WorldWideScience

Sample records for astatine 196

  1. Radiochemistry of astatine

    Energy Technology Data Exchange (ETDEWEB)

    Ruth, T J; Dombsky, M; D' Auria, J M; Ward, T E

    1988-01-01

    This monograph is a review of the literature through 1987 and covers the methods of producing the radioisotopes of astatine and the inorganic, nuclear, and organic chemistry of astatine. The discussion is limited to chemical and physical chemical properties of astatine. The monograph, after the introduction, is divided into chapters titled: production methods, nuclear spectroscopy, chemistry of astatine, separation and isolation (dry and wet), and selected procedures. 209 refs., 15 figs., 7 tabs. (DLC)

  2. Discovery of the astatine, radon, francium, and radium isotopes

    Energy Technology Data Exchange (ETDEWEB)

    Fry, C.; Thoennessen, M., E-mail: thoennessen@nscl.msu.edu

    2013-09-15

    Thirty-nine astatine, thirty-nine radon, thirty-five francium, and thirty-four radium isotopes have so far been observed; the discovery of these isotopes is described. For each isotope a brief summary of the first refereed publication, including the production and identification method, is presented.

  3. Discovery of the astatine, radon, francium, and radium isotopes

    CERN Document Server

    Fry, C

    2012-01-01

    Currently, thirty-nine astatine, thirty-nine radon, thirty-five francium, and thirty-four radium isotopes have so far been observed; the discovery of these isotopes is discussed. For each isotope a brief summary of the first refereed publication, including the production and identification method, is presented.

  4. Discovery of the astatine, radon, francium, and radium isotopes

    Science.gov (United States)

    Fry, C.; Thoennessen, M.

    2013-09-01

    Thirty-nine astatine, thirty-nine radon, thirty-five francium, and thirty-four radium isotopes have so far been observed; the discovery of these isotopes is described. For each isotope a brief summary of the first refereed publication, including the production and identification method, is presented.

  5. Delayed and In-beam Spectroscopy on Francium and Astatine Nuclei at the Proton Drip Line

    Energy Technology Data Exchange (ETDEWEB)

    Uusitalo, J.; Jakobsson, U. [Department of Physics, University of Jyvaeskylae (Finland); Collaboration: RITU-Gamma Gollaboration

    2011-11-30

    Delayed and in-beam spectroscopy on francium and astatine nuclei at and beyond the proton drip line has been performed. In neutron deficient astatine nuclei a shift to deformed shapes as a function of decreasing neutron has been obtained. In neutron deficient francium isotope the same shift is evident.

  6. Delayed and In-beam Spectroscopy on Francium and Astatine Nuclei at the Proton Drip Line

    Science.gov (United States)

    Uusitalo, J.; Jakobsson, U.

    2011-11-01

    Delayed and in-beam spectroscopy on francium and astatine nuclei at and beyond the proton drip line has been performed. In neutron deficient astatine nuclei a shift to deformed shapes as a function of decreasing neutron has been obtained. In neutron deficient francium isotope the same shift is evident.

  7. Measurement of the first ionization potential of astatine by laser ionization spectroscopy

    CERN Document Server

    Rothe, S; Antalic, S; Borschevsky, A; Capponi, L; Cocolios, T E; De Witte, H; Eliav, E; Fedorov, D V; Fedosseev, V N; Fink, D A; Fritzsche, S; Ghys, L; Huyse, M; Imai, N; Kaldor, U; Kudryavtsev, Yu; Köster, U; Lane, J; Lassen, J; Liberati, V; Lynch, K M; Marsh, B A; Nishio, K; Pauwels, D; Pershina, V; Popescu, L; Procter, T J; Radulov, D; Raeder, S; Rajabali, M M; Rapisarda, E; Rossel, R E; Sandhu, K; Seliverstov, M D; Sjödin, A M; Van den Bergh, P; Van Duppen, P; Venhart, M; Wakabayashi, Y; Wendt K D A

