WorldWideScience

Sample records for astatine 196

  1. Bibliography of astatine chemistry and biomedical applications

    International Nuclear Information System (INIS)

    An overall bibliography is presented on astatine chemistry and on the biomedical applications of its 211At isotope. The references were grouped in the following chapters: General reviews; Discovery, Natural Occurence; Nuclear Data; Preparation, Handling, Radiation Risk; Physico-chemical Properties; Astatine Compounds and Chemical Reactions; Biological Effects and Applications. Entries are sorted alphabetically by authors name in each chapter, and cross-references to other chapters are provided if appropriate. (R.P.)

  2. Astatine-211: production and availability.

    Science.gov (United States)

    Zalutsky, Michael R; Pruszynski, Marek

    2011-07-01

    The 7.2-h half life radiohalogen (211)At offers many potential advantages for targeted α-particle therapy; however, its use for this purpose is constrained by its limited availability. Astatine-211 can be produced in reasonable yield from natural bismuth targets via the (209)Bi(α,2n)(211)At nuclear reaction utilizing straightforward methods. There is some debate as to the best incident α-particle energy for maximizing 211At production while minimizing production of (210)At, which is problematic because of its 138.4-day half life α-particle emitting daughter, (210)Po. The intrinsic cost for producing (211)At is reasonably modest and comparable to that of commercially available (123)I. The major impediment to (211)At availability is attributed to the need for a medium energy α-particle beam for its production. On the other hand, there are about 30 cyclotrons in the world that have the beam characteristics required for (211)At production. PMID:22201707

  3. Adsorption interaction of astatine species with quartz and gold surfaces

    Energy Technology Data Exchange (ETDEWEB)

    Serov, A. [Paul Scherrer Institute, Villigen (Switzerland). Lab. for Radiochemistry and Environmental Chemistry; Bern Univ. (Switzerland). Dept. for Chemistry and Biochemistry; Aksenov, N.; Bozhikov, G. [Joint Institute for Nuclear Research, Dubna (RU). Flerov Lab. of Nuclear Reactions] (and others)

    2011-07-01

    The adsorption interaction of various astatine species with quartz and gold surfaces was investigated by gas chromatography methods. Due to variations of the redox potential of the carrier gas elemental astatine, astatine oxide and hypo-astatic acid have been produced. The identification of the astatine compounds is based on the analogy assumption to the gas phase chemistry of the closest homologues in group 17 of the periodic table, iodine and bromine. The deposition temperatures as well as enthalpies of adsorption have been determined for the astatine species. The enhancement of the metallic character within group 17 towards higher Z is clearly confirmed. Macroscopic properties (sublimation enthalpy) of previously unstudied AtO{sub 2} and HAtO were estimated. The determined data for elemental astatine were compared to available literature data. Based on the obtained experimental results possible designs of experiments for studying of chemical properties of the recently discovered element 117 can be suggested. (orig.)

  4. Recent advances in the organic chemistry of astatine

    International Nuclear Information System (INIS)

    Investigation on the chemical behaviour of astatine in the last decade are surveyed. The survey covers the physical and chemical properties of astatine, synthesis and identification of organic astatine compounds, their physicochemical properties. A special chapter is devoted to biomedical applications, including inorganic 211At species, 211At-labelled proteins and drugs. An extensive bibliography of the related literature is given. (N.T.) 129 refs.; 12 figs.; 14 tabs

  5. Discovery of the astatine, radon, francium, and radium isotopes

    CERN Document Server

    Fry, C

    2012-01-01

    Currently, thirty-nine astatine, thirty-nine radon, thirty-five francium, and thirty-four radium isotopes have so far been observed; the discovery of these isotopes is discussed. For each isotope a brief summary of the first refereed publication, including the production and identification method, is presented.

  6. Extraction of astatine isotopes for development of radiopharmaceuticals using a 211Rn-211At generator

    International Nuclear Information System (INIS)

    In order to utilize a 211At isotope, a promising α-emitter for radionuclide therapy, the chemical properties of astatine isotopes are studied. We have examined wet chemistry methods through the distribution ratios of astatine in liquid-liquid extraction. The astatine isotopes have been found to be well extracted into DIPE and MIBK. We observed that the distribution ratio of astatine isotopes increases with concentrations of HCl greater than 3 M, while it decreases with the HCl concentration less than 2 M. The results will be useful for development of the 211Rn-211At generator. (author)

  7. Astatine-211-Labeled Targeted Radiotherapeutics: An Update

    International Nuclear Information System (INIS)

    The heavy halogen 211At was first proposed for use in α-particle targeted radiotherapy more than 30 years ago and continues to be one of the most promising radionuclides for this purpose. Although its 7.2-h half life is not ideal for intravenously administered whole antibodies, it is compatible with the pharmacokinetics of antibody fragments, peptides, aptamers and organic molecules. Its diverse chemistry allows its incorporation into a wide array of targeting vehicles, relying on its chemical similarity to iodine to provide a useful point of departure. On the other hand, the relatively low carbon-astatine bond strength is challenging. In common with the other α-emitters being discussed at this symposium, lack of reliable availability is one of the biggest hurdles in the use of 211At for targeted radiotherapy. However, in the case of 211At, it is not a question of production cost or availability of target material, because 211At can be produced in reasonable yield from natural bismuth targets. Rather, the difficulty is the lack of cyclotrons equipped with the medium energy α-particle beams required for its production. If the infrastructure for producing 211At is to be improved to the stage where 211At-labeled radiopharmaceuticals can have a meaningful impact, several developments must occur. First, the ability to produce clinically relevant levels of 211At that can be shipped to remote locations in chemically tractable form must be demonstrated. Approaches under consideration include compensating for radiolysis-mediated effects and the consideration of alternative chemistries. Second, strategies for compensating for heterogeneities in dose deposition must be developed, hopefully in a way that is compatible with approval for human use. And third, it is essential that more clinical trials be performed with 211At-labeled therapeutics, particularly in settings of minimum residual disease where the radiobiological advantages of α-particles can be best exploited. Our

  8. Measurement of the first ionization potential of astatine by laser ionization spectroscopy

    CERN Document Server

    Rothe, S; Antalic, S; Borschevsky, A; Capponi, L; Cocolios, T E; De Witte, H; Eliav, E; Fedorov, D V; Fedosseev, V N; Fink, D A; Fritzsche, S; Ghys, L; Huyse, M; Imai, N; Kaldor, U; Kudryavtsev, Yu; Köster, U; Lane, J; Lassen, J; Liberati, V; Lynch, K M; Marsh, B A; Nishio, K; Pauwels, D; Pershina, V; Popescu, L; Procter, T J; Radulov, D; Raeder, S; Rajabali, M M; Rapisarda, E; Rossel, R E; Sandhu, K; Seliverstov, M D; Sjödin, A M; Van den Bergh, P; Van Duppen, P; Venhart, M; Wakabayashi, Y; Wendt K D A

    2013-01-01

    The radioactive element astatine exists only in trace amounts in nature. Its properties can therefore only be explored by study of smallest quantities of artificially produced isotopes or by performing theoretical calculations. One of the most important properties influencing the chemical behaviour is the energy required to remove one electron from the valence shell, referred to as the ionization potential. Here we use laser spectroscopy to probe the optical spectrum of astatine near the ionization threshold. The observed series of Rydberg states enabled the first determination of the ionization potential of the astatine atom, 9.317510(8) eV. New ab initio calculations were performed to support the experimental result. The measured value serves as a benchmark for quantum chemistry calculations of the properties of astatine as well as for the theoretical prediction of the ionization potential of super-heavy element 117, the heaviest homologue of astatine.

  9. Synthesis and Evaluation of Astatinated N-[2-(Maleimido)ethyl]-3-(trimethylstannyl)benzamide Immunoconjugates.

    Science.gov (United States)

    Aneheim, Emma; Gustafsson, Anna; Albertsson, Per; Bäck, Tom; Jensen, Holger; Palm, Stig; Svedhem, Sofia; Lindegren, Sture

    2016-03-16

    Effective treatment of metastasis is a great challenge in the treatment of different types of cancers. Targeted alpha therapy utilizes the short tissue range (50-100 μm) of α particles, making the method suitable for treatment of disseminated occult cancers in the form of microtumors or even single cancer cells. A promising radioactive nuclide for this type of therapy is astatine-211. Astatine-211 attached to tumor-specific antibodies as carrier molecules is a system currently under investigation for use in targeted alpha therapy. In the common radiolabeling procedure, astatine is coupled to the antibody arbitrarily on lysine residues. By instead coupling astatine to disulfide bridges in the antibody structure, the immunoreactivity of the antibody conjugates could possibly be increased. Here, the disulfide-based conjugation was performed using a new coupling reagent, maleimidoethyl 3-(trimethylstannyl)benzamide (MSB), and evaluated for chemical stability in vitro. The immunoconjugates were subsequently astatinated, resulting in both high radiochemical yield and high specific activity. The MSB-conjugate was shown to be stable with a long shelf life prior to the astatination. In a comparison of the in vivo distribution of the new immunoconjugate with other tin-based immunoconjugates in tumor-bearing mice, the MSB conjugation method was found to be a viable option for successful astatine labeling of different monoclonal antibodies. PMID:26791409

  10. Measurement of the first ionization potential of astatine by laser ionization spectroscopy

    OpenAIRE

    Rothe, S.; A. N. Andreyev; Antalic, S; Borschevsky, A.; Capponi, L.; Cocolios, T.E.; Witte, H.; Eliav, E.; Fedorov, D. V.; Fedosseev, V. N.; Fink, D. A.; Fritzsche, S.; Ghys, L.; Huyse, M.; Imai, N.

    2013-01-01

    The radioactive element astatine exists only in trace amounts in nature. Its properties can therefore only be explored by study of the minute quantities of artificially produced isotopes or by performing theoretical calculations. One of the most important properties influencing the chemical behaviour is the energy required to remove one electron from the valence shell, referred to as the ionization potential. Here we use laser spectroscopy to probe the optical spectrum of astatine near the io...

  11. Automated astatination of biomolecules - a stepping stone towards multicenter clinical trials

    DEFF Research Database (Denmark)

    Aneheim, Emma; Albertsson, Per; Bäck, Tom;

    2015-01-01

    To facilitate multicentre clinical studies on targeted alpha therapy, it is necessary to develop an automated, on-site procedure for conjugating rare, short-lived, alpha-emitting radionuclides to biomolecules. Astatine-211 is one of the few alpha-emitting nuclides with appropriate chemical...... and physical properties for use in targeted therapies for cancer. Due to the very short range of the emitted α-particles, this therapy is particularly suited to treating occult, disseminated cancers. Astatine is not intrinsically tumour-specific; therefore, it requires an appropriate tumour-specific targeting...... vector, which can guide the radiation to the cancer cells. Consequently, an appropriate method is required for coupling the nuclide to the vector. To increase the availability of astatine-211 radiopharmaceuticals for targeted alpha therapy, their production should be automated. Here, we present a method...

  12. Study of Astatine (III) reactions with O, S and N ligands in solution

    International Nuclear Information System (INIS)

    Full text of publication follows. Astatine (At, Z=85: [Xe]4f145d106s26p5) belongs to the halogen group and is located below iodine in the periodic table. One of its isotopes (211At) appears promising as a therapeutic agent in nuclear medicine (Ref.1) owing to the energy of the alpha particles emitted during the disintegration of its nucleus and its short physical half-life (7.2 h). Since there are no stable isotopes of astatine, the chemistry of this element remains poorly understood. Generally, At is supposed to behave as a halogen (Ref.2) but it has been shown recently in our group that astatine presents a metallic behaviour in aqueous solution: it notably exists as At+ and AtO+ species under the oxidation states +I and +III (Ref.3). At the present time, the number of studies dealing with the complexation properties of the cationic forms of astatine remains limited (Ref.4), owing to its low availability. In this work, we have investigated the reactions of AtO+ species with different hetero-atomic (N, S, O) model ligands. A combined approach based on experimental and theoretical studies has been used (Ref.5). On account of the difficulties of experimental investigations of astatine species, the reactivity of AtO+ was explored using a competition method founded on astatine distributions between two distinct phases. Furthermore, for each AtO+/ ligand complex, the nature of the species formed and the associated thermodynamic constants were determined by computational modeling (DFT calculations). In this framework, an original computational methodology was developed to take into account the specificities of astatine, notably the associated relativistic effects. The computed equilibrium constants have been confronted with the experimental results. This comparison demonstrates an outstanding coherence between experience and theory. Furthermore, the analysis of the results shows a key role of solvent effects on astatine chemistry. Lastly, a specific reactivity for the

  13. Some aspects of the organic, biological and inorganic chemistry of astatine

    International Nuclear Information System (INIS)

    Astatine has no stable isotopes and the radioactive isotopes with half-lives sufficiently long for chemical experiments (209At, 210At, 211At) must be produced artificially with a cyclotron or with a high energy accelerator by spallation of Th. This thesis deals with the synthesis and chemistry of At-compounds and the determination of some of their properties. (C.F.)

  14. Astatine-211 Pathway from Radiochemistry to Clinical Investigation

    International Nuclear Information System (INIS)

    Particularly in clinical settings where tumour burden is low and cancers are located in close proximity to essential normal tissue structures, α-particle emitting radionuclides can offer significant advantages for targeted radionuclide therapy. One of the first alpha emitters to be evaluated for this purpose is the 7.2-h half-life radiohalogen Astatine-211 (211At). From a commercialization-potential perspective 211At, is less appealing than the longer half-life alpha particle emitters Radium-223, Actinium-225 and Thorium-227, which have become the focus of many laboratories. However, if methods for providing a better supply of 211At could be developed, this alpha emitter would be the radionuclide of choice for many potential therapeutic applications. With regard to the production of 211At, this can be readily be accomplished by bombarding natural bismuth targets with 28−29.5 MeV alpha particles via the 209Bi(α,2n)211At reaction. The goal is to utilize an alpha particle beam energy that provides the required balance for maximizing 211At production while minimizing creation of 210At, which is problematic because of its 138.4-day half life alpha-particle emitting daughter, 210Po. For most intended clinical applications, alpha particle beam energy of about 29 MeV offers the best compromise between maximizing yield and providing 211At with sufficient radionuclidic purity for clinical use. Clinically relevant levels of 211At have been produced at several institutions using both internal and external cyclotron targets

  15. 32 CFR 196.310 - Recruitment.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Recruitment. 196.310 Section 196.310 National... Discrimination on the Basis of Sex in Admission and Recruitment Prohibited § 196.310 Recruitment. (a) Nondiscriminatory recruitment. A recipient to which §§ 196.300 through 196.310 apply shall not discriminate on...

  16. An attempt to explore the production routes of Astatine radionuclides: Theoretical approach

    OpenAIRE

    Maiti, Moumita; Lahiri, Susanta

    2008-01-01

    In order to fulfil the recent thrust of Astatine radionuclides in the field of nuclear medicine various production routes have been explored in the present work. The possible production routes of $^{209-211}$At comprise both light and heavy ion induced reactions at the bombarding energy range starting from threshold to maximum 100 MeV energy. For this purpose, we have used the nuclear reaction model codes TALYS, ALICE91 and PACE-II. Excitation functions of those radionuclides, produced throug...

  17. Determination of the electron affinity of astatine and polonium by laser photodetachment

    CERN Multimedia

    We propose to conduct the first electron anity (EA) measurements of the two elements astatine (At) and polonium (Po). Collinear photodetachment spectroscopy will allow us to measure these quantities with an uncertainty limited only by the spectral linewidth of the laser. We plan to use negative ion beams of the two radioactive elements At and Po, which are only accessible on-line and at ISOLDE. The feasibility of our proposed method and the functionality of the experimental setup have been demonstrated at ISOLDE in o-line tests by the clear observation of the photodetachment threshold for stable iodine. This proposal is based on our Letter of Intent I-148 [1].

  18. 46 CFR 196.15-10 - Sanitation.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Sanitation. 196.15-10 Section 196.15-10 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OCEANOGRAPHIC RESEARCH VESSELS OPERATIONS Test, Drills, and Inspections § 196.15-10 Sanitation. (a) It shall be the duty of the master and chief...

  19. 32 CFR 196.405 - Housing.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Housing. 196.405 Section 196.405 National... Discrimination on the Basis of Sex in Education Programs or Activities Prohibited § 196.405 Housing. (a... different fees or requirements, or offer different services or benefits related to housing, except...

  20. 46 CFR 196.12-1 - Posting.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Posting. 196.12-1 Section 196.12-1 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OCEANOGRAPHIC RESEARCH VESSELS OPERATIONS Stability Letter § 196.12-1 Posting. If a stability letter is issued in accordance with the requirements in § 170.120...

  1. 46 CFR 196.34-1 - Application.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Application. 196.34-1 Section 196.34-1 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OCEANOGRAPHIC RESEARCH VESSELS OPERATIONS Work Vests § 196.34-1 Application. (a) Provisions of this subpart shall apply to all...

  2. 32 CFR 196.525 - Fringe benefits.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Fringe benefits. 196.525 Section 196.525... Prohibited § 196.525 Fringe benefits. (a) “Fringe benefits” defined. For purposes of these Title IX regulations, fringe benefits means: Any medical, hospital, accident, life insurance, or retirement...

  3. 32 CFR 196.510 - Recruitment.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Recruitment. 196.510 Section 196.510 National... Recruitment. (a) Nondiscriminatory recruitment and hiring. A recipient shall not discriminate on the basis of sex in the recruitment and hiring of employees. Where a recipient has been found to be...

  4. 32 CFR 196.540 - Advertising.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Advertising. 196.540 Section 196.540 National Defense Department of Defense (Continued) OFFICE OF THE SECRETARY OF DEFENSE (CONTINUED) MISCELLANEOUS... Advertising. A recipient shall not in any advertising related to employment indicate preference,...

  5. 27 CFR 24.196 - Formula required.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Formula required. 24.196... OF THE TREASURY LIQUORS WINE Production of Special Natural Wine § 24.196 Formula required. Before producing any special natural wine, the proprietor shall receive approval of the formula by which it is...

  6. 32 CFR 196.515 - Compensation.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Compensation. 196.515 Section 196.515 National... Compensation. A recipient shall not make or enforce any policy or practice that, on the basis of sex: (a) Makes distinctions in rates of pay or other compensation; (b) Results in the payment of wages to employees of one...

  7. Dicty_cDB: VHP196 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VH (Link to library) VHP196 (Link to dictyBase) - - - - VHP196P (Link to Original site) VHP196F 619 VHP1...96Z 690 VHP196P 1289 - - Show VHP196 Library VH (Link to library) Clone ID VHP196 (Link... to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VH/VHP1...-D/VHP196Q.Seq.d/ Representative seq. ID VHP196P (Link to... Original site) Representative DNA sequence >VHP196 (VHP196Q) /CSM/VH/VHP1-D/VHP196Q.Seq.d/ TTAACTCTCGAGTGCA

  8. Dicty_cDB: CFD196 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CF (Link to library) CFD196 (Link to dictyBase) - - - Contig-U15664-1 CFD196Z (Link... to Original site) - - CFD196Z 567 - - - - Show CFD196 Library CF (Link to library) Clone ID CFD196 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/CF/CFD1-D/CFD196Q.Seq.d/ Representative seq. ID CFD19...6Z (Link to Original site) Representative DNA sequence >CFD196 (CFD196Q) /CSM/CF/CFD1-D/CFD196Q.Seq.d/ XXXXX...lenkv Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value CFD196 (CFD196Q) /CSM/CF/CFD1-D/CFD

  9. Dicty_cDB: CHS196 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH (Link to library) CHS196 (Link to dictyBase) - - - Contig-U16411-1 | Contig-U16470-1 CHS19...6P (Link to Original site) CHS196F 587 CHS196Z 845 CHS196P 1412 - - Show CHS196 Library CH (Link to library) Clone ID CHS19...411-1 | Contig-U16470-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/CH/CHS1-D/CHS19...6Q.Seq.d/ Representative seq. ID CHS196P (Link to Original site) Representative DNA sequence >CHS196 (CHS19...6Q) /CSM/CH/CHS1-D/CHS196Q.Seq.d/ CATAATAAATAATAATTAAAATTTGCATATATAAAAGAAATAAAAATTTTTTATTTTTTG

  10. Dicty_cDB: SSC196 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available SS (Link to library) SSC196 (Link to dictyBase) - - - Contig-U10839-1 | Contig-U15438-1 SSC...196P (Link to Original site) SSC196F 607 SSC196Z 604 SSC196P 1211 - - Show SSC196 Library SS (Link to library) Clone ID SSC...839-1 | Contig-U15438-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SS/SSC1-D/SSC...196Q.Seq.d/ Representative seq. ID SSC196P (Link to Original site) Representative DNA sequence >SSC196 (SSC...196Q) /CSM/SS/SSC1-D/SSC196Q.Seq.d/ ATCAAATCAAATAAAACAAAAAAAATAAACAAAAACTATATTGAATTAAATTTAATAAAT

  11. Unexpected Behavior of the Heaviest Halogen Astatine in the Nucleophilic Substitution of Aryliodonium Salts.

    Science.gov (United States)

    Guérard, François; Lee, Yong-Sok; Baidoo, Kwamena; Gestin, Jean-François; Brechbiel, Martin W

    2016-08-22

    Aryliodonium salts have become precursors of choice for the synthesis of (18) F-labeled tracers for nuclear imaging. However, little is known on the reactivity of these compounds with heavy halides, that is, radioiodide and astatide, at the radiotracer scale. In the first comparative study of radiohalogenation of aryliodonium salts with (125) I(-) and (211) At(-) , initial experiments on a model compound highlight the higher reactivity of astatide compared to iodide, which could not be anticipated from the trends previously observed within the halogen series. Kinetic studies indicate a significant difference in activation energy (Ea =23.5 and 17.1 kcal mol(-1) with (125) I(-) and (211) At(-) , respectively). Quantum chemical calculations suggest that astatination occurs via the monomeric form of an iodonium complex whereas iodination occurs via a heterodimeric iodonium intermediate. The good to excellent regioselectivity of halogenation and high yields achieved with diversely substituted aryliodonium salts indicate that this class of compounds is a promising alternative to the stannane chemistry currently used for heavy radiohalogen labeling of tracers in nuclear medicine. PMID:27305065

  12. Part I: $\\beta$-delayed fission, laser spectroscopy and shape-coexistence studies with astatine beams; Part II: Delineating the island of deformation in the light gold isotopes by means of laser spectroscopy

    CERN Document Server

    Andreyev, Andrei

    2013-01-01

    Part I: $\\beta$-delayed fission, laser spectroscopy and shape-coexistence studies with astatine beams; Part II: Delineating the island of deformation in the light gold isotopes by means of laser spectroscopy

  13. ASTATINE-211 RADIOCHEMISTRY: THE DEVELOPMENT OF METHODOLOGIES FOR HIGH ACTIVITY LEVEL RADIOSYNTHESIS

    Energy Technology Data Exchange (ETDEWEB)

    MICHAEL R. ZALUTSKY

    2012-08-08

    Targeted radionuclide therapy is emerging as a viable approach for cancer treatment because of its potential for delivering curative doses of radiation to malignant cell populations while sparing normal tissues. Alpha particles such as those emitted by 211At are particularly attractive for this purpose because of their short path length in tissue and high energy, making them highly effective in killing cancer cells. The current impact of targeted radiotherapy in the clinical domain remains limited despite the fact that in many cases, potentially useful molecular targets and labeled compounds have already been identified. Unfortunately, putting these concepts into practice has been impeded by limitations in radiochemistry methodologies. A critical problem is that the synthesis of therapeutic radiopharmaceuticals provides additional challenges in comparison to diagnostic reagents because of the need to perform radio-synthesis at high levels of radioactivity. This is particularly important for {alpha}-particle emitters such as 211At because they deposit large amounts of energy in a highly focal manner. The overall objective of this project is to develop convenient and reproducible radiochemical methodologies for the radiohalogenation of molecules with the {alpha}-particle emitter 211At at the radioactivity levels needed for clinical studies. Our goal is to address two problems in astatine radiochemistry: First, a well known characteristic of 211At chemistry is that yields for electrophilic astatination reactions decline as the time interval after radionuclide isolation from the cyclotron target increases. This is a critical problem that must be addressed if cyclotrons are to be able to efficiently supply 211At to remote users. And second, when the preparation of high levels of 211At-labeled compounds is attempted, the radiochemical yields can be considerably lower than those encountered at tracer dose. For these reasons, clinical evaluation of promising 211At

  14. 22 CFR 19.6 - Court orders and divorce decrees.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Court orders and divorce decrees. 19.6 Section 19.6 Foreign Relations DEPARTMENT OF STATE PERSONNEL BENEFITS FOR SPOUSES AND FORMER SPOUSES OF PARTICIPANTS IN THE FOREIGN SERVICE RETIREMENT AND DISABILITY SYSTEM § 19.6 Court orders and divorce decrees....

  15. 46 CFR 196.30-10 - Notice required before repair.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Notice required before repair. 196.30-10 Section 196.30... OPERATIONS Reports of Accidents, Repairs, and Unsafe Equipment § 196.30-10 Notice required before repair. (a) No repairs or alterations, except in an emergency, shall be made to any lifesaving or fire...

  16. 46 CFR 196.37-9 - Carbon dioxide alarm.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Carbon dioxide alarm. 196.37-9 Section 196.37-9 Shipping... Markings for Fire and Emergency Equipment, etc. § 196.37-9 Carbon dioxide alarm. (a) All carbon dioxide alarms shall be conspicuously identified: “WHEN ALARM SOUNDS—VACATE AT ONCE. CARBON DIOXIDE...

  17. 34 CFR 668.196 - Average rates appeals.

    Science.gov (United States)

    2010-07-01

    ... 34 Education 3 2010-07-01 2010-07-01 false Average rates appeals. 668.196 Section 668.196....196 Average rates appeals. (a) Eligibility. (1) You may appeal a notice of a loss of eligibility under... calculated as an average rate under § 668.183(d)(2). (2) You may appeal a notice of a loss of...

  18. 46 CFR 196.30-5 - Accidents to machinery.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Accidents to machinery. 196.30-5 Section 196.30-5... Reports of Accidents, Repairs, and Unsafe Equipment § 196.30-5 Accidents to machinery. (a) In the event of an accident to a boiler, unfired pressure vessel, or machinery tending to render the further use...

  19. An all-solid state laser system for the laser ion sources RILIS and in-source laser spectroscopy of astatine at ISOLDE/CERN

    Energy Technology Data Exchange (ETDEWEB)

    Rothe, Sebastian

    2012-09-24

    This doctoral thesis describes the extension of the resonance ionization laser ion source RILIS at CERN/ISOLDE by the addition of an all-solid state tunable titanium:sapphire (Ti:Sa) laser system to complement the well-established system of dye lasers. Synchronous operation of the so called Dual RILIS system of Ti:Sa and dye lasers was investigated and the potential for increased ion beam intensity, reliability, and reduced setup time has been demonstrated. In-source resonance ionization spectroscopy was performed at ISOLDE/CERN and at ISAC/TRIUMF radioactive ion beam facilities to develop an efficient and selective three-colour ionization scheme for the purely radioactive element astatine. A LabVIEW based monitoring, control and measurement system was conceived which enabled, in conjunction with Dual RILIS operation, the spectroscopy of high lying Rydberg states, from which the ionization potential of the astatine atom was determined for the first time experimentally.

  20. An all-solid state laser system for the laser ion sources RILIS and in-source laser spectroscopy of astatine at ISOLDE/CERN

    International Nuclear Information System (INIS)

    This doctoral thesis describes the extension of the resonance ionization laser ion source RILIS at CERN/ISOLDE by the addition of an all-solid state tunable titanium:sapphire (Ti:Sa) laser system to complement the well-established system of dye lasers. Synchronous operation of the so called Dual RILIS system of Ti:Sa and dye lasers was investigated and the potential for increased ion beam intensity, reliability, and reduced setup time has been demonstrated. In-source resonance ionization spectroscopy was performed at ISOLDE/CERN and at ISAC/TRIUMF radioactive ion beam facilities to develop an efficient and selective three-colour ionization scheme for the purely radioactive element astatine. A LabVIEW based monitoring, control and measurement system was conceived which enabled, in conjunction with Dual RILIS operation, the spectroscopy of high lying Rydberg states, from which the ionization potential of the astatine atom was determined for the first time experimentally.

  1. Radiobiological Effects of Alpha-Particles from Astatine-211: From DNA Damage to Cell Death

    Energy Technology Data Exchange (ETDEWEB)

    Claesson, Kristina

    2011-05-15

    In recent years, the use of high linear energy transfer (LET) radiation for radiotherapeutic applications has gained increased interest. Astatine-211 (211At) is an alpha-particle emitting radionuclide, promising for targeted radioimmunotherapy of isolated tumor cells and microscopic clusters. To improve development of safe radiotherapy using 211At it is important to increase our knowledge of the radiobiological effects in cells. During radiotherapy, both tumors and adjacent normal tissue will be irradiated and therefore, it is of importance to understand differences in the radio response between proliferating and resting cells. The aim of this thesis was to investigate effects in fibroblasts with different proliferation status after irradiation with alpha-particles from 211At or X-rays, from inflicted DNA damage, to cellular responses and biological consequences. Throughout this work, irradiation was performed with alpha-particles from 211A or X-rays. The induction and repair of double-strand breaks (DSBs) in human normal fibroblasts were investigated using pulsed-field gel electrophoresis and fragment analysis. The relative biological effectiveness (RBE) of 211At for DSB induction varied between 1.4 and 3.1. A small increase of DSBs was observed in cycling cells compared to stationary cells. The repair kinetics was slower after 211At and more residual damage was found after 24 h. Comparison between cells with different proliferation status showed that the repair was inefficient in cycling cells with more residual damage, regardless of radiation quality. Activation of cell cycle arrests was investigated using immunofluorescent labeling of the checkpoint kinase Chk2 and by measuring cell cycle distributions with flow cytometry analysis. After alpha-particle irradiation, the average number of Chk2-foci was larger and the cells had a more affected cell cycle progression for several weeks compared with X-irradiated cells, indicating a more powerful arrest after 211At

  2. β -delayed fission and α decay of 196At

    Science.gov (United States)

    Truesdale, V. L.; Andreyev, A. N.; Ghys, L.; Huyse, M.; Van Duppen, P.; Sels, S.; Andel, B.; Antalic, S.; Barzakh, A.; Capponi, L.; Cocolios, T. E.; Derkx, X.; De Witte, H.; Elseviers, J.; Fedorov, D. V.; Fedosseev, V. N.; Heßberger, F. P.; Kalaninová, Z.; Köster, U.; Lane, J. F. W.; Liberati, V.; Lynch, K. M.; Marsh, B. A.; Mitsuoka, S.; Nagame, Y.; Nishio, K.; Ota, S.; Pauwels, D.; Popescu, L.; Radulov, D.; Rapisarda, E.; Rothe, S.; Sandhu, K.; Seliverstov, M. D.; Sjödin, A. M.; Van Beveren, C.; Van den Bergh, P.; Wakabayashi, Y.

    2016-09-01

    A nuclear-decay spectroscopy study of the neutron-deficient isotope 196At is reported where an isotopically pure beam was produced using the selective Resonance Ionization Laser Ion Source and On-Line Isotope Mass Separator (CERN). The fine-structure α decay of 196At allowed the low-energy excited states in the daughter nucleus 192Bi to be investigated. A β -delayed fission study of 196At was also performed. A mixture of symmetric and asymmetric fission-fragment mass distributions of the daughter isotope 196Po (populated by β decay of 196At) was deduced based on the measured fission-fragment energies. A β DF probability Pβ DF(196At) =9 (1 ) ×10-5 was determined.

  3. 46 CFR 196.15-55 - Requirements for fuel oil.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Requirements for fuel oil. 196.15-55 Section 196.15-55... Test, Drills, and Inspections § 196.15-55 Requirements for fuel oil. (a) It shall be the duty of the chief engineer to cause an entry in the log to be made of each supply of fuel oil received on...

  4. 32 CFR 196.130 - Effect of employment opportunities.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Effect of employment opportunities. 196.130... FEDERAL FINANCIAL ASSISTANCE Introduction § 196.130 Effect of employment opportunities. The obligation to comply with these Title IX regulations is not obviated or alleviated because employment opportunities...

  5. 27 CFR 41.196 - Power of attorney.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 2 2010-04-01 2010-04-01 false Power of attorney. 41.196... PROCESSED TOBACCO Tobacco Products Importers § 41.196 Power of attorney. If the application for permit or... attorney in fact for any person, or if an individual is to otherwise officially represent such...

  6. 21 CFR 133.196 - Swiss cheese for manufacturing.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Swiss cheese for manufacturing. 133.196 Section... Standardized Cheese and Related Products § 133.196 Swiss cheese for manufacturing. Swiss cheese for manufacturing conforms to the definition and standard of identity prescribed for swiss cheese by §...

  7. Acalabrutinib (ACP-196): a selective second-generation BTK inhibitor

    OpenAIRE

    WU, JINGJING; Zhang, Mingzhi; Liu, Delong

    2016-01-01

    More and more targeted agents become available for B cell malignancies with increasing precision and potency. The first-in-class Bruton’s tyrosine kinase (BTK) inhibitor, ibrutinib, has been in clinical use for the treatment of chronic lymphocytic leukemia, mantle cell lymphoma, and Waldenstrom’s macroglobulinemia. More selective BTK inhibitors (ACP-196, ONO/GS-4059, BGB-3111, CC-292) are being explored. Acalabrutinib (ACP-196) is a novel irreversible second-generation BTK inhibitor that was ...

  8. High Performance Liquid Chromatography at -196 °C.

    Science.gov (United States)

    Motono, Tomohiro; Kitagawa, Shinya; Ohtani, Hajime

    2016-07-01

    Ultralow temperature high-performance liquid chromatography (HPLC) was developed using a liquefied gas as the mobile phase. HPLC separation of low molecular weight alkanes at -196 °C with liquid nitrogen mobile phase was successfully achieved, whereas their GC separation at -196 °C using helium gas mobile phase failed to elute the analytes due to strong adsorption. Prior to the further study of HPLC at -196 °C, the effect of column temperature on the chromatographic behavior was investigated, and it was found that the retention of analytes drastically increased when the column temperature was over the boiling point of the mobile phase. As the study of retention control in HPLC at -196 °C, the mobile phases of nitrogen and methane mixtures were investigated. The addition of methane to the nitrogen mobile phase suppressed the retention of the analytes (tetra-deuterated methane, ethane, and propane), that is, the retention on HPLC at ultralow temperature could be controlled by the mobile phase composition, akin to the typical retention in HPLC. The selectivity toward the n- and iso-alkane in HPLC at -196 °C was altered compared with that in GC separation at room temperature. A significant enhancement of retention of alkanes compared with alkanes were observed in HPLC at -196 °C. PMID:27282809

  9. Final Report for research grant "Development of Methods for High Specific Activity Labeling of Biomolecules Using Astatine-211 in Different Oxidation States"

    Energy Technology Data Exchange (ETDEWEB)

    Wilbur, D., Scott

    2011-12-14

    The overall objective of this research effort was to develop methods for labeling biomolecules with higher oxidation state species of At-211. This was to be done in an effort to develop reagents that had higher in vivo stability than the present carbon-bonded At-211-labeled compounds. We were unsuccessful in that effort, as none of the approaches studied provided reagents that were stable to in vivo deastatination. However, we gained a lot of information about At-211 in higher oxidation states. The studies proved to be very difficult as small changes in pH and other conditions appeared to change the nature of the species that obtained (by HPLC retention time analyses), with many of the species being unidentifiable. The fact that there are no stable isotopes of astatine, and the chemistry of the nearest halogen iodine is quite different, made it very difficult to interpret results of some experiments. With that said, we believe that a lot of valuable information was obtained from the studies. The research effort evaluated: (1) methods for chemical oxidation of At-211, (2) approaches to chelation of oxidized At-211, and (3) approaches to oxidation of astatophenyl compounds. A major hurdle that had to be surmounted to conduct the research was the development of HPLC conditions to separate and identify the various oxidized species formed. Attempts to develop conditions for separation of iodine and astatine species by normal and reversed-phase TLC and ITLC were not successful. However, we were successful in developing conditions (from a large number of attempts) to separate oxidized forms of iodine ([I-125]iodide, [I-125]iodate and [I-125]periodate) and astatine ([At-211]astatide, [At-211]astatate, [At-211]perastatate, and several unidentified At-211 species). Information on the basic oxidation and characterization of At-211 species is provided under Objective 1. Conditions were developed to obtain new At-211 labeling method where At-211 is chelated with the DOTA and

  10. 46 CFR 196.34-5 - Approved types of work vests.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Approved types of work vests. 196.34-5 Section 196.34-5 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OCEANOGRAPHIC RESEARCH VESSELS OPERATIONS Work Vests § 196.34-5 Approved types of work vests. (a) Each buoyant work vest carried under...

  11. 37 CFR 2.196 - Times for taking action: Expiration on Saturday, Sunday or Federal holiday.

    Science.gov (United States)

    2010-07-01

    ... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Times for taking action: Expiration on Saturday, Sunday or Federal holiday. 2.196 Section 2.196 Patents, Trademarks, and Copyrights... General Information and Correspondence in Trademark Cases § 2.196 Times for taking action: Expiration...

  12. High miR-196a levels promote the oncogenic phenotype of colorectal cancer cells

    Institute of Scientific and Technical Information of China (English)

    Carl Christoph Schimanski; Kirsten Frerichs; Fareed Rahman; Martin Berger; Hauke Lang; Peter R Galle; Markus Moehler; Ines Gockel

    2009-01-01

    AIM: To analyze the relevance of the microRNA miR- 196a for colorectal oncogenesis. METHODS: The impact of miR-196a on the restriction targets HoxA7, HoxB8, HoxC8 and HoxD8 was analyzed by reverse transcription polymerase chain reaction (RT-PCR) after transient transfection of SW480 cancer cells. The miR-196a transcription profile in colorectal cancer samples, mucosa samples and diverse cancer cell lines was quantified by RT-PCR. Transiently miR- 196a-transfected colorectal cancer cells were used for diverse functional assays in vitro and for a xenograft lung metastasis model in vivo. RESULTS: HoxA7, HoxB8, HoxC8 and HoxD8 were restricted by miR-196a in a dose-dependent and gene-specific manner. High levels of miR-196a activated the AKT signaling pathway as indicated by increased phosphorylation of AKT. In addition, high levels of miR-196a promoted cancer cell detachment, migration, invasion and chemosensitivity towards platin derivatives but did not impact on proliferation or apoptosis. Furthermore, miR-196a increased the development of lung metastases in mice after tail vein injection. CONCLUSION: miR-196a exerts a pro-oncogenic influence in colorectal cancer.

  13. 21 CFR 19.6 - Code of ethics for government service.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 1 2010-04-01 2010-04-01 false Code of ethics for government service. 19.6... STANDARDS OF CONDUCT AND CONFLICTS OF INTEREST General Provisions § 19.6 Code of ethics for government service. The following code of ethics, adopted by Congress on July 11, 1958, shall apply to all Food...

  14. Investigation of the angular structure of the quasar 3C196 radio emission

    International Nuclear Information System (INIS)

    The angular dimensions and spectral characteristics are determined for the components of the preferrable brightness distribution model of the quasar 3C196 at decameter and shorter wavelengths. The physical processes are discussed that might be responsible for the extended region of radio emission that has been detected in 3C196 at decameter wavelengths

  15. 32 CFR 196.440 - Health and insurance benefits and services.

    Science.gov (United States)

    2010-07-01

    ... Activities Prohibited § 196.440 Health and insurance benefits and services. Subject to § 196.235(d), in providing a medical, hospital, accident, or life insurance benefit, service, policy, or plan to any of its... 32 National Defense 2 2010-07-01 2010-07-01 false Health and insurance benefits and services....

  16. 46 CFR 196.30-1 - Repairs to boilers and pressure vessels.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Repairs to boilers and pressure vessels. 196.30-1... VESSELS OPERATIONS Reports of Accidents, Repairs, and Unsafe Equipment § 196.30-1 Repairs to boilers and pressure vessels. (a) Before making any repairs to boilers or unfired pressure vessels, the Chief...

  17. 46 CFR 196.35-5 - Actions required to be logged.

    Science.gov (United States)

    2010-10-01

    ... Arrangements) of this chapter. (b) Steering gear, whistle, and means of communication. Prior to departure. See § 196.15-3. (c) Drafts and load line marks. Prior to leaving port, ocean, coastwise, and Great Lakes.... See § 196.15-18. (f) Emergency lighting and power systems. Weekly and semiannually. See §...

  18. 46 CFR 196.15-15 - Examination of boilers and machinery.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Examination of boilers and machinery. 196.15-15 Section... VESSELS OPERATIONS Test, Drills, and Inspections § 196.15-15 Examination of boilers and machinery. (a) It shall be the duty of the chief engineer when he assumes charge of the boilers and machinery of a...

  19. Anisotropies in the HI gas distribution toward 3C 196

    Science.gov (United States)

    Kalberla, P. M. W.; Kerp, J.

    2016-10-01

    Context. The local Galactic Hi gas was found to contain cold neutral medium (CNM) filaments that are aligned with polarized dust emission. These filaments appear to be dominated by the magnetic field and in this case turbulence is expected to show distinct anisotropies. Aims: We use the Galactic Effelsberg-Bonn Hi Survey (EBHIS) to derive 2D turbulence spectra for the Hi distribution in direction to 3C 196 and two more comparison fields. Methods: Prior to Fourier transform we apply a rotational symmetric 50% Tukey window to apodize the data. We derive average as well as position angle dependent power spectra. Anisotropies in the power distribution are defined as the ratio of the spectral power in orthogonal directions. Results: We find strong anisotropies. For a narrow range in position angle, in direction perpendicular to the filaments and the magnetic field, the spectral power is on average more than an order of magnitude larger than parallel. In the most extreme case the anisotropy reaches locally a factor of 130. Anisotropies increase on average with spatial frequency as predicted by Goldreich & Sridhar (1995, ApJ, 438, 763), at the same time the Kolmogorov spectral index remains almost unchanged. The strongest anisotropies are observable for a narrow range in velocity and decay with a power law index close to -8/3, almost identical to the average isotropic spectral index of -2.9 Hi filaments, associated with linear polarization structures in LOFAR observations in direction to 3C 196, show turbulence spectra with marked anisotropies. Decaying anisotropies appear to indicate that we witness an ongoing shock passing the Hi and affecting the observed Faraday depth.

  20. 41 CFR 102-73.196 - What types of special purpose space may the Department of Homeland Security lease?

    Science.gov (United States)

    2010-07-01

    ... purpose space may the Department of Homeland Security lease? 102-73.196 Section 102-73.196 Public... Delegations § 102-73.196 What types of special purpose space may the Department of Homeland Security lease? The Department of Homeland Security is delegated authority to lease whatever space its...

  1. MicroRNA-196b promotes cell proliferation and suppress cell differentiation in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Cao, Donglin, E-mail: caodlgz@sina.com; Hu, Liangshan; Lei, Da; Fang, Xiaolin; Zhang, Zhihong; Wang, Ting; Lin, Maorui; Huang, Jiwei; Yang, Huawen; Zhou, Xuan; Zhong, Limei

    2015-01-30

    Highlights: • miRNA-196b increases proliferation and blocks differentiation of progenitor cell. • miRNA-196b inhibits apoptosis and increases viability of cells lines. • Forced expression of miR-196b blocks the differentiation of THP1 induced by PMA. - Abstract: MicroRNA-196b (miR-196b) is frequently amplified and aberrantly overexpressed in acute leukemias. To investigate the role of miR-196b in acute leukemias, it has been observed that forced expression of this miRNA increases proliferation and inhibits apoptosis in human cell lines. More importantly, we show that this miRNA can significantly increase the colony-forming capacity of mouse normal bone marrow progenitor cells alone, as well as partially blocking the cells from differentiation. Taken together, our studies suggest that miRNA-196b may play an essential role in the development of MLL-associated leukemias through inhibiting cell differentiation and apoptosis, while promoting cell proliferation.

  2. Anisotropies in the HI gas distribution toward 3C196

    CERN Document Server

    Kalberla, P M W

    2016-01-01

    The local Galactic HI gas was found to contain cold neutral medium (CNM) filaments that are aligned with polarized dust emission. These filaments appear to be dominated by the magnetic field and in this case turbulence is expected to show distinct anisotropies. We use the Galactic Effelsberg--Bonn HI Survey (EBHIS) to derive 2D turbulence spectra for the HI distribution in direction to 3C196 and two more comparison fields. Prior to Fourier transform we apply a rotational symmetric 50% Tukey window to apodize the data. We derive average as well as position angle dependent power spectra. Anisotropies in the power distribution are defined as the ratio of the spectral power in orthogonal directions. We find strong anisotropies. For a narrow range in position angle, in direction perpendicular to the filaments and the magnetic field, the spectral power is on average more than an order of magnitude larger than parallel. In the most extreme case the anisotropy reaches locally a factor of 130. Anisotropies increase on...

  3. Specific immunotherapy generates CD8(+) CD196(+) T cells to suppress lung cancer growth in mice.

    Science.gov (United States)

    Zhang, Jian; Liu, Jing; Chen, Huiguo; Wu, Weibin; Li, Xiaojun; Wu, Yonghui; Wang, Zhigang; Zhang, Kai; Li, Yun; Weng, Yimin; Liao, Hongying; Gu, Lijia

    2016-08-01

    That specific immunotherapy can inhibit cancer growth has been recognized; its efficiency is to be improved. This study aimed to inhibit lung cancer (LC) growth in a mouse model by using an LC-specific vaccination. In this study, a LC mouse model was created by adoptive transplantation with LC cells. The tumor-bearing mice were vaccinated with LC cell extracts plus adjuvant TNBS or adoptive transplantation with specific CD8(+) CD196(+) T cells. The results showed that the vaccination with LC extracts (LCE)/TNBS markedly inhibited the LC growth and induced CD8(+) CD196(+) T cells in LC tissue and the spleen. These CD8(+) CD196(+) T cells proliferated and produce high levels of perforin upon exposure to LCE and specifically induced LC cell apoptosis. Exposure to TNBS induced RAW264.7 cells to produce macrophage inflammatory protein-3α; the latter activated signal transducer and activator of transcription 3 and further induced perforin expression in the CD8(+) CD196(+) T cells. Adoptive transfer with specific CD8(+) CD196(+) T cells suppressed LC growth in mice. In conclusion, immunization with LC extracts and TNBS can induce LC-specific CD8(+) CD196(+) T cells in LC-bearing mice and inhibit LC growth. PMID:26910585

  4. ELISA-Based Detection System for Protein S K196E Mutation, a Genetic Risk Factor for Venous Thromboembolism.

    Directory of Open Access Journals (Sweden)

    Keiko Maruyama

    Full Text Available Protein S (PS acts as a cofactor for activated protein C in the plasma anticoagulant system. PS Lys196-to-Glu (K196E mutation is a genetic risk factor for venous thromboembolism in Japanese individuals. Because of the substantial overlap in PS anticoagulant activity between KK (wild-type and KE (heterozygous genotypes, it is difficult to identify PS K196E carriers by measuring PS activity. Here, we generated monoclonal antibodies specific to the PS K196E mutant and developed a simple and reliable method for the identification of PS K196E carriers. We immunized mice with a keyhole limpet hemocyanin-conjugated synthetic peptide with Glu196. The hybridoma cells were screened for the binding ability of the produced antibodies to recombinant mutant EGF-like domains of PS (Ile117-Glu283. We obtained three hybridoma cell lines producing PS K196E mutation-specific antibodies. We established a sandwich enzyme-linked immunosorbent assay (ELISA system in which the PS K196E mutation-specific monoclonal antibody was used as a detection antibody. We measured human plasma samples by using this system and successfully discriminated 11 individuals with the KE genotype from 122 individuals with the KK genotype. The ELISA system using the PS K196E mutation-specific antibody is a useful tool for the rapid identification of PS K196E carriers, who are at a higher risk for venous thromboembolism.

  5. miR-196a targets netrin 4 and regulates cell proliferation and migration of cervical cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Jie [Department of Pathology, Liaocheng People’s Hospital, Liaocheng 252000 (China); Zheng, Fangxia [Department of Radiotherapy, Liaocheng People’s Hospital, Liaocheng 252000 (China); Yu, Gang [Department for Disease Control, Tumor Hospital of Liaocheng, Liaocheng 252000 (China); Yin, Yanhua, E-mail: yinyanhuablk@163.com [Department of Pathology, Liaocheng People’s Hospital, Liaocheng 252000 (China); Lu, Qingyang [Department of Pathology, Liaocheng People’s Hospital, Liaocheng 252000 (China)

    2013-11-01

    Highlights: •miR-196a was overexpressed in cervical cancer tissue compared to normal tissue. •miR-196a expression elevated proliferation and migration of cervical cancer cells. •miR-196a inhibited NTN4 expression by binding 3′-UTR region of NTN4 mRNA. •NTN4 inversely correlated with miR-196a expression in cervical tissue and cell line. •NTN4 expression was low in cervical cancer tissue compared to normal tissue. -- Abstract: Recent research has uncovered tumor-suppressive and oncogenic potential of miR-196a in various tumors. However, the expression and mechanism of its function in cervical cancer remains unclear. In this study, we assess relative expression of miR-196a in cervical premalignant lesions, cervical cancer tissues, and four cancer cell lines using quantitative real-time PCR. CaSki and HeLa cells were treated with miR-196a inhibitors, mimics, or pCDNA/miR-196a to investigate the role of miR-196a in cancer cell proliferation and migration. We demonstrated that miR-196a was overexpressed in cervical intraepithelial neoplasia 2–3 and cervical cancer tissue. Moreover, its expression contributes to the proliferation and migration of cervical cancer cells, whereas inhibiting its expression led to a reduction in proliferation and migration. Five candidate targets of miR-196a chosen by computational prediction and Cervical Cancer Gene Database search were measured for their mRNA in both miR-196a-overexpressing and -depleted cancer cells. Only netrin 4 (NTN4) expression displayed an inverse association with miR-196a. Fluorescent reporter assays revealed that miR-196a inhibited NTN4 expression by targeting one binding site in the 3′-untranslated region (3′-UTR) of NTN4 mRNA. Furthermore, qPCR and Western blot assays verified NTN4 expression was downregulated in cervical cancer tissues compared to normal controls, and in vivo mRNA level of NTN4 inversely correlated with miR-196a expression. In summary, our findings provide new insights about the

  6. MicroRNA-196a promotes non-small cell lung cancer cell proliferation and invasion through targeting HOXA5

    International Nuclear Information System (INIS)

    MicroRNAs (miRNAs) are short, non-coding RNAs (~22 nt) that play important roles in the pathogenesis of human diseases by negatively regulating gene expression. Although miR-196a has been implicated in several other cancers, its role in non-small cell lung cancer (NSCLC) is unknown. The aim of the present study was to examine the expression pattern of miR-196a in NSCLC and its clinical significance, as well as its biological role in tumor progression. Expression of miR-196a was analyzed in 34 NSCLC tissues and five NSCLC cell lines by quantitative reverse-transcription polymerase chain reaction (qRT-PCR). The effect of DNA methylation on miR-196a expression was investigated by 5-aza-2-deoxy-cytidine treatment and bisulfite sequencing. The effect of miR-196a on proliferation was evaluated by MTT and colony formation assays, and cell migration and invasion were evaluated by transwell assays. Analysis of target protein expression was determined by western blotting. Luciferase reporter plasmids were constructed to confirm the action of miR-196a on downstream target genes, including HOXA5. Differences between the results were tested for significance using Student’s t-test (two-tailed). miR-196a was highly expressed both in NSCLC samples and cell lines compared with their corresponding normal counterparts, and the expression of miR-196a may be affected by DNA demethylation. Higher expression of miR-196a in NSCLC tissues was associated with a higher clinical stage, and also correlated with NSCLC lymph-node metastasis. In vitro functional assays demonstrated that modulation of miR-196a expression affected NSCLC cell proliferation, migration and invasion. Our analysis showed that miR-196a suppressed the expression of HOXA5 both at the mRNA and protein levels, and luciferase assays confirmed that miR-196a directly bound to the 3’untranslated region of HOXA5. Knockdown of HOXA5 expression in A549 cells using RNAi was shown to promote NSCLC cell proliferation, migration

  7. 46 CFR 196.15-3 - Steering gear, whistle, and means of communication.

    Science.gov (United States)

    2010-10-01

    ... RESEARCH VESSELS OPERATIONS Test, Drills, and Inspections § 196.15-3 Steering gear, whistle, and means of communication. (a) On all vessels making a voyage of more than 48 hours duration, the entire steering gear, the whistle, and the means of communication between the bridge or pilothouse and engineroom shall be...

  8. 46 CFR 196.37-33 - Instructions for changing steering gear.

    Science.gov (United States)

    2010-10-01

    ... VESSELS OPERATIONS Markings for Fire and Emergency Equipment, etc. § 196.37-33 Instructions for changing... engineroom, relating in order, the different steps to be taken in changing to the emergency steering gear... which is to be “opened” or “closed” in shifting to any means of steering for which the vessel...

  9. 32 CFR 196.210 - Military and merchant marine educational institutions.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Military and merchant marine educational... OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Coverage § 196.210 Military and merchant marine... purpose is the training of individuals for a military service of the United States or for the...

  10. 75 FR 64248 - Approval for Manufacturing Authority Foreign-Trade Zone 196 ATC Logistics & Electronics (Cell...

    Science.gov (United States)

    2010-10-19

    ...); Whereas, notice inviting public comment has been given in the Federal Register (75 FR 17691, 4/7/2010) and... & Electronics (Cell Phone Kitting) Fort Worth, TX Pursuant to its authority under the Foreign-Trade Zones Act of... following Order: Whereas, ATC Logistics & Electronics (ATCLE), an operator of Foreign-Trade Zone 196,...

  11. 33 CFR 110.196 - Sabine Pass Channel, Sabine Pass, Tex.

    Science.gov (United States)

    2010-07-01

    ... SECURITY ANCHORAGES ANCHORAGE REGULATIONS Anchorage Grounds § 110.196 Sabine Pass Channel, Sabine Pass, Tex...) The regulations. (1) The anchorage area is for the temporary use of vessels of all types, but... paragraph (b)(3) of this section. (6) Fixed moorings, piles or stakes, and floats or buoys for...

  12. 46 CFR 196.45-1 - Master and chief engineer responsible.

    Science.gov (United States)

    2010-10-01

    ... VESSELS OPERATIONS Carrying of Excess Steam § 196.45-1 Master and chief engineer responsible. (a) It shall be the duty of the master and the engineer in charge of the boilers of any vessel to require that a steam pressure is not carried in excess of that allowed by the certificate of inspection and to...

  13. 32 CFR 196.425 - Counseling and use of appraisal and counseling materials.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Counseling and use of appraisal and counseling... Programs or Activities Prohibited § 196.425 Counseling and use of appraisal and counseling materials. (a) Counseling. A recipient shall not discriminate against any person on the basis of sex in the counseling...

  14. 基于FPGA的HMAC_SHA1_96 算法设计与实现%Implementation of HMAC_SHA1_96 Based on FPGA

    Institute of Scientific and Technical Information of China (English)

    丁黄胜; 陆生礼; 田渊; 吴旭凡

    2003-01-01

    在简要介绍安全散列函数SHA1和HMAC_SHA1_96算法体系的基础上,结合FPGA芯片(Altera的APEX20KE系列)的特点,进行信息安全加密验证算法的硬件系统优化设计和验证.本文讨论了该优化设计的步骤和方法,给出了较好的验证结果.

  15. MicroRNA-196b regulates the homeobox B7-vascular endothelial growth factor axis in cervical cancer.

    Directory of Open Access Journals (Sweden)

    Christine How

    Full Text Available The down-regulation of microRNA-196b (miR-196b has been reported, but its contribution to cervical cancer progression remains to be investigated. In this study, we first demonstrated that miR-196b down-regulation was significantly associated with worse disease-free survival (DFS for cervical cancer patients treated with combined chemo-radiation. Secondly, using a tri-modal approach for target identification, we determined that homeobox-B7 (HOXB7 was a bona fide target for miR-196b, and in turn, vascular endothelial growth factor (VEGF was a downstream transcript regulated by HOXB7. Reconstitution of miR-196b expression by transient transfection resulted in reduced cell growth, clonogenicity, migration and invasion in vitro, as well as reduced tumor angiogenesis and tumor cell proliferation in vivo. Concordantly, siRNA knockdown of HOXB7 or VEGF phenocopied the biological effects of miR-196b over-expression. Our findings have demonstrated that the miR-196b/HOXB7/VEGF pathway plays an important role in cervical cancer progression; hence targeting this pathway could be a promising therapeutic strategy for the future management of this disease.

  16. Angular structure of radio emission from the quasar 3C196

    International Nuclear Information System (INIS)

    The authors analyze measurements of the angular structure of the radio emission from the quasar 3C196 at frequencies from 38 to 5000 MHz. We show that over this entire range, the quasar consists of compact features with individual dimensions less than 3.1'', and it contains no extended components with flux greater than 5-10% of the overall emission from the source

  17. Angular structure of radio emission from the quasar 3C196

    Energy Technology Data Exchange (ETDEWEB)

    Men' , A.V.; Braude, S.Ya.; Sharykin, N.K.; Shepelev, V.A.

    1987-10-01

    The authors analyze measurements of the angular structure of the radio emission from the quasar 3C196 at frequencies from 38 to 5000 MHz. We show that over this entire range, the quasar consists of compact features with individual dimensions less than 3.1'', and it contains no extended components with flux greater than 5-10% of the overall emission from the source.

  18. Beauty production cross section measurements at E(cm) = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    D' Onofrio, Monica; /Geneva U.

    2005-05-01

    The RunII physics program at the Tevatron started in spring 2001 with protons and antiprotons colliding at an energy of {radical}s = 1.96 TeV, and it is carrying on with more than 500 pb{sup -1} of data as collected by both the CDF and D0 experiments. Recent results on beauty production cross section measurements are here reported.

  19. Porting for Using MicroC/OS-Ⅱ with 80C196%MicroC/OS-Ⅱ在80C196上的移植实现

    Institute of Scientific and Technical Information of China (English)

    吴永; 张旭东; 赵自信

    2006-01-01

    在嵌入式系统中使用实时操作系统,可以提高系统的稳定性、可靠性和实时性.MicroC/OS-Ⅱ是一个完整的,可移植、可固化、可剪裁的抢占式多任务实时内核,并且开放源代码,得到了广泛应用.本文结合具体应用,介绍了MicroC/0S-Ⅱ在80C196上移植实现过程和注意事项.

  20. Clinical analysis of 196 infectious keratitis in Jingzhou Region%感染性角膜炎196例临床分析

    Institute of Scientific and Technical Information of China (English)

    伍志琴; 刘剑平; 聂尚武; 王晓琴

    2013-01-01

    目的 分析196例感染性角膜炎住院患者的发病特点及疾病转归,为地区性角膜病的防盲治盲工作提供参考依据.方法 对2010年1月至2012年12月在荆州市中心医院眼科符合人选标准的196例感染性角膜炎患者的临床资料、发病特点、致病因素、实验室检查结果、治疗效果等进行回顾性分析.结果 196例(198只眼)感染性角膜炎中,男性118例120只眼,女性78例78只眼.发病平均年龄58.6岁,主要集中于41~60岁.主要致病因素为角膜外伤、继发眼表感染、角膜接触镜的配戴、皮质类固醇的使用以及继发手术感染.根据临床表现及实验室检查结果,诊断为真菌性角膜炎128例128只眼(65.3%),居感染的首位,病毒性角膜炎47例49只眼(24.0%),细菌性角膜炎患者21例21只眼(10.7%).在真菌性角膜炎中,角膜刮片直接镜检法的诊断阳性率为67.2%.123例培养结果中,46例呈阳性,其中细菌8例,真菌38例.患者从发病至来院就诊时间为1~90 d,平均(32±7.4)d.60例患者接受手术治疗,其中24例行病灶清创联合球结膜遮盖术,12例行病灶清创联合羊膜移植及结膜瓣遮盖,8例转上级医院行角膜移植术,最终行眼内容物剜除16例,包括3例羊膜移植手术失败者.结论 真菌性角膜炎是感染性角膜炎住院患者的主要病因,其次为病毒性.近年来,真菌性角膜炎发病率呈明显上升趋势,药物治疗无效时,行病灶清创联合羊膜移植和(或)球结膜遮盖可以有效降低患者视力丧失,挽救眼球,值得推广.%Objective To investigate the general features,epidemiology and sequelae of 196 infectious keratitis in Jingzhou Region,and to provide proper evidences for blindness prevention.Methods Retrospective review of the general features,predisposing factors,laboratory examination and treatment effectiveness were collected and analyzed in 196 patients with confirmed infectious keratitis in our hospital from

  1. Liquid Nitrogen (-196°C effect under pollen of some cultured or ornamental species

    Directory of Open Access Journals (Sweden)

    Sabina GLIGOR

    2006-05-01

    Full Text Available The criopreservation involve the stock of the vegetal material at low temperatures (-196°C in liquid nitrogen, in thermal conditions in which the division of cells and metabolic processes slow down, thus that the samplings may be conserved for long periods without suffering any genetic modifications. This stock technique is applied till present only on 80 vegetal species, keeping their seeds and vitrocultures preponderantly; researches were made regarding the maintenance of pollen in liquid nitrogen.The mature pollen, able to resist a higher degree of desiccation, may be conserved at low temperatures, without criopreservation. It was made researches on criopreservation of rise, maize, wheat, roses, sun flower and soy pollen. Our study purpose was to follow the impact of liquid nitrogen (-196°C about on viability of some cultured and ornamental species. The designed time of criopreservation it was 30 minutes and 7 days, using the TTC (tripheniltetrazole chloride method which allows testing the viability of vegetal material based on dehydrogenase activity.It was observed at Petunia hybrida species, that the pollen viability was low - in relevance with the witness represented from the pollen which was not resigned to the nitrogen liquid treatment - between percentage limits of 3.5-8%, in the case when the vegetal material was submersed 30 minutes in liquid nitrogen and 7.5-14.5% 7 days at (-196°C. The submersing of Nicotiana alata var. grandiflora species at 7 days, determined a low viability with 11.53%. The following two studied species Cucurbita and Hosta were proved to be the most resistant at submersing and maintenance in liquid nitrogen. The most affected pollen was Campsis radicans species. At Datura stramonium species was observed 2.59% a low viability of pollen, after 30 minutes of liquid nitrogen treatment, was 19.56%, after 7 days of submersing, the most pollen granules losing completely their viability.

  2. Observation of double pygmy resonances in $^{195,196}$Pt and enhanced astrophysical reaction rates

    CERN Document Server

    Giacoppo, F; Eriksen, T K; Görgen, A; Guttormsen, M; Hagen, T W; Larsen, A C; Kheswa, B V; Klintefjord, M; Koehler, P E; Nyhus, H T; Renstr\\om, T; Sahin, E; Siem, S; Tornyi, T G

    2014-01-01

    Our measurements of $^{195,196}$Pt $\\gamma$-strength functions show a double-humped enhancement in the $E_{\\gamma}= 4-8$ MeV region. For the first time, the detailed shape of these resonances is revealed for excitation energies in the quasicontinuum. We demonstrate that the corresponding neutron-capture cross sections and astrophysical reaction rates are increased by up to a factor of 2 when these newly observed pygmy resonances are included. These results lend credence to theoretical predictions of enhanced reaction rates due to such pygmy resonances and hence are important for a better understanding of r-process nucleosynthesis.

  3. Probing the O(6) character of {sup 196}Pt with inelastic electron scattering

    Energy Technology Data Exchange (ETDEWEB)

    Aslanidou, Simela; Krugmann, Andreas; Neumann-Cosel, Peter von; Pietralla, Norbert [Institut fuer Kernphysik, Technische Universitaet Darmstadt (Germany)

    2014-07-01

    The Interacting-Boson-Model provides an elegant tool to classify low lying collective states in medium and heavy mass even-even nuclei. One of its dynamical symmetries is O(6) and a crucial test of this theory is to investigate the monopole transitions to the band head of the K=0,σ=N-2 band. A powerful tool to investigate monopole transitions is inelastic electron scattering. An experiment on {sup 196}Pt -claimed to be a perfect O(6) nucleus- has recently been performed at the superconducting electron linear accelerator S-DALINAC at Darmstadt using the high resolution LINTOTT spectrometer. The experiment and preliminary results will be presented.

  4. Roman Policies towards Antiochus III and the Greeks from Winter 197/196 B.C. to Autumn 196 B.C.

    Directory of Open Access Journals (Sweden)

    Deutschmann, Eike Hellmut

    2012-01-01

    Full Text Available In the Second Macedonian War (200-196 B.C., the res publica reduced the strength of the enemy King Philip V apparently to establish a new political order in Southern Balkans: Assumedly a pro-Roman balance of forces should prevail there, untainted by influence of another major power. A particular senatorial policy towards the Greeks probably did not exist before the fighting in Hellas came to an end in summer 197 B.C. In the same year, the Seleucid king Antiochus III brought large parts of the west coast of Asia Minor under control and set about crossing the Hellespont. Rome subsequently stylized itself as the guardian of freedom for the Greeks living in Hellas and Asia Minor. The statesmen of the res publica could have perceived Antiochus’ expansion as a threat to the mentioned new order. Therefore, the Roman Policy of Freedom was possibly applied primarily to take action against the Seleucid king. Die res publica verminderte im Zweiten Makedonischen Krieg (200-196 a.c. die Macht des gegnerischen Königs Philipp V - anscheinend um eine neue politische Ordnung im südlichen Balkanraum zu etablieren: Vermutlich sollte dort ein romfreundliches Kräftegleichgewicht vorherrschen, auf das keine andere Großmacht Einfluß hat. Eine speziell an die Griechen gerichtete Politik seitens des römischen Senats gab es wahrscheinlich nicht vor Ende der Kampfhandlungen in Hellas im Sommer 197 a.c. In dem Jahr erweiterte der seleukidische König Antiochos III. seinen Einflussbereich auf große Teile der kleinasiatischen Westküste und schickte sich an, den Hellespont zu überqueren. Rom stilisierte sich in der Folgezeit zum Freiheitsgarant der in Hellas und Kleinasien lebenden Griechen. Antiochos Expansion könnte von den Staatsmännern der res publica als Bedrohung der genannten neuen Ordnung angesehen worden sein. Demzufolge wurde die römische Freiheitspolitik möglicherweise in erster Linie angewendet, um gegen den seleukidischen König vorzugehen.

  5. 21 centimeter HI absorption at z = 0.437 against the extended radio structure of 3c 196

    International Nuclear Information System (INIS)

    We report the detection of an absorption line at 988.7. MHz toward the quasar 3C 196. We identify this line as the lambda21 cm line of neutral atomic hydrogen seen at a redshift of z/sub abs/ = 0.4366. No optical absorption lines have been noted in the z/sub em/ = 0.871 quasar 3C 196 heretofore. All the radio emission of 3C 196 is contained in two thetaroughly-equal3'' extended lobes symmetrically placed (position angle approx.260) about the optical object. The optical QSO itself is an extremely weak, 0, that is in a direction perpendicular to the separation of the radio lobes. If this wisp is the disk of an intervening galaxy, then the H i absorption is direct evidence for absorption in a galactic halo. Puzzles abound; (1) If the optical wisp seen superposed on the QSO is an intervening galaxy then what aspects, if any, of the emission from 3C 196 are gravitational lens effects. (2) If the wisp is associated with the QSO, why is it radio quiet and why is it orthogonal to the extended radio structure of 3C 196. (3) Is it significant that z/sub abs/ is one-half z/sub em/ within the errors

  6. miR-196a Ameliorates Cytotoxicity and Cellular Phenotype in Transgenic Huntington's Disease Monkey Neural Cells.

    Science.gov (United States)

    Kunkanjanawan, Tanut; Carter, Richard L; Prucha, Melinda S; Yang, Jinjing; Parnpai, Rangsun; Chan, Anthony W S

    2016-01-01

    Huntington's disease (HD) is an inherited neurodegenerative disorder caused by the expansion of polyglutamine (polyQ) tract that leads to motor, cognitive and psychiatric impairment. Currently there is no cure for HD. A transgenic HD nonhuman primate (HD-NHP) model was developed with progressive development of clinical and pathological features similar to human HD, which suggested the potential preclinical application of the HD-NHP model. Elevated expression of miR-196a was observed in both HD-NHP and human HD brains. Cytotoxicity and apoptosis were ameliorated by the overexpression of miR-196a in HD-NHP neural progenitor cells (HD-NPCs) and differentiated neural cells (HD-NCs). The expression of apoptosis related gene was also down regulated. Mitochondrial morphology and activity were improved as indicated by mitotracker staining and the upregulation of CBP and PGC-1α in HD-NPCs overexpressing miR-196a. Here we demonstrated the amelioration of HD cellular phenotypes in HD-NPCs and HD-NCs overexpressing miR-196a. Our results also suggested the regulatory role of miR-196a in HD pathogenesis that may hold the key for understanding molecular regulation in HD and developing novel therapeutics. PMID:27631085

  7. miR-196a Ameliorates Cytotoxicity and Cellular Phenotype in Transgenic Huntington’s Disease Monkey Neural Cells

    Science.gov (United States)

    Carter, Richard L.; Prucha, Melinda S.; Yang, Jinjing; Parnpai, Rangsun; Chan, Anthony W. S.

    2016-01-01

    Huntington’s disease (HD) is an inherited neurodegenerative disorder caused by the expansion of polyglutamine (polyQ) tract that leads to motor, cognitive and psychiatric impairment. Currently there is no cure for HD. A transgenic HD nonhuman primate (HD-NHP) model was developed with progressive development of clinical and pathological features similar to human HD, which suggested the potential preclinical application of the HD-NHP model. Elevated expression of miR-196a was observed in both HD-NHP and human HD brains. Cytotoxicity and apoptosis were ameliorated by the overexpression of miR-196a in HD-NHP neural progenitor cells (HD-NPCs) and differentiated neural cells (HD-NCs). The expression of apoptosis related gene was also down regulated. Mitochondrial morphology and activity were improved as indicated by mitotracker staining and the upregulation of CBP and PGC-1α in HD-NPCs overexpressing miR-196a. Here we demonstrated the amelioration of HD cellular phenotypes in HD-NPCs and HD-NCs overexpressing miR-196a. Our results also suggested the regulatory role of miR-196a in HD pathogenesis that may hold the key for understanding molecular regulation in HD and developing novel therapeutics. PMID:27631085

  8. 80C196KC单片机在层流流量计数字式仪表开发中的应用%The Application of 80C196KC Micro -controller In Developing a Digital Laminar Flow Meter

    Institute of Scientific and Technical Information of China (English)

    李过房

    2012-01-01

    In this paper, using 80C196KC micro - controller, a digital laminar flow meter is de- signed. Practice has proved that compared with the MCS -51 micro -controller,the 80C196KC mi- cro- controller can greatly improve the efficiency of the development processes. And, at the same time, it can ensure the running speed of the digital meters developed.%本文通过实例,介绍了80C196KC单片机在层流流量计数字式仪表开发中的应用方法,实践证明,与传统的MCS-51单片机比,它可大大提高数字式仪表的开发效率,同时,保证所开发的数字式仪表的运行速度。

  9. 196例HIV/AIDS感染者配偶HIV抗体检测分析

    Institute of Scientific and Technical Information of China (English)

    朱荣华; 向信春

    2010-01-01

    目的:了解HIV感染者配偶HIV的感染情况,为防治艾滋病提供科学依据.方法:收集隆阳区自1990-2009年9月并在随访状态下已婚HIV/AIDS患者基本信息,统计分析HIV感染者配偶情况.结果:在统计分析的196例HIV/AIDS患者中,配偶检测HIV抗体阳性102例,HIV抗体阳性率为52.04%(102/196);其中男性HIV/AIDS患者其配偶HIV抗体阳性率为44.74%(51/114),女性HIV/AIDS患者其配偶HIV抗体阳性率为62.20%(51/82);男女HIV/AIDS患者其配偶HIV抗体阳性率之间的差异有统计学意义(X2=5.82,P<.05).结论:对HIV/AIDS患者的配偶告知并进行HIV抗体检测,采取保护性的措施,具有重要意义.

  10. VERITAS and Multiwavelength Observations of the BL Lacertae Object 1ES 1741+196

    CERN Document Server

    Abeysekara, A U; Archer, A; Benbow, W; Bird, R; Biteau, J; Buchovecky, M; Buckley, J H; Bugaev, V; Byrum, K; Cardenzana, J V; Cerruti, M; Chen, X; Christiansen, J L; Ciupik, L; Connolly, M P; Cui, W; Dickinson, H J; Dumm, J; Eisch, J D; Errando, M; Falcone, A; Feng, Q; Finley, J P; Fleischhack, H; Flinders, A; Fortin, P; Fortson, L; Furniss, A; Gillanders, G H; Griffin, S; Grube, J; Gyuk, G; Hütten, M; Hanna, D; Holder, J; Humensky, T B; Johnson, C A; Kaaret, P; Kar, P; Kelley-Hoskins, N; Kertzman, M; Kieda, D; Krause, M; Krennrich, F; Kumar, S; Lang, M J; Maier, G; McArthur, S; McCann, A; Meagher, K; Moriarty, P; Mukherjee, R; Nieto, D; O'Brien, S; de Bhróithe, A O'Faoláin; Ong, R A; Otte, A N; Park, N; Pelassa, V; Petrashyk, A; Pohl, M; Popkow, A; Pueschel, E; Quinn, J; Ragan, K; Ratliff, G; Reyes, L C; Reynolds, P T; Richards, G T; Roache, E; Rulten, C; Santander, M; Sembroski, G H; Shahinyan, K; Smith, A W; Staszak, D; Telezhinsky, I; Tucci, J V; Tyler, J; Vincent, S; Wakely, S P; Weiner, O M; Weinstein, A; Wilhelm, A; Williams, D A; Zitzer, B

    2016-01-01

    We present results from multiwavelength observations of the BL Lacertae object 1ES 1741+196, including results in the very-high-energy $\\gamma$-ray regime using the Very Energetic Radiation Imaging Telescope Array System (VERITAS). The VERITAS time-averaged spectrum, measured above 180 GeV, is well-modelled by a power law with a spectral index of $2.7\\pm0.7_{\\mathrm{stat}}\\pm0.2_{\\mathrm{syst}}$. The integral flux above 180 GeV is $(3.9\\pm0.8_{\\mathrm{stat}}\\pm1.0_{\\mathrm{syst}})\\times 10^{-8}$ m$^{-2}$ s$^{-1}$, corresponding to 1.6% of the Crab Nebula flux on average. The multiwavelength spectral energy distribution of the source suggests that 1ES 1741+196 is an extreme-high-frequency-peaked BL Lacertae object. The observations analysed in this paper extend over a period of six years, during which time no strong flares were observed in any band. This analysis is therefore one of the few characterizations of a blazar in a non-flaring state.

  11. Common SNP in hsa-miR-196a-2 increases hsa-miR-196a-5p expression and predisposes to idiopathic male infertility in Chinese Han population

    OpenAIRE

    Jing Lu; Hao Gu; Qiuqin Tang; Wei Wu; Beilei Yuan; Dan Guo; Yongyue Wei; Hong Sun; Yankai Xia; Hongjuan Ding,; Lingqing Hu; Daozhen Chen; Jiahao Sha; Xinru Wang

    2016-01-01

    MicroRNA plays an important role in spermatogenesis. Whether pre-miRNAs polymorphisms are associated with idiopathic male infertility remains obscure. In this study, 1378 idiopathic infertile males and 486 fertile controls were included between 2006 and 2014. Genotype of three polymorphisms (hsa-mir-146a rs2910164, hsa-mir-196a-2 rs11614913, and hsa-mir-499 rs3746444) and expression of miRNA in seminal plasma were examined by TaqMan method. The role of hsa-miR-196a-5p in cell proliferation, a...

  12. Aryl hydrocarbon receptor-dependent regulation of miR-196a expression controls lung fibroblast apoptosis but not proliferation

    Energy Technology Data Exchange (ETDEWEB)

    Hecht, Emelia [Department of Medicine, McGill University, Montreal, Quebec (Canada); Zago, Michela [Research Institute of the McGill University Health Centre, McGill University, Montreal, Quebec (Canada); Sarill, Miles [Department of Medicine, McGill University, Montreal, Quebec (Canada); Rico de Souza, Angela [Research Institute of the McGill University Health Centre, McGill University, Montreal, Quebec (Canada); Gomez, Alvin; Matthews, Jason [Department of Pharmacology and Toxicology, University of Toronto, Toronto, ON (Canada); Hamid, Qutayba; Eidelman, David H. [Department of Medicine, McGill University, Montreal, Quebec (Canada); Research Institute of the McGill University Health Centre, McGill University, Montreal, Quebec (Canada); Baglole, Carolyn J., E-mail: Carolyn.baglole@McGill.ca [Department of Medicine, McGill University, Montreal, Quebec (Canada); Research Institute of the McGill University Health Centre, McGill University, Montreal, Quebec (Canada)

    2014-11-01

    The aryl hydrocarbon receptor (AhR) is a ligand-activated transcription factor implicated in the regulation of apoptosis and proliferation. Although activation of the AhR by xenobiotics such as dioxin inhibits the cell cycle and control apoptosis, paradoxically, AhR expression also promotes cell proliferation and survival independent of exogenous ligands. The microRNA (miRNA) miR-196a has also emerged as a regulator of proliferation and apoptosis but a relationship between the AhR and miR-196a is not known. Therefore, we hypothesized that AhR-dependent regulation of endogenous miR-196a expression would promote cell survival and proliferation. Utilizing lung fibroblasts from AhR deficient (AhR{sup −/−}) and wild-type (AhR{sup +/+}) mice, we show that there is ligand-independent regulation of miRNA, including low miR-196a in AhR{sup −/−} cells. Validation by qRT-PCR revealed a significant decrease in basal expression of miR-196a in AhR{sup −/−} compared to AhR{sup +/+} cells. Exposure to AhR agonists benzo[a]pyrene (B[a]P) and FICZ as well as AhR antagonist CH-223191 decreased miR-196a expression in AhR{sup +/+} fibroblasts concomitant with decreased AhR protein levels. There was increased proliferation only in AhR{sup +/+} lung fibroblasts in response to serum, corresponding to a decrease in p27{sup KIP1} protein, a cyclin-dependent kinase inhibitor. Increasing the cellular levels of miR-196a had no effect on proliferation or expression of p27{sup KIP1} in AhR{sup −/−} fibroblasts but attenuated cigarette smoke-induced apoptosis. This study provides the first evidence that AhR expression is essential for the physiological regulation of cellular miRNA levels- including miR-196a. Future experiments designed to elucidate the functional relationship between the AhR and miR-196a may delineate additional novel ligand-independent roles for the AhR. - Highlights: • The AhR controls proliferation and apoptosis in lung cells. • The AhR regulates the

  13. Observation of low-lying resonances in the quasicontinuum of 195,196Pt and enhanced astrophysical reaction rates

    Directory of Open Access Journals (Sweden)

    Giacoppo F.

    2015-01-01

    Full Text Available An excess of strength on the low-energy tail of the giant dipole resonance recently has been observed in the γ-decay from the quasicontinuum of 195,196Pt. The nature of this phenomenon is not yet fully investigated. If this feature is present also in the γ-ray strength of the neutron-rich isotopes, it can affect the neutron-capture reactions involved in the formation of heavy-elements in stellar nucleosynthesis. The experimental level density and γ-ray strength function of 195,196Pt are presented together with preliminary calculations of the corresponding neutron-capture cross sections.

  14. Antinociceptive effects of morphine and naloxone in mu-opioid receptor knockout mice transfected with the MORS196A gene

    Directory of Open Access Journals (Sweden)

    Tao Pao-Luh

    2010-04-01

    Full Text Available Abstract Background Opioid analgesics such as morphine and meperidine have been used to control moderate to severe pain for many years. However, these opioids have many side effects, including the development of tolerance and dependence after long-term use, which has limited their clinical use. We previously reported that mutations in the mu-opioid receptors (MOR S196L and S196A rendered them responsive to the opioid antagonist naloxone without altering the agonist phenotype. In MORS196A knock-in mice, naloxone and naltrexone were antinociceptive but did not cause tolerance or physical dependence. In this study we delivery this mutated MOR gene into pain related pathway to confirm the possibility of in vivo transfecting MORS196A gene and using naloxone as a new analgesic agent. Methods The MOR-knockout (MOR-KO mice were used to investigate whether morphine and naloxone could show antinociceptive effects when MORS196A gene was transfected into the spinal cords of MOR-KO mice. Double-stranded adeno-associated virus type 2 (dsAAV2 was used to deliver the MORS196A-enhanced green fluorescence protein (EGFP gene by microinjected the virus into the spinal cord (S2/S3 dorsal horn region. Tail-flick test was used to measure the antinociceptive effect of drugs. Results Morphine (10 mg/kg, s.c. and naloxone (10 mg/kg, s.c. had no antinociceptive effects in MOR-KO mice before gene transfection. However, two or three weeks after the MOR-S196A gene had been injected locally into the spinal cord of MOR-KO mice, significant antinociceptive effects could be induced by naloxone or morphine. On the other hand, only morphine but not naloxone induced significant tolerance after sub-chronic treatment. Conclusion Transfecting the MORS196A gene into the spinal cord and systemically administering naloxone in MOR-KO mice activated the exogenously delivered mutant MOR and provided antinociceptive effect without causing tolerance. Since naloxone will not activate natural

  15. TNFR 2 M196R Polymorphism and Acne Vulgaris in Han Chinese:A Case-control Study

    Institute of Scientific and Technical Information of China (English)

    田黎明; 谢红付; 杨婷; 胡耀华; 李吉; 王玮蓁

    2010-01-01

    In this case-control study,the relationship between M196R(676 T→G) variant in exon 6 of tumor necrosis factor receptor type 2(TNFR2) gene and genetic susceptibility of acne vulgaris in Han Chinese was investigated.A total of 93 acne vulgaris patients and 90 healthy subjects from Han Chinese ethnic group were enrolled in this study.Polymerase chain reaction-restriction fragment length polymorphism(PCR-RFLP) technique was adopted to analyze the single nucleotide polymorphisms(SNPs) of TNFR2 M196R gene,and to ...

  16. Insights into the evolution of sorbitol metabolism: phylogenetic analysis of SDR196C family

    Directory of Open Access Journals (Sweden)

    Sola Carvajal Agustín

    2012-08-01

    Full Text Available Abstract Background Short chain dehydrogenases/reductases (SDR are NAD(P(H-dependent oxidoreductases with a highly conserved 3D structure and of an early origin, which has allowed them to diverge into several families and enzymatic activities. The SDR196C family (http://www.sdr-enzymes.org groups bacterial sorbitol dehydrogenases (SDH, which are of great industrial interest. In this study, we examine the phylogenetic relationship between the members of this family, and based on the findings and some sequence conserved blocks, a new and a more accurate classification is proposed. Results The distribution of the 66 bacterial SDH species analyzed was limited to Gram-negative bacteria. Six different bacterial families were found, encompassing α-, β- and γ-proteobacteria. This broad distribution in terms of bacteria and niches agrees with that of SDR, which are found in all forms of life. A cluster analysis of sorbitol dehydrogenase revealed different types of gene organization, although with a common pattern in which the SDH gene is surrounded by sugar ABC transporter proteins, another SDR, a kinase, and several gene regulators. According to the obtained trees, six different lineages and three sublineages can be discerned. The phylogenetic analysis also suggested two different origins for SDH in β-proteobacteria and four origins for γ-proteobacteria. Finally, this subdivision was further confirmed by the differences observed in the sequence of the conserved blocks described for SDR and some specific blocks of SDH, and by a functional divergence analysis, which made it possible to establish new consensus sequences and specific fingerprints for the lineages and sub lineages. Conclusion SDH distribution agrees with that observed for SDR, indicating the importance of the polyol metabolism, as an alternative source of carbon and energy. The phylogenetic analysis pointed to six clearly defined lineages and three sub lineages, and great variability in

  17. Clinical analysis of tumor related venous thromboembolism:196 cases%肿瘤并发静脉血栓形成196例临床分析

    Institute of Scientific and Technical Information of China (English)

    申丽华; 张忠伟; 朱彪

    2016-01-01

    Background and purpose:Venous thromboembolism (VTE) is the second common cause of death in cancer patients. The clinical data from VTE patients in Fudan University Shanghai Cancer Center were collected and analyzed during the last 5 years in this study to increase awareness for diagnosis and prevention of VTE in cancer patients and to improve their prognosis.Methods:The clinical data from 196 VTE patients among the 207 514 cancer patients were analyzed during the period from Jul. 2009 to Jun. 2014, and the clinical characteristics of cancer patients with VTE were investigated to understand the inlfuence of risk factors and symptoms in VTE patients.Results:The incidence of VTE in cancer patients was 0.94‰. Adenocarcinoma was the most common type of gynecological cancer (56.5%), gastrointestinal tract cancer (91.7%), lung cancer (71.4) and pancreatic cancer (80%). Logistic regression analysis showed adenocarcinoma was the high risk factor in cancer patients with pulmonary embolism (PE, OR=0.36, 95%CI: 0.146-0.885,P=0.026). Compared with patients who received 2 cycles of chemotherapy, patients who received 3 cycles of chemotherapy had higher incidence of VTE (χ2=10.976,P=0.001). The incidence of VTE in operative group was higher than that in non-operative group. The patients bearing gynecological cancer with ascites (>2 000 mL) had higher VTE incidence compared with the patients with less ascites. Besides, 78%-88% of the VTE patients were diagnosed because of the deep vein thrombosis (DVT) symptom during postoperative recovery and chemoradiotherapy.However, 59.1% of the preoperative VTE patients were diagnosed by the compression venous ultrasonography (CUS) in lower extremity. Physical therapy was adopted to prevent thrombus in 15 postoperative patients.Conclusion:The incidence of cancer-associated VTE in Fudan University Shanghai Cancer Center is lower compared with those reported in other epidemiologic investigations. The VTE incidence in postoperative patients

  18. Charged Hadron Distributions In 19.6-gev Gold+gold Collisions

    CERN Document Server

    Picha, R

    2005-01-01

    Experimental results from a low-energy heavy ion run in year 2001 at the Relativistic Heavy Ion Collider (RHIC) using the Solenoidal Tracker at RHIC (STAR) detector are presented. From the collisions of gold ions at sNN = 19.6 GeV, six species of particles (π±, K±, p, and p¯) are identified via energy loss mechanism and their transverse mass spectra are analyzed at midrapidity (|y| < 0.5) and m T − m0 < 1.0 GeV/c 2. Rapidity distributions, particle ratios, and hadronic freeze-out conditions are discussed. This study provides a low energy measurement at RHIC which is very close to that at the SPS for cross comparison between collider experiments and fixed target experiments. The analysis provides a good reference to study excitation functions of strangeness production, net baryon, and collective flow inside heavy ion collisions.

  19. MicroC/OS-Ⅱ在80C196上的移植实现

    Institute of Scientific and Technical Information of China (English)

    吴永; 张旭东; 赵自信

    2006-01-01

    在嵌入式系统中使用实时操作系统,可以提高系统的稳定性、可靠性和实时性。Micr0C/OS-Ⅱ是一个完整的,可移植、可固化、可剪裁的抢占式多任务实时内核,并且开放源代码,得到了广泛应用。本文结合具体应用,介绍了MicmC/OS-Ⅱ在80C196上移植实现过程和注意事项。

  20. Direct search for Dirac magnetic monopoles in pp collisions at square root s = 1.96 TeV.

    Science.gov (United States)

    Abulencia, A; Acosta, D; Adelman, J; Affolder, T; Akimoto, T; Albrow, M G; Ambrose, D; Amerio, S; Amidei, D; Anastassov, A; Anikeev, K; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Arguin, J-F; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Azfar, F; Azzi-Bacchetta, P; Azzurri, P; Bacchetta, N; Bachacou, H; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Baroiant, S; Bartsch, V; Bauer, G; Bedeschi, F; Behari, S; Belforte, S; Bellettini, G; Bellinger, J; Belloni, A; Ben-Haim, E; Benjamin, D; Beretvas, A; Beringer, J; Berry, T; Bhatti, A; Binkley, M; Bisello, D; Bishai, M; Blair, R E; Blocker, C; Bloom, K; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bolla, G; Bolshov, A; Bortoletto, D; Boudreau, J; Bourov, S; Boveia, A; Brau, B; Bromberg, C; Brubaker, E; Budagov, J; Budd, H S; Budd, S; Burkett, K; Busetto, G; Bussey, P; Byrum, K L; Cabrera, S; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carlsmith, D; Carosi, R; Carron, S; Carter, A; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chapman, J; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, I; Cho, K; Chokheli, D; Chou, J P; Chu, P H; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Ciljak, M; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Coca, M; Connolly, A; Convery, M E; Conway, J; Cooper, B; Copic, K; Cordelli, M; Cortiana, G; Cruz, A; Cuevas, J; Culbertson, R; Cyr, D; DaRonco, S; D'Auria, S; D'Onofrio, M; Dagenhart, D; de Barbaro, P; De Cecco, S; Deisher, A; De Lentdecker, G; Dell'Orso, M; Demers, S; Demortier, L; Deng, J; Deninno, M; De Pedis, D; Derwent, P F; Dionisi, C; Dittmann, J; DiTuro, P; Dörr, C; Dominguez, A; Donati, S; Donega, M; Dong, P; Donini, J; Dorigo, T; Dube, S; Ebina, K; Efron, J; Ehlers, J; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, I; Fedorko, W T; Feild, R G; Feindt, M; Fernandez, J P; Field, R; Flanagan, G; Flores-Castillo, L R; Foland, A; Forrester, S; Foster, G W; Franklin, M; Freeman, J C; Fujii, Y; Furic, I; Gajjar, A; Gallinaro, M; Galyardt, J; Garcia, J E; Garcia Sciverez, M; Garfinkel, A F; Gay, C; Gerberich, H; Gerchtein, E; Gerdes, D; Giagu, S; Giannetti, P; Gibson, A; Gibson, K; Ginsburg, C; Giolo, K; Giordani, M; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Goldstein, J; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Gotra, Y; Goulianos, K; Gresele, A; Griffiths, M; Grinstein, S; Grosso-Pilcher, C; Grundler, U; da Costa, J Guimaraes; Haber, C; Hahn, S R; Hahn, K; Halkiadakis, E; Hamilton, A; Han, B-Y; Handler, R; Happacher, F; Hara, K; Hare, M; Harper, S; Harr, R F; Harris, R M; Hatakeyama, K; Hauser, J; Hays, C; Hayward, H; Heijboer, A; Heinemann, B; Heinrich, J; Hennecke, M; Herndon, M; Heuser, J; Hidas, D; Hill, C S; Hirschbuehl, D; Hocker, A; Holloway, A; Hou, S; Houlden, M; Hsu, S-C; Huffman, B T; Hughes, R E; Huston, J; Ikado, K; Incandela, J; Introzzi, G; Iori, M; Ishizawa, Y; Ivanov, A; Iyutin, B; James, E; Jang, D; Jayatilaka, B; Jeans, D; Jensen, H; Jeon, E J; Jones, M; Joo, K K; Jun, S Y; Junk, T R; Kamon, T; Kang, J; Karagoz-Unel, M; Karchin, P E; Kato, Y; Kemp, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, M S; Kim, S B; Kim, S H; Kim, Y K; Kirby, M; Kirsch, L; Klimenko, S; Klute, M; Knuteson, B; Ko, B R; Kobayashi, H; Kondo, K; Kong, D J; Konigsberg, J; Kordas, K; Korytov, A; Kotwal, A V; Kovalev, A; Kraus, J; Kravchenko, I; Kreps, M; Kreymer, A; Kroll, J; Krumnack, N; Kruse, M; Krutelyov, V; Kuhlmann, S E; Kusakabe, Y; Kwang, S; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; Lecci, C; LeCompte, T; Lee, J; Lee, J; Lee, S W; Lefèvre, R; Leonardo, N; Leone, S; Levy, S; Lewis, J D; Li, K; Lin, C; Lin, C S; Lindgren, M; Lipeles, E; Liss, T M; Lister, A; Litvintsev, D O; Liu, T; Liu, Y; Lockyer, N S; Loginov, A; Loreti, M; Loverre, P; Lu, R-S; Lucchesi, D; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Lytken, E; Mack, P; MacQueen, D; Madrak, R; Maeshima, K; Maksimovic, P; Manca, G; Margaroli, F; Marginean, R; Marino, C; Martin, A; Martin, M; Martin, V; Martínez, M; Maruyama, T; Matsunaga, H; Mattson, M E; Mazini, R; Mazzanti, P; McFarland, K S; McGivern, D; McIntyre, P; McNamara, P; McNulty, R; Mehta, A; Menzemer, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; von der Mey, M; Miao, T; Miladinovic, N; Miles, J; Miller, R; Miller, J S; Mills, C; Milnik, M; Miquel, R; Miscetti, S; Mitselmakher, G; Miyamoto, A; Moggi, N; Mohr, B; Moore, R; Morello, M; Fernandez, P Movilla; Mülmenstädt, J; Mukherjee, A; Mulhearn, M; Muller, Th; Mumford, R; Murat, P; Nachtman, J; Nahn, S; Nakano, I; Napier, A; Naumov, D; Necula, V; Neu, C; Neubauer, M S; Nielsen, J; Nigmanov, T; Nodulman, L; Norniella, O

    2006-05-26

    We search for pair-produced Dirac magnetic monopoles in 35.7 pb(-1) of proton-antiproton collisions at square root s = 1.96 TeV with the Collider Detector at Fermilab (CDF). We find no monopole candidates corresponding to a 95% confidence-level cross-section limit sigma 360 GeV/c2.

  1. The nonoxidative conversion of nitroethane to ethylnitronate in Neurospora crassa 2-nitropropane dioxygenase is catalyzed by histidine 196.

    Science.gov (United States)

    Francis, Kevin; Gadda, Giovanni

    2008-09-01

    The deprotonation of nitroethane catalyzed by Neurospora crassa 2-nitropropane dioxygenase was investigated by measuring the formation and release of ethylnitronate formed in turnover as a function of pH and through mutagenesis studies. Progress curves for the enzymatic reaction obtained by following the increase in absorbance at 228 nm over time were visibly nonlinear, requiring a logarithmic approximation of the initial reaction rates for the determination of the kinetic parameters of the enzyme. The pH dependence of the second-order rate constant k cat/ K m with nitroethane as substrate implicates the presence of a group with a p K a of 8.1 +/- 0.1 that must be unprotonated for nitronate formation. Mutagenesis studies suggest that this group is histidine 196 as evident from the inability of a H196N variant form of the enzyme to catalyze the formation of ethylnitronate from nitroethane. Replacement of histidine 196 with asparagine resulted in an approximately 15-fold increase in the k cat/ K m with ethylnitronate as compared to the wild-type, which results from the inability of the mutant enzyme to undergo nonoxidative turnover. The results presented herein are consistent with a branched catalytic mechanism for the enzyme in which the ethylnitronate intermediate formed from the H196-catalyzed deprotonation of nitroethane partitions between release from the active site and oxidative denitrification to yield acetaldehyde and nitrite. PMID:18690716

  2. Fracture toughness testing of V-4Cr-4Ti at 25{degrees}C and -196{degrees}C

    Energy Technology Data Exchange (ETDEWEB)

    Li, H.X.; Kurtz, R.J. [Pacific Northwest National Lab., Richland, WA (United States)

    1996-10-01

    Measurements of the fracture toughness of the production-scale heat (832665) of V-4Cr-4Ti have been performed at 25{degrees}C and {minus}196{degrees}C using compact tension (CT) specimens. Test specimens were vacuum annealed at either 1000{degrees}C for 1 hour (HT1) or 1050{degrees}C for two hours (HT2). Specimens given the HT1 treatment were annealed after final machining, whereas the HT2 specimens received the 1050{degrees}C anneal at Teledyne Wah Chang prior to final machining. Following machining HT2 specimens were then vacuum annealed at 180{degrees}C for two hours to remove hydrogen. Specimens treated using HT1 had a partially recrystallized microstructure and those treated using HT2 had a fully recrystallized microstructure. The fracture toughness at 25{degrees}C was determined by J-integral tests and at {minus}196{degrees}C by ASTM E 399 type tests. Toughness values obtained at {minus}196{degrees}C were converted to J-integral values for comparison to the 25{degrees}C data. The 25{degrees}C fracture toughness was very high with none of the specimens giving valid results per ASTM criteria. Specimens fractured by microvoid coalescence. The fracture toughness at {minus}196{degrees}C was much lower than that at 25{degrees}C and the fracture surface showed predominantly cleavage features. The present results show a transition from ductile to brittle behavior with decreasing test temperature which is not observed from one-third scale Charpy impact tests. The fracture toughness at {minus}196{degrees}C was still quite high, however, at about 75 kJ/m{sup 2}. Delaminations in planes normal to the thickness direction were seen at both test temperatures. Fracture surfaces inside the delaminations exhibited nearly 100% cleavage facets. The cause of the brittle delaminations was not determined, but will be a subject for further investigation.

  3. s196wo.m77t and s196wo.h77t: MGD77T data and header file for single-beam bathymetry for field activity S-1-96-WO in Cascadia, Washington from 04/14/1996 to 06/06/1996

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — Single-beam bathymetry data along with GPS navigation data was collected as part of the U.S. Geological Survey cruise S-1-96-WO. The cruise was conducted in...

  4. Low expression of miR-196b enhances the expression of BCR-ABL1 and HOXA9 oncogenes in chronic myeloid leukemogenesis.

    Directory of Open Access Journals (Sweden)

    Yue Liu

    Full Text Available MicroRNAs (miRNAs can function as tumor suppressors or oncogene promoters during tumor development. In this study, low levels of expression of miR-196b were detected in patients with chronic myeloid leukemia. Bisulfite genomic sequencing PCR and methylation-specific PCR were used to examine the methylation status of the CpG islands in the miR-196b promoter in K562 cells, patients with leukemia and healthy individuals. The CpG islands showed more methylation in patients with chronic myeloid leukemia compared with healthy individuals (P<0.05, which indicated that low expression of miR-196b may be associated with an increase in the methylation of CpG islands. The dual-luciferase reporter assay system demonstrated that BCR-ABL1 and HOXA9 are the target genes of miR-196b, which was consistent with predictions from bioinformatics software analyses. Further examination of cell function indicated that miR-196b acts to reduce BCR-ABL1 and HOXA9 protein levels, decrease cell proliferation rate and retard the cell cycle. A low level of expression of miR-196b can cause up-regulation of BCR-ABL1 and HOXA9 expression, which leads to the development of chronic myeloid leukemia. MiR-196b may represent an effective target for chronic myeloid leukemia therapy.

  5. Linear polarization structures in LOFAR observations of the interstellar medium in the 3C 196 field

    Science.gov (United States)

    Jelić, V.; de Bruyn, A. G.; Pandey, V. N.; Mevius, M.; Haverkorn, M.; Brentjens, M. A.; Koopmans, L. V. E.; Zaroubi, S.; Abdalla, F. B.; Asad, K. M. B.; Bus, S.; Chapman, E.; Ciardi, B.; Fernandez, E. R.; Ghosh, A.; Harker, G.; Iliev, I. T.; Jensen, H.; Kazemi, S.; Mellema, G.; Offringa, A. R.; Patil, A. H.; Vedantham, H. K.; Yatawatta, S.

    2015-11-01

    Aims: This study aims to characterize linear polarization structures in LOFAR observations of the interstellar medium (ISM) in the 3C 196 field, one of the primary fields of the LOFAR-Epoch of Reionization key science project. Methods: We have used the high band antennas (HBA) of LOFAR to image this region and rotation measure (RM) synthesis to unravel the distribution of polarized structures in Faraday depth. Results: The brightness temperature of the detected Galactic emission is 5-15 K in polarized intensity and covers the range from -3 to +8 rad m-2 in Faraday depth. The most interesting morphological feature is a strikingly straight filament at a Faraday depth of +0.5 rad m-2 running from north to south, right through the centre of the field and parallel to the Galactic plane. There is also an interesting system of linear depolarization canals conspicuous in an image showing the peaks of Faraday spectra. We used the Westerbork Synthesis Radio Telescope (WSRT) at 350 MHz to image the same region. For the first time, we see some common morphology in the RM cubes made at 150 and 350 MHz. There is no indication of diffuse emission in total intensity in the interferometric data, in line with results at higher frequencies and previous LOFAR observations. Based on our results, we determined physical parameters of the ISM and proposed a simple model that may explain the observed distribution of the intervening magneto-ionic medium. Conclusions: The mean line-of-sight magnetic field component, B∥, is determined to be 0.3 ± 0.1 μG and its spatial variation across the 3C 196 field is 0.1 μG. The filamentary structure is probably an ionized filament in the ISM, located somewhere within the Local Bubble. This filamentary structure shows an excess in thermal electron density (neB∥> 6.2 cm-3μG) compared to its surroundings. The RM cubes (FITS files) are available at the CDS via anonymous ftp to http://cdsarc.u-strasbg.fr (ftp://130.79.128.5) or via http://cdsarc

  6. MiR-196a exerts its oncogenic effect in glioblastoma multiforme by inhibition of IκBα both in vitro and in vivo

    KAUST Repository

    Yang, Guang

    2014-01-23

    BackgroundRecent studies have revealed that miR-196a is upregulated in glioblastoma multiforme (GBM) and that it correlates with the clinical outcome of patients with GBM. However, its potential regulatory mechanisms in GBM have never been reported.MethodsWe used quantitative real-time PCR to assess miR-196a expression levels in 132 GBM specimens in a single institution. Oncogenic capability of miR-196a was detected by apoptosis and proliferation assays in U87MG and T98G cells. Immunohistochemistry was used to determine the expression of IκBα in GBM tissues, and a luciferase reporter assay was carried out to confirm whether IκBα is a direct target of miR-196a. In vivo, xenograft tumors were examined for an antiglioma effect of miR-196a inhibitors.ResultsWe present for the first time evidence that miR-196a could directly interact with IκBα 3′-UTR to suppress IκBα expression and subsequently promote activation of NF-κB, consequently promoting proliferation of and suppressing apoptosis in GBM cells both in vitro and in vivo. Our study confirmed that miR-196a was upregulated in GBM specimens and that high levels of miR-196a were significantly correlated with poor outcome in a large cohort of GBM patients. Our data from human tumor xenografts in nude mice treated with miR-196 inhibitors demonstrated that inhibition of miR-196a could ameliorate tumor growth in vivo.ConclusionsMiR-196a exerts its oncogenic effect in GBM by inhibiting IκBα both in vitro and in vivo. Our findings provide new insights into the pathogenesis of GBM and indicate that miR-196a may predict clinical outcome of GBM patients and serve as a new therapeutic target for GBM. © 2014 © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Neuro-Oncology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  7. Linear polarization structures in LOFAR observations of the interstellar medium in the 3C196 field

    CERN Document Server

    Jelić, V; Pandey, V N; Mevius, M; Haverkorn, M; Brentjens, M A; Koopmans, L V E; Zaroubi, S; Abdalla, F B; Asad, K M B; Bus, S; Chapman, E; Ciardi, B; Fernandez, E R; Ghosh, A; Harker, G; Iliev, I T; Jensen, H; Kazemi, S; Mellema, G; Offringa, A R; Patil, A H; Vedantham, H K; Yatawatta, S

    2015-01-01

    This study aims to characterise linear polarization structures in LOFAR observations of the interstellar medium (ISM) in the 3C196 field, one of the primary fields of the LOFAR-Epoch of Reionization key science project. We have used the high band antennas (HBA) of LOFAR to image this region and RM-synthesis to unravel the distribution of polarized structures in Faraday depth. The brightness temperature of the detected Galactic emission is $5-15~{\\rm K}$ in polarized intensity and covers the range from -3 to +8 ${\\rm rad~m^{-2}}$ in Faraday depth. The most interesting morphological feature is a strikingly straight filament at a Faraday depth of $+0.5~{\\rm rad~m^{-2}}$ running from north to south, right through the centre of the field and parallel to the Galactic plane. There is also an interesting system of linear depolarization canals conspicuous in an image showing the peaks of Faraday spectra. We have used the Westerbork Synthesis Radio Telescope (WSRT) at 350 MHz to image the same region. For the first tim...

  8. Polarization leakage in Epoch of Reionization windows: I. LOFAR observations of the 3C196 field

    CERN Document Server

    Asad, Khan M B; Jelić, Vibor; Pandey, V N; Ghosh, Abhik; Abdalla, F B; Bernardi, G; Brentjens, M A; de Bruyn, A G; Bus, S; Ciardi, B; Chapman, E; Daiboo, S; Fernandez, E R; Harker, G; Iliev, I T; Jensen, H; Martinez-Rubi, O; Mellema, G; Mevius, M; Offringa, A R; Patil, A H; Schaye, J; Thomas, R M; van der Tol, S; Vedantham, H K; Yatawatta, S; Zaroubi, S

    2015-01-01

    Detection of the cosmological 21-cm signal coming from the epoch of reionization (EoR) is challenging in the presence of astrophysical foregrounds and direction (in)dependent systematic errors of the instrument. Even after removing the foregrounds, the residual Stokes I maps contain, in addition to the system noise, the polarized foreground leaked from Stokes Q, U due to systematic and random errors which can mimic the EoR signal. Here we discuss the systematic errors, especially the primary beam, of LOFAR and present realistic simulations of the leakages caused by them. We made a Stokes Q, U sky model of the Galactic diffuse emission based on the LOFAR observations of the 3C196 field, simulated the full-Stokes visibilities that would be produced by LOFAR in the presence of its nominal model beam, created RM-cubes and the cylindrically and spherically averaged 3D power spectra (PS), and compared them with the PS of a simulated EoR signal. From the spherical PS, we found that at 134-166 MHz, within the central...

  9. 水稻内生细菌B196的鉴定及其对水稻纹枯病的防治作用%Identification of Rice Endophytic Bacterial Strain B196 and Its Control Effect on Rice Sheath Blight

    Institute of Scientific and Technical Information of China (English)

    农倩; 陈雪凤; 黎起秦; 袁高庆; 林纬; 黄永禄

    2011-01-01

    从水稻体内分离得到的细菌菌株B196对水稻纹枯病菌Rhizoctonia solani的生长有较强抑制作用.通过形态学和生理生化鉴定及16S rDNA序列分析,将菌株B196鉴定为巨大芽孢杆菌Bacillus megaterium.采用浸种和喷雾的方法将菌株B196接种到水稻植株后,均能在稻株体内回收到该菌株,表明菌株B196能在水稻体内定殖.菌株B196对水稻纹枯病的盆栽和田间防效分别为64.29%和55.13%.%A bacterium strain B196, isolated from the rice plants, could inhibit the growth of Rhizoctonia solani. According to its morphological, physiological and biochemical characteristics and 16S rDNA sequence analysis, the strain B196 was identified as Bacillus megaterium. This strain could colonize in rice plants after inoculating with seed dipping and spraying. Control effect of strain B196 on rice sheath blight was 64.29% in pot and 55.13% in fields.

  10. Toll-like receptor 2 -196 to -174 del polymorphism influences the susceptibility of Han Chinese people to Alzheimer's disease

    Directory of Open Access Journals (Sweden)

    Mao Cai-Xia

    2011-10-01

    Full Text Available Abstract Background Toll-like receptor 2 (TLR2 represents a reasonable functional and positional candidate gene for Alzheimer's disease (AD as it is located under the linkage region of AD on chromosome 4q, and functionally is involved in the microglia-mediated inflammatory response and amyloid-β clearance. The -196 to -174 del polymorphism affects the TLR2 gene and alters its promoter activity. Methods We recruited 800 unrelated Northern Han Chinese individuals comprising 400 late-onset AD (LOAD patients and 400 healthy controls matched for gender and age. The -196 to -174 del polymorphism in the TLR2 gene was genotyped using the polymerase chain reaction (PCR method. Results There were significant differences in genotype (P = 0.026 and allele (P = 0.009 frequencies of the -196 to -174 del polymorphism between LOAD patients and controls. The del allele was associated with an increased risk of LOAD (OR = 1.31, 95% CI = 1.07-1.60, Power = 84.9%. When these data were stratified by apolipoprotein E (ApoE ε4 status, the observed association was confined to ApoE ε4 non-carriers. Logistic regression analysis suggested an association of LOAD with the polymorphism in a recessive model (OR = 1.64, 95% CI = 1.13-2.39, Bonferroni corrected P = 0.03. Conclusions Our data suggest that the -196 to -174 del/del genotype of TLR2 may increase risk of LOAD in a Northern Han Chinese population.

  11. Spectral energy distribution simulations of a possible ring structure around the young, red brown dwarf G 196-3 B

    Science.gov (United States)

    Zakhozhay, Olga V.; Zapatero Osorio, María Rosa; Béjar, Víctor J. S.; Boehler, Yann

    2016-09-01

    The origin of the very red optical and infrared colours of intermediate-age (˜10-500 Myr) L-type dwarfs remains unknown. It has been suggested that low-gravity atmospheres containing large amounts of dust may account for the observed reddish nature. We explored an alternative scenario by simulating protoplanetary and debris discs around G 196-3 B, which is an L3 young brown dwarf with a mass of ˜15 MJup and an age in the interval 20-300 Myr. The best-fit solution to G 196-3 B's photometric spectral energy distribution from optical wavelengths through 24 μm corresponds to the combination of an unreddened L3 atmosphere (Teff ≈ 1870 K) and a warm (≈ 1280 K), narrow (≈ 0.07-0.11 R⊙) debris disc located at very close distances (≈ 0.12-0.20 R⊙) from the central brown dwarf. This putative, optically thick, dusty belt, whose presence is compatible with the relatively young system age, would have a mass ≥7 × 10-10 M⊕ comprised of sub-micron/micron characteristic dusty particles with temperatures close to the sublimation threshold of silicates. Considering the derived global properties of the belt and the disc-to-brown dwarf mass ratio, the dusty ring around G 196-3 B may resemble the rings of Neptune and Jupiter, except for its high temperature and thick vertical height (≈6 × 103 km). Our inferred debris disc model is able to reproduce G 196-3 B's spectral energy distribution to a satisfactory level of achievement.

  12. Role of Phe-99 and Trp-196 of sepiapterin reductase from Chlorobium tepidum in the production of L-threo-tetrahydrobiopterin

    Institute of Scientific and Technical Information of China (English)

    Supangat; Sun Ok Park; Kyung Hye Seo; Sang Yeol Lee; Young Shik Park; Kon Ho Lee

    2008-01-01

    Sepiapterin reductase from Chlorobium tepidum (cSR) catalyzes the synthesis of a distinct tetrahydrobiopterin (BH4), L-threo-BH4, different from the mammalian enzyme product. The 3-D crystal structure of cSR has revealed that the product configuration is determined solely by the substrate binding mode within the well-conserved catalytic triads. In cSR, the sepiapterin is stacked between two aromatic side chains of Phe-99 and Trp-196 and rotated approximately 180o around the active site from the position in mouse sepiapterin reductase. To confirm their roles in substrate binding, we mutated Phe-99 and/or Trp-196 to alanine (F99A, W196A) by site-directed mutagenesis and comparatively examined substrate binding of the purified proteins by kinetics analysis and differential scanning calorimetry. These mutants had higher Km values than the wild type. Remarkably, the W196A mutation resulted in a higher Km increase compared with the F99A mutation. Consistent with the results, the melting temperature (Tm) in the presence of sepiapterin was lower in the mutant proteins and the worst was W196A. These findings indicate that the two residues are indispensable for substrate binding in cSR, and Trp-196 is more important than Phe-99 for different stereoisomer production.

  13. 196株金黄色葡萄球菌的分布及耐药性分析%Clinical distribution and drug resistance of 196 strains of Staphylococcus aureus

    Institute of Scientific and Technical Information of China (English)

    王若飞; 丁天鹏; 李定宪; 龚英英; 周志虹; 夏云昆

    2013-01-01

    OBJECTIVE To investigate the clinical distribution and drug resistance of Staphylococcus aureus(SAU) isolated from the hospitalized patients during the past three years so as to guide the reasonable use of antibiotics. METHODS The clinical distribution and antimicrobial resistance of 196 strains of S. aureus were investigated and analyzed. The bacterial culture and identification of S. aureus strains were performed according to National Guide to Clinical Laboratory Operation Procedures. The antimicrobial susceptibility testing was performed by KB method recommended by CLSI. RESULTS Of 196 strains of S. aureus, 48. 5% were methicillin-resistant S. aureus (MRSA), and 51. 5% were methicillin-susceptible S. aureusi MSSA). Of 95 strains of MRSA, isolation rate was relatively high in the ICU, respiratory department, or the neurology department, and was low in the pediatrics department. S. aureus strains varied in the drug resistance to various commonly used antibiotics. The drug resistance rate of the MRSA strains was higher than the MSSA strains. CONCLUSION The drug resistance of S. aureusstrains is serious. It is very important to enhance the monitoring of drug resistance and rational application of antibiotics.%目的 分析近3年医院住院患者金黄色葡萄球菌(SAU)分离株的临床分布及耐药性,为指导临床治疗SAU感染合理使用抗菌药物提供帮助.方法 对196株SAU的分布及耐药性进行调查分析,严格按照《全国临床检验操作规程》进行SAU培养与鉴定,采用CLSI推荐的KB法进行药敏试验.结果 196株SAU中,48.5%为耐甲氧西林金黄色葡萄球菌(MRSA),51.5%为甲氧西林敏感金黄色葡萄球菌(MSSA);在95株MRSA中,ICU、呼吸科、神经内科检出率较高,儿科检出率相对较低;SAU对多种常用抗菌药物均产生了不同程度的耐药;MRSA的耐药率均高于MSSA.结论 SAU引起的耐药现象严重,加强耐药性监测,合理使用抗菌药物非常重要.

  14. MicroRNA-196a & microRNA-101 expression in Barrett's oesophagus in patients with medically and surgically treated gastro-oesophageal reflux

    Directory of Open Access Journals (Sweden)

    Bright Tim

    2011-02-01

    Full Text Available Abstract Background Proton pump inhibitor (PPI medication and surgical fundoplication are used for the control of gastro-oesophageal reflux in patients with Barrett's oesophagus, but differ in their effectiveness for both acid and bile reflux. This might impact on the inflammatory processes that are associated with progression of Barrett's oesophagus to cancer, and this may be evident in the gene expression profile and microRNA expression pattern in Barrett's oesophagus mucosa. We hypothesised that two miRNAs with inflammatory and oncogenic roles, miR-101 and miR-196a, are differentially expressed in Barrett's oesophagus epithelium in patients with reflux treated medically vs. surgically. Findings Mucosal tissue was obtained at endoscopy from patients with Barrett's oesophagus whose reflux was controlled by proton pump inhibitor (PPI therapy (n = 20 or by fundoplication (n = 19. RNA was extracted and the expression of miR-101 and miR-196a was measured using real-time reverse transcription - polymerase chain reaction. There were no significant differences in miR-101 and miR-196a expression in Barrett's oesophagus epithelium in patients treated by PPI vs. fundoplication (p = 0.768 and 0.211 respectively. Secondary analysis showed a correlation between miR-196a expression and Barrett's oesophagus segment length (p = 0.014. Conclusion The method of reflux treatment did not influence the expression of miR-101 and miR-196a in Barrett's oesophagus. This data does not provide support to the hypothesis that surgical treatment of reflux better prevents cancer development in Barrett's oesophagus. The association between miR-196a expression and Barrett's oesophagus length is consistent with a tumour promoting role for miR-196a in Barrett's oesophagus.

  15. 慢性硬膜下血肿196例诊治%Experience of Treatment of Chronic Subdural Hematoma

    Institute of Scientific and Technical Information of China (English)

    宋志旺; 祁震宇

    2012-01-01

    目的 探讨慢性硬膜下血肿的临床特征及其诊治.方法 对2002年~2011年收治的196例慢性硬膜下血肿患者的临床资料进行回顾性分析.结果 慢性硬膜下血肿的临床表现以头昏头痛、肢体肌力下降、精神症状、大小便失禁、癫痫症状为主.治疗上167例采取钻孔引流术,29例采取开瓣血肿清除术.术后症状明显缓解,复查CT示血肿消失或明显减少.结论 慢性硬膜下血肿临床表现缺乏特异性,早期正确诊断并行钻孔引流术或开瓣血肿清除术是治疗慢性硬膜下血肿的主要方法,效果确切.%Objective To evaluate clinical character and diagnosis and treatment on chronic subdural hematoma(CSDH).Methods 196 cases of chronic subdural hematoma were analyzed.Results The classical presentation of CSDH included dizzy,hedache,body strength down,mental symptoms,incontinence and epilepsy symptoms.Of 196 patients,there were 167 cases treated with drilling drainage and 29 cases with open-flap hematoma.Postoperative symptoms were improved,head CT review showed hematoma decreased significantly or disappeared.Conclusion Typical presentation is still lacking for CSDH.Early correct diagnosis and conduct drilling drainage or open-flap hematoma is the main therapy of chronic subdural hematoma.

  16. Experimental investigation of the angular structure of the quasar 3C196 radio emission in the decameter wavelengths

    International Nuclear Information System (INIS)

    The angular structure of the radio emission from 3C196 is measured at 25, 20 and 16.7 MHz by URAN-1 and URAN-4 radiointerferometers. As it has been found of the two compact details observable at higher frequencies only one remains in the decameter band. The preferrable simple model of the radio brightness, distribution has been suggested for the source. It consists of the observable compact detail and the extended component that has been detected at these frequencies. The component brings about a noticeable increase in the angular size of the object

  17. The Association of Common Functional Polymorphisms in Mir-146a and Mir-196a2 and Hepatocellular Carcinoma Risk

    OpenAIRE

    Peng, Qiliu; Li, Shan; Lao, Xianjun; Chen, Zhiping; Li, Ruolin; DENG, YAN; Qin, Xue

    2014-01-01

    Abstract MicroRNAs (miRNAs) are small non-coding RNA molecules that function as tumor suppressors or oncogenes. Single nucleotide polymorphisms (SNPs) located in the miRNAs influence the function of mature miRNAs and may contribute to cancer development. Studies investigating the association between miR-146a rs2910164 and miR-196a2 rs11614913 polymorphisms and hepatocellular carcinoma (HCC) risk reported inconsistent results. We performed a meta-analysis of all available studies to summarize ...

  18. Temperature dependent tunneling study of CaFe1.96Ni0.04As2 single crystals

    Science.gov (United States)

    Dutta, Anirban; Thamizhavel, A.; Gupta, Anjan K.

    2014-04-01

    We report on temperature dependent scanning tunneling microscopy and spectroscopy studies on CaFe1.96Ni0.04As2 single crystals in 5.4 - 19.7 K temperature range across the normal metal - superconductor transition temperature, TC = 14K. The in-situ cleaved crystals show reasonably flat surface with signatures of atomic resolution. The tunnel spectra show significant spatial inhomogeneity below TC, which reduces significantly as the temperature goes above the TC. We discuss these results in terms of an inhomogeneous electronic phase that may exist due to the vicinity of this composition to the quantum critical point.

