box 100.436, 24001-970 Niteroi, RJ (Brazil); Programs in Environmental Science and Marine Biology, Universidade Federal Fluminense, Niteroi, RJ (Brazil); Gouvea, Rita de Cassia dos Santos [Laboratory of Radiobiology and Radiometry-LARARA-PLS, Universidade Federal Fluminense, P.O.Box 100.436, 24001-970 Niteroi, RJ (Brazil)

    2011-05-15

    Polonium-210 ({sup 210}Po) radioactive concentrations were determined in human semen fluid of vasectomized non-smoker volunteers. The {sup 210}Po levels ranged from 0.10 to 0.39 mBq g{sup -1} (mean: 0.23 {+-} 0.08 mBq g{sup -1}). This value decreased to 0.10 {+-} 0.02 mBq g{sup -1} (range from 0.07 to 0.13 mBq g{sup -1}) after two weeks of a controlled diet, excluding fish and seafood. Then, volunteers ate during a single meal 200 g of the cooked mussel Perna perna L., and {sup 210}Po levels were determined again, during ten days, in semen fluid samples collected every morning. Volunteers continued with the controlled diet and maintained sexual abstinence through the period of the experiment. A 300% increase of {sup 210}Po level was observed the day following mussel consumption, with a later reduction, such that the level returned to near baseline by day 4.

  2. The golgin GMAP-210 is required for efficient membrane trafficking in the early secretory pathway.

    Science.gov (United States)

    Roboti, Peristera; Sato, Keisuke; Lowe, Martin

    2015-04-15

    Golgins are coiled-coil proteins that participate in membrane-tethering events at the Golgi complex. Golgin-mediated tethering is thought to be important for vesicular trafficking and Golgi organization. However, the degree to which individual golgins contribute to these processes is poorly defined, and it has been proposed that golgins act in a largely redundant manner. Previous studies on the golgin GMAP-210 (also known as TRIP11), which is mutated in the rare skeletal disorder achondrogenesis type 1A, have yielded conflicting results regarding its involvement in trafficking. Here, we re-investigated the trafficking role of GMAP-210, and found that it is indeed required for efficient trafficking in the secretory pathway. GMAP-210 acts at both the endoplasmic reticulum (ER)-to-Golgi intermediate compartment (ERGIC) and Golgi complex during anterograde trafficking, and is also required for retrograde trafficking to the ER. Using co-depletion experiments, we also found that GMAP-210 acts in a partially redundant manner with the golgin GM130 to ensure efficient anterograde cargo delivery to the cis-Golgi. In summary, our results indicate a role for GMAP-210 in several trafficking steps at the ER-Golgi interface, some of which are partially redundant with another golgin, namely GM130 (also known as GOLGA2). © 2015. Published by The Company of Biologists Ltd.

  3. The Radial Growth Rate of Japanese Precious Corals Using Pb-210 Dating Method

    Science.gov (United States)

    Yamada, M.; Iwasaki, N.; Suzuki, A.; Aono, T.

    2014-12-01

    Precious corals belong to the subclass Octocorallia of the class Anthozoa. Its major component is calcium carbonate and the crystal structure is high-Mg calcite. Their skeletal axes are used for jewellery, rosary, amulet, etc. They are found mainly in the Japanese coast, the Mediterranean and off the Midway Islands and they are distributed at a depth of 100 m to 1500m. The growing skeletons of precious corals have potential for recording environmental change. Pb-210 is a naturally occurring radionuclide with a half-life of 22.3 years. Pb-210 is a natural sediment marker suitable for dating events that have occurred over the past 100 years and has been used to measure the sedimentation rates of lake and coastal marine sediments. The objectives of this study were to measure the Pb-210 concentration in the skeletons of Japanese red coral, pink coral and white coral and to estimate the radial growth rate using Pb-210 dating method. The radial growth rate of the skeleton can be estimated by the gradual decrease in Pb-210 concentrations measured from the surface inwards. The radial growth rate of the pink coral skeleton (Corallium elatius), collected at depths of 200 to 300 m off the coast of the Ryukyu Islands, Japan, was 0.15 mm/year, so slow that it would take as long as 50 years for a colony to grow to 15 mm in diameter.

  4. Atmospheric deposition patterns of (210)Pb and (7)Be in Cienfuegos, Cuba.

    Science.gov (United States)

    Alonso-Hernández, Carlos M; Morera-Gómez, Yasser; Cartas-Águila, Héctor; Guillén-Arruebarrena, Aniel

    2014-12-01

    The radiometric composition of bulk deposition samples, collected monthly for one year, February 2010 until January 2011, at a site located in Cienfuegos (22° 03' N, 80° 29' W) (Cuba), are analysed in this paper. Measurement of (7)Be and (210)Pb activity concentrations were carried out in 12 bulk deposition samples. The atmospheric deposition fluxes of (7)Be and (210)Pb are in the range of 13.2-132 and 1.24-8.29 Bq m(-2), and their mean values are: 56.6 and 3.97 Bq m(-2), respectively. The time variations of the different radionuclide have been discussed in relation with meteorological factors and the mean values have been compared to those published in recent literature from other sites located at different latitudes. The annual average flux of (210)Pb and (7)Be were 47 and 700 Bq m(-2) y(-1), respectively. Observed seasonal variations of deposition data are explained in terms of different environmental features. The atmospheric deposition fluxes of (7)Be and (210)Pb were moderately well correlated with precipitation and well correlated with one another. The (210)Pb/(7)Be ratios in the monthly depositions samples varied in the range of 0.05-0.10 and showed a strong correlation with the number of rainy days. Copyright © 2014 Elsevier Ltd. All rights reserved.

  5. Determination of 210Pb, 210Po, 226Ra, 228Ra and uranium isotopes in drinking water in order to comply with the requirements of the EU ‘Drinking Water Directive.

    Science.gov (United States)

    Vasile, M; Loots, H; Jacobs, K; Verheyen, L; Sneyers, L; Verrezen, F; Bruggeman, M

    2016-03-01

    The European Union published in 2013 a new Drinking Water Directive with stricter requirements for measuring natural radioactivity. In order to adhere to this, a method for sequential separation of 210Pb, 210Po, 238U and 234U in drinking water was applied using UTEVA® and Sr resins. Polonium-210, 238U and 234U were quantified using alpha-particle spectrometry and 210Pb using liquid scintillation counting. Radium-226 and 228Ra were determined using 3M Empore Radium RAD Disks, and their quantification was done using a Quantulus™ 1220 liquid scintillation counter.

  6. Study of the particulate matter transfer and dumping using {sup 210} Po et le {sup 210} Pb. Application to the Gulf of Biscary (NE Atlantic Ocean) and the Gulf of Lion (NW Mediterranean Sea) continental margins; Etude du transfert et du depot du materiel particulaire par le {sup 210} Po et le {sup 210} Pb. Application aux marges continentales du Golfe de Gascogne (NE Atlantique) et du Golfe du Lion (NW Mediterranee)

    Energy Technology Data Exchange (ETDEWEB)

    Radakovitch, O.

    1995-07-07

    {sup 210} Po and {sup 210} Pb activities and fluxes were measured on seawater, sediment-trapped material collected during one year and sediment. Focalization of {sup 210} Pb is clearly noticed on the Cap-Ferret canyon (Gulf of Biscary) and the Lacaze-Duthiers canyon (western part of the Gulf of Lion). In both sites, {sup 210} Pb fluxes in traps and sediment are always higher than {sup 210} Pb flux available from atmospheric and in situ production. On the contrary, Grand-Rhone canyon and its adjacent open slope exhibit a {sup 210} Pb budget near equilibrium in the near-bottom sediment traps, but focalization is important in the sediment. For the entire Gulf of Lion margin, focalization of {sup 210} Pb in the sediment occurred principally between 500 and 1500 m water depth on the slope, and on the middle shelf mud-patch. {sup 210} Po and {sup 210} Pb have been used in the Cap Ferret and Grand-Rhone canyons to characterize the origin of the particulate trapped material. Two main sources feed the water column. The first source, localized in surface waters, is constituted by biogenic particles from primary production and lithogenic material. The second source, deeper, is due to resuspension at the shelf break and/or on the open slope. In each site, {sup 210} Po and {sup 210} Pb activities of the trapped particles did not show any relations with the major constituents. Quantity of particles appeared to be the main factor regulating adsorption processes of these nuclides. Sedimentation rates based on {sup 210} Po profiles decreased with increasing water depth, from 0.4 ti 0.06 cm y-1 on the Cap Ferret canyon (400 to 3000 m water depth) and from 0.5 to 0.05 cm y-1 for the entire Gulf of Lion margin (50 to 2000 m water depth). (author). 243 refs.

  7. Linking sedimentary total organic carbon to 210Pbex chronology from Changshou Lake in the Three Gorges Reservoir Region, China.

    Science.gov (United States)

    Anjum, Raheel; Gao, Jinzhang; Tang, Qiang; He, Xiubin; Zhang, Xinbao; Long, Yi; Shi, Zhonglin; Wang, Mingfeng

    2017-05-01

    The influences of total organic carbon (TOC) and total nitrogen (TN) on Lead-210 (210Pb) dating have recently been of increasing concern in lacustrine research. Sediment core from Changshou Lake in the Longxi catchment was investigated for influence of TOC on 210Pb dating. Lead-210 excess (210Pbex), Cesium-137 (137Cs) activities, TOC, TN, and particle size were measured. We proposed a dating index based on 137Cs chronology and particle size distribution of the lake sediment profile and rainfall erosivities calculated from Longxi catchment metrological records. Increasing trends in TOC and TN were specifically caused by commercial cage fish farming after 1989. The statistically significant correlation between 210Pbex activity, TOC (0.61, p = 0.04) and TN (0.51, p = 0.04), respectively explained post-1989 210Pb scavenging. The 210Pbex activity was closely related with coupled peaks of TOC and TN from mass depth 5-10 g cm-2. Higher TOC/TN ratio (8.33) indicated submerged macrophytes and native aquatic algal growth as main source of carbon from enhanced primary productivity because of massive fertilizer use and coherent climate warming. The study supported key hypothesis on vital role of fertilizer usage and algal derived TOC in controlling sedimentary 210Pbex activity at Changshou Lake sediment. 137Cs profile and erosive events as time markers provided reliable and consistent sedimentation rate of (1.6 cm y-1). 210Pbex activity decayed exponentially after peak at mass depth 5.68 g cm-2. Therefore, violation of 210Pb dating primary assumptions made it inappropriate for sediment dating at Changshou Lake. TOC content must be considered while using 210Pb as dating tool for lake sediment profiles. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. {sup 210}Po in marine organisms consumed by the population of Seville; {sup 210}PO en organismos marinos consumidos por la poblacion sevillana

    Energy Technology Data Exchange (ETDEWEB)

    Diaz-Frances, I.; Mantero, J.; Manjon, G.; Garcia-Tenorio, R.

    2011-07-01

    The natural radionuclide {sup 210}Po is one belonging to the series of uranium, which is ubiquitously present in trace quantities in the various environmental compartments (water, soil, air) and through its route along the food chain may end incorporated into the human body via food or water intake. This radionuclide is highly radio toxic, presenting the highest value for the ingestion dose coefficient for adults. The Spanish population is an important component of their diet to marine products. found higher values of ingestion dose in the Spanish population compared to other European populations where the culture of introducing fish into your diet is not so entered. The study detailed here estimates the contribution of {sup 2}10Po to the ingestion dose received by the Sevillian population due to consumption of fish, mollusks and crustaceans. The results obtained in this study will be presented and discussed in this paper. (Author)

  9. Evaluation of the contribution of smoking to total blood polonium-210 in Saudi population

    Energy Technology Data Exchange (ETDEWEB)

    Shabana, E.I. E-mail: eshabana@kacst.edu.sa; Elaziz, M.A. Abd; Al-Arifi, M.N.; Al-Dhawailie, A.A.; Al-Bokari, M.M-A

    2000-01-01

    A preliminary study of {sup 210}Po concentrations in the blood of some smokers and nonsmokers is presented in order to evaluate the contribution of smoking to total blood {sup 210}Po in Saudi population. Blood samples were collected from 30 volunteers and analyzed by high resolution {alpha}-spectrometry using a radiochemical technique. The technique is based on the separation of polonium from other components of the sample by wet ashing with an HNO{sub 3}/H{sub 2}O{sub 2} oxidizing mixture and spontaneous deposition on a silver disc under the relevant conditions for {alpha}-particle counting. The results indicated that a significant fraction (about 30%) of blood {sup 210}Po is related to smoking.

  10. 137Cs and 210Po in Pacific Walrus and Bearded Seal from St. Lawrence Island, Alaska

    Energy Technology Data Exchange (ETDEWEB)

    Hamilton, T F; Seagars, D J; Jokela, T; Layton, D

    2005-02-02

    The activity concentration of Cesium-137 ({sup 137}Cs) and naturally-occurring Polonium-210 ({sup 210}Po) were measured in the muscle tissue, kidney and liver of Pacific walrus (Odobenus rosmarus divergens) and bearded seal (Erignathus barbatus) collected by native hunters from the Bering Sea. The mean {sup 137}Cs concentrations in muscle, liver and kidney of Pacific walrus were 0.07, 0.09 and 0.07 Bq kg{sup -1} (N= 5, wet weight), respectively, and 0.17, 0.10, and 0.17 Bq kg{sup -1} (N=2, wet weight), respectively, in bearded seal. In general, {sup 137}Cs tissue concentrations are significantly lower than those previously reported for mammals from other regions. By comparison, {sup 210}Po activity concentrations appear to be higher than those reported elsewhere but a larger variation. The mean {sup 210}Po concentration in the muscle tissue, liver and kidney of Pacific walrus (N=5, wet weight) were 28.7, 189, and 174 Bq kg{sup -1}, respectively. This compares with {sup 210}Po concentration values (N=2, wet weight) of 27, 207, and 68 Bq kg{sup -1} measured in the muscle tissue, liver and kidney, of bearded seal, respectively. Estimated bioaccumulation factors--as defined by the radionuclide concentration ratio between the target tissue to that in sea water--were two to three orders of magnitude higher for {sup 210}Po that those of {sup 137}Cs. We conclude from radiological dose estimates that ingestion of {sup 137}Cs in foods derived from walrus and seal will pose no threat to human health. This work has important implications for assessing health risks to Alaskan coastal communities concerned about the dumping of nuclear waste in the Russia Arctic.

  11. [sup 210]Po, [sup 210]Pb, [sup 226]Ra in aquatic ecosystems and polders, anthropogenic sources, distribution and enhanced radiation doses in The Netherlands

    Energy Technology Data Exchange (ETDEWEB)

    Koester, H.W.; Marwitz, P.A. (National Inst. of Public Health and Environmental Protection (RIVM), Bilthoven (Netherlands)); Berger, G.W. (Netherlands Inst. for Sea Research, Den Burg (Netherlands)); Weers, A.W. van (Netherlands Energy Research Foundation (ECN), Petten (Netherlands)); Hagel, P. (National Inst. of Fisheries Research (RIVO-DLO), Ijmuiden (Netherlands)); Nieuwenhuize, J. (Centre for Estuarine and Coastal Ecology, Yerseke (Netherlands))

    1992-01-01

    Surveys of Dutch waters show that the Oosterschelde estuary and regular fresh waters have the lowest levels of [sup 210]Po, [sup 210]Pb and [sup 226]Ra. Elsewhere effluents from phosphates and iron ore processing industries cause nearby enhancements. At a distance of 50-100 km, enhancements of [sup 210]Po in edible parts of mussels and shrimps are of the order of 100 Bq.kg[sup -1] dry weight. Estimates indicate that high consumption rates of seafood from specific waters may result in dose enhancements of 0.1-0.3 mSv.y[sup -1] which probably affect a group of less than 1000 anglers and an unknown number of frequent mussel and shrimp consumers. Harbour sludge, with probably enhanced activity levels due to the phospho-gypsum effluents, has been used as landfill in polders around Rotterdam. Here enhanced doses of 0.3-1 mSv.y[sup -1] may occur from consumption of local livestock produce and from inhalation of enhanced indoor radon. Further research is indicated to obtain information on effluent emissions, their associated environmental enhancements and risks. (author).

  12. Speech Quality Measurement of GSM Infrastructure Built on USRP N210 and OpenBTS Project

    Directory of Open Access Journals (Sweden)

    Marcel Fajkus

    2014-01-01

    Full Text Available The paper deals with the methodology for speech quality measuring in GSM networks using Perceptual Evaluation of Speech Quality (PESQ. The paper brings results of practical measurement of own GSM network build on the Universal Software Radio Peripheral (USRP N210 hardware and OpenBTS software. This OpenBTS station was installed in open terrain, and the speech quality was measured from different distances from the transmitter. The limit parameters of OpenBTS station with USRP N210 were obtained.

  13. 238U–230Th–226Ra–210Pb–210Po disequilibria constraints on magma generation, ascent, and degassing during the ongoing eruption of Kīlauea

    Science.gov (United States)

    Girard, Guillaume; Reagan, Mark K.; Sims, Kenneth W. W.; Thornber, Carl; Waters, Christopher L.; Phillips, Erin H.

    2017-01-01

    The timescales of magma genesis, ascent, storage and degassing at Kīlauea volcano, Hawai‘i are addressed by measuring 238U-series radionuclide abundances in lava and tephra erupted between 1982 and 2008. Most analyzed samples represent lavas erupted by steady effusion from Pu‘u ‘Ō‘ō and Kūpahianaha from 1983 to 2008. Also included are samples erupted at the summit in April 1982 and March 2008, along the East Rift Zone at the onset of the ongoing eruption in January 1983, and during vent shifting episodes 54 and 56, at Nāpau crater in January 1997, and Kane Nui O Hamo in June 2007. In general, samples have small (∼4%) excesses of (230Th) over (238U) and ∼3 to ∼17% excesses of (226Ra) over (230Th), consistent with melting of a garnet peridotite source at melting rates between 1 × 10–3 and 5 × 10–3 kg m–3 a–1, and melting region porosity between ∼2 and ∼10%, in agreement with previous studies of the ongoing eruption and historical eruptions. A small subset of samples has near-equilibrium (230Th/238U) values, and thus were generated at higher melting rates. Based on U–Th–Ra disequilibria and Th isotopic data from this and earlier studies, melting processes and sources have been relatively stable over at least the past two centuries or more, including during the ongoing unusually long (>30 years) and voluminous (4 km3) eruption. Lavas recently erupted from the East Rift Zone have average initial (210Pb/226Ra) values of 0·80 ± 0·11 (1σ), which we interpret to be the result of partitioning of 222Rn into a persistently generated CO2-rich gas phase over a minimum of 8 years. This (210Pb) deficit implies an average magma ascent rate of ≤3·7 km a–1 from ∼30 km depth to the surface. Spatter and lava associated with vent-opening episodes erupt with variable (210Pb) deficits ranging from 0·7 to near-equilibrium values in some samples. The samples with near-equilibrium (210Pb/226Ra) are typically more

  14. 40 CFR 5.210 - Military and merchant marine educational institutions.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Military and merchant marine... FINANCIAL ASSISTANCE Coverage § 5.210 Military and merchant marine educational institutions. These Title IX... for a military service of the United States or for the merchant marine. ...

  15. 6 CFR 17.210 - Military and merchant marine educational institutions.

    Science.gov (United States)

    2010-01-01

    ... 6 Domestic Security 1 2010-01-01 2010-01-01 false Military and merchant marine educational... Coverage § 17.210 Military and merchant marine educational institutions. These Title IX regulations do not... service of the United States or for the merchant marine. ...

  16. 24 CFR 3.210 - Military and merchant marine educational institutions.

    Science.gov (United States)

    2010-04-01

    ... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Military and merchant marine... ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Coverage § 3.210 Military and merchant marine educational... the training of individuals for a military service of the United States or for the merchant marine. ...

  17. 22 CFR 146.210 - Military and merchant marine educational institutions.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Military and merchant marine educational... § 146.210 Military and merchant marine educational institutions. These Title IX regulations do not apply... service of the United States or for the merchant marine. ...

  18. 14 CFR 1253.210 - Military and merchant marine educational institutions.

    Science.gov (United States)

    2010-01-01

    ... 14 Aeronautics and Space 5 2010-01-01 2010-01-01 false Military and merchant marine educational... Coverage § 1253.210 Military and merchant marine educational institutions. These Title IX regulations do... military service of the United States or for the merchant marine. ...

  19. 15 CFR 8a.210 - Military and merchant marine educational institutions.

    Science.gov (United States)

    2010-01-01

    ... 15 Commerce and Foreign Trade 1 2010-01-01 2010-01-01 false Military and merchant marine... Coverage § 8a.210 Military and merchant marine educational institutions. These Title IX regulations do not... service of the United States or for the merchant marine. ...

  20. 43 CFR 41.210 - Military and merchant marine educational institutions.

    Science.gov (United States)

    2010-10-01

    ... 43 Public Lands: Interior 1 2010-10-01 2010-10-01 false Military and merchant marine educational... Coverage § 41.210 Military and merchant marine educational institutions. These Title IX regulations do not... service of the United States or for the merchant marine. ...

  1. 13 CFR 113.210 - Military and merchant marine educational institutions.

    Science.gov (United States)

    2010-01-01

    ... 13 Business Credit and Assistance 1 2010-01-01 2010-01-01 false Military and merchant marine... Financial Assistance Coverage § 113.210 Military and merchant marine educational institutions. These Title... individuals for a military service of the United States or for the merchant marine. ...

  2. 22 CFR 229.210 - Military and merchant marine educational institutions.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Military and merchant marine educational... Coverage § 229.210 Military and merchant marine educational institutions. These Title IX regulations do not... service of the United States or for the merchant marine. ...

  3. 36 CFR 1211.210 - Military and merchant marine educational institutions.

    Science.gov (United States)

    2010-07-01

    ... 36 Parks, Forests, and Public Property 3 2010-07-01 2010-07-01 false Military and merchant marine... ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Coverage § 1211.210 Military and merchant marine... purpose is the training of individuals for a military service of the United States or for the merchant...

  4. 41 CFR 101-4.210 - Military and merchant marine educational institutions.

    Science.gov (United States)

    2010-07-01

    ... Coverage § 101-4.210 Military and merchant marine educational institutions. These Title IX regulations do... military service of the United States or for the merchant marine. ... 41 Public Contracts and Property Management 2 2010-07-01 2010-07-01 true Military and merchant...

  5. 32 CFR 196.210 - Military and merchant marine educational institutions.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Military and merchant marine educational... OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Coverage § 196.210 Military and merchant marine... purpose is the training of individuals for a military service of the United States or for the merchant...

  6. 45 CFR 618.210 - Military and merchant marine educational institutions.

    Science.gov (United States)

    2010-10-01

    ... 45 Public Welfare 3 2010-10-01 2010-10-01 false Military and merchant marine educational... RECEIVING FEDERAL FINANCIAL ASSISTANCE Coverage § 618.210 Military and merchant marine educational... the training of individuals for a military service of the United States or for the merchant marine. ...

  7. 49 CFR 25.210 - Military and merchant marine educational institutions.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 1 2010-10-01 2010-10-01 false Military and merchant marine educational... Coverage § 25.210 Military and merchant marine educational institutions. These Title IX regulations do not... service of the United States or for the merchant marine. ...

  8. 45 CFR 2555.210 - Military and merchant marine educational institutions.

    Science.gov (United States)

    2010-10-01

    ... 45 Public Welfare 4 2010-10-01 2010-10-01 false Military and merchant marine educational... ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Coverage § 2555.210 Military and merchant marine... purpose is the training of individuals for a military service of the United States or for the merchant...

  9. 10 CFR 1042.210 - Military and merchant marine educational institutions.

    Science.gov (United States)

    2010-01-01

    ... 10 Energy 4 2010-01-01 2010-01-01 false Military and merchant marine educational institutions....210 Military and merchant marine educational institutions. These Title IX regulations do not apply to... service of the United States or for the merchant marine. ...

  10. 18 CFR 1317.210 - Military and merchant marine educational institutions.

    Science.gov (United States)

    2010-04-01

    ... RECEIVING FEDERAL FINANCIAL ASSISTANCE Coverage § 1317.210 Military and merchant marine educational... the training of individuals for a military service of the United States or for the merchant marine. ... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Military and merchant...

  11. 38 CFR 23.210 - Military and merchant marine educational institutions.

    Science.gov (United States)

    2010-07-01

    ... ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Coverage § 23.210 Military and merchant marine educational... the training of individuals for a military service of the United States or for the merchant marine. ... 38 Pensions, Bonuses, and Veterans' Relief 2 2010-07-01 2010-07-01 false Military and merchant...

  12. 31 CFR 28.210 - Military and merchant marine educational institutions.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 1 2010-07-01 2010-07-01 false Military and merchant marine... FINANCIAL ASSISTANCE Coverage § 28.210 Military and merchant marine educational institutions. These Title IX... for a military service of the United States or for the merchant marine. ...

  13. 49 CFR 210.29 - Operation standards (moving locomotives and rail cars).

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Operation standards (moving locomotives and rail... REGULATIONS Inspection and Testing § 210.29 Operation standards (moving locomotives and rail cars). The operation standards for the noise emission levels of moving locomotives, rail cars, or consists of...

  14. 17 CFR 210.12-29 - Mortgage loans on real estate. 1

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Mortgage loans on real estate... § 210.12-29 Mortgage loans on real estate. 1 Column A—Description 2,3,4 Column B—Interest rate Column C... mortgage loans on real estate investments has been written down or reserved against, describe the item and...

  15. 17 CFR 210.12-24 - Real estate owned and rental income. 1

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Real estate owned and rental... § 210.12-24 Real estate owned and rental income. 1 Part 1—Real estate owned at end of period Column A... In a separate schedule classify by states in which the real estate owned is located the total amounts...

  16. 17 CFR 210.3-15 - Special provisions as to real estate investment trusts.

    Science.gov (United States)

    2010-04-01

    ... Financial Statements § 210.3-15 Special provisions as to real estate investment trusts. (a)(1) The income... real estate investment trust under applicable provisions of the Internal Revenue Code as amended shall... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Special provisions as to real...

  17. Yeast Interacting Proteins Database: YOR210W, YDR527W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YOR210W RPB10 RNA polymerase subunit ABC10-beta, common to RNA polymerases I, II, and III Rows with this...description RNA polymerase subunit ABC10-beta, common to RNA polymerases I, II, and III Rows with this

  18. 17 CFR 210.6A-05 - What schedules are to be filed.

    Science.gov (United States)

    2010-04-01

    ... ACT OF 1934, PUBLIC UTILITY HOLDING COMPANY ACT OF 1935, INVESTMENT COMPANY ACT OF 1940, INVESTMENT ADVISERS ACT OF 1940, AND ENERGY POLICY AND CONSERVATION ACT OF 1975 Employee Stock Purchase, Savings and... audited. Schedule I—Investments. A schedule substantially in form prescribed by § 210.12-12 shall be filed...

  19. 17 CFR 210.2-02 - Accountants' reports and attestation reports.

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Accountants' reports and... Accountants § 210.2-02 Accountants' reports and attestation reports. (a) Technical requirements for accountants' reports. The accountant's report: (1) Shall be dated; (2) Shall be signed manually; (3) Shall...

  20. Acute hypoxia induces upregulation of microRNA-210 expression in glioblastoma spheroids

    DEFF Research Database (Denmark)

    Rosenberg, Tine Agerbo; Thomassen, Mads; Jensen, Stine Skov

    2015-01-01

    & METHODS: Glioblastoma spheroid cultures were grown in either 2 or 21% oxygen. Subsequently, miRNA profiling was performed and expression of ten stem cell markers was examined. RESULTS: MiRNA-210 was significantly upregulated in hypoxia in patient-derived spheroids. The stem cell markers displayed...

  1. 30 CFR 285.210 - How does MMS initiate the competitive leasing process?

    Science.gov (United States)

    2010-07-01

    ..., or more specific schedule of lease sales pertaining to one or more types of renewable energy. ... OFFSHORE RENEWABLE ENERGY ALTERNATE USES OF EXISTING FACILITIES ON THE OUTER CONTINENTAL SHELF Issuance of OCS Renewable Energy Leases Competitive Lease Process § 285.210 How does MMS initiate the competitive...

  2. 30 CFR 210.102 - What production reports must I submit?

    Science.gov (United States)

    2010-07-01

    ... MANAGEMENT FORMS AND REPORTS Production Reports-Oil and Gas § 210.102 What production reports must I submit? (a) Form MMS-4054, Oil and Gas Operations Report. If you operate a Federal or Indian onshore or OCS oil and gas lease or federally approved unit or communitization agreement that contains one or more...

  3. 17 CFR 210.3A-03 - Statement as to principles of consolidation or combination followed.

    Science.gov (United States)

    2010-04-01

    ... separate financial statements, including the principles followed in determining the inclusion or exclusion... AND EXCHANGE COMMISSION FORM AND CONTENT OF AND REQUIREMENTS FOR FINANCIAL STATEMENTS, SECURITIES ACT... Consolidated and Combined Financial Statements § 210.3A-03 Statement as to principles of consolidation or...

  4. 32 CFR 37.210 - To what types of recipients may I award a TIA?

    Science.gov (United States)

    2010-07-01

    ... GRANT AND AGREEMENT REGULATIONS TECHNOLOGY INVESTMENT AGREEMENTS Appropriate Use of Technology Investment Agreements § 37.210 To what types of recipients may I award a TIA? (a) As a matter of DoD policy... potential for additional self-governance is particularly good when a consortium includes multiple for-profit...

  5. 17 CFR 210.6-10 - What schedules are to be filed.

    Science.gov (United States)

    2010-04-01

    ... ACT OF 1934, PUBLIC UTILITY HOLDING COMPANY ACT OF 1935, INVESTMENT COMPANY ACT OF 1940, INVESTMENT ADVISERS ACT OF 1940, AND ENERGY POLICY AND CONSERVATION ACT OF 1975 Registered Investment Companies § 210...) Management investment companies. (1) Except as otherwise provided in the applicable form, the schedules...

  6. {sup 137}Cs and {sup 210}Pb inventories in soils and sediments from Chapala Lake (Mexico)

    Energy Technology Data Exchange (ETDEWEB)

    Ruiz-Fernandez, A.C.; Perez-Bernal, L.H. [Unidad Academica Mazatlan, Instituto de Ciencias del Mar y Limnologia, Universidad Nacional Autonoma de Mexico (Mexico); Sanchez-Cabeza, J.A. [Unidad Academica de Procesos Oceanicos y Costeros, Instituto de Ciencias del Mar y Limnologia, Universidad Nacional Autonoma de Mexico (Mexico); Ontiveros-Cuadras, J.F. [Posgrado en Ciencias del Mar y Limnologia, Instituto de Ciencias del Mar y Limnologia, Universidad Nacional Autonoma de Mexico (Mexico)

    2014-07-01

    Chapala Lake is the largest natural freshwater reservoir in Mexico and it is located in Central Mexico, at 1524 m above sea level. The lake is considered to be fairly anthropized and it has experienced periods of extremely low water level as a result of recent climate change and water extraction. The study of recent manifestations of global change in Chapala Lake requires accurate {sup 210}Pb chronological reconstructions, taking into account the expected variability of sediment accumulation rates by using the Constant Flux model. For a reliable application of this dating model, it is important that {sup 210}Pb flux values in the lacustrine sedimentary record are in correspondence with the local atmospheric fluxes. With the aim to estimate the fluxes of the fallout radionuclides {sup 210}Pb and {sup 137}Cs in the region, sediment and soil cores were collected in the Chapala Lake. Sediment profiles were evaluated and estimated fluxes in sediments and soils were compared. Some geochemical properties (e.g. grain size distribution, organic matter concentration, XRF-derived elemental composition and magnetic susceptibility) were also evaluated to understand how diagenesis changes and sediment provenance can affect the {sup 210}Pb and {sup 137}Cs depth profiles and inventories. Document available in abstract form only. (authors)

  7. Beryllium-7 and {sup 210}Pb atmospheric deposition measured in moss and dependence on cumulative precipitation

    Energy Technology Data Exchange (ETDEWEB)

    Krmar, M., E-mail: krmar@df.uns.ac.rs [Faculty of Science, Physics Department, Trg Dositeja Obradovića 4, Novi Sad (Serbia); Mihailović, D.T.; Arsenić, I. [Faculty of Agriculture, Trg Dositeja Obradovića 8, Novi Sad (Serbia); Radnović, D. [Faculty of Science, Biology Department, Trg Dositeja Obradovića 4, Novi Sad (Serbia); Pap, I. [Faculty of Agriculture, Trg Dositeja Obradovića 8, Novi Sad (Serbia)

    2016-01-15

    This paper focuses on analysis of the time series of {sup 7}Be and {sup 210}Pb activity measured in moss, and the amount, as well as duration of precipitation, to gain a better understanding of the possible relationships between airborne radionuclide deposition and precipitation. Here we consider whether the amount of these airborne radionuclides in moss samples is a cumulative measure of radionuclide deposition and decay, and a new approach for analyses of the relationships between precipitation and moss activity concentrations is suggested. Through these analyses it was shown that comparison of cumulative activity measured at one location using moss, normalized by values of cumulative amount or duration of precipitation, showed different regimes of airborne radionuclide deposition. - Graphical abstract: Correlation between cumulative activity of {sup 7}Be and {sup 210}Pb measured in moss samples normalized by the cumulative precipitation. - Highlights: • Use of mosses in measurement of airborne radionuclides deposition was investigated • Prior work indicated {sup 7}Be and {sup 210}Pb activities were not correlated with precipitation • This is unusual since radionuclides moss tissues depends on depositional fluxes. • A new method for study of {sup 7}Be and {sup 210}Pb depositional dynamics was developed • Different seasonal regimes of {sup 7}Be deposition are more noticeable in new technique.