    2013-01-01

    The radioactive element astatine exists only in trace amounts in nature. Its properties can therefore only be explored by study of smallest quantities of artificially produced isotopes or by performing theoretical calculations. One of the most important properties influencing the chemical behaviour is the energy required to remove one electron from the valence shell, referred to as the ionization potential. Here we use laser spectroscopy to probe the optical spectrum of astatine near the ionization threshold. The observed series of Rydberg states enabled the first determination of the ionization potential of the astatine atom, 9.317510(8) eV. New ab initio calculations were performed to support the experimental result. The measured value serves as a benchmark for quantum chemistry calculations of the properties of astatine as well as for the theoretical prediction of the ionization potential of super-heavy element 117, the heaviest homologue of astatine.

  8. Measurement of the first ionization potential of astatine by laser ionization spectroscopy.

    Science.gov (United States)

    Rothe, S; Andreyev, A N; Antalic, S; Borschevsky, A; Capponi, L; Cocolios, T E; De Witte, H; Eliav, E; Fedorov, D V; Fedosseev, V N; Fink, D A; Fritzsche, S; Ghys, L; Huyse, M; Imai, N; Kaldor, U; Kudryavtsev, Yuri; Köster, U; Lane, J F W; Lassen, J; Liberati, V; Lynch, K M; Marsh, B A; Nishio, K; Pauwels, D; Pershina, V; Popescu, L; Procter, T J; Radulov, D; Raeder, S; Rajabali, M M; Rapisarda, E; Rossel, R E; Sandhu, K; Seliverstov, M D; Sjödin, A M; Van den Bergh, P; Van Duppen, P; Venhart, M; Wakabayashi, Y; Wendt, K D A

    2013-01-01

    The radioactive element astatine exists only in trace amounts in nature. Its properties can therefore only be explored by study of the minute quantities of artificially produced isotopes or by performing theoretical calculations. One of the most important properties influencing the chemical behaviour is the energy required to remove one electron from the valence shell, referred to as the ionization potential. Here we use laser spectroscopy to probe the optical spectrum of astatine near the ionization threshold. The observed series of Rydberg states enabled the first determination of the ionization potential of the astatine atom, 9.31751(8) eV. New ab initio calculations are performed to support the experimental result. The measured value serves as a benchmark for quantum chemistry calculations of the properties of astatine as well as for the theoretical prediction of the ionization potential of superheavy element 117, the heaviest homologue of astatine.

  9. Spectroscopy of low-lying states in neutron-deficient astatine and francium nuclei

    Energy Technology Data Exchange (ETDEWEB)

    Jakobsson, U., E-mail: ulrjak@kth.se; Cederwall, B. [KTH, The Division of Nuclear Physics, AlbaNova University Center, SE-10691 Stockholm (Sweden); Uusitalo, J.; Auranen, K.; Badran, H.; Cox, D. M.; Grahn, T.; Greenlees, P. T.; Julin, R.; Juutinen, S.; Herzáň, A.; Konki, J.; Leino, M.; Mallaburn, M.; Pakarinen, J.; Papadakis, P.; Partanen, J.; Rahkila, P.; Sandzelius, M.; Sarén, J. [University of Jyvaskyla, Department of Physics, P.O. Box 35, FI-40014 University of Jyvaskyla (Finland); and others

    2015-10-15

    Low-lying states in neutron-deficient astatine and francium nuclei have been studied by means of in-beam and delayed spectroscopy. The 13/2{sup +} state has been observed in francium nuclei with a similar down-sloping trend as in neighbouring astatine and bismuth isotopes, as a function of decreasing neutron number. A systematic trend can also now be seen for the 1/2{sup +} state both in astatine and francium nuclei, where the level energy decreases steeply as a function of neutron number when moving further away from the neutron shell closure. This trend is very similar between astatine nuclei and their francium isotones. Moreover, shape coexistence has been observed between the 13/2{sup +} state and the spherical 9/2{sup −} ground state in {sup 203}Fr and {sup 205}Fr.