  19. Search for chargino-neutralino production in pp collisions at sq rt[s] = 1.96 TeV.

    Science.gov (United States)

    Aaltonen, T; Abulencia, A; Adelman, J; Affolder, T; Akimoto, T; Albrow, M G; Amerio, S; Amidei, D; Anastassov, A; Anikeev, K; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Aurisano, A; Azfar, F; Azzi-Bacchetta, P; Azzurri, P; Bacchetta, N; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Baroiant, S; Bartsch, V; Bauer, G; Beauchemin, P-H; Bedeschi, F; Behari, S; Bellettini, G; Bellinger, J; Belloni, A; Benjamin, D; Beretvas, A; Beringer, J; Berry, T; Bhatti, A; Binkley, M; Bisello, D; Bizjak, I; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bolla, G; Bolshov, A; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, J; Budd, H S; Budd, S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Byrum, K L; Cabrera, S; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carillo, S; Carlsmith, D; Carosi, R; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, I; Cho, K; Chokheli, D; Chou, J P; Choudalakis, G; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Cilijak, M; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Coca, M; Compostella, G; Convery, M E; Conway, J; Cooper, B; Copic, K; Cordelli, M; Cortiana, G; Crescioli, F; Almenar, C Cuenca; Cuevas, J; Culbertson, R; Cully, J C; Daronco, S; Datta, M; D'Auria, S; Davies, T; Dagenhart, D; de Barbaro, P; De Cecco, S; Deisher, A; De Lentdecker, G; De Lorenzo, G; Dell'orso, M; Delli Paoli, F; Demortier, L; Deng, J; Deninno, M; De Pedis, D; Derwent, P F; Di Giovanni, G P; Dionisi, C; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Dörr, C; Donati, S; Dong, P; Donini, J; Dorigo, T; Dube, S; Efron, J; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, I; Fedorko, W T; Feild, R G; Feindt, M; Fernandez, J P; Field, R; Flanagan, G; Forrest, R; Forrester, S; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; Garcia, J E; Garberson, F; Garfinkel, A F; Gay, C; Gerberich, H; Gerdes, D; Giagu, S; Giannetti, P; Gibson, K; Gimmell, J L; Ginsburg, C; Giokaris, N; Giordani, M; Giromini, P; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Goldstein, J; Golossanov, A; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Grinstein, S; Grosso-Pilcher, C; Grundler, U; da Costa, J Guimaraes; Gunay-Unalan, Z; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Hamilton, A; Han, B-Y; Han, J Y; Handler, R; Happacher, F; Hara, K; Hare, D; Hare, M; Harper, S; Harr, R F; Harris, R M; Hartz, M; Hatakeyama, K; Hauser, J; Hays, C; Heck, M; Heijboer, A; Heinemann, B; Heinrich, J; Henderson, C; Herndon, M; Heuser, J; Hidas, D; Hill, C S; Hirschbuehl, D; Hocker, A; Holloway, A; Hou, S; Houlden, M; Hsu, S-C; Huffman, B T; Hughes, R E; Husemann, U; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ivanov, A; Iyutin, B; James, E; Jang, D; Jayatilaka, B; Jeans, D; Jeon, E J; Jindariani, S; Johnson, W; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Karchin, P E; Kato, Y; Kemp, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Klute, M; Knuteson, B; Ko, B R; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kraan, A C; Kraus, J; Kreps, M; Kroll, J; Krumnack, N; Kruse, M; Krutelyov, V; Kubo, T; Kuhlmann, S E; Kuhr, T; Kulkarni, N P; Kusakabe, Y; Kwang, S; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; Lecompte, T; Lee, J; Lee, J; Lee, Y J; Lee, S W; Lefèvre, R; Leonardo, N; Leone, S; Levy, S; Lewis, J D; Lin, C; Lin, C S; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Lu, R-S; Lucchesi, D; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Lytken, E; Mack, P; Macqueen, D; Madrak, R; Maeshima, K; Makhoul, K; Maki, T; Maksimovic, P; Malde, S; Malik, S; Manca, G; Manousakis, A; Margaroli, F; Marginean, R; Marino, C; Marino, C P; Martin, A; Martin, M; Martin, V; Martínez, M; Martínez-Ballarín, R; Maruyama, T; Mastrandrea, P; Masubuchi, T; Matsunaga, H; Mattson, M E; Mazini, R; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtala, P; Menzemer, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Miao, T; Miladinovic, N; Miles, J; Miller, R; Mills, C; Milnik, M; Mitra, A; Mitselmakher, G; Miyamoto, A; Moed, S; Moggi, N; Mohr, B; Moon, C S; Moore, R; Morello, M; Fernandez, P Movilla; Mülmenstädt, J; Mukherjee, A; Muller, Th; Mumford, R; Murat, P; Mussini, M; Nachtman, J; Nagano, A; Naganoma, J; Nakamura, K; Nakano, I; Napier, A; Necula, V; Neu, C; Neubauer, M S

    2007-11-01

    We present a search for associated production of the chargino and neutralino supersymmetric particles using up to 1.1 fb{-1} of integrated luminosity collected by the CDF II experiment at the Tevatron pp collider at sq rt[s]=1.96 TeV. We analyze events with a large transverse momentum imbalance and either three charged leptons or two charged leptons of the same electric charge. The numbers of observed events are consistent with standard model expectations. Upper limits on the production cross section are derived in different theoretical models. PMID:18233067

  20. Probing the order-to-chaos region in superdeformed 151Tb and 196Pb nuclei with continuum gamma-transitions

    CERN Document Server

    Leoni, S; Blasi, N; Bracco, A; Brambilla, S; Camera, F; Corsi, A; Crespi, F C L; Mason, P; Million, B; Montanari, D; Pignanelli, M; Vigezzi, E; Wieland, O; Matsuo, M; Shimizu, Y R; Bednarczyk, P; Castoldi, M; Curien, D; Duchêne, G; Herskind, B; Kmiecik, M; Maj, A; Meczynski, W; Robin, J; Styczen, J; Zieblinski, M; Zuber, K; Zucchiatti, A

    2008-01-01

    The gamma-decay associated with the warm rotation of the superdeformed (SD) nuclei 151Tb and 196Pb has been measured with the EUROBALL IV array. Several independent quantities provide a stringent test of the population and decay dynamics in the SD well. A Monte Carlo simulation of the gamma-decay based on microscopic calculations gives remarkable agreement with the data only assuming a large enhancement of the B(E1) strength at low excitation energy, which may be related to the evidence for octupole vibrations in both mass regions.

  1. New results on the superdeformed {sup 196}Pb nucleus: The decay of the excited bands to the yrast band

    Energy Technology Data Exchange (ETDEWEB)

    Bouneau, S.; Azaiez, F.; Duprat, J. [IPN, Orsay (France)] [and others

    1996-12-31

    The study of the superdeformed (SD) {sup 196}Pb nucleus has been revisited using the EUROGAM phase 2 spectrometer. In addition to the known yrast and two lowest excited SD bands, a third excited SD band has been seen. All of the three excited bands were found to decay to the yrast SD band through, presumably, E1 transitions, allowing relative spin and excitation energy assignments. Comparisons with calculations using the random-phase approximation suggest that all three excited bands can be interpreted as octupole vibrational structures.

  2. Measurement of the ttbar production cross section in ppbar collisions at sqrt{s} = 1.96 TeV

    CERN Document Server

    Abazov, V; Abolins, M; Acharya, B S; Adams, M; Adams, T; Aguiló, E; Ahn, S H; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Ancu, L S; Andeen, T; Anderson, S; Andrieu, B; Anzelc, M S; Aoki, M; Arnoud, Y; Arov, M; Arthaud, M; Askew, A; sman, B; Assis-Jesus, A C S; Atramentov, O; Avila, C; Ay, C; Badaud, F; Baden, AA; Bagby, L; Baldin, B; Bandurin, D V; Banerjee, P; Banerjee, S; Barberis, E; Barfuss, A F; Bargassa, P; Baringer, P; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Beale, S; Bean, A; Begalli, M; Begel, M; Belanger-Champagne, C; Bellantoni, L; Bellavance, A; Benítez, J A; Beri, S B; Bernardi, G; Bernhard, R; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Biscarat, C; Blazey, G; Blekman, F; Blessing, S; Bloch, D; Bloom, K; Böhnlein, A; Boline, D; Bolton, T A; Borissov, G; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Brown, D; Buchanan, N J; Buchholz, D; Bühler, M; Büscher, V; Bunichev, V; Burdin, S; Burke, S; Burnett, T H; Buszello, C P; Butler, J M; Calfayan, P; Calvet, S; Cammin, J; Carvalho, W; Casey, B C K; Castilla-Valdez, H; Chakrabarti, S; Chakraborty, D; Chan, K; Chan, K M; Chandra, A; Charles, F; Cheu, E; Chevallier, F; Cho, D K; Choi, S; Choudhary, B; Christofek, L; Christoudias, T; Cihangir, S; Claes, D; Coadou, Y; Cooke, M; Cooper, W E; Corcoran, M; Couderc, F; Cousinou, M C; Crepe-Renaudin, S; Cutts, D; Cwiok, M; Da Motta, H; Das, A; Davies, G; De, K; De Jong, S J; De La Cruz-Burelo, E; De Oliveira Martins, C; Degenhardt, J D; Dliot, F; Demarteau, M; Demina, R; Denisov, D; Denisov, S P; Desai, S; Diehl, e H T; Diesburg, M; Dominguez, A; Dong, H; Dudko, L V; Duflot, L; Dugad, S R; Duggan, D; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Ellison, J; Elvira, V D; Enari, Y; Eno, S; Ermolov, P; Evans, H; Evdokimov, A; Evdokimov, V N; Ferapontov, A V; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Fortner, M; Fox, H; Fu, S; Fuess, S; Gadfort, T; Galea, C F; Gallas, E; García, C; García-Bellido, A; Gavrilov, V; Gay, P; Geist, W; Gel, D; Gerber, eC E; Gershtein, Yu; Gillberg, D; Ginther, G; Gollub, N; Gmez, B; Goussiou, A; Grannis, P D; Greenlee, o H; Greenwood, Z D; Gregores, E M; Grenier, G; Gris, P; Grivaz, J F; Grohsjean, A; Grünendahl, S; Grünewald, M W; Guo, F; Guo, J; Gutíerrez, G; Gutíerrez, P; Haas, A; Hadley, N J; Haefner, P; Hagopian, S; Haley, J; Hall, I; Hall, R E; Han, L; Harder, K; Harel, A; Harrington, R; Hauptman, J M; Hauser, R; Hays, J; Hebbeker, T; Hedin, D; Hegeman, J G; Heinmiller, J M; Heinson, A P; Heintz, U; Hensel, C; Herner, K; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hoeth, H; Hohlfeld, M; Hong, S J; Hossain, S; Houben, P; Hu, Y; Hubacek, Z; Hynek, V; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jakobs, K; Jarvis, C; Jesik, e R; Johns, K; Johnson, C; Johnson, M; Jonckheere, A; Jonsson, P; Juste, A; Kajfasz, E; Kalinin, A M; Kalk, J M; Kappler, S; Karmanov, D; Kasper, P A; Katsanos, I; Kau, D; Kaushik, V; Kehoe, R; Kermiche, S; Khalatyan, N; Khanov, A; Kharchilava, A; Kharzheev, Yu M; Khatidze, D; Kim, T J; Kirby, M H; Kirsch, M; Klima, B; Kohli, J M; Konrath, J P; Korablev, V M; Kozelov, A V; Kraus, J; Krop, D; Kühl, T; Kumar, A; Kupco, A; Kura, T; Kvita, J; Lacroix, F; Lam, cD; Lammers, S; Landsberg, G; Lebrun, P; Lee, W M; Leflat, A; Lellouch, J; Lévêque, J; Li, J; Li, L; Li, Q Z; Lietti, S M; Lima, J G R; Lincoln, D; Linnemann, J; Lipaev, V V; Lipton, R; Liu, Y; Liu, Z; Lobodenko, A; Lokajícek, M; Love, P; Lubatti, H J; Luna, R; Lyon, A L; Maciel, A K A; Mackin, D; Madaras, R J; Mättig, P; Magass, C; Magerkurth, A; Mal, P K; Malbouisson, H B; Malik, S; Malyshev, V L; Mao, H S; Maravin, Y; Martin, B; McCarthy, R; Melnitchouk, A; Mendoza, L; Mercadante, P G; Merkin, M; Merritt, K W; Meyer, A; Meyer, J; Millet, T; Mitrevski, J; Molina, J; Mommsen, R K; Mondal, N K; Moore, R W; Moulik, T; Muanza, G S; Mulders, M; Mulhearn, M; Mundal, O; Mundim, L; Nagy, E; Naimuddin, M; Narain, M; Naumann, N A; Neal, H A; Negret, J P; Neustroev, P; Nilsen, H; Nogima, H; Novaes, S F; Nunnemann, T; O'Dell, V; O'Neil, D C; Obrant, G; Ochando, C; Onoprienko, D; Oshima, N; Osman, N; Osta, J; Otec, R; Oteroy-Garzon, G J; Owen, M; Padley, P; Pangilinan, M; Parashar, N; Park, S J; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Pawloski, G; Penning, B; Perfilov, M; Peters, K; Peters, Y; Pétroff, P; Petteni, M; Piegaia, R; Piper, J; Pleier, M A; Podesta-Lerma, P L M; Podstavkov, e V M; Pogorelov, Y; Pol, M E; Polozov, P; Pope, B G; Popov, A V; Potter, C; Prado da Silva, W L; Prosper, H B; Protopopescu, S; Qian, J; Quadt, A; Quinn, B; Rakitine, A; Rangel, M S; Ranjan, K; Ratoff, P N; Renkel, P; Reucroft, S; Rich, P; Rieger, J; Rijssenbeek, M; Ripp-Baudot, I; Rizatdinova, F; Robinson, S; Rodrigues, R F

    2008-01-01

    We measure the ttbar production cross section in ppbar collisions at sqrt{s}=1.96 TeV in the lepton+jets channel. Two complementary methods discriminate between signal and background, b-tagging and a kinematic likelihood discriminant. Based on 0.9 fb-1 of data collected by the D0 detector at the Fermilab Tevatron Collider, we measure sigma_ttbar=7.62+/-0.85 pb, assuming the current world average m_t=172.6 GeV. We compare our cross section measurement with theory predictions to determine a value for the top quark mass of 170+/-7 GeV.

  3. ZZ to llvv production in pp collisions at sqrt(s) = 1.96 TeV

    CERN Document Server

    Abazov, V; Abolins, M; Acharya, B S; Adams, M; Adams, T; Aguiló, E; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Ancu, L S; Andeen, T; Andrieu, B; Anzelc, M S; Aoki, M; Arnoud, Y; Arov, M; Arthaud, M; Askew, A; sman, B; Assis-Jesus, A C S; Atramentov, O; Avila, C; Badaud, F; Bagby, L; Baldin, B; Bandurin, A D V; Banerjee, P; Banerjee, S; Barberis, E; Barfuss, A F; Bargassa, P; Baringer, P; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Beale, S; Bean, A; Begalli, M; Begel, M; Belanger-Champagne, C; Bellantoni, L; Bellavance, A; Benítez, J A; Beri, S B; Bernardi, G; Bernhard, R; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Biscarat, C; Blazey, G; Blekman, F; Blessing, S; Bloom, K; Böhnlein, A; Boline, D; Bolton, T A; Boos, E E; Borissov, G; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Brown, D; Bu, X B; Buchanan, N J; Buchholz, D; Bühler, M; Büscher, V; Bunichev, V; Burdin, S; Burnett, T H; Buszello, C P; Butler, J M; Calfayan, P; Calvet, S; Cammin, J; Carrera, E; Carvalho, W; Casey, B C K; Castilla-Valdez, H; Cerminara, G; Chakrabarti, S; Chakraborty, D; Chan, K M; Chandra, A; Cheu, E; Chevallier, F; Cho, D K; Choi, S; Choudhary, B; Christofek, L; Christoudias, T; Cihangir, S; Claes, D; Clutter, J; Cooke, M; Cooper, W E; Corcoran, M; Couderc, F; Cousinou, M C; Crepe-Renaudin, S; Cuplov, V; Cutts, D; Cwiok, M; Da Motta, H; Das, A; Davies, G; De, K; De Jong, S J; De La Cruz-Burelo, E; De Oliveira Martins, C; De Vaughan, K; Degenhardt, J D; Dliot, F; Demarteau, M; Demina, R; Denisov, D; Denisov, S P; Desai, S; Diehl, H T; Diesburg, M; Dominguez, A; Dong, H; Dorland, T; Dubey, A; Dudko, L V; Duflot, L; Dugad, S R; Duggan, D; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Ellison, J; Elvira, V D; Enari, Y; Eno, S; Ermolov, P; Evans, H; Evdokimov, A; Evdokimov, V N; Facini, G; Ferapontov, A V; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Fortner, M; Fox, H; Fu, S; Fuess, S; Gadfort, T; Galea, C F; García, C; García-Bellido, A; Gavrilov, V; Gay, P; Geist, W; Geng, W; Gerber, C E; Gershtein, Yu; Gillberg, D; Ginther, G; Gollub, N; Gmez, B; Goussiou, A; Grannis, P D; Greenlee, H; Greenwood, Z D; Gregores, E M; Grenier, G; Gris, P; Grivaz, J F; Grohsjean, A; Grünendahl, S; Grünewald, M W; Guo, F; Guo, J; Gutíerrez, G; Gutíerrez, P; Haas, A; Hadley, N J; Haefner, P; Hagopian, S; Haley, J; Hall, I; Hall, R E; Han, L; Harder, K; Harel, A; Hauptman, J M; Hays, J; Hebbeker, T; Hedin, D; Hegeman, J G; Heinson, A P; Heintz, U; Hensel, C; Herner, K; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hoeth, H; Hohlfeld, M; Hossain, S; Houben, P; Hu, Y; Hubacek, Z; Hynek, V; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jakobs, K; Jarvis, C; Jesik, R; Johns, K; Johnson, C; Johnson, M; Johnston, D; Jonckheere, A; Jonsson, P; Juste, A; Kajfasz, E; Kalk, J M; Karmanov, D; Kasper, P A; Katsanos, I; Kau, D; Kaushik, V; Kehoe, R; Kermiche, S; Khalatyan, N; Khanov, A; Kharchilava, A; Kharzheev, Yu M; Khatidze, D; Kim, T J; Kirby, M H; Kirsch, M; Klima, B; Kohli, J M; Konrath, J P; Kozelov, A V; Kraus, J; Kühl, T; Kumar, A; Kupco, A; Kura, T; Kuzmin, V A; Kvita, J; Lacroix, F; Lam, D; Lammers, S; Landsberg, G; Lebrun, P; Lee, W M; Leflat, A; Lellouch, J; Li, J; Li, L; Li, Q Z; Lietti, S M; Lim, J K; Lima, J G R; Lincoln, D; Linnemann, J; Lipaev, V V; Lipton, R; Liu, Y; Liu, Z; Lobodenko, A; Lokajícek, M; Love, P; Lubatti, H J; Luna, R; Lyon, A L; Maciel, A K A; Mackin, D; Madaras, R J; Mättig, P; Magass, C; Magerkurth, A; Mal, P K; Malbouisson, H B; Malik, S; Malyshev, V L; Maravin, Y; Martin, B; McCarthy, R; Melnitchouk, A; Mendoza, L; Mercadante, P G; Merkin, M; Merritt, K W; Meyer, A; Meyer, J; Mitrevski, J; Mommsen, R K; Mondal, N K; Moore, R W; Moulik, T; Muanza, G S; Mulhearn, M; Mundal, O; Mundim, L; Nagy, E; Naimuddin, M; Narain, M; Naumann, N A; Neal, H A; Negret, J P; Neustroev, P; Nilsen, H; Nogima, H; Novaes, S F; Nunnemann, T; O'Dell, V; O'Neil, D C; Obrant, G; Ochando, C; Onoprienko, D; Oshima, N; Osman, N; Osta, J; Otec, R; Oteroy-Garzon, G J; Owen, M; Padley, P; Pangilinan, M; Parashar, N; Park, S J; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Pawloski, G; Penning, B; Perfilov, M; Peters, K; Peters, Y; Pétroff, P; Petteni, M; Piegaia, R; Piper, J; Pleier, M A; Podesta-Lerma, P L M; Podstavkov, V M; Pogorelov, Y; Pol, M E; Polozov, P; Pope, B G; Popov, A V; Potter, C; Prado da Silva, W L; Prosper, H B; Protopopescu, S; Qian, J; Quadt, A; Quinn, B; Rakitine, A; Rangel, M S; Ranjan, K; Ratoff, P N; Renkel, P; Rich, P; Rieger, J; Rijssenbeek, M; Ripp-Baudot, I; Rizatdinova, F; Robinson, S; Rodrigues, R F; Rominsky, M; Royon, C; Rubinov, P; Ruchti, R; Safronov, G; Sajot, G; Sánchez-Hernández, A; Sanders, M P; Sanghi, B; Savage, G; Sawyer, L

    2008-01-01

    We describe a search for Z boson pair production in pp collisions at sqrt(s)= 1.96 TeV with the D0 detector at the Fermilab Tevatron Collider using a data sample corresponding to an integrated luminosity of 2.7 fb^-1. Using the final state decay ZZ to llvv (where l = e or mu) we measure a signal with a 2.6 standard deviations significance (2.0 expected) and measure a cross section of sigma(pp to ZZ + X) = 2.01 +- 0.93 (stat.) +- 0.29 (sys.) pb.

  4. Spectral energy distribution simulations of a possible ring structure around the young, red brown dwarf G196-3B

    CERN Document Server

    Zakhozhay, Olga V; Béjar, Víctor J S; Boehler, Yann

    2016-01-01

    The origin of the very red optical and infrared colours of intermediate-age ($\\sim$10 - 500 Myr) L-type dwarfs remains unknown. It has been suggested that low-gravity atmospheres containing large amounts of dust may account for the observed reddish nature. We explored an alternative scenario by simulating protoplanetary and debris discs around G196-3B, which is an L3 young brown dwarf with a mass of $\\sim 15$ $M_{\\rm Jup}$ and an age in the interval 20 - 300 Myr. The best-fit solution to G196-3B's photometric spectral energy distribution from optical wavelengths through 24 $\\mu$m corresponds to the combination of an unreddened L3 atmosphere ($T_{\\rm eff} \\approx 1870$~K) and a warm ($\\approx$ 1280 K), narrow ($\\approx$ 0.07 - 0.11 R$_{\\odot}$) debris disc located at very close distances ($\\approx$ 0.12 - 0.20 R$_{\\odot}$) from the central brown dwarf. This putative, optically thick, dusty belt, whose presence is compatible with the relatively young system age, would have a mass $\\ge 7\\times 10^{-10}$ M$_{\\opl...

  5. Ignition and Growth Reactive Flow Modeling of Shock Initiation of PBX 9502 at -55∘C and -196∘C

    Science.gov (United States)

    Chidester, Steven; Tarver, Craig

    2015-06-01

    Recently Gustavsen et al. and Hollowell et al. published two stage gas gun embedded particle velocity gauge experiments on PBX 9502 (95%TATB, 5% Kel-F800) cooled to -55°C and -196°C, respectively. At -196°C, PBX 9502 was shown to be much less shock sensitive than at -55°C, but it did transition to detonation. Previous Ignition and Growth model parameters for shock initiation of PBX 9502 at -55°C are modified based on the new data, and new parameters for -196°C PBX 9502 are created to accurately simulate the measured particle velocity histories and run distances to detonation versus shock pressures. This work was performed under the auspices of the U. S. Department of Energy by the Lawrence Livermore National Laboratory under Contract No. DE-AC52-07NA27344.

  6. MiR-196a促进人非小细胞肺癌细胞NCI-H1299侵袭转移的研究%Up-regualated miR-196a Promotes NSCLC Cell NCI-H1299 Migration and Invasion

    Institute of Scientific and Technical Information of China (English)

    张二宝; 殷丹丹; 刘志军; 孔荣; 德伟

    2013-01-01

    Objective:The development and the molecular mechanism of non-small cell lung cancer is still the focus of current research.Recent studies have shown that microRNA plays an important role in the process of tumor development.To investigate the expression level of miR-196a in NSCLC tissues and cell lines,and study the effect of inhibition ofmiR-196a expression on NSCLC cells migration and invasion.Methods:Real-time quantitative PCR was performed to detect the relative expression of miR-196a in NSCLC cell lines and tissues.MiR-196a inhibitors were transfected into NCI-H1299 cells to down-regulate miR-196a expression,and qPCR was used to test the transfection efficiency.Transwell assays were performed to detect the effect ofmiR-196a on NSCLC cells migration and invasion.Results:Our study showed that miR-196a was highly expressed both in NSCLC samples and cell lines compared with their corresponding normal tissues and cell lines.MiR-196a inhibitors transfection could significantly decrease its expression in NCI-H1299 cells,and down-regulating ofmiR-196a expression could inhibit NCI-H1299 cells migration and invasion.Conclusion:Quantitative PCR results showed that miR-196a highly expressed in non-small cell lung cancer tissues and cells,and inhibition of miR-196a expression can affect the migration and invasion of non-small cell lung cancer cells.It is possible that miR-196a may play a key role in the occurrence and development of non-small cell lung cancer,and may be used for non-small cell lung cancer diagnosis,and prognosis molecular target.%目的:非小细胞肺癌发生、发展的分子机制仍是目前研究的热点与难点,新近研究表明microRNA在肿瘤的发展过程中起着重要的作用.本研究旨在探讨miR-196a在人非小细胞肺癌组织及细胞系中的表达水平,以及抑制miR-196a对非小细胞肺癌细胞侵袭转移能力的影响.方法:通过real-time PCR技术检测人非小细胞肺癌及细胞系中miR-196a的

  7. Cathepsin activities and membrane integrity of zebrafish (Danio rerio) oocytes after freezing to -196 degrees C using controlled slow cooling.

    Science.gov (United States)

    Zhang, T; Rawson, D M; Tosti, L; Carnevali, O

    2008-04-01

    This study investigated enzymatic activity of cathepsins and the membrane integrity of zebrafish (Danio rerio) oocytes after freezing to -196 degrees C using controlled slow cooling. Stage III oocytes (>0.5mm), obtained through dissection of anaesthetised female fish and desegregation of ovarian cumulus, were exposed to 2M methanol or 2M DMSO (both prepared in Hank's medium) for 30min at 22 degrees C before being loaded into 0.5ml plastic straws and placed into a programmable cooler. After controlled slow freezing, samples were plunged into liquid nitrogen (LN) and held for at least 10min, and thawed by immersing straws into a 27 degrees C water bath for 10s. Thawed oocytes were washed twice in Hank's medium. Cathepsin activity and membrane integrity of oocytes were assessed both after cryoprotectant treatment at 22 degrees C and after freezing in LN. Cathepsin B and L colorimetric analyses were performed using substrates Z-Arg-ArgNNap and Z-Phe-Arg-4MbetaNA-HCl, respectively, and 2-naphthylamine and 4-methoxy-2-naphthylamine were used as standards. Cathepsin D activity was performed by analysing the level of hydrolytic action on haemoglobin. Oocytes membrane integrity was assessed using 0.2% Trypan blue staining for 5min. Analysis of cathepsin activities showed that whilst the activity of cathepsin B and D was not affected by 2M DMSO treatment, their activity was lowered when treated with 2M methanol. Following freezing to -196 degrees C, the activity of all cathepsins (B, D and L) was significantly decreased in both 2M DMSO and 2M methanol. Trypan blue staining showed that 63.0+/-11.3% and 72.7+/-5.2% oocytes membrane stayed intact after DMSO and methanol treatment for 30min at 22 degrees C, respectively, whilst 14.9+/-2.6% and 1.4+/-0.8% stayed intact after freezing in DMSO and methanol to -196 degrees C. The results indicate that cryoprotectant treatment and freezing modified the activities of lysosomal enzymes involved in oocyte maturation and yolk

  8. Double parton interactions in photon+3 jet events in ppbar collisions sqrt{s}=1.96 TeV

    CERN Document Server

    ,

    2009-01-01

    We have used a sample of photon+3 jets events collected by the D0 experiment with an integrated luminosity of about 1 fb^-1 to determine the fraction of events with double parton scattering (f_DP) in a single ppbar collision at sqrt{s}=1.96 TeV. The DP fraction and effective cross section (sigma_eff), a process-independent scale parameter related to the parton density inside the nucleon, are measured in three intervals of the second (ordered in pT) jet transverse momentum pT_jet2 within the range 15 < pT_jet2 < 30 GeV. In this range, f_DP varies between 0.23 < f_DP < 0.47, while sigma_eff has the average value sigma_eff_ave = 16.4 +- 0.3(stat) +- 2.3(syst) mb.

  9. Search for chargino-neutralino production in ppbar collisions at $\\sqrt{s}$ = 1.96 TeV

    CERN Document Server

    Aaltonen, T; Adelman, J; Affolder, T; Akimoto, T; Albrow, M G; Amerio, S; Amidei, D; Anastassov, A; Anikeev, K; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Aurisano, A; Azfar, F; Azzi-Bacchetta, P; Azzurri, P; Bacchetta, N; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Baroiant, S; Bartsch, V; Bauer, G; Beauchemin, P H; Bedeschi, F; Behari, S; Bellettini, G; Bellinger, J; Belloni, A; Benjamin, D; Beretvas, A; Beringer, J; Berry, T; Bhatti, A; Binkley, M; Bisello, D; Bizjak, I; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bölla, G; Bolshov, A; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, Yu; Budd, H S; Budd, S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Byrum, K L; Cabrera, S; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carillo, S; Carlsmith, D; Carosi, R; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, I; Cho, K; Chokheli, D; Chou, J P; Choudalakis, G; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Cilijak, M; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Coca, M; Compostella, G; Convery, M E; Conway, J; Cooper, B; Copic, K; Cordelli, M; Cortiana, G; Crescioli, F; Cuenca-Almenar, C; Cuevas-Maestro, J; Culbertson, R; Cully, J C; Da Ronco, S; Datta, M; D'Auria, S; Davies, T; Dagenhart, D; De Barbaro, P; De Cecco, S; Deisher, A; De Lentdecker, G; De Lorenzo, G; Dell'Orso, Mauro; Delli Paoli, F; Demortier, L; Deng, J; Deninno, M; De Pedis, D; Derwent, P F; Di Giovanni, G P; Dionisi, C; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Dorr, C; Donati, S; Dong, P; Donini, J; Dorigo, T; Dube, S; Efron, J; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, I; Fedorko, W T; Feild, R G; Feindt, M; Fernández, J P; Field, R; Flanagan, G; Forrest, R; Forrester, S; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; García, J E; Garberson, F; Garfinkel, A F; Gay, C; Gerberich, H; Gerdes, D; Giagu, S; Giannetti, P; Gibson, K; Gimmell, J L; Ginsburg, C; Giokaris, N; Giordani, M; Giromini, P; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Goldstein, J; Golossanov, A; Gómez, G; Gómez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Grinstein, S; Grosso-Pilcher, C; Group, R C; Grundler, U; Guimarães da Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Hamilton, A; Han, B Y; Han, J Y; Handler, R; Happacher, F; Hara, K; Hare, D; Hare, M; Harper, S; Harr, R F; Harris, R M; Hartz, M; Hatakeyama, K; Hauser, J; Hays, C; Heck, M; Heijboer, A; Heinemann, B; Heinrich, J; Henderson, C; Herndon, M; Heuser, J; Hidas, D; Hill, C S; Hirschbuehl, D; Höcker, A; Holloway, A; Hou, S; Houlden, M; Hsu, S C; Huffman, B T; Hughes, R E; Husemann, U; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ivanov, A; Iyutin, B; James, E; Jang, D; Jayatilaka, B; Jeans, D; Jeon, E J; Jindariani, S; Johnson, W; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Karchin, P E; Kato, Y; Kemp, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Klute, M; Knuteson, B; Ko, B R; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kraan, A C; Kraus, J; Kreps, M; Kroll, J; Krumnack, N; Kruse, M; Krutelyov, V; Kubo, T; Kuhlmann, S E; Kuhr, T; Kulkarni, N P; Kusakabe, Y; Kwang, S; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; LeCompte, T; Lee, J; Lee, J; Lee, Y J; Lee, S W; Lefèvre, R; Leonardo, N; Leone, S; Levy, S; Lewis, J D; Lin, C; Lin, C S; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Lu, R S; Lucchesi, D; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Lytken, E; Mack, P; MacQueen, D; Madrak, R; Maeshima, K; Makhoul, K; Mäki, T; Maksimovic, P; Malde, S; Malik, S; Manca, G; Manousakis, A; Margaroli, F; Marginean, R; Marino, C; Marino, C P; Martin, A; Martin, M; Martin, V; Martínez, M; Martinez-Ballarin, R; Maruyama, T; Mastrandrea, P; Masubuchi, T; Matsunaga, H; Mattson, M E; Mazini, R; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtälä, P; Menzemer, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Miao, T; Miladinovic, N; Miles, J; Miller, R; Mills, C; Milnik, M; Mitra, A; Mitselmakher, G; Miyamoto, A; Moed, S; Moggi, N; Mohr, B; Moon, C S; Moore, R; Morello, M; Movilla-Fernández, P A; Mülmenstädt, J; Mukherjee, A; Müller, T; Mumford, R; Murat, P; Mussini, M; Nachtman, J; Nagano, A; Naganoma, J; Nakamura, K; Nakano, I; Napier, A; Necula, V

    2007-01-01

    We present the results of a search for associated production of the chargino and neutralino supersymmetric particles using up to 1.1 fb-1 of integrated luminosity collected by the CDF II experiment at the Tevatron ppbar collider at a center-of-mass energy of 1.96 TeV. The search is conducted by analyzing events with a large transverse momentum imbalance and either three charged leptons or two charged leptons of the same electric charge. The numbers of observed events are found to be consistent with standard model expectations. Upper limits on the production cross section are derived in different theoretical models. In one of these models a lower limit on the mass of the chargino is set at 129 GeV/c^2 at the 95% confidence level.

  10. Production of psi(2S) Mesons in p anti-p Collisions at 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Aaltonen, T.; /Helsinki Inst. of Phys.; Adelman, Jahred A.; /Chicago U., EFI; Akimoto, T.; /Tsukuba U.; Alvarez Gonzalez, B.; /Cantabria Inst. of Phys.; Amerio, S.; /INFN, Padua; Amidei, Dante E.; /Michigan U.; Anastassov, A.; /Northwestern U.; Annovi, Alberto; /Frascati; Antos, Jaroslav; /Comenius U.; Apollinari, G.; /Fermilab; Apresyan, A.; /Purdue U. /Waseda U.

    2009-05-01

    The authors have measured the differential cross section for the inclusive production of {psi}(2S) mesons decaying to {mu}{sup +}{mu}{sup -} that were produced in prompt or B-decay processes from p{bar p} collisions at 1.96 TeV. These measurements have been made using a data set from an integrated luminosity of 1.1 fb{sup -1} collected by the CDF II detector at Fermilab. For events with transverse momentum p{sub T}({psi}(2S)) > 2 GeV/c and rapidity |y({psi}(2S))| < 0.6 we measure the integrated inclusive cross section {sigma}(p{bar p} {yields} {psi}(2S)X) {center_dot} Br({psi}(2S) {yields} {mu}{sup +}{mu}{sup -}) to be 3.29 {+-} 0.04(stat.) {+-} 0.32(syst.) nb.

  11. Fission excitation function for 19F + 194,196,198Pt at near and above barrier energies

    Directory of Open Access Journals (Sweden)

    Singh Varinderjit

    2015-01-01

    Full Text Available Fission excitation functions for 19F + 194,196,198Pt reactions populating 213,215,217Fr compound nuclei are reported. Out of these three compound nuclei, 213Fr is a shell closed (N=126 compound nucleus and the other two are away from the shell closure. From a comparison of the experimental fission cross-sections with the statistical model predictions, it is observed that the fission cross-sections are underestimated by the statistical model predictions using shell corrected finite range rotating liquid drop model (FRLDM fission barriers. Further the FRLDM fission barriers are reduced to fit the fission cross-sections over the entire measured energy range.

  12. Search for a heavy toplike quark in pp collisions at √s=1.96 TeV.

    Science.gov (United States)

    Aaltonen, T; Álvarez González, B; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Apollinari, G; Appel, J A; Apresyan, A; Arisawa, T; Artikov, A; Asaadi, J; Ashmanskas, W; Auerbach, B; Aurisano, A; Azfar, F; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Barria, P; Bartos, P; Bauce, M; Bauer, G; Bedeschi, F; Beecher, D; Behari, S; Bellettini, G; Bellinger, J; Benjamin, D; Beretvas, A; Bhatti, A; Binkley, M; Bisello, D; Bizjak, I; Bland, K R; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Brigliadori, L; Brisuda, A; Bromberg, C; Brucken, E; Bucciantonio, M; Budagov, J; Budd, H S; Budd, S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Cabrera, S; Calancha, C; Camarda, S; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carls, B; Carlsmith, D; Carosi, R; Carrillo, S; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavaliere, V; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, K; Chokheli, D; Chou, J P; Chung, W H; Chung, Y S; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Compostella, G; Convery, M E; Conway, J; Corbo, M; Cordelli, M; Cox, C A; Cox, D J; Crescioli, F; Cuenca Almenar, C; Cuevas, J; Culbertson, R; Dagenhart, D; d'Ascenzo, N; Datta, M; de Barbaro, P; De Cecco, S; De Lorenzo, G; Dell'Orso, M; Deluca, C; Demortier, L; Deng, J; Deninno, M; Devoto, F; d'Errico, M; Di Canto, A; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Donati, S; Dong, P; Dorigo, T; Ebina, K; Elagin, A; Eppig, A; Erbacher, R; Errede, D; Errede, S; Ershaidat, N; Eusebi, R; Fang, H C; Farrington, S; Feindt, M; Fernandez, J P; Ferrazza, C; Field, R; Flanagan, G; Forrest, R; Frank, M J; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; Garcia, J E; Garfinkel, A F; Garosi, P; Gerberich, H; Gerchtein, E; Giagu, S; Giakoumopoulou, V; Giannetti, P; Gibson, K; Ginsburg, C M; Giokaris, N; Giromini, P; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldin, D; Goldschmidt, N; Golossanov, A; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Grinstein, S; Grosso-Pilcher, C; Group, R C; Guimaraes da Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, S R; Halkiadakis, E; Hamaguchi, A; Han, J Y; Happacher, F; Hara, K; Hare, D; Hare, M; Harr, R F; Hatakeyama, K; Hays, C; Heck, M; Heinrich, J; Herndon, M; Hewamanage, S; Hidas, D; Hocker, A; Hopkins, W; Horn, D; Hou, S; Hughes, R E; Hurwitz, M; Husemann, U; Hussain, N; Hussein, M; Huston, J; Introzzi, G; Iori, M; Ivanov, A; James, E; Jang, D; Jayatilaka, B; Jeon, E J; Jha, M K; Jindariani, S; Johnson, W; Jones, M; Joo, K K; Jun, S Y; Junk, T R; Kamon, T; Karchin, P E; Kato, Y; Ketchum, W; Keung, J; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, H W; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Klimenko, S; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kreps, M; Kroll, J; Krop, D; Krumnack, N; Kruse, M; Krutelyov, V; Kuhr, T; Kurata, M; Kwang, S; Laasanen, A T; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; LeCompte, T; Lee, E; Lee, H S; Lee, J S; Lee, S W; Leo, S; Leone, S; Lewis, J D; Lin, C-J; Linacre, J; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, C; Liu, Q; Liu, T; Lockwitz, S; Lockyer, N S; Loginov, A; Lucchesi, D; Lueck, J; Lujan, P; Lukens, P; Lungu, G; Lys, J; Lysak, R; Madrak, R; Maeshima, K; Makhoul, K; Maksimovic, P; Malik, S; Manca, G; Manousakis-Katsikakis, A; Margaroli, F; Marino, C; Martínez, M; Martínez-Ballarín, R; Mastrandrea, P; Mathis, M; Mattson, M E; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtala, P; Menzione, A; Mesropian, C; Miao, T; Mietlicki, D; Mitra, A; Miyake, H; Moed, S; Moggi, N; Mondragon, M N; Moon, C S; Moore, R; Morello, M J; Morlock, J; Movilla Fernandez, P; Mukherjee, A; Muller, Th; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Naganoma, J; Nakano, I; Napier, A; Nett, J; Neu, C; Neubauer, M S; Nielsen, J; Nodulman, L; Norniella, O; Nurse, E; Oakes, L; Oh, S H; Oh, Y D; Oksuzian, I; Okusawa, T; Orava, R; Ortolan, L; Pagan Griso, S; Pagliarone, C; Palencia, E; Papadimitriou, V; Paramonov, A A; Patrick, J; Pauletta, G; Paulini, M; Paus, C; Pellett, D E; Penzo, A; Phillips, T J; Piacentino, G; Pianori, E; Pilot, J; Pitts, K; Plager, C; Pondrom, L; Potamianos, K; Poukhov, O; Prokoshin, F; Pronko, A; Ptohos, F; Pueschel, E; Punzi, G; Pursley, J; Rahaman, A; Ramakrishnan, V; Ranjan, N; Redondo, I; Renton, P; Rescigno, M; Rimondi, F; Ristori, L; Robson, A; Rodrigo, T; Rodriguez, T; Rogers, E; Rolli, S; Roser, R; Rossi, M; Ruffini, F; Ruiz, A; Russ, J; Rusu, V; Safonov, A; Sakumoto, W K; Santi, L; Sartori, L; Sato, K; Saveliev, V; Savoy-Navarro, A; Schlabach, P; Schmidt, A; Schmidt, E E; Schmidt, M P; Schmitt, M; Schwarz, T; Scodellaro, L; Scribano, A; Scuri, F; Sedov, A; Seidel, S; Seiya, Y; Semenov, A; Sforza, F; Sfyrla, A; Shalhout, S Z; Shears, T; Shepard, P F; Shimojima, M; Shiraishi, S; Shochet, M; Shreyber, I; Simonenko, A; Sinervo, P; Sissakian, A; Sliwa, K; Smith, J R; Snider, F D; Soha, A; Somalwar, S; Sorin, V; Squillacioti, P; Stanitzki, M; St Denis, R; Stelzer, B; Stelzer-Chilton, O; Stentz, D; Strologas, J; Strycker, G L; Sudo, Y; Sukhanov, A; Suslov, I; Takemasa, K; Takeuchi, Y; Tang, J; Tecchio, M; Teng, P K; Thom, J; Thome, J; Thompson, G A; Thomson, E; Ttito-Guzmán, P; Tkaczyk, S; Toback, D; Tokar, S; Tollefson, K; Tomura, T; Tonelli, D; Torre, S; Torretta, D; Totaro, P; Trovato, M; Tu, Y; Turini, N; Ukegawa, F; Uozumi, S; Varganov, A; Vataga, E; Vázquez, F; Velev, G; Vellidis, C; Vidal, M; Vila, I; Vilar, R; Vogel, M; Volpi, G; Wagner, P; Wagner, R L; Wakisaka, T; Wallny, R; Wang, S M; Warburton, A; Waters, D; Weinberger, M; Wester, W C; Whitehouse, B; Whiteson, D; Wicklund, A B; Wicklund, E; Wilbur, S; Wick, F; Williams, H H; Wilson, J S; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolfe, H; Wright, T; Wu, X; Wu, Z; Yamamoto, K; Yamaoka, J; Yang, T; Yang, U K; Yang, Y C; Yao, W-M; Yeh, G P; Yi, K; Yoh, J; Yorita, K; Yoshida, T; Yu, G B; Yu, I; Yu, S S; Yun, J C; Zanetti, A; Zeng, Y; Zucchelli, S

    2011-12-23

    We present the results of a search for pair production of a heavy toplike (t') quark decaying to Wq final states using data corresponding to an integrated luminosity of 5.6 fb(-1) collected by the CDF II detector in pp collisions at √s=1.96 TeV. We perform parallel searches for t'→Wb and t'→Wq (where q is a generic down-type quark) in events containing a lepton and four or more jets. By performing a fit to the two-dimensional distribution of total transverse energy versus reconstructed t' quark mass, we set upper limits on the t't' production cross section and exclude a standard model fourth-generation t' quark decaying to Wb (Wq) with mass below 358 (340) GeV/c(2) at 95% C.L.

  13. Search for long-lived massive charged particles in 1.96 TeV pp collisions.

    Science.gov (United States)

    Aaltonen, T; Adelman, J; Akimoto, T; Alvarez González, B; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Apollinari, G; Apresyan, A; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Aurisano, A; Azfar, F; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Barria, P; Bartsch, V; Bauer, G; Beauchemin, P-H; Bedeschi, F; Beecher, D; Behari, S; Bellettini, G; Bellinger, J; Benjamin, D; Beretvas, A; Beringer, J; Bhatti, A; Binkley, M; Bisello, D; Bizjak, I; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bolla, G; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Bridgeman, A; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, J; Budd, H S; Budd, S; Burke, S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Byrum, K L; Cabrera, S; Calancha, C; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carls, B; Carlsmith, D; Carosi, R; Carrillo, S; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavaliere, V; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, K; Chokheli, D; Chou, J P; Choudalakis, G; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Chwalek, T; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Compostella, G; Convery, M E; Conway, J; Cordelli, M; Cortiana, G; Cox, C A; Cox, D J; Crescioli, F; Cuenca Almenar, C; Cuevas, J; Culbertson, R; Cully, J C; Dagenhart, D; Datta, M; Davies, T; de Barbaro, P; De Cecco, S; Deisher, A; De Lorenzo, G; Dell'orso, M; Deluca, C; Demortier, L; Deng, J; Deninno, M; Derwent, P F; Di Canto, P; di Giovanni, G P; Dionisi, C; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Donati, S; Dong, P; Donini, J; Dorigo, T; Dube, S; Efron, J; Elagin, A; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, W T; Feild, R G; Feindt, M; Fernandez, J P; Ferrazza, C; Field, R; Flanagan, G; Forrest, R; Frank, M J; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; Garberson, F; Garcia, J E; Garfinkel, A F; Garosi, P; Genser, K; Gerberich, H; Gerdes, D; Gessler, A; Giagu, S; Giakoumopoulou, V; Giannetti, P; Gibson, K; Gimmell, J L; Ginsburg, C M; Giokaris, N; Giordani, M; Giromini, P; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Golossanov, A; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Grinstein, S; Grosso-Pilcher, C; Grundler, U; Guimaraes da Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Han, B-Y; Han, J Y; Happacher, F; Hara, K; Hare, D; Hare, M; Harper, S; Harr, R F; Harris, R M; Hartz, M; Hatakeyama, K; Hays, C; Heck, M; Heijboer, A; Heinrich, J; Henderson, C; Herndon, M; Heuser, J; Hewamanage, S; Hidas, D; Hill, C S; Hirschbuehl, D; Hocker, A; Hou, S; Houlden, M; Hsu, S-C; Huffman, B T; Hughes, R E; Husemann, U; Hussein, M; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ivanov, A; James, E; Jang, D; Jayatilaka, B; Jeon, E J; Jha, M K; Jindariani, S; Johnson, W; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Kar, D; Karchin, P E; Kato, Y; Kephart, R; Keung, J; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, H W; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Knuteson, B; Ko, B R; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kreps, M; Kroll, J; Krop, D; Krumnack, N; Kruse, M; Krutelyov, V; Kubo, T; Kuhr, T; Kulkarni, N P; Kurata, M; Kwang, S; Laasanen, A T; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; Lecompte, T; Lee, E; Lee, H S; Lee, S W; Leone, S; Lewis, J D; Lin, C-S; Linacre, J; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, C; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Lovas, L; Lucchesi, D; Luci, C; Lueck, J; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Macqueen, D; Madrak, R; Maeshima, K; Makhoul, K; Maki, T; Maksimovic, P; Malde, S; Malik, S; Manca, G; Manousakis-Katsikakis, A; Margaroli, F; Marino, C; Marino, C P; Martin, A; Martin, V; Martínez, M; Martínez-Ballarín, R; Maruyama, T; Mastrandrea, P; Masubuchi, T; Mathis, M; Mattson, M E; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtala, P; Menzione, A; Merkel, P; Mesropian, C; Miao, T; Miladinovic, N; Miller, R; Mills, C; Milnik, M; Mitra, A; Mitselmakher, G; Miyake, H; Moggi, N; Moon, C S; Moore, R; Morello, M J; Morlock, J; Movilla Fernandez, P; Mülmenstädt, J; Mukherjee, A; Muller, Th; Mumford, R; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Nagano, A; Naganoma, J; Nakamura, K; Nakano, I; Napier, A; Necula, V; Nett, J; Neu, C; Neubauer, M S; Neubauer, S; Nielsen, J; Nodulman, L; Norman, M; Norniella, O; Nurse, E; Oakes, L; Oh, S H; Oh, Y D; Oksuzian, I; Okusawa, T; Orava, R; Osterberg, K; Pagan Griso, S; Palencia, E; Papadimitriou, V; Papaikonomou, A; Paramonov, A A

    2009-07-10

    We performed a signature-based search for long-lived charged massive particles produced in 1.0 fb-1 of pp[over ] collisions at sqrt[s]=1.96 TeV, collected with the CDF II detector using a high transverse-momentum (pT) muon trigger. The search used time of flight to isolate slowly moving, high-pT particles. One event passed our selection cuts with an expected background of 1.9+/-0.2 events. We set an upper bound on the production cross section and, interpreting this result within the context of a stable scalar top-quark model, set a lower limit on the particle mass of 249 GeV/c2 at 95% C.L. PMID:19659197

  14. Direct measurement of the W Boson width in ppover collisions at square roots = 1.96 TeV.

    Science.gov (United States)

    Aaltonen, T; Adelman, J; Akimoto, T; Albrow, M G; González, B Alvarez; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Apresyan, A; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Aurisano, A; Azfar, F; Azzi-Bacchetta, P; Azzurri, P; Bacchetta, N; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Baroiant, S; Bartsch, V; Bauer, G; Beauchemin, P-H; Bedeschi, F; Bednar, P; Beecher, D; Behari, S; Bellettini, G; Bellinger, J; Belloni, A; Benjamin, D; Beretvas, A; Beringer, J; Berry, T; Bhatti, A; Binkley, M; Bisello, D; Bizjak, I; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bolla, G; Bolshov, A; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Bridgeman, A; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, J; Budd, H S; Budd, S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Byrum, K L; Cabrera, S; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carlsmith, D; Carosi, R; Carrillo, S; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, K; Chokheli, D; Chou, J P; Choudalakis, G; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Compostella, G; Convery, M E; Conway, J; Cooper, B; Copic, K; Cordelli, M; Cortiana, G; Crescioli, F; Almenar, C Cuenca; Cuevas, J; Culbertson, R; Cully, J C; Dagenhart, D; Datta, M; Davies, T; de Barbaro, P; De Cecco, S; Deisher, A; De Lentdecker, G; De Lorenzo, G; Dell'orso, M; Demortier, L; Deng, J; Deninno, M; De Pedis, D; Derwent, P F; Giovanni, G P Di; Dionisi, C; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Donati, S; Dong, P; Donini, J; Dorigo, T; Dube, S; Efron, J; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, W T; Feild, R G; Feindt, M; Fernandez, J P; Ferrazza, C; Field, R; Flanagan, G; Forrest, R; Forrester, S; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; Garberson, F; Garcia, J E; Garfinkel, A F; Gerberich, H; Gerdes, D; Giagu, S; Giakoumopolou, V; Giannetti, P; Gibson, K; Gimmell, J L; Ginsburg, C M; Giokaris, N; Giordani, M; Giromini, P; Giunta, M; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Golossanov, A; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Grinstein, S; Grosso-Pilcher, C; Grundler, U; da Costa, J Guimaraes; Gunay-Unalan, Z; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Hamilton, A; Han, B-Y; Han, J Y; Handler, R; Happacher, F; Hara, K; Hare, D; Hare, M; Harper, S; Harr, R F; Harris, R M; Hartz, M; Hatakeyama, K; Hauser, J; Hays, C; Heck, M; Heijboer, A; Heinemann, B; Heinrich, J; Henderson, C; Herndon, M; Heuser, J; Hewamanage, S; Hidas, D; Hill, C S; Hirschbuehl, D; Hocker, A; Hou, S; Houlden, M; Hsu, S-C; Huffman, B T; Hughes, R E; Husemann, U; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ivanov, A; Iyutin, B; James, E; Jayatilaka, B; Jeans, D; Jeon, E J; Jindariani, S; Johnson, W; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Kar, D; Karchin, P E; Kato, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Klute, M; Knuteson, B; Ko, B R; Koay, S A; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kraus, J; Kreps, M; Kroll, J; Krumnack, N; Kruse, M; Krutelyov, V; Kubo, T; Kuhlmann, S E; Kuhr, T; Kulkarni, N P; Kusakabe, Y; Kwang, S; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; Lecompte, T; Lee, J; Lee, J; Lee, Y J; Lee, S W; Lefèvre, R; Leonardo, N; Leone, S; Levy, S; Lewis, J D; Lin, C; Lin, C S; Linacre, J; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Lovas, L; Lu, R-S; Lucchesi, D; Lueck, J; Luci, C; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Lytken, E; Mack, P; Macqueen, D; Madrak, R; Maeshima, K; Makhoul, K; Maki, T; Maksimovic, P; Malde, S; Malik, S; Manca, G; Manousakis, A; Margaroli, F; Marino, C; Marino, C P; Martin, A; Martin, M; Martin, V; Martínez, M; Martínez-Ballarín, R; Maruyama, T; Mastrandrea, P; Masubuchi, T; Mattson, M E; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtala, P; Menzemer, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Miao, T; Miladinovic, N; Miles, J; Miller, R; Mills, C; Milnik, M; Mitra, A; Mitselmakher, G; Miyake, H; Moed, S; Moggi, N; Moon, C S; Moore, R; Morello, M; Fernandez, P Movilla; Mülmenstädt, J; Mukherjee, A; Muller, Th; Mumford, R; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Nagano, A; Naganoma, J; Nakamura, K; Nakano, I; Napier, A; Necula, V; Neu, C; Neubauer, M S; Nielsen, J; Nodulman, L; Norman, M; Norniella, O; Nurse, E; Oh, S H

    2008-02-22

    A direct measurement of the total decay width of the W boson Gamma(W) is presented using 350 pb(-1) of data from pp[over ] collisions at square root s = 1.96 TeV collected with the CDF II detector at the Fermilab Tevatron. The width is determined by normalizing predicted signal and background distributions to 230 185 W candidates decaying to enu and micronu in the transverse-mass region 50

  15. Search for electroweak single top quark production in ppbar collisions at sqrt{s}=1.96 TeV

    CERN Document Server

    Acosta, D; Affolder, T; Akimoto, T; Albrow, M G; Ambrose, D; Amerio, S; Amidei, D; Anastassov, A; Anikeev, K; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Arisawa, T; Arguin, J F; Artikov, A; Ashmanskas, W; Attal, A; Azfar, F; Azzi-Bacchetta, P; Bacchetta, N; Bachacou, H; Badgett, W; Barbaro-Galtieri, A; Barker, G J; Barnes, V E; Barnett, B A; Baroiant, S; Barone, M; Bauer, G; Bedeschi, F; Behari, S; Belforte, S; Bellettini, G; Bellinger, J; Ben-Haim, E; Benjamin, D; Beretvas, A; Bhatti, A A; Binkley, M; Bisello, D; Bishai, M; Blair, R E; Blocker, C; Bloom, K; Blumenfeld, B; Bocci, A; Bodek, A; Bölla, G; Bolshov, A; Booth, P S L; Bortoletto, D; Boudreau, J; Bourov, S; Bromberg, C; Brubaker, E; Budagov, Yu A; Budd, H S; Burkett, K; Busetto, G; Bussey, P; Byrum, K L; Cabrera, S; Campanelli, M; Campbell, M; Canepa, A; Casarsa, M; Carlsmith, D; Carron, S; Carosi, R; Cavalli-Sforza, M; Castro, A; Catastini, P; Cauz, D; Cerri, A; Cerrito, L; Chapman, J; Chen, C; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, I; Cho, K; Chokheli, D; Chou, J P; Chu, M L; Chuang, S; Chung, J Y; Chung, W H; Chung, Y S; Ciobanu, C I; Ciocci, M A; Clark, A G; Clark, D; Coca, M; Connolly, A; Convery, M; Conway, J; Cooper, B; Cordelli, M; Cortiana, G; Cranshaw, J; Cuevas-Maestro, J; Culbertson, R; Currat, C; Cyr, D; Dagenhart, D; Da Ronco, S; D'Auria, S; De Barbaro, P; De Cecco, S; De Lentdecker, G; Dell'Agnello, S; Dell'Orso, Mauro; Demers, S; Demortier, L; Deninno, M; De Pedis, D; Derwent, P F; Dionisi, C; Dittmann, J R; Doksus, P; Dominguez, A; Donati, S; Donega, M; Donini, J; D'Onofrio, M; Dorigo, T; Drollinger, V; Ebina, K; Eddy, N; Ely, R; Erbacher, R; Erdmann, M; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, I; Fedorko, W T; Feild, R G; Feindt, M; Fernández, J P; Ferretti, C; Field, R D; Flanagan, G; Flaugher, B; Flores-Castillo, L R; Foland, A; Forrester, S; Foster, G W; Franklin, M; Freeman, J C; Fujii, Y; Furic, I; Gajjar, A; Gallas, A; Galyardt, J; Gallinaro, M; García-Sciveres, M; Garfinkel, A F; Gay, C; Gerberich, H; Gerdes, D W; Gerchtein, E; Giagu, S; Giannetti, P; Gibson, A; Gibson, K; Ginsburg, C; Giolo, K; Giordani, M; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Goldstein, D; Goldstein, J; Gómez, G; Gómez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Gotra, Yu; Goulianos, K; Gresele, A; Griffiths, M; Grosso-Pilcher, C; Grundler, U; Günther, M; Guimarães da Costa, J; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Hamilton, A; Han, B Y; Handler, R; Happacher, F; Hara, K; Hare, M; Harr, R F; Harris, R M; Hartmann, F; Hatakeyama, K; Hauser, J; Hays, C; Hayward, H; Heider, E; Heinemann, B; Heinrich, J; Hennecke, M; Herndon, M; Hill, C; Hirschbuehl, D; Höcker, A; Hoffman, K D; Holloway, A; Hou, S; Houlden, M A; Huffman, B T; Huang, Y; Hughes, R E; Huston, J; Ikado, K; Incandela, J R; Introzzi, G; Iori, M; Ishizawa, Y; Issever, C; Ivanov, A; Iwata, Y; Iyutin, B; James, E; Jang, D; Jarrell, J; Jeans, D; Jensen, H; Jeon, E J; Jones, M; Joo, K K; Jun, S; Junk, T R; Kamon, T; Kang, J; Karagoz-Unel, M; Karchin, P E; Kartal, S; Kato, Y; Kemp, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, M S; Kim, S B; Kim, S H; Kim, T H; Kim, Y K; King, B T; Kirby, M; Kirsch, L; Klimenko, S; Knuteson, B; Ko, B R; Kobayashi, H; Koehn, P; Kong, D J; Kondo, K; Konigsberg, J; Kordas, K; Korn, A J; Korytov, A; Kotelnikov, K; Kotwal, A V; Kovalev, A; Kraus, J; Kravchenko, I; Kreymer, A; Kroll, J; Kruse, M; Krutelyov, V; Kuhlmann, S E; Kuznetsova, N; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, J; Lancaster, M; Lander, R; Lannon, K; Lath, A; Latino, G; Lauhakangas, R; Lazzizzera, I; Le, Y; Lecci, C; LeCompte, T; Lee, J; Lee, S W; Lefèvre, R; Leonardo, N; Leone, S; Lewis, J D; Li, K; Lin, C; Lin, C S; Lindgren, M; Liss, T M; Litvintsev, D O; Liu, T; Liu, Y; Lockyer, N S; Loginov, A; Loreti, M; Loverre, P F; Lu, R S; Lucchesi, D; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; MacQueen, D; Madrak, R; Maeshima, K; Maksimovic, P; Malferrari, L; Manca, G; Marginean, R; Martin, M; Martin, A; Martin, V; Martínez, M; Maruyama, T; Matsunaga, H; Mattson, M; Mazzanti, P; McFarland, K S; McGivern, D; McIntyre, P M; McNamara, P; NcNulty, R; Menzemer, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Miao, T; Miladinovic, N; Miller, L; Miller, R; Miller, J S; Miquel, R; Miscetti, S; Mitselmakher, G; Miyamoto, A; Miyazaki, Y; Moggi, N; Mohr, B; Moore, R; Morello, M; Mukherjee, A; Mulhearn, M; Müller, T; Mumford, R; Munar, A; Murat, P; Nachtman, J; Nahn, S; Nakamura, I; Nakano, I; Napier, A; Napora, R; Naumov, D V; Necula, V; Niell, F; Nielsen, J; Nelson, C; Nelson, T; Neu, C; Neubauer, M S; Newman-Holmes, C; Nicollerat, A S; Nigmanov, T; Nodulman, L; Norniella, O; Österberg, K; Ogawa, T; Oh, S H; Oh, Y D; Ohsugi, T; Okusawa, T; Oldeman, R G C; Orava, R; Orejudos, W; Pagliarone, C; Palencia, E; Paoletti, R; Papadimitriou, V; Pashapour, S; Patrick, J; Pauletta, G; Paulini, M; Pauly, T; Paus, C; Pellett, D; Penzo, Aldo L; Phillips, T J; Piacentino, G; Piedra, J; Pitts, K T; Plager, C; Pompos, A; Pondrom, L; Pope, G; Poukhov, O; Prakoshyn, F; Pratt, T; Pronko, A; Proudfoot, J; Ptohos, F; Punzi, G; Rademacker, J; Rakitine, A; Rappoccio, S; Ratnikov, F; Ray, H; Reichold, A; Reisert, B; Rekovic, V; Renton, P B; Rescigno, M; Rimondi, F; Rinnert, K; Ristori, L; Robertson, W J; Robson, A; Rodrigo, T; Rolli, S; Rosenson, L; Roser, R; Rossin, R; Rott, C; Russ, J; Rusu, V; Ruiz, A; Ryan, D; Saarikko, H; Sabik, S; Safonov, A; Saint-Denis, R; Sakumoto, W K; Salamanna, G; Saltzberg, D; Sánchez, C; Sansoni, A; Santi, L; Sarkar, S; Sato, K; Savard, P; Savoy-Navarro, A; Schlabach, P; Schmidt, E E; Schmidt, M P; Schmitt, M; Scodellaro, L; Scribano, A; Scuri, F; Sedov, A; Seidel, S; Seiya, Y; Semeria, F; Sexton-Kennedy, L; Sfiligoi, I; Shapiro, M D; Shears, T G; Shepard, P F; Sherman, D; Shimojima, M; Shochet, M; Shon, Y; Shreyber, I; Sidoti, A; Siegrist, J; Siket, M; Sill, A; Sinervo, P; Sissakian, A N; Skiba, A; Slaughter, A J; Sliwa, K; Smirnov, D; Smith, J R; Snider, F D; Snihur, R; Soha, A; Somalwar, S V; Spalding, J; Spezziga, M; Spiegel, L; Spinella, F; Spiropulu, M; Squillacioti, P; Stadie, H; Stelzer, B; Stelzer-Chilton, O; Strologas, J; Stuart, D; Sukhanov, A; Sumorok, K; Sun, H; Suzuki, T; Taffard, A C; Tafirout, R; Takach, S F; Takano, H; Takashima, R; Takeuchi, Y; Takikawa, K; Tanaka, M; Tanaka, R; Tanimoto, N; Tapprogge, Stefan; Tecchio, M; Teng, P K; Terashi, K; Tesarek, R J; Tether, S; Thom, J; Thompson, A S; Thomson, E; Tipton, P; Tiwari, V; Tkaczyk, S; Toback, D; Tollefson, K; Tomura, T; Tonelli, D; Tonnesmann, M; Torre, S; Torretta, D; Tourneur, S; Trischuk, W; Tseng, J; Tsuchiya, R; Tsuno, S; Tsybychev, D; Turini, N; Turner, M; Ukegawa, F; Unverhau, T; Uozumi, S; Usynin, D; Vacavant, L; Vaiciulis, A W; Varganov, A; Vataga, E; Vejcik, S; Velev, G V; Veszpremi, V; Veramendi, G; Vickey, T; Vidal, R; Vila, I; Vilar, R; Vollrath, I; Volobuev, I P; Von der Mey, M; Wagner, P; Wagner, R G; Wagner, R L; Wagner, W; Wallny, R; Walter, T; Yamashita, T; Yamamoto, K; Wan, Z; Wang, M J; Wang, S M; Warburton, A; Ward, B; Waschke, S; Waters, D; Watts, T; Weber, M; Wester, W C; Whitehouse, B; Wicklund, A B; Wicklund, E; Williams, H H; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolter, M; Worcester, M; Worm, S; Wright, T; Wu, X; Würthwein, F; Wyatt, A; Yagil, A; Yang, U K; Yao, W; Yeh, G P; Yi, K; Yoh, J; Yoon, P; Yorita, K; Yoshida, T; Yu, I; Yu, S; Yu, Z; Yun, J C; Zanello, L; Zanetti, A; Zaw, I; Zetti, F; Zhou, J; Zsenei, A; Zucchelli, S

    2004-01-01

    We report on a search for Standard Model t-channel and s-channel single top quark production in ppbar collisions at a center of mass energy of 1.96 TeV. We use a data sample corresponding to 162 pb^{-1} recorded by the upgraded Collider Detector at Fermilab. We find no significant evidence for electroweak top quark production and set upper limits at the 95% confidence level on the production cross section, consistent with the Standard Model: 10.1 pb for the t-channel, 13.6 pb for the s-channel and 17.8 pb for the combined cross section of t- and s-channel.

  16. Double parton interactions in photon+3 jet events in ppbar collisions sqrt{s}=1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abazov, V.M.; /Dubna, JINR; Abbott, B.; /Oklahoma U.; Abolins, M.; /Michigan State U.; Acharya, B.S.; /Tata Inst.; Adams, M.; /Illinois U., Chicago; Adams, T.; /Florida State U.; Aguilo, E.; /Simon Fraser U. /York U., Canada; Alexeev, G.D.; /Dubna, JINR; Alkhazov, G.; /St. Petersburg, INP; Alton, A.; /Michigan State U.; Alverson, G.; /Northeastern U. /Rio de Janeiro, CBPF

    2009-12-01

    We have used a sample of photon+3 jets events collected by the D0 experiment with an integrated luminosity of about 1 fb{sup -1} to determine the fraction of events with double parton scattering (f{sub DP}) in a single ppbar collision at {radical}s = 1.96 TeV. The DP fraction and effective cross section (sigma{sub eff}), a process-independent scale parameter related to the parton density inside the nucleon, are measured in three intervals of the second (ordered in p{sub T}) jet transverse momentum pT{sub jet2} within the range 15 < pT{sub jet2} < 30 GeV. In this range, f{sub DP} varies between 0.23 < f{sub DP} < 0.47, while sigma{sub eff} has the average value sigma{sub effave} = 16.4 {+-} 0.3(stat) {+-} 2.3(syst) mb.

  17. Limits on Anomalous Triple Gauge Couplings in ppbar Collisions at sqrt{s}=1.96 TeV

    CERN Document Server

    Aaltonen, T; Adelman, J; Affolder, T; Akimoto, T; Albrow, M G; Amerio, S; Amidei, D; Anastassov, A; Anikeev, K; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Aurisano, A; Azfar, F; Azzi-Bacchetta, P; Azzurri, P; Bacchetta, N; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Baroiant, S; Bartsch, V; Bauer, G; Beauchemin, P H; Bedeschi, F; Behari, S; Bellettini, G; Bellinger, J; Belloni, A; Benjamin, D; Beretvas, A; Beringer, J; Berry, T; Bhatti, A; Binkley, M; Bisello, D; Bizjak, I; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bölla, G; Bolshov, A; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, Yu A; Budd, H S; Budd, S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Byrum, K L; Cabrera, S; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carillo, S; Carlsmith, D; Carosi, R; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, I; Cho, K; Chokheli, D; Chou, J P; Choudalakis, G; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Cilijak, M; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Coca, M; Compostella, G; Convery, M E; Conway, J; Cooper, B; Copic, K; Cordelli, M; Cortiana, G; Crescioli, F; Cuenca-Almenar, C; Cuevas-Maestro, J; Culbertson, R; Cully, J C; Da Ronco, S; Datta, M; D'Auria, S; Davies, T; Dagenhart, D; De Barbaro, P; De Cecco, S; Deisher, A; De Lentdecker, G; De Lorenzo, G; Dell'Orso, Mauro; Delli Paoli, F; Demortier, L; Deng, J; Deninno, M; De Pedis, D; Derwent, P F; Di Giovanni, G P; Dionisi, C; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Dorr, C; Donati, S; Dong, P; Donini, J; Dorigo, T; Dube, S; Efron, J; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, I; Fedorko, W T; Feild, R G; Feindt, M; Fernández, J P; Field, R; Flanagan, G; Forrest, R; Forrester, S; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; García, J E; Garberson, F; Garfinkel, A F; Gay, C; Gerberich, H; Gerdes, D; Giagu, S; Giannetti, P; Gibson, K; Gimmell, J L; Ginsburg, C; Giokaris, N; Giordani, M; Giromini, P; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Goldstein, J; Golossanov, A; Gómez, G; Gómez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Grinstein, S; Grosso-Pilcher, C; Group, R C; Grundler, U; Guimarães da Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Hamilton, A; Han, B Y; Han, J Y; Handler, R; Happacher, F; Hara, K; Hare, D; Hare, M; Harper, S; Harr, R F; Harris, R M; Hartz, M; Hatakeyama, K; Hauser, J; Hays, C; Heck, M; Heijboer, A; Heinemann, B; Heinrich, J; Henderson, C; Herndon, M; Heuser, J; Hidas, D; Hill, C S; Hirschbuehl, D; Höcker, A; Holloway, A; Hou, S; Houlden, M; Hsu, S C; Huffman, B T; Hughes, R E; Husemann, U; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ivanov, A; Iyutin, B; James, E; Jang, D; Jayatilaka, B; Jeans, D; Jeon, E J; Jindariani, S; Johnson, W; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Karchin, P E; Kato, Y; Kemp, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Klute, M; Knuteson, B; Ko, B R; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kraan, A C; Kraus, J; Kreps, M; Kroll, J; Krumnack, N; Kruse, M; Krutelyov, V; Kubo, T; Kuhlmann, S E; Kuhr, T; Kulkarni, N P; Kusakabe, Y; Kwang, S; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; LeCompte, T; Lee, J; Lee, J; Lee, Y J; Lee, S W; Lefèvre, R; Leonardo, N; Leone, S; Levy, S; Lewis, J D; Lin, C; Lin, C S; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Lu, R S; Lucchesi, D; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Lytken, E; Mack, P; MacQueen, D; Madrak, R; Maeshima, K; Makhoul, K; Mäki, T; Maksimovic, P; Malde, S; Malik, S; Manca, G; Manousakis, A; Margaroli, F; Marginean, R; Marino, C; Marino, C P; Martin, A; Martin, M; Martin, V; Martínez, M; Martinez-Ballarin, R; Maruyama, T; Mastrandrea, P; Masubuchi, T; Matsunaga, H; Mattson, M E; Mazini, R; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtälä, P; Menzemer, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Miao, T; Miladinovic, N; Miles, J; Miller, R; Mills, C; Milnik, M; Mitra, A; Mitselmakher, G; Miyamoto, A; Moed, S; Moggi, N; Mohr, B; Moon, C S; Moore, R; Morello, M; Movilla-Fernández, P A; Mülmenstädt, J; Mukherjee, A; Müller, T; Mumford, R; Murat, P; Mussini, M; Nachtman, J; Nagano, A; Naganoma, J; Nakamura, K; Nakano, I; Napier, A; Necula, V; Neu, C; Neubauer, M S; Nielsen, J; Nodulman, L; Norniella, O; Nurse, E; Oh, S H; Oh, Y D; Oksuzian, I; Okusawa, T; Oldeman, R; Orava, R; Österberg, K; Pagliarone, C; Palencia, E; Papadimitriou, V; Papaikonomou, A; Paramonov, A A; Parks, B; Pashapour, S; Patrick, J; Pauletta, G; Paulini, M; Paus, C; Pellett, D E; Penzo, Aldo L; Phillips, T J; Piacentino, G; Piedra, J; Pinera, L; Pitts, K; Plager, C; Pondrom, L; Portell, X; Poukhov, O; Pounder, N; Prakoshyn, F; Pronko, A; Proudfoot, J; Ptohos, F; Punzi, G; Pursley, J; Rademacker, J; Rahaman, A; Ramakrishnan, V; Ranjan, N; Redondo, I; Reisert, B; Rekovic, V; Renton, P B; Rescigno, M; Richter, S; Rimondi, F; Ristori, L; Robson, A; Rodrigo, T; Rogers, E; Rolli, S; Roser, R; Rossi, M; Rossin, R; Roy, P; Ruiz, A; Russ, J; Rusu, V; Saarikko, H; Safonov, A; Sakumoto, W K; Salamanna, G; Salto, O; Santi, L; Sarkar, S; Sartori, L; Sato, K; Savard, P; Savoy-Navarro, A; Scheidle, T; Schlabach, P; Schmidt, E E; Schmidt, M P; Schmitt, M; Schwarz, T; Scodellaro, L; Scott, A L; Scribano, A; Scuri, F; Sedov, A; Seidel, S; Seiya, Y; Semenov, A; Sexton-Kennedy, L; Sfyrla, A; Shalhout, S Z; Shapiro, M D; Shears, T G; Shepard, P F; Sherman, D; Shimojima, M; Shochet, M; Shon, Y; Shreyber, I; Sidoti, A; Sinervo, P; Sisakian, A; Sjölin, J; Slaughter, A J; Slaunwhite, J; Sliwa, K; Smith, J R; Snider, F D; Snihur, R; Söderberg, M; Soha, A; Somalwar, S; Sorin, V; Spalding, J; Spinella, F; Spreitzer, T; Squillacioti, P; Stanitzki, M; Staveris-Polykalas, A; Saint-Denis, R; Stelzer, B; Stelzer-Chilton, O; Stentz, D; Strologas, J; Stuart, D; Suh, J S; Sukhanov, A; Sun, H; Suslov, I; Suzuki, T; Taffard, A; Takashima, R; Takeuchi, Y; Tanaka, R; Tecchio, M; Teng, P K; Terashi, K; Thom, J; Thompson, A S; Thomson, E; Tipton, P; Tiwari, V; Tkaczyk, S; Toback, D; Tokar, S; Tollefson, K; Tomura, T; Tonelli, D; Torre, S; Torretta, D; Tourneur, S; Trischuk, W; Tsuno, S; Tu, Y; Turini, N; Ukegawa, F; Uozumi, S; Vallecorsa, S; Van Remortel, N; Varganov, A; Vataga, E; Vázquez, F; Velev, G; Vellidis, C; Veramendi, G; Veszpremi, V; Vidal, M; Vidal, R; Vila, I; Vilar, R; Vine, T; Vogel, M; Vollrath, I; Volobuev, I P; Volpi, G; Würthwein, F; Wagner, P; Wagner, R G; Wagner, R L; Wagner, J; Wagner, W; Wallny, R; Wang, S M; Warburton, A; Waters, D; Weinberger, M; Wester, W C; Whitehouse, B; Whiteson, D; Wicklund, A B; Wicklund, E; Williams, G; Williams, H H; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolfe, C; Wright, T; Wu, X; Wynne, S M; Yagil, A; Yamamoto, K; Yamaoka, J; Yamashita, T; Yang, C; Yang, U K; Yang, Y C; Yao, W M; Yeh, G P; Yoh, J; Yorita, K; Yoshida, T; Yu, G B; Yu, I; Yu, S S; Yun, J C; Zanello, L; Zanetti, A; Zaw, I; Zhang, X; Zhou, J; Zucchelli, S

    2007-01-01

    We present a search for anomalous triple gauge couplings (ATGC) in WW and WZ boson production. The boson pairs are produced in ppbar collisions at sqrt{s}=1.96 TeV, and the data sample corresponds to 350 pb-1 of integrated luminosity collected with the CDF II detector at the Fermilab Tevatron. In this search one W decays to leptons, and the other boson (W or Z) decays hadronically. Combining with a previously published CDF measurement of Wgamma boson production yields ATGC limits of -0.18 < lambda < 0.17 and -0.46 < Delta kappa < 0.39 at the 95% confidence level, using a cut-off scale Lambda=1.5 TeV.

  18. Observation of ZZ production in ppbar collisions at sqrt(s) = 1.96 TeV

    CERN Document Server

    Abazov, V M; Abolins, M; Acharya, B S; Adams, M; Adams, T; Aguiló, E; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Ancu, L S; Andeen, T; Andrieu, B; Anzelc, M S; Aoki, M; Arnoud, Y; Arov, M; Arthaud, M; Askew, A; sman, B; Assis-Jesus, A C S; Atramentov, O; Avila, C; Badaud, F; Bagby, L; Baldin, B; Bandurin, AD V; Banerjee, P; Banerjee, S; Barberis, E; Barfuss, A F; Bargassa, P; Baringer, P; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Beale, S; Bean, A; Begalli, M; Begel, M; Belanger-Champagne, C; Bellantoni, L; Bellavance, A; Benítez, J A; Beri, S B; Bernardi, G; Bernhard, R; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Biscarat, C; Blazey, G; Blekman, F; Blessing, S; Bloom, K; Böhnlein, A; Boline, D; Bolton, T A; Boos, E E; Borissov, G; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Brown, D; Bu, X B; Buchanan, N J; Buchholz, D; Bühler, M; Büscher, V; Bunichev, V; Burdin, S; Burnett, T H; Buszello, C P; Butler, J M; Calfayan, P; Calvet, S; Cammin, J; Carrera, E; Carvalho, W; Casey, B C K; Castilla-Valdez, H; Cerminara, G; Chakrabarti, S; Chakraborty, D; Chan, K M; Chandra, A; Cheu, E; Chevallier, F; Cho, D K; Choi, S; Choudhary, B; Christofek, L; Christoudias, T; Cihangir, S; Claes, D; Clutter, J; Cooke, M; Cooper, W E; Corcoran, M; Couderc, F; Cousinou, M C; Crepe-Renaudin, S; Cuplov, V; Cutts, D; Cwiok, M; Da Motta, H; Das, A; Davies, G; De, K; De Jong, S J; De La Cruz-Burelo, E; De Oliveira Martins, C; De Vaughan, K; Degenhardt, J D; Dliot, F; Demarteau, M; Demina, R; Denisov, D; Denisov, S P; Desai, S; Diehl, H T; Diesburg, M; Dominguez, A; Dong, H; Dorland, T; Dubey, A; Dudko, L V; Duflot, L; Dugad, S R; Duggan, D; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Ellison, J; Elvira, V D; Enari, Y; Eno, S; Ermolov, P; Evans, H; Evdokimov, A; Facini, G; Evdokimov, V N; Ferapontov, A V; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Fortner, M; Fox, H; Fu, S; Fuess, S; Gadfort, T; Galea, C F; García, C; García-Bellido, A; Gavrilov, V; Gay, P; Geist, W; Geng, W; Gerber, C E; Gershtein, Yu; Gillberg, D; Ginther, G; Gollub, N; Gómez, B; Goussiou, A; Grannis, P D; Greenlee, H; Greenwood, Z D; Gregores, E M; Grenier, G; Gris, P; Grivaz, J F; Grohsjean, A; Grünendahl, S; Grünewald, M W; Guo, F; Guo, J; Gutíerrez, G; Gutíerrez, P; Haas, A; Hadley, N J; Haefner, P; Hagopian, S; Haley, J; Hall, I; Hall, R E; Han, L; Harder, K; Harel, A; Hauptman, J M; Hays, J; Hebbeker, T; Hedin, D; Hegeman, J G; Heinson, A P; Heintz, U; Hensel, C; Herner, K; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hoeth, H; Hohlfeld, M; Hossain, S; Houben, P; Hu, Y; Hubacek, Z; Hynek, V; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jakobs, K; Jarvis, C; Jesik, R; Johns, K; Johnson, C; Johnson, M; Johnston, D; Jonckheere, A; Jonsson, P; Juste, A; Kajfasz, E; Kalk, J M; Karmanov, D; Kasper, P A; Katsanos, I; Kau, D; Kaushik, V; Kehoe, R; Kermiche, S; Khalatyan, N; Khanov, A; Kharchilava, A; Kharzheev, Yu M; Khatidze, D; Kim, T J; Kirby, M H; Kirsch, M; Klima, B; Kohli, J M; Konrath, J P; Kozelov, A V; Kraus, J; Kühl, T; Kumar, A; Kupco, A; Kura, T; Kuzmin, V A; Kvita, J; Lacroix, F; Lam, D; Lammers, S; Landsberg, G; Lebrun, P; Lee, W M; Leflat, A; Lellouch, J; Li, J; Li, L; Li, Q Z; Lietti, S M; Lim, J K; Lima, J G R; Lincoln, D; Linnemann, J; Lipaev, V V; Lipton, R; Liu, Y; Liu, Z; Lobodenko, A; Lokajícek, M; Love, P; Lubatti, H J; Luna, R; Lyon, A L; Maciel, A K A; Mackin, D; Madaras, R J; Mättig, P; Magass, C; Magerkurth, A; Mal, P K; Malbouisson, H B; Malik, S; Malyshev, V L; Maravin, Y; Martin, B; McCarthy, R; Melnitchouk, A; Mendoza, L; Mercadante, P G; Merkin, M; Merritt, K W; Meyer, A; Meyer, J; Mitrevski, J; Mommsen, R K; Mondal, N K; Moore, R W; Moulik, T; Muanza, G S; Mulhearn, M; Mundal, O; Mundim, L; Nagy, E; Naimuddin, M; Narain, M; Naumann, N A; Neal, H A; Negret, J P; Neustroev, P; Nilsen, H; Nogima, H; Novaes, S F; Nunnemann, T; O'Dell, V; O'Neil, D C; Obrant, G; Ochando, C; Onoprienko, D; Oshima, N; Osman, N; Osta, J; Otec, R; Oteroy-Garzon, G J; Owen, M; Padley, P; Pangilinan, M; Parashar, N; Park, S J; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Pawloski, G; Penning, B; Perfilov, M; Peters, K; Peters, Y; Pétroff, P; Petteni, M; Piegaia, R; Piper, J; Pleier, M A; Podesta-Lerma, P L M; Podstavkov, V M; Pogorelov, Y; Pol, M E; Polozov, P; Pope, B G; Popov, A V; Potter, C; Prado da Silva, W L; Prosper, H B; Protopopescu, S; Qian, J; Quadt, A; Quinn, B; Rakitine, A; Rangel, M S; Ranjan, K; Ratoff, P N; Razumov, I; Renkel, P; Rich, P; Rieger, J; Rijssenbeek, M; Ripp-Baudot, I; Rizatdinova, F; Robinson, S; Rodrigues, R F; Rominsky, M; Royon, C; Rubinov, P; Ruchti, R; Safronov, G; Sajot, G; Sánchez-Hernández, A; Sanders, M P; Sanghi, B

    2008-01-01

    We present an observation for ZZ -> l+l-l'+l'- (l, l' = e or mu) production in ppbar collisions at a center-of-mass energy of sqrt(s) = 1.96 TeV. Using 1.7 fb-1 of data collected by the D0 experiment at the Fermilab Tevatron Collider, we observe three candidate events with an expected background of 0.14 +0.03 -0.02 events. The significance of this observation is 5.3 standard deviations. The combination of D0 results in this channel, as well as in ZZ -> l+l-nunubar, yields a significance of 5.7 standard deviations and a combined cross section of sigma(ZZ) = 1.60 +/- 0.63 (stat.) +0.16 -0.17 (syst.) pb.

  19. Clinical experience with Liraglutide in 196 patients with type 2 diabetes from a tertiary care center in India

    Directory of Open Access Journals (Sweden)

    Parjeet Kaur

    2014-01-01

    Full Text Available Context: GLP-1 receptor agonists (GLP-1 RA are unique antidiabetic agents that have the ability to lower blood glucose without causing hypoglycemia, while at the same time promoting weight loss. Information on the efficacy and safety of GLP-1 RA in the Indian diabetic population is limited. Aims: (1 To evaluate the effect of GLP-1 RA, Liraglutide on glycemic control, and weight in obese Indian patients with type 2 diabetes. (2 To study the adverse event profile of Liraglutide in these patients in real-world clinical setting. Settings and Design: Observational study conducted in a tertiary care hospital. Materials and Methods: Liraglutide was prescribed to 196 obese patients with type 2 diabetes who had poor glycemic control on oral medications ± insulin. The initial dose of Liraglutide was 0.6 mg, which was up-titrated to 1.2 mg after 1 week; further up-titration to 1.8 mg was done based on tolerance. Dipeptidyl peptidase-IV (DPP-IV inhibitors were discontinued and dose of other medications adjusted according to clinical judgment during the study period. Results: Mean age of patients was 49.9 ± 9.6 years. Three month data were available for 175 patients out of a total of 196. At 3 months, glycosylated hemoglobin (HbA1c was 7.6 ± 0.9% vs. 9.2 ± 1.9% at baseline (P = 0.007 and mean body weight was 96.0 ± 16.5 kg vs. 100.1 ± 17.5 kg at baseline (P < 0.001. Most common adverse events were nausea, burping, and eructation (10%. Conclusion: Liraglutide significantly improves glycemic control with low risk of hypoglycemia and is associated with significant weight loss in obese Indian patients with type 2 diabetes mellitus.

  20. Measurement of the $W$ Boson Mass in Proton-Antiproton Collisions at a Center of Mass Energy of 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Yacoob, Sahal [Northwestern Univ., Evanston, IL (United States)

    2010-06-01

    I present the measurement of the mass of the W Boson in the electron channel using 4.4 fb-1 of p $\\bar{p}$ collisions at √s = 1:96 TeV recorded by the D0 detector operating at the Fermilab Tevatron Collider.

  1. Hiljutine maksulahend Euroopa Kohtus - ettevõtja kasuks! : Cadbury Schweppes vs. Ühendkuningriigi maksuhaldur, C-196/04 / Hiie Marrandi

    Index Scriptorium Estoniae

    Marrandi, Hiie

    2006-01-01

    Euroopa Kohtu eelotsusetaotluse alusel tehtud lahendist (12. 09. 2006 C-196/04) Cadbury Schweppes´i ja Suurbritannia maksuhalduri vaidluse kohta, mis puudutas madala maksumääraga territooriumil asuva tütarühingu tulu omistamist Suurbritannia emaühingule

  2. miR-196a-2 rs11614913 polymorphism is associated with vitiligo by affecting heterodimeric molecular complexes of Tyr and Tyrp1.

    Science.gov (United States)

    Cui, T-T; Yi, X-L; Zhang, W-G; Wei, C; Zhou, F-B; Jian, Z; Wang, G; Gao, T-W; Li, C-Y; Li, K

    2015-10-01

    Tyrosinase and tyrosinase-related protein 1 (Tyr-Tyrp1) complex plays a critical role in the synthesis of melanin intermediates, which involves the production of reactive oxygen species (ROS) and contributes to the development of vitiligo. Based on our previous observation that rs11614913 single nucleotide polymorphism (SNP) in miR-196a-2 could affect the risk of vitiligo by influencing Tyrp1, we hypothesized that the same SNP could also regulate the level of Tyr in vitiligo. The aim of this study was to evaluate the potential association between rs11614913 SNP in miR-196a-2 and serum Tyr level in vitiligo and the regulatory role of miR-196a-2 in the expression of Tyr in melanocytes. The serum Tyr level was detected in 116 patients with vitiligo and 116 controls by ELISA plate assay. The expression level of Tyrp1 and Tyr in PIG1(normal melanocyte cell lines) cells was analyzed by western blotting. The ROS level and apoptosis rate in PIG1 cells transfected with si-Tyr or control siRNA were tested by flow cytometry. The results show that the individuals with TT+TC genotypes in miR-196a-2 and higher Tyr level in serum had an increased risk of vitiligo compared with those who had the CC genotype and lower Tyr level (P vitiligo.

  3. Search for the lightest scalar top quark in events with two leptons in p$\\overline{\\p}$ collisions at $\\sqrt{s}$= 1.96 TeV

    CERN Document Server

    Abazov, V; Acharya, B S; Adams, M; Adams, T; Aguiló, E; Ahn, S H; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Ancu, L S; Andeen, T; Anderson, S; Andrieu, B; Anzelc, M S; Arnoud, Y; Arov, M; Arthaud, M; Askew, A; Åsman, B; Assis-Jesus, A C S; Atramentov, O; Autermann, C; Avila, C; Ay, C; Badaud, F; Baden, A; Bagby, L; Baldin, B; Bandurin, D V; Banerjee, S; Banerjee, P; Barberis, E; Barfuss, A F; Bargassa, P; Baringer, P; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Beale, S; Bean, A; Begalli, M; Begel, M; Belanger-Champagne, C; Bellantoni, L; Bellavance, A; Benítez, J A; Beri, S B; Bernardi, G; Bernhard, R; Berntzon, L; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Biscarat, C; Blazey, G; Blekman, F; Blessing, S; Bloch, D; Bloom, K; Böhnlein, A; Boline, D; Bolton, T A; Borissov, G; Bos, K; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Brown, D; Buchanan, N J; Buchholz, D; Bühler, M; Büscher, V; Burdin, S; Burke, S; Burnett, T H; Buszello, C P; Butler, J M; Calfayan, P; Calvet, S; Cammin, J; Caron, S; Carvalho, W; Casey, B C K; Cason, N M; Castilla-Valdez, H; Chakrabarti, S; Chakraborty, D; Chan, K M; Chan, K; Chandra, A; Charles, F; Cheu, E; Chevallier, F; Cho, D K; Choi, S; Choudhary, B; Christofek, L; Christoudias, T; Cihangir, S; Claes, D; Clement, B; Coadou, Y; Cooke, M; Cooper, W E; Corcoran, M; Couderc, F; Cousinou, M C; Crepe-Renaudin, S; Cutts, D; Cwiok, M; Da Motta, H; Das, A; Davies, G; De, K; De Jong, S J; de Jong, P; De La Cruz-Burelo, E; De Oliveira Martins, C; Degenhardt, J D; Déliot, F; Demarteau, M; Demina, R; Denisov, D; Denisov, S P; Desai, S; Diehl, H T; Diesburg, M; Dominguez, A; Dong, H; Dudko, L V; Duflot, L; Dugad, S R; Duggan, D; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Ellison, J; Elvira, V D; Enari, Y; Eno, S; Ermolov, P; Evans, H; Evdokimov, A; Evdokimov, V N; Ferapontov, A V; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Ford, M; Fortner, M; Fox, H; Fu, S; Fuess, S; Gadfort, T; Galea, C F; Gallas, E; Galyaev, E; García, C; García-Bellido, A; Gavrilov, V; Gay, P; Geist, W; Gelé, D; Gerber, C E; Gershtein, Yu; Gillberg, D; Ginther, G; Gollub, N; Gómez, B; Goussiou, A; Grannis, P D; Greenlee, H; Greenwood, Z D; Gregores, E M; Grenier, G; Gris, P; Grivaz, J F; Grohsjean, A; Grünendahl, S; Grünewald, M W; Guo, J; Guo, F; Gutíerrez, P; Gutíerrez, G; Haas, A; Hadley, N J; Haefner, P; Hagopian, S; Haley, J; Hall, I; Hall, R E; Han, L; Hanagaki, K; Hansson, P; Harder, K; Harel, A; Harrington, R; Hauptman, J M; Hauser, R; Hays, J; Hebbeker, T; Hedin, D; Hegeman, J G; Heinmiller, J M; Heinson, A P; Heintz, U; Hensel, C; Herner, K; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hoeth, H; Hohlfeld, M; Hong, S J; Hooper, R; Hossain, S; Houben, P; Hu, Y; Hubacek, Z; Hynek, V; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jakobs, K; Jarvis, C; Jesik, R; Johns, K; Johnson, C; Johnson, M; Jonckheere, A; Jonsson, P; Juste, A; Käfer, D; Kahn, S; Kajfasz, E; Kalinin, A M; Kalk, J R; Kalk, J M; Kappler, S; Karmanov, D; Kasper, J; Kasper, P; Katsanos, I; Kau, D; Kaur, R; Kaushik, V; Kehoe, R; Kermiche, S; Khalatyan, N; Khanov, A; Kharchilava, A; Kharzheev, Yu M; Khatidze, D; Kim, H; Kim, T J; Kirby, M H; Kirsch, M; Klima, B; Kohli, J M; Konrath, J P; Kopal, M; Korablev, V M; Kozelov, A V; Krop, D; Kryemadhi, A; Kühl, T; Kumar, A; Kunori, S; Kupco, A; Kurca, T; Kvita, J; Lacroix, F; Lam, D; Lammers, S; Landsberg, G L; Lazoflores, J; Lebrun, P; Lee, W M; Leflat, A; Lehner, F; Lellouch, J; Lévêque, J; Lewis, P; Li, J; Li, Q Z; Li, L; Lietti, S M; Lima, J G R; Lincoln, D; Linnemann, J; Lipaev, V V; Lipton, R; Liu, Y; Liu, Z; Lobo, L; Lobodenko, A; Lokajícek, M; Lounis, A; Love, P; Lubatti, H J; Lyon, A L; Maciel, A K A; Mackin, D; Madaras, R J; Mättig, P; Magass, C; Magerkurth, A; Makovec, N; Mal, P K; Malbouisson, H B; Malik, S; Malyshev, V L; Mao, H S; Maravin, Y; Martin, B; McCarthy, R; Melnitchouk, A; Mendes, A; Mendoza, L; Mercadante, P G; Merkin, M; Merritt, K W; Meyer, J; Meyer, A; Michaut, M; Millet, T; Mitrevski, J; Molina, J; Mommsen, R K; Mondal, N K; Moore, R W; Moulik, T; Muanza, G S; Mulders, M; Mulhearn, M; Mundal, O; Mundim, L; Nagy, E; Naimuddin, M; Narain, M; Naumann, N A; Neal, H A; Negret, J P; Neustroev, P; Nilsen, H; Nomerotski, A; Novaes, S F; Nunnemann, T; O'Dell, V; O'Neil, D C; Obrant, G; Ochando, C; Onoprienko, D; Oshima, N; Osta, J; Otec, R; Oteroy-Garzon, G J; Owen, M; Padley, P; Pangilinan, M; Parashar, N; Park, S J; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Pawloski, G; Penning, B; Peters, K; Peters, Y; Petroff, P; Petteni, M; Piegaia, R; Piper, J; Pleier, M A; Podesta-Lerma, P L M; Podstavkov, V M; Pogorelov, Y; Pol, M E; Polozov, P; Pompo, A; Pope, B G; Popov, A V; Potter, C

    2008-01-01

    Data collected by the D0 detector at a p-pbar center-of-mass energy of 1.96 TeV at the Fermilab Tevatron Collider have been used to search for pair production of the lightest supersymmetric partner of the top quark decaying into $b \\ell \\tilde{\

  4. 颅脑损伤患者进展性颅内血肿增多196例诊治体会%Clinical experience of 196 patients of craniocerebral injury with intracranial hematoma increasing evolution-ally

    Institute of Scientific and Technical Information of China (English)

    张国栋; 徐雅彪; 张萌; 姜晓玲; 郑建辉; 黄春刚; 刘维田; 常久魁; 李建华; 刘全良; 周晋

    2013-01-01

    目的:探讨颅脑损伤患者入院后颅内血肿进展性增多的诊断及治疗方法,总结如何尽量降低死亡率和致残率。方法回顾性分析2005-07-2013-07我院收治的颅脑损伤患者196例,住院时首次CT扫描未见颅内血肿23例,颅内已形成血肿173例,血肿量为12~32 mL,观察1.5~72 h内病情变化,再次复查CT见颅内出现血肿和原有血肿不同程度增多,及时采取相应的治疗措施。结果患者出院后6个月,根据格拉斯哥预后评分( GOS)评订预后,其中恢复良好124例,中残40例,重残19例,植物生存5例,死亡8例。结论因外伤性致颅内血肿的患者住院后,颅内血肿短时间有继续增多的可能,注意观察病情变化,及时诊断并采取治疗措施,患者能得到较好的治疗效果。%Objective To summarize the diagnosis and treat method about intracranial hematoma increasing evolutionally after patients with craniocerebral injury admitting to hospital and about how to reduce the mortality and morbidity to the greatest extent .Methods The clinical data of 196 patients with craniocerebral injury from July 2005 to July 2013 in Fengrun District people's hospital was analyzed retrospectively .There are 173 cases of intracranial he-matoma by brain CT scan on 196 patients admitting to hospital , with 12~32 mL of hematoncus ;Not 23 cases of in-tracranial hematoma.After observing conditions in 1.5~72 hours, relevant treatments were carried on when observ-ing the emerging and Original hematoma increasing to some degree by reviewing brain CT scan .Results All cases were followed up for more than half an year .According to GOS , 124 cases were in good recovery , 40 cases in moder-ate disability, 19 cases in severe disability, 5 cases in plants survived and 8 cases in death.Conclusion After pa-tients with craniocerebral injury admit to hospital , there is possibillity of intracranial hematoma increasing evolutional-ly, so it

  5. 包皮手术196例疗效分析%Clinical anaalisis on operation of circumcision

    Institute of Scientific and Technical Information of China (English)

    吴忠良; 钱伟华; 苏志刚; 王心治

    2014-01-01

    Objective:To compare the curative effect of three kinds of circumcision .Methods:196 cases of wrapping was too long , phi-mosis patients into three groups , respectively by classical circumcision , circumcision TaoZa apparatus , circumcision surgery .Results:Classic mature operation , suitable for all kinds of patients , but slightly more postoperative complications , the foreskin edema and edema with lace-up side was relatively rare , and the edge was not beautiful;Circumcision TaoZa operation , less bleeding , incision neatly , ede-ma were less light , but the foreign body sensation;Circumcision surgery , time was short , less bleeding , incision and tidy and beautiful , significant edema was light , time was short .Conclusion:Circumcision surgery should be a good operation method .%目的:总结比较3种包皮环切术的疗效。方法:对196例包皮过长、包茎患者分3组,分别以传统包皮环切术、包皮环切套扎器术、包皮环切器手术。结果:经典手术成熟,适用于各种患者,但术后并发症稍多,包皮水肿且以系带侧水肿较为多见,且边缘不够美观;包皮环切套扎术,出血少,切口整齐,水肿情况稍轻,但异物感明显;包皮环切器术,时间短,出血少,切口整齐美观,水肿情况较前明显轻,且时间短。结论:包皮环切器术是很好的手术方式,但价格昂贵。

  6. 基于80C196KC20的变温气流式PCR仪%A Poikilothermal Airstream PCR Apparatus Based on 80C196KC20

    Institute of Scientific and Technical Information of China (English)

    张民权; 林凡

    2004-01-01

    PCR是基因扩增所需经历的一种生物化学反应,而此反应成功与足其反应实体所需的温度循环条件即高温变性,低温退火,中温引物延伸,每一阶段都有其具体的时间要求.选用变温气流方案,采用80C196KC20单片机系统通过控制PWM输出的占空比,对固态继电器的通断进行控制,进而控制电热丝加热功率从而达到对气流介质控温的目的.此方法变温迅速,易于设定不同的变温程序,可以满足不同的试验需求.

  7. 调QALEXLAZR激光治疗太田痣196例临床疗效分析%Clinical effect of Q- switched ALEXLAZR laser in the treatment of 196 cases of nevus of Ota

    Institute of Scientific and Technical Information of China (English)

    陶晓苹; 彭大文; 杨超; 刘林; 李绍兴; 余珊珊; 万绍平

    2003-01-01

    目的:探讨调Q ALEXLAZR激光(以下简称ALEX激光)治疗太田痣的疗效.方法:我所运用ALEX激光器对196例患者进行了多次皮损区照射治疗.治疗间期3~6个月,对年龄大小、治疗次数、面积大小、皮损类型、皮损颜色、皮损部位、不良反应等进行了分组观察研究.结果:其年龄小、面积小、随治疗次数增加疗效越显著,经过1~8次治疗:痊愈80例,显效81例,有效35例,无无效病例.80例痊愈患者平均治愈次数为4.13次.其中1~6岁为3.1次.一般治疗4次左右可以治愈,无1例留下瘢痕.结论:ALEX激光为目前治疗太田痣的一种安全,有效的方法.

  8. First Measurement of ZZ Production in ppbar Collisions at $\\sqrt{s}$=1.96 TeV

    CERN Document Server

    Aaltonen, T; Akimoto, T; Albrow, M G; Alvarez-Gonzalez, B; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Apresyan, A; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Aurisano, A; Azfar, F; Azzi-Bacchetta, P; Azzurri, P; Bacchetta, N; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Baroiant, S; Bartsch, V; Bauer, G; Beauchemin, P H; Bedeschi, F; Bednar, P; Behari, S; Bellettini, G; Bellinger, J; Belloni, A; Benjamin, D; Beretvas, A; Beringer, J; Berry, T; Bhatti, A; Binkley, M; Bisello, D; Bizjak, I; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bölla, G; Bolshov, A; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Bridgeman, A; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, Yu A; Budd, H S; Budd, S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Byrum, K L; Cabrerar, S; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carlsmith, D; Carosi, R; Carrillol, S; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavalli-Sforza, M; Cerri, A; Cerritop, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, K; Chokheli, D; Chou, J P; Choudalakis, G; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Compostella, G; Convery, M E; Conway, J; Cooper, B; Copic, K; Cordelli, M; Cortiana, G; Crescioli, F; Cuenca Almenarr, C; Cuevaso, J; Culbertson, R; Cully, J C; Dagenhart, D; Datta, M; Davies, T; De Barbaro, P; De Cecco, S; Deisher, A; De Lentdeckerd, G; De Lorenzo, G; Dell'Orso, Mauro; Demortier, L; Deng, J; Deninno, M; De Pedis, D; Derwent, P F; Di Giovanni, G P; Dionisi, C; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Donati, S; Dong, P; Donini, J; Dorigo, T; Dube, S; Efron, J; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, W T; Feild, R G; Feindt, M; Fernández, J P; Ferrazza, C; Field, R; Flanagan, G; Forrest, R; Forrester, S; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; Garberson, F; García, J E; Garfinkel, A F; Genser, K; Gerberich, H; Gerdes, D; Giagu, S; Giakoumopoloua, V; Giannetti, P; Gibson, K; Gimmell, J L; Ginsburg, C M; Giokarisa, N; Giordani, M; Giromini, P; Giunta, M; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Golossanov, A; Gómez, G; Gómez-Ceballos, G; Goncharov, M; Gonzlez, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Grinstein, S; Grosso-Pilcher, C; Group, R C; Grundler, U; Guimaraesda Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Hamilton, A; Han, B Y; Han, J Y; Handler, R; Happacher, F; Hara, K; Hare, D; Hare, M; Harper, S; Harr, R F; Harris, R M; Hartz, M; Hatakeyama, K; Hauser, J; Hays, C; Heck, M; Heijboer, A; Heinemann, B; Heinrich, J; Henderson, C; Herndon, M; Heuser, J; Hewamanage, S; Hidas, D; Hillc, C S; Hirschbuehl, D; Höcker, A; Hou, S; Houlden, M; Hsu, S C; Huffman, B T; Hughes, R E; Husemann, U; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ivanov, A; Iyutin, B; James, E; Jayatilaka, B; Jeans, D; Jeon, E J; Jindariani, S; Johnson, W; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Kar, D; Karchin, P E; Kato, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Klute, M; Knuteson, B; Ko, B R; Koay, S A; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kraus, J; Kreps, M; Kroll, J; Krumnack, N; Kruse, M; Krutelyov, V; Kubo, T; Kuhlmann, S E; Kuhr, T; Kulkarni, N P; Kusakabe, Y; Kwang, S; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; Le Compte, T; Lee, J; Lee, J; Lee, Y J; Leeq, S W; Lefèvre, R; Leonardo, N; Leone, S; Levy, S; Lewis, J D; Lin, C; Lin, C S; Linacre, J; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Lovas, L; Lu, R S; Lucchesi, D; Lueck, J; Luci, C; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Lytken, E; Mack, P; MacQueen, D; Madrak, R; Maeshima, K; Makhoul, K; Mäki, T; Maksimovic, P; Malde, S; Malik, S; Manca, G; Manousakisa, A; Margaroli, F; Marino, C; Marino, C P; Martin, A; Martin, M; Martinj, V; Martínez, M; Martinez-Ballarin, R; Maruyama, T; Mastrandrea, P; Masubuchi, T; Mattson, M E; Mazzanti, P; McFarland, K S; McIntyre, P; McNultyi, R; Mehta, A; Mehtälä, P; Menzemerk, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Miao, T; Miladinovic, N; Miles, J; Miller, R; Mills, C; Milnik, M; Mitra, A; Mitselmakher, G; Miyake, H; Moed, S; Moggi, N; Moon, C S; Moore, R; Morello, M; Movilla-Fernández, P A; Mülmenstädt, J; Mukherjee, A; Müller, T; Mumford, R; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Nagano, A; Naganoma, J; Nakamura, K; Nakano, I; Napier, A; Necula, V; Neu, C; Neubauer, M S; Nielsenf, J; Nodulman, L; Norman, M

    2008-01-01

    We report the first measurement of the cross section for Z boson pair production at a hadron collider. This result is based on a data sample corresponding to 1.9 fb-1 of integrated luminosity from ppbar collisions at sqrt{s} = 1.96 TeV collected with the CDF II detector at the Fermilab Tevatron. In the llll channel, we observe three ZZ candidates with an expected background of 0.096^{+0.092}_{-0.063} events. In the llnunu channel, we use a leading-order calculation of the relative ZZ and WW event probabilities to discriminate between signal and background. In the combination of llll and llnunu channels, we observe an excess of events with a probability of $5.1\\times 10^{-6}$ to be due to the expected background. This corresponds to a significance of 4.4 standard deviations. The measured cross section is sigma(ppbar -> ZZ) = 1.4^{+0.7}_{-0.6} (stat.+syst.) pb, consistent with the standard model expectation.

  9. Search for New Physics in Dielectron Events in 1.96-TeV Proton - Anti-proton Collisions

    Energy Technology Data Exchange (ETDEWEB)

    Ikado, Koji

    2004-03-01

    The authors have searched for new physics beyond the Standard Model of elementary particle physics in dielectron decay mode at the CDF (Collider Detector at Fermilab) experiment in {bar p}p collisions at {radical}s = 1.96 TeV. The data were collected during the 2002-2003 runs corresponding to an integrated luminosity of 200 pb{sup -1}. Many extensions of the Standard Model have been proposed. Grand Unified Theories (GUT) assumes a larger gauge symmetry group and predict new gauge bosons. GUT has hierarchy problem in it and there have been many attempts to solve the hierarchy problem. Solutions for the hierarchy problem are supersymmetry, technicolor, large extra dimensions, warped extra dimensions and little Higgs models. The authors analyze the differential distribution of dielectron events in terms of their invariant mass and no significant excess is found in very high mass region. They present a 95% confidence level limit on the production cross section times branching ratio for new resonant particles decaying into an electron pair as a function of invariant mass. New resonant particles include new neutral gauge boson Z', Randall-Sundrum graviton, R-parity violating sneutrino, and technicolor particles. They also present limits on the effective Planck scale of large extra dimensions.

  10. Rectosigmoid findings are not associated with proximal colon cancer: Analysis of 6 196 consecutive cases undergoing total colonoscopy

    Institute of Scientific and Technical Information of China (English)

    Makoto Okamoto; Takao Kawabe; Yutaka Yamaji; Jun Kato; Tsuneo Ikenoue; Goichi Togo; Haruhiko Yoshida; Yasushi Shiratori; Masao Omata

    2005-01-01

    AIM: To review the risk of proximal colon cancer in patients undergoing colonoscopy.METHODS: We estimated the risk of advanced proximal adenomas and cancers in 6 196 consecutive patients that underwent colonoscopy (mean age 60 years, 65% males,without prior history of colorectal examination). Neoplasms were classified as diminutive adenoma (5 mm or less),small adenoma (6-9 mm), advanced adenoma (10 mm or more, with villous component or high-grade dysplasia)and cancer (invasive adenocarcinoma). The sites of neoplasms were defined as rectosigmoid (rectum and sigmoid colon) and proximal colon (from cecum to descending colon).RESULTS: The trend of the prevalence of advanced proximal adenoma was to increase with severe rectosigmoid findings, while the prevalence of proximal colon cancer did not increase with severe rectosigmoid findings. Among the 157 patients with proximal colon cancer, 74% had no neoplasm in the rectosigmoid colon. Multivariate logisticregression analysis revealed that age was the main predictor of proximal colon cancer and existence of rectosigmoid adenoma was not a predictor of proximal colon cancer.CONCLUSION: Sigmoidoscopy is inadequate for colorectal cancer screening, especially in older populations.

  11. Strong evidence for ZZ production in pp[over] collisions at sqrt[s]=1.96 TeV.

    Science.gov (United States)

    Aaltonen, T; Adelman, J; Akimoto, T; Albrow, M G; Alvarez González, B; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Apresyan, A; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Aurisano, A; Azfar, F; Azzi-Bacchetta, P; Azzurri, P; Bacchetta, N; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Baroiant, S; Bartsch, V; Bauer, G; Beauchemin, P-H; Bedeschi, F; Bednar, P; Behari, S; Bellettini, G; Bellinger, J; Belloni, A; Benjamin, D; Beretvas, A; Beringer, J; Berry, T; Bhatti, A; Binkley, M; Bisello, D; Bizjak, I; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bolla, G; Bolshov, A; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Bridgeman, A; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, J; Budd, H S; Budd, S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Byrum, K L; Cabrera, S; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carlsmith, D; Carosi, R; Carrillo, S; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, K; Chokheli, D; Chou, J P; Choudalakis, G; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Compostella, G; Convery, M E; Conway, J; Cooper, B; Copic, K; Cordelli, M; Cortiana, G; Crescioli, F; Cuenca Almenar, C; Cuevas, J; Culbertson, R; Cully, J C; Dagenhart, D; Datta, M; Davies, T; de Barbaro, P; De Cecco, S; Deisher, A; De Lentdecker, G; De Lorenzo, G; Dell'Orso, M; Demortier, L; Deng, J; Deninno, M; De Pedis, D; Derwent, P F; Di Giovanni, G P; Dionisi, C; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Donati, S; Dong, P; Donini, J; Dorigo, T; Dube, S; Efron, J; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, W T; Feild, R G; Feindt, M; Fernandez, J P; Ferrazza, C; Field, R; Flanagan, G; Forrest, R; Forrester, S; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; Garberson, F; Garcia, J E; Garfinkel, A F; Genser, K; Gerberich, H; Gerdes, D; Giagu, S; Giakoumopolou, V; Giannetti, P; Gibson, K; Gimmell, J L; Ginsburg, C M; Giokaris, N; Giordani, M; Giromini, P; Giunta, M; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Golossanov, A; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Grinstein, S; Grosso-Pilcher, C; Grundler, U; Guimaraes da Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Hamilton, A; Han, B-Y; Han, J Y; Handler, R; Happacher, F; Hara, K; Hare, D; Hare, M; Harper, S; Harr, R F; Harris, R M; Hartz, M; Hatakeyama, K; Hauser, J; Hays, C; Heck, M; Heijboer, A; Heinemann, B; Heinrich, J; Henderson, C; Herndon, M; Heuser, J; Hewamanage, S; Hidas, D; Hill, C S; Hirschbuehl, D; Hocker, A; Hou, S; Houlden, M; Hsu, S-C; Huffman, B T; Hughes, R E; Husemann, U; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ivanov, A; Iyutin, B; James, E; Jayatilaka, B; Jeans, D; Jeon, E J; Jindariani, S; Johnson, W; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Kar, D; Karchin, P E; Kato, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Klute, M; Knuteson, B; Ko, B R; Koay, S A; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kraus, J; Kreps, M; Kroll, J; Krumnack, N; Kruse, M; Krutelyov, V; Kubo, T; Kuhlmann, S E; Kuhr, T; Kulkarni, N P; Kusakabe, Y; Kwang, S; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; LeCompte, T; Lee, J; Lee, J; Lee, Y J; Lee, S W; Lefèvre, R; Leonardo, N; Leone, S; Levy, S; Lewis, J D; Lin, C; Lin, C S; Linacre, J; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Lovas, L; Lu, R-S; Lucchesi, D; Lueck, J; Luci, C; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Lytken, E; Mack, P; MacQueen, D; Madrak, R; Maeshima, K; Makhoul, K; Maki, T; Maksimovic, P; Malde, S; Malik, S; Manca, G; Manousakis, A; Margaroli, F; Marino, C; Marino, C P; Martin, A; Martin, M; Martin, V; Martínez, M; Martínez-Ballarín, R; Maruyama, T; Mastrandrea, P; Masubuchi, T; Mattson, M E; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtala, P; Menzemer, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Miao, T; Miladinovic, N; Miles, J; Miller, R; Mills, C; Milnik, M; Mitra, A; Mitselmakher, G; Miyake, H; Moed, S; Moggi, N; Moon, C S; Moore, R; Morello, M; Movilla Fernandez, P; Mülmenstädt, J; Mukherjee, A; Muller, Th; Mumford, R; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Nagano, A; Naganoma, J; Nakamura, K; Nakano, I; Napier, A; Necula, V; Neu, C; Neubauer, M S; Nielsen, J; Nodulman, L; Norman, M; Norniella, O; Nurse, E; Oh, S H

    2008-05-23

    We report the first evidence of Z boson pair production at a hadron collider with a significance exceeding 4 standard deviations. This result is based on a data sample corresponding to 1.9 fb(-1) of integrated luminosity from pp[over] collisions at sqrt[s]=1.96 TeV collected with the Collider Detector at Fermilab II detector. In the lll'l' channel, we observe three ZZ candidates with an expected background of 0.096(-0.063)+0.092 events. In the llnunu channel, we use a leading-order calculation of the relative ZZ and WW event probabilities to discriminate between signal and background. In the combination of lll'l' and llnunu channels, we observe an excess of events with a probability of 5.1 x 10(-6) to be due to the expected background. This corresponds to a significance of 4.4 standard deviations. The measured cross section is sigma(pp[over]-->ZZ)=1.4(-0.6)+0.7(stat+syst) pb, consistent with the standard model expectation. PMID:18518523

  12. Event Shapes in $p\\bar p$ Collisions at $\\sqrt{s} = 1.96$ TeV

    Energy Technology Data Exchange (ETDEWEB)

    Atkins, Scott [Louisiana Tech Univ., Ruston, LA (United States)

    2012-08-01

    This dissertation presents the analysis of nine different event shapes measured in high energy p$\\bar{p}$ collisions. An event shape can be defined as an event-based quantity that measures how the final energies are distributed in the final event. This analysis will test strong interactions as described by Quantum Chromodynamics (QCD), through their implementation in different Monte Carlo-based models. Each of the event shapes provides information about the flow of energy in QCD events and about the hadronic final states that occur in p$\\bar{p}$ particle collisions, thus allowing the study of the dynamics of QCD multijet events. Any deviation of an event shape from zero will be indicative of higher-order effects, meaning that more than the two jets were produced in the event. For each of the event shapes, both normalized differential distributions ( 1/σ dσ/dX) and average event shapes ($\\bar{X}$σ) were measured, where X is the event shape and σ is the cross section. This analysis uses 0.7 fb-1 of data taken between 2004 and 2006 by the DØ detector located at the Fermi National Accelerator Lab (Fermilab) in Batavia, IL, using p$\\bar{p}$ collisions at a center-of-mass energy of √s = 1.96 TeV.

  13. Polyurethane rigid foam, a proven thermal insulating material for applications between +130°C and -196°C

    Science.gov (United States)

    Demharter, Anton

    Polyurethanes are high molecular weight polymers based on the polyaddition of polyfunctional hydroxyl-group containing compounds and polyisocyanates. A wide variety of properties can be tailored to fulfil the requirements of different applications: soft to hard, plastic, elastic or thermoset, compact or foamed. Compared with other insulating materials, PUR rigid foam is highly competitive. There are five product-related advantages: lowest thermal conductivity, high mechanical and chemical properties at both high and low temperatures, all major international fire safety requirements can be satisfied, the ability to form sandwich structures with various facer materials, and the new generation of PUR is CFC-free and recyclable. Rigid polyurethane foams perform well in most areas of low-temperature insulations. Products in density ranging from approximately 30 to 200 kg m -3 withstand temperatures down to -196°C. Typical applications are: refrigerated vehicles, road and rail tankers, vessels for refrigerated cargo, pipelines, liquid gas tanks for LPG and LNG and cryogenic wind tunnels. The paper presents applications, corresponding properties of the rigid foams used, and also other insulating materials in competition to PUR are discussed.

  14. Search for Electroweak Single Top Quark Production in 1.96 TeV Proton-Antiproton Collisions

    Energy Technology Data Exchange (ETDEWEB)

    Stelzer, Bernd [Univ. of Toronto, ON (Canada). Dept. of Physics

    2005-01-01

    This thesis describes the first search for electroweak single top quark production in proton-antiproton collisions at a center of mass energy of 1.96 TeV. The data sample used for this analysis corresponds to 162 pb-1 recorded by the upgraded Collider Detector at Fermilab. The search is performed by doing a classic maximum likelihood fit to the HT distribution in data. The kinematic variable HT is the scalar sum of transverse energies of all final state particles in the event. This variable has the advantage that its distribution looks very similar for both contributing (s-channel and t-channel) single top processes, but is different for background processes. The combination of both channels to one signal improves the sensitivity of the search. No significant evidence for electroweak single top quark production is found and we set an upper limit at the 95% confidence level on the combined single top quark production cross section of 17.8 pb.

  15. Measurement of trilinear gauge boson couplings from at {\\boldmath$\\sqrt{s}=1.96$} TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abazov, Victor Mukhamedovich; /Dubna, JINR; Abbott, Braden Keim; /Oklahoma U.; Abolins, Maris A.; /Michigan State U.; Acharya, Bannanje Sripath; /Tata Inst.; Adams, Mark Raymond; /Illinois U., Chicago; Adams, Todd; /Florida State U.; Aguilo, Ernest; /Alberta U. /Simon Fraser U. /York U., Canada /McGill U.; Ahsan, Mahsana; /Kansas State U.; Alexeev, Guennadi D.; /Dubna, JINR; Alkhazov, Georgiy D.; /St. Petersburg, INP; Alton, Andrew K.; /Michigan U. /Augustana Coll., Sioux Falls /Northeastern U.

    2009-07-01

    We present a direct measurement of trilinear gauge boson couplings at gammaWW and ZWW vertices in WW and WZ events produced in p{bar p} collisions at {radical}s = 1.96 TeV. We consider events with one electron or muon, missing transverse energy, and at least two jets. The data were collected using the D0 detector and correspond to 1.1 fb{sup -1} of integrated luminosity. Considering two different relations between the couplings at the gammaWW and ZWW vertices, we measure these couplings at 68% C.L. to be kappa{sub gamma} = 1.07{sub -0.29}{sup +0.26}, lambda = 0.00{sub -0.06}{sup +0.06}, and g{sub 1}{sup Z} = 1.04{sup -0.09}{sup +0.09} in a scenario respecting SU(2){sub L}[direct-product]U(1){sub Y} gauge symmetry and kappa = 1.04{sub -0.11}{sup +0.11} and lambda=0.00{sub -0.06}{sup +0.06} in an 'equal couplings' scenario.