  8. Sedimentation rates in Atibaia River basin, Sao Paulo State, Brazil, using {sup 210}Pb as geochronometer

    Energy Technology Data Exchange (ETDEWEB)

    Sabaris, T.P.P. [Departamento de Petrologia e Metalogenia, Universidade Estadual Paulista (UNESP), Av. 24-A, No. 1515, C.P. 178, CEP 13506-900, Rio Claro, Sao Paulo (Brazil); Bonotto, D.M., E-mail: danielbonotto@yahoo.com.b [Departamento de Petrologia e Metalogenia, Universidade Estadual Paulista (UNESP), Av. 24-A, No. 1515, C.P. 178, CEP 13506-900, Rio Claro, Sao Paulo (Brazil)

    2011-01-15

    The constant initial concentration (CIC) of unsupported/excess {sup 210}Pb model was successfully used to assess {sup 210}Pb data of nine sediment cores from Atibaia River basin, Sao Paulo State, Brazil. The {sup 210}Pb-based apparent sediment mass accumulation rates ranged from 47.7 to 782.4 mg/cm{sup 2} yr, whereas the average linear sedimentation rates between 0.16 and 1.32 cm/yr, which are compatible with the calculated sediment mass fluxes, i.e. a higher sediment mass accumulation rate yielded a higher linear sedimentation rate. The higher long-term based accumulation rate tended to be found in topographically softer regions. This occurs because the sediments are preferentially transported in topographically steeper regions instead of being deposited. Anthropic activities like deforestation possibly interfered with the natural/normal sedimentation processes, which increased in accordance with modifications on the channel drainage. The radionuclide geochronology as described in this paper allows determination of sedimentation rates that are compatible with values estimated elsewhere. The adoption of an appropriate factor generated from previous laboratory experiments resulted in a successful correction for the {sup 222}Rn-loss from the sediments, bringing the estimate of the parent-supported (in-situ produced) {sup 210}Pb to reliable values required by the CIC model.

  9. 19 CFR 210.30 - Requests for production of documents and things and entry upon land.

    Science.gov (United States)

    2010-04-01

    ... INVESTIGATIONS OF UNFAIR PRACTICES IN IMPORT TRADE ADJUDICATION AND ENFORCEMENT Discovery and Compulsory Process..., charts, photographs, and other data compilations from which information can be obtained), or to inspect... operation thereon, within the scope of § 210.27(b). (b) Procedure. (1) The request may be served upon any...

  10. 23 CFR 972.210 - Federal lands bridge management system (BMS).

    Science.gov (United States)

    2010-04-01

    ... Section 972.210 Highways FEDERAL HIGHWAY ADMINISTRATION, DEPARTMENT OF TRANSPORTATION FEDERAL LANDS HIGHWAYS FISH AND WILDLIFE SERVICE MANAGEMENT SYSTEMS Fish and Wildlife Service Management Systems § 972... framework for a BMS: (1) A database and an ongoing program for the collection and maintenance of the...

  11. 21 CFR 210.1 - Status of current good manufacturing practice regulations.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 4 2010-04-01 2010-04-01 false Status of current good manufacturing practice... SERVICES (CONTINUED) DRUGS: GENERAL CURRENT GOOD MANUFACTURING PRACTICE IN MANUFACTURING, PROCESSING, PACKING, OR HOLDING OF DRUGS; GENERAL § 210.1 Status of current good manufacturing practice regulations...

  12. 21 CFR 210.2 - Applicability of current good manufacturing practice regulations.

    Science.gov (United States)

    2010-04-01

    ... AND HUMAN SERVICES (CONTINUED) DRUGS: GENERAL CURRENT GOOD MANUFACTURING PRACTICE IN MANUFACTURING, PROCESSING, PACKING, OR HOLDING OF DRUGS; GENERAL § 210.2 Applicability of current good manufacturing... 21 Food and Drugs 4 2010-04-01 2010-04-01 false Applicability of current good manufacturing...

  13. 42 CFR 3.210 - Required disclosure of patient safety work product to the Secretary.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Required disclosure of patient safety work product... HUMAN SERVICES GENERAL PROVISIONS PATIENT SAFETY ORGANIZATIONS AND PATIENT SAFETY WORK PRODUCT Confidentiality and Privilege Protections of Patient Safety Work Product § 3.210 Required disclosure of patient...

  14. 33 CFR 96.210 - Who does this subpart apply to?

    Science.gov (United States)

    2010-07-01

    ... VESSEL OPERATING REGULATIONS RULES FOR THE SAFE OPERATION OF VESSELS AND SAFETY MANAGEMENT SYSTEMS Company and Vessel Safety Management Systems § 96.210 Who does this subpart apply to? (a) This subpart... foreign voyage that are— (i) A vessel transporting more than 12 passengers; or (ii) A tanker, a bulk...

  15. Broadening the absorption bandwidth of metamaterial absorbers by transverse magnetic harmonics of 210 mode

    Science.gov (United States)

    Long, Chang; Yin, Sheng; Wang, Wei; Li, Wei; Zhu, Jianfei; Guan, Jianguo

    2016-01-01

    By investigating a square-shaped metamaterial structure we discover that wave diffraction at diagonal corners of such a structure excites transverse magnetic harmonics of 210 mode (TM210 harmonics). Multi-layer overlapping and deliberately regulating period length between adjacent unit cells can significantly enhance TM210 harmonics, leading to a strong absorption waveband. On such a basis, a design strategy is proposed to achieve broadband, thin-thickness multi-layered metamaterial absorbers (MMAs). In this strategy big pyramidal arrays placed in the “white blanks” of a chessboard exhibit two isolated absorption bands due to their fundamental and TM210 harmonics, which are further connected by another absorption band from small pyramidal arrays in the “black blanks” of the chessboard. The as-designed MMA at a total thickness (h) of 4.36 mm shows an absorption of above 0.9 in the whole frequency range of 7–18 GHz, which is 38% broader with respect to previous design methods at the same h. This strategy provides an effective route to extend the absorption bandwidth of MMAs without increasing h. PMID:26888365

  16. The 226 Ra, 210 Pb and essential elements bioavailability to pines at Urgeirica uranium mill tailings

    Energy Technology Data Exchange (ETDEWEB)

    Madruga, M.J.; Faria, I. [Nuclear and Technological Institute, Dept. of Radiological Protection and Nuclear Safety (Portugal)

    2006-07-01

    The objective of this study is to correlate the uptake of the natural radilides {sup 226}Ra and {sup 210}Pb with the essential elements, potassium, calcium and magnesium in the pines growing at the 'Urgeirica uranium mill tailings. It can be concluded that the potassium, calcium and magnesium mean concentration ratio values are, about two to three orders of magnitude, higher than the values obtained to {sup 226}Ra and {sup 210}Pb for pines growing on the Urgeirica uranium mill tailings. The concentration ratio values higher than 1 obtained to the potassium, calcium and magnesium elements indicate that pines are behaving as accumulators to these elements. Contrarily, the {sup 226}Ra and {sup 210}Pb concentration ratio values lower than 1 indicates that pines are behaving as excluders to these radionuclides. So, it can be concluded that this kind of plants is not suitable to a phyto remediation strategy. In general, a marginally significant correlation was observed between the potassium, calcium and magnesium concentrations, the cation-exchange capacity and the ph in the tailings and the {sup 226}Ra and {sup 210}Pb pines/tailings concentration ratios. (N.C.)

  17. C2H4 adsorption on Cu(210), revisited: bonding nature and coverage effects.

    Science.gov (United States)

    Amino, Shuichi; Arguelles, Elvis; Agerico Diño, Wilson; Okada, Michio; Kasai, Hideaki

    2016-08-24

    With the aid of density functional theory (DFT)-based calculations, we investigate the adsorption of C2H4 on Cu(210). We found two C2H4 adsorption sites, viz., the top of the step-edge atom (S) and the long bridge between two step-edge atoms (SS) of Cu(210). The step-edge atoms on Cu(210) block the otherwise active terrace sites found on copper surfaces with longer step sizes. This results in the preference for π-bonded over di-σ-bonded C2H4. We also found two stable C2H4 adsorption orientations on the S- and SS-sites, viz., with the C2H4 C[double bond, length as m-dash]C bond parallel (fit) and perpendicular (cross) to [001]. Furthermore, we found that the three peaks observed in previous temperature programmed desorption (TPD) experiment [Surf. Sci., 2011, 605, 934-940] could be attributed to C2H4 in the S-fit or S-cross, S-fit and S-cross-fit (S-cross and S-fit configurations that both exist in the same unit cell) configurations on Cu(210).

  18. Low-level gamma-ray spectrometry for the determination of 210Pb

    DEFF Research Database (Denmark)

    Markovic, Nikola; Roos, Per; Nielsen, Sven Poul

    2017-01-01

    A well High purity germanium (HPGe) gamma spectrometer with NaI(Tl) Compton anticoincidence shield recently installed at DTU Nutech and specially designed for low-level measurements was used for the 210Pb determination in environmental samples. The system is compared to standard stand-alone HPGe...

  19. 24 CFR 570.210 - Prohibition on use of assistance for employment relocation activities.

    Science.gov (United States)

    2010-04-01

    ... DEVELOPMENT BLOCK GRANTS Eligible Activities § 570.210 Prohibition on use of assistance for employment relocation activities. (a) Prohibition. CDBG funds may not be used to directly assist a business, including a business expansion, in the relocation of a plant, facility, or operation from one LMA to another LMA if the...

  20. 17 CFR 210.3A-04 - Intercompany items and transactions.

    Science.gov (United States)

    2010-04-01

    ... Financial Statements § 210.3A-04 Intercompany items and transactions. In general, there shall be eliminated intercompany items and transactions between persons included in the (a) consolidated financial statements being... FORM AND CONTENT OF AND REQUIREMENTS FOR FINANCIAL STATEMENTS, SECURITIES ACT OF 1933, SECURITIES...

  1. 17 CFR 210.5-04 - What schedules are to be filed.

    Science.gov (United States)

    2010-04-01

    ... reflected in the audited consolidated financial statements required by §§ 210.3-01 and 3-02. The schedule... AND CONTENT OF AND REQUIREMENTS FOR FINANCIAL STATEMENTS, SECURITIES ACT OF 1933, SECURITIES EXCHANGE... shown in the related financial statement or in a note thereto without making such statement unclear or...

  2. 17 CFR 210.3A-05 - Special requirements as to public utility holding companies.

    Science.gov (United States)

    2010-04-01

    ... Consolidated and Combined Financial Statements § 210.3A-05 Special requirements as to public utility holding companies. There shall be shown in the consolidated balance sheet of a public utility holding company the... SECURITIES AND EXCHANGE COMMISSION FORM AND CONTENT OF AND REQUIREMENTS FOR FINANCIAL STATEMENTS, SECURITIES...

  3. 17 CFR 210.3-02 - Consolidated statements of income and changes in financial positions.

    Science.gov (United States)

    2010-04-01

    ... General Instructions As to Financial Statements § 210.3-02 Consolidated statements of income and changes... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Consolidated statements of... SECURITIES AND EXCHANGE COMMISSION FORM AND CONTENT OF AND REQUIREMENTS FOR FINANCIAL STATEMENTS, SECURITIES...

  4. 17 CFR 210.7-05 - What schedules are to be filed.

    Science.gov (United States)

    2010-04-01

    ... the audited consolidated financial statements required by §§ 210.3-01 and 3-02. The schedule may be... AND CONTENT OF AND REQUIREMENTS FOR FINANCIAL STATEMENTS, SECURITIES ACT OF 1933, SECURITIES EXCHANGE... notes thereto) may be shown in the related financial statement or in a note thereto without making such...

  5. Nuclear pore complex assembly and maintenance in POM121- and gp210-deficient cells

    DEFF Research Database (Denmark)

    Stavru, Fabrizia; Nautrup-Pedersen, Gitte; Cordes, Volker C

    2006-01-01

    So far, POM121 and gp210 are the only known anchoring sites of vertebrate nuclear pore complexes (NPCs) within the lipid bilayer of the nuclear envelope (NE) and, thus, are excellent candidates for initiating the NPC assembly process. Indeed, we demonstrate that POM121 can recruit several nucleop...

  6. 29 CFR 780.210 - The typical hatchery operations constitute “agriculture.”

    Science.gov (United States)

    2010-07-01

    ... EXEMPTIONS APPLICABLE TO AGRICULTURE, PROCESSING OF AGRICULTURAL COMMODITIES, AND RELATED SUBJECTS UNDER THE FAIR LABOR STANDARDS ACT Agriculture as It Relates to Specific Situations Hatchery Operations § 780.210 The typical hatchery operations constitute “agriculture.” As stated in § 780.127, the typical hatchery...

  7. 20 CFR 411.210 - What happens if I do not make timely progress toward self-supporting employment?

    Science.gov (United States)

    2010-04-01

    ... toward self-supporting employment? 411.210 Section 411.210 Employees' Benefits SOCIAL SECURITY... timely progress toward self-supporting employment? (a) General. If it is determined that you are not making timely progress toward self-supporting employment, we will find that you are no longer using a...

  8. 40 CFR 2.210 - Nondisclosure for reasons other than business confidentiality or where disclosure is prohibited...

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Nondisclosure for reasons other than business confidentiality or where disclosure is prohibited by other statute. 2.210 Section 2.210 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GENERAL PUBLIC INFORMATION Confidentiality of Business...

  9. The stellar content of the isolated transition dwarf galaxy DDO210

    Science.gov (United States)

    McConnachie, Alan W.; Arimoto, Nobuo; Irwin, Mike; Tolstoy, Eline

    2006-12-01

    We use Subaru Suprime-Cam and VLT FORS1 photometry of the dwarf galaxy DDO210 to study the global stellar content and structural properties of a transition-type galaxy (with properties intermediate between dwarf irregular and dwarf spheroidal systems). This galaxy is sufficiently isolated that tidal interactions are not likely to have affected its evolution in any way. The colour-magnitude diagrams of DDO210 show a red giant branch (RGB) population (with an RGB bump), a bright asymptotic giant branch population, a red clump, young main-sequence stars and blue-loop stars. The youngest stars formed within the last 60Myr and have a distinct radial distribution compared to the main population. Whereas the overall stellar spatial distribution and HI spatial distribution are concentric, the young stars are offset from the centre of DDO210 and are coincident with a `dent' in the HI distribution. The implied recent star formation rate required to form the young population is significantly higher than the derived current star formation rate, by a factor of >10. Most of the stars in DDO210 are found in a red clump, and its mean I-band magnitude suggests that the majority of stars in DDO210 have an average age of 4+2-1Gyr. Given this age, the colour of the RGB implies a mean metallicity of [Fe/H] ~= -1.3. By comparing the shape of the red clump with models for a variety of star formation histories, we estimate that an old (>10 Gyr) stellar population can contribute ~20-30 per cent of the stars in DDO210 at most. The unusual star formation history of DDO210, its low-mass estimate and its isolated nature, provide insight into how star formation proceeds in the lowest mass, unperturbed, dwarf galaxy haloes. Based in part on data collected at Subaru Telescope, which is operated by the National Astronomical Observatory of Japan E-mail: alan@uvic.ca

  10. (210)Pb as a tracer of soil erosion, sediment source area identification and particle transport in the terrestrial environment.

    Science.gov (United States)

    Matisoff, Gerald

    2014-12-01

    Although (137)Cs has been used extensively to study soil erosion and particle transport in the terrestrial environment, there has been much less work using excess or unsupported (210)Pb ((210)Pbxs) to study the same processes. Furthermore, since (137)Cs activities in soils are decreasing because of radioactive decay, some locations have an added complication due to the addition of Chernobyl-derived (137)Cs, and the activities of (137)Cs in the southern hemisphere are low, there is a need to develop techniques that use (210)Pbxs to provide estimates of rates of soil erosion and particle transport. This paper reviews the current status of (210)Pbxs methods to quantify soil erosion rates, to identify and partition suspended sediment source areas, and to determine the transport rates of particles in the terrestrial landscape. Soil erosion rates determined using (210)Pbxs are based on the unsupported (210)Pb ((210)Pbxs) inventory in the soil, the depth distribution of (210)Pbxs, and a mass balance calibration ('conversion model') that relates the soil inventory to the erosion rate using a 'reference site' at which neither soil erosion nor soil deposition has occurred. In this paper several different models are presented to illustrate the effects of different model assumptions such as the timing, depth and rates of the surface soil mixing on the calculated erosion rates. The suitability of model assumptions, including estimates of the depositional flux of (210)Pbxs to the soil surface and the post-depositional mobility of (210)Pb are also discussed. (210)Pb can be used as one tracer to permit sediment source area identification. This sediment 'fingerprinting' has been extended far beyond using (210)Pb as a single radioisotope to include numerous radioactive and stable tracers and has been applied to identifying the source areas of suspended sediment based on underlying rock type, land use (roads, stream banks, channel beds, cultivated or uncultivated lands, pasture lands

  11. [Genomic characteristics of coxsackievirus B5 A210/KM/09 strain isolated in Yunnan, China].

    Science.gov (United States)

    Liu, Jiansheng; Shao, Congwen; Zhao, Weizhong; Zhang, Yunkun; Ji, Ma; Zhu, Yanju; Ma, Zhongfei; Ma, Shaohui

    2014-03-01

    To characterize the complete genome sequence of coxsackievirus B5 (CVB5)A210/KM/09 strain which was isolated from Yunnan, China, 2009. Eight overlapping clones covering the whole viral genome (excluding the poly-A tail)were obtained by RT-PCR and sequenced, with their nucleotide and amino acid sequences compared with other known CVB5 strains. The genome of the CVB5 A210/KM/09 strain had 7 372 nucleotides in length, and containing a 742-nt non-translated region (NTR) at the 5' end and a 98-nt NTR at the 3' end. The entire open reading frame contained 6 555 nt, encoding a 2 185-aa polyprotein. In the coding region, there appeared no nucleotide deletion or insertion, but some changes of amino acid seemed unique. Based on the complete genome sequence alignments, CVB5 isolate A210/KM/09 strain showed the highest nucleotide (92.5%) and amino acid (97.3%) identities to the CVB5/CC10/10. It also shared nucleotide (80.1%-92.5%) and amino acid (95.0%-97.3%) homology with other CVB5 strains: 17Y, 19CSF, 20CSF, 1954/85/US, 2000/CSF/KOR, 03001N, CoxB5/Henan/2010, VB5/SD/09 and Faulkner. Blast between genome fragments, A210/KM/09 showed similarity on nucleotide (80.1%-92.5%) and amino acid (95.0%-97.3%) identities with other CVB5 strains. The phylogenetic tree, constructed on the complete VP1 regions, indicated that CVB5 could be divided into genotype A, B, C and D. while Genotype C and D could be further divided into C1-C4 and D1-D4 subgenotypes. A210/KM/09 and other CVB5 predominant strains isolated in China belonged to CVB5 subgenotype C4.

  12. Pb-210 deposition measured in rainfall in Sao Paulo, SP-Brazil

    Energy Technology Data Exchange (ETDEWEB)

    Damatto, Sandra R.; Frujuele, Jonatan V.; Souza, Joseilton M.; Santos, Levi F., E-mail: damatto@ipen.br [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil). Lab. de Radiometria Ambiental

    2013-07-01

    Pb-210 (T{sub 1/2} = 22.3 y), a natural radionuclide from U-238 serie can be found in the atmosphere, as a product of {sup 222}Rn decay that emanates from the ground, where its atoms become rapidly fixed to aerosols and return to the earth as dry fallout or are washed out in the rain. This natural radionuclide has been widely used as an atmospheric tracer, to determine the aerosol residence time as well as chronometers in the environment. Pb-210 was measured during a period of two years, 2011 to 2013, in samples of rainfall in all the rainy events that occurred at the Instituto de Pesquisas Energeticas e Nucleares (IPEN) campus (23 deg 33’59.24” S - 46 deg 44’15.63” O at 760 m above sea level) which is located in the city of Sao Paulo, in the state of Sao Paulo, Brazil. Pb-210 concentration was measured in a total of 123 rainy events by beta gross counting in a low background gas flow proportional detector, after radiochemistry procedure. The results obtained were correlated to seasons and rainfall. The concentrations of {sup 210}Pb in rainfall varied from the minimum detectable activity, 4.9 mBq L{sup -1} to 1408± 43 mBq L{sup -1}. The highest concentrations were obtained in the months of winter and the lowest in summer. The monthly depositional flux of {sup 210}Pb, varied from 4.03 Bq m{sup -2} month{sup -1} to 46.4 Bq m{sup -2} month{sup -1}presenting a strong correlation with the amount of precipitation and hence showing seasonal trends. (author)

  13. Variations of 210Po activity in mussel (Perna viridis) of Samut Sakhon and its contribution to dose assessment

    Science.gov (United States)

    Porntepkasemsan, B.; Srisuksawad, K.; Kulsawat, W.

    2015-05-01

    The activities of 210Po and its effective dose in green mussel (Perna viridis) collected from a mussel farming area in Samut Sakhon province during the period of 20122013 are presented. Several parameters including maximum shell length and the physiological performance of mussels using condition index and physical properties of seawater (pH, salinity, conductivity, TDS, DO and cation-anion elements) were measured. Each individual mussel was measured for its maximum shell length which was adopted as size class. The activity concentration of 210Po was determined spectroscopically through its 5.30 MeV alpha particle emission, using 209Po as an internal tracer. The 210Po activity concentration in mussels was found to vary between 1.044 and 6.951 Bq/kg wet weight. The 210Po concentration was higher in smaller-sized (≤35 mm) and lower in larger ones (40-70 mm). This confirmed that larger mussels have lower 210Po activities on a weight basis. The 210Po body burden (activity per mussel) ranged from 1.035 to 17.183 mBq. Contrary to the 210Po concentrations, results of the body burden revealed the lower activities in smaller-sized mussels (≤35 mm) and the higher in larger-sized ones (40-70 mm). The type of fluctuations observed with 210Po concentrations were interpreted as a seasonal effect. Total annual effective 210Po dose due to mussel consumption was calculated to be in the range of 3.081 to 16.401 pSv. Based on the international guideline, the average dose calculated due to 210Po in mussels of Samut Sakhon would not pose any significant radiological impact on human health and the mussels are considered to be safe for consumption.

  14. Contribution to the study of the geophysical behaviour of lead-210 by application of alpha spectrometry; Contribution a l'etude du comportement geophysique du plomb 210 par application de la spectrometrie alpha

    Energy Technology Data Exchange (ETDEWEB)

    Nezami, M. [Commissariat a l' Energie Atomique, Saclay (France). Centre d' Etudes Nucleaires

    1965-06-01

    A study of the changes in the lead-210 contents of rain-water and of water produced by melting polar ice has required the development of a method for dosing lead-210, an {alpha} emitter. This method is 40 times more sensitive than that which measures the lead-210 by bismuth-210, a ({beta} emitter. The first part of the report presents the study of a spectrometry using semiconductor detectors; a catalogue of a spectra shows the advantages of this method. In the second part will be found at first a new chemical separation method for polonium-210 and the results obtained with this method. The main results obtained on the geophysical behaviour of lead-210 are the following: - the monthly lead-210 and polonium-210 contents in rain water are approximately constant with time. - in the Gif-sur-Yvette region, the clean-up by 'dry fall-out' can attain 40 to 50 per cent of the total fall-out. - a study of Antarctic ice samples makes it possible to determine an annual accumulation rate equivalent to 13.8 cm of water and to show discrepancies in the periodic concentrations which correspond to the latest maxima of solar activity. - a balance is drawn up between the radon produced by the continents and the lead-210 fall-out. (author) [French] Une etude sur les variations de la teneur en plomb 210 des eaux de pluie et des eaux de fusion des glaces polaires a necessite la mise au point d'une methode de dosage du plomb 210 emetteur {alpha}. Cette methode permet d'obtenir une sensibilite quarante fois superieure a celle dosant le plomb 210 par le bismuth 210 emetteur {beta}. La premiere partie du travail presente l'etude de la spectrometrie {alpha} par detecteur a semiconducteurs, un catalogue de spectres {alpha} met en evidence les avantages de cette methode. Dans la deuxieme partie on trouvera en premier lieu une nouvelle methode chimique de separation du polonium 210 ainsi que les resultats obtenus grace a cette methode. Les principaux resultats sur le

  15. The human alimentary tract transfer and body retention of environmental polonium-210

    Energy Technology Data Exchange (ETDEWEB)

    Hunt, G J; Rumney, H S [Centre for Environment, Fisheries and Aquaculture Science, Lowestoft, Suffolk NR33 0HT (United Kingdom)

    2007-12-15

    This paper presents the results of a 4 year study to investigate the human alimentary tract transfer factor (f{sub A} value) and body retention of {sup 210}Po in shellfish. In the first 3 years, mussels (Mytilus edulis L.), cockles (Cerastoderma edule L.) and brown meat from crab (Cancer pagurus L.) were successively studied. In each year five volunteers (from a pool of seven) ate a suitable portion of the shellfish and provided 24 h samples of excreta usually for 3 days before and for at least 7 days during and after eating. Subsamples of shellfish were analysed to determine the intakes of {sup 210}Po. Faeces were analysed and the data used to assess apparent f{sub A} values. Urine samples were analysed in the mussel and crab studies to provide urinary excretion parameters. Pb-210 was also analysed during the mussel study; the levels were low, leading to large uncertainties, but confirming the negligible effect of radioactive decay to its granddaughter {sup 210}Po in the main study. In the fourth year, larger samples of brown crab meat were eaten by five volunteers and faecal samples were taken at suitable times over periods of up to 43 days to study body retention of {sup 210}Po. The first {approx}7 days provided additional data on f{sub A} values. Pooled results for the apparent f{sub A} for the whole study lay in the range 0.15-0.65 with a mean of 0.46; corrections for endogenous excretion suggest a true f{sub A} value of {approx}0.51, supporting the value of 0.5 currently used by the International Commission on Radiological Protection (ICRP). The retention data suggest a biological half-time of about 40 days, in broad consistency with the 50 days currently used by the ICRP. Thus there is no strong evidence from this study suggesting a change in dose coefficient for {sup 210}Po. Full experimental data are provided to allow independent further interpretation.

  16. Expression of p210 BCR/ABl increases hematopoietic progenitor cell radiosensitivity

    Energy Technology Data Exchange (ETDEWEB)

    Santucci, M.A.; Anklesaria, P.; Das, I.J.; Sakakeeny, M.A.; FitzGerald, T.J.; Greenberger, J.S. (Univ. of Massachusetts Medical Center, Worcester, MA (United States)); Laneuville, P. (Royal Victoria Hospital, Montreal, Quebec (Canada))

    1993-08-01

    The cytogenetic finding of the Ph1+ chromosome and its molecular biologic marker bcr/abl gene rearrangement in cells from patients with chronic myeloid leukemia are associated with a proliferative advantage of the Ph1+ clone in vivo. Although the transition to the acute terminal phase or blastic crisis is often associated with additional cytogenetic abnormalities, the molecular events which correlate the initial cytogenetic lesion with the terminal phase are poorly understood. Defective cellular DNA repair capacity is often associated with chromosomal instability, increased mutation frequency, and biologic alterations. The authors tested whether the protein product of the bcr/abl translocation (p210) could alter DNA repair after gamma-irradiation of murine cell lines expressing the bcr/abl cDNA. The 32D cl 3 parent, 32D cl 3 pYN (containing the control vector plasmid) and each of two sources of 32D cl 3 cells expressing p210 cDNA (32D-PC1 cell line and 32D-LG7 subclone) showed a D[sub 0] of 1.62, 1.57, 1.16, and 1.27 Gy, respectively. Thus, expression of the p210 product induced a significant increase in radiosensitivity at the clinically relevant radiation therapy dose-rate. The increased radiosensitivity of p210-expressing cells persisted if cells were held before plating in a density-inhibited state for 8 hr after gamma-irradiation, indicating little effect on the repair of potentially lethal gamma-irradiation damage. The IL-3 dependent parent 32D cl 3 cells demonstrated programmed cell death in the absence of growth factor or following gamma-irradiation to 200 cGy. Expression of p210 cDNA in the 32D-PC1 and 32D-LG7 subclones abrogated IL-3 requirement of these cell lines and inhibited gamma-irradiation induced programmed cell death. These data suggest a role for p210 in amplifying gamma-irradiation DNA damage or broadly inhibiting DNA repair, conditions that may stimulate further cytogenetic alterations in hematopoietic cells. 43 refs., 3 figs., 1 tab.

  17. Golgi localisation of GMAP210 requires two distinct cis-membrane binding mechanisms

    Directory of Open Access Journals (Sweden)

    Goud Bruno

    2009-08-01

    Full Text Available Abstract Background The Golgi apparatus in mammals appears as a ribbon made up of interconnected stacks of flattened cisternae that is positioned close to the centrosome in a microtubule-dependent manner. How this organisation is achieved and retained is not well understood. GMAP210 is a long coiled-coil cis-Golgi associated protein that plays a role in maintaining Golgi ribbon integrity and position and contributes to the formation of the primary cilium. An amphipathic alpha-helix able to bind liposomes in vitro has been recently identified at the first 38 amino acids of the protein (amphipathic lipid-packing sensor motif, and an ARF1-binding domain (Grip-related Arf-binding domain was found at the C-terminus. To which type of membranes these two GMAP210 regions bind in vivo and how this contributes to GMAP210 localisation and function remains to be investigated. Results By using truncated as well as chimeric mutants and videomicroscopy we found that both the N-terminus and the C-terminus of GMAP210 are targeted to the cis-Golgi in vivo. The ALPS motif was identified as the N-terminal binding motif and appeared concentrated in the periphery of Golgi elements and between Golgi stacks. On the contrary, the C-terminal domain appeared uniformly distributed in the cis-cisternae of the Golgi apparatus. Strikingly, the two ends of the protein also behave differently in response to the drug Brefeldin A. The N-terminal domain redistributed to the endoplasmic reticulum (ER exit sites, as does the full-length protein, whereas the C-terminal domain rapidly dissociated from the Golgi apparatus to the cytosol. Mutants comprising the full-length protein but lacking one of the terminal motifs also associated with the cis-Golgi with distribution patterns similar to those of the corresponding terminal end whereas a mutant consisting in fused N- and C-terminal ends exhibits identical localisation as the endogenous protein. Conclusion We conclude that the Golgi

  18. Budget and residence time of {sup 210}Pb along the Gulf of Lion`s continental slope (Northwestern Mediterranean Sea)

    Energy Technology Data Exchange (ETDEWEB)

    Abassi, A.; Radakovitch, O.; Heussner, S.; Monaco, A. [Perpignan Univ., 66 (France). Lab. de Sedimentologie et Geochimie Marines

    1997-12-31

    Concentration of {sup 210}Pb has been measured in water and sediment trap samples collected on 7 experimental sites representative of the Gulf of Lion`s continental margin. This marine system is characterised by a major continental input through the Rhone river and a powerful along-slope cyclonic current (Northern Current). From the distribution of bulk {sup 210}Pb activities, it was intended to gain some information on the processes controlling the transport of trace metals at the ocean/continent boundary. Residence times of {sup 210}Pb relative to scavenging in surface waters (0-100 m) showed a constant along-slope (i.e., downstream) decrease that can be related to increasing concentrations in suspended particles. Annual time-series of {sup 210}Pb activities in settling particles were determined on samples collected by traps at 500 and 1000 m depth. From this data set, a budget for {sup 210}Pb on this margin was established which permitted to determine the flux of {sup 210}Pb theoretically adsorbed onto particles. This theoretical flux was compared, at each site, with fluxes effectively measured by traps and revealed that exchange processes - mainly in the form of large inputs of this nuclide (import of 47 to 93% of measured flux) - largely affect the {sup 210}Pb distribution on this continental margin. (author) 12 refs.

  19. 41 CFR 50-210.1 - Coverage under the Walsh-Healey Public Contracts Act of truck drivers employed by oil dealers.

    Science.gov (United States)

    2010-07-01

    ...-Healey Public Contracts Act of truck drivers employed by oil dealers. 50-210.1 Section 50-210.1 Public...-210.1 Coverage under the Walsh-Healey Public Contracts Act of truck drivers employed by oil dealers... Interpretations No. 2 1 with respect to coverage under the Walsh-Healey Public Contracts Act of truck drivers...

  20. 7 CFR 868.210 - Grades and grade requirements for the classes of Rough Rice. (See also § 868.212.)

    Science.gov (United States)

    2010-01-01

    ... United States Standards for Rough Rice Principles Governing Application of Standards § 868.210 Grades and grade requirements for the classes of Rough Rice. (See also § 868.212.) Grade Maximum limits of— Seeds... Rice. (See also § 868.212.) 868.210 Section 868.210 Agriculture Regulations of the Department of...

  1. 22 CFR 210.220 - By when must I publish my drug-free workplace statement and establish my drug-free awareness...

    Science.gov (United States)

    2010-04-01

    ... statement and establish my drug-free awareness program? 210.220 Section 210.220 Foreign Relations AGENCY FOR... statement and establish my drug-free awareness program? If you are a new recipient that does not already have a policy statement as described in § 210.205 and an ongoing awareness program as described in...

  2. Overexpression of miR-210 is associated with SDH-related pheochromocytomas, paragangliomas, and gastrointestinal stromal tumours.

    Science.gov (United States)

    Tsang, V H M; Dwight, T; Benn, D E; Meyer-Rochow, G Y; Gill, A J; Sywak, M; Sidhu, S; Veivers, D; Sue, C M; Robinson, B G; Clifton-Bligh, R J; Parker, N R

    2014-06-01

    miR-210 is a key regulator of response to hypoxia. Pheochromocytomas (PCs) and paragangliomas (PGLs) with germline SDHx or VHL mutations have pseudohypoxic gene expression signatures. We hypothesised that PC/PGLs containing SDHx or VHL mutations, and succinate dehydrogenase (SDH)-deficient gastrointestinal stromal tumours (GISTs), would overexpress miR-210 relative to non-SDH or -VHL-mutated counterparts. miR-210 was analysed by quantitative PCR in i) 39 PC/PGLs, according to genotype (one SDHA, five SDHB, seven VHL, three NF1, seven RET, 15 sporadic, one unknown) and pathology (18 benign, eight atypical, 11 malignant, two unknown); ii) 18 GISTs, according to SDHB immunoreactivity (nine SDH-deficient and nine SDH-proficient) and iii) two novel SDHB-mutant neurosphere cell lines. miR-210 was higher in SDHx- or VHL-mutated PC/PGLs (7.6-fold) compared with tumours without SDHx or VHL mutations (P=0.0016). miR-210 was higher in malignant than in unequivocally benign PC/PGLs (P=0.05), but significance was lost when benign and atypical tumours were combined (P=0.08). In multivariate analysis, elevated miR-210 was significantly associated with SDHx or VHL mutation, but not with malignancy. In GISTs, miR-210 was higher in SDH-deficient (median 2.58) compared with SDH-proficient tumours (median 0.60; P=0.0078). miR-210 was higher in patient-derived neurosphere cell lines containing SDHB mutations (6.5-fold increase) compared with normal controls, in normoxic conditions (PSDH deficiency in PC, PGL and GISTs induces miR-210 expression and substantiates the role of aberrant hypoxic-type cellular responses in the development of these tumours.