  10. Spectroscopy of low-lying states in neutron-deficient astatine and francium nuclei

    Science.gov (United States)

    Jakobsson, U.; Uusitalo, J.; Auranen, K.; Badran, H.; Cederwall, B.; Cox, D. M.; Grahn, T.; Greenlees, P. T.; Julin, R.; Juutinen, S.; HerzáÅ, A.; Konki, J.; Leino, M.; Mallaburn, M.; Pakarinen, J.; Papadakis, P.; Partanen, J.; Rahkila, P.; Sandzelius, M.; Sarén, J.; Scholey, C.; Sorri, J.; Stolze, S.

    2015-10-01

    Low-lying states in neutron-deficient astatine and francium nuclei have been studied by means of in-beam and delayed spectroscopy. The 13/2+ state has been observed in francium nuclei with a similar down-sloping trend as in neighbouring astatine and bismuth isotopes, as a function of decreasing neutron number. A systematic trend can also now be seen for the 1/2+ state both in astatine and francium nuclei, where the level energy decreases steeply as a function of neutron number when moving further away from the neutron shell closure. This trend is very similar between astatine nuclei and their francium isotones. Moreover, shape coexistence has been observed between the 13/2+ state and the spherical 9/2- ground state in 203Fr and 205Fr.

  11. Automated astatination of biomolecules - a stepping stone towards multicenter clinical trials

    DEFF Research Database (Denmark)

    Aneheim, Emma; Albertsson, Per; Bäck, Tom

    2015-01-01

    To facilitate multicentre clinical studies on targeted alpha therapy, it is necessary to develop an automated, on-site procedure for conjugating rare, short-lived, alpha-emitting radionuclides to biomolecules. Astatine-211 is one of the few alpha-emitting nuclides with appropriate chemical...

  12. Measurement of the first ionization potential of astatine by laser ionization spectroscopy

    NARCIS (Netherlands)

    Rothe, S.; Andreyev, A. N.; Antalic, S.; Borschevsky, A.; Capponi, L.; Cocolios, T. E.; De Witte, H.; Eliav, E.; Fedorov, D. V.; Fedosseev, V. N.; Fink, D. A.; Fritzsche, S.; Ghys, L.; Huyse, M.; Imai, N.; Kaldor, U.; Kudryavtsev, Yuri; Koester, U.; Lane, J. F. W.; Lassen, J.; Liberati, V.; Lynch, K. M.; Marsh, B. A.; Nishio, K.; Pauwels, D.; Pershina, V.; Popescu, L.; Procter, T. J.; Radulov, D.; Raeder, S.; Rajabali, M. M.; Rapisarda, E.; Rossel, R. E.; Sandhu, K.; Seliverstov, M. D.; Sjoedin, A. M.; Van den Bergh, P.; Van Duppen, P.; Venhart, M.; Wakabayashi, Y.; Wendt, K. D. A.

    The radioactive element astatine exists only in trace amounts in nature. Its properties can therefore only be explored by study of the minute quantities of artificially produced isotopes or by performing theoretical calculations. One of the most important properties influencing the chemical

  13. An attempt to explore the production routes of Astatine radionuclides: Theoretical approach

    OpenAIRE

    Maiti, Moumita; Lahiri, Susanta

    2008-01-01

    In order to fulfil the recent thrust of Astatine radionuclides in the field of nuclear medicine various production routes have been explored in the present work. The possible production routes of $^{209-211}$At comprise both light and heavy ion induced reactions at the bombarding energy range starting from threshold to maximum 100 MeV energy. For this purpose, we have used the nuclear reaction model codes TALYS, ALICE91 and PACE-II. Excitation functions of those radionuclides, produced throug...

  14. Synthesis and Evaluation of Astatinated N-[2-(Maleimido)ethyl]-3-(trimethylstannyl)benzamide Immunoconjugates

    DEFF Research Database (Denmark)

    Aneheim, Emma; Gustafsson, Anna; Albertsson, Per

    2016-01-01

    Effective treatment of metastasis is a great challenge in the treatment of different types of cancers. Targeted alpha therapy utilizes the short tissue range (50-100 μm) of α particles, making the method suitable for treatment of disseminated occult cancers in the form of microtumors or even sing...... of the in vivo distribution of the new immunoconjugate with other tin-based immunoconjugates in tumor-bearing mice, the MSB conjugation method was found to be a viable option for successful astatine labeling of different monoclonal antibodies....