  16. Search for excited electrons in ppbar collisions at $\\sqrt{s}$ = 1.96 TeV

    CERN Document Server

    Abazov, V; Abolins, M; Acharya, B S; Adams, M; Adams, T; Aguiló, E; Ahn, S H; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Ancu, L S; Andeen, T; Anderson, S; Andrieu, B; Anzelc, M S; Arnoud, Y; Arov, M; Arthaud, M; Askew, A; sman, B; Assis-Jesus, A C S; Atramentov, O; Autermann, C; Avila, C; Ay, C; Badaud, F; Baden, A A; Bagby, L; Baldin, B; Bandurin, D V; Banerjee, S; Banerjee, P; Barberis, E; Barfuss, A F; Bargassa, P; Baringer, P; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Beale, S; Bean, A; Begalli, M; Begel, M; Belanger-Champagne, C; Bellantoni, L; Bellavance, A; Benítez, J A; Beri, S B; Bernardi, G; Bernhard, R; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Biscarat, C; Blazey, G; Blekman, F; Blessing, S; Bloch, D; Bloom, K; Böhnlein, A; Boline, D; Bolton, T A; Borissov, G; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Brown, D; Buchanan, N J; Buchholz, D; Bühler, M; Büscher, V; Bunichev, V; Burdin, S; Burke, S; Burnett, T H; Buszello, C P; Butler, J M; Calfayan, P; Calvet, S; Cammin, J; Carvalho, W; Casey, B C K; Cason, N M; Castilla-Valdez, H; Chakrabarti, S; Chakraborty, D; Chan, K M; Chan, K; Chandra, A; Charles, F; Cheu, E; Chevallier, F; Cho, D K; Choi, S; Choudhary, B; Christofek, L; Christoudias, T; Cihangir, S; Claes, D; Coadou, Y; Cooke, M; Cooper, W E; Corcoran, M; Couderc, F; Cousinou, M C; Crepe-Renaudin, S; Cutts, D; Cwiok, M; Da Motta, H; Das, A; Davies, eeG; De, K; De Jong, S J; De La Cruz-Burelo, E; De Oliveira Martins, C; Degenhardt, J D; Dliot, F; Demarteau, M; Demina, R; Denisov, D; Denisov, S P; Desai, S; Diehl, H T; Diesburg, M; Dominguez, e A; Dong, H; Dudko, L V; Duflot, L; Dugad, S R; Duggan, D; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Ellison, J; Elvira, V D; Enari, Y; Eno, S; Ermolov, P; Evans, H; Evdokimov, A; Evdokimov, V N; Ferapontov, A V; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Ford, M; Fortner, M; Fox, H; Fu, S; Fuess, S; Gadfort, T; Galea, C F; Gallas, E; Galyaev, E; García, C; García-Bellido, A; Gavrilov, V; Gay, P; Geist, W; Gel, D; Gerber, eC E; Gershtein, Yu; Gillberg, D; Ginther, G; Gollub, N; Gmez, B; Goussiou, A; Grannis, P D; Greenlee, o H; Greenwood, Z D; Gregores, E M; Grenier, G; Gris, P; Grivaz, J F; Grohsjean, A; Grünendahl, S; Grünewald, M W; Guo, J; Guo, F; Gutíerrez, P; Gutíerrez, G; Haas, A; Hadley, N J; Haefner, P; Hagopian, S; Haley, J; Hall, I; Hall, R E; Han, L; Hansson, P; Harder, K; Harel, A; Harrington, R; Hauptman, J M; Hauser, R; Hays, J; Hebbeker, T; Hedin, D; Hegeman, J G; Heinmiller, J M; Heinson, A P; Heintz, U; Hensel, C; Herner, K; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hoeth, H; Hohlfeld, M; Hong, S J; Hossain, S; Houben, P; Hu, Y; Hubacek, Z; Hynek, V; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jakobs, e K; Jarvis, C; Jesik, R; Johns, K; Johnson, C; Johnson, M; Jonckheere, A; Jonsson, P; Juste, A; Kajfasz, E; Kalinin, A M; Kalk, J R; Kalk, J M; Kappler, S; Karmanov, D; Kasper, P A; Katsanos, I; Kau, D; Kaur, R; Kaushik, V; Kehoe, R; Kermiche, S; Khalatyan, N; Khanov, A; Kharchilava, A; Kharzheev, Yu M; Khatidze, D; Kim, T J; Kirby, M H; Kirsch, M; Klima, B; Kohli, J M; Konrath, J P; Korablev, V M; Kozelov, A V; Krop, D; Kühl, T; Kumar, A; Kunori, S; Kupco, A; Kura, T; Kvita, J; Lacroix, F; Lam, D; Lammers, S; Landsberg, G; Lebrun, P; Lee, cW M; Leflat, A; Lehner, F; Lellouch, J; Lévêque, J; Li, J; Li, Q Z; Li, L; Lietti, S M; Lima, J G R; Lincoln, D; Linnemann, J; Lipaev, V V; Lipton, R; Liu, Y; Liu, Z; Lobodenko, A; Lokajícek, M; Love, P; Lubatti, H J; Luna, R; Lyon, A L; Maciel, A K A; Mackin, D; Madaras, R J; Mättig, P; Magass, C; Magerkurth, A; Mal, P K; Malbouisson, H B; Malik, S; Malyshev, V L; Mao, H S; Maravin, Y; Martin, B; McCarthy, R; Melnitchouk, A; Mendoza, L; Mercadante, P G; Merkin, M; Merritt, K W; Meyer, J; Meyer, A; Millet, T; Mitrevski, J; Molina, J; Mommsen, R K; Mondal, N K; Moore, R W; Moulik, T; Muanza, G S; Mulders, M; Mulhearn, M; Mundal, O; Mundim, L; Nagy, E; Naimuddin, M; Narain, M; Naumann, N A; Neal, H A; Negret, J P; Neustroev, P; Nilsen, H; Nogima, H; Novaes, S F; Nunnemann, T; O'Dell, V; O'Neil, D C; Obrant, G; Ochando, C; Onoprienko, D; Oshima, N; Osta, J; Otec, R; Oteroy-Garzon, G J; Owen, M; Padley, P; Pangilinan, M; Parashar, N; Park, S J; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Pawloski, G; Penning, B; Perfilov, M; Peters, K; Peters, Y; Ptroff, P; Petteni, M; Piegaia, cR; Piper, J; Pleier, M A; Podesta-Lerma, P L M; Podstavkov, V M; Pogorelov, Y; Pol, M E; Polozov, P; Pope, B G; Popov, A V; Potter, C; Prado da Silva, W L; Prosper, H B; Protopopescu, S; Qian, J; Quadt, A; Quinn, B; Rakitine, A; Rangel, M S; Ranjan, K; Ratoff, P N; Renkel, P; Reucroft, S; Rich, P; Rieger, J; Rijssenbeek, M

    2008-01-01

    We present the results of a search for the production of an excited state of the electron, e*, in proton-antiproton collisions at $\\sqrt{s}$ = 1.96 TeV. The data were collected with the D0 experiment at the Fermilab Tevatron Collider and correspond to an integrated luminosity of approximately 1 fb^-1. We search for e* in the process ppbar -> e* e, with the e* subsequently decaying to an electron plus photon. No excess above the standard model background is observed. Interpreting our data in the context of a model that describes e* production by four-fermion contact interactions and e* decay via electroweak processes, we set 95% C.L. upper limits on the production cross section ranging from 8.9 fb to 27 fb, depending on the mass of the excited electron. Choosing the scale for contact interactions to be Lambda = 1 TeV, excited electron masses below 756 GeV are excluded at the 95% C.L.

  17. A combined search for the standard model Higgs boson at $\\sqrt{s}$=1.96 TeV

    CERN Document Server

    Abazov, V M; Abolins, M; Acharya, B S; Adams, M; Adams, T; Aguiló, E; Ahn, S H; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Ancu, L S; Andeen, T; Anderson, S; Andrieu, B; Anzelc, M S; Arnoud, Y; Arov, M; Arthaud, M; Askew, A; sman, B; Assis-Jesus, A C S; Atramentov, O; Autermann, C; Avila, C; Ay, C; Badaud, F; Baden, A; Bagby, L; Baldin, B; Bandurin, D V; Banerjee, S; Banerjee, P; Barberis, E; Barfuss, A F; Bargassa, P; Baringer, P; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Beale, S; Bean, A; Begalli, M; Begel, M; Belanger-Champagne, C; Bellantoni, L; Bellavance, A; Benítez, J A; Beri, S B; Bernardi, G; Bernhard, R; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Biscarat, C; Blazey, G; Blekman, F; Blessing, S; Bloch, D; Bloom, K; Böhnlein, A; Boline, D; Bolton, T A; Borissov, G; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Brown, D; Buchanan, N J; Buchholz, D; Bühler, M; Büscher, V; Bunichev, V; Burdin, S; Burke, S; Burnett, T H; Buszello, C P; Butler, J M; Calfayan, P; Calvet, S; Cammin, J; Carvalho, W; Casey, B C K; Cason, N M; Castilla-Valdez, H; Chakrabarti, S; Chakraborty, D; Chan, K M; Chan, K; Chandra, A; Charles, F; Cheu, E; Chevallier, F; Cho, D K; Choi, S; Choudhary, B; Christofek, L; Christoudias, T; Cihangir, S; Claes, D; Coadou, Y; Cooke, M; Cooper, W E; Corcoran, M; Couderc, F; Cousinou, M C; Crepe-Renaudin, S; Cutts, D; Cwiok, M; Da Motta, H; Das, eeA; Davies, G; De, K; De Jong, S J; De La Cruz-Burelo, E; De Oliveira Martins, C; Degenhardt, J D; Dliot, F; Demarteau, M; Demina, R; Denisov, D; Denisov, S P; Desai, S; Diehl, H T; Diesburg, M; Dominguez, A; Dong, H; Dudko, L V; Duflot, L; Dugad, S R; Duggan, D; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Ellison, J; Elvira, V D; Enari, Y; Eno, S; Ermolov, P; Evans, H; Evdokimov, A; Evdokimov, V N; Ferapontov, A V; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Ford, M; Fortner, M; Fox, H; Fu, S; Fuess, S; Gadfort, T; Galea, C F; Gallas, E; Galyaev, E; García, C; García-Bellido, A; Gavrilov, V; Gay, P; Geist, W; Gel, D; Gerber, C E; Gershtein, Yu; Gillberg, D; Ginther, G; Gollub, N; Gmez, B; Goussiou, A; Grannis, P D; Greenlee, H; Greenwood, Z D; Gregores, E M; Grenier, G; Gris, P; Grivaz, J F; Grohsjean, A; Grünendahl, S; Grünewald, M W; Guo, J; Guo, F; Gutíerrez, P; Gutíerrez, G; Haas, A; Hadley, N J; Haefner, P; Hagopian, S; Haley, J; Hall, I; Hall, R E; Han, L; Hanagaki, K; Hansson, P; Harder, K; Harel, A; Harrington, R; Hauptman, J M; Hauser, R; Hays, J; Hebbeker, T; Hedin, D; Hegeman, J G; Heinmiller, J M; Heinson, A P; Heintz, U; Hensel, C; Herner, K; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hoeth, H; Hohlfeld, M; Hong, S J; Hossain, S; Houben, P; Hu, Y; Hubacek, Z; Hynek, V; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jakobs, K; Jarvis, C; Jesik, R; Johns, K; Johnson, C; Johnson, M; Jonckheere, A; Jonsson, P; Juste, A; Kfer, D; Kajfasz, E; Kalinin, A M; Kalk, J R; Kalk, J M; Kappler, S; Karmanov, D; Kasper, P; Katsanos, I; Kau, D; Kaur, R; Kaushik, V; Kehoe, R; Kermiche, S; Khalatyan, N; Khanov, A; Kharchilava, A; Kharzheev, Yu M; Khatidze, D; Kim, H; Kim, T J; Kirby, M H; Kirsch, M; Klima, B; Kohli, J M; Konrath, J P; Kopal, M; Korablev, V M; Kozelov, A V; Krop, D; Kühl, T; Kumar, A; Kunori, S; Kupco, A; Kura, T; Kvita, J; Lacroix, F; Lam, D; Lammers, S; Landsberg, G; Lebrun, P; Lee, W M; Leflat, A; Lehner, F; Lellouch, J; Lévêque, J; Lewis, P; Li, J; Li, Q Z; Li, L; Lietti, S M; Lima, J G R; Lincoln, D; Linnemann, J; Lipaev, V V; Lipton, R; Liu, Y; Liu, Z; Lobo, L; Lobodenko, A; Lokajícek, M; Love, P; Lubatti, H J; Lyon, A L; Maciel, A K A; Mackin, D; Madaras, R J; Mättig, P; Magass, C; Magerkurth, A; Mal, P K; Malbouisson, H B; Malik, S; Malyshev, V L; Mao, H S; Maravin, Y; Martin, B; McCarthy, R; Melnitchouk, A; Mendes, A; Mendoza, L; Mercadante, P G; Merkin, M; Merritt, K W; Meyer, J; Meyer, A; Millet, T; Mitrevski, J; Molina, J; Mommsen, R K; Mondal, N K; Moore, R W; Moulik, T; Muanza, G S; Mulders, M; Mulhearn, M; Mundal, O; Mundim, L; Nagy, E; Naimuddin, M; Narain, M; Naumann, N A; Neal, H A; Negret, J P; Neustroev, P; Nilsen, H; Nogima, H; Nomerotski, A; Novaes, S F; Nunnemann, T; O'Dell, V; O'Neil, D C; Obrant, G; Ochando, C; Onoprienko, D; Oshima, N; Osta, J; Otec, R; Oteroy-Garzon, G J; Owen, M; Padley, P; Pangilinan, M; Parashar, N; Park, S J; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Pawloski, G; Penning, B; Perfilov, M; Peters, K; Peters, Y; Pétroff, P; Petteni, M; Piegaia, R; Piper, J; Pleier, M A; Podesta-Lerma, P L M; Podstavkov, V M; Pogorelov, Y; Pol, M E; Polozov, P; Pope, B G; Popov, A V; Potter, C; Prado da Silva, W L; Prosper, H B; Protopopescu, S; Qian, J; Quadt, A; Quinn, B; Rakitine, A; Rangel, M S; Ranjan, K

    2008-01-01

    We present new results of the search for WH to lepton neutrino b b production in ppbar collisions at a center of mass energy of sqrt{s}=1.96 TeV, based on a dataset with integrated luminosity of 0.44 fb-1. We combine these new results with previously published searches by the D0 collaboration, for WH and ZH production analyzed in the MET b b final state, for ZH (to l+l- b b) production, for WH (to WWW) production, and for H (to WW) direct production. No signal-like excess is observed either in the WH analysis or in the combination of all D0 Higgs boson analyses. We set 95% C.L. (expected) upper limits on to 1.9 (3.3) pb for Higgs boson masses between 105 and 145 GeV, to be compared to the theoretical prediction of 0.13 pb for a standard model (SM) Higgs boson with mass m_H=115 GeV. After combination with the other D0 Higgs boson searches, we obtain for m_H=115 GeV an observed (expected) limit 8.5 (12.1) times higher than the SM predicted Higgs boson production cross section. For m_H=160 GeV, the corresponding...

  18. Search for New Physics in Dielectron Events in 1.96-TeV Proton - Anti-proton Collisions

    Energy Technology Data Exchange (ETDEWEB)

    Ikado, Koji [Waseda Univ., Shinjuku (Japan)

    2004-03-01

    The authors have searched for new physics beyond the Standard Model of elementary particle physics in dielectron decay mode at the CDF (Collider Detector at Fermilab) experiment in {bar p}p collisions at √s = 1.96 TeV. The data were collected during the 2002-2003 runs corresponding to an integrated luminosity of 200 pb-1. Many extensions of the Standard Model have been proposed. Grand Unified Theories (GUT) assumes a larger gauge symmetry group and predict new gauge bosons. GUT has hierarchy problem in it and there have been many attempts to solve the hierarchy problem. Solutions for the hierarchy problem are supersymmetry, technicolor, large extra dimensions, warped extra dimensions and little Higgs models. The authors analyze the differential distribution of dielectron events in terms of their invariant mass and no significant excess is found in very high mass region. They present a 95% confidence level limit on the production cross section times branching ratio for new resonant particles decaying into an electron pair as a function of invariant mass. New resonant particles include new neutral gauge boson Z', Randall-Sundrum graviton, R-parity violating sneutrino, and technicolor particles. They also present limits on the effective Planck scale of large extra dimensions.

  19. Search for Excited Muons in ppbar Collisions at $\\sqrt{s}$ = 1.96 TeV

    CERN Document Server

    Abazov, V M; Abolins, M; Acharya, B S; Adams, M; Adams, T; Agelou, M; Agram, J L; Ahn, S H; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Andeen, T; Anderson, S; Andrieu, B; Anzelc, M S; Arnoud, Y; Arov, M; Askew, A; Åsman, B; Assis-Jesus, A C S; Atramentov, O; Autermann, C; Avila, C; Ay, C; Badaud, F; Baden, A; Bagby, L; Baldin, B; Bandurin, D V; Banerjee, P; Banerjee, S; Barberis, E; Bargassa, P; Baringer, P; Barnes, C; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Bean, A; Begalli, M; Begel, M; Belanger-Champagne, C; Bellavance, A; Benítez, J A; Beri, S B; Bernardi, G; Bernhard, R; Berntzon, L; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Binder, M; Biscarat, C; Black, K M; Blackler, I; Blazey, G; Blekman, F; Blessing, S; Bloch, D; Bloom, K; Blumenschein, U; Böhnlein, A; Boeriu, O; Bolton, T A; Borcherding, F; Borissov, G; Bos, K; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Brown, D; Buchanan, N J; Buchholz, D; Bühler, M; Büscher, V; Burdin, S; Burke, S; Burnett, T H; Busato, E; Buszello, C P; Butler, J M; Calvet, S; Cammin, J; Caron, S; Carvalho, W; Casey, B C K; Cason, N M; Castilla-Valdez, H; Chakrabarti, S; Chakraborty, D; Chan, K M; Chandra, A; Chapin, D; Charles, F; Cheu, E; Chevallier, F; Cho, D K; Choi, S; Choudhary, B; Christofek, L; Claes, D; Clement, B; Clément, C; Coadou, Y; Coenen, J; Cooke, M; Cooper, W E; Coppage, D; Corcoran, M; Cousinou, M C; Cox, B; Crepe-Renaudin, S; Cutts, D; Cwiok, M; Da Motta, H; Das, A; Das, M; Davies, B; Davies, G; Davis, G A; De, K; de Jong, P; De Jong, S J; De La Cruz-Burelo, E; De Oliveira Martins, C; Degenhardt, J D; Déliot, F; Demarteau, M; Demina, R; Demine, P; Denisov, D; Denisov, S P; Desai, S; Diehl, H T; Diesburg, M; Doidge, M; Dominguez, A; Dong, H; Dudko, L V; Duflot, L; Dugad, S R; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Edwards, T; Ellison, J; Elmsheuser, J; Elvira, V D; Eno, S; Ermolov, P; Estrada, J; Evans, H; Evdokimov, A; Evdokimov, V N; Fatakia, S N; Feligioni, L; Ferapontov, A V; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Fleck, I; Ford, M; Fortner, M; Fox, H; Fu, S; Fuess, S; Gadfort, T; Galea, C F; Gallas, E; Galyaev, E; García, C; García-Bellido, A; Gardner, J; Gavrilov, V; Gay, A; Gay, P; Gelé, D; Gelhaus, R; Gerber, C E; Gershtein, Yu; Gillberg, D; Ginther, G; Gollub, N; Gómez, B; Gounder, K; Goussiou, A; Grannis, P D; Greenlee, H; Greenwood, Z D; Gregores, E M; Grenier, G; Gris, P; Grivaz, J F; Grünendahl, S; Grünewald, M W; Guo, F; Guo, J; Gutíerrez, G; Gutíerrez, P; Haas, A; Hadley, N J; Haefner, P; Hagopian, S; Haley, J; Hall, I; Hall, R E; Han, L; Hanagaki, K; Harder, K; Harel, A; Harrington, R; Hauptman, J M; Hauser, R; Hays, J; Hebbeker, T; Hedin, D; Hegeman, J G; Heinmiller, J M; Heinson, A P; Heintz, U; Hensel, C; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hohlfeld, M; Hong, S J; Hooper, R; Houben, P; Hu, Y; Hynek, V; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jakobs, K; Jarvis, C; Jenkins, A; Jesik, R; Johns, K; Johnson, C; Johnson, M; Jonckheere, A; Jonsson, P; Juste, A; Käfer, D; Kahn, S; Kajfasz, E; Kalinin, A M; Kalk, J M; Kalk, J R; Kappler, S; Karmanov, D; Kasper, J; Katsanos, I; Kau, D; Kaur, R; Kehoe, R; Kermiche, S; Kesisoglou, S; Khanov, A; Kharchilava, A I; Kharzheev, Yu M; Khatidze, D; Kim, H; Kim, T J; Kirby, M H; Klima, B; Kohli, J M; Konrath, J P; Kopal, M; Korablev, V M; Kotcher, J; Kothari, B; Koubarovsky, A; Kozelov, A V; Kozminski, J; Kryemadhi, A; Krzywdzinski, S; Kühl, T; Kumar, A; Kunori, S; Kupco, A; Kurca, T; Kvita, J; Lager, S; Lammers, S; Landsberg, G L; Lazoflores, J; Le Bihan, A C; Lebrun, P; Lee, W M; Leflat, A; Lehner, F; Leonidopoulos, C; Lesne, V; Lévêque, J; Lewis, P; Li, J; Li, Q Z; Lima, J G R; Lincoln, D; Linnemann, J; Lipaev, V V; Lipton, R; Liu, Z; Lobo, L; Lobodenko, A; Lokajícek, M; Lounis, A; Love, P; Lubatti, H J; Lynker, M; Lyon, A L; Maciel, A K A; Madaras, R J; Mättig, P; Magass, C; Magerkurth, A; Magnan, A M; Makovec, N; Mal, P K; Malbouisson, H B; Malik, S; Malyshev, V L; Mao, H S; Maravin, Y; Martens, M; Mattingly, S E K; McCarthy, R; McCroskey, R; Meder, D; Melnitchouk, A; Mendes, A; Mendoza, L; Merkin, M; Merritt, K W; Meyer, A; Meyer, J; Michaut, M; Miettinen, H; Millet, T; Mitrevski, J; Molina, J; Mondal, N K; Monk, J; Moore, R W; Moulik, T; Muanza, G S; Mulders, M; Mulhearn, M; Mundim, L; Mutaf, Y D; Nagy, E; Naimuddin, M; Narain, M; Naumann, N A; Neal, H A; Negret, J P; Nelson, S; Neustroev, P; Nöding, C; Nomerotski, A; Novaes, S F; Nunnemann, T; O'Dell, V; O'Neil, D C; Obrant, G; Oguri, V; Oliveira, N; Oshima, N; Otec, R; Oteroy-Garzon, G J; Owen, M; Padley, P; Parashar, N; Park, S J; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Pawloski, G; Perea, P M; Pérez, E; Peters, K; Petroff, P; Petteni, M; Piegaia, R; Pleier, M A; Podesta-Lerma, P L M; Podstavkov, V M; Pogorelov, Y; Pol, M E; Pompos, A; Pope, B G; Popov, A V; Prado da Silva, W L; Prosper, H B; Protopopescu, S D; Qian, J; Quadt, A; Quinn, B; Rani, K J; Ranjan, K; Rapidis, P A; Ratoff, P N; Renkel, P; Reucroft, S; Rijssenbeek, M; Ripp-Baudot, I; Rizatdinova, F K; Robinson, S; Rodrigues, R F; Royon, C; Rubinov, P; Ruchti, R; Rud, V I; Sajot, G; Sánchez-Hernández, A; Sanders, M P; Santoro, A F S; Savage, G; Sawyer, L; Scanlon, T; Schaile, A D; Schamberger, R D; Scheglov, Y; Schellman, H; Schieferdecker, P; Schmitt, C; Schwanenberger, C; Schwartzman, A; Schwienhorst, R; Sen-Gupta, S; Severini, H; Shabalina, E; Shamim, M; Shary, V; Shchukin, A A; Shephard, W D; Shivpuri, R K; Shpakov, D; Siccardi, V; Sidwell, R A; Simák, V; Sirotenko, V I; Skubic, P L; Slattery, P F; Smith, R P; Snow, G R; Snow, J; Snyder, S; Söldner-Rembold, S; Song, X; Sonnenschein, L; Sopczak, A; Sosebee, M; Soustruznik, K; Souza, M; Spurlock, B; Stark, J; Steele, J; Stevenson, K; Stolin, V; Stone, A; Stoyanova, D A; Strandberg, J; Strang, M A; Strauss, M; Ströhmer, R; Strom, D; Strovink, M; Stutte, L; Sumowidagdo, S; Sznajder, A; Talby, M; Tamburello, P; Taylor, W; Telford, P; Temple, J; Tiller, B; Titov, M; Tokmenin, V V; Tomoto, M; Toole, T; Torchiani, I; Towers, S; Trefzger, T; Trincaz-Duvoid, S; Tsybychev, D; Tuchming, B; Tully, C; Turcot, A S; Tuts, P M; Unalan, R; Uvarov, L; Uvarov, S; Uzunyan, S; Vachon, B; Vanden Berg, P J; Van Kooten, R; Van Leeuwen, W M; Varelas, N; Varnes, E W; Vartapetian, A H; Vasilyev, I A; Vaupel, M; Verdier, P; Vertogradov, L S; Verzocchi, M; Villeneuve-Séguier, F; Vint, P; Vlimant, J R; Von Törne, E; Voutilainen, M; Vreeswijk, M; Wahl, H D; Wang, L; Warchol, J; Watts, G; Wayne, M; Weber, M; Weerts, H; Wermes, N; Wetstein, M; White, A; Wicke, D; Wilson, G W; Wimpenny, S J; Wobisch, M; Womersley, J; Wood, D R; Wyatt, T R; Xie, Y; Xuan, N; Yacoob, S; Yamada, R; Yan, M; Yasuda, T; Yatsunenko, Y A; Yip, K; Yoo, H D; Youn, S W; Yu, C; Yu, J; Yurkewicz, A; Zatserklyaniy, A; Zeitnitz, C; Zhang, D; Zhao, T; Zhao, Z; Zhou, B; Zhu, J; Zielinski, M; Zieminska, D; Zieminski, A; Zutshi, V; Zverev, E G

    2006-01-01

    We present the results of a search for the production of an excited state of the muon, mu*, in proton antiproton collisions at sqrt s = 1.96 TeV. The data have been collected with the D0 experiment at the Fermilab Tevatron Collider and correspond to an integrated luminosity of approximately 380 pb^-1. We search for mu* in the process p pbar -> mu* mu, with the mu* subsequently decaying to a muon plus photon. No excess above the standard model expectation is observed in data. Interpreting our data in the context of a model that describes mu* production by four-fermion contact interactions and mu* decay via electroweak processes, we exclude production cross sections higher than 0.057 pb -- 0.112 pb at the 95% confidence level, depending on the mass of the excited muon. Choosing the scale for contact interactions to be Lambda = 1 TeV, excited muon masses below 618 GeV are excluded.

  20. Correlative connection between characteristics of mother line and hybrid seed ft generation of maize hybrid ZPTC196

    Directory of Open Access Journals (Sweden)

    Milenković Jasmina

    2003-01-01

    Full Text Available Production of the maize hybrid seed (Zea mays L in the area of the town of Zaječar and its surroundings is limited by the ecological conditions. The loss of precipitations and high air temperatures during summer do not allow the hybrid seed of later vegetation to be produced. However, reduced amount of precipitations in the period of time from August to September, with favorable heat conditions, provide mature and healthy seed material only if the mother line has shorter vegetation period (FAO 200-300. This study examines the influence of the cob corn characteristics (cob length, number of seeds on a cob, mass of the seeds on a cob, number of the seeds in a fraction and germination of natural seed material of the maize hybrid ZPTC 196, seed. The applied correlative analysis involved all experimental conditions (two years, plant rows of the mother line, with watering and without watering. The results of the investigation showed mat the applied approach of correlative analysis for the fractional content of a cob corn (number and mass per fractions almost owerwhelming, as far as the seed germination, is concerned, it was probable that all factors having influence on that characteristic were not included.

  1. Search for First-Generation Scalar Leptoquarks in $\\bm{p \\bar{p}}$ collisions at $\\sqrt{s}$=1.96 TeV

    CERN Document Server

    Acosta, D; Affolder, T; Akimoto, T; Albrow, M G; Ambrose, D; Amerio, S; Amidei, D; Anastassov, A; Anikeev, K; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Arisawa, T; Arguin, J F; Artikov, A; Ashmanskas, W; Attal, A; Azfar, F; Azzi-Bacchetta, P; Bacchetta, N; Bachacou, H; Badgett, W; Barbaro-Galtieri, A; Barker, G J; Barnes, V E; Barnett, B A; Baroiant, S; Bauer, G; Bedeschi, F; Behari, S; Belforte, S; Bellettini, G; Bellinger, J; Belloni, A; Ben-Haim, E; Benjamin, D; Beretvas, A; Berry, T; Bhatti, A A; Binkley, M; Bisello, D; Bishai, M; Blair, R E; Blocker, C; Bloom, K; Blumenfeld, B; Bocci, A; Bodek, A; Bölla, G; Bolshov, A; Bortoletto, D; Boudreau, J; Bourov, S; Brau, B; Bromberg, C; Brubaker, E; Budagov, Yu A; Budd, H S; Burkett, K; Busetto, G; Bussey, P; Byrum, K L; Cabrera, S; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Casarsa, M; Carlsmith, D; Carosi, R; Carron, S; Cavalli-Sforza, M; Castro, A; Catastini, P; Cauz, D; Cerri, A; Cerrito, L; Chapman, J; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, I; Cho, K; Chokheli, D; Chou, J P; Chuang, S; Chung, K; Chung, W H; Chung, Y S; Cijliak, M; Ciobanu, C I; Ciocci, M A; Clark, A G; Clark, D; Coca, M; Connolly, A; Convery, M; Conway, J; Cooper, B; Copic, K; Cordelli, M; Cortiana, G; Cranshaw, J; Cuevas-Maestro, J; Cruz, A; Culbertson, R; Currat, C; Cyr, D; Dagenhart, D; Da Ronco, S; D'Auria, S; De Barbaro, P; De Cecco, S; Deisher, A; De Lentdecker, G; Dell'Orso, Mauro; Demers, S; Demortier, L; Deninno, M; De Pedis, D; Derwent, P F; Devlin, T; Dionisi, 50C; Dittmann, J R; Di Turo, P; Dorr, C; Dominguez, A; Donati, S; Donega, M; Donini, J; D'Onofrio, M; Dorigo, T; Ebina, K; Efron, J; Ehlers, J; Erbacher, R; Erdmann, M; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, I; Fedorko, W T; Feild, R G; Feindt, M; Fernández, J P; Field, R D; Flanagan, G; Flores-Castillo, L R; Foland, A; Forrester, S; Foster, G W; Franklin, M; Freeman, J C; Fujii, Y; Furic, I; Gajjar, A; Gallinaro, M; Galyardt, J; García-Sciveres, M; Garfinkel, A F; Gay, C; Gerberich, H; Gerdes, D W; Gerchtein, E; Giagu, S; Giannetti, P; Gibson, A; Gibson, K; Ginsburg, C; Giolo, K; Giordani, M; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D A; Gold, M; Goldschmidt, N; Goldstein, D; Goldstein, J; Gómez, G; Gómez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Gotra, Yu; Goulianos, K; Gresele, A; Griffiths, M; Grosso-Pilcher, C; Grundler, U; Guimarães da Costa, J; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Hamilton, A; Han, B Y; Handler, R; Happacher, F; Hara, K; Hare, M; Harr, R F; Harris, R M; Hartmann, F; Hatakeyama, K; Hauser, J; Hays, C; Hayward, H; Heinemann, B; Heinrich, J; Hennecke, M; Herndon, M; Hill, C; Hirschbuehl, D; Höcker, A; Hoffman, K D; Holloway, A; Hou, S; Houlden, M A; Huffman, B T; Huang, Y; Hughes, R E; Huston, J; Ikado, K; Incandela, J R; Introzzi, G; Iori, M; Ishizawa, Y; Issever, C; Ivanov, A; Iwata, Y; Iyutin, B; James, E; Jang, D; Jayatilaka, B; Jeans, D; Jensen, H; Jeon, E J; Jones, M; Joo, K K; Jun, S Y; Junk, T R; Kamon, T; Kang, J; Karagoz-Unel, M; Karchin, P E; Kato, Y; Kemp, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, M S; Kim, S B; Kim, S H; Kim, Y K; Kirby, M; Kirsch, L; Klimenko, S; Klute, M; Knuteson, B; Ko, B R; Kobayashi, H; Kong, D J; Kondo, K; Konigsberg, J; Kordas, K; Korn, A; Korytov, A; Kotwal, A V; Kovalev, A; Kraus, J; Kravchenko, I; Kreymer, A; Kroll, J; Kruse, M; Krutelyov, V; Kuhlmann, S E; Kwang, S; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, M; Lander, R; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; Lecci, C; LeCompte, T; Lee, J; Lee, S W; Lefèvre, R; Leonardo, N; Leone, S; Levy, S; Lewis, J D; Li, K; Lin, C; Lin, C S; Lindgren, M; Lipeles, E; Liss, T M; Lister, A; Litvintsev, D O; Liu, T; Liu, Y; Lockyer, N S; Loginov, A; Loreti, M; Loverre, P F; Lu, R S; Lucchesi, D; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Lytken, E; MacQueen, D; Madrak, R; Maeshima, K; Maksimovic, P; Manca, G; Margaroli, F; Marginean, R; Marino, C; Martin, A; Martin, M; Martin, V; Martínez, M; Maruyama, T; Matsunaga, H; Mattson, M; Mazzanti, P; McFarland, K S; McGivern, D; McIntyre, P M; McNamara, P; McNulty, R; Mehta, A; Menzemer, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Miao, T; Miladinovic, N; Miles, J; Miller, L; Miller, R; Miller, J S; Mills, C; Miquel, R; Miscetti, S; Mitselmakher, G; Miyamoto, A; Moggi, N; Mohr, B; Moore, R; Morello, M; Movilla-Fernández, P A; Mülmenstädt, J; Mukherjee, A; Mulhearn, M; Müller, T; Mumford, R; Munar, A; Murat, P; Nachtman, J; Nahn, S; Nakano, I; Napier, A; Napora, R; Naumov, D; Necula, V; Nielsen, J; Nelson, T; Neu, C; Neubauer, M S; Nigmanov, T; Nodulman, L; Norniella, O; Ogawa, T; Oh, S H; Oh, Y D; Ohsugi, T; Okusawa, T; Oldeman, R; Orava, R; Orejudos, W; Österberg, K; Pagliarone, C; Palencia, E; Paoletti, R; Papadimitriou, V; Paramonov, A A; Pashapour, S; Patrick, J; Pauletta, G; Paulini, M; Paus, C; Pellett, D; Penzo, Aldo L; Phillips, T J; Piacentino, G; Piedra, J; Pitts, K T; Plager, C; Pondrom, L; Pope, G; Portell, X; Poukhov, O; Pounder, N; Prakoshyn, F; Pronko, A; Proudfoot, J; Ptohos, F; Punzi, G; Rademacker, J; Rahaman, M A; Rakitine, A; Rappoccio, S; Ratnikov, F; Ray, H; Reisert, B; Rekovic, V; Renton, P B; Rescigno, M; Rimondi, F; Rinnert, K; Ristori, L; Robertson, W J; Robson, A; Rodrigo, T; Rolli, S; Roser, R; Rossin, R; Rott, C; Russ, J; Rusu, V; Ruiz, A; Ryan, D; Saarikko, H; Sabik, S; Safonov, A; Saint-Denis, R; Sakumoto, W K; Salamanna, G; Saltzberg, D; Sánchez, C; Santi, L; Sarkar, S; Sato, K; Savard, P; Savoy-Navarro, A; Schlabach, P; Schmidt, E E; Schmidt, M P; Schmitt, M; Schwarz, T; Scodellaro, L; Scott, A L; Scribano, A; Scuri, F; Sedov, A; Seidel, S; Seiya, Y; Semenov, A; Semeria, F; Sexton-Kennedy, L; Sfiligoi, I; Shapiro, M D; Shears, T G; Shepard, P F; Sherman, D; Shimojima, M; Shochet, M; Shon, Y; Shreyber, I; Sidoti, A; Sill, A; Sinervo, P; Sisakian, A; Sjölin, J; Skiba, A; Slaughter, A J; Sliwa, K; Smirnov, D; Smith, J R; Snider, F D; Snihur, R; Söderberg, M; Soha, A; Somalwar, S V; Spalding, J; Spezziga, M; Spinella, F; Squillacioti, P; Stadie, H; Stanitzki, M; Stelzer, B; Stelzer-Chilton, O; Stentz, D; Strologas, J; Stuart, D; Suh, J S; Sukhanov, A; Sumorok, K; Sun, H; Suzuki, T; Taffard, A; Tafirout, R; Takano, H; Takashima, R; Takeuchi, Y; Takikawa, K; Tanaka, M; Tanaka, R; Tanimoto, N; Tecchio, M; Teng, P K; Terashi, K; Tesarek, R J; Tether, S; Thom, J; Thompson, A S; Thomson, E; Tipton, P; Tiwari, V; Tkaczyk, S; Toback, D; Tollefson, K; Tomura, T; Tonelli, D; Tonnesmann, M; Torre, S; Torretta, D; Tourneur, S; Trischuk, W; Tsuchiya, R; Tsuno, S; Tsybychev, D; Turini, N; Ukegawa, F; Unverhau, T; Uozumi, S; Usynin, D; Vacavant, L; Vaiciulis, A W; Varganov, A; Vejcik, S; Velev, G; Veszpremi, V; Veramendi, G; Vickey, T; Vidal, R; Vila, I; Vilar, R; Vollrath, I; Volobuev, I P; Von der Mey, M; Wagner, P; Wagner, R G; Wagner, R L; Wagner, W; Wallny, R; Walter, T; Wan, Z; Wang, M J; Wang, S M; Warburton, A; Ward, B; Waschke, S; Waters, D; Watts, T; Weber, M; Wester, W C; Whitehouse, B; Whiteson, D; Wicklund, A B; Wicklund, E; Williams, H H; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolfe, C; Wolter, M; Worcester, M; Worm, S; Wright, T; Wu, X; Würthwein, F; Wyatt, A; Yagil, A; Yamashita, T; Yamamoto, K; Yamaoka, J; Yang, C; Yang, U K; Yao, W; Yeh, G P; Yoh, J; Yorita, K; Yoshida, T; Yu, I; Yu, S; Yun, J C; Zanello, L; Zanetti, A; Zaw, I; Zetti, F; Zhou, J; Zucchelli, S

    2005-01-01

    We report on a search for pair production of first-generation scalar leptoquarks ($LQ$) in $p \\bar{p}$ collisions at $\\sqrt{s}$=1.96 TeV using an integrated luminosity of 203 $pb^{-1}$ collected at the Fermilab Tevatron collider by the CDF experiment. We observe no evidence for $LQ$ production in the topologies arising from $LQ \\bar{LQ} \\to eqeq$ and $LQ \\bar{LQ} \\to eq \

  2. What is the implication of the observation by CDF Collaboration of the Transverse Momentum Spectrum at $\\sqrt s = 1.96$ TeV ?

    CERN Document Server

    Biyajima, Minoru; Suzuki, Naomichi

    2016-01-01

    To describe the transverse distribution of charged hadrons at 1.96 TeV observed by CDF Collaboration, we propose a formula including two components, hadron gas distribution and inverse power law. The data are also analyzed by various models. Moreover, the data at 0.9, 2.76, 7.0 and 13 TeV obtained by ALICE Collaboration are analyzed using the two component models.

  3. Measurement of top quark mass in the all hadronic channel in √s = 1.96 TeF, p$\\bar{p}$ collisions at D0

    Energy Technology Data Exchange (ETDEWEB)

    Lam, David Wai Kui [Univ. of Notre Dame, IN (United States)

    2008-04-01

    A measurement of the top quark mass in proton-antiproton collisions at √s = 1.96 TeV using 1040fb-1 of data collected in D detector at Fermilab is presented. This analysis focuses on the all-hadronic decay mode of the top quark and therefore only events with six or more calorimeter jets in the final state are considered.

  4. Measurement of the Top Quark Mass by Dynamical Likelihood Method using the Lepton plus Jets Events in 1.96 Tev Proton-Antiproton Collisions

    Energy Technology Data Exchange (ETDEWEB)

    Yorita, Kohei [Waseda Univ., Shinjuku (Japan)

    2005-03-01

    We have measured the top quark mass with the dynamical likelihood method (DLM) using the CDF II detector at the Fermilab Tevatron. The Tevatron produces top and anti-top pairs in pp collisions at a center of mass energy of 1.96 TeV. The data sample used in this paper was accumulated from March 2002 through August 2003 which corresponds to an integrated luminosity of 162 pb-1.

  5. Search for large extra dimensions in the mono-photon final state at $\\sqrt{s}$ = 1.96 TeV

    CERN Document Server

    Abazov, V; Abolins, M; Acharya, B S; Adams, M; Adams, T; Aguiló, E; Ahn, S H; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Ancu, L S; Andeen, T; Anderson, S; Andrieu, B; Anzelc, M S; Aoki, M; Arnoud, Y; Arov, M; Arthaud, M; Askew, A; sman, B; Assis-Jesus, A C S; Atramentov, O; Avila, C; Ay, C; Badaud, F; Baden, AA; Bagby, L; Baldin, B; Bandurin, D V; Banerjee, P; Banerjee, S; Barberis, E; Barfuss, A F; Bargassa, P; Baringer, P; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Beale, S; Bean, A; Begalli, M; Begel, M; Belanger-Champagne, C; Bellantoni, L; Bellavance, A; Benítez, J A; Beri, S B; Bernardi, G; Bernhard, R; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Biscarat, C; Blazey, G; Blekman, F; Blessing, S; Bloch, D; Bloom, K; Böhnlein, A; Boline, D; Bolton, T A; Borissov, G; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Brown, D; Buchanan, N J; Buchholz, D; Bühler, M; Büscher, V; Bunichev, V; Burdin, S; Burke, S; Burnett, T H; Buszello, C P; Butler, J M; Calfayan, P; Calvet, S; Cammin, J; Carrera, E; Carvalho, W; Casey, B C K; Castilla-Valdez, H; Chakrabarti, S; Chakraborty, D; Chan, K; Chan, K M; Chandra, A; Charles, F; Cheu, E; Chevallier, F; Cho, D K; Choi, S; Choudhary, B; Christofek, L; Christoudias, T; Cihangir, S; Claes, D; Coadou, Y; Cooke, M; Cooper, W E; Corcoran, M; Couderc, F; Cousinou, M C; Crepe-Renaudin, S; Cutts, D; Cwiok, M; Da Motta, H; Das, A; Davies, G; De, K; De Jong, S J; De La Cruz-Burelo, E; De Oliveira Martins, C; Degenhardt, J D; Dliot, F; Demarteau, M; Demina, R; Denisov, D; Denisov, S P; Desai, S; Diehl, e H T; Diesburg, M; Dominguez, A; Dong, H; Dudko, L V; Duflot, L; Dugad, S R; Duggan, D; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Ellison, J; Elvira, V D; Enari, Y; Eno, S; Ermolov, P; Evans, H; Evdokimov, A; Evdokimov, V N; Ferapontov, A V; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Fortner, M; Fox, H; Fu, S; Fuess, S; Gadfort, T; Galea, C F; Gallas, E; García, C; García-Bellido, A; Gavrilov, V; Gay, P; Geist, W; Gel, D; Gerber, e C E; Gershtein, Yu; Gillberg, D; Ginther, G; Gollub, N; Gmez, B; Goussiou, A; Grannis, P D; Greenlee, o H; Greenwood, Z D; Gregores, E M; Grenier, G; Gris, P; Grivaz, J F; Grohsjean, A; Grünendahl, S; Grünewald, M W; Guo, F; Guo, J; Gutíerrez, G; Gutíerrez, P; Haas, A; Hadley, N J; Haefner, P; Hagopian, S; Haley, J; Hall, I; Hall, R E; Han, L; Harder, K; Harel, A; Harrington, R; Hauptman, J M; Hauser, R; Hays, J; Hebbeker, T; Hedin, D; Hegeman, J G; Heinmiller, J M; Heinson, A P; Heintz, U; Hensel, C; Herner, K; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hoeth, H; Hohlfeld, M; Hong, S J; Hossain, S; Houben, P; Hu, Y; Hubacek, Z; Hynek, V; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jakobs, K; Jarvis, C; Jesik, e R; Johns, K; Johnson, C; Johnson, M; Jonckheere, A; Jonsson, P; Juste, A; Kajfasz, E; Kalinin, A M; Kalk, J M; Kappler, S; Karmanov, D; Kasper, P A; Katsanos, I; Kau, D; Kaushik, V; Kehoe, R; Kermiche, S; Khalatyan, N; Khanov, A; Kharchilava, A; Kharzheev, Yu M; Khatidze, D; Kim, T J; Kirby, M H; Kirsch, M; Klima, B; Kohli, J M; Konrath, J P; Korablev, V M; Kozelov, A V; Kraus, J; Krop, D; Kühl, T; Kumar, A; Kupco, A; Kura, T; Kvita, J; Lacroix, F; Lam, cD; Lammers, S; Landsberg, G; Lebrun, P; Lee, W M; Leflat, A; Lellouch, J; Lévêque, J; Li, J; Li, L; Li, Q Z; Lietti, S M; Lima, J G R; Lincoln, D; Linnemann, J; Lipaev, V V; Lipton, R; Liu, Y; Liu, Z; Lobodenko, A; Lokajícek, M; Love, P; Lubatti, H J; Luna, R; Lyon, A L; Maciel, A K A; Mackin, D; Madaras, R J; Mättig, P; Magass, C; Magerkurth, A; Mal, P K; Malbouisson, H B; Malik, S; Malyshev, V L; Mao, H S; Maravin, Y; Martin, B; McCarthy, R; Melnitchouk, A; Mendoza, L; Mercadante, P G; Merkin, M; Merritt, K W; Meyer, A; Meyer, J; Millet, T; Mitrevski, J; Molina, J; Mommsen, R K; Mondal, N K; Moore, R W; Moulik, T; Muanza, G S; Mulders, M; Mulhearn, M; Mundal, O; Mundim, L; Nagy, E; Naimuddin, M; Narain, M; Naumann, N A; Neal, H A; Negret, J P; Neustroev, P; Nilsen, H; Nogima, H; Novaes, S F; Nunnemann, T; O'Dell, V; O'Neil, D C; Obrant, G; Ochando, C; Onoprienko, D; Oshima, N; Osman, N; Osta, J; Otec, R; Oteroy-Garzon, G J; Owen, M; Padley, P; Pangilinan, M; Parashar, N; Park, S J; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Pawloski, G; Penning, B; Perfilov, M; Peters, K; Peters, Y; Pétroff, P; Petteni, M; Piegaia, R; Piper, J; Pleier, M A; Podesta-Lerma, P L M; Podstavkov, e V M; Pogorelov, Y; Pol, M E; Polozov, P; Pope, B G; Popov, A V; Potter, C; Prado da Silva, W L; Prosper, H B; Protopopescu, S; Qian, J; Quadt, A; Quinn, B; Rakitine, A; Rangel, M S; Ranjan, K; Ratoff, P N; Renkel, P; Reucroft, S; Rich, P; Rieger, J; Rijssenbeek, M; Ripp-Baudot, I; Rizatdinova, F; Robinson, S

    2008-01-01

    We report on a search for large extra dimensions in a data sample of approximately 1 fb^{-1} of p pbar collisions at $\\sqrt{s}$ = 1.96 TeV. We investigate Kaluza-Klein graviton production with a photon and missing transverse energy in the final state. At the 95% C.L. we set limits on the fundamental mass scale M_{D} from 884 GeV to 778 GeV for 2 to 8 extra dimensions.

  6. Immunization with a novel Clostridium perfringens epsilon toxin mutant rETX(Y196E)-C confers strong protection in mice.

    Science.gov (United States)

    Yao, Wenwu; Kang, Jingjing; Kang, Lin; Gao, Shan; Yang, Hao; Ji, Bin; Li, Ping; Liu, Jing; Xin, Wenwen; Wang, Jinglin

    2016-01-01

    Epsilon toxin (ETX) is produced by toxinotypes B and D of Clostridium perfringens. It can induce lethal enterotoxemia in domestic animals, mainly in sheep, goats and cattle, causing serious economic losses to global animal husbandry. In this study, a novel and stable epsilon toxin mutant rETX(Y196E)-C, obtained by substituting the 196th tyrosine (Y196) with glutamic acid (E) and introducing of 23 amino acids long C-terminal peptide, was determined as a promising recombinant vaccine candidate against enterotoxemia. After the third vaccination, the antibody titers against recombinant wild type (rETX) could reach 1:10(5) in each immunized group, and the mice were completely protected from 100 × LD50 (50% lethal dose) of rETX challenge. The mice in 15 μg subcutaneously immunized group fully survived at the dose of 500 × LD50 of rETX challenge and 80% of mice survived at 180 μg (1000 × LD50) of rETX administration. In vitro, immune sera from 15 μg subcutaneously immunized group could completely protect MDCK cells from 16 × CT50 (50% lethal dose of cells) of rETX challenge and protect against 10 × LD50 dose (1.8 μg) of rETX challenge in mice. These data suggest that recombinant protein rETX(Y196E)-C is a potential vaccine candidate for future applied researches. PMID:27048879

  7. Magnetic Properties and Phase Transformation of Tb1-xPrxFe1.96 (x=0 to 0.7) Compounds

    Institute of Scientific and Technical Information of China (English)

    Zhang Shaoqiang; Zhang Maocai; Gao Xuexu; Qiao Yi; Zhou Shouzeng

    2006-01-01

    The magnetic properties and the phase Transformation of Tb1-xPrxFe1.96 (x=0 to 0.7) compounds were studied by means of vibrating sample magnetometer(VSM), X-ray diffraction(XRD) and SEM back-scattered electron (BSE).The result indicates that the saturation magnetization σs of compounds along an easy axis decreases with the addition of Pr contents, which reduces from 77.24 Am2·kg-1 (x=0) to 11.84 Am2·kg-1 (x=0.5) and then returns to 37.14 Am2·kg-1 (x=0.7).The non-cubic phases appear when x exceeds 0.2, and the matrix of Tb1-xPrxFe1.96 compounds changes from (Tb, Pr)Fe2 phase with x=0 to (Tb, Pr)Fe3 phase with x=0.4, and at last to (Tb, Pr)2Fe17 phase in Tb0.3Pr0.7Fe1.96.Moreover, the structure of the compounds may become more complex with the increase of Pr content.

  8. Preparation of spherical spinel LiCr_(0.04)Mn_(1.96)O_4 cathode materials based on the slurry spray drying method

    Institute of Scientific and Technical Information of China (English)

    JIANG Qinglai; HU Guorong; PENG Zhongdong; DU Ke; CAO Yanbing; TANG Daichun

    2009-01-01

    Regular spherical chromium doped spinel lithium manganese oxides (LiCr_(0.04)Mn_(1.96)O_4) with an average particle size of about 20 μm were prepared by the slurry spray drying process. The materials were compared with non-spherical LiCr_(0.04)Mn_(1.96)O_4 materials prepared by the common drying process, and all materials were characterized by X-ray diffraction (XRD), scanning electron microscopy (SEM), laser parti-cle analyzer and Brunauer-Emmett-Teller (BET) specific surface area test. Electrochemical performances of these cathode materials were studied by cyclic voltammetry (CV), electrochemical impedance spectroscopy (EIS) and Li/LiCr_(0.04)Mn_(1.96)O_4 battery test. The results show that the spherical active material is single spinel structure, compact, and with narrow particle size distribution and low BET specific surface area. Compared with the non-spherical material, the spherical material prepared by the spray drying process shows a lower electrochemical impedance, a fewer electrochemical polarization and a better charge/discharge rate capability and capacity retention at elevated temperatures.

  9. Physical and underway data collected aboard the KNORR during cruise KN196-01 in the Davis Strait, Gulf of St. Lawrence and others from 2009-09-17 to 2009-10-02 (NODC Accession 0104280)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC accession 0104280 includes physical and underway data collected aboard the KNORR during cruise KN196-01 in the Davis Strait, Gulf of St. Lawrence and others...

  10. Measurement of electroweak single top quark production in proton-antiproton collisions at 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Dong, Peter Joseph; /UCLA

    2008-05-01

    The top quark is an extremely massive fundamental particle that is predominantly produced in pairs at particle collider experiments. The Standard Model of particle physics predicts that top quarks can also be produced singly by the electroweak force; however, this process is more difficult to detect because it occurs at a smaller rate and is more difficult to distinguish from background processes. The cross section of this process is related to the Cabbibo-Kobayashi-Maskawa matrix element |V{sub tb}|, and measurement of the single top quark production cross section is currently the only method to directly measure this quantity without assuming the number of generations of fermions. This thesis describes a measurement of the cross section of electroweak single top quark production in proton-antiproton collisions at a center-of-mass energy of 1.96 TeV. This analysis uses 2.2 fb{sup -1} of integrated luminosity recorded by the Collider Detector at Fermilab. The search is performed using a matrix element method which calculates the differential cross section for each event for several signal and background hypotheses. These numbers are combined into a single discriminant and used to construct templates from Monte Carlo simulation. A maximum likelihood fit to the data distribution gives a measurement of the cross section. This analysis measures a value of 2.2{sub -0.7}{sup +0.8} pb, which corresponds to a value of |V{sub tb}| = 0.88{sub -0.14}{sup +0.16}experimental{+-}0.7(theoretical). The probability that this result originates from a background fluctuation in the absence of single top production (p-value) is 0.0003, which is equivalent to 3.4 standard deviations in Gaussian statistics. The expected (median) p-value as estimated from pseudo-experiments for this analysis is 0.000003, which corresponds to 4.5 standard deviations in Gaussian statistics.

  11. Study on the top quark pair production mechanism in 1.96 TeV proton-antiproton collisions

    Energy Technology Data Exchange (ETDEWEB)

    Naganoma, Junji; /Waseda U.

    2008-03-01

    The study of the top quark pair production mechanism in proton-antiproton collisions at a center-of-mass energy of 1.96 TeV is described. The main subjects are the measurements of the top quark pair production cross section, the top quark mass and a search for a new particle decaying to the top quark pair. The analyses are based on 1.9 fb{sup -1} of data collected by the Collider Detector at Fermilab (CDF) Run II experiment between March 2002 and May 2007, using the lepton+jets events. The measured top quark pair production cross section is 8.2 {+-} 0.5 (stat.) {+-} 0.8 (syst.) {+-} 0.5 (lum.) pb, which is slightly higher than the standard model prediction at the top mass of 175 GeV/c{sup 2}. The top quark mass is an important parameter in the standard model, and also in the experimental studies. The measured top quark mass if 171.6 {+-} 2.0 (stat.) {+-} 1.3(syst.) GeV/c{sup 2}. Finally, they report on a search for a new gauge boson decaying to t{bar t}, which interferes with the standard model gluon in the q{bar q} {yields} t{bar t} production process. They call such a hypothetical particle a 'Massive Gluon'. The observed t{bar t} invariant mass distribution is consistent with the standard model expectations, and also the measured massive gluon coupling strength with quarks is consistent within a statistical fluctuation of the standard model expectation in the wide range of the massive gluon masses and widths. They set the upper and lower limits on the coupling strength of the massive gluon.

  12. Measurement of electroweak single top quark production in proton-antiproton collisions at 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Dong, Peter Joseph [Univ. of California, Los Angeles, CA (United States)

    2008-01-01

    The top quark is an extremely massive fundamental particle that is predominantly produced in pairs at particle collider experiments. The Standard Model of particle physics predicts that top quarks can also be produced singly by the electroweak force; however, this process is more difficult to detect because it occurs at a smaller rate and is more difficult to distinguish from background processes. The cross section of this process is related to the Cabbibo-Kobayashi-Maskawa matrix element |V tb|, and measurement of the single top quark production cross section is currently the only method to directly measure this quantity without assuming the number of generations of fermions. This thesis describes a measurement of the cross section of electroweak single top quark production in proton-antiproton collisions at a center-of-mass energy of 1.96 TeV. This analysis uses 2.2 fb-1 of integrated luminosity recorded by the Collider Detector at Fermilab. The search is performed using a matrix element method which calculates the differential cross section for each event for several signal and background hypotheses. These numbers are combined into a single discriminant and used to construct templates from Monte Carlo simulation. A maximum likelihood fit to the data distribution gives a measurement of the cross section. This analysis measures a value of 2.2$+0.8\\atop{-0.7}$ pb, which corresponds to a value of |V tb| = 0.88$+0.16\\atop{-0.14}$experimental±0.7(theoretical). The probability that this result originates from a background fluctuation in the absence of single top production (p-value) is 0.0003, which is equivalent to 3.4 standard deviations in Gaussian statistics. The expected (median) p-value as estimated from pseudo-experiments for this analysis is 0.000003, which corresponds to 4.5 standard deviations in Gaussian statistics.

  13. Study on the top quark pair production mechanism in 1.96 TeV proton-antiproton collisions

    Energy Technology Data Exchange (ETDEWEB)

    Naganoma, Junji [Waseda Univ., Shinjuku (Japan)

    2008-03-01

    The study of the top quark pair production mechanism in proton-antiproton collisions at a center-of-mass energy of 1.96 TeV is described. The main subjects are the measurements of the top quark pair production cross section, the top quark mass and a search for a new particle decaying to the top quark pair. The analyses are based on 1.9 fb-1 of data collected by the Collider Detector at Fermilab (CDF) Run II experiment between March 2002 and May 2007, using the lepton+jets events. The measured top quark pair production cross section is 8.2 ± 0.5 (stat.) ± 0.8 (syst.) ± 0.5 (lum.) pb, which is slightly higher than the standard model prediction at the top mass of 175 GeV/c2. The top quark mass is an important parameter in the standard model, and also in the experimental studies. The measured top quark mass if 171.6 ± 2.0 (stat.) ± 1.3(syst.) GeV/c2. Finally, they report on a search for a new gauge boson decaying to t$\\bar{t}$, which interferes with the standard model gluon in the q$\\bar{q}$ → t$\\bar{t}$ production process. They call such a hypothetical particle a 'Massive Gluon'. The observed t$\\bar{t}$ invariant mass distribution is consistent with the standard model expectations, and also the measured massive gluon coupling strength with quarks is consistent within a statistical fluctuation of the standard model expectation in the wide range of the massive gluon masses and widths. They set the upper and lower limits on the coupling strength of the massive gluon.

  14. Diffractive Dijet Production in $\\bar{p}p$ Collisions at $\\sqrt{s}=1.96$ TeV

    Energy Technology Data Exchange (ETDEWEB)

    Aaltonen, T.; /Helsinki Inst. of Phys.; Albrow, M.; /Fermilab; Alvarez Gonzalez, B.; /Oviedo U. /Cantabria Inst. of Phys.; Amerio, S.; /INFN, Padua; Amidei, D.; /Michigan U.; Anastassov, A.; /Northwestern U. /Fermilab; Annovi, A.; /Frascati; Antos, J.; /Comenius U.; Apollinari, G.; /Fermilab; Appel, J.A.; /Fermilab; Arisawa, T.; /Waseda U. /Dubna, JINR

    2012-06-01

    We report on a study of diffractive dijet production in {bar p}p collisions at {radical}s = 1.96 TeV using the CDF II detector at the Fermilab Tevatron {bar p}p collider. A data sample from 310 pb{sup -1} of integrated luminosity collected by triggering on a high transverse energy jet, E{sub T}{sup jet}, in coincidence with a recoil antiproton detected in a Roman pot spectrometer is used to measure the ratio of single-diffractive to inclusive-dijet event rates as a function of x{sup {bar p}} of the interacting parton in the antiproton, the Bjorken-x, x{sub Bj}{sup {bar p}}, and a Q{sup 2} {approx} (E{sub T}{sup jet}){sup 2} in the ranges 10{sup -3} < x{sub Bj}{sup {bar p}} < 10{sup -1} and 10{sup 2} < Q{sup 2} < 10{sup 4} GeV{sup 2}, respectively. Results are presented for the region of {bar p}-momentum-loss fraction 0.03 < {zeta}{sub {bar p}} < 0.09 and a four-momentum transfer squared t{sub {bar p}} > -4 GeV{sup 2}. The t{sub {bar p}} dependence is measured as a function of Q{sup 2} and x{sub Bj}{sup {bar p}} and compared with that of inclusive single diffraction dissociation. We find weak x{sub Bj}{sup bar p}} and Q{sup 2} dependencies in the ratio of single diffractive to inclusive event rates, and no significant Q{sup 2} dependence in the diffractive t{sub {bar p}} distributions.

  15. 苯丙胺所致精神障碍患者血清脑源性神经营养因子水平及其基因G196A多态性研究%The serum concentrations of brain derived neurotrophic factor and its G196A polymorphism in amphetamine induced-psychosis inpatients

    Institute of Scientific and Technical Information of China (English)

    蒋贤飞; 侯峰; 王年生; 苏中华; 郝伟

    2015-01-01

    目的 探讨苯丙胺所致精神障碍患者外周血脑源性神经营养因子(BDNF)水平及其基因多态性(G196A)与苯丙胺滥用之间的相关性.方法 以233例苯丙胺滥用患者为研究对象,110例健康体检者为对照,采用ELISA法检测血清BDNF水平,应用聚合酶链式反应(PCR)扩增技术,检测其BDNF基因G196A分型,运用SPSS 12.0统计软件进行数据分析.结果 病例组血清BDNF水平[(205.81±75.36)pg/ml]明显高于对照组[(95.04±31.63)pg/ml](t=15.02,P<0.01),苯丙胺所致精神障碍组与苯丙胺滥用组患者血清BDNF水平差异无统计学意义(P>0.05),各等位基因及各基因型血清BDNF水平差异无统计学意义(P>0.05);苯丙胺所致精神障碍组、苯丙胺滥用组和对照组BDNF基因G196A的基因型频率及等位基因频率差异无统计学意义(P>0.05).结论 血清BDNF水平与苯丙胺滥用相关,与其G196A基因多态性无关;BDNF G196A基因多态性与苯丙胺滥用无关.%Objective To investigate the relationship between the serum concentrations of brain derived neurotrophicfactor (BDNF) and its G196A polymorphism in the amphetamine induced-psychosis inpatients.Methods The cross-sectional study included 233 amphetamine abuses and 110 healthy participants who served as controls.The serum concentration of BDNF was measured by sandwich ELISA,and the genotype of BDNF G196A polymorphism was determined used polymerase chain reaction (PCR) techniques.The data were analyzed using SPSS 12.0 statistics software.Results The serum concentration of BDNF in case group((205.81±75.36) pg/ml) were significantly higher than that in control group((95.04±31.63) pg/ml;t=15.02,P<0.01).There was no significant difference about the BDNF serum concentrations between the inpatients with the amphetamine induced psychosis and the inpatients with the amphetamine abuse (P>0.05).The BDNF serum concentration showed no significant difference in the genotype distributions and allele

  16. Search for W' -> tbbar in ppbar Collisions at sqrt(s)=1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Cully, James Clark; /Michigan U.

    2008-12-01

    We present a search for a narrow resonance in the t{bar b} mass spectrum using 1.9 fb{sup -1} of p{bar p} collisions at {radical}s = 1.96 TeV recorded with the CDF II detector at the Fermilab Tevatron. We select events with a lepton, neutrino candidate, and two or three jets from which to construct the t{bar b} mass. We quantify the result using the model of a massive Standard Model-like charged-boson (W{prime}) decaying to t{bar b}, but we are generally sensitive to the presence of any narrow state decaying to the third generation. For a purely right-handed W{prime} with Standard Model couplings, we set a new limit at 95% confidence of {sigma}(p{bar p} {yields} W{prime}{sub R}) x BR(W{prime}{sub R} {yields} t{bar b}) < 0.28 pb and M{sub W{prime}{sub R}} > 800 GeV/c{sup 2}. The limit increases to M{sub W{prime}{sub R}} > 825 GeV/c{sup 2} if decay to right-handed neutrinos is forbidden. These results are shown in Table 7 and plotted in Figure 7.1. The best prior search found M{sub W{prime}} {ge} 768 GeV/c{sup 2} if leptonic decays are forbidden [16]. For a simple W{prime} model with effective coupling g{sub W{prime}}, the cross-section is proportional to g{sub W{prime}}{sup 4}. Relaxing the assumption of the universal weak coupling (g{sub W{prime}} = g{sub W}), our cross-section limits can be rewritten as upper limits on g{sub W{prime}}, as a function of M{sub W{prime}}. This is relevant to both the right-handed W{prime} model as well as a left-handed W{prime} model in which the W{prime}{sub L}-W interference is negligible. The excluded region of the g{sub W{prime}}-M{sub W{prime}} plane is shown in Figure 7.2, with g{sub W{prime}} in units of g{sub W}. At M{sub W{prime}} = 300 GeV/c{sup 2}, we limit (95% C.L.) the effective coupling to be less than 0.40 of the standard weak coupling.

  17. Measurement of the single top production cross section in proton-antiproton collisions at 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Tanasijczuk, Andres Jorge; /Buenos Aires U.

    2010-05-01

    This thesis describes a search for singly produced top quarks via an electroweak vertex in head-on proton-antiproton collisions at a center of mass energy of {radical}s = 1.96 TeV. The analysis uses a total of 2.3 fb{sup -1} of data collected with the D0 detector at Fermilab, corresponding to two different run periods of the Tevatron collider. Two channels contribute to single top quark production at the Tevatron, the s-channel and the t-channel. In the s-channel, a virtual W boson is produced from the aniquilation of a quark and an antiquark and a top and a bottom quarks are produced from the W decay. The top quark decays almost exclusively into a W boson and a bottom quark. Final states are considered in which the W boson decays leptonically into an electron or a muon plus a neutrino. Thus, at the detector level, the final state characterizing the s-channel contains one lepton, missing energy accounting for the neutrino, and two jets from the two bottom quarks. In the t-channel, the final state has an additional jet coming from a light quark. Clearly, a precise reconstruction of the events requires a precise measurement of the energy of the jets. A multivariate technique, Bayesian neural networks, is used to extract the single top signal from the overwhelming background still left after event selection. A Bayesian likelihood probability is then computed to measure the single top cross section. Assuming the observed excess is due to single top events, the measured single top quark production cross section is {sigma}(p{bar p} {yields} tb + X, tqb + X) = 4.70{sub -0.93}{sup +1.18} pb. The observed excess is associated with a p-value of (3.2 {+-} 2.3) x 10{sup -8}, assuming the background-only hypothesis. This p-value corresponds to an excess over background of 5.4 standard deviations for a Gaussian density. The p-value computed using the standard model signal cross section of 3.46 pb is (22.7 {+-} 0.6) x 10{sup -6}, corresponding to an expected significance of 4

  18. Measurement of the Single Top Quark Production Cross Section in 1.96-TeV Proton-Antiproton Collisions

    Energy Technology Data Exchange (ETDEWEB)

    Nakamura, Koji [Univ. of Tsukuba (Japan)

    2009-02-01

    Top quarks are predominantly produced in pairs via the strong interaction in $\\bar{p}$p collisions at √s = 1.96 TeV . The top quark has a weak isospin 1/2, composing a weak isospin doublet with the bottom quark. This characteristic predicts not only top quark pair production via strong interaction but also single production together with a bottom quark via weak interaction. However, finding single top quark production is challenging since it is rarely produced (σ singletop = 2.9 pb) against background processes with the same final state like W+jets and t$\\bar{t}$. A measurement of electroweak single top production probes the W-t-b vertex, which provides a direct determination of the Cabbibo-Kobayashi-Maskawa (CKM) matrix element |Vtb|. The sample offers a source of almost 100% polarized top quarks. This thesis describes an optimized search for s-channel single top quark production and a measurement of the single top production cross section using 2.7 fb-1 of data accumulated with the CDF detector. We are using events with one high-pT lepton, large missing ET and two identified b-quark jets where one jet is identified using a secondary vertex tagger, called SecVtx, and the other jet is identified using SecVtx or a jet probability tagger, called JetProb. In this analysis we have developed a kinematics fitter and a likelihood-based separator between signal and background. As a result, we found that the probability (p-value) that the candidate events originate from a background fluctuation in the absence of single top s-channel production is 0.003, which is equivalent to 2.7 σ deviations in Gaussian statistics, and this excess corresponds to the single top s-channel cross section of 2.38-0.84+1.01 pb. An observed value of |Vtb| is 1.43-0.26+0.38(experimental) ± 0.11(theory). We also set the 95% CL. upper limit of σs = 4.15 pb for the s

  19. Measurement of the single top production cross section in proton-antiproton collisions at 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Tanasijczuk, Andres Jorge [Univ. of Buenos Aires (Argentina)

    2010-03-25

    This thesis describes a search for singly produced top quarks via an electroweak vertex in head-on proton-antiproton collisions at a center of mass energy of √s = 1.96 TeV. The analysis uses a total of 2.3 fb-1 of data collected with the D0 detector at Fermilab, corresponding to two different run periods of the Tevatron collider. Two channels contribute to single top quark production at the Tevatron, the s-channel and the t-channel. In the s-channel, a virtual W boson is produced from the aniquilation of a quark and an antiquark and a top and a bottom quarks are produced from the W decay. The top quark decays almost exclusively into a W boson and a bottom quark. Final states are considered in which the W boson decays leptonically into an electron or a muon plus a neutrino. Thus, at the detector level, the final state characterizing the s-channel contains one lepton, missing energy accounting for the neutrino, and two jets from the two bottom quarks. In the t-channel, the final state has an additional jet coming from a light quark. Clearly, a precise reconstruction of the events requires a precise measurement of the energy of the jets. A multivariate technique, Bayesian neural networks, is used to extract the single top signal from the overwhelming background still left after event selection. A Bayesian likelihood probability is then computed to measure the single top cross section. Assuming the observed excess is due to single top events, the measured single top quark production cross section is σ(p$\\bar{p}$ → tb + X, tqb + X) = 4.70+1.18-0.93 pb. The observed excess is associated with a p-value of (3.2 ± 2.3) x 10-8, assuming the background-only hypothesis. This p-value corresponds to an excess over background of 5.4 standard deviations for a Gaussian density. The p-value computed using the standard model signal cross section of 3.46 pb is (22.7 ± 0.6) x 10-6, corresponding to an expected significance

  20. Measurement of Inclusive Jet Cross Sections in Z/g* (-> ee)+jets Production in ppbar Collisions at $\\sqrt{s}$=1.96 TeV

    CERN Document Server

    Aaltonen, T; Akimoto, T; Albrow, M G; Alvarez-Gonzalez, B; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Apresyan, A; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Aurisano, A; Azfar, F; Azzi-Bacchetta, P; Azzurri, P; Bacchetta, N; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Baroiant, S; Bartsch, V; Bauer, G; Beauchemin, P H; Bedeschi, F; Bednar, P; Behari, S; Bellettini, G; Bellinger, J; Belloni, A; Benjamin, D; Beretvas, A; Beringer, J; Berry, T; Bhatti, A; Binkley, M; Bisello, D; Bizjak, I; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bölla, G; Bolshov, A; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Bridgeman, A; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, Yu A; Budd, H S; Budd, S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Byrum, K L; Cabrerar, S; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carlsmith, D; Carosi, R; Carrillol, S; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavalli-Sforza, M; Cerri, A; Cerritop, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, K; Chokheli, D; Chou, J P; Choudalakis, G; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Compostella, G; Convery, M E; Conway, J; Cooper, B; Copic, K; Cordelli, M; Cortiana, G; Crescioli, F; Cuenca Almenarr, C; Cuevaso, J; Culbertson, R; Cully, J C; Dagenhart, D; Datta, M; Davies, T; De Barbaro, P; De Cecco, S; Deisher, A; De Lentdeckerd, G; De Lorenzo, G; Dell'Orso, Mauro; Demortier, L; Deng, J; Deninno, M; De Pedis, D; Derwent, P F; Di Giovanni, G P; Dionisi, C; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Donati, S; Dong, P; Donini, J; Dorigo, T; Dube, S; Efron, J; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, W T; Feild, R G; Feindt, M; Fernández, J P; Ferrazza, C; Field, R; Flanagan, G; Forrest, R; Forrester, S; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; Garberson, F; García, J E; Garfinkel, A F; Gerberich, H; Gerdes, D; Giagu, S; Giakoumopoloua, V; Giannetti, P; Gibson, K; Gimmell, J L; Ginsburg, C M; Giokarisa, N; Giordani, M; Giromini, P; Giunta, M; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Golossanov, A; Gómez, G; Gómez-Ceballos, G; Goncharov, M; Gonzlez, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Grinstein, S; Grosso-Pilcher, C; Group, R C; Grundler, U; Guimaraesda Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Hamilton, A; Han, B Y; Han, J Y; Handler, R; Happacher, F; Hara, K; Hare, D; Hare, M; Harper, S; Harr, R F; Harris, R M; Hartz, M; Hatakeyama, K; Hauser, J; Hays, C; Heck, M; Heijboer, A; Heinemann, B; Heinrich, J; Henderson, C; Herndon, M; Heuser, J; Hewamanage, S; Hidas, D; Hillc, C S; Hirschbuehl, D; Höcker, A; Hou, S; Houlden, M; Hsu, S C; Huffman, B T; Hughes, R E; Husemann, U; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ivanov, A; Iyutin, B; James, E; Jayatilaka, B; Jeans, D; Jeon, E J; Jindariani, S; Johnson, W; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Kar, D; Karchin, P E; Kato, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Klute, M; Knuteson, B; Ko, B R; Koay, S A; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kraus, J; Kreps, M; Kroll, J; Krumnack, N; Kruse, M; Krutelyov, V; Kubo, T; Kuhlmann, S E; Kuhr, T; Kulkarni, N P; Kusakabe, Y; Kwang, S; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; Le Compte, T; Lee, J; Lee, J; Lee, Y J; Leeq, S W; Lefèvre, R; Leonardo, N; Leone, S; Levy, S; Lewis, J D; Lin, C; Lin, C S; Linacre, J; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Lovas, L; Lu, R S; Lucchesi, D; Lueck, J; Luci, C; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Lytken, E; Mack, P; MacQueen, D; Madrak, R; Maeshima, K; Makhoul, K; Mäki, T; Maksimovic, P; Malde, S; Malik, S; Manca, G; Manousakisa, A; Margaroli, F; Marino, C; Marino, C P; Martin, A; Martin, M; Martinj, V; Martínez, M; Martinez-Ballarin, R; Maruyama, T; Mastrandrea, P; Masubuchi, T; Mattson, M E; Mazzanti, P; McFarland, K S; McIntyre, P; McNultyi, R; Mehta, A; Mehtälä, P; Menzemerk, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Miao, T; Miladinovic, N; Miles, J; Miller, R; Mills, C; Milnik, M; Mitra, A; Mitselmakher, G; Miyake, H; Moed, S; Moggi, N; Moon, C S; Moore, R; Morello, M; Movilla-Fernández, P A; Mülmenstädt, J; Mukherjee, A; Müller, T; Mumford, R; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Nagano, A; Naganoma, J; Nakamura, K; Nakano, I; Napier, A; Necula, V; Neu, C; Neubauer, M S; Nielsenf, J; Nodulman, L; Norman, M

    2007-01-01

    Inclusive jet cross sections in Z/gamma^* events, with Z/gamma^* decaying into an electron-positron pair, are measured as a function of jet transverse momentum and jet multiplicity in ppbar collisions at sqrt{s} = 1.96 TeV with the upgraded Collider Detector at Fermilab in Run II, based on an integrated luminosity of 1.7 fb^-1. The measurements cover the rapidity region | yjet | 30 GeV/c. Next-to-leading order perturbative QCD predictions are in good agreement with the measured cross sections.

  1. Search for Wprime Boson Decaying to Electron-Neutrino Pairs in pbarp Collisions at sqrt{s}=1.96 TeV

    CERN Document Server

    Abulencia, A; Affolder, T; Akimoto, T; Albrow, M G; Ambrose, D; Amerio, S; Amidei, D; Anastassov, A; Anikeev, K; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Arguin, J F; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Azfar, F; Azzi-Bacchetta, P; Azzurri, P; Bacchetta, N; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Baroiant, S; Bartsch, V; Bauer, G; Bedeschi, F; Behari, S; Belforte, S; Bellettini, G; Bellinger, J; Belloni, A; Benjamin, D; Beretvas, A; Beringer, J; Berry, T; Bhatti, A; Binkley, M; Bisello, D; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bölla, G; Bolshov, A; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, Yu A; Budd, H S; Budd, S; Budroni, S; Burkett, K; Busetto, G; Bussey, P; Byrum, K L; Cabrera, S; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carillo, S; Carlsmith, D; Carosi, R; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, I; Cho, K; Chokheli, D; Chou, J P; Choudalakis, G; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Ciljak, M; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Coca, M; Compostella, G; Convery, M E; Conway, J; Cooper, B; Copic, K; Cordelli, M; Cortiana, G; Crescioli, F; Cuenca-Almenar, C; Cuevas-Maestro, J; Culbertson, R; Cully, J C; Cyr, D; Da Ronco, S; D'Auria, S; Davies, T; D'Onofrio, M; Dagenhart, D; De Barbaro, P; De Cecco, S; Deisher, A; De Lentdecker, G; Dell'Orso, Mauro; Delli Paoli, F; Demortier, L; Deng, J; Deninno, M; De Pedis, D; Derwent, P F; Di Giovanni, G P; Dionisi, C; Di Ruzza, B; Dittmann, J R; Di Turo, P; Dorr, C; Donati, S; Donega, M; Dong, P; Donini, J; Dorigo, T; Dube, S; Efron, J; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, I; Fedorko, W T; Feild, R G; Feindt, M; Fernández, J P; Field, R; Flanagan, G; Foland, A; Forrester, S; Foster, G W; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; García, J E; Garberson, F; Garfinkel, A F; Gay, C; Gerberich, H; Gerdes, D; Giagu, S; Giannetti, P; Gibson, A; Gibson, K; Gimmell, J L; Ginsburg, C; Giokaris, N; Giordani, M; Giromini, P; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Goldstein, J; Gómez, G; Gómez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Griffiths, M; Grinstein, S; Grosso-Pilcher, C; Group, R C; Grundler, U; Guimarães da Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Hamilton, A; Han, B Y; Han, J Y; Handler, R; Happacher, F; Hara, K; Hare, M; Harper, S; Harr, R F; Harris, R M; Hartz, M; Hatakeyama, K; Hauser, J; Heijboer, A; Heinemann, B; Heinrich, J; Henderson, C; Herndon, M; Heuser, J; Hidas, D; Hill, C S; Hirschbuehl, D; Höcker, A; Holloway, A; Hou, S; Houlden, M; Hsu, S C; Huffman, B T; Hughes, R E; Husemann, U; Huston, J; Incandela, J R; Introzzi, G; Iori, M; Ishizawa, Y; Ivanov, A; Iyutin, B; James, E; Jang, D; Jayatilaka, B; Jeans, D; Jensen, H; Jeon, E J; Jindariani, S; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Karchin, P E; Kato, Y; Kemp, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Klute, M; Knuteson, B; Ko, B R; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kovalev, A; Kraan, A C; Kraus, J; Kravchenko, I; Kreps, M; Kroll, J; Krumnack, N; Kruse, M; Krutelyov, V; Kubo, T; Kuhlmann, S E; Kuhr, T; Kusakabe, Y; Kwang, S; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; LeCompte, T; Lee, J; Lee, Y J; Lee, S W; Lefèvre, R; Leonardo, N; Leone, S; Levy, S; Lewis, J D; Lin, C; Lin, C S; Lindgren, M; Lipeles, E; Liss, T M; Lister, A; Litvintsev, D O; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Loverre, P F; Lu, R S; Lucchesi, D; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Lytken, E; Mack, P; MacQueen, D; Madrak, R; Maeshima, K; Makhoul, K; Mäki, T; Maksimovic, P; Malde, S; Manca, G; Margaroli, F; Marginean, R; Marino, C; Marino, C P; Martin, A; Martin, M; Martin, V; Martínez, M; Maruyama, T; Mastrandrea, P; Masubuchi, T; Matsunaga, H; Mattson, M E; Mazini, R; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtälä, P; Menzemer, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Miao, T; Miladinovic, N; Miles, J; Miller, R; Mills, C; Milnik, M; Mitra, A; Mitselmakher, G; Miyamoto, A; Moed, S; Moggi, N; Mohr, B; Moore, R; Morello, M; Movilla-Fernández, P A; Mülmenstädt, J; Mukherjee, A; Müller, T; Mumford, R; Murat, P; Nachtman, J; Nagano, A; Naganoma, J; Nakano, I; Napier, A; Necula, V; Neu, C; Neubauer, M S; Nielsen, J; Nigmanov, T; Nodulman, L; Norniella, O

    2006-01-01

    We present the results of a search for Wprime boson decaying to electron-neutrino pairs in pbarp collisions at a center-of-mass energy of 1.96 TeV, using a data sample corresponding to 205 pb^-1 of integrated luminosity collected by the CDF II detector at Fermilab. We observe no evidence for this decay mode and set limits on the production cross section times branching fraction, assuming the neutrinos from Wprime boson decays to be light. If we assume the manifest left-right symmetric model, we exclude a Wprime boson with mass less than 788 GeV/c^2 at the 95% confidence level.

  2. Search for a Fermiophobic Higgs Boson Decaying into Diphotons in p p-bar Collisions at sqrt{s} = 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Aaltonen, T.; /Helsinki Inst. of Phys.; Adelman, Jahred A.; /Chicago U., EFI; Akimoto, T.; /Tsukuba U.; Alvarez Gonzalez, B.; /Cantabria Inst. of Phys.; Amerio, S.; /INFN, Padua; Amidei, Dante E.; /Michigan U.; Anastassov, A.; /Northwestern U.; Annovi, Alberto; /Frascati; Antos, Jaroslav; /Comenius U.; Apollinari, G.; /Fermilab; Apresyan, A.; /Purdue U. /Waseda U.

    2009-05-01

    A search for a narrow diphoton mass resonance is presented based on data from 3.0 fb{sup -1} of integrated luminosity from p{bar p} collisions at {radical}s = 1.96 TeV collected by the CDF experiment. No evidence of a resonance in the diphoton mass spectrum is observed, and upper limits are set on the cross section times branching fraction of the resonant state as a function of Higgs boson mass. The resulting limits exclude Higgs bosons with masses below 106 GeV/c{sup 2} at a 95% Bayesian credibility level (C.L.) for one fermiophobic benchmark model.

  3. Search for charged Higgs bosons from top quark decays in \\ppbar collisions at $\\sqrt{s}=1.96$ TeV

    CERN Document Server

    Abulencia, A; Adelman, J; Affolder, T; Akimoto, T; Albrow, M G; Ambrose, D; Amerio, S; Amidei, D; Anastassov, A; Anikeev, K; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Arguin, J F; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Azfar, F; Azzi-Bacchetta, P; Azzurri, P; Bacchetta, N; Bachacou, H; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Baroiant, S; Bartsch, V; Bauer, G; Bedeschi, F; Behari, S; Belforte, S; Bellettini, G; Bellinger, J; Belloni, A; Ben-Haim, E; Benjamin, D; Beretvas, A; Beringer, J; Berry, T; Bhatti, A A; Binkley, M; Bisello, D; Bishai, M; Blair, R E; Blocker, C; Bloom, K; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bölla, G; Bolshov, A; Bortoletto, D; Boudreau, J; Bourov, S; Boveia, A; Brau, B; Bromberg, C; Brubaker, E; Budagov, Yu A; Budd, H S; Budd, S; Burkett, K; Busetto, G; Bussey, P; Byrum, K L; Cabrera, S; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carlsmith, D; Carosi, R; Carron, S; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chapman, J; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, I; Cho, K; Chokheli, D; Chou, J P; Chu, P H; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Ciljak, M; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Coca, M; Connolly, A; Convery, M E; Conway, J; Cooper, B; Copic, K; Cordelli, M; Cortiana, G; Cruz, A; Cuevas-Maestro, J; Culbertson, R; Cyr, D; Da Ronco, S; D'Auria, S; D'Onofrio, M; Dagenhart, D; De Barbaro, P; De Cecco, S; Deisher, A; De Lentdecker, G; Dell'Orso, Mauro; Demers, S; Demortier, L; Deng, J; Deninno, M; De Pedis, D; Derwent, P F; Dionisi, C; Dittmann, J R; Di Turo, P; Dorr, C; Dominguez, A; Donati, S; Donega, M; Dong, P; Donini, J; Dorigo, T; Dube, S; Ebina, K; Efron, J; Ehlers, J; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, I; Fedorko, W T; Feild, R G; Feindt, M; Fernández, J P; Field, R; Flanagan, G; Flores-Castillo, L R; Foland, A; Forrester, S; Foster, G W; Franklin, M; Freeman, J C; Fujii, Y; Furic, I; Gajjar, A; Gallinaro, M; Galyardt, J; García, J E; García-Sciveres, M; Garfinkel, A F; Gay, C; Gerberich, H; Gerchtein, E; Gerdes, D; Giagu, S; Giannetti, P; Gibson, A; Gibson, K; Ginsburg, C; Giolo, K; Giordani, M; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D A; Gold, M; Goldschmidt, N; Goldstein, J; Gómez, G; Gómez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Gotra, Yu; Goulianos, K; Gresele, A; Griffiths, M; Grinstein, S; Grosso-Pilcher, C; Grundler, U; Guimarães da Costa, J; Haber, C; Hahn, S R; Hahn, K; Halkiadakis, E; Hamilton, A; Han, B Y; Handler, R; Happacher, F; Hara, K; Hare, M; Harper, S; Harr, R F; Harris, R M; Hatakeyama, K; Hauser, J; Hays, C; Hayward, H; Heijboer, A; Heinemann, B; Heinrich, J; Hennecke, M; Herndon, M; Heuser, J; Hidas, D; Hill, C S; Hirschbuehl, D; Höcker, A; Holloway, A; Hou, S; Houlden, M; Hsu, S C; Huffman, B T; Hughes, R E; Huston, J; Ikado, K; Incandela, J R; Introzzi, G; Iori, M; Ishizawa, Y; Ivanov, A; Iyutin, B; James, E; Jang, D; Jayatilaka, B; Jeans, D; Jensen, H; Jeon, E J; Jones, M; Joo, K K; Jun, S Y; Junk, T R; Kamon, T; Kang, J; Karagoz-Unel, M; Karchin, P E; Kato, Y; Kemp, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, M S; Kim, S B; Kim, S H; Kim, Y K; Kirby, M; Kirsch, L; Klimenko, S; Klute, M; Knuteson, B; Ko, B R; Kobayashi, H; Kondo, K; Kong, D J; Konigsberg, J; Kordas, K; Korytov, A; Kotwal, A V; Kovalev, A; Kraus, J; Kravchenko, I; Kreps, M; Kreymer, A; Kroll, J; Krumnack, N; Kruse, M; Krutelyov, V; Kuhlmann, S E; Kusakabe, Y; Kwang, S; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; Lecci, C; LeCompte, T; Lee, J; Lee, S W; Lefèvre, R; Leonardo, N; Leone, S; Levy, S; Lewis, J D; Li, K; Lin, C; Lin, C S; Lindgren, M; Lipeles, E; Liss, T M; Lister, A; Litvintsev, D O; Liu, T; Liu, Y; Lockyer, N S; Loginov, A; Loreti, M; Loverre, P F; Lu, R S; Lucchesi, D; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Lytken, E; Mack, P; MacQueen, D; Madrak, R; Maeshima, K; Maksimovic, P; Manca, G; Margaroli, F; Marginean, R; Marino, C; Martin, A; Martin, M; Martin, V; Martínez, M; Maruyama, T; Matsunaga, H; Mattson, M E; Mazini, R; Mazzanti, P; McFarland, K S; McGivern, D; McIntyre, P; McNamara, P; McNulty, R; Mehta, A; Menzemer, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Von der Mey, M; Miao, T; Miladinovic, N; Miles, J; Miller, R; Miller, J S; Mills, C; Milnik, M; Miquel, R; Miscetti, S; Mitselmakher, G; Miyamoto, A; Moggi, N; Mohr, B; Moore, R; Morello, M; Movilla-Fernández, P A; Mülmenstädt, J; Mukherjee, A; Mulhearn, M; Müller, T; Mumford, R; Murat, P; Nachtman, J; Nahn, S; Nakano, I; Napier, A; Naumov, D; Necula, V; Neu, C; Neubauer, M S; Nielsen, J; Nigmanov, T; Nodulman, L; Norniella, O; Ogawa, T; Oh, S H; Oh, Y D; Okusawa, T; Oldeman, R; Orava, R; Österberg, K; Pagliarone, C; Palencia, E; Paoletti, R; Papadimitriou, V; Papikonomou, A; Paramonov, A A; Parks, B; Pashapour, S; Patrick, J; Pauletta, G; Paulini, M; Paus, C; Pellett, D E; Penzo, Aldo L; Phillips, T J; Piacentino, G; Piedra, J; Pitts, K; Plager, C; Pondrom, L; Pope, G; Portell, X; Poukhov, O; Pounder, N; Prakoshyn, F; Pronko, A; Proudfoot, J; Ptohos, F; Punzi, G; Pursley, J; Rademacker, J; Rahaman, A; Rakitine, A; Rappoccio, S; Ratnikov, F; Reisert, B; Rekovic, V; Van Remortel, N; Renton, P B; Rescigno, M; Richter, S; Rimondi, F; Rinnert, K; Ristori, L; Robertson, W J; Robson, A; Rodrigo, T; Rogers, E; Rolli, S; Roser, R; Rossi, M; Rossin, R; Rott, C; Ruiz, A; Russ, J; Rusu, V; Ryan, D; Saarikko, H; Sabik, S; Safonov, A; Sakumoto, W K; Salamanna, G; Salto, O; Saltzberg, D; Sánchez, C; Santi, L; Sarkar, S; Sato, K; Savard, P; Savoy-Navarro, A; Scheidle, T; Schlabach, P; Schmidt, E E; Schmidt, M P; Schmitt, M; Schwarz, T; Scodellaro, L; Scott, A L; Scribano, A; Scuri, F; Sedov, A; Seidel, S; Seiya, Y; Semenov, A; Semeria, F; Sexton-Kennedy, L; Sfiligoi, I; Shapiro, M D; Shears, T G; Shepard, P F; Sherman, D; Shimojima, M; Shochet, M; Shon, Y; Shreyber, I; Sidoti, A; Sill, A; Sinervo, P; Sisakian, A; Sjölin, J; Skiba, A; Slaughter, A J; Sliwa, K; Smirnov, D; Smith, J R; Snider, F D; Snihur, R; Söderberg, M; Soha, A; Somalwar, S; Sorin, V; Spalding, J; Spinella, F; Squillacioti, P; Stanitzki, M; Staveris-Polykalas, A; Saint-Denis, R; Stelzer, B; Stelzer-Chilton, O; Stentz, D; Strologas, J; Stuart, D; Suh, J S; Sukhanov, A; Sumorok, K; Sun, H; Suzuki, T; Taffard, A; Tafirout, R; Takashima, R; Takeuchi, Y; Takikawa, K; Tanaka, M; Tanaka, R; Tecchio, M; Teng, P K; Terashi, K; Tether, S; Thom, J; Thompson, A S; Thomson, E; Tipton, P; Tiwari, V; Tkaczyk, S; Toback, D; Tollefson, K; Tomura, T; Tonelli, D; Tonnesmann, M; Torre, S; Torretta, D; Tourneur, S; Trischuk, W; Tsuchiya, R; Tsuno, S; Turini, N; Ukegawa, F; Unverhau, T; Uozumi, S; Usynin, D; Vacavant, L; Vaiciulis, A W; Vallecorsa, S; Varganov, A; Vataga, E; Velev, G; Veramendi, G; Veszpremi, V; Vickey, T; Vidal, R; Vila, I; Vilar, R; Vollrath, I; Volobuev, I P; Würthwein, F; Wagner, P; Wagner, R G; Wagner, R L; Wagner, W; Wallny, R; Walter, T; Wan, Z; Wang, M J; Wang, S M; Warburton, A; Ward, B; Waschke, S; Waters, D; Watts, T; Weber, M; Wester, W C; Whitehouse, B; Whiteson, D; Wicklund, A B; Wicklund, E; Williams, H H; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolfe, C; Worm, S; Wright, T; Wu, X; Wynne, S M; Yagil, A; Yamamoto, K; Yamaoka, J; Yamashita, Y; Yang, C; Yang, U K; Yao, W M; Yeh, G P; Yoh, J; Yorita, K; Yoshida, T; Yu, I; Yu, S S; Yun, J C; Zanello, L; Zanetti, A; Zaw, I; Zetti, F; Zhang, X; Zhou, J; Zucchelli, S

    2006-01-01

    We report the results of a search for a charged Higgs boson in the decays of top quarks produced in \\ppbar collisions at a center-of-mass energy of 1.96 TeV. We use a data sample corresponding to an integrated luminosity of 193/pb collected by the upgraded Collider Detector at Fermilab. No evidence for charged Higgs production is found, allowing 95% C.L. upper limits to be placed on BR(t->H^+b) for different charged Higgs decay scenarios. In addition, we present in the MSSM (mH,tan beta) plane the first exclusion regions with radiative and Yukawa coupling corrections.

  4. Proceedings of Japan-U.S. workshop P-196 on high heat flux components and plasma surface interactions for next devices

    International Nuclear Information System (INIS)

    The Japan-US Workshop P-196 was successfully carried out in Kyushu University, Chikushi Campus, from November 17 to 19. The major concern was on the research and development required both for international Thermonuclear Experimental Reactor (ITER) and Large Helical Device (LHD). Most of the discussion items was similar to that of the last workshop, e.g. PFC and PSI in Large Device, High Heat Flux Component, Laboratory Studies and Neutron Damage. The presentation number concerning High Heat Flux Component was largest. (J.P.N.)

  5. Study of double parton interactions in diphoton + dijet events in $p\\bar{p}$ collisions at $\\sqrt{s} = 1.96$ TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abazov, Victor Mukhamedovich; et al.

    2016-03-17

    We use a sample of diphoton+dijet events to measure the effective cross section of double parton interactions, which characterizes the area containing the interacting partons in proton-antiproton collisions, and find it to be σeff=19.3±1.4(stat)±7.8(syst) mb. The sample was collected by the D0 detector at the Fermilab Tevatron collider in pp¯ collisions at s=1.96 TeV and corresponds to an integrated luminosity of 8.7 fb-1.

  6. Measurement of prompt charm meson production cross sections in pp collisions at square root s = 1.96 TeV.

    Science.gov (United States)

    Acosta, D; Affolder, T; Ahn, M H; Akimoto, T; Albrow, M G; Ambrose, D; Amidei, D; Anastassov, A; Anikeev, K; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Arguin, J-F; Arisawa, T; Artikov, A; Asakawa, T; Ashmanskas, W; Attal, A; Azfar, F; Azzi-Bacchetta, P; Bacchetta, N; Bachacou, H; Badgett, W; Bailey, S; Barbaro-Galtieri, A; Barker, G; Barnes, V E; Barnett, B A; Baroiant, S; Barone, M; Bauer, G; Bedeschi, F; Behari, S; Belforte, S; Bell, W H; Bellettini, G; Bellinger, J; Benjamin, D; Beretvas, A; Bhatti, A; Binkley, M; Bisello, D; Bishai, M; Blair, R E; Blocker, C; Bloom, K; Blumenfeld, B; Bocci, A; Bodek, A; Bolla, G; Bolshov, A; Booth, P S L; Bortoletto, D; Boudreau, J; Bourov, S; Bromberg, C; Brozovic, M; Brubaker, E; Budagov, J; Budd, H S; Burkett, K; Busetto, G; Bussey, P; Byrum, K L; Cabrera, S; Calafiura, P; Campanelli, M; Campbell, M; Canepa, A; Carlsmith, D; Carron, S; Carosi, R; Casarsa, M; Caskey, W; Castro, A; Catastini, P; Cauz, D; Cerri, A; Cerri, C; Cerrito, L; Chapman, J; Chen, C; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, K; Chokheli, D; Chu, M L; Chung, J Y; Chung, W-H; Chung, Y S; Ciobanu, C I; Ciocci, M A; Clark, A G; Coca, M N; Connolly, A; Convery, M E; Conway, J; Cordelli, M; Cortiana, G; Cranshaw, J; Culbertson, R; Currat, C; Cyr, D; Dagenhart, D; DaRonco, S; D'Auria, S; De Barbaro, P; De Cecco, S; Dell'Agnello, S; Dell'Orso, M; Demers, S; Demortier, L; Deninno, M; De Pedis, D; Derwent, P F; Dionisi, C; Dittmann, J R; Doksus, P; Dominguez, A; Donati, S; D'Onofrio, M; Dorigo, T; Drollinger, V; Ebina, K; Eddy, N; Ely, R; Erbacher, R; Erdmann, M; Errede, D; Errede, S; Eusebi, R; Fang, H-C; Farrington, S; Fedorko, I; Feild, R G; Feindt, M; Fernandez, J P; Ferretti, C; Field, R D; Fiori, I; Flanagan, G; Flaugher, B; Flores-Castillo, L R; Foland, A; Forrester, S; Foster, G W; Franklin, M; Frisch, H; Fujii, Y; Furic, I; Gallas, A; Gallinaro, M; Galyardt, J; Garcia-Sciveres, M; Garfinkel, A F; Gay, C; Gerberich, H; Gerchtein, E; Gerdes, D W; Giagu, S; Giannetti, P; Gibson, A; Gibson, K; Ginsburg, C; Giolo, K; Giordani, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Goldstein, D; Goldstein, J; Gomez, G; Gomez-Ceballos, G; Goncharov, M; Gorelov, I; Goshaw, A T; Gotra, Y; Goulianos, K; Gresele, A; Grim, G; Grosso-Pilcher, C; Guenther, M; Guimaraes Da Costa, J; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Hall, C; Handler, R; Happacher, F; Hara, K; Hare, M; Harr, R F; Harris, R M; Hartmann, F; Hatakeyama, K; Hauser, J; Hays, C; Heider, E; Heinemann, B; Heinrich, J; Hennecke, M; Herndon, M; Hill, C; Hirschbuehl, D; Hocker, A; Hoffman, K D; Holloway, A; Hou, S; Houlden, M A; Huffman, B T; Hughes, R E; Huston, J; Ikado, K; Incandela, J; Introzzi, G; Iori, M; Ishizawa, Y; Issever, C; Ivanov, A; Iwata, Y; Iyutin, B; James, E; Jang, D; Jarrell, J; Jeans, D; Jensen, H; Jones, M; Jun, S Y; Junk, T; Kamon, T; Kang, J; Karagoz Unel, M; Karchin, P E; Kartal, S; Kato, Y; Kemp, Y; Kephart, R; Kerzel, U; Khazins, D; Khotilovich, V; Kilminster, B; Kim, B J; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, M S; Kim, S B; Kim, S H; Kim, T H; Kim, Y K; King, B T; Kirby, M; Kirk, M; Kirsch, L; Klimenko, S; Knuteson, B; Kobayashi, H; Koehn, P; Kondo, K; Konigsberg, J; Kordas, K; Korn, A; Korytov, A; Kotelnikov, K; Kotwal, A V; Kovalev, A; Kraus, J; Kravchenko, I; Kreymer, A; Kroll, J; Kruse, M; Krutelyov, V; Kuhlmann, S E; Kuznetsova, N; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, J; Lancaster, M; Lander, R; Lannon, K; Lath, A; Latino, G; Lauhakangas, R; Lazzizzera, I; Le, Y; Lecci, C; LeCompte, T; Lee, J; Lee, J; Lee, S W; Leonardo, N; Leone, S; Lewis, J D; Li, K; Lin, C S; Lindgren, M; Liss, T M; Litvintsev, D O; Liu, T; Liu, Y; Lockyer, N S; Loginov, A; Loken, J; Loreti, M; Loverre, P; Lucchesi, D; Lukens, P; Lyons, L; Lys, J; MacQueen, D; Madrak, R; Maeshima, K; Maksimovic, P; Malferrari, L; Manca, G; Marginean, R; Martin, A; Martin, M; Martin, V; Martinez, M; Maruyama, T; Matsunaga, H; Mattson, M; Mazzanti, P; McFarland, K S; McGivern, D; McIntyre, P M; McNamara, P; McNulty, R; Menzemer, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Meyer, A; Miao, T; Miller, L; Miller, R; Miller, J S; Miquel, R; Miscetti, S; Mishina, M; Mitselmakher, G; Miyamoto, A; Miyazaki, Y; Moggi, N; Moore, R; Morello, M; Moulik, T; Mukherjee, A; Mulhearn, M; Muller, T; Mumford, R; Munar, A; Murat, P; Murgia, S; Nachtman, J; Nahn, S; Nakamura, I; Nakano, I; Napier, A; Napora, R; Necula, V; Niell, F; Nielsen, J; Nelson, C; Nelson, T; Neu, C; Neubauer, M S; Newman-Holmes, C; Nicollerat, A-S; Nigmanov, T; Niu, H; Nodulman, L; Oesterberg, K; Ogawa, T; Oh, S; Oh, Y D; Ohsugi, T; Oishi, R; Okusawa, T; Oldeman, R; Orava, R; Orejudos, W; Pagliarone, C; Palmonari, F; Paoletti, R; Papadimitriou, V; Partos, D; Pashapour, S; Patrick, J; Pauletta, G; Paulini, M; Pauly, T; Paus, C; Pellett, D

    2003-12-12

    We report on measurements of differential cross sections dsigma/dp(T) for prompt charm meson production in ppmacr; collisions at sqrt[s]=1.96 TeV using 5.8+/-0.3 pb(-1) of data from the CDF II detector at the Fermilab Tevatron. The data are collected with a new trigger that is sensitive to the long lifetime of hadrons containing heavy flavor. The charm meson cross sections are measured in the central rapidity region |y|K-pi(+), D(*+)-->D0pi(+), D+-->K-pi(+)pi(+), D(+)(s)-->phipi(+), and their charge conjugates. The measured cross sections are compared to theoretical calculations.

  7. Search for long-lived doubly charged Higgs bosons in pp collisions at sqrt[s] = 1.96 TeV.

    Science.gov (United States)

    Acosta, D; Adelman, J; Affolder, T; Akimoto, T; Albrow, M G; Ambrose, D; Amerio, S; Amidei, D; Anastassov, A; Anikeev, K; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Arisawa, T; Arguin, J-F; Artikov, A; Ashmanskas, W; Attal, A; Azfar, F; Azzi-Bacchetta, P; Bacchetta, N; Bachacou, H; Badgett, W; Barbaro-Galtieri, A; Barker, G J; Barnes, V E; Barnett, B A; Baroiant, S; Bauer, G; Bedeschi, F; Behari, S; Belforte, S; Bellettini, G; Bellinger, J; Belloni, A; Ben-Haim, E; Benjamin, D; Beretvas, A; Bhatti, A; Binkley, M; Bisello, D; Bishai, M; Blair, R E; Blocker, C; Bloom, K; Blumenfeld, B; Bocci, A; Bodek, A; Bolla, G; Bolshov, A; Bortoletto, D; Boudreau, J; Bourov, S; Brau, B; Bromberg, C; Brubaker, E; Budagov, J; Budd, H S; Burkett, K; Busetto, G; Bussey, P; Byrum, K L; Cabrera, S; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Casarsa, M; Carlsmith, D; Carosi, R; Carron, S; Cavalli-Sforza, M; Castro, A; Catastini, P; Cauz, D; Cerri, A; Cerrito, L; Chapman, J; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, I; Cho, K; Chokheli, D; Chou, J P; Chuang, S; Chung, K; Chung, W-H; Chung, Y S; Cijliak, M; Ciobanu, C I; Ciocci, M A; Clark, A G; Clark, D; Coca, M; Connolly, A; Convery, M; Conway, J; Cooper, B; Copic, K; Cordelli, M; Cortiana, G; Cranshaw, J; Cuevas, J; Cruz, A; Culbertson, R; Currat, C; Cyr, D; Dagenhart, D; Da Ronco, S; D'Auria, S; de Barbaro, P; De Cecco, S; Deisher, A; De Lentdecker, G; Dell'Orso, M; Demers, S; Demortier, L; Deninno, M; De Pedis, D; Derwent, P F; Dionisi, C; Dittmann, J R; DiTuro, P; Dörr, C; Dominguez, A; Donati, S; Donega, M; Donini, J; D'Onofrio, M; Dorigo, T; Ebina, K; Efron, J; Ehlers, J; Erbacher, R; Erdmann, M; Errede, D; Errede, S; Eusebi, R; Fang, H-C; Farrington, S; Fedorko, I; Fedorko, W T; Feild, R G; Feindt, M; Fernandez, J P; Field, R D; Flanagan, G; Flores-Castillo, L R; Foland, A; Forrester, S; Foster, G W; Franklin, M; Freeman, J C; Fujii, Y; Furic, I; Gajjar, A; Gallinaro, M; Galyardt, J; Garcia-Sciveres, M; Garfinkel, A F; Gay, C; Gerberich, H; Gerdes, D W; Gerchtein, E; Giagu, S; Giannetti, P; Gibson, A; Gibson, K; Ginsburg, C; Giolo, K; Giordani, M; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Goldstein, D; Goldstein, J; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Gotra, Y; Goulianos, K; Gresele, A; Griffiths, M; Grosso-Pilcher, C; Grundler, U; da Costa, J Guimaraes; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Hamilton, A; Han, B-Y; Handler, R; Happacher, F; Hara, K; Hare, M; Harr, R F; Harris, R M; Hartmann, F; Hatakeyama, K; Hauser, J; Hays, C; Hayward, H; Heinemann, B; Heinrich, J; Hennecke, M; Herndon, M; Hill, C; Hirschbuehl, D; Hocker, A; Hoffman, K D; Holloway, A; Hou, S; Houlden, M A; Huffman, B T; Huang, Y; Hughes, R E; Huston, J; Ikado, K; Incandela, J; Introzzi, G; Iori, M; Ishizawa, Y; Issever, C; Ivanov, A; Iwata, Y; Iyutin, B; James, E; Jang, D; Jayatilaka, B; Jeans, D; Jensen, H; Jeon, E J; Jones, M; Joo, K K; Jun, S Y; Junk, T; Kamon, T; Kang, J; Unel, M Karagoz; Karchin, P E; Kato, Y; Kemp, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, M S; Kim, S B; Kim, S H; Kim, Y K; Kirby, M; Kirsch, L; Klimenko, S; Klute, M; Knuteson, B; Ko, B R; Kobayashi, H; Kong, D J; Kondo, K; Konigsberg, J; Kordas, K; Korn, A; Korytov, A; Kotwal, A V; Kovalev, A; Kraus, J; Kravchenko, I; Kreymer, A; Kroll, J; Kruse, M; Krutelyov, V; Kuhlmann, S E; Kwang, S; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, M; Lander, R; Lannon, K; Lath, A; Latino, G; Lauhakangas, R; Lazzizzera, I; Lecci, C; Lecompte, T; Lee, J; Lee, J; Lee, S W; Lefèvre, R; Leonardo, N; Leone, S; Levy, S; Lewis, J D; Li, K; Lin, C; Lin, C S; Lindgren, M; Lipeles, E; Liss, T M; Lister, A; Litvintsev, D O; Liu, T; Liu, Y; Lockyer, N S; Loginov, A; Loreti, M; Loverre, P; Lu, R-S; Lucchesi, D; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Lytken, E; Macqueen, D; Madrak, R; Maeshima, K; Maksimovic, P; Manca, G; Marginean, R; Marino, C; Martin, A; Martin, M; Martin, V; Martínez, M; Maruyama, T; Matsunaga, H; Mattson, M; Mazzanti, P; McFarland, K S; McGivern, D; McIntyre, P M; McNamara, P; McNulty, R; Mehta, A; Menzemer, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Miao, T; Miladinovic, N; Miles, J; Miller, L; Miller, R; Miller, J S; Mills, C; Miquel, R; Miscetti, S; Mitselmakher, G; Miyamoto, A; Moggi, N; Mohr, B; Moore, R; Morello, M; Fernandez, P A Movilla; Muelmenstaedt, J; Mukherjee, A; Mulhearn, M; Muller, T; Mumford, R; Munar, A; Murat, P; Nachtman, J; Nahn, S; Nakano, I; Napier, A; Napora, R; Naumov, D; Necula, V; Nielsen, J; Nelson, T; Neu, C; Neubauer, M S; Nigmanov, T; Nodulman, L; Norniella, O; Ogawa, T; Oh, S H; Oh, Y D; Ohsugi, T; Okusawa, T; Oldeman, R; Orava, R; Orejudos, W; Osterberg, K; Pagliarone, C; Palencia, E

    2005-08-12

    We present a search for long-lived doubly charged Higgs bosons (H(+/- +/-)), with signatures of high ionization energy loss and muonlike penetration. We use 292 pb(-1) of data collected in pp collisions at sqrt[s] = 1.96 TeV by the CDF II detector at the Fermilab Tevatron. Observing no evidence of long-lived doubly charged particle production, we exclude H(+/- +/-)(L) and H(+/- +/-)(R) bosons with masses below 133 GeV/c(2) and 109 GeV/c(2), respectively. In the degenerate case we exclude H(+/- +/-) mass below 146 GeV/c(2). All limits are quoted at the 95% confidence level.

  8. Search for large extra dimensions in the production of jets and missing transverse energy in pp collisions at square root of s = 1.96 TeV.

    Science.gov (United States)

    Abulencia, A; Acosta, D; Adelman, J; Affolder, T; Akimoto, T; Albrow, M G; Ambrose, D; Amerio, S; Amidei, D; Anastassov, A; Anikeev, K; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Arguin, J-F; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Azfar, F; Azzi-Bacchetta, P; Azzurri, P; Bacchetta, N; Bachacou, H; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Baroiant, S; Bartsch, V; Bauer, G; Beachemin, P-H; Bedeschi, F; Behari, S; Belforte, S; Bellettini, G; Bellinger, J; Belloni, A; Ben-Haim, E; Benjamin, D; Beretvas, A; Beringer, J; Berry, T; Bhatti, A; Binkley, M; Bisello, D; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bolla, G; Bolshov, A; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Bromberg, C; Brubaker, E; Budagov, J; Budd, H S; Budd, S; Burkett, K; Busetto, G; Bussey, P; Byrum, K L; Cabrera, S; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carlsmith, D; Carosi, R; Carron, S; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chapman, J; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, I; Cho, K; Chokheli, D; Chou, J P; Chu, P H; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Ciljak, M; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Coca, M; Compostella, G; Convery, M E; Conway, J; Cooper, B; Copic, K; Cordelli, M; Cortiana, G; Cresciolo, F; Cruz, A; Cuenca Almenar, C; Cuevas, J; Culbertson, R; Cyr, D; DaRonco, S; D'Auria, S; D'onofrio, M; Dagenhart, D; de Barbaro, P; De Cecco, S; Deisher, A; De Lentdecker, G; Dell'Orso, M; Delli Paoli, F; Demers, S; Demortier, L; Deng, J; Deninno, M; De Pedis, D; Derwent, P F; Dionisi, C; Dittmann, J R; DiTuro, P; Dörr, C; Donati, S; Donega, M; Dong, P; Donini, J; Dorigo, T; Dube, S; Ebina, K; Efron, J; Ehlers, J; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, I; Fedorko, W T; Feild, R G; Feindt, M; Fernandez, J P; Field, R; Flanagan, G; Flores-Castillo, L R; Foland, A; Forrester, S; Foster, G W; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; Garcia, J E; Garcia Sciveres, M; Garfinkel, A F; Gay, C; Gerberich, H; Gerdes, D; Giagu, S; Giannetti, P; Gibson, A; Gibson, K; Ginsburg, C; Giokaris, N; Giolo, K; Giordani, M; Giromini, P; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Goldstein, J; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Gotra, Y; Goulianos, K; Gresele, A; Griffiths, M; Grinstein, S; Grosso-Pilcher, C; Grundler, U; Guimaraes da Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, S R; Hahn, K; Halkiadakis, E; Hamilton, A; Han, B-Y; Han, J Y; Handler, R; Happacher, F; Hara, K; Hare, M; Harper, S; Harr, R F; Harris, R M; Hatakeyama, K; Hauser, J; Hays, C; Heijboer, A; Heinemann, B; Heinrich, J; Herndon, M; Hidas, D; Hill, C S; Hirschbuehl, D; Hocker, A; Holloway, A; Hou, S; Houlden, M; Hsu, S-C; Huffman, B T; Hughes, R E; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ishizawa, Y; Ivanov, A; Iyutin, B; James, E; Jang, D; Jayatilaka, B; Jeans, D; Jensen, H; Jeon, E J; Jindariani, S; Jones, M; Joo, K K; Jun, S Y; Junk, T R; Kamon, T; Kang, J; Karchin, P E; Kato, Y; Kemp, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kirsch, L; Klimenko, S; Klute, M; Knuteson, B; Ko, B R; Kobayashi, H; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kovalev, A; Kraan, A; Kraus, J; Kravchenko, I; Kreps, M; Kroll, J; Krumnack, N; Kruse, M; Krutelyov, V; Kuhlmann, S E; Kusakabe, Y; Kwang, S; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; LeCompte, T; Lee, J; Lee, J; Lee, Y J; Lee, S W; Lefèvre, R; Leonardo, N; Leone, S; Levy, S; Lewis, J D; Lin, C; Lin, C S; Lindgren, M; Lipeles, E; Liss, T M; Lister, A; Litvintsev, D O; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Loverre, P; Lu, R-S; Lucchesi, D; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Lytken, E; Mack, P; MacQueen, D; Madrak, R; Maeshima, K; Maki, T; Maksimovic, P; Malde, S; Manca, G; Margaroli, F; Marginean, R; Marino, C; Martin, A; Martin, V; Martínez, M; Maruyama, T; Matsunaga, H; Mattson, M E; Mazini, R; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Menzemer, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; von der Mey, M; Miao, T; Miladinovic, N; Miles, J; Miller, R; Miller, J S; Mills, C; Milnik, M; Miquel, R; Mitra, A; Mitselmakher, G; Miyamoto, A; Moggi, N; Mohr, B; Moore, R; Morello, M; Movilla Fernandez, P; Mülmenstädt, J; Mukherjee, A; Muller, Th; Mumford, R; Murat, P; Nachtman, J; Naganoma, J; Nahn, S; Nakano, I; Napier, A; Naumov, D; Necula, V; Neu, C; Neubauer, M S; Nielsen, J; Nigmanov, T; Nodulman, L; Norniella, O; Nurse, E; Ogawa, T; Oh, S H; Oh, Y D; Okusawa, T; Oldeman, R; Orava, R

    2006-10-27

    We present the results of a search for new physics in the jets plus missing transverse energy data sample collected from 368 pb(-1) of pp collisions at square root of s = 1.96 TeV recorded by the Collider Detector at Fermilab. We compare the number of events observed in the data with a data-based estimate of the standard model backgrounds contributing to this signature. We observe no significant excess of events, and we interpret this null result in terms of lower limits on the fundamental Planck scale for a large extra dimensions scenario.

  9. Observation of the narrow state X(3872)-->J/psipi+pi- in pp collisions at sqaure root of s=1.96 TeV.

    Science.gov (United States)

    Acosta, D; Affolder, T; Ahn, M H; Akimoto, T; Albrow, M G; Ambrose, D; Amerio, S; Amidei, D; Anastassov, A; Anikeev, K; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Arguin, J-F; Arisawa, T; Artikov, A; Asakawa, T; Ashmanskas, W; Attal, A; Azfar, F; Azzi-Bacchetta, P; Bacchetta, N; Bachacou, H; Badgett, W; Bailey, S; Barbaro-Galtieri, A; Barker, G; Barnes, V E; Barnett, B A; Baroiant, S; Barone, M; Bauer, G; Bedeschi, F; Behari, S; Belforte, S; Bell, W H; Bellettini, G; Bellinger, J; Benjamin, D; Beretvas, A; Bhatti, A; Binkley, M; Bisello, D; Bishai, M; Blair, R E; Blocker, C; Bloom, K; Blumenfeld, B; Bocci, A; Bodek, A; Bolla, G; Bolshov, A; Booth, P S L; Bortoletto, D; Boudreau, J; Bourov, S; Bromberg, C; Brubaker, E; Budagov, J; Budd, H S; Burkett, K; Busetto, G; Bussey, P; Byrum, K L; Cabrera, S; Calafiura, P; Campanelli, M; Campbell, M; Canepa, A; Carlsmith, D; Carron, S; Carosi, R; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cerri, A; Cerri, C; Cerrito, L; Chapman, J; Chen, C; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, K; Chokheli, D; Chu, M L; Chung, J Y; Chung, W-H; Chung, Y S; Ciobanu, C I; Ciocci, M A; Clark, A G; Clark, D; Coca, M N; Connolly, A; Convery, M E; Conway, J; Cordelli, M; Cortiana, G; Cranshaw, J; Culbertson, R; Currat, C; Cyr, D; Dagenhart, D; DaRonco, S; D'Auria, S; de Barbaro, P; De Cecco, S; De Lentdecker, G; Dell'Agnello, S; Dell'Orso, M; Demers, S; Demortier, L; Deninno, M; De Pedis, D; Derwent, P F; Dionisi, C; Dittmann, J R; Doksus, P; Dominguez, A; Donati, S; D'Onofrio, M; Dorigo, T; Drollinger, V; Ebina, K; Eddy, N; Ely, R; Erbacher, R; Erdmann, M; Errede, D; Errede, S; Eusebi, R; Fang, H-C; Farrington, S; Fedorko, I; Feild, R G; Feindt, M; Fernandez, J P; Ferretti, C; Field, R D; Fiori, I; Flanagan, G; Flaugher, B; Flores-Castillo, L R; Foland, A; Forrester, S; Foster, G W; Franklin, M; Frisch, H; Fujii, Y; Furic, I; Gaijar, A; Gallas, A; Gallinaro, M; Galyardt, J; Garcia-Sciveres, M; Garfinkel, A F; Gay, C; Gerberich, H; Gerchtein, E; Gerdes, D W; Giagu, S; Giannetti, P; Gibson, A; Gibson, K; Ginsburg, C; Giolo, K; Giordani, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Goldstein, D; Goldstein, J; Gomez, G; Gomez-Ceballos, G; Goncharov, M; Gorelov, I; Goshaw, A T; Gotra, Y; Goulianos, K; Gresele, A; Grosso-Pilcher, C; Guenther, M; Guimaraes da Costa, J; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Hall, C; Handler, R; Happacher, F; Hara, K; Hare, M; Harr, R F; Harris, R M; Hartmann, F; Hatakeyama, K; Hauser, J; Hays, C; Hayward, H; Heider, E; Heinemann, B; Heinrich, J; Hennecke, M; Herndon, M; Hill, C; Hirschbuehl, D; Hocker, A; Hoffman, K D; Holloway, A; Hou, S; Houlden, M A; Huang, Y; Huffman, B T; Hughes, R E; Huston, J; Ikado, K; Incandela, J; Introzzi, G; Iori, M; Ishizawa, Y; Issever, C; Ivanov, A; Iwata, Y; Iyutin, B; James, E; Jang, D; Jarrell, J; Jeans, D; Jensen, H; Jones, M; Jun, S Y; Junk, T; Kamon, T; Kang, J; Karagoz Unel, M; Karchin, P E; Kartal, S; Kato, Y; Kemp, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, B J; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, M S; Kim, S B; Kim, S H; Kim, T H; Kim, Y K; King, B T; Kirby, M; Kirsch, L; Klimenko, S; Knuteson, B; Ko, B R; Kobayashi, H; Koehn, P; Kondo, K; Konigsberg, J; Kordas, K; Korn, A; Korytov, A; Kotelnikov, K; Kotwal, A V; Kovalev, A; Kraus, J; Kravchenko, I; Kreymer, A; Kroll, J; Kruse, M; Krutelyov, V; Kuhlmann, S E; Kuznetsova, N; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, J; Lancaster, M; Lander, R; Lannon, K; Lath, A; Latino, G; Lauhakangas, R; Lazzizzera, I; Le, Y; Lecci, C; LeCompte, T; Lee, J; Lee, J; Lee, S W; Leonardo, N; Leone, S; Lewis, J D; Li, K; Lin, C S; Lindgren, M; Liss, T M; Litvintsev, D O; Liu, T; Liu, Y; Lockyer, N S; Loginov, A; Loken, J; Loreti, M; Loverre, P; Lucchesi, D; Lukens, P; Lyons, L; Lys, J; MacQueen, D; Madrak, R; Maeshima, K; Maksimovic, P; Malferrari, L; Manca, G; Marginean, R; Martin, A; Martin, M; Martin, V; Martinez, M; Maruyama, T; Matsunaga, H; Mattson, M; Mazzanti, P; McFarland, K S; McGivern, D; McIntyre, P M; McNamara, P; McNulty, R; Menzemer, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Meyer, A; Miao, T; Miladinovic, N; Miller, L; Miller, R; Miller, J S; Miquel, R; Miscetti, S; Mishina, M; Mitselmakher, G; Miyamoto, A; Miyazaki, Y; Moggi, N; Moore, R; Morello, M; Moulik, T; Mukherjee, A; Mulhearn, M; Muller, T; Mumford, R; Munar, A; Murat, P; Nachtman, J; Nahn, S; Nakamura, I; Nakano, I; Napier, A; Napora, R; Necula, V; Niell, F; Nielsen, J; Nelson, C; Nelson, T; Neu, C; Neubauer, M S; Newman-Holmes, C; Nicollerat, A-S; Nigmanov, T; Nodulman, L; Oesterberg, K; Ogawa, T; Oh, S; Oh, Y D; Ohsugi, T; Oishi, R; Okusawa, T; Oldeman, R; Orava, R; Orejudos, W; Pagliarone, C; Palmonari, F; Paoletti, R; Papadimitriou, V; Pashapour, S; Patrick, J; Pauletta, G; Paulini, M; Pauly, T; Paus, C

    2004-08-13

    We report the observation of a narrow state decaying into J/psipi+pi- and produced in 220 pb(-1) of p p-bar collisions at =1.96 Tesqaure root of sV in the CDF II experiment. We observe 730+/-90 decays. The mass is measured to be 3871.3+/-0.7(stat)+/-0.4(syst) MeV/c2, with an observed width consistent with the detector resolution. This is in agreement with the recent observation by the Belle Collaboration of the X(3872) meson.