  3. Enhanced Atomic Desorption of 209 and 210 Francium from Organic Coating.

    Science.gov (United States)

    Agustsson, Steinn; Bianchi, Giovanni; Calabrese, Roberto; Corradi, Lorenzo; Dainelli, Antonio; Khanbekyan, Alen; Marinelli, Carmela; Mariotti, Emilio; Marmugi, Luca; Ricci, Leonardo; Stiaccini, Leonardo; Tomassetti, Luca; Vanella, Andrea

    2017-06-23

    Controlled atomic desorption from organic Poly-DiMethylSiloxane coating is demonstrated for improving the loading efficiency of (209,210)Fr magneto-optical traps. A three times increase in the cold atoms population is obtained with contact-less pulsed light-induced desorption, applied to different isotopes, either bosonic or fermionic, of Francium. A six times increase of (210)Fr population is obtained with a desorption mechanism based on direct charge transfer from a triboelectric probe to the adatom-organic coating complex. Our findings provide new insight on the microscopic mechanisms of atomic desorption from organic coatings. Our results, obtained at room temperature so as to preserve ideal vacuum conditions, represent concrete alternatives, independent from the atomic species in use, for high-efficiency laser cooling in critical conditions.

  4. Polonium-210 and Caesium-137 in lynx (Lynx lynx), wolverine (Gulo gulo) and wolves (Canis lupus).

    Science.gov (United States)

    Gjelsvik, Runhild; Holm, Elis; Kålås, John Atle; Persson, Bertil; Asbrink, Jessica

    2014-12-01

    Wolves, lynx and wolverines are on the top of the food-chain in northern Scandinavia and Finland. (210)Po and (137)Cs have been analysed in samples of liver, kidney and muscle from 28 wolves from Sweden. In addition blood samples were taken from 27 wolves. In 9 of the wolves, samples of muscle, liver and blood were analysed for (210)Po. Samples of liver and muscle were collected from 16 lynx and 16 wolverines from Norway. The liver samples were analysed for (210)Po and (137)Cs. Only (137)Cs analyses were carried out for the muscle samples. The wolves were collected during the winter 2010 and 2011, while the samples for lynx and wolverines were all from 2011. The activity concentrations of (210)Po in wolves were higher for liver (range 20-523 Bq kg(-1) d.w.) and kidney (range 24-942 Bq kg(-1) d.w.) than muscle (range 1-43 Bq kg(-1) d.w.) and blood (range 2-54 Bq kg(-1) d.w.). Activity ratios, (210)Po/(210)Pb, in wolf samples of muscle, liver and blood were in the ranges 2-77, 9-56 and 2-54. Using a wet weight ratio of 3.8 the maximal absorbed dose from (210)Po to wolf liver was estimated to 3500 μGy per year. Compared to wolf, the ranges of (210)Po in liver samples were lower in lynx (range 22-211 Bq kg(-1) d.w.) and wolverine (range16-160 Bq kg(-1) d.w.). Concentration of (137)Cs in wolf samples of muscle, liver, kidney and blood were in the ranges 70-8410 Bq kg(-1) d.w., 36-4050 Bq kg(-1) d.w., 31-3453 Bq kg(-1) d.w. and 4-959 Bq kg(-1) d.w., respectively. (137)Cs in lynx muscle and liver samples were in the ranges 44-13393 Bq kg(-1) d.w. and 125-10260 Bq kg(-1) d.w. The corresponding values for (137)Cs in wolverine were 22-3405 Bq kg(-1) d.w. for liver and 53-4780 Bq kg(-1) d.w. for muscle. The maximal absorbed dose from (137)Cs to lynx was estimated to 3000 μGy per year. Copyright © 2014 Elsevier Ltd. All rights reserved.

  5. 210Polonium bioaccessibility assessment in algae for human consumption: An in vitro gastrointestinal digestion method.

    Science.gov (United States)

    Desideri, Donatella; Meli, Maria Assunta; Roselli, Carla; Feduzi, Laura; Ugolini, Lucia

    2017-01-01

    The occurrence and mobility of natural radioactive element as 210Polonium (210Po) in 13 commercial algae consumed in Italy by humans were determined because the effects on human health need to take into account the bioavailability of these elements. The simulation of gastrointestinal (GIT) digestion was divided into three stages and was accomplished using three different artificial solutions: saliva, gastric, and synthetic bile-pancreas solution. The same sample was treated in two different ways: a) only gastric digestion and b) complete GIT digestion (gastric digestion followed by bile-pancreas solution). The difference between Po gastric mobility with respect to that found for GIT digestion was not significant; in fact, Po mobility exhibited a mean value 17.2 ± 15.1% and 19.5 ± 11.5% for gastric and GIT digestion, respectively.

  6. Hypoxia induces miR-210, leading to anti-apoptosis in ovarian follicular cells of marine medaka Oryzias melastigma

    Energy Technology Data Exchange (ETDEWEB)

    Tse, Anna Chung-Kwan [School of Biological Sciences, The University of Hong Kong, Pokfulam Road, Hong Kong SAR (China); State Key Laboratory in Marine Pollution, Hong Kong SAR (China); Li, Jing-Woei; Chan, Ting-Fung [School of Life Sciences, Hong Kong Bioinformatics Centre, The Chinese University of Hong Kong, Hong Kong SAR (China); Wu, Rudolf Shiu-Sun [School of Biological Sciences, The University of Hong Kong, Pokfulam Road, Hong Kong SAR (China); State Key Laboratory in Marine Pollution, Hong Kong SAR (China); Lai, Keng-Po, E-mail: balllai@hku.hk [School of Biological Sciences, The University of Hong Kong, Pokfulam Road, Hong Kong SAR (China); State Key Laboratory in Marine Pollution, Hong Kong SAR (China)

    2015-08-15

    Highlights: • We demonstrate hypoxia induced miR-210 in ovarian follicular cells. • We show anti-apoptotic roles of miR-210 in ovarian follicular cells under hypoxia. • Apoptotic genes (DLC1, SLK, TNFRSF10B, RBM25, and USP7) are target of miR-210. • MiR-210 is vital for ovarian follicular cells proliferation in response to hypoxia. - Abstract: Hypoxia is a major global problem that impairs reproductive functions and reduces the quality and quantity of gametes and the fertilization success of marine fish. Nevertheless, the detailed molecular mechanism underlying hypoxia-induced female reproductive impairment remains largely unknown. There is increasing evidence that miRNA is vital in regulating ovarian functions and is closely associated with female fertility in humans. Certain miRNAs that regulate apoptotic genes can be induced by hypoxia, resulting in cell apoptosis. Using primary ovarian follicular cells of the marine medaka, Oryzias melastigma, as a model, we investigated the response of miR-210 to hypoxic stress in ovarian tissues to see if it would interrupt reproductive functions. A significant induction of miR-210 was found in primary ovarian follicular cells exposed to hypoxia, and gene ontology analysis further highlighted the potential roles of miR-210 in cell proliferation, cell differentiation, and cell apoptosis. A number of miR-210 target apoptotic genes, including Deleted in liver cancer 1 protein (DLC1), STE20-like serine/threonine-protein kinase (SLK), tumor necrosis factor receptor superfamily member 10b (TNFRSF10B), RNA binding motif protein 25 (RBM25), and Ubiquitin-specific-processing protease 7 (USP7), were identified. We further showed that ectopic expression of miR-210 would result in down-regulation of these apoptotic genes. On the other hand, the inhibition of miR-210 promoted apoptotic cell death and the expression of apoptotic marker – caspase 3 in follicular cells under hypoxic treatment, supporting the regulatory role of mi

  7. miR-210 expression is associated with methionine-induced differentiation of trout satellite cells.

    Science.gov (United States)

    Latimer, Mary; Sabin, Nathalie; Le Cam, Aurélie; Seiliez, Iban; Biga, Peggy; Gabillard, Jean-Charles

    2017-08-15

    In fish, data on microRNAs (miRNAs) involved in myogenesis are scarce. In order to identify miRNAs involved in satellite cell differentiation, we used a methionine depletion/replenishment protocol to synchronize myogenic cell differentiation. Our results validated that methionine removal (72 h) from the medium strongly decreased myoD1 and myogenin expression, indicating differentiation arrest. In contrast, methionine replenishment rescued expression of myoD1 and myogenin , showing a resumption of differentiation. We performed a miRNA array analysis of myogenic cells under three conditions: presence of methionine for 72 h (control), absence of methionine for 72 h (Meth-) and absence of methionine for 48 h followed by 24 h of methionine replenishment (Meth-/+). A clustering analysis identified three clusters: cluster I corresponds to miRNA upregulated only in Meth-/+ conditions; cluster II corresponds to miRNA downregulated only in Meth-/+ conditions; cluster III corresponds to miRNAs with high expression in control, low expression in Meth- conditions and intermediate expression after methionine replenishment (Meth-/+). Cluster III was very interesting because it fitted with the data obtained for myoD1 and myogenin (supporting an involvement in differentiation) and contained seven miRNAs with muscle-related function (e.g. miR-133a) and one (miR-210) with unknown function. Based on our previously published miRNA repertoire ( Juanchich et al., 2016), we confirmed miR-133a was expressed only in white muscle and showed that miR-210 had strong expression in white muscle. We also showed that miR-210 expression was upregulated during differentiation of satellite cells, suggesting that miR-210 was potentially involved in the differentiation of satellite cells. © 2017. Published by The Company of Biologists Ltd.

  8. Minimum speed limit for ocean ridge magmatism from 210Pb-226Ra-230Th disequilibria.

    Science.gov (United States)

    Rubin, K H; van der Zander, I; Smith, M C; Bergmanis, E C

    2005-09-22

    Although 70 per cent of global crustal magmatism occurs at mid-ocean ridges-where the heat budget controls crustal structure, hydrothermal activity and a vibrant biosphere-the tempo of magmatic inputs in these regions remains poorly understood. Such timescales can be assessed, however, with natural radioactive-decay-chain nuclides, because chemical disruption to secular equilibrium systems initiates parent-daughter disequilibria, which re-equilibrate by the shorter half-life in a pair. Here we use 210Pb-226Ra-230Th radioactive disequilibria and other geochemical attributes in oceanic basalts less than 20 years old to infer that melts of the Earth's mantle can be transported, accumulated and erupted in a few decades. This implies that magmatic conditions can fluctuate rapidly at ridge volcanoes. 210Pb deficits of up to 15 per cent relative to 226Ra occur in normal mid-ocean ridge basalts, with the largest deficits in the most magnesium-rich lavas. The 22-year half-life of 210Pb requires very recent fractionation of these two uranium-series nuclides. Relationships between 210Pb-deficits, (226Ra/230Th) activity ratios and compatible trace-element ratios preclude crustal-magma differentiation or daughter-isotope degassing as the main causes for the signal. A mantle-melting model can simulate observed disequilibria but preservation requires a subsequent mechanism to transport melt rapidly. The likelihood of magmatic disequilibria occurring before melt enters shallow crustal magma bodies also limits differentiation and heat replenishment timescales to decades at the localities studied.

  9. (210)Pb and compositional data of sediments from Rondonian lakes, Madeira River basin, Brazil.

    Science.gov (United States)

    Bonotto, Daniel Marcos; Vergotti, Marcelo

    2015-05-01

    Gold exploration has been intensive in Brazilian Amazon over the last 40 years, where the use of mercury as an amalgam has caused abnormal Hg concentrations in water bodies. Special attention has been directed to Madeira River due to fact it is a major tributary of Amazon River and that since 1986, gold exploration has been officially permitted along a 350km sector of the river. The (21)(0)Pb method has been used to date sediments taken from nine lakes situated in Madeira River basin, Rondônia State, and to verify where anthropogenic Hg might exist due to gold exploitation in Madeira River. Activity profiles of excess (21)(0)Pb determined in the sediment cores provided a means to evaluate the sedimentation rates using a Constant Flux: Constant Sedimentation (CF:CS) and Constant Rate of Supply (CRS) of unsupported/excess (21)(0)Pb models. A significant relationship was found between the CF:CS sedimentation rates and the mean values of the CRS sedimentation rates (Pearson correlation coefficient r=0.59). Chemical data were also determined in the sediments for identifying possible relationships with Hg occurring in the area. Significant values were found in statistical correlation tests realized among the Hg, major oxides and Total Organic Carbon (TOC) content in the sediments. The TOC increased in the sediment cores accompanied by a loss on ignition (LOI) increment, whereas silica decreased following a specific surface area raising associated to the TOC increase. The CRS model always provided ages within the permitted range of the (21)(0)Pb-method in the studied lakes, whereas the CF:CS model predicted two values above 140 years. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. 210 year anniversary of the Botanical Garden of the University of Tartu

    Directory of Open Access Journals (Sweden)

    Politsinski Zanna

    2014-03-01

    Full Text Available June 28, 2013 Botanic Garden of the University of Tartu has celebrated its 210th anniversary. To mark the occasion four significant events were presented: the first electric car trip, opening of the sculpture in honor of the gardeners of Estonia, the opening of "Moss garden" and a concert at the summer stage in the rock, which was held on June 29.

  11. An actively accreting massive black hole in the dwarf starburst galaxy Henize 2-10.

    Science.gov (United States)

    Reines, Amy E; Sivakoff, Gregory R; Johnson, Kelsey E; Brogan, Crystal L

    2011-02-03

    Supermassive black holes are now thought to lie at the heart of every giant galaxy with a spheroidal component, including our own Milky Way. The birth and growth of the first 'seed' black holes in the earlier Universe, however, is observationally unconstrained and we are only beginning to piece together a scenario for their subsequent evolution. Here we report that the nearby dwarf starburst galaxy Henize 2-10 (refs 5 and 6) contains a compact radio source at the dynamical centre of the galaxy that is spatially coincident with a hard X-ray source. From these observations, we conclude that Henize 2-10 harbours an actively accreting central black hole with a mass of approximately one million solar masses. This nearby dwarf galaxy, simultaneously hosting a massive black hole and an extreme burst of star formation, is analogous in many ways to galaxies in the infant Universe during the early stages of black-hole growth and galaxy mass assembly. Our results confirm that nearby star-forming dwarf galaxies can indeed form massive black holes, and that by implication so can their primordial counterparts. Moreover, the lack of a substantial spheroidal component in Henize 2-10 indicates that supermassive black-hole growth may precede the build-up of galaxy spheroids.

  12. (137)Cs, (40)K and (210)Po in marine mammals from the southern Baltic Sea.

    Science.gov (United States)

    Ciesielski, Tomasz; Góral, Marta; Szefer, Piotr; Jenssen, Bjørn Munro; Bojanowski, Ryszard

    2015-12-15

    This study provides information on baseline concentrations of the radionuclides Cesium-137, Potassium-40 and Polonium-210 in sea mammals from the Baltic Sea. The radionuclides were analyzed in the liver, kidney and muscle of harbor porpoises, striped dolphins, and gray and ringed seals from the Polish coast by γ- and α-spectrometry. Median (137)Cs activities were 14.8, 13.2 and 23.2 Bq kg(-1) w.w. in the liver, kidney and muscles, respectively. Activities of (40)K and (210)Po in the respective tissues were found to be 79.1, 79.8 and 111 Bq kg(-1) for (40)K and 58.1, 59.2 and 32.9 Bq kg(-1) for (210)Po. The measured (137)Cs concentrations were extraordinarily high in comparison to those reported in sea mammals from other locations. However, dose assessments did not imply health effects from (137)Cs exposure in Baltic Sea mammals. Correlations between (137)Cs tissue activities and reported sea water concentrations highlight the potential use of marine mammals for biomonitoring purposes. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Investigation on 2D disks and stadiums micro-resonators structures based on UV210 polymer

    Science.gov (United States)

    Pluchon, D.; Huby, N.; Lhermite, H.; Duval, D.; Beche, B.

    2012-06-01

    In this paper, we report on the design and the overall realization of micro-resonators based on the development of adequate processes on UV210 polymer. These micro-optical structures are developed by deep ultraviolet lithography allowing fabrication of nano-structured devices by mean of low cost and reproducible processes. Resonant microstructures of disk and stadium shapes with various sizes were investigated. Structural and optical characterizations have been carried out to ensure their ability as integrated resonant micro-structures. At first, scanning electron microscopy studies confirm the UV-light process resolution down to 450 nm developed on UV210 polymer. Then, optical characterizations have been performed as regards spectral properties of such micro-resonators. Field intensity measurements in visible and infrared range have been realized and validate the aptitude of the micro-structures to propagate and to allow an evanescent photonic coupling between waveguides and micro-resonators. Finally, spectral analyses on TE modes demonstrate the presence of optical resonances associated to whispering gallery modes for disk structures and chaotic modes for stadium shapes. The UV210 polymer appears appropriate for the realization of microstructures requiring a few hundred nanometers gap-scale while maintaining adequate spectral properties for versatile applications in telecommunication and metrology.

  14. Effect of synthetic cannabinoid HU210 on memory deficits and neuropathology in Alzheimer's disease mouse model.

    Science.gov (United States)

    Chen, B; Bromley-Brits, K; He, G; Cai, F; Zhang, X; Song, W

    2010-05-01

    Cannabinoids have been shown to increase neurogenesis in adult brain, as well as protect neurons from excitotoxicity, calcium influx, inflammation, and ischemia. Recent studies have shown that synthetic cannabinoids can alleviate water maze impairments in rats treated with intracranial amyloid beta protein (Abeta); however it is unknown whether this effect is due to the cannabinoids' anti-inflammatory properties or whether it affects Abeta processing. Here we investigate whether cannabinoids have any effect on Alzheimer's disease in vivo. We found that HU210, a potent synthetic cannabinoid, did not improve water maze performance or a contextual fear conditioning task in an APP23/PS45 double transgenic mouse model of AD. HU210 had no effect on APP processing and Abeta generation, as well as neuritic plaque formation in the brains of AD transgenic mice. Our study showed that synthetic cannabinoid HU210 had no beneficial effects on AD neuropathology and behavioral deficits of AD model mice, which advises caution of such drug's application in AD therapies.

  15. Sedimentation Rate and 210Pb Sediment Dating at Apipucos Reservoir, Recife, Brazil

    Directory of Open Access Journals (Sweden)

    Rízia K. do Nascimento

    2012-09-01

    Full Text Available The Apipucos Reservoir is located in Pernambuco-Brazil. Several districts of the metropolitan area use this reservoir to dispose of rubbish, waste and sewage. Dating sediments uses the 210Pb from the atmosphere. 210Pb is a daughter of the 222Rn, which emanates from the soil but is different from that contained in the sediment, which is in balance with the 226Ra. The chosen model for dating sediments depends on certain conditions: in environments where the amount of sediment can vary, the Constant Rate of Supply (CRS model is adopted. In environments where the sediments can be considered to be constant, a Constant Initial Concentration (CIC model is applied. A 70 cm long and 5 cm internal-diameter wide core was used for sediment sampling. Samples were dried at 105 °C, and about 5 g dry material was dissolved with acids. The 210Pb and 226Ra content was determined by their radioactive descendants’ concentrations. For the second sampling point, both models could be used. The results showed an increase in sedimentation rate over the last 50–60 years. We could conclude that the top sediment interval had been there 30 years ago. We could decide that the CRS was the best applicable model.

  16. Pb-210 and fly ash particles in ombrotrophic peat bogs as indicators of industrial emissions.

    Science.gov (United States)

    Vaasma, Taavi; Karu, Helen; Kiisk, Madis; Pensa, Margus; Isakar, Kadri; Realo, Enn; Alliksaar, Tiiu; Tkaczyk, Alan Henry

    2017-08-01

    Peat cores were collected from a Sphagnum-dominated Selisoo bog, which is located about 40 km from the large oil shale-fired power plants (PPs) in Estonia. These PPs have been operational from the 1960's and had the largest negative impact on the surrounding environment during the 1970's and 1980's. Nearby ombrotrophic peatlands are good indicators of atmospheric pollution due to their properties of effectively adsorbing mineral matter and pollutants. Collected peat cores (S1 and S2) from Selisoo peat bog were sliced into 1 cm thick layers and measured gamma spectrometrically. In addition, spherical fly ash particles (SFAP) originating from the combustion of the PPs were counted. The maximum concentrations (particles per cm3) of the SFAP remained between 7 and 12 cm for core S1 and between 11 and 17 cm for core S2. The concentration profiles of the SFAP reflect the combustion and emission history of the PPs. Pb-210 activity concentrations have the maximum values up to 500 Bq kg-1 and 413 Bq m-2 for S1 and for the S2 the values are 441 Bq kg-1 and 535 Bq m-2 (dry weight). The unsupported 210Pb inventory is around 4250 Bq m-2. This represents a 210Pb deposition flux of 133 Bq m-2 y-1. The estimated 210Pb deposition via fly ash from the PPs at Selisoo area remains between 0.2 and 2.2 Bq m-2 y-1. Considering the annual 210Pb deposition from the atmosphere (with a precipitation rate of 600 mm y-1) between 92 and 133 Bq m-2, which is regarded as the natural background value, we show that the radiological burden due to the power plants at these distances is negligible. As the peat cores exhibit noticeable differences from each other (in terms of radionuclide concentration distribution), the SFAP can provide a good additional parameter to improve the validity of results obtained only from radiometric methods in the chronological studies. SFAP can also act as a possible tool to estimate the radionuclide deposition rate via fly ash in the vicinity of

  17. Prevalence of Plasmodium vivax VK210 and VK247 subtype in Myanmar

    Directory of Open Access Journals (Sweden)

    Kang Yoon-Joong

    2010-07-01

    Full Text Available Abstract Background Plasmodium vivax is divided into two subtypes, a dominant form, VK210 and a variant form, VK247. This division is dependent on the amino acid composition of the circumsporozoite (CS protein. In this study, the prevalence of the VK247 variant form of P. vivax was investigated in Myanmar. Methods The existence of malaria parasites in blood samples was determined by microscopic examination, polymerase chain reaction (PCR and DNA hybridization assays. To test for antibodies against P. vivax and Plasmodium falciparum in blood samples, an indirect immunofluorescence antibody test (IFAT was performed using asexual blood antigens. An enzyme-linked immunosorbent assay with synthetic VK210 and VK247 antigens was carried out to discriminate between the P. vivax subtypes. Results By thick smear examination, 73 (n = 100 patients were single infected with P. vivax, one with P. falciparum and 13 with both species. By thin smear, 53 patients were single infected with P. vivax, eight with only P. falciparum and 16 with both. Most of the collected blood samples were shown to be P. vivax positive (n = 95 by PCR. All cases that were positive for P. falciparum by PCR (n = 43 were also positive for P. vivax. However, 52 cases were single infected with P. vivax. IFAT showed antibody titres from 1:32 to 1:4,096. Additionally, using specific antibodies for VK210 and VK247, ELISA showed that 12 patients had antibodies for only the VK210 subtype, 4 patients had only VK247 subtype antibodies and 21 patients had antibodies for both subtypes. Using a DNA hybridization test, 47 patients were infected with the VK210 type, one patient was infected with VK247 and 23 patients were infected with both subtypes. Conclusions The proportion of the VK247 subtype in Myanmar was 43.1% (n = 25 among 58 positive cases by serodiagnosis and 25.6% (n = 24 among 94 positive cases by genetic diagnosis. In both diagnostic methods, the infection status of malaria patients is

  18. Teores elevados de Polônio-210 em plantas aquáticas da restinga de Carapebus, RJ

    Directory of Open Access Journals (Sweden)

    Kelecom Alphonse

    1999-01-01

    Full Text Available 210Po concentrations have been determined in one green alga and in five freshwater plants grown in a pond of the Carapebus restinga (State of Rio de Janeiro. The alga Chara sp showed elevated concentration of 210Po, similar to that observed for marine algae. All the other plants had the lowest concentration of 210Po in the stems and the highest in the roots. Intermediate values were observed in the leaves. The unexpected high concentration of 210Po in the roots, even superior to reported values for roots of plants from high radioactive background areas, must be due to the elevated levels of this radionuclide in associated soils that are known to be rich in humic organic material. There seem to have been no translocation of this radionuclide from the roots to the other parts of the plants.

  19. TLR3-induced placental miR-210 down-regulates the STAT6/interleukin-4 pathway.

    Directory of Open Access Journals (Sweden)

    Shelley E Kopriva

    Full Text Available Several clinical studies have reported increased placental miR-210 expression in women with PE compared to normotensive women, but whether miR-210 plays a role in the etiology of PE is unknown. We reported that activation of TLR3 produces the PE-like symptoms of hypertension, endothelial dysfunction, and proteinuria in mice only when pregnant, but whether TLR3 activation in pregnant mice and human cytotrophoblasts (CTBs increases miR-210 and modulates its targets related to inflammation are unknown. Placental miR-210 levels were increased significantly in pregnant mice treated with the TLR3 agonist poly I:C (P-PIC. Both HIF-1α and NF-κBp50, known to bind the miR-210 promoter and induce its expression, were also increased significantly in placentas of P-PIC mice. Target identification algorithms and gene ontology predicted STAT6 as an inflammation-related target of miR-210 and STAT6 was decreased significantly in placentas of P-PIC mice. IL-4, which is regulated by STAT6 and increases during normotensive pregnancy, failed to increase in serum of P-PIC mice. P-PIC TLR3 KO mice did not develop hypertension and placental HIF-1α, NF-κBp50, miR-210, STAT6, and IL-4 levels were unchanged. To determine the placental etiology, treatment of human CTBs with poly I:C significantly increased HIF-1α, NF-κBp50, and miR-210 levels and decreased STAT6 and IL-4 levels. Overexpression of miR-210 in CTBs decreased STAT6 and IL-4 while inhibition of miR-210 increased STAT6 and IL-4. These findings demonstrate that TLR3 activation induces placental miR-210 via HIF-1α and NF-κBp50 leading to decreased STAT6 and IL-4 levels and this may contribute to the development of PE.

  20. Uptake of 210Po by aquatic plants of a fresh water ecosystem around the uranium mill tailings management facility of Jaduguda, India.

    Science.gov (United States)

    Jha, V N; Tripathi, R M; Sethy, N K; Sahoo, S K; Puranik, V D

    2013-10-01

    The present study was designed to investigate the uptake of Polonium-210 ((210)Po) by aquatic plants growing in a fresh water ecosystem around the tailings management facility of the uranium industry of Jaduguda, India. Evaluation of the activity concentration of (210)Po in aquatic plants, the concentration ratio of (210)Po from substrate to plants and the relationship of (210)Po with other stable elements were major objectives of the investigation. Based on the habitat, three types of plant were collected and analyzed for (210)Po activity estimation. Along with aquatic plants, effluent, surface water and bottom sediment were also collected and analyzed for (210)Po activity content. From the acid solution (210)Po was electrodeposited on brightly polished silver discs and counted for alpha activity in an alpha counter. The highest (210)Po activity concentration (4884 Bq kg(-1) fresh weight) was found in filamentous algae from residual water of the tailings pond. For sediment-rooted plants, a significant positive correlation (r = 0.91, p plant and sediment activity concentration of (210)Po. For all of the three different groups of plants studied, highly significant correlations were observed between activity concentration of (210)Po and Cu with the significance level variation between 0.00-0.05 (both for linear and log transformed data).

  1. The polonium 210 in aerosols: contribution to the study of savannah fires and volcano emissions; Le polonium 210 dans les aerosols: contribution a l`etude des feux de savanes et des emissions volcaniques

    Energy Technology Data Exchange (ETDEWEB)

    Nho-Kim, E.Y

    1996-06-27

    Natural sources plan a fundamental role on the emission of the species causing climatic variations. The aim of this study is, on the one hand, to estimate fluxes of different components emitted by biomass burning and volcanoes, and on the other hand, to trace these components in time and space. We used {sup 210}Po, last decay product in the {sup 238}U series, as a tracer, as it is one of the characteristic species emitted by these sources: it is highly enriched in these plumes compared to the usual atmosphere and the {sup 210}Po radioactivity is not affected by chemical transformation. We have shown that the contribution of biomass burning on the {sup 210}Po concentration in local background atmosphere is minor during the dry season, compared to that of Saharan soil dusts despite of the importance of this source in the global budget of {sup 210}Po (10%). However, the good correlation observed between the {sup 210}Po concentration and that of carbonaceous aerosols and of CO{sub 2} in biomass burning plumes reveals that {sup 210}Po can be used as a reference of the components emitted by biomass burning. We have estimated the contribution of the Indonesian volcanoes which represent about 5 to 30 % of the global volcanic budget of trace metals. Atmospheric transport of these volcanic plumes was simulated using the {sup 210}Po as a tracer. Due to the characteristic atmospheric circulation in this region, vertical transport is predominant over meridian dispersion, which is moderated by the convergence of the trade winds. The impact of these volcanic emissions on the atmospheric concentration of the trace metals remains a local effect when the volcanic activity is out of cataclysmal eruptions. (author)

  2. Transport mechanism for Pb-210, Cs-137 and Pu fallout radionuclides through fluvial-marine systems

    Science.gov (United States)

    Smith, J. N.; Ellis, K. M.

    1982-06-01

    Pb-210, Cs-137 and Pu-239,240 sediment-depth profiles in an anoxic, unbioturbated, estuarine depositional regime at the head of the Saguenay Fjord, Que. exhibit a seasonally-modulated component caused by pulsed inputs of silts and sands during high energy, spring river discharge events superimposed on an ambient depositional pattern of finer grained clays and organic matter. A precise sediment timestratigraphy has been determined by the inverse correlation of the Pb-210 activity with the rate of river discharge during the period, 1963-1976. The historical record of Cs-137 and Pu-239,240 sediment fluxes has been reconstructed through the normalization of fallout radionuclide activities to the excess Pb-210 activity profile. Radionuclide flux geochronologies have been interpreted on the basis of a fluvial-marine transport model which distinguishes between inputs due to direct adsorption of radionuclides onto particles in the water column and inputs resulting from the erosion of particle-associated radionuclides from the drainage basin. Rate constants corresponding to residence times of one year for Cs-137 and Pu-239,240 in the water column and 1500 years for each radionuclide in the drainage basin provide reasonable agreement between the model and experimental results, although there is some evidence for a slightly longer drainage basin residence time for plutonium. Both the threshold for the initial appearance of Pu-238, derived from the atmospheric burnup of a SNAP-9A satellite reactor in 1964, and the magnitude of its isotopic dilution by drainage basin inputs of Pu-239,240 are also in agreement with model predictions.

  3. Sedimentation rate and {sup 210}Pb sediment dating at Apipucos reservoir, Recife, Brazil

    Energy Technology Data Exchange (ETDEWEB)

    Figueiredo, Marcela D.C. de; Silva, Danubia B. da; Cunha, Manuela S. da; Rodrigues, Kelia R.G.; Pedroza, Eryka H.; Melo, Roberto T. de; Oliveira, Aristides; Hazin, Clovis A.; Souza, Vivianne L.B. de, E-mail: rtmelo@cnen.gov.b, E-mail: chazin@cnen.gov.b, E-mail: vlsouza@cnen.gov.b [Centro Regional de Ciencias Nucleares (CRCN-NE/CNEN-PE), Recife, PE (Brazil)

    2011-07-01

    The Apipucos Reservoir is located in Recife, State of Pernambuco, and, several districts of the metropolitan area use this reservoir to dispose waste and sewage. Dating sediments uses {sup 210}Pb from the atmosphere which is formed as a result of {sup 222}Rn emanation from the soil. Atmospheric lead, carried by rain, is called non-supported {sup 21}'0Pb, to differentiate it from the one contained in the sediment, in balance with the {sup 226}Ra. The model chosen for dating sediments depends on certain conditions: in an environment where the amount of sediment influx can vary, the constant rate of supply model is adopted. On the other hand, in environments where the sedimentation rate is constant and the sediment can be considered to have a constant initial concentration of unsupported {sup 210}Pb and the (CIC) model is applied. A 70-cm long, 5-cm internal-diameter wide core was collected for sediment dating. Each core was sliced, into 5 or 10 cm intervals. Samples were dried at 105 deg C, and about 5 g dry material from each sample was dissolved with acids. The {sup 210}Pb and {sup 226}Ra contents were separated and determined by beta and alpha counting by using a gas-flow proportional counter. Sediment ages were calculated by the two models, and for the second and fourth sampling points, both models could be used. The results showed an increase in sedimentation rate over the last 50 - 60 years. We can conclude that the top sediment layer is dated from 30 years ago. We can also conclude that the CRS is the best applicable model to use in this area. (author)

  4. In vivo measurements of lead-210 for assessing cumulative radon exposure in uranium miners

    Energy Technology Data Exchange (ETDEWEB)

    Guilmette, R.A.; Laurer, G.R. [New York Univ. Inst. of Environmental Medicine, Tuxedo, NY (United States); Lambert, W.E.; Gilliland, F.D. [Univ. of New Mexico, Albuquerque, NM (United States)] [and others

    1995-12-01

    It has long been recognized that a major contributor to the uncertainty in risk analysis of lung cancer in uranium and other hard rock miners is the estimation of total radon progeny exposure of individual miners under study. These uncertainties arise from the fact that only a limited number of measurements of airborne {sup 222}Rn progeny concentrations were made in the mines during the times that the miners were being exposed, and that dosimeters capable of integrating the Rn progeny exposures of the miners did not exist. Historically, the cumulative exposures for individual uranium and other hard rock miners have been calculated by combining the employee`s work history, which may or may not have included time spent at different jobs within the mines and at different locations within the mines, with whatever periodic measurements of Rn and Rn progeny were available. The amount and quality of the measurement data varied enormously from mine to mine and from population to population. Because the quality of the exposure data collected during the period of active mining in the United STates cannot now be altered substantially, significant improvement in individual miner exposure estimates is only likely to be achieved if a new cumulative exposure metric is developed and implemented. The decay chain of Rn includes the production of {sup 210}Pb, which can accumulate in the skeleton in amounts proportional to the intake of Rn progeny. We hypothesize that the in vivo measurement of {sup 210}Pb in the skulls of miners will provide such a metric. In summary, the primary purpose of this pilot study to demonstrate the feasibility of measuring {sup 210}Pb in the heads of former uranium miners has been accomplished.