  15. Laser photodetachment of radioactive ions: towards the determination of the electronegativity of astatine

    CERN Multimedia

    Rothe, Sebastian; Welander, Jakob Emanuel; Chrysalidis, Katerina; Day Goodacre, Thomas; Fedosseev, Valentine; Fiotakis, Spyridon; Forstner, Oliver; Heinke, Reinhard Matthias; Johnston, Karl; Kron, Tobias; Koester, Ulli; Liu, Yuan; Marsh, Bruce; Ringvall Moberg, Annie; Rossel, Ralf Erik; Seiffert, Christoph; Studer, Dominik; Wendt, Klaus; Hanstorp, Dag

    2017-01-01

    Negatively charged ions are mainly stabilized through the electron correlation effect. A measure of the stability of a negative ion is the electron affinity, which the energy gain by attaching an electron to a neutral atom. This fundamental quantity is, due to the almost general lack of bound excited states, the only atomic property that can be determined with high accuracy for negative ions. We will present the results of the first laser photodetachment studies of radioactive negative ions at CERN-ISOLDE. The photodetachment threshold for the radiogenic iodine isotope 128I was measured successfully, demonstrating the performance of the upgraded GANDALPH experimental beam line. The first detection of photo-detached astatine atoms marks a milestone towards the determination of the EA of this radioactive element.

  16. Complexation study on no-carrier-added astatine with insulin: A candidate radiopharmaceutical

    Energy Technology Data Exchange (ETDEWEB)

    Lahiri, Susanta [Chemical Sciences Division, Saha Institute of Nuclear Physics, 1/AF Bidhannagar, Kolkata 700 064 (India)], E-mail: susanta.lahiri@saha.ac.in; Roy, Kamalika [Chemical Sciences Division, Saha Institute of Nuclear Physics, 1/AF Bidhannagar, Kolkata 700 064 (India); Sen, Souvik [Berhampur Sadar Hospital, Berhampur, Murshidabad 742 101 (India)

    2008-12-15

    No-carrier-added astatine radionuclides produced in the {sup 7}Li-irradiated lead matrix were separated from bulk lead nitrate target by complexing At with insulin, followed by dialysis. The method offers simultaneous separation of At from lead as well as its complexation with insulin. The At-insulin complex might be a potential radiopharmaceutical in the treatment of hepatocellular carcinoma. The stability of At-insulin complex was checked by dialysis against deionized water and Ringer lactate (RL) solution. It has been found that the half-life of At-insulin complex is about {approx}12 h, when dialyzed against deionized water and is only 6 h, when dialyzed against RL solution having the same composition as blood serum. The 6 h half-life of this Insulin-At complex is perfect for killing cancer cells from external cell surfaces as the half-life of internalization of insulin molecule inside the cell is 7-12 h.

  17. Determination of the electron affinity of astatine and polonium by laser photodetachment

    CERN Multimedia

    We propose to conduct the first electron affinity (EA) measurements of the two elements astatine (At) and polonium (Po). Collinear photo-detachment spectroscopy will allow us to measure these quantities with an uncertainty limited only by the spectral line width of the laser. We plan to use negative ion beams of the two radioactive elements At and Po, which are only accessible on-line and at ISOLDE. The feasibility of our proposed method and the functionality of the experimental setup have been demonstrated at ISOLDE in off-line tests by the clear observation of the photo-detachment threshold for stable iodine. This proposal is based on our Letter of Intent I-148.