  10. Measurement of the Cross Section for Prompt Isolated Diphoton Production in p\\bar p Collisions at \\sqrt s = 1.96 TeV

    CERN Document Server

    Vellidis, Costas

    2011-01-01

    This article reports a measurement of the cross section of prompt isolated photon pair production in pp collisions at a total energy \\sqrt{s} = 1.96 TeV using data of 5.36 fb-1 integrated luminosity collected with the CDF II detector at the Fermilab Tevatron. The measured cross section, differential in basic kinematic variables, is compared with three perturbative QCD predictions, a leading order (LO) parton shower calculation and two next-to-leading order (NLO) calculations. The NLO calculations reproduce most aspects of the data. By including photon radiation from quarks before and after hard scattering, the parton shower prediction becomes competitive with the NLO predictions.

  11. Revealing the extra-high ductility and toughness of micro+duplex medium+Mn steel in a large temperature range from 200 ℃ to -196

    DEFF Research Database (Denmark)

    Cao, Wenquan; Hu, Jun; Dong, Han;

    2014-01-01

    A medium-Mn steel (0.2C5Mn) was processed by intercritical annealing at different temperature (625℃ and 650℃) after forging and hot rolling. The microstructures were characterized by transmission electron microscopy and the mechanical properties were measured by tensile tests and impact tests at...... obtained in the temperature range from 200℃ to -196℃. And significantly delayed transition from ductile to brittle and no less than 200J impact toughness at -40℃ could be obtained in the ART-annealed medium-Mn steel. Based on the analysis of microstructure and mechanical properties, the enhanced ductility...

  12. Search for a standard model Higgs boson in WH --> lvbb in pp collisions at square root s = 1.96 TeV.

    Science.gov (United States)

    Aaltonen, T; Adelman, J; Akimoto, T; Alvarez González, B; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Apollinari, G; Apresyan, A; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Aurisano, A; Azfar, F; Azzurri, P; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Bartsch, V; Bauer, G; Beauchemin, P-H; Bedeschi, F; Beecher, D; Behari, S; Bellettini, G; Bellinger, J; Benjamin, D; Beretvas, A; Beringer, J; Bhatti, A; Binkley, M; Bisello, D; Bizjak, I; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bolla, G; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Bridgeman, A; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, J; Budd, H S; Budd, S; Burke, S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Byrum, K L; Cabrera, S; Calancha, C; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carls, B; Carlsmith, D; Carosi, R; Carrillo, S; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavaliere, V; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, K; Chokheli, D; Chou, J P; Choudalakis, G; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Chwalek, T; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Compostella, G; Convery, M E; Conway, J; Cordelli, M; Cortiana, G; Cox, C A; Cox, D J; Crescioli, F; Cuenca Almenar, C; Cuevas, J; Culbertson, R; Cully, J C; Dagenhart, D; Datta, M; Davies, T; de Barbaro, P; De Cecco, S; Deisher, A; De Lorenzo, G; Dell'orso, M; Deluca, C; Demortier, L; Deng, J; Deninno, M; Derwent, P F; di Giovanni, G P; Dionisi, C; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Donati, S; Dong, P; Donini, J; Dorigo, T; Dube, S; Efron, J; Elagin, A; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, W T; Feild, R G; Feindt, M; Fernandez, J P; Ferrazza, C; Field, R; Flanagan, G; Forrest, R; Frank, M J; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; Garberson, F; Garcia, J E; Garfinkel, A F; Genser, K; Gerberich, H; Gerdes, D; Gessler, A; Giagu, S; Giakoumopoulou, V; Giannetti, P; Gibson, K; Gimmell, J L; Ginsburg, C M; Giokaris, N; Giordani, M; Giromini, P; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Golossanov, A; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Grinstein, S; Grosso-Pilcher, C; Grundler, U; Guimaraes da Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Han, B-Y; Han, J Y; Happacher, F; Hara, K; Hare, D; Hare, M; Harper, S; Harr, R F; Harris, R M; Hartz, M; Hatakeyama, K; Hays, C; Heck, M; Heijboer, A; Heinrich, J; Henderson, C; Herndon, M; Heuser, J; Hewamanage, S; Hidas, D; Hill, C S; Hirschbuehl, D; Hocker, A; Hou, S; Houlden, M; Hsu, S-C; Huffman, B T; Hughes, R E; Husemann, U; Hussein, M; Husemann, U; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ivanov, A; James, E; Jayatilaka, B; Jeon, E J; Jha, M K; Jindariani, S; Johnson, W; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Kar, D; Karchin, P E; Kato, Y; Kephart, R; Keung, J; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, H W; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Knuteson, B; Ko, B R; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kreps, M; Kroll, J; Krop, D; Krumnack, N; Kruse, M; Krutelyov, V; Kubo, T; Kuhr, T; Kulkarni, N P; Kurata, M; Kwang, S; Laasanen, A T; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; Lecompte, T; Lee, E; Lee, H S; Lee, S W; Leone, S; Lewis, J D; Lin, C-S; Linacre, J; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, C; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Lovas, L; Lucchesi, D; Luci, C; Lueck, J; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Macqueen, D; Madrak, R; Maeshima, K; Makhoul, K; Maki, T; Maksimovic, P; Malde, S; Malik, S; Manca, G; Manousakis-Katsikakis, A; Margaroli, F; Marino, C; Marino, C P; Martin, A; Martin, V; Martínez, M; Martínez-Ballarín, R; Maruyama, T; Mastrandrea, P; Masubuchi, T; Mathis, M; Mattson, M E; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtala, P; Menzione, A; Merkel, P; Mesropian, C; Miao, T; Miladinovic, N; Miller, R; Mills, C; Milnik, M; Mitra, A; Mitselmakher, G; Miyake, H; Moggi, N; Moon, C S; Moore, R; Morello, M J; Morlock, J; Movilla Fernandez, P; Mülmenstädt, J; Mukherjee, A; Muller, Th; Mumford, R; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Nagano, A; Naganoma, J; Nakamura, K; Nakano, I; Napier, A; Necula, V; Nett, J; Neu, C; Neubauer, M S; Neubauer, S; Nielsen, J; Nodulman, L; Norman, M; Norniella, O; Nurse, E; Oakes, L; Oh, S H; Oh, Y D; Oksuzian, I; Okusawa, T; Orava, R; Osterberg, K; Pagan Griso, S; Palencia, E; Papadimitriou, V; Papaikonomou, A; Paramonov, A A; Parks, B

    2009-09-01

    We present a search for a standard model Higgs boson produced in association with a W boson using 2.7 fb(-1) of integrated luminosity of pp collision data taken at square root s = 1.96 TeV. Limits on the Higgs boson production rate are obtained for masses between 100 and 150 GeV/c(2). Through the use of multivariate techniques, the analysis achieves an observed (expected) 95% confidence level upper limit of 5.6 (4.8) times the theoretically expected production cross section for a standard model Higgs boson with a mass of 115 GeV/c(2). PMID:19792296

  13. Forward-backward asymmetry in top-quark production in pp[over] collisions at sqrt[s]=1.96 TeV.

    Science.gov (United States)

    Aaltonen, T; Adelman, J; Akimoto, T; Albrow, M G; González, B Alvarez; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Apollinari, G; Apresyan, A; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Aurisano, A; Azfar, F; Azzurri, P; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Bartsch, V; Bauer, G; Beauchemin, P-H; Bedeschi, F; Bednar, P; Beecher, D; Behari, S; Bellettini, G; Bellinger, J; Benjamin, D; Beretvas, A; Beringer, J; Bhatti, A; Binkley, M; Bisello, D; Bizjak, I; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bolla, G; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Bridgeman, A; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, J; Budd, H S; Budd, S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Byrum, K L; Cabrera, S; Calancha, C; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carlsmith, D; Carosi, R; Carrillo, S; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavaliere, V; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, K; Chokheli, D; Chou, J P; Choudalakis, G; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Chwalek, Th; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Compostella, G; Convery, M E; Conway, J; Copic, K; Cordelli, M; Cortiana, G; Cox, D J; Crescioli, F; Almenar, C Cuenca; Cuevas, J; Culbertson, R; Cully, J C; Dagenhart, D; Datta, M; Davies, T; de Barbaro, P; De Cecco, S; Deisher, A; De Lorenzo, G; Dell'orso, M; Deluca, C; Demortier, L; Deng, J; Deninno, M; Derwent, P F; di Giovanni, G P; Dionisi, C; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Donati, S; Dong, P; Donini, J; Dorigo, T; Dube, S; Efron, J; Elagin, A; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, W T; Feild, R G; Feindt, M; Fernandez, J P; Ferrazza, C; Field, R; Flanagan, G; Forrest, R; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; Garberson, F; Garcia, J E; Garfinkel, A F; Genser, K; Gerberich, H; Gerdes, D; Gessler, A; Giagu, S; Giakoumopoulou, V; Giannetti, P; Gibson, K; Gimmell, J L; Ginsburg, C M; Giokaris, N; Giordani, M; Giromini, P; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Golossanov, A; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Grinstein, S; Grosso-Pilcher, C; Grundler, U; da Costa, J Guimaraes; Gunay-Unalan, Z; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Han, B-Y; Han, J Y; Handler, R; Happacher, F; Hara, K; Hare, D; Hare, M; Harper, S; Harr, R F; Harris, R M; Hartz, M; Hatakeyama, K; Hauser, J; Hays, C; Heck, M; Heijboer, A; Heinemann, B; Heinrich, J; Henderson, C; Herndon, M; Heuser, J; Hewamanage, S; Hidas, D; Hill, C S; Hirschbuehl, D; Hocker, A; Hou, S; Houlden, M; Hsu, S-C; Huffman, B T; Hughes, R E; Husemann, U; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ivanov, A; James, E; Jayatilaka, B; Jeon, E J; Jha, M K; Jindariani, S; Johnson, W; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Kar, D; Karchin, P E; Kato, Y; Kephart, R; Keung, J; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Knuteson, B; Ko, B R; Koay, S A; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kreps, M; Kroll, J; Krop, D; Krumnack, N; Kruse, M; Krutelyov, V; Kubo, T; Kuhr, T; Kulkarni, N P; Kurata, M; Kusakabe, Y; Kwang, S; Laasanen, A T; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; Lecompte, T; Lee, E; Lee, S W; Leone, S; Lewis, J D; Lin, C S; Linacre, J; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, C; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Lovas, L; Lu, R-S; Lucchesi, D; Lueck, J; Luci, C; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Lytken, E; Mack, P; Macqueen, D; Madrak, R; Maeshima, K; Makhoul, K; Maki, T; Maksimovic, P; Malde, S; Malik, S; Manca, G; Manousakis-Katsikakis, A; Margaroli, F; Marino, C; Marino, C P; Martin, A; Martin, V; Martínez, M; Martínez-Ballarín, R; Maruyama, T; Mastrandrea, P; Masubuchi, T; Mattson, M E; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtala, P; Menzione, A; Merkel, P; Mesropian, C; Miao, T; Miladinovic, N; Miller, R; Mills, C; Milnik, M; Mitra, A; Mitselmakher, G; Miyake, H; Moggi, N; Moon, C S; Moore, R; Morello, M J; Morlok, J; Fernandez, P Movilla; Mülmenstädt, J; Mukherjee, A; Muller, Th; Mumford, R; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Nagano, A; Naganoma, J; Nakamura, K; Nakano, I; Napier, A; Necula, V; Neu, C; Neubauer, M S; Nielsen, J; Nodulman, L; Norman, M; Norniella, O; Nurse, E; Oakes, L; Oh, S H; Oh, Y D; Oksuzian, I; Okusawa, T; Orava, R; Osterberg, K; Griso, S Pagan; Pagliarone, C; Palencia, E; Papadimitriou, V; Papaikonomou, A; Paramonov, A A

    2008-11-14

    We present measurements of the forward-backward charge asymmetry in top pair production using 1.9 fb;{-1} of pp[over ] collisions at sqrt[s]=1.96 TeV recorded with the Collider Detector at Fermilab II. Correcting for acceptance and measurement dilutions we obtain parton-level asymmetries of A_{FB};{pp[over ]}=0.17+/-0.08 in the pp[over ] frame and A_{FB};{tt[over ]}=0.24+/-0.14 in the tt[over ] frame. The values are consistent with the standard model expectation and disfavor exotic production mechanisms with significant negative values. PMID:19113329

  14. Direct measurement of the W production charge asymmetry in pp collisions at square root s=1.96 TeV.

    Science.gov (United States)

    Aaltonen, T; Adelman, J; Akimoto, T; Alvarez González, B; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Apollinari, G; Apresyan, A; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Aurisano, A; Azfar, F; Azzurri, P; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Bartsch, V; Bauer, G; Beauchemin, P-H; Bedeschi, F; Beecher, D; Behari, S; Bellettini, G; Bellinger, J; Benjamin, D; Beretvas, A; Beringer, J; Bhatti, A; Binkley, M; Bisello, D; Bizjak, I; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bolla, G; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Bridgeman, A; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, J; Budd, H S; Budd, S; Burke, S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Byrum, K L; Cabrera, S; Calancha, C; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carls, B; Carlsmith, D; Carosi, R; Carrillo, S; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavaliere, V; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, K; Chokheli, D; Chou, J P; Choudalakis, G; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Chwalek, T; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Compostella, G; Convery, M E; Conway, J; Cordelli, M; Cortiana, G; Cox, C A; Cox, D J; Crescioli, F; Cuenca Almenar, C; Cuevas, J; Culbertson, R; Cully, J C; Dagenhart, D; Datta, M; Davies, T; de Barbaro, P; De Cecco, S; Deisher, A; De Lorenzo, G; Dell'orso, M; Deluca, C; Demortier, L; Deng, J; Deninno, M; Derwent, P F; di Giovanni, G P; Dionisi, C; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Donati, S; Dong, P; Donini, J; Dorigo, T; Dube, S; Efron, J; Elagin, A; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, W T; Feild, R G; Feindt, M; Fernandez, J P; Ferrazza, C; Field, R; Flanagan, G; Forrest, R; Frank, M J; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; Garberson, F; Garcia, J E; Garfinkel, A F; Genser, K; Gerberich, H; Gerdes, D; Gessler, A; Giagu, S; Giakoumopoulou, V; Giannetti, P; Gibson, K; Gimmell, J L; Ginsburg, C M; Giokaris, N; Giordani, M; Giromini, P; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Golossanov, A; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Grinstein, S; Grosso-Pilcher, C; Grundler, U; Guimaraes da Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Han, B-Y; Han, J Y; Happacher, F; Hara, K; Hare, D; Hare, M; Harper, S; Harr, R F; Harris, R M; Hartz, M; Hatakeyama, K; Hays, C; Heck, M; Heijboer, A; Heinrich, J; Henderson, C; Herndon, M; Heuser, J; Hewamanage, S; Hidas, D; Hill, C S; Hirschbuehl, D; Hocker, A; Hou, S; Houlden, M; Hsu, S-C; Huffman, B T; Hughes, R E; Husemann, U; Hussein, M; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ivanov, A; James, E; Jang, D; Jayatilaka, B; Jeon, E J; Jha, M K; Jindariani, S; Johnson, W; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Kar, D; Karchin, P E; Kato, Y; Kephart, R; Keung, J; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, H W; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Knuteson, B; Ko, B R; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kreps, M; Kroll, J; Krop, D; Krumnack, N; Kruse, M; Krutelyov, V; Kubo, T; Kuhr, T; Kulkarni, N P; Kurata, M; Kwang, S; Laasanen, A T; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; Lecompte, T; Lee, E; Lee, H S; Lee, S W; Leone, S; Lewis, J D; Lin, C-S; Linacre, J; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, C; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Lovas, L; Lucchesi, D; Luci, C; Lueck, J; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Macqueen, D; Madrak, R; Maeshima, K; Makhoul, K; Maki, T; Maksimovic, P; Malde, S; Malik, S; Manca, G; Manousakis-Katsikakis, A; Margaroli, F; Marino, C; Marino, C P; Martin, A; Martin, V; Martínez, M; Martínez-Ballarín, R; Maruyama, T; Mastrandrea, P; Masubuchi, T; Mathis, M; Mattson, M E; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtala, P; Menzione, A; Merkel, P; Mesropian, C; Miao, T; Miladinovic, N; Miller, R; Mills, C; Milnik, M; Mitra, A; Mitselmakher, G; Miyake, H; Moggi, N; Moon, C S; Moore, R; Morello, M J; Morlock, J; Movilla Fernandez, P; Mülmenstädt, J; Mukherjee, A; Muller, Th; Mumford, R; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Nagano, A; Naganoma, J; Nakamura, K; Nakano, I; Napier, A; Necula, V; Nett, J; Neu, C; Neubauer, M S; Neubauer, S; Nielsen, J; Nodulman, L; Norman, M; Norniella, O; Nurse, E; Oakes, L; Oh, S H; Oh, Y D; Oksuzian, I; Okusawa, T; Orava, R; Osterberg, K; Pagan Griso, S; Palencia, E; Papadimitriou, V; Papaikonomou, A; Paramonov, A A; Parks, B; Pashapour, S

    2009-05-01

    We present the first direct measurement of the W production charge asymmetry as a function of the W boson rapidity yW in pp collisions at sqrt[s]=1.96 TeV. We use a sample of W-->enu events in data from 1 fb-1 of integrated luminosity collected using the CDF II detector. In the region |yW|<3.0, this measurement is capable of constraining the ratio of up- and down-quark momentum distributions in the proton more directly than in previous measurements of the asymmetry that are functions of the charged-lepton pseudorapidity. PMID:19518858

  15. Search for a fermiophobic Higgs boson decaying into diphotons in pp[over] collisions at sqrt[s] = 1.96 TeV.

    Science.gov (United States)

    Aaltonen, T; Adelman, J; Akimoto, T; Alvarez González, B; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Apollinari, G; Apresyan, A; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Aurisano, A; Azfar, F; Azzurri, P; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Bartsch, V; Bauer, G; Beauchemin, P-H; Bedeschi, F; Beecher, D; Behari, S; Bellettini, G; Bellinger, J; Benjamin, D; Beretvas, A; Beringer, J; Bhatti, A; Binkley, M; Bisello, D; Bizjak, I; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bolla, G; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Bridgeman, A; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, J; Budd, H S; Budd, S; Burke, S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Byrum, K L; Cabrera, S; Calancha, C; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carls, B; Carlsmith, D; Carosi, R; Carrillo, S; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavaliere, V; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, K; Chokheli, D; Chou, J P; Choudalakis, G; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Chwalek, T; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Compostella, G; Convery, M E; Conway, J; Cordelli, M; Cortiana, G; Cox, C A; Cox, D J; Crescioli, F; Cuenca Almenar, C; Cuevas, J; Culbertson, R; Cully, J C; Dagenhart, D; Datta, M; Davies, T; de Barbaro, P; De Cecco, S; Deisher, A; De Lorenzo, G; Dell'orso, M; Deluca, C; Demay, C; Demortier, L; Deng, J; Deninno, M; Derwent, P F; di Giovanni, G P; Dionisi, C; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Donati, S; Dong, P; Donini, J; Dorigo, T; Dube, S; Efron, J; Elagin, A; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, W T; Feild, R G; Feindt, M; Fernandez, J P; Ferrazza, C; Field, R; Flanagan, G; Forrest, R; Frank, M J; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; Garberson, F; Garcia, J E; Garfinkel, A F; Genser, K; Gerberich, H; Gerdes, D; Gessler, A; Giagu, S; Giakoumopoulou, V; Giannetti, P; Gibson, K; Gimmell, J L; Ginsburg, C M; Giokaris, N; Giordani, M; Giromini, P; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Golossanov, A; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Grinstein, S; Grosso-Pilcher, C; Grundler, U; Guimaraes da Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Han, B-Y; Han, J Y; Happacher, F; Hara, K; Hare, D; Hare, M; Harper, S; Harr, R F; Harris, R M; Hartz, M; Hatakeyama, K; Hays, C; Heck, M; Heijboer, A; Heinrich, J; Henderson, C; Herndon, M; Heuser, J; Hewamanage, S; Hidas, D; Hill, C S; Hirschbuehl, D; Hocker, A; Hou, S; Houlden, M; Hsu, S-C; Huffman, B T; Hughes, R E; Husemann, U; Hussein, M; Husemann, U; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ivanov, A; James, E; Jayatilaka, B; Jeon, E J; Jha, M K; Jindariani, S; Johnson, W; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Kar, D; Karchin, P E; Kato, Y; Kephart, R; Keung, J; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, H W; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Knuteson, B; Ko, B R; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kreps, M; Kroll, J; Krop, D; Krumnack, N; Kruse, M; Krutelyov, V; Kubo, T; Kuhr, T; Kulkarni, N P; Kurata, M; Kwang, S; Laasanen, A T; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; Lecompte, T; Lee, E; Lee, H S; Lee, S W; Leone, S; Lewis, J D; Lin, C-S; Linacre, J; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, C; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Lovas, L; Lucchesi, D; Luci, C; Lueck, J; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Macqueen, D; Madrak, R; Maeshima, K; Makhoul, K; Maki, T; Maksimovic, P; Malde, S; Malik, S; Manca, G; Manousakis-Katsikakis, A; Margaroli, F; Marino, C; Marino, C P; Martin, A; Martin, V; Martínez, M; Martínez-Ballarín, R; Maruyama, T; Mastrandrea, P; Masubuchi, T; Mathis, M; Mattson, M E; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtala, P; Menzione, A; Merkel, P; Mesropian, C; Miao, T; Miladinovic, N; Miller, R; Mills, C; Milnik, M; Mitra, A; Mitselmakher, G; Miyake, H; Moggi, N; Moon, C S; Moore, R; Morello, M J; Morlock, J; Movilla Fernandez, P; Mülmenstädt, J; Mukherjee, A; Muller, Th; Mumford, R; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Nagano, A; Naganoma, J; Nakamura, K; Nakano, I; Napier, A; Necula, V; Nett, J; Neu, C; Neubauer, M S; Neubauer, S; Nielsen, J; Nodulman, L; Norman, M; Norniella, O; Nurse, E; Oakes, L; Oh, S H; Oh, Y D; Oksuzian, I; Okusawa, T; Orava, R; Osterberg, K; Pagan Griso, S; Palencia, E; Papadimitriou, V; Papaikonomou, A; Paramonov, A A; Parks, B

    2009-08-01

    A search for a narrow diphoton mass resonance is presented based on data from 3.0 fb;{-1} of integrated luminosity from pp[over ] collisions at sqrt[s] = 1.96 TeV collected by the CDF experiment. No evidence of a resonance in the diphoton mass spectrum is observed, and upper limits are set on the cross section times branching fraction of the resonant state as a function of Higgs boson mass. The resulting limits exclude Higgs bosons with masses below 106 GeV/c;{2} at a 95% Bayesian credibility level for one fermiophobic benchmark model. PMID:19792552

  16. Measurement of direct photon pair production cross sections in p¯p collisions at √s = 1.96 TeV

    OpenAIRE

    Abazov, V. M. et al. (D0 Collaboration); B. Abbott; Abolins, M.; Acharya, B. S.; M. Adams; Adams, T.; Aguilo, E; Ahsan, M.; Alexeev, G.D.; Alkhazov, G.; A. Alton; Alverson, G.; Alves, G. A.; Ancu, L. S.; Andeen, T.

    2009-01-01

    A search for pair production of first-generation leptoquarks (LQ ) is performed with data collected by the DØ experiment in View the MathML sourcepp¯ collisions at View the MathML sources=1.96 TeV at the Fermilab Tevatron Collider. In a sample of data corresponding to ∼1 fb−1∼1 fb−1 the search has been performed on the final states with two electrons and two jets or one electron, two jets and missing transverse energy. We find our data consistent with standard model expectations. The results...

  17. Measurement of the Cross Section for Prompt Diphoton Production in p-pbar Collisions at $\\sqrt{s}$ = 1.96 TeV

    CERN Document Server

    Acosta, D; Affolder, T; Akimoto, T; Albrow, M G; Ambrose, D; Amerio, S; Amidei, D; Anastassov, A; Anikeev, K; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Arisawa, T; Arguin, F; Artikov, A; Ashmanskas, W; Attal, A; Azfar, F; Azzi, P; Bacchetta; Bacchetta, N; Bachacou, H; Badgett, W; Barbaro-Galtieri, A; Galtieri; Barker, G J; Barnes, V E; Barnett, B A; Baroiant, S; Barone, M; Bauer, G; Bedeschi, F; Behari, S; Belforte, S; Bellettini, G; Bellinger, J; Ben-Haim, E; Benjamin, D; Beretvas, A; Bhatti, A A; Binkley, M; Bisello, D; Bishai, M; Blair, R E; Blocker, C; Bloom, K; Blumenfeld, B; Bocci, A; Bodek, A; Bölla, G; Bolshov, A; Booth, P S L; Bortoletto, D; Boudreau, J; Bourov, S; Brau, B; Bromberg, C; Brubaker, E; Budagov, Yu A; Budd, H S; Burkett, K; Busetto, G; Bussey, P; Byrum, K L; Cabrera, S; Campanelli, M; Campbell, M; Canepa, A; Casarsa, M; Carlsmith, D; Carron, S; Carosi, R; Cavalli-Sforza, M; Castro, A; Catastini, P; Cauz, D; Cerri, A; Cerrito, L; Chapman, J; Chen, C; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, I; Cho, K; Chokheli, D; Chou, J P; Chu, M L; Chuang, S; Chung, J Y; Chung, W H; Chung, Y S; Ciobanu, C I; Ciocci, M A; Clark, A G; Clark, D; Coca, M; Connolly, A; Convery, M; Conway, J; Cooper, B; Cordelli, M; Cortiana, G; Cranshaw, J; Cuevas-Maestro, J; Culbertson, R; Currat, C; Cyr, D; Dagenhart, D; Da Ronco, S; D'Auria, S; De Barbaro, P; De Cecco, S; Dell'Agnello, S; Dell'Orso, Mauro; Demers, S; Demortier, L; Deninno, M; De Pedis, D; Derwent, P F; Dionisi, C; Dittmann, J R; Dorr, C; Doksus, P; Dominguez, A; Donati, S; Donega, M; Donini, J; D'Onofrio, M; Dorigo, T; Drollinger, V; Ebina, K; Eddy, N; Ehlers, J; Ely, R; Erbacher, R; Erdmann, M; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, I; Fedorko, W T; Feild, R G; Feindt, M; Fernández, J P; Ferretti, C; Field, R D; Flanagan, G; Flaugher, B; Flores-Castillo, L R; Foland, A; Forrester, S; Foster, G W; Franklin, M; Freeman, J C; Fujii, Y; Furic, I; Gajjar, A; Gallas, A; Galyardt, J; Gallinaro, M; García-Sciveres, M; Garfinkel, A F; Gay, C; Gerberich, H; Gerdes, D W; Gerchtein, E; Giagu, S; Giannetti, P; Gibson, A; Gibson, K; Ginsburg, C; Giolo, K; Giordani, M; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Goldstein, D; Goldstein, J; Gómez, G; Gómez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Gotra, Yu; Goulianos, K; Gresele, A; Griffiths, M; Grosso-Pilcher, C; Grundler, U; Günther, M; Guimarães da Costa, J; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Hamilton, A; Han, B Y; Handler, R; Happacher, F; Hara, K; Hare, M; Harr, R F; Harris, R M; Hartmann, F; Hatakeyama, K; Hauser, J; Hays, C; Hayward, H; Heider, E; Heinemann, B; Heinrich, J; Hennecke, M; Herndon, M; Hill, C; Hirschbuehl, D; Höcker, A; Hoffman, K D; Holloway, A; Hou, S; Houlden, M A; Huffman, B T; Huang, Y; Hughes, R E; Huston, J; Ikado, K; Incandela, J R; Introzzi, G; Iori, M; Ishizawa, Y; Issever, C; Ivanov, A; Iwata, Y; Iyutin, B; James, E; Jang, D; Jarrell, J; Jeans, D; Jensen, H; Jeon, E J; Jones, M; Joo, K K; Jun, S Y; Junk, T R; Kamon, T; Kang, J; Karagoz-Unel, M; Karchin, P E; Kartal, S; Kato, Y; Kemp, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, M S; Kim, S B; Kim, S H; Kim, T H; Kim, Y K; King, B T; Kirby, M; Kirsch, L; Klimenko, S; Knuteson, B; Ko, B R; Kobayashi, H; Koehn, P; Kong, D J; Kondo, K; Konigsberg, J; Kordas, K; Korn, A J; Korytov, A; Kotelnikov, K; Kotwal, A V; Kovalev, A; Kraus, J; Kravchenko, I; Kreymer, A; Kroll, J; Kruse, M; Krutelyov, V; Kuhlmann, S E; Kwang, S; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, J; Lancaster, M; Lander, R; Lannon, K; Latino, G; Lauhakangas, R; Lazzizzera, I; Le, Y; Lecci, C; LeCompte, T; Lee, J; Lee, S W; Lefèvre, R; Leonardo, N; Leone, S; Levy, S; Lewis, J D; Li, K; Lin, C; Lin, C S; Lindgren, M; Liss, T M; Lister, A; Litvintsev, D O; Liu, T; Liu, Y; Lockyer, N S; Loginov, A; Loreti, M; Loverre, P F; Lu, R S; Lucchesi, D; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; MacQueen, D; Madrak, R; Maeshima, K; Maksimovic, P; Malferrari, L; Manca, G; Marginean, R; Marino, C; Martin, A; Martin, M; Martin, V; Martínez, M; Maruyama, T; Matsunaga, H; Mattson, M; Mazzanti, P; McFarland, K S; McGivern, D; McIntyre, P M; McNamara, P; NcNulty, R; Mehta, A; Menzemer, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Miao, T; Miladinovic, N; Miller, L; Miller, R; Miller, J S; Miquel, R; Miscetti, S; Mitselmakher, G; Miyamoto, A; Miyazaki, Y; Moggi, N; Mohr, B; Moore, R; Morello, M; Movilla-Fernández, P A; Mukherjee, A; Mulhearn, M; Müller, T; Mumford, R; Munar, A; Murat, P; Nachtman, J; Nahn, S; Nakamura, I; Nakano, I; Napier, A; Napora, R; Naumov, D V; Necula, V; Niell, F; Nielsen, J; Nelson, C; Nelson, T; Neu, C; Neubauer, M S; Newman-, C; Holmes, J A; Nigmanov, T; Nodulman, L; Norniella, O; Österberg, K; Ogawa, T; Oh, S H; Oh, Y D; Ohsugi, T; Okusawa, T; Oldeman, R G C; Orava, R; Orejudos, W; Pagliarone, C; Palencia, E; Paoletti, R; Papadimitriou, V; Pashapour, S; Patrick, J; Pauletta, G; Paulini, M; Pauly, T; Paus, C; Pellett, D; Penzo, Aldo L; Phillips, T J; Piacentino, G; Piedra, J; Pitts, K T; Plager, C; Pompos, A; Pondrom, L; Pope, G; Portell, X; Poukhov, O; Prakoshyn, F; Pratt, T; Pronko, A; Proudfoot, J; Ptohos, F; Punzi, G; Rademacker, J; Rahaman, M A; Rakitine, A; Rappoccio, S; Ratnikov, F; Ray, H; Reisert, B; Rekovic, V; Renton, P B; Rescigno, M; Rimondi, F; Rinnert, K; Ristori, L; Robertson, W J; Robson, A; Rodrigo, T; Rolli, S; Rosenson, L; Roser, R; Rossin, R; Rott, C; Russ, J; Rusu, V; Ruiz, A; Ryan, D; Saarikko, H; Sabik, S; Safonov, A; Saint-Denis, R; Sakumoto, W K; Salamanna, G; Saltzberg, D; Sánchez, C; Sansoni, A; Santi, L; Sarkar, S; Sato, K; Savard, P; Savoy-Navarro, A; Schlabach, P; Schmidt, E E; Schmidt, M P; Schmitt, M; Scodellaro, L; Scribano, A; Scuri, F; Sedov, A; Seidel, S; Seiya, Y; Semeria, F; Sexton-Kennedy, L; Sfiligoi, I; Shapiro, M D; Shears, T G; Shepard, P F; Sherman, D; Shimojima, M; Shon, Y; Shreyber, I; Sidoti, A; Siegrist, J; Siket, M; Sill, A; Sinervo, P; Sissakian, A N; Skiba, A; Slaughter, A J; Sliwa, K; Smirnov, D; Smith, J R; Snider, F D; Snihur, R; Soha, A; Somalwar, S V; Spalding, J; Spezziga, M; Spiegel, L; Spinella, F; Spiropulu, M; Squillacioti, P; Stadie, H; Stelzer, B; Stelzer-, O; Chilton; Strologas, J; Stuart, D; Sukhanov, A; Sumorok, K; Sun, H; Suzuki, T; Taffard, A C; Tafirout, R; Takach, S F; Takano, H; Takashima, R; Takeuchi, Y; Takikawa, K; Tanaka, M; Tanaka, R; Tanimoto, N; Tapprogge, Stefan; Tecchio, M; Teng, P K; Terashi, K; Tesarek, R J; Tether, S; Thom, J; Thompson, A S; Thomson, E; Tipton, P; Tiwari, V; Tkaczyk, S; Toback, D; Tollefson, K; Tomura, T; Tonelli, D; Tonnesmann, M; Torre, S; Torretta, D; Tourneur, S; Trischuk, W; Tseng, J; Tsuchiya, R; Tsuno, S; Tsybychev, D; Turini, N; Turner, M; Ukegawa, F; Unverhau, T; Uozumi, S; Usynin, D; Vacavant, L; Vaiciulis, A W; Varganov, A; Vataga, E; Vejcik, S; Velev, G V; Veszpremi, V; Veramendi, G; Vickey, T; Vidal, R; Vila, I; Vilar, R; Vollrath, I; Volobuev, I P; Von der Mey, M; Wagner, P; Wagner, R G; Wagner, R L; Wagner, W; Wallny, R; Walter, T; Yamashita, T; Yamamoto, K; Wan, Z; Wang, M J; Wang, S M; Warburton, A; Ward, B; Waschke, S; Waters, D; Watts, T; Weber, M; Wester, W C; Whitehouse, B; Wicklund, A B; Wicklund, E; Williams, H H; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolter, M; Worcester, M; Worm, S; Wright, T; Wu, X; Würthwein, F; Wyatt, A; Yagil, A; Yang, C; Yang, U K; Yao, W; Yeh, G P; Yi, K; Yoh, J; Yoon, P; Yorita, K; Yoshida, T; Yu, I; Yu, S; Yu, Z; Yun, J C; Zanello, L; Zanetti, A; Zaw, I; Zetti, F; Zhou, J; Zsenei, A; Zucchelli, S

    2004-01-01

    We report a measurement of the rate of prompt diphoton production in $p\\bar{p}$ collisions at $\\sqrt{s}$=1.96 ~\\hbox{TeV}$ using a data sample of 207 pb$^{-1}$ collected with the upgraded Collider Detector at Fermilab (CDF II). The background from non-prompt sources is determined using a statistical method based on differences in the electromagnetic showers. The cross section is measured as a function of the diphoton mass, the transverse momentum of the diphoton system, and the azimuthal angle between the two photons and is found to be consistent with perturbative QCD predictions.

  18. Search for Bs->mu+mu- and Bd->mu+mu- Decays in ppbar Collisions at $\\sqrt{s}$=1.96 TeV

    CERN Document Server

    Acosta, D; Akimoto, T; Albrow, M G; Ambrose, D; Amerio, S; Amidei, D; Anastassov, A; Anikeev, K; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Arguin, J F; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Azfar, F; Azzi-Bacchetta, P; Bacchetta, N; Bachacou, H; Badgett, W; Barbaro-Galtieri, A; Barker, G J; Barnes, V E; Barnett, B A; Baroiant, S; Barone, M; Bauer, G; Bedeschi, F; Behari, S; Belforte, S; Bellettini, Giorgio; Bellinger, J; Benjamin, D; Beretvas, A; Bhatti, A A; Binkley, M; Bisello, D; Bishai, M; Blair, R E; Blocker, C; Bloom, K; Blumenfeld, B; Bocci, A; Bodek, A; Bölla, G; Bolshov, A; Booth, P S L; Bortoletto, Daniela; Boudreau, J; Bourov, S; Bromberg, C; Brubaker, E; Budagov, Yu A; Budd, H S; Burkett, K; Busetto, G; Bussey, P; Byrum, K L; Cabrera, S; Calafiura, P; Campanelli, M; Campbell, M; Canepa, A; Carlsmith, D; Carosi, R; Carron, S; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cerri, A; Cerri, C; Cerrito, L; Chapman, J; Chen, C; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, I; Cho, K; Chokheli, D; Chu, M L; Chuang, S; Chung, J Y; Chung, W H; Chung, Y S; Ciobanu, C I; Ciocci, M A; Clark, A G; Clark, D; Coca, M; Connolly, A; Convery, M; Conway, J; Cordelli, M; Cortiana, G; Cranshaw, J; Cuevas-Maestro, J; Culbertson, R; Currat, C; Cyr, D; D'Auria, S; D'Onofrio, M; Da Ronco, S; Dagenhart, D; De Barbaro, P; De Cecco, S; De Lentdecker, G; De Pedis, D; Dell'Agnello, S; Dell'Orso, Mauro; Demers, S; Demortier, L; Deninno, M; Derwent, P F; Devlin, T; Dionisi, C; Dittmann, J R; Doksus, P; Dominguez, A; Donati, S; Donega, M; Dorigo, T; Drollinger, V; Ebina, K; Eddy, N; Ely, R; Erbacher, R; Erdmann, M; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, I; Feild, R G; Feindt, M; Fernández, J P; Ferretti, C; Field, R D; Fiori, I; Flanagan, G; Flaugher, B; Flores-Castillo, L R; Foland, A D; Forrester, S; Foster, G W; Franklin, M; Frisch, H; Fujii, Y; Furic, I; Gajjar, A; Gallas, A; Gallinaro, M; Galyardt, J; Garcia-, M; Garfinkel, A F; Gay, C; Gerberich, H; Gerchtein, E; Gerdes, D W; Giagu, S; Giannetti, P; Gibson, A; Gibson, K; Ginsburg, C; Giolo, K; Giordani, M; Giurgiu, G; Glagolev, V; Glenzinski, D A; Gold, M; Goldschmidt, N; Goldstein, D; Goldstein, J; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Gotra, Yu; Goulianos, K; Gresele, A; Grosso-Pilcher, C; Guimarães da Costa, J; Gómez, G; Gómez-Ceballos, G; Günther, M; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Handler, R; Happacher, F; Hara, K; Hare, M; Harr, R F; Harris, R M; Hartmann, F; Hatakeyama, K; Hauser, J; Hays, C; Hayward, H; Heider, E; Heinemann, B; Heinrich, J; Hennecke, M; Herndon, M; Hill, C; Hirschbuehl, D; Hoffman, K D; Holloway, A; Hou, S; Houlden, M A; Huang, Y; Huffman, B T; Hughes, R E; Huston, J; Höcker, A; Ikado, K; Incandela, J R; Introzzi, G; Iori, M; Ishizawa, Y; Issever, C; Ivanov, A; Iwata, Y; Iyutin, B; James, E; Jang, D; Jarrell, J; Jeans, D; Jensen, H; Jeon, E J; Jones, M; Joo, K K; Jun, S; Junk, T R; Kamon, T; Kang, J; Karagoz-Unel, M; Karchin, P E; Kartal, S; Kato, Y; Kemp, Y; Kephart, R D; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, M S; Kim, S B; Kim, S H; Kim, T H; Kim, Y K; King, B T; Kirby, M; Kirsch, L; Klimenko, S; Knuteson, B; Ko, B R; Kobayashi, H; Koehn, P; Kondo, K; Kong, D J; Konigsberg, J; Kordas, K; Korn, A J; Korytov, A; Kotelnikov, K A; Kotwal, A V; Kovalev, A; Kraus, J; Kravchenko, I; Kreymer, A; Kroll, J; Kruse, M; Krutelyov, V; Kuhlmann, S E; Kuznetsova, N; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, J; Lancaster, M; Lander, R; Lannon, K; Lath, A; Latino, G; Lauhakangas, R; Lazzizzera, I; Le, Y; LeCompte, T J; Lecci, C; Lee, J; Lee, S W; Leonardo, N; Leone, S; Lewis, J D; Li, K; Lin, C; Lin, C S; Lindgren, M; Liss, T M; Litvintsev, D O; Liu, T; Liu, Y; Lockyer, N S; Loginov, A; Loreti, M; Loverre, P F; Lu, R S; Lucchesi, D; Lukens, P; Lyons, L; Lys, J; Lysak, R; MacQueen, D; Madrak, R; Maeshima, K; Maksimovic, P; Malferrari, L; Manca, G; Marginean, R; Martin, A; Martin, M; Martin, V; Martínez, M; Maruyama, T; Matsunaga, H; Mattson, M E; Mazzanti, P; McFarland, K S; McGivern, D; McIntyre, P M; McNamara, P; McNulty, R; Menzemer, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Miao, T; Miladinovic, N; Miller, J S; Miller, L; Miller, R; Miquel, R; Miscetti, S; Mitselmakher, G; Miyamoto, A; Miyazaki, Y; Moggi, N; Mohr, B; Moore, R; Morello, M; Moulik, T; Mukherjee, A; Mulhearn, M; Mumford, R; Munar, A; Murat, P; Müller, T; Nachtman, J; Nahn, S; Nakamura, I; Nakano, I; Napier, A; Napora, R; Naumov, D V; Necula, V; Nelson, C; Nelson, T; Neu, C; Neubauer, M S; Newman-Holmes, C; Nicollerat, A S; Niell, F; Nielsen, J; Nigmanov, T; Nodulman, L; Ogawa, T; Oh, S; Oh, Y D; Ohsugi, T; Okusawa, T; Oldeman, R G C; Orava, Risto; Orejudos, W; Pagliarone, C; Palmonari, F; Paoletti, R; Papadimitriou, V; Pashapour, S; Patrick, J; Pauletta, G; Paulini, M; Pauly, T; Paus, C; Pellett, D; Penzo, Aldo L; Phillips, T J; Piacentino, G; Piedra, J; Pitts, K T; Plager, C; Pompos, A; Pondrom, L; Pope, G; Poukhov, O; Prakoshyn, F; Pratt, T; Pronko, A G; Proudfoot, J; Ptohos, F; Punzi, G; Rademacker, J; Rakitine, A; Rappoccio, S; Ratnikov, F; Ray, H; Reichold, A; Rekovic, V; Renton, P B; Rescigno, M; Rimondi, F; Rinnert, K; Ristori, L; Robertson, W J; Robson, A; Rodrigo, T; Rolli, S; Rosenson, L; Roser, R; Rossin, R; Rott, C; Ruiz, A; Russ, J; Ryan, D; Saarikko, H; Safonov, A; Saint-Denis, R; Sakumoto, W K; Salamanna, G; Saltzberg, D; Sansoni, A; Santi, L; Sarkar, S; Sato, K; Savard, P; Schemitz, P; Schlabach, P; Schmidt, E E; Schmidt, M P; Schmitt, M; Sciveres; Scodellaro, L; Scribano, A; Scuri, F; Sedov, A; Seidel, S; Seiya, Y; Semeria, F; Sexton-Kennedy, L; Sfiligoi, I; Shapiro, M D; Shears, T G; Shepard, P F; Shimojima, M; Shochet, M; Shon, Y; Shreyber, I; Sidoti, A; Siket, M; Sill, A; Sinervo, P; Sissakian, A N; Skiba, A; Slaughter, A J; Sliwa, K; Smith, J R; Snider, F D; Snihur, R; Somalwar, S V; Spalding, J; Spezziga, M; Spiegel, L; Spinella, F; Spiropulu, M; Squillacioti, P; Stadie, H; Stefanini, A; Stelzer, B; Stelzer-Chilton, O; Strologas, J; Stuart, D; Sukhanov, A; Sumorok, K; Sun, H; Suzuki, T; Sánchez, C; Taffard, A C; Tafirout, R; Takach, S F; Takano, H; Takashima, R; Takeuchi, Y; Takikawa, K; Tanaka, M; Tanaka, R; Tanimoto, N; Tapprogge, Stefan; Tecchio, M; Teng, P K; Terashi, K; Tesarek, R J; Tether, S; Thom, J; Thompson, A S; Thomson, E; Tipton, P; Tiwari, V; Tkaczyk, S; Toback, D; Tollefson, K; Tonelli, D; Tonnesmann, M; Torre, S; Torretta, D; Trischuk, W; Tseng, J; Tsuchiya, R; Tsuno, S; Tsybychev, D; Turini, N; Turner, M; Ukegawa, F; Unverhau, T; Uozumi, S; Usynin, D; Vacavant, L; Vaiciulis, A W; Varganov, A; Vataga, E; Vejcik, S; Velev, G V; Veramendi, G; Vickey, T; Vidal, R; Vila, I; Vilar, R; Volobuev, I P; Von der Mey, M; Wagner, R G; Wagner, R L; Wagner, W; Wallny, R; Walter, T; Wan, Z; Wang, M J; Wang, S M; Warburton, A; Ward, B; Waschke, S; Waters, D; Watts, T; Weber, M; Wester, W C; Whitehouse, B; Wicklund, A B; Wicklund, E; Williams, H H; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolter, M; Worcester, M; Worm, S; Wright, T; Wu, X; Wyatt, A; Würthwein, F; Yagil, A; Yamamoto, K; Yamashita, T; Yang, U K; Yao, W; Yeh, G P; Yi, K; Yoh, J K; Yoon, P; Yorita, K; Yoshida, T; Yu, I; Yu, S; Yu, Z; Yun, C; Zanello, L; Zanetti, A; Zaw, I; Zetti, F; Zhou, J; Zsenei, A; Zucchelli, S; Österberg, K

    2004-01-01

    We report on a search for Bs->mu+mu- and Bd->mu+mu- decays in ppbar collisions at $\\sqrt{s}$=1.96 TeV using 171 pb-1 of data collected by the CDF II experiment at the Fermilab Tevatron Collider. The decay rates of these rare processes are sensitive to contributions from physics beyond the Standard Model. One event survives all our selection requirements,consistent with the background expectation. We derive branching ratio limits of BR(Bs->mu+mu-) mu+mu-) < 1.5 x 10^-7 at 90% confidence level.

  19. Search for Large Extra Dimensions via Single Photons Plus Missing Energy Final States at √s = 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Carrera, Edgar Fernando [Florida State Univ., Tallahassee, FL (United States)

    2008-12-01

    This dissertation presents a search for large extra dimensions in the single photon plus missing transverse energy final states. We use a data sample of approximately 2.7 fb-1 of p$\\bar{p}$ collisions at √s = 1.96 TeV (recorded with the D- detector) to investigate direct Kaluza Klein graviton production and set limits, at the 95% C.L., on the fundamental mass scale MD from 970 GeV to 816 GeV for two to eight extra dimensions.

  20. Inclusive high-p$\\perp$ b$\\bar{b}$cross section measurement at √s = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Galyaev, Eugene N. [Univ. of Notre Dame, IN (United States)

    2006-11-01

    The Run II physics program at the Tevatron started in the spring of 2001 with protons and antiprotons colliding at an energy of √s = 1.96 TeV, and is continuing with about 1.2 fb-1 of data currently collected by the CDF and D0 experiments. A measurement of the b-jet cross section as function of jet transverse momentum p$\\perp$ has been performed using 312 pb-1 of D0 data. The results for this measurement were obtained and are presented herein. A neural network algorithm was used to identify b jets.

  1. Measurement of the W + γ Production in Proton - Anti-proton Collisions at √s = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Kirby, Michael H. [Duke Univ., Durham, NC (United States)

    2004-01-01

    The authors present a measurement of the $\\bar{p}$p → Wγ + X → evγ + X production cross section using data form the Collider Detector at Fermilab. The p$\\bar{p}$ collisions were provided by the Tevatron Collider at a center of mass energy of 1.96 TeV. Electroweak theory includes the trilinear vector boson coupling, WWγ, which contributes to the evγ final state. The electron decay channel of the W provides a clean sample to study the production of diboson pairs. The measurement of the production cross section tests the structure of the non-Abelian character of Electroweak theory.

  2. Search for Randall-Sundrum gravitons with 1 fb-1 of data from ppbar collisions at $\\sqrt{s}$=1.96 TeV

    CERN Document Server

    Abazov, V; Abolins, M; Acharya, B S; Adams, M; Adams, T; Aguiló, E; Ahn, S H; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Ancu, L S; Andeen, T; Anderson, S; Andrieu, B; Anzelc, M S; Arnoud, Y; Arov, M; Arthaud, M; Askew, A; Åsman, B; Assis-Jesus, A C S; Atramentov, O; Autermann, C; Avila, C; Ay, C; Badaud, F; Baden, A; Bagby, L; Baldin, B; Bandurin, D V; Banerjee, S; Banerjee, P; Barberis, E; Barfuss, A F; Bargassa, P; Baringer, P; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Beale, S; Bean, A; Begalli, M; Begel, M; Belanger-Champagne, C; Bellantoni, L; Bellavance, A; Benítez, J A; Beri, S B; Bernardi, G; Bernhard, R; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Biscarat, C; Blazey, G; Blekman, F; Blessing, S; Bloch, D; Bloom, K; Böhnlein, A; Boline, D; Bolton, T A; Borissov, G; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Brown, D; Buchanan, N J; Buchholz, D; Bühler, M; Büscher, V; Bunichev, S; Burdin, S; Burke, S; Burnett, T H; Buszello, C P; Butler, J M; Calfayan, P; Calvet, S; Cammin, J; Carvalho, W; Casey, B C K; Cason, N M; Castilla-Valdez, H; Chakrabarti, S; Chakraborty, D; Chan, K M; Chan, K; Chandra, A; Charles, F; Cheu, E; Chevallier, F; Cho, D K; Choi, S; Choudhary, B; Christofek, L; Christoudias, T; Cihangir, S; Claes, D; Coadou, Y; Cooke, M; Cooper, W E; Corcoran, M; Couderc, F; Cousinou, M C; Crepe-Renaudin, S; Cutts, D; Cwiok, M; Da Motta, H; Das, A; Davies, G; De, K; De Jong, S J; De La Cruz-Burelo, E; De Oliveira Martins, C; Degenhardt, J D; Déliot, F; Demarteau, M; Demina, R; Denisov, D; Denisov, S P; Desai, S; Diehl, H T; Diesburg, M; Dominguez, A; Dong, H; Dudko, L V; Duflot, L; Dugad, S R; Duggan, D; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Ellison, J; Elvira, V D; Enari, Y; Eno, S; Ermolov, P; Evans, H; Evdokimov, A; Evdokimov, V N; Ferapontov, A V; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Ford, M; Fortner, M; Fox, H; Fu, S; Fuess, S; Gadfort, T; Galea, C F; Gallas, E; Galyaev, E; García, C; García-Bellido, A; Gavrilov, V; Gay, P; Geist, W; Gelé, D; Gerber, C E; Gershtein, Yu; Gillberg, D; Ginther, G; Gollub, N; Gómez, B; Goussiou, A; Grannis, P D; Greenlee, H; Greenwood, Z D; Gregores, E M; Grenier, G; Gris, P; Grivaz, J F; Grohsjean, A; Grünendahl, S; Grünewald, M W; Guo, J; Guo, F; Gutíerrez, P; Gutíerrez, G; Haas, A; Hadley, N J; Haefner, P; Hagopian, S; Haley, J; Hall, I; Hall, R E; Han, L; Hanagaki, K; Hansson, P; Harder, K; Harel, A; Harrington, R; Hauptman, J M; Hauser, R; Hays, J; Hebbeker, T; Hedin, D; Hegeman, J G; Heinmiller, J M; Heinson, A P; Heintz, U; Hensel, C; Herner, K; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hoeth, H; Hohlfeld, M; Hong, S J; Hossain, S; Houben, P; Hu, Y; Hubacek, Z; Hynek, V; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jakobs, K; Jarvis, C; Jesik, R; Johns, K; Johnson, C; Johnson, M; Jonckheere, A; Jonsson, P; Juste, A; Käfer, D; Kajfasz, E; Kalinin, A M; Kalk, J R; Kalk, J M; Kappler, S; Karmanov, D; Kasper, P; Katsanos, I; Kau, D; Kaur, R; Kaushik, V; Kehoe, R; Kermiche, S; Khalatyan, N; Khanov, A; Kharchilava, A; Kharzheev, Yu M; Khatidze, D; Kim, H; Kim, T J; Kirby, M H; Kirsch, M; Klima, B; Kohli, J M; Konrath, J P; Kopal, M; Korablev, V M; Kozelov, A V; Krop, D; Kühl, T; Kumar, A; Kunori, S; Kupco, A; Kurca, T; Kvita, J; Lacroix, F; Lam, D; Lammers, S; Landsberg, G; Lebrun, P; Lee, W M; Leflat, A; Lehner, F; Lellouch, J; Lévêque, J; Lewis, P; Li, J; Li, Q Z; Li, L; Lietti, S M; Lima, J G R; Lincoln, D; Linnemann, J; Lipaev, V V; Lipton, R; Liu, Y; Liu, Z; Lobo, L; Lobodenko, A; Lokajícek, M; Love, P; Lubatti, H J; Lyon, A L; Maciel, A K A; Mackin, D; Madaras, R J; Mättig, P; Magass, C; Magerkurth, A; Mal, P K; Malbouisson, H B; Malik, S; Malyshev, V L; Mao, H S; Maravin, Y; Martin, B; McCarthy, R; Melnitchouk, A; Mendes, A; Mendoza, L; Mercadante, P G; Merkin, M; Merritt, K W; Meyer, J; Meyer, A; Millet, T; Mitrevski, J; Molina, J; Mommsen, R K; Mondal, N K; Moore, R W; Moulik, T; Muanza, G S; Mulders, M; Mulhearn, M; Mundal, O; Mundim, L; Nagy, E; Naimuddin, M; Narain, M; Naumann, N A; Neal, H A; Negret, J P; Neustroev, P; Nilsen, H; Nogima, H; Nomerotski, A; Novaes, S F; Nunnemann, T; O'Dell, V; O'Neil, D C; Obrant, G; Ochando, C; Onoprienko, D; Oshima, N; Osta, J; Otec, R; Oteroy-Garzon, G J; Owen, M; Padley, P; Pangilinan, M; Parashar, N; Park, S J; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Pawloski, G; Penning, B; Perfilov, M; Peters, K; Peters, Y; Petroff, P; Petteni, M; Piegaia, R; Piper, J; Pleier, M A; Podesta-Lerma, P L M; Podstavkov, V M; Pogorelov, Y; Pol, M E; Polozov, P; Pope, B G; Popov, A V; Potter, C; Prado da Silva, W L; Prosper, H B; Protopopescu, S; Qian, J; Quadt, A; Quinn, B; Rakitine, A; Rangel, M S; Ranjan, K

    2007-01-01

    Using 1 fb-1 of data from ppbar collisions at $\\sqrt{s}$=1.96 TeV at the Fermilab Tevatron collider collected by the D0 detector, we search for decays of Kaluza-Klein excitations of the graviton in the Randall-Sundrum model of extra dimensions to $e^+e^-$ and diphotons. We set 95% confidence level upper limits on the production cross section times branching fraction which translate into lower limits on the mass of the lightest excitation between 300 and 900 GeV for values of the coupling k/M(Planck) between 0.01 and 0.1.

  3. Search for Large Extra Dimensions in the Production of Jets and Missing Transverse Energy in ppbar Collisions at s**(1/2) = 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abulencia, A.; Acosta, D.; Adelman, Jahred A.; Affolder, T.; Akimoto, T.; Albrow, M.G.; Ambrose, D.; Amerio, S.; Amidei, D.; Anastassov, A.; Anikeev, K.; /Taiwan, Inst.

    2006-04-01

    The authors present the results of a search for new physics in the jets plus missing transverse energy data sample collected from 368 pb{sup -1} of p{bar p} collisions at {radical}s = 1.96 TeV recorded by the Collider Detector at Fermilab. They compare the number of events observed in the data with a data-based estimate of the standard model backgrounds contributing to this signature. They observe no significant excess of events, and they interpret this null result in terms of lower limits on the fundamental Planck scale for a large extra dimensions scenario.

  4. Search for scalar leptoquarks in the acoplanar jet topology in ppbar collisions at $\\sqrt{s}$=1.96 TeV

    CERN Document Server

    Abazov, V M; Abolins, M; Acharya, B S; Adams, M; Adams, T; Agelou, M; Agram, J L; Ahn, S H; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Andeen, T; Anderson, S; Andrieu, B; Anzelc, M S; Arnoud, Y; Arov, M; Askew, A; Åsman, B; Assis-Jesus, A C S; Atramentov, O; Autermann, C; Avila, C; Ay, C; Badaud, F; Baden, A; Bagby, L; Baldin, B; Bandurin, D V; Banerjee, P; Banerjee, S; Barberis, E; Bargassa, P; Baringer, P; Barnes, C; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Bean, A; Begalli, M; Begel, M; Belanger-Champagne, C; Bellantoni, L; Bellavance, A; Benítez, J A; Beri, S B; Bernardi, G; Bernhard, R; Berntzon, L; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Binder, M; Biscarat, C; Black, K M; Blackler, I; Blazey, G; Blekman, F; Blessing, S; Bloch, D; Bloom, K; Blumenschein, U; Böhnlein, A; Boeriu, O; Bolton, T A; Borissov, G; Bos, K; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Brown, D; Buchanan, N J; Buchholz, D; Bühler, M; Büscher, V; Burdin, S; Burke, S; Burnett, T H; Busato, E; Buszello, C P; Butler, J M; Calfayan, P; Calvet, S; Cammin, J; Caron, S; Carvalho, W; Casey, B C K; Cason, N M; Castilla-Valdez, H; Chakrabarti, S; Chakraborty, D; Chan, K M; Chandra, A; Chapin, D; Charles, F; Cheu, E; Chevallier, F; Cho, D K; Choi, S; Choudhary, B; Christofek, L; Claes, D; Clement, B; Clément, C; Coadou, Y; Cooke, M; Cooper, W E; Coppage, D; Corcoran, M; Cousinou, M C; Cox, B; Crepe-Renaudin, S; Cutts, D; Cwiok, M; Da Motta, H; Das, A; Das, M; Davies, B; Davies, G; Davis, G A; De, K; de Jong, P; De Jong, S J; De La Cruz-Burelo, E; De Oliveira Martins, C; Degenhardt, J D; Déliot, F; Demarteau, M; Demina, R; Demine, P; Denisov, D; Denisov, S P; Desai, S; Diehl, H T; Diesburg, M; Doidge, M; Dominguez, A; Dong, H; Dudko, L V; Duflot, L; Dugad, S R; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Edwards, T; Ellison, J; Elmsheuser, J; Elvira, V D; Eno, S; Ermolov, P; Estrada, J; Evans, H; Evdokimov, A; Evdokimov, V N; Fatakia, S N; Feligioni, L; Ferapontov, A V; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Fleck, I; Ford, M; Fortner, M; Fox, H; Fu, S; Fuess, S; Gadfort, T; Galea, C F; Gallas, E; Galyaev, E; García, C; García-Bellido, A; Gardner, J; Gavrilov, V; Gay, A; Gay, P; Gelé, D; Gelhaus, R; Gerber, C E; Gershtein, Yu; Gillberg, D; Ginther, G; Gollub, N; Gómez, B; Goussiou, A; Grannis, P D; Greenlee, H; Greenwood, Z D; Gregores, E M; Grenier, G; Gris, P; Grivaz, J F; Grünendahl, S; Grünewald, M W; Guo, F; Guo, J; Gutíerrez, G; Gutíerrez, P; Haas, A; Hadley, N J; Haefner, P; Hagopian, S; Haley, J; Hall, I; Hall, R E; Han, L; Hanagaki, K; Harder, K; Harel, A; Harrington, R; Hauptman, J M; Hauser, R; Hays, J; Hebbeker, T; Hedin, D; Hegeman, J G; Heinmiller, J M; Heinson, A P; Heintz, U; Hensel, C; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hoeth, H; Hohlfeld, M; Hong, S J; Hooper, R; Houben, P; Hu, Y; Hubacek, Z; Hynek, V; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jakobs, K; Jarvis, C; Jenkins, A; Jesik, R; Johns, K; Johnson, C; Johnson, M; Jonckheere, A; Jonsson, P; Juste, A; Käfer, D; Kahn, S; Kajfasz, E; Kalinin, A M; Kalk, J M; Kalk, J R; Kappler, S; Karmanov, D; Kasper, J; Kasper, P; Katsanos, I; Kau, D; Kaur, R; Kehoe, R; Kermiche, S; Kesisoglou, S; Khalatyan, N; Khanov, A; Kharchilava, A I; Kharzheev, Yu M; Khatidze, D; Kim, H; Kim, T J; Kirby, M H; Klima, B; Kohli, J M; Konrath, J P; Kopal, M; Korablev, V M; Kotcher, J; Kothari, B; Koubarovsky, A; Kozelov, A V; Kozminski, J; Krop, D; Kryemadhi, A; Kühl, T; Kumar, A; Kunori, S; Kupco, A; Kurca, T; Kvita, J; Lager, S; Lammers, S; Landsberg, G L; Lazoflores, J; Le Bihan, A C; Lebrun, P; Lee, W M; Leflat, A; Lehner, F; Lesne, V; Lévêque, J; Lewis, P; Li, J; Li, Q Z; Lima, J G R; Lincoln, D; Linnemann, J; Lipaev, V V; Lipton, R; Liu, Z; Lobo, L; Lobodenko, A; Lokajícek, M; Lounis, A; Love, P; Lubatti, H J; Lynker, M; Lyon, A L; Maciel, A K A; Madaras, R J; Mättig, P; Magass, C; Magerkurth, A; Magnan, A M; Makovec, N; Mal, P K; Malbouisson, H B; Malik, S; Malyshev, V L; Mao, H S; Maravin, Y; Martens, M; Mattingly, S E K; McCarthy, R; Meder, D; Melnitchouk, A; Mendes, A; Mendoza, L; Merkin, M; Merritt, K W; Meyer, A; Meyer, J; Michaut, M; Miettinen, H; Millet, T; Mitrevski, J; Molina, J; Mondal, N K; Monk, J; Moore, R W; Moulik, T; Muanza, G S; Mulders, M; Mulhearn, M; Mundim, L; Mutaf, Y D; Nagy, E; Naimuddin, M; Narain, M; Naumann, N A; Neal, H A; Negret, J P; Nelson, S; Neustroev, P; Nöding, C; Nomerotski, A; Novaes, S F; Nunnemann, T; O'Dell, V; O'Neil, D C; Obrant, G; Oguri, V; Oliveira, N; Oshima, N; Otec, R; Oteroy-Garzon, G J; Owen, M; Padley, P; Parashar, N; Park, S J; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Pawloski, G; Perea, P M; Pérez, E; Peters, K; Petroff, P; Petteni, M; Piegaia, R; Pleier, M A; Podesta-Lerma, P L M; Podstavkov, V M; Pogorelov, Y; Pol, M E; Pompos, A; Pope, B G; Popov, A V; Prado da Silva, W L; Prosper, H B; Protopopescu, S D; Qian, J; Quadt, A; Quinn, B; Rani, K J; Ranjan, K; Ratoff, P N; Renkel, P; Reucroft, S; Rijssenbeek, M; Ripp-Baudot, I; Rizatdinova, F K; Robinson, S; Rodrigues, R F; Royon, C; Rubinov, P; Ruchti, R; Rud, V I; Sajot, G; Sánchez-Hernández, A; Sanders, M P; Santoro, A F S; Savage, G; Sawyer, L; Scanlon, T; Schaile, A D; Schamberger, R D; Scheglov, Y; Schellman, H; Schieferdecker, P; Schmitt, C; Schwanenberger, C; Schwartzman, A; Schwienhorst, R; Sen-Gupta, S; Severini, H; Shabalina, E; Shamim, M; Shary, V; Shchukin, A A; Shephard, W D; Shivpuri, R K; Shpakov, D; Siccardi, V; Sidwell, R A; Simák, V; Sirotenko, V I; Skubic, P L; Slattery, P F; Smith, R P; Snow, G R; Snow, J; Snyder, S; Söldner-Rembold, S; Song, X; Sonnenschein, L; Sopczak, A; Sosebee, M; Soustruznik, K; Souza, M; Spurlock, B; Stark, J; Steele, J; Stolin, V; Stone, A; Stoyanova, D A; Strandberg, J; Strang, M A; Strauss, M; Ströhmer, R; Strom, D; Strovink, M; Stutte, L; Sumowidagdo, S; Sznajder, A; Talby, M; Tamburello, P; Taylor, W; Telford, P; Temple, J; Tiller, B; Titov, M; Tokmenin, V V; Tomoto, M; Toole, T; Torchiani, I; Towers, S; Trefzger, T; Trincaz-Duvoid, S; Tsybychev, D; Tuchming, B; Tully, C; Turcot, A S; Tuts, P M; Unalan, R; Uvarov, L; Uvarov, S; Uzunyan, S; Vachon, B; Vanden Berg, P J; Van Kooten, R; Van Leeuwen, W M; Varelas, N; Varnes, E W; Vartapetian, A H; Vasilyev, I A; Vaupel, M; Verdier, P; Vertogradov, L S; Verzocchi, M; Villeneuve-Séguier, F; Vint, P; Vlimant, J R; Von Törne, E; Voutilainen, M; Vreeswijk, M; Wahl, H D; Wang, L; Warchol, J; Watts, G; Wayne, M; Weber, M; Weerts, H; Wermes, N; Wetstein, M; White, A; Wicke, D; Wilson, G W; Wimpenny, S J; Wobisch, M; Womersley, J; Wood, D R; Wyatt, T R; Xie, Y; Xuan, N; Yacoob, S; Yamada, R; Yan, M; Yasuda, T; Yatsunenko, Y A; Yip, K; Yoo, H D; Youn, S W; Yu, C; Yu, J; Yurkewicz, A; Zatserklyaniy, A; Zeitnitz, C; Zhang, D; Zhao, T; Zhou, B; Zhu, J; Zielinski, M; Zieminska, D; Zieminski, A; Zutshi, V; Zverev, E G

    2006-01-01

    A search for leptoquarks has been performed in 310 pb-1 of data from ppbar collisions at a center-of-mass energy of 1.96 TeV, collected by the D0 detector at the Fermilab Tevatron Collider. The topology analyzed consists of acoplanar jets with missing transverse energy. The data show good agreement with standard model expectations, and a lower mass limit of 136 GeV has been set at the 95% C.L. for a scalar leptoquark decaying exclusively into a quark and a neutrino.

  5. Search for large extra dimensions in the mono-photon final state at s**(1/2) = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abazov, V.M.; /Dubna, JINR; Abbott, B.; /Oklahoma U.; Abolins, M.; /Michigan State U.; Acharya, B.S.; /Tata Inst.; Adams, M.; /Illinois U., Chicago; Adams, T.; /Florida State U.; Aguilo, E.; /Simon Fraser U.; Ahn, S.H.; /Korea U., KODEL; Ahsan, M.; /Kansas State U.; Alexeev, G.D.; /Dubna, JINR; Alkhazov, G.; /St. Petersburg, INP /Michigan U.

    2008-03-01

    The authors report on a search for large extra dimensions in a data sample of approximately 1 fb{sup -1} of p{bar p} collisions at {radical}s = 1.96 TeV. They investigate Kaluza-Klein graviton production with a photon and missing transverse energy in the final state. At the 95% C.L. they set limits on the fundamental mass scale M{sub D} from 884 GeV to 778 GeV for 2 to 8 extra dimensions.

  6. Evaluation of a novel functional single-nucleotide polymorphism (rs35010275 G>C) in MIR196A2 promoter region as a risk factor of gastric cancer in a Chinese population.

    Science.gov (United States)

    Xu, Ming; Qiang, Fulin; Gao, Yan; Kang, Meiyun; Wang, Meilin; Tao, Guoquan; Gong, Weida; Zhu, Haixia; Wu, Dongmei; Zhang, Zhengdong; Zhao, Qinghong

    2014-11-01

    Single-nucleotide polymorphisms (SNPs) in microRNAs (miRNAs) have been suggested to influence the occurrence and progression of cancer through altering the expression and biological function of miRNAs. The aim of this study was to investigate whether the potential functional SNPs in MIR196A2 promoter had effect on the susceptibility to gastric cancer (GC) in a Chinese population.We conducted a 2-stage case-control study (753 cases and 854 controls in testing set; 940 cases and 1061 controls in validation set) to evaluate the association between 2 potential functional SNPs in MIR196A2 promoter (rs12304647 A>C and rs35010275 G>C) and GC risk. The luciferase reporter assay and electrophoretic mobility shift assay were used to examine the functionality of the important polymorphism.We found that the rs35010275 C allele was significantly associated with the decreased risk of GC (adjusted odds ratio = 0.85, 95% confidence interval = 0.77-0.94) in the combined case-control studies. The miR-196a expression levels in GC tissues were significantly higher than that in corresponding adjacent normal tissues (P C polymorphism in MIR196A2 promoter was significantly associated with miR-196a expression and influenced the genetic susceptibility to GC.

  7. Search for Higgs boson production in proton-antiproton collisions at √s = 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Kusakabe, Yoshiaki [Waseda Univ., Shinjuku (Japan)

    2006-12-01

    We performed a search for Standard Model Higgs boson production in association with W boson (p$\\bar{p}$ → W±H → ℓvb$\\bar{b}$) in p$\\bar{p}$ collisions at √s = 1.96 TeV. The search uses the data collected between February 2002 and February 2006 at Collider Detector at Fermilab (CDF), which corresponds to an integrated luminosity of about 1 fb-1. The experimental final state of WH → ℓvb$\\bar{b}$ process is lepton (e±±), missing transverse energy and two jets. The largest background in lepton+jets events is W+light flavor process, therefore the identification of jets as b-jets reduces this kind of background significantly. We used displaced SECondary VerTeX b-tagging (SECVTX) technique, which utilizes the signature that b-jets have secondary vertex displaced away from primary vertex because of the long life time of B-mesons. However, there is still much contamination in SECVTX b-tagged jets. Finite resolution of secondary vertex tracking measurements results in false tags, and c-jets are also identified as b-jets due to the long life time of D-mesons frequently. For the purpose of increasing the purity of the SECVTX b-tagged jets, we applied Neural Network to SECVTX tagged jets for the first time by using secondary vertex variables and some variables independent of it. Neural Network filter rejects 65% of light flavor jets and 50% of c-jets from the SECVTX tagged jets. We improved the sensitivity of the Higgs boson signal search by 10% with Neural Network b-tagging technique. Events with one high pT electron or muon, large missing transverse energy and either single SECVTX b-tagged jet which passes the Neural Network filter or at least two SECVTX b-tagged jets are selected. The number of selected events and dijet mass distributions are consistent with the Standard Model background expectations. Therefore we set an upper limit on σ(p$\\bar{p}$ → WH) • Br(H → b$\\bar{b}$) as 3.9 to 1

  8. Storage of blood for methemoglobin determination: comparison of storage with a cryoprotectant at -30 degrees C and without any additions at -80 degrees C or -196 degrees C.

    Science.gov (United States)

    Sato, K; Tamaki, K; Tsutsumi, H; Okajima, H; Katsumata, Y

    1990-03-01

    Changes in methemoglobin (Met-Hb) concentrations during storage of whole blood or mixtures of blood and a cryoprotectant at refrigerated or various freezing temperatures were examined using blood samples from nitrite-administered rats and from autopsy cadavers. When whole blood was stored at 3 degrees C, Met-Hb reduction was observed in blood samples from nitrite-administered rats and in the blood from a victim poisoned by a weed killer containing some oxidant. When samples were stored at -30 degrees C, Met-Hb formation by autoxidation was inevitably observed in blood samples stored as whole blood, whereas addition of a cryoprotectant to whole blood could prevent Met-Hb formation in all the blood samples. When whole blood was stored at -80 degrees C or -196 degrees C, Met-Hb concentrations were practically stable until at least 30 days regardless of the initial values except in the control rat blood samples stored at -80 degrees C which showed slight formation of Met-Hb. From the results obtained, both the storage with a cryoprotectant at -30 degrees C and that without any additions at -80 degrees C or -196 degrees C proved to be suitable for long-term storage of blood samples from autopsy cadavers for Met-Hb determination. PMID:2335326

  9. Gold nanoparticles production using reactor and cyclotron based methods in assessment of (196,198)Au production yields by (197)Au neutron absorption for therapeutic purposes.

    Science.gov (United States)

    Khorshidi, Abdollah

    2016-11-01

    Medical nano-gold radioisotopes is produced regularly using high-flux nuclear reactors, and an accelerator-driven neutron activator can turn out higher yield of (197)Au(n,γ)(196,198)Au reactions. Here, nano-gold production via radiative/neutron capture was investigated using irradiated Tehran Research Reactor flux and also simulated proton beam of Karaj cyclotron in Iran. (197)Au nano-solution, including 20nm shaped spherical gold and water, was irradiated under Tehran reactor flux at 2.5E+13n/cm(2)/s for (196,198)Au activity and production yield estimations. Meanwhile, the yield was examined using 30MeV proton beam of Karaj cyclotron via simulated new neutron activator containing beryllium target, bismuth moderator around the target, and also PbF2 reflector enclosed the moderator region. Transmutation in (197)Au nano-solution samples were explored at 15 and 25cm distances from the target. The neutron flux behavior inside the water and bismuth moderators was investigated for nano-gold particles transmutation. The transport of fast neutrons inside bismuth material as heavy nuclei with a lesser lethargy can be contributed in enhanced nano-gold transmutation with long duration time than the water moderator in reactor-based method. Cyclotron-driven production of βeta-emitting radioisotopes for brachytherapy applications can complete the nano-gold production technology as a safer approach as compared to the reactor-based method. PMID:27524041

  10. Hsa-miR-196a2 Rs11614913 polymorphism contributes to cancer susceptibility: evidence from 15 case-control studies.

    Directory of Open Access Journals (Sweden)

    Haiyan Chu

    Full Text Available BACKGROUND: MicroRNAs (miRNAs are a family of endogenous, small and noncoding RNAs that negatively regulate gene expression by suppressing translation or degrading mRNAs. Recently, many studies investigated the association between hsa-miR-196a2 rs11614913 polymorphism and cancer risk, which showed inconclusive results. METHODOLOGY/PRINCIPAL FINDINGS: We conducted a meta-analysis of 15 studies that included 9,341 cancer cases and 10,569 case-free controls. We assessed the strength of the association, using odds ratios (ORs with 95% confidence intervals (CIs. Overall, individuals with the TC/CC genotypes were associated with higher cancer risk than those with the TT genotype (OR=1.18, 95% CI=1.03-1.34, P<0.001 for heterogeneity test. In the stratified analyses, we observed that the CC genotype might modulate breast cancer risk (OR=1.11, 95%CI=1.01-1.23, Pheterogeneity=0.210 and lung cancer risk (OR=1.25, 95%CI=1.06-1.46, Pheterogeneity=0.958, comparing with the TC/TT genotype. Moreover, a significantly increased risk was found among Asian populations in a dominant model (TC/CC versus TT, OR=1.24, 95% CI=1.07-1.43, Pheterogeneity=0.006. CONCLUSIONS: These findings supported that hsa-miR-196a2 rs11614913 polymorphism may contribute to the susceptibility of cancers.

  11. Measurement of the Top Quark Pair Production Cross Section in p anti-p collisions at √s = 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Otero y Garzon, Gustavo J. [Univ. of Illinois, Chicago, IL (United States)

    2006-03-01

    The subject of this thesis is the measurement of the rate at which a top-antitop quark pair is produced in pp collisions at a center of mass energy of ps = 1:96 TeV. The data are collected with the D detector, a multi-purpose detector operating at the Fermilab Tevatron collider during Run II. A measurement of the top quark pair (t$\\bar{t}$) production cross section ( σt$\\bar{t}$) in p$\\bar{p}$ collisions at a center of mass energy of 1.96 TeV is presented. The measurement is based on data recorded by the D0 Detector at the Fermilab Tevatron Collider, and preselected in the e+jets (366 pb-1) and μ+jets (363 pb-1) channels. The cross section is extracted by applying a lifetime-tagging technique to the data, and yields σt$\\bar{t}$ = 6.96$+1.07\\atop{-0.98}$(stat + syst) ± 0.45(lumi) pb; for a top quark mass mt =175 GeV, in good agreement with the Standard Model prediction.

  12. Tungsten Inert Gas and Friction Stir Welding Characteristics of 4-mm-Thick 2219-T87 Plates at Room Temperature and -196 °C

    Science.gov (United States)

    Lei, Xuefeng; Deng, Ying; Yin, Zhimin; Xu, Guofu

    2014-06-01

    2219-T87 aluminum alloy is widely used for fabricating liquid rocket propellant storage tank, due to its admirable cryogenic property. Welding is the dominant joining method in the manufacturing process of aerospace components. In this study, the tungsten inert gas welding and friction stir welding (FSW) characteristics of 4-mm-thick 2219-T87 alloy plate at room temperature (25 °C) and deep cryogenic temperature (-196 °C) were investigated by property measurements and microscopy methods. The studied 2219 base alloy exhibits a low strength plane anisotropy and excellent room temperature and cryogenic mechanical properties. The ultimate tensile strength values of TIG and FSW welding joints can reach 265 and 353 MPa at room temperature, and 342 and 438 MPa at -196 °C, respectively. The base metal consists of elongated deformed grains and many nano-scaled θ (Al2Cu) aging precipitates. Fusion zone and heat-affected zone (HAZ) of the TIG joint are characterized by coarsening dendritic grains and equiaxed recrystallized grains, respectively. The FSW-welded joint consists of the weld nugget zone, thermo-mechanically affected zone (TMAZ), and HAZ. In the weld nugget zone, a micro-scaled sub-grain structure is the main microstructure characteristic. The TMAZ and HAZ are both characterized by coarsened aging precipitates and elongated deformed grains. The excellent FSW welding properties are attributed to the preservation of the working structures and homogenous chemical compositions.

  13. Studies of high-transverse momentum jet substructure and top quarks produced in 1.96 TeV proton-antiproton collisions

    CERN Document Server

    Aaltonen, Timo Antero; Amerio, Silvia; Amidei, Dante E; Anastassov, Anton Iankov; Annovi, Alberto; Antos, Jaroslav; Apollinari, Giorgio; Appel, Jeffrey A; Arisawa, Tetsuo; Artikov, Akram Muzafarovich; Asaadi, Jonathan A; Ashmanskas, William Joseph; Auerbach, Benjamin; Aurisano, Adam J; Azfar, Farrukh A; Badgett, William Farris; Bae, Taegil; Barbaro-Galtieri, Angela; Barnes, Virgil E; Barnett, Bruce Arnold; Barria, Patrizia; Bartos, Pavol; Bauce, Matteo; Bedeschi, Franco; Behari, Satyajit; Bellettini, Giorgio; Bellinger, James Nugent; Benjamin, Douglas P; Beretvas, Andrew F; Bhatti, Anwar Ahmad; Bland, Karen Renee; Blumenfeld, Barry J; Bocci, Andrea; Bodek, Arie; Bortoletto, Daniela; Boudreau, Joseph Francis; Boveia, Antonio; Brigliadori, Luca; Bromberg, Carl Michael; Brucken, Erik; Budagov, Ioulian A; Budd, Howard Scott; Burkett, Kevin Alan; Busetto, Giovanni; Bussey, Peter John; Butti, Pierfrancesco; Buzatu, Adrian; Calamba, Aristotle; Camarda, Stefano; Campanelli, Mario; Canelli, Florencia; Carls, Benjamin; Carlsmith, Duncan L; Carosi, Roberto; Carrillo Moreno, Salvador; Casal Larana, Bruno; Casarsa, Massimo; Castro, Andrea; Catastini, Pierluigi; Cauz, Diego; Cavaliere, Viviana; Cavalli-Sforza, Matteo; Cerri, Alessandro; Cerrito, Lucio; Chen, Yen-Chu; Chertok, Maxwell Benjamin; Chiarelli, Giorgio; Chlachidze, Gouram; Cho, Kihyeon; Chokheli, Davit; Clark, Allan Geoffrey; Clarke, Christopher Joseph; Convery, Mary Elizabeth; Conway, John Stephen; Corbo, Matteo; Cordelli, Marco; Cox, Charles Alexander; Cox, David Jeremy; Cremonesi, Matteo; Cruz Alonso, Daniel; Cuevas Maestro, Javier; Culbertson, Raymond Lloyd; D'Ascenzo, Nicola; Datta, Mousumi; de Barbaro, Pawel; Demortier, Luc M; Deninno, Maria Maddalena; D'Errico, Maria; Devoto, Francesco; Di Canto, Angelo; Di Ruzza, Benedetto; Dittmann, Jay Richard; Donati, Simone; D'Onofrio, Monica; Dorigo, Mirco; Driutti, Anna; Duchovni, Ehud; Ebina, Koji; Edgar, Ryan Christopher; Elagin, Andrey L; Erbacher, Robin D; Errede, Steven Michael; Esham, Benjamin; Farrington, Sinead Marie; Fernández Ramos, Juan Pablo; Field, Richard D; Flanagan, Gene U; Forrest, Robert David; Franklin, Melissa EB; Freeman, John Christian; Frisch, Henry J; Funakoshi, Yujiro; Galloni, Camilla; Garfinkel, Arthur F; Garosi, Paola; Gerberich, Heather Kay; Gerchtein, Elena A; Giagu, Stefano; Giakoumopoulou, Viktoria Athina; Gibson, Karen Ruth; Ginsburg, Camille Marie; Giokaris, Nikos D; Giromini, Paolo; Glagolev, Vladimir; Glenzinski, Douglas Andrew; Gold, Michael S; Goldin, Daniel; Golossanov, Alexander; Gomez, Gervasio; Gomez-Ceballos, Guillelmo; Goncharov, Maxim T; González López, Oscar; Gorelov, Igor V; Goshaw, Alfred T; Goulianos, Konstantin A; Gramellini, Elena; Grinstein, Sebastian; Grosso-Pilcher, Carla; Group, Robert Craig; Guimaraes da Costa, Joao; Hahn, Stephen R; Han, Ji-Yeon; Happacher, Fabio; Hara, Kazuhiko; Hare, Matthew Frederick; Harr, Robert Francis; Harrington-Taber, Timothy; Hatakeyama, Kenichi; Hays, Christopher Paul; Heinrich, Joel G; Herndon, Matthew Fairbanks; Hocker, James Andrew; Hong, Ziqing; Hopkins, Walter Howard; Hou, Suen Ray; Hughes, Richard Edward; Husemann, Ulrich; Hussein, Mohammad; Huston, Joey Walter; Introzzi, Gianluca; Iori, Maurizio; Ivanov, Andrew Gennadievich; James, Eric B; Jang, Dongwook; Jayatilaka, Bodhitha Anjalike; Jeon, Eun-Ju; Jindariani, Sergo Robert; Jones, Matthew T; Joo, Kyung Kwang; Jun, Soon Yung; Junk, Thomas R; Kambeitz, Manuel; Kamon, Teruki; Karchin, Paul Edmund; Kasmi, Azeddine; Kato, Yukihiro; Ketchum, Wesley Robert; Keung, Justin Kien; Kilminster, Benjamin John; Kim, DongHee; Kim, Hyunsoo; Kim, Jieun; Kim, Min Jeong; Kim, Shin-Hong; Kim, Soo Bong; Kim, Young-Jin; Kim, Young-Kee; Kimura, Naoki; Kirby, Michael H; Knoepfel, Kyle James; Kondo, Kunitaka; Kong, Dae Jung; Konigsberg, Jacobo; Kotwal, Ashutosh Vijay; Kreps, Michal; Kroll, IJoseph; Kruse, Mark Charles; Kuhr, Thomas; Kurata, Masakazu; Laasanen, Alvin Toivo; Lammel, Stephan; Lancaster, Mark; Lannon, Kevin Patrick; Latino, Giuseppe; Lee, Hyun Su; Lee, Jaison; Leo, Sabato; Leone, Sandra; Lewis, Jonathan D; Limosani, Antonio; Lipeles, Elliot David; Lister, Alison; Liu, Hao; Liu, Qiuguang; Liu, Tiehui Ted; Lockwitz, Sarah E; Loginov, Andrey Borisovich; Lucchesi, Donatella; Lucà, Alessandra; Lueck, Jan; Lujan, Paul Joseph; Lukens, Patrick Thomas; Lungu, Gheorghe; Lys, Jeremy E; Lysak, Roman; Madrak, Robyn Leigh; Maestro, Paolo; Malik, Sarah Alam; Manca, Giulia; Manousakis-Katsikakis, Arkadios; Marchese, Luigi Marchese; Margaroli, Fabrizio; Marino, Christopher Phillip; Martínez-Perez, Mario; Matera, Keith; Mattson, Mark Edward; Mazzacane, Anna; Mazzanti, Paolo; McNulty, Ronan; Mehta, Andrew; Mehtala, Petteri; Mesropian, Christina; Miao, Ting; Mietlicki, David John; Mitra, Ankush; Miyake, Hideki; Moed, Shulamit; Moggi, Niccolo; Moon, Chang-Seong; Moore, Ronald Scott; Morello, Michael Joseph; Mukherjee, Aseet; Muller, Thomas; Murat, Pavel A; Mussini, Manuel; Nachtman, Jane Marie; Nagai, Yoshikazu; Naganoma, Junji; Nakano, Itsuo; Napier, Austin; Nett, Jason Michael; Neu, Christopher Carl; Nigmanov, Turgun S; Nodulman, Lawrence J; Noh, Seoyoung; Norniella Francisco, Olga; Oakes, Louise Beth; Oh, Seog Hwan; Oh, Young-do; Oksuzian, Iuri Artur; Okusawa, Toru; Orava, Risto Olavi; Ortolan, Lorenzo; Pagliarone, Carmine Elvezio; Palencia, Jose Enrique; Palni, Prabhakar; Papadimitriou, Vaia; Parker, William Chesluk; Pauletta, Giovanni; Paulini, Manfred; Paus, Christoph Maria Ernst; Perez, Gilad; Phillips, Thomas J; Piacentino, Giovanni M; Pianori, Elisabetta; Pilot, Justin Robert; Pitts, Kevin T; Plager, Charles; Pondrom, Lee G; Poprocki, Stephen; Potamianos, Karolos Jozef; Pranko, Aliaksandr Pavlovich; Prokoshin, Fedor; Ptohos, Fotios K; Punzi, Giovanni; Redondo Fernández, Ignacio; Renton, Peter B; Rescigno, Marco; Rimondi, Franco; Ristori, Luciano; Robson, Aidan; Rodriguez, Tatiana Isabel; Rolli, Simona; Ronzani, Manfredi; Roser, Robert Martin; Rosner, Jonathan L; Ruffini, Fabrizio; Ruiz Jimeno, Alberto; Russ, James S; Rusu, Vadim Liviu; Sakumoto, Willis Kazuo; Sakurai, Yuki; Santi, Lorenzo; Sato, Koji; Saveliev, Valeri; Savoy-Navarro, Aurore; Schlabach, Philip; Schmidt, Eugene E; Schwarz, Thomas A; Scodellaro, Luca; Scuri, Fabrizio; Seidel, Sally C; Seiya, Yoshihiro; Semenov, Alexei; Sforza, Federico; Shalhout, Shalhout Zaki; Shears, Tara G; Shepard, Paul F; Shimojima, Makoto; Shochet, Melvyn J; Shreyber-Tecker, Irina; Simonenko, Alexander V; Sinervo, Pekka; Sliwa, Krzysztof Jan; Smith, John Rodgers; Snider, Frederick Douglas; Song, Hao; Sorin, Maria Veronica; St Denis, Richard Dante; Stancari, Michelle Dawn; Stentz, Dale James; Strologas, John; Sudo, Yuji; Sukhanov, Alexander I; Suslov, Igor M; Takemasa, Ken-ichi; Takeuchi, Yuji; Tang, Jian; Tecchio, Monica; Teng, Ping-Kun; Thom, Julia; Thomson, Evelyn Jean; Thukral, Vaikunth; Toback, David A; Tokar, Stanislav; Tollefson, Kirsten Anne; Tomura, Tomonobu; Tonelli, Diego; Torre, Stefano; Torretta, Donatella; Totaro, Pierluigi; Trovato, Marco; Ukegawa, Fumihiko; Uozumi, Satoru; Velev, Gueorgui; Vellidis, Konstantinos; Vernieri, Caterina; Vidal Marono, Miguel; Vilar Cortabitarte, Rocio; Vizán Garcia, Jesus Manuel; Vogel, Marcelo; Volpi, Guido; Vázquez-Valencia, Elsa Fabiola; Wagner, Peter; Wallny, Rainer S; Wang, Song-Ming; Waters, David S; Wester, William Carl; Whiteson, Daniel O; Wicklund, Arthur Barry; Wilbur, Scott; Williams, Hugh H; Wilson, Jonathan Samuel; Wilson, Peter James; Winer, Brian L; Wittich, Peter; Wolbers, Stephen A; Wolfe, Homer; Wright, Thomas Roland; Wu, Xin; Wu, Zhenbin; Yamamoto, Kazuhiro; Yamato, Daisuke; Yang, Tingjun; Yang, Un-Ki; Yang, Yu Chul; Yao, Wei-Ming; Yeh, Gong Ping; Yi, Kai; Yoh, John; Yorita, Kohei; Yoshida, Takuo; Yu, Geum Bong; Yu, Intae; Zanetti, Anna Maria; Zeng, Yu; Zhou, Chen; Zucchelli, Stefano

    2015-01-01

    Results of a study of the substructure of the highest transverse momentum (pT) jets observed by the CDF collaboration are presented. Events containing at least one jet with pT > 400 GeV/c in a sample corresponding to an integrated luminosity of 5.95 inverse fb, collected in 1.96 TeV proton-antiproton collisions at the Fermilab Tevatron collider, are selected. A study of the jet mass, angularity, and planar-flow distributions is presented, and the measurements are compared with predictions of perturbative quantum chromodynamics. A search for boosted top-quark production is also described, leading to a 95% confidence level upper limit of 38 fb on the production cross section of top quarks with pT > 400 GeV/c.

  14. Two-Particle Momentum Correlations in Jets Produced in ppbar Collisions at s**(1/2) = 1.96-TeV

    CERN Document Server

    Aaltonen, T; Akimoto, T; Albrow, M G; Alvarez-Gonzalez, B; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Apresyan, A; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Aurisano, A; Azfar, F; Azzi-Bacchetta, P; Azzurri, P; Bacchetta, N; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Baroiant, S; Bartsch, V; Bauer, G; Beauchemin, P H; Bedeschi, F; Bednar, P; Behari, S; Bellettini, G; Bellinger, J; Belloni, A; Benjamin, D; Beretvas, A; Beringer, J; Berry, T; Bhatti, A; Binkley, M; Bisello, D; Bizjak, I; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bölla, G; Bolshov, A; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Bridgeman, A; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, Yu A; Budd, H S; Budd, S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Byrum, K L; Cabrerar, S; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carlsmith, D; Carosi, R; Carrillol, S; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavalli-Sforza, M; Cerri, A; Cerritop, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, K; Chokheli, D; Chou, J P; Choudalakis, G; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Compostella, G; Convery, M E; Conway, J; Cooper, B; Copic, K; Cordelli, M; Cortiana, G; Crescioli, F; Cuenca Almenarr, C; Cuevaso, J; Culbertson, R; Cully, J C; Dagenhart, D; Datta, M; Davies, T; De Barbaro, P; De Cecco, S; Deisher, A; De Lentdeckerd, G; De Lorenzo, G; Dell'Orso, Mauro; Demortier, L; Deng, J; Deninno, M; De Pedis, D; Derwent, P F; Di Giovanni, G P; Dionisi, C; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Donati, S; Dong, P; Donini, J; Dorigo, T; Dube, S; Efron, J; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, W T; Feild, R G; Feindt, M; Fernández, J P; Ferrazza, C; Field, R; Flanagan, G; Forrest, R; Forrester, S; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; Garberson, F; García, J E; Garfinkel, A F; Genser, K; Gerberich, H; Gerdes, D; Giagu, S; Giakoumopoloua, V; Giannetti, P; Gibson, K; Gimmell, J L; Ginsburg, C M; Giokarisa, N; Giordani, M; Giromini, P; Giunta, M; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Golossanov, A; Gómez, G; Gómez-Ceballos, G; Goncharov, M; Gonzlez, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Grinstein, a S; Grosso-Pilcher, C; Group, R C; Grundler, U; Guimaraesda Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Hamilton, A; Han, B Y; Han, J Y; Handler, R; Happacher, F; Hara, K; Hare, D; Hare, M; Harper, S; Harr, R F; Harris, R M; Hartz, M; Hatakeyama, K; Hauser, J; Hays, C; Heck, M; Heijboer, A; Heinemann, B; Heinrich, J; Henderson, C; Herndon, M; Heuser, J; Hewamanage, S; Hidas, D; Hillc, C S; Hirschbuehl, D; Höcker, A; Hou, S; Houlden, M; Hsu, S C; Huffman, B T; Hughes, R E; Husemann, U; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ivanov, A; Iyutin, B; James, E; Jayatilaka, B; Jeans, D; Jeon, E J; Jindariani, S; Johnson, W; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Kar, D; Karchin, P E; Kato, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Klute, M; Knuteson, B; Ko, B R; Koay, S A; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kraus, J; Kreps, M; Kroll, J; Krumnack, N; Kruse, M; Krutelyov, V; Kubo, T; Kuhlmann, S E; Kuhr, T; Kulkarni, N P; Kusakabe, Y; Kwang, S; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; Le Compte, T; Lee, J; Lee, J; Lee, Y J; Leeq, S W; Lefèvre, R; Leonardo, N; Leone, S; Levy, S; Lewis, J D; Lin, C; Lin, C S; Linacre, J; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Lovas, L; Lu, R S; Lucchesi, D; Lueck, J; Luci, C; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Lytken, E; Mack, P; MacQueen, D; Madrak, R; Maeshima, K; Makhoul, K; Mäki, T; Maksimovic, P; Malde, S; Malik, S; Manca, G; Manousakisa, A; Margaroli, F; Marino, C; Marino, C P; Martin, A; Martin, M; Martinj, V; Martínez, M; Martinez-Ballarin, R; Maruyama, T; Mastrandrea, P; Masubuchi, T; Mattson, M E; Mazzanti, P; McFarland, K S; McIntyre, P; McNultyi, R; Mehta, A; Mehtälä, P; Menzemerk, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Miao, T; Miladinovic, N; Miles, J; Miller, R; Mills, C; Milnik, M; Mitra, A; Mitselmakher, G; Miyake, H; Moed, S; Moggi, N; Moon, C S; Moore, R; Morello, M; Movilla-Fernández, P A; Mulmenstdt, J; Mukherjee, A; Müller, T; Mumford, R; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Nagano, A; Naganoma, J; Nakamura, K; Nakano, I; Napier, A; Necula, V; Neu, C; Neubauer, M S; Nielsenf, J; Nodulman, L; Norman, M

    2008-01-01

    We present the first measurement of two-particle momentum correlations in jets produced in $p\\bar p$ collisions at $\\sqrt{s}=1.96$ TeV. Results are obtained for charged particles within a restricted cone with an opening angle of 0.5 radians around the jet axis and for events with dijet masses between 66 and 563 GeV/c$^{2}$. A comparison of the experimental data to theoretical predictions obtained for partons within the framework of resummed perturbative QCD in the next-to-leading log approximation (NLLA) shows that the parton momentum correlations survive the hadronization stage of jet fragmentation, giving further support to the hypothesis of local parton-hadron duality. The extracted value of the NLLA parton shower cutoff scale $Q_\\mathit{eff}$ is found to be $(1.4^{+0.9}_{-0.7})\\times 100$ MeV.

  15. Search for New Heavy Particles Decaying to Z^0 Z^0 -> eeee in p-pbar Collisions at $\\sqrt{s}$ = 1.96 TeV

    CERN Document Server

    Aaltonen, A; Akimoto, T; Albrow, M G; Alvarez-Gonzalez, B; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Apresyan, A; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Aurisano, A; Azfar, F; Azzi-Bacchetta, P; Azzurri, P; Bacchetta, N; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Baroiant, S; Bartsch, V; Bauer, G; Beauchemin, P H; Bedeschi, F; Bednar, P; Behari, S; Bellettini, G; Bellinger, J; Belloni, A; Benjamin, D; Beretvas, A; Beringer, J; Berry, T; Bhatti, A; Binkley, M; Bisello, D; Bizjak, I; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bölla, G; Bolshov, A; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Bridgeman, A; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, Yu A; Budd, H S; Budd, S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Byrum, K L; Cabrerar, S; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carlsmith, D; Carosi, R; Carrillol, S; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavalli-Sforza, M; Cerri, A; Cerritop, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, K; Chokheli, D; Chou, J P; Choudalakis, G; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Compostella, G; Convery, M E; Conway, J; Cooper, B; Copic, K; Cordelli, M; Cortiana, G; Crescioli, F; Cuenca Almenarr, C; Cuevaso, J; Culbertson, R; Cully, J C; Dagenhart, D; Datta, M; Davies, T; De Barbaro, P; De Cecco, S; Deisher, A; De Lentdeckerd, G; De Lorenzo, G; Dell'Orso, Mauro; Demortier, L; Deng, J; Deninno, M; De Pedis, D; Derwent, P F; Di Giovanni, G P; Dionisi, C; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Donati, S; Dong, P; Donini, J; Dorigo, T; Dube, S; Efron, J; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, W T; Feild, R G; Feindt, M; Fernández, J P; Ferrazza, C; Field, R; Flanagan, G; Forrest, R; Forrester, S; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; Garberson, F; García, J E; Garfinkel, A F; Genser, K; Gerberich, H; Gerdes, D; Giagu, S; Giakoumopoloua, V; Giannetti, P; Gibson, K; Gimmell, J L; Ginsburg, C M; Giokarisa, N; Giordani, M; Giromini, P; Giunta, M; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Golossanov, A; Gómez, G; Gómez-Ceballos, G; Goncharov, M; Gonzlez, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Grinstein, S; Grosso-Pilcher, C; Group, R C; Grundler, U; Guimaraesda Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Hamilton, A; Han, B Y; Han, J Y; Handler, R; Happacher, F; Hara, K; Hare, D; Hare, M; Harper, S; Harr, R F; Harris, R M; Hartz, M; Hatakeyama, K; Hauser, J; Hays, C; Heck, M; Heijboer, A; Heinemann, B; Heinrich, J; Henderson, C; Herndon, M; Heuser, J; Hewamanage, S; Hidas, D; Hillc, C S; Hirschbuehl, D; Höcker, A; Hou, S; Houlden, M; Hsu, S C; Huffman, B T; Hughes, R E; Husemann, U; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ivanov, A; Iyutin, B; James, E; Jayatilaka, B; Jeans, D; Jeon, E J; Jindariani, S; Johnson, W; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Kar, D; Karchin, P E; Kato, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Klute, M; Knuteson, B; Ko, B R; Koay, S A; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kraus, J; Kreps, M; Kroll, J; Krumnack, N; Kruse, M; Krutelyov, V; Kubo, T; Kuhlmann, S E; Kuhr, T; Kulkarni, N P; Kusakabe, Y; Kwang, S; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; Le Compte, T; Lee, J; Lee, J; Lee, Y J; Leeq, S W; Lefèvre, R; Leonardo, N; Leone, S; Levy, e S; Lewis, J D; Lin, C; Lin, C S; Linacre, J; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Lovas, L; Lu, R S; Lucchesi, D; Lueck, J; Luci, C; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Lytken, E; Mack, P; MacQueen, D; Madrak, R; Maeshima, K; Makhoul, K; Mäki, T; Maksimovic, P; Malde, S; Malik, S; Manca, G; Manousakisa, A; Margaroli, F; Marino, C; Marino, C P; Martin, A; Martin, M; Martinj, V; Martínez, M; Martinez-Ballarin, R; Maruyama, T; Mastrandrea, P; Masubuchi, T; Mattson, M E; Mazzanti, P; McFarland, K S; McIntyre, P; McNultyi, R; Mehta, A; Mehtälä, P; Menzemerk, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Miao, T; Miladinovic, N; Miles, J; Miller, R; Mills, C; Milnik, M; Mitra, A; Mitselmakher, G; Miyake, H; Moed, S; Moggi, N; Moon, C S; Moore, R; Morello, M; Movilla-Fernández, P A; Mulmenstdt, J; Mukherjee, A; Müller, T; Mumford, R; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Nagano, A; Naganoma, J; Nakamura, K; Nakano, I; Napier, A; Necula, V; Neu, C; Neubauer, M S; Nielsenf, J; Nodulman, L; Norman, M

    2008-01-01

    We report the results of a search for the anomalous production of a massive particle decaying to four electrons via two Z^0 bosons in 1.1 fb^{-1} of p-pbar collisions at $\\sqrt{s}$=1.96 TeV collected by the CDF II detector at Fermilab. We employ optimized electron identification criteria to maximize acceptance and efficiency. We estimate the backgrounds in the invariant mass range 500 - 1000 GeV/c^2 to be 0.028 +/- 0.009 (stat) +/- 0.011 (syst) events. We observe zero events in this search region. Assuming a Randall-Sundrum graviton production model, we set 95% CL limits on \\sigma times BF(G -> Z^0 Z^0) < 4 - 6 pb, depending on the graviton mass.

  16. Search for chargino-neutralino production in p-pbar collisions at 1.96 TeV with high pT leptons

    CERN Document Server

    Aaltonen, T; Akimoto, T; Albrow, M G; Alvarez-Gonzalez, B; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Apresyan, A; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Aurisano, A; Azfar, F; Azzi-Bacchetta, P; Azzurri, P; Bacchetta, N; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Baroiant, S; Bartsch, V; Bauer, G; Beauchemin, P H; Bedeschi, F; Bednar, P; Behari, S; Bellettini, G; Bellinger, J; Belloni, A; Benjamin, D; Beretvas, A; Beringer, J; Berry, T; Bhatti, A; Binkley, M; Bisello, D; Bizjak, I; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bölla, G; Bolshov, A; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Bridgeman, A; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, Yu A; Budd, H S; Budd, S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Byrum, K L; Cabrerar, S; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carlsmith, D; Carosi, R; Carrillol, S; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavalli-Sforza, M; Cerri, A; Cerritop, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, K; Chokheli, D; Chou, J P; Choudalakis, G; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Compostella, G; Convery, M E; Conway, J; Cooper, B; Copic, K; Cordelli, M; Cortiana, G; Crescioli, F; Cuenca Almenarr, C; Cuevaso, J; Culbertson, R; Cully, J C; Dagenhart, D; Datta, M; Davies, T; De Barbaro, P; De Cecco, S; Deisher, A; De Lentdeckerd, G; De Lorenzo, G; Dell'Orso, Mauro; Demortier, L; Deng, J; Deninno, M; De Pedis, D; Derwent, P F; Di Giovanni, G P; Dionisi, C; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Donati, S; Dong, P; Donini, J; Dorigo, T; Dube, S; Efron, J; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, W T; Feild, R G; Feindt, M; Fernández, J P; Ferrazza, C; Field, R; Flanagan, G; Forrest, R; Forrester, S; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; Garberson, F; García, J E; Garfinkel, A F; Genser, K; Gerberich, H; Gerdes, D; Giagu, S; Giakoumopoloua, V; Giannetti, P; Gibson, K; Gimmell, J L; Ginsburg, C M; Giokarisa, N; Giordani, M; Giromini, P; Giunta, M; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Golossanov, A; Gómez, G; Gómez-Ceballos, G; Goncharov, M; Gonzlez, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Grinstein, S; Grosso-Pilcher, C; Group, R C; Grundler, U; Guimaraesda Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Hamilton, A; Han, B Y; Han, J Y; Handler, R; Happacher, F; Hara, K; Hare, D; Hare, M; Harper, S; Harr, R F; Harris, R M; Hartz, M; Hatakeyama, K; Hauser, J; Hays, C; Heck, M; Heijboer, A; Heinemann, B; Heinrich, J; Henderson, C; Herndon, M; Heuser, J; Hewamanage, S; Hidas, D; Hillc, C S; Hirschbuehl, D; Höcker, A; Hou, S; Houlden, M; Hsu, S C; Huffman, B T; Hughes, R E; Husemann, U; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ivanov, A; Iyutin, B; James, E; Jayatilaka, B; Jeans, D; Jeon, E J; Jindariani, S; Johnson, W; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Kar, D; Karchin, P E; Kato, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Klute, M; Knuteson, B; Ko, B R; Koay, S A; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kraus, J; Kreps, M; Kroll, J; Krumnack, N; Kruse, M; Krutelyov, V; Kubo, T; Kuhlmann, S E; Kuhr, T; Kulkarni, N P; Kusakabe, Y; Kwang, S; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; Le Compte, T; Lee, J; Lee, J; Lee, Y J; Leeq, S W; Lefèvre, R; Leonardo, N; Leone, S; Levy, S; Lewis, J D; Lin, C; Lin, C S; Linacre, J; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Lovas, L; Lu, R S; Lucchesi, D; Lueck, J; Luci, C; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Lytken, E; Mack, P; MacQueen, D; Madrak, R; Maeshima, K; Makhoul, K; Mäki, T; Maksimovic, P; Malde, S; Malik, S; Manca, G; Manousakisa, A; Margaroli, F; Marino, C; Marino, C P; Martin, A; Martin, M; Martinj, V; Martínez, M; Martinez-Ballarin, R; Maruyama, T; Mastrandrea, P; Masubuchi, T; Mattson, M E; Mazzanti, P; McFarland, K S; McIntyre, P; McNultyi, R; Mehta, A; Mehtälä, P; Menzemerk, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Miao, T; Miladinovic, N; Miles, J; Miller, R; Mills, C; Milnik, M; Mitra, A; Mitselmakher, G; Miyake, H; Moed, S; Moggi, N; Moon, C S; Moore, R; Morello, M; Movilla-Fernández, P A; Mülmenstädt, J; Mukherjee, A; Müller, T; Mumford, R; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Nagano, A; Naganoma, J; Nakamura, K; Nakano, I; Napier, A; Necula, V; Neu, C; Neubauer, M S; Nielsenf, J; Nodulman, L; Norman, M

    2007-01-01

    We present a search for the associated production of charginos and neutralinos in p-pbar collisions at 1.96 TeV. The data were collected at the Collider Detector at Fermilab (CDF II) and correspond to integrated luminosities between 0.7 and 1.0 fb-1. We look for final states with one high pT electron or muon, and two additional leptons. Our results are consistent with the standard model expectations, and we set limits on the cross section as a function of the chargino mass in three different supersymmetric scenarios. For a specific MSSM scenario with no slepton mixing we set a 95 % C.L. limit at 151 GeV/c^2.

  17. Measurement of the cross section for W-boson production in association with jets in ppbar collisions at $\\sqrt{s}$=1.96$ TeV

    CERN Document Server

    Aaltonen, T; Akimoto, T; Albrow, M G; Alvarez-Gonzalez, B; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Apresyan, A; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Aurisano, A; Azfar, F; Azzi-Bacchetta, P; Azzurri, P; Bacchetta, N; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Baroiant, S; Bartsch, V; Bauer, G; Beauchemin, P H; Bedeschi, F; Bednar, P; Behari, S; Bellettini, G; Bellinger, J; Belloni, A; Benjamin, D; Beretvas, A; Beringer, J; Berry, T; Bhatti, A; Binkley, M; Bisello, D; Bizjak, I; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bölla, G; Bolshov, A; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Bridgeman, A; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, Yu A; Budd, H S; Budd, S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Byrum, K L; Cabrerar, S; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carlsmith, D; Carosi, R; Carrillol, S; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavalli-Sforza, M; Cerri, A; Cerritop, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, K; Chokheli, D; Chou, J P; Choudalakis, G; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Compostella, G; Convery, M E; Conway, J; Cooper, B; Copic, K; Cordelli, M; Cortiana, G; Crescioli, F; Cuenca Almenarr, C; Cuevaso, J; Culbertson, R; Cully, J C; Dagenhart, D; Datta, M; Davies, T; De Barbaro, P; De Cecco, S; Deisher, A; De Lentdeckerd, G; De Lorenzo, G; Dell'Orso, Mauro; Demortier, L; Deng, J; Deninno, M; De Pedis, D; Derwent, P F; Di Giovanni, G P; Dionisi, C; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Donati, S; Dong, P; Donini, J; Dorigo, T; Dube, S; Efron, J; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, W T; Feild, R G; Feindt, M; Fernández, J P; Ferrazza, C; Field, R; Flanagan, G; Forrest, R; Forrester, S; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; Garberson, F; García, J E; Garfinkel, A F; Gerberich, H; Gerdes, D; Giagu, S; Giakoumopoloua, V; Giannetti, P; Gibson, K; Gimmell, J L; Ginsburg, C M; Giokarisa, N; Giordani, M; Giromini, P; Giunta, M; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Golossanov, A; Gómez, G; Gómez-Ceballos, G; Goncharov, M; Gonzlez, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Grinstein, S; Grosso-Pilcher, C; Group, R C; Grundler, U; Guimaraesda Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Hamilton, A; Han, B Y; Han, J Y; Handler, R; Happacher, F; Hara, K; Hare, D; Hare, M; Harper, S; Harr, R F; Harris, R M; Hartz, M; Hatakeyama, K; Hauser, J; Hays, C; Heck, M; Heijboer, A; Heinemann, B; Heinrich, J; Henderson, C; Herndon, M; Heuser, J; Hewamanage, S; Hidas, D; Hillc, C S; Hirschbuehl, D; Höcker, A; Hou, S; Houlden, M; Hsu, S C; Huffman, B T; Hughes, R E; Husemann, U; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ivanov, A; Iyutin, B; James, E; Jayatilaka, B; Jeans, D; Jeon, E J; Jindariani, S; Johnson, W; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Kar, D; Karchin, P E; Kato, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Klute, M; Knuteson, B; Ko, B R; Koay, S A; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kraus, J; Kreps, M; Kroll, J; Krumnack, N; Kruse, M; Krutelyov, V; Kubo, T; Kuhlmann, S E; Kuhr, T; Kulkarni, N P; Kusakabe, Y; Kwang, S; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; Le Compte, T; Lee, J; Lee, J; Lee, Y J; Leeq, S W; Lefèvre, R; Leonardo, N; Leone, S; Levy, S; Lewis, J D; Lin, C; Lin, C S; Linacre, J; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Lovas, L; Lu, R S; Lucchesi, D; Lueck, J; Luci, C; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Lytken, E; Mack, P; MacQueen, D; Madrak, R; Maeshima, K; Makhoul, K; Mäki, T; Maksimovic, P; Malde, S; Malik, S; Manca, G; Manousakisa, A; Margaroli, F; Marino, C; Marino, C P; Martin, A; Martin, M; Martinj, V; Martínez, M; Martinez-Ballarin, R; Maruyama, T; Mastrandrea, P; Masubuchi, T; Mattson, M E; Mazzanti, P; McFarland, K S; McIntyre, P; McNultyi, R; Mehta, A; Mehtälä, P; Menzemerk, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Miao, T; Miladinovic, N; Miles, J; Miller, R; Mills, C; Milnik, M; Mitra, A; Mitselmakher, G; Miyake, H; Moed, S; Moggi, N; Moon, C S; Moore, R; Morello, M; Movilla-Fernández, P A; Mülmenstädt, J; Mukherjee, A; Müller, T; Mumford, R; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Nagano, A; Naganoma, J; Nakamura, K; Nakano, I; Napier, A; Necula, V; Neu, C; Neubauer, M S; Nielsenf, J; Nodulman, L; Norman, M

    2007-01-01

    We present a measurement of the cross section for W-boson production in association with jets in pbarp collisions at $\\sqrt{s}$=1.96$ TeV. The analysis uses a data sample corresponding to an integrated luminosity of 320 pb^-1 collected with the CDF II detector. W bosons are identified in their electron decay channel and jets are reconstructed using a cone algorithm. For each W+>= n-jet sample ($n= 1 - 4$) we measure sigma(ppbar =>W+>=n$-jet)x BR(W => e nu) with respect to the transverse energy E_T of the n^th-highest E_T jet above 20 GeV, for a restricted W => e nu decay phase space. The cross sections, corrected for all detector effects, can be directly compared to particle level W+ jet(s) predictions. We present here comparisons to leading order and next-to-leading order predictions.

  18. Measurement of Prompt Charm Meson Production Cross Sections in p anti-p Collisions at s**(1/2) = 1.96 TeV

    CERN Document Server

    Acosta, D; Ahn, M H; Akimoto, T; Albrow, M G; Ambrose, D; Amidei, D; Anastassov, A; Anikeev, K; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Arguin, J F; Arisawa, T; Artikov, A; Asakawa, T; Ashmanskas, W; Attal, A; Azfar, F; Azzi-Bacchetta, P; Bacchetta, N; Bachacou, H; Badgett, W F; Bailey, S; Barbaro-Galtieri, A; Barker, G; Barnes, V E; Barnett, B A; Baroiant, S; Barone, M; Bauer, G; Bedeschi, F; Behari, S; Belforte, S; Bell, W H; Bellettini, Giorgio; Bellinger, J; Benjamin, D; Beretvas, A; Bhatti, A A; Binkley, M; Bisello, D; Bishai, M; Blair, R E; Blocker, C; Bloom, K; Blumenfeld, B; Bocci, A; Bodek, A; Bölla, G; Bolshov, A; Booth, P S L; Bortoletto, Daniela; Boudreau, J; Bourov, S; Bromberg, C; Brozovic, M; Brubaker, E; Budagov, Yu A; Budd, H S; Burkett, K; Busetto, G; Bussey, P; Byrum, K L; Cabrera, S; Calafiura, P; Campanelli, M; Campbell, M; Canepa, A; Carlsmith, D; Carosi, R; Carron, S; Casarsa, M; Caskey, W; Castro, A; Catastini, P; Cauz, D; Cerri, A; Cerri, C; Cerrito, L; Chapman, J; Chen, Y C; Chen, C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, K; Chokheli, D; Chu, M L; Chung, J Y; Chung, Y S; Chung, W H; Ciobanu, C I; Ciocci, M A; Clark, A G; Coca, M N; Connolly, A; Convery, E; Conway, J; Cordelli, M; Cortiana, G; Cranshaw, J; Culbertson, R; Currat, C; Cyr, D; D'Auria, S; D'Onofrio, M; Da Ronco, S; Dagenhart, D; De Cecco, S; De Pedis, D; Dell'Agnello, S; Dell'Orso, Mauro; Demers, S; Demortier, L; Deninno, M; Denis, St; Derwent, P F; Dionisi, C; Dittmann, J R; Doksus, P; Dominguez, A; Donati, S; Dorigo, T; Drollinger, V; Ebina, K; Eddy, N; Ely, R; Erbacher, R D; Erdmann, M; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, I; Feild, R G; Feindt, M; Fernández, J P; Ferretti, C; Field, R D; Fiori, I; Flanagan, G; Flaugher, B; Flores-Castillo, L R; Foland, A D; Forrester, S; Foster, G W; Franklin, M; Frisch, H; Fujii, Y; Furic, I; Gallas, A; Gallinaro, M; Galyardt, J; García-Sciveres, M; Garfinkel, F; Gay, C; Gerberich, H; Gerchtein, E; Gerdes, D W; Giagu, S; Giannetti, P; Gibson, K; Gibson, A; Ginsburg, C; Giolo, K; Giordani, M; Giurgiu, G; Glagolev, V; Glenzinski, D A; Gold, M; Goldschmidt, N; Goldstein, J; Goldstein, D B; Gómez, G; Gómez-Ceballos, G; Goncharov, M; Gorelov, I; Goshaw, A T; Gotra, Yu; Goulianos, K; Gresele, A; Grim, G; Grosso-Pilcher, C; Günther, M; Guimaraesda Costa, J; Haber, C; Hahn, S R; Hahn, K; Halkiadakis, E; Hall, C; Handler, R; Happacher, F; Hara, K; Hare, M; Harr, R F; Harris, M; Hartmann, F; Hatakeyama, K; Hauser, J; Hays, C; Heider, E; Heinemann, B; Heinrich, J; Hennecke, M; Herndon, M; Hill, C; Hirschbuehl, D; Höcker, A; Hoffman, K D; Holloway, A; Hou, S; Houlden, M A; Huffman, B T; Hughes, R E; Huston, J; Ikado, K; Incandela, J R; Introzzi, G; Iori, M; Ishizawa, Y; Issever, C; Ivanov, A; Iwata, Y; Iyutin, B; James, E; Jang, D; Jarrell, J; Jeans, D; Jensen, H; Jones, M; Jun, S Y; Junk, T R; Kamon, T; Kang, J; Karagoz-Unel, M; Karchin, E; Kartal, S; Kato, Y; Kemp, Y; Kephart, R D; Kerzel, U; Khazins, D; Khotilovich, V; Kilminster, B; Kim, M J; Kim, B J; Kim, D H; Kim, J E; Kim, M S; Kim, S B; Kim, K; Kim, T H; Kim, H S; Kim, S H; King, T; Kirby, M; Kirk, M; Kirsch, L; Klimenko, S; Knuteson, B; Kobayashi, H; Koehn, P; Kondo, K; Konigsberg, J; Kordas, K; Korn, A J; Korytov, A; Kotelnikov, K A; Kotwal, A V; Kovalev, A; Kraus, J; Kravchenko, I V; Kreymer, A; Kroll, J; Kruse, M; Krutelyov, V; Kuhlmann, S E; Kuznetsova, N; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, J; Lancaster, M; Lander, R; Lannon, K; Lath, A; Latino, G; Lauhakangas, R; Lazzizzera, I; LeCompte, T J; Le, Y; Lecci, C; Lee, J; Lee, S W; Leonardo, N; Leone, S; Lewis, J D; Li, K; Lin, C S; Lindgren, M; Liss, T M; Litvintsev, D O; Liu, T; Liu, Y; Lockyer, N S; Loginov, A; Loken, J; Loreti, M; Loverre, P F; Lucchesi, D; Lukens, P; Lyons, L; Lys, J; MacQueen, D; Madrak, R; Maeshima, K; Maksimovic, P; Malferrari, L; Manca, G; Marginean, R; Martin, V; Martin, M; Martin, A; Martínez, M; Maruyama, T; Matsunaga, H; Mattson, M E; Mazzanti, P; McFarland, K S; McGivern, D; McIntyre, P M; McNamara, P; McNulty, R; Menzemer, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Meyer, A; Miao, T; Miller, L; Miller, R; Miller, J S; Miquel, R; Miscetti, S; Mishina, M; Mitselmakher, G; Miyamoto, A; Miyazaki, Y; Moggi, N; Moore, R; Morello, M; Moulik, T; Mukherjee, A; Mulhearn, M; Müller, T; Mumford, R; Munar, A; Murat, P; Murgia, S; Nachtman, J; Nahn, S; Nakamura, I; Nakano, I; Napier, A; Napora, R; Necula, V; Nelson, C; Nelson, T; Neu, C; Neubauer, M S; Newman-Holmes, C; Nicollerat, A S; Niell, F; Nielsen, J; Nigmanov, T; Niu, H; Nodulman, L; Österberg, K; Ogawa, T; Oh, Y D; Oh, S; Ohsugi, T; Oishi, R; Okusawa, T; Oldeman, R G C; Orava, Risto; Orejudos, W; Pagliarone, C; Palmonari, F; Paoletti, R; Papadimitriou, V; Partos, D; Pashapour, S; Patrick, J; Pauletta, G; Paulini, M; Pauly, T; Paus, C; Pellett, D; Penzo, Aldo L; Phillips, T J; Piacentino, G; Piedra, J; Pitts, K T; Pompos, A; Pondrom, L; Pope, G; Poukhov, O; Prakoshyn, F; Pratt, T; Pronko, A G; Proudfoot, J; Ptohos, F; Punzi, G; Rademacker, J; Rakitine, A; Rappoccio, S; Ratnikov, F; Ray, H; Reichold, A; Rekovic, V; Renton, P B; Rescigno, M; Rimondi, F; Rinnert, K; Ristori, L; Riveline, M; Robertson, W J; Robson, A; Rodrigo, T; Rolli, S; Rosenson, L; Roser, R; Rossin, R; Rott, C; Ruiz, A; Russ, J; Ryan, D; Saarikko, H; Safonov, A; Sakumoto, W K; Saltzberg, D; Sánchez, C; Sansoni, A; Santi, L; Sarkar, S; Sato, K; Savard, P; Savoy-Navarro, A; Schemitz, P; Schlabach, P; Schmidt, E E; Schmidt, M P; Schmitt, M; Schofield, G L; Scodellaro, L; Scribano, A; Scuri, F; Sedov, A; Seidel, S; Seiya, Y; Semeria, F; Sexton-Kennedy, L; Sfiligoi, I; Shapiro, M D; Shears, T G; Shepard, P F; Shimojima, M; Shochet, M J; Shon, Y; Sidoti, A; Siket, M; Sill, A; Sinervo, P; Sissakian, A N; Skiba, A; Slaughter, A J; Sliwa, K; Smith, R; Snider, F D; Snihur, R; Somalwar, S V; Spalding, J; Spezziga, M; Spiegel, L; Spinella, F; Spiropulu, M; Stadie, H; Stelzer, B; Stelzer-Chilton, O; Strologas, J; Stuart, D; Sukhanov, A; Sumorok, K; Sun, H; Suzuki, T; Taffard, A C; Takach, S F; Takano, H; Takashima, R; Takeuchi, Y; Takikawa, K; Tamburello, P; Tanaka, M; Tanaka, R; Tanimoto, N; Tannenbaum, B; Tapprogge, Stefan; Tecchio, M; Teng, P K; Terashi, K; Tesarek, R J; Tether, S; Thom, J; Thompson, A S; Thomson, E; Thurman-Keup, R M; Tipton, P; Tiwari, V K; Tkaczyk, S M; Toback, D; Tollefson, K; Tonelli, D; Tonnesmann, M; Torre, S; Torretta, D; Trischuk, W; Tseng, J; Tsuchiya, R; Tsuno, S; Tsybychev, D; Turini, N; Turner, M; Ukegawa, F; Unverhau, T; Uozumi, S; Usynin, D; Vacavant, L; Vaiciulis, T; Varganov, A V; Vataga, E; Vejcik, S; Velev, G V; Veramendi, G; Vickey, T; Vidal, R; Vila, I; Vilar, R; Volobuev, I P; Wagner, R G; Wagner, R L; Wagner, W; Wallace, N; Walter, T; Wan, Z; Wang, M J; Wang, S M; Ward, B; Waschke, S; Waters, D; Watts, T; Weber, M; Wester, W; De Barbaro, P; Von der Mey, M

    2003-01-01

    We report on measurements of differential cross sections d sigma/d p_t for prompt charm meson production in p anti-p collisions at s**(1/2) = 1.96 TeV using 5.8 +/- 0.3 pb-1 of data from the CDF II detector at the Fermilab Tevatron. The data are collected with a new trigger that is sensitive to the long lifetime of hadrons containing heavy flavor. The charm meson cross sections are measured in the central rapidity region |y| \\leq 1 in four fully reconstructed decay modes: D0 --> K- pi+, D*+ -> D0 pi+, D+ --> K- pi+ pi+, D+_s--> phi pi+, and their charge conjugates. The measured cross sections are compared to theoretical calculations.