  5. Hypoxia-related microRNA-210 is a diagnostic marker for discriminating osteoblastoma and osteosarcoma.

    Science.gov (United States)

    Riester, Scott M; Torres-Mora, Jorge; Dudakovic, Amel; Camilleri, Emily T; Wang, Wei; Xu, Fuhua; Thaler, Roman R; Evans, Jared M; Zwartbol, René; Briaire-de Bruijn, Inge H; Maran, Avudaiappan; Folpe, Andrew L; Inwards, Carrie Y; Rose, Peter S; Shives, Thomas C; Yaszemski, Michael J; Sim, Franklin H; Deyle, David R; Larson, Annalise N; Galindo, Mario A; Cleven, Arjen G H; Oliveira, Andre M; Cleton-Jansen, Anne-Marie; Bovée, Judith V M G; van Wijnen, Andre J

    2017-05-01

    Osteoblastoma is a benign bone tumor that can often be difficult to distinguish from malignant osteosarcoma. Because misdiagnosis can result in unfavorable clinical outcomes, we have investigated microRNAs as potential diagnostic biomarkers for distinguishing between these two tumor types. Next generation RNA sequencing was used as an expression screen to evaluate >2,000 microRNAs present in tissue derived from rare formalin fixed paraffin embedded (FFPE) archival tumor specimens. MicroRNAs displaying the greatest ability to discriminate between these two tumors were validated on an independent tumor set, using qPCR assays. Initial screening by RNA-seq identified four microRNA biomarker candidates. Expression of three miRNAs (miR-451a, miR-144-3p, miR-486-5p) was higher in osteoblastoma, while the miR-210 was elevated in osteosarcoma. Validation of these microRNAs on an independent data set of 22 tumor specimens by qPCR revealed that miR-210 is the most discriminating marker. This microRNA displays low levels of expression across all of the osteoblastoma specimens and robust expression in the majority of the osteosarcoma specimens. Application of these biomarkers to a clinical test case showed that these microRNA biomarkers permit re-classification of a misdiagnosed FFPE tumor sample from osteoblastoma to osteosarcoma. Our findings establish that the hypoxia-related miR-210 is a discriminatory marker that distinguishes between osteoblastoma and osteosarcoma. This discovery provides a complementary molecular approach to support pathological classification of two diagnostically challenging musculoskeletal tumors. Because miR-210 is linked to the cellular hypoxia response, its detection may be linked to well-established pro-angiogenic and metastatic roles of hypoxia in osteosarcomas and other tumor cell types. © 2016 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 35:1137-1146, 2017. © 2016 Orthopaedic Research Society. Published by

  6. Downregulation of miR-210 expression inhibits proliferation, induces apoptosis and enhances radiosensitivity in hypoxic human hepatoma cells in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Yang, Wei, E-mail: detachedy@yahoo.com.cn [Department of Radiobiology, School of Radiological Medicine and Protection, Soochow University, Suzhou (China); Sun, Ting [Brain and Nerve Research Laboratory, The First Affiliated Hospital, Soochow University, Suzhou (China); Cao, Jianping; Liu, Fenju [Department of Radiobiology, School of Radiological Medicine and Protection, Soochow University, Suzhou (China); Tian, Ye [Department of Radiotherapy and Oncology, The Second Affiliated Hospital, Soochow University, Suzhou (China); Zhu, Wei [Department of Radiobiology, School of Radiological Medicine and Protection, Soochow University, Suzhou (China)

    2012-05-01

    Hypoxia is a common feature of solid tumors and an important contributor to tumor radioresistance. miR-210 is the most consistently and robustly induced microRNA under hypoxia in different types of tumor cells and normal cells. In the present study, to explore the feasibility of miR-210 as an effective therapeutic target, lentiviral-mediated anti-sense miR-210 gene transfer technique was employed to downregulate miR-210 expression in hypoxic human hepatoma SMMC-7721, HepG2 and HuH7 cells, and phenotypic changes of which were analyzed. Hypoxia led to an increased hypoxia inducible factor-1{alpha} (HIF-1{alpha}) and miR-210 expression and cell arrest in the G{sub 0}/G{sub 1} phase in all cell lines. miR-210 downregulation significantly suppressed cell viability, induced cell arrest in the G{sub 0}/G{sub 1} phase, increased apoptotic rate and enhanced radiosensitivity in hypoxic human hepatoma cells. Moreover, apoptosis-inducing factor, mitochondrion-associated, 3 (AIFM3) was identified as a direct target gene of miR-210. AIFM3 downregulation by siRNA attenuated radiation induced apoptosis in miR-210 downregulated hypoxic human hepatoma cells. Taken together, these data suggest that miR-210 might be a potential therapeutic target and specific inhibition of miR-210 expression in combination with radiotherapy might be expected to exert strong anti-tumor effect on hypoxic human hepatoma cells. -- Highlights: Black-Right-Pointing-Pointer miR-210 downregulation radiosensitized hypoxic hepatoma. Black-Right-Pointing-Pointer AIFM3 was identified as a direct target gene of miR-210. Black-Right-Pointing-Pointer miR-210 might be a therapeutic target to hypoxic hepatoma.

  7. Particle mixing rates in deep-sea sediments determined from excess /sup 210/Pb and /sup 32/Si profile

    Energy Technology Data Exchange (ETDEWEB)

    DeMaster, D.J.; Cochran, J.K. (Yale Univ., New Haven, CT (USA). Dept. of Geology and Geophysics)

    1982-12-01

    Particle mixing rates have been determined for 5 South Atlantic/Antarctic and 3 equatorial Pacific deep-sea cores using excess /sup 210/Pb and /sup 32/Si measurements. Radionuclide profiles from these siliceous, calcareous, and clay-rich sediments have been evaluated using a steady state vertical advection diffusion model. In Antarctic siliceous sediments /sup 210/Pb mixing coefficients (0.04-0,16 cm/sup 2//y) are in reasonable agreement with the /sup 32/Si mixing coefficient (0.2 or 0.4 cm/sup 2//y, depending on /sup 32/Si half-life). In an equatorial Pacific sediment core, however, the /sup 210/Pb mixing coefficient (0.22 cm/sup 2//y) is 3-7 times greater than the /sup 32/Si mixing coefficient (0.03 or 0.07 cm/sup 2//y). The difference in /sup 210/Pb and /sup 32/Si mixing rates in the Pacific sediments results from: (1) non-steady state mixing and differences in characteristic time and depth scales of the two radionuclides, (2) preferential mixing of fine-grained clay particles containing most of the /sup 210/Pb activity relative to coarser particles (large radiolaria) containing the /sup 32/Si activity, or (3) the supply of /sup 222/Rn from the bottom of manganese nodules which increases the measured excess /sup 210/Pb activity (relative to /sup 226/Ra) at depth and artificially increases the /sup 210/Pb mixing coefficient. Based on /sup 32/Si data and pore water silica profiles, dissolution of biogenic silica in the sediment column appears to have a minor effect on the /sup 32/Si profile in the mixed layer.

  8. Improving the {sup 210}Pb-chronology of Pb deposition in peat cores from Chao de Lamoso (NW Spain)

    Energy Technology Data Exchange (ETDEWEB)

    Olid, Carolina, E-mail: carolina.olid@emg.umu.se [Department of Ecology and Environmental Science, Umeå University, SE-901 87 Umeå (Sweden); Departament de Física, Universitat Autònoma de Barcelona, E-08193 Bellaterra (Spain); Garcia-Orellana, Jordi, E-mail: jordi.garcia@uab.cat [Departament de Física, Universitat Autònoma de Barcelona, E-08193 Bellaterra (Spain); Institut de Ciència i Tecnologia Ambientals (ICTA), Universitat Autònoma de Barcelona, E-08193 Bellaterra (Spain); Masqué, Pere, E-mail: pere.masque@uab.cat [Departament de Física, Universitat Autònoma de Barcelona, E-08193 Bellaterra (Spain); Institut de Ciència i Tecnologia Ambientals (ICTA), Universitat Autònoma de Barcelona, E-08193 Bellaterra (Spain); Cortizas, Antonio Martínez, E-mail: antonio.martinez.cortizas@usc.es [Departamento de Edafoloxía e Química Agrícola, Universidade de Santiago de Compostela, E-15782 Santiago de Compostela (Spain); and others

    2013-01-15

    The natural radionuclide {sup 210}Pb is commonly used to establish accurate and precise chronologies for the recent (past 100–150 years) layers of peat deposits. The most widely used {sup 210}Pb-dating model, Constant Rate of Supply (CRS), was applied using data from three peat cores from Chao de Lamoso, an ombrotrophic mire in Galicia (NW Spain). On the basis of the CRS-chronologies, maximum Pb concentrations and enrichment factors (EFs) occurred in the 1960s and late 1970s, consistent with the historical use of Pb. However, maximum Pb fluxes were dated in the 1940s and the late 1960s, 10 to 20 years earlier. Principal component analysis (PCA) showed that, although the {sup 210}Pb distribution was mainly (74%) controlled by radioactive decay, about 20% of the {sup 210}Pb flux variability was associated with atmospheric metal pollution, suggesting an extra {sup 210}Pb supply source and thus invalidating the main assumption of the CRS model. When the CRS-ages were recalculated after correcting for the extra input from the {sup 210}Pb inventory of the uppermost peat layers of each core, Pb flux variations were consistent with the historical atmospheric Pb deposition. Our results not only show the robustness of the CRS model to establish accurate chronologies of recent peat deposits but also provide evidence that there are confounding factors that might influence the calculation of reliable peat accumulation rates (and thus also element accumulation rates/fluxes). This study emphasizes the need to verify the hypotheses of {sup 210}Pb-dating models and the usefulness of a full geochemical interpretation of peat bog records. - Highlights: ► Peat cores collected in NW Spain were used to reconstruct recent Pb deposition. ► Applicability of {sup 210}Pb-dating models (CRS) in bogs is discussed based on PCA results. ► Results showed that ∼ 20% of the {sup 210}Pb flux was related to anthropogenic metal pollution. ► Geochemical analysis of bogs is useful to

  9. COX-2-10aa-PGIS gene therapy improves erectile function in rats after cavernous nerve injury.

    Science.gov (United States)

    Lin, Haocheng; Yuan, Jiuhong; Ruan, Ke-He; Yang, Wenli; Zhang, Junlan; Dai, Yutian; Wang, Run

    2013-06-01

    Erectile dysfunction (ED) is a very common complication after radical prostatectomy. COX-2-10aa-PGIS is a newly engineered protein with COX-2 and prostacyclin synthase activities that converts arachidonic acid directly to prostacyclin (prostaglandin I2 [PGI2]). PGI2 is a potent smooth muscle relaxant. The purpose of this study was to explore the effect and mechanism of COX-2-10aa-PGIS gene therapy in penile rehabilitation. Bilateral cavernous nerve crush (BCNC) in adult Sprague-Dawley rats was used to mimic radical prostatectomy-induced ED. Sprague-Dawley rats were randomly assigned into four groups: 1. sham surgery; 2. BCNC; 3. BCNC + null control recombinant adenovirus intracavernous injection; and 4. BCNC + Ad-COX2-10aa-PGIS intracavernous injection. Twenty-eight days later, intracavernosal pressure (ICP) was recorded under cavernous nerve stimulation; in the meantime, the mean arterial pressure (MAP) was monitored. At the end of the measurement, the penis was harvested and processed for (i) immunohistochemistry analysis of endothelial nitric oxide synthase (eNOS), alpha-smooth muscle actin (α-SMA), and transforming growth factor beta-1 (TGF-β1); (ii) Masson's trichrome stain for smooth muscle/collagen ratios; (iii) Western blot of eNOS, α-SMA, TGF-β1, and COX2-10aa-PGIS; and (iv) terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay for apoptosis. Erectile function was evaluated by ICP/MAP. Smooth muscle and endothelium functions in corpora cavernosum were assessed by Masson's trichrome stain, immunohistochemistry, and Western blot. Apoptosis was identified by TUNEL assay. The results were the following: 1. COX2-10aa-PGIS gene therapy improved erectile function (82%, compared with control) in the BCNC rat model; 2. COX2-10aa-PGIS gene therapy increased eNOS (121%) and α-SMA (118%) expression and decreased TGF-β1 (45%) expression; 3. COX2-10aa-PGIS gene therapy reduced cell apoptosis after cavernous nerve injury (64%); and 4. COX2-10aa

  10. Tracking legacy radionuclides in St. Louis, Missouri, via unsupported (210)Pb.

    Science.gov (United States)

    Kaltofen, Marco P J; Alvarez, Robert; Hixson, Lucas

    2016-03-01

    Analysis of 287 soil, sediment and house dust samples collected in a 200 km(2)-zone in northern St. Louis County, Missouri, establish that offsite migration of radiological contaminants from Manhattan Project-era uranium processing wastes has occurred in this populated area. Specifically, 48% of samples (111 of a subset of 229 soils and sediments tested) had (210)Pb concentrations above the risk-based soil cleanup limits for residential farming established by the US Department of Energy at the Fernald, OH, uranium plant, which handled and stored the same concentrated Manhattan Project-era wastes; the geographical distribution of the exceedances are consistent with water and radon gas releases from a landfill and related sites used to store and dispose of legacy uranium wastes; and offsite soil and house dust samples proximal to the landfill showed distinctive secular disequilibrium among uranium and its progeny indicative of uranium ore processing wastes. The secular disequilibrium of uranium progeny in the environment provides an important method for distinguishing natural uranium from industrial uranium wastes. In this study, the detection of unsupported (210)Pb beyond expected atmospheric deposition rates is examined as a possible indicator of excessive radon emissions from buried uranium and radium-containing wastes. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. Fatigue Properties of the Ultra-High Strength Steel TM210A.

    Science.gov (United States)

    Yin, Guang-Qiang; Kang, Xia; Zhao, Gui-Ping

    2017-09-09

    This paper presents the results of an experiment to investigate the high cycle fatigue properties of the ultra-high strength steel TM210A. A constant amplitude rotating bending fatigue experiment was performed at room temperature at stress ratio R = -1. In order to evaluate the notch effect, the fatigue experiment was carried out upon two sets of specimens, smooth and notched, respectively. In the experiment, the rotating bending fatigue life was tested using the group method, and the rotating bending fatigue limit was tested using the staircase method at 1 × 10⁷ cycles. A double weighted least square method was then used to fit the stress-life (S-N) curve. The S-N curves of the two sets of specimens were obtained and the morphologies of the fractures of the two sets of specimens were observed with scanning electron microscopy (SEM). The results showed that the fatigue limit of the smooth specimen for rotating bending fatigue was 615 MPa; the ratio of the fatigue limit to tensile strength was 0.29, and the cracks initiated at the surface of the smooth specimen; while the fatigue limit of the notched specimen for rotating bending fatigue was 363 MPa, and the cracks initiated at the edge of the notch. The fatigue notch sensitivity index of the ultra-high strength maraging steel TM210A was 0.69.

  12. Stochastic properties of the geomagnetic field across the 210 mm chain

    Science.gov (United States)

    Wanliss, J. A.; Shiokawa, K.; Yumoto, K.

    2013-12-01

    We explore the stochastic fractal qualities of the geomagnetic field from 210 mm ground-based magnetometers during quiet and active magnetospheric conditions. We search through 10 years of these data to find events that qualify. Quiet intervals are defined by Kp ≤ 1 for 1,440 consecutive minutes. Similarly, active intervals require Kp ≥ 4 for 1,440 consecutive minutes. The total for quiet intervals is ~4.3×106 minutes and 2×108 minutes for active data points. With this large number of events compiled we then characterize changes in the nonlinear statistics of the geomagnetic field via measurements of a fractal scaling exponent. A clear difference in statistical behavior during quiet and active intervals is implied through analysis of the scaling exponents; active intervals generally have larger values of scaling exponents. This means that although 210 mm data appears monofractal on shorter timescales, it is more properly described as a multifractional Brownian motion. Long-range statistical behavior of the geomagnetic field at a local observation site can be described as a multifractional Brownian motion, thus suggesting the statistical structure required of mathematical models of magnetospheric activity. We also find that low-latitudes have scaling exponents that are consistently larger than for high-latitudes.

  13. In-vivo measurements of Pb-210 to determine cumulative exposure to radon daughters: A pilot study

    Energy Technology Data Exchange (ETDEWEB)

    Laurer, G.R.; Cohen, N. (New York Univ. Medical Center, Tuxedo, NY (United States). Dept. of Environmental Medicine); Stark, A.; Ju, C. (New York State Dept. of Health, Albany, NY (United States). Bureau of Environmental and Occupational Epidemiology)

    1991-05-01

    The objective of this study is to demonstrate the feasibility of estimating cumulative exposure of individuals to low concentrations of radon by measuring the amount of Pb-A-10 in their skeletons. This report presents progress to date establishing the validity of an vivo technique to measure skeletal burdens of Pb-210, accumulated from exposure to radon and radon progeny. With the skeletal content of Pb--210 and a model for Pb metabolism, cumulative exposure to radon and its short-lived daughters (radon/daughters) may be calculated for use in deriving a dose-response relationship between lung cancer and exposure to radon/daughters. Data are presented for 29 subjects exposed to above-average'' radon concentrations in their homes, showing the correlation between measured Pb--210 burdens, and measured pCi/l and WLM exposure estimates. Their results are compared to measurements of a population of 24 subject's presumed exposed to average concentrations. Measurements of a Pennsylvania family exposed for a year in a home with an extremely high radon content are also presented. Update of results of an ongoing study of the biological half-time of Pb--210 in man involving measurements, of a retired radiation worker with a 40 year old skeletal burden of Pb-210.

  14. Coupling of vesicle tethering and Rab binding is required for in vivo functionality of the golgin GMAP-210.

    Science.gov (United States)

    Sato, Keisuke; Roboti, Peristera; Mironov, Alexander A; Lowe, Martin

    2015-02-01

    Golgins are extended coiled-coil proteins believed to participate in membrane-tethering events at the Golgi apparatus. However, the importance of golgin-mediated tethering remains poorly defined, and alternative functions for golgins have been proposed. Moreover, although golgins bind to Rab GTPases, the functional significance of Rab binding has yet to be determined. In this study, we show that depletion of the golgin GMAP-210 causes a loss of Golgi cisternae and accumulation of numerous vesicles. GMAP-210 function in vivo is dependent upon its ability to tether membranes, which is mediated exclusively by the amino-terminal ALPS motif. Binding to Rab2 is also important for GMAP-210 function, although it is dispensable for tethering per se. GMAP-210 length is also functionally important in vivo. Together our results indicate a key role for GMAP-210-mediated membrane tethering in maintaining Golgi structure and support a role for Rab2 binding in linking tethering with downstream docking and fusion events at the Golgi apparatus. © 2015 Sato, Roboti, et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  15. Holistic risk assessment of surface water contamination due to Pb-210 in oil produced water from the Bakken Shale.

    Science.gov (United States)

    Torres, Luisa; Yadav, Om Prakash; Khan, Eakalak

    2017-02-01

    A holistic risk assessment of surface water (SW) contamination due to lead-210 (Pb-210) in oil produced water (PW) from the Bakken Shale in North Dakota (ND) was conducted. Pb-210 is a relatively long-lived radionuclide and very mobile in water. Because of limited data on Pb-210, a simulation model was developed to determine its concentration based on its parent radium-226 and historical total dissolved solids levels in PW. Scenarios where PW spills could reach SW were analyzed by applying the four steps of the risk assessment process. These scenarios are: (1) storage tank overflow, (2) leakage in equipment, and (3) spills related to trucks used to transport PW. Furthermore, a survey was conducted in ND to quantify the risk perception of PW from different stakeholders. Findings from the study include a low probability of a PW spill reaching SW and simulated concentration of Pb-210 in drinking water higher than the recommended value established by the World Health Organization. Also, after including the results from the risk perception survey, the assessment indicates that the risk of contamination of the three scenarios evaluated is between medium-high to high. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Proposed systematic methodology for analysis of Pb-210 radioactivity in residues produced in Brazilian natural gas pipes; Proposicao de um modelo analitico sistematico da atividade de Pb-210 em residuos gerados em linhas de gas

    Energy Technology Data Exchange (ETDEWEB)

    Ferreira, Aloisio Cordilha

    2003-11-15

    Since the 80's, the potential radiological hazards due to the handling of solid wastes contaminated with Rn-222 long-lived progeny - Pb-210 in special - produced in gas pipes and removed by pig operations have been subject of growing concern abroad our country. Nevertheless, little or no attention has been paid to this matter in the Brazilian plants up to now, being these hazards frequently underestimated or even ignored. The main purpose of this work was to propose a systematic methodology for analysis of Pb-210 radioactivity in black powder samples from some Brazilian plants, through the evaluation of direct Pb-210 gamma spectrometry and Bi-210 beta counting technical viabilities. In both cases, one in five samples of black powder analysed showed relevant activity (above 1Bq/kg) of Pb-210, being these results probably related to particular features of each specific plant (production levels, reservoir geochemical profile, etc.), in such a way that a single pattern is not observed. For the proposed methodology, gamma spectrometry proved to be the most reliable technique, showing a 3.5% standard deviation, and, for a 95% confidence level, overall fitness in the range of Pb-210 concentration of activity presented in the standard sample reference sheet, provided by IAEA for intercomparison purposes. In the Brazilian scene, however, the availability of statistically supported evidences is insufficient to allow the potential radiological hazard due to the management of black powder to be discarded. Thus, further research efforts are recommended in order to detect the eventually critical regions or plants where gas exploration, production and processing practices will require a regular program of radiological surveillance, in the near future. (author)

  17. Seasonal and long-term variation of 210Pb concentration in air, atmospheric deposition rate and total deposition velocity in south Germany.

    Science.gov (United States)

    Winkler, R; Rosner, G

    2000-12-18

    The activity concentration in air and atmospheric deposition rate of the long-lived radon progeny 210Pb has been investigated at Munich-Neuherberg, south Germany, from 1972 (activity concentration) and from 1981 (atmospheric flux) to 1999. For these periods, the continuous measurements yielded an average 210Pb activity concentration at ground level of 0.57 mBq m(-3) and an average total 210Pb deposition rate to ground of 180 Bq m(-2) year(-1). The average total deposition velocity, which relates the total 210Pb deposition rate to the 210Pb activity concentration was calculated to be 1.0 cm s(-1). The variation of the data with time was studied by time-series analysis and distinct seasonal patterns were identified. Maximum 210Pb activity concentrations in air are observed in the autumn and winter months (October through February) of each year. By contrast, the maximum 210Pb deposition rate is observed during summer (June-August), i.e. in the months with the highest amount of rainfall at this site. Like the 210Pb deposition rate, the total deposition velocity exhibits a seasonal pattern with maximum values in summer. Due to the long observation period of 18 years, it was possible to observe for the first time a strong positive relationship between 210Pb deposition and precipitation, especially for the months May and June and to a smaller extent for several other months. In the long-term, variations of approximately a factor of 2 were observed in the annual average 210Pb activity concentrations, the annual deposition sums and the annual average deposition velocities. Since around 1981 210Pb concentrations in air steadily decreased while 210Pb depositions increased. As a consequence of these significant trends, the time series of the total deposition velocity exhibits a trend of the data from approximately 0.7 cm s(-1) in 1981 to 1.7 cm s(-1) in 1999.

  18. Inhibition of miRNA-210 reverses nicotine-induced brain hypoxic-ischemic injury in neonatal rats.

    Science.gov (United States)

    Wang, Lei; Ke, Jun; Li, Yong; Ma, Qinyi; Dasgupta, Chiranjib; Huang, Xiaohui; Zhang, Lubo; Xiao, DaLiao

    2017-01-01

    Maternal tobacco use in pregnancy increases the risk of neurodevelopmental disorders and neurobehavioral deficits in postnatal life. The present study tested the hypothesis that perinatal nicotine exposure exacerbated brain vulnerability to hypoxic-ischemic (HI) injury in neonatal rats through up-regulation of miR-210 expression in the developing brain. Nicotine was administered to pregnant rats via subcutaneous osmotic minipumps. Experiments of HI brain injury were performed in 10-day-old pups. Perinatal nicotine treatment significantly decreased neonatal body and brain weights, but increased the brain to body weight ratio. Perinatal nicotine exposure caused a significant increase in HI brain infarct size in the neonates. In addition, nicotine enhanced miR-210 expression and significantly attenuated brain-derived neurotrophic factor (BDNF) and tropomyosin-related kinase isoform B (TrkB) protein abundance in the brain. Of importance, intracerebroventricular administration of a miR-210 inhibitor (miR-210-LNA) significantly decreased HI-induced brain infarct size and reversed the nicotine-increased vulnerability to brain HI injury in the neonate. Furthermore, miR-210-LNA treatment also reversed nicotine-mediated down-regulation of BDNF and TrkB protein expression in the neonatal brains. These findings provide novel evidence that the increased miR-210 plays a causal role in perinatal nicotine-induced developmental programming of ischemic sensitive phenotype in the brain. It represents a potential novel therapeutic approach for treatment of brain hypoxic-ischemic encephalopathy in the neonate-induced by fetal stress.

  19. A brief review of 210Pb sediment dating models and uncertainties in a world of global change

    Science.gov (United States)

    Sanchez-Cabeza, J. A.; Ruiz-Fernandez, A. C.

    2016-12-01

    Irrespective of the model names used, assumptions and (usually forgotten) uncertainties, the fact is that 210Pb sediment dating is an increasingly relevant tool in our world of global change. 210Pb dating results are needed to assess historical trends of sea level rise, quantify blue carbon fluxes and reconstruct environmental records of biogeochemical proxies for diverse processes in the aquatic ecosystems (such as ocean acidification, hypoxia and pollution). Although in the past 210Pb profiles departing from "ideal" decay trends were usually discarded, all profiles have useful information. In this work we review the principles and assumptions of the most common 210Pb dating models, and propose a logical formulation and classification of the models. 210Pb dating models provide two kinds of results: chronologies (i.e. age models) and accumulation rates. In many cases, the use of sediment and/or mass accumulation rates (SAR and MAR) is needed to assess environmental fluxes or, simply, to describe changes, such as catchment erosion or saltmarsh accretion. Although uncertainty quadratic propagation is a well-known technique, it requires that all variables are fully independent and requires demanding mathematical expressions which might lead to wrong results. We present here a Monte Carlo method that makes calculation easier and, likely, error-free. Not unexpectedly, the most important uncertainty sources are measurement uncertainties, which impose limitations on common techniques such as gamma spectrometry. 210Pb chronology does not cover all anthropogenic impacts, such as those caused by ancient civilizations, so radiocarbon also plays an important role in this kind of work. We also conceptually revise the limitations of both techniques and encourage scientists to link both dating techniques with a symmetrically open mind. Acknowledgements: projects CONACYT PDCPN2013-01/214349 and CB2010/153492, UNAM PAPIIT-IN203313, PRODEP network "Aquatic contamination: levels and

  20. Extended structure and fate of the nucleus in Henize 2-10

    Energy Technology Data Exchange (ETDEWEB)

    Nguyen, Dieu D.; Seth, Anil C.; Den Brok, Mark [Department of Physics and Astronomy, University of Utah, 115 South 1400 East, Salt Lake City, UT 84112 (United States); Reines, Amy E. [National Radio Astronomy Observatory, Charlottesville, VA 22903 (United States); Sand, David [Department of Physics, Texas Tech University, 2500 Broadway Street, Lubbock, TX 79409 (United States); McLeod, Brian, E-mail: dieu.nguyen@utah.edu, E-mail: aseth@astro.utah.edu, E-mail: denbrok@physics.utah.edu, E-mail: areines@nrao.edu, E-mail: david.sand@ttu.edu, E-mail: bmcleod@cfa.harvard.edu [Harvard-Smithsonian Center for Astrophysics, Harvard University, 60 Garden Street, Cambridge, MA 02138 (United States)

    2014-10-10

    We investigate the structure and nuclear region of the black hole (BH) hosting galaxy Henize 2-10. Surface brightness profiles are analyzed using Magellan/Megacam g- and r-band images. Excluding the central starburst, we find a best-fit two-component Sérsic profile with n {sub in} ∼ 0.6, r {sub eff,} {sub in} ∼ 260 pc and n {sub out} ∼ 1.8, r ∼ 1 kpc. Integrating out to our outermost data point (100'' ∼ 4.3 kpc), we calculate M{sub g} = –19.2 and M{sub r} = –19.8. The corresponding enclosed stellar mass is M {sub *} ∼ (10 ± 3) × 10{sup 9} M {sub ☉}, ∼3 × larger than previous estimates. Apart from the central ≲500 pc, with blue colors and an irregular morphology, the galaxy appears to be an early-type system. The outer color is quite red, (g – r){sub 0} = 0.75, suggesting a dominant old population. We study the nuclear region of the galaxy using archival Gemini/NIFS K-band adaptive optics spectroscopy and Hubble Space Telescope imaging. We place an upper limit on the BH mass of ∼10{sup 7} M {sub ☉} from the NIFS data, consistent with that from the M {sub BH}-radio-X-ray fundamental plane. No coronal lines are seen, but a Brγ source is located at the position of the BH with a luminosity consistent with the X-ray emission. The starburst at the center of Henize 2-10 has led to the formation of several super star clusters, which are within ∼100 pc of the BH. We examine the fate of the nucleus by estimating the dynamical masses and dynamical friction timescales of the clusters. The most massive clusters (∼10{sup 6} M {sub ☉}) have τ{sub dyn} ≲ 200 Myr, and thus Henize 2-10 may represent a rare snapshot of nuclear star cluster formation around a preexisting massive BH.

  1. Rate constant for the reaction of O(3P) with diacetylene from 210 to 423 K

    Science.gov (United States)

    Mitchell, M. B.; Nava, D. F.; Stief, L. J.

    1986-01-01

    The absolute rate constant for the reaction of O(3P) with diacetylene (C4H2) has been measured as a function of pressure and temperature by the flash-photolysis/resonance-fluorescence method. At 298 K and below, no pressure dependence of the rate constant was observed, but at 423 K a moderate (factor-of-2) increase was detected in the range 3 to 75 torr Ar.Results at or near the high-pressure limit are represented by an Arrhenius expression over the temperature range 210 to 423 K. The results are compared with previous determinations, all of which employed the discharge-flow/mass-spectrometry technique. The mechanism of the reaction is considered, including both primary and secondary processes. The heats of formation of the reactants, adducts, and products for the O(3P) + C4H2 reaction are discussed and contrasted with those for O(3P) + C2H2.

  2. Collective 2{sup +}{sub 1} excitations in {sup 206}Po and {sup 208,210}Rn

    Energy Technology Data Exchange (ETDEWEB)

    Grahn, T.; Auranen, K.; Herzan, A.; Jakobsson, U.; Julin, R.; Konki, J.; Peura, P.; Rahkila, P.; Stolze, S. [Department of Physics, University of Jyvaskyla (Finland); Helsinki Institute of Physics, Helsinki (Finland); Pakarinen, J. [Department of Physics, University of Jyvaskyla (Finland); Helsinki Institute of Physics, Helsinki (Finland); CERN-ISOLDE, PH Department, CERN, Geneva (Switzerland); Jokiniemi, L.; Suhonen, J. [Department of Physics, University of Jyvaskyla (Finland); Albers, M.; Blazhev, A.; Lewandowski, L.; Moschner, K.; Pfeiffer, M.; Radeck, D.; Reiter, P.; Rudiger, M.; Seidlitz, M.; Siebeck, B.; Steinbach, T.; Thoele, P.; Warr, N.; Vogt, A. [Universitaet zu Koeln, Institut fuer Kernphysik, Koeln (Germany); Bauer, C.; Boenig, S.; Kroell, T.; Thuerauf, M. [TU Darmstadt, Institut fuer Kernphysik, Darmstadt (Germany); Bernards, C. [Yale University, Wright Nuclear Structure Laboratory, New Haven, CT (United States); Butler, P.A. [University of Liverpool, Department of Physics, Oliver Lodge Laboratory, Liverpool (United Kingdom); Damyanova, A. [Universite de Geneve (Switzerland); Coster, T. de; Witte, H. de; Elseviers, J.; Huyse, M.; Kesteloot, N.; Reynders, K.; Sambi, S.; Wrzosek-Lipska, K. [Department of Physics, Instituut voor Kern- en Stralingsfysica, Leuven (Belgium); Gaffney, L.P. [University of Liverpool, Department of Physics, Oliver Lodge Laboratory, Liverpool (United Kingdom); Department of Physics, Instituut voor Kern- en Stralingsfysica, Leuven (Belgium); University of the West of Scotland, School of Engineering, Paisley (United Kingdom); Rapisarda, E.; Duppen, P. van [Department of Physics, Instituut voor Kern- en Stralingsfysica, Leuven (Belgium); CERN-ISOLDE, PH Department, CERN, Geneva (Switzerland); Salsac, M.D.; Zielinska, M. [CEA-Saclay, Gif-sur-Yvette (France); Scheck, M. [TU Darmstadt, Institut fuer Kernphysik, Darmstadt (Germany); University of the West of Scotland, School of Engineering, Paisley (United Kingdom); Venhart, M.; Veselsky, M. [Slovak Academy of Sciences, Institute of Physics, Bratislava 45 (Slovakia); Vermeulen, M.J. [University of York, Department of Physics, York (United Kingdom); Werner, V. [TU Darmstadt, Institut fuer Kernphysik, Darmstadt (Germany); Yale University, Wright Nuclear Structure Laboratory, New Haven, CT (United States)

    2016-11-15

    In the present study, B(E2; 2{sup +}{sub 1} → 0{sup +}{sub 1}) values have been measured in the {sup 208,210}Rn and {sup 206}Po nuclei through Coulomb excitation of re-accelerated radioactive beams in inverse kinematics at CERN-ISOLDE. These nuclei have been proposed to lie in, or at the boundary of the region where the seniority scheme should persist. However, contributions from collective excitations are likely to be present when moving away from the N = 126 closed shell. Such an effect is confirmed by the observed increased collectivity of the 2{sup +}{sub 1} → 0{sup +}{sub 1} transitions. Experimental results have been interpreted with the aid of theoretical studies carried out within the BCS-based QRPA framework. (orig.)

  3. A review of radio chemical analysis and estimation of 210Po in soil matrices

    Directory of Open Access Journals (Sweden)

    N.K. Sethy

    2015-10-01

    Full Text Available The naturally occurring radionuclide 210Po, arising from the uranium–radium decay series, provides a considerable contribution to the radiation exposure to humans. Polonium is analyzed for a variety of purposes, including for radiological impact assessment or as a tracer of environmental processes. Losses of polonium may occur at temperatures above 100 °C, depending on conditions, requiring particular care in sample preparation and treatment. There has been little development regarding analysis of polonium in environmental samples since 1960 as radiochemical analysis of polonium is quite straight forward due to easy of source preparation through auto-deposition on to metal surfaces. In this paper a brief review of estimation of polonium in the soil samples have given emphasis.