  18. Adsorption of the astatine species on a gold surface: A relativistic density functional theory study

    Science.gov (United States)

    Demidov, Yuriy; Zaitsevskii, Andréi

    2018-01-01

    We report first-principle based studies of the adsorption interaction of astatine species on a gold surface. These studies are aimed primarily at the support and interpretation of gas chromatographic experiments with superheavy elements, tennessine (Ts, Z = 117), a heavier homologue of At, and possibly its pseudo-homologue nihonium (Nh, Z = 113). We use gold clusters with up to 69 atoms to simulate the adsorption sites and estimate the desorption energies of At & AtOH from a stable gold (1 1 1) surface. To describe the electronic structure of At -Aun and AtOH -Aun complexes, we combine accurate shape-consistent relativistic pseudopotentials and non-collinear two-component relativistic density functional theory. The predicted desorption energies of At and AtOH on gold are 130 ± 10 kJ/mol and 90 ± 10 kJ/mol, respectively. These results confirm the validity of the estimates derived from chromatographic data (147 ± 15 kJ/mol for At, and 100-10+20 kJ/mol for AtOH).

  19. ASTATINE-211 RADIOCHEMISTRY: THE DEVELOPMENT OF METHODOLOGIES FOR HIGH ACTIVITY LEVEL RADIOSYNTHESIS

    Energy Technology Data Exchange (ETDEWEB)

    MICHAEL R. ZALUTSKY

    2012-08-08

    Targeted radionuclide therapy is emerging as a viable approach for cancer treatment because of its potential for delivering curative doses of radiation to malignant cell populations while sparing normal tissues. Alpha particles such as those emitted by 211At are particularly attractive for this purpose because of their short path length in tissue and high energy, making them highly effective in killing cancer cells. The current impact of targeted radiotherapy in the clinical domain remains limited despite the fact that in many cases, potentially useful molecular targets and labeled compounds have already been identified. Unfortunately, putting these concepts into practice has been impeded by limitations in radiochemistry methodologies. A critical problem is that the synthesis of therapeutic radiopharmaceuticals provides additional challenges in comparison to diagnostic reagents because of the need to perform radio-synthesis at high levels of radioactivity. This is particularly important for {alpha}-particle emitters such as 211At because they deposit large amounts of energy in a highly focal manner. The overall objective of this project is to develop convenient and reproducible radiochemical methodologies for the radiohalogenation of molecules with the {alpha}-particle emitter 211At at the radioactivity levels needed for clinical studies. Our goal is to address two problems in astatine radiochemistry: First, a well known characteristic of 211At chemistry is that yields for electrophilic astatination reactions decline as the time interval after radionuclide isolation from the cyclotron target increases. This is a critical problem that must be addressed if cyclotrons are to be able to efficiently supply 211At to remote users. And second, when the preparation of high levels of 211At-labeled compounds is attempted, the radiochemical yields can be considerably lower than those encountered at tracer dose. For these reasons, clinical evaluation of promising 211At

  20. 32 CFR 196.310 - Recruitment.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Recruitment. 196.310 Section 196.310 National... Discrimination on the Basis of Sex in Admission and Recruitment Prohibited § 196.310 Recruitment. (a) Nondiscriminatory recruitment. A recipient to which §§ 196.300 through 196.310 apply shall not discriminate on the...

  1. An all-solid state laser system for the laser ion sources RILIS and in-source laser spectroscopy of astatine at ISOLDE/CERN

    Energy Technology Data Exchange (ETDEWEB)

    Rothe, Sebastian

    2012-09-24

    This doctoral thesis describes the extension of the resonance ionization laser ion source RILIS at CERN/ISOLDE by the addition of an all-solid state tunable titanium:sapphire (Ti:Sa) laser system to complement the well-established system of dye lasers. Synchronous operation of the so called Dual RILIS system of Ti:Sa and dye lasers was investigated and the potential for increased ion beam intensity, reliability, and reduced setup time has been demonstrated. In-source resonance ionization spectroscopy was performed at ISOLDE/CERN and at ISAC/TRIUMF radioactive ion beam facilities to develop an efficient and selective three-colour ionization scheme for the purely radioactive element astatine. A LabVIEW based monitoring, control and measurement system was conceived which enabled, in conjunction with Dual RILIS operation, the spectroscopy of high lying Rydberg states, from which the ionization potential of the astatine atom was determined for the first time experimentally.