  19. Search for neutral Higgs bosons decaying to tau pairs in p anti-p collisions at s**(1/2) = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abazov, V.M.; Abbott, B.; Abolins, M.; Acharya, B.S.; Adams, M.; Adams, T.; Agelou, M.; Agram, J.-L.; Ahn, S.H.; Ahsan, M.; Alexeev, G.D.; /Buenos Aires U. /Rio de

    2006-05-01

    A search for the production of neutral Higgs bosons {Phi} decaying into {tau}{sup +}{tau}{sup -} final states in p{bar p} collisions at a center-of-mass energy of 1.96 TeV is presented. The data, corresponding to an integrated luminosity of approximately 325 pb{sup -1}, were collected by the D0 experiment at the Fermilab Tevatron Collider. Since no excess compared to the expectation from standard model processes is found, limits on the production cross section times branching ratio are set. The results are combined with those obtained from the D0 search for {Phi}b({bar b}) {yields} b{bar b}b({bar b}) and are interpreted in the minimal supersymmetric standard model.

  20. Search for particles decaying into a Z boson and a photon in p anti-p collisions at s**(1/2) = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abazov, V.M.; Abbott, B.; Abolins, M.; Acharya, B.S.; Adams, M.; Adams, T.; Agelou, M.; Agram, J.-L.; Ahn, S.H.; Ahsan, M.; Alexeev, G.D.; /Buenos Aires U. /Rio de

    2006-05-01

    The authors present the results of the first search for a new particle X produced in p{bar p} collisions at {radical}s = 1.96 TeV and subsequently decaying to Z{gamma}. The search uses 0.3 fb{sup -1} of data collected with the D0 detector at the Fermilab Tevatron Collider. They set limits on the production cross section times the branching fraction {sigma}(p{bar p} {yields} X) x B(X {yields} Z{gamma}) that range from 0.4-3.5 pb at the 95% C.L. for X with invariant masses between 100 and 1000 GeV/c{sup 2} over a wide range of X decay widths.

  1. Search for chargino-neutralino production in p anti-p collisions at s**(1/2) = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    2007-07-01

    We present the results of a search for associated production of the chargino and neutralino supersymmetric particles using up to 1.1 fb{sup -1} of integrated luminosity collected by the CDF II experiment at the Tevatron p{bar p} collider at a center-of-mass energy of 1.96 TeV. The search is conducted by analyzing events with a large transverse momentum imbalance and either three charged leptons or two charged leptons of the same electric charge. The numbers of observed events are found to be consistent with standard model expectations. Upper limits on the production cross section are derived in different theoretical models. In one of these models a lower limit on the mass of the chargino is set at 129 GeV/c{sup 2} at the 95% confidence level.

  2. Direct Measurement of the W Production Charge Asymmetry in p anti-p Collisions at s**(1/2) = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Aaltonen, T.; /Helsinki Inst. of Phys.; Adelman, J.; /Chicago U., EFI; Akimoto, T.; /Tsukuba U.; Alvarez Gonzalez, B.; /CSIC, Catalunya; Amerio, S.; /INFN, Padua; Amidei, D.; /Michigan U.; Anastassov, A.; /Northwestern U.; Annovi, A.; /Frascati; Antos, J.; /Comenius U.; Apollinari, G.; /Fermilab; Apresyan, A.; /Purdue U. /Waseda U.

    2009-01-01

    We present the first direct measurement of the W production charge asymmetry as a function of the W boson rapidity y{sub W} in p{bar p} collisions at {radical}s = 1.96 TeV. We use a sample of W {yields} e{nu} events in data from 1 fb{sup -1} of integrated luminosity collected using the CDF II detector. In the region |y{sub W}| < 3.0, this measurement is capable of constraining the ratio of up and down quark momentum distributions in the proton more directly than in previous measurements of the asymmetry that are a function of the charged-lepton pseudorapidity.

  3. Mass and lifetime measurements of bottom and charm baryons in $p\\bar p$ collisions at $\\sqrt{s}= 1.96 TeV

    CERN Document Server

    Aaltonen, Timo Antero; Amidei, Dante E; Anastassov, Anton Iankov; Annovi, Alberto; Antos, Jaroslav; Apollinari, Giorgio; Appel, Jeffrey A; Arisawa, Tetsuo; Artikov, Akram Muzafarovich; Asaadi, Jonathan A; Ashmanskas, William Joseph; Auerbach, Benjamin; Aurisano, Adam J; Azfar, Farrukh A; Badgett, William Farris; Bae, Taegil; Barbaro-Galtieri, Angela; Barnes, Virgil E; Barnett, Bruce Arnold; Barria, Patrizia; Bartos, Pavol; Bauce, Matteo; Bedeschi, Franco; Behari, Satyajit; Bellettini, Giorgio; Bellinger, James Nugent; Benjamin, Douglas P; Beretvas, Andrew F; Bhatti, Anwar Ahmad; Bland, Karen Renee; Blumenfeld, Barry J; Bocci, Andrea; Bodek, Arie; Bortoletto, Daniela; Boudreau, Joseph Francis; Boveia, Antonio; Brigliadori, Luca; Bromberg, Carl Michael; Brucken, Erik; Budagov, Ioulian A; Budd, Howard Scott; Burkett, Kevin Alan; Busetto, Giovanni; Bussey, Peter John; Butti, Pierfrancesco; Buzatu, Adrian; Calamba, Aristotle; Camarda, Stefano; Campanelli, Mario; Canelli, Florencia; Carls, Benjamin; Carlsmith, Duncan L; Carosi, Roberto; Carrillo Moreno, Salvador; Casal Larana, Bruno; Casarsa, Massimo; Castro, Andrea; Catastini, Pierluigi; Cauz, Diego; Cavaliere, Viviana; Cavalli-Sforza, Matteo; Cerri, Alessandro; Cerrito, Lucio; Chen, Yen-Chu; Chertok, Maxwell Benjamin; Chiarelli, Giorgio; Chlachidze, Gouram; Cho, Kihyeon; Chokheli, Davit; Clark, Allan Geoffrey; Clarke, Christopher Joseph; Convery, Mary Elizabeth; Conway, John Stephen; Corbo, Matteo; Cordelli, Marco; Cox, Charles Alexander; Cox, David Jeremy; Cremonesi, Matteo; Cruz Alonso, Daniel; Cuevas Maestro, Javier; Culbertson, Raymond Lloyd; D'Ascenzo, Nicola; Datta, Mousumi; de Barbaro, Pawel; Demortier, Luc M; Deninno, Maria Maddalena; D'Errico, Maria; Devoto, Francesco; Di Canto, Angelo; Di Ruzza, Benedetto; Dittmann, Jay Richard; Donati, Simone; D'Onofrio, Monica; Dorigo, Mirco; Driutti, Anna; Ebina, Koji; Edgar, Ryan Christopher; Elagin, Andrey L; Erbacher, Robin D; Errede, Steven Michael; Esham, Benjamin; Farrington, Sinead Marie; Fernández Ramos, Juan Pablo; Field, Richard D; Flanagan, Gene U; Forrest, Robert David; Franklin, Melissa EB; Freeman, John Christian; Frisch, Henry J; Funakoshi, Yujiro; Galloni, Camilla; Garfinkel, Arthur F; Garosi, Paola; Gerberich, Heather Kay; Gerchtein, Elena A; Giagu, Stefano; Giakoumopoulou, Viktoria Athina; Gibson, Karen Ruth; Ginsburg, Camille Marie; Giokaris, Nikos D; Giromini, Paolo; Giurgiu, Gavril A; Glagolev, Vladimir; Glenzinski, Douglas Andrew; Gold, Michael S; Goldin, Daniel; Golossanov, Alexander; Gomez, Gervasio; Gomez-Ceballos, Guillelmo; Goncharov, Maxim T; González López, Oscar; Gorelov, Igor V; Goshaw, Alfred T; Goulianos, Konstantin A; Gramellini, Elena; Grinstein, Sebastian; Grosso-Pilcher, Carla; Group, Robert Craig; Guimaraes da Costa, Joao; Hahn, Stephen R; Han, Ji-Yeon; Happacher, Fabio; Hara, Kazuhiko; Hare, Matthew Frederick; Harr, Robert Francis; Harrington-Taber, Timothy; Hatakeyama, Kenichi; Hays, Christopher Paul; Heinrich, Joel G; Herndon, Matthew Fairbanks; Hocker, James Andrew; Hong, Ziqing; Hopkins, Walter Howard; Hou, Suen Ray; Hughes, Richard Edward; Husemann, Ulrich; Hussein, Mohammad; Huston, Joey Walter; Introzzi, Gianluca; Iori, Maurizio; Ivanov, Andrew Gennadievich; James, Eric B; Jang, Dongwook; Jayatilaka, Bodhitha Anjalike; Jeon, Eun-Ju; Jindariani, Sergo Robert; Jones, Matthew T; Joo, Kyung Kwang; Jun, Soon Yung; Junk, Thomas R; Kambeitz, Manuel; Kamon, Teruki; Karchin, Paul Edmund; Kasmi, Azeddine; Kato, Yukihiro; Ketchum, Wesley Robert; Keung, Justin Kien; Kilminster, Benjamin John; Kim, DongHee; Kim, Hyunsoo; Kim, Jieun; Kim, Min Jeong; Kim, Shin-Hong; Kim, Soo Bong; Kim, Young-Jin; Kim, Young-Kee; Kimura, Naoki; Kirby, Michael H; Knoepfel, Kyle James; Kondo, Kunitaka; Kong, Dae Jung; Konigsberg, Jacobo; Kotwal, Ashutosh Vijay; Kreps, Michal; Kroll, IJoseph; Kruse, Mark Charles; Kuhr, Thomas; Kurata, Masakazu; Laasanen, Alvin Toivo; Lammel, Stephan; Lancaster, Mark; Lannon, Kevin Patrick; Latino, Giuseppe; Lee, Hyun Su; Lee, Jaison; Leo, Sabato; Leone, Sandra; Lewis, Jonathan D; Limosani, Antonio; Lipeles, Elliot David; Lister, Alison; Liu, Hao; Liu, Qiuguang; Liu, Tiehui Ted; Lockwitz, Sarah E; Loginov, Andrey Borisovich; Lucchesi, Donatella; Lucà, Alessandra; Lueck, Jan; Lujan, Paul Joseph; Lukens, Patrick Thomas; Lungu, Gheorghe; Lys, Jeremy E; Lysak, Roman; Madrak, Robyn Leigh; Maestro, Paolo; Malik, Sarah Alam; Manca, Giulia; Manousakis-Katsikakis, Arkadios; Marchese, Luigi Marchese; Margaroli, Fabrizio; Marino, Christopher Phillip; Martínez-Perez, Mario; Matera, Keith; Mattson, Mark Edward; Mazzacane, Anna; Mazzanti, Paolo; McNulty, Ronan; Mehta, Andrew; Mehtala, Petteri; Mesropian, Christina; Miao, Ting; Mietlicki, David John; Mitra, Ankush; Miyake, Hideki; Moed, Shulamit; Moggi, Niccolo; Moon, Chang-Seong; Moore, Ronald Scott; Morello, Michael Joseph; Mukherjee, Aseet; Muller, Thomas; Murat, Pavel A; Mussini, Manuel; Nachtman, Jane Marie; Nagai, Yoshikazu; Naganoma, Junji; Nakano, Itsuo; Napier, Austin; Nett, Jason Michael; Neu, Christopher Carl; Nigmanov, Turgun S; Nodulman, Lawrence J; Noh, Seoyoung; Norniella Francisco, Olga; Oakes, Louise Beth; Oh, Seog Hwan; Oh, Young-do; Oksuzian, Iuri Artur; Okusawa, Toru; Orava, Risto Olavi; Ortolan, Lorenzo; Pagliarone, Carmine Elvezio; Palencia, Jose Enrique; Palni, Prabhakar; Papadimitriou, Vaia; Parker, William Chesluk; Pauletta, Giovanni; Paulini, Manfred; Paus, Christoph Maria Ernst; Phillips, Thomas J; Piacentino, Giovanni M; Pianori, Elisabetta; Pilot, Justin Robert; Pitts, Kevin T; Plager, Charles; Pondrom, Lee G; Poprocki, Stephen; Potamianos, Karolos Jozef; Pranko, Aliaksandr Pavlovich; Prokoshin, Fedor; Ptohos, Fotios K; Punzi, Giovanni; Ranjan, Niharika; Redondo Fernández, Ignacio; Renton, Peter B; Rescigno, Marco; Rimondi, Franco; Ristori, Luciano; Robson, Aidan; Rodriguez, Tatiana Isabel; Rolli, Simona; Ronzani, Manfredi; Roser, Robert Martin; Rosner, Jonathan L; Ruffini, Fabrizio; Ruiz Jimeno, Alberto; Russ, James S; Rusu, Vadim Liviu; Sakumoto, Willis Kazuo; Sakurai, Yuki; Santi, Lorenzo; Sato, Koji; Saveliev, Valeri; Savoy-Navarro, Aurore; Schlabach, Philip; Schmidt, Eugene E; Schwarz, Thomas A; Scodellaro, Luca; Scuri, Fabrizio; Seidel, Sally C; Seiya, Yoshihiro; Semenov, Alexei; Sforza, Federico; Shalhout, Shalhout Zaki; Shears, Tara G; Shepard, Paul F; Shimojima, Makoto; Shochet, Melvyn J; Shreyber-Tecker, Irina; Simonenko, Alexander V; Sliwa, Krzysztof Jan; Smith, John Rodgers; Snider, Frederick Douglas; Song, Hao; Sorin, Maria Veronica; St Denis, Richard Dante; Stancari, Michelle Dawn; Stentz, Dale James; Strologas, John; Sudo, Yuji; Sukhanov, Alexander I; Suslov, Igor M; Takemasa, Ken-ichi; Takeuchi, Yuji; Tang, Jian; Tecchio, Monica; Teng, Ping-Kun; Thom, Julia; Thomson, Evelyn Jean; Thukral, Vaikunth; Toback, David A; Tokar, Stanislav; Tollefson, Kirsten Anne; Tomura, Tomonobu; Tonelli, Diego; Torre, Stefano; Torretta, Donatella; Totaro, Pierluigi; Trovato, Marco; Ukegawa, Fumihiko; Uozumi, Satoru; Velev, Gueorgui; Vellidis, Konstantinos; Vernieri, Caterina; Vidal Marono, Miguel; Vilar Cortabitarte, Rocio; Vizán Garcia, Jesus Manuel; Vogel, Marcelo; Volpi, Guido; Vázquez-Valencia, Elsa Fabiola; Wagner, Peter; Wallny, Rainer S; Wang, Song-Ming; Waters, David S; Wester, William Carl; Whiteson, Daniel O; Wicklund, Arthur Barry; Wilbur, Scott; Williams, Hugh H; Wilson, Jonathan Samuel; Wilson, Peter James; Winer, Brian L; Wittich, Peter; Wolbers, Stephen A; Wolfe, Homer; Wright, Thomas Roland; Wu, Xin; Wu, Zhenbin; Yamamoto, Kazuhiro; Yamato, Daisuke; Yang, Tingjun; Yang, Un-Ki; Yang, Yu Chul; Yao, Wei-Ming; Yeh, Gong Ping; Yi, Kai; Yoh, John; Yorita, Kohei; Yoshida, Takuo; Yu, Geum Bong; Yu, Intae; Zanetti, Anna Maria; Zeng, Yu; Zhou, Chen; Zucchelli, Stefano

    2014-01-01

    We report on mass and lifetime measurements of several ground state charmed and bottom baryons, using a data sample corresponding to 9.6 $\\textrm{fb}^{-1}$ from $p\\bar p$ collisions at $\\sqrt{s}=1.96$ TeV, and recorded with the Collider Detector at Fermilab. Baryon candidates are reconstructed from data collected with an online event selection designed for the collection of long-lifetime heavy-flavor decay products and a second event selection designed to collect $J/\\psi \\rightarrow \\mu^+ \\, \\mu^-$ candidates. First evidence for the process $\\Omega_b^- \\rightarrow \\Omega_c^0 \\, \\pi^-$ is presented with a significance of $3.3\\sigma$. We measure the following baryon masses: \\begin{eqnarray} M(\\Xi_c^{0}) = 2470.85\\pm0.24(stat)\\pm0.55(syst) \\, MeV/c^2, \

  4. Search for Second-Generation Scalar Leptoquarks in $\\bm{p \\bar{p}}$ Collisions at $\\sqrt{s}$=1.96 TeV

    CERN Document Server

    Abulencia, A; Adelman, J; Affolder, T; Akimoto, T; Albrow, M G; Ambrose, D; Amerio, S; Amidei, D; Anastassov, A; Anikeev, K; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Arguin, J F; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Azfar, F; Azzi-Bacchetta, P; Azzurri, P; Bacchetta, N; Bachacou, H; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Baroiant, S; Bartsch, V; Bauer, G; Bedeschi, F; Behari, S; Belforte, S; Bellettini, G; Bellinger, J; Belloni, A; Ben-Haim, E; Benjamin, D; Beretvas, A; Beringer, J; Berry, T; Bhatti, A; Binkley, M; Bisello, D; Bishai, M; Blair, R E; Blocker, C; Bloom, K; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bölla, G; Bolshov, A; Bortoletto, D; Boudreau, J; Bourov, S; Boveia, A; Brau, B; Bromberg, C; Brubaker, E; Budagov, Yu A; Budd, H S; Budd, S; Burkett, K; Busetto, G; Bussey, P; Byrum, K L; Cabrera, S; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carlsmith, D; Carosi, R; Carron, S; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chapman, J; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, I; Cho, K; Chokheli, D; Chou, J P; Chu, P H; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Ciljak, M; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Coca, M; Connolly, A; Convery, M E; Conway, J; Cooper, B; Copic, K; Cordelli, M; Cortiana, G; Cruz, A; Cuevas-Maestro, J; Culbertson, R; Cyr, D; Da Ronco, S; D'Auria, S; D'onofrio, M; Dagenhart, D; De Barbaro, P; De Cecco, S; Deisher, A; De Lentdecker, G; Dell'Orso, Mauro; Demers, S; Demortier, L; Deng, J; Deninno, M; De Pedis, D; Derwent, P F; Dionisi, C; Dittmann, J R; Di Turo, P; Dorr, C; Dominguez, A; Donati, S; Donega, M; Dong, P; Donini, J; Dorigo, T; Dube, S; Ebina, K; Efron, J; Ehlers, J; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, I; Fedorko, W T; Feild, R G; Feindt, M; Fernández, J P; Field, R; Flanagan, G; Flores-Castillo, L R; Foland, A; Forrester, S; Foster, G W; Franklin, M; Freeman, J C; Fujii, Y; Furic, I; Gajjar, A; Gallinaro, M; Galyardt, J; García, J E; García-Sciveres, M; Garfinkel, A F; Gay, C; Gerberich, H; Gerchtein, E; Gerdes, D; Giagu, S; Di Giovanni, G P; Giannetti, P; Gibson, A; Gibson, K; Ginsburg, C; Giokaris, N; Giolo, K; Giordani, M; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D A; Gold, M; Goldschmidt, N; Goldstein, J; Gómez, G; Gómez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Gotra, Yu; Goulianos, K; Gresele, A; Griffiths, M; Grinstein, S; Grosso-Pilcher, C; Grundler, U; Guimarães da Costa, J; Haber, C; Hahn, S R; Hahn, K; Halkiadakis, E; Hamilton, A; Han, B Y; Handler, R; Happacher, F; Hara, K; Hare, M; Harper, S; Harr, R F; Harris, R M; Hatakeyama, K; Hauser, J; Hays, C; Hayward, H; Heijboer, A; Heinemann, B; Heinrich, J; Hennecke, M; Herndon, M; Heuser, J; Hidas, D; Hill, C S; Hirschbuehl, D; Höcker, A; Holloway, A; Hou, S; Houlden, M; Hsu, S C; Huffman, B T; Hughes, R E; Huston, J; Ikado, K; Incandela, J R; Introzzi, G; Iori, M; Ishizawa, Y; Ivanov, A; Iyutin, B; James, E; Jang, D; Jayatilaka, B; Jeans, D; Jensen, H; Jeon, E J; Jones, M; Joo, K K; Jun, S Y; Junk, T R; Kamon, T; Kang, J; Karagoz-Unel, M; Karchin, P E; Kato, Y; Kemp, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, M S; Kim, S B; Kim, S H; Kim, Y K; Kirby, M; Kirsch, L; Klimenko, S; Klute, M; Knuteson, B; Ko, B R; Kobayashi, H; Kondo, K; Kong, D J; Konigsberg, J; Kordas, K; Korytov, A; Kotwal, A V; Kovalev, A; Kraus, J; Kravchenko, I; Kreps, M; Kreymer, A; Kroll, J; Krumnack, N; Kruse, M; Krutelyov, V; Kuhlmann, S E; Kusakabe, Y; Kwang, S; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; Lecci, C; LeCompte, T; Lee, J; Lee, S W; Lefèvre, R; Leonardo, N; Leone, S; Levy, S; Lewis, J D; Li, K; Lin, C; Lin, C S; Lindgren, M; Lipeles, E; Liss, T M; Lister, A; Litvintsev, D O; Liu, T; Liu, Y; Lockyer, N S; Loginov, A; Loreti, M; Loverre, P F; Lu, R S; Lucchesi, D; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Lytken, E; Mack, P; MacQueen, D; Madrak, R; Maeshima, K; Maksimovic, P; Manca, G; Margaroli, F; Marginean, R; Marino, C; Martin, A; Martin, M; Martin, V; Martínez, M; Maruyama, T; Matsunaga, H; Mattson, M E; Mazini, R; Mazzanti, P; McFarland, K S; McGivern, D; McIntyre, P; McNamara, P; McNulty, R; Mehta, A; Menzemer, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Von der Mey, M; Miao, T; Miladinovic, N; Miles, J; Miller, R; Miller, J S; Mills, C; Milnik, M; Miquel, R; Miscetti, S; Mitselmakher, G; Miyamoto, A; Moggi, N; Mohr, B; Moore, R; Morello, M; Movilla-Fernández, P A; Mülmenstädt, J; Mukherjee, A; Mulhearn, M; Müller, T; Mumford, R; Murat, P; Nachtman, J; Nahn, S; Nakano, I; Napier, A; Naumov, D; Necula, V; Neu, C; Neubauer, M S; Nielsen, J; Nigmanov, T; Nodulman, L; Norniella, O; Ogawa, T; Oh, S H; Oh, Y D; Okusawa, T; Oldeman, R; Orava, R; Österberg, K; Pagliarone, C; Palencia, E; Paoletti, R; Papadimitriou, V; Papikonomou, A; Paramonov, A A; Parks, B; Pashapour, S; Patrick, J; Pauletta, G; Paulini, M; Paus, C; Pellett, D E; Penzo, Aldo L; Phillips, T J; Piacentino, G; Piedra, J; Pitts, K; Plager, C; Pondrom, L; Pope, G; Portell, X; Poukhov, O; Pounder, N; Prakoshyn, F; Pronko, A; Proudfoot, J; Ptohos, F; Punzi, G; Pursley, J; Rademacker, J; Rahaman, A; Rakitine, A; Rappoccio, S; Ratnikov, F; Reisert, B; Rekovic, V; Van Remortel, N; Renton, P B; Rescigno, M; Richter, S; Rimondi, F; Rinnert, K; Ristori, L; Robertson, W J; Robson, A; Rodrigo, T; Rogers, E; Rolli, S; Roser, R; Rossi, M; Rossin, R; Rott, C; Ruiz, A; Russ, J; Rusu, V; Ryan, D; Saarikko, H; Sabik, S; Safonov, A; Sakumoto, W K; Salamanna, G; Salto, O; Saltzberg, D; Sánchez, C; Santi, L; Sarkar, S; Sato, K; Savard, P; Savoy-Navarro, A; Scheidle, T; Schlabach, P; Schmidt, E E; Schmidt, M P; Schmitt, M; Schwarz, T; Scodellaro, L; Scott, A L; Scribano, A; Scuri, F; Sedov, A; Seidel, S; Seiya, Y; Semenov, A; Semeria, F; Sexton-Kennedy, L; Sfiligoi, I; Shapiro, M D; Shears, T G; Shepard, P F; Sherman, D; Shimojima, M; Shochet, M; Shon, Y; Shreyber, I; Sidoti, A; Sill, A; Sinervo, P; Sisakian, A; Sjölin, J; Skiba, A; Slaughter, A J; Sliwa, K; Smirnov, D; Smith, J R; Snider, F D; Snihur, R; Söderberg, M; Soha, A; Somalwar, S; Sorin, V; Spalding, J; Spinella, F; Squillacioti, P; Stanitzki, M; Staveris-Polykalas, A; Saint-Denis, R; Stelzer, B; Stelzer-Chilton, O; Stentz, D; Strologas, J; Stuart, D; Suh, J S; Sukhanov, A; Sumorok, K; Sun, H; Suzuki, T; Taffard, A; Tafirout, R; Takashima, R; Takeuchi, Y; Takikawa, K; Tanaka, M; Tanaka, R; Tecchio, M; Teng, P K; Terashi, K; Tether, S; Thom, J; Thompson, A S; Thomson, E; Tipton, P; Tiwari, V; Tkaczyk, S; Toback, D; Tokar, S; Tollefson, K; Tomura, T; Tonelli, D; Tonnesmann, M; Torre, S; Torretta, D; Tourneur, S; Trischuk, W; Tsuchiya, R; Tsuno, S; Turini, N; Ukegawa, F; Unverhau, T; Uozumi, S; Usynin, D; Vacavant, L; Vaiciulis, A W; Vallecorsa, S; Varganov, A; Vataga, E; Velev, G; Veramendi, G; Veszpremi, V; Vickey, T; Vidal, R; Vila, I; Vilar, R; Vollrath, I; Volobuev, I P; Würthwein, F; Wagner, P; Wagner, R G; Wagner, R L; Wagner, W; Wallny, R; Walter, T; Wan, Z; Wang, M J; Wang, S M; Warburton, A; Ward, B; Waschke, S; Waters, D; Watts, T; Weber, M; Wester, W C; Whitehouse, B; Whiteson, D; Wicklund, A B; Wicklund, E; Williams, H H; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolfe, C; Worm, S; Wright, T; Wu, X; Wynne, S M; Yagil, A; Yamamoto, K; Yamaoka, J; Yamashita, Y; Yang, C; Yang, U K; Yao, W M; Yeh, G P; Yoh, J; Yorita, K; Yoshida, T; Yu, I; Yu, S S; Yun, J C; Zanello, L; Zanetti, A; Zaw, I; Zetti, F; Zhang, X; Zhou, J; Zucchelli, S

    2006-01-01

    Results on a search for pair production of second generation scalar leptoquark in $p \\bar{p}$ collisions at $\\sqrt{s}$=1.96 TeV are reported. The data analyzed were collected by the CDF detector during the 2002-2003 Tevatron Run II and correspond to an integrated luminosity of 198 pb$^{-1}$. Leptoquarks (LQ) are sought through their decay into (charged) leptons and quarks, with final state signatures represented by two muons and jets and one muon, large transverse missing energy and jets. We observe no evidence for $LQ$ production and derive 95% C.L. upper limits on the $LQ$ production cross sections as well as lower limits on their mass as a function of $\\beta$, where $\\beta$ is the branching fraction for $LQ \\to \\mu q$.

  5. Measurement of the ttbar production cross section in ppbar collisions at sqrt{s} = 1.96 TeV using kinematic characteristics of lepton + jets events

    CERN Document Server

    Abazov, V M; Abolins, M; Acharya, B S; Adams, M; Adams, T; Aguiló, E; Ahn, S H; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Ancu, L S; Andeen, T; Anderson, S; Andrieu, B; Anzelc, M S; Arnoud, Y; Arov, M; Arthaud, M; Askew, A; Åsman, B; Assis-Jesus, A C S; Atramentov, O; Autermann, C; Avila, C; Ay, C; Badaud, F; Baden, A; Bagby, L; Baldin, B; Bandurin, D V; Banerjee, S; Banerjee, P; Barberis, E; Barfuss, A F; Bargassa, P; Baringer, P; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Beale, S; Bean, A; Begalli, M; Begel, M; Belanger-Champagne, C; Bellantoni, L; Bellavance, A; Benítez, J A; Beri, S B; Bernardi, G; Bernhard, R; Berntzon, L; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Biscarat, C; Blazey, G; Blekman, F; Blessing, S; Bloch, D; Bloom, K; Böhnlein, A; Boline, D; Bolton, T A; Borissov, G; Bos, K; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Brown, D; Buchanan, N J; Buchholz, D; Bühler, M; Büscher, V; Burdin, S; Burke, S; Burnett, T H; Buszello, C P; Butler, J M; Calfayan, P; Calvet, S; Cammin, J; Caron, S; Carvalho, W; Casey, B C K; Cason, N M; Castilla-Valdez, H; Chakrabarti, S; Chakraborty, D; Chan, K M; Chan, K; Chandra, A; Charles, F; Cheu, E; Chevallier, F; Cho, D K; Choi, S; Choudhary, B; Christofek, L; Christoudias, T; Cihangir, S; Claes, D; Clément, C; Clement, B; Coadou, Y; Cooke, M; Cooper, W E; Corcoran, M; Couderc, F; Cousinou, M C; Crepe-Renaudin, S; Cutts, D; Cwiok, M; Da Motta, H; Das, A; Davies, G; De, K; De Jong, S J; de Jong, P; De La Cruz-Burelo, E; De Oliveira Martins, C; Degenhardt, J D; Déliot, F; Demarteau, M; Demina, R; Denisov, D; Denisov, S P; Desai, S; Diehl, H T; Diesburg, M; Dominguez, A; Dong, H; Dudko, L V; Duflot, L; Dugad, S R; Duggan, D; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Ellison, J; Elvira, V D; Enari, Y; Eno, S; Ermolov, P; Evans, H; Evdokimov, A; Evdokimov, V N; Ferapontov, A V; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Ford, M; Fortner, M; Fox, H; Fu, S; Fuess, S; Gadfort, T; Galea, C F; Gallas, E; Galyaev, E; García, C; García-Bellido, A; Gavrilov, V; Gay, P; Geist, W; Gelé, D; Gerber, C E; Gershtein, Yu; Gillberg, D; Ginther, G; Gollub, N; Gómez, B; Goussiou, A; Grannis, P D; Greenlee, H; Greenwood, Z D; Gregores, E M; Grenier, G; Gris, P; Grivaz, J F; Grohsjean, A; Grünendahl, S; Grünewald, M W; Guo, J; Guo, F; Gutíerrez, P; Gutíerrez, G; Haas, A; Hadley, N J; Haefner, P; Hagopian, S; Haley, J; Hall, I; Hall, R E; Han, L; Hanagaki, K; Hansson, P; Harder, K; Harel, A; Harrington, R; Hauptman, J M; Hauser, R; Hays, J; Hebbeker, T; Hedin, D; Hegeman, J G; Heinmiller, J M; Heinson, A P; Heintz, U; Hensel, C; Herner, K; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hoeth, H; Hohlfeld, M; Hong, S J; Hooper, R; Hossain, S; Houben, P; Hu, Y; Hubacek, Z; Hynek, V; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jakobs, K; Jarvis, C; Jesik, R; Johns, K; Johnson, C; Johnson, M; Jonckheere, A; Jonsson, P; Juste, A; Käfer, D; Kahn, S; Kajfasz, E; Kalinin, A M; Kalk, J R; Kalk, J M; Kappler, S; Karmanov, D; Kasper, J; Kasper, P; Katsanos, I; Kau, D; Kaur, R; Kaushik, V; Kehoe, R; Kermiche, S; Khalatyan, N; Khanov, A; Kharchilava, A I; Kharzheev, Yu M; Khatidze, D; Kim, H; Kim, T J; Kirby, M H; Kirsch, M; Klima, B; Kohli, J M; Konrath, J P; Kopal, M; Korablev, V M; Kothari, B; Kozelov, A V; Krop, D; Kryemadhi, A; Kühl, T; Kumar, A; Kunori, S; Kupco, A; Kurca, T; Kvita, J; Lacroix, F; Lam, D; Lammers, S; Landsberg, G L; Lazoflores, J; Lebrun, P; Lee, W M; Leflat, A; Lehner, F; Lellouch, J; Lesne, V; Lévêque, J; Lewis, P; Li, J; Li, Q Z; Li, L; Lietti, S M; Lima, J G R; Lincoln, D; Linnemann, J; Lipaev, V V; Lipton, R; Liu, Y; Liu, Z; Lobo, L; Lobodenko, A; Lokajícek, M; Lounis, A; Love, P; Lubatti, H J; Lyon, A L; Maciel, A K A; Mackin, D; Madaras, R J; Mättig, P; Magass, C; Magerkurth, A; Makovec, N; Mal, P K; Malbouisson, H B; Malik, S; Malyshev, V L; Mao, H S; Maravin, Y; Martin, B; McCarthy, R; Melnitchouk, A; Mendes, A; Mendoza, L; Mercadante, P G; Merkin, M; Merritt, K W; Meyer, J; Meyer, A; Michaut, M; Millet, T; Mitrevski, J; Molina, J; Mommsen, R K; Mondal, N K; Moore, R W; Moulik, T; Muanza, G S; Mulders, M; Mulhearn, M; Mundal, O; Mundim, L; Nagy, E; Naimuddin, M; Narain, M; Naumann, N A; Neal, H A; Negret, J P; Neustroev, P; Nilsen, H; Nomerotski, A; Novaes, S F; Nunnemann, T; O'Dell, V; O'Neil, D C; Obrant, G; Ochando, C; Onoprienko, D; Oshima, N; Osta, J; Otec, R; Oteroy-Garzon, G J; Owen, M; Padley, P; Pangilinan, M; Parashar, N; Park, S J; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Pawloski, G; Penning, B; Perea, P M; Peters, K; Peters, Y; Petroff, P; Petteni, M; Piegaia, R; Piper, J; Pleier, M A; Podesta-Lerma, P L M; Podstavkov, V M; Pogorelov, Y; Pol, M E; Polozov, P; Pompo, A; Pope, B G; Popov, A V; Potter, C; Prado da Silva, W L; Prosper, H B; Protopopescu, S D; Qian, J; Quadt, A; Quinn, B; Rakitine, A; Rangel, M S; Rani, K J; Ranjan, K; Ratoff, P N; Renkel, P; Reucroft, S; Rich, P; Rijssenbeek, M; Ripp-Baudot, I; Rizatdinova, F K; Robinson, S; Rodrigues, R F; Royon, C; Rubinov, P; Ruchti, R; Safronov, G; Sajot, G; Sánchez-Hernández, A; Sanders, M P; Santoro, A F S; Savage, G; Sawyer, L; Scanlon, T; Schaile, A D; Schamberger, R D; Scheglov, Y; Schellman, H; Schieferdecker, P; Schliephake, T; Schmitt, C; Schwanenberger, C; Schwartzman, A; Schwienhorst, R; Sekaric, J; Sen-Gupta, S; Severini, H; Shabalina, E; Shamim, M; Shary, V; Shchukin, A A; Shivpuri, R K; Shpakov, D; Siccardi, V; Simák, V; Sirotenko, V I; Skubic, P L; Slattery, P F; Smirnov, D; Smith, R P; Snow, J; Snow, G R; Snyder, S; Söldner-Rembold, S; Sonnenschein, L; Sopczak, A; Sosebee, M; Soustruznik, K; Souza, M; Spurlock, B; Stark, J; Steele, J; Stolin, V; Stone, A; Stoyanova, D A; Strandberg, J; Strandberg, S; Strang, M A; Strauss, M; Strauss, E; Ströhmer, R; Strom, D; Strovink, M; Stutte, L; Sumowidagdo, S; Svoisky, P; Sznajder, A; Talby, M; Tamburello, P; Tanasijczuk, A; Taylor, W; Telford, P; Temple, J; Tiller, B; Tissandier, F; Titov, M; Tokmenin, V V; Tomoto, M; Toole, T; Torchiani, I; Trefzger, T; Tsybychev, D; Tuchming, B; Tully, C; Tuts, P M; Unalan, R; Uvarov, S; Uvarov, L; Uzunyan, S; Vachon, B; Van den Berg, P J; van Eijk, B; Van Kooten, R; Van Leeuwen, W M; Varelas, N; Varnes, E W; Vartapetian, A H; Vasilyev, I A; Vaupel, M; Verdier, P; Vertogradov, L S; Verzocchi, M; Villeneuve-Séguier, F; Vint, P; Vlimant, J R; Vokac, P; Von Törne, E; Voutilainen, M; Vreeswijk, M; Wagner, R; Wahl, H D; Wang, L; Wang, M H L; Warchol, J; Watts, G; Wayne, M; Weber, M; Weber, G; Weerts, H; Wenger, A; Wermes, N; Wetstein, M; White, A; Wicke, D; Wilson, G W; Wimpenny, S J; Wobisch, M; Wood, D R; Wyatt, T R; Xie, Y; Yacoob, S; Yamada, R; Yan, M; Yasuda, T; Yatsunenko, Y A; Yip, K; Yoo, H D; Youn, S W; Yu, J; Yu, C; Yurkewicz, A; Zatserklyaniy, A; Zeitnitz, C; Zhang, D; Zhao, T; Zhou, B; Zhu, J; Zielinski, M; Zieminska, D; Zieminski, A; Zivkovic, L; Zutshi, V; Zverev, E G

    2007-01-01

    We present a measurement of the top quark pair production cross section in ppbar collisions at sqrt(s)=1.96 TeV utilizing 425 pb-1 of data collected with the D0 detector at the Fermilab Tevatron Collider. We consider the final state of the top quark pair containing one high-pT electron or muon and at least four jets. We exploit specific kinematic features of ttbar events to extract the cross section. For a top quark mass of 175 GeV, we measure sigma_ttbar = 6.4 +1.3-1.2(stat} +/- 0.7(syst)+/- 0.4(lum) pb in good agreement with the standard model prediction.

  6. Measurement of the Three-jet Mass Cross Section in $p\\bar{p}$ Collisions at $\\sqrt{s}=1.96$ TeV

    Energy Technology Data Exchange (ETDEWEB)

    Hubacek, Zdenek [Czech Technical Univ., Prague (Czech Republic)

    2010-06-01

    This thesis describes the measurement of the inclusive three-jet cross section in proton-antiproton collisions at √s = 1.96 TeV measured at the D0 experiment at the Fermilab Tevatron Collider in the Fermi National Accelerator Laboratory, Batavia, Illinois, USA. The cross section as a function of three-jet invariant mass is provided in three regions of the third jet transverse momentum and three regions of jet rapidities. It utilizes a data sample collected in the so called Run IIa data taking period (2002-2006) corresponding to the integrated luminosity of about 0.7 fb-1. The results are used to test the next-to-leading order predictions of Quantum chromodynamics computed using the latest parton distribution functions.

  7. Search for Gauge Mediated SUSY Breaking in Diphoton Events in proton anti-proton Collisions at s**(1/2) = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Minsuk

    2004-12-01

    The authors present the results of a search for anomalous production of diphoton events with large missing transverse energy using the Collider Detector at Fermilab. In 202 pb{sup -1} of p{bar p} collisions at {radical}s = 1.96 TeV they observe no candidate events, with an expected standard model background of 0.27 {+-} 0.07(stat) {+-} 0.10(syst) events. The results exclude a lightest chargino of mass less than 167 GeV/c{sup 2}, and lightest neutralino of 93 GeV/c{sup 2} at 95% confidence level in a gauge-mediated supersymmetry-breaking model with a light gravitino.

  8. Evaluation of SNPs in miR-196-a2, miR-27a and miR-146a as risk factors of colorectal cancer

    Institute of Scientific and Technical Information of China (English)

    Renata Hezova; Rostislav Vyzula,; Ondrej Slaby; Alena Kovarikova; Julie Bienertova-Vasku; Milana Sachlova; Martina Redova; Anna Vasku; Marek Svoboda; Lenka Radova; Igor Kiss,

    2012-01-01

    AIM:To investigate whether selected single nucleotide polymorphisms (SNPs) in miR-196a2,miR-27a and miR146a genes are associated with sporadic colorectal cancer (CRC).METHODS:In order to investigate the effect of these SNPs in CRC,we performed a case-control study of 197 cases of sporadic CRC and 212 cancer-free controls originating from the Central-European Caucasian population using TaqMan Real-Time polymerase chain reaction and allelic discrimination analysis.RESULTS:The genotype and allele frequencies of SNPs were compared between the cases and the controis.None of the performed analysis showed any statistically significant results.CONCLUSION:Our data suggest a lack of association between rs11614913,rs895819 and rs2910164 and colorectal cancer risk in the Central-European Caucasian population,a population with an extremely high incidence of sporadic colorectal cancer.

  9. Top quark pair production cross section measurements in p anti-p collisions at s**(1/2) = 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Cabrera, S.; /Valencia U., IFIC

    2006-07-01

    The CDF and D0 experiments have measured the t{bar t} production cross section in p{bar p} collisions at {radical}s = 1.96 TeV from different final states using a wide variety of techniques. CDF has combined 6 measurements using data samples with integrated luminosities up to 760 pb{sup -1}: {sigma}{sub t{bar t}} = 7.3 {+-} 0.5(stat) {+-} 0.6(syst) {+-} 0.4(lum) pb in good agreement with the theoretical calculations: 6.7 {+-} 0.8 pb for a top mass of 175 GeV/c{sup 2}. The experimental precision of the current CDF combined result is comparable for the first time to the accuracy of the QCD NLO theory: {approx} 12%.

  10. Search for dark matter in events with one jet and missing transverse energy in pp¯ collisions at √s=1.96 TeV.

    Science.gov (United States)

    Aaltonen, T; Alvarez González, B; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Apollinari, G; Appel, J A; Arisawa, T; Artikov, A; Asaadi, J; Ashmanskas, W; Auerbach, B; Aurisano, A; Azfar, F; Badgett, W; Bae, T; Bai, Y; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Barria, P; Bartos, P; Bauce, M; Bedeschi, F; Behari, S; Bellettini, G; Bellinger, J; Benjamin, D; Beretvas, A; Bhatti, A; Bisello, D; Bizjak, I; Bland, K R; Blumenfeld, B; Bocci, A; Bodek, A; Bortoletto, D; Boudreau, J; Boveia, A; Brigliadori, L; Bromberg, C; Brucken, E; Budagov, J; Budd, H S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Calamba, A; Calancha, C; Camarda, S; Campanelli, M; Campbell, M; Canelli, F; Carls, B; Carlsmith, D; Carosi, R; Carrillo, S; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavaliere, V; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, K; Chokheli, D; Chung, W H; Chung, Y S; Ciocci, M A; Clark, A; Clarke, C; Compostella, G; Convery, M E; Conway, J; Corbo, M; Cordelli, M; Cox, C A; Cox, D J; Crescioli, F; Cuevas, J; Culbertson, R; Dagenhart, D; d'Ascenzo, N; Datta, M; de Barbaro, P; Dell'Orso, M; Demortier, L; Deninno, M; Devoto, F; d'Errico, M; Di Canto, A; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Donati, S; Dong, P; Dorigo, M; Dorigo, T; Ebina, K; Elagin, A; Eppig, A; Erbacher, R; Errede, S; Ershaidat, N; Eusebi, R; Farrington, S; Feindt, M; Fernandez, J P; Field, R; Flanagan, G; Forrest, R; Fox, P J; Frank, M J; Franklin, M; Freeman, J C; Funakoshi, Y; Furic, I; Gallinaro, M; Garcia, J E; Garfinkel, A F; Garosi, P; Gerberich, H; Gerchtein, E; Giagu, S; Giakoumopoulou, V; Giannetti, P; Gibson, K; Ginsburg, C M; Giokaris, N; Giromini, P; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldin, D; Goldschmidt, N; Golossanov, A; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Grinstein, S; Grosso-Pilcher, C; Group, R C; Guimaraes da Costa, J; Hahn, S R; Halkiadakis, E; Hamaguchi, A; Han, J Y; Happacher, F; Hara, K; Hare, D; Hare, M; Harnik, R; Harr, R F; Hatakeyama, K; Hays, C; Heck, M; Heinrich, J; Herndon, M; Hewamanage, S; Hocker, A; Hopkins, W; Horn, D; Hou, S; Hughes, R E; Hurwitz, M; Husemann, U; Hussain, N; Hussein, M; Huston, J; Introzzi, G; Iori, M; Ivanov, A; James, E; Jang, D; Jayatilaka, B; Jeon, E J; Jindariani, S; Jones, M; Joo, K K; Jun, S Y; Junk, T R; Kamon, T; Karchin, P E; Kasmi, A; Kato, Y; Ketchum, W; Keung, J; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kim, Y J; Kimura, N; Kirby, M; Klimenko, S; Knoepfel, K; Kondo, K; Kong, D J; Konigsberg, J; Kotwal, A V; Kreps, M; Kroll, J; Krop, D; Kruse, M; Krutelyov, V; Kuhr, T; Kurata, M; Kwang, S; Laasanen, A T; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lecompte, T; Lee, E; Lee, H S; Lee, J S; Lee, S W; Leo, S; Leone, S; Lewis, J D; Limosani, A; Lin, C-J; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, C; Liu, H; Liu, Q; Liu, T; Lockwitz, S; Loginov, A; Lucchesi, D; Lueck, J; Lujan, P; Lukens, P; Lungu, G; Lys, J; Lysak, R; Madrak, R; Maeshima, K; Maestro, P; Malik, S; Manca, G; Manousakis-Katsikakis, A; Margaroli, F; Marino, C; Martínez, M; Mastrandrea, P; Matera, K; Mattson, M E; Mazzacane, A; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtala, P; Mesropian, C; Miao, T; Mietlicki, D; Mitra, A; Miyake, H; Moed, S; Moggi, N; Mondragon, M N; Moon, C S; Moore, R; Morello, M J; Morlock, J; Movilla Fernandez, P; Mukherjee, A; Muller, Th; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Naganoma, J; Nakano, I; Napier, A; Nett, J; Neu, C; Neubauer, M S; Nielsen, J; Nodulman, L; Noh, S Y; Norniella, O; Oakes, L; Oh, S H; Oh, Y D; Oksuzian, I; Okusawa, T; Orava, R; Ortolan, L; Pagan Griso, S; Pagliarone, C; Palencia, E; Papadimitriou, V; Paramonov, A A; Patrick, J; Pauletta, G; Paus, C; Pellett, D E; Penzo, A; Phillips, T J; Piacentino, G; Pianori, E; Pilot, J; Pitts, K; Plager, C; Pondrom, L; Poprocki, S; Potamianos, K; Prokoshin, F; Pranko, A; Ptohos, F; Punzi, G; Rahaman, A; Ramakrishnan, V; Ranjan, N; Redondo, I; Renton, P; Rescigno, M; Riddick, T; Rimondi, F; Ristori, L; Robson, A; Rodrigo, T; Rodriguez, T; Rogers, E; Rolli, S; Roser, R; Ruffini, F; Ruiz, A; Russ, J; Rusu, V; Safonov, A; Sakumoto, W K; Sakurai, Y; Santi, L; Sato, K; Saveliev, V; Savoy-Navarro, A; Schlabach, P; Schmidt, A; Schmidt, E E; Schwarz, T; Scodellaro, L; Scribano, A; Scuri, F; Seidel, S; Seiya, Y; Semenov, A; Sforza, F; Shalhout, S Z; Shears, T; Shepard, P F; Shimojima, M; Shochet, M; Shreyber-Tecker, I; Simonenko, A; Sinervo, P; Sliwa, K; Smith, J R; Snider, F D; Soha, A; Sorin, V; Song, H; Squillacioti, P; Stancari, M; St Denis, R; Stelzer, B; Stelzer-Chilton, O; Stentz, D; Strologas, J; Strycker, G L; Sudo, Y; Sukhanov, A; Suslov, I; Takemasa, K; Takeuchi, Y; Tang, J; Tecchio, M; Teng, P K; Thom, J; Thome, J; Thompson, G A; Thomson, E; Toback, D; Tokar, S; Tollefson, K; Tomura, T; Tonelli, D; Torre, S; Torretta, D; Totaro, P; Trovato, M; Ukegawa, F; Uozumi, S; Varganov, A; Vázquez, F; Velev, G; Vellidis, C; Vidal, M; Vila, I; Vilar, R; Vizán, J; Vogel, M; Volpi, G; Wagner, P; Wagner, R L; Wakisaka, T; Wallny, R; Wang, S M; Warburton, A; Waters, D; Wester, W C; Whiteson, D; Wicklund, A B; Wicklund, E; Wilbur, S; Wick, F; Williams, H H; Wilson, J S; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolfe, H; Wright, T; Wu, X; Wu, Z; Yamamoto, K; Yamato, D; Yang, T; Yang, U K; Yang, Y C; Yao, W-M; Yeh, G P; Yi, K; Yoh, J; Yorita, K; Yoshida, T; Yu, G B; Yu, I; Yu, S S; Yun, J C; Zanetti, A; Zeng, Y; Zhou, C; Zucchelli, S

    2012-05-25

    We present the results of a search for dark matter production in the monojet signature. We analyze a sample of Tevatron pp[over ¯] collisions at √s=1.96 TeV corresponding to an integrated luminosity of 6.7 fb(-1) recorded by the CDF II detector. In events with large missing transverse energy and one energetic jet, we find good agreement between the standard model prediction and the observed data. We set 90% confidence level upper limits on the dark matter production rate. The limits are translated into bounds on nucleon-dark matter scattering rates which are competitive with current direct detection bounds on spin-independent interaction below a dark matter candidate mass of 5 GeV/c(2), and on spin-dependent interactions up to masses of 200 GeV/c(2).

  11. Description of E4 Transitions in A = 192, 194,196, 198 Platinum Isotopes in a Microscopic sdgIBM- 1

    Institute of Scientific and Technical Information of China (English)

    ZHANG ZhanJun; YANG Jie; WANG Xin; LIU Yong

    2001-01-01

    Influence of the effective fermion hexadecapole force newly incorporated in a microscopic sdgIBM-1 on spectra, reduced E2 and E4 transition matrix elements (T(E2)s and T(E4)s) in the even-even platinum isotopes (A = 192,194,196,198) is investigated in terms of numerical calculations. It is found that the introduced interaction causes only limited modification to the spectrum and T(E2)s, apart from a few exceptions. However, it plays an essential role in describing E4 transitions. Thus in the case that the interaction is incorporated with certain strength, a reasonable description of all the E4 transitions in the platinum isotopes is reached in the microscopic sdgIBM-1 in comparing both to experimental data and the results calculated in phenomenological boson model.``

  12. Search for excited and exotic muons in the mugamma decay channel in p-p collisions at sqrt s =1.96 TeV.

    Science.gov (United States)

    Abulencia, A; Acosta, D; Adelman, J; Affolder, T; Akimoto, T; Albrow, M G; Ambrose, D; Amerio, S; Amidei, D; Anastassov, A; Anikeev, K; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Arguin, J-F; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Azfar, F; Azzi-Bacchetta, P; Azzurri, P; Bacchetta, N; Bachacou, H; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Baroiant, S; Bartsch, V; Bauer, G; Bedeschi, F; Behari, S; Belforte, S; Bellettini, G; Bellinger, J; Belloni, A; Haim, E Ben; Benjamin, D; Beretvas, A; Beringer, J; Berry, T; Bhatti, A; Binkley, M; Bisello, D; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bolla, G; Bolshov, A; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Bromberg, C; Brubaker, E; Budagov, J; Budd, H S; Budd, S; Burkett, K; Busetto, G; Bussey, P; Byrum, K L; Cabrera, S; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carlsmith, D; Carosi, R; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chapman, J; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, I; Cho, K; Chokheli, D; Chou, J P; Chu, P H; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Ciljak, M; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Coca, M; Compostella, G; Convery, M E; Conway, J; Cooper, B; Copic, K; Cordelli, M; Cortiana, G; Crescioli, F; Cruz, A; Cuenca Almenar, C; Cuevas, J; Culbertson, R; Cyr, D; DaRonco, S; D'Auria, S; D'Onofrio, M; Dagenhart, D; de Barbaro, P; De Cecco, S; Deisher, A; De Lentdecker, G; Dell'Orso, M; Delli Paoli, F; Demers, S; Demortier, L; Deng, J; Deninno, M; De Pedis, D; Derwent, P F; Di Giovanni, G P; Di Ruzza, B; Dionisi, C; Dittmann, J R; DiTuro, P; Dörr, C; Donati, S; Donega, M; Dong, P; Donini, J; Dorigo, T; Dube, S; Ebina, K; Efron, J; Ehlers, J; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, I; Fedorko, W T; Feild, R G; Feindt, M; Fernandez, J P; Field, R; Flanagan, G; Flores-Castillo, L R; Foland, A; Forrester, S; Foster, G W; Franklin, M; Freeman, J C; Frisch, H J; Furic, I; Gallinaro, M; Galyardt, J; Garcia, J E; Garcia Sciveres, M; Garfinkel, A F; Gay, C; Gerberich, H; Gerdes, D; Giagu, S; Giannetti, P; Gibson, A; Gibson, K; Ginsburg, C; Giokaris, N; Giolo, K; Giordani, M; Giromini, P; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Goldstein, J; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Gotra, Y; Goulianos, K; Gresele, A; Griffiths, M; Grinstein, S; Grosso-Pilcher, C; Grundler, U; Guimaraes da Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, S R; Hahn, K; Halkiadakis, E; Hamilton, A; Han, B-Y; Han, J Y; Handler, R; Happacher, F; Hara, K; Hare, M; Harper, S; Harr, R F; Harris, R M; Hatakeyama, K; Hauser, J; Hays, C; Heijboer, A; Heinemann, B; Heinrich, J; Herndon, M; Hidas, D; Hill, C S; Hirschbuehl, D; Hocker, A; Holloway, A; Hou, S; Houlden, M; Hsu, S-C; Huffman, B T; Hughes, R E; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ishizawa, Y; Ivanov, A; Iyutin, B; James, E; Jang, D; Jayatilaka, B; Jeans, D; Jensen, H; Jeon, E J; Jindariani, S; Jones, M; Joo, K K; Jun, S Y; Junk, T R; Kamon, T; Kang, J; Karchin, P E; Kato, Y; Kemp, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kirsch, L; Klimenko, S; Klute, M; Knuteson, B; Ko, B R; Kobayashi, H; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kovalev, A; Kraan, A; Kraus, J; Kravchenko, I; Kreps, M; Kroll, J; Krumnack, N; Kruse, M; Krutelyov, V; Kuhlmann, S E; Kusakabe, Y; Kwang, S; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; LeCompte, T; Lee, J; Lee, J; Lee, Y J; Lee, S W; Lefèvre, R; Leonardo, N; Leone, S; Levy, S; Lewis, J D; Lin, C; Lin, C S; Lindgren, M; Lipeles, E; Liss, T M; Lister, A; Litvintsev, D O; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Loverre, P; Lu, R-S; Lucchesi, D; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Lytken, E; Mack, P; MacQueen, D; Madrak, R; Maeshima, K; Maki, T; Maksimovic, P; Malde, S; Manca, G; Margaroli, F; Marginean, R; Marino, C; Martin, A; Martin, V; Martínez, M; Maruyama, T; Mastrandrea, P; Matsunaga, H; Mattson, M E; Mazini, R; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Menzemer, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; von der Mey, M; Miao, T; Miladinovic, N; Miles, J; Miller, R; Miller, J S; Mills, C; Milnik, M; Miquel, R; Mitra, A; Mitselmakher, G; Miyamoto, A; Moggi, N; Mohr, B; Moore, R; Morello, M; Movilla Fernandez, P; Mülmenstädt, J; Mukherjee, A; Muller, Th; Mumford, R; Murat, P; Nachtman, J; Naganoma, J; Nahn, S; Nakano, I; Napier, A; Naumov, D; Necula, V; Neu, C; Neubauer, M S; Nielsen, J; Nigmanov, T; Nodulman, L; Norniella, O; Nurse, E; Ogawa, T

    2006-11-10

    We search for excited and exotic muon states mu* using an integrated luminosity of 371 pb(-1) of p[over]p collision data at sqrt[s]=1.96 TeV. We search for associated production of mumu* followed by the decay mu*-->mugamma. We compare the data to model predictions as a function of the mass of the excited muon M(mu*), the compositeness energy scale Lambda, and the gauge coupling factor f. No signal above the standard model expectation is observed. We exclude 107

  13. Measurement of the tt production cross section in pp collisions at sqrt[s]=1.96 TeV using dilepton events.

    Science.gov (United States)

    Acosta, D; Affolder, T; Akimoto, T; Albrow, M G; Ambrose, D; Amerio, S; Amidei, D; Anastassov, A; Anikeev, K; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Arisawa, T; Arguin, J-F; Artikov, A; Ashmanskas, W; Attal, A; Azfar, F; Azzi-Bacchetta, P; Bacchetta, N; Bachacou, H; Badgett, W; Barbaro-Galtieri, A; Barker, G J; Barnes, V E; Barnett, B A; Baroiant, S; Barone, M; Bauer, G; Bedeschi, F; Behari, S; Belforte, S; Bellettini, G; Bellinger, J; Benjamin, D; Beretvas, A; Bhatti, A; Binkley, M; Bisello, D; Bishai, M; Blair, R E; Blocker, C; Bloom, K; Blumenfeld, B; Bocci, A; Bodek, A; Bolla, G; Bolshov, A; Booth, P S L; Bortoletto, D; Boudreau, J; Bourov, S; Bromberg, C; Brubaker, E; Budagov, J; Budd, H S; Burkett, K; Busetto, G; Bussey, P; Byrum, K L; Cabrera, S; Calafiura, P; Campanelli, M; Campbell, M; Canepa, A; Casarsa, M; Carlsmith, D; Carron, S; Carosi, R; Castro, A; Catastini, P; Cauz, D; Cerri, A; Cerri, C; Cerrito, L; Chapman, J; Chen, C; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, I; Cho, K; Chokheli, D; Chu, M L; Chuang, S; Chung, J Y; Chung, W-H; Chung, Y S; Ciobano, C I; Ciocci, M A; Clark, A G; Clark, D; Coca, M; Connolly, A; Convery, M; Conway, J; Cordelli, M; Cortiana, G; Cranshaw, J; Cuevas, J; Culbertson, R; Currat, C; Cyr, D; Dagenhart, D; Da Ronco, S; D'Auria, S; de Barbaro, P; De Cecco, S; De Lentdecker, G; Dell'Agnello, S; Dell'Orso, M; Demers, S; Demortier, L; Deninno, M; De Pedis, D; Derwent, P F; Dionisi, C; Dittmann, J R; Doksus, P; Dominguez, A; Donati, S; Donega, M; D'Onofrio, M; Dorigo, T; Drollinger, V; Ebina, K; Eddy, N; Ely, R; Erbacher, R; Erdmann, M; Errede, D; Errede, S; Eusebi, R; Fang, H-C; Farrington, S; Fedorko, I; Feild, R G; Feindt, M; Fernandez, J P; Ferretti, C; Field, R D; Fiori, I; Flanagan, G; Flaugher, B; Flores-Castillo, L R; Foland, A; Forrester, S; Foster, G W; Franklin, M; Frisch, H; Fujii, Y; Furic, I; Gajjar, A; Gallas, A; Galyardt, J; Gallinaro, M; Garcia-Sciveres, M; Garfinkel, A F; Gay, C; Gerberich, H; Gerdes, D W; Gerchtein, E; Giagu, S; Giannetti, P; Gibson, A; Gibson, K; Ginsburg, C; Giolo, K; Giordani, M; Giurgui, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Goldstein, D; Goldstein, J; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Gotra, Y; Goulianos, K; Gresele, A; Grosso-Pilcher, C; Guenther, M; Guimaraes de Costa, J; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Handler, R; Happacher, F; Hara, K; Hare, M; Harr, R F; Harris, R M; Hartmann, F; Hatakeyama, K; Hauser, J; Hays, C; Hayward, H; Heider, E; Heinemann, B; Heinrich, J; Hennecke, M; Herndon, M; Hill, C; Hirschbuehl, D; Hocker, A; Hoffman, K D; Holloway, A; Hou, S; Houlden, M A; Huffman, B T; Huang, Y; Hughes, R E; Huston, J; Ikado, K; Incandela, J; Introzzi, G; Iori, M; Ishizawa, Y; Issever, C; Ivanov, A; Iwata, Y; Iyutin, B; James, E; Jang, D; Jarrell, J; Jeans, D; Jensen, H; Jeon, E J; Jones, M; Joo, K K; Jun, S; Junk, T; Kamon, T; Kang, J; Karagoz Unel, M; Karchin, P E; Kartal, S; Kato, Y; Kemp, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, M S; Kim, S B; Kim, S H; Kim, T H; Kim, Y K; King, B T; Kirby, M; Kirsch, L; Klimenko, S; Knuteson, B; Ko, B R; Kobayashi, H; Koehn, P; Kong, D J; Kondo, K; Konigsberg, J; Kordas, K; Korn, A; Korytov, A; Kotelnikov, K; Kotwal, A V; Kovalev, A; Kraus, J; Kravchenko, I; Kreymer, A; Kroll, J; Kruse, M; Krutelyov, V; Kuhlmann, S E; Kuznetsova, N; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, J; Lancaster, M; Lander, R; Lannon, K; Lath, A; Latino, G; Lauhakangas, R; Lazzizzera, I; Le, Y; Lecci, C; LeCompte, T; Lee, J; Lee, J; Lee, S W; Leonardo, N; Leone, S; Lewis, J D; Li, K; Lin, C; Lin, C S; Lindgren, M; Liss, T M; Litvintsev, D O; Liu, T; Liu, Y; Lockyer, N S; Loginov, A; Loreti, M; Loverre, P; Lu, R-S; Lucchesi, D; Lukens, P; Lyons, L; Lys, J; Lysak, R; MacQueen, D; Madrak, R; Maeshima, K; Maksimovic, P; Malferrari, L; Manca, G; Marginean, R; Martin, M; Martin, A; Martin, V; Martínez, M; Maruyama, T; Matsunaga, H; Mattson, M; Mazzanti, P; McFarland, K S; McGivern, D; McIntyre, P M; McNamara, P; McNulty, R; Menzemer, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Miao, T; Miladinovic, N; Miller, L; Miller, R; Miller, J S; Mills, C; Miquel, R; Miscetti, S; Mitselmakher, G; Miyamoto, A; Miyazaki, Y; Moggi, N; Mohr, B; Moore, R; Morello, M; Moulik, T; Mukherjee, A; Mulhearn, M; Muller, T; Mumford, R; Munar, A; Murat, P; Nachtman, J; Nahn, S; Nakamura, I; Nakano, I; Napier, A; Napora, R; Naumov, D; Necula, V; Niell, F; Nielsen, J; Nelson, C; Nelson, T; Neu, C; Neubauer, M S; Newman-Holmes, C; Nicollerat, A-S; Nignamov, T; Nodulman, L; Oesterberg, K; Ogawa, T; Oh, S; Oh, Y D; Ohsugi, T; Okusawa, T; Oldeman, R; Orava, R; Orejudos, W; Pagliarone, C; Palmonari, F; Paoletti, R; Papadimitriou, V; Pashapour, S; Patrick, J

    2004-10-01

    We report a measurement of the tt production cross section using dilepton events with jets and missing transverse energy in pp collisions at a center-of-mass energy of 1.96 TeV. Using a 197+/-12 pb(-1) data sample recorded by the upgraded Collider Detector at Fermilab, we use two complementary techniques to select candidate events. We compare the number of observed events and selected kinematical distributions with the predictions of the standard model and find good agreement. The combined result of the two techniques yields a tt production cross section of 7.0(+2.4)(-2.1)(stat)+1.6-1.1(syst)+/-0.4(lum) pb.

  14. Search for the production of scalar bottom quarks in pp collisions at square root(s) = 1.96 TeV.

    Science.gov (United States)

    Aaltonen, T; Adelman, J; Alvarez González, B; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Apollinari, G; Apresyan, A; Arisawa, T; Artikov, A; Asaadi, J; Ashmanskas, W; Attal, A; Aurisano, A; Azfar, F; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Barria, P; Bartos, P; Bauer, G; Beauchemin, P-H; Bedeschi, F; Beecher, D; Behari, S; Bellettini, G; Bellinger, J; Benjamin, D; Beretvas, A; Bhatti, A; Binkley, M; Bisello, D; Bizjak, I; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Bridgeman, A; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, J; Budd, H S; Budd, S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Byrum, K L; Cabrera, S; Calancha, C; Camarda, S; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carls, B; Carlsmith, D; Carosi, R; Carrillo, S; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavaliere, V; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, K; Chokheli, D; Chou, J P; Chung, K; Chung, W H; Chung, Y S; Chwalek, T; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Compostella, G; Convery, M E; Conway, J; Corbo, M; Cordelli, M; Cox, C A; Cox, D J; Crescioli, F; Cuenca Almenar, C; Cuevas, J; Culbertson, R; Cully, J C; Dagenhart, D; Datta, M; Davies, T; de Barbaro, P; De Cecco, S; Deisher, A; De Lorenzo, G; Dell'Orso, M; Deluca, C; Demortier, L; Deng, J; Deninno, M; d'Errico, M; Di Canto, A; di Giovanni, G P; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Donati, S; Dong, P; Dorigo, T; Dube, S; Ebina, K; Elagin, A; Erbacher, R; Errede, D; Errede, S; Ershaidat, N; Eusebi, R; Fang, H C; Farrington, S; Fedorko, W T; Feild, R G; Feindt, M; Fernandez, J P; Ferrazza, C; Field, R; Flanagan, G; Forrest, R; Frank, M J; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; Garberson, F; Garcia, J E; Garfinkel, A F; Garosi, P; Gerberich, H; Gerdes, D; Gessler, A; Giagu, S; Giakoumopoulou, V; Giannetti, P; Gibson, K; Gimmell, J L; Ginsburg, C M; Giokaris, N; Giordani, M; Giromini, P; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Golossanov, A; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Grinstein, S; Grosso-Pilcher, C; Group, R C; Grundler, U; Guimaraes da Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, S R; Halkiadakis, E; Han, B-Y; Han, J Y; Happacher, F; Hara, K; Hare, D; Hare, M; Harr, R F; Hartz, M; Hatakeyama, K; Hays, C; Heck, M; Heinrich, J; Herndon, M; Heuser, J; Hewamanage, S; Hidas, D; Hill, C S; Hirschbuehl, D; Hocker, A; Hou, S; Houlden, M; Hsu, S-C; Hughes, R E; Hurwitz, M; Husemann, U; Hussein, M; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ivanov, A; James, E; Jang, D; Jayatilaka, B; Jeon, E J; Jha, M K; Jindariani, S; Johnson, W; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Kar, D; Karchin, P E; Kato, Y; Kephart, R; Ketchum, W; Keung, J; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, H W; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kreps, M; Kroll, J; Krop, D; Krumnack, N; Kruse, M; Krutelyov, V; Kuhr, T; Kulkarni, N P; Kurata, M; Kwang, S; Laasanen, A T; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; LeCompte, T; Lee, E; Lee, H S; Lee, J S; Lee, S W; Leone, S; Lewis, J D; Lin, C-J; Linacre, J; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, C; Liu, T; Lockyer, N S; Loginov, A; Lovas, L; Lucchesi, D; Lueck, J; Lujan, P; Lukens, P; Lungu, G; Lys, J; Lysak, R; MacQueen, D; Madrak, R; Maeshima, K; Makhoul, K; Maksimovic, P; Malde, S; Malik, S; Manca, G; Manousakis-Katsikakis, A; Margaroli, F; Marino, C; Marino, C P; Martin, A; Martin, V; Martínez, M; Martínez-Ballarín, R; Mastrandrea, P; Mathis, M; Mattson, M E; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtala, P; Menzione, A; Mesropian, C; Miao, T; Mietlicki, D; Miladinovic, N; Miller, R; Mills, C; Milnik, M; Mitra, A; Mitselmakher, G; Miyake, H; Moed, S; Moggi, N; Mondragon, M N; Moon, C S; Moore, R; Morello, M J; Morlock, J; Movilla Fernandez, P; Mülmenstädt, J; Mukherjee, A; Muller, Th; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Naganoma, J; Nakamura, K; Nakano, I; Napier, A; Nett, J; Neu, C; Neubauer, M S; Neubauer, S; Nielsen, J; Nodulman, L; Norman, M; Norniella, O; Nurse, E; Oakes, L; Oh, S H; Oh, Y D; Oksuzian, I; Okusawa, T; Orava, R; Osterberg, K; Pagan Griso, S; Pagliarone, C; Palencia, E; Papadimitriou, V; Papaikonomou, A; Paramanov, A A; Parks, B; Pashapour, S; Patrick, J; Pauletta, G; Paulini, M; Paus, C; Peiffer, T; Pellett, D E; Penzo, A; Phillips, T J; Piacentino, G; Pianori, E; Pinera, L; Pitts, K; Plager, C; Pondrom, L

    2010-08-20

    We report on a search for direct scalar bottom quark (sbottom) pair production in pp collisions at square root(s) = 1.96 TeV, in events with large missing transverse energy and two jets of hadrons in the final state, where at least one of the jets is required to be identified as originating from a b quark. The study uses a collider detector at Fermilab Run II data sample corresponding to 2.65 fb(-1) of integrated luminosity. The data are in agreement with the standard model. In an R-parity conserving minimal supersymmetric scenario, and assuming that the sbottom decays exclusively into a bottom quark and a neutralino, 95% confidence-level upper limits on the sbottom pair production cross section of 0.1 pb are obtained. For neutralino masses below 70 GeV/c2, sbottom masses up to 230 GeV/c2 are excluded at 95% confidence level.

  15. Search for single vectorlike quarks in pp ̄ collisions at √s=1.96  TeV.

    Science.gov (United States)

    Abazov, V M; Abbott, B; Acharya, B S; Adams, M; Adams, T; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Ancu, L S; Aoki, M; Arnoud, Y; Arov, M; Askew, A; Åsman, B; Atramentov, O; Avila, C; BackusMayes, J; Badaud, F; Bagby, L; Baldin, B; Bandurin, D V; Banerjee, S; Barberis, E; Baringer, P; Barreto, J; Bartlett, J F; Bassler, U; Bazterra, V; Beale, S; Bean, A; Begalli, M; Begel, M; Belanger-Champagne, C; Bellantoni, L; Beri, S B; Bernardi, G; Bernhard, R; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Blazey, G; Blessing, S; Bloom, K; Boehnlein, A; Boline, D; Bolton, T A; Boos, E E; Borissov, G; Bose, T; Brandt, A; Brandt, O; Brock, R; Brooijmans, G; Bross, A; Brown, D; Brown, J; Bu, X B; Buehler, M; Buescher, V; Bunichev, V; Burdin, S; Burnett, T H; Buszello, C P; Calpas, B; Camacho-Pérez, E; Carrasco-Lizarraga, M A; Casey, B C K; Castilla-Valdez, H; Caughron, S; Chakrabarti, S; Chakraborty, D; Chan, K M; Chandra, A; Chen, G; Chevalier-Théry, S; Cho, D K; Cho, S W; Choi, S; Choudhary, B; Christoudias, T; Cihangir, S; Claes, D; Clutter, J; Cooke, M; Cooper, W E; Corcoran, M; Couderc, F; Cousinou, M-C; Croc, A; Cutts, D; Ćwiok, M; Das, A; Davies, G; De, K; de Jong, S J; De la Cruz-Burelo, E; Déliot, F; Demarteau, M; Demina, R; Denisov, D; Denisov, S P; Desai, S; DeVaughan, K; Diehl, H T; Diesburg, M; Dominguez, A; Dorland, T; Dubey, A; Dudko, L V; Duggan, D; Duperrin, A; Dutt, S; Dyshkant, A; Eads, M; Edmunds, D; Ellison, J; Elvira, V D; Enari, Y; Evans, H; Evdokimov, A; Evdokimov, V N; Facini, G; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Fortner, M; Fox, H; Fuess, S; Gadfort, T; Garcia-Bellido, A; Gavrilov, V; Gay, P; Geist, W; Geng, W; Gerbaudo, D; Gerber, C E; Gershtein, Y; Ginther, G; Golovanov, G; Goussiou, A; Grannis, P D; Greder, S; Greenlee, H; Greenwood, Z D; Gregores, E M; Grenier, G; Gris, Ph; Grivaz, J-F; Grohsjean, A; Grünendahl, S; Grünewald, M W; Guo, F; Gutierrez, G; Gutierrez, P; Haas, A; Hagopian, S; Haley, J; Han, L; Harder, K; Harel, A; Hauptman, J M; Hays, J; Head, T; Hebbeker, T; Hedin, D; Hegab, H; Heinson, A P; Heintz, U; Hensel, C; Heredia-De la Cruz, I; Herner, K; Hesketh, G; Hildreth, M D; Hirosky, R; Hoang, T; Hobbs, J D; Hoeneisen, B; Hohlfeld, M; Hossain, S; Hubacek, Z; Huske, N; Hynek, V; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jamin, D; Jesik, R; Johns, K; Johnson, M; Johnston, D; Jonckheere, A; Jonsson, P; Joshi, J; Juste, A; Kaadze, K; Kajfasz, E; Karmanov, D; Kasper, P A; Katsanos, I; Kehoe, R; Kermiche, S; Khalatyan, N; Khanov, A; Kharchilava, A; Kharzheev, Y N; Khatidze, D; Kirby, M H; Kohli, J M; Kozelov, A V; Kraus, J; Kumar, A; Kupco, A; Kurča, T; Kuzmin, V A; Kvita, J; Lammers, S; Landsberg, G; Lebrun, P; Lee, H S; Lee, S W; Lee, W M; Lellouch, J; Li, L; Li, Q Z; Lietti, S M; Lim, J K; Lincoln, D; Linnemann, J; Lipaev, V V; Lipton, R; Liu, Y; Liu, Z; Lobodenko, A; Lokajicek, M; Love, P; Lubatti, H J; Luna-Garcia, R; Lyon, A L; Maciel, A K A; Mackin, D; Madar, R; Magaña-Villalba, R; Malik, S; Malyshev, V L; Maravin, Y; Martínez-Ortega, J; McCarthy, R; McGivern, C L; Meijer, M M; Melnitchouk, A; Menezes, D; Mercadante, P G; Merkin, M; Meyer, A; Meyer, J; Mondal, N K; Muanza, G S; Mulhearn, M; Nagy, E; Naimuddin, M; Narain, M; Nayyar, R; Neal, H A; Negret, J P; Neustroev, P; Novaes, S F; Nunnemann, T; Obrant, G; Orduna, J; Osman, N; Osta, J; Otero y Garzón, G J; Owen, M; Padilla, M; Pangilinan, M; Parashar, N; Parihar, V; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Penning, B; Perfilov, M; Peters, K; Peters, Y; Petrillo, G; Pétroff, P; Piegaia, R; Piper, J; Pleier, M-A; Podesta-Lerma, P L M; Podstavkov, V M; Pol, M-E; Polozov, P; Popov, A V; Prewitt, M; Price, D; Protopopescu, S; Qian, J; Quadt, A; Quinn, B; Rangel, M S; Ranjan, K; Ratoff, P N; Razumov, I; Renkel, P; Rich, P; Rijssenbeek, M; Ripp-Baudot, I; Rizatdinova, F; Rominsky, M; Royon, C; Rubinov, P; Ruchti, R; Safronov, G; Sajot, G; Sánchez-Hernández, A; Sanders, M P; Sanghi, B; Santos, A S; Savage, G; Sawyer, L; Scanlon, T; Schamberger, R D; Scheglov, Y; Schellman, H; Schliephake, T; Schlobohm, S; Schwanenberger, C; Schwienhorst, R; Sekaric, J; Severini, H; Shabalina, E; Shary, V; Shchukin, A A; Shivpuri, R K; Simak, V; Sirotenko, V; Skubic, P; Slattery, P; Smirnov, D; Smith, K J; Snow, G R; Snow, J; Snyder, S; Söldner-Rembold, S; Sonnenschein, L; Sopczak, A; Sosebee, M; Soustruznik, K; Spurlock, B; Stark, J; Stolin, V; Stoyanova, D A; Strauss, M; Strom, D; Stutte, L; Suter, L; Svoisky, P; Takahashi, M; Tanasijczuk, A; Taylor, W; Titov, M; Tokmenin, V V; Tsai, Y-T; Tsybychev, D; Tuchming, B; Tully, C; Tuts, P M; Uvarov, L; Uvarov, S; Uzunyan, S; Van Kooten, R; van Leeuwen, W M; Varelas, N; Varnes, E W; Vasilyev, I A; Verdier, P; Vertogradov, L S; Verzocchi, M

    2011-02-25

    We present a search for hypothetical vectorlike quarks in pp ̅ collisions at √s=1.96  TeV. The data were collected by the D0 detector at the Fermilab Tevatron Collider and correspond to an integrated luminosity of 5.4  fb(-1). We select events with a final state composed of a W or Z boson and a jet consistent with a heavy object decay. We observe no significant excess in comparison to the background prediction and set limits on production cross sections for vectorlike quarks decaying to W+jet and Z+jet. These are the most stringent limits to date for electroweak single vectorlike quark production at hadron colliders.

  16. Search for pair production of scalar bottom quarks in pp collisions at square root of s = 1.96 TeV.

    Science.gov (United States)

    Abazov, V M; Abbott, B; Abolins, M; Acharya, B S; Adams, M; Adams, T; Agelou, M; Ahn, S H; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Andeen, T; Anderson, S; Andrieu, B; Anzelc, M S; Arnoud, Y; Arov, M; Askew, A; Asman, B; Jesus, A C S Assis; Atramentov, O; Autermann, C; Avila, C; Ay, C; Badaud, F; Baden, A; Bagby, L; Baldin, B; Bandurin, D V; Banerjee, P; Banerjee, S; Barberis, E; Bargassa, P; Baringer, P; Barnes, C; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Bean, A; Begalli, M; Begel, M; Belanger-Champagne, C; Bellantoni, L; Bellavance, A; Benitez, J A; Beri, S B; Bernardi, G; Bernhard, R; Berntzon, L; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Binder, M; Biscarat, C; Black, K M; Blackler, I; Blazey, G; Blekman, F; Blessing, S; Bloch, D; Bloom, K; Blumenschein, U; Boehnlein, A; Boeriu, O; Bolton, T A; Borissov, G; Bos, K; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Brown, D; Buchanan, N J; Buchholz, D; Buehler, M; Buescher, V; Burdin, S; Burke, S; Burnett, T H; Busato, E; Buszello, C P; Butler, J M; Calfayan, P; Calvet, S; Cammin, J; Caron, S; Carvalho, W; Casey, B C K; Cason, N M; Castilla-Valdez, H; Chakraborty, D; Chan, K M; Chandra, A; Charles, F; Cheu, E; Chevallier, F; Cho, D K; Choi, S; Choudhary, B; Christofek, L; Claes, D; Clément, B; Clément, C; Coadou, Y; Cooke, M; Cooper, W E; Coppage, D; Corcoran, M; Cousinou, M-C; Cox, B; Crépé-Renaudin, S; Cutts, D; Cwiok, M; da Motta, H; Das, A; Das, M; Davies, B; Davies, G; Davis, G A; De, K; de Jong, P; de Jong, S J; De La Cruz-Burelo, E; De Oliveira Martins, C; Degenhardt, J D; Déliot, F; Demarteau, M; Demina, R; Demine, P; Denisov, D; Denisov, S P; Desai, S; Diehl, H T; Diesburg, M; Doidge, M; Dominguez, A; Dong, H; Dudko, L V; Duflot, L; Dugad, S R; Duggan, D; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Edwards, T; Ellison, J; Elmsheuser, J; Elvira, V D; Eno, S; Ermolov, P; Evans, H; Evdokimov, A; Evdokimov, V N; Fatakia, S N; Feligioni, L; Ferapontov, A V; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Fleck, I; Ford, M; Fortner, M; Fox, H; Fu, S; Fuess, S; Gadfort, T; Galea, C F; Gallas, E; Galyaev, E; Garcia, C; Garcia-Bellido, A; Gardner, J; Gavrilov, V; Gay, A; Gay, P; Gelé, D; Gelhaus, R; Gerber, C E; Gershtein, Y; Gillberg, D; Ginther, G; Gollub, N; Gómez, B; Goussiou, A; Grannis, P D; Greenlee, H; Greenwood, Z D; Gregores, E M; Grenier, G; Gris, Ph; Grivaz, J-F; Grünendahl, S; Grünewald, M W; Guo, F; Guo, J; Gutierrez, G; Gutierrez, P; Haas, A; Hadley, N J; Haefner, P; Hagopian, S; Haley, J; Hall, I; Hall, R E; Han, L; Hanagaki, K; Harder, K; Harel, A; Harrington, R; Hauptman, J M; Hauser, R; Hays, J; Hebbeker, T; Hedin, D; Hegeman, J G; Heinmiller, J M; Heinson, A P; Heintz, U; Hensel, C; Herner, K; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hoeth, H; Hohlfeld, M; Hong, S J; Hooper, R; Houben, P; Hu, Y; Hubacek, Z; Hynek, V; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jakobs, K; Jarvis, C; Jenkins, A; Jesik, R; Johns, K; Johnson, C; Johnson, M; Jonckheere, A; Jonsson, P; Juste, A; Käfer, D; Kahn, S; Kajfasz, E; Kalinin, A M; Kalk, J M; Kalk, J R; Kappler, S; Karmanov, D; Kasper, J; Kasper, P; Katsanos, I; Kau, D; Kaur, R; Kehoe, R; Kermiche, S; Khalatyan, N; Khanov, A; Kharchilava, A; Kharzheev, Y M; Khatidze, D; Kim, H; Kim, T J; Kirby, M H; Klima, B; Kohli, J M; Konrath, J-P; Kopal, M; Korablev, V M; Kotcher, J; Kothari, B; Koubarovsky, A; Kozelov, A V; Kozminski, J; Krop, D; Kryemadhi, A; Kuhl, T; Kumar, A; Kunori, S; Kupco, A; Kurca, T; Kvita, J; Lammers, S; Landsberg, G; Lazoflores, J; Le Bihan, A-C; Lebrun, P; Lee, W M; Leflat, A; Lehner, F; Lesne, V; Leveque, J; Lewis, P; Li, J; Li, Q Z; Lima, J G R; Lincoln, D; Linnemann, J; Lipaev, V V; Lipton, R; Liu, Z; Lobo, L; Lobodenko, A; Lokajicek, M; Lounis, A; Love, P; Lubatti, H J; Lynker, M; Lyon, A L; Maciel, A K A; Madaras, R J; Mättig, P; Magass, C; Magerkurth, A; Magnan, A-M; Makovec, N; Mal, P K; Malbouisson, H B; Malik, S; Malyshev, V L; Mao, H S; Maravin, Y; Martens, M; McCarthy, R; Meder, D; Melnitchouk, A; Mendes, A; Mendoza, L; Merkin, M; Merritt, K W; Meyer, A; Meyer, J; Michaut, M; Miettinen, H; Millet, T; Mitrevski, J; Molina, J; Mondal, N K; Monk, J; Moore, R W; Moulik, T; Muanza, G S; Mulders, M; Mulhearn, M; Mundim, L; Mutaf, Y D; Nagy, E; Naimuddin, M; Narain, M; Naumann, N A; Neal, H A; Negret, J P; Neustroev, P; Noeding, C; Nomerotski, A; Novaes, S F; Nunnemann, T; O'Dell, V; O'Neil, D C; Obrant, G; Oguri, V; Oliveira, N; Oshima, N; Otec, R; Y Garzón, G J Otero; Owen, M; Padley, P; Parashar, N; Park, S-J; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Pawloski, G; Perea, P M; Perez, E; Peters, K; Pétroff, P; Petteni, M; Piegaia, R; Piper, J; Pleier, M-A; Podesta-Lerma, P L M

    2006-10-27

    A search for direct production of scalar bottom quarks (b) is performed with 310 pb(-1) of data collected by the D0 experiment in pp collisions at square root s = 1.96 TeV at the Fermilab Tevatron Collider. The topology analyzed consists of two b jets and an imbalance in transverse momentum due to undetected neutralinos (chi(1)0), with chi(1)0 assumed to be the lightest supersymmetric particle. We find the data consistent with standard model expectations, and set a 95% C.L. exclusion domain in the (m(b), m(chi(1)0)) mass plane, improving significantly upon the results from run I of the Tevatron.

  17. Search for charged Higgs bosons in decays of top quarks in pp collisions at square root s = 1.96 TeV.

    Science.gov (United States)

    Aaltonen, T; Adelman, J; Akimoto, T; Alvarez González, B; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Apollinari, G; Apresyan, A; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Aurisano, A; Azfar, F; Azzurri, P; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Bartsch, V; Bauer, G; Beauchemin, P-H; Bedeschi, F; Beecher, D; Behari, S; Bellettini, G; Bellinger, J; Benjamin, D; Beretvas, A; Beringer, J; Bhatti, A; Binkley, M; Bisello, D; Bizjak, I; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bolla, G; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Bridgeman, A; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, J; Budd, H S; Budd, S; Burke, S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Byrum, K L; Cabrera, S; Calancha, C; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carls, B; Carlsmith, D; Carosi, R; Carrillo, S; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavaliere, V; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, K; Chokheli, D; Chou, J P; Choudalakis, G; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Chwalek, T; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Compostella, G; Convery, M E; Conway, J; Cordelli, M; Cortiana, G; Cox, C A; Cox, D J; Crescioli, F; Cuenca Almenar, C; Cuevas, J; Culbertson, R; Cully, J C; Dagenhart, D; Datta, M; Davies, T; de Barbaro, P; De Cecco, S; Deisher, A; De Lorenzo, G; Dell'orso, M; Deluca, C; Demortier, L; Deng, J; Deninno, M; Derwent, P F; di Giovanni, G P; Dionisi, C; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Donati, S; Dong, P; Donini, J; Dorigo, T; Dube, S; Efron, J; Elagin, A; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, W T; Feild, R G; Feindt, M; Fernandez, J P; Ferrazza, C; Field, R; Flanagan, G; Forrest, R; Frank, M J; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; Garberson, F; Garcia, J E; Garfinkel, A F; Genser, K; Gerberich, H; Gerdes, D; Gessler, A; Giagu, S; Giakoumopoulou, V; Giannetti, P; Gibson, K; Gimmell, J L; Ginsburg, C M; Giokaris, N; Giordani, M; Giromini, P; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Golossanov, A; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Grinstein, S; Grosso-Pilcher, C; Grundler, U; Guimaraes da Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Han, B-Y; Han, J Y; Happacher, F; Hara, K; Hare, D; Hare, M; Harper, S; Harr, R F; Harris, R M; Hartz, M; Hatakeyama, K; Hays, C; Heck, M; Heijboer, A; Heinrich, J; Henderson, C; Herndon, M; Heuser, J; Hewamanage, S; Hidas, D; Hill, C S; Hirschbuehl, D; Hocker, A; Hou, S; Houlden, M; Hsu, S-C; Huffman, B T; Hughes, R E; Husemann, U; Hussein, M; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ivanov, A; James, E; Jang, D; Jayatilaka, B; Jeon, E J; Jha, M K; Jindariani, S; Johnson, W; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Kar, D; Karchin, P E; Kato, Y; Kephart, R; Keung, J; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, H W; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Knuteson, B; Ko, B R; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kreps, M; Kroll, J; Krop, D; Krumnack, N; Kruse, M; Krutelyov, V; Kubo, T; Kuhr, T; Kulkarni, N P; Kurata, M; Kwang, S; Laasanen, A T; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; Lecompte, T; Lee, E; Lee, H S; Lee, S W; Leone, S; Lewis, J D; Lin, C-S; Linacre, J; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, C; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Lovas, L; Lucchesi, D; Luci, C; Lueck, J; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Macqueen, D; Madrak, R; Maeshima, K; Makhoul, K; Maki, T; Maksimovic, P; Malde, S; Malik, S; Manca, G; Manousakis-Katsikakis, A; Margaroli, F; Marino, C; Marino, C P; Martin, A; Martin, V; Martínez, M; Martínez-Ballarín, R; Maruyama, T; Mastrandrea, P; Masubuchi, T; Mathis, M; Mattson, M E; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtala, P; Menzione, A; Merkel, P; Mesropian, C; Miao, T; Miladinovic, N; Miller, R; Mills, C; Milnik, M; Mitra, A; Mitselmakher, G; Miyake, H; Moggi, N; Moon, C S; Moore, R; Morello, M J; Morlock, J; Movilla Fernandez, P; Mülmenstädt, J; Mukherjee, A; Muller, Th; Mumford, R; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Nagano, A; Naganoma, J; Nakamura, K; Nakano, I; Napier, A; Necula, V; Nett, J; Neu, C; Neubauer, M S; Neubauer, S; Nielsen, J; Nodulman, L; Norman, M; Norniella, O; Nurse, E; Oakes, L; Oh, S H; Oh, Y D; Oksuzian, I; Okusawa, T; Orava, R; Osterberg, K; Pagan Griso, S; Palencia, E; Papadimitriou, V; Papaikonomou, A; Paramonov, A A; Parks, B; Pashapour, S

    2009-09-01

    We report on the first direct search for charged Higgs bosons decaying into cs in tt events produced by pp collisions at square root s = 1.96 TeV. The search uses a data sample corresponding to an integrated luminosity of 2.2 fb(-1) collected by the CDF II detector at Fermilab and looks for a resonance in the invariant mass distribution of two jets in the lepton + jets sample of tt candidates. We observe no evidence of charged Higgs bosons in top quark decays. Hence, 95% upper limits on the top quark decay branching ratio are placed at B(t --> H(+)b) cs)=1.0. The upper limits on B(t --> H(+)b) are also used as model-independent limits on the decay branching ratio of top quarks to generic scalar charged bosons beyond the standard model.

  18. Electrical and thermal transports of binary copper sulfides CuxS with x from 1.8 to 1.96

    Science.gov (United States)

    Qiu, Pengfei; Zhu, Yaqin; Qin, Yuting; Shi, Xun; Chen, Lidong

    2016-10-01

    In this study, a series of copper sulfides CuxS with x spanning from 1.8 to 1.96 was prepared and their crystal structures, elemental valence states, and thermoelectric properties were systematically studied. The valence state of Cu in CuxS is unchanged as the ratio of Cu/S varies, while the thermoelectric properties are very sensitive to the deficiency of Cu. In addition, the type of sulfur arrangement in the crystal structure also plays an important role on the electrical transports. Finally, the optimum Cu/S atomic ratios in the binary CuxS system were identified for high power factor and thermoelectric figure of merit.

  19. Collision geometry scaling of Au+Au pseudorapidity density from √(sNN )=19.6 to 200 GeV

    Science.gov (United States)

    Back, B. B.; Baker, M. D.; Ballintijn, M.; Barton, D. S.; Betts, R. R.; Bickley, A. A.; Bindel, R.; Budzanowski, A.; Busza, W.; Carroll, A.; Decowski, M. P.; García, E.; George, N.; Gulbrandsen, K.; Gushue, S.; Halliwell, C.; Hamblen, J.; Heintzelman, G. A.; Henderson, C.; Hofman, D. J.; Hollis, R. S.; Hołyński, R.; Holzman, B.; Iordanova, A.; Johnson, E.; Kane, J. L.; Katzy, J.; Khan, N.; Kucewicz, W.; Kulinich, P.; Kuo, C. M.; Lin, W. T.; Manly, S.; McLeod, D.; Mignerey, A. C.; Nouicer, R.; Olszewski, A.; Pak, R.; Park, I. C.; Pernegger, H.; Reed, C.; Remsberg, L. P.; Reuter, M.; Roland, C.; Roland, G.; Rosenberg, L.; Sagerer, J.; Sarin, P.; Sawicki, P.; Skulski, W.; Steinberg, P.; Stephans, G. S.; Sukhanov, A.; Tonjes, M. B.; Tang, J.-L.; Trzupek, A.; Vale, C.; van Nieuwenhuizen, G. J.; Verdier, R.; Wolfs, F. L.; Wosiek, B.; Woźniak, K.; Wuosmaa, A. H.; Wysłouch, B.

    2004-08-01

    The centrality dependence of the midrapidity charged particle multiplicity in Au+Au heavy-ion collisions at √(sNN )=19.6 and 200 GeV is presented. Within a simple model, the fraction of hard (scaling with number of binary collisions) to soft (scaling with number of participant pairs) interactions is consistent with a value of x=0.13±0.01 (stat) ±0.05 (syst) at both energies. The experimental results at both energies, scaled by inelastic p ( p¯ ) +p collision data, agree within systematic errors. The ratio of the data was found not to depend on centrality over the studied range and yields a simple linear scale factor of R200/19.6 =2.03±0.02 (stat) ±0.05 (syst) .

  20. Measurement of the Cross Section for Prompt Isolated Diphoton Production in p\\bar p Collisions at \\sqrt{s} = 1.96 TeV

    CERN Document Server

    Culbertson, Raymond; Vellidis, Constantinos

    2011-01-01

    This letter reports a measurement of the cross section of prompt isolated photon pair production in p\\bar p collisions at a total energy \\sqrt{s} = 1.96 TeV using data of 5.36/fb integrated luminosity collected with the CDF II detector at the Fermilab Tevatron. The measured cross section, differential in basic kinematic variables, is compared with three perturbative QCD predictions, a Leading Order (LO) parton shower calculation and two Next-to-Leading Order (NLO) calculations. The NLO calculations reproduce most aspects of the data. By including photon radiation from quarks before and after hard scattering, the parton shower prediction becomes competitive with the NLO predictions.

  1. Studies of high-transverse momentum jet substructure and top quarks produced in 1.96 TeV proton-antiproton collisions

    Science.gov (United States)

    Aaltonen, T.; Alon, R.; Amerio, S.; Amidei, D.; Anastassov, A.; Annovi, A.; Antos, J.; Apollinari, G.; Appel, J. A.; Arisawa, T.; Artikov, A.; Asaadi, J.; Ashmanskas, W.; Auerbach, B.; Aurisano, A.; Azfar, F.; Badgett, W.; Bae, T.; Barbaro-Galtieri, A.; Barnes, V. E.; Barnett, B. A.; Barria, P.; Bartos, P.; Bauce, M.; Bedeschi, F.; Behari, S.; Bellettini, G.; Bellinger, J.; Benjamin, D.; Beretvas, A.; Bhatti, A.; Bland, K. R.; Blumenfeld, B.; Bocci, A.; Bodek, A.; Bortoletto, D.; Boudreau, J.; Boveia, A.; Brigliadori, L.; Bromberg, C.; Brucken, E.; Budagov, J.; Budd, H. S.; Burkett, K.; Busetto, G.; Bussey, P.; Butti, P.; Buzatu, A.; Calamba, A.; Camarda, S.; Campanelli, M.; Canelli, F.; Carls, B.; Carlsmith, D.; Carosi, R.; Carrillo, S.; Casal, B.; Casarsa, M.; Castro, A.; Catastini, P.; Cauz, D.; Cavaliere, V.; Cerri, A.; Cerrito, L.; Chen, Y. C.; Chertok, M.; Chiarelli, G.; Chlachidze, G.; Cho, K.; Chokheli, D.; Clark, A.; Clarke, C.; Convery, M. E.; Conway, J.; Corbo, M.; Cordelli, M.; Cox, C. A.; Cox, D. J.; Cremonesi, M.; Cruz, D.; Cuevas, J.; Culbertson, R.; d'Ascenzo, N.; Datta, M.; de Barbaro, P.; Demortier, L.; Deninno, M.; D'Errico, M.; Devoto, F.; Di Canto, A.; Di Ruzza, B.; Dittmann, J. R.; Donati, S.; D'Onofrio, M.; Dorigo, M.; Driutti, A.; Duchovni, E.; Ebina, K.; Edgar, R.; Elagin, A.; Erbacher, R.; Errede, S.; Esham, B.; Farrington, S.; Fernández Ramos, J. P.; Field, R.; Flanagan, G.; Forrest, R.; Franklin, M.; Freeman, J. C.; Frisch, H.; Funakoshi, Y.; Galloni, C.; Garfinkel, A. F.; Garosi, P.; Gerberich, H.; Gerchtein, E.; Giagu, S.; Giakoumopoulou, V.; Gibson, K.; Ginsburg, C. M.; Giokaris, N.; Giromini, P.; Glagolev, V.; Glenzinski, D.; Gold, M.; Goldin, D.; Golossanov, A.; Gomez, G.; Gomez-Ceballos, G.; Goncharov, M.; González López, O.; Gorelov, I.; Goshaw, A. T.; Goulianos, K.; Gramellini, E.; Grosso-Pilcher, C.; Group, R. C.; Guimaraes da Costa, J.; Hahn, S. R.; Han, J. Y.; Happacher, F.; Hara, K.; Hare, M.; Harr, R. F.; Harrington-Taber, T.; Hatakeyama, K.; Hays, C.; Heinrich, J.; Herndon, M.; Hocker, A.; Hong, Z.; Hopkins, W.; Hou, S.; Hughes, R. E.; Husemann, U.; Hussein, M.; Huston, J.; Introzzi, G.; Iori, M.; Ivanov, A.; James, E.; Jang, D.; Jayatilaka, B.; Jeon, E. J.; Jindariani, S.; Jones, M.; Joo, K. K.; Jun, S. Y.; Junk, T. R.; Kambeitz, M.; Kamon, T.; Karchin, P. E.; Kasmi, A.; Kato, Y.; Ketchum, W.; Keung, J.; Kilminster, B.; Kim, D. H.; Kim, H. S.; Kim, J. E.; Kim, M. J.; Kim, S. H.; Kim, S. B.; Kim, Y. J.; Kim, Y. K.; Kimura, N.; Kirby, M.; Knoepfel, K.; Kondo, K.; Kong, D. J.; Konigsberg, J.; Kotwal, A. V.; Kreps, M.; Kroll, J.; Kruse, M.; Kuhr, T.; Kurata, M.; Laasanen, A. T.; Lammel, S.; Lancaster, M.; Lannon, K.; Latino, G.; Lee, H. S.; Lee, J. S.; Leo, S.; Leone, S.; Lewis, J. D.; Limosani, A.; Lipeles, E.; Lister, A.; Liu, H.; Liu, Q.; Liu, T.; Lockwitz, S.; Loginov, A.; Lucchesi, D.; Lucà, A.; Lueck, J.; Lujan, P.; Lukens, P.; Lungu, G.; Lys, J.; Lysak, R.; Madrak, R.; Maestro, P.; Malik, S.; Manca, G.; Manousakis-Katsikakis, A.; Marchese, L.; Margaroli, F.; Marino, P.; Matera, K.; Mattson, M. E.; Mazzacane, A.; Mazzanti, P.; McNulty, R.; Mehta, A.; Mehtala, P.; Mesropian, C.; Miao, T.; Mietlicki, D.; Mitra, A.; Miyake, H.; Moed, S.; Moggi, N.; Moon, C. S.; Moore, R.; Morello, M. J.; Mukherjee, A.; Muller, Th.; Murat, P.; Mussini, M.; Nachtman, J.; Nagai, Y.; Naganoma, J.; Nakano, I.; Napier, A.; Nett, J.; Neu, C.; Nigmanov, T.; Nodulman, L.; Noh, S. Y.; Norniella, O.; Oakes, L.; Oh, S. H.; Oh, Y. D.; Oksuzian, I.; Okusawa, T.; Orava, R.; Ortolan, L.; Pagliarone, C.; Palencia, E.; Palni, P.; Papadimitriou, V.; Parker, W.; Pauletta, G.; Paulini, M.; Paus, C.; Perez, G.; Phillips, T. J.; Piacentino, G.; Pianori, E.; Pilot, J.; Pitts, K.; Plager, C.; Pondrom, L.; Poprocki, S.; Potamianos, K.; Pranko, A.; Prokoshin, F.; Ptohos, F.; Punzi, G.; Redondo Fernández, I.; Renton, P.; Rescigno, M.; Rimondi, F.; Ristori, L.; Robson, A.; Rodriguez, T.; Rolli, S.; Ronzani, M.; Roser, R.; Rosner, J. L.; Ruffini, F.; Ruiz, A.; Russ, J.; Rusu, V.; Sakumoto, W. K.; Sakurai, Y.; Santi, L.; Sato, K.; Saveliev, V.; Savoy-Navarro, A.; Schlabach, P.; Schmidt, E. E.; Schwarz, T.; Scodellaro, L.; Scuri, F.; Seidel, S.; Seiya, Y.; Semenov, A.; Sforza, F.; Shalhout, S. Z.; Shears, T.; Shepard, P. F.; Shimojima, M.; Shochet, M.; Shreyber-Tecker, I.; Simonenko, A.; Sinervo, P.; Sliwa, K.; Smith, J. R.; Snider, F. D.; Song, H.; Sorin, V.; St. Denis, R.; Stancari, M.; Stentz, D.; Strologas, J.; Sudo, Y.; Sukhanov, A.; Suslov, I.; Takemasa, K.; Takeuchi, Y.; Tang, J.; Tecchio, M.; Teng, P. K.; Thom, J.; Thomson, E.; Thukral, V.; Toback, D.; Tokar, S.; Tollefson, K.; Tomura, T.; Tonelli, D.; Torre, S.; Torretta, D.; Totaro, P.; Trovato, M.; Ukegawa, F.; Uozumi, S.; Vázquez, F.; Velev, G.; Vellidis, C.; Vernieri, C.; Vidal, M.; Vilar, R.; Vizán, J.; Vogel, M.; Volpi, G.; Wagner, P.; Wallny, R.; Wang, S. M.; Waters, D.; Wester, W. C.; Whiteson, D.; Wicklund, A. B.; Wilbur, S.; Williams, H. H.; Wilson, J. S.; Wilson, P.; Winer, B. L.; Wittich, P.; Wolbers, S.; Wolfe, H.; Wright, T.; Wu, X.; Wu, Z.; Yamamoto, K.; Yamato, D.; Yang, T.; Yang, U. K.; Yang, Y. C.; Yao, W.-M.; Yeh, G. P.; Yi, K.; Yoh, J.; Yorita, K.; Yoshida, T.; Yu, G. B.; Yu, I.; Zanetti, A. M.; Zeng, Y.; Zhou, C.; Zucchelli, S.; CDF Collaboration

    2015-02-01

    Results of a study of the substructure of the highest transverse momentum (pT) jets observed by the CDF Collaboration are presented. Events containing at least one jet with pT>400 GeV /c in a sample corresponding to an integrated luminosity of 5.95 fb-1 , collected in 1.96 TeV proton-antiproton collisions at the Fermilab Tevatron collider, are selected. A study of the jet mass, angularity, and planar-flow distributions is presented, and the measurements are compared with predictions of perturbative quantum chromodynamics. A search for boosted top-quark production is also described, leading to a 95% confidence level upper limit of 38 fb on the production cross section of top quarks with pT>400 GeV /c .

  2. Signature-based search for delayed photons in exclusive photon plus missing transverse energy events from pp¯ collisions with s=1.96TeV

    Science.gov (United States)

    Aaltonen, T.; Amerio, S.; Amidei, D.; Anastassov, A.; Annovi, A.; Antos, J.; Apollinari, G.; Appel, J. A.; Arisawa, T.; Artikov, A.; Asaadi, J.; Ashmanskas, W.; Auerbach, B.; Aurisano, A.; Azfar, F.; Badgett, W.; Bae, T.; Barbaro-Galtieri, A.; Barnes, V. E.; Barnett, B. A.; Barria, P.; Bartos, P.; Bauce, M.; Bedeschi, F.; Behari, S.; Bellettini, G.; Bellinger, J.; Benjamin, D.; Beretvas, A.; Bhatti, A.; Bland, K. R.; Blumenfeld, B.; Bocci, A.; Bodek, A.; Bortoletto, D.; Boudreau, J.; Boveia, A.; Brigliadori, L.; Bromberg, C.; Brucken, E.; Budagov, J.; Budd, H. S.; Burkett, K.; Busetto, G.; Bussey, P.; Butti, P.; Buzatu, A.; Calamba, A.; Camarda, S.; Campanelli, M.; Canelli, F.; Carls, B.; Carlsmith, D.; Carosi, R.; Carrillo, S.; Casal, B.; Casarsa, M.; Castro, A.; Catastini, P.; Cauz, D.; Cavaliere, V.; Cavalli-Sforza, M.; Cerri, A.; Cerrito, L.; Chen, Y. C.; Chertok, M.; Chiarelli, G.; Chlachidze, G.; Cho, K.; Chokheli, D.; Ciocci, M. A.; Clark, A.; Clarke, C.; Convery, M. E.; Conway, J.; Corbo, M.; Cordelli, M.; Cox, C. A.; Cox, D. J.; Cremonesi, M.; Cruz, D.; Cuevas, J.; Culbertson, R.; d'Ascenzo, N.; Datta, M.; De Barbaro, P.; Demortier, L.; Deninno, M.; d'Errico, M.; Devoto, F.; Di Canto, A.; Di Ruzza, B.; Dittmann, J. R.; D'Onofrio, M.; Donati, S.; Dorigo, M.; Driutti, A.; Ebina, K.; Edgar, R.; Elagin, A.; Erbacher, R.; Errede, S.; Esham, B.; Eusebi, R.; Farrington, S.; Fernández Ramos, J. P.; Field, R.; Flanagan, G.; Forrest, R.; Franklin, M.; Freeman, J. C.; Frisch, H.; Funakoshi, Y.; Garfinkel, A. F.; Garosi, P.; Gerberich, H.; Gerchtein, E.; Giagu, S.; Giakoumopoulou, V.; Gibson, K.; Ginsburg, C. M.; Giokaris, N.; Giromini, P.; Giurgiu, G.; Glagolev, V.; Glenzinski, D.; Gold, M.; Goldin, D.; Golossanov, A.; Gomez, G.; Gomez-Ceballos, G.; Goncharov, M.; González López, O.; Gorelov, I.; Goshaw, A. T.; Goulianos, K.; Gramellini, E.; Grinstein, S.; Grosso-Pilcher, C.; Group, R. C.; Guimaraes da Costa, J.; Hahn, S. R.; Han, J. Y.; Happacher, F.; Hara, K.; Hare, M.; Harr, R. F.; Harrington-Taber, T.; Hatakeyama, K.; Hays, C.; Heinrich, J.; Herndon, M.; Hocker, A.; Hong, Z.; Hopkins, W.; Hou, S.; Hughes, R. E.; Husemann, U.; Hussein, M.; Huston, J.; Introzzi, G.; Iori, M.; Ivanov, A.; James, E.; Jang, D.; Jayatilaka, B.; Jeon, E. J.; Jindariani, S.; Jones, M.; Joo, K. K.; Jun, S. Y.; Junk, T. R.; Kambeitz, M.; Kamon, T.; Karchin, P. E.; Kasmi, A.; Kato, Y.; Ketchum, W.; Keung, J.; Kilminster, B.; Kim, D. H.; Kim, H. S.; Kim, J. E.; Kim, M. J.; Kim, S. B.; Kim, S. H.; Kim, Y. J.; Kim, Y. K.; Kimura, N.; Kirby, M.; Knoepfel, K.; Kondo, K.; Kong, D. J.; Konigsberg, J.; Kotwal, A. V.; Kreps, M.; Kroll, J.; Kruse, M.; Kuhr, T.; Kurata, M.; Laasanen, A. T.; Lammel, S.; Lancaster, M.; Lannon, K.; Latino, G.; Lee, H. S.; Lee, J. S.; Leo, S.; Leone, S.; Lewis, J. D.; Limosani, A.; Lipeles, E.; Lister, A.; Liu, H.; Liu, Q.; Liu, T.; Lockwitz, S.; Loginov, A.; Lucà, A.; Lucchesi, D.; Lueck, J.; Lujan, P.; Lukens, P.; Lungu, G.; Lys, J.; Lysak, R.; Madrak, R.; Maestro, P.; Malik, S.; Manca, G.; Manousakis-Katsikakis, A.; Margaroli, F.; Marino, P.; Martínez, M.; Matera, K.; Mattson, M. E.; Mazzacane, A.; Mazzanti, P.; McNulty, R.; Mehta, A.; Mehtala, P.; Mesropian, C.; Miao, T.; Mietlicki, D.; Mitra, A.; Miyake, H.; Moed, S.; Moggi, N.; Moon, C. S.; Moore, R.; Morello, M. J.; Mukherjee, A.; Muller, Th.; Murat, P.; Mussini, M.; Nachtman, J.; Nagai, Y.; Naganoma, J.; Nakano, I.; Napier, A.; Nett, J.; Neu, C.; Nigmanov, T.; Nodulman, L.; Noh, S. Y.; Norniella, O.; Oakes, L.; Oh, S. H.; Oh, Y. D.; Oksuzian, I.; Okusawa, T.; Orava, R.; Ortolan, L.; Pagliarone, C.; Palencia, E.; Palni, P.; Papadimitriou, V.; Parker, W.; Pauletta, G.; Paulini, M.; Paus, C.; Phillips, T. J.; Piacentino, G.; Pianori, E.; Pilot, J.; Pitts, K.; Plager, C.; Pondrom, L.; Poprocki, S.; Potamianos, K.; Pranko, A.; Prokoshin, F.; Ptohos, F.; Punzi, G.; Ranjan, N.; Redondo Fernández, I.; Renton, P.; Rescigno, M.; Rimondi, F.; Ristori, L.; Robson, A.; Rodriguez, T.; Rolli, S.; Ronzani, M.; Roser, R.; Rosner, J. L.; Ruffini, F.; Ruiz, A.; Russ, J.; Rusu, V.; Sakumoto, W. K.; Sakurai, Y.; Santi, L.; Sato, K.; Saveliev, V.; Savoy-Navarro, A.; Schlabach, P.; Schmidt, E. E.; Schwarz, T.; Scodellaro, L.; Scuri, F.; Seidel, S.; Seiya, Y.; Semenov, A.; Sforza, F.; Shalhout, S. Z.; Shears, T.; Shepard, P. F.; Shimojima, M.; Shochet, M.; Shreyber-Tecker, I.; Simonenko, A.; Sinervo, P.; Sliwa, K.; Smith, J. R.; Snider, F. D.; Song, H.; Sorin, V.; Stancari, M.; Denis, R. St.; Stelzer, B.; Stelzer-Chilton, O.; Stentz, D.; Strologas, J.; Sudo, Y.; Sukhanov, A.; Suslov, I.; Takemasa, K.; Takeuchi, Y.; Tang, J.; Tecchio, M.; Teng, P. K.; Thom, J.; Thomson, E.; Thukral, V.; Toback, D.; Tokar, S.; Tollefson, K.; Tomura, T.; Tonelli, D.; Torre, S.; Torretta, D.; Totaro, P.; Trovato, M.; Ukegawa, F.; Uozumi, S.; Vázquez, F.; Velev, G.; Vellidis, C.; Vernieri, C.; Vidal, M.; Vilar, R.; Vizán, J.; Vogel, M.; Volpi, G.; Wagner, P.; Wallny, R.; Wang, S. M.; Warburton, A.; Waters, D.; Wester, W. C., III; Whiteson, D.; Wicklund, A. B.; Wilbur, S.; Williams, H. H.; Wilson, J. S.; Wilson, P.; Winer, B. L.; Wittich, P.; Wolbers, S.; Wolfe, H.; Wright, T.; Wu, X.; Wu, Z.; Yamamoto, K.; Yamato, D.; Yang, T.; Yang, U. K.; Yang, Y. C.; Yao, W.-M.; Yeh, G. P.; Yi, K.; Yoh, J.; Yorita, K.; Yoshida, T.; Yu, G. B.; Yu, I.; Zanetti, A. M.; Zeng, Y.; Zhou, C.; Zucchelli, S.

    2013-08-01

    We present the first signature-based search for delayed photons using an exclusive photon plus missing transverse energy final state. Events are reconstructed in a data sample from the CDF II detector corresponding to 6.3fb-1 of integrated luminosity from s=1.96TeV proton-antiproton collisions. Candidate events are selected if they contain a photon with an arrival time in the detector larger than expected from a promptly produced photon. The mean number of events from standard model sources predicted by the data-driven background model based on the photon timing distribution is 286±24. A total of 322 events are observed. A p value of 12% is obtained, showing consistency of the data with standard model predictions.

  3. Search for pair production of strongly interacting particles decaying to pairs of jets in pp collisions at √s=1.96 TeV.

    Science.gov (United States)

    Aaltonen, T; Albin, E; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Apollinari, G; Appel, J A; Arisawa, T; Artikov, A; Asaadi, J; Ashmanskas, W; Auerbach, B; Aurisano, A; Azfar, F; Badgett, W; Bae, T; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Barria, P; Bartos, P; Bauce, M; Bedeschi, F; Behari, S; Bellettini, G; Bellinger, J; Benjamin, D; Beretvas, A; Bhatti, A; Bland, K R; Blumenfeld, B; Bocci, A; Bodek, A; Bortoletto, D; Boudreau, J; Boveia, A; Brigliadori, L; Bromberg, C; Brucken, E; Budagov, J; Budd, H S; Burkett, K; Busetto, G; Bussey, P; Butti, P; Buzatu, A; Calamba, A; Camarda, S; Campanelli, M; Canelli, F; Carls, B; Carlsmith, D; Carosi, R; Carrillo, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavaliere, V; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Cho, K; Chokheli, D; Ciocci, M A; Clark, A; Clarke, C; Convery, M E; Conway, J; Corbo, M; Cordelli, M; Cox, C A; Cox, D J; Cremonesi, M; Cruz, D; Cuevas, J; Culbertson, R; d'Ascenzo, N; Datta, M; De Barbaro, P; Demortier, L; Deninno, M; Devoto, F; d'Errico, M; Di Canto, A; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Donati, S; Dorigo, M; Driutti, A; Ebina, K; Edgar, R; Elagin, A; Erbacher, R; Errede, S; Esham, B; Eusebi, R; Farrington, S; Fernández Ramos, J P; Field, R; Flanagan, G; Forrest, R; Franklin, M; Freeman, J C; Frisch, H; Funakoshi, Y; Garfinkel, A F; Garosi, P; Gerberich, H; Gerchtein, E; Giagu, S; Giakoumopoulou, V; Gibson, K; Ginsburg, C M; Giokaris, N; Giromini, P; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldin, D; Golossanov, A; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González López, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gramellini, E; Grinstein, S; Grosso-Pilcher, C; Group, R C; Guimaraes da Costa, J; Hahn, S R; Han, J Y; Happacher, F; Hara, K; Hare, M; Harr, R F; Harrington-Taber, T; Hatakeyama, K; Hays, C; Heinrich, J; Herndon, M; Hocker, A; Hong, Z; Hopkins, W; Hou, S; Hughes, R E; Husemann, U; Hussein, M; Huston, J; Introzzi, G; Iori, M; Ivanov, A; James, E; Jang, D; Jayatilaka, B; Jeon, E J; Jindariani, S; Jones, M; Joo, K K; Jun, S Y; Junk, T R; Kambeitz, M; Kamon, T; Karchin, P E; Kasmi, A; Kato, Y; Ketchum, W; Keung, J; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kim, Y J; Kimura, N; Kirby, M; Knoepfel, K; Kondo, K; Kong, D J; Konigsberg, J; Kotwal, A V; Kreps, M; Kroll, J; Kruse, M; Kuhr, T; Kurata, M; Laasanen, A T; Lammel, S; Lancaster, M; Lannon, K; Latino, G; Lee, H S; Lee, J S; Leo, S; Leone, S; Lewis, J D; Limosani, A; Lipeles, E; Liu, H; Liu, Q; Liu, T; Lockwitz, S; Loginov, A; Lucchesi, D; Lueck, J; Lujan, P; Lukens, P; Lungu, G; Lys, J; Lysak, R; Madrak, R; Maestro, P; Malik, S; Manca, G; Manousakis-Katsikakis, A; Margaroli, F; Marino, P; Martínez, M; Matera, K; Mattson, M E; Mazzacane, A; Mazzanti, P; McNulty, R; Mehta, A; Mehtala, P; Mesropian, C; Miao, T; Mietlicki, D; Mitra, A; Miyake, H; Moed, S; Moggi, N; Moon, C S; Moore, R; Morello, M J; Mukherjee, A; Muller, Th; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Naganoma, J; Nakano, I; Napier, A; Nett, J; Neu, C; Nigmanov, T; Nodulman, L; Noh, S Y; Norniella, O; Oakes, L; Oh, S H; Oh, Y D; Oksuzian, I; Okusawa, T; Orava, R; Ortolan, L; Pagliarone, C; Palencia, E; Palni, P; Papadimitriou, V; Parker, W; Pauletta, G; Paulini, M; Paus, C; Phillips, T J; Piacentino, G; Pianori, E; Pilot, J; Pitts, K; Plager, C; Pondrom, L; Poprocki, S; Potamianos, K; Prokoshin, F; Pranko, A; Ptohos, F; Punzi, G; Ranjan, N; Redondo Fernández, I; Renton, P; Rescigno, M; Riddick, T; Rimondi, F; Ristori, L; Robson, A; Rodriguez, T; Rolli, S; Ronzani, M; Roser, R; Rosner, J L; Ruffini, F; Ruiz, A; Russ, J; Rusu, V; Safonov, A; Sakumoto, W K; Sakurai, Y; Santi, L; Sato, K; Saveliev, V; Savoy-Navarro, A; Schlabach, P; Schmidt, E E; Schwarz, T; Scodellaro, L; Scuri, F; Seidel, S; Seiya, Y; Semenov, A; Sforza, F; Shalhout, S Z; Shears, T; Shepard, P F; Shimojima, M; Shochet, M; Shreyber-Tecker, I; Simonenko, A; Sinervo, P; Sliwa, K; Smith, J R; Snider, F D; Sorin, V; Song, H; Stancari, M; St Denis, R; Stelzer, B; Stelzer-Chilton, O; Stentz, D; Strologas, J; Sudo, Y; Sukhanov, A; Suslov, I; Takemasa, K; Takeuchi, Y; Tang, J; Tecchio, M; Teng, P K; Thom, J; Thomson, E; Thukral, V; Toback, D; Tokar, S; Tollefson, K; Tomura, T; Tonelli, D; Torre, S; Torretta, D; Totaro, P; Trovato, M; Ukegawa, F; Uozumi, S; Vázquez, F; Velev, G; Vellidis, C; Vernieri, C; Vidal, M; Vilar, R; Vizán, J; Vogel, M; Volpi, G; Wagner, P; Wallny, R; Wang, S M; Warburton, A; Waters, D; Wester, W C; Whiteson, D; Wicklund, A B; Wilbur, S; Williams, H H; Wilson, J S; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolfe, H; Wright, T; Wu, X; Wu, Z; Yamamoto, K; Yamato, D; Yang, T; Yang, U K; Yang, Y C; Yao, W-M; Yeh, G P; Yi, K; Yoh, J; Yorita, K; Yoshida, T; Yu, G B; Yu, I; Zanetti, A M; Zeng, Y; Zhou, C; Zucchelli, S

    2013-07-19

    We present a search for the pair production of a narrow nonstandard-model strongly interacting particle that decays to a pair of quarks or gluons, leading to a final state with four hadronic jets. We consider both nonresonant production via an intermediate gluon as well as resonant production via a distinct nonstandard-model intermediate strongly interacting particle. We use data collected by the CDF experiment in proton-antiproton collisions at √[s]=1.96 TeV corresponding to an integrated luminosity of 6.6 fb(-1). We find the data to be consistent with nonresonant production. We report limits on σ(pp[over ¯]→jjjj) as a function of the masses of the hypothetical intermediate particles. Upper limits on the production cross sections for nonstandard-model particles in several resonant and nonresonant processes are also derived.