  4. Development of OFDM based Secondary Link: Some Experimental Results on USRP N210 Platform

    Directory of Open Access Journals (Sweden)

    M. Janjić

    2014-06-01

    Full Text Available Some experimental results of the concept development and practical implementation of an Orthogonal Frequency Division Multiplexing (OFDM based secondary cognitive link are presented in this paper. The secondary link is realized using Universal Software Radio Peripheral (USRP N210 platforms. For communication with USRP, we use MATLAB toolbox. Several algorithms are used to overcome transmission problems. Time-synchronization is achieved using a method based on auto-correlation of two sliding windows. Frequency offset estimation is performed using a phase offset between samples in a signal header, comprised of a sinusoid. A channel is estimated using predefined symbols inserted at the beginning of every frame, which enables channel equalization. Also, the cognitive feature of spectrum sensing and changing transmission parameters is implemented. A least-mean-square adaptive filter is introduced to offer time-synchronization error estimation as well as an alternative option for channel equalization.

  5. New μs isomers in the neutron-rich 210Hg nucleus

    Science.gov (United States)

    Gottardo, A.; Valiente-Dobón, J. J.; Benzoni, G.; Gadea, A.; Lunardi, S.; Boutachkov, P.; Bruce, A. M.; Górska, M.; Grebosz, J.; Pietri, S.; Podolyák, Zs.; Pfützner, M.; Regan, P. H.; Weick, H.; Alcántara Núñez, J.; Algora, A.; Al-Dahan, N.; de Angelis, G.; Ayyad, Y.; Alkhomashi, N.; Allegro, P. R. P.; Bazzacco, D.; Benlliure, J.; Bowry, M.; Bracco, A.; Bunce, M.; Camera, F.; Casarejos, E.; Cortes, M. L.; Crespi, F. C. L.; Corsi, A.; Denis Bacelar, A. M.; Deo, A. Y.; Domingo-Pardo, C.; Doncel, M.; Dombradi, Zs.; Engert, T.; Eppinger, K.; Farrelly, G. F.; Farinon, F.; Farnea, E.; Geissel, H.; Gerl, J.; Goel, N.; Gregor, E.; Habermann, T.; Hoischen, R.; Janik, R.; John, P. R.; Klupp, S.; Kojouharov, I.; Kurz, N.; Lenzi, S. M.; Leoni, S.; Mandal, S.; Menegazzo, R.; Mengoni, D.; Million, B.; Modamio, V.; Morales, A. I.; Napoli, D. R.; Naqvi, F.; Nicolini, R.; Nociforo, C.; Prochazka, A.; Prokopowicz, W.; Recchia, F.; Ribas, R. V.; Reed, M. W.; Rudolph, D.; Sahin, E.; Schaffner, H.; Sharma, A.; Sitar, B.; Siwal, D.; Steiger, K.; Strmen, P.; Swan, T. P. D.; Szarka, I.; Ur, C. A.; Walker, P. M.; Wieland, O.; Wollersheim, H.-J.

    2013-10-01

    Neutron-rich nuclei in the lead region, beyond N = 126, have been studied at the FRS-RISING setup at GSI, exploiting the fragmentation of a primary uranium beam. Two isomeric states have been identified in 210Hg: the 8+ isomer expected from the seniority scheme in the νg9/2 shell and a second one at low spin and low excitation energy. The decay strength of the 8+ isomer confirms the need of effective three-body forces in the case of neutron-rich lead isotopes. The other unexpected low-lying isomer has been tentatively assigned as a 3- state, although this is in contrast with theoretical expectations.

  6. New μs isomers in the neutron-rich {sup 210}Hg nucleus

    Energy Technology Data Exchange (ETDEWEB)

    Gottardo, A., E-mail: andrea.gottardo@lnl.infn.it [Istituto Nazionale di Fisica Nucleare, Laboratori Nazionali di Legnaro, Legnaro, 35020 (Italy); Dipartimento di Fisica dell' Università degli Studi di Padova, Padova, 35131 (Italy); Valiente-Dobón, J.J. [Istituto Nazionale di Fisica Nucleare, Laboratori Nazionali di Legnaro, Legnaro, 35020 (Italy); Benzoni, G. [Istituto Nazionale di Fisica Nucleare, Sezione di Milano, Milano, 20133 (Italy); Gadea, A. [Instituto de Física Corpuscular, CSIC-Universitat de València, València, E-46980 (Spain); Lunardi, S. [Dipartimento di Fisica dell' Università degli Studi di Padova, Padova, 35131 (Italy); Istituto Nazionale di Fisica Nucleare, Sezione di Padova, Padova, 35131 (Italy); Boutachkov, P. [GSI Helmholtzzentrum für Schwerionenforschung, Darmstadt, D-64291 (Germany); Bruce, A.M. [School of Computing, Engineering and Mathematics, University of Brighton, Brighton, BN2 4GJ (United Kingdom); Górska, M. [GSI Helmholtzzentrum für Schwerionenforschung, Darmstadt, D-64291 (Germany); Grebosz, J. [Niewodniczanski Institute of Nuclear Physics, Polish Academy of Science, Krakow, PL-31-342 (Poland); Pietri, S. [GSI Helmholtzzentrum für Schwerionenforschung, Darmstadt, D-64291 (Germany); Podolyák, Zs. [Department of Physics, University of Surrey, Guildford, GU2 7XH (United Kingdom); Pfützner, M. [Faculty of Physics, University of Warsaw, Warsaw, PL-00681 (Poland); Regan, P.H. [Department of Physics, University of Surrey, Guildford, GU2 7XH (United Kingdom); Weick, H. [GSI Helmholtzzentrum für Schwerionenforschung, Darmstadt, D-64291 (Germany); Alcántara Núñez, J. [Universidade de Santiago de Compostela, Santiago de Compostela, E-175706 (Spain); and others

    2013-10-01

    Neutron-rich nuclei in the lead region, beyond N=126, have been studied at the FRS-RISING setup at GSI, exploiting the fragmentation of a primary uranium beam. Two isomeric states have been identified in {sup 210}Hg: the 8{sup +} isomer expected from the seniority scheme in the νg{sub 9/2} shell and a second one at low spin and low excitation energy. The decay strength of the 8{sup +} isomer confirms the need of effective three-body forces in the case of neutron-rich lead isotopes. The other unexpected low-lying isomer has been tentatively assigned as a 3{sup −} state, although this is in contrast with theoretical expectations.

  7. Radionuclide scrotal imaging: further experience with 210 patients. Part I. Anatomy, pathophysiology, and methods

    Energy Technology Data Exchange (ETDEWEB)

    Chen, D.C.P.; Holder, L.E.; Melloul, M.

    1983-08-01

    Ten years' experience with radionuclide scrotal imaging (RSI) to evaluate perfusion of the scrotal contents has confirmed the value of this examination. In 1973, Nadel et al. first proposed using sodium pertechnetate (Tc-99m) to diagnose testicular torsion. By the end of 1982, more than thirty articles have been published on this topic, with most emphasizing the usefulness of RSI in managing patients with acute scrotal pain. The present communication describes our findings in 210 patients, not previously reported. There were four groups with relatively distinct clinical presentations: (a) acute scrotal pain, (b) chronic scrotal pain, (c) scrotal injury, and (d) scrotal mass. The anatomic and pathophysiologic bases for the scan findings will be emphasized. We discuss the staging of testicular torsion; viability of the compromised testicle; variability in the presentation of acute infection; anatomy of trauma, varicocele, and inguinal hernia; and the correlation with scrotal sonography.

  8. Geochemistry of manganese, iron, uranium, lead-210 and major ions in the Susquehanna River

    Energy Technology Data Exchange (ETDEWEB)

    Lewis, D.M.

    1976-01-01

    The change in water composition accompanying a change in discharge of large streams and the Susquehanna River results from the change in the proportions of the total flow composed of type waters of constant composition. This change in the flow proportions is due to the different hydrologic responses to precipitation inputs of basins underlain by different single rock types. The in-river precipitation of mine-drainage-injected Mn and Fe was studied at a pH of approximately 7. For Mn the removal from solution appears to be first order. The rate constant is 10/sup 3/ times greater than the extrapolated autocatalytic rate constant of previous laboratory experiments. The study of the removal of Fe from solution yields a first order rate constant consistent with previous laboratory experiments. Lead-210 was used as a natural tracer to study the fate of trace metals.

  9. Trace element dating by 210Pb: Application to an estuarine lagoon

    Science.gov (United States)

    Souza, V. L. B.; Hazin, C. A.; Lima, R. A.

    2007-09-01

    The Lagoa Olho D'Água (Pernambuco, Brazil), is a 3.75 km 2 lagoon which receives freshwater from both the Atlantic Ocean and Jaboatão River. The lagoon is under severe degradation process caused by pollutants released from industrial facilities and by the discharge of untreated domestic sewage. This contamination can be traced by analyzing sediments, which are the ultimate sink of pollutants that are derived from anthropogenic activities. The 210Pb dating method is the principal technique for characterizing sediments on a time scale spanning over the last 100-150 years. The objective of this study was to trace the time evolution of metal contaminants in sediments and its correlation with the industrial history of the area.

  10. Bremsstrahlung emission probability in the {alpha} decay of {sup 210}Po

    Energy Technology Data Exchange (ETDEWEB)

    Boie, Hans-Hermann

    2009-06-03

    A high-statistics measurement of bremsstrahlung emitted in the {alpha} decay of {sup 210}Po has been performed. The measured differential emission probabilities, which could be followed up to {gamma}-energies of {proportional_to} 500 keV, allow for the first time for a serious test of various model calculations of the bremsstrahlung accompanied {alpha} decay. It is shown that corrections to the {alpha}-{gamma} angular correlation due to the interference between the electric dipole and quadrupole amplitudes and due to the relativistic character of the process have to be taken into account. With the experimentally derived angular correlation the measured energydifferential bremsstrahlung emission probabilities show excellent agreement with the fully quantum mechanical calculation. (orig.)

  11. MicroRNA-210 Suppresses Junction Proteins and Disrupts Blood-Brain Barrier Integrity in Neonatal Rat Hypoxic-Ischemic Brain Injury.

    Science.gov (United States)

    Ma, Qingyi; Dasgupta, Chiranjib; Li, Yong; Huang, Lei; Zhang, Lubo

    2017-06-24

    Cerebral edema, primarily caused by disruption of the blood-brain barrier (BBB), is one of the serious complications associated with brain injury in neonatal hypoxic-ischemic encephalopathy (HIE). Our recent study demonstrated that the hypoxic-ischemic (HI) treatment significantly increased microRNA-210 (miR-210) in the neonatal rat brain and inhibition of miR-210 provided neuroprotection in neonatal HI brain injury. The present study aims to determine the role of miR-210 in the regulation of BBB integrity in the developing brain. miR-210 mimic was administered via intracerebroventricular injection (i.c.v.) into the brain of rat pups. Forty-eight hours after the injection, a modified Rice-Vannucci model was conducted to produce HI brain injury. Post-assays included cerebral edema analysis, western blotting, and immunofluorescence staining for serum immunoglobulin G (IgG) leakage. The results showed that miR-210 mimic exacerbated cerebral edema and IgG leakage into the brain parenchyma. In contrast, inhibition of miR-210 with its complementary locked nucleic acid oligonucleotides (miR-210-LNA) significantly reduced cerebral edema and IgG leakage. These findings suggest that miR-210 negatively regulates BBB integrity i n the neonatal brain. Mechanistically, the seed sequences of miR-210 were identified complementary to the 3' untranslated region (3' UTR) of the mRNA transcripts of tight junction protein occludin and adherens junction protein β-catenin, indicating downstream targets of miR-210. This was further validated by in vivo data showing that miR-210 mimic significantly reduced the expression of these junction proteins in rat pup brains. Of importance, miR-210-LNA preserved the expression of junction proteins occludin and β-catenin from neonatal HI insult. Altogether, the present study reveals a novel mechanism of miR-210 in impairing BBB integrity that contributes to cerebral edema formation after neonatal HI insult, and provides new insights in miR-210-LNA

  12. Out-of-body experience in vestibular disorders - A prospective study of 210 patients with dizziness.

    Science.gov (United States)

    Lopez, Christophe; Elzière, Maya

    2017-06-08

    Out-of-body experiences (OBEs) are states during which people experience their centre of awareness as located outside of their physical body, along with the sensation of seeing the environment from an elevated viewpoint. OBE is encountered in epilepsy, migraine and depersonalization, and it is not an uncommon experience in the general population. Current neuroscientific models of bodily self-consciousness consider that OBE are related to a failure to integrate visual, somatosensory and vestibular signals. These models have highlighted the importance of visual-vestibular mismatch in OBE. Case reports from older clinical literature suggest that vestibular disorders may precipitate OBE, but we were lacking population-based evidence that OBE is related to vestibular disorders. The present observational, prospective study describes otoneurological, neuropsychological and phenomenological correlates of OBE in the largest sample of patients with dizziness to date (n = 210) compared to a group of age- and gender-matched controls with no history of dizziness (n = 210). We show a significantly higher occurrence of OBE in patients with dizziness (14%) than in healthy participants (5%). Most of the patients experienced OBE only after they started having dizziness for the first time. OBE in patients with dizziness were mainly related to peripheral vestibular disorders. We also identify depersonalization-derealization, depression and anxiety as the main predictors of OBE in patients with dizziness, as well as a contribution of migraine. Depersonalization-derealization was the only significant predictor of OBE in healthy controls. Altogether, our data indicate that OBE in patients with dizziness may arise from a combination of perceptual incoherence evoked by the vestibular dysfunction with psychological factors (depersonalization-derealization, depression and anxiety) and neurological factors (migraine). Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Use of 210Pb/ 226Ra disequilibria in the dating of deep-sea whale falls

    Science.gov (United States)

    Schuller, Daniel; Kadko, David; Smith, Craig R.

    2004-02-01

    Deep-sea whale falls, in particular the skeletal remains of whales that have sunk to the seafloor, are remarkable temporary reducing habitats. Reduced chemical species created by anaerobic microbial decay of lipid and organic compounds within the whale bone matrix fuel chemosynthetic-based communities, including bacteria, mussels, limpets, snails, and clams. Many of these species exhibit taxonomic affinities to other chemosynthetic deep-sea organisms colonizing hydrothermal vents and cold seeps. Knowledge of the timescales of whale fall community succession and persistence of these assemblages is needed to reliably estimate the abundance of whale fall habitats and to understand the dynamics of the whale fall communities and their potential roles as stepping stones for sulfophilic species. We have developed a radiochemical method based on 210Pb/ 226Ra disequilibria for estimating the ages of seafloor whale bone communities. Measurements of 210Pb/ 226Ra performed on known age bone samples yielded radioisotope ages in good agreement with the known ages. Our results indicate that this technique is valid for bones 10-85 years old (time since cetacean death). This technique, applied to multiple bones of unknown age whale falls taken from Monterey Canyon, Santa Catalina Basin, and San Nicholas Basin, constrained the upper limit ages of these systems (in 2002) to 6.3±1.0 years, 44.0±7.0 to 53.4±8.3 years, and 66.4±9.6 to 82.6±11 years, respectively. These ages were in reasonable agreement with faunal and/or skeletal observations. In addition, a preliminary lipid degradation rate was calculated for the Santa Catalina Basin whale fall using an independent time series and calibrated to the radiochemically determined age. Both radiochemical and lipid degradation evidence suggest that the whale fall microhabitat is able to support life for many decades.

  14. NPC-EXs Alleviate Endothelial Oxidative Stress and Dysfunction through the miR-210 Downstream Nox2 and VEGFR2 Pathways

    Directory of Open Access Journals (Sweden)

    Hua Liu

    2017-01-01

    Full Text Available We have demonstrated that neural progenitor cells (NPCs protect endothelial cells (ECs from oxidative stress. Since exosomes (EXs can convey the benefit of parent cells through their carried microRNAs (miRs and miR-210 is ubiquitously expressed with versatile functions, we investigated the role of miR-210 in the effects of NPC-EXs on oxidative stress and dysfunction in ECs. NPCs were transfected with control and miR-210 scramble/inhibitor/mimic to generate NPC-EXscon, NPC-EXssc, NPC-EXsanti-miR-210, and NPC-EXsmiR-210. The effects of various NPC-EXs on angiotensin II- (Ang II- induced reactive oxygen species (ROS overproduction, apoptosis, and dysfunction, as well as dysregulation of Nox2, ephrin A3, VEGF, and p-VEGFR2/VEGFR2 in ECs were evaluated. Results showed (1 Ang II-induced ROS overproduction, increase in apoptosis, and decrease in tube formation ability, accompanied with Nox2 upregulation and reduction of p-VEGFR2/VEGFR2 in ECs. (2 Compared to NPC-EXscon or NPC-EXssc, NPC-EXsanti-miR-210 were less whereas NPC-EXsmiR-210 were more effective on attenuating these detrimental effects induced by Ang II in ECs. (3 These effects of NPC-EXsanti-miR-210 and NPC-EXsmiR-210 were associated with the changes of miR-210, ephrin A3, VEGF, and p-VEGFR2/VEGFR2 ratio in ECs. Altogether, the protective effects of NPC-EXs on Ang II-induced endothelial injury through miR-210 which controls Nox2/ROS and VEGF/VEGFR2 signals were studied.

  15. [Using 137Cs and 210Pb(ex) to trace the impact of soil erosion on soil organic carbon at a slope farmland in the black soil region].

    Science.gov (United States)

    Fang, Hai-Yan; Sheng, Mei-Ling; Sun, Li-Ying; Cai, Qiang-Guo

    2013-07-01

    Soil cores were collected from a 28.5 hm2 slope farmland in the black soil region of Northeast China. Based on the sampled data of 137Cs, 210Pb(ex) and SOC, the potentials of applying 137Cs and 210Pb(ex) for assessing SOC redistribution were evaluated, aimed to approach the impact of soil erosion on soil organic carbon (SOC) in black soil region. At both planar and vertical directions, the 137Cs, 210Pb(ex) and SOC in the farmland had similar distribution patterns. Although there were large planar variations in the 137Cs and 210Pb(ex) areal activities and the SOC stock as affected by soil erosion and deposition, the 137Cs, 210Pb(ex) and SOC had similar changing trends over the landscape. Two depth distribution profiles were also used to study the relations of 137Cs and 210Pb(ex) with SOC. At eroded site, the radioactivities of 137Cs and 210Pb(ex) and the SOC mass fraction did not show large variations in 0-25 cm soil layer, but decreased sharply below 25 cm. For the deposition sample, the radioactivities of 137Cs and 210Pb(ex) in 0-100 cm soil increased firstly and then decreased. The SOC mass fraction also had similar depth distribution pattern in this soil layer. The 137Cs and 210Pb(ex) presented positive linear correlations with the SOC, indicating that 137Cs, 210Pb(ex) and SOC moved with the same physical mechanism in the farmland, and fallout 137Cs and 210Pb(ex) could be used to study spatio-temporal distribution characteristics of SOC in the black soil region under the condition of soil erosion.

  16. Carbon export fluxes and export efficiency in the central Arctic during the record sea-ice minimum in 2012: a joint 234Th/238U and 210Po/210Pb study

    Science.gov (United States)

    Roca-Martí, Montserrat; Puigcorbé, Viena; Rutgers van der Loeff, Michiel M.; Katlein, Christian; Fernández-Méndez, Mar; Peeken, Ilka; Masqué, Pere

    2016-07-01

    The Arctic sea-ice extent reached a record minimum in September 2012. Sea-ice decline increases the absorption of solar energy in the Arctic Ocean, affecting primary production and the plankton community. How this will modulate the sinking of particulate organic carbon (POC) from the ocean surface remains a key question. We use the 234Th/238U and 210Po/210Pb radionuclide pairs to estimate the magnitude of the POC export fluxes in the upper ocean of the central Arctic in summer 2012, covering time scales from weeks to months. The 234Th/238U proxy reveals that POC fluxes at the base of the euphotic zone were very low (2 ± 2 mmol C m-2 d-1) in late summer. Relationships obtained between the 234Th export fluxes and the phytoplankton community suggest that prasinophytes contributed significantly to the downward fluxes, likely via incorporation into sea-ice algal aggregates and zooplankton-derived material. The magnitude of the depletion of 210Po in the upper water column over the entire study area indicates that particle export fluxes were higher before July/August than later in the season. 210Po fluxes and 210Po-derived POC fluxes correlated positively with sea-ice concentration, showing that particle sinking was greater under heavy sea-ice conditions than under partially ice-covered regions. Although the POC fluxes were low, a large fraction of primary production (>30%) was exported at the base of the euphotic zone in most of the study area during summer 2012, indicating a high export efficiency of the biological pump in the central Arctic.

  17. A 2-10 GHz GaAs MMIC opto-electronic phase detector for optical microwave signal generators

    DEFF Research Database (Denmark)

    Bruun, Marlene; Gliese, Ulrik Bo; Petersen, Anders Kongstad

    1994-01-01

    Optical transmission of microwave signals becomes increasingly important. Techniques using beat between optical carriers of semiconductor lasers are promising if efficient optical phase locked loops are realized. A highly efficient GaAs MMIC optoelectronic phase detector for a 2-10 GHz OPLL...

  18. Sedimentation rates in Atibaia River basin, São Paulo State, Brazil, using 210Pb as geochronometer.

    Science.gov (United States)

    Sabaris, T P P; Bonotto, D M

    2011-01-01

    The constant initial concentration (CIC) of unsupported/excess (210)Pb model was successfully used to assess (210)Pb data of nine sediment cores from Atibaia River basin, São Paulo State, Brazil. The (210)Pb-based apparent sediment mass accumulation rates ranged from 47.7 to 782.4 mg/cm(2)yr, whereas the average linear sedimentation rates between 0.16 and 1.32 cm/yr, which are compatible with the calculated sediment mass fluxes, i.e. a higher sediment mass accumulation rate yielded a higher linear sedimentation rate. The higher long-term based accumulation rate tended to be found in topographically softer regions. This occurs because the sediments are preferentially transported in topographically steeper regions instead of being deposited. Anthropic activities like deforestation possibly interfered with the natural/normal sedimentation processes, which increased in accordance with modifications on the channel drainage. The radionuclide geochronology as described in this paper allows determination of sedimentation rates that are compatible with values estimated elsewhere. The adoption of an appropriate factor generated from previous laboratory experiments resulted in a successful correction for the (222)Rn-loss from the sediments, bringing the estimate of the parent-supported (in-situ produced) (210)Pb to reliable values required by the CIC model. Copyright © 2010 Elsevier Ltd. All rights reserved.

  19. {sup 210}Pb atmospheric flux and growth rates of a microbial mat from the northwestern Mediterranean Sea (Ebro River Delta)

    Energy Technology Data Exchange (ETDEWEB)

    Sanchez-Cabeza, J.A.; Masque, P.; Martinez-Alonso, M.; Mir, J.; Esteve, I.

    1999-11-01

    Environmental archives are needed to study the variability of natural systems and the impact of man on them. Microbial mats, modern homologues of stromatolites, can be found in extreme environments such as the Ebro River Delta and were studied as potential environmental archives of atmospheric deposition. {sup 210}Pb, a radiotracer widely used in geochronology studies, was used both to determine the growth rates of a microbial mat from this environment and to estimate the {sup 210}Pb atmospheric flux in the northwestern Mediterranean Sea. The {sup 210}Pb profile showed the presence of three distinct peaks related to low growth-rate periods. This variability indicted the sensitivity of the system to external forcing. The annual atmospheric flux of {sup 210}Pb was 81.2 {+-} 1.4 B1 m{sup {minus}2}yr{sup {minus}1}, which is similar to other values found in the literature. The age profile showed two layers of differing growth rates, being 0.99 {+-} 0.10 mm yr{sup {minus}1} from the surface down to 10 mm depth. The accumulated mass profile showed a change at about 9 mm depth, corresponding to year 1983 {+-} 1. It is noteworthy that this is coincident with a strong El Nino Southern Oscillation event during 1982--1983, which has been shown to affect other ecosystems, including some in the Mediterranean area.

  20. 17 CFR 210.4-10 - Financial accounting and reporting for oil and gas producing activities pursuant to the Federal...

    Science.gov (United States)

    2010-04-01

    ... reporting for oil and gas producing activities pursuant to the Federal securities laws and the Energy Policy... of General Application § 210.4-10 Financial accounting and reporting for oil and gas producing... engaged in oil and gas producing activities in filings under the Federal securities laws and for the...

  1. 40 CFR 1060.210 - What records should equipment manufacturers keep if they do not apply for certification?

    Science.gov (United States)

    2010-07-01

    ... IN-USE NONROAD AND STATIONARY EQUIPMENT Certifying Emission Families § 1060.210 What records should... family names of the certificates that will cover your equipment, the part numbers of those certified... information for each piece of equipment you produce. (c) Describe how you comply with any emission-related...

  2. 17 CFR 210.6-08 - Special provisions applicable to the statements of operations of issuers of face-amount...

    Science.gov (United States)

    2010-04-01

    ... HOLDING COMPANY ACT OF 1935, INVESTMENT COMPANY ACT OF 1940, INVESTMENT ADVISERS ACT OF 1940, AND ENERGY POLICY AND CONSERVATION ACT OF 1975 Registered Investment Companies § 210.6-08 Special provisions... Operations 1. Investment income. State separately income from: (a) Interest on mortgages; (b) interest on...

  3. 17 CFR 210.6-06 - Special provisions applicable to the balance sheets of issuers of face-amount certificates.

    Science.gov (United States)

    2010-04-01

    ... 1935, INVESTMENT COMPANY ACT OF 1940, INVESTMENT ADVISERS ACT OF 1940, AND ENERGY POLICY AND CONSERVATION ACT OF 1975 Registered Investment Companies § 210.6-06 Special provisions applicable to the... certificates shall comply with the following provisions: Assets 1. Investments. State separately each major...

  4. Polyphosphate formation by Acinetobacter johnsonii 210A: effect of cellular energy status and phosphate-specific transport system

    NARCIS (Netherlands)

    Niel, E.W.J.; Best, de J.H.; Kets, E.P.W.; Bonting, C.F.C.; Kortstee, G.J.J.

    1999-01-01

    In acetate-limited chemostat cultures of Acinetobacter johnsonii 210A at a dilution rate of 0.1 h-1 the polyphosphate content of the cells increased from 13% to 24% of the biomass dry weight by glucose (100 mM), which was only oxidized to gluconic acid. At this dilution rate, only about 17% of the

  5. Rules implementing Sections 201 and 210 of the Public Utility Regulatory Policies Act of 1978: a regulatory history

    Energy Technology Data Exchange (ETDEWEB)

    Danziger, R.N.; Caples, P.W.; Huning, J.R.

    1980-09-15

    An analysis is made of the rules implementing Sections 201 and 210 of the Public Utility Regulatory Policies Act of 1978 (PURPA). The act provides that utilities must purchase power from qualifying producers of electricity at nondiscriminatory rates, and it exempts private generators from virtually all state and Federal utility regulations. Most of the analysis presented is taken from the perspective of photovoltaics (PV) and solar thermal electric point-focusing distributed receivers (pfdr). It is felt, however, that the analysis is applicable both to cogeneration and other emerging technologies. Chapters presented are: The FERC Response to Oral Comments on the Proposed Rules Implementing Sections 201 and 210 of PURPA; Additional Changes Made or Not Made That Were Addressed in Other Than Oral Testimony; View on the Proposed Rules Implementing Sections 201 and 210 of PURPA; Response to Comments on the Proposed 201 and 210 Rules; and Summary Analysis of the Environmental Assessment of the Rules. Pertinent reference material is provided in the Appendices, including the text of the rules. (MCW)

  6. 17 CFR 210.12-23 - Mortgage loans on real estate and interest earned on mortgages. 1

    Science.gov (United States)

    2010-04-01

    ... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Mortgage loans on real estate... and Content of Schedules § 210.12-23 Mortgage loans on real estate and interest earned on mortgages. 1 Part 1—Mortgage loans on real estate at close of period Column A—List by classification indicated below...

  7. 20 CFR 1002.210 - What seniority rights does an employee have when reemployed following a period of uniformed service?

    Science.gov (United States)

    2010-04-01

    ... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false What seniority rights does an employee have... and Benefits Seniority Rights and Benefits § 1002.210 What seniority rights does an employee have when... and seniority-based rights and benefits that the employee would have attained if he or she had...

  8. Summary of the Blind Test Campaign to predict the High Reynolds number performance of DU00-W-210 airfoil

    DEFF Research Database (Denmark)

    Yilmaz, Özlem Ceyhan; Pires, Oscar; Munduate, Xabier

    2017-01-01

    This paper summarizes the results of a blind test campaign organized in the AVATAR project to predict the high Reynolds number performance of a wind turbine airfoil for wind turbine applications. The DU00-W-210 airfoil was tested in the DNW-HDG pressurized wind tunnel in order to investigate...

  9. 42 CFR 413.210 - Conditions for payment under the end-stage renal disease (ESRD) prospective payment system.

    Science.gov (United States)

    2010-10-01

    ... REIMBURSEMENT; PAYMENT FOR END-STAGE RENAL DISEASE SERVICES; OPTIONAL PROSPECTIVELY DETERMINED PAYMENT RATES FOR SKILLED NURSING FACILITIES Payment for End-Stage Renal Disease (ESRD) Services and Organ Procurement Costs § 413.210 Conditions for payment under the end-stage renal disease (ESRD) prospective payment system...

  10. 17 CFR 210.3-09 - Separate financial statements of subsidiaries not consolidated and 50 percent or less owned persons.

    Science.gov (United States)

    2010-04-01

    ... financial statements of subsidiaries not consolidated and 50 percent or less owned persons. (a) If any of... consolidated financial statements required by §§ 210.3-01 and 3-02. However, these separate financial... 17 Commodity and Securities Exchanges 2 2010-04-01 2010-04-01 false Separate financial statements...

  11. 49 CFR 210.9 - Movement of a noise defective locomotive, rail car, or consist of a locomotive and rail cars.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Movement of a noise defective locomotive, rail car, or consist of a locomotive and rail cars. 210.9 Section 210.9 Transportation Other Regulations... locomotive, rail car, or consist of a locomotive and rail cars. A locomotive, rail car, or consist of a...

  12. Genetic and hypoxic alterations of the microRNA-210-ISCU1/2 axis promote iron–sulfur deficiency and pulmonary hypertension

    Science.gov (United States)

    White, Kevin; Lu, Yu; Annis, Sofia; Hale, Andrew E; Chau, B Nelson; Dahlman, James E; Hemann, Craig; Opotowsky, Alexander R; Vargas, Sara O; Rosas, Ivan; Perrella, Mark A; Osorio, Juan C; Haley, Kathleen J; Graham, Brian B; Kumar, Rahul; Saggar, Rajan; Saggar, Rajeev; Wallace, W Dean; Ross, David J; Khan, Omar F; Bader, Andrew; Gochuico, Bernadette R; Matar, Majed; Polach, Kevin; Johannessen, Nicolai M; Prosser, Haydn M; Anderson, Daniel G; Langer, Robert; Zweier, Jay L; Bindoff, Laurence A; Systrom, David; Waxman, Aaron B; Jin, Richard C; Chan, Stephen Y

    2015-01-01

    Iron–sulfur (Fe-S) clusters are essential for mitochondrial metabolism, but their regulation in pulmonary hypertension (PH) remains enigmatic. We demonstrate that alterations of the miR-210-ISCU1/2 axis cause Fe-S deficiencies in vivo and promote PH. In pulmonary vascular cells and particularly endothelium, hypoxic induction of miR-210 and repression of the miR-210 targets ISCU1/2 down-regulated Fe-S levels. In mouse and human vascular and endothelial tissue affected by PH, miR-210 was elevated accompanied by decreased ISCU1/2 and Fe-S integrity. In mice, miR-210 repressed ISCU1/2 and promoted PH. Mice deficient in miR-210, via genetic/pharmacologic means or via an endothelial-specific manner, displayed increased ISCU1/2 and were resistant to Fe-S-dependent pathophenotypes and PH. Similar to hypoxia or miR-210 overexpression, ISCU1/2 knockdown also promoted PH. Finally, cardiopulmonary exercise testing of a woman with homozygous ISCU mutations revealed exercise-induced pulmonary vascular dysfunction. Thus, driven by acquired (hypoxia) or genetic causes, the miR-210-ISCU1/2 regulatory axis is a pathogenic lynchpin causing Fe-S deficiency and PH. These findings carry broad translational implications for defining the metabolic origins of PH and potentially other metabolic diseases sharing similar underpinnings. PMID:25825391

  13. 31 CFR 363.210 - Is there any period of time during which I will be unable to process certain transactions...

    Science.gov (United States)

    2010-07-01

    ... proceeds, change the view or transaction rights, make transfers, initiate a SellDirect ® transaction, or... which I will be unable to process certain transactions regarding my security? 363.210 Section 363.210... certain transactions regarding my security? A closed book period will be in effect for four business days...

  14. 20 CFR 652.210 - What are the Act's requirements for administration of the work test and assistance to UI claimants?

    Science.gov (United States)

    2010-04-01

    ... administration of the work test and assistance to UI claimants? 652.210 Section 652.210 Employees' Benefits EMPLOYMENT AND TRAINING ADMINISTRATION, DEPARTMENT OF LABOR ESTABLISHMENT AND FUNCTIONING OF STATE EMPLOYMENT... requirements for administration of the work test and assistance to UI claimants? (a) State UI law or rules...

  15. 20 CFR 664.210 - How is the “requires additional assistance to complete an educational program, or to secure and...

    Science.gov (United States)

    2010-04-01

    ... secure and hold employment” criterion in § 664.200(c)(6) defined and documented? Definitions and... and documented? 664.210 Section 664.210 Employees' Benefits EMPLOYMENT AND TRAINING ADMINISTRATION... educational program, or to secure and hold employment” criterion of § 664.200(c)(6) may be established at the...

  16. 7Be/210Pbxs Ratio as an Indicator of Suspended Sediment Age or Fraction New Sediment in Suspension

    Science.gov (United States)

    Matisoff, G.; Wilson, C. G.; Whiting, P. J.