  2. An all-solid state laser system for the laser ion source RILIS and in-source laser spectroscopy of astatine at ISOLDE, CERN

    CERN Document Server

    Rothe, Sebastian; Nörtershäuser, W

    This doctoral thesis describes the extension of the resonance ionization laser ion source RILIS at ISOLDE, CERN, by the addition of an all-solid state tuneable titanium: sapphire (Ti:Sa) laser system to complement the well-established system of dye lasers. Synchronous operation of the so called Dual RILIS system of Ti:Sa and dye lasers was investigated and the potential for increased ion beam intensity, reliability, and reduced setup time has been demonstrated. In-source resonance ionization spectroscopy was performed at ISOLDE, CERN, and at ISAC, TRIUMF, radioactive ion beam facilities to develop an efficient and selective three-colour ionization scheme for the purely radioactive element astatine. A LabVIEW based monitoring, control and measurement system was conceived which enabled, in conjunction with Dual RILIS operation, the spectroscopy of high lying Rydberg states, from which the ionization potential of the astatine atom was determined for the first time experimentally.

  3. 32 CFR 196.405 - Housing.

    Science.gov (United States)

    2010-07-01

    ... Discrimination on the Basis of Sex in Education Programs or Activities Prohibited § 196.405 Housing. (a... 32 National Defense 2 2010-07-01 2010-07-01 false Housing. 196.405 Section 196.405 National... different fees or requirements, or offer different services or benefits related to housing, except as...

  4. 46 CFR 196.34-10 - Use.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Use. 196.34-10 Section 196.34-10 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OCEANOGRAPHIC RESEARCH VESSELS OPERATIONS Work Vests § 196.34-10 Use. (a) Approved buoyant work vests are considered to be items of safety apparel and may be carried...

  5. 21 CFR 211.196 - Distribution records.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 4 2010-04-01 2010-04-01 false Distribution records. 211.196 Section 211.196 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) DRUGS: GENERAL CURRENT GOOD MANUFACTURING PRACTICE FOR FINISHED PHARMACEUTICALS Records and Reports § 211.196...

  6. 46 CFR 196.15-10 - Sanitation.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Sanitation. 196.15-10 Section 196.15-10 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OCEANOGRAPHIC RESEARCH VESSELS OPERATIONS Test, Drills, and Inspections § 196.15-10 Sanitation. (a) It shall be the duty of the master and chief engineer...

  7. 22 CFR 196.4 - Administering office.

    Science.gov (United States)

    2010-04-01

    ... AFFAIRS/GRADUATE FOREIGN AFFAIRS FELLOWSHIP PROGRAM § 196.4 Administering office. The Department of State.... Pickering Foreign Affairs/Graduate Foreign Affairs Fellowship Program and grants to post-secondary... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Administering office. 196.4 Section 196.4...

  8. 32 CFR 196.500 - Employment.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Employment. 196.500 Section 196.500 National... Discrimination on the Basis of Sex in Employment in Education Programs or Activities Prohibited § 196.500 Employment. (a) General. (1) No person shall, on the basis of sex, be excluded from participation in, be...

  9. Dicty_cDB: AHB196 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available library) AHB196 (Link to dictyBase) - - - - AHB196P (Link to Original site) AHB196F 192 AHB196Z 564 AHB196P...AHB196P 736 - - Show AHB196 Library AH (Link to library) Clone ID AHB196 (Link to dictyBase) Atlas ID - NBRP...biol.tsukuba.ac.jp/CSM/AH/AHB1-D/AHB196Q.Seq.d/ Representative seq. ID AHB196P (Link to Original site)...site) Representative DNA sequence >AHB196 (AHB196Q) /CSM/AH/AHB1-D/AHB196Q.Seq.d/ ATGATTATTATAATTCAAATTA...vacuolar >> prediction for AHB196 is cyt 5' end seq. ID AHB196F 5' end seq. >AHB196F.Seq ATGATTATTATAATT