  4. Search for Pair Production of Strongly Interacting Particles Decaying to Pairs of Jets in pp¯ Collisions at s=1.96TeV

    Science.gov (United States)

    Aaltonen, T.; Albin, E.; Amerio, S.; Amidei, D.; Anastassov, A.; Annovi, A.; Antos, J.; Apollinari, G.; Appel, J. A.; Arisawa, T.; Artikov, A.; Asaadi, J.; Ashmanskas, W.; Auerbach, B.; Aurisano, A.; Azfar, F.; Badgett, W.; Bae, T.; Barbaro-Galtieri, A.; Barnes, V. E.; Barnett, B. A.; Barria, P.; Bartos, P.; Bauce, M.; Bedeschi, F.; Behari, S.; Bellettini, G.; Bellinger, J.; Benjamin, D.; Beretvas, A.; Bhatti, A.; Bland, K. R.; Blumenfeld, B.; Bocci, A.; Bodek, A.; Bortoletto, D.; Boudreau, J.; Boveia, A.; Brigliadori, L.; Bromberg, C.; Brucken, E.; Budagov, J.; Budd, H. S.; Burkett, K.; Busetto, G.; Bussey, P.; Butti, P.; Buzatu, A.; Calamba, A.; Camarda, S.; Campanelli, M.; Canelli, F.; Carls, B.; Carlsmith, D.; Carosi, R.; Carrillo, S.; Casal, B.; Casarsa, M.; Castro, A.; Catastini, P.; Cauz, D.; Cavaliere, V.; Cavalli-Sforza, M.; Cerri, A.; Cerrito, L.; Chen, Y. C.; Chertok, M.; Chiarelli, G.; Chlachidze, G.; Cho, K.; Chokheli, D.; Ciocci, M. A.; Clark, A.; Clarke, C.; Convery, M. E.; Conway, J.; Corbo, M.; Cordelli, M.; Cox, C. A.; Cox, D. J.; Cremonesi, M.; Cruz, D.; Cuevas, J.; Culbertson, R.; d'Ascenzo, N.; Datta, M.; De Barbaro, P.; Demortier, L.; Deninno, M.; Devoto, F.; d'Errico, M.; Di Canto, A.; Di Ruzza, B.; Dittmann, J. R.; D'Onofrio, M.; Donati, S.; Dorigo, M.; Driutti, A.; Ebina, K.; Edgar, R.; Elagin, A.; Erbacher, R.; Errede, S.; Esham, B.; Eusebi, R.; Farrington, S.; Fernández Ramos, J. P.; Field, R.; Flanagan, G.; Forrest, R.; Franklin, M.; Freeman, J. C.; Frisch, H.; Funakoshi, Y.; Garfinkel, A. F.; Garosi, P.; Gerberich, H.; Gerchtein, E.; Giagu, S.; Giakoumopoulou, V.; Gibson, K.; Ginsburg, C. M.; Giokaris, N.; Giromini, P.; Giurgiu, G.; Glagolev, V.; Glenzinski, D.; Gold, M.; Goldin, D.; Golossanov, A.; Gomez, G.; Gomez-Ceballos, G.; Goncharov, M.; González López, O.; Gorelov, I.; Goshaw, A. T.; Goulianos, K.; Gramellini, E.; Grinstein, S.; Grosso-Pilcher, C.; Group, R. C.; Guimaraes da Costa, J.; Hahn, S. R.; Han, J. Y.; Happacher, F.; Hara, K.; Hare, M.; Harr, R. F.; Harrington-Taber, T.; Hatakeyama, K.; Hays, C.; Heinrich, J.; Herndon, M.; Hocker, A.; Hong, Z.; Hopkins, W.; Hou, S.; Hughes, R. E.; Husemann, U.; Hussein, M.; Huston, J.; Introzzi, G.; Iori, M.; Ivanov, A.; James, E.; Jang, D.; Jayatilaka, B.; Jeon, E. J.; Jindariani, S.; Jones, M.; Joo, K. K.; Jun, S. Y.; Junk, T. R.; Kambeitz, M.; Kamon, T.; Karchin, P. E.; Kasmi, A.; Kato, Y.; Ketchum, W.; Keung, J.; Kilminster, B.; Kim, D. H.; Kim, H. S.; Kim, J. E.; Kim, M. J.; Kim, S. B.; Kim, S. H.; Kim, Y. K.; Kim, Y. J.; Kimura, N.; Kirby, M.; Knoepfel, K.; Kondo, K.; Kong, D. J.; Konigsberg, J.; Kotwal, A. V.; Kreps, M.; Kroll, J.; Kruse, M.; Kuhr, T.; Kurata, M.; Laasanen, A. T.; Lammel, S.; Lancaster, M.; Lannon, K.; Latino, G.; Lee, H. S.; Lee, J. S.; Leo, S.; Leone, S.; Lewis, J. D.; Limosani, A.; Lipeles, E.; Liu, H.; Liu, Q.; Liu, T.; Lockwitz, S.; Loginov, A.; Lucchesi, D.; Lueck, J.; Lujan, P.; Lukens, P.; Lungu, G.; Lys, J.; Lysak, R.; Madrak, R.; Maestro, P.; Malik, S.; Manca, G.; Manousakis-Katsikakis, A.; Margaroli, F.; Marino, P.; Martínez, M.; Matera, K.; Mattson, M. E.; Mazzacane, A.; Mazzanti, P.; McNulty, R.; Mehta, A.; Mehtala, P.; Mesropian, C.; Miao, T.; Mietlicki, D.; Mitra, A.; Miyake, H.; Moed, S.; Moggi, N.; Moon, C. S.; Moore, R.; Morello, M. J.; Mukherjee, A.; Muller, Th.; Murat, P.; Mussini, M.; Nachtman, J.; Nagai, Y.; Naganoma, J.; Nakano, I.; Napier, A.; Nett, J.; Neu, C.; Nigmanov, T.; Nodulman, L.; Noh, S. Y.; Norniella, O.; Oakes, L.; Oh, S. H.; Oh, Y. D.; Oksuzian, I.; Okusawa, T.; Orava, R.; Ortolan, L.; Pagliarone, C.; Palencia, E.; Palni, P.; Papadimitriou, V.; Parker, W.; Pauletta, G.; Paulini, M.; Paus, C.; Phillips, T. J.; Piacentino, G.; Pianori, E.; Pilot, J.; Pitts, K.; Plager, C.; Pondrom, L.; Poprocki, S.; Potamianos, K.; Prokoshin, F.; Pranko, A.; Ptohos, F.; Punzi, G.; Ranjan, N.; Redondo Fernández, I.; Renton, P.; Rescigno, M.; Riddick, T.; Rimondi, F.; Ristori, L.; Robson, A.; Rodriguez, T.; Rolli, S.; Ronzani, M.; Roser, R.; Rosner, J. L.; Ruffini, F.; Ruiz, A.; Russ, J.; Rusu, V.; Safonov, A.; Sakumoto, W. K.; Sakurai, Y.; Santi, L.; Sato, K.; Saveliev, V.; Savoy-Navarro, A.; Schlabach, P.; Schmidt, E. E.; Schwarz, T.; Scodellaro, L.; Scuri, F.; Seidel, S.; Seiya, Y.; Semenov, A.; Sforza, F.; Shalhout, S. Z.; Shears, T.; Shepard, P. F.; Shimojima, M.; Shochet, M.; Shreyber-Tecker, I.; Simonenko, A.; Sinervo, P.; Sliwa, K.; Smith, J. R.; Snider, F. D.; Sorin, V.; Song, H.; Stancari, M.; Denis, R. St.; Stelzer, B.; Stelzer-Chilton, O.; Stentz, D.; Strologas, J.; Sudo, Y.; Sukhanov, A.; Suslov, I.; Takemasa, K.; Takeuchi, Y.; Tang, J.; Tecchio, M.; Teng, P. K.; Thom, J.; Thomson, E.; Thukral, V.; Toback, D.; Tokar, S.; Tollefson, K.; Tomura, T.; Tonelli, D.; Torre, S.; Torretta, D.; Totaro, P.; Trovato, M.; Ukegawa, F.; Uozumi, S.; Vázquez, F.; Velev, G.; Vellidis, C.; Vernieri, C.; Vidal, M.; Vilar, R.; Vizán, J.; Vogel, M.; Volpi, G.; Wagner, P.; Wallny, R.; Wang, S. M.; Warburton, A.; Waters, D.; Wester, W. C., III; Whiteson, D.; Wicklund, A. B.; Wilbur, S.; Williams, H. H.; Wilson, J. S.; Wilson, P.; Winer, B. L.; Wittich, P.; Wolbers, S.; Wolfe, H.; Wright, T.; Wu, X.; Wu, Z.; Yamamoto, K.; Yamato, D.; Yang, T.; Yang, U. K.; Yang, Y. C.; Yao, W.-M.; Yeh, G. P.; Yi, K.; Yoh, J.; Yorita, K.; Yoshida, T.; Yu, G. B.; Yu, I.; Zanetti, A. M.; Zeng, Y.; Zhou, C.; Zucchelli, S.

    2013-07-01

    We present a search for the pair production of a narrow nonstandard-model strongly interacting particle that decays to a pair of quarks or gluons, leading to a final state with four hadronic jets. We consider both nonresonant production via an intermediate gluon as well as resonant production via a distinct nonstandard-model intermediate strongly interacting particle. We use data collected by the CDF experiment in proton-antiproton collisions at s=1.96TeV corresponding to an integrated luminosity of 6.6fb-1. We find the data to be consistent with nonresonant production. We report limits on σ(pp¯→jjjj) as a function of the masses of the hypothetical intermediate particles. Upper limits on the production cross sections for nonstandard-model particles in several resonant and nonresonant processes are also derived.

  5. Search for first-generation scalar leptoquarks in p anti-p collisions at s**(1/2) = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abazov, V.M.; Abbott, B.; Abolins, M.; Acharya, B.S.; Adams, M.; Adams, T.; Agelou, M.; Agram, J.-L.; Ahn, S.H.; Ahsan, M.; Alexeev, G.D.; Alkhazov, G.; Alton, A.; Alverson, G.; Alves, G.A.; Anastasoaie, M.; Andeen, T.; Anderson, S.; Andrieu, B.; Arnoud, Y.; Askew, A.; /Buenos Aires U. /Rio de Janeiro, CBPF /Rio de Janeiro State U. /Sao

    2004-12-01

    The authors report on a search for pair production of first-generation scalar leptoquarks (LQ) in p{bar p} collisions at {radical}s = 1.96 TeV using an integrated luminosity of 252 pb{sup -1} collected at the Fermilab Tevatron collider by the D0 detector. They observe no evidence for LQ production in the topologies arising from LQ{ovr LQ} {yields} eqeq and LQ{ovr LQ} {yields} eqvq, and derive 95% C.L. lower limits on the LQ mass as a function of {beta}, where {beta} is the branching fraction for LQ {yields} eq. The limits are 241 and 218 GeV/c{sup 2} for {beta} = 1 and 0.5, respectively. These results are combined with those obtained by D0 at {radical}s = 1.8 TeV, which increases these LQ mass limits to 256 and 234 GeV/c{sup 2}.

  6. First observation of dijet events with an antiproton tag at s**(1/2) = 1.96 TeV using the D0 Forward Proton Detector

    Energy Technology Data Exchange (ETDEWEB)

    Strang, Michael Allen

    2005-07-01

    The Forward Proton Detector (FPD) is a new sub-system of the D0 detector, a 5000 ton particle physics detector located at the Fermilab Tevatron proton-antiproton collider. The FPD was implemented for the Tevatron Run II and gives access to a wide range of diffractive scattering processes, where one or both of the beam particles remain intact. The analysis described in this thesis makes use of the dipole spectrometer of the FPD to tag outgoing antiprotons in events that have a dijet signature in the central D0 calorimeter. Properties of jets with a diffractive tag signature are compared to jets without such a signature yielding the first observation of tagged diffractive dijets at a 1.96 TeV center-of-mass energy.

  7. Evidence for electroweak top quark production in proton-antiproton collisions at s**(1/2) = 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Gadfort, Thomas; /Washington U., Seattle

    2007-04-01

    We present the first evidence for electroweak single top quark production using nearly 1 fb{sup -1} of Tevatron Run II data at {radical}s = 1.96 TeV. We select single-top-like data events in the lepton+jets decay channel and separate them from backgrounds using the matrix element analysis method. This technique uses leading order matrix elements to compute an event probability for both signal and background hypotheses. Using the expected signal acceptance, background, and observed data we measure the single top quark cross section: {sigma}(p{bar p} {yields} tb + tqb + X) = 4.6{sub -1.5}{sup +}1.8 pb. The probability for the background to have fluctuated up to give at least the cross section measured in this analysis is 0.21%, which corresponds to a Gaussian equivalent significance of 2.9{sigma}.

  8. Search for a neutral Higgs boson decaying to a W boson pair in p antip collisions at s**(1/2) = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abulencia, A.; Acosta, D.; Adelman, Jahred A.; Affolder, T.; Akimoto, T.; Albrow, M.G.; Ambrose, D.; Amerio, S.; Amidei, D.; Anastassov, A.; Anikeev, K.; /Illinois U.,

    2006-05-01

    The authors present the results of a search for standard model Higgs boson production with decay to WW*, identified through the leptonic final states e{sup +}e{sup -} {bar {nu}}{nu}, e{sup {+-}}{mu}{sup {-+}} {bar {nu}}{nu} and {mu}{sup +} {mu}{sup -} {bar {nu}}{nu}. This search uses 360 pb{sup -1} of data collected from p{bar p} collisions at {radical}s = 1.96 TeV by the upgraded Collider Detector at Fermilab (CDF II). They observe no signal excess and set 95% confidence level upper limits on the production cross section times branching ratio for the Higgs boson to WW* or any new scalar particle with similar decay products. These upper limits range from 5.5 to 3.2 pb for Higgs boson masses between 120 and 200 GeV/c{sup 2}.

  9. Search for the flavor-changing neutral-current decay t-->Zq in pp collisions at sqrt[s] = 1.96 TeV.

    Science.gov (United States)

    Aaltonen, T; Adelman, J; Akimoto, T; Albrow, M G; Alvarez González, B; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Apollinari, G; Apresyan, A; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Aurisano, A; Azfar, F; Azzurri, P; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Bartsch, V; Bauer, G; Beauchemin, P-H; Bedeschi, F; Bednar, P; Beecher, D; Behari, S; Bellettini, G; Bellinger, J; Benjamin, D; Beretvas, A; Beringer, J; Bhatti, A; Binkley, M; Bisello, D; Bizjak, I; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bolla, G; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Bridgeman, A; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, J; Budd, H S; Budd, S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Byrum, K L; Cabrera, S; Calancha, C; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carlsmith, D; Carosi, R; Carrillo, S; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavaliere, V; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, K; Chokheli, D; Chou, J P; Choudalakis, G; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Compostella, G; Convery, M E; Conway, J; Copic, K; Cordelli, M; Cortiana, G; Cox, D J; Crescioli, F; Cuenca Almenar, C; Cuevas, J; Culbertson, R; Cully, J C; Dagenhart, D; Datta, M; Davies, T; de Barbaro, P; De Cecco, S; Deisher, A; De Lorenzo, G; Dell'Orso, M; Deluca, C; Demortier, L; Deng, J; Deninno, M; Derwent, P F; di Giovanni, G P; Dionisi, C; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Donati, S; Dong, P; Donini, J; Dorigo, T; Dube, S; Efron, J; Elagin, A; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, W T; Feild, R G; Feindt, M; Fernandez, J P; Ferrazza, C; Field, R; Flanagan, G; Forrest, R; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; Garberson, F; Garcia, J E; Garfinkel, A F; Genser, K; Gerberich, H; Gerdes, D; Gessler, A; Giagu, S; Giakoumopoulou, V; Giannetti, P; Gibson, K; Gimmell, J L; Ginsburg, C M; Giokaris, N; Giordani, M; Giromini, P; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Golossanov, A; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Grinstein, S; Grosso-Pilcher, C; Grundler, U; Guimaraes da Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Han, B-Y; Han, J Y; Handler, R; Happacher, F; Hara, K; Hare, D; Hare, M; Harper, S; Harr, R F; Harris, R M; Hartz, M; Hatakeyama, K; Hauser, J; Hays, C; Heck, M; Heijboer, A; Heinemann, B; Heinrich, J; Henderson, C; Herndon, M; Heuser, J; Hewamanage, S; Hidas, D; Hill, C S; Hirschbuehl, D; Hocker, A; Hou, S; Houlden, M; Hsu, S-C; Huffman, B T; Hughes, R E; Husemann, U; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ivanov, A; James, E; Jayatilaka, B; Jeon, E J; Jha, M K; Jindariani, S; Johnson, W; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Kar, D; Karchin, P E; Kato, Y; Kephart, R; Keung, J; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Knuteson, B; Ko, B R; Koay, S A; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kreps, M; Kroll, J; Krop, D; Krumnack, N; Kruse, M; Krutelyov, V; Kubo, T; Kuhr, T; Kulkarni, N P; Kurata, M; Kusakabe, Y; Kwang, S; Laasanen, A T; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; LeCompte, T; Lee, E; Lee, S W; Leone, S; Lewis, J D; Lin, C S; Linacre, J; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, C; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Lovas, L; Lu, R-S; Lucchesi, D; Lueck, J; Luci, C; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Lytken, E; Mack, P; MacQueen, D; Madrak, R; Maeshima, K; Makhoul, K; Maki, T; Maksimovic, P; Malde, S; Malik, S; Manca, G; Manousakis-Katsikakis, A; Margaroli, F; Marino, C; Marino, C P; Martin, A; Martin, V; Martínez, M; Martínez-Ballarín, R; Maruyama, T; Mastrandrea, P; Masubuchi, T; Mattson, M E; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtala, P; Menzione, A; Merkel, P; Mesropian, C; Miao, T; Miladinovic, N; Miller, R; Mills, C; Milnik, M; Mitra, A; Mitselmakher, G; Miyake, H; Moggi, N; Moon, C S; Moore, R; Morello, M J; Morlok, J; Movilla Fernandez, P; Mülmenstädt, J; Mukherjee, A; Muller, Th; Mumford, R; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Nagano, A; Naganoma, J; Nakamura, K; Nakano, I; Napier, A; Necula, V; Neu, C; Neubauer, M S; Nielsen, J; Nodulman, L; Norman, M; Norniella, O; Nurse, E; Oakes, L; Oh, S H; Oh, Y D; Oksuzian, I; Okusawa, T; Orava, R; Osterberg, K; Griso, S Pagan; Pagliarone, C; Palencia, E; Papadimitriou, V; Papaikonomou, A; Paramonov, A A; Parks, B

    2008-11-01

    We report a search for the flavor-changing neutral-current decay of the top quark t-->Zq (q=u, c) in pp collisions at sqrt[s]=1.96 TeV using a data sample corresponding to an integrated luminosity of 1.9 fb(-1) collected by the CDF II detector. This decay is strongly suppressed in the standard model and an observation of a signal at the Fermilab Tevatron would be an indication of physics beyond the standard model. Using Z+ > or = 4 jet final state candidate events, with and without an identified bottom quark jet, we obtain an upper limit of B(t-->Zq) < 3.7% at 95% C.L. PMID:19113262

  10. Search for high-mass e+e- resonances in pp collisions at sqrt[s]=1.96 TeV.

    Science.gov (United States)

    Aaltonen, T; Adelman, J; Akimoto, T; Albrow, M G; Alvarez González, B; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Apollinari, G; Apresyan, A; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Aurisano, A; Azfar, F; Azzurri, P; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Bartsch, V; Bauer, G; Beauchemin, P-H; Bedeschi, F; Beecher, D; Behari, S; Bellettini, G; Bellinger, J; Benjamin, D; Beretvas, A; Beringer, J; Bhatti, A; Binkley, M; Bisello, D; Bizjak, I; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bolla, G; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Bridgeman, A; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, J; Budd, H S; Budd, S; Burke, S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Byrum, K L; Cabrera, S; Calancha, C; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carls, B; Carlsmith, D; Carosi, R; Carrillo, S; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavaliere, V; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, K; Chokheli, D; Chou, J P; Choudalakis, G; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Chwalek, T; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Compostella, G; Convery, M E; Conway, J; Cordelli, M; Cortiana, G; Cox, C A; Cox, D J; Crescioli, F; Cuenca Almenar, C; Cuevas, J; Culbertson, R; Cully, J C; Dagenhart, D; Datta, M; Davies, T; de Barbaro, P; De Cecco, S; Deisher, A; De Lorenzo, G; Dell'Orso, M; Deluca, C; Demortier, L; Deng, J; Deninno, M; Derwent, P F; di Giovanni, G P; Dionisi, C; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Donati, S; Dong, P; Donini, J; Dorigo, T; Dube, S; Efron, J; Elagin, A; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, W T; Feild, R G; Feindt, M; Fernandez, J P; Ferrazza, C; Field, R; Flanagan, G; Forrest, R; Frank, M J; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; Garberson, F; Garcia, J E; Garfinkel, A F; Genser, K; Gerberich, H; Gerdes, D; Gessler, A; Giagu, S; Giakoumopoulou, V; Giannetti, P; Gibson, K; Gimmell, J L; Ginsburg, C M; Giokaris, N; Giordani, M; Giromini, P; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Golossanov, A; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Grinstein, S; Grosso-Pilcher, C; Grundler, U; Guimaraes da Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Han, B-Y; Han, J Y; Happacher, F; Hara, K; Hare, D; Hare, M; Harper, S; Harr, R F; Harris, R M; Hartz, M; Hatakeyama, K; Hays, C; Heck, M; Heijboer, A; Heinrich, J; Henderson, C; Herndon, M; Heuser, J; Hewamanage, S; Hidas, D; Hill, C S; Hirschbuehl, D; Hocker, A; Hou, S; Houlden, M; Hsu, S-C; Huffman, B T; Hughes, R E; Husemann, U; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ivanov, A; James, E; Jayatilaka, B; Jeon, E J; Jha, M K; Jindariani, S; Johnson, W; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Kar, D; Karchin, P E; Kato, Y; Kephart, R; Keung, J; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, H W; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Knuteson, B; Ko, B R; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kreps, M; Kroll, J; Krop, D; Krumnack, N; Kruse, M; Krutelyov, V; Kubo, T; Kuhr, T; Kulkarni, N P; Kurata, M; Kusakabe, Y; Kwang, S; Laasanen, A T; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; LeCompte, T; Lee, E; Lee, H S; Lee, S W; Leone, S; Lewis, J D; Lin, C-S; Linacre, J; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, C; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Lovas, L; Lucchesi, D; Luci, C; Lueck, J; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Macqueen, D; Madrak, R; Maeshima, K; Makhoul, K; Maki, T; Maksimovic, P; Malde, S; Malik, S; Manca, G; Manousakis-Katsikakis, A; Margaroli, F; Marino, C; Marino, C P; Martin, A; Martin, V; Martínez, M; Martínez-Ballarín, R; Maruyama, T; Mastrandrea, P; Masubuchi, T; Mathis, M; Mattson, M E; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtala, P; Menzione, A; Merkel, P; Mesropian, C; Miao, T; Miladinovic, N; Miller, R; Mills, C; Milnik, M; Mitra, A; Mitselmakher, G; Miyake, H; Moggi, N; Moon, C S; Moore, R; Morello, M J; Morlok, J; Movilla Fernandez, P; Mülmenstädt, J; Mukherjee, A; Muller, Th; Mumford, R; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Nagano, A; Naganoma, J; Nakamura, K; Nakano, I; Napier, A; Necula, V; Nett, J; Neu, C; Neubauer, M S; Neubauer, S; Nielsen, J; Nodulman, L; Norman, M; Norniella, O; Nurse, E; Oakes, L; Oh, S H; Oh, Y D; Oksuzian, I; Okusawa, T; Orava, R; Griso, S Pagan; Palencia, E; Papadimitriou, V; Papaikonomou, A; Paramonov, A A; Parks, B; Pashapour, S; Patrick, J

    2009-01-23

    A search for high-mass resonances in the e+e- final state is presented based on 2.5 fb(-1) of sqrt[s]=1.96 TeV pp collision data from the CDF II detector at the Fermilab Tevatron. The largest excess over the standard model prediction is at an e+e- invariant mass of 240 GeV/c2. The probability of observing such an excess arising from fluctuations in the standard model anywhere in the mass range of 150-1000 GeV/c2 is 0.6% (equivalent to 2.5sigma). We exclude the standard model coupling Z' and the Randall-Sundrum graviton for k/MPl=0.1 with masses below 963 and 848 GeV/c2 at the 95% credibility level, respectively. PMID:19257342

  11. First measurement of W boson production in association with a single Charm quark in pp collisions at sqrt(s)=1.96 TeV.

    Science.gov (United States)

    Aaltonen, T; Adelman, J; Akimoto, T; Albrow, M G; Alvarez González, B; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Apresyan, A; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Aurisano, A; Azfar, F; Azzi-Bacchetta, P; Azzurri, P; Bacchetta, N; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Baroiant, S; Bartsch, V; Bauer, G; Beauchemin, P-H; Bedeschi, F; Bednar, P; Behari, S; Bellettini, G; Bellinger, J; Belloni, A; Benjamin, D; Beretvas, A; Beringer, J; Berry, T; Bhatti, A; Binkley, M; Bisello, D; Bizjak, I; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bolla, G; Bolshov, A; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Bridgeman, A; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, J; Budd, H S; Budd, S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Byrum, K L; Cabrera, S; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carlsmith, D; Carosi, R; Carrillo, S; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, K; Chokheli, D; Chou, J P; Choudalakis, G; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Compostella, G; Convery, M E; Conway, J; Cooper, B; Copic, K; Cordelli, M; Cortiana, G; Crescioli, F; Cuenca Almenar, C; Cuevas, J; Culbertson, R; Cully, J C; Dagenhart, D; Datta, M; Davies, T; de Barbaro, P; De Cecco, S; Deisher, A; De Lentdecker, G; De Lorenzo, G; Dell'Orso, M; Demortier, L; Deng, J; Deninno, M; De Pedis, D; Derwent, P F; Di Giovanni, G P; Dionisi, C; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Donati, S; Dong, P; Donini, J; Dorigo, T; Dube, S; Efron, J; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, W T; Feild, R G; Feindt, M; Fernandez, J P; Ferrazza, C; Field, R; Flanagan, G; Forrest, R; Forrester, S; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; Garberson, F; Garcia, J E; Garfinkel, A F; Genser, K; Gerberich, H; Gerdes, D; Giagu, S; Giakoumopolou, V; Giannetti, P; Gibson, K; Gimmell, J L; Ginsburg, C M; Giokaris, N; Giordani, M; Giromini, P; Giunta, M; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Golossanov, A; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Grinstein, S; Grosso-Pilcher, C; Grundler, U; Guimaraes da Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Hamilton, A; Han, B-Y; Han, J Y; Handler, R; Happacher, F; Hara, K; Hare, D; Hare, M; Harper, S; Harr, R F; Harris, R M; Hartz, M; Hatakeyama, K; Hauser, J; Hays, C; Heck, M; Heijboer, A; Heinemann, B; Heinrich, J; Henderson, C; Herndon, M; Heuser, J; Hewamanage, S; Hidas, D; Hill, C S; Hirschbuehl, D; Hocker, A; Hou, S; Houlden, M; Hsu, S-C; Huffman, B T; Hughes, R E; Husemann, U; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ivanov, A; Iyutin, B; James, E; Jayatilaka, B; Jeans, D; Jeon, E J; Jindariani, S; Johnson, W; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Kar, D; Karchin, P E; Kato, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Klute, M; Knuteson, B; Ko, B R; Koay, S A; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kraus, J; Kreps, M; Kroll, J; Krumnack, N; Kruse, M; Krutelyov, V; Kubo, T; Kuhlmann, S E; Kuhr, T; Kulkarni, N P; Kusakabe, Y; Kwang, S; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; LeCompte, T; Lee, J; Lee, J; Lee, Y J; Lee, S W; Lefèvre, R; Leonardo, N; Leone, S; Levy, S; Lewis, J D; Lin, C; Lin, C S; Linacre, J; Lindgren, M; Lipeles, E; Liss, T M; Lister, A; Litvintsev, D O; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Lovas, L; Lu, R-S; Lucchesi, D; Lueck, J; Luci, C; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Lytken, E; Mack, P; MacQueen, D; Madrak, R; Maeshima, K; Makhoul, K; Maki, T; Maksimovic, P; Malde, S; Malik, S; Manca, G; Mangano, M L; Manousakis, A; Margaroli, F; Marino, C; Marino, C P; Martin, A; Martin, M; Martin, V; Martínez, M; Martínez-Ballarín, R; Maruyama, T; Mastrandrea, P; Masubuchi, T; Mattson, M E; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtala, P; Menzemer, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Miao, T; Miladinovic, N; Miles, J; Miller, R; Mills, C; Milnik, M; Mitra, A; Mitselmakher, G; Miyake, H; Moed, S; Moggi, N; Moon, C S; Moore, R; Morello, M; Movilla Fernandez, P; Mülmenstädt, J; Mukherjee, A; Muller, Th; Mumford, R; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Nagano, A; Naganoma, J; Nakamura, K; Nakano, I; Napier, A; Necula, V; Neu, C; Neubauer, M S; Nielsen, J; Nodulman, L; Norman, M

    2008-03-01

    We present the first measurement of the production cross section of a W boson with a single charm quark (c) in pp collisions at sqrt(s)=1.96 TeV, using soft muon tagging of c jets. In a data sample of approximately 1.8 fb(-1), recorded with the Collider Detector at Fermilab II detector at the Fermilab Tevatron, we select events with W+1 or 2 jets. We use the charge correlation between the W and the muon from the semileptonic decay of a charm hadron to extract the Wc signal. We measure sigma Wc(PTc >20 GeV/c,|eta c|l nu)=9.8+/-3.2 pb, in agreement with theoretical expectations. PMID:18352698

  12. Search for charged Higgs bosons in decays of top quarks in pp collisions at square root s = 1.96 TeV.

    Science.gov (United States)

    Aaltonen, T; Adelman, J; Akimoto, T; Alvarez González, B; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Apollinari, G; Apresyan, A; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Aurisano, A; Azfar, F; Azzurri, P; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Bartsch, V; Bauer, G; Beauchemin, P-H; Bedeschi, F; Beecher, D; Behari, S; Bellettini, G; Bellinger, J; Benjamin, D; Beretvas, A; Beringer, J; Bhatti, A; Binkley, M; Bisello, D; Bizjak, I; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bolla, G; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Bridgeman, A; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, J; Budd, H S; Budd, S; Burke, S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Byrum, K L; Cabrera, S; Calancha, C; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carls, B; Carlsmith, D; Carosi, R; Carrillo, S; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavaliere, V; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, K; Chokheli, D; Chou, J P; Choudalakis, G; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Chwalek, T; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Compostella, G; Convery, M E; Conway, J; Cordelli, M; Cortiana, G; Cox, C A; Cox, D J; Crescioli, F; Cuenca Almenar, C; Cuevas, J; Culbertson, R; Cully, J C; Dagenhart, D; Datta, M; Davies, T; de Barbaro, P; De Cecco, S; Deisher, A; De Lorenzo, G; Dell'orso, M; Deluca, C; Demortier, L; Deng, J; Deninno, M; Derwent, P F; di Giovanni, G P; Dionisi, C; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Donati, S; Dong, P; Donini, J; Dorigo, T; Dube, S; Efron, J; Elagin, A; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, W T; Feild, R G; Feindt, M; Fernandez, J P; Ferrazza, C; Field, R; Flanagan, G; Forrest, R; Frank, M J; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; Garberson, F; Garcia, J E; Garfinkel, A F; Genser, K; Gerberich, H; Gerdes, D; Gessler, A; Giagu, S; Giakoumopoulou, V; Giannetti, P; Gibson, K; Gimmell, J L; Ginsburg, C M; Giokaris, N; Giordani, M; Giromini, P; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Golossanov, A; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Grinstein, S; Grosso-Pilcher, C; Grundler, U; Guimaraes da Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Han, B-Y; Han, J Y; Happacher, F; Hara, K; Hare, D; Hare, M; Harper, S; Harr, R F; Harris, R M; Hartz, M; Hatakeyama, K; Hays, C; Heck, M; Heijboer, A; Heinrich, J; Henderson, C; Herndon, M; Heuser, J; Hewamanage, S; Hidas, D; Hill, C S; Hirschbuehl, D; Hocker, A; Hou, S; Houlden, M; Hsu, S-C; Huffman, B T; Hughes, R E; Husemann, U; Hussein, M; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ivanov, A; James, E; Jang, D; Jayatilaka, B; Jeon, E J; Jha, M K; Jindariani, S; Johnson, W; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Kar, D; Karchin, P E; Kato, Y; Kephart, R; Keung, J; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, H W; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Knuteson, B; Ko, B R; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kreps, M; Kroll, J; Krop, D; Krumnack, N; Kruse, M; Krutelyov, V; Kubo, T; Kuhr, T; Kulkarni, N P; Kurata, M; Kwang, S; Laasanen, A T; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; Lecompte, T; Lee, E; Lee, H S; Lee, S W; Leone, S; Lewis, J D; Lin, C-S; Linacre, J; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, C; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Lovas, L; Lucchesi, D; Luci, C; Lueck, J; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Macqueen, D; Madrak, R; Maeshima, K; Makhoul, K; Maki, T; Maksimovic, P; Malde, S; Malik, S; Manca, G; Manousakis-Katsikakis, A; Margaroli, F; Marino, C; Marino, C P; Martin, A; Martin, V; Martínez, M; Martínez-Ballarín, R; Maruyama, T; Mastrandrea, P; Masubuchi, T; Mathis, M; Mattson, M E; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtala, P; Menzione, A; Merkel, P; Mesropian, C; Miao, T; Miladinovic, N; Miller, R; Mills, C; Milnik, M; Mitra, A; Mitselmakher, G; Miyake, H; Moggi, N; Moon, C S; Moore, R; Morello, M J; Morlock, J; Movilla Fernandez, P; Mülmenstädt, J; Mukherjee, A; Muller, Th; Mumford, R; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Nagano, A; Naganoma, J; Nakamura, K; Nakano, I; Napier, A; Necula, V; Nett, J; Neu, C; Neubauer, M S; Neubauer, S; Nielsen, J; Nodulman, L; Norman, M; Norniella, O; Nurse, E; Oakes, L; Oh, S H; Oh, Y D; Oksuzian, I; Okusawa, T; Orava, R; Osterberg, K; Pagan Griso, S; Palencia, E; Papadimitriou, V; Papaikonomou, A; Paramonov, A A; Parks, B; Pashapour, S

    2009-09-01

    We report on the first direct search for charged Higgs bosons decaying into cs in tt events produced by pp collisions at square root s = 1.96 TeV. The search uses a data sample corresponding to an integrated luminosity of 2.2 fb(-1) collected by the CDF II detector at Fermilab and looks for a resonance in the invariant mass distribution of two jets in the lepton + jets sample of tt candidates. We observe no evidence of charged Higgs bosons in top quark decays. Hence, 95% upper limits on the top quark decay branching ratio are placed at B(t --> H(+)b) cs)=1.0. The upper limits on B(t --> H(+)b) are also used as model-independent limits on the decay branching ratio of top quarks to generic scalar charged bosons beyond the standard model. PMID:19792297

  13. Measurement of the k(T) distribution of particles in jets produced in pp collisions at sqrt(s)=1.96 TeV.

    Science.gov (United States)

    Aaltonen, T; Adelman, J; Akimoto, T; Alvarez González, B; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Apollinari, G; Apresyan, A; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Aurisano, A; Azfar, F; Azzurri, P; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Bartsch, V; Bauer, G; Beauchemin, P-H; Bedeschi, F; Beecher, D; Behari, S; Bellettini, G; Bellinger, J; Benjamin, D; Beretvas, A; Beringer, J; Bhatti, A; Binkley, M; Bisello, D; Bizjak, I; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bolla, G; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Bridgeman, A; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, J; Budd, H S; Budd, S; Burke, S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Byrum, K L; Cabrera, S; Calancha, C; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carls, B; Carlsmith, D; Carosi, R; Carrillo, S; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavaliere, V; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, K; Chokheli, D; Chou, J P; Choudalakis, G; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Chwalek, T; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Compostella, G; Convery, M E; Conway, J; Cordelli, M; Cortiana, G; Cox, C A; Cox, D J; Crescioli, F; Cuenca Almenar, C; Cuevas, J; Culbertson, R; Cully, J C; Dagenhart, D; Datta, M; Davies, T; de Barbaro, P; De Cecco, S; Deisher, A; De Lorenzo, G; Dell'orso, M; Deluca, C; Demortier, L; Deng, J; Deninno, M; Derwent, P F; di Giovanni, G P; Dionisi, C; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Donati, S; Dong, P; Donini, J; Dorigo, T; Dube, S; Efron, J; Elagin, A; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, W T; Feild, R G; Feindt, M; Fernandez, J P; Ferrazza, C; Field, R; Flanagan, G; Forrest, R; Frank, M J; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; Garberson, F; Garcia, J E; Garfinkel, A F; Genser, K; Gerberich, H; Gerdes, D; Gessler, A; Giagu, S; Giakoumopoulou, V; Giannetti, P; Gibson, K; Gimmell, J L; Ginsburg, C M; Giokaris, N; Giordani, M; Giromini, P; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Golossanov, A; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Grinstein, S; Grosso-Pilcher, C; Grundler, U; Guimaraes da Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Han, B-Y; Han, J Y; Happacher, F; Hara, K; Hare, D; Hare, M; Harper, S; Harr, R F; Harris, R M; Hartz, M; Hatakeyama, K; Hays, C; Heck, M; Heijboer, A; Heinrich, J; Henderson, C; Herndon, M; Heuser, J; Hewamanage, S; Hidas, D; Hill, C S; Hirschbuehl, D; Hocker, A; Hou, S; Houlden, M; Hsu, S-C; Huffman, B T; Hughes, R E; Husemann, U; Hussein, M; Husemann, U; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ivanov, A; James, E; Jayatilaka, B; Jeon, E J; Jha, M K; Jindariani, S; Johnson, W; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Kar, D; Karchin, P E; Kato, Y; Kephart, R; Keung, J; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, H W; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Knuteson, B; Ko, B R; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kreps, M; Kroll, J; Krop, D; Krumnack, N; Kruse, M; Krutelyov, V; Kubo, T; Kuhr, T; Kulkarni, N P; Kurata, M; Kwang, S; Laasanen, A T; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; Lecompte, T; Lee, E; Lee, H S; Lee, S W; Leone, S; Lewis, J D; Lin, C-S; Linacre, J; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, C; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Lovas, L; Lucchesi, D; Luci, C; Lueck, J; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Macqueen, D; Madrak, R; Maeshima, K; Makhoul, K; Maki, T; Maksimovic, P; Malde, S; Malik, S; Manca, G; Manousakis-Katsikakis, A; Margaroli, F; Marino, C; Marino, C P; Martin, A; Martin, V; Martínez, M; Martínez-Ballarín, R; Maruyama, T; Mastrandrea, P; Masubuchi, T; Mathis, M; Mattson, M E; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtala, P; Menzione, A; Merkel, P; Mesropian, C; Miao, T; Miladinovic, N; Miller, R; Mills, C; Milnik, M; Mitra, A; Mitselmakher, G; Miyake, H; Moggi, N; Moon, C S; Moore, R; Morello, M J; Morlok, J; Movilla Fernandez, P; Mülmenstädt, J; Mukherjee, A; Muller, Th; Mumford, R; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Nagano, A; Naganoma, J; Nakamura, K; Nakano, I; Napier, A; Necula, V; Nett, J; Neu, C; Neubauer, M S; Neubauer, S; Nielsen, J; Nodulman, L; Norman, M; Norniella, O; Nurse, E; Oakes, L; Oh, S H; Oh, Y D; Oksuzian, I; Okusawa, T; Orava, R; Pagan Griso, S; Palencia, E; Papadimitriou, V; Papaikonomou, A; Paramonov, A A; Parks, B; Pashapour, S; Patrick, J

    2009-06-12

    We present a measurement of the transverse momentum with respect to the jet axis (k(t)) of particles in jets produced in pp collisions at sqrt(s)=1.96 TeV. Results are obtained for charged particles in a cone of 0.5 radians around the jet axis in events with dijet invariant masses between 66 and 737 GeV/c(2). The experimental data are compared to theoretical predictions obtained for fragmentation partons within the framework of resummed perturbative QCD using the modified leading log and next-to-modified leading log approximations. The comparison shows that trends in data are successfully described by the theoretical predictions, indicating that the perturbative QCD stage of jet fragmentation is dominant in shaping basic jet characteristics. PMID:19658924

  14. Search for new physics in high-mass electron-positron events in pp[over] collisions at square root s = 1.96 TeV.

    Science.gov (United States)

    Aaltonen, T; Abulencia, A; Adelman, J; Affolder, T; Akimoto, T; Albrow, M G; Amerio, S; Amidei, D; Anastassov, A; Anikeev, K; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Aurisano, A; Azfar, F; Azzi-Bacchetta, P; Azzurri, P; Bacchetta, N; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Baroiant, S; Bartsch, V; Bauer, G; Beauchemin, P-H; Bedeschi, F; Behari, S; Bellettini, G; Bellinger, J; Belloni, A; Benjamin, D; Beretvas, A; Beringer, J; Berry, T; Bhatti, A; Binkley, M; Bisello, D; Bizjak, I; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bolla, G; Bolshov, A; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, J; Budd, H S; Budd, S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Byrum, K L; Cabrera, S; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carrillo, S; Carlsmith, D; Carosi, R; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, I; Cho, K; Chokheli, D; Chou, J P; Choudalakis, G; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Cilijak, M; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Coca, M; Compostella, G; Convery, M E; Conway, J; Cooper, B; Copic, K; Cordelli, M; Cortiana, G; Crescioli, F; Cuenca Almenar, C; Cuevas, J; Culbertson, R; Cully, J C; DaRonco, S; Datta, M; D'Auria, S; Davies, T; Dagenhart, D; de Barbaro, P; De Cecco, S; Deisher, A; De Lentdecker, G; De Lorenzo, G; Dell'Orso, M; Delli Paoli, F; Demortier, L; Deng, J; Deninno, M; De Pedis, D; Derwent, P F; Di Giovanni, G P; Dionisi, C; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Dörr, C; Donati, S; Dong, P; Donini, J; Dorigo, T; Dube, S; Efron, J; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, I; Fedorko, W T; Feild, R G; Feindt, M; Fernandez, J P; Field, R; Flanagan, G; Forrest, R; Forrester, S; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; Garcia, J E; Garberson, F; Garfinkel, A F; Gay, C; Gerberich, H; Gerdes, D; Giagu, S; Giannetti, P; Gibson, K; Gimmell, J L; Ginsburg, C; Giokaris, N; Giordani, M; Giromini, P; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Goldstein, J; Golossanov, A; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Grinstein, S; Grosso-Pilcher, C; Grundler, U; Guimaraes da Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Hamilton, A; Han, B-Y; Han, J Y; Handler, R; Happacher, F; Hara, K; Hare, D; Hare, M; Harper, S; Harr, R F; Harris, R M; Hartz, M; Hatakeyama, K; Hauser, J; Hays, C; Heck, M; Heijboer, A; Heinemann, B; Heinrich, J; Henderson, C; Herndon, M; Heuser, J; Hidas, D; Hill, C S; Hirschbuehl, D; Hocker, A; Holloway, A; Hou, S; Houlden, M; Hsu, S-C; Huffman, B T; Hughes, R E; Husemann, U; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ivanov, A; Iyutin, B; James, E; Jang, D; Jayatilaka, B; Jeans, D; Jeon, E J; Jindariani, S; Johnson, W; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Karchin, P E; Kato, Y; Kemp, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Klute, M; Knuteson, B; Ko, B R; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kraan, A C; Kraus, J; Kreps, M; Kroll, J; Krumnack, N; Kruse, M; Krutelyov, V; Kubo, T; Kuhlmann, S E; Kuhr, T; Kulkarni, N P; Kusakabe, Y; Kwang, S; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; Lecompte, T; Lee, J; Lee, J; Lee, Y J; Lee, S W; Lefèvre, R; Leonardo, N; Leone, S; Levy, S; Lewis, J D; Lin, C; Lin, C S; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Lu, R-S; Lucchesi, D; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Lytken, E; Mack, P; Macqueen, D; Madrak, R; Maeshima, K; Makhoul, K; Maki, T; Maksimovic, P; Malde, S; Malik, S; Manca, G; Manousakis, A; Margaroli, F; Marginean, R; Marino, C; Marino, C P; Martin, A; Martin, M; Martin, V; Martínez, M; Martínez-Ballarín, R; Maruyama, T; Mastrandrea, P; Masubuchi, T; Matsunaga, H; Mattson, M E; Mazini, R; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtala, P; Menzemer, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Miao, T; Miladinovic, N; Miles, J; Miller, R; Mills, C; Milnik, M; Mitra, A; Mitselmakher, G; Miyamoto, A; Moed, S; Moggi, N; Mohr, B; Moon, C S; Moore, R; Morello, M; Fernandez, P Movilla; Mülmenstädt, J; Mukherjee, A; Muller, Th; Mumford, R; Murat, P; Mussini, M; Nachtman, J; Nagano, A; Naganoma, J; Nakamura, K; Nakano, I; Napier, A; Necula, V; Neu, C; Neubauer, M S

    2007-10-26

    We report the results of a search for a narrow resonance in electron-positron events in the invariant mass range of 150-950 GeV/c(2) using 1.3 fb(-1) of pp[over] collision data at square root s = 1.96 TeV collected by the CDF II detector at Fermilab. No significant evidence of such a resonance is observed and we interpret the results to exclude the standard-model-like Z' with a mass below 923 GeV/c(2) and the Randall-Sundrum graviton with a mass below 807 GeV/c(2) for k/M[over](pl) = 0.1, both at the 95% confidence level. Combining with diphoton data excludes the Randall-Sundrum graviton for masses below 889 GeV/c(2) for k/M[over](pl) = 0.1. PMID:17995318

  15. Search for the Higgs boson produced in association with Z-->l+l in pp collisions at sqrt[s]=1.96 TeV.

    Science.gov (United States)

    Aaltonen, T; Adelman, J; Akimoto, T; Albrow, M G; Alvarez González, B; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Apollinari, G; Apresyan, A; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Aurisano, A; Azfar, F; Azzurri, P; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Bartsch, V; Bauer, G; Beauchemin, P-H; Bedeschi, F; Bednar, P; Beecher, D; Behari, S; Bellettini, G; Bellinger, J; Benjamin, D; Beretvas, A; Beringer, J; Bhatti, A; Binkley, M; Bisello, D; Bizjak, I; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bolla, G; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Bridgeman, A; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, J; Budd, H S; Budd, S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Byrum, K L; Cabrera, S; Calancha, C; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carlsmith, D; Carosi, R; Carrillo, S; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavaliere, V; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, K; Chokheli, D; Chou, J P; Choudalakis, G; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Compostella, G; Convery, M E; Conway, J; Copic, K; Cordelli, M; Cortiana, G; Cox, D J; Crescioli, F; Cuenca Almenar, C; Cuevas, J; Culbertson, R; Cully, J C; Dagenhart, D; Datta, M; Davies, T; de Barbaro, P; De Cecco, S; Deisher, A; De Lorenzo, G; Dell'orso, M; Deluca, C; Demortier, L; Deng, J; Deninno, M; Derwent, P F; di Giovanni, G P; Dionisi, C; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Donati, S; Dong, P; Donini, J; Dorigo, T; Dube, S; Efron, J; Elagin, A; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, W T; Feild, R G; Feindt, M; Fernandez, J P; Ferrazza, C; Field, R; Flanagan, G; Forrest, R; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; Garberson, F; Garcia, J E; Garfinkel, A F; Genser, K; Gerberich, H; Gerdes, D; Gessler, A; Giagu, S; Giakoumopoulou, V; Giannetti, P; Gibson, K; Gimmell, J L; Ginsburg, C M; Giokaris, N; Giordani, M; Giromini, P; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Golossanov, A; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Grinstein, S; Grosso-Pilcher, C; Grundler, U; Guimaraes da Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Han, B-Y; Han, J Y; Handler, R; Happacher, F; Hara, K; Hare, D; Hare, M; Harper, S; Harr, R F; Harris, R M; Hartz, M; Hatakeyama, K; Hauser, J; Hays, C; Heck, M; Heijboer, A; Heinemann, B; Heinrich, J; Henderson, C; Herndon, M; Heuser, J; Hewamanage, S; Hidas, D; Hill, C S; Hirschbuehl, D; Hocker, A; Hou, S; Houlden, M; Hsu, S-C; Huffman, B T; Hughes, R E; Husemann, U; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ivanov, A; James, E; Jayatilaka, B; Jeon, E J; Jha, M K; Jindariani, S; Johnson, W; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Kar, D; Karchin, P E; Kato, Y; Kephart, R; Keung, J; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Knuteson, B; Ko, B R; Koay, S A; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kreps, M; Kroll, J; Krop, D; Krumnack, N; Kruse, M; Krutelyov, V; Kubo, T; Kuhr, T; Kulkarni, N P; Kurata, M; Kusakabe, Y; Kwang, S; Laasanen, A T; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; Lecompte, T; Lee, E; Lee, S W; Leone, S; Lewis, J D; Lin, C S; Linacre, J; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, C; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Lovas, L; Lu, R-S; Lucchesi, D; Lueck, J; Luci, C; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Lytken, E; Mack, P; Macqueen, D; Madrak, R; Maeshima, K; Makhoul, K; Maki, T; Maksimovic, P; Malde, S; Malik, S; Manca, G; Manousakis-Katsikakis, A; Margaroli, F; Marino, C; Marino, C P; Martin, A; Martin, V; Martínez, M; Martínez-Ballarín, R; Maruyama, T; Mastrandrea, P; Masubuchi, T; Mattson, M E; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtala, P; Menzione, A; Merkel, P; Mesropian, C; Miao, T; Miladinovic, N; Miller, R; Mills, C; Milnik, M; Mitra, A; Mitselmakher, G; Miyake, H; Moggi, N; Moon, C S; Moore, R; Morello, M J; Morlok, J; Movilla Fernandez, P; Mülmenstädt, J; Mukherjee, A; Muller, Th; Mumford, R; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Nagano, A; Naganoma, J; Nakamura, K; Nakano, I; Napier, A; Necula, V; Neu, C; Neubauer, M S; Nielsen, J; Nodulman, L; Norman, M; Norniella, O; Nurse, E; Oakes, L; Oh, S H; Oh, Y D; Oksuzian, I; Okusawa, T; Orava, R; Osterberg, K; Pagan Griso, S; Pagliarone, C; Palencia, E; Papadimitriou, V; Papaikonomou, A; Paramonov, A A; Parks, B

    2008-12-19

    We present a search for the Higgs boson in the process qq-->ZH-->l;{+}l;{-}bb[over ]. The analysis uses an integrated luminosity of 1 fb;{-1} of pp[over ] collisions produced at sqrt[s]=1.96 TeV and accumulated by the upgraded Collider Detector at Fermilab (CDF II). We employ artificial neural networks both to correct jets mismeasured in the calorimeter and to distinguish the signal kinematic distributions from those of the background. We see no evidence for Higgs boson production, and set 95% C.L. upper limits on sigma{ZH}B(H-->bb[over ]), ranging from 1.5 to 1.2 pb for a Higgs boson mass (m{H}) of 110 to 150 GeV/c(2). PMID:19113696

  16. Search for squark production in events with jets, hadronically decaying tau leptons and missing transverse energy at s**(1/2) = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abazov, V.M.; /Dubna, JINR; Abbott, B.; /Oklahoma U.; Abolins, M.; /Michigan State U.; Acharya, B.S.; /Tata Inst.; Adams, M.; /Illinois U., Chicago; Adams, T.; /Florida State U.; Aguilo, E.; /Alberta U. /Simon Fraser U. /York U., Canada /McGill U.; Ahsan, M.; /Kansas State U.; Alexeev, G.D.; /Dubna, JINR; Alkhazov, G.; /St. Petersburg, INP; Alton, A.; /Michigan U. /Northeastern U.

    2009-05-01

    A search for supersymmetric partners of quarks is performed in the topology of multijet events accompanied by at least one tau lepton decaying hadronically and large missing transverse energy. Approximately 1 fb-1 of ppbar collision data from the Fermilab Tevatron Collider at a center of mass energy of 1.96 TeV recorded by the D0 detector is analyzed. Results are combined with the previously published D0 inclusive search for squarks and gluinos. No evidence of physics beyond the standard model is found and lower limits on the squark mass up to 410 GeV are derived in the framework of minimal supergravity with tan(beta)=15, A{sub 0}=-2m{sub 0} and mu<0, in the region where decays to tau leptons dominate. Gaugino masses m{sub 1/2} are excluded up to 172 GeV.

  17. First measurement of sigma (p anti-p ---> Z) . Br (Z ---> tau tau) at s**(1/2) = 1.96- TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abazov, V.M.; Abbott, B.; Abolins, M.; Acharya, B.S.; Adams, M.; Adams, T.; Agelou, M.; Agram, J.-L.; Ahn, S.H.; Ahsan, M.; Alexeev, G.D.; Alkhazov, G.; Alton, A.; Alverson, G.; Alves, G.A.; Anastasoaie, M.; Andeen, T.; Anderson, S.; Andrieu, B.; Arnoud, Y.; Askew, A.; /Buenos Aires U. /Rio de Janeiro, CBPF /Rio de Janeiro State U. /Sao

    2004-12-01

    The authors present a measurement of the cross section for Z production times the branching fraction to {tau} leptons, {sigma} {center_dot} Br(Z {yields} {tau}{sup +}{tau}{sup -}), in p{bar p} collisions at {radical}s = 1.96 TeV in the channel in which one {tau} decays into {mu}{nu}{sub {mu}}{nu}{sub {tau}}, and the other into hadrons + {nu}{sub {tau}} or e{nu}{sub e}{nu}{sub {tau}}. The data sample corresponds to an integrated luminosity of 226 pb{sup -1} collected with the D0 detector at the Fermilab Tevatron collider. The final sample contains 2008 candidate events with an estimated background of 55%. From this they obtain {sigma} {center_dot} Br(Z {yields} {tau}{sup +}{tau}{sup -}) = 237 {+-} 15(stat) {+-} 18(sys) {+-} 15(lum) pb, in agreement with the standard model prediction.

  18. Search for high-mass resonances decaying to eμ in p$\\bar{p}$ collisions at √s = 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Hahn, Kristian Allan [Univ. of Pennsylvania, Philadelphia, PA (United States)

    2006-01-01

    We describe a general search for resonances decaying to a neutral eμ final state in p$\\bar{p}$ collisions at a center-of-mass energy of 1.96 TeV. Using a data sample representing 344 pb-1 of integrated luminosity recorded by the CDF II experiment, we compare Standard Model predictions with the number of observed events for invariant masses between 50 and 800 GeV/c2. Finding no significant excess (5 events observed vs. 7.7 ± 0.8 expected for M> 100 GeV/c2), we set limits on sneutrino and Z' masses as functions of lepton family number violating couplings.

  19. Measurement of Spin Correlation between Top and Antitop Quarks Produced in $p\\bar{p}$ Collisions at $\\sqrt{s} = 1.96$ TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abazov, Victor Mukhamedovich; et al.

    2015-12-29

    We present a measurement of the correlation between the spins of t and tbar quarks produced in proton-antiproton collisions at the Tevatron Collider at a center-of-mass energy of 1.96 TeV. We apply a matrix element technique to dilepton and single-lepton+jets final states in data accumulated with the D0 detector that correspond to an integrated luminosity of 9.7 fb$^{-1}$. The measured value of the correlation coefficient in the off-diagonal basis, $O_{off} = 0.89 \\pm 0.22$ (stat + syst), is in agreement with the standard model prediction, and represents evidence for a top-antitop quark spin correlation difference from zero at a level of 4.2 standard deviations.

  20. Measurement of the W + gamma Production in Proton - Anti-proton Collisions at s**(1/2) = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Kirby, Michael H

    2004-10-01

    The authors present a measurement of the {bar p}p {yields} W{gamma} + X {yields} e{nu}{gamma} + X production cross section using data form the Collider Detector at Fermilab. The p{bar p} collisions were provided by the Tevatron Collider at a center of mass energy of 1.96 TeV. Electroweak theory includes the trilinear vector boson coupling, WW{gamma}, which contributes to the e{nu}{gamma} final state. The electron decay channel of the W provides a clean sample to study the production of diboson pairs. The measurement of the production cross section tests the structure of the non-Abelian character of Electroweak theory.

  1. Measurement of associated production of z bosons with charm quark jets in pp collisions at √s=1.96  TeV.

    Science.gov (United States)

    Abazov, V M; Abbott, B; Acharya, B S; Adams, M; Adams, T; Agnew, J P; Alexeev, G D; Alkhazov, G; Alton, A; Askew, A; Atkins, S; Augsten, K; Avila, C; Badaud, F; Bagby, L; Baldin, B; Bandurin, D V; Banerjee, S; Barberis, E; Baringer, P; Bartlett, J F; Bassler, U; Bazterra, V; Bean, A; Begalli, M; Bellantoni, L; Beri, S B; Bernardi, G; Bernhard, R; Bertram, I; Besançon, M; Beuselinck, R; Bhat, P C; Bhatia, S; Bhatnagar, V; Blazey, G; Blessing, S; Bloom, K; Boehnlein, A; Boline, D; Boos, E E; Borissov, G; Brandt, A; Brandt, O; Brock, R; Bross, A; Brown, D; Bu, X B; Buehler, M; Buescher, V; Bunichev, V; Burdin, S; Buszello, C P; Camacho-Pérez, E; Casey, B C K; Castilla-Valdez, H; Caughron, S; Chakrabarti, S; Chan, K M; Chandra, A; Chapon, E; Chen, G; Cho, S W; Choi, S; Choudhary, B; Cihangir, S; Claes, D; Clutter, J; Cooke, M; Cooper, W E; Corcoran, M; Couderc, F; Cousinou, M-C; Cutts, D; Das, A; Davies, G; de Jong, S J; De La Cruz-Burelo, E; Déliot, F; Demina, R; Denisov, D; Denisov, S P; Desai, S; Deterre, C; DeVaughan, K; Diehl, H T; Diesburg, M; Ding, P F; Dominguez, A; Dubey, A; Dudko, L V; Duperrin, A; Dutt, S; Eads, M; Edmunds, D; Ellison, J; Elvira, V D; Enari, Y; Evans, H; Evdokimov, V N; Feng, L; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Fortner, M; Fox, H; Fuess, S; Garcia-Bellido, A; García-González, J A; Gavrilov, V; Geng, W; Gerber, C E; Gershtein, Y; Ginther, G; Golovanov, G; Grannis, P D; Greder, S; Greenlee, H; Grenier, G; Gris, Ph; Grivaz, J-F; Grohsjean, A; Grünendahl, S; Grünewald, M W; Guillemin, T; Gutierrez, G; Gutierrez, P; Haley, J; Han, L; Harder, K; Harel, A; Hauptman, J M; Hays, J; Head, T; Hebbeker, T; Hedin, D; Hegab, H; Heinson, A P; Heintz, U; Hensel, C; Heredia-De La Cruz, I; Herner, K; Hesketh, G; Hildreth, M D; Hirosky, R; Hoang, T; Hobbs, J D; Hoeneisen, B; Hogan, J; Hohlfeld, M; Holzbauer, J L; Howley, I; Hubacek, Z; Hynek, V; Iashvili, I; Ilchenko, Y; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jayasinghe, A; Jeong, M S; Jesik, R; Jiang, P; Johns, K; Johnson, E; Johnson, M; Jonckheere, A; Jonsson, P; Joshi, J; Jung, A W; Juste, A; Kajfasz, E; Karmanov, D; Katsanos, I; Kehoe, R; Kermiche, S; Khalatyan, N; Khanov, A; Kharchilava, A; Kharzheev, Y N; Kiselevich, I; Kohli, J M; Kozelov, A V; Kraus, J; Kumar, A; Kupco, A; Kurča, T; Kuzmin, V A; Lammers, S; Lebrun, P; Lee, H S; Lee, S W; Lee, W M; Lei, X; Lellouch, J; Li, D; Li, H; Li, L; Li, Q Z; Lim, J K; Lincoln, D; Linnemann, J; Lipaev, V V; Lipton, R; Liu, H; Liu, Y; Lobodenko, A; Lokajicek, M; Lopes de Sa, R; Luna-Garcia, R; Lyon, A L; Maciel, A K A; Madar, R; Magaña-Villalba, R; Malik, S; Malyshev, V L; Mansour, J; Martínez-Ortega, J; McCarthy, R; McGivern, C L; Meijer, M M; Melnitchouk, A; Menezes, D; Mercadante, P G; Merkin, M; Meyer, A; Meyer, J; Miconi, F; Mondal, N K; Mulhearn, M; Nagy, E; Narain, M; Nayyar, R; Neal, H A; Negret, J P; Neustroev, P; Nguyen, H T; Nunnemann, T; Orduna, J; Osman, N; Osta, J; Pal, A; Parashar, N; Parihar, V; Park, S K; Partridge, R; Parua, N; Patwa, A; Penning, B; Perfilov, M; Peters, Y; Petridis, K; Petrillo, G; Pétroff, P; Pleier, M-A; Podstavkov, V M; Popov, A V; Prewitt, M; Price, D; Prokopenko, N; Qian, J; Quadt, A; Quinn, B; Ratoff, P N; Razumov, I; Ripp-Baudot, I; Rizatdinova, F; Rominsky, M; Ross, A; Royon, C; Rubinov, P; Ruchti, R; Sajot, G; Sánchez-Hernández, A; Sanders, M P; Santos, A S; Savage, G; Sawyer, L; Scanlon, T; Schamberger, R D; Scheglov, Y; Schellman, H; Schwanenberger, C; Schwienhorst, R; Sekaric, J; Severini, H; Shabalina, E; Shary, V; Shaw, S; Shchukin, A A; Simak, V; Skubic, P; Slattery, P; Smirnov, D; Snow, G R; Snow, J; Snyder, S; Söldner-Rembold, S; Sonnenschein, L; Soustruznik, K; Stark, J; Stoyanova, D A; Strauss, M; Suter, L; Svoisky, P; Titov, M; Tokmenin, V V; Tsai, Y-T; Tsybychev, D; Tuchming, B; Tully, C; Uvarov, L; Uvarov, S; Uzunyan, S; Van Kooten, R; van Leeuwen, W M; Varelas, N; Varnes, E W; Vasilyev, I A; Verkheev, A Y; Vertogradov, L S; Verzocchi, M; Vesterinen, M; Vilanova, D; Vokac, P; Wahl, H D; Wang, M H L S; Warchol, J; Watts, G; Wayne, M; Weichert, J; Welty-Rieger, L; Williams, M R J; Wilson, G W; Wobisch, M; Wood, D R; Wyatt, T R; Xie, Y; Yamada, R; Yang, S; Yasuda, T; Yatsunenko, Y A; Ye, W; Ye, Z; Yin, H; Yip, K; Youn, S W; Yu, J M; Zennamo, J; Zhao, T G; Zhou, B; Zhu, J; Zielinski, M; Zieminska, D; Zivkovic, L

    2014-01-31

    We present the first measurements of the ratios of cross sections σ(pp → Z+c jet)/σ(pp → Z+jet) and σ(pp → Z+c jet)/σ(pp → Z+b jet) for the associated production of a Z boson with at least one charm or bottom quark jet. Jets have transverse momentum ​pT(jet)​>20  GeV and pseudorapidity |​η(jet)​|<2.5. These cross section ratios are measured differentially as a function of jet and Z boson transverse momenta, based on 9.7  fb(-1) of pp collisions collected with the D0 detector at the Fermilab Tevatron Collider at √s=1.96  TeV. The measurements show significant deviations from perturbative QCD calculations and predictions from various event generators. PMID:24580440

  2. Microstructural Evolution of an Al-Alloyed Duplex Stainless Steel During Tensile Deformation Between 77 K and 473 K (-196 °C and 200 °C)

    Science.gov (United States)

    Rahimi, Reza; Ullrich, Christiane; Rafaja, David; Biermann, Horst; Mola, Javad

    2016-06-01

    Tensile deformation behavior of an Al-alloyed Fe-17Cr-6Mn-4Al-3Ni-0.45C (mass pct) duplex stainless steel containing approximately 20 vol pct ferrite was studied in the temperature range from 77 K to 473 K (-196 °C to 200 °C). While the elongation exhibited a maximum near room temperature, the yield strength continuously increased at lower tensile test temperatures. According to the microstructural examinations, the twinning-induced plasticity and the dislocation cell formation were the dominant deformation mechanisms in the austenite and ferrite, respectively. Reduction of the tensile ductility at T cells, cell refinement, and microbands formation occurred in sequence during deformation. Microhardness evolution of ferrite and austenite in the interrupted tensile test specimens implied a higher strain-hardening rate for the austenite as it clearly became the harder phase at higher tensile strain levels.

  3. Measurement of the ttbar Production Cross Section in ppbar Collisions at $\\sqrt{s}$ = 1.96 TeV using Dilepton Events

    CERN Document Server

    Acosta, D; Affolder, T; Akimoto, T; Albrow, M G; Ambrose, D; Amerio, S; Amidei, D; Anastassov, A; Anikeev, K; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Arisawa, T; Arguin, J F; Artikov, A; Ashmanskas, W; Attal, A; Azfar, F; Azzi-Bacchetta, P; Bacchetta, N; Bachacou, H; Badgett, W; Barbaro-Galtieri, A; Galtieri; Barker, G J; Barnes, V E; Barnett, B A; Baroiant, S; Barone, M; Bauer, G; Bedeschi, F; Behari, S; Belforte, S; Bellettini, G; Bellinger, J; Benjamin, D; Beretvas, A; Bhatti, A A; Binkley, M; Bisello, D; Bishai, M; Blair, R E; Blocker, C; Bloom, K; Blumenfeld, B; Bocci, A; Bodek, A; Bölla, G; Bolshov, A; Booth, P S L; Bortoletto, D; Boudreau, J; Bourov, S; Bromberg, C; Brubaker, E; Budagov, Yu A; Budd, H S; Burkett, K; Busetto, G; Bussey, P; Byrum, K L; Cabrera, S; Calafiura, P; Campanelli, M; Campbell, M; Canepa, A; Casarsa, M; Carlsmith, D; Carron, S; Carosi, R; Castro, A; Catastini, P; Cauz, D; Cerri, A; Cerri, C; Cerrito, L; Chapman, J; Chen, C; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, I; Cho, K; Chokheli, D; Chu, M L; Chuang, S; Chung, J Y; Chung, W H; Chung, Y S; Ciobanu, C I; Ciocci, M A; Clark, A G; Clark, D; Coca, M; Connolly, A; Convery, M; Conway, J; Cordelli, M; Cortiana, G; Cranshaw, J; Cuevas-Maestro, J; Culbertson, R; Currat, C; Cyr, D; Dagenhart, D; Da Ronco, S; D'Auria, S; De Barbaro, P; De Cecco, S; De Lentdecker, G; Dell'Agnello, S; Dell'Orso, Mauro; Demers, S; Demortier, L; Deninno, M; De Pedis, D; Derwent, P F; Dionisi, C; Dittmann, J R; Doksus, P; Dominguez, A; Donati, S; Donega, M; D'Onofrio, M; Dorigo, T; Drollinger, V; Ebina, K; Eddy, N; Ely, R; Erbacher, R; Erdmann, M; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, I; Feild, R G; Feindt, M; Fernández, J P; Ferretti, C; Field, R D; Fiori, I; Flanagan, G; Flaugher, B; Flores-Castillo, L R; Foland, A; Forrester, S; Foster, G W; Franklin, M; Frisch, H; Fujii, Y; Furic, I; Gajjar, A; Gallas, A; Galyardt, J; Gallinaro, M; García-Sciveres, M; Garfinkel, A F; Gay, C; Gerberich, H; Gerdes, D W; Gerchtein, E; Giagu, S; Giannetti, P; Gibson, A; Gibson, K; Ginsburg, C; Giolo, K; Giordani, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Goldstein, D; Goldstein, J; Gómez, G; Gómez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Gotra, Yu; Goulianos, K; Gresele, A; Grosso-Pilcher, C; Günther, M; Guimarães, J; Da Costa, M; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Handler, R; Happacher, F; Hara, K; Hare, M; Harr, R F; Harris, R M; Hartmann, F; Hatakeyama, K; Hauser, J; Hays, C; Hayward, H; Heider, E; Heinemann, B; Heinrich, J; Hennecke, M; Herndon, M; Hill, C; Hirschbuehl, D; Höcker, A; Hoffman, K D; Holloway, A; Hou, S; Houlden, M A; Huffman, B T; Huang, Y; Hughes, R E; Huston, J; Ikado, K; Incandela, J R; Introzzi, G; Iori, M; Ishizawa, Y; Issever, C; Ivanov, A; Iwata, Y; Iyutin, B; James, E; Jang, D; Jarrell, J; Jeans, D; Jensen, H; Jeon, E J; Jones, M; Joo, K K; Jun, S; Junk, T R; Kamon, T; Kang, J; Karagoz-Unel, M; Karchin, P E; Kartal, S; Kato, Y; Kemp, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, M S; Kim, S B; Kim, S H; Kim, T H; Kim, Y K; King, B T; Kirby, M; Kirsch, L; Klimenko, S; Knuteson, B; Ko, B R; Kobayashi, H; Koehn, P; Kong, D J; Kondo, K; Konigsberg, J; Kordas, K; Korn, A J; Korytov, A; Kotelnikov, K; Kotwal, A V; Kovalev, A; Kraus, J; Kravchenko, I; Kreymer, A; Kroll, J; Kruse, M; Krutelyov, V; Kuhlmann, S E; Kuznetsova, N; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, J; Lancaster, M; Lander, R; Lannon, K; Lath, A; Latino, G; Lauhakangas, R; Lazzizzera, I; Le, Y; Lecci, C; LeCompte, T; Lee, J; Lee, S W; Leonardo, N; Leone, S; Lewis, J D; Li, K; Lin, C; Lin, C S; Lindgren, M; Liss, T M; Litvintsev, D O; Liu, T; Liu, Y; Lockyer, N S; Loginov, A; Loreti, M; Loverre, P F; Lu, R S; Lucchesi, D; Lukens, P; Lyons, L; Lys, J; Lysak, R; MacQueen, D; Madrak, R; Maeshima, K; Maksimovic, P; Malferrari, L; Manca, G; Marginean, R; Martin, M; Martin, A; Martin, V; Martínez, M; Maruyama, T; Matsunaga, H; Mattson, M; Mazzanti, P; McFarland, K S; McGivern, D; McIntyre, P M; McNamara, P; NcNulty, R; Menzemer, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Miao, T; Miladinovic, N; Miller, L; Miller, R; Miller, J S; Mills, C; Miquel, R; Miscetti, S; Mitselmakher, G; Miyamoto, A; Miyazaki, Y; Moggi, N; Mohr, B; Moore, R; Morello, M; Moulik, T; Mukherjee, A; Mulhearn, M; Müller, T; Mumford, R; Munar, A; Murat, P; Nachtman, J; Nahn, S; Nakamura, I; Nakano, I; Napier, A; Napora, R; Naumov, D V; Necula, V; Niell, F; Nielsen, J; Nelson, C; Nelson, T; Neu, C; Neubauer, M S; Newman--, C; Holmes, J A; Nicollerat, A S; Nigmanov, T; Nodulman, L; Österberg, K; Ogawa, T; Oh, S; Oh, Y D; Ohsugi, T; Okusawa, T; Oldeman, R G C; Orava, R; Orejudos, W; Pagliarone, C; Palmonari, F; Paoletti, R; Papadimitriou, V; Pashapour, S; Patrick, J; Pauletta, G; Paulini, M; Pauly, T; Paus, C; Pellett, D; Penzo, Aldo L; Phillips, T J; Piacentino, G; Piedra, J; Pitts, K T; Plager, C; Pompos, A; Pondrom, L; Pope, G; Poukhov, O; Prakoshyn, F; Pratt, T; Pronko, A; Proudfoot, J; Ptohos, F; Punzi, G; Rademacker, J; Rakitine, A; Rappoccio, S; Ratnikov, F; Ray, H; Reichold, A; Reisert, B; Rekovic, V; Renton, P B; Rescigno, M; Rimondi, F; Rinnert, K; Ristori, L; Robertson, W J; Robson, A; Rodrigo, T; Rolli, S; Rosenson, L; Roser, R; Rossin, R; Rott, C; Russ, J; Ruiz, A; Ryan, D; Saarikko, H; Safonov, A; Saint-Denis, R; Sakumoto, W K; Salamanna, G; Saltzberg, D; Sánchez, C; Sansoni, A; Santi, L; Sarkar, S; Sato, K; Savard, P; Savoy-Navarro, A; Schemitz, P; Schlabach, P; Schmidt, E E; Schmidt, M P; Schmitt, M; Scodellaro, L; Sfiligoi, I; Shears, T G; Scribano, A; Scuri, F; Sedov, A; Seidel, S; Seiya, Y; Semeria, F; Sexton-Kennedy, L; Shapiro, M D; Shepard, P F; Shimojima, M; Shochet, M; Shon, Y; Shreyber, I; Sidoti, A; Siket, M; Sill, A; Sinervo, P; Sissakian, A N; Skiba, A; Slaughter, A J; Sliwa, K; Smith, J R; Snider, F D; Snihur, R; Somalwar, S V; Spalding, J; Spezziga, M; Spiegel, L; Spinella, F; Spiropulu, M; Squillacioti, P; Stadie, H; Stefanini, A; Stelzer, B; Stelzer-Chilton, O; Strologas, J; Stuart, D; Sukhanov, A; Sumorok, K; Sun, H; Suzuki, T; Taffard, A C; Tafirout, R; Takach, S F; Takano, H; Takashima, R; Takeuchi, Y; Takikawa, K; Tanaka, M; Tanaka, R; Tanimoto, N; Tapprogge, Stefan; Tecchio, M; Teng, P K; Terashi, K; Tesarek, R J; Tether, S; Thom, J; Thompson, A S; Thomson, E; Tipton, P; Tiwari, V; Tkaczyk, S; Toback, D; Tollefson, K; Tonelli, D; Tonnesmann, M; Torre, S; Torretta, D; Trischuk, W; Tseng, J; Tsuchiya, R; Tsuno, S; Tsybychev, D; Turini, N; Turner, M; Ukegawa, F; Unverhau, T; Uozumi, S; Usynin, D; Vacavant, L; Vaiciulis, A W; Varganov, A; Vataga, E; Vejcik, S; Velev, G V; Veramendi, G; Vickey, T; Vidal, R; Vila, I; Vilar, R; Volobuev, I P; Von der Mey, M; Wagner, R G; Wagner, R L; Wagner, W; Wallny, R; Walter, T; Yamashita, T; Yamamoto, K; Wan, Z; Wang, M J; Wang, S M; Warburton, A; Ward, B; Waschke, S; Waters, D; Watts, T; Weber, M; Wester, W C; Whitehouse, B; Wicklund, A B; Wicklund, E; Williams, H H; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolter, M; Worcester, M; Worm, S; Wright, T; Wu, X; Würthwein, F; Wyatt, A; Yagil, A; Yang, U K; Yao, W; Yeh, G P; Yi, K; Yoh, J; Yoon, P; Yorita, K; Yoshida, T; Yu, I; Yu, S; Yu, Z; Yun, C; Zanello, L; Zanetti, A; Zaw, I; Zetti, F; Zhou, J; Zsenei, A; Zucchelli, S

    2004-01-01

    We report a measurement of the ttbar production cross section using dilepton events with jets and missing transverse energy in ppbar collisions at a center-of-mass energy of 1.96 TeV. Using a 197 +/- 12 pb-1 data sample recorded by the upgraded Collider Detector at Fermilab, we use two complementary techniques to select candidate events. We compare the number of observed events and selected kinematical distributions with the predictions of the Standard Model and find good agreement. The combined result of the two techniques yields a ttbar production cross section of 7.0 +2.4/-2.1(stat.) +1.6/-1.1(syst.) +/- 0.4(lum.) pb.

  4. A Search for Scalar Bottom Quarks from Gluino Decays in $\\bar{p}p$ Collisions at $\\sqrt{s}=1.96$ TeV

    CERN Document Server

    Abulencia, A; Adelman, J; Affolder, T; Akimoto, T; Albrow, M G; Ambrose, D; Amerio, S; Amidei, D; Anastassov, A; Anikeev, K; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Arguin, J F; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Azfar, F; Azzi-Bacchetta, P; Azzurri, P; Bacchetta, N; Bachacou, H; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Baroiant, S; Bartsch, V; Bauer, G; Bedeschi, F; Behari, S; Belforte, S; Bellettini, G; Bellinger, J; Belloni, A; Ben-Haim, E; Benjamin, D; Beretvas, A; Beringer, J; Berry, T; Bhatti, A; Binkley, M; Bisello, D; Bishai, M; Blair, R E; Blocker, C; Bloom, K; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bölla, G; Bolshov, A; Bortoletto, D; Boudreau, J; Bourov, S; Boveia, A; Brau, B; Bromberg, C; Brubaker, E; Budagov, Yu A; Budd, H S; Budd, S; Burkett, K; Busetto, G; Bussey, P; Byrum, K L; Cabrera, S; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carlsmith, D; Carosi, R; Carron, S; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chapman, J; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, I; Cho, K; Chokheli, D; Chou, J P; Chu, P H; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Ciljak, M; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Coca, M; Connolly, A; Convery, M E; Conway, J; Cooper, B; Copic, K; Cordelli, M; Cortiana, G; Cruz, A; Cuevas-Maestro, J; Culbertson, R; Cyr, D; Da Ronco, S; D'Auria, S; D'onofrio, M; Dagenhart, D; De Barbaro, P; De Cecco, S; Deisher, A; De Lentdecker, G; Dell'Orso, Mauro; Demers, S; Demortier, L; Deng, J; Deninno, M; De Pedis, D; Derwent, P F; Dionisi, C; Dittmann, J R; Di Turo, P; Dorr, C; Dominguez, A; Donati, S; Donega, M; Dong, P; Donini, J; Dorigo, T; Dube, S; Ebina, K; Efron, J; Ehlers, J; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, I; Fedorko, W T; Feild, R G; Feindt, M; Fernández, J P; Field, R; Flanagan, G; Flores-Castillo, L R; Foland, A; Forrester, S; Foster, G W; Franklin, M; Freeman, J C; Fujii, Y; Furic, I; Gajjar, A; Gallinaro, M; Galyardt, J; García, J E; García-Sciveres, M; Garfinkel, A F; Gay, C; Gerberich, H; Gerchtein, E; Gerdes, D; Giagu, S; Di Giovanni, G P; Giannetti, P; Gibson, A; Gibson, K; Ginsburg, C; Giokaris, N; Giolo, K; Giordani, M; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D A; Gold, M; Goldschmidt, N; Goldstein, J; Gómez, G; Gómez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Gotra, Yu; Goulianos, K; Gresele, A; Griffiths, M; Grinstein, S; Grosso-Pilcher, C; Grundler, U; Guimarães da Costa, J; Haber, C; Hahn, S R; Hahn, K; Halkiadakis, E; Hamilton, A; Han, B Y; Handler, R; Happacher, F; Hara, K; Hare, M; Harper, S; Harr, R F; Harris, R M; Hatakeyama, K; Hauser, J; Hays, C; Hayward, H; Heijboer, A; Heinemann, B; Heinrich, J; Hennecke, M; Herndon, M; Heuser, J; Hidas, D; Hill, C S; Hirschbuehl, D; Höcker, A; Holloway, A; Hou, S; Houlden, M; Hsu, S C; Huffman, B T; Hughes, R E; Huston, J; Ikado, K; Incandela, J R; Introzzi, G; Iori, M; Ishizawa, Y; Ivanov, A; Iyutin, B; James, E; Jang, D; Jayatilaka, B; Jeans, D; Jensen, H; Jeon, E J; Jones, M; Joo, K K; Jun, S Y; Junk, T R; Kamon, T; Kang, J; Karagoz-Unel, M; Karchin, P E; Kato, Y; Kemp, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, M S; Kim, S B; Kim, S H; Kim, Y K; Kirby, M; Kirsch, L; Klimenko, S; Klute, M; Knuteson, B; Ko, B R; Kobayashi, H; Kondo, K; Kong, D J; Konigsberg, J; Kordas, K; Korytov, A; Kotwal, A V; Kovalev, A; Kraus, J; Kravchenko, I; Kreps, M; Kreymer, A; Kroll, J; Krumnack, N; Kruse, M; Krutelyov, V; Kuhlmann, S E; Kusakabe, Y; Kwang, S; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; Lecci, C; LeCompte, T; Lee, J; Lee, S W; Lefèvre, R; Leonardo, N; Leone, S; Levy, S; Lewis, J D; Li, K; Lin, C; Lin, C S; Lindgren, M; Lipeles, E; Liss, T M; Lister, A; Litvintsev, D O; Liu, T; Liu, Y; Lockyer, N S; Loginov, A; Loreti, M; Loverre, P F; Lu, R S; Lucchesi, D; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Lytken, E; Mack, P; MacQueen, D; Madrak, R; Maeshima, K; Maksimovic, P; Manca, G; Margaroli, F; Marginean, R; Marino, C; Martin, A; Martin, M; Martin, V; Martínez, M; Maruyama, T; Matsunaga, H; Mattson, M E; Mazini, R; Mazzanti, P; McFarland, K S; McGivern, D; McIntyre, P; McNamara, P; McNulty, R; Mehta, A; Menzemer, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Von der Mey, M; Miao, T; Miladinovic, N; Miles, J; Miller, R; Miller, J S; Mills, C; Milnik, M; Miquel, R; Miscetti, S; Mitselmakher, G; Miyamoto, A; Moggi, N; Mohr, B; Moore, R; Morello, M; Movilla-Fernández, P A; Mülmenstädt, J; Mukherjee, A; Mulhearn, M; Müller, T; Mumford, R; Murat, P; Nachtman, J; Nahn, S; Nakano, I; Napier, A; Naumov, D; Necula, V; Neu, C; Neubauer, M S; Nielsen, J; Nigmanov, T; Nodulman, L; Norniella, O; Ogawa, T; Oh, S H; Oh, Y D; Okusawa, T; Oldeman, R; Orava, R; Österberg, K; Pagliarone, C; Palencia, E; Paoletti, R; Papadimitriou, V; Papikonomou, A; Paramonov, A A; Parks, B; Pashapour, S; Patrick, J; Pauletta, G; Paulini, M; Paus, C; Pellett, D E; Penzo, Aldo L; Phillips, T J; Piacentino, G; Piedra, J; Pitts, K; Plager, C; Pondrom, L; Pope, G; Portell, X; Poukhov, O; Pounder, N; Prakoshyn, F; Pronko, A; Proudfoot, J; Ptohos, F; Punzi, G; Pursley, J; Rademacker, J; Rahaman, A; Rakitine, A; Rappoccio, S; Ratnikov, F; Reisert, B; Rekovic, V; Van Remortel, N; Renton, P B; Rescigno, M; Richter, S; Rimondi, F; Rinnert, K; Ristori, L; Robertson, W J; Robson, A; Rodrigo, T; Rogers, E; Rolli, S; Roser, R; Rossi, M; Rossin, R; Rott, C; Ruiz, A; Russ, J; Rusu, V; Ryan, D; Saarikko, H; Sabik, S; Safonov, A; Sakumoto, W K; Salamanna, G; Salto, O; Saltzberg, D; Sánchez, C; Santi, L; Sarkar, S; Sato, K; Savard, P; Savoy-Navarro, A; Scheidle, T; Schlabach, P; Schmidt, E E; Schmidt, M P; Schmitt, M; Schwarz, T; Scodellaro, L; Scott, A L; Scribano, A; Scuri, F; Sedov, A; Seidel, S; Seiya, Y; Semenov, A; Semeria, F; Sexton-Kennedy, L; Sfiligoi, I; Shapiro, M D; Shears, T G; Shepard, P F; Sherman, D; Shimojima, M; Shochet, M; Shon, Y; Shreyber, I; Sidoti, A; Siegrist, J L; Sill, A; Sinervo, P; Sisakian, A; Sjölin, J; Skiba, A; Slaughter, A J; Sliwa, K; Smirnov, D; Smith, J R; Snider, F D; Snihur, R; Söderberg, M; Soha, A; Somalwar, S; Sorin, V; Spalding, J; Spinella, F; Squillacioti, P; Stanitzki, M; Staveris-Polykalas, A; Saint-Denis, R; Stelzer, B; Stelzer-Chilton, O; Stentz, D; Strologas, J; Stuart, D; Suh, J S; Sukhanov, A; Sumorok, K; Sun, H; Suzuki, T; Taffard, A; Tafirout, R; Takashima, R; Takeuchi, Y; Takikawa, K; Tanaka, M; Tanaka, R; Tecchio, M; Teng, P K; Terashi, K; Tether, S; Thom, J; Thompson, A S; Thomson, E; Tipton, P; Tiwari, V; Tkaczyk, S; Toback, D; Tokar, S; Tollefson, K; Tomura, T; Tonelli, D; Tonnesmann, M; Torre, S; Torretta, D; Tourneur, S; Trischuk, W; Tsuchiya, R; Tsuno, S; Turini, N; Ukegawa, F; Unverhau, T; Uozumi, S; Usynin, D; Vacavant, L; Vaiciulis, A W; Vallecorsa, S; Varganov, A; Vataga, E; Velev, G; Veramendi, G; Veszpremi, V; Vickey, T; Vidal, R; Vila, I; Vilar, R; Vollrath, I; Volobuev, I P; Würthwein, F; Wagner, P; Wagner, R G; Wagner, R L; Wagner, W; Wallny, R; Walter, T; Wan, Z; Wang, M J; Wang, S M; Warburton, A; Ward, B; Waschke, S; Waters, D; Watts, T; Weber, M; Wester, W C; Whitehouse, B; Whiteson, D; Wicklund, A B; Wicklund, E; Williams, H H; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolfe, C; Worm, S; Wright, T; Wu, X; Wynne, S M; Yagil, A; Yamamoto, K; Yamaoka, J; Yamashita, Y; Yang, C; Yang, U K; Yao, W M; Yeh, G P; Yoh, J; Yorita, K; Yoshida, T; Yu, I; Yu, S S; Yun, J C; Zanello, L; Zanetti, A; Zaw, I; Zetti, F; Zhang, X; Zhou, J; Zucchelli, S

    2006-01-01

    We searched for scalar bottom quarks in 156~pb$^{-1}$ of {\\bf $\\bar{p}p$} collisions at {\\bf $\\sqrt{s}=1.96$}~TeV recorded by the CDF II experiment at the Tevatron. Scalar bottom quarks can be produced from gluino decays in R-parity conserving models of supersymmetry when the mass of the gluino exceeds that of the scalar bottom quark. Then, a scalar bottom quark can decay into a bottom quark and a neutralino. To search for this scenario, we investigated events with large missing transverse energy and at least three jets, two or more of which were identified as containing a secondary vertex from the hadronization of $b$ quarks. We found four candidate events, where $2.6\\pm 0.7$ are expected from standard model processes, and placed 95% confidence level lower limits on gluino and scalar bottom quark masses of up to 280 and $240\\gevm$, respectively.

  5. Forward-Backward Asymmetry in Top Quark Production in ppbar Collisions at sqrt{s}=1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Aaltonen, T.; /Helsinki Inst. of Phys.; Adelman, J.; /Chicago U., EFI; Akimoto, T.; /Tsukuba U.; Albrow, M.G.; /Fermilab; Alvarez Gonzalez, B.; /Cantabria U., Santander; Amerio, S.; /Padua U.; Amidei, D.; /Michigan U.; Anastassov, A.; /Northwestern U.; Annovi, A.; /Frascati; Antos, J.; /Comenius U.; Apollinari, G.; /Fermilab

    2008-06-01

    Reconstructable final state kinematics and charge assignment in the reaction p{bar p} {yields} t{bar t} allows tests of discrete strong interaction symmetries at high energy. We define frame dependent forward-backward asymmetries for the outgoing top quark in both the p{bar p} and t{bar t} rest frames, correct for experimental distortions, and derive values at the parton-level. Using 1.9 fb{sup -1} of p{bar p} collisions at {radical}s = 1.96 TeV recorded with the CDF II detector at the Fermilab Tevatron, we measure forward-backward top quark production asymmetries in the p{bar p} and t{bar t} rest frames of A{sub FB}{sup p{bar p}} = 0.17 {+-} 0.08 and A{sub FB}{sup t{bar t}} = 0.24 {+-} 0.14.

  6. Search for New Physics in High Mass Electron-Positron Events in ppbar Collisions at $\\sqrt{s}$ = 1.96 TeV

    CERN Document Server

    Aaltonen, T; Adelman, J; Affolder, T; Akimoto, T; Albrow, M G; Amerio, S; Amidei, D; Anastassov, A; Anikeev, K; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Aurisano, A; Azfar, F; Azzi-Bacchetta, P; Azzurri, P; Bacchetta, N; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Baroiant, S; Bartsch, V; Bauer, G; Beauchemin, P H; Bedeschi, F; Behari, S; Bellettini, G; Bellinger, J; Belloni, A; Benjamin, D; Beretvas, A; Beringer, J; Berry, T; Bhatti, A; Binkley, M; Bisello, D; Bizjak, I; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bölla, G; Bolshov, A; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, Yu; Budd, H S; Budd, S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Byrum, K L; Cabrera, S; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carrillo, S; Carlsmith, D; Carosi, R; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, I; Cho, K; Chokheli, D; Chou, J P; Choudalakis, G; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Cilijak, M; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Coca, M; Compostella, G; Convery, M E; Conway, J; Cooper, B; Copic, K; Cordelli, M; Cortiana, G; Crescioli, F; Cuenca-Almenar, C; Cuevas-Maestro, J; Culbertson, R; Cully, J C; Da Ronco, S; Datta, M; D'Auria, S; Davies, T; Dagenhart, D; De Barbaro, P; De Cecco, S; Deisher, A; De Lentdecker, G; De Lorenzo, G; Dell'Orso, Mauro; Delli Paoli, F; Demortier, L; Deng, J; Deninno, M; De Pedis, D; Derwent, P F; Di Giovanni, G P; Dionisi, C; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Dorr, C; Donati, S; Dong, P; Donini, J; Dorigo, T; Dube, S; Efron, J; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, I; Fedorko, W T; Feild, R G; Feindt, M; Fernández, J P; Field, R; Flanagan, G; Forrest, R; Forrester, S; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; García, J E; Garberson, F; Garfinkel, A F; Gay, C; Gerberich, H; Gerdes, D; Giagu, S; Giannetti, P; Gibson, K; Gimmell, J L; Ginsburg, C; Giokaris, N; Giordani, M; Giromini, P; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Goldstein, J; Golossanov, A; Gómez, G; Gómez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Grinstein, S; Grosso-Pilcher, C; Group, R C; Grundler, U; Guimarães da Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Hamilton, A; Han, B Y; Han, J Y; Handler, R; Happacher, F; Hara, K; Hare, D; Hare, M; Harper, S; Harr, R F; Harris, R M; Hartz, M; Hatakeyama, K; Hauser, J; Hays, C; Heck, M; Heijboer, A; Heinemann, B; Heinrich, J; Henderson, C; Herndon, M; Heuser, J; Hidas, D; Hill, C S; Hirschbuehl, D; Höcker, A; Holloway, A; Hou, S; Houlden, M; Hsu, S C; Huffman, B T; Hughes, R E; Husemann, U; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ivanov, A; Iyutin, B; James, E; Jang, D; Jayatilaka, B; Jeans, D; Jeon, E J; Jindariani, S; Johnson, W; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Karchin, P E; Kato, Y; Kemp, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Klute, M; Knuteson, B; Ko, B R; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kraan, A C; Kraus, J; Kreps, M; Kroll, J; Krumnack, N; Kruse, M; Krutelyov, V; Kubo, T; Kuhlmann, S E; Kuhr, T; Kulkarni, N P; Kusakabe, Y; Kwang, S; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; LeCompte, T; Lee, J; Lee, J; Lee, Y J; Lee, S W; Lefèvre, R; Leonardo, N; Leone, S; Levy, S; Lewis, J D; Lin, C; Lin, C S; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Lu, R S; Lucchesi, D; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Lytken, E; Mack, P; MacQueen, D; Madrak, R; Maeshima, K; Makhoul, K; Mäki, T; Maksimovic, P; Malde, S; Malik, S; Manca, G; Manousakis, A; Margaroli, F; Marginean, R; Marino, C; Marino, C P; Martin, A; Martin, M; Martin, V; Martínez, M; Martinez-Ballarin, R; Maruyama, T; Mastrandrea, P; Masubuchi, T; Matsunaga, H; Mattson, M E; Mazini, R; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtälä, P; Menzemer, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Miao, T; Miladinovic, N; Miles, J; Miller, R; Mills, C; Milnik, M; Mitra, A; Mitselmakher, G; Miyamoto, A; Moed, S; Moggi, N; Mohr, B; Moon, C S; Moore, R; Morello, M; Movilla-Fernández, P A; Mülmenstädt, J; Mukherjee, A; Müller, T; Mumford, R; Murat, P; Mussini, M; Nachtman, J; Nagano, A; Naganoma, J; Nakamura, K; Nakano, I; Napier, A; Necula, V; Neu, C; Neubauer, M S; Nielsen, J; Nodulman, L; Norniella, O; Nurse, E; Oh, S H; Oh, Y D; Oksuzian, I; Okusawa, T; Oldeman, R; Orava, R; Österberg, K; Pagliarone, C; Palencia, E; Papadimitriou, V; Papaikonomou, A; Paramonov, A A; Parks, B; Pashapour, S; Patrick, J; Pauletta, G; Paulini, M; Paus, C; Pellett, D E; Penzo, Aldo L; Phillips, T J; Piacentino, G; Piedra, J; Pinera, L; Pitts, K; Plager, C; Pondrom, L; Portell, X; Poukhov, O; Pounder, N; Prakoshyn, F; Pronko, A; Proudfoot, J; Ptohos, F; Punzi, G; Pursley, J; Rademacker, J; Rahaman, A; Ramakrishnan, V; Ranjan, N; Redondo, I; Reisert, B; Rekovic, V; Renton, P B; Rescigno, M; Richter, S; Rimondi, F; Ristori, L; Robson, A; Rodrigo, T; Rogers, E; Rolli, S; Roser, R; Rossi, M; Rossin, R; Roy, P; Ruiz, A; Russ, J; Rusu, V; Saarikko, H; Safonov, A; Sakumoto, W K; Salamanna, G; Salto, O; Santi, L; Sarkar, S; Sartori, L; Sato, K; Savard, P; Savoy-Navarro, A; Scheidle, T; Schlabach, P; Schmidt, E E; Schmidt, M P; Schmitt, M; Schwarz, T; Scodellaro, L; Scott, A L; Scribano, A; Scuri, F; Sedov, A; Seidel, S; Seiya, Y; Semenov, A; Sexton-Kennedy, L; Sfyrla, A; Shalhout, S Z; Shapiro, M D; Shears, T G; Shepard, P F; Sherman, D; Shimojima, M; Shochet, M; Shon, Y; Shreyber, I; Sidoti, A; Sinervo, P; Sisakian, A; Slaughter, A J; Slaunwhite, J; Sliwa, K; Smith, J R; Snider, F D; Snihur, R; Söderberg, M; Soha, A; Somalwar, S; Sorin, V; Spalding, J; Spinella, F; Spreitzer, T; Squillacioti, P; Stanitzki, M; Staveris-Polykalas, A; Saint-Denis, R; Stelzer, B; Stelzer-Chilton, O; Stentz, D; Strologas, J; Stuart, D; Suh, J S; Sukhanov, A; Sun, H; Suslov, I; Suzuki, T; Taffard, A; Takashima, R; Takeuchi, Y; Tanaka, R; Tecchio, M; Teng, P K; Terashi, K; Thom, J; Thompson, A S; Thomson, E; Tipton, P; Tiwari, V; Tkaczyk, S; Toback, D; Tokar, S; Tollefson, K; Tomura, T; Tonelli, D; Torre, S; Torretta, D; Tourneur, S; Trischuk, W; Tsuno, S; Tu, Y; Turini, N; Ukegawa, F; Uozumi, S; Vallecorsa, S; Van Remortel, N; Varganov, A; Vataga, E; Vázquez, F; Velev, G; Vellidis, C; Veramendi, G; Veszpremi, V; Vidal, M; Vidal, R; Vila, I; Vilar, R; Vine, T; Vogel, M; Vollrath, I; Volobuev, I; Volpi, G; Würthwein, F; Wagner, P; Wagner, R G; Wagner, R L; Wagner, J; Wagner, W; Wallny, R; Wang, S M; Warburton, A; Waters, D; Weinberger, M; Wester, W C; Whitehouse, B; Whiteson, D; Wicklund, A B; Wicklund, E; Williams, G; Williams, H H; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolfe, C; Wright, T; Wu, X; Wynne, S M; Yagil, A; Yamamoto, K; Yamaoka, J; Yamashita, T; Yang, C; Yang, U K; Yang, Y C; Yao, W M; Yeh, G P; Yoh, J; Yorita, K; Yoshida, T; Yu, G B; Yu, I; Yu, S S; Yun, J C; Zanello, L; Zanetti, A; Zaw, I; Zhang, X; Zhou, J; Zucchelli, S

    2007-01-01

    We report the results of a search for a narrow resonance in electron-positron events in the invariant mass range of 150-950 GeV/c^2 using 1.3 fb^-1 of ppbar collision data at $\\sqrt{s}$ = 1.96 TeV collected by the CDF II detector at Fermilab. No significant evidence of such a resonance is observed and we interpret the results to exclude the standard model-like Z' with a mass below 923 GeV/c^2 and the Randall-Sundrum graviton with a mass below 807 GeV/c^2 for k/M_pl=0.1, both at the 95% confidence level. Combining with di-photon data excludes the Randall-Sundrum graviton for masses below 889 GeV/c^2 for k/M_pl=0.1.

  7. A direct Measurement of the W Boson Width in ppbar Collisions at $\\sqrt{s}$ = 1.96 TeV

    CERN Document Server

    Aaltonen, T; Akimoto, T; Albrow, M G; Alvarez-Gonzalez, B; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Apresyan, A; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Aurisano, A; Azfar, F; Azzi-Bacchetta, P; Azzurri, P; Bacchetta, N; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Baroiant, S; Bartsch, V; Bauer, G; Beauchemin, P H; Bedeschi, F; Bednar, P; Beecher, D; Behari, S; Bellettini, G; Bellinger, J; Belloni, A; Benjamin, D; Beretvas, A; Beringer, J; Berry, T; Bhatti, A; Binkley, M; Bisello, D; Bizjak, I; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bölla, G; Bolshov, A; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Bridgeman, A; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, Yu; Budd, H S; Budd, S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Byrum, K L; Cabrera, S; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carlsmith, D; Carosi, R; Carrillo, S; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, K; Chokheli, D; Chou, J P; Choudalakis, G; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Compostella, G; Convery, M E; Conway, J; Cooper, B; Copic, K; Cordelli, M; Cortiana, G; Crescioli, F; Cuenca-Almenar, C; Cuevas-Maestro, J; Culbertson, R; Cully, J C; Dagenhart, D; Datta, M; Davies, T; De Barbaro, P; De Cecco, S; Deisher, A; De Lentdecker, G; De Lorenzo, G; Dell'Orso, Mauro; Demortier, L; Deng, J; Deninno, M; De Pedis, D; Derwent, P F; Di Giovanni, G P; Dionisi, C; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Donati, S; Dong, P; Donini, J; Dorigo, T; Dube, S; Efron, J; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, W T; Feild, R G; Feindt, M; Fernández, J P; Ferrazza, C; Field, R; Flanagan, G; Forrest, R; Forrester, S; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; Garberson, F; García, J E; Garfinkel, A F; Gerberich, H; Gerdes, D; Giagu, S; Giakoumopolou, V; Giannetti, P; Gibson, K; Gimmell, J L; Ginsburg, C M; Giokaris, N; Giordani, M; Giromini, P; Giunta, M; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Golossanov, A; Gómez, G; Gómez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Grinstein, S; Grosso-Pilcher, C; Group, R C; Grundler, U; Guimarães da Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Hamilton, A; Han, B Y; Han, J Y; Handler, R; Happacher, F; Hara, K; Hare, D; Hare, M; Harper, S; Harr, R F; Harris, R M; Hartz, M; Hatakeyama, K; Hauser, J; Hays, C; Heck, M; Heijboer, A; Heinemann, B; Heinrich, J; Henderson, C; Herndon, M; Heuser, J; Hewamanage, S; Hidas, D; Hill, C S; Hirschbuehl, D; Höcker, A; Hou, S; Houlden, M; Hsu, S C; Huffman, B T; Hughes, R E; Husemann, U; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ivanov, A; Iyutin, B; James, E; Jayatilaka, B; Jeans, D; Jeon, E J; Jindariani, S; Johnson, W; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Kar, D; Karchin, P E; Kato, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Klute, M; Knuteson, B; Ko, B R; Koay, S A; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kraus, J; Kreps, M; Kroll, J; Krumnack, N; Kruse, M; Krutelyov, V; Kubo, T; Kuhlmann, S E; Kuhr, T; Kulkarni, N P; Kusakabe, Y; Kwang, S; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; LeCompte, T; Lee, J; Lee, J; Lee, Y J; Lee, S W; Lefèvre, R; Leonardo, N; Leone, S; Levy, S; Lewis, J D; Lin, C; Lin, C S; Linacre, J; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Lovas, L; Lu, R S; Lucchesi, D; Lueck, J; Luci, C; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Lytken, E; Mack, P; MacQueen, D; Madrak, R; Maeshima, K; Makhoul, K; Mäki, T; Maksimovic, P; Malde, S; Malik, S; Manca, G; Manousakis, A; Margaroli, F; Marino, C; Marino, C P; Martin, A; Martin, M; Martin, V; Martínez, M; Martinez-Ballarin, R; Maruyama, T; Mastrandrea, P; Masubuchi, T; Mattson, M E; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtälä, P; Menzemer, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Miao, T; Miladinovic, N; Miles, J; Miller, R; Mills, C; Milnik, M; Mitra, A; Mitselmakher, G; Miyake, H; Moed, S; Moggi, N; Moon, C S; Moore, R; Morello, M; Movilla-Fernández, P A; Mülmenstädt, J; Mukherjee, A; Müller, T; Mumford, R; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Nagano, A; Naganoma, J; Nakamura, K; Nakano, I; Napier, A; Necula, V; Neu, C; Neubauer, M S; Nielsen, J; Nodulman, L; Norman, M; Norniella, O; Nurse, E; Oh, S H; Oh, Y D; Oksuzian, I; Okusawa, T; Oldeman, R; Orava, R; Österberg, K; Pagan Griso, S; Pagliarone, C; Palencia, E; Papadimitriou, V; Papaikonomou, A; Paramonov, A A; Parks, B; Pashapour, S; Patrick, J; Pauletta, G; Paulini, M; Paus, C; Pellett, D E; Penzo, Aldo L; Phillips, T J; Piacentino, G; Piedra, J; Pinera, L; Pitts, K; Plager, C; Pondrom, L; Portell, X; Poukhov, O; Pounder, N; Prakoshyn, F; Pronko, A; Proudfoot, J; Ptohos, F; Punzi, G; Pursley, J; Rademacker, J; Rahaman, A; Ramakrishnan, V; Ranjan, N; Redondo, I; Reisert, B; Rekovic, V; Renton, P B; Rescigno, M; Richter, S; Rimondi, F; Ristori, L; Robson, A; Rodrigo, T; Rogers, E; Rolli, S; Roser, R; Rossi, M; Rossin, R; Roy, P; Ruiz, A; Russ, J; Rusu, V; Saarikko, H; Safonov, A; Sakumoto, W K; Salamanna, G; Salto, O; Santi, L; Sarkar, S; Sartori, L; Sato, K; Savoy-Navarro, A; Scheidle, T; Schlabach, P; Schmidt, E E; Schmidt, M A; Schmidt, M P; Schmitt, M; Schwarz, T; Scodellaro, L; Scott, A L; Scribano, A; Scuri, F; Sedov, A; Seidel, S; Seiya, Y; Semenov, A; Sexton-Kennedy, L; Sfyria, A; Shalhout, S Z; Shapiro, M D; Shears, T G; Shepard, P F; Sherman, D; Shimojima, M; Shochet, M; Shon, Y; Shreyber, I; Sidoti, A; Sinervo, P; Sisakian, A; Slaughter, A J; Slaunwhite, J; Sliwa, K; Smith, J R; Snider, F D; Snihur, R; Söderberg, M; Soha, A; Somalwar, S; Sorin, V; Spalding, J; Spinella, F; Spreitzer, T; Squillacioti, P; Stanitzki, M; Saint-Denis, R; Stelzer, B; Stelzer-Chilton, O; Stentz, D; Strologas, J; Stuart, D; Suh, J S; Sukhanov, A; Sun, H; Suslov, I; Suzuki, T; Taffard, A; Takashima, R; Takeuchi, Y; Tanaka, R; Tecchio, M; Teng, P K; Terashi, K; Thom, J; Thompson, A S; Thompson, G A; Thomson, E; Tipton, P; Tiwari, V; Tkaczyk, S; Toback, D; Tokar, S; Tollefson, K; Tomura, T; Tonelli, D; Torre, S; Torretta, D; Tourneur, S; Trischuk, W; Tu, Y; Turini, N; Ukegawa, F; Uozumi, S; Vallecorsa, S; Van Remortel, N; Varganov, A; Vataga, E; Vázquez, F; Velev, G; Vellidis, C; Veszpremi, V; Vidal, M; Vidal, R; Vila, I; Vilar, R; Vine, T; Vogel, M; Volobuev, I; Volpi, G; Würthwein, F; Wagner, P; Wagner, R G; Wagner, R L; Wagner-Kuhr, J; Wagner, W; Wakisaka, T; Wallny, R; Wang, S M; Warburton, A; Waters, D; Weinberger, M; Wester, W C; Whitehouse, B; Whiteson, D; Wicklund, A B; Wicklund, E; Williams, G; Williams, H H; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolfe, C; Wright, T; Wu, X; Wynne, S M; Yagil, A; Yamamoto, K; Yamaoka, J; Yamashita, T; Yang, C; Yang, U K; Yang, Y C; Yao, W M; Yeh, G P; Yoh, J; Yorita, K; Yoshida, T; Yu, G B; Yu, I; Yu, S S; Yun, J C; Zanello, L; Zanetti, A; Zaw, I; Zhang, X; Zheng, Y; Zucchelli, S

    2007-01-01

    A direct measurement of the total decay width of the W boson G_W is presented using 350 pb-1 of data from ppbar collisions at $\\sqrt{s}$ = 1.96 TeV collected with the CDF II detector at the Fermilab Tevatron. The width is determined by normalizing predicted signal and background distributions to 230185 W candidates decaying to enu and munu in the transverse-mass region 50 < M_T < 90 GeV and then fitting the predicted shape to 6055 events in the high-M_T region, 90 < M_T < 200 GeV. The result is G_W = 2032 +/- 45 (stat.) +/- 57 (syst.) MeV, consistent with the standard model expectation.

  8. Search for Anomalous Kinematics of Top Dilepton Events in Proton - Anti-proton Collisions at s**(1/2) = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Ivanov, Andrew Gennadievich

    2004-12-01

    The author presents a search for anomalous kinematics of t{bar t} dilepton events in p{bar p} collisions at {radical}s = 1.96 TeV using 193 pb{sup -1} of data collected with the CDF II detector. They developed a new a priori technique designed to silate the subset in a data sample revealing the largest deviation from Standard Model expectations and to quantify the significance of this departure. In the four-variable space considered, no particular subset shows a significant discrepancy and they find that the probability to obtain a data sample less consistent with the Standard Model than what is observed is 1.0-4.5%.

  9. Measurement of dijet angular distributions at sqrt{s}=1.96TeV and searches for quark compositeness and extra spatial dimensions

    Energy Technology Data Exchange (ETDEWEB)

    Collaboration, D0

    2009-06-01

    We present the first measurement of dijet angular distributions in p{bar p} collisions at {radical}s = 1.96 TeV at the Fermilab Tevatron Collider. The measurement is based on a dataset corresponding to an integrated luminosity of 0.7 fb{sup -1} collected with the D0 detector. Dijet angular distributions have been measured over a range of dijet masses, from 0.25 TeV to above 1.1 TeV. The data are in good agreement with the predictions of perturbative QCD and are used to constrain new physics models including quark compositeness, large extra dimensions, and TeV{sup -1} scale extra dimensions. For all models considered, we set the most stringent direct limits to date.

  10. Determination of the strong coupling constant from the inclusive jet cross section in ppbar collisions at sqrt(s)=1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abazov, V.M.; /Dubna, JINR; Abbott, B.; /Oklahoma U.; Abolins, M.; /Michigan State U.; Acharya, B.S.; /Tata Inst.; Adams, M.; /Illinois U., Chicago; Adams, T.; /Florida State U.; Aguilo, E.; /Alberta U. /Simon Fraser U. /York U., Canada /McGill U.; Ahsan, M.; /Kansas State U.; Alexeev, G.D.; /Dubna, JINR; Alkhazov, G.; /St. Petersburg, INP; Alton, A.; /Michigan U. /Northeastern U.

    2009-11-01

    We determine the strong coupling constant {alpha}{sub s} and its energy dependence from the p{sub T} dependence of the inclusive jet cross section in p{bar p} collisions at {radical}s = 1.96 TeV. The strong coupling constant is determined over the transverse momentum range 50 < p{sub T} < 145 GeV. Using perturbative QCD calculations to order {Omicron}({alpha}{sub s}{sup 3}) combined with {Omicron}({alpha}{sub s}{sup 4}) contributions from threshold corrections, we obtain {alpha}{sub s}(M{sub Z}) = 0.1173{sub -0.0049}{sup +0.0041}. This is the most precise result obtained at a hadron-hadron collider.

  11. Search for Gluino-Mediated Sbottom Production in p anti-p Collisions at s**(1/2) = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Aaltonen, T.; /Helsinki Inst. of Phys.; Adelman, Jahred A.; /Chicago U., EFI; Akimoto, T.; /Tsukuba U.; Alvarez Gonzalez, B.; /Cantabria Inst. of Phys.; Amerio, S.; /INFN, Padua; Amidei, Dante E.; /Michigan U.; Anastassov, A.; /Northwestern U.; Annovi, Alberto; /Frascati; Antos, Jaroslav; /Comenius U.; Apollinari, G.; /Fermilab; Apresyan, A.; /Purdue U. /Waseda U.

    2009-03-01

    We report on a search for the supersymmetric partner of the bottom quark produced from gluino decays in data from 2.5 fb{sup -1} of integrated luminosity collected by the Collider Detector at Fermilab at {radical}s = 1.96 TeV. Candidate events are selected requiring two or more jets and large missing transverse energy. At least two of the jets are required to be tagged as originating from a b quark to enhance the sensitivity. The results are in good agreement with the prediction of the standard model processes, giving no evidence for gluino decay to sbottom quarks. This result constrains the gluino-pair-production cross section to be less than 40 fb at 95% credibility level for a gluino mass of 350 GeV/c{sup 2}.

  12. Search for chargino-neutralino production in p anti-p collisions at 1.96-TeV with high-p(T) leptons

    Energy Technology Data Exchange (ETDEWEB)

    Aaltonen, T.; /Helsinki Inst. of Phys.; Adelman, J.; /Chicago U., EFI; Akimoto, T.; /Tsukuba U.; Albrow, M.G.; /Fermilab; Alvarez Gonzalez, B.; /Cantabria U., Santander; Amerio, S.; /Padua U.; Amidei, D.; /Michigan U.; Anastassov, A.; /Rutgers U., Piscataway; Annovi, A.; /Frascati; Antos, J.; /Comenius U.; Aoki, M.; /Illinois U., Urbana /Fermilab

    2007-11-01

    The authors present a search for the associated production of charginos and neutralinos in p{bar p} collisions at {radical}s = 1.96 TeV. The data were collected at the Collider Detector at Fermilab (CDF II) and correspond to integrated luminosities between 0.7 and 1.0 fb{sup -1}. They look for final states with one high-p{sub T} electron or muon, and two additional leptons. The results are consistent with the standard model expectations, and they set limits on the cross section as a function of the chargino mass in three different supersymmetric scenarios. For a specific MSSM scenario with no slepton mixing they set a 95% C.L. limit at 151 GeV/c{sup 2}.

  13. Search for Higgs bosons decaying to tau(+)tau(-) pairs in p(p)over-bar collisions at root s=1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abazov, V.M.; Abazov, V. M.; Abbott, B.; Achary, B. S.; Adams, M.; Adams, T.; Alexeev, G. D.; Alkhazov, G.; Alton, A.; Alverson, G.; Alves, G. A.; Aoki, M.; Arov, M.; Askew, A.; Asman, B.; Atramentov, O.; Avila, C.; BackusMayes, J.; Badaud, F.; Bagby, L.; Baldin, B.; Bandurin, D. V.; Banerjee, S.; Barberis, E.; Baringer, P.; Barreto, J.; Bartlett, J. F.; Bassler, U.; Bazterra, V.; Beale, S.; Bean, A.; Begalli, M.; Begel, M.; Belanger-Champagne, C.; Bellantoni, L.; Beri, S. B.; Bernardi, G.; Bernhard, R.; Bertram, I.; Besancon, M.; Beuselinck, R.; Bezzubov, V. A.; Bhat, P. C.; Bhatnagar, V.; Blazey, G.; Blessing, S.; Bloom, K.; Boehnlein, A.; Boline, D.; Boos, E. E.; Borissov, G.; Bose, T.; Brandt, A.; Brandt, O.; Brock, R.; Brooijmans, G.; Bross, A.; Brown, D.; Brown, J.; Bu, X. B.; Buehler, M.; Buescher, V.; Bunichev, V.; Burdin, S.; Burnett, T. H.; Buszello, C. P.; Calpas, B.; Camacho-Perez, E.; Carrasco-Lizarraga, M. A.; Casey, B. C. K.; Castilla-Valdez, H.; Chakrabarti, S.; Chakraborty, D.; Chan, K. M.; Chandra, A.; Chen, G.; Chevalier-Thery, S.; Cho, D. K.; Cho, S. W.; Choi, S.; Choudhary, B.; Cihangir, S.; Claes, D.; Clutter, J.; Cooke, M.; Cooper, W. E.; Corcoran, M.; Couderc, F.; Cousinou, M. -C.; Croc, A.; Cutts, D.; Das, A.; Davies, G.; De, K.; de Jong, S. J.; De La Cruz-Burelo, E.; Deliot, F.; Demarteau, M.; Demina, R.; Denisov, D.; Denisov, S. P.; Desai, S.; Deterre, C.; DeVaughan, K.; Diehl, H. T.; Diesburg, M.; Ding, P. F.; Dominguez, A.; Dorland, T.; Dubey, A.; Dudko, L. V.; Duggan, D.; Duperrin, A.; Dutt, S.; Dyshkant, A.; Eads, M.; Edmunds, D.; Ellison, J.; Elvira, V. D.; Enari, Y.; Evans, H.; Evdokimov, A.; Evdokimov, V. N.; Facini, G.; Ferbel, T.; Fiedler, F.; Filthaut, F.; Fisher, W.; Fisk, H. E.; Fortner, M.; Fox, H.; Fuess, S.; Garcia-Bellido, A.; Gavrilov, V.; Gay, P.; Geng, W.; Gerbaudo, D.; Gerber, C. E.; Gershtein, Y.; Ginther, G.; Golovanov, G.; Goussiou, A.; Grannis, P. D.; Greder, S.; Greenlee, H.; Greenwood, Z. D.; Gregores, E. M.; Grenier, G.; Gris, Ph.; Grivaz, J. -F.; Grohsjea, A.; Gruenendahl, S.; Gruenewald, M. W.; Guillemin, T.; Guo, F.; Gutierrez, G.; Gutierrez, P.; Haas, A.; Hagopia, S.; Haley, J.; Hang, L.; Harder, K.; Harein, A.; Hauptman, J. M.; Hays, J.; Head, T.; Hebbeker, T.; Hedin, D.; Hegab, H.; Heinson, A. P.; Heintz, U.; Hensel, C.; Heredia-De La Cruz, I.; Herner, K.; Hesketh, G.; Hildreth, M. D.; Hirosky, R.; Hoangau, T.; Hobbs, J. D.; Hoeneisen, B.; Hohlfeld, M.; Hubacek, Z.; Huske, N.; Hynek, V.; Lashvili, I.; Ilchenko, Y.; Illingworth, R.; Ito, A. S.; Jabeen, S.; Jaffre, M.; Jamin, D.; Jayasinghe, A.; Jesik, R.; Johns, K.; Johnson, M.; Johnston, D.; Jonckheere, A.; Jonsson, P.; Joshi, J.; Jung, A. W.; Juste, A.; Kaadze, K.; Kajfasz, E.; Karmanov, D.; Kasper, P. A.; Katsanos, I. I.; Kehoe, R.; Kermiche, S.; Khalatyan, N.; Khanov, A.; Kharchilava, A.; Kharzheev, Y. N.; Kirby, M. H.; Kohli, J. M.; Kozelov, A. V.; Kraus, J.; Kulikov, S.; Kumar, A.; Kupco, A.; Kurca, T.; Kuzmin, V. A.; Kvita, J.; Lammers, S.; Landsberg, G.; Lebrun, P.; Lee, H. S.; Lee, S. W.; Lee, W. M.; Lellouch, J.; Li, L.; Li, Q. Z.; Lietti, S. M.; Lim, J. K.; Lincoln, D.; Linnemann, J.; Lipaev, V. V.; Lipton, R.; Liu, Y.; Liu, Z.; Lobodenko, A.; Lokajicek, M.; de Sa, R. Lopes; Lubatti, H. J.; Luna-Garcia, R.; Lyon, A. L.; Maciel, A. K. A.; Mackin, D.; Madar, R.; Magana-Villalba, R.; Malik, S.; Malyshev, V. L.; Maravin, Y.; Martinez-Ortega, J.; McCarthy, R.; McGivern, C. L.; Meijer, M. M.; Melnitchouk, A.; Menezes, D.; Mercadante, P. G.; Merkin, M.; Meyer, A.; Meyer, J.; et al.

    2012-02-01

    We present a search for the production of neutral Higgs bosons decaying into {tau}{sup +}{tau}{sup -} pairs in p{bar p} collisions at a center-of-mass energy of 1.96 TeV. The data, corresponding to an integrated luminosity of 5.4 fb{sup -1}, were collected by the D0 experiment at the Fermilab Tevatron Collider. We set upper limits at the 95% C.L. on the product of production cross section and branching ratio for a scalar resonance decaying into {tau}{sup +}{tau}{sup -} pairs, and we interpret these limits as limits on the production of Higgs bosons in the minimal supersymmetric standard model (MSSM) and as constraints in the MSSM parameter space.