    2005-12-01

    We present a technique to use the 7Be/210Pbxs ratio as a measure of suspended sediment age or as an indicator of the fraction of the suspended sediment that is recently eroded from the landscape. Although both 7Be and 210Pbxs are delivered seasonally and stochastically to the landscape by precipitation, the ratio of the two radionuclides varies substantially less. The 7Be/210Pbxs ratios measured in three different watersheds decrease in the following manner: precipitation (~16) > suspended sediments in rivers (6-7) > suspended sediments in estuaries (4-6) > sediment collected in sediment traps in the estuary (~1) > surface sediment of the estuary (~0.5). Decreases in the 7Be/210Pbxs ratio in suspended sediments can be interpreted to be the result of increased age of the sediment, since 7Be decays faster than 210Pb. Alternatively, a decrease in the 7Be/210Pbxs ratio in suspended sediments can be interpreted to be the result of dilution of newly-tagged 7Be-rich sediment by 7Be-dead sediment, for example, by erosion of soil below the 7Be-enriched surface layer or by resuspension of 7Be-dead bottom sediment. We present a model which uses the 7Be/210Pbxs ratio in suspended sediments to determine the time since the particles were tagged by precipitation-derived radionuclides (i.e., the age of the suspended sediment). In addition, we present an alternative model to determine the fraction of the sediment that is `newly-tagged'. These two models are applied to three watersheds - Old Woman Creek, Ohio; Weeks Bay, Alabama; and South Slough, Oregon - and yield similar findings at all three sites. Sediment ages increase from 0 in newly tagged material to 50-80 days in rivers to about 80-100 days in the estuaries to about 200 days in the sediment traps to about 300 days on surface bottom sediments. Alternatively, the percent new sediment decreases from 100% in newly-tagged material to about 35-50% in rivers to 25-35% in the estuary to less than 10% in the sediment traps to 1

  17. Comparison of 210Po, 234Th and Sediment-Trap Based Export Fluxes in the Northern Gulf of Mexico

    Science.gov (United States)

    Maiti, K.; Bosu, S.; D'Sa, E. J.; Sutor, M.; Adhikari, P. L.

    2016-02-01

    The northern Gulf of Mexico (NGOM) is one of the well-studied areas of global ocean, especially after the Deepwater Horizon oil spill in 2010 and yet direct estimates of upper ocean POC fluxes from this region is practically nonexistent. In oligotrophic waters of the open Gulf of Mexico, particulate carbon is the main source of particles and POC flux is the key mechanism for the removal of metals and other particle reactive contaminants like polycyclic aromatic hydrocarbons from the upper ocean. Disequilibria between natural radioisotope pairs 238U-234Th and 210Pb-210Po as well as sediment traps have been widely used to measure particle export fluxes from the upper ocean on time scale of few days to months. The present work measured the vertical profiles of total and particle size-fractionated 210Pb, 210Po and 234Th activities, together with particulate carbon concentrations in the Gulf of Mexico during April 2012 and 2013. In spite of the difference in time scale both 210Po and 234Th based estimates are in reasonably agreement with sinking POC fluxes, caught in sediment traps, and each tracer provides unique information about the magnitude and efficiency of the ocean's biological pump. POC flux estimates ranged between 22-41 mgCm-2day-1 at 150m to 9-29 mgCm-2day-1 at 350m. POC export efficiencies ranged between 0.04- 0.10 at 150m which is similar to export efficiencies of 0.11-0.15 calculated from satellite based export production models.

  18. EFSA CEF Panel (EFSA Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids), 2014. Scientific Opinion on Flavouring Group Evaluation 210, Revision 1 (FGE.210Rev1): Consideration of genotoxic potential for α,β-unsaturated alicyclic ketones and precursors from chemical subgroup 2

    DEFF Research Database (Denmark)

    Beltoft, Vibe Meister; Binderup, Mona-Lise; Lund, Pia

    The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to evaluate the genotoxic potential of 13 flavouring substances in Flavouring Group Evaluation 210 (FGE.210) and one additional substance [FL-no: 07.225] in this revis......The Panel on Food Contact Materials, Enzymes, Flavourings and Processing Aids of the European Food Safety Authority was requested to evaluate the genotoxic potential of 13 flavouring substances in Flavouring Group Evaluation 210 (FGE.210) and one additional substance [FL-no: 07.......225] in this revision 1 (FGE.210Rev1). In the first version of FGE.210 the Panel concluded that a genotoxic potential could not be ruled out for any of the 13 substances based on data available at that time. The Flavouring Industry has now submitted additional genotoxicity data. The Panel has evaluated these data...

  19. Differentially expressed miRNA-210 during follicular-luteal transition regulates pre-ovulatory granulosa cell function targeting HRas and EFNA3.

    Science.gov (United States)

    Shukla, Astha; Dahiya, Sunita; Onteru, Suneel Kumar; Singh, Dheer

    2017-11-13

    Ovarian folliculogenesis, ovulation and luteinization are an important prerequisite for fertility performance in mammals. Spatial and temporal key factors and proteins for their regulation are well known. Recent advancement in the field of molecular biology led to the discovery of another class of gene regulators, microRNA (miRNA). Previous studies on profiling of miRNA in buffalo ovaries revealed that miRNA-210 (miR-210) is differently expressed in follicular-luteal transition. Therefore, the present study was planned to ascertain the role of miR-210 in buffalo granulosa cells. Cultured granulosa cells were transfected with miR-210 mimic. Effect of overexpression of miR-210 was analyzed on granulosa cell marker genes (CYP19A1 and PCNA) which were significantly downregulated (psoftware v7.1 and a list of 37 genes with cumulative weight context score (CWCS) > 0.5 was sorted followed by their functional annotation and network analyses using PANTHER and STRING software. Bioinformatics analyses identified HRas gene as a potential hub gene of miR-210targeted genes. HRas has been shown to be involved in diverse biological pathways regulating ovarian functions. An expression analysis of HRas was further validated both in vitro and in vivo. EFNA3 (EFHRIN-A3), another identified target of miR-210 known to be involved in angiogenesis, was also downregulated in miR-210 transfected granulosa cells. In conclusion, the present study demonstrated that miR-210 can regulate granulosa cell function at preovulatory stage through HRas and EFNA3. Further studies are needed to find the mechanism how miR-210 regulates the granulosa cells function through these targets. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  20. An application of excess lead-210 analysis for the study of fine sediment connectivity in a Mediterranean mountain basin with badlands, the Vallcebre research catchments

    Science.gov (United States)

    Moreno de las Heras, Mariano; Gallart, Francesc; Latron, Jérôme; Martínez-Carreras, Núria; Ferrer, Laura; Estrany, Joan

    2017-04-01

    Analysis of sediment dynamics in Mediterranean environments is fundamental to basin management, particularly for mountain catchments with badlands, which affect water bodies and freshwater ecosystems. Connectivity has emerged in Environmental and Earth Sciences as an evolution of the sediment delivery concept, providing a useful framework for understanding how sediments are transferred between geomorphic zones of the catchment. This study explores the feasibility of excess lead-210 (210Pbex) to analyse sediment connectivity in a 4-km2 Mediterranean mountain basin with badlands (the Vallcebre research catchments, Eastern Pyrenees) by applying simple 210Pbex mass-balance models for hypothesis generation and experimental testing in the field. Badland surfaces in the basin are weathered by freezing during the winter and are further eroded in summer by the effect of high-intensity storms. The eroded sediments may remain deposited within the catchment streams from months to years. Application of 210Pbex balance models in our basin proposes: (i) a saw-tooth seasonal pattern of badland surface 210Pbex activities (increasing from October to May, and depleted in summer) and (ii) a downstream increase in sediment activity due to fallout lead-210 accumulation in streambed sediment deposits. Both deposited and suspended sediments collected at the Vallcebre catchments showed, in general, low sediment 210Pbex concentrations, illustrating their fresh-rock origin at the badland sites, but also hampering the understanding of sediment 210Pbex patterns due to high measurement uncertainty (particularly for sediments with d50>20µm) and to strong dependence on sediment sampling methodology. Suspended sediment 210Pbex activity reproduced the simulated seasonal activity patterns for the badland surfaces. Contrary to the in-stream transit increases of sediment 210Pbex activity that were predicted by our model simulations, fallout lead-210 concentrations in the suspended sediments decreased

  1. Modeling the downward transport of {sup 210}Pb in Peatlands: Initial Penetration‐Constant Rate of Supply (IP-CRS) model

    Energy Technology Data Exchange (ETDEWEB)

    Olid, Carolina, E-mail: olid.carolina@gmail.com [Department of Ecology and Environmental Science, Umeå University, SE-90187, Umeå (Sweden); Diego, David [Department of Earth Science, University of Bergen, NO-5020 Bergen (Norway); Garcia-Orellana, Jordi [Departament de Física, Universitat Autònoma de Barcelona, E-08193 Bellaterra (Spain); Institut de Ciència i Tecnologia Ambientals (ICTA), Universitat Autònoma de Barcelona, E-08193 Bellaterra (Spain); Cortizas, Antonio Martínez [Departamento de Edafoloxía e Química Agrícola, Universidade de Santiago de Compostela, E-15782 Santiago de Compostela (Spain); Klaminder, Jonatan [Department of Ecology and Environmental Science, Umeå University, SE-90187, Umeå (Sweden)

    2016-01-15

    The vertical distribution of {sup 210}Pb is commonly used to date peat deposits accumulated over the last 100–150 years. However, several studies have questioned this method because of an apparent post-depositional mobility of {sup 210}Pb within some peat profiles. In this study, we introduce the Initial Penetration–Constant Rate of Supply (IP-CRS) model for calculating ages derived from {sup 210}Pb profiles that are altered by an initial migration of the radionuclide. This new, two-phased, model describes the distribution of atmospheric-derived {sup 210}Pb ({sup 210}Pb{sub xs}) in peat taking into account both incorporation of {sup 210}Pb into the accumulating peat matrix as well as an initial flushing of {sup 210}Pb through the uppermost peat layers. The validity of the IP-CRS model is tested in four anomalous {sup 210}Pb peat records that showed some deviations from the typical exponential decay profile not explained by variations in peat accumulation rates. Unlike the most commonly used {sup 210}Pb-dating model (Constant Rate of Supply (CRS)), the IP-CRS model estimates peat accumulation rates consistent with typical growth rates for peatlands from the same areas. Confidence in the IP-CRS chronology is also provided by the good agreement with independent chronological markers (i.e. {sup 241}Am and {sup 137}Cs). Our results showed that the IP-CRS can provide chronologies from peat records where {sup 210}Pb mobility is evident, being a valuable tool for studies reconstructing past environmental changes using peat archives during the Anthropocene. - Highlights: • Accurate age dating of peat and sediment cores is critical for evaluating change. • A new {sup 210}Pb dating model that includes vertical transport of {sup 210}Pb was developed. • The IP-CRS model provided consistent peat accumulation rates. • The IP-CRS ages were consistent with independent chronological markers. • The IP-CRS model derives peat ages where downward {sup 210}Pb transport is

  2. Excess Lead-210 and Plutonium-239+240: Two suitable radiogenic soil erosion tracers for mountain grassland sites.

    Science.gov (United States)

    Meusburger, K; Porto, P; Mabit, L; La Spada, C; Arata, L; Alewell, C

    2018-01-01

    The expected growing population and challenges associated with globalisation will increase local food and feed demands and enhance the pressure on local and regional upland soil resources. In light of these potential future developments it is necessary to define sustainable land use and tolerable soil loss rates with methods applicable and adapted to mountainous areas. Fallout-radionuclides (FRNs) are proven techniques to increase our knowledge about the status and resilience of agro-ecosystems. However, the use of the Caesium-137 ( 137 Cs) method is complicated in the European Alps due to its heterogeneous input and the timing of the Chernobyl fallout, which occurred during a few single rain events on partly snow covered ground. Other radioisotopic techniques have been proposed to overcome these limitations. The objective of this study is to evaluate the suitability of excess Lead-210 ( 210 Pb ex ) and Plutonium-239+240 ( 239+240 Pu) as soil erosion tracers for three different grassland management types at the steep slopes (slope angles between 35 and 38°) located in the Central Swiss Alps. All three FRNs identified pastures as having the highest mean (± standard deviation) net soil loss of -6.7 ± 1.1, -9.8 ± 6.8 and -7.0 ± 5.2 Mg ha -1 yr -1 for 137 Cs, 210 Pb ex and 239+240 Pu, respectively. A mean soil loss of -5.7 ± 1.5, -5.2 ± 1.5 and-5.6 ± 2.1 was assessed for hayfields and the lowest rates were established for pastures with dwarf-shrubs (-5.2 ± 2.5, -4.5 ± 2.5 and -3.3 ± 2.4 Mg ha -1 yr -1 for 137 Cs, 210 Pb ex and 239+240 Pu, respectively). These rates, evaluated at sites with an elevated soil erosion risk exceed the respective soil production rates. Among the three FRN methods used, 239+240 Pu appears as the most promising tracer in terms of measurement uncertainty and reduced small scale variability (CV of 13%). Despite a higher level of uncertainty, 210 Pb ex produced comparable results, with a wide range of erosion rates sensitive to changes

  3. Hydromagnetic spectroscopy of the magnetosphere with Pc3 geomagnetic pulsations along the 210° meridian

    Directory of Open Access Journals (Sweden)

    V. Pilipenko

    1999-01-01

    Full Text Available Analysis of Pc3 observational data along the 210° magnetic meridian showed a complicated frequency-latitude structure at middle latitudes. The observed period-latitude distributions vary between events with a "noisy source": the D component has a colored-noise spectrum, while the spectrum of H component exhibits regular peaks that vary with latitude, and events with a "band-limited source": the spectral power density of the D component is enhanced at certain frequencies throughout the network. For most ULF events a local gap of the H component amplitude has been exhibited at both conjugate stations at L ~ 2.1. A quantitative interpretation has been given assuming that band-limited MHD emission from an extra-magnetospheric source is distorted by local field line resonances. Resonant frequencies had been singled out with the use of the asymmetry between spectra of H and D components. Additionally, a local resonant frequency at L ~ 1.6 was determined by the quasi-gradient method using the data from nearly conjugate stations. The experimentally determined local resonance frequencies agree satisfactorily with those obtained from a numerical model of the Alfven resonator with the equatorial plasma density taken by extrapolation of Carpenter-Anderson model. We demonstrate how simple methods of hydromagnetic spectroscopy enable us to monitor simultaneously both the magnitude of the IMF and the magnetospheric plasma density from ULF data.Key words. Magnetospheric physics (Magnetosphere-ionosphere interactions; MHD waves and instabilities; plasmasphere

  4. Determination of 210Po concentration in commercially available infant formulae and assessment of daily ingestion dose

    Directory of Open Access Journals (Sweden)

    Ravi K. Prabhath

    2015-07-01

    Full Text Available A study has been conducted to estimate the concentration of natural radioactive polonium in commercially available packaged infant food formulae available in Mumbai, India and the corresponding daily dose normalized based on its shelf life. Eleven most popular international brands of infant formulae were sourced from market and three aliquots from each sample were analysed for concordant results. Autodeposition method onto a silver planchet from hot dilute acid solution followed by alpha spectrometry was performed for estimation of polonium. Radiochemical recovery was ascertained by the addition of 209Po tracer. Radiochemical recovery of 209Po tracer was ranged from 14.7 to 98.1 %. The 210Po concentration in the samples was in the range of 0.08–0.23 Bq kg−1 on measured date and the corresponding daily dose, calculated on normalized date which is at mid-point of the shelf life of the sample, was ranged from 0.04 to 0.89 μSv d−1 as per the recommended daily consumption. The annual committed effective dose estimated based on the average of daily dose was found to be 150 μSv.

  5. Methodology for identifying parameters for the TRNSYS model Type 210 - wood pellet stoves and boilers

    Energy Technology Data Exchange (ETDEWEB)

    Persson, Tomas; Fiedler, Frank; Nordlander, Svante

    2006-05-15

    This report describes a method how to perform measurements on boilers and stoves and how to identify parameters from the measurements for the boiler/stove-model TRNSYS Type 210. The model can be used for detailed annual system simulations using TRNSYS. Experience from measurements on three different pellet stoves and four boilers were used to develop this methodology. Recommendations for the set up of measurements are given and the required combustion theory for the data evaluation and data preparation are given. The data evaluation showed that the uncertainties are quite large for the measured flue gas flow rate and for boilers and stoves with high fraction of energy going to the water jacket also the calculated heat rate to the room may have large uncertainties. A methodology for the parameter identification process and identified parameters for two different stoves and three boilers are given. Finally the identified models are compared with measured data showing that the model generally agreed well with measured data during both stationary and dynamic conditions.

  6. In vivo synthesis of nano-selenium by Tetrahymena thermophila SB210.

    Science.gov (United States)

    Cui, Yin-Hua; Li, Ling-Li; Zhou, Nan-Qing; Liu, Jing-Hua; Huang, Qing; Wang, Hui-Juan; Tian, Jie; Yu, Han-Qing

    2016-12-01

    Nano-selenium has a great potential to be used in chemical, biological, medical and environmental fields. Biological methods for nano-selenium synthesis have attracted wide interests, because they can be operated at ambient temperature and pressure without complicated equipments. In this work, a protozoa, Tetrahymena thermophila (T. thermophila) SB210, was used to in vivo synthesize nano-selenium. The biosynthesized nano-selenium was characterized using transmission electron microscopy, energy dispersive X-ray spectroscopy and Raman spectroscopy. The synthesized amorphous spherical selenium nanoparticles had diameters of 50-500nm with the coexistence of irregular nano-selenium. The expressions of glutathione (GSH) synthesis related gene glutathione synthase, cysteine-rich protein metallothionein related gene metallothionein-1 and [2Fe-2S] cluster-binding protein related gene were up-regulated in the nano-selenium producing group. Also, the subsequent GSH detection and in vitro synthesis experimental results suggest the three proteins were likely to be involved in the nano-selenium synthesis process. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Chromium-manganese stainless steels with nitrogen content up to 2.10 wt%

    Energy Technology Data Exchange (ETDEWEB)

    Andreev, C.; Rashev, Ts. [Bylgarska Akademiya na Naukite, Sofia (Bulgaria). Inst. po Metaloznanie i Tekhnologiya na Metalite

    1999-07-01

    This paper presents the possibilities of existent in the Institute of metal science (Sofia) plants for nitrogen alloying of corrosion resistant steels type CrMnMo21 18 3 with nitrogen content up to 2.10 wt%. The method of producing is with only one melting of the charge without an additional electroslag remelting under pressure (ESRP). It is used the combination method for nitrogen alloying of the melt by solid nitrogen carrier and nitrogen gaseous blowing under high pressure up to 8 MPa. It has been obtained the compact and homogeneous ingots (10 kg of each). It is proved the possibilities for producing of industrial 0.5 and 1.8 t ingots of these grades steels with nitrogen content up to 1.20 wt percentage. All ingots of both nitrogen content levels were plastic deformed by forging and rolling. The industrial ingots were forged on radial forging machine CFM-SH 500 and laboratory ingots were deformed on laboratory rolling mill quarto in IMS. After high temperature quenching (1473-1523 K; water) the high nitrogen steels have shown a very good complex of mechanical properties: yield strength (R{sub 0.2}): 750-1000 MPa, tensile strength (R{sub m}):1250-1500 MPa, relative reduction of area (Z):60-50%, Rockwell hardness : 30-50. (orig.)

  8. In vivo measurement of Pb-210 in the skull for retrospective assessment of exposure to radon; Die in-vivo Messung von Pb-210 im Schaedel zur retrospektiven Bestimmung von Radon-Expositionen

    Energy Technology Data Exchange (ETDEWEB)

    Doerfel, H. [Forschungszentrum Karlsruhe GmbH (Germany). Hauptabteilung Sicherheit/Dosimetrie

    1997-12-01

    The study shows that the new HPGe detectors with a larger surface are significantly better in terms of results and performance than the Phoswich detectors hitherto used for in vivo measurement of Pb-210 in the human skull. The experimental evaluations indicate that smaller HPGe detectors likewise are better than the Phoswich detectors, but some additional studies are required for final evaluation of these instruments. (orig./CB) [Deutsch] Die Untersuchungen haben gezeigt, dass die neuen grossflaechigen HPGe-Detektoren wesentlich besser zur in-vivo Messung von Pb-210 im Skelett geeignet sind als die bisher eingesetzten Phoswich-Detektoren. Auch kleinere HPGe-Detektoren sind offenbar besser geeignet als Phoswich-Detektoren, allerdings sind hier noch einige ergaenzende Untersuchungen erforderlich. (orig./SR)

  9. Determination of Pb-210 and Ra-226 in sediments from Acude de Apipucos - Recife, Pernambuco, Brazil; Determinacao de chumbo-210 e radio-226 em sedimentos do Acude de Apipucos - Recife - Brasil

    Energy Technology Data Exchange (ETDEWEB)

    Souza, Vivianne Lucia Bormann de; Melo, Roberto Teodozio de; Figueiredo, Marcela Durao Cesar de; Rodrigues, Kelia Rejane Goncalves; Cunha, Manuela Silva da; Silva, Danubia B. da; Pedroza, Eryka de H., E-mail: vlsouza@cnen.gov.b, E-mail: rtmelo@cnen.gov.b [Centro Regional de Ciencias Nucleares (CRCN-NE/CNEN-PE), Recife, PE (Brazil); Oliveira, Aristides [Hospital de Cancer de Pernambuco, Recife, PE (Brazil)

    2011-07-01

    This study aims to determine the age of sediment layers in Apipucos Reservoir, located in Recife, Brazil. Dating with {sup 210}Pb and {sup 226}Ra concentrations found in these sediments was used. A core with length of 70 cm and internal diameter of 5 cm was used for sediment sampling and each obtained profile was sectioned. Lead and radium were extracted from these samples by adding acids. {sup 210}Pb and {sup 226}Ra were determined in a gas flow proportional detector, based on the activities of their daughters. It was found that the CRS model (Constant Rate of Supply) to calculate the ages of sediment was more appropriate than CIC (Constant Initial Concentration). The chronology showed that the first sediment layers were 30 years old. (author)

  10. Retrospective estimation of exposure to short-lived {sup 222}Rn progeny by measurements of {sup 210}Pb in the skull

    Energy Technology Data Exchange (ETDEWEB)

    Scheler, R.; Dettmann, K.; Brose, J

    1998-07-01

    The inhalation of {sup 222}Rn and its short-lived decay products results in the exposure of the respiratory tract followed by the skeletal deposition of {sup 210}Pb originating in the lung from {sup 214}Po. By measurement of the {sup 210}Pb activity in the skull it could be possible to estimate previous exposures for a known relationship between {sup 210}Pb content in the skeleton and exposure. The measurement technique consists of two arrays of low energy germanium detectors (LEGe) with a total active area of 8000 mm{sup 2} installed in a large shielded chamber. The interpretation of estimated {sup 210}Pb deposit in terms of exposure can be made by using 'conversion coefficients' K{sub E}(t{sub m}) for the relationship between the {sup 210}Pb activity A(t{sub m}) and cumulative exposure. The decision limit of {sup 210}Pb for the total skeleton in a counting time of 7200 s was estimated to be 17 Bq, or about 0.9 J.h.m{sup -3} (250 WLM) of exposure. The results of the first measurements of a group of individuals living in high radon prone areas show a good qualitative correspondence with the expected {sup 210}Pb content of the skeleton. (author)

  11. Polonium-210 and other radionuclides in terrestrial, freshwater and brackish environments Results from the NKS project GAPRAD (Filling knowledge gaps in radiation protection methodologies for non-human biota)

    Energy Technology Data Exchange (ETDEWEB)

    Gjelsvik, R.; Brown, J.; Holm, E.; Roos, P.; Saxen, R.; Outola, I.

    2012-01-15

    The background and rationale to filling knowledge gaps in radiation protection methodologies for biota are presented. Concentrations of Po-210 and Pb-210 are reported for biota sampled in Dovrefjell, Norway and selected lake and brackish ecosystems in Finland. Furthermore, details in relation to Po-210 uptake and biokinetics in humans based on experimental studies are recounted. (Author)

  12. THE RATE OF SEDIMENTATION ESTIMATION OF TANJUNG API-API ESTUARY SOUTH SUMATERA BY USING 210Pb PROFILE

    Directory of Open Access Journals (Sweden)

    Purnomo Raharjo

    2017-07-01

    Full Text Available Sedimentary processes occur intensively in Tanjung Api-Api area situated in the estuary of Musi Banyuasin river. A study on 210Pb isotopes of the sediments has been done to understand the rate of sedimentation. For that purpose, the Marine Geological Institute of Indonesia (MGI has also conducted bathymetry and sediment distribution mappings. Two samples represent depths of 17-30 cm and 190-210 cm below sea floor give age of 11.54 and 22.45 years. The average of sedimentation rate is 2.03 cm/years (from 0 to 0.3 m below seafloor and 8.9 cm/years (until 2.1 m depth below seafloor. The result shows, decreasing sedimentation rate upward, that indicates the surficial sediment less influenced by wave and surface current nowadays.

  13. Application of the {sup 210}Pb-dating technique to evaluate environmental changes resulting from recent human activities

    Energy Technology Data Exchange (ETDEWEB)

    Jenkinson, A.V.; Chisari, R.; Farrar, Y.J.; Heijnis, H.; McOrist, G.D. [Australian Nuclear Science and Technology Organisation, Lucas Heights, NSW (Australia); Hallegraeff, G. [University of Tasmania, Tasmania, (Australia). Department of Plant Science; Hughes, M.; Napoli, M. [University of Sydney, Sydney, NSW (Australia). Department of Geology and Geophysics; James, J.M. [University of Sydney, NSW, (Australia). School of Chemistry; McMinn, A.; Thomson, P. [University of Tasmania, Tasmania, (Australia). Institute of Antartic and Southern Ocean Studies; Smith, J.D.; Tinker, R.A. [University of Melbourne, Parkville, VIC (Australia). School of Chemistry, Marine Chemistry Laboratory

    1997-10-01

    The {sup 210}Pb-dating technique has shown particular promise for the study of recent environmental change by enabling the establishment of chronologies for contemporary environmental processes. In this paper two case studies are discussed. Case Study (1) looks at trace element and heavy metal levels in the estuaries of the Georges River and the Hacking River which are partly located in suburban Sydney and Case Study (2) looks at blooms of the toxic dinoflagellate Gymnodinium catenatum which were first observed in Tasmanian waters, principally the Huon and Derwent Rivers in 1980. In both cases the {sup 210}Pb dating technique has been used to establish the sequence of sediment deposition in order to associate an age to the sediment layer which contains the entity under investigation 7 refs., 5 figs.

  14. Comparative receptor modelling study of TSP, PM2 and PM2-10 in Ho Chi Minh City

    Energy Technology Data Exchange (ETDEWEB)

    Hien, P.D.; Binh, N.T.; Truong, Y.; Ngo, N.T.; Sieu, L.N. [Vietnam Atomic Energy Agency, Hanoi (Vietnam)

    2001-07-01

    Elemental compositions were measured for TSP (total suspended particulate matter), PM2-10 and PM2 (particulate matter with aerodynamic diameters from 2 to 10 {mu}m and less than 2 {mu}m, respectively) in Ho Chi Minh City. Concentrations of 23 elements and particulate mass (PM) were used for receptor modelling to identify and quantify aerosol sources using principal component factor analysis (PCFA). A suite of factors containing similar elements with significant factor loadings were revealed among the factor matrices, thus facilitating the identification of common sources for different aerosol types. These sources include vehicular emissions (Br and Zn), coal burning (Se), industrial processes (Ce, Co, Cr, Pb and Sb), road dust (Al, Ti, V), soil dust (Fe and Th) and biomass burning (K). Marine aerosols (Na and Cl) and mineral fly ash (Sc and La) were revealed only in the PM2-10 model.

  15. Evaluation of the Siltation of River Taquari, Pantanal, Brazil, through 210Pb Geochronology of Floodplain Lake Sediments

    Directory of Open Access Journals (Sweden)

    Godoy José M.

    2002-01-01

    Full Text Available This work presents the 210Pb geochronology of seven bottom sediment cores, collected in three floodplain lakes located in the area of the middle Taquari River, Pantanal, Brazil. In five of them, a significant increase in the sediment mass deposition rate was observed, reflecting an increase of the sediment input to the Pantanal. Additionally, in order to validate the 210Pb results, the mercury content was determined for two sediment cores, showing that despite a constant concentration, the flux of Hg has increased due to an increase in the mass sedimentation rate. This increase can be attributed to the expansion of agricultural activity in the upper Taquari River during the last 25 years.

  16. Analytical Applications of Reactions of Iron(III and Hexacyanoferrate(III with 2,10-Disubstituted Phenothiazines

    Directory of Open Access Journals (Sweden)

    Helena Puzanowska-Tarasiewicz

    2009-01-01

    Full Text Available The presented review is devoted to analytical applications of reactions of Fe(III and K3[Fe(CN6] with 2,10-disubstituted phenothiazines (PT. It was found that iron(III and hexacyanoferrate(III ions in acidic media easily oxidized PT with the formation of colored oxidation products. This property has been exploited for spectrophotometric determination of iron(III ions and phenothiazines. Some flow-injection procedures of the determination of PT based on the oxidation reaction by means of the above-mentioned oxidants have been proposed. In the presented review, the application of 2,10-disubstituted phenothiazines as indicators in complexometric titration of iron(III as well as procedures of PT determination based on generation of ternary compound in the system Fe(III-SCN−- PT was also described.

  17. Studies of the Vertical Distribution of Cs-134, Cs-137, Pu-238, Pu-239,240, Pu-241, Am-241 and Pb-210 in ombrogenous mires in Ireland

    Science.gov (United States)

    McGarry, A. T.; Mitchell, P. I.

    The technique of using Pb-210, a member of the naturally occurring U-238 chain, as a dating tool, has been widely used since the 1960's and has been shown to be reliable when applied to ombrotrophic peat bogs. Its application rests on two fundamental assumptions (a) that the flux of Pb-210 is constant when averaged over periods of at least a few years and (b) that Pb-210 is essentially immobile in peat over the range of natural conditions usually encountered…

  18. Distinct Effects of miR-210 Reduction on Neurogenesis: Increased Neuronal Survival of Inflammation But Reduced Proliferation Associated with Mitochondrial Enhancement.

    Science.gov (United States)

    Voloboueva, Ludmila A; Sun, Xiaoyun; Xu, Lijun; Ouyang, Yi-Bing; Giffard, Rona G

    2017-03-15

    Neurogenesis is essential to brain development and plays a central role in the response to brain injury. Stroke and head trauma stimulate proliferation of endogenous neural stem cells (NSCs); however, the survival of young neurons is sharply reduced by postinjury inflammation. Cellular mitochondria are critical to successful neurogenesis and are a major target of inflammatory injury. Mitochondrial protection was shown to improve survival of young neurons. This study tested whether reducing cellular microRNA-210 (miR-210) would enhance mitochondrial function and improve survival of young murine neurons under inflammatory conditions. Several studies have demonstrated the potential of miR-210 inhibition to enhance and protect mitochondrial function through upregulation of mitochondrial proteins. Here, miR-210 inhibition significantly increased neuronal survival and protected the activity of mitochondrial enzymes cytochrome c oxidase and aconitase in differentiating NSC cultures exposed to inflammatory mediators. Unexpectedly, we found that reducing miR-210 significantly attenuated NSC proliferation upon induction of differentiation. Further investigation revealed that increased mitochondrial function suppressed the shift to primarily glycolytic metabolism and reduced mitochondrial length characteristic of dividing cells. Activation of AMP-regulated protein kinase-retinoblastoma signaling is important in NSC proliferation and the reduction of this activation observed by miR-210 inhibition is one mechanism contributing to the reduced proliferation. Postinjury neurogenesis occurs as a burst of proliferation that peaks in days, followed by migration and differentiation over weeks. Our studies suggest that mitochondrial protective miR-210 inhibition should be delayed until after the initial burst of proliferation, but could be beneficial during the prolonged differentiation stage.SIGNIFICANCE STATEMENT Increasing the success of endogenous neurogenesis after brain injury

  19. Diagnostic value of anti-gp210 antibodies in primary biliary cirrhosis: a case-based review

    OpenAIRE

    Valour, Florent; Durupt, Stéphane; Khenifer, Safia; Durieu, Isabelle

    2013-01-01

    Primary biliary cirrhosis (PBC) is an autoimmune liver disease characterised by chronic cholestasis usually associated with antimitochondrial antibodies. Moreover, several types of antinuclear antibodies have been associated with primary biliary cirrhosis. We describe an 83-year-old man, in whom the exploration of a chronic cholestasis led to the diagnosis of primary biliary cirrhosis despite negative antimitochondrial antibodies, regarding the presence of anti-gp210 antibodies. Found in 25% ...

  20. Cannabinoid HU210 Protects Isolated Rat Stomach against Impairment Caused by Serum of Rats with Experimental Acute Pancreatitis

    Science.gov (United States)

    Cao, Ming-hua; Li, Yong-yu; Xu, Jing; Feng, Ya-jing; Lin, Xu-hong; Li, Kun; Han, Tong; Chen, Chang-Jie

    2012-01-01

    Acute pancreatitis (AP), especially severe acute pancreatitis often causes extra-pancreatic complications, such as acute gastrointestinal mucosal lesion (AGML) which is accompanied by a considerably high mortality, yet the pathogenesis of AP-induced AGML is still not fully understood. In this report, we investigated the alterations of serum components and gastric endocrine and exocrine functions in rats with experimental acute pancreatitis, and studied the possible contributions of these alterations in the pathogenesis of AGML. In addition, we explored the intervention effects of cannabinoid receptor agonist HU210 and antagonist AM251 on isolated and serum-perfused rat stomach. Our results showed that the AGML occurred after 5 h of AP replication, and the body homeostasis was disturbed in AP rat, with increased levels of pancreatic enzymes, lipopolysaccharide (LPS), proinflammtory cytokines and chemokines in the blood, and an imbalance of the gastric secretion function. Perfusing the isolated rat stomach with the AP rat serum caused morphological changes in the stomach, accompanied with a significant increment of pepsin and [H+] release, and increased gastrin and decreased somatostatin secretion. HU210 reversed the AP-serum-induced rat pathological alterations, including the reversal of transformation of the gastric morphology to certain degree. The results from this study prove that the inflammatory responses and the imbalance of the gastric secretion during the development of AP are responsible for the pathogenesis of AGML, and suggest the therapeutic potential of HU210 for AGML associated with acute pancreatitis. PMID:23285225

  1. Investigation of fabrication and resonant optical coupling in various 2D micro-resonator structures in a UV210 polymer

    Science.gov (United States)

    Pluchon, D.; Huby, N.; Lhermite, H.; Duval, D.; Bêche, B.

    2012-08-01

    In this paper, we report on the design and the overall realization of micro-resonators based on the development of adequate processes on a UV210 polymer. These micro-optical structures are developed by deep ultraviolet lithography allowing fabrication of nano-structured devices by means of low cost and reproducible processes. Two families of resonant micro-structures shaped on disk and stadium with various sizes are investigated. Structural and optical imaging characterizations have been carried out to ensure their ability to act as resonant integrated micro-structures. At first, scanning electron microscopy and Nomarsky microscopy studies confirm the UV-light process resolution down to 450 nm developed on a UV210 polymer. Then, optical characterizations have been performed as regards intensity and spectral properties of such micro-resonators. Field intensity measurements in visible and infrared ranges have been realized and validate light propagation by evanescent coupling between waveguides and micro-resonators. Finally, spectral analyses on TE modes demonstrate the presence of optical resonances with 1.45 nm and 2.19 nm free spectral range values for respectively disk and stadium micro-structures. The UV210 polymer appears appropriate for the realization of micro-structures requiring a few hundred nanometers gap-scale while maintaining adequate spectral properties for versatile applications in telecommunication and metrology.

  2. Sensitivity of Global Modeling Initiative chemistry and transport model simulations of radon-222 and lead-210 to input meteorological data

    Directory of Open Access Journals (Sweden)

    D. B. Considine

    2005-01-01

    Full Text Available We have used the Global Modeling Initiative chemistry and transport model to simulate the radionuclides radon-222 and lead-210 using three different sets of input meteorological information: 1. Output from the Goddard Space Flight Center Global Modeling and Assimilation Office GEOS-STRAT assimilation; 2. Output from the Goddard Institute for Space Studies GISS II' general circulation model; and 3. Output from the National Center for Atmospheric Research MACCM3 general circulation model. We intercompare these simulations with observations to determine the variability resulting from the different meteorological data used to drive the model, and to assess the agreement of the simulations with observations at the surface and in the upper troposphere/lower stratosphere region. The observational datasets we use are primarily climatologies developed from multiple years of observations. In the upper troposphere/lower stratosphere region, climatological distributions of lead-210 were constructed from ~25 years of aircraft and balloon observations compiled into the US Environmental Measurements Laboratory RANDAB database. Taken as a whole, no simulation stands out as superior to the others. However, the simulation driven by the NCAR MACCM3 meteorological data compares better with lead-210 observations in the upper troposphere/lower stratosphere region. Comparisons of simulations made with and without convection show that the role played by convective transport and scavenging in the three simulations differs substantially. These differences may have implications for evaluation of the importance of very short-lived halogen-containing species on stratospheric halogen budgets.

  3. Uranium, radon-222 and polonium-210 in drinking waters from metropolitan area of Recife, PE, Brazil; Uranio, radonio-222 e polonio-210 em aguas de abastecimento publico da regiao metropolitana do Recife

    Energy Technology Data Exchange (ETDEWEB)

    Silva, Cleomacio Miguel da

    2000-04-01

    There is only scarce information on the presence of radionuclides in water for public consumption in Brazil. A recently issued federal regulation requires that waters from public supplies be screened to determine their content of alpha and beta emitters. In order to comply with this requirement the present work was carried out with the purpose of determining the concentration of natural uranium, {sup 222} Rn and {sup 210} Po in water supplies in the metropolitan region of Recife, Brazil. The analyses were performed in 17 points of supply of superficial water and 94 points of groundwater supply. The concentrations of uranium were determined by the fluorimetric method, whereas the liquid scintillation method was used to determine the concentration of {sup 222} Rn. Polonium-210, on the other hand, was determined by alpha spectrometry, following its spontaneous deposition on copper disks. The water analyzer presented uranium concentrations varying from 35.3 to 1146.5 mBq/L for superficial resources and from 20.2 to 919.15 mBq/L for underground sources. The concentration of uranium in superficial water showed significant correlation with some parameters such as conductivity, alkalinity and total hardness, as well as, with the concentrations of Ca, Mg, Cl, K, SO{sub 4} and Mn. No correlation, however, was shown with the concentrations of Fe, NO{sub 2} and NO{sub 3}. The concentrations of {sup 222} Rn varied from 5.3 to 83.7 Bq/L in the groundwater analyzer. Radon concentration was not measured in superficial water due to the high emanation rate of radon in open air conditions. As far as {sup 210} Po is concerned, the analyses showed concentrations ranging from <22 mBq/L (the lowest limit of detection) to 57.4 mBq/L for superficial water and from <22 to 813 mBq/L for ground water samples. The concentrations of {sup 210} Po did not show and correlation with physico-chemical parameters. The average concentrations of uranium and {sup 210} Po in superficial water were of 44

  4. Death by polonium-210: lessons learned from the murder of former Soviet spy Alexander Litvinenko.

    Science.gov (United States)

    McFee, Robin B; Leikin, Jerrold B

    2009-02-01

    The medical response to radiation--whether the result of radiological warfare, terrorist deployment of improvised radiation dispersal weapons, political assassination, occupational or industrial accidents or the medically radiated patient remains one of the least taught among all disciplines within medical education. In the aftermath of 9/11 among medical vulnerabilities to toxicant threats, of all the categories of weapons of mass destruction (WMD)--whether using the CBRNE (chemical, biological, radiological, nuclear, explosive) or NBC (nuclear, biological, chemical) acronym--radiation is the least taught in professional schools, responder cultures or civil preparedness organizations. To date, few health care professionals (HCP) possess the fundamental knowledge or skills to identify and diagnose, let alone treat a radiation victim; this vulnerability made even more obvious in the aftermath of the high profile assassination of former Russian agent Alexander Litvinenko. He was poisoned with Polonium210. Radioactive substances are ubiquitous with radiation sources being in or transported through virtually every region nationwide. It is essential to increase preparedness among community and rural health care facilities as well as urban and university hospitals. Managing radiation injuries effectively requires access to specialized equipment and expertise. Radiation sickness is progressive and may require acute, critical and long-term care throughout the course of illness. Regardless of the source, preparedness rests upon acknowledging a threat exists and dedicating the resources to address the risks including the enhancement of training and equipment. Mass or individual exposures to radiation present unique challenges to the entire response continuum from law enforcement, first responders and emergency medical care. Increased education about and practice in responding to radiological threats is essential to enhance preparedness.

  5. Characterization Data Package for Containerized Sludge Samples Collected from Engineered Container SCS-CON-210

    Energy Technology Data Exchange (ETDEWEB)

    Fountain, Matthew S.; Fiskum, Sandra K.; Baldwin, David L.; Daniel, Richard C.; Bos, Stanley J.; Burns, Carolyn A.; Carlson, Clark D.; Coffey, Deborah S.; Delegard, Calvin H.; Edwards, Matthew K.; Greenwood, Lawrence R.; Neiner, Doinita; Oliver, Brian M.; Pool, Karl N.; Schmidt, Andrew J.; Shimskey, Rick W.; Sinkov, Sergey I.; Snow, Lanee A.; Soderquist, Chuck Z.; Thompson, Christopher J.; Trang-Le, Truc LT; Urie, Michael W.

    2013-09-10

    This data package contains the K Basin sludge characterization results obtained by Pacific Northwest National Laboratory during processing and analysis of four sludge core samples collected from Engineered Container SCS-CON-210 in 2010 as requested by CH2M Hill Plateau Remediation Company. Sample processing requirements, analytes of interest, detection limits, and quality control sample requirements are defined in the KBC-33786, Rev. 2. The core processing scope included reconstitution of a sludge core sample distributed among four to six 4-L polypropylene bottles into a single container. The reconstituted core sample was then mixed and subsampled to support a variety of characterization activities. Additional core sludge subsamples were combined to prepare a container composite. The container composite was fractionated by wet sieving through a 2,000 micron mesh and a 500-micron mesh sieve. Each sieve fraction was sampled to support a suite of analyses. The core composite analysis scope included density determination, radioisotope analysis, and metals analysis, including the Waste Isolation Pilot Plant Hazardous Waste Facility Permit metals (with the exception of mercury). The container composite analysis included most of the core composite analysis scope plus particle size distribution, particle density, rheology, and crystalline phase identification. A summary of the received samples, core sample reconstitution and subsampling activities, container composite preparation and subsampling activities, physical properties, and analytical results are presented. Supporting data and documentation are provided in the appendices. There were no cases of sample or data loss and all of the available samples and data are reported as required by the Quality Assurance Project Plan/Sampling and Analysis Plan.

  6. Inventory of {sup 226}Ra, {sup 228}Ra and {sup 210}Pb in marine sediments cores of Southwest Atlantic Ocean

    Energy Technology Data Exchange (ETDEWEB)

    Costa, Alice M.R.; Oliveira, Joselene de, E-mail: alice.costa@usp.br, E-mail: jolivei@ipen.br [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil). Gerencia de Metrologia das Radiacoes. Lab. de Radiometria Ambiental; Figueira, Rubens C.L.; Mahiques, Michel M.; Sousa, Silvia H.M., E-mail: rfigueira@usp.br, E-mail: mahiques@usp.br, E-mail: smsousa@usp.br [Universidade de Sao Paulo (USP), Sao Paulo, SP (Brazil). Instituto Oceanografico

    2015-07-01

    {sup 210}Pb (22.3 y) is a radioactive isotope successfully applied as tracer of sediment dating of the last 100-150 years. The application of {sup 226}Ra and {sup 228}Ra as paleoceanographic tracers (half-lives of 1,600 y and 5.7 y, respectively) also gives some information of ocean's role in past climate change. In this work, it was analyzed 2 sediment cores collect at Southwest Atlantic Ocean. The sediments samples were freeze-dried and acid digested in microwave. It was carried out a radiochemical separation of {sup 226}Ra, {sup 228}Ra and {sup 210}Pb and performed a gross alpha and gross beta measurement of both precipitates Ba(Ra)SO{sub 4} and PbCrO{sub 4} in a low background gas-flow proportional counter. Activity concentrations of {sup 226}Ra ranged from 45 Bq kg{sup -1} to 70 Bq kg{sup -1} in NAP-62 and from 57 Bq kg{sup -1} to 82 Bq kg{sup -1} in NAP-63 samples. The concentration of {sup 228}Ra varied between 37 Bq kg{sup -1} and 150 Bq kg{sup -1} in NAP-62 and between 23 Bq kg{sup -1} and 111 Bq kg{sup -1} in NAP-63 samples. The concentration of total {sup 210}Pb ranged from 126 Bq kg{sup -1} to 256 Bq kg{sup -1} in NAP-62 and from 63 Bq kg{sup -1} to 945 Bq kg{sup -1} in NAP-63 samples. Results of {sup 210}Pb{sub uns} varied from 68 Bq kg{sup -1} to 192 Bq kg{sup -1} for NAP-62, while varied from <4.9 Bq kg{sup -1} to 870 Bq kg{sup -1} in NAP-63 profile. Increased values of {sup 210}Pb{sub uns} were found on the top of both NAP-62 and NAP- 63 sediment profile. (author)

  7. 46 CFR 57.04-1 - Test specimen requirements and definition of ranges (modifies QW 202, QW 210, QW 451, and QB 202).

    Science.gov (United States)

    2010-10-01

    ... HOMELAND SECURITY (CONTINUED) MARINE ENGINEERING WELDING AND BRAZING Procedure Qualification Range § 57.04... procedure specification shall be in accordance with QW 202, QW 210, or QB 202 of the ASME Code as applicable...

  8. Lichens and mosses for correlation between trace elements and Po-210 in the areas near coal-fired power plant at Yatagan, Turkey

    Energy Technology Data Exchange (ETDEWEB)

    Ugur, A.; Ozden, B.; Sac, M.M.; Yener, G.; Altinbas, U.; Kurucu, Y.; Bolca, M. [Ege University Institute of Nuclear Science, Izmir (Turkey)

    2004-07-01

    The lichens Rhizoplaca melanophthalma, Cladonia convoluta, Cladonia pyxidata and the mosses Grimmia pulvinata, Hypnum cupressiforme were analyzed for Pb, Cr, Cd, Co, Ni, Mn, Cu, Zn and Fe using atomic absorption spectrophotometry over a wide area around a coal-fired power plant located in Yatagan. The results were compared with the Po-210 concentrations previously measured in the same samples. Correlations between Po-210 and trace elements for different moss and lichen species of the same localization and for different localizations for the same species were also studied. In general trace element concentrations do not show significant differences from site to site for all species except Mn in Hypnum cupressiforme and Po-210 in Grimmia pulvinata. To discuss the Pb-210 level and sources in indicator plants analyzed, also radium contents of surface soil at each sampling station was measured and compared with the average values for similar soil types in the literature.

  9. VUV Photodissociation Dynamics of Nitrous Oxide: The O((1)SJ=0) and O((3)PJ=2,1,0) Product Channels.

    Science.gov (United States)

    Yu, Shengrui; Yuan, Daofu; Chen, Wentao; Yang, Xueming; Wang, Xingan

    2015-07-23

    Vacuum ultraviolet photodissociation dynamics of nitrous oxide was investigated using the time-sliced velocity ion imaging technique. Images of the O((1)SJ=0) and the O((3)PJ=2,1,0) products were measured at nine photolysis wavelengths from 124.44 to 133.20 nm, respectively. Three main dissociation channels: O((1)S0) + N2(X(1)Σg(+)), O((3)PJ=2,1,0) + N2(A(3)Σu(+)), and O((3)PJ=2,1,0) + N2(B(3)Πg) were observed and identified in the product images where vibrational states of N2 were fully resolved. Product total kinetic energy releases and angular distributions were acquired. In all product channels, the branching ratios of vibrational states of N2 products were determined. In addition, the O((3)PJ=2,1,0) + N2(A(3)Σu(+))/O((3)PJ=2,1,0) + N2(B(3)Πg) branching ratios were determined. We found that in the O((3)PJ=2,1,0) channels the O((3)PJ=2,1,0) + N2(B(3)Πg) channel becomes dominant at long photolysis wavelength, indicating a strong coupling between the singlet D((1)Σg(+)) state and the triplet (3)Π state. For both O((1)S0) and O((3)PJ=2,1,0) products, the derived angular anisotropy parameters (β values) are very close to 2 at lower vibrational states of the correlated N2 electronic states and gradually decrease with the increasing vibrational quantum number. These behaviors suggest that the photodissociation processes are primarily governed by a fast dissociation in a linear geometry, while the N2 products at excited vibrational states are very likely produced via a more bent transition state.

  10. HIF-1α had Pivotal Effects on Downregulation of miR-210 Decreasing Viability and Inducing Apoptosis in Hypoxic Chondrocytes

    Directory of Open Access Journals (Sweden)

    Zhiqiang Chang

    2014-01-01

    Full Text Available Hypoxia-inducible factor 1-alpha (HIF-1α and some microRNA (miRNAs play pivotal roles in response to hypoxia-related physiologic and pathophysiologic responses. Up to date, the regulatory mechanisms of these molecules were largely unknown in chondrocytes. In this study, to study the mechanisms of degradation and homeostasis of chondrocytes, the effects of miRNAs and HIF-1α on chondrocytes in physiologic environment were investigated. We found that the overexpression of miR-210 and HIF-1α was present on hypoxia in C28/I2 human chondrocytes significantly by qRT-PCR and western plot. Further study displayed that miR-210 played positive role as a promoter in regulation and its regulated molecules (bcl-xl and PHD-2 in C28/I2 cells on hypoxia by silenced miR-210, silenced HIF-1α, and adding miR-210. Moreover, downregulated miR-210 could significantly repress the viability and increase the apoptosis in C28/I2 cells on hypoxia, compared to those on normoxia. Furthermore, miR-210 could not modulate viability and apoptosis in C28/I2 cells with the HIF-1α knockdown on hypoxia and normoxia. Taken together, this study demonstrated that the MiR-210 was involved in an HIF-1α-dependent way in C28/I2 human chondrocytes for the first time. It also suggested that miR-210 downregulation decreased viability and induced apoptosis in hypoxic chondrocytes depending on HIF-1α.

  11. The use of statistical methods for censored data to evaluate the activity concentration of Pb-210 in beans (Phaseolus vulgaris L.).

    Science.gov (United States)

    Mingote, Raquel M; Nogueira, Regina A

    2016-10-01

    A survey of (210)Pb activity concentration, one of the major internal natural radiation sources to man, has been carried in the most common species of beans (Phaseolus vulgaris L.) grown and consumed in Brazil. The representative bean types chosen, Carioca beans and black type sown in the Brazilian Midwestern and Southern regions, have been collected in this study and (210)Pb determined by liquid scintillation spectrometry after separation with chromatographic extraction using Sr-resin. Available values in data set of radioactivity in Brazil (GEORAD) on the (210)Pb activity concentration in black beans grown in Southeastern region have been added to the results of this study with the purpose of to amplify the population considered. Concerning the multiple detection limits and due to the high level of censored observations, a robust semi-parametric statistical method called regression on order statistics (ROS) has been employed to provide a reference value of the (210)Pb in Brazilian beans, which amounted to 41 mBq kg(-1) fresh wt. The results suggest that the (210)Pb activity concentration in carioca beans is lower than in black beans. Also evaluated was the (210)Pb activity concentration in vegetable component of a typical diet, which displays lower values than those shown in the literature for food consumed in Europe. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Radiochemical determination of {sup 210} Pb and {sup 226}Ra in petroleum sludges and scales; Determinacao radioquimica de {sup 210} Pb e {sup 226}Ra em borras e incrustacoes de petroleo

    Energy Technology Data Exchange (ETDEWEB)

    Araujo, Andressa Arruda de

    2005-07-01

    The oil extraction and production, both onshore and offshore, can generate different types of residues, such as sludge, that is deposited in the water/oil separators, valves and storage tanks and scales, which form i the inner surface of ducts and equipment. Analyses already carried out through gamma spectrometry indicated the existence of high radioisotope concentration. However, radionuclides emitting low-energy gamma-rays, such as {sup 210} Pb, are hardly detected by that technique. Consequently, there is a need to test alternative techniques to determine this and other radionuclides from the {sup 238} U series. This work, therefore, focuses on the radiochemical determination of the concentration of {sup 210}Pb, and {sup 226} Ra in samples of sludge and scale from the oil processing stations of the UN-SEAL, a PETROBRAS unit responsible for the exploration and production of petroleum in Sergipe and Alagoas. The sludge and scale samples went through a preliminary process of extraction of oil, in order to separate the solid phase, where the largest fraction of the radioactivity is concentrated. After oil removal, the samples were digested using alkaline fusion as an option for dissolution. Finally, their activity concentration was determined for the samples of sludge and scales, using and alternative radiochemical method, which is based on ionic exchange. The activity concentration found for {sup 210}Pb varied from 1,14 to 507,3 kBq kg{sup -1}. The values for {sup 226}Ra were higher, varying from 4,36 to 3.445 kBq kg{sup -1}. The results for {sup 226}Ra were then compared with the ones found for the same samples of sludge and scales using gamma spectrometry. The results of the comparison confirm the efficiency of the methodology used int hi work, that is, radiochemical determination by means of ionic exchange. (author)

  13. {sup 2}10Po in engraulis encrasilocus in the North of the Valencian community; {sup 2}10Po en Engraulis Encrasilocus en el Norte de la Comunidad Valenciana

    Energy Technology Data Exchange (ETDEWEB)

    Delgado Belmar, V.; Camara Garcia, T.; Ferrero Calabuig, J. L.

    2013-07-01

    Within the scope of natural radiation, one of the most studied radionuclides is currently radon and their descendants. The doses due to this radionuclide are the most high and dangerous, not only in areas where there is radon this is already inhaled by the population but it also swallowed their descendants via food, contributing to a dose rate more. The objective of this work is the study of the concentration of {sup 2}10Po in anchovy (Engraulis Encrasilocus) in an area with a coastal lagoon with high concentration of {sup 2}22 Rn. (Author)

  14. Intercomparison of Pb-210, Cs-137, Pu-239,240 and C-14-Based Chronologies of Recent Sediments - Problems and Challenges

    Science.gov (United States)

    Baskaran, M. M.

    2016-12-01

    Short-lived naturally-occurring Pb-210 and anthropogenically-delivered Cs-137 are the two most extensively utilized chronometers over the time scale of less than a decade to 60 (Cs-137) to 120 yrs (Pb-210) in a variety of environment including terrestrial and aqueous systems and glaciers. Despite all the advances in the field, still major issues, we confront several issues on the robustness of their applications in these environments. Those include: i) how does the temporal and spatial variations of Pb-210 input to an aqueous environment affect the Pb-210 chronology? ii) how well we are able to quantify the multiple source inputs (atmospheric fallout, watershed erosional input, production of Pb-210 from the decay of SGD-derived Rn-222 and Ra-226, etc); iii) How well are we able to sort out a number of processes that affect the vertical profiles of both Cs-137 and Pb-210 which include sediment mixing (biological and/or physical), sediment focusing/erosion due to bottom currents and transport of sediments in subsurface environment and post-depositional mobility of Cs-137 and Pb-210. In this presentation, the following case studies will be discussed: 1) where there is excellent as well non-agreement between Pb-210 and Cs-137-based chronologies; 2) agreement between Cs-137-based chronology with historical time-marker from Hg mining, while no chronology obtainable from Pb-210; 3) agreement between five different methods of dating in a reservoir; 4) evidence of Cs-137 diffusion in some of the sediment cores, but not in all cores in a small reservoir; and 5) evidence of long-term remineralization based on a comparison of C-14-based ages with those of Pb-210, Cs-137 and Pu-239,240-based methods. We also show evidence Cs-137 diffusion based on a set of laboratory-based diffusion experiments under different pore water chemical conditions. A brief discussion on time resolution and error estimation on ages will be discussed. The challenges in the field of `Anthropocene

  15. Antibody dependent cellular phagocytosis (ADCP) and antibody dependent cellular cytotoxicity (ADCC) of breast cancer cells mediated by bispecific antibody, MDX-210.

    Science.gov (United States)

    Watanabe, M; Wallace, P K; Keler, T; Deo, Y M; Akewanlop, C; Hayes, D F

    1999-02-01

    MDX-210 is a bispecific antibody (BsAb) with specificity for both the proto-oncogene product of HER-2/neu (c-erbB-2) and FcgammaRI (CD64). HER-2/neu is overexpressed in malignant tissue of approximately 30% of patients with breast cancer, and FcgammaRI is expressed on human monocytes, macrophages, and IFN-gamma activated granulocytes. We investigated phagocytosis and cytolysis of cultured human breast cancer cells by human monocyte-derived macrophages (MDM) mediated by BsAb MDX-210, its partially humanized derivative (MDX-H210), and its parent MoAb 520C9 (anti-HER-2/neu) under various conditions. Purified monocytes were cultured with GM-CSF, M-CSF, or no cytokine for five or six days. Antibody dependent cellular phagocytosis (ADCP) and cytolysis (ADCC) assays were performed with the MDM and HER-2/neu positive target cells (SK-BR-3). ADCP was measured by two-color fluorescence flow cytometry using PKH2 (green fluorescent dye) and phycoerythrin-conjugated (red) monoclonal antibodies (MoAb) against human CD14 and CD11b. ADCC was measured with a non-radioactive LDH detection kit. Both BsAb MDX-210 (via FcgammaRI) and MoAb 520C9 (mouse IgG1, via FcgammaRII) mediated similar levels of ADCP and ADCC. ADCP mediated by BsAb MDX-H210 was identical to that mediated by BsAb MDX-210. Confocal microscopy demonstrated that dual-labeled cells represented true phagocytosis. Both ADCP and ADCC were higher when MDM were pre-incubated with GM-CSF than when incubated with M-CSF. BsAb MDX-210 is as active in vitro as the parent MoAb 520C9 in inducing both phagocytosis and cytolysis of MDM. MDX-210 and its partially humanized derivative, MDX-H210, mediated similar levels of ADCP. GM-CSF appears to superior to M-CSF in inducing MDM-mediated ADCC and ADCP. These studies support the ongoing clinical investigations of BsAb MDX-210 and its partially humanized derivative.

  16. Initial oxidation behavior of Ni{sub 3}Al (210) surface induced by supersonic oxygen molecular beam at room temperature

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Ya, E-mail: XU.Ya@nims.go.jp [Hydrogen Materials Unit, National Institute for Materials Science, 1-2-1 Sengen, Tsukuba, Ibaraki 305-0047 (Japan); Sakurai, Junya [Hydrogen Materials Unit, National Institute for Materials Science, 1-2-1 Sengen, Tsukuba, Ibaraki 305-0047 (Japan); Teraoka, Yuden; Yoshigoe, Akitaka [Quantum Beam Science Center, Japan Atomic Energy Research Agency, 1-1-1 Kouto, Sayo-cho, Hyogo 679-5148 (Japan); Demura, Masahiko; Hirano, Toshiyuki [Hydrogen Materials Unit, National Institute for Materials Science, 1-2-1 Sengen, Tsukuba, Ibaraki 305-0047 (Japan)

    2017-01-01

    Graphical abstract: - Highlights: • Initial oxidation of Ni{sub 3}Al (210) induced by O{sub 2} beam was investigated. • This was done using real-time synchrotron radiation XPS. • Both the Al and the Ni atoms on the surface were oxidized. • Oxidation of Al progressed much faster than that of Ni. - Abstract: The initial oxidation behavior of a clean Ni{sub 3}Al (210) surface was studied at 300 K using a supersonic O{sub 2} molecular beam (O{sub 2} SSMB) having an O{sub 2} translational energy of 2.3 eV, and real-time photoemission spectroscopy performed with high-brilliance synchrotron radiation. The evolution behaviors of the O 1s, Ni 2p, Al 2p, and Ni 3p spectra were examined during irradiation with the O{sub 2} SSMB. The spectral analysis revealed that both the Al atoms and the Ni atoms on the surface were oxidized; however, the oxidation of Al progressed much faster than that of Ni. The oxidation of Al began to occur and AlO{sub x} was formed at an oxygen coverage of 0.26 monolayer (ML) (1 ML was defined as the atomic density of the Ni{sub 3}Al (210) surface) and saturated at an oxygen coverage of 2.5 ML. In contrast, the oxidation of Ni commenced a little late at an oxygen coverage of 1.6 ML and slowly progressed to saturation, which occurred at an oxygen coverage of 4.89 ML.

  17. Overview on Workpackage 210: Emission indices and distribution of aircraft related trace species in the upper troposphere and lower stratosphere

    Energy Technology Data Exchange (ETDEWEB)

    Schlager, H. [Deutsche Forschungsanstalt fuer Luft- und Raumfahrt e.V. (DLR), Wessling (Germany). Inst. fuer Physik der Atmosphaere

    1997-12-01

    The focus of Workpackage (WP) 210 was on the characterisation of near-field emissions from individual source aircraft and their conversion to secondary exhaust products, the investigation of plume dispersal, and the analysis of regional effects of air-traffic emissions within the North Atlantic flight corridor. Thus, observations were necessary at scales ranging from the engine exit plane and the aircraft wake to the heavily travelled airspace of a flight corridor. The WP210 includes the following projects: In situ measurements in aircraft exhaust plumes and in the North Atlantic flight corridor (211, Schlager et al., 212, Arnold et al., 213, Slemr et al.), and airborne measurements of aircraft emissions using passive infrared Fourier transform spectroscopy (214, Haschberger et al.). The activities which were accomplished are as follows: 1. Development of fast-response aircraft-borne in situ and non-intrusive remote sensing measuring techniques for aircraft exhaust species; 2. Ground-based measurements behind jet engines; 3. In-flight measurements of near-field aircraft emissions; 4. Focused measurements of air-traffic related trace species in flight corridors. The measurements of WP210 were strongly related to other workpackages. The data sampled within aircraft exhaust plumes were utilised to test model treatments of plume/wake dynamics and chemistry in WP220. The observations of the distribution of aircraft related trace gases within and near the eastern North Atlantic flight corridor were used for comparisons with regional and global CTM and GCM simulations performed in WP400. (orig.) 144 figs., 42 tabs., 497 refs.

  18. Diagnostic value of anti-gp210 antibodies in primary biliary cirrhosis: a case-based review.

    Science.gov (United States)

    Valour, Florent; Durupt, Stéphane; Khenifer, Safia; Durieu, Isabelle

    2013-06-26

    Primary biliary cirrhosis (PBC) is an autoimmune liver disease characterised by chronic cholestasis usually associated with antimitochondrial antibodies. Moreover, several types of antinuclear antibodies have been associated with primary biliary cirrhosis. We describe an 83-year-old man, in whom the exploration of a chronic cholestasis led to the diagnosis of primary biliary cirrhosis despite negative antimitochondrial antibodies, regarding the presence of anti-gp210 antibodies. Found in 25% of patients, these antinuclear antibodies must be sought before a strong suspicion of primary biliary cirrhosis with antimitochondrial antibodies negative, as they are highly specific of the disease. They are generally associated with a more aggressive form of PBC.

  19. 210Pb and 137Cs as tracers of recent sedimentary processes in two water reservoirs in Cuba.

    Science.gov (United States)

    Díaz-Asencio, Misael; Corcho-Alvarado, José Antonio; Cartas-Aguila, Héctor; Pulido-Caraballé, Anabell; Betancourt, Carmen; Smoak, Joseph M; Alvarez-Padilla, Elizabeth; Labaut-Betancourt, Yeny; Alonso-Hernández, Carlos; Seisdedo-Losa, Mabel

    2017-10-01

    Hanabanilla and Paso Bonito Reservoirs are the main fresh water sources for about half a million inhabitants in central Cuba. Prior to this investigation precise information about the losses of storage capacity was not available. Sedimentation is the dominant process leading to reduction in water storage capacity. We investigated the sedimentation process in both reservoirs by analyzing environmental radionuclides (e.g. 210Pb, 226Ra and 137Cs) in sediment cores. In the shallow Paso Bonito Reservoir (mean depth of 6.5 m; water volume of 8 × 106 m3), we estimated a mean mass accumulation rate (MAR) of 0.4 ± 0.1 g cm-2y-1 based on 210Pb chronologies. 137Cs was detected in the sediments, but due to the recent construction of this reservoir (1975), it was not possible to use it to validate the 210Pb chronologies. The estimated MAR in this reservoir is higher than the typical values reported in similar shallow fresh water reservoirs worldwide. Our results highlight a significant loss of water storage capacity during the past 30 years. In the deeper and larger Hanabanilla Reservoir (mean depth of 15.5 m; water volume of 292 × 106 m3), the MAR was investigated in three different sites of the reservoir. The mean MARs based on the 210Pb chronologies varied between 0.15 and 0.24 g cm-2y-1. The MARs calculated based on the 137Cs profiles further validated these values. We show that the sediment accumulation did not change significantly over the last 50 years. A simple empirical mixing and sedimentation model that assumes 137Cs in the water originated from both, direct atmospheric fallout and the catchment area, was applied to interpret the 137Cs depth profiles. The model consistently reproduced the measured 137Cs profiles in the three cores (R2 > 0.9). Mean residence times for 137Cs in the water and in the catchment area of 1 y and 35-50 y, respectively were estimated. The model identified areas where the catchment component was higher, zones with higher

  20. 210Pb-226Ra chronology reveals rapid growth rate of Madrepora oculata and Lophelia pertusa on world's largest cold-water coral reef

    Directory of Open Access Journals (Sweden)

    N. Tisnérat-Laborde

    2012-03-01

    Full Text Available Here we show the use of the 210Pb-226Ra excess method to determine the growth rate of two corals from the world's largest known cold-water coral reef, Røst Reef, north of the Arctic circle off Norway. Colonies of each of the two species that build the reef, Lophelia pertusa and Madrepora oculata, were collected alive at 350 m depth using a submersible. Pb and Ra isotopes were measured along the major growth axis of both specimens using low level alpha and gamma spectrometry and trace element compositions were studied. 210Pb and 226Ra differ in the way they are incorporated into coral skeletons. Hence, to assess growth rates, we considered the exponential decrease of initially incorporated 210Pb, as well as the increase in 210Pb from the decay of 226Ra and contamination with 210Pb associated with Mn-Fe coatings that we were unable to remove completely from the oldest parts of the skeletons. 226Ra activity was similar in both coral species, so, assuming constant uptake of 210Pb through time, we used the 210Pb-226Ra chronology to calculate growth rates. The 45.5 cm long branch of M. oculata was 31 yr with an average linear growth rate of 14.4 ± 1.1 mm yr−1 (2.6 polyps per year. Despite cleaning, a correction for Mn-Fe oxide contamination was required for the oldest part of the colony; this correction corroborated our radiocarbon date of 40 yr and a mean growth rate of 2 polyps yr−1. This rate is similar to the one obtained in aquarium experiments under optimal growth conditions. For the 80 cm-long L. pertusa colony, metal-oxide contamination remained in both the middle and basal part of the coral skeleton despite cleaning, inhibiting similar age and growth rate estimates. The youngest part of the colony was free of metal oxides and this 15 cm section had an estimated a growth rate of 8 mm yr−1, with high uncertainty (~1 polyp every two to three years. We are less certain of this 210Pb growth rate estimate which is within the lowermost

  1. Role of VHL, HIF1A and SDH on the expression of miR-210: Implications for tumoral pseudo-hypoxic fate.

    Science.gov (United States)

    Merlo, Anna; Bernardo-Castiñeira, Cristóbal; Sáenz-de-Santa-María, Inés; Pitiot, Ana S; Balbín, Milagros; Astudillo, Aurora; Valdés, Nuria; Scola, Bartolomé; Del Toro, Raquel; Méndez-Ferrer, Simón; Piruat, José I; Suarez, Carlos; Chiara, María-Dolores

    2017-01-24

    The hypoxia-inducible factor 1α (HIF-1α) and its microRNA target, miR-210, are candidate tumor-drivers of metabolic reprogramming in cancer. Neuroendocrine neoplasms such as paragangliomas (PGLs) are particularly appealing for understanding the cancer metabolic adjustments because of their associations with deregulations of metabolic enzymes, such as succinate dehydrogenase (SDH), and the von Hippel Lindau (VHL) gene involved in HIF-1α stabilization. However, the role of miR-210 in the pathogenesis of SDH-related tumors remains an unmet challenge. Herein is described an in vivo genetic analysis of the role of VHL, HIF1A and SDH on miR-210 by using knockout murine models, siRNA gene silencing, and analyses of human tumors. HIF-1α knockout abolished hypoxia-induced miR-210 expression in vivo but did not alter its constitutive expression in paraganglia. Normoxic miR-210 levels substantially increased by complete, but not partial, VHL silencing in paraganglia of knockout VHL-mice and by over-expression of p76del-mutated pVHL. Similarly, VHL-mutated PGLs, not those with decreased VHL-gene/mRNA dosage, over-expressed miR-210 and accumulate HIF-1α in most tumor cells. Ablation of SDH activity in SDHD-null cell lines or reduction of the SDHD or SDHB protein levels elicited by siRNA-induced gene silencing did not induce miR-210 whereas the presence of SDH mutations in PGLs and tumor-derived cell lines was associated with mild increase of miR-210 and the presence of a heterogeneous, HIF-1α-positive and HIF-1α-negative, tumor cell population. Thus, activation of HIF-1α is likely an early event in VHL-defective PGLs directly linked to VHL mutations, but it is a late event favored but not directly triggered by SDHx mutations. This combined analysis provides insights into the mechanisms of HIF-1α/miR-210 regulation in normal and tumor tissues potentially useful for understanding the pathogenesis of cancer and other diseases sharing similar underpinnings.