  14. Measurement of the inclusive jet cross section in p(p)over-bar collisions at root s=1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abazov V. M.; Abbott B.; Acharya B. S.; Adams M.; Adams T.; Alexeev G. D.; Alkhazov G.; Alton A.; Alverson G.; Alves G. A.; Aoki M.; Askew A.; Asman B.; Atkins S.; Atramentov O.; Augsten K.; Avila C.; BackusMayes J.; Badaud F.; Bagby L.; Baldin B.; Bandurin D. V.; Banerjee S.; Barberis E.; Baringer P.; Barreto J.; Bartlett J. F.; Bassler U.; Bazterra V.; Bean A.; Begalli M.; Belanger-Champagne C.; Bellantoni L.; Beri S. B.; Bernardi G.; Bernhard R.; Bertram I.; Besancon M.; Beuselinck R.; Bezzubov V. A.; Bhat P. C.; Bhatnagar V.; Blazey G.; Blessing S.; Bloom K.; Boehnlein A.; Boline D.; Boos E. E.; Borissov G.; Bose T.; Brandt A.; Brandt O.; Brock R.; Brooijmans G.; Bross A.; Brown D.; Brown J.; Bu X. B.; Buehler M.; Buescher V.; Bunichev V.; Burdin S.; Burnett T. H.; Buszello C. P.; Calpas B.; Camacho-Perez E.; Carrasco-Lizarraga M. A.; Casey B. C. K.; Castilla-Valdez H.; Chakrabarti S.; Chakraborty D.; Chan K. M.; Chandra A.; Chapon E.; Chen G.; Chevalier-Thery S.; Cho D. K.; Cho S. W.; Choi S.; Choudhary B.; Cihangir S.; Claes D.; Clutter J.; Cooke M.; Cooper W. E.; Corcoran M.; Couderc F.; Cousinou M-C.; Croc A.; Cutts D.; Das A.; Davies G.; De K.; de Jong S. J.; De La Cruz-Burelo E.; Deliot F.; Demina R.; Denisov D.; Denisov S. P.; Desai S.; Deterre C.; DeVaughan K.; Diehl H. T.; Diesburg M.; Ding P. F.; Dominguez A.; Dorland T.; Dubey A.; Dudko L. V.; Duggan D.; Duperrin A.; Dutt S.; Dyshkant A.; Eads M.; Edmunds D.; Ellison J.; Elvira V. D.; Enari Y.; Evans H.; Evdokimov A.; Evdokimov V. N.; Facini G.; Ferbel T.; Fiedler F.; Filthaut F.; Fisher W.; Fisk H. E.; Fortner M.; Fox H.; Fuess S.; Garcia-Bellido A.; Garcia-Guerra G. A.; Gavrilov V.; Gay P.; Geng W.; Gerbaudo D.; Gerber C. E.; Gershtein Y.; Gillberg D.; Ginther G.; Golovanov G.; Goussiou A.; Grannis P. D.; Greder S.; Greenlee H.; Greenwood Z. D.; Gregores E. M.; Grenier G.; Gris Ph.; Grivaz J-F.; Grohsjean A.; Gruenendahl S.; Gruenewald M. W.; Guillemin T.; Gutierrez G.; Gutierrez P.; Haas A.; Hagopian S.; Haley J.; Han L.; Harder K.; Harel A.; Hauptman J. M.; Hays J.; Head T.; Hebbeker T.; Hedin D.; Hegab H.; Hegeman J. G.; Heinson A. P.; Heintz U.; Hensel C.; Heredia-De La Cruz I.; Herner K.; Hesketh G.; Hildreth M. D.; Hirosky R.; Hoang T.; Hobbs J. D.; Hoeneisen B.; Hohlfeld M.; Hubacek Z.; Hynek V.; Iashvili I.; Ilchenko Y.; Illingworth R.; Ito A. S.; Jabeen S.; Jaffre M.; Jamin D.; Jayasinghe A.; Jesik R.; Johns K.; Johnson M.; Jonckheere A.; Jonsson P.; Joshi J.; Jung A. W.; Juste A.; Kaadze K.; Kajfasz E.; Karmanov D.; Kasper P. A.; Katsanos I.; Kehoe R.; Kermiche S.; Khalatyan N.; Khanov A.; Kharchilava A.; Kharzheev Y. N.; Kohli J. M.; Kozelov A. V.; Kraus J.; Kulikov S.; Kumar A.; Kupco A.; Kurca T.; Kuzmin V. A.; Kvita J.; Lammers S.; Landsberg G.; Lebrun P.; Lee H. S.; Lee S. W.; Lee W. M.; Lellouch J.; Li L.; Li Q. Z.; Lietti S. M.; Lim J. K.; Lincoln D.; Linnemann J.; Lipaev V. V.; Lipton R.; Liu Y.; Lobodenko A.; Lokajicek M.; de Sa R. Lopes; Lubatti H. J.; Luna-Garcia R.; Lyon A. L.; Maciel A. K. A.; Mackin D.; Madar R.; Magana-Villalba R.; Makovec N.; Malik S.; Malyshev V. L.; Maravin Y.; Martinez-Ortega J.; McCarthy R.; McGivern C. L.; Meijer M. M.; Melnitchouk A.; Menezes D.; Mercadante P. G.; Merkin M.; Meyer A.; Meyer J.; et al.

    2012-03-20

    We present a measurement of the inclusive jet cross section using the Run II cone algorithm and data collected by the D0 experiment in p{bar p} collisions at a center-of-mass energy {radical}s = 1.96 TeV, corresponding to an integrated luminosity of 0.70 fb{sup -1}. The jet energy calibration and the method used to extract the inclusive jet cross section are described. We discuss the main uncertainties, which are dominated by the jet energy scale uncertainty. The results cover jet transverse momenta from 50 GeV to 600 GeV with jet rapidities in the range -2.4 to 2.4 and are compared to predictions using recent proton parton distribution functions. Studies of correlations between systematic uncertainties in transverse momentum and rapidity are presented.

  15. First study of the radiation-amplitude zero in Wgamma production and limits on anomalous WWgamma couplings at $\\sqrt{s}$=1.96 TeV

    CERN Document Server

    Abazov, V M; Abolins, M; Acharya, B S; Adams, M; Adams, T; Aguiló, E; Ahn, S H; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Ancu, L S; Andeen, T; Anderson, S; Andrieu, B; Anzelc, M S; Aoki, M; Arnoud, Y; Arov, M; Arthaud, M; Askew, A; sman, B; Assis-Jesus, A C S; Atramentov, O; Avila, C; Ay, C; Badaud, F; Baden, AA; Bagby, L; Baldin, B; Bandurin, D V; Banerjee, P; Banerjee, S; Barberis, E; Barfuss, A F; Bargassa, P; Baringer, P; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Beale, S; Bean, A; Begalli, M; Begel, M; Belanger-Champagne, C; Bellantoni, L; Bellavance, A; Benítez, J A; Beri, S B; Bernardi, G; Bernhard, R; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Biscarat, C; Blazey, G; Blekman, F; Blessing, S; Bloch, D; Bloom, K; Böhnlein, A; Boline, D; Bolton, T A; Borissov, G; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Brown, D; Buchanan, N J; Buchholz, D; Bühler, M; Büscher, V; Bunichev, V; Burdin, S; Burke, S; Burnett, T H; Buszello, C P; Butler, J M; Calfayan, P; Calvet, S; Cammin, J; Carvalho, W; Casey, B C K; Castilla-Valdez, H; Chakrabarti, S; Chakraborty, D; Chan, K; Chan, K M; Chandra, A; Charles, F; Cheu, E; Chevallier, F; Cho, D K; Choi, S; Choudhary, B; Christofek, L; Christoudias, T; Cihangir, S; Claes, D; Coadou, Y; Cooke, M; Cooper, W E; Corcoran, M; Couderc, F; Cousinou, M C; Crepe-Renaudin, S; Cutts, D; Cwiok, M; Da Motta, H; Das, A; Davies, G; De, K; De Jong, S J; De La Cruz-Burelo, E; De Oliveira Martins, C; Degenhardt, J D; Dliot, F; Demarteau, M; Demina, R; Denisov, D; Denisov, S P; Desai, S; Diehl, e H T; Diesburg, M; Dominguez, A; Dong, H; Dudko, L V; Duflot, L; Dugad, S R; Duggan, D; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Ellison, J; Elvira, V D; Enari, Y; Eno, S; Ermolov, P; Evans, H; Evdokimov, A; Evdokimov, V N; Ferapontov, A V; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Fortner, M; Fox, H; Fu, S; Fuess, S; Gadfort, T; Galea, C F; Gallas, E; García, C; García-Bellido, A; Gavrilov, V; Gay, P; Geist, W; Gel, D; Gerber, C E; Gershtein, Yu; Gillberg, D; Ginther, G; Gollub, N; Gmez, B; Goussiou, A; Grannis, P D; Greenlee, o H; Greenwood, Z D; Gregores, E M; Grenier, G; Gris, P; Grivaz, J F; Grohsjean, A; Grünendahl, S; Grünewald, M W; Guo, F; Guo, J; Gutíerrez, G; Gutíerrez, P; Haas, A; Hadley, N J; Haefner, P; Hagopian, S; Haley, J; Hall, I; Hall, R E; Han, L; Harder, K; Harel, A; Harrington, R; Hauptman, J M; Hauser, R; Hays, J; Hebbeker, T; Hedin, D; Hegeman, J G; Heinmiller, J M; Heinson, A P; Heintz, U; Hensel, C; Herner, K; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hoeth, H; Hohlfeld, M; Hong, S J; Hossain, S; Houben, P; Hu, Y; Hubacek, Z; Hynek, V; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jakobs, K; Jarvis, C; Jesik, e R; Johns, K; Johnson, C; Johnson, M; Jonckheere, A; Jonsson, P; Juste, A; Kajfasz, E; Kalinin, A M; Kalk, J M; Kappler, S; Karmanov, D; Kasper, P A; Katsanos, I; Kau, D; Kaushik, V; Kehoe, R; Kermiche, S; Khalatyan, N; Khanov, A; Kharchilava, A; Kharzheev, Yu M; Khatidze, D; Kim, T J; Kirby, M H; Kirsch, M; Klima, B; Kohli, J M; Konrath, J P; Korablev, V M; Kozelov, A V; Kraus, J; Krop, D; Kühl, T; Kumar, A; Kupco, A; Kura, T; Kvita, J; Lacroix, F; Lam, D; Lammers, S; Landsberg, G; Lebrun, P; Lee, W M; Leflat, A; Lellouch, J; Lévêque, J; Li, J; Li, L; Li, Q Z; Lietti, S M; Lima, J G R; Lincoln, D; Linnemann, J; Lipaev, V V; Lipton, R; Liu, Y; Liu, Z; Lobodenko, A; Lokajícek, M; Love, P; Lubatti, H J; Luna, R; Lyon, A L; Maciel, A K A; Mackin, D; Madaras, R J; Mättig, P; Magass, C; Magerkurth, A; Mal, P K; Malbouisson, H B; Malik, S; Malyshev, V L; Mao, H S; Maravin, Y; Martin, B; McCarthy, R; Melnitchouk, A; Mendoza, L; Mercadante, P G; Merkin, M; Merritt, K W; Meyer, A; Meyer, J; Millet, T; Mitrevski, J; Molina, J; Mommsen, R K; Mondal, N K; Moore, R W; Moulik, T; Muanza, G S; Mulders, M; Mulhearn, M; Mundal, O; Mundim, L; Nagy, E; Naimuddin, M; Narain, M; Naumann, N A; Neal, H A; Negret, J P; Neustroev, P; Nilsen, H; Nogima, H; Novaes, S F; Nunnemann, T; O'Dell, V; O'Neil, D C; Obrant, G; Ochando, C; Onoprienko, D; Oshima, N; Osman, N; Osta, J; Otec, R; Oteroy-Garzon, G J; Owen, M; Padley, P; Pangilinan, M; Parashar, N; Park, S J; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Pawloski, G; Penning, B; Perfilov, M; Peters, K; Peters, Y; Pétroff, P; Petteni, M; Piegaia, R; Piper, J; Pleier, M A; Podesta-Lerma, P L M; Podstavkov, V M; Pogorelov, Y; Pol, M E; Polozov, P; Pope, B G; Popov, A V; Potter, C; Prado da Silva, W L; Prosper, H B; Protopopescu, S; Qian, J; Quadt, A; Quinn, B; Rakitine, A; Rangel, M S; Ranjan, K; Ratoff, P N; Renkel, P; Reucroft, S; Rich, P; Rieger, J; Rijssenbeek, M; Ripp-Baudot, I; Rizatdinova, F; Robinson, S; Rodrigues, R F

    2008-01-01

    We present results from a study of p-pbar -> W(gamma) + X events utilizing data corresponding to 0.7 fb^{-1} of integrated luminosity at $\\sqrt{s}$ = 1.96 TeV collected by the D0 detector at the Fermilab Tevatron Collider. We set limits on anomalous WWgamma couplings at the 95% C.L. The one dimensional 95% C.L. limits are 0.49 < kappa_{gamma} < 1.51 and -0.12 < lambda_{gamma} < 0.13. We make the first study of the charge-signed rapidity difference between the lepton and the photon and find it to be indicative of the standard model radiation-amplitude zero in the Wgamma system.

  16. Evidence of WW+WZ production with lepton + jets final states in proton-antiproton collisions at sqrt(s)=1.96 TeV

    CERN Document Server

    Abazov, V M; Abolins, M; Acharya, B S; Adams, M; Adams, T; Aguiló, E; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Ancu, L S; Andeen, T; Andrieu, B; Anzelc, M S; Aoki, M; Arnoud, Y; Arov, M; Arthaud, M; Askew, A; sman, B; Assis-Jesus, A C S; Atramentov, O; Avila, C; Badaud, F; Bagby, L; Baldin, B; Bandurin, AD V; Banerjee, P; Banerjee, S; Barberis, E; Barfuss, A F; Bargassa, P; Baringer, P; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Beale, S; Bean, A; Begalli, M; Begel, M; Belanger-Champagne, C; Bellantoni, L; Bellavance, A; Benítez, J A; Beri, S B; Bernardi, G; Bernhard, R; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Blazey, G; Blekman, F; Blessing, S; Bloom, K; Böhnlein, A; Boline, D; Bolton, T A; Boos, E E; Borissov, G; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Brown, D; Bu, X B; Buchanan, N J; Buchholz, D; Bühler, M; Büscher, V; Bunichev, V; Burdin, S; Burnett, T H; Buszello, C P; Calfayan, P; Calvet, S; Cammin, J; Carrasco-Lizarraga, M A; Carrera, E; Carvalho, W; Casey, B C K; Castilla-Valdez, H; Chakrabarti, S; Chakraborty, D; Chan, K M; Chandra, A; Cheu, E; Cho, D K; Choi, S; Choudhary, B; Christofek, L; Christoudias, T; Cihangir, S; Claes, D; Clutter, J; Cooke, M; Cooper, W E; Corcoran, M; Couderc, F; Cousinou, M C; Crepe-Renaudin, S; Cuplov, V; Da Motta, H; Das, A; Davies, G; De, K; De Jong, S J; De La Cruz-Burelo, E; Cutts, D; De Oliveira Martins, M CC; De Vaughan, K; Dliot, F; Demarteau, M; Demina, R; Denisov, D; Denisov, S P; Desai, e S; Diehl, H T; Diesburg, M; Dominguez, A; Dorland, T; Dubey, A; Dudko, L V; Duflot, L; Dugad, S R; Duggan, D; Duperrin, A; Dutt, S; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Ellison, J; Elvira, V D; Enari, Y; Eno, S; Ermolov, P; Evans, H; Evdokimov, A; Evdokimov, V N; Ferapontov, A V; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Fortner, M; Fox, H; Fu, S; Fuess, S; Gadfort, T; Galea, C F; García, C; García-Bellido, A; Gavrilov, V; Gay, P; Geist, W; Geng, W; Gerber, C E; Gershtein, Yu; Gillberg, D; Ginther, G; Gmez, B; Goussiou, A; Grannis, o P D; Greenlee, H; Greenwood, Z D; Gregores, E M; Grenier, G; Gris, P; Grivaz, J F; Grohsjean, A; Grünendahl, S; Grünewald, M W; Guo, F; Guo, J; Gutíerrez, G; Gutíerrez, P; Haas, A; Hadley, N J; Haefner, P; Hagopian, S; Haley, J; Hall, I; Hall, R E; Han, L; Harder, K; Harel, A; Hauptman, J M; Hays, J; Hebbeker, T; Hedin, D; Hegeman, J G; Heinson, A P; Heintz, U; Hensel, C; Herner, K; Hesketh, G; Hildreth, M D; Hirosky, R; Hoang, T; Hobbs, J D; Hoeneisen, B; Hohlfeld, M; Hossain, S; Houben, P; Hu, Y; Hubacek, Z; Hynek, V; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jakobs, K; Jarvis, C; Jesik, R; Johns, K; Johnson, C; Johnson, M; Johnston, D; Jonckheere, A; Jonsson, P; Juste, A; Kajfasz, E; Karmanov, D; Kasper, P A; Katsanos, I; Kaushik, V; Kehoe, R; Kermiche, S; Khalatyan, N; Khanov, A; Kharchilava, A; Kharzheev, Y N; Khatidze, D; Kim, T J; Kirby, M H; Kirsch, M; Klima, B; Kohli, J M; Konrath, J P; Kozelov, A V; Kraus, J; Kühl, T; Kumar, A; Kupco, A; Kura, T; Kuzmin, cV A; Kvita, J; Lacroix, F; Lam, D; Lammers, S; Landsberg, G; Lebrun, P; Lee, W M; Leflat, A; Lellouch, J; Li, J; Li, L; Li, Q Z; Lietti, S M; Lim, J K; Lima, J G R; Lincoln, D; Linnemann, J; Lipaev, V V; Lipton, R; Liu, Y; Liu, Z; Lobodenko, A; Lokajícek, M; Love, P; Lubatti, H J; Luna-Garcia, R; Lyon, A L; Maciel, A K A; Mackin, D; Madaras, R J; Mättig, P; Magerkurth, A; Mal, P K; Malbouisson, H B; Malik, S; Malyshev, V L; Maravin, Y; Martin, B; McCarthy, R; Meijer, M M; Melnitchouk, A; Mendoza, L; Mercadante, P G; Merkin, M; Merritt, K W; Meyer, A; Meyer, J; Mitrevski, J; Mommsen, R K; Mondal, N K; Moore, R W; Moulik, T; Muanza, G S; Mulhearn, M; Mundal, O; Mundim, L; Nagy, E; Naimuddin, M; Narain, M; Neal, H A; Negret, J P; Neustroev, P; Nilsen, H; Nogima, H; Novaes, S F; Nunnemann, T; O'Neil, D C; Obrant, G; Ochando, C; Onoprienko, D; Oshima, N; Osman, N; Osta, J; Otec, R; Oteroy-Garzon, G J; Owen, M; Padley, P; Pangilinan, M; Parashar, N; Park, S J; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Pawloski, G; Penning, B; Perfilov, M; Peters, K; Peters, Y; Pétroff, P; Petteni, M; Piegaia, R; Piper, J; Pleier, M A; Podesta-Lerma, P L M; Podstavkov, V M; Pogorelov, Y; Pol, M E; Polozov, P; Pope, B G; Popov, A V; Potter, C; Prado da Silva, W L; Prosper, H B; Protopopescu, S; Qian, J; Quadt, A; Quinn, B; Rakitine, A; Rangel, M S; Ranjan, K; Ratoff, P N; Renkel, P; Rich, P; Rijssenbeek, M; Ripp-Baudot, I; Rizatdinova, F; Robinson, S; Rodrigues, R F; Rominsky, M; Royon, C; Rubinov, P; Ruchti, R; Safronov, G; Sajot, G; Sánchez-Hernández, A; Sanders, M P; Sanghi, B; Savage, G; Sawyer, L; Scanlon, T; Schaile, A D; Schamberger, R D; Scheglov, Y; Schellman, H; Schliephake, T; Schlobohm, S

    2008-01-01

    We present the first evidence of WW+WZ production with lepton+jets final states at a hadron collider. The data correspond to 1.07 inverse femtobarns of integrated luminosity collected with the D0 detector at the Fermilab Tevatron Collider in proton-antiproton collisions at sqrt(s)=1.96 TeV. The observed cross section for WW+WZ production is 20.2 +/- 4.5 pb, consistent with the SM prediction of 16.1 +/- 0.9 pb. The probability for background fluctuations to produce an excess equal to or larger than that observed is estimated to be 5.4e-6, corresponding to a significance of 4.4 standard deviations.

  17. Measurement of the inclusive jet cross section in $p \\bar{p}$ collisions at $\\sqrt{s}=1.96 {\\rm TeV}$

    CERN Document Server

    Abazov, V M; Abolins, M; Acharya, B S; Adams, M; Adams, T; Aguiló, E; Ahn, S H; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Ancu, L S; Andeen, T; Anderson, S; Andrieu, B; Anzelc, M S; Arnoud, Y; Arov, M; Arthaud, M; Askew, A; sman, B; Assis-Jesus, A C S; Atramentov, O; Autermann, C; Avila, C; Ay, C; Badaud, F; Baden, AA; Bagby, L; Baldin, B; Bandurin, D V; Banerjee, P; Banerjee, S; Barberis, E; Barfuss, A F; Bargassa, P; Baringer, P; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Beale, S; Bean, A; Begalli, M; Begel, M; Belanger-Champagne, C; Bellantoni, L; Bellavance, A; Benítez, J A; Beri, S B; Bernardi, G; Bernhard, R; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Biscarat, C; Blazey, G; Blekman, F; Blessing, S; Bloch, D; Bloom, K; Böhnlein, A; Boline, D; Bolton, T A; Borissov, G; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Brown, D; Buchanan, N J; Buchholz, D; Bühler, M; Büscher, V; Bunichev, V; Burdin, S; Burke, S; Burnett, T H; Buszello, C P; Butler, J M; Calfayan, P; Calvet, S; Cammin, J; Carvalho, W; Casey, B C K; Castilla-Valdez, H; Chakrabarti, S; Chakraborty, D; Chan, K; Chan, K M; Chandra, A; Charles, F; Cheu, E; Chevallier, F; Cho, D K; Choi, S; Choudhary, B; Christofek, L; Christoudias, T; Cihangir, S; Claes, D; Coadou, Y; Cooke, M; Cooper, W E; Corcoran, M; Couderc, F; Cousinou, M C; Crepe-Renaudin, S; Cutts, D; Cwiok, M; Da Motta, H; Das, A; Davies, G; De, K; De Jong, S J; De La Cruz-Burelo, E; De Oliveira Martins, C; Degenhardt, J D; Dliot, F; Demarteau, M; Demina, R; Denisov, D; Denisov, S P; Desai, S; Diehl, H T; Diesburg, M; Dominguez, e A; Dong, H; Dudko, L V; Duflot, L; Dugad, S R; Duggan, D; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Ellison, J; Elvira, V D; Enari, Y; Eno, S; Ermolov, P; Evans, H; Evdokimov, A; Evdokimov, V N; Ferapontov, A V; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Ford, M; Fortner, M; Fox, H; Fu, S; Fuess, S; Gadfort, T; Galea, C F; Gallas, E; García, C; García-Bellido, A; Gavrilov, V; Gay, P; Geist, W; Gel, D; Gerber, C E; Gershtein, Yu; Gillberg, D; Ginther, G; Gollub, N; Gmez, B; Goussiou, A; Grannis, P D; Greenlee, H; Greenwood, Z D; Gregores, E M; Grenier, G; Gris, P; Grivaz, J F; Grohsjean, A; Grünendahl, S; Grünewald, M W; Guo, F; Guo, J; Gutíerrez, G; Gutíerrez, P; Haas, A; Hadley, N J; Haefner, P; Hagopian, S; Haley, J; Hall, I; Hall, R E; Han, L; Harder, K; Harel, A; Harrington, R; Hauptman, J M; Hauser, R; Hays, J; Hebbeker, T; Hedin, D; Hegeman, J G; Heinmiller, J M; Heinson, A P; Heintz, U; Hensel, C; Herner, K; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hoeth, H; Hohlfeld, M; Hong, S J; Hossain, S; Houben, P; Hu, Y; Hubacek, Z; Hynek, V; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jakobs, K; Jarvis, C; Jesik, R; Johns, K; Johnson, C; Johnson, M; Jonckheere, A; Jonsson, P; Juste, A; Kajfasz, E; Kalinin, A M; Kalk, J M; Kappler, S; Karmanov, D; Kasper, P A; Katsanos, I; Kau, D; Kaur, R; Kaushik, V; Kehoe, R; Kermiche, S; Khalatyan, N; Khanov, A; Kharchilava, A; Kharzheev, Yu M; Khatidze, D; Kim, T J; Kirby, M H; Kirsch, M; Klima, B; Kohli, J M; Konrath, J P; Korablev, V M; Kozelov, A V; Kraus, J; Krop, D; Kühl, T; Kumar, A; Kupco, A; Kura, T; Kvita, J; Lacroix, F; Lam, cD; Lammers, S; Landsberg, G; Lebrun, P; Lee, W M; Leflat, A; Lellouch, J; Lévêque, J; Li, J; Li, L; Li, Q Z; Lietti, S M; Lima, J G R; Lincoln, D; Linnemann, J; Lipaev, V V; Lipton, R; Liu, Y; Liu, Z; Lobodenko, A; Lokajícek, M; Love, P; Lubatti, H J; Luna, R; Lyon, A L; Maciel, A K A; Mackin, D; Madaras, R J; Mättig, P; Magass, C; Magerkurth, A; Mal, P K; Malbouisson, H B; Malik, S; Malyshev, V L; Mao, H S; Maravin, Y; Martin, B; McCarthy, R; Melnitchouk, A; Mendoza, L; Mercadante, P G; Merkin, M; Merritt, K W; Meyer, A; Meyer, J; Millet, T; Mitrevski, J; Molina, J; Mommsen, R K; Mondal, N K; Moore, R W; Moulik, T; Muanza, G S; Mulders, M; Mulhearn, M; Mundal, O; Mundim, L; Nagy, E; Naimuddin, M; Narain, M; Naumann, N A; Neal, H A; Negret, J P; Neustroev, P; Nilsen, H; Nogima, H; Novaes, S F; Nunnemann, T; O'Dell, V; O'Neil, D C; Obrant, G; Ochando, C; Onoprienko, D; Oshima, N; Osman, N; Osta, J; Otec, R; Oteroy-Garzon, G J; Owen, M; Padley, P; Pangilinan, M; Parashar, N; Park, S J; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Pawloski, G; Penning, B; Perfilov, M; Peters, K; Peters, Y; Pétroff, P; Petteni, M; Piegaia, R; Piper, J; Pleier, M A; Podesta-Lerma, P L M; Podstavkov, e V M; Pogorelov, Y; Pol, M E; Polozov, P; Pope, B G; Popov, A V; Potter, C; Prado da Silva, W L; Prosper, H B; Protopopescu, S; Qian, J; Quadt, A; Quinn, B; Rakitine, A; Rangel, M S; Ranjan, K; Ratoff, P N; Renkel, P; Reucroft, S; Rich, P; Rieger, J; Rijssenbeek, M; Ripp-Baudot, I; Rizatdinova, F; Robinson, S

    2008-01-01

    We report on a measurement of the inclusive jet cross section in $p \\bar{p}$ collisions at a center-of-mass energy $\\sqrt s=$1.96 TeV using data collected by the D0 experiment at the Fermilab Tevatron Collider corresponding to an integrated luminosity of 0.70 fb$^{-1}$. The data cover jet transverse momenta from 50 GeV to 600 GeV and jet rapidities in the range -2.4 to 2.4. Detailed studies of correlations between systematic uncertainties in transverse momentum and rapidity are presented, and the cross section measurements are found to be in good agreement with next-to-leading order QCD calculations.

  18. Search for a narrow t(t)over-bar resonance in p(p)over-bar collisions at root s=1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abazov V. M.; Abbott B.; Acharya B. S.; Adams M.; Adams T.; Alexeev G. D.; Alkhazov G.; Alton A.; Alverson G.; Alves G. A.; Aoki M.; Askew A.; Asman B.; Atkins S.; Atramentov O.; Augsten K.; Avila C.; BackusMayes J.; Badaud F.; Bagby L.; Baldin B.; Bandurin D. V.; Banerjee S.; Barberis E.; Baringer P.; Barreto J.; Bartlett J. F.; Bassler U.; Bazterra V.; Bean A.; Begalli M.; Belanger-Champagne C.; Bellantoni L.; Beri S. B.; Bernardi G.; Bernhard R.; Bertram I.; Besancon M.; Beuselinck R.; Bezzubov V. A.; Bhat P. C.; Bhatnagar V.; Blazey G.; Blessing S.; Bloom K.; Boehnlein A.; Boline D.; Boos E. E.; Borissov G.; Bose T.; Brandt A.; Brandt O.; Brock R.; Brooijmans G.; Bross A.; Brown D.; Brown J.; Bu X. B.; Buehler M.; Buescher V.; Bunichev V.; Burdin S.; Burnett T. H.; Buszello C. P.; Calpas B.; Camacho-Perez E.; Carrasco-Lizarraga M. A.; Casey B. C. K.; Castilla-Valdez H.; Chakrabarti S.; Chakraborty D.; Chan K. M.; Chandra A.; Chapon E.; Chen G.; Chevalier-Thery S.; Cho D. K.; Cho S. W.; Choi S.; Choudhary B.; Cihangir S.; Claes D.; Clutter J.; Cooke M.; Cooper W. E.; Corcoran M.; Couderc F.; Cousinou M-C; Croc A.; Cutts D.; Das A.; Davies G.; De K.; de Jong S. J.; De La Cruz-Burelo E.; Deliot F.; Demina R.; Denisov D.; Denisov S. P.; Desai S.; Deterre C.; DeVaughan K.; Diehl H. T.; Diesburg M.; Ding P. F.; Dominguez A.; Dorland T.; Dubey A.; Dudko L. V.; Duggan D.; Duperrin A.; Dutt S.; Dyshkant A.; Eads M.; Edmunds D.; Ellison J.; Elvira V. D.; Enari Y.; Evans H.; Evdokimov A.; Evdokimov V. N.; Facini G.; Ferbel T.; Fiedler F.; Filthaut F.; Fisher W.; Fisk H. E.; Fortner M.; Fox H.; Fuess S.; Garcia-Bellido A.; Garcia-Guerra G. A.; Gavrilov V.; Gay P.; Geng W.; Gerbaudo D.; Gerber C. E.; Gershtein Y.; Ginther G.; Golovanov G.; Goussiou A.; Grannis P. D.; Greder S.; Greenlee H.; Greenwood Z. D.; Gregores E. M.; Grenier G.; Gris Ph; Grivaz J-F; Grohsjean A.; Gruenendahl S.; Gruenewald M. W.; Guillemin T.; Gutierrez G.; Gutierrez P.; Haas A.; Hagopian S.; Haley J.; Han L.; Harder K.; Harel A.; Hauptman J. M.; Hays J.; Head T.; Hebbeker T.; Hedin D.; Hegab H.; Heinson A. P.; Heintz U.; Hensel C.; Heredia-De La Cruz I.; Herner K.; Hesketh G.; Hildreth M. D.; Hirosky R.; Hoang T.; Hobbs J. D.; Hoeneisen B.; Hohlfeld M.; Hubacek Z.; Hynek V.; Iashvili I.; Ilchenko Y.; Illingworth R.; Ito A. S.; Jabeen S.; Jaffre M.; Jamin D.; Jayasinghe A.; Jesik R.; Johns K.; Johnson M.; Jonckheere A.; Jonsson P.; Joshi J.; Jung A. W.; Juste A.; Kaadze K.; Kajfasz E.; Karmanov D.; Kasper P. A.; Katsanos I.; Kehoe R.; Kermiche S.; Khalatyan N.; Khanov A.; Kharchilava A.; Kharzheev Y. N.; Kohli J. M.; Kozelov A. V.; Kraus J.; Kulikov S.; Kumar A.; Kupco A.; Kurca T.; Kuzmin V. A.; Kvita J.; Lammers S.; Landsberg G.; Lebrun P.; Lee H. S.; Lee S. W.; Lee W. M.; Lellouch J.; Li L.; Li Q. Z.; Lietti S. M.; Lim J. K.; Lincoln D.; Linnemann J.; Lipaev V. V.; Lipton R.; Liu Y.; Lobodenko A.; Lokajicek M.; de Sa R. Lopes; Lubatti H. J.; Luna-Garcia R.; Lyon A. L.; Maciel A. K. A.; Mackin D.; Madar R.; Magana-Villalba R.; Malik S.; Malyshev V. L.; Maravin Y.; Martinez-Ortega J.; McCarthy R.; McGivern C. L.; Meijer M. M.; Melnitchouk A.; Menezes D.; Mercadante P. G.; Merkin M.; Meyer A.; Meyer J.; et al.

    2012-03-14

    We report a search for a narrow t{bar t} resonance that decays into a lepton+jets final state based on an integrated luminosity of 5.3 fb{sup -1} of proton-antiproton collisions at {radical}s = 1.96 TeV collected by the D0 Collaboration at the Fermilab Tevatron Collider. We set upper limits on the production cross section of such a resonance multiplied by its branching fraction to t{bar t}. We exclude a leptophobic topcolor Z' at the 95% confidence level for masses below 835 GeV (940 GeV) if its width is 1.2% (3%) of its mass. We also exclude color octet vector bosons (colorons) with masses below 775 GeV.

  19. Measurement of the differential cross section d\\sigma/dt in elastic $p\\bar{p}$ scattering at sqrt(s)=1.96 TeV

    CERN Document Server

    Abazov, V M; Acharya, B S; Adams, M; Adams, T; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Aoki, M; Askew, A; Atkins, S; Augsten, K; Avila, C; Badaud, F; Bagby, L; Baldin, B; Bandurin, D V; Banerjee, S; Barberis, E; Baringer, P; Barreto, J; Bartlett, J F; Bassler, U; Bazterra, V; Bean, A; Begalli, M; Bellantoni, L; Beri, S B; Bernardi, G; Bernhard, R; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatia, S; Bhatnagar, V; Blazey, G; Blessing, S; Bloom, K; Boehnlein, A; Boline, D; Boos, E E; Borissov, G; Bose, T; Brandt, A; Brandt, O; Brock, R; Brooijmans, G; Bross, A; Brown, D; Brown, J; Bu, X B; Buehler, M; Buescher, V; Bunichev, V; Burdin, S; Buszello, C P; Camacho-Pérez, E; Carvalho, W; Casey, B C K; Castilla-Valdez, H; Caughron, S; Chakrabarti, S; Chakraborty, D; Chan, K M; Chandra, A; Chapon, E; Chen, G; Chevalier-Théry, S; Cho, D K; Cho, S W; Choi, S; Choudhary, B; Cihangir, S; Claes, D; Clutter, J; Cooke, M; Cooper, W E; Corcoran, M; Couderc, F; Cousinou, M -C; Croc, A; Cutts, D; Das, A; Davies, G; de Jong, S J; De La Cruz-Burelo, E; Martins, C De Oliveira; Déliot, F; Demina, R; Denisov, D; Denisov, S P; Desai, S; Deterre, C; DeVaughan, K; Diehl, H T; Diesburg, M; Ding, P F; Dominguez, A; Dubey, A; Dudko, L V; Duggan, D; Duperrin, A; Dutt, S; Dyshkant, A; Eads, M; Edmunds, D; Ellison, J; Elvira, V D; Enari, Y; Evans, H; Evdokimov, A; Evdokimov, V N; Facini, G; Feng, L; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Fortner, M; Fox, H; Fuess, S; Garcia-Bellido, A; García-González, J A; García-Guerra, G A; Gavrilov, V; Gay, P; Geng, W; Gerbaudo, D; Gerber, C E; Gershtein, Y; Ginther, G; Golovanov, G; Goussiou, A; Grannis, P D; Greder, S; Greenlee, H; Gregores, E M; Grenier, G; Gris, Ph; Grivaz, J -F; Grohsjean, A; Grünendahl, S; Grünewald, M W; Guillemin, T; Gutierrez, G; Gutierrez, P; Haas, A; Hagopian, S; Haley, J; Han, L; Harder, K; Harel, A; Hauptman, J M; Hays, J; Head, T; Hebbeker, T; Hedin, D; Hegab, H; Heinson, A P; Heintz, U; Hensel, C; La Cruz, I Heredia-De; Herner, K; Hesketh, G; Hildreth, M D; Hirosky, R; Hoang, T; Hobbs, J D; Hoeneisen, B; Hohlfeld, M; Howley, I; Hubacek, Z; Hynek, V; Iashvili, I; Ilchenko, Y; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jayasinghe, A; Jesik, R; Johns, K; Johnson, E; Johnson, M; Jonckheere, A; Jonsson, P; Joshi, J; Jung, A W; Juste, A; Kaadze, K; Kajfasz, E; Karmanov, D; Kasper, P A; Katsanos, I; Kehoe, R; Kermiche, S; Khalatyan, N; Khanov, A; Kharchilava, A; Kharzheev, Y N; Kiselevich, I; Kohli, J M; Kozelov, A V; Kraus, J; Kulikov, S; Kumar, A; Kupco, A; Kurča, T; Kuzmin, V A; Lammers, S; Landsberg, G; Lebrun, P; Lee, H S; Lee, S W; Lee, W M; Lellouch, J; Li, H; Li, L; Li, Q Z; Lim, J K; Lincoln, D; Linnemann, J; Lipaev, V V; Lipton, R; Liu, H; Liu, Y; Lobodenko, A; Lokajicek, M; de Sa, R Lopes; Lubatti, H J; Luna-Garcia, R; Lyon, A L; Maciel, A K A; Madar, R; Magaña-Villalba, R; Malik, S; Malyshev, V L; Maravin, Y; Martínez-Ortega, J; McCarthy, R; McGivern, C L; Meijer, M M; Melnitchouk, A; Mendoza, L; Menezes, D; Mercadante, P G; Merkin, M; Meyer, A; Meyer, J; Miconi, F; Molina, J; Mondal, N K; da Motta, H; Mulhearn, M; Mundim, L; Nagy, E; Naimuddin, M; Narain, M; Nayyar, R; Neal, H A; Negret, J P; Neustroev, P; Novaes, S F; Nunnemann, T; Obrant, G; Oguri, V; Orduna, J; Osman, N; Osta, J; Padilla, M; Pal, A; Parashar, N; Parihar, V; Park, S K; Partridge, R; Parua, N; Patwa, A; Penning, B; Perfilov, M; Peters, Y; Petridis, K; Petrillo, G; Pétroff, P; Pleier, M -A; Podesta-Lerma, P L M; Podstavkov, V M; Pol, M -E; Popov, A V; da Silva, W L Prado; Prewitt, M; Price, D; Prokopenko, N; Qian, J; Quadt, A; Quinn, B; Rangel, M S; Ranjan, K; Ratoff, P N; Razumov, I; Renkel, P; Ripp-Baudot, I; Rizatdinova, F; Rominsky, M; Ross, A; Royon, C; Rubinov, P; Ruchti, R; Sajot, G; Salcido, P; Sánchez-Hernández, A; Sanders, M P; Sanghi, B; Santoro, A; Santos, A S; Savage, G; Sawyer, L; Scanlon, T; Schamberger, R D; Scheglov, Y; Schellman, H; Schlobohm, S; Schwanenberger, C; Schwienhorst, R; Sekaric, J; Severini, H; Shabalina, E; Shary, V; Shaw, S; Shchukin, A A; Shivpuri, R K; Simak, V; Skubic, P; Slattery, P; Smirnov, D; Smith, K J; Snow, G R; Snow, J; Snyder, S; Söldner-Rembold, S; Sonnenschein, L; Soustruznik, K; Stark, J; Stoyanova, D A; Strang, M A; Strauss, M; Stutte, L; Suter, L; Svoisky, P; Takahashi, M; Titov, M; Tokmenin, V V; Tsai, Y -T; Tschann-Grimm, K; Tsybychev, D; Tuchming, B; Tully, C; Uvarov, L; Uvarov, S; Uzunyan, S; Van Kooten, R; van Leeuwen, W M; Varelas, N; Varnes, E W; Vasilyev, I A; Verdier, P; Verkheev, A Y; Vertogradov, L S; Verzocchi, M; Vesterinen, M; Vilanova, D; Vokac, P; Wahl, H D; Wang, M H L S; Warchol, J; Watts, G; Wayne, M; Weichert, J; Welty-Rieger, L; White, A; Wicke, D; Williams, M R J; Wilson, G W; Wobisch, M; Wood, D R; Wyatt, T R; Xie, Y

    2012-01-01

    We present a measurement of the elastic differential cross section $d\\sigma(p\\bar{p}\\rightarrow p\\bar{p})/dt$ as a function of the four-momentum-transfer squared t. The data sample corresponds to an integrated luminosity of $\\approx 31 nb^{-1}$ collected with the D0 detector using dedicated Tevatron $p\\bar{p} $ Collider operating conditions at sqrt(s) = 1.96 TeV and covers the range $0.26 <|t|< 1.2 GeV^2$. For $|t|<0.6 GeV^2$, d\\sigma/dt is described by an exponential function of the form $Ae^{-b|t|}$ with a slope parameter $ b = 16.86 \\pm 0.10(stat) \\pm 0.20(syst) GeV^{-2}$. A change in slope is observed at $|t| \\approx 0.6 GeV^2$, followed by a more gradual |t| dependence with increasing values of |t|.

  20. Search for ttbar resonances in the lepton plus jets final state in ppbar collisions at sqrt{s}=1.96TeV

    CERN Document Server

    Abazov, V M; Abolins, M; Acharya, B S; Adams, M; Adams, T; Aguiló, E; Ahn, S H; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Ancu, L S; Andeen, T; Anderson, S; Andrieu, B; Anzelc, M S; Aoki, M; Arnoud, Y; Arov, M; Arthaud, M; Askew, A; sman, B; Assis-Jesus, A C S; Atramentov, O; Avila, C; Badaud, F; Baden, A A; Bagby, L; Baldin, B; Bandurin, D V; Banerjee, P; Banerjee, S; Barberis, E; Barfuss, A F; Bargassa, P; Baringer, P; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Beale, S; Bean, A; Begalli, M; Begel, M; Belanger-Champagne, C; Bellantoni, L; Bellavance, A; Benítez, J A; Beri, S B; Bernardi, G; Bernhard, R; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Biscarat, C; Blazey, G; Blekman, F; Blessing, S; Bloch, D; Bloom, K; Böhnlein, A; Boline, D; Bolton, T A; Boos, E E; Borissov, G; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Brown, D; Buchanan, N J; Buchholz, D; Bühler, M; Büscher, V; Bunichev, V; Burdin, S; Burke, S; Burnett, T H; Buszello, C P; Butler, J M; Calfayan, P; Calvet, S; Cammin, J; Carvalho, W; Casey, B C K; Castilla-Valdez, H; Chakrabarti, S; Chakraborty, D; Chan, K; Chan, K M; Chandra, A; Charles, F; Cheu, E; Chevallier, F; Cho, D K; Choi, S; Choudhary, B; Christofek, L; Christoudias, T; Cihangir, S; Claes, D; Clutter, J; Cooke, M; Cooper, W E; Corcoran, M; Couderc, F; Cousinou, M C; Crepe-Renaudin, S; Cutts, D; Cwiok, M; Da Motta, H; Das, A; Davies, G; De, K; De Jong, S J; De La Cruz-Burelo, E; De Oliveira Martins, C; Degenhardt, J D; Dliot, F; Demarteau, M; Demina, R; Denisov, D; Denisov, S P; Desai, S; Diehl, H T; Diesburg, M; Dominguez, A; Dong, H; Dudko, L V; Duflot, L; Dugad, S R; Duggan, D; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Ellison, J; Elvira, V D; Enari, Y; Eno, S; Ermolov, P; Evans, H; Evdokimov, A; Evdokimov, V N; Ferapontov, A V; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Fortner, M; Fox, H; Fu, S; Fuess, S; Gadfort, T; Galea, C F; Gallas, E; García, C; García-Bellido, A; Gavrilov, V; Gay, P; Geist, W; Gel, D; Gerber, C E; Gershtein, Yu; Gillberg, D; Ginther, G; Gollub, N; Gmez, B; Goussiou, A; Grannis, P D; Greenlee, H; Greenwood, Z D; Gregores, E M; Grenier, G; Gris, P; Grivaz, J F; Grohsjean, A; Grünendahl, S; Grünewald, M W; Guo, F; Guo, J; Gutíerrez, G; Gutíerrez, P; Haas, A; Hadley, N J; Haefner, P; Hagopian, S; Haley, J; Hall, I; Hall, R E; Han, L; Harder, K; Harel, A; Hauptman, J M; Hauser, R; Hays, J; Hebbeker, T; Hedin, D; Hegeman, J G; Heinson, A P; Heintz, U; Hensel, C; Herner, K; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hoeth, H; Hohlfeld, M; Hong, S J; Hossain, S; Houben, P; Hu, Y; Hubacek, Z; Hynek, V; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jakobs, K; Jarvis, C; Jesik, R; Johns, K; Johnson, C; Johnson, M; Jonckheere, A; Jonsson, P; Juste, A; Kajfasz, E; Kalk, J M; Karmanov, D; Kasper, P A; Katsanos, I; Kau, D; Kaushik, V; Kehoe, R; Kermiche, S; Khalatyan, N; Khanov, A; Kharchilava, A; Kharzheev, Yu M; Khatidze, D; Kim, T J; Kirby, M H; Kirsch, M; Klima, B; Kohli, J M; Konrath, J P; Kozelov, A V; Kraus, J; Krop, D; Kühl, T; Kumar, A; Kupco, A; Kura, T; Kuzmin, V A; Kvita, J; Lacroix, F; Lam, D; Lammers, S; Landsberg, G; Lebrun, P; Lee, W M; Leflat, A; Lellouch, J; Lévêque, J; Li, J; Li, L; Li, Q Z; Lietti, S M; Lima, J G R; Lincoln, D; Linnemann, J; Lipaev, V V; Lipton, R; Liu, Y; Liu, Z; Lobodenko, A; Lokajícek, M; Love, P; Lubatti, H J; Luna, R; Lyon, A L; Maciel, A K A; Mackin, D; Madaras, R J; Mättig, P; Magass, C; Magerkurth, A; Mal, P K; Malbouisson, H B; Malik, S; Malyshev, V L; Mao, H S; Maravin, Y; Martin, B; McCarthy, R; Melnitchouk, A; Mendoza, L; Mercadante, P G; Merkin, M; Merritt, K W; Meyer, A; Meyer, J; Millet, T; Mitrevski, J; Mommsen, R K; Mondal, N K; Moore, R W; Moulik, T; Muanza, G S; Mulhearn, M; Mundal, O; Mundim, L; Nagy, E; Naimuddin, M; Narain, M; Naumann, N A; Neal, H A; Negret, J P; Neustroev, P; Nilsen, H; Nogima, H; Novaes, S F; Nunnemann, T; O'Dell, V; O'Neil, D C; Obrant, G; Ochando, C; Onoprienko, D; Oshima, N; Osman, N; Osta, J; Otec, R; Oteroy-Garzon, G J; Owen, M; Padley, P; Pangilinan, M; Parashar, N; Park, S J; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Pawloski, G; Penning, B; Perfilov, M; Peters, K; Peters, Y; Pétroff, P; Petteni, M; Piegaia, R; Piper, J; Pleier, M A; Podesta-Lerma, P L M; Podstavkov, V M; Pogorelov, Y; Pol, M E; Polozov, P; Pope, B G; Popov, A V; Potter, C; Prado da Silva, W L; Prosper, H B; Protopopescu, S; Qian, J; Quadt, A; Quinn, B; Rakitine, A; Rangel, M S; Ranjan, K; Ratoff, P N; Renkel, P; Reucroft, S; Rich, P; Rieger, J; Rijssenbeek, M; Ripp-Baudot, I; Rizatdinova, F; Robinson, S; Rodrigues, R F; Rominsky, M; Royon, C; Rubinov, P; Ruchti, R; Safronov, G; Sajot, G; Sánchez-Hernández, A

    2008-01-01

    We present a search for a narrow-width heavy resonance decaying into top quark pairs X->ttbar in ppbar collisions at sqrt{s}=1.96TeV using approximately 0.9fb^-1 of data collected with the D0 detector at the Fermilab Tevatron Collider. This analysis considers ttbar candidate events in the lepton plus jets channel with at least one identified b jet and uses the ttbar invariant mass distribution to search for evidence of resonant production. We find no evidence for a narrow resonance X decaying to ttbar. Therefore, we set upper limits on sigma*B(X->ttbar) for different hypothesized resonance masses using a Bayesian approach. For a Topcolor-assisted technicolor model, the existence of a leptophobic Z' boson with mass M_Z'<700GeV and width Gamma_Z'=0.012 M_Z' can be excluded at the 95% C.L.

  1. Search for high-mass resonances decaying to e mu in p anti-p collisions at s**(1/2) = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abulencia, A.; Acosta, D.; Adelman, Jahred A.; Affolder, T.; Akimoto, T.; Albrow, M.G.; Ambrose, D.; Amerio, S.; Amidei, D.; Anastassov, A.; Anikeev, K.; /Taiwan, Inst.

    2006-03-01

    The authors describe a general search for resonances decaying to a neutral e{mu} final state in p{bar p} collisions at a center-of-mass energy of 1.96 TeV. Using a data sample representing 344 pb{sup -1} of integrated luminosity recorded by the CDF II experiment, they compare Standard Model predictions with the number of observed events for invariant masses between 50 and 800 GeV/c{sup 2}. Finding no significant excess (5 events observed vs. 7.7 {+-} 0.8 expected for M{sub e{mu}} > 100 GeV/c{sup 2}), they set limits on sneutrino and Z{prime} masses as functions of lepton family number violating couplings.

  2. Measurement of z boson transverse momentum in proton - anti-proton collisions at s**(1/2) = 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Lei; /Maryland U.

    2007-11-01

    This dissertation describes a measurement of the shape of the boson transverse momentum distribution in p{bar p} {yields} Z/{gamma}* {yields} e{sup +}e{sup -} + X events at a center-of-mass energy of 1.96 TeV. The measurement is made for events with electron-positron mass between 70 < M{sub ee} < 110 GeV/c{sup 2} and uses 976 pb{sup -1} of data collected at the Fermilab Tevatron collider with the D0 detector. The shape is measured both for the inclusive sample and for the subset of events containing a boson with large rapidity. The large-rapidity distribution shows better agreement with theory when the calculation is done using traditional Collins-Soper-Sterman resummation than when using a recent resummed form factor with modifications in the small-x region.

  3. Search for V + A current in top quark decay in p anti-p collisions at s**(1/2) = 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abulencia, A.; Adelman, J.; Affolder, T.; Akimoto, T.; Albrow, M.G.; Ambrose, D.; Amerio, S.; Amidei, D.; Anastassov, A.; Anikeev, K.; Annovi, A.; Antos, J.; Aoki, M.; Apollinari, G.; Arguin, J.-F.; Arisawa, T.; Artikov, A.; Ashmanskas, W.; Attal, A.; Azfar, F.; Azzi-Bacchetta, P.

    2006-09-01

    The authors report an upper limit on the fraction of V + A current, f{sub V+A}, in top quark decays, using approximately 700 pb{sup -1} of p{bar p} collisions at {radical}s = 1.96 TeV acquired by the upgraded Collider Detector at Fermilab. For the decay t {yields} Wb {yields} {ell}{nu}b (where {ell} = e or {mu}), the invariant mass of the charged lepton and the bottom quark jet is sensitive to the polarization of the W boson. They determine f{sub V+A} = -0.06 {+-} 0.25 given a top quark mass of 175 GeV/c{sup 2}. They set an upper limit on f{sub V+A} of 0.29 at the 95% confidence level, which represents an improvement by a factor of two on the previous best direct limit.

  4. Search for V+A current in top quark decay in p anti-p collisions at s**(1/2) = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abulencia, A.; Adelman, J.; Affolder, T.; Akimoto, T.; Albrow, M.G.; Ambrose, D.; Amerio, S.; Amidei, D.; Anastassov, A.; Anikeev, K.; Annovi, A.; /Taiwan, Inst. Phys.

    2006-08-01

    The authors report an upper limit on the fraction of V + A current, f{sub V+A}, in top quark decays, using approximately 700 pb{sup -1} of p{bar p} collisions at {radical}s = 1.96 TeV acquired by the upgraded Collider Detector at Fermilab. For the decay t {yields} wb {yields} {ell}vb (where {ell} = e or {mu}), the invariant mass of the charged lepton and the bottom quark jet is sensitive to the polarization of the W boson. They determine f{sub V+A} = -0.06 {+-} 0.25 given a top quark mass of 175 GeV/c{sup 2}. They set an upper limit on f{sub V+A} of 0.29 at the 95% confidence level, which represents an improvement by a factor of two on the previous best direct limit.

  5. Search for a fourth generation b'-quark at LEP-II at sqrt{s}=196-209 GeV

    CERN Document Server

    Abdallah, J; Adam, W; Adzic, P; Albrecht, T; Alemany-Fernandez, R; Allmendinger, T; Allport, P P; Amaldi, Ugo; Amapane, N; Amato, S; Anashkin, E; Andreazza, A; Andringa, S; Anjos, N; Antilogus, P; Apel, W D; Arnoud, Y; Ask, S; Åsman, B; Augustin, J E; Augustinus, A; Baillon, P; Ballestrero, A; Bambade, P; Barbier, R; Bardin, D; Barker, G J; Baroncelli, A; Battaglia, M; Baubillier, M; Becks, K H; Begalli, M; Behrmann, A; Ben-Haim, E; Benekos, N; Benvenuti, A; Bérat, C; Berggren, M; Berntzon, L; Bertrand, D; Besançon, M; Besson, N; Bloch, D; Blom, M; Bluj, M; Bonesini, M; Boonekamp, M; Booth, P S L; Borisov, G; Botner, O; Bouquet, B; Bowcock, T J V; Boyko, I; Bracko, M; Brenner, R; Brodet, E; Brückman, P; Brunet, J M; Buschbeck, B; Buschmann, P; Calvi, M; Camporesi, T; Canale, V; Carena, F; Castro, N; Cavallo, F; Chapkin, M; Charpentier, P; Checchia, P; Chierici, R; Shlyapnikov, P; Chudoba, J; Chung, S U; Cieslik, K; Collins, P; Contri, R; Cosme, G; Cossutti, F; Costa, M J; Crennell, D J; Cuevas-Maestro, J; D'Hondt, J; Dalmau, J; Da Silva, T; Da Silva, W; Della Ricca, G; De Angelis, A; de Boer, Wim; De Clercq, C; De Lotto, B; De Maria, N; De Min, A; De Paula, L; Di Ciaccio, L; Di Simone, A; Doroba, K; Drees, J; Eigen, G; Ekelöf, T J C; Ellert, M; Elsing, M; Espirito-Santo, M C; Fanourakis, G K; Fassouliotis, D; Feindt, M; Fernández, J; Ferrer, A; Ferro, F; Flagmeyer, U; Föth, H; Fokitis, E; Fulda-Quenzer, F; Fuster, J; Gandelman, M; García, C; Gavillet, P; Gazis, E; Gokieli, R; Golob, B; Gómez-Ceballos, G; Gonçalves, P; Graziani, E; Grosdidier, G; Grzelak, K; Guy, J; Haag, C; Hallgren, A; Hamacher, K; Hamilton, K; Haug, S; Hauler, F; Hedberg, V; Hennecke, M; Herr, H; Hoffman, J; Holmgren, S O; Holt, P J; Houlden, M A; Jackson, J N; Jarlskog, G; Jarry, P; Jeans, D; Johansson, E K; Johansson, P D; Jonsson, P; Joram, C; Jungermann, L; Kapusta, F; Katsanevas, S; Katsoufis, E; Kernel, G; Kersevan, B P; Kerzel, U; King, B T; Kjaer, N J; Kluit, P; Kokkinias, P; Kourkoumelis, C; Kuznetsov, O; Krumshtein, Z; Kucharczyk, M; Lamsa, J; Leder, G; Ledroit, F; Leinonen, L; Leitner, R; Lemonne, J; Lepeltier, V; Lesiak, T; Liebig, W; Liko, D; Lipniacka, A; Lopes, J H; López, J M; Loukas, D; Lutz, P; Lyons, L; MacNaughton, J; Malek, A; Maltezos, S; Mandl, F; Marco, J; Marco, R; Maréchal, B; Margoni, M; Marin, J C; Mariotti, C; Markou, A; Martínez-Rivero, C; Mazzucato, M; Mönig, K; Mulders, M; Nawrocki, K; Olshevskii, A G; Masik, J; McNulty, R; Mastroyiannopoulos, N; Migliore, E; Matorras, F; Matteuzzi, C; Mazzucato, F; Moch, M; Montenegro, J; Moraes, D; Moreno, S; Morettini, P; Müller, U; Münich, K; Murray, W; Monge, R; Orava, R; Muryn, B; Österberg, K; Myatt, G; Myklebust, T; Nassiakou, M; Oliveira, O; Paganoni, M; Navarria, F; Nikolenko, M; Oblakowska-Mucha, A; Ouraou, A; Obraztsov, V F; Oyanguren, A; Oliveira, S M; Paiano, S; Meroni, C; Mitaroff, W A; Mjörnmark, U; Moa, T; Mundim, L; Onofre, A; Nicolaidou, R; Palacios, J P; Palka, H; Papadopoulou, T D; Pape, L; Parkes, C; Parodi, F; Parzefall, U; Passeri, A; Passon, O; Peralta, L; Perepelitsa, V; Perrotta, A; Petrolini, A; Piedra, J; Pieri, L; Pierre, F; Pimenta, M; Piotto, E; Podobnik, T; Poireau, V; Pol, M E; Polok, G; Pozdnyakov, V; Pukhaeva, N; Pullia, A; Rames, J; Read, A; Rebecchi, P; Rehn, J; Reid, D; Reinhardt, R; Renton, P B; Richard, F; Rídky, J; Rivero, M; Rodríguez, D; Romero, A; Ronchese, P; Roudeau, P; Rovelli, T; Ruhlmann-Kleider, V; Ryabtchikov, D; Sadovskii, A; Siebel, M; Stanitzki, M; Salmi, L; Stocchi, A; Salt, J; Sander, C; Stugu, B; Santos, R; Savoy-Navarro, A; Sopczak, A; Szeptycka, M; Schwickerath, U; Sosnowski, R; Szumlak, T; Sekulin, R; Spassoff, Tz; Tabarelli de Fatis, T; Sisakian, A; Smadja, G; Strauss, J; Smirnova, O; Sokolov, A; Szczekowski, M; Taffard, A C; Tegenfeldt, F; Timmermans, J; Tkatchev, L; Tobin, M; Todorovova, S; Tomé, B; Tonazzo, A; Tortosa, P; Travnicek, P; Treille, D; Tristram, G; Trochimczuk, M; Troncon, C; Turluer, M L; Tyapkin, I A; Tyapkin, P; Tzamarias, S; Uvarov, V; Valenti, G; van Dam, P; Van Eldik, J; Van Remortel, N; Van Vulpen, I; Vegni, G; Veloso, F; Venus, W; Verdier, P; Verzi, V; Vilanova, D; Vitale, L; Vrba, V; Wahlen, H; Washbrook, A J; Weiser, C; Wicke, D; Wickens, J; Wilkinson, G; Winter, M; Witek, M; Yushchenko, O; Zalewska-Bak, A; Zalewski, P; Zavrtanik, D; Zhuravlov, V; Zimin, N I; Zintchenko, A; Zupan, M

    2007-01-01

    A search for the pair production of fourth generation b'-quarks was performed using data taken by the DELPHI detector at LEP-II. The analysed data were collected at centre-of-mass energies ranging from 196 to 209 GeV, corresponding to an integrated luminosity of 420 pb^{-1}. No evidence for a signal was found. Upper limits on BR(b' -> bZ) and BR(b' -> cW) were obtained for b' masses ranging from 96 to 103 GeV/c^2. These limits, together with the theoretical branching ratios predicted by a sequential four generations model, were used to constrain the value of R_{CKM}=|V_{cb'}/V_{tb'}V_{tb}|, where V_{cb'}, V_{tb'} and V_{tb} are elements of the extended CKM matrix.

  6. Search for pair production of scalar bottom quarks in ppbar collisions at $\\sqrt{s}$=1.96 TeV

    CERN Document Server

    Abazov, V M; Abolins, M; Acharya, B S; Adams, M; Adams, T; Agelou, M; Ahn, S H; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Andeen, T; Anderson, S; Andrieu, B; Anzelc, M S; Arnoud, Y; Arov, M; Askew, A; Åsman, B; Assis-Jesus, A C S; Atramentov, O; Autermann, C; Avila, C; Ay, C; Badaud, F; Baden, A; Bagby, L; Baldin, B; Bandurin, D V; Banerjee, P; Banerjee, S; Barberis, E; Bargassa, P; Baringer, P; Barnes, C; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Bean, A; Begalli, M; Begel, M; Belanger-Champagne, C; Bellantoni, L; Bellavance, A; Benítez, J A; Beri, S B; Bernardi, G; Bernhard, R; Berntzon, L; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Binder, M; Biscarat, C; Black, K M; Blackler, I; Blazey, G; Blekman, F; Blessing, S; Bloch, D; Bloom, K; Blumenschein, U; Böhnlein, A; Boeriu, O; Bolton, T A; Borissov, G; Bos, K; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Brown, D; Buchanan, N J; Buchholz, D; Bühler, M; Büscher, V; Burdin, S; Burke, S; Burnett, T H; Busato, E; Buszello, C P; Butler, J M; Calfayan, P; Calvet, S; Cammin, J; Caron, S; Carvalho, W; Casey, B C K; Cason, N M; Castilla-Valdez, H; Chakraborty, D; Chan, K M; Chandra, A; Charles, F; Cheu, E; Chevallier, F; Cho, D K; Choi, S; Choudhary, B; Christofek, L; Claes, D; Clement, B; Clément, C; Coadou, Y; Cooke, M; Cooper, W E; Coppage, D; Corcoran, M; Cousinou, M C; Cox, B; Crepe-Renaudin, S; Cutts, D; Cwiok, M; Da Motta, H; Das, A; Das, M; Davies, B; Davies, G; Davis, G A; De, K; de Jong, P; De Jong, S J; De La Cruz-Burelo, E; De Oliveira Martins, C; Degenhardt, J D; Déliot, F; Demarteau, M; Demina, R; Demine, P; Denisov, D; Denisov, S P; Desai, S; Diehl, H T; Diesburg, M; Doidge, M; Dominguez, A; Dong, H; Dudko, L V; Duflot, L; Dugad, S R; Duggan, D; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Edwards, T; Ellison, J; Elmsheuser, J; Elvira, V D; Eno, S; Ermolov, P; Evans, H; Evdokimov, A; Evdokimov, V N; Fatakia, S N; Feligioni, L; Ferapontov, A V; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Fleck, I; Ford, M; Fortner, M; Fox, H; Fu, S; Fuess, S; Gadfort, T; Galea, C F; Gallas, E; Galyaev, E; García, C; García-Bellido, A; Gardner, J; Gavrilov, V; Gay, A; Gay, P; Gelé, D; Gelhaus, R; Gerber, C E; Gershtein, Yu; Gillberg, D; Ginther, G; Gollub, N; Gómez, B; Goussiou, A; Grannis, P D; Greenlee, H; Greenwood, Z D; Gregores, E M; Grenier, G; Gris, P; Grivaz, J F; Grünendahl, S; Grünewald, M W; Guo, F; Guo, J; Gutíerrez, G; Gutíerrez, P; Haas, A; Hadley, N J; Haefner, P; Hagopian, S; Haley, J; Hall, I; Hall, R E; Han, L; Hanagaki, K; Harder, K; Harel, A; Harrington, R; Hauptman, J M; Hauser, R; Hays, J; Hebbeker, T; Hedin, D; Hegeman, J G; Heinmiller, J M; Heinson, A P; Heintz, U; Hensel, C; Herner, K; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hoeth, H; Hohlfeld, M; Hong, S J; Hooper, R; Houben, P; Hu, Y; Hubacek, Z; Hynek, V; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jakobs, K; Jarvis, C; Jenkins, A; Jesik, R; Johns, K; Johnson, C; Johnson, M; Jonckheere, A; Jonsson, P; Juste, A; Käfer, D; Kahn, S; Kajfasz, E; Kalinin, A M; Kalk, J M; Kalk, J R; Kappler, S; Karmanov, D; Kasper, J; Kasper, P; Katsanos, I; Kau, D; Kaur, R; Kehoe, R; Kermiche, S; Khalatyan, N; Khanov, A; Kharchilava, A I; Kharzheev, Yu M; Khatidze, D; Kim, H; Kim, T J; Kirby, M H; Klima, B; Kohli, J M; Konrath, J P; Kopal, M; Korablev, V M; Kotcher, J; Kothari, B; Koubarovsky, A; Kozelov, A V; Kozminski, J; Krop, D; Kryemadhi, A; Kühl, T; Kumar, A; Kunori, S; Kupco, A; Kurca, T; Kvita, J; Lammers, S; Landsberg, G L; Lazoflores, J; Le Bihan, A C; Lebrun, P; Lee, W M; Leflat, A; Lehner, F; Lesne, V; Lévêque, J; Lewis, P; Li, J; Li, Q Z; Lima, J G R; Lincoln, D; Linnemann, J; Lipaev, V V; Lipton, R; Liu, Z; Lobo, L; Lobodenko, A; Lokajícek, M; Lounis, A; Love, P; Lubatti, H J; Lynker, M; Lyon, A L; Maciel, A K A; Madaras, R J; Mättig, P; Magass, C; Magerkurth, A; Magnan, A M; Makovec, N; Mal, P K; Malbouisson, H B; Malik, S; Malyshev, V L; Mao, H S; Maravin, Y; Martens, M; McCarthy, R; Meder, D; Melnitchouk, A; Mendes, A; Mendoza, L; Merkin, M; Merritt, K W; Meyer, A; Meyer, J; Michaut, M; Miettinen, H; Millet, T; Mitrevski, J; Molina, J; Mondal, N K; Monk, J; Moore, R W; Moulik, T; Muanza, G S; Mulders, M; Mulhearn, M; Mundim, L; Mutaf, Y D; Nagy, E; Naimuddin, M; Narain, M; Naumann, N A; Neal, H A; Negret, J P; Neustroev, P; Nöding, C; Nomerotski, A; Novaes, S F; Nunnemann, T; O'Dell, V; O'Neil, D C; Obrant, G; Oguri, V; Oliveira, N; Oshima, N; Otec, R; Oteroy-Garzon, G J; Owen, M; Padley, P; Parashar, N; Park, S J; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Pawloski, G; Perea, P M; Pérez, E; Peters, K; Petroff, P; Petteni, M; Piegaia, R; Piper, J; Pleier, M A; Podesta-Lerma, P L M; Podstavkov, V M; Pogorelov, Y; Pol, M E; Pompos, A; Pope, B G; Popov, A V; Potter, C; Prado da Silva, W L; Prosper, H B; Protopopescu, S D; Qian, J; Quadt, A; Quinn, B; Rangel, M S; Rani, K J; Ranjan, K; Ratoff, P N; Renkel, P; Reucroft, S; Rijssenbeek, M; Ripp-Baudot, I; Rizatdinova, F K; Robinson, S; Rodrigues, R F; Royon, C; Rubinov, P; Ruchti, R; Rud, V I; Sajot, G; Sánchez-Hernández, A; Sanders, M P; Santoro, A F S; Savage, G; Sawyer, L; Scanlon, T; Schaile, A D; Schamberger, R D; Scheglov, Y; Schellman, H; Schieferdecker, P; Schmitt, C; Schwanenberger, C; Schwartzman, A; Schwienhorst, R; Sekaric, J; Sen-Gupta, S; Severini, H; Shabalina, E; Shamim, M; Shary, V; Shchukin, A A; Shephard, W D; Shivpuri, R K; Shpakov, D; Siccardi, V; Sidwell, R A; Simák, V; Sirotenko, V I; Skubic, P L; Slattery, P F; Smith, R P; Snow, G R; Snow, J; Snyder, S; Söldner-Rembold, S; Song, X; Sonnenschein, L; Sopczak, A; Sosebee, M; Soustruznik, K; Souza, M; Spurlock, B; Stark, J; Steele, J; Stolin, V; Stone, A; Stoyanova, D A; Strandberg, J; Strandberg, S; Strang, M A; Strauss, M; Ströhmer, R; Strom, D; Strovink, M; Stutte, L; Sumowidagdo, S; Sznajder, A; Talby, M; Tamburello, P; Taylor, W; Telford, P; Temple, J; Tiller, B; Titov, M; Tokmenin, V V; Tomoto, M; Toole, T; Torchiani, I; Towers, S; Trefzger, T; Trincaz-Duvoid, S; Tsybychev, D; Tuchming, B; Tully, C; Turcot, A S; Tuts, P M; Unalan, R; Uvarov, L; Uvarov, S; Uzunyan, S; Vachon, B; vanden Berg, P J; Van Kooten, R; Van Leeuwen, W M; Varelas, N; Varnes, E W; Vartapetian, A H; Vasilyev, I A; Vaupel, M; Verdier, P; Vertogradov, L S; Verzocchi, M; Villeneuve-Séguier, F; Vint, P; Vlimant, J R; Von Törne, E; Voutilainen, M; Vreeswijk, M; Wahl, H D; Wang, L; Wang, M H L; Warchol, J; Watts, G; Wayne, M; Weber, M; Weerts, H; Wermes, N; Wetstein, M; White, A; Wicke, D; Wilson, G W; Wimpenny, S J; Wobisch, M; Womersley, J; Wood, D R; Wyatt, T R; Xie, Y; Xuan, N; Yacoob, S; Yamada, R; Yan, M; Yasuda, T; Yatsunenko, Y A; Yip, K; Yoo, H D; Youn, S W; Yu, C; Yu, J; Yurkewicz, A; Zatserklyaniy, A; Zeitnitz, C; Zhang, D; Zhao, T; Zhou, B; Zhu, J; Zielinski, M; Zieminska, D; Zieminski, A; Zutshi, V; Zverev, E G

    2006-01-01

    A search for direct production of scalar bottom quarks (sb) is performed with 310 pb-1 of data collected by the DO experiment in ppbar collisions at $\\sqrt{s}$=1.96 TeV at the Fermilab Tevatron Collider. The topology analyzed consists of two b jets and an imbalance in transverse momentum due to undetected neutralinos chi0_1, with chi0_1 assumed to be the lightest supersymmetric particle. We find the data consistent with standard model expectations, and set a 95% C.L. exclusion domain in the (m_sb,m_chi0_1) mass plane, improving significantly upon the results from Run I of the Tevatron.

  7. Search for squarks and gluinos in events with jets and missing transverse energy in ppbar collisions at $\\sqrt{s}$=1.96 TeV

    CERN Document Server

    Abazov, V M; Abolins, M; Acharya, B S; Adams, M; Adams, T; Agelou, M; Agram, J L; Ahn, S H; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Andeen, T; Anderson, S; Andrieu, B; Anzelc, M S; Arnoud, Y; Arov, M; Askew, A; Åsman, B; Assis-Jesus, A C S; Atramentov, O; Autermann, C; Avila, C; Ay, C; Badaud, F; Baden, A; Bagby, L; Baldin, B; Bandurin, D V; Banerjee, P; Banerjee, S; Barberis, E; Bargassa, P; Baringer, P; Barnes, C; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Bean, A; Begalli, M; Begel, M; Belanger-Champagne, C; Bellavance, A; Benítez, J A; Beri, S B; Bernardi, G; Bernhard, R; Berntzon, L; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Binder, M; Biscarat, C; Black, K M; Blackler, I; Blazey, G; Blekman, F; Blessing, S; Bloch, D; Bloom, K; Blumenschein, U; Böhnlein, A; Boeriu, O; Bolton, T A; Borcherding, F; Borissov, G; Bos, K; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Brown, D; Buchanan, N J; Buchholz, D; Bühler, M; Büscher, V; Burdin, S; Burke, S; Burnett, T H; Busato, E; Buszello, C P; Butler, J M; Calvet, S; Cammin, J; Caron, S; Carvalho, W; Casey, B C K; Cason, N M; Castilla-Valdez, H; Chakrabarti, S; Chakraborty, D; Chan, K M; Chandra, A; Chapin, D; Charles, F; Cheu, E; Chevallier, F; Cho, D K; Choi, S; Choudhary, B; Christofek, L; Claes, D; Clement, B; Clément, C; Coadou, Y; Cooke, M; Cooper, W E; Coppage, D; Corcoran, M; Cousinou, M C; Cox, B; Crepe-Renaudin, S; Cutts, D; Cwiok, M; Da Motta, H; Das, A; Das, M; Davies, B; Davies, G; Davis, G A; De, K; de Jong, P; De Jong, S J; De La Cruz-Burelo, E; De Oliveira Martins, C; Degenhardt, J D; Déliot, F; Demarteau, M; Demina, R; Demine, P; Denisov, D; Denisov, S P; Desai, S; Diehl, H T; Diesburg, M; Doidge, M; Dominguez, A; Dong, H; Dudko, L V; Duflot, L; Dugad, S R; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Edwards, T; Ellison, J; Elmsheuser, J; Elvira, V D; Eno, S; Ermolov, P; Estrada, J; Evans, H; Evdokimov, A; Evdokimov, V N; Fatakia, S N; Feligioni, L; Ferapontov, A V; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Fleck, I; Ford, M; Fortner, M; Fox, H; Fu, S; Fuess, S; Gadfort, T; Galea, C F; Gallas, E; Galyaev, E; García, C; García-Bellido, A; Gardner, J; Gavrilov, V; Gay, A; Gay, P; Gelé, D; Gelhaus, R; Gerber, C E; Gershtein, Yu; Gillberg, D; Ginther, G; Gollub, N; Gómez, B; Gounder, K; Goussiou, A; Grannis, P D; Greenlee, H; Greenwood, Z D; Gregores, E M; Grenier, G; Gris, P; Grivaz, J F; Grünendahl, S; Grünewald, M W; Guo, F; Guo, J; Gutíerrez, G; Gutíerrez, P; Haas, A; Hadley, N J; Haefner, P; Hagopian, S; Haley, J; Hall, I; Hall, R E; Han, L; Hanagaki, K; Harder, K; Harel, A; Harrington, R; Hauptman, J M; Hauser, R; Hays, J; Hebbeker, T; Hedin, D; Hegeman, J G; Heinmiller, J M; Heinson, A P; Heintz, U; Hensel, C; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hohlfeld, M; Hong, S J; Hooper, R; Houben, P; Hu, Y; Hynek, V; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jakobs, K; Jarvis, C; Jenkins, A; Jesik, R; Johns, K; Johnson, C; Johnson, M; Jonckheere, A; Jonsson, P; Juste, A; Käfer, D; Kahn, S; Kajfasz, E; Kalinin, A M; Kalk, J M; Kalk, J R; Kappler, S; Karmanov, D; Kasper, J; Katsanos, I; Kau, D; Kaur, R; Kehoe, R; Kermiche, S; Kesisoglou, S; Khanov, A; Kharchilava, A I; Kharzheev, Yu M; Khatidze, D; Kim, H; Kim, T J; Kirby, M H; Klima, B; Kohli, J M; Konrath, J P; Kopal, M; Korablev, V M; Kotcher, J; Kothari, B; Koubarovsky, A; Kozelov, A V; Kozminski, J; Kryemadhi, A; Krzywdzinski, S; Kühl, T; Kumar, A; Kunori, S; Kupco, A; Kurca, T; Kvita, J; Lager, S; Lammers, S; Landsberg, G L; Lazoflores, J; Le Bihan, A C; Lebrun, P; Lee, W M; Leflat, A; Lehner, F; Leonidopoulos, C; Lesne, V; Lévêque, J; Lewis, P; Li, J; Li, Q Z; Lima, J G R; Lincoln, D; Linnemann, J; Lipaev, V V; Lipton, R; Liu, Z; Lobo, L; Lobodenko, A; Lokajícek, M; Lounis, A; Love, P; Lubatti, H J; Lynker, M; Lyon, A L; Maciel, A K A; Madaras, R J; Mättig, P; Magass, C; Magerkurth, A; Magnan, A M; Makovec, N; Mal, P K; Malbouisson, H B; Malik, S; Malyshev, V L; Mao, H S; Maravin, Y; Martens, M; Mattingly, S E K; McCarthy, R; McCroskey, R; Meder, D; Melnitchouk, A; Mendes, A; Mendoza, L; Merkin, M; Merritt, K W; Meyer, A; Meyer, J; Michaut, M; Miettinen, H; Millet, T; Mitrevski, J; Molina, J; Mondal, N K; Monk, J; Moore, R W; Moulik, T; Muanza, G S; Mulders, M; Mulhearn, M; Mundim, L; Mutaf, Y D; Nagy, E; Naimuddin, M; Narain, M; Naumann, N A; Neal, H A; Negret, J P; Nelson, S; Neustroev, P; Nöding, C; Nomerotski, A; Novaes, S F; Nunnemann, T; O'Dell, V; O'Neil, D C; Obrant, G; Oguri, V; Oliveira, N; Oshima, N; Otec, R; Oteroy-Garzon, G J; Owen, M; Padley, P; Parashar, N; Park, S J; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Pawloski, G; Perea, P M; Pérez, E; Peters, K; Petroff, P; Petteni, M; Piegaia, R; Pleier, M A; Podesta-Lerma, P L M; Podstavkov, V M; Pogorelov, Y; Pol, M E; Pompos, A; Pope, B G; Popov, A V; Prado da Silva, W L; Prosper, H B; Protopopescu, S D; Qian, J; Quadt, A; Quinn, B; Rani, K J; Ranjan, K; Rapidis, P A; Ratoff, P N; Renkel, P; Reucroft, S; Rijssenbeek, M; Ripp-Baudot, I; Rizatdinova, F K; Robinson, S; Rodrigues, R F; Royon, C; Rubinov, P; Ruchti, R; Rud, V I; Sajot, G; Sánchez-Hernández, A; Sanders, M P; Santoro, A F S; Savage, G; Sawyer, L; Scanlon, T; Schaile, A D; Schamberger, R D; Scheglov, Y; Schellman, H; Schieferdecker, P; Schmitt, C; Schwanenberger, C; Schwartzman, A; Schwienhorst, R; Sen-Gupta, S; Severini, H; Shabalina, E; Shamim, M; Shary, V; Shchukin, A A; Shephard, W D; Shivpuri, R K; Shpakov, D; Siccardi, V; Sidwell, R A; Simák, V; Sirotenko, V I; Skubic, P L; Slattery, P F; Smith, R P; Snow, G R; Snow, J; Snyder, S; Söldner-Rembold, S; Song, X; Sonnenschein, L; Sopczak, A; Sosebee, M; Soustruznik, K; Souza, M; Spurlock, B; Stark, J; Steele, J; Stevenson, K; Stolin, V; Stone, A; Stoyanova, D A; Strandberg, J; Strang, M A; Strauss, M; Ströhmer, R; Strom, D; Strovink, M; Stutte, L; Sumowidagdo, S; Sznajder, A; Talby, M; Tamburello, P; Taylor, W; Telford, P; Temple, J; Tiller, B; Titov, M; Tokmenin, V V; Tomoto, M; Toole, T; Torchiani, I; Towers, S; Trefzger, T; Trincaz-Duvoid, S; Tsybychev, D; Tuchming, B; Tully, C; Turcot, A S; Tuts, P M; Unalan, R; Uvarov, L; Uvarov, S; Uzunyan, S; Vachon, B; Vanden Berg, P J; Van Kooten, R; Van Leeuwen, W M; Varelas, N; Varnes, E W; Vartapetian, A H; Vasilyev, I A; Vaupel, M; Verdier, P; Vertogradov, L S; Verzocchi, M; Villeneuve-Séguier, F; Vint, P; Vlimant, J R; Von Törne, E; Voutilainen, M; Vreeswijk, M; Wahl, H D; Wang, L; Warchol, J; Watts, G; Wayne, M; Weber, M; Weerts, H; Wermes, N; Wetstein, M; White, A; Wicke, D; Wilson, G W; Wimpenny, S J; Wobisch, M; Womersley, J; Wood, D R; Wyatt, T R; Xie, Y; Xuan, N; Yacoob, S; Yamada, R; Yan, M; Yasuda, T; Yatsunenko, Y A; Yip, K; Yoo, H D; Youn, S W; Yu, C; Yu, J; Yurkewicz, A; Zatserklyaniy, A; Zeitnitz, C; Zhang, D; Zhao, T; Zhao, Z; Zhou, B; Zhu, J; Zielinski, M; Zieminska, D; Zieminski, A; Zutshi, V; Zverev, E G

    2006-01-01

    The results of a search for squarks and gluinos using data from ppbar collisions recorded at a center-of-mass energy of 1.96 TeV by the DO detector at the Fermilab Tevatron Collider are reported. The topologies analyzed consist of acoplanar-jet and multijet events with large missing transverse energy. No evidence for the production of squarks or gluinos was found in a data sample of 310 pb-1. New constraints were obtained in the framework of minimal supergravity. Lower limits of 325 and 241 GeV were derived at the 95% C.L. on the squark and gluino masses, respectively, for tan(beta)=3, A_0=0, and mu<0.

  8. Search for Neutral Higgs Bosons Decaying to Tau Pairs in p-pbar Collisions at $\\sqrt{s}$ = 1.96 TeV

    CERN Document Server

    Abazov, V M; Abolins, M; Acharya, B S; Adams, M; Adams, T; Agelou, M; Agram, J L; Ahn, S H; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Andeen, T; Anderson, S; Andrieu, B; Anzelc, M S; Arnoud, Y; Arov, M; Askew, A; Åsman, B; Assis-Jesus, A C S; Atramentov, O; Autermann, C; Avila, C; Ay, C; Badaud, F; Baden, A; Bagby, L; Baldin, B; Bandurin, D V; Banerjee, P; Banerjee, S; Barberis, E; Bargassa, P; Baringer, P; Barnes, C; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Bean, A; Begalli, M; Begel, M; Belanger-Champagne, C; Bellantoni, L; Bellavance, A; Benítez, J A; Beri, S B; Bernardi, G; Bernhard, R; Berntzon, L; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Binder, M; Biscarat, C; Black, K M; Blackler, I; Blazey, G; Blekman, F; Blessing, S; Bloch, D; Bloom, K; Blumenschein, U; Böhnlein, A; Boeriu, O; Bolton, T A; Borcherding, F; Borissov, G; Bos, K; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Brown, D; Buchanan, N J; Buchholz, D; Bühler, M; Büscher, V; Burdin, S; Burke, S; Burnett, T H; Busato, E; Buszello, C P; Butler, J M; Calfayan, P; Calvet, S; Cammin, J; Caron, S; Carvalho, W; Casey, B C K; Cason, N M; Castilla-Valdez, H; Chakrabarti, S; Chakraborty, D; Chan, K M; Chandra, A; Chapin, D; Charles, F; Cheu, E; Chevallier, F; Cho, D K; Choi, S; Choudhary, B; Christofek, L; Claes, D; Clement, B; Clément, C; Coadou, Y; Cooke, M; Cooper, W E; Coppage, D; Corcoran, M; Cousinou, M C; Cox, B; Crepe-Renaudin, S; Cutts, D; Cwiok, M; Da Motta, H; Das, A; Das, M; Davies, B; Davies, G; Davis, G A; De, K; de Jong, P; De Jong, S J; De La Cruz-Burelo, E; De Oliveira Martins, C; Degenhardt, J D; Déliot, F; Demarteau, M; Demina, R; Demine, P; Denisov, D; Denisov, S P; Desai, S; Diehl, H T; Diesburg, M; Doidge, M; Dominguez, A; Dong, H; Dudko, L V; Duflot, L; Dugad, S R; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Edwards, T; Ellison, J; Elmsheuser, J; Elvira, V D; Eno, S; Ermolov, P; Estrada, J; Evans, H; Evdokimov, A; Evdokimov, V N; Fatakia, S N; Feligioni, L; Ferapontov, A V; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Fleck, I; Ford, M; Fortner, M; Fox, H; Fu, S; Fuess, S; Gadfort, T; Galea, C F; Gallas, E; Galyaev, E; García, C; García-Bellido, A; Gardner, J; Gavrilov, V; Gay, A; Gay, P; Gelé, D; Gelhaus, R; Gerber, C E; Gershtein, Yu; Gillberg, D; Ginther, G; Gollub, N; Gómez, B; Gounder, K; Goussiou, A; Grannis, P D; Greenlee, H; Greenwood, Z D; Gregores, E M; Grenier, G; Gris, P; Grivaz, J F; Grünendahl, S; Grünewald, M W; Guo, F; Guo, J; Gutíerrez, G; Gutíerrez, P; Haas, A; Hadley, N J; Haefner, P; Hagopian, S; Haley, J; Hall, I; Hall, R E; Han, L; Hanagaki, K; Harder, K; Harel, A; Harrington, R; Hauptman, J M; Hauser, R; Hays, J; Hebbeker, T; Hedin, D; Hegeman, J G; Heinmiller, J M; Heinson, A P; Heintz, U; Hensel, C; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hoeth, H; Hohlfeld, M; Hong, S J; Hooper, R; Houben, P; Hu, Y; Hubacek, Z; Hynek, V; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jakobs, K; Jarvis, C; Jenkins, A; Jesik, R; Johns, K; Johnson, C; Johnson, M; Jonckheere, A; Jonsson, P; Juste, A; Käfer, D; Kahn, S; Kajfasz, E; Kalinin, A M; Kalk, J M; Kalk, J R; Kappler, S; Karmanov, D; Kasper, J; Kasper, P; Katsanos, I; Kau, D; Kaur, R; Kehoe, R; Kermiche, S; Kesisoglou, S; Khalatyan, N; Khanov, A; Kharchilava, A I; Kharzheev, Yu M; Khatidze, D; Kim, H; Kim, T J; Kirby, M H; Klima, B; Kohli, J M; Konrath, J P; Kopal, M; Korablev, V M; Kotcher, J; Kothari, B; Koubarovsky, A; Kozelov, A V; Kozminski, J; Kryemadhi, A; Krzywdzinski, S; Kühl, T; Kumar, A; Kunori, S; Kupco, A; Kurca, T; Kvita, J; Lager, S; Lammers, S; Landsberg, G L; Lazoflores, J; Le Bihan, A C; Lebrun, P; Lee, W M; Leflat, A; Lehner, F; Lesne, V; Lévêque, J; Lewis, P; Li, J; Li, Q Z; Lima, J G R; Lincoln, D; Linnemann, J; Lipaev, V V; Lipton, R; Liu, Z; Lobo, L; Lobodenko, A; Lokajícek, M; Lounis, A; Love, P; Lubatti, H J; Lynker, M; Lyon, A L; Maciel, A K A; Madaras, R J; Mättig, P; Magass, C; Magerkurth, A; Magnan, A M; Makovec, N; Mal, P K; Malbouisson, H B; Malik, S; Malyshev, V L; Mao, H S; Maravin, Y; Martens, M; Mattingly, S E K; McCarthy, R; McCroskey, R; Meder, D; Melnitchouk, A; Mendes, A; Mendoza, L; Merkin, M; Merritt, K W; Meyer, A; Meyer, J; Michaut, M; Miettinen, H; Millet, T; Mitrevski, J; Molina, J; Mondal, N K; Monk, J; Moore, R W; Moulik, T; Muanza, G S; Mulders, M; Mulhearn, M; Mundim, L; Mutaf, Y D; Nagy, E; Naimuddin, M; Narain, M; Naumann, N A; Neal, H A; Negret, J P; Nelson, S; Neustroev, P; Nöding, C; Nomerotski, A; Novaes, S F; Nunnemann, T; O'Dell, V; O'Neil, D C; Obrant, G; Oguri, V; Oliveira, N; Oshima, N; Otec, R; Oteroy-Garzon, G J; Owen, M; Padley, P; Parashar, N; Park, S J; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Pawloski, G; Perea, P M; Pérez, E; Peters, K; Petroff, P; Petteni, M; Piegaia, R; Pleier, M A; Podesta-Lerma, P L M; Podstavkov, V M; Pogorelov, Y; Pol, M E; Pompos, A; Pope, B G; Popov, A V; Prado da Silva, W L; Prosper, H B; Protopopescu, S D; Qian, J; Quadt, A; Quinn, B; Rani, K J; Ranjan, K; Rapidis, P A; Ratoff, P N; Renkel, P; Reucroft, S; Rijssenbeek, M; Ripp-Baudot, I; Rizatdinova, F K; Robinson, S; Rodrigues, R F; Royon, C; Rubinov, P; Ruchti, R; Rud, V I; Sajot, G; Sánchez-Hernández, A; Sanders, M P; Santoro, A F S; Savage, G; Sawyer, L; Scanlon, T; Schaile, A D; Schamberger, R D; Scheglov, Y; Schellman, H; Schieferdecker, P; Schmitt, C; Schwanenberger, C; Schwartzman, A; Schwienhorst, R; Sen-Gupta, S; Severini, H; Shabalina, E; Shamim, M; Shary, V; Shchukin, A A; Shephard, W D; Shivpuri, R K; Shpakov, D; Siccardi, V; Sidwell, R A; Simák, V; Sirotenko, V I; Skubic, P L; Slattery, P F; Smith, R P; Snow, G R; Snow, J; Snyder, S; Söldner-Rembold, S; Song, X; Sonnenschein, L; Sopczak, A; Sosebee, M; Soustruznik, K; Souza, M; Spurlock, B; Stark, J; Steele, J; Stevenson, K; Stolin, V; Stone, A; Stoyanova, D A; Strandberg, J; Strang, M A; Strauss, M; Ströhmer, R; Strom, D; Strovink, M; Stutte, L; Sumowidagdo, S; Sznajder, A; Talby, M; Tamburello, P; Taylor, W; Telford, P; Temple, J; Tiller, B; Titov, M; Tokmenin, V V; Tomoto, M; Toole, T; Torchiani, I; Towers, S; Trefzger, T; Trincaz-Duvoid, S; Tsybychev, D; Tuchming, B; Tully, C; Turcot, A S; Tuts, P M; Unalan, R; Uvarov, L; Uvarov, S; Uzunyan, S; Vachon, B; vanden Berg, P J; Van Kooten, R; Van Leeuwen, W M; Varelas, N; Varnes, E W; Vartapetian, A H; Vasilyev, I A; Vaupel, M; Verdier, P; Vertogradov, L S; Verzocchi, M; Villeneuve-Séguier, F; Vint, P; Vlimant, J R; Von Törne, E; Voutilainen, M; Vreeswijk, M; Wahl, H D; Wang, L; Warchol, J; Watts, G; Wayne, M; Weber, M; Weerts, H; Wermes, N; Wetstein, M; White, A; Wicke, D; Wilson, G W; Wimpenny, S J; Wobisch, M; Womersley, J; Wood, D R; Wyatt, T R; Xie, Y; Xuan, N; Yacoob, S; Yamada, R; Yan, M; Yasuda, T; Yatsunenko, Y A; Yip, K; Yoo, H D; Youn, S W; Yu, C; Yu, J; Yurkewicz, A; Zatserklyaniy, A; Zeitnitz, C; Zhang, D; Zhao, T; Zhao, Z; Zhou, B; Zhu, J; Zielinski, M; Zieminska, D; Zieminski, A; Zutshi, V

    2006-01-01

    A search for the production of neutral Higgs bosons Phi decaying into tau^+tau^- final states in p-pbar collisions at a center-of-mass energy of 1.96 TeV is presented. The data, corresponding to an integrated luminosity of up to 348 pb^-1, were collected by the D0 experiment at the Fermilab Tevatron Collider. Since no excess compared to the expectation from standard model processes is found, limits on the production cross section times branching ratio are set. The results are combined with those obtained from the D0 search for Phi b(b) to b-bbar-b(bbar) and are interpreted in the minimal supersymmetric standard model.

  9. Search for particles decaying into a Z boson and a photon in p\\bar{p} collisions at \\sqrt{s} = 1.96 TeV

    CERN Document Server

    Abazov, V M; Abolins, M; Acharya, B S; Adams, M; Adams, T; Agelou, M; Agram, J L; Ahn, S H; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Andeen, T; Anderson, S; Andrieu, B; Anzelc, M S; Arnoud, Y; Arov, M; Askew, A; Åsman, B; Assis-Jesus, A C S; Atramentov, O; Autermann, C; Avila, C; Ay, C; Badaud, F; Baden, A; Bagby, L; Baldin, B; Bandurin, D V; Banerjee, P; Banerjee, S; Barberis, E; Bargassa, P; Baringer, P; Barnes, C; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Bean, A; Begalli, M; Begel, M; Belanger-Champagne, C; Bellantoni, L; Bellavance, A; Benítez, J A; Beri, S B; Bernardi, G; Bernhard, R; Berntzon, L; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Binder, M; Biscarat, C; Black, K M; Blackler, I; Blazey, G; Blekman, F; Blessing, S; Bloch, D; Bloom, K; Blumenschein, U; Böhnlein, A; Boeriu, O; Bolton, T A; Borcherding, F; Borissov, G; Bos, K; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Brown, D; Buchanan, N J; Buchholz, D; Bühler, M; Büscher, V; Burdin, S; Burke, S; Burnett, T H; Busato, E; Buszello, C P; Butler, J M; Calfayan, P; Calvet, S; Cammin, J; Caron, S; Carvalho, W; Casey, B C K; Cason, N M; Castilla-Valdez, H; Chakrabarti, S; Chakraborty, D; Chan, K M; Chandra, A; Chapin, D; Charles, F; Cheu, E; Chevallier, F; Cho, D K; Choi, S; Choudhary, B; Christofek, L; Claes, D; Clement, B; Clément, C; Coadou, Y; Cooke, M; Cooper, W E; Coppage, D; Corcoran, M; Cousinou, M C; Cox, B; Crepe-Renaudin, S; Cutts, D; Cwiok, M; Da Motta, H; Das, A; Das, M; Davies, B; Davies, G; Davis, G A; De, K; de Jong, P; De Jong, S J; De La Cruz-Burelo, E; De Oliveira Martins, C; Degenhardt, J D; Déliot, F; Demarteau, M; Demina, R; Demine, P; Denisov, D; Denisov, S P; Desai, S; Diehl, H T; Diesburg, M; Doidge, M; Dominguez, A; Dong, H; Dudko, L V; Duflot, L; Dugad, S R; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Edwards, T; Ellison, J; Elmsheuser, J; Elvira, V D; Eno, S; Ermolov, P; Estrada, J; Evans, H; Evdokimov, A; Evdokimov, V N; Fatakia, S N; Feligioni, L; Ferapontov, A V; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Fleck, I; Ford, M; Fortner, M; Fox, H; Fu, S; Fuess, S; Gadfort, T; Galea, C F; Gallas, E; Galyaev, E; García, C; García-Bellido, A; Gardner, J; Gavrilov, V; Gay, A; Gay, P; Gelé, D; Gelhaus, R; Gerber, C E; Gershtein, Yu; Gillberg, D; Ginther, G; Gollub, N; Gómez, B; Gounder, K; Goussiou, A; Grannis, P D; Greenlee, H; Greenwood, Z D; Gregores, E M; Grenier, G; Gris, P; Grivaz, J F; Grünendahl, S; Grünewald, M W; Guo, F; Guo, J; Gutíerrez, G; Gutíerrez, P; Haas, A; Hadley, N J; Haefner, P; Hagopian, S; Haley, J; Hall, I; Hall, R E; Han, L; Hanagaki, K; Harder, K; Harel, A; Harrington, R; Hauptman, J M; Hauser, R; Hays, J; Hebbeker, T; Hedin, D; Hegeman, J G; Heinmiller, J M; Heinson, A P; Heintz, U; Hensel, C; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hoeth, H; Hohlfeld, M; Hong, S J; Hooper, R; Houben, P; Hu, Y; Hubacek, Z; Hynek, V; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jakobs, K; Jarvis, C; Jenkins, A; Jesik, R; Johns, K; Johnson, C; Johnson, M; Jonckheere, A; Jonsson, P; Juste, A; Käfer, D; Kahn, S; Kajfasz, E; Kalinin, A M; Kalk, J M; Kalk, J R; Kappler, S; Karmanov, D; Kasper, J; Kasper, P; Katsanos, I; Kau, D; Kaur, R; Kehoe, R; Kermiche, S; Kesisoglou, S; Khalatyan, N; Khanov, A; Kharchilava, A I; Kharzheev, Yu M; Khatidze, D; Kim, H; Kim, T J; Kirby, M H; Klima, B; Kohli, J M; Konrath, J P; Kopal, M; Korablev, V M; Kotcher, J; Kothari, B; Koubarovsky, A; Kozelov, A V; Kozminski, J; Kryemadhi, A; Krzywdzinski, S; Kühl, T; Kumar, A; Kunori, S; Kupco, A; Kurca, T; Kvita, J; Lager, S; Lammers, S; Landsberg, G L; Lazoflores, J; Le Bihan, A C; Lebrun, P; Lee, W M; Leflat, A; Lehner, F; Lesne, V; Lévêque, J; Lewis, P; Li, J; Li, Q Z; Lima, J G R; Lincoln, D; Linnemann, J; Lipaev, V V; Lipton, R; Liu, Z; Lobo, L; Lobodenko, A; Lokajícek, M; Lounis, A; Love, P; Lubatti, H J; Lynker, M; Lyon, A L; Maciel, A K A; Madaras, R J; Mättig, P; Magass, C; Magerkurth, A; Magnan, A M; Makovec, N; Mal, P K; Malbouisson, H B; Malik, S; Malyshev, V L; Mao, H S; Maravin, Y; Martens, M; Mattingly, S E K; McCarthy, R; McCroskey, R; Meder, D; Melnitchouk, A; Mendes, A; Mendoza, L; Merkin, M; Merritt, K W; Meyer, A; Meyer, J; Michaut, M; Miettinen, H; Millet, T; Mitrevski, J; Molina, J; Mondal, N K; Monk, J; Moore, R W; Moulik, T; Muanza, G S; Mulders, M; Mulhearn, M; Mundim, L; Mutaf, Y D; Nagy, E; Naimuddin, M; Narain, M; Naumann, N A; Neal, H A; Negret, J P; Nelson, S; Neustroev, P; Nöding, C; Nomerotski, A; Novaes, S F; Nunnemann, T; O'Dell, V; O'Neil, D C; Obrant, G; Oguri, V; Oliveira, N; Oshima, N; Otec, R; Oteroy-Garzon, G J; Owen, M; Padley, P; Parashar, N; Park, S J; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Pawloski, G; Perea, P M; Pérez, E; Peters, K; Petroff, P; Petteni, M; Piegaia, R; Pleier, M A; Podesta-Lerma, P L M; Podstavkov, V M; Pogorelov, Y; Pol, M E; Pompos, A; Pope, B G; Popov, A V; Prado da Silva, W L; Prosper, H B; Protopopescu, S D; Qian, J; Quadt, A; Quinn, B; Rani, K J; Ranjan, K; Rapidis, P A; Ratoff, P N; Renkel, P; Reucroft, S; Rijssenbeek, M; Ripp-Baudot, I; Rizatdinova, F K; Robinson, S; Rodrigues, R F; Royon, C; Rubinov, P; Ruchti, R; Rud, V I; Sajot, G; Sánchez-Hernández, A; Sanders, M P; Santoro, A F S; Savage, G; Sawyer, L; Scanlon, T; Schaile, A D; Schamberger, R D; Scheglov, Y; Schellman, H; Schieferdecker, P; Schmitt, C; Schwanenberger, C; Schwartzman, A; Schwienhorst, R; Sen-Gupta, S; Severini, H; Shabalina, E; Shamim, M; Shary, V; Shchukin, A A; Shephard, W D; Shivpuri, R K; Shpakov, D; Siccardi, V; Sidwell, R A; Simák, V; Sirotenko, V I; Skubic, P L; Slattery, P F; Smith, R P; Snow, G R; Snow, J; Snyder, S; Söldner-Rembold, S; Song, X; Sonnenschein, L; Sopczak, A; Sosebee, M; Soustruznik, K; Souza, M; Spurlock, B; Stark, J; Steele, J; Stevenson, K; Stolin, V; Stone, A; Stoyanova, D A; Strandberg, J; Strang, M A; Strauss, M; Ströhmer, R; Strom, D; Strovink, M; Stutte, L; Sumowidagdo, S; Sznajder, A; Talby, M; Tamburello, P; Taylor, W; Telford, P; Temple, J; Tiller, B; Titov, M; Tokmenin, V V; Tomoto, M; Toole, T; Torchiani, I; Towers, S; Trefzger, T; Trincaz-Duvoid, S; Tsybychev, D; Tuchming, B; Tully, C; Turcot, A S; Tuts, P M; Unalan, R; Uvarov, L; Uvarov, S; Uzunyan, S; Vachon, B; vanden Berg, P J; Van Kooten, R; Van Leeuwen, W M; Varelas, N; Varnes, E W; Vartapetian, A H; Vasilyev, I A; Vaupel, M; Verdier, P; Vertogradov, L S; Verzocchi, M; Villeneuve-Séguier, F; Vint, P; Vlimant, J R; Von Törne, E; Voutilainen, M; Vreeswijk, M; Wahl, H D; Wang, L; Warchol, J; Watts, G; Wayne, M; Weber, M; Weerts, H; Wermes, N; Wetstein, M; White, A; Wicke, D; Wilson, G W; Wimpenny, S J; Wobisch, M; Womersley, J; Wood, D R; Wyatt, T R; Xie, Y; Xuan, N; Yacoob, S; Yamada, R; Yan, M; Yasuda, T; Yatsunenko, Y A; Yip, K; Yoo, H D; Youn, S W; Yu, C; Yu, J; Yurkewicz, A; Zatserklyaniy, A; Zeitnitz, C; Zhang, D; Zhao, T; Zhao, Z; Zhou, B; Zhu, J; Zielinski, M; Zieminska, D; Zieminski, A; Zutshi, V

    2006-01-01

    We present the results of the first search for a new particle X produced in $p\\bar{p}$ collisions at \\sqrt{s}=1.96 TeV and subsequently decaying to Z\\gamma. The search uses 0.3 fb$^{-1}$ of data collected with the D{\\O}detector at the Fermilab Tevatron Collider. We set limits on the production cross section times the branching fraction $\\sigma(p \\bar{p} \\to X) \\times B(X\\to Z\\gamma)$ that range from 0.4 -- 3.5 pb at the 95% C.L. for $X$ with invariant masses between 100 and 1000 GeV/$c^2$ over a wide range of $X$ decay widths.

  10. Search for Neutral, Long-lived Particles Decaying into Two Muons in p-pbar Collisions at $\\sqrt{s}$ = 1.96 TeV

    CERN Document Server

    Abazov, V M; Abolins, M; Acharya, B S; Adams, M; Adams, T; Agelou, M; Agram, J L; Ahn, S H; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Andeen, T; Anderson, S; Andrieu, B; Anzelc, M S; Arnoud, Y; Arov, M; Askew, A; Åsman, B; Assis-Jesus, A C S; Atramentov, O; Autermann, C; Avila, C; Ay, C; Badaud, F; Baden, A; Bagby, L; Baldin, B; Bandurin, D V; Banerjee, P; Banerjee, S; Barberis, E; Bargassa, P; Baringer, P; Barnes, C; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Bean, A; Begalli, M; Begel, M; Belanger-Champagne, C; Bellantoni, L; Bellavance, A; Benítez, J A; Beri, S B; Bernardi, G; Bernhard, R; Berntzon, L; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Binder, M; Biscarat, C; Black, K M; Blackler, I; Blazey, G; Blekman, F; Blessing, S; Bloch, D; Bloom, K; Blumenschein, U; Böhnlein, A; Boeriu, O; Bolton, T A; Borissov, G; Bos, K; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Brown, D; Buchanan, N J; Buchholz, D; Bühler, M; Büscher, V; Burdin, S; Burke, S; Burnett, T H; Busato, E; Buszello, C P; Butler, J M; Calfayan, P; Calvet, S; Cammin, J; Caron, S; Carvalho, W; Casey, B C K; Cason, N M; Castilla-Valdez, H; Chakrabarti, S; Chakraborty, D; Chan, K M; Chandra, A; Chapin, D; Charles, F; Cheu, E; Chevallier, F; Cho, D K; Choi, S; Choudhary, B; Christofek, L; Claes, D; Clement, B; Clément, C; Coadou, Y; Cooke, M; Cooper, W E; Coppage, D; Corcoran, M; Cousinou, M C; Cox, B; Crepe-Renaudin, S; Cutts, D; Cwiok, M; Da Motta, H; Das, A; Das, M; Davies, B; Davies, G; Davis, G A; De, K; de Jong, P; De Jong, S J; De La Cruz-Burelo, E; De Oliveira Martins, C; Degenhardt, J D; Déliot, F; Demarteau, M; Demina, R; Demine, P; Denisov, D; Denisov, S P; Desai, S; Diehl, H T; Diesburg, M; Doidge, M; Dominguez, A; Dong, H; Dudko, L V; Duflot, L; Dugad, S R; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Edwards, T; Ellison, J; Elmsheuser, J; Elvira, V D; Eno, S; Ermolov, P; Estrada, J; Evans, H; Evdokimov, A; Evdokimov, V N; Fatakia, S N; Feligioni, L; Ferapontov, A V; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Fleck, I; Ford, M; Fortner, M; Fox, H; Fu, S; Fuess, S; Gadfort, T; Galea, C F; Gallas, E; Galyaev, E; García, C; García-Bellido, A; Gardner, J; Gavrilov, V; Gay, A; Gay, P; Gelé, D; Gelhaus, R; Gerber, C E; Gershtein, Yu; Gillberg, D; Ginther, G; Gollub, N; Gómez, B; Goussiou, A; Grannis, P D; Greenlee, H; Greenwood, Z D; Gregores, E M; Grenier, G; Gris, P; Grivaz, J F; Grünendahl, S; Grünewald, M W; Guo, F; Guo, J; Gutíerrez, G; Gutíerrez, P; Haas, A; Hadley, N J; Haefner, P; Hagopian, S; Haley, J; Hall, I; Hall, R E; Han, L; Hanagaki, K; Harder, K; Harel, A; Harrington, R; Hauptman, J M; Hauser, R; Hays, J; Hebbeker, T; Hedin, D; Hegeman, J G; Heinmiller, J M; Heinson, A P; Heintz, U; Hensel, C; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hoeth, H; Hohlfeld, M; Hong, S J; Hooper, R; Houben, P; Hu, Y; Hubacek, Z; Hynek, V; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jakobs, K; Jarvis, C; Jenkins, A; Jesik, R; Johns, K; Johnson, C; Johnson, M; Jonckheere, A; Jonsson, P; Juste, A; Käfer, D; Kahn, S; Kajfasz, E; Kalinin, A M; Kalk, J M; Kalk, J R; Kappler, S; Karmanov, D; Kasper, J; Kasper, P; Katsanos, I; Kau, D; Kaur, R; Kehoe, R; Kermiche, S; Kesisoglou, S; Khalatyan, N; Khanov, A; Kharchilava, A I; Kharzheev, Yu M; Khatidze, D; Kim, H; Kim, T J; Kirby, M H; Klima, B; Kohli, J M; Konrath, J P; Kopal, M; Korablev, V M; Kotcher, J; Kothari, B; Koubarovsky, A; Kozelov, A V; Kozminski, J; Krop, D; Kryemadhi, A; Kühl, T; Kumar, A; Kunori, S; Kupco, A; Kurca, T; Kvita, J; Lager, S; Lammers, S; Landsberg, G L; Lazoflores, J; Le Bihan, A C; Lebrun, P; Lee, W M; Leflat, A; Lehner, F; Lesne, V; Lévêque, J; Lewis, P; Li, J; Li, Q Z; Lima, J G R; Lincoln, D; Linnemann, J; Lipaev, V V; Lipton, R; Liu, Z; Lobo, L; Lobodenko, A; Lokajícek, M; Lounis, A; Love, P; Lubatti, H J; Lynker, M; Lyon, A L; Maciel, A K A; Madaras, R J; Mättig, P; Magass, C; Magerkurth, A; Magnan, A M; Makovec, N; Mal, P K; Malbouisson, H B; Malik, S; Malyshev, V L; Mao, H S; Maravin, Y; Martens, M; Mattingly, S E K; McCarthy, R; Meder, D; Melnitchouk, A; Mendes, A; Mendoza, L; Merkin, M; Merritt, K W; Meyer, A; Meyer, J; Michaut, M; Miettinen, H; Millet, T; Mitrevski, J; Molina, J; Mondal, N K; Monk, J; Moore, R W; Moulik, T; Muanza, G S; Mulders, M; Mulhearn, M; Mundim, L; Mutaf, Y D; Nagy, E; Naimuddin, M; Narain, M; Naumann, N A; Neal, H A; Negret, J P; Nelson, S; Neustroev, P; Nöding, C; Nomerotski, A; Novaes, S F; Nunnemann, T; O'Dell, V; O'Neil, D C; Obrant, G; Oguri, V; Oliveira, N; Oshima, N; Otec, R; Oteroy-Garzon, G J; Owen, M; Padley, P; Parashar, N; Park, S J; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Pawloski, G; Perea, P M; Pérez, E; Peters, K; Petroff, P; Petteni, M; Piegaia, R; Pleier, M A; Podesta-Lerma, P L M; Podstavkov, V M; Pogorelov, Y; Pol, M E; Pompos, A; Pope, B G; Popov, A V; Prado da Silva, W L; Prosper, H B; Protopopescu, S D; Qian, J; Quadt, A; Quinn, B; Rani, K J; Ranjan, K; Ratoff, P N; Renkel, P; Reucroft, S; Rijssenbeek, M; Ripp-Baudot, I; Rizatdinova, F K; Robinson, S; Rodrigues, R F; Royon, C; Rubinov, P; Ruchti, R; Rud, V I; Sajot, G; Sánchez-Hernández, A; Sanders, M P; Santoro, A F S; Savage, G; Sawyer, L; Scanlon, T; Schaile, A D; Schamberger, R D; Scheglov, Y; Schellman, H; Schieferdecker, P; Schmitt, C; Schwanenberger, C; Schwartzman, A; Schwienhorst, R; Sen-Gupta, S; Severini, H; Shabalina, E; Shamim, M; Shary, V; Shchukin, A A; Shephard, W D; Shivpuri, R K; Shpakov, D; Siccardi, V; Sidwell, R A; Simák, V; Sirotenko, V I; Skubic, P L; Slattery, P F; Smith, R P; Snow, G R; Snow, J; Snyder, S; Söldner-Rembold, S; Song, X; Sonnenschein, L; Sopczak, A; Sosebee, M; Soustruznik, K; Souza, M; Spurlock, B; Stark, J; Steele, J; Stolin, V; Stone, A; Stoyanova, D A; Strandberg, J; Strang, M A; Strauss, M; Ströhmer, R; Strom, D; Strovink, M; Stutte, L; Sumowidagdo, S; Sznajder, A; Talby, M; Tamburello, P; Taylor, W; Telford, P; Temple, J; Tiller, B; Titov, M; Tokmenin, V V; Tomoto, M; Toole, T; Torchiani, I; Towers, S; Trefzger, T; Trincaz-Duvoid, S; Tsybychev, D; Tuchming, B; Tully, C; Turcot, A S; Tuts, P M; Unalan, R; Uvarov, L; Uvarov, S; Uzunyan, S; Vachon, B; Vanden Berg, P J; Van Kooten, R; Van Leeuwen, W M; Varelas, N; Varnes, E W; Vartapetian, A H; Vasilyev, I A; Vaupel, M; Verdier, P; Vertogradov, L S; Verzocchi, M; Villeneuve-Séguier, F; Vint, P; Vlimant, J R; Von Törne, E; Voutilainen, M; Vreeswijk, M; Wahl, H D; Wang, L; Warchol, J; Watts, G; Wayne, M; Weber, M; Weerts, H; Wermes, N; Wetstein, M; White, A; Wicke, D; Wilson, G W; Wimpenny, S J; Wobisch, M; Womersley, J; Wood, D R; Wyatt, T R; Xie, Y; Xuan, N; Yacoob, S; Yamada, R; Yan, M; Yasuda, T; Yatsunenko, Y A; Yip, K; Yoo, H D; Youn, S W; Yu, C; Yu, J; Yurkewicz, A; Zatserklyaniy, A; Zeitnitz, C; Zhang, D; Zhao, T; Zhou, B; Zhu, J; Zielinski, M; Zieminska, D; Zieminski, A; Zutshi, V; Zverev, E G

    2006-01-01

    We present a search for a neutral particle, pair-produced in p-pbar collisions at $\\sqrt{s}$=1.96 TeV, which decays into two muons and lives long enough to travel at least 5 cm before decaying. The analysis uses ~380 pb^-1 of data recorded with the D0 detector. The background is estimated to be about one event. No candidates are observed, and limits are set on the pair production cross section times branching fraction into dimuons + X for such particles. For a mass of 10 GeV and lifetime of 4x10^-11 s, we exclude values greater than 0.14 pb (95% C.L.). These results are used to limit the interpretation of NuTeV's excess of di-muon events.

  11. Search for associated production of z and Higgs bosons in proton-antiproton collisions at 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    BackusMayes, John Alexander [Univ. of Washington, Seattle, WA (United States)

    2010-01-01

    We present a search for associated production of Z and Higgs bosons in 4.2 fb-1 of $\\bar{p}$p collisions at √s = 1.96 TeV, produced in RunII of the Tevatron and recorded by the D0 detector. The search is performed in events containing at least two muons and at least two jets. The ZH signal is distinguished from the expected backgrounds by means of multivariate classifiers known as random forests. Binned random forest output distributions are used in comparing the data to background-only and signal+background hypotheses. No excess is observed in the data, so we set upper limits on ZH production with a 95% confidence level.

  12. Measurement of Z+ γ production and search for anomalous triple gauge couplings in proton-antiproton collisions at √S = 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Deng, Jianrong [Duke Univ., Durham, NC (United States)

    2008-01-01

    The author presents a measurement of p$\\bar{p}$ → Zγ + X → e+e-γ + X production using proton-antiproton collisions data collected at the Collider Detector at Fermilab at a center of mass energy of 1.96 TeV. Zγ production provides a direct test of the triple neutral gauge couplings. A measurement of Zγ production cross section and search for anomalous ZZγ and Zγγ couplings are presented. The data presented are from 1.1 fb-1 of p$\\bar{p}$ integrated luminosity collected at the CDF Detector. Electrons from Z decays are selected with Et > 20 Gev. Photons (Et > 7 GeV) are required to be well-separated from the electrons. There are 390 eeγ candidate events found with 1.1 fb-1 of data, compared to the SM prediction of 375.3 ± 25.2 events. The Standard Model prediction for the cross section for p$\\bar{p}$ → e+e-γ + X production at √s = 1.96 TeV is 4.5 ± 0.4 pb. The measured cross section is 4.7 ± 0.6 pb. The cross section and kinematic distributions of the eeγ events are in good agreement with theoretical predictions. Limits on the ZZγ and Zγγ couplings are extracted using the photon Et distribution of eeγ events with meeγ > 100 GeV/c2. These are the first limits measured using CDF Run II data. These limits provide important test of the interaction of the photon and the Z boson.

  13. The Associations of Single Nucleotide Polymorphisms in miR196a2, miR-499, and miR-608 With Breast Cancer Susceptibility

    Science.gov (United States)

    Dai, Zhi-Ming; Kang, Hua-Feng; Zhang, Wang-Gang; Li, Hong-Bao; Zhang, Shu-Qun; Ma, Xiao-Bin; Lin, Shuai; Wang, Meng; Feng, Yan-Jing; Liu, Kang; Liu, Xing-Han; Xu, Peng; Dai, Zhi-Jun

    2016-01-01

    Abstract MicroRNAs (miRNAs) play an important role as regulators of tumor suppressors and oncogenes in cancer-related processes. Single nucleotide polymorphisms (SNPs) in miRNAs have been shown to be relevant to various different cancers, including breast cancer (BC). The aim of this study was to estimate the associations between miRNA-related gene polymorphisms (miR-196a2, miR-499, and miR-608) and the risk of BC in a Chinese population. Gene polymorphisms were analyzed in 1143 subjects (controls = 583; BC = 560). The 3 SNPs were genotyped using the Sequenom Mass-ARRAY platform. The associations between the SNP frequencies and BC were assessed by computing odds ratios (ORs) and 95% confidence intervals (95% CIs), as well as by applying Chi-square tests. The miR-196a2 (rs11614913) T allele was associated with a decreased risk of BC based on results from dominant (OR = 0.67, 95% CI = 0.52–0.86), recessive (OR = 0.65, 95% CI = 0.48–0.86), and allele models (OR = 0.73, 95% CI = 0.62–0.86). In contrast, the miR-499 (rs3746444) AG/GG genotypes were associated with an increased risk of BC (OR = 1.45, 95% CI = 1.10–1.91), and miR-608 (rs4919510) was not significantly associated with BC risk. Our study suggested that the polymorphisms of rs11614913 and rs3746444 may be associated with BC risk in Chinese individuals. PMID:26886638

  14. Physical and underway data collected aboard the KNORR during cruise KN196-02 in the Davis Strait from 2009-10-06 to 2009-10-29 (NODC Accession 0104281)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC accession 0104281 includes physical and underway data collected aboard the KNORR during cruise KN196-02 in the Davis Strait from 2009-10-06 to 2009-10-29....

  15. $\\beta$-delayed fission, laser spectroscopy and shape-coexistence studies with radioactive At beams

    CERN Multimedia

    We propose to study the $\\beta$-delayed fission, laser spectroscopy and radioactive decay of the newly available pure beams of neutron-deficient and neutron-rich astatine (Z=85) isotopes. The fission probability and the fission fragment distribution of the even-even isotopes $^{194,196}$Po following the $\\beta$-decay of the isotopes $^{194,196}$At will be studied with the Windmill setup. In-source laser spectroscopy will be performed on the entire astatine isotopic chain, using a combination of the Windmill setup, ISOLTRAP MR-ToF and ISOLDE Faraday. Radioactive decay data will be acquired at the Windmill setup throughout those studies and contribute to the global understanding of the phenomenon of shape coexistence in the neutron-deficient lead region.