  2. Cryoconites from Alpine glaciers: Radionuclide accumulation and age estimation with Pu and Cs isotopes and 210Pb.

    Science.gov (United States)

    Wilflinger, T; Lettner, H; Hubmer, A; Bossew, P; Sattler, B; Slupetzky, H

    2017-10-19

    Cryoconites ("cold dust", derived from the Greek) are aeolian sediments accumulated on glacier surfaces. In cryoconites from the surface of the Stubacher Sonnblickkees, a temperate Austrian glacier, extremely high activity concentrations of artificial and natural radionuclides were found. Artificial radionuclides stem from two clearly distinguishable sources, global fallout from the nuclear weapons testing era deposited over a period of years until roughly 1966 and the fallout from Chernobyl in 1986, which was essentially deposited as a single input during one week. Anthropogenic radionuclides identified were 137Cs, 134Cs, 238Pu, 239+240Pu, 90Sr, 241Am, 60Co, 125Sb, 154Eu, and 207Bi. The naturally occurring radionuclides detected were the long-lived radon decay product 210Pb, the primordial radionuclide 4 K and the cosmogenic 7Be. Isotopic ratios of 134Cs/137Cs and 239+240Pu/238Pu were used to separate the nuclide inventory into the contributions of the two aforementioned sources, which show varying degrees of mixing and provide information on the mixing age of the cryoconites. Since isotopic ratios of Pu often have high uncertainties due to low absolute concentrations, age estimation based on this method can be quite inaccurate. Additional information about the age of cryoconites was obtained through analysis of 210Pb, which is constantly deposited over time. Copyright © 2017. Published by Elsevier Ltd.

  3. Determination of {sup 226}Ra, {sup 228}Ra, and {sup 210}Pb in mushroom from a naturally high radioactive region

    Energy Technology Data Exchange (ETDEWEB)

    Rosa, Mychelle M.L.; Custodio, Luis Gustavo; Cheberle, Luan T.V.; Taddei, Maria Helena T., E-mail: mychelle@cnen.gov.br, E-mail: lgcustodio@hotmail.com, E-mail: lt.cheberle@bol.com.br, E-mail: mhtaddei@cnen.gov.br [Comissao Nacional de Energia Nuclear (LAPOC/CNEN-MG), Pocos de Caldas, MG (Brazil). Laboratorio de Pocos de Caldas; Maihara, Vera A., E-mail: vmaihara@ipen.br [Instituto de Pesquisas Energeticas e Nucleares (CNEN/IPEN-SP), Sao Paulo, SP (Brazil)

    2013-07-01

    Many studies have shown that mushrooms are organisms which efficiently accumulate radionuclides and can be used as indicators of environmental contamination and ecosystem quality. The Pocos de Caldas plateau, in Minas Gerais, is a region that has elevated natural radioactivity due to the presence of radiological anomalies of volcanic origin. Seventy areas of radioactive anomalies have been identified in this region. From the radiological point of view the determination of {sup 226}Ra, {sup 228}Ra, and {sup 210}Pb is relevant because they are decay products of the natural series of {sup 238}U and {sup 232}Th, mainly responsible for natural radioactive exposures of man. The present paper is part of a broader study conducted in the Pocos de Caldas plateau, in which the concentration activities of {sup 226}Ra, {sup 228}Ra, and {sup 210}Pb in mushroom samples were determined. The mushrooms were collected at different points of the plateau under the influence of radioactive anomalies and away from the influence of anomalies. From statistical studies a correlation between the accumulation of radionuclides in mushrooms and anomalies was established and it was possible to confirm the efficiency that the mushrooms present as environmental contamination indicators. (author)

  4. Iron-induced oligomerization of human FXN81-210 and bacterial CyaY frataxin and the effect of iron chelators

    DEFF Research Database (Denmark)

    Ahlgren, Eva Christina; Fekry, Mostafa; Wiemann, Mathias

    2017-01-01

    long forms, FXN42-210 and FXN56-210, have been shown to spontaneously form oligomeric particles stabilized by the extended N-terminal sequence. The short variant FXN81-210, on other hand, has only been observed in the monomeric state. However, a highly homologous E. coli frataxin CyaY, which also lacks...... studies suggest that within the oligomers FXN81-210 and CyaY monomers are packed in a head-to-tail fashion in ring-shaped structures with potential iron-binding sites located at the interface between monomers. The higher stability of CyaY oligomers can be explained by a higher number of acidic residues...... not show any effect on oligomerization in this case. The results suggest that FXN81-210 oligomerization is primarily driven by ferric iron, while both ferric and ferrous iron participate in CyaY oligomer stabilization. Analysis of the amino acid sequences of bacterial and eukaryotic frataxins suggests...

  5. In-vivo measurements of Pb-210 to determine cumulative exposure to radon daughters: A pilot study. Final report, 1 March, 1990--May 31, 1991

    Energy Technology Data Exchange (ETDEWEB)

    Laurer, G.R.; Cohen, N. [New York Univ. Medical Center, Tuxedo, NY (United States). Dept. of Environmental Medicine; Stark, A.; Ju, C. [New York State Dept. of Health, Albany, NY (United States). Bureau of Environmental and Occupational Epidemiology

    1991-05-01

    The objective of this study is to demonstrate the feasibility of estimating cumulative exposure of individuals to low concentrations of radon by measuring the amount of Pb-A-10 in their skeletons. This report presents progress to date establishing the validity of an vivo technique to measure skeletal burdens of Pb-210, accumulated from exposure to radon and radon progeny. With the skeletal content of Pb--210 and a model for Pb metabolism, cumulative exposure to radon and its short-lived daughters (radon/daughters) may be calculated for use in deriving a dose-response relationship between lung cancer and exposure to radon/daughters. Data are presented for 29 subjects exposed to ``above-average`` radon concentrations in their homes, showing the correlation between measured Pb--210 burdens, and measured pCi/l and WLM exposure estimates. Their results are compared to measurements of a population of 24 subject`s presumed exposed to average concentrations. Measurements of a Pennsylvania family exposed for a year in a home with an extremely high radon content are also presented. Update of results of an ongoing study of the biological half-time of Pb--210 in man involving measurements, of a retired radiation worker with a 40 year old skeletal burden of Pb-210.

  6. Estimation of Polonium-210 activity in marine and terrestrial samples and computation of ingestion dose to the public in and around Kanyakumari coast, India

    Directory of Open Access Journals (Sweden)

    L. Macklin Rani

    2014-04-01

    Full Text Available The brown mussel Perna perna, an effective bioindicator species for monitoring radioactive pollution, was used to evaluate the concentration of 210Po in and around the coastal areas of Kanyakumari, a Monazite rich region. 210Po concentration in P. perna collected from ten different locations in this region exhibited values ranging between 78.09 ± 5.5 and 320.00 ± 18.1 Bq/kg (wet. Kalluvilai recorded the maximum concentration of 210Po (320.00 ± 18.1 Bq/kg, and hence further studies involving the activity of 210Po in other marine organisms and terrestrial samples were carried out from this site. The annual intake of 210Po by the population residing in this location via dietary sources was estimated. Similarly, the total annual committed effective dose to the public was found to be 2.24 mSv/year. The results obtained were compared to the values reported by earlier studies in India and also in other countries.

  7. Analysis of the gamma spectrometry {sup 210}Pb radioisotope in river bottom sediments of the hydrographic sub-basins around the UTM-Caldas

    Energy Technology Data Exchange (ETDEWEB)

    Dutra, Pedro H.; Carvalho Filho, Carlos A.; Moreira, Rubens M.; Menezes, Maria Angela B.C.; Oliveira, Aline F.G. de, E-mail: pedrohenrique.dutra@gmail.com [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil); Silva, Nivaldo C., E-mail: ncsilva@cnen.gov.br [Comissao Nacional de Energia Nuclear (LAPOC/CNEN-MG), Pocos de Caldas, MG (Brazil). Laboratorio de Pocos de Caldas; Viana, Valquiria F.L., E-mail: valquiria.flviana@gmail.com [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Instituto de Ciencias Biologicas

    2015-07-01

    The uranium mine of Caldas, currently named Ore Treatment Unit (UTM-Caldas), is sited at the Pocos de Caldas Plateau (Minas Gerais State) and was the first uranium mineral-industrial complex in Brazil. It has been installed since 1982 and now it is under decommissioning process. Taking into account the potential sources of contamination and the assessment of the impact of the mine, based on the presence of radionuclides from the radioactive decay series of natural {sup 238}U, the aim of the article is to present the distribution of {sup 210}Pb in the stream bottom sediments of the study area that consists of the Taquari watershed, sub-divided by its three major sub-basins: Consulta stream, Soberbo stream and Taquari river. The radionuclide activity concentrations were measured in sediment samples that were collected in twelve collecting points, during four sampling campaigns, carried out in the dry and rainy seasons of 2010 and 2011. The results of the {sup 210}Pb concentration activity were obtained by gamma spectrometry performed in both high and low energy CANBERRA detectors. The results point out that the UTM-Caldas is influencing on the bottom sediment distribution of {sup 210}Pb activity in its neighborhood. However, a more detailed study should be done in order to identify if there is another source of {sup 210}Pb in the study area, such as a geogenic anomaly, that may contributing to the local increment of {sup 210}Pb activity. (author)

  8. Final Report for grant entitled "Production of Astatine-211 for U.S. Investigators"

    Energy Technology Data Exchange (ETDEWEB)

    Wilbur, Daniel Scott

    2012-12-12

    Alpha-particle emitting radionuclides hold great promise in the therapy of cancer, but few alpha-emitters are available to investigators to evaluate. Of the alpha-emitters that have properties amenable for use in humans, 211At is of particular interest as it does not have alpha-emitting daughter radionuclides. Thus, there is a high interest in having a source of 211At for sale to investigators in the US. Production of 211At is accomplished on a cyclotron using an alpha-particle beam irradiation of bismuth metal. Unfortunately, there are few cyclotrons available that can produce an alpha particle beam for that production. The University of Washington has a cyclotron, one of three in the U.S., that is currently producing 211At. In the proposed studies, the things necessary for production and shipment of 211At to other investigators will be put into place at UW. Of major importance is the efficient production and isolation of 211At in a form that can be readily used by other investigators. In the studies, production of 211At on the UW cyclotron will be optimized by determining the best beam energy and the highest beam current to maximize 211At production. As it would be very difficult for most investigators to isolate the 211At from the irradiated target, the 211At-isolation process will be optimized and automated to more safely and efficiently obtain the 211At for shipment. Additional tasks to make the 211At available for distribution include obtaining appropriate shipping vials and containers, putting into place the requisite standard operating procedures for Radiation Safety compliance at the levels of 211At activity to be produced / shipped, and working with the Department of Energy, Isotope Development and Production for Research and Applications Program, to take orders, make shipments and be reimbursed for costs of production and shipment.

  9. Production of Astatine-211 at the Duke University Medical Center for its regional distribution

    Energy Technology Data Exchange (ETDEWEB)

    Zalutsky, Michael [Duke University Medical Center, Durham, NC (United States)

    2016-01-01

    Systemic targeted radiation therapy and radioimmunotherapy continue to be important tools in the treatment of certain cancers. Because of their high energy and short path length, alpha particle emitters such as 211At are more effective than either external beam x- ray or in vivo beta radiation in delivering potentially curative doses of radiation. The limited clinical trials that have been conducted to date have yielded encouraging responses in some patients, e.g., malignant brain tumors. In order to escalate the additional necessary research and development in radiochemistry, radiobiology and efficacy evaluation of alpha particle radiotherapeutics, it is universally agreed that access to an affordable, reliable supply of 211At is warranted. In conjunction with the Department of Energy's intent to enhance stable and radioactive isotope availability for research applications, it is the primary objective of this project to improve 211At production and purification capabilities at Duke so that this radionuclide can be supplied to researchers at other institutions throughout the US.The most widely used 211At production method involves the α,2n reaction on Bismuth using a cyclotron with beams ≤ 28 MeV. Yields can be enhanced with use of an internal target that allows for a higher alpha fluence plus efficient heat dissipation in the target. Both of these items are in place at Duke; however, in order to support production for multi-institutional use, irradiation campaigns in excess of 50 µAp and four hours duration will be needed. Further, post-irradiation processing equipment is lacking that will enable the distribution process. Financial support is sought for i) a shielded, ventilated processing/containment hood; ii) development of a post-irradiation target retrieval system; iii) fabrication of a 211At distillation and recovery module and iv) a performance review and, where needed, an enhancement of seven major subsystems that comprise the CS-30 Cyclotron. With these modifications in place, routine production of ≥200 mCi of At-211 should be readily achievable, given our methodological development of At-211 target preparation, internal target irradiation and dry distillation to recover the radionuclide.

  10. A revised B(E2; 2{sup +}{sub 1} → 0{sup +}{sub 1}) value in the semi-magic nucleus {sup 210}Po

    Energy Technology Data Exchange (ETDEWEB)

    Kocheva, D.; Rainovski, G.; Djongolov, M.; Gladnishki, K.; Stoyanova, M. [St. Kliment Ohridski University of Sofia, Faculty of Physics, Sofia (Bulgaria); Jolie, J.; Blazhev, A.; Altenkirch, R.; Ansari, S.; Braunroth, T.; Dewald, A.; Diel, F.; Fransen, C.; Hennig, A.; Karayonchev, V.; Kluge, E.; Litzinger, J.; Mueller-Gatermann, C.; Rudigier, M.; Scholz, P.; Spieker, M.; Thoele, P.; Warr, N.; Woelk, D.; Zell, K.O. [Universitaet Koeln, Institut fuer Kernphysik (Germany); Pietralla, N.; Cortes, M.L.; Stahl, C.; Stegmann, R.; Werner, V.; Witt, W.; Ponomarev, V.Yu. [Technische Universitaet Darmstadt, Institut fuer Kernphysik, Darmstadt (Germany); Astier, A. [CSNSM, IN2P3/CNRS et Universite Paris-Sud, Orsay (France); Keatings, J.M.; Scheck, M.; Spagnoletti, P. [University of the West of Scotland, School of Engineering and Computing, Paisley (United Kingdom); Petkov, P. [National Institute for Physics and Nuclear Engineering, Bucharest-Magurele (Romania); Van Isacker, P. [Grand Accelerateur National d' Ions Lourds, CEA/DRF-CNRS/IN2P3, Caen (France)

    2017-09-15

    The lifetimes of the 2{sup +}{sub 1}, the 2{sup +}{sub 2} and the 3{sup -}{sub 1} states of {sup 210}Po have been measured in the {sup 208}Pb({sup 12}C,{sup 10}Be){sup 210}Po transfer reaction by the Doppler-shift attenuation method. The result for the lifetime of the 2{sup +}{sub 1} state is about three times shorter than the adopted value. However, the new value still does not allow for a consistent description of the properties of the yrast 2{sup +}{sub 1}, 4{sup +}{sub 1}, 6{sup +}{sub 1}, and 8{sup +}{sub 1} states of {sup 210}Po in the framework of nuclear shell models. Quasi-particle Phonon Model (QPM) calculations also cannot overcome this problem thus indicating the existence of a peculiarity which is neglected in both theoretical approaches. (orig.)

  11. Detection of sup 210 Po by CR-39 from filter papers used in 1984 for measuring radon daughters in a room

    Energy Technology Data Exchange (ETDEWEB)

    Abu-Jarad, F. (King Fahd Univ. of Petroleum and Minerals, Dhahran (Saudi Arabia). Energy Resources Div.)

    1991-01-01

    The correlation between the environmental level in a room of short lived radon daughter products and the long lived alpha emitting Po-210 decay product was studied using CR-39 track detectors. Filter papers were used to collect radon daughters and thus to measure the working levels in-situ. These filters were stored after the experiment, and were used five years later to study the activity of the long-lived alpha emitting daughter, Po-210 (138 days half life). This isotope is separated from the short-lived daughters by Pb-210 (beta emitter with 22 years half life). The CR-39 detectors were placed on the surfaces of different filters for 3 months for two different post-sampling times. The counting results showed very good correlation with the environmental activities of 5 years earlier. (author).

  12. Behaviour of {sup 210}Po in fresh water ecosystem located in high rainfall area around proposed uranium mining site in India

    Energy Technology Data Exchange (ETDEWEB)

    Jha, S.K. [Environmental Radioactivity measurement Section, Health Physics Division, Bhabha Atomic Research Centre, Mumbai-400085 (India)

    2014-07-01

    Several naturally occurring alpha or beta emitting radionuclides such as {sup 238}U, {sup 226}Ra, {sup 210}Pb, {sup 228}Ra and others are frequently dissolved in water supplies and their concentrations vary over an extremely wide range, mainly depending upon the amount of radio elements present in bedrock and soil with which the water comes in contact. In Meghalaya, Kylleng-Pyndensohiong, Mawthabah (KP Mawthabah Domiasiat) in West Khasi Hills District and adjoining region receives highest rainfall, and is situated near a proposed uranium mineralization zone, therefore these regions can be considered as potential sources of naturally occurring radionuclides of uranium series to the biosphere via different media. The population of the region depends mainly on different surface water sources for drinking water and also for agricultural purposes. Under these conditions some Po can be allochthonous i.e. coming with rainwater as water supply comes from the naturally formed small storage basin between the rocks which accumulate rainwater. Apart from cultivation, the occupation of the local tribal people is production of wood charcoal. This leads to excess deforestation, escalating the erosion of soil exposing the uranium bearing rock at some places, may enhance the natural radioactivity levels in nearby water bodies. The physico chemical parameter, Fe, Mn, gross alpha and {sup 210}Po activities were estimated for radiological assessment of surface water quality and behavior of {sup 210}Po. The measurement of {sup 210}Po was carried out using the {sup 208}Po tracers. A tracer recovery of 85% was observed in the case of biological samples. Recovery in the range of 90% to 95% was observed in the case of water sample. The {sup 210}Po concentration ranged from 10 to 64 mBq L{sup -1}. The lowest concentrations of {sup 210}Po were detected in water samples from Wakhaji (10±0.03) and the highest concentration of {sup 210}Po was observed in the water bodies of Nongtynger (64±0

  13. Levels of polonium-210 in highly consumed sea foods from a fish market of the city of Niteroi, RJ-Brazil

    Energy Technology Data Exchange (ETDEWEB)

    Marsico, Eliane T.; Sao Clemente, Sergio C. de [Universidade Federal Fluminense (UFF), Niteroi, RJ (Brazil). Faculdade de Veterinaria. Dept. de Tecnologia de Alimentos; Kelecom, Alphonse; Gouvea, Rita de Cassia S. [Universidade Federal Fluminense (UFF), Niteroi, RJ (Brazil). Dept. de Biologia Geral. Lab. de Radiobiologia e Radiometria Pedro Lopes dos Santos - LARARA

    2007-07-01

    Polonium-210 ({sup 210}Po), a short-lived member from the uranium series, is broadly distributed in Nature being among all alpha-emitters the major contributor to the internal dose in man. Studies of diets have shown that marine foods are important sources of this radionuclide. The levels of {sup 210}Po have been determined in three highly consumed marine species, the fishes Sardinella brasiliensis (sardine) and Thunnus atlanticus (tuna), and the shrimp Litopenaeus brasiliensis, purchased from the Niteroi (RJ, Brazil) fish market, and caught along the coast of the state of Rio de Janeiro. Doses of {sup 210}Po were determined for the entire organisms and for some tissues and organs, such as eyes, heart, gills, muscle, stomach liver, intestine and pyloric caecal (fishes) or eyes, head content, exoskeleton, muscle, hepatopancreas and pleopods. {sup 210}Po is not uniformly distributed within these species, the highest levels being observed for sardine in the intestine (1634.6 mBq g-1), tuna in pyloric caecal (4656.1 mBq g-1) and shrimp in the hepatopancreas (1460.5 mBq g-1). The {sup 210}Po activities in sardine, tuna and shrimp, calculated on a mean whole-organism basis, were 64.6, 34.5 and 39.5 Bq kg-1 (dry weight) respectively, with corresponding concentration factors of 7.2 x104, 3.8 x104 and 4.4 x104. Considering body distribution, almost 60% of the total activity is concentrated in the pyloric caecal of both fishes and in the hepatopancreas of the shrimp. In turn, the edible parts concentrate much less activity. (author)

  14. The [sup 210]Po content of North Sea edible crab, Cancer pagurus L. , and the common shrimp, Crangon crangon L. and the potential radiological impact

    Energy Technology Data Exchange (ETDEWEB)

    Swift, D.J.; Smith, D.L.; Allington, D.J.; Ives, M.J. (Ministry of Agriculture, Fisheries and Food, Lowestoft (United Kingdom). Directorate of Fisheries Research)

    1994-01-01

    The [sup 210]Po content of brown shrimp and edible crab has been measured in monthly samples over one year to investigate possible seasonal changes. The highest value measured in shrimp was found in August for hepatopancreas tissue. Tailmuscle values were significantly lower than those in the hepatopancreas but followed a similar trend, with the highest value being measured in August. However, in neither tissue were these statistically significant changes correlated with time. No statistically significant difference was found between male and female crab brown meat [sup 210]Po. There was no statistically significant variation in the brown meat [sup 210]Po content of female crabs over the period of the study. However, there was a statistically significant variation in the brown meat [sup 210]Po content for males, but there was no clear pattern with time. Male claw muscle contained less [sup 210]Po than female and was more variable with time, although, again, without a clear pattern being visible. The median individual effective dose equivalent for [sup 210]Po from eating North Sea shrimp tail muscle was estimated at about 0.001 mSv a[sup -1] by using the NRPB recommended dose coefficient of 4.35 x 10[sup -7] Sv Bq[sup -1]. The equivalent value for eating dressed crab (mixed crab brown meat and claw muscle) was about 0.02 mSv a[sup -1]. A measure of whole shrimp, traditionally one pint (568 ml), was estimated to represent an effective dose equivalent of about 0.007 [mu]Sv. The equivalent mean value for an average weight of dressed crab (135 g wet weight) was 1.1 [mu]Sv (range 0.6-2.2 [mu]Sv). (Author).

  15. Aspectos qualitativos da carcaça e da carne de machos braford superprecoces, desmamados aos 72 ou 210 dias de idade

    Directory of Open Access Journals (Sweden)

    Vaz Fabiano Nunes

    2002-01-01

    Full Text Available Este trabalho foi conduzido com o objetivo de estudar os aspectos qualitativos da carcaça e da carne de machos Braford (5/8 Hereford 3/8 Nelore desmamados em duas idades, aos 72 (T72 ou 210 (T210 dias. Utilizaram-se 36 bezerros, não castrados, os quais foram terminados em confinamento e abatidos aos quatorze meses de idade. Não houve diferença significativa para as porcentagens de músculo, gordura e osso, sendo que as médias entre os dois tratamentos para essas características foram de 63,29; 21,97; e 15,03%, respectivamente. O T72 apresentou maior relação músculo/osso (4,49 contra 4,02 que o T210, não existindo diferença entre os dois tratamentos para relação músculo + gordura/osso. A cor, textura e marmoreio da carne foram semelhantes entre os dois tratamentos, sendo os valores observados no T72 de 4,19; 3,31; e 5,75 pontos, respectivamente, e no T210 de 3,89; 3,63; e 5,63 pontos, citados na mesma ordem. A maciez da carne foi classificada como levemente acima da média nos dois tratamentos e a força de cizalhamento foi de 7,36 e 7,17 kg, respectivamente, para T72 e T210. Os animais do T72 apresentaram 6,32 e 5,97 pontos, respectivamente, para palatabilidade e suculência da carne; nos animais do T210, esses valores foram de 6,41 e 6,08 pontos. A quebra ao descongelamento da carne foi 4,84% e a quebra à cocção, de 28,97%, no T72, enquanto no T210 estes valores foram de 7,01 e 26,76%, citados na mesma ordem. Machos Braford desmamados aos 72 ou 210 dias de idade e abatidos aos quatorze meses de idade apresentaram carne com características sensoriais semelhantes, indicando que os dois manejos são adequados para a produção de machos superprecoces.

  16. Lysine 271 but not lysine 210 of XRCC4 is required for the nuclear localization of XRCC4 and DNA ligase IV

    Energy Technology Data Exchange (ETDEWEB)

    Fukuchi, Mikoto; Wanotayan, Rujira; Liu, Sicheng; Imamichi, Shoji; Sharma, Mukesh Kumar; Matsumoto, Yoshihisa, E-mail: yoshim@nr.titech.ac.jp

    2015-06-12

    XRCC4 and DNA Ligase IV (LIG4) cooperate to join two DNA ends at the final step of DNA double-strand break (DSB) repair through non-homologous end-joining (NHEJ). However, it is not fully understood how these proteins are localized to the nucleus. Here we created XRCC4{sup K271R} mutant, as Lys271 lies within the putative nuclear localization signal (NLS), and XRCC4{sup K210R} mutant, as Lys210 was reported to undergo SUMOylation, implicated in the nuclear localization of XRCC4. Wild-type and mutated XRCC4 with EGFP tag were introduced into HeLa cell, in which endogenous XRCC4 had been knocked down using siRNA directed to 3′-untranslated region, and tested for the nuclear localization function by fluorescence microscopy. XRCC4{sup K271R} was defective in the nuclear localization of itself and LIG4, whereas XRCC4{sup K210R} was competent for the nuclear localization with LIG4. To examine DSB repair function, wild-type and mutated XRCC4 were introduced into XRCC4-deficient M10. M10-XRCC4{sup K271R}, but not M10-XRCC4{sup K210R}, showed significantly reduced surviving fraction after 2 Gy γ-ray irradiation as compared to M10-XRCC4{sup WT}. The number of γ-H2AX foci remaining 2 h after 2 Gy γ-ray irradiation was significantly greater in M10-XRCC4{sup K271R} than in M10-XRCC4{sup WT}, whereas it was only marginally increased in M10-XRCC4{sup K210R} as compared to M10-XRCC4{sup WT}. The present results collectively indicated that Lys271, but not Lys210, of XRCC4 is required for the nuclear localization of XRCC4 and LIG4 and that the nuclear localizing ability is essential for DSB repair function of XRCC4. - Highlights: • XRCC4{sup K271R} is defective in the nuclear localization of itself and LIG4. • XRCC4{sup K210R} is competent for the nuclear localization of itself and LIG4. • XRCC4{sup K271R} is deficient in DSB repair function. • XRCC4{sup K210R} is mostly normal in DSB repair function.

  17. Intercomparison of radiocarbon bomb pulse and {sup 210}Pb age models. A study in a peat bog core from North Poland

    Energy Technology Data Exchange (ETDEWEB)

    Piotrowska, Natalia, E-mail: natalia.piotrowska@polsl.p [Department of Radioisotopes, Institute of Physics, Silesian University of Technology, Krzywoustego, 2, Gliwice 44100 (Poland); Vleeschouwer, Francois De; Sikorski, Jaroslaw; Pawlyta, Jacek [Department of Radioisotopes, Institute of Physics, Silesian University of Technology, Krzywoustego, 2, Gliwice 44100 (Poland); Fagel, Nathalie; Roux, Gael Le [Clays and Palaeoclimate Unit, Department of Geology, University of Liege, Allee du 6 Aout, B18, Sart Tilman, Liege 4000 (Belgium); Pazdur, Anna [Department of Radioisotopes, Institute of Physics, Silesian University of Technology, Krzywoustego, 2, Gliwice 44100 (Poland)

    2010-04-15

    Radiocarbon and {sup 210}Pb were measured on the uppermost 40 cm of a Wardenaar peat core retrieved from a Baltic raised bog at Slowinskie Blota (Pomerania, North Poland). This site is the subject of ongoing multiproxy studies covering the last 1300 years. Radiocarbon age model was constructed on the basis of 14 AMS dates obtained on selected Sphagnum spp. fragments, with use of P{sub S}equence tool. We present here a comparison of this model with the age model obtained using CRS model classically applied to {sup 210}Pb measurements.

  18. The particulate {sup 7}Be/{sup 210}Pb{sub xs} and {sup 234}Th/{sup 210}Pb{sub xs} activity ratios as tracers for tidal-to-seasonal particle dynamics in the Gironde estuary (France): Implications for the budget of particle-associated contaminants

    Energy Technology Data Exchange (ETDEWEB)

    Saari, Hanna-Kaisa [Universite de Bordeaux, UMR5805 EPOC, F-33405 Talence Cedex (France); Schmidt, Sabine, E-mail: s.schmidt@epoc.u-bordeaux1.fr [CNRS, UMR5805 EPOC, F-33405 Talence Cedex (France); Castaing, Patrice; Blanc, Gerard [Universite de Bordeaux, UMR5805 EPOC, F-33405 Talence Cedex (France); Sautour, Benoit [Universite de Bordeaux, UMR5805 EPOC, Station Marine d' Arcachon, F-33120 Arcachon (France); Masson, Olivier [IRSN, BP 3, 13115 Saint Paul Lez Durance (France); Cochran, J. Kirk [Marine Sciences Research Center, School of Marine and Atmospheric Sciences, Stony Brook University, Stony Brook, New York 11794-5000 (United States)

    2010-09-15

    The short-lived natural radionuclides {sup 7}Be (T{sub 1/2} = 53 days), {sup 234}Th{sub xs} (T{sub 1/2} = 24.1 days) and {sup 210}Pb{sub xs} (T{sub 1/2} = 22.3 years), i.e. {sup 234}Th and {sup 210}Pb in excesses of that supported within particles by the decay of their parent isotopes, were analysed in suspended particulate matter (SPM) to study the particle dynamics in the Gironde fluvial estuarine system (France), strongly impacted by heavy metal pollution. From surveys of this land-ocean interface in 2006 and 2007, we established a times series of these radioisotopes and of their activity ratios ({sup 7}Be/{sup 210}Pb{sub xs} and {sup 234}Th/{sup 210}Pb{sub xs} ARs) in particles sampled under different hydrological conditions. The particulate {sup 7}Be/{sup 210}Pb{sub xs} AR varies along the fluvial estuarine system mainly due to variations in {sup 7}Be activities, controlled by riverine, oceanic and atmospheric inputs and by resuspension of old {sup 7}Be-deficient sediments. These processes vary with river discharge, tidal cycle and season. Therefore, seasonal particle transport processes can be described using variations of the SPM {sup 7}Be/{sup 210}Pb{sub xs} ARs. During high river discharge, the SPM {sup 7}Be/{sup 210}Pb{sub x} ARs decrease from river to the ocean. The turbidity maximum zone (TMZ) is dispersed and the particles, and the associated contaminants, are rapidly transported from river to coastal waters, without significant retention within the TMZ. During low river discharge, the TMZ intrudes into the fluvial estuary, and the lowest {sup 7}Be/{sup 210}Pb{sub x} ARs are observed there due to resuspension of {sup 7}Be-deficient sediments. Away from the TMZ, from the middle to lower estuary, SPM {sup 7}Be/{sup 210}Pb{sub x} ARs increase, indicating that the particles have been recently tagged with {sup 7}Be. We explain this trend as being caused by marine input of dissolved radionuclides, as traced by SPM {sup 234}Th/{sup 210}Pb{sub xs} ARs

  19. River-plume sedimentation and 210Pb/7Be seabed delivery on the Mississippi River delta front

    Science.gov (United States)

    Keller, Gregory; Bentley, Samuel J.; Georgiou, Ioannis Y.; Maloney, Jillian; Miner, Michael D.; Xu, Kehui

    2017-06-01

    To constrain the timing and processes of sediment delivery and submarine mass-wasting events spanning the last few decades on the Mississippi River delta front, multi-cores and gravity cores (0.5 and deposition (from 7Be) and accumulation (from 210Pb) indicate that proximity to the river mouth has stronger influence than local facies (mudflow gully, depositional lobe, prodelta) over the timeframe and seabed depth represented by the cores (deposition from river plumes coupled with infrequent tropical cyclone activity near the delta in the last 7 years (2006-2013), and by the location of most sediment failure surfaces (from mass flows indicated by parallel geophysical studies) deeper than the core-sampling depths of the present study.

  20. Total lead (Pb) concentration in oil shale ash samples based on correlation to isotope Pb-210 gamma-spectrometric measurements

    Energy Technology Data Exchange (ETDEWEB)

    Vaasma, T.; Kiisk, M.; Tkaczyk, A.H. [University of Tartu (Estonia); Bitjukova, L. [Tallinn University of Technology (Estonia)

    2014-07-01

    (PF) and circulating fluidized bed (CFB) firing technology. These samples were analyzed to determine macro and trace elements by the ICP-MS method. The same samples were also measured with a high-purity germanium detector (planar BSI GPD-50400) to determine the activity concentrations of natural radionuclides. The lead concentrations and Pb-210 activity concentrations were determined, and the correlation between the corresponding values was analyzed. Initial results demonstrate a strong positive linear relationship between these values, with the coefficient of determination (R{sup 2}) over 94. The correlation coefficient (Pearson's, 'r') had a value over 0.95. Both Pb and Pb-210 values had an increasing trend from the bottom ash towards electrostatic precipitator (ESP) ashes. The strong linear correlation between Pb concentrations and Pb-210 activity concentrations gives a credible indication that lead can be measured in ash samples using its radioactive isotope Pb-210. Especially in situations where there are higher concentrations of Pb, for example in the case of wastes from the metallurgic and energy industries, this method could be used to detect the lead concentration quickly and with no chemical processing of the sample. Document available in abstract form only. (authors)