  16. Search for Excited and Exotic Muons in the mu+gamma Decay Channel in p-pbar Collisions at sqrt{s} = 1.96 TeV

    CERN Document Server

    Abulencia, A; Adelman, J; Affolder, T; Akimoto, T; Albrow, M G; Ambrose, D; Amerio, S; Amidei, D; Anastassov, A; Anikeev, K; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Arguin, J F; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Azfar, F; Azzi-Bacchetta, P; Azzurri, P; Bacchetta, N; Bachacou, H; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Baroiant, S; Bartsch, V; Bauer, G; Bedeschi, F; Behari, S; Belforte, S; Bellettini, G; Bellinger, J; Belloni, A; Ben Haim, E; Benjamin, D; Beretvas, A; Beringer, J; Berry, T; Bhatti, A; Binkley, M; Bisello, D; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bölla, G; Bolshov, A; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Bromberg, C; Brubaker, E; Budagov, Yu A; Budd, H S; Budd, S; Burkett, K; Busetto, G; Bussey, P; Byrum, K L; Cabrera, S; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carlsmith, D; Carosi, R; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chapman, J; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, I; Cho, K; Chokheli, D; Chou, J P; Chu, P H; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Ciljak, M; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Coca, M; Compostella, G; Convery, M E; Conway, J; Cooper, B; Copic, K; Cordelli, M; Cortiana, G; Crescioli, F; Cruz, A; Cuenca-Almenar, C; Cuevas-Maestro, J; Culbertson, R; Cyr, D; Da Ronco, S; D'Auria, S; D'Onofrio, M; Dagenhart, D; De Barbaro, P; De Cecco, S; Deisher, A; De Lentdecker, G; Dell'Orso, Mauro; Delli Paoli, F; Demers, S; Demortier, L; Deng, J; Deninno, M; De Pedis, D; Derwent, P F; Di Giovanni, G P; Di Ruzza, B; Dionisi, C; Dittmann, J R; Di Turo, P; Dorr, C; Donati, S; Donega, M; Dong, P; Donini, J; Dorigo, T; Dube, S; Ebina, K; Efron, J; Ehlers, J; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, I; Fedorko, W T; Feild, R G; Feindt, M; Fernández, J P; Field, R; Flanagan, G; Flores-Castillo, L R; Foland, A; Forrester, S; Foster, G W; Franklin, M; Freeman, J C; Frisch, H J; Furic, I; Gallinaro, M; Galyardt, J; García, J E; García-Sciveres, M; Garfinkel, A F; Gay, C; Gerberich, H; Gerdes, D; Giagu, S; Giannetti, P; Gibson, A; Gibson, K; Ginsburg, C; Giokaris, N; Giolo, K; Giordani, M; Giromini, P; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Goldstein, J; Gómez, G; Gómez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Gotra, Yu; Goulianos, K; Gresele, A; Griffiths, M; Grinstein, S; Grosso-Pilcher, C; Grundler, U; Guimarães da Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, S R; Hahn, K; Halkiadakis, E; Hamilton, A; Han, B Y; Han, J Y; Handler, R; Happacher, F; Hara, K; Hare, M; Harper, S; Harr, R F; Harris, R M; Hatakeyama, K; Hauser, J; Hays, C; Heijboer, A; Heinemann, B; Heinrich, J; Herndon, M; Hidas, D; Hill, C S; Hirschbuehl, D; Höcker, A; Holloway, A; Hou, S; Houlden, M; Hsu, S C; Huffman, B T; Hughes, R E; Huston, J; Incandela, J R; Introzzi, G; Iori, M; Ishizawa, Y; Ivanov, A; Iyutin, B; James, E; Jang, D; Jayatilaka, B; Jeans, D; Jensen, H; Jeon, E J; Jindariani, S; Jones, M; Joo, K K; Jun, S Y; Junk, T R; Kamon, T; Kang, J; Karchin, P E; Kato, Y; Kemp, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kirsch, L; Klimenko, S; Klute, M; Knuteson, B; Ko, B R; Kobayashi, H; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kovalev, A; Kraan, A C; Kraus, J; Kravchenko, I; Kreps, M; Kroll, J; Krumnack, N; Kruse, M; Krutelyov, V; Kuhlmann, S E; Kusakabe, Y; Kwang, S; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; LeCompte, T; Lee, J; Lee, Y J; Lee, S W; Lefèvre, R; Leonardo, N; Leone, S; Levy, S; Lewis, J D; Lin, C; Lin, C S; Lindgren, M; Lipeles, E; Liss, T M; Lister, A; Litvintsev, D O; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Loverre, P F; Lu, R S; Lucchesi, D; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Lytken, E; Mack, P; MacQueen, D; Madrak, R; Maeshima, K; Mäki, T; Maksimovic, P; Malde, S; Manca, G; Margaroli, F; Marginean, R; Marino, C; Martin, A; Martin, V; Martínez, M; Maruyama, T; Mastrandrea, P; Matsunaga, H; Mattson, M E; Mazini, R; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Menzemer, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Von der Mey, M; Miao, T; Miladinovic, N; Miles, J; Miller, R; Miller, J S; Mills, C; Milnik, M; Miquel, R; Mitra, A; Mitselmakher, G; Miyamoto, A; Moggi, N; Mohr, B; Moore, R; Morello, M; Movilla-Fernández, P A; Mülmenstädt, J; Mukherjee, A; Müller, T; Mumford, R; Murat, P; Nachtman, J; Naganoma, J; Nahn, S; Nakano, I; Napier, A; Naumov, D; Necula, V; Neu, C; Neubauer, M S; Nielsen, J; Nigmanov, T; Nodulman, L; Norniella, O

    2006-01-01

    We present a search for excited and exotic muon states mu*, conducted using an integrated luminosity of 371 pb^{-1} of data collected in p-pbar collisions at sqrt{s} = 1.96 TeV at the Tevatron with the CDF II detector. We search for associated production of mu+mu* followed by the decay mu* -> mu+gamma, resulting in the mu+mu+gamma final state. We compare the data to model predictions as a function of the mass of the excited muon M(mu*), the compositeness energy scale Lambda, and the gauge coupling factor f. No signal above the standard model expectation is observed in the mu+gamma mass spectrum. In the contact interaction model, we exclude 107 < M(mu*) < 853 GeV/c^2 for Lambda = M(mu*); in the gauge-mediated model, we exclude 100 < M(mu) < 410 GeV/c^2 for f/Lambda = 0.01/GeV. These 95% confidence level exclusions extend previous limits and are the first hadron collider results on mu* production in the gauge-mediated model.

  17. Search for Exotic S=-2 Baryons in proton-antiproton Collisions at $\\sqrt{s}$ = 1.96 TeV

    CERN Document Server

    Abulencia, A; Affolder, T; Akimoto, T; Albrow, M G; Ambrose, D; Amerio, S; Amidei, D; Anastassov, A; Anikeev, K; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Arguin, J F; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Azfar, F; Azzi-Bacchetta, P; Azzurri, P; Bacchetta, N; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Baroiant, S; Bartsch, V; Bauer, G; Bedeschi, F; Behari, S; Belforte, S; Bellettini, G; Bellinger, J; Belloni, A; Benjamin, D; Beretvas, A; Beringer, J; Berry, T; Bhatti, A; Binkley, M; Bisello, D; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bolshov, A; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, Yu A; Budd, H S; Budd, S; Budroni, S; Burkett, K; Busetto, G; Bussey, P; Byrum, K L; Bölla, G; Cabrera, S; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carillo, S; Carlsmith, D; Carosi, R; Carron, S; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, I; Cho, K; Chokheli, D; Chou, J P; Choudalakis, G; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Ciljak, M; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Coca, M; Compostella, G; Convery, M E; Conway, J; Cooper, B; Copic, K; Cordelli, M; Cortiana, G; Crescioli, F; Cuenca-Almenar, C; Cuevas-Maestro, J; Culbertson, R; Cully, J C; Cyr, D; D'Auria, S; D'Onofrio, M; Da Ronco, S; Dagenhart, D; Datta, M; Davies, T; De Barbaro, P; De Cecco, S; De Lentdecker, G; De Pedis, D; Deisher, A; Dell'Orso, Mauro; Delli Paoli, F; Demortier, L; Deng, J; Deninno, M; Derwent, P F; Di Giovanni, G P; Di Ruzza, B; Di Turo, P; Dionisi, C; Dittmann, J R; Donati, S; Donega, M; Dong, P; Donini, J; Dorigo, T; Dorr, C; Dube, S; Efron, J; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, I; Fedorko, W T; Feild, R G; Feindt, M; Fernández, J P; Field, R; Flanagan, G; Foland, A; Forrester, S; Foster, G W; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; Garberson, F; García, J E; Garfinkel, A F; Gay, C; Gerberich, H; Gerchtein, E; Gerdes, D; Giagu, S; Giannetti, P; Gibson, A; Gibson, K; Gimmell, J L; Ginsburg, C; Giokaris, N; Giordani, M; Giromini, P; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Goldstein, J; Golossanov, A; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Griffiths, M; Grinstein, S; Grosso-Pilcher, C; Group, R C; Grundler, U; Guimarães da Costa, J; Gunay-Unalan, Z; Gómez, G; Gómez-Ceballos, G; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Hamilton, A; Han, B Y; Han, J Y; Handler, R; Happacher, F; Hara, K; Hare, M; Harper, S; Harr, R F; Harris, R M; Hartz, M; Hatakeyama, K; Hauser, J; Heijboer, A; Heinemann, B; Heinrich, J; Henderson, C; Herndon, M; Heuser, J; Hidas, D; Hill, C S; Hirschbuehl, D; Holloway, A; Hou, S; Houlden, M; Hsu, S C; Huffman, B T; Hughes, R E; Husemann, U; Huston, J; Höcker, A; Incandela, J R; Introzzi, G; Iori, M; Ishizawa, Y; Ivanov, A; Iyutin, B; James, E; Jang, D; Jayatilaka, B; Jeans, D; Jensen, H; Jeon, E J; Jindariani, S; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Karchin, P E; Kato, Y; Kemp, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Klute, M; Knuteson, B; Ko, B R; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kovalev, A; Kraan, A C; Kraus, J; Kravchenko, I; Kreps, M; Kroll, J; Krumnack, N; Kruse, M; Krutelyov, V; Kubo, T; Kuhlmann, S E; Kuhr, T; Kusakabe, Y; Kwang, S; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; LeCompte, T; Lee, J; Lee, S W; Lee, Y J; Lefèvre, R; Leonardo, N; Leone, S; Levy, S; Lewis, J D; Lin, C; Lin, C S; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Loverre, P F; Lu, R S; Lucchesi, D; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Lytken, E; MacQueen, D; Mack, P; Madrak, R; Maeshima, K; Makhoul, K; Maksimovic, P; Malde, S; Manca, G; Margaroli, F; Marginean, R; Marino, C; Marino, C P; Martin, A; Martin, M; Martin, V; Martínez, M; Maruyama, T; Mastrandrea, P; Masubuchi, T; Matsunaga, H; Mattson, M E; Mazini, R; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtälä, P; Menzemer, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Miao, T; Miladinovic, N; Miles, J; Miller, R; Mills, C; Milnik, M; Mitra, A; Mitselmakher, G; Miyamoto, A; Moed, S; Moggi, N; Mohr, B; Moore, R; Morello, M; Movilla-Fernández, P A; Mukherjee, A; Mumford, R; Murat, P; Mäki, T; Müller, T; Mülmenstädt, J; Nachtman, J; Nagano, A; Naganoma, J; Nakano, I; Napier, A; Necula, V; Neu, C; Neubauer, M S; Nielsen, J

    2007-01-01

    A search for a manifestly exotic S=-2 baryon state decaying to Xi- pi-, and its neutral partner decaying to Xi- pi+, has been performed using 220 pb^(-1) of pp= collisions at $\\sqrt{s}$=1.96 TeV collected by the Collider Detector at Fermilab. The Xi trajectories were measured in a silicon tracker before their decay, resulting in a sample with low background and excellent position resolution. No evidence was found for S=-2 pentaquark candidates in the invariant mass range of 1600--2100 MeV/c^2 Upper limits on the product of pentaquark production cross section times its branching fraction to Xi- pi^{+,-}, relative to the cross section of the well established Xi(1530) resonance, are presented for neutral and doubly negative candidates with pT>2 GeV/c and |y|<1 as a function of pentaquark mass. At 1862 MeV/c^2, these upper limits for neutral and doubly negative final states were found to be 3.2% and 1.7% at the 90% confidence level, respectively.

  18. Measurement of Ratios of Fragmentation Fractions for Bottom Hadrons in p-pbar Collisions at sqrt{s}=1.96 TeV

    CERN Document Server

    Aaltonen, T; Akimoto, T; Albrow, M G; Alvarez-Gonzalez, B; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Apresyan, A; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Aurisano, A; Azfar, F; Azzi-Bacchetta, P; Azzurri, P; Bacchetta, N; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Baroiant, S; Bartsch, V; Bauer, G; Beauchemin, P H; Bedeschi, F; Bednar, P; Behari, S; Bellettini, G; Bellinger, J; Belloni, A; Benjamin, D; Beretvas, A; Beringer, J; Berry, T; Bhatti, A; Binkley, M; Bisello, D; Bizjak, I; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bölla, G; Bolshov, A; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Bridgeman, A; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, Yu A; Budd, H S; Budd, S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Byrum, K L; Cabrerar, S; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carlsmith, D; Carosi, R; Carrillol, S; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavalli-Sforza, M; Cerri, A; Cerritop, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, K; Chokheli, D; Chou, J P; Choudalakis, G; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Compostella, G; Convery, M E; Conway, J; Cooper, B; Copic, K; Cordelli, M; Cortiana, G; Crescioli, F; Cuenca Almenarr, C; Cuevaso, J; Culbertson, R; Cully, J C; Dagenhart, D; Datta, M; Davies, T; De Barbaro, P; De Cecco, S; Deisher, A; De Lentdeckerd, G; De Lorenzo, G; Dell'Orso, Mauro; Demortier, L; Deng, J; Deninno, M; De Pedis, D; Derwent, P F; Di Giovanni, G P; Dionisi, C; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Donati, S; Dong, P; Donini, J; Dorigo, T; Dube, S; Efron, J; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, W T; Feild, R G; Feindt, M; Fernández, J P; Ferrazza, C; Field, R; Flanagan, G; Forrest, R; Forrester, S; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; Garberson, F; García, J E; Garfinkel, A F; Genser, K; Gerberich, H; Gerdes, D; Giagu, S; Giakoumopoloua, V; Giannetti, P; Gibson, K; Gimmell, J L; Ginsburg, C M; Giokarisa, N; Giordani, M; Giromini, P; Giunta, M; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Golossanov, A; Gómez, G; Gómez-Ceballos, G; Goncharov, M; Gonzlez, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Grinstein, aS; Grosso-Pilcher, C; Group, R C; Grundler, U; Guimaraesda Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Hamilton, A; Han, B Y; Han, J Y; Handler, R; Happacher, F; Hara, K; Hare, D; Hare, M; Harper, S; Harr, R F; Harris, R M; Hartz, M; Hatakeyama, K; Hauser, J; Hays, C; Heck, M; Heijboer, A; Heinemann, B; Heinrich, J; Henderson, C; Herndon, M; Heuser, J; Hewamanage, S; Hidas, D; Hillc, C S; Hirschbuehl, D; Höcker, A; Hou, S; Houlden, M; Hsu, S C; Huffman, B T; Hughes, R E; Husemann, U; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ivanov, A; Iyutin, B; James, E; Jayatilaka, B; Jeans, D; Jeon, E J; Jindariani, S; Johnson, W; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Kar, D; Karchin, P E; Kato, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Klute, M; Knuteson, B; Ko, B R; Koay, S A; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kraus, J; Kreps, M; Kroll, J; Krumnack, N; Kruse, M; Krutelyov, V; Kubo, T; Kuhlmann, S E; Kuhr, T; Kulkarni, N P; Kusakabe, Y; Kwang, S; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; Le Compte, T; Lee, J; Lee, J; Lee, Y J; Leeq, S W; Lefèvre, R; Leonardo, N; Leone, S; Levy, S; Lewis, J D; Lin, C; Lin, C S; Linacre, J; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Lovas, L; Lu, R S; Lucchesi, D; Lueck, J; Luci, C; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Lytken, E; Mack, P; MacQueen, D; Madrak, R; Maeshima, K; Makhoul, K; Mäki, T; Maksimovic, P; Malde, S; Malik, S; Manca, G; Manousakisa, A; Margaroli, F; Marino, C; Marino, C P; Martin, A; Martin, M; Martinj, V; Martínez, M; Martinez-Ballarin, R; Maruyama, T; Mastrandrea, P; Masubuchi, T; Mattson, M E; Mazzanti, P; McFarland, K S; McIntyre, P; McNultyi, R; Mehta, A; Mehtälä, P; Menzemerk, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Miao, T; Miladinovic, N; Miles, J; Miller, R; Mills, C; Milnik, M; Mitra, A; Mitselmakher, G; Miyake, H; Moed, S; Moggi, N; Moon, C S; Moore, R; Morello, M; Movilla-Fernández, P A; Mulmenstdt, J; Mukherjee, A; Müller, T; Mumford, R; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Nagano, A; Naganoma, J; Nakamura, K; Nakano, I; Napier, A; Necula, V; Neu, C; Neubauer, M S; Nielsenf, J; Nodulman, L; Norman, M

    2008-01-01

    This paper describes the first measurement of b-quark fragmentation fractions into bottom hadrons in Run II of the Tevatron Collider at Fermilab. The result is based on a 360 pb-1 sample of data collected with the CDF II detector in p-pbar collisions at sqrt{s}=1.96 TeV. Semileptonic decays of B0, B+, and B_s mesons, as well as Lambda_b baryons, are reconstructed. For an effective bottom hadron p_T threshold of 7 GeV/c, the fragmentation fractions are measured to be f_u/f_d=1.054 +/- 0.018 (stat) +0.025-0.045(sys) +/- 0.058 (Br), f_s/(f_u+f_d)=0.160 +/- 0.005 (stat) +0.011-0.010 (sys) +0.057-0.034 (Br), and f_{Lambda_b}/(f_u+f_d)=0.281\\pm0.012 (stat) +0.058-0.056 (sys) +0.128-0.086 (Br), where the uncertainty (Br) is due to uncertainties on measured branching ratios. The value of f_s/(f_u+f_d) agrees within one standard deviation with previous CDF measurements and the world average of this quantity, which is dominated by LEP measurements. However, the ratio f_{Lambda_b}/(f_u+f_d) is approximately twice the va...

  19. Limits on the Production of Narrow t-tbar Resonances in p-pbar Collisions at $\\sqrt{s}$=1.96 TeV

    CERN Document Server

    Aaltonen, T; Akimoto, T; Albrow, M G; Alvarez-Gonzalez, B; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Apresyan, A; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Aurisano, A; Azfar, F; Azzi-Bacchetta, P; Azzurri, P; Bacchetta, N; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Baroiant, S; Bartsch, V; Bauer, G; Beauchemin, P H; Bedeschi, F; Bednar, P; Behari, S; Bellettini, G; Bellinger, J; Belloni, A; Benjamin, D; Beretvas, A; Beringer, J; Berry, T; Bhatti, A; Binkley, M; Bisello, D; Bizjak, I; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bölla, G; Bolshov, A; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Bridgeman, A; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, Yu A; Budd, H S; Budd, S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Byrum, K L; Cabrerar, S; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carlsmith, D; Carosi, R; Carrillol, S; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavalli-Sforza, M; Cerri, A; Cerritop, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, K; Chokheli, D; Chou, J P; Choudalakis, G; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Compostella, G; Convery, M E; Conway, J; Cooper, B; Copic, K; Cordelli, M; Cortiana, G; Crescioli, F; Cuenca Almenarr, C; Cuevaso, J; Culbertson, R; Cully, J C; Dagenhart, D; Datta, M; Davies, T; De Barbaro, P; De Cecco, S; Deisher, A; De Lentdeckerd, G; De Lorenzo, G; Dell'Orso, Mauro; Demortier, L; Deng, J; Deninno, M; De Pedis, D; Derwent, P F; Di Giovanni, G P; Dionisi, C; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Donati, S; Dong, P; Donini, J; Dorigo, T; Dube, S; Efron, J; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, W T; Feild, R G; Feindt, M; Fernández, J P; Ferrazza, C; Field, R; Flanagan, G; Forrest, R; Forrester, S; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; Garberson, F; García, J E; Garfinkel, A F; Gerberich, H; Gerdes, D; Giagu, S; Giakoumopoloua, V; Giannetti, P; Gibson, K; Gimmell, J L; Ginsburg, C M; Giokarisa, N; Giordani, M; Giromini, P; Giunta, M; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Golossanov, A; Gómez, G; Gómez-Ceballos, G; Goncharov, M; Gonzlez, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Grinstein, S; Grosso-Pilcher, C; Group, R C; Grundler, U; Guimaraesda Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Hamilton, A; Han, B Y; Han, J Y; Handler, R; Happacher, F; Hara, K; Hare, D; Hare, M; Harper, S; Harr, R F; Harris, R M; Hartz, M; Hatakeyama, K; Hauser, J; Hays, C; Heck, M; Heijboer, A; Heinemann, B; Heinrich, J; Henderson, C; Herndon, M; Heuser, J; Hewamanage, S; Hidas, D; Hillc, C S; Hirschbuehl, D; Höcker, A; Hou, S; Houlden, M; Hsu, S C; Huffman, B T; Hughes, R E; Husemann, U; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ivanov, A; Iyutin, B; James, E; Jayatilaka, B; Jeans, D; Jeon, E J; Jindariani, S; Johnson, W; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kagan, M; Kamon, T; Kar, D; Karchin, P E; Kato, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Klute, M; Knuteson, B; Ko, B R; Koay, S A; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kraus, J; Kreps, M; Kroll, J; Krumnack, N; Kruse, M; Krutelyov, V; Kubo, T; Kuhlmann, S E; Kuhr, T; Kulkarni, N P; Kusakabe, Y; Kwang, S; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; Le Compte, T; Lee, J; Lee, J; Lee, Y J; Leeq, S W; Lefèvre, R; Leonardo, N; Leone, S; Levy, S; Lewis, J D; Lin, C; Lin, C S; Linacre, J; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Lovas, L; Lu, R S; Lucchesi, D; Lueck, J; Luci, C; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Lytken, E; Mack, P; MacQueen, D; Madrak, R; Maeshima, K; Makhoul, K; Mäki, T; Maksimovic, P; Malde, S; Malik, S; Manca, G; Manousakisa, A; Margaroli, F; Marino, C; Marino, C P; Martin, A; Martin, M; Martinj, V; Martínez, M; Martinez-Ballarin, R; Maruyama, T; Mastrandrea, P; Masubuchi, T; Mattson, M E; Mazzanti, P; McFarland, K S; McIntyre, P; McNultyi, R; Mehta, A; Mehtälä, P; Menzemerk, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Miao, T; Miladinovic, N; Miles, J; Miller, R; Mills, C; Milnik, M; Mitra, A; Mitselmakher, G; Miyake, H; Moed, S; Moggi, N; Moon, C S; Moore, R; Morello, M; Movilla-Fernández, P A; Mülmenstädt, J; Mukherjee, A; Müller, T; Mumford, R; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Nagano, A; Naganoma, J; Nakamura, K; Nakano, I; Napier, A; Necula, V; Neu, C; Neubauer, M S; Nielsenf, J; Nodulman, L; Norman, M

    2007-01-01

    We search for evidence of resonant top quark pair production in 955 pb-1 of p-pbar collisions at $\\sqrt{s}$=1.96 TeV recorded with the CDF II detector at the Fermilab Tevatron. For fully reconstructed candidate t-tbar events triggered on leptons with large transverse momentum and containing at least one identified b-quark jet, we compare the invariant mass spectrum of t-tbar pairs to the expected superposition of standard model t-tbar, non-t-tbar backgrounds, and a simple resonance model based on a sequential Z' boson. We establish upper limits for sigma(p-pbar to Z') times Br(Z' to t-tbar) in the Z' mass interval from 450 GeV/c2 to 900 GeV/c2. A topcolor leptophobic Z' is ruled out below 720 GeV/c2, and the cross section of any narrow Z'-like state decaying to t-tbar is found to be less than 0.64 pb at 95% C.L. for M(Z') above 700 GeV/c2.

  20. Search for a Higgs-like boson decaying to two photons in $p\\bar{p}$ collisions at $\\sqrt{s} = 1.96$ TeV

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Guo [Univ. of Kansas, Lawrence, KS (United States)

    2013-01-01

    We present a search for the Standard Model (SM) Higgs boson decaying to two photons using the 9.6 fb-1 of p$\\bar{p}$ collisions at √s = 1.96 TeV collected by the D0 detector at the Tevatron from July 2002 to September 2011. The data corresponds to the complete data-set in the RunII period of the Tevatron. This thesis employs a multivariate technique, boosted decision trees, to optimize the discrimination of signal from background. No significant excess of data above theoretical prediction is observed, so limits on the ratio of the production cross section times the branching ratio to the SM value are set at 95% confidence level as a function of hypothetical Higgs boson mass. The expected and observed limits on this ratio are 8.7 and 12.8 respectively at 125 GeV. We also interpret the data in the fermiophobic Higgs model. The result has reached a sensitivity of 114 GeV, and we set a lower limit on the fermiophobic Higgs mass of MHf > 113 GeV.

  1. Search for t-Channel Single Top Quark Production in p$\\bar{p}$ Collisions at 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Perea, Philip Michael [Univ. of California, Riverside, CA (United States)

    2006-06-01

    I have performed a search for t-channel single top quark production in p$\\bar{p}$ single number sub collisions at 1.96 TeV on a 366 pb-1 dataset collected with the D0 detector from 2002-2005. The analysis is restricted to the leptonic decay of the W boson from the top quark to an electron or muon, tq$\\bar{b}$ → lvlb q$\\bar{b}$ (l = e,μ). A powerful b-quark tagging algorithm derived from neural networks is used to identify b jets and significantly reduce background. I further use neural networks to discriminate signal from background, and apply a binned likelihood calculation to the neural network output distributions to derive the final limits. No direct observation of single top quark production has been made, and I report expected/measured 95% confidence level limits of 3.5/8.0 pb.

  2. First Measurement of ZZ Production in panti-p Collisions at s**(1/2) = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Aaltonen, T.; /Helsinki Inst. of Phys.; Adelman, J.; /Chicago U., EFI; Akimoto, T.; /Tsukuba U.; Albrow, M.G.; /Fermilab; Alvarez Gonzalez, B.; /Cantabria U., Santander; Amerio, S.; /Padua U.; Amidei, D.; /Michigan U.; Anastassov, A.; /Rutgers U., Piscataway; Annovi, A.; /Frascati; Antos, J.; /Comenius U.; Aoki, M.; /Illinois U., Urbana /Fermilab

    2008-01-01

    We report the first measurement of the cross section for Z boson pair production at a hadron collider. This result is based on a data sample corresponding to 1.9 fb{sup -1} of integrated luminosity from p{bar p} collisions at {radical}s = 1.96 TeV collected with the CDF II detector at the Fermilab Tevatron. In the {ell}{ell}{ell}{prime}{ell}{prime} channel, we observe three ZZ candidates with an expected background of 0.096{sub -0.063}{sup +0.092} events. In the {ell}{ell}{nu}{nu} channel, we use a leading-order calculation of the relative ZZ and WW event probabilities to discriminate between signal and background. In the combination of {ell}{ell}{ell}{prime}{ell}{prime} and {ell}{ell}{nu}{nu} channels, we observe an excess of events with a probability of 5.1 x 10{sup -6} to be due to the expected background. This corresponds to a significance of 4.4 standard deviations. The measured cross section is {sigma}(p{bar p} {yields}ZZ) = 1.4{sub -0.6}{sup +0.7} (stat.+syst.) pb, consistent with the standard model expectation.

  3. Measurement of b-jet Shapes in Inclusive Jet Production in p anti-p Collisions at s**(1/2) = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Aaltonen, T.

    2008-06-01

    We present a measurement of the shapes of b-jets using 300 pb{sup -1} of data obtained with the upgraded Collider Detector at Fermilab (CDF II) in p{bar p} collisions at center of mass energy {radical}s = 1.96 TeV. This measurement covers a wide transverse momentum range, from 52 to 300 GeV/c. Samples of heavy-flavor enhanced jets together with inclusive jets are used to extract the average shapes of b-jets. The b-jets are expected to be broader than inclusive jets. Moreover, b-jets containing a single b-quark are expected to be narrower than those containing a b{bar b} pair from gluon splitting. The measured b-jet shapes are found to be significantly broader than expected from the pythia and HERWIG Monte Carlo simulations. This effect may arise from an underestimation of the fraction of b-jets originating from gluon splitting in these simulations.

  4. Measurement of the cross section for W-boson production in association with jets in ppbar collisions at s**(1/2) = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Aaltonen, T.

    2007-11-01

    We present a measurement of the cross section for W-boson production in association with jets in p{bar p} collisions at {radical}s = 1.96 TeV. The analysis uses a data sample corresponding to an integrated luminosity of 320 pb{sup -1} collected with the CDF II detector. W bosons are identified in their electron decay channel and jets are reconstructed using a cone algorithm. For each W + {ge} n-jet sample (n = 1-4) we measure {sigma}(p{bar p} {yields} W + {ge} n-jet) x {Beta}(W {yields} e{nu}) with respect to the transverse energy E{sub T} of the nth-highest E{sub T} jet above 20 GeV, for a restricted W {yields} e{nu} decay phase space. The cross sections, corrected for all detector effects, can be directly compared to particle level W + jet(s) predictions. We present here comparisons to leading order and next-to-leading order predictions.

  5. Search for the Production of Scalar Bottom Quarks in $p \\bar {p} $ collisions at $\\sqrt{s} $ = 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Aaltonen, T.; /Helsinki Inst. of Phys.; Adelman, J.; /Chicago U., EFI; Alvarez Gonzalez, B.; /Cantabria Inst. of Phys.; Amerio, S.; /INFN, Padua; Amidei, D.; /Michigan U.; Anastassov, A.; /Northwestern U.; Annovi, A.; /Frascati; Antos, J.; /Comenius U.; Apollinari, G.; /Fermilab; Apresyan, A.; /Purdue U.; Arisawa, T.; /Waseda U. /Dubna, JINR

    2010-05-01

    We report on a search for direct scalar bottom quark (sbottom) pair production in p{bar p} collisions at {radical}s = 1.96 TeV, in events with large missing transverse energy and two jets of hadrons in the final state, where at least one of the jets is required to be identified as originating from a b quark. The study uses a CDF Run II data sample corresponding to 2.65 fb{sup -1} of integrated luminosity. The data are in agreement with the standard model. In an R-parity conserving minimal supersymmetric scenario, and assuming that the sbottom decays exclusively into a bottom quark and a neutralino, 95% confidence-level upper limits on the sbottom pair production cross section of 0.1 pb are obtained. For neutralino masses below 70 GeV/c{sup 2}, sbottom masses up to 230 GeV/c{sup 2} are excluded at 95% confidence level.

  6. Search for Pair Production of Supersymmetric Top Quarks in Dilepton Events from $p\\bar{p}$ Collisions at $\\sqrt{s}$ = 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Aaltonen, T.; /Helsinki Inst. of Phys.; Adelman, J.; /Chicago U., EFI; Akimoto, T.; /Tsukuba U.; Alvarez Gonzalez, B.; /Cantabria Inst. of Phys.; Amerio, S.; /INFN, Padua; Amidei, D.; /Michigan U.; Anastassov, A.; /Northwestern U.; Annovi, A.; /Frascati; Antos, J.; /Comenius U.; Apollinari, G.; /Fermilab; Apresyan, A.; /Purdue U. /Waseda U.

    2009-12-01

    We present the results of a search for pair production of the supersymmetric partner of the top quark (the stop quark {approx}{sub 1}) decaying to a b-quark and a chargino {tilde {chi}}{sub 1}{sup {+-}} with a subsequent {tilde {chi}}{sub 1}{sup {+-}} decay into a neutralino {tilde {chi}}{sub 1}{sup 0}, lepton {ell}, and neutrino {nu}. Using a data sample corresponding to 2.7 fb{sup -1} of integrated luminosity of p{bar p} collisions at {radical}s = 1.96 TeV collected by the CDF II detector, we reconstruct the mass of candidate stop events and fit the observed mass spectrum to a combination of standard model processes and stop quark signal. We find no evidence for {tilde t}{sub 1}{bar {tilde t}}{sub 1} production and set 95% C.L. limits on the masses of the stop quark and the neutralino for several values of the chargino mass and the branching ratio {Beta}({tilde {chi}}{sub 1}{sup {+-}} {yields} {tilde {chi}}{sub 1}{sup 0}{ell}{sup {+-}}{nu}).

  7. Search for charged Higgs bosons in decays of top quarks in proton - antiproton collisions at s**(1/2) = 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Geum Bong; /Rochester U.

    2009-08-01

    In this dissertation we report on the first direct search for charged Higgs bosons in decays of top quarks in p{bar p} collisions at {radical}s = 1.96 TeV. The search uses a data sample with an integrated luminosity of 2.2 fb{sup -1} collected by the CDF II detector at Fermilab and looks for a resonance in the invariant mass distribution of two jets in the lepton+jets sample of t{bar t} candidates. We observe no evidence of charged Higgs bosons in top quark decays; hence 95% C.L. upper limits on the branching ratio are placed at {Beta}(t {yields} H{sup +}b) < 0.1 to 0.3 for charged Higgs boson masses of 60 to 150 GeV/c{sup 2} assuming {Beta}(H{sup +} {yields} c{bar s}) = 1.0 and {Beta}(t {yields} Wb)+{Beta}(t {yields} H{sup +}b) = 1.0. The upper limits on {Beta}(t {yields} H{sup +}b) are also used as model independent limits on the decay branching ratio of top quarks to any charged scalar bosons beyond the standard model.

  8. Search for a two-Higgs-boson doublet using a simplified model in $p\\bar{p}$ collisions at $\\sqrt{s}=1.96$ TeV

    CERN Document Server

    Aaltonen, T; Alvarez Gonzalez, B; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Apollinari, G; Appel, J A; Arisawa, T; Artikov, A; Asaadi, J; Ashmanskas, W; Auerbach, B; Aurisano, A; Azfar, F; Badgett, W; Bae, T; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Barria, P; Bartos, P; Bauce, M; Bedeschi, F; Behari, S; Bellettini, G; Bellinger, J; Benjamin, D; Beretvas, A; Bhatti, A; Bisello, D; Bizjak, I; Bland, K R; Blumenfeld, B; Bocci, A; Bodek, A; Bortoletto, D; Boudreau, J; Boveia, A; Brigliadori, L; Bromberg, C; Brucken, E; Budagov, J; Budd, H S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Calamba, A; Calancha, C; Camarda, S; Campanelli, M; Campbell, M; Canelli, F; Carls, B; Carlsmith, D; Carosi, R; Carrillo, S; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavaliere, V; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Chokheli, D; Cho, K; Chung, W H; Chung, Y S; Ciocci, M A; Clark, A; Clarke, C; Compostella, G; Convery, M E; Conway, J; Corbo, M; Cordelli, M; Cox, C A; Cox, D J; Crescioli, F; Cuevas, J; Culbertson, R; Dagenhart, D; d'Ascenzo, N; Datta, M; de Barbaro, P; Dell'Orso, M; Demortier, L; Deninno, M; d'Errico, M; Devoto, F; Di Canto, A; Di Ruzza, B; Dittmann, J R; Donati, S; Dong, P; D'Onofrio, M; Dorigo, M; Dorigo, T; Ebina, K; Elagin, A; Eppig, A; Erbacher, R; Errede, S; Ershaidat, N; Eusebi, R; Farrington, S; Feindt, M; Fernandez, J P; Field, R; Flanagan, G; Forrest, R; Franklin, M; Frank, M J; Freeman, J C; Funakoshi, Y; Furic, I; Gallinaro, M; Garcia, J E; Garfinkel, A F; Garosi, P; Gerberich, H; Gerchtein, E; Giagu, S; Giakoumopoulou, V; Giannetti, P; Gibson, K; Ginsburg, C M; Giokaris, N; Giromini, P; Giurgiu, G; Glagolev, V; Glenzinski, D; Goldin, D; Gold, M; Goldschmidt, N; Golossanov, A; Gomez-Ceballos, G; Gomez, G; Goncharov, M; Gonzalez, O; Gorelov, I; Goshaw, A T; Goulianos, K; Grinstein, S; Grosso-Pilcher, C; Group, R C; Guimaraes da Costa, J; Hahn, S R; Halkiadakis, E; Hamaguchi, A; Han, J Y; Happacher, F; Hara, K; Hare, D; Hare, M; Harr, R F; Hatakeyama, K; Hays, C; Heck, M; Heinrich, J; Herndon, M; Hewamanage, S; Hocker, A; Hopkins, W; Horn, D; Hou, S; Hughes, R E; Hurwitz, M; Husemann, U; Hussain, N; Hussein, M; Huston, J; Introzzi, G; Iori, M; Ivanov, A; James, E; Jang, D; Jayatilaka, B; Jeon, E J; Jindariani, S; Johnstone, A; Jones, M; Joo, K K; Junk, T R; Jun, S Y; Kamon, T; Karchin, P E; Kasmi, A; Kato, Y; Ketchum, W; Keung, J; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kimura, N; Kim, Y J; Kim, Y K; Kirby, M; Klimenko, S; Knoepfel, K; Kondo, K; Kong, D J; Konigsberg, J; Kotwal, A V; Kreps, M; Kroll, J; Krop, D; Kruse, M; Krutelyov, V; Kuhr, T; Kurata, M; Kwang, S; Laasanen, A T; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; LeCompte, T; Lee, E; Lee, H S; Lee, J S; Lee, S W; Leone, S; Leo, S; Lewis, J D; Limosani, A; Lin, C J; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, C; Liu, H; Liu, Q; Liu, T; Lockwitz, S; Loginov, A; Lucchesi, D; Lueck, J; Lujan, P; Lukens, P; Lungu, G; Lysak, R; Lys, J; Madrak, R; Maeshima, K; Maestro, P; Malik, S; Manca, G; Manousakis-Katsikakis, A; Margaroli, F; Marino, C; Martinez, M; Mastrandrea, P; Matera, K; Mattson, M E; Mazzacane, A; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtala, P; Mesropian, C; Miao, T; Mietlicki, D; Mitra, A; Miyake, H; Moed, S; Moggi, N; Mondragon, M N; Moon, C S; Moore, R; Morello, M J; Morlock, J; Movilla Fernandez, P; Mukherjee, A; Muller, Th; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Naganoma, J; Nakano, I; Napier, A; Nett, J; Neubauer, M S; Neu, C; Nielsen, J; Nodulman, L; Noh, S Y; Norniella, O; Oakes, L; Oh, S H; Oh, Y D; Oksuzian, I; Okusawa, T; Orava, R; Ortolan, L; Pagan Griso, S; Pagliarone, C; Palencia, E; Papadimitriou, V; Paramonov, A A; Patrick, J; Pauletta, G; Paulini, M; Paus, C; Pellett, D E; Penzo, A; Phillips, T J; Piacentino, G; Pianori, E; Pilot, J; Pitts, K; Plager, C; Pondrom, L; Poprocki, S; Potamianos, K; Pranko, A; Prokoshin, F; Ptohos, F; Punzi, G; Rahaman, A; Ramakrishnan, V; Ranjan, N; Rao, K; Redondo, I; Renton, P; Rescigno, M; Riddick, T; Rimondi, F; Ristori, L; Robson, A; Rodrigo, T; Rodriguez, T; Rogers, E; Rolli, S; Roser, R; Ruffini, F; Ruiz, A; Russ, J; Rusu, V; Safonov, A; Sakumoto, W K; Sakurai, Y; Santi, L; Sato, K; Saveliev, V; Savoy-Navarro, A; Schlabach, P; Schmidt, A; Schmidt, E E; Schwarz, T; Scodellaro, L; Scribano, A; Scuri, F; Seidel, S; Seiya, Y; Semenov, A; Sforza, F; Shalhout, S Z; Shears, T; Shepard, P F; Shimojima, M; Shochet, M; Shreyber-Tecker, I; Simonenko, A; Sinervo, P; Sliwa, K; Smith, J R; Snider, F D; Soha, A; Song, H; Sorin, V; Squillacioti, P; Stancari, M; St. Denis, R; Stelzer, B; Stelzer-Chilton, O; Stentz, D; Strologas, J; Strycker, G L; Sudo, Y; Sukhanov, A; Suslov, I; Takemasa, K; Takeuchi, Y; Tang, J; Tecchio, M; Teng, P K; Thome, J; Thom, J; Thompson, G A; Thomson, E; Toback, D; Tokar, S; Tollefson, K; Tomura, T; Tonelli, D; Torre, S; Torretta, D; Totaro, P; Trovato, M; Truong, A; Ukegawa, F; Uozumi, S; Varganov, A; Vazquez, F; Velev, G; Vellidis, C; Vidal, M; Vila, I; Vilar, R; Vizan, J; Vogel, M; Volpi, G; Wagner, P; Wagner, R L; Wakisaka, T; Wallny, R; Wang, S M; Warburton, A; Waters, D; Wester, W C, III; Whiteson, D; Wick, F; Wicklund, A B; Wicklund, E; Wilbur, S; Williams, H H; Wilson, J S; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolfe, H; Wright, T; Wu, X; Wu, Z; Yamamoto, K; Yamato, D; Yang, T; Yang, U K; Yang, Y C; Yao, W M; Yeh, G P; Yi, K; Yoh, J; Yorita, K; Yoshida, T; Yu, G B; Yu, I; Yun, J C; Yu, S S; Zanetti, A; Zeng, Y; Zhou, C; Zucchelli, S

    2013-01-01

    We present a search for new particles in an extension to the standard model that includes a heavy Higgs boson ($H^0$), a lighter charged Higgs boson ($H^\\pm$), and an even-lighter Higgs boson $h^0$, with decays leading to a $W$-boson pair and a bottom-antibottom quark pair in the final state. We use events with exactly one lepton, missing transverse momentum, and at least four jets in data corresponding to an integrated luminosity of 8.7 fb$^{-1}$ collected by the CDF II detector in proton-antiproton collisions at $\\sqrt{s}=1.96$ TeV. We find the data to be consistent with standard model predictions and report the results in terms of a simplified Higgs-cascade-decay model, setting 95% confidence level upper limits on the product of cross-section and branching fraction from 1.3 pb to 15 fb as a function of $H^0$ and $H^\\pm$ masses for $m_h^{0}=126$ GeV$/c^2$.

  9. Search for heavy, long-lived particles that decay to photons in $p \\bar{p}$ collisions at $\\sqrt{s}$ = 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Wagner, Peter [Texas A & M Univ., College Station, TX (United States)

    2007-08-01

    This dissertation presents the results of the first search for heavy, neutral, longlived particles that decay to photons at a hadron collider. We use a sample of +jet+missing transverse energy events in $p \\bar{p}$ collisions at √s = 1.96 TeV taken with the Collider Detector at Fermilab. Candidate events are selected based on the arrival time of a high-energy photon at the electromagnetic calorimeter as measured with a timing system that was recently installed. The final result is that we find 2 events, using 570±34 pb-1 of data collected during 2004-2005 at the Fermilab Tevatron, consistent with the background estimate of 1.3±0.7 events. While our search strategy does not rely on model-specific dynamics, we interpret this result in terms of cross section limits in a supersymmetric model with $\\vec{X}$$0\\atop{1}$ eG and set a world-best e 01 mass reach of 101 GeV/c2 at e = 5 ns. We can exclude any γ+jet+missing transverse energy signal that would produce more than 5.5 events.

  10. Search for the Higgs Boson Decaying to Two Tau Leptons in $p\\bar{p}$ Collisions at a Center of Mass Energy of 1.96 Tev

    Energy Technology Data Exchange (ETDEWEB)

    Elagin, Andrey Lvovich [Texas A & M Univ., College Station, TX (United States)

    2011-12-01

    A search for the Higgs boson decaying to $\\tau\\tau$ using 7.8~fb$^{-1}$ of $p\\bar{p}$ collisions at 1.96~TeV collected with CDF II detector is presented. The search is sensitive to four production mechanisms of the Higgs boson: ggH, WH, ZH and VBF. Modes where one tau decay leptonically, and another decay, hadronically, are considered. Two novel techniques are developed and used in the search. A Probabilistic Particle Flow Algorithm is used for energy measurements of the hadronic tau candidates. The signal is discriminated from backgrounds by the Missing Mass Calculator, which allows for full invariant mass reconstruction of $\\tau\\tau$ pair. The data are found to be consistent with the background only hypothesis. Therefore a 95\\% confidence level upper limit on the Standard Model Higgs boson cross section was set. At $M_H$$=$120~GeV/$c^2$ observed limit is 14.9$\\times\\sigma_{SM}\\times Br (H → ττ)$.

  11. Search for new physics in high mass electron-positron events in p anti-p collisions at s**(1/2) = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Aaltonen, T.; Abulencia, A.; Adelman, J.; Affolder, Anthony Allen; Akimoto, T.; Albrow, Michael G.; Amerio, S.; Amidei, Dante E.; Anastassov, A.; Anikeev, K.; Annovi, A. /Taiwan, Inst. Phys. /Argonne /Barcelona, IFAE /Baylor U. /INFN, Bologna /Bologna U. /Brandeis U. /UC, Davis /UCLA /UC, San Diego /UC, Santa Barbara

    2007-07-01

    We report the results of a search for a narrow resonance in electron-positron events in the invariant mass range of 150-950 GeV/c{sup 2} using 1.3 fb{sup -1} of p{bar p} collision data at {radical}s=1.96 TeV collected by the CDF II detector at Fermilab. No significant evidence of such a resonance is observed and we interpret the results to exclude the standard model-like Z{prime} with a mass below 923 GeV/c{sup 2} and the Randall-Sundrum graviton with a mass below 807 GeV/c{sup 2} for k/{bar M}{sub pl} = 0.1, both at the 95% confidence level. Combining with di-photon data excludes the Randall-Sundrum graviton for masses below 889 GeV/c{sup 2} for k/{bar M}{sub pl} = 0.1

  12. Study of vector boson plus $D^{*}(2010)^+$ meson production in $\\bar{p}p$ collisions at $\\sqrt{s}=1.96\\, {\\rm TeV}$

    CERN Document Server

    Aaltonen, T; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Apollinari, G; Appel, J A; Arisawa, T; Artikov, A; Asaadi, J; Ashmanskas, W; Auerbach, B; Aurisano, A; Azfar, F; Badgett, W; Bae, T; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Barria, P; Bartos, P; Bauce, M; Bedeschi, F; Behari, S; Bellettini, G; Bellinger, J; Benjamin, D; Beretvas, A; Bhatti, A; Bland, K R; Blumenfeld, B; Bocci, A; Bodek, A; Bortoletto, D; Boudreau, J; Boveia, A; Brigliadori, L; Bromberg, C; Brucken, E; Budagov, J; Budd, H S; Burkett, K; Busetto, G; Bussey, P; Butti, P; Buzatu, A; Calamba, A; Camarda, S; Campanelli, M; Canelli, F; Carls, B; Carlsmith, D; Carosi, R; Carrillo, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavaliere, V; Cerri, A; Cerrito, L; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Cho, K; Chokheli, D; Clark, A; Clarke, C; Convery, M E; Conway, J; Corbo, M; Cordelli, M; Cox, C A; Cox, D J; Cremonesi, M; Cruz, D; Cuevas, J; Culbertson, R; d'Ascenzo, N; Datta, M; de Barbaro, P; Demortier, L; Marchese, L; Deninno, M; Devoto, F; D'Errico, M; Di Canto, A; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Donati, S; Dorigo, M; Driutti, A; Ebina, K; Edgar, R; Elagin, A; Erbacher, R; Errede, S; Esham, B; Farrington, S; Ramos, J P Fernández; Field, R; Flanagan, G; Forrest, R; Franklin, M; Freeman, J C; Frisch, H; Funakoshi, Y; Galloni, C; Garfinkel, A F; Garosi, P; Gerberich, H; Gerchtein, E; Giagu, S; Giakoumopoulou, V; Gibson, K; Ginsburg, C M; Giokaris, N; Giromini, P; Glagolev, V; Glenzinski, D; Gold, M; Goldin, D; Golossanov, A; Gomez, G; Gomez-Ceballos, G; Goncharov, M; López, O González; Gorelov, I; Goshaw, A T; Goulianos, K; Gramellini, E; Grosso-Pilcher, C; da Costa, J Guimaraes; Hahn, S R; Han, J Y; Happacher, F; Hara, K; Hare, M; Harr, R F; Harrington-Taber, T; Hatakeyama, K; Hays, C; Heinrich, J; Herndon, M; Hocker, A; Hong, Z; Hopkins, W; Hou, S; Hughes, R E; Husemann, U; Hussein, M; Huston, J; Introzzi, G; Iori, M; Ivanov, A; James, E; Jang, D; Jayatilaka, B; Jeon, E J; Jindariani, S; Jones, M; Joo, K K; Jun, S Y; Junk, T R; Kambeitz, M; Kamon, T; Karchin, P E; Kasmi, A; Kato, Y; Ketchum, W; Keung, J; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kim, Y J; Kimura, N; Kirby, M; Knoepfel, K; Kondo, K; Kong, D J; Konigsberg, J; Kotwal, A V; Kreps, M; Kroll, J; Kruse, M; Kuhr, T; Kurata, M; Laasanen, A T; Lammel, S; Lancaster, M; Lannon, K; Latino, G; Lee, H S; Lee, J S; Leo, S; Leone, S; Lewis, J D; Limosani, A; Lipeles, E; Lister, A; Liu, H; Liu, Q; Liu, T; Lockwitz, S; Loginov, A; Lucà, A; Lucchesi, D; Lueck, J; Lujan, P; Lukens, P; Lungu, G; Lys, J; Lysak, R; Madrak, R; Maestro, P; Malik, S; Manca, G; Manousakis-Katsikakis, A; Margaroli, F; Marino, P; Matera, K; Mattson, M E; Mazzacane, A; Mazzanti, P; McNulty, R; Mehta, A; Mehtala, P; Mesropian, C; Miao, T; Mietlicki, D; Mitra, A; Miyake, H; Moed, S; Moggi, N; Moon, C S; Moore, R; Morello, M J; Mukherjee, A; Muller, Th; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Naganoma, J; Nakano, I; Napier, A; Nett, J; Neu, C; Nigmanov, T; Nodulman, L; Noh, S Y; Norniella, O; Oakes, L; Oh, S H; Oh, Y D; Oksuzian, I; Okusawa, T; Orava, R; Ortolan, L; Pagliarone, C; Palencia, E; Palni, P; Papadimitriou, V; Parker, W; Pauletta, G; Paulini, M; Paus, C; Phillips, T J; Piacentino, G; Pianori, E; Pilot, J; Pitts, K; Plager, C; Pondrom, L; Poprocki, S; Potamianos, K; Prokoshin, F; Pranko, A; Ptohos, F; Punzi, G; Fernández, I Redondo; Renton, P; Rescigno, M; Rimondi, F; Ristori, L; Robson, A; Rodriguez, T; Rolli, S; Ronzani, M; Roser, R; Rosner, J L; Ruffini, F; Ruiz, A; Russ, J; Rusu, V; Sakumoto, W K; Sakurai, Y; Santi, L; Sato, K; Saveliev, V; Savoy-Navarro, A; Schlabach, P; Schmidt, E E; Schwarz, T; Scodellaro, L; Scuri, F; Seidel, S; Seiya, Y; Semenov, A; Sforza, F; Shalhout, S Z; Shears, T; Shepard, P F; Shimojima, M; Shochet, M; Shreyber-Tecker, I; Simonenko, A; Sliwa, K; Smith, J R; Snider, F D; Sorin, V; Song, H; Stancari, M; Denis, R St; Stentz, D; Strologas, J; Sudo, Y; Sukhanov, A; Suslov, I; Takemasa, K; Takeuchi, Y; Tang, J; Tecchio, M; Teng, P K; Thom, J; Thomson, E; Thukral, V; Toback, D; Tokar, S; Tollefson, K; Tomura, T; Tonelli, D; Torre, S; Torretta, D; Totaro, P; Trovato, M; Ukegawa, F; Uozumi, S; Vázquez, F; Velev, G; Vellidis, C; Vernieri, C; Vidal, M; Vilar, R; Vizán, J; Vogel, M; Volpi, G; Wagner, P; Wallny, R; Wang, S M; Waters, D; Wester, W C; Whiteson, D; Wicklund, A B; Wilbur, S; Williams, H H; Wilson, J S; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolfe, H; Wright, T; Wu, X; Wu, Z; Yamamoto, K; Yamato, D; Yang, T; Yang, U K; Yang, Y C; Yao, W -M; Yeh, G P; Yi, K; Yoh, J; Yorita, K; Yoshida, T; Yu, G B; Yu, I; Zanetti, A M; Zeng, Y; Zhou, C; Zucchelli, S

    2015-01-01

    A study of vector boson ($V$) production in conjunction with a $D^{*}(2010)^+$ meson is presented. Using a data sample correponding to $9.7\\, {\\rm fb}^{-1}$ of proton-antiproton collisions at center-of-mass energy $\\sqrt{s}=1.96\\rm~ TeV$ produced by the Fermilab Tevatron, we reconstruct $V+D^{*+}$ samples with the CDF~II detector. The $D^{*+}$ is fully reconstructed in the $D^{*}(2010)^+ \\rightarrow D^{0}(\\to K^-\\pi^+)\\pi^+$ decay mode. This technique is sensitive to the associated production of vector boson plus charm or bottom mesons. We measure the ratio of production cross sections $\\sigma(W+D^{*})/\\sigma(W)$ = $[1.75\\pm 0.13 {\\rm (stat)}\\pm 0.09 {\\rm (syst)}]\\% $ and $\\sigma(Z+D^{*})/\\sigma(Z)$ = $[1.5\\pm 0.4 {\\rm (stat)} \\pm 0.2 {\\rm (syst)}]\\% $. Event properties are utilized to determine the fraction of $V+D^{*}(2010)^+$ events originating from different production processes. The results are in agreement with the predictions obtained with the {\\sc pythia} program, limiting possible contribution from n...

  13. Measurements of the t$\\bar{t}$ Production Cross Section at √s = 1.96-TeV and Top Mass in the Dielectron Channel

    Energy Technology Data Exchange (ETDEWEB)

    Kozminski, Joseph Francis [Michigan State Univ., East Lansing, MI (United States)

    2005-05-01

    The first measurement of the top-antitop production cross section in proton-antiproton collisions at √s = 1.96 TeV using 243 pb-1 of data collected with the D0 detector at Fermilab is presented. In this analysis, only the dielectron final state is considered. Five events are observed, and 0.93 background events are expected. The measured cross section, after accounting for the expected branching ratio to the dielectron channel, is σt$\\bar{t}$ = 14.9$+9.4\\atop{-7.0}$(stat)$+2.5\\atop{-1.8}${sup +2.5}(syst) ± 1.0 (lumi) pb, which agrees with the predicted cross section for top quarks with a mass of 175 GeV. In addition, a first-pass at a measurement of the top mass using the neutrino-weighting method is presented. This measurement is also performed in the dielectron channel using the five events observed in the cross section measurement.

  14. Search for Charged Higgs in t$\\bar{t}$ Decay Products from Proton-Antiproton Collisions at √s = 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Eusebi, Ricardo [Univ. of Rochester, NY (United States)

    2005-10-01

    This dissertation reports the results of a search for charged Higgs bosons in the decays of t$\\bar{t}$ pairs produced in p$\\bar{p}$ collisions at a center-of-mass energy of 1.96 TeV. The search is performed on a data sample recorded by the upgraded Collider Detector at Fermilab and corresponding to an integrated luminosity of 193 pb-1. The search is based on the relative rates of events in the different t$\\bar{t}$ decay channels. Results are obtained in the context of different models. In the context of the minimal supersymmetric extension of the Standard Model (MSSM), for which they fully account for radiative and Yukawa coupling corrections, regions in the (mH±, tan (β)) plane are excluded. In the Tauonic Higgs Model in which the charged Higgs is assumed to decay exclusively to $\\bar{τ}$, the BR(t → H+b) is constrained to be less than 0.4 at 95% C.L. If no assumption is made on the charged Higgs decay, the BR(t → H+b) is constrained to be less than 0.90 at 95% C.L. No evidence for charged Higgs production is found.

  15. Search for ZZ and Zγ* Production in p pmacr Collisions at s=1.96TeV and Limits on Anomalous ZZZ and ZZγ* Couplings

    Science.gov (United States)

    Abazov, V. M.; Abbott, B.; Abolins, M.; Acharya, B. S.; Adams, M.; Adams, T.; Aguilo, E.; Ahn, S. H.; Ahsan, M.; Alexeev, G. D.; Alkhazov, G.; Alton, A.; Alverson, G.; Alves, G. A.; Anastasoaie, M.; Ancu, L. S.; Andeen, T.; Anderson, S.; Andrieu, B.; Anzelc, M. S.; Arnoud, Y.; Arov, M.; Arthaud, M.; Askew, A.; Åsman, B.; Assis Jesus, A. C. S.; Atramentov, O.; Autermann, C.; Avila, C.; Ay, C.; Badaud, F.; Baden, A.; Bagby, L.; Baldin, B.; Bandurin, D. V.; Banerjee, S.; Banerjee, P.; Barberis, E.; Barfuss, A.-F.; Bargassa, P.; Baringer, P.; Barreto, J.; Bartlett, J. F.; Bassler, U.; Bauer, D.; Beale, S.; Bean, A.; Begalli, M.; Begel, M.; Belanger-Champagne, C.; Bellantoni, L.; Bellavance, A.; Benitez, J. A.; Beri, S. B.; Bernardi, G.; Bernhard, R.; Bertram, I.; Besançon, M.; Beuselinck, R.; Bezzubov, V. A.; Bhat, P. C.; Bhatnagar, V.; Biscarat, C.; Blazey, G.; Blekman, F.; Blessing, S.; Bloch, D.; Bloom, K.; Boehnlein, A.; Boline, D.; Bolton, T. A.; Borissov, G.; Bose, T.; Brandt, A.; Brock, R.; Brooijmans, G.; Bross, A.; Brown, D.; Buchanan, N. J.; Buchholz, D.; Buehler, M.; Buescher, V.; Bunichev, V.; Burdin, S.; Burke, S.; Burnett, T. H.; Buszello, C. P.; Butler, J. M.; Calfayan, P.; Calvet, S.; Cammin, J.; Carvalho, W.; Casey, B. C. K.; Cason, N. M.; Castilla-Valdez, H.; Chakrabarti, S.; Chakraborty, D.; Chan, K. M.; Chan, K.; Chandra, A.; Charles, F.; Cheu, E.; Chevallier, F.; Cho, D. K.; Choi, S.; Choudhary, B.; Christofek, L.; Christoudias, T.; Cihangir, S.; Claes, D.; Coadou, Y.; Cooke, M.; Cooper, W. E.; Corcoran, M.; Couderc, F.; Cousinou, M.-C.; Crépé-Renaudin, S.; Cutts, D.; Ćwiok, M.; da Motta, H.; Das, A.; Davies, G.; de, K.; de Jong, S. J.; de La Cruz-Burelo, E.; de Oliveira Martins, C.; Degenhardt, J. D.; Déliot, F.; Demarteau, M.; Demina, R.; Denisov, D.; Denisov, S. P.; Desai, S.; Diehl, H. T.; Diesburg, M.; Dominguez, A.; Dong, H.; Dudko, L. V.; Duflot, L.; Dugad, S. R.; Duggan, D.; Duperrin, A.; Dyer, J.; Dyshkant, A.; Eads, M.; Edmunds, D.; Ellison, J.; Elvira, V. D.; Enari, Y.; Eno, S.; Ermolov, P.; Evans, H.; Evdokimov, A.; Evdokimov, V. N.; Ferapontov, A. V.; Ferbel, T.; Fiedler, F.; Filthaut, F.; Fisher, W.; Fisk, H. E.; Ford, M.; Fortner, M.; Fox, H.; Fu, S.; Fuess, S.; Gadfort, T.; Galea, C. F.; Gallas, E.; Galyaev, E.; Garcia, C.; Garcia-Bellido, A.; Gavrilov, V.; Gay, P.; Geist, W.; Gelé, D.; Gerber, C. E.; Gershtein, Y.; Gillberg, D.; Ginther, G.; Gollub, N.; Gómez, B.; Goussiou, A.; Grannis, P. D.; Greenlee, H.; Greenwood, Z. D.; Gregores, E. M.; Grenier, G.; Gris, Ph.; Grivaz, J.-F.; Grohsjean, A.; Grünendahl, S.; Grünewald, M. W.; Guo, J.; Guo, F.; Gutierrez, P.; Gutierrez, G.; Haas, A.; Hadley, N. J.; Haefner, P.; Hagopian, S.; Haley, J.; Hall, I.; Hall, R. E.; Han, L.; Hanagaki, K.; Hansson, P.; Harder, K.; Harel, A.; Harrington, R.; Hauptman, J. M.; Hauser, R.; Hays, J.; Hebbeker, T.; Hedin, D.; Hegeman, J. G.; Heinmiller, J. M.; Heinson, A. P.; Heintz, U.; Hensel, C.; Herner, K.; Hesketh, G.; Hildreth, M. D.; Hirosky, R.; Hobbs, J. D.; Hoeneisen, B.; Hoeth, H.; Hohlfeld, M.; Hong, S. J.; Hossain, S.; Houben, P.; Hu, Y.; Hubacek, Z.; Hynek, V.; Iashvili, I.; Illingworth, R.; Ito, A. S.; Jabeen, S.; Jaffré, M.; Jain, S.; Jakobs, K.; Jarvis, C.; Jesik, R.; Johns, K.; Johnson, C.; Johnson, M.; Jonckheere, A.; Jonsson, P.; Juste, A.; Käfer, D.; Kajfasz, E.; Kalinin, A. M.; Kalk, J. R.; Kalk, J. M.; Kappler, S.; Karmanov, D.; Kasper, P.; Katsanos, I.; Kau, D.; Kaur, R.; Kaushik, V.; Kehoe, R.; Kermiche, S.; Khalatyan, N.; Khanov, A.; Kharchilava, A.; Kharzheev, Y. M.; Khatidze, D.; Kim, H.; Kim, T. J.; Kirby, M. H.; Kirsch, M.; Klima, B.; Kohli, J. M.; Konrath, J.-P.; Kopal, M.; Korablev, V. M.; Kozelov, A. V.; Krop, D.; Kuhl, T.; Kumar, A.; Kunori, S.; Kupco, A.; Kurča, T.; Kvita, J.; Lacroix, F.; Lam, D.; Lammers, S.; Landsberg, G.; Lebrun, P.; Lee, W. M.; Leflat, A.; Lehner, F.; Lellouch, J.; Leveque, J.; Lewis, P.; Li, J.; Li, Q. Z.; Li, L.; Lietti, S. M.; Lima, J. G. R.; Lincoln, D.; Linnemann, J.; Lipaev, V. V.; Lipton, R.; Liu, Y.; Liu, Z.; Lobo, L.; Lobodenko, A.; Lokajicek, M.; Love, P.; Lubatti, H. J.; Lyon, A. L.; Maciel, A. K. A.; Mackin, D.; Madaras, R. J.; Mättig, P.; Magass, C.; Magerkurth, A.; Mal, P. K.; Malbouisson, H. B.; Malik, S.; Malyshev, V. L.; Mao, H. S.; Maravin, Y.; Martin, B.; McCarthy, R.; Melnitchouk, A.; Mendes, A.; Mendoza, L.; Mercadante, P. G.; Merkin, M.; Merritt, K. W.; Meyer, J.; Meyer, A.; Millet, T.; Mitrevski, J.; Molina, J.; Mommsen, R. K.; Mondal, N. K.; Moore, R. W.; Moulik, T.; Muanza, G. S.; Mulders, M.; Mulhearn, M.; Mundal, O.; Mundim, L.; Nagy, E.; Naimuddin, M.; Narain, M.; Naumann, N. A.; Neal, H. A.; Negret, J. P.; Neustroev, P.; Nilsen, H.; Nogima, H.; Nomerotski, A.; Novaes, S. F.; Nunnemann, T.; O'Dell, V.; O'Neil, D. C.

    2008-04-01

    We present a study of μμμμ, eeee, and μμee events using 1fb-1 of data collected with the D0 detector at the Fermilab Tevatron p pmacr Collider at s=1.96TeV. Requiring the lepton pair masses to be greater than 30 GeV, we observe one event, consistent with the expected background of 0.13±0.03 events and with the predicted standard model ZZ and Zγ* production of 1.71±0.15 events. We set an upper limit on the ZZ and Zγ* cross section of 4.4 pb at the 95% C.L. We also derive limits on anomalous neutral trilinear ZZZ and ZZγ* gauge couplings. The one-parameter 95% C.L. coupling limits with a form-factor scale Λ=1.2TeV are -0.28

  16. Search for Supersymmetry Using Diphoton Events in p anti-p Collisions at a center of mass energy of 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Eun Sin [Texas A & M Univ., College Station, TX (United States)

    2010-05-01

    This dissertation presents the results of a search for supersymmetry in protonantiproton collisions with a center of mass energy of 1.96 TeV studied with the Collider Detector at Fermilab. Our strategy is to select collisions with two photons in the nal state that have the properties of being the decays of very massive supersymmetric particles. This includes looking for large total energy from the decayed particles as well as for the presence of particles that leave the detector without interacting. We nd no events using 2.6 fb-1 of data collected during the 2004-2008 collider run of the Fermilab Tevatron which is consistent with the background estimate of 1.4 0.4 events. Since there is no evidence of new particles we set cross section limits in a gaugemediated supersymmetry model with X$\\tilde{o}$1→ eG, where the X$\\tilde{o}$1 and eG are the lightest neutralino and the gravitino (the lightest supersymmetric particle), respectively. We set limits on models as a function of the X$\\tilde{o}$1 mass and lifetime, producing the world's most sensitive search for X$\\tilde{o}$1 by excluding masses up to 149 GeV=c2 for X$\\tilde{o}$1 lifetimes much less than 1 ns.

  17. A Measurement of the Top Quark Mass in 1.96 TeV Proton-Antiproton Collisions Using a Novel Matrix Element Method

    International Nuclear Information System (INIS)

    A measurement of the top quark mass in t(bar t) → l + jets candidate events, obtained from p(bar p) collisions at √s = 1.96 TeV at the Fermilab Tevatron using the CDF II detector, is presented. The measurement approach is that of a matrix element method. For each candidate event, a two dimensional likelihood is calculated in the top pole mass and a constant scale factor, 'JES', where JES multiplies the input particle jet momenta and is designed to account for the systematic uncertainty of the jet momentum reconstruction. As with all matrix element techniques, the method involves an integration using the Standard Model matrix element for t(bar t) production and decay. However, the technique presented is unique in that the matrix element is modified to compensate for kinematic assumptions which are made to reduce computation time. Background events are dealt with through use of an event observable which distinguishes signal from background, as well as through a cut on the value of an event's maximum likelihood. Results are based on a 955 pb-1 data sample, using events with a high-pT lepton and exactly four high-energy jets, at least one of which is tagged as coming from a b quark; 149 events pass all the selection requirements. They find Mmeas = 169.8 ± 2.3(stat.) ± 1.4(syst.) GeV/c2

  18. Characterization of Vadose Zone Sediments Below the T Tank Farm: Boreholes C4104, C4105, 299-W10-196, and RCRA Borehole 299-W11-39

    Energy Technology Data Exchange (ETDEWEB)

    Serne, R. Jeffrey; Bjornstad, Bruce N.; Horton, Duane G.; Lanigan, David C.; Schaef, Herbert T.; Lindenmeier, Clark W.; Lindberg, Michael J.; Clayton, Ray E.; Legore, Virginia L.; Geiszler, Keith N.; Baum, Steven R.; Valenta, Michelle M.; Kutnyakov, Igor V.; Vickerman, Tanya S.; Orr, Robert D.; Brown, Christopher F.

    2008-09-11

    This report was revised in September 2008 to remove acid-extractable sodium data from Tables 4.8, 4.28, and 4.52. The sodium data was removed due to potential contamination introduced during the acid extraction process. The rest of the text remains unchanged from the original report issued in September 2004. The overall goal of the Tank Farm Vadose Zone Project, led by CH2M HILL Hanford Group, Inc., is to define risks from past and future single-shell tank farm activities at Hanford. To meet this goal, CH2M HILL Hanford Group, Inc. tasked scientists from Pacific Northwest National Laboratory to perform detailed analyses on vadose zone sediments from within Waste Management Area (WMA) T-TX-TY. This report is the second of two reports written to present the results of these analyses. Specifically, this report contains all the geologic, geochemical, and selected physical characterization data collected on vadose zone sediment recovered from boreholes C4104 and C4105 in the T Tank Farm, and from borehole 299-W-11-39 installed northeast of the T Tank Farm. Finally, the measurements on sediments from borehole C4104 are compared with a nearby borehole drilled in 1993, 299- W10-196, through the tank T-106 leak plume.

  19. Search for Exotic S=-2 Baryons in proton-antiproton Collisions at sqrt(s) = 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abulencia, A.; Adelman, J.; Affolder, T.; Akimoto, T.; Albrow, M.G.; Ambrose, D.; Amerio, S.; Amidei, D.; Anastassov, A.; Anikeev, K.; Annovi, A.; /Taiwan, Inst. Phys.

    2006-12-01

    A search for a manifestly exotic S = -2 baryon state decaying to {Xi}{sup -}{pi}{sup -}, and its neutral partner decaying to {Xi}{sup -}{pi}{sup +}, has been performed using 220 pb{sup -1} of p{bar p} collisions at {radical}s = 1.96 TeV collected by the Collider Detector at Fermilab. The {Xi}{sup -} trajectories were measured in a silicon tracker before their decay, resulting in a sample with low background and excellent position resolution. No evidence was found for S = -2 pentaquark candidates in the invariant mass range of 1600-2100 MeV/c{sup 2}. Upper limits on the product of pentaquark production cross section times its branching fraction to {Xi}{sup -}{pi}{sup +,-}, relative to the cross section of the well established {Xi}(1530) resonance, are presented for neutral and doubly negative candidates with p{sub T} > 2 GeV/c and |y| < 1 as a function of pentaquark mass. At 1862 MeV/c{sup 2}, these upper limits for neutral and doubly negative final states were found to be 3.2% and 1.7% at the 90% confidence level, respectively.

  20. Search for pair production of supersymmetric top quarks in dilepton events from pp collisions at sqrt[s]=1.96  TeV.

    Science.gov (United States)

    Aaltonen, T; Adelman, J; Akimoto, T; Alvarez González, B; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Apollinari, G; Apresyan, A; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Aurisano, A; Azfar, F; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Barria, P; Bartsch, V; Bauer, G; Beauchemin, P-H; Bedeschi, F; Beecher, D; Behari, S; Bellettini, G; Bellinger, J; Benjamin, D; Beretvas, A; Beringer, J; Bhatti, A; Binkley, M; Bisello, D; Bizjak, I; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bolla, G; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Bridgeman, A; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, J; Budd, H S; Budd, S; Burke, S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Byrum, K L; Cabrera, S; Calancha, C; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carls, B; Carlsmith, D; Carosi, R; Carrillo, S; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavaliere, V; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, K; Chokheli, D; Chou, J P; Choudalakis, G; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Chwalek, T; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Compostella, G; Convery, M E; Conway, J; Cordelli, M; Cortiana, G; Cox, C A; Cox, D J; Crescioli, F; Cuenca Almenar, C; Cuevas, J; Culbertson, R; Cully, J C; Dagenhart, D; Datta, M; Davies, T; de Barbaro, P; De Cecco, S; Deisher, A; De Lorenzo, G; Dell'orso, M; Deluca, C; Demortier, L; Deng, J; Deninno, M; Derwent, P F; Di Canto, A; di Giovanni, G P; Dionisi, C; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Donati, S; Dong, P; Donini, J; Dorigo, T; Dube, S; Efron, J; Elagin, A; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, W T; Feild, R G; Feindt, M; Fernandez, J P; Ferrazza, C; Field, R; Flanagan, G; Forrest, R; Frank, M J; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; Garberson, F; Garcia, J E; Garfinkel, A F; Garosi, P; Genser, K; Gerberich, H; Gerdes, D; Gessler, A; Giagu, S; Giakoumopoulou, V; Giannetti, P; Gibson, K; Gimmell, J L; Ginsburg, C M; Giokaris, N; Giordani, M; Giromini, P; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Golossanov, A; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Grinstein, S; Grosso-Pilcher, C; Group, R C; Grundler, U; Guimaraes da Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Han, B-Y; Han, J Y; Happacher, F; Hara, K; Hare, D; Hare, M; Harper, S; Harr, R F; Harris, R M; Hartz, M; Hatakeyama, K; Hays, C; Heck, M; Heijboer, A; Heinrich, J; Henderson, C; Herndon, M; Heuser, J; Hewamanage, S; Hidas, D; Hill, C S; Hirschbuehl, D; Hocker, A; Hou, S; Houlden, M; Hsu, S-C; Huffman, B T; Hughes, R E; Husemann, U; Hussein, M; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ivanov, A; James, E; Jang, D; Jayatilaka, B; Jeon, E J; Jha, M K; Jindariani, S; Johnson, W; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Kar, D; Karchin, P E; Kato, Y; Kephart, R; Ketchum, W; Keung, J; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, H W; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Knuteson, B; Ko, B R; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kreps, M; Kroll, J; Krop, D; Krumnack, N; Kruse, M; Krutelyov, V; Kubo, T; Kuhr, T; Kulkarni, N P; Kurata, M; Kwang, S; Laasanen, A T; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; Lecompte, T; Lee, E; Lee, H S; Lee, S W; Leone, S; Lewis, J D; Lin, C-S; Linacre, J; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, C; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Lovas, L; Lucchesi, D; Luci, C; Lueck, J; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Macqueen, D; Madrak, R; Maeshima, K; Makhoul, K; Maki, T; Maksimovic, P; Malde, S; Malik, S; Manca, G; Manousakis-Katsikakis, A; Margaroli, F; Marino, C; Marino, C P; Martin, A; Martin, V; Martínez, M; Martínez-Ballarín, R; Maruyama, T; Mastrandrea, P; Masubuchi, T; Mathis, M; Mattson, M E; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtala, P; Menzione, A; Merkel, P; Mesropian, C; Miao, T; Miladinovic, N; Miller, R; Mills, C; Milnik, M; Mitra, A; Mitselmakher, G; Miyake, H; Moggi, N; Moon, C S; Moore, R; Morello, M J; Morlock, J; Movilla Fernandez, P; Mülmenstädt, J; Mukherjee, A; Muller, Th; Mumford, R; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Nagano, A; Naganoma, J; Nakamura, K; Nakano, I; Napier, A; Necula, V; Nett, J; Neu, C; Neubauer, M S; Neubauer, S; Nielsen, J; Nodulman, L; Norman, M; Norniella, O; Nurse, E; Oakes, L; Oh, S H; Oh, Y D; Oksuzian, I; Okusawa, T; Orava, R; Osterberg, K; Pagan Griso, S; Palencia, E; Papadimitriou, V

    2010-06-25

    We present the results of a search for pair production of the supersymmetric partner of the top quark (the top squark t{1}) decaying to a b quark and a chargino χ{1}{±} with a subsequent χ{1}{±} decay into a neutralino χ{1}{0}, lepton ℓ, and neutrino ν. Using a data sample corresponding to 2.7  fb{-1} of integrated luminosity of pp collisions at sqrt[s]=1.96  TeV collected by the CDF II detector, we reconstruct the mass of top squark candidate events and fit the observed mass spectrum to a combination of standard model processes and t{1}t{1} signal. We find no evidence for t{1}t{1} production and set 95% C.L. limits on the masses of the top squark and the neutralino for several values of the chargino mass and the branching ratio B(χ{1}{±}→χ{1}{0}ℓ{±}ν).

  1. Search for production of heavy particles decaying to top quarks and invisible particles in pp collisions at √s = 1.96  TeV.

    Science.gov (United States)

    Aaltonen, T; Álvarez González, B; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Apollinari, G; Appel, J A; Apresyan, A; Arisawa, T; Artikov, A; Asaadi, J; Ashmanskas, W; Auerbach, B; Aurisano, A; Azfar, F; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Barria, P; Bartos, P; Bauce, M; Bauer, G; Bedeschi, F; Beecher, D; Behari, S; Bellettini, G; Bellinger, J; Benjamin, D; Beretvas, A; Bhatti, A; Binkley, M; Bisello, D; Bizjak, I; Bland, K R; Blumenfeld, B; Bocci, A; Bodek, A; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Brigliadori, L; Brisuda, A; Bromberg, C; Brucken, E; Bucciantonio, M; Budagov, J; Budd, H S; Budd, S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Calancha, C; Camarda, S; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carls, B; Carlsmith, D; Carosi, R; Carrillo, S; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavaliere, V; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, K; Chokheli, D; Chou, J P; Chung, W H; Chung, Y S; Ciobanu, C I; Ciocci, M A; Clark, A; Compostella, G; Convery, M E; Conway, J; Corbo, M; Cordelli, M; Cox, C A; Cox, D J; Crescioli, F; Cuenca Almenar, C; Cuevas, J; Culbertson, R; Dagenhart, D; d'Ascenzo, N; Datta, M; de Barbaro, P; De Cecco, S; De Lorenzo, G; Dell'Orso, M; Deluca, C; Demortier, L; Deng, J; Deninno, M; Devoto, F; d'Errico, M; Di Canto, A; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Donati, S; Dong, P; Dorigo, M; Dorigo, T; Ebina, K; Elagin, A; Eppig, A; Erbacher, R; Errede, D; Errede, S; Ershaidat, N; Eusebi, R; Fang, H C; Farrington, S; Feindt, M; Fernandez, J P; Ferrazza, C; Field, R; Flanagan, G; Forrest, R; Frank, M J; Franklin, M; Freeman, J C; Funakoshi, Y; Furic, I; Gallinaro, M; Galyardt, J; Garcia, J E; Garfinkel, A F; Garosi, P; Gerberich, H; Gerchtein, E; Giagu, S; Giakoumopoulou, V; Giannetti, P; Gibson, K; Ginsburg, C M; Giokaris, N; Giromini, P; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldin, D; Goldschmidt, N; Golossanov, A; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Grinstein, S; Grosso-Pilcher, C; Group, R C; Guimaraes da Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, S R; Halkiadakis, E; Hamaguchi, A; Han, J Y; Happacher, F; Hara, K; Hare, D; Hare, M; Harr, R F; Hatakeyama, K; Hays, C; Heck, M; Heinrich, J; Herndon, M; Hewamanage, S; Hidas, D; Hocker, A; Hopkins, W; Horn, D; Hou, S; Hughes, R E; Hurwitz, M; Husemann, U; Hussain, N; Hussein, M; Huston, J; Introzzi, G; Iori, M; Ivanov, A; James, E; Jang, D; Jayatilaka, B; Jeon, E J; Jha, M K; Jindariani, S; Johnson, W; Jones, M; Joo, K K; Jun, S Y; Junk, T R; Kamon, T; Karchin, P E; Kato, Y; Ketchum, W; Keung, J; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, H W; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirby, M; Klimenko, S; Kondo, K; Kong, D J; Konigsberg, J; Kotwal, A V; Kreps, M; Kroll, J; Krop, D; Krumnack, N; Kruse, M; Krutelyov, V; Kuhr, T; Kurata, M; Kwang, S; Laasanen, A T; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; LeCompte, T; Lee, E; Lee, H S; Lee, J S; Lee, S W; Leo, S; Leone, S; Lewis, J D; Limosani, A; Lin, C-J; Linacre, J; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, C; Liu, Q; Liu, T; Lockwitz, S; Lockyer, N S; Loginov, A; Lucchesi, D; Lueck, J; Lujan, P; Lukens, P; Lungu, G; Lys, J; Lysak, R; Madrak, R; Maeshima, K; Makhoul, K; Maksimovic, P; Malik, S; Manca, G; Manousakis-Katsikakis, A; Margaroli, F; Marino, C; Martínez, M; Martínez-Ballarín, R; Mastrandrea, P; Mathis, M; Mattson, M E; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtala, P; Menzione, A; Mesropian, C; Miao, T; Mietlicki, D; Mitra, A; Miyake, H; Moed, S; Moggi, N; Mondragon, M N; Moon, C S; Moore, R; Morello, M J; Morlock, J; Movilla Fernandez, P; Mukherjee, A; Muller, Th; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Naganoma, J; Nakano, I; Napier, A; Nett, J; Neu, C; Neubauer, M S; Nielsen, J; Nodulman, L; Norniella, O; Nurse, E; Oakes, L; Oh, S H; Oh, Y D; Oksuzian, I; Okusawa, T; Orava, R; Ortolan, L; Pagan Griso, S; Pagliarone, C; Palencia, E; Papadimitriou, V; Paramonov, A A; Patrick, J; Pauletta, G; Paulini, M; Paus, C; Pellett, D E; Penzo, A; Phillips, T J; Piacentino, G; Pianori, E; Pilot, J; Pitts, K; Plager, C; Pondrom, L; Potamianos, K; Poukhov, O; Prokoshin, F; Pronko, A; Ptohos, F; Pueschel, E; Punzi, G; Pursley, J; Rahaman, A; Ramakrishnan, V; Ranjan, N; Rao, K; Redondo, I; Renton, P; Rescigno, M; Rimondi, F; Ristori, L; Robson, A; Rodrigo, T; Rodriguez, T; Rogers, E; Rolli, S; Roser, R; Rossi, M; Rubbo, F; Ruffini, F; Ruiz, A; Russ, J; Rusu, V; Safonov, A; Sakumoto, W K; Sakurai, Y; Santi, L; Sartori, L; Sato, K; Saveliev, V; Savoy-Navarro, A; Schlabach, P; Schmidt, A; Schmidt, E E; Schmidt, M P; Schmitt, M

    2011-05-13

    We present a search for a new particle T' decaying to top quark via T' → t + X, where X is an invisible particle. In a data sample with 4.8  fb(-1) of integrated luminosity collected by the CDF II detector at Fermilab in pp collisions with √s = 1.96  TeV, we search for pair production of T' in the lepton + jets channel, pp → tt + X + X → ℓνbqq'b + X + X. We interpret our results primarily in terms of a model where T' are exotic fourth generation quarks and X are dark matter particles. Current direct and indirect bounds on such exotic quarks restrict their masses to be between 300 and 600  GeV/c2, the dark matter particle mass being anywhere below m(T'). The data are consistent with standard model expectations, and we set 95% confidence level limits on the generic production of T'T' → tt + X + X. For the dark matter model we exclude T' at 95% confidence level up to m(T') = 360  GeV/c2 for m(X) ≤ 100  GeV/c2.

  2. A measurement of the top quark mass in 1.96 TeV proton-antiproton collisions using a novel matrix element method

    Energy Technology Data Exchange (ETDEWEB)

    Freeman, John C.; /LBL, Berkeley

    2007-12-01

    A measurement of the top quark mass in t{bar t} {yields} l + jets candidate events, obtained from p{bar p} collisions at {radical}s = 1.96 TeV at the Fermilab Tevatron using the CDF II detector, is presented. The measurement approach is that of a matrix element method. For each candidate event, a two dimensional likelihood is calculated in the top pole mass and a constant scale factor, 'JES', where JES multiplies the input particle jet momenta and is designed to account for the systematic uncertainty of the jet momentum reconstruction. As with all matrix elements techniques, the method involves an integration using the Standard Model matrix element for tt production and decay. however, the technique presented is unique in that the matrix element is modified to compensate for kinematic assumptions which are made to reduce computation time. Background events are dealt with through use of an event observable which distinguishes signal from background, as well as through a cut on the value of an event's maximum likelihood. Results are based on a 955 pb{sup -1} data sample, using events with a high-p{sub T} lepton and exactly four high-energy jets, at least one of which is tagged as coming from a b quark; 149 events pass all the selection requirements. They find M{sub meas} = 169.8 {+-} 2.3(stat.) {+-} 1.4(syst.) GeV/c{sup 2}.

  3. Search for a dijet resonance in events with jets and missing transverse energy in pp¯ collisions at s=1.96TeV

    Science.gov (United States)

    Aaltonen, T.; Amerio, S.; Amidei, D.; Anastassov, A.; Annovi, A.; Antos, J.; Apollinari, G.; Appel, J. A.; Arisawa, T.; Artikov, A.; Asaadi, J.; Ashmanskas, W.; Auerbach, B.; Aurisano, A.; Azfar, F.; Badgett, W.; Bae, T.; Barbaro-Galtieri, A.; Barnes, V. E.; Barnett, B. A.; Barria, P.; Bartos, P.; Bauce, M.; Bedeschi, F.; Behari, S.; Bellettini, G.; Bellinger, J.; Benjamin, D.; Beretvas, A.; Bhatti, A.; Bland, K. R.; Blumenfeld, B.; Bocci, A.; Bodek, A.; Bortoletto, D.; Boudreau, J.; Boveia, A.; Brigliadori, L.; Bromberg, C.; Brucken, E.; Budagov, J.; Budd, H. S.; Burkett, K.; Busetto, G.; Bussey, P.; Butti, P.; Buzatu, A.; Calamba, A.; Camarda, S.; Campanelli, M.; Canelli, F.; Carls, B.; Carlsmith, D.; Carosi, R.; Carrillo, S.; Casal, B.; Casarsa, M.; Castro, A.; Catastini, P.; Cauz, D.; Cavaliere, V.; Cavalli-Sforza, M.; Cerri, A.; Cerrito, L.; Chen, Y. C.; Chertok, M.; Chiarelli, G.; Chlachidze, G.; Cho, K.; Chokheli, D.; Clark, A.; Clarke, C.; Convery, M. E.; Conway, J.; Corbo, M.; Cordelli, M.; Cox, C. A.; Cox, D. J.; Cremonesi, M.; Cruz, D.; Cuevas, J.; Culbertson, R.; d'Ascenzo, N.; Datta, M.; de Barbaro, P.; Demortier, L.; Deninno, M.; D'Errico, M.; Devoto, F.; Di Canto, A.; Di Ruzza, B.; Dittmann, J. R.; Donati, S.; D'Onofrio, M.; Dorigo, M.; Driutti, A.; Ebina, K.; Edgar, R.; Elagin, A.; Erbacher, R.; Errede, S.; Esham, B.; Farrington, S.; Fernández Ramos, J. P.; Field, R.; Flanagan, G.; Forrest, R.; Franklin, M.; Freeman, J. C.; Frisch, H.; Funakoshi, Y.; Galloni, C.; Garfinkel, A. F.; Garosi, P.; Gerberich, H.; Gerchtein, E.; Giagu, S.; Giakoumopoulou, V.; Gibson, K.; Ginsburg, C. M.; Giokaris, N.; Giromini, P.; Giurgiu, G.; Glagolev, V.; Glenzinski, D.; Gold, M.; Goldin, D.; Golossanov, A.; Gomez, G.; Gomez-Ceballos, G.; Goncharov, M.; González López, O.; Gorelov, I.; Goshaw, A. T.; Goulianos, K.; Gramellini, E.; Grinstein, S.; Grosso-Pilcher, C.; Group, R. C.; Guimaraes da Costa, J.; Hahn, S. R.; Han, J. Y.; Happacher, F.; Hara, K.; Hare, M.; Harr, R. F.; Harrington-Taber, T.; Hatakeyama, K.; Hays, C.; Heinrich, J.; Herndon, M.; Hocker, A.; Hong, Z.; Hopkins, W.; Hou, S.; Hughes, R. E.; Husemann, U.; Hussein, M.; Huston, J.; Introzzi, G.; Iori, M.; Ivanov, A.; James, E.; Jang, D.; Jayatilaka, B.; Jeon, E. J.; Jindariani, S.; Jones, M.; Joo, K. K.; Jun, S. Y.; Junk, T. R.; Kambeitz, M.; Kamon, T.; Karchin, P. E.; Kasmi, A.; Kato, Y.; Ketchum, W.; Keung, J.; Kilminster, B.; Kim, D. H.; Kim, H. S.; Kim, J. E.; Kim, M. J.; Kim, S. H.; Kim, S. B.; Kim, Y. J.; Kim, Y. K.; Kimura, N.; Kirby, M.; Knoepfel, K.; Kondo, K.; Kong, D. J.; Konigsberg, J.; Kotwal, A. V.; Kreps, M.; Kroll, J.; Kruse, M.; Kuhr, T.; Kurata, M.; Laasanen, A. T.; Lammel, S.; Lancaster, M.; Lannon, K.; Latino, G.; Lee, H. S.; Lee, J. S.; Leo, S.; Leone, S.; Lewis, J. D.; Limosani, A.; Lipeles, E.; Lister, A.; Liu, H.; Liu, Q.; Liu, T.; Lockwitz, S.; Loginov, A.; Lucchesi, D.; Lucà, A.; Lueck, J.; Lujan, P.; Lukens, P.; Lungu, G.; Lys, J.; Lysak, R.; Madrak, R.; Maestro, P.; Malik, S.; Manca, G.; Manousakis-Katsikakis, A.; Marchese, L.; Margaroli, F.; Marino, P.; Martínez, M.; Matera, K.; Mattson, M. E.; Mazzacane, A.; Mazzanti, P.; McNulty, R.; Mehta, A.; Mehtala, P.; Mesropian, C.; Miao, T.; Mietlicki, D.; Mitra, A.; Miyake, H.; Moed, S.; Moggi, N.; Moon, C. S.; Moore, R.; Morello, M. J.; Mukherjee, A.; Muller, Th.; Murat, P.; Mussini, M.; Nachtman, J.; Nagai, Y.; Naganoma, J.; Nakano, I.; Napier, A.; Nett, J.; Neu, C.; Nigmanov, T.; Nodulman, L.; Noh, S. Y.; Norniella, O.; Oakes, L.; Oh, S. H.; Oh, Y. D.; Oksuzian, I.; Okusawa, T.; Orava, R.; Ortolan, L.; Pagliarone, C.; Palencia, E.; Palni, P.; Papadimitriou, V.; Parker, W.; Pauletta, G.; Paulini, M.; Paus, C.; Phillips, T. J.; Piacentino, G.; Pianori, E.; Pilot, J.; Pitts, K.; Plager, C.; Pondrom, L.; Poprocki, S.; Potamianos, K.; Pranko, A.; Prokoshin, F.; Ptohos, F.; Punzi, G.; Ranjan, N.; Redondo Fernández, I.; Renton, P.; Rescigno, M.; Rimondi, F.; Ristori, L.; Robson, A.; Rodriguez, T.; Rolli, S.; Ronzani, M.; Roser, R.; Rosner, J. L.; Ruffini, F.; Ruiz, A.; Russ, J.; Rusu, V.; Sakumoto, W. K.; Sakurai, Y.; Santi, L.; Sato, K.; Saveliev, V.; Savoy-Navarro, A.; Schlabach, P.; Schmidt, E. E.; Schwarz, T.; Scodellaro, L.; Scuri, F.; Seidel, S.; Seiya, Y.; Semenov, A.; Sforza, F.; Shalhout, S. Z.; Shears, T.; Shepard, P. F.; Shimojima, M.; Shochet, M.; Shreyber-Tecker, I.; Simonenko, A.; Sliwa, K.; Smith, J. R.; Snider, F. D.; Song, H.; Sorin, V.; St. Denis, R.; Stancari, M.; Stentz, D.; Strologas, J.; Sudo, Y.; Sukhanov, A.; Suslov, I.; Takemasa, K.; Takeuchi, Y.; Tang, J.; Tecchio, M.; Teng, P. K.; Thom, J.; Thomson, E.; Thukral, V.; Toback, D.; Tokar, S.; Tollefson, K.; Tomura, T.; Tonelli, D.; Torre, S.; Torretta, D.; Totaro, P.; Trovato, M.; Ukegawa, F.; Uozumi, S.; Vázquez, F.; Velev, G.; Vellidis, C.; Vernieri, C.; Vidal, M.; Vilar, R.; Vizán, J.; Vogel, M.; Volpi, G.; Wagner, P.; Wallny, R.; Wang, S. M.; Waters, D.; Wester, W. C., III; Whiteson, D.; Wicklund, A. B.; Wilbur, S.; Williams, H. H.; Wilson, J. S.; Wilson, P.; Winer, B. L.; Wittich, P.; Wolbers, S.; Wolfe, H.; Wright, T.; Wu, X.; Wu, Z.; Yamamoto, K.; Yamato, D.; Yang, T.; Yang, U. K.; Yang, Y. C.; Yao, W.-M.; Yeh, G. P.; Yi, K.; Yoh, J.; Yorita, K.; Yoshida, T.; Yu, G. B.; Yu, I.; Zanetti, A. M.; Zeng, Y.; Zhou, C.; Zucchelli, S.

    2013-11-01

    We report on a search for a dijet resonance in events with only two or three jets and a large imbalance in the total event transverse momentum. This search is sensitive to the possible production of a new particle in association with a W or Z boson, where the boson decays leptonically with one or more neutrinos in the final state. We use the full data set collected by the CDF II detector at the Tevatron collider at a proton-antiproton center-of-mass energy of 1.96 TeV. These data correspond to an integrated luminosity of 9.1fb-1. We study the invariant mass distribution of the two jets with highest transverse energy. We find good agreement between data and standard model background expectations and measure the combined cross section for WW, WZ, and ZZ production to be 13.8-2.7+3.0pb. No significant anomalies are observed in the mass spectrum, and 95% credibility level upper limits are set on the production rates of a potential new particle in association with a W or Z boson.

  4. Measurement of the Bc± production cross section in p p ¯ collisions at √{s }=1.96 TeV

    Science.gov (United States)

    Aaltonen, T.; Amerio, S.; Amidei, D.; Anastassov, A.; Annovi, A.; Antos, J.; Apollinari, G.; Appel, J. A.; Arisawa, T.; Artikov, A.; Asaadi, J.; Ashmanskas, W.; Auerbach, B.; Aurisano, A.; Azfar, F.; Badgett, W.; Bae, T.; Barbaro-Galtieri, A.; Barnes, V. E.; Barnett, B. A.; Barria, P.; Bartos, P.; Bauce, M.; Bedeschi, F.; Behari, S.; Bellettini, G.; Bellinger, J.; Benjamin, D.; Beretvas, A.; Bhatti, A.; Bland, K. R.; Blumenfeld, B.; Bocci, A.; Bodek, A.; Bortoletto, D.; Boudreau, J.; Boveia, A.; Brigliadori, L.; Bromberg, C.; Brucken, E.; Budagov, J.; Budd, H. S.; Burkett, K.; Busetto, G.; Bussey, P.; Butti, P.; Buzatu, A.; Calamba, A.; Camarda, S.; Campanelli, M.; Canelli, F.; Carls, B.; Carlsmith, D.; Carosi, R.; Carrillo, S.; Casal, B.; Casarsa, M.; Castro, A.; Catastini, P.; Cauz, D.; Cavaliere, V.; Cerri, A.; Cerrito, L.; Chen, Y. C.; Chertok, M.; Chiarelli, G.; Chlachidze, G.; Cho, K.; Chokheli, D.; Clark, A.; Clarke, C.; Convery, M. E.; Conway, J.; Corbo, M.; Cordelli, M.; Cox, C. A.; Cox, D. J.; Cremonesi, M.; Cruz, D.; Cuevas, J.; Culbertson, R.; d'Ascenzo, N.; Datta, M.; de Barbaro, P.; Demortier, L.; Deninno, M.; D'Errico, M.; Devoto, F.; Di Canto, A.; Di Ruzza, B.; Dittmann, J. R.; Donati, S.; D'Onofrio, M.; Dorigo, M.; Driutti, A.; Ebina, K.; Edgar, R.; Erbacher, R.; Errede, S.; Esham, B.; Farrington, S.; Fernández Ramos, J. P.; Field, R.; Flanagan, G.; Forrest, R.; Franklin, M.; Freeman, J. C.; Frisch, H.; Funakoshi, Y.; Galloni, C.; Garfinkel, A. F.; Garosi, P.; Gerberich, H.; Gerchtein, E.; Giagu, S.; Giakoumopoulou, V.; Gibson, K.; Ginsburg, C. M.; Giokaris, N.; Giromini, P.; Glagolev, V.; Glenzinski, D.; Gold, M.; Goldin, D.; Golossanov, A.; Gomez, G.; Gomez-Ceballos, G.; Goncharov, M.; González López, O.; Gorelov, I.; Goshaw, A. T.; Goulianos, K.; Gramellini, E.; Grosso-Pilcher, C.; Guimaraes da Costa, J.; Hahn, S. R.; Han, J. Y.; Happacher, F.; Hara, K.; Hare, M.; Harr, R. F.; Harrington-Taber, T.; Hartz, M.; Hatakeyama, K.; Hays, C.; Heinrich, J.; Herndon, M.; Hocker, A.; Hong, Z.; Hopkins, W.; Hou, S.; Hughes, R. E.; Husemann, U.; Hussein, M.; Huston, J.; Introzzi, G.; Iori, M.; Ivanov, A.; James, E.; Jang, D.; Jayatilaka, B.; Jeon, E. J.; Jindariani, S.; Jones, M.; Joo, K. K.; Jun, S. Y.; Junk, T. R.; Kambeitz, M.; Kamon, T.; Karchin, P. E.; Kasmi, A.; Kato, Y.; Ketchum, W.; Keung, J.; Kilminster, B.; Kim, D. H.; Kim, H. S.; Kim, J. E.; Kim, M. J.; Kim, S. H.; Kim, S. B.; Kim, Y. J.; Kim, Y. K.; Kimura, N.; Kirby, M.; Knoepfel, K.; Kondo, K.; Kong, D. J.; Konigsberg, J.; Kotwal, A. V.; Kreps, M.; Kroll, J.; Kruse, M.; Kuhr, T.; Kurata, M.; Laasanen, A. T.; Lammel, S.; Lancaster, M.; Lannon, K.; Latino, G.; Lee, H. S.; Lee, J. S.; Leo, S.; Leone, S.; Lewis, J. D.; Limosani, A.; Lipeles, E.; Lister, A.; Liu, Q.; Liu, T.; Lockwitz, S.; Loginov, A.; Lucchesi, D.; Lucà, A.; Lueck, J.; Lujan, P.; Lukens, P.; Lungu, G.; Lys, J.; Lysak, R.; Madrak, R.; Maestro, P.; Malik, S.; Manca, G.; Manousakis-Katsikakis, A.; Marchese, L.; Margaroli, F.; Marino, P.; Matera, K.; Mattson, M. E.; Mazzacane, A.; Mazzanti, P.; McNulty, R.; Mehta, A.; Mehtala, P.; Mesropian, C.; Miao, T.; Mietlicki, D.; Mitra, A.; Miyake, H.; Moed, S.; Moggi, N.; Moon, C. S.; Moore, R.; Morello, M. J.; Mukherjee, A.; Muller, Th.; Murat, P.; Mussini, M.; Nachtman, J.; Nagai, Y.; Naganoma, J.; Nakano, I.; Napier, A.; Nett, J.; Nigmanov, T.; Nodulman, L.; Noh, S. Y.; Norniella, O.; Oakes, L.; Oh, S. H.; Oh, Y. D.; Okusawa, T.; Orava, R.; Ortolan, L.; Pagliarone, C.; Palencia, E.; Palni, P.; Papadimitriou, V.; Parker, W.; Pauletta, G.; Paulini, M.; Paus, C.; Phillips, T. J.; Piacentino, G.; Pianori, E.; Pilot, J.; Pitts, K.; Plager, C.; Pondrom, L.; Poprocki, S.; Potamianos, K.; Pranko, A.; Prokoshin, F.; Ptohos, F.; Punzi, G.; Redondo Fernández, I.; Renton, P.; Rescigno, M.; Rimondi, F.; Ristori, L.; Robson, A.; Rodriguez, T.; Rolli, S.; Ronzani, M.; Roser, R.; Rosner, J. L.; Ruffini, F.; Ruiz, A.; Russ, J.; Rusu, V.; Sakumoto, W. K.; Sakurai, Y.; Santi, L.; Sato, K.; Saveliev, V.; Savoy-Navarro, A.; Schlabach, P.; Schmidt, E. E.; Schwarz, T.; Scodellaro, L.; Scuri, F.; Seidel, S.; Seiya, Y.; Semenov, A.; Sforza, F.; Shalhout, S. Z.; Shears, T.; Shepard, P. F.; Shimojima, M.; Shochet, M.; Shreyber-Tecker, I.; Simonenko, A.; Sliwa, K.; Smith, J. R.; Snider, F. D.; Song, H.; Sorin, V.; St. Denis, R.; Stancari, M.; Stentz, D.; Strologas, J.; Sudo, Y.; Sukhanov, A.; Suslov, I.; Takemasa, K.; Takeuchi, Y.; Tang, J.; Tecchio, M.; Teng, P. K.; Thom, J.; Thomson, E.; Thukral, V.; Toback, D.; Tokar, S.; Tollefson, K.; Tomura, T.; Tonelli, D.; Torre, S.; Torretta, D.; Totaro, P.; Trovato, M.; Ukegawa, F.; Uozumi, S.; Vázquez, F.; Velev, G.; Vellidis, C.; Vernieri, C.; Vidal, M.; Vilar, R.; Vizán, J.; Vogel, M.; Volpi, G.; Wagner, P.; Wallny, R.; Wang, S. M.; Waters, D.; Wester, W. C.; Whiteson, D.; Wicklund, A. B.; Wilbur, S.; Williams, H. H.; Wilson, J. S.; Wilson, P.; Winer, B. L.; Wittich, P.; Wolbers, S.; Wolfe, H.; Wright, T.; Wu, X.; Wu, Z.; Yamamoto, K.; Yamato, D.; Yang, T.; Yang, U. K.; Yang, Y. C.; Yao, W.-M.; Yeh, G. P.; Yi, K.; Yoh, J.; Yorita, K.; Yoshida, T.; Yu, G. B.; Yu, I.; Zanetti, A. M.; Zeng, Y.; Zhou, C.; Zucchelli, S.; CDF Collaboration

    2016-03-01

    We describe a measurement of the ratio of the cross sections times branching fractions of the Bc+ meson in the decay mode Bc+→J /ψ μ+ν to the B+ meson in the decay mode B+→J /ψ K+ in proton-antiproton collisions at center-of-mass energy √{s }=1.96 TeV . The measurement is based on the complete CDF Run II data set, which comes from an integrated luminosity of 8.7 fb-1. The ratio of the production cross sections times branching fractions for Bc+ and B+ mesons with momentum transverse to the beam greater than 6 GeV /c and rapidity magnitude smaller than 0.6 is 0.211 ±0.012 (stat)-0.020 +0.021(syst ) . Using the known B+→J /ψ K+ branching fraction, the known B+ production cross section, and a selection of the predicted Bc+→J /ψ μ+ν branching fractions, the range for the total Bc+ production cross section is estimated.

  5. Measurement of vector boson plus D*(2010)+ meson production in p ¯p collisions at √{s }=1.96 TeV

    Science.gov (United States)

    Aaltonen, T.; Amerio, S.; Amidei, D.; Anastassov, A.; Annovi, A.; Antos, J.; Apollinari, G.; Appel, J. A.; Arisawa, T.; Artikov, A.; Asaadi, J.; Ashmanskas, W.; Auerbach, B.; Aurisano, A.; Azfar, F.; Badgett, W.; Bae, T.; Barbaro-Galtieri, A.; Barnes, V. E.; Barnett, B. A.; Barria, P.; Bartos, P.; Bauce, M.; Bedeschi, F.; Behari, S.; Bellettini, G.; Bellinger, J.; Benjamin, D.; Beretvas, A.; Bhatti, A.; Bland, K. R.; Blumenfeld, B.; Bocci, A.; Bodek, A.; Bortoletto, D.; Boudreau, J.; Boveia, A.; Brigliadori, L.; Bromberg, C.; Brucken, E.; Budagov, J.; Budd, H. S.; Burkett, K.; Busetto, G.; Bussey, P.; Butti, P.; Buzatu, A.; Calamba, A.; Camarda, S.; Campanelli, M.; Canelli, F.; Carls, B.; Carlsmith, D.; Carosi, R.; Carrillo, S.; Casal, B.; Casarsa, M.; Castro, A.; Catastini, P.; Cauz, D.; Cavaliere, V.; Cerri, A.; Cerrito, L.; Chen, Y. C.; Chertok, M.; Chiarelli, G.; Chlachidze, G.; Cho, K.; Chokheli, D.; Clark, A.; Clarke, C.; Convery, M. E.; Conway, J.; Corbo, M.; Cordelli, M.; Cox, C. A.; Cox, D. J.; Cremonesi, M.; Cruz, D.; Cuevas, J.; Culbertson, R.; d'Ascenzo, N.; Datta, M.; de Barbaro, P.; Demortier, L.; Deninno, M.; D'Errico, M.; Devoto, F.; Di Canto, A.; Di Ruzza, B.; Dittmann, J. R.; Donati, S.; D'Onofrio, M.; Dorigo, M.; Driutti, A.; Ebina, K.; Edgar, R.; Elagin, A.; Erbacher, R.; Errede, S.; Esham, B.; Farrington, S.; Fernández Ramos, J. P.; Field, R.; Flanagan, G.; Forrest, R.; Franklin, M.; Freeman, J. C.; Frisch, H.; Funakoshi, Y.; Galloni, C.; Garfinkel, A. F.; Garosi, P.; Gerberich, H.; Gerchtein, E.; Giagu, S.; Giakoumopoulou, V.; Gibson, K.; Ginsburg, C. M.; Giokaris, N.; Giromini, P.; Glagolev, V.; Glenzinski, D.; Gold, M.; Goldin, D.; Golossanov, A.; Gomez, G.; Gomez-Ceballos, G.; Goncharov, M.; González López, O.; Gorelov, I.; Goshaw, A. T.; Goulianos, K.; Gramellini, E.; Grosso-Pilcher, C.; Group, R. C.; Guimaraes da Costa, J.; Hahn, S. R.; Han, J. Y.; Happacher, F.; Hara, K.; Hare, M.; Harr, R. F.; Harrington-Taber, T.; Hatakeyama, K.; Hays, C.; Heinrich, J.; Herndon, M.; Hocker, A.; Hong, Z.; Hopkins, W.; Hou, S.; Hughes, R. E.; Husemann, U.; Hussein, M.; Huston, J.; Introzzi, G.; Iori, M.; Ivanov, A.; James, E.; Jang, D.; Jayatilaka, B.; Jeon, E. J.; Jindariani, S.; Jones, M.; Joo, K. K.; Jun, S. Y.; Junk, T. R.; Kambeitz, M.; Kamon, T.; Karchin, P. E.; Kasmi, A.; Kato, Y.; Ketchum, W.; Keung, J.; Kilminster, B.; Kim, D. H.; Kim, H. S.; Kim, J. E.; Kim, M. J.; Kim, S. H.; Kim, S. B.; Kim, Y. J.; Kim, Y. K.; Kimura, N.; Kirby, M.; Knoepfel, K.; Kondo, K.; Kong, D. J.; Konigsberg, J.; Kotwal, A. V.; Kreps, M.; Kroll, J.; Kruse, M.; Kuhr, T.; Kurata, M.; Laasanen, A. T.; Lammel, S.; Lancaster, M.; Lannon, K.; Latino, G.; Lee, H. S.; Lee, J. S.; Leo, S.; Leone, S.; Lewis, J. D.; Limosani, A.; Lipeles, E.; Lister, A.; Liu, H.; Liu, Q.; Liu, T.; Lockwitz, S.; Loginov, A.; Lucchesi, D.; Lucà, A.; Lueck, J.; Lujan, P.; Lukens, P.; Lungu, G.; Lys, J.; Lysak, R.; Madrak, R.; Maestro, P.; Malik, S.; Manca, G.; Manousakis-Katsikakis, A.; Marchese, L.; Margaroli, F.; Marino, P.; Matera, K.; Mattson, M. E.; Mazzacane, A.; Mazzanti, P.; McNulty, R.; Mehta, A.; Mehtala, P.; Mesropian, C.; Miao, T.; Mietlicki, D.; Mitra, A.; Miyake, H.; Moed, S.; Moggi, N.; Moon, C. S.; Moore, R.; Morello, M. J.; Mukherjee, A.; Muller, Th.; Murat, P.; Mussini, M.; Nachtman, J.; Nagai, Y.; Naganoma, J.; Nakano, I.; Napier, A.; Nett, J.; Neu, C.; Nigmanov, T.; Nodulman, L.; Noh, S. Y.; Norniella, O.; Oakes, L.; Oh, S. H.; Oh, Y. D.; Oksuzian, I.; Okusawa, T.; Orava, R.; Ortolan, L.; Pagliarone, C.; Palencia, E.; Palni, P.; Papadimitriou, V.; Parker, W.; Pauletta, G.; Paulini, M.; Paus, C.; Phillips, T. J.; Piacentino, G.; Pianori, E.; Pilot, J.; Pitts, K.; Plager, C.; Pondrom, L.; Poprocki, S.; Potamianos, K.; Pranko, A.; Prokoshin, F.; Ptohos, F.; Punzi, G.; Redondo Fernández, I.; Renton, P.; Rescigno, M.; Rimondi, F.; Ristori, L.; Robson, A.; Rodriguez, T.; Rolli, S.; Ronzani, M.; Roser, R.; Rosner, J. L.; Ruffini, F.; Ruiz, A.; Russ, J.; Rusu, V.; Sakumoto, W. K.; Sakurai, Y.; Santi, L.; Sato, K.; Saveliev, V.; Savoy-Navarro, A.; Schlabach, P.; Schmidt, E. E.; Schwarz, T.; Scodellaro, L.; Scuri, F.; Seidel, S.; Seiya, Y.; Semenov, A.; Sforza, F.; Shalhout, S. Z.; Shears, T.; Shepard, P. F.; Shimojima, M.; Shochet, M.; Shreyber-Tecker, I.; Simonenko, A.; Sliwa, K.; Smith, J. R.; Snider, F. D.; Song, H.; Sorin, V.; Denis, R. St.; Stancari, M.; Stentz, D.; Strologas, J.; Sudo, Y.; Sukhanov, A.; Suslov, I.; Takemasa, K.; Takeuchi, Y.; Tang, J.; Tecchio, M.; Teng, P. K.; Thom, J.; Thomson, E.; Thukral, V.; Toback, D.; Tokar, S.; Tollefson, K.; Tomura, T.; Tonelli, D.; Torre, S.; Torretta, D.; Totaro, P.; Trovato, M.; Ukegawa, F.; Uozumi, S.; Vázquez, F.; Velev, G.; Vellidis, C.; Vernieri, C.; Vidal, M.; Vilar, R.; Vizán, J.; Vogel, M.; Volpi, G.; Wagner, P.; Wallny, R.; Wang, S. M.; Waters, D.; Wester, W. C.; Whiteson, D.; Wicklund, A. B.; Wilbur, S.; Williams, H. H.; Wilson, J. S.; Wilson, P.; Winer, B. L.; Wittich, P.; Wolbers, S.; Wolfe, H.; Wright, T.; Wu, X.; Wu, Z.; Yamamoto, K.; Yamato, D.; Yang, T.; Yang, U. K.; Yang, Y. C.; Yao, W.-M.; Yeh, G. P.; Yi, K.; Yoh, J.; Yorita, K.; Yoshida, T.; Yu, G. B.; Yu, I.; Zanetti, A. M.; Zeng, Y.; Zhou, C.; Zucchelli, S.; CDF Collaboration

    2016-03-01

    A measurement of vector boson (V ) production in conjunction with a D*(2010)+meson is presented. Using a data sample corresponding to 9.7 fb-1 of proton-antiproton collisions at center-of-mass energy √{s }=1.96 TeV produced by the Fermilab Tevatron, we reconstruct V +D*+ samples with the CDF II detector. The D*+ is fully reconstructed in the D*(2010)+→D0(→K-π+)π+ decay mode. This technique is sensitive to the associated production of vector boson plus charm or bottom mesons. We measure the ratio of production cross sections σ (W +D*)/σ (W )=[1.75 ±0.13 (stat ) ±0.09 (stat ) ]% and σ (Z +D*)/σ (Z )=[1.5 ±0.4 (stat ) ±0.2 (stat ) ]% and perform a differential measurement of d σ (W +D*)/d pT(D*). Event properties are utilized to determine the fraction of V +D*(2010)+ events originating from different production processes. The results are in agreement with the predictions obtained with the pythia program, limiting possible contribution from non-standard-model physics processes.

  6. Measurements of the B Production Cross Section in Proton-Antiproton Collisions at √s = 1.96 TeV using semileptonic decays of b hadrons

    Energy Technology Data Exchange (ETDEWEB)

    Kraus, James Alexander [Univ. of Illinois, Urbana-Champaign, IL (United States)

    2006-07-01

    The authors present a measurement of the cross section of b hadron (Hb) production in p$\\bar{p}$ collisions at √s = 1.96 TeV using the CDF II detector at the Fermilab Tevatron. They use 83 pb-1 of data taken between october 2002 and May 2003 that was collected with a trigger sensitive to high momentum muons and displaced tracks. They use partially reconstructed decays in the following modes: Hb → μ- $\\bar{v}$μD0X, D0 → K-π+, and Hb → μ-$\\bar{v}$μD*+ X, D*+ → D0π+, D0 → K- π+, and their charge conjugates. They correct for the backgrounds from c$\\bar{c}$ and b$\\bar{b}$ decays, for trigger and reconstruction efficiencies, and for detector acceptance. They report the total cross section above a minimum transverse momentum (pT) of 9 GeV/c for the rapidity range |y| ≤ 0.6.

  7. Search for the supersymmetric partner of the top quark in ppbar collisions at sqrt(s) = 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Aaltonen, T.; /Helsinki Inst. of Phys.; Alvarez Gonzalez, B.; /Oviedo U. /Cantabria Inst. of Phys.; Amerio, S.; /INFN, Padua; Amidei, D.; /Michigan U.; Anastassov, A.; /Northwestern U.; Annovi, A.; /Frascati; Antos, J.; /Comenius U.; Apollinari, G.; /Fermilab; Appel, J.A.; /Fermilab; Apresyan, A.; /Purdue U.; Arisawa, T.; /Waseda U. /Dubna, JINR

    2010-09-01

    We present a search for the lightest supersymmetric partner of the top quark in proton-antiproton collisions at a center-of-mass energy {radical}s = 1.96 TeV. This search was conducted within the framework of the R-parity conserving minimal supersymmetric extension of the standard model, assuming the stop decays dominantly to a lepton, a sneutrino, and a bottom quark. We searched for events with two oppositely-charged leptons, at least one jet, and missing transverse energy in a data sample corresponding to an integrated luminosity of 1 fb{sup -1} collected by the CDF experiment. No significant evidence of a stop quark signal was found. Exclusion limits at 95% confidence level in the stop quark versus sneutrino mass plane are set. Stop quark masses up to 180 GeV/c{sup 2} are excluded for sneutrino masses around 45 GeV/c{sup 2}, and sneutrino masses up to 116 GeV/c{sup 2} are excluded for stop quark masses around 150 GeV/c{sup 2}.

  8. Search for charged Higgs bosons in decays of top quarks in proton - antiproton collisions at √s = 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Geum Bong [Univ. of Rochester, NY (United States)

    2009-01-01

    In this dissertation we report on the first direct search for charged Higgs bosons in decays of top quarks in p$\\bar{p}$ collisions at √s = 1.96 TeV. The search uses a data sample with an integrated luminosity of 2.2 fb-1 collected by the CDF II detector at Fermilab and looks for a resonance in the invariant mass distribution of two jets in the lepton+jets sample of t$\\bar{t}$ candidates. We observe no evidence of charged Higgs bosons in top quark decays; hence 95% C.L. upper limits on the branching ratio are placed at β(t → H+b) < 0.1 to 0.3 for charged Higgs boson masses of 60 to 150 GeV/c2 assuming β(H+ → c$\\bar{s}$) = 1.0 and β(t → Wb)+β(t → H+b) = 1.0. The upper limits on β(t → H+b) are also used as model independent limits on the decay branching ratio of top quarks to any charged scalar bosons beyond the standard model.

  9. Search for charged Higgs bosons in decays of top quarks in p anti-p collisions at s**(1/2) = 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Aaltonen, T.; /Helsinki U. /Helsinki Inst. of Phys.; Adelman, J.; /Chicago U., EFI; Akimoto, T.; /Tsukuba U.; Alvarez Gonzalez, B.; /Cantabria Inst. of Phys.; Amerio, S.; /Padua U. /INFN, Padua; Amidei, D.; /Michigan U.; Anastassov, A.; /Northwestern U.; Annovi, A.; /Frascati; Antos, J.; /Comenius U.; Apollinari, G.; /Fermilab; Apresyan, A.; /Purdue U. /Waseda U.

    2009-07-01

    We report on the first direct search for charged Higgs bosons in decays of top quarks in p{bar p} collisions at {radical}s = 1.96 TeV. The search uses a data sample corresponding to an integrated luminosity of 2.2 fb{sup -1} collected by the CDF II detector at Fermilab, and looks for a resonance in the invariant mass distribution of two jets in the lepton+jets sample of t{bar t} candidates. We observe no evidence of charged Higgs bosons in top quark decays. Hence, 95% upper limits on the top quark decay branching ratio are placed at {Beta}(t {yields} H{sup +}b) < 0.1 to 0.3 for charged Higgs boson masses of 60 to 150 GeV/c{sup 2}, assuming {Beta}(H{sup +} {yields} c{bar s}) = 1.0. The upper limits on {Beta}(t {yields} H{sup +}b) can also be used as model-independent limits on the decay branching ratio of top quarks to generic scalar charged bosons beyond the standard model.

  10. Search for the Flavor Changing Neutral Current Decay t --> Z q at sqrt(s) = 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Gimmell, Jennifer Lindsay; /Rochester U.

    2009-01-01

    This thesis reports the results of a search for the flavor changing neutral current decay of the top quark, t {yields} Zq, in decays of t{bar t} pairs produced in p{bar p} collisions at a center-of-mass energy of 1.96 TeV. This search is performed on a data sample recorded by the Collider Detector at Fermilab (CDF), corresponding to an integrated luminosity of 1.9 fb{sup -1}. This search follows a previous CDF analysis that resulted in an upper limit for the branching fraction {Beta}(t {yields} Zq) of 10.4% at 95% C.L. using a dataset equivalent to 1.1 fb{sup -1} of integrated luminosity. This thesis extends to 1.9 fb{sup -1} of data, and has improved sensitivity to the small signal with the introduction of a template fit technique that includes systematic uncertainties by a linear interpolation between templates. Using a Feldman-Cousins construction, an upper limit at 95% C.L. is set on {Beta}(t {yields} Zq) of 3.7%, with the expected upper limit in absence of a signal is 5.0 {+-} 2.2% for a top mass of 175 GeV/c{sup 2}.

  11. Observation of exclusive charmonium production and gammagamma --> micro;{+}micro;{-} in pp[over] collisions at sqrt[s] = 1.96 TeV.

    Science.gov (United States)

    Aaltonen, T; Adelman, J; Akimoto, T; Albrow, M G; Alvarez González, B; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Apollinari, G; Apresyan, A; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Aurisano, A; Azfar, F; Azzurri, P; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Bartsch, V; Bauer, G; Beauchemin, P-H; Bedeschi, F; Beecher, D; Behari, S; Bellettini, G; Bellinger, J; Benjamin, D; Beretvas, A; Beringer, J; Bhatti, A; Binkley, M; Bisello, D; Bizjak, I; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bolla, G; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Bridgeman, A; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, J; Budd, H S; Budd, S; Burke, S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Byrum, K L; Cabrera, S; Calancha, C; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carls, B; Carlsmith, D; Carosi, R; Carrillo, S; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavaliere, V; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, K; Chokheli, D; Chou, J P; Choudalakis, G; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Chwalek, T; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Compostella, G; Convery, M E; Conway, J; Cordelli, M; Cortiana, G; Cox, C A; Cox, D J; Crescioli, F; Cuenca Almenar, C; Cuevas, J; Culbertson, R; Cully, J C; Dagenhart, D; Datta, M; Davies, T; de Barbaro, P; De Cecco, S; Deisher, A; De Lorenzo, G; Dell'orso, M; Deluca, C; Demortier, L; Deng, J; Deninno, M; Derwent, P F; di Giovanni, G P; Dionisi, C; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Donati, S; Dong, P; Donini, J; Dorigo, T; Dube, S; Efron, J; Elagin, A; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, W T; Feild, R G; Feindt, M; Fernandez, J P; Ferrazza, C; Field, R; Flanagan, G; Forrest, R; Frank, M J; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; Garberson, F; Garcia, J E; Garfinkel, A F; Genser, K; Gerberich, H; Gerdes, D; Gessler, A; Giagu, S; Giakoumopoulou, V; Giannetti, P; Gibson, K; Gimmell, J L; Ginsburg, C M; Giokaris, N; Giordani, M; Giromini, P; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Golossanov, A; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Grinstein, S; Grosso-Pilcher, C; Grundler, U; Guimaraes da Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Hamilton, A; Han, B-Y; Han, J Y; Happacher, F; Hara, K; Hare, D; Hare, M; Harper, S; Harr, R F; Harris, R M; Hartz, M; Hatakeyama, K; Hays, C; Heck, M; Heijboer, A; Heinrich, J; Henderson, C; Herndon, M; Heuser, J; Hewamanage, S; Hidas, D; Hill, C S; Hirschbuehl, D; Hocker, A; Hou, S; Houlden, M; Hsu, S-C; Huffman, B T; Hughes, R E; Husemann, U; Hussein, M; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ivanov, A; James, E; Jang, D; Jayatilaka, B; Jeon, E J; Jha, M K; Jindariani, S; Johnson, W; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Kar, D; Karchin, P E; Kato, Y; Kephart, R; Keung, J; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, H W; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Knuteson, B; Ko, B R; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kreps, M; Kroll, J; Krop, D; Krumnack, N; Kruse, M; Krutelyov, V; Kubo, T; Kuhr, T; Kulkarni, N P; Kurata, M; Kwang, S; Laasanen, A T; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; Lecompte, T; Lee, E; Lee, H S; Lee, S W; Leone, S; Lewis, J D; Lin, C-S; Linacre, J; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, C; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Lovas, L; Lucchesi, D; Luci, C; Lueck, J; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R