  10. Final Report for research grant "Development of Methods for High Specific Activity Labeling of Biomolecules Using Astatine-211 in Different Oxidation States"

    Energy Technology Data Exchange (ETDEWEB)

    Wilbur, D. Scott [Univ. of Washington, Seattle, WA (United States)

    2011-12-14

    The overall objective of this research effort was to develop methods for labeling biomolecules with higher oxidation state species of At-211. This was to be done in an effort to develop reagents that had higher in vivo stability than the present carbon-bonded At-211-labeled compounds. We were unsuccessful in that effort, as none of the approaches studied provided reagents that were stable to in vivo deastatination. However, we gained a lot of information about At-211 in higher oxidation states. The studies proved to be very difficult as small changes in pH and other conditions appeared to change the nature of the species that obtained (by HPLC retention time analyses), with many of the species being unidentifiable. The fact that there are no stable isotopes of astatine, and the chemistry of the nearest halogen iodine is quite different, made it very difficult to interpret results of some experiments. With that said, we believe that a lot of valuable information was obtained from the studies. The research effort evaluated: (1) methods for chemical oxidation of At-211, (2) approaches to chelation of oxidized At-211, and (3) approaches to oxidation of astatophenyl compounds. A major hurdle that had to be surmounted to conduct the research was the development of HPLC conditions to separate and identify the various oxidized species formed. Attempts to develop conditions for separation of iodine and astatine species by normal and reversed-phase TLC and ITLC were not successful. However, we were successful in developing conditions (from a large number of attempts) to separate oxidized forms of iodine ([I-125]iodide, [I-125]iodate and [I-125]periodate) and astatine ([At-211]astatide, [At-211]astatate, [At-211]perastatate, and several unidentified At-211 species). Information on the basic oxidation and characterization of At-211 species is provided under Objective 1. Conditions were developed to obtain new At-211 labeling method where At-211 is chelated with the DOTA and

  11. 32 CFR 196.510 - Recruitment.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Recruitment. 196.510 Section 196.510 National... Recruitment. (a) Nondiscriminatory recruitment and hiring. A recipient shall not discriminate on the basis of sex in the recruitment and hiring of employees. Where a recipient has been found to be presently...

  12. 32 CFR 196.540 - Advertising.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Advertising. 196.540 Section 196.540 National Defense Department of Defense (Continued) OFFICE OF THE SECRETARY OF DEFENSE (CONTINUED) MISCELLANEOUS... Advertising. A recipient shall not in any advertising related to employment indicate preference, limitation...

  13. 32 CFR 196.525 - Fringe benefits.

    Science.gov (United States)

    2010-07-01

    ... FINANCIAL ASSISTANCE Discrimination on the Basis of Sex in Employment in Education Programs or Activities Prohibited § 196.525 Fringe benefits. (a) “Fringe benefits” defined. For purposes of these Title IX... employment not subject to the provision of § 196.515. (b) Prohibitions. A recipient shall not: (1...

  14. Dicty_cDB: CFD196 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CF (Link to library) CFD196 (Link to dictyBase) - - - Contig-U15664-1 CFD196Z (Link... to Original site) - - CFD196Z 567 - - - - Show CFD196 Library CF (Link to library) Clone ID CFD196 (Link to...ycdb.biol.tsukuba.ac.jp/CSM/CF/CFD1-D/CFD196Q.Seq.d/ Representative seq. ID CFD19...6Z (Link to Original site) Representative DNA sequence >CFD196 (CFD196Q) /CSM/CF/CFD1-D/CFD196Q.Seq.d/ XXXXX...lenkv Homology vs CSM-cDNA Score E Sequences producing significant alignments: (bits) Value CFD196 (CFD196Q) /CSM/CF/CFD1-D/CFD

  15. Dicty_cDB: CHF196 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available CH (Link to library) CHF196 (Link to dictyBase) - G01653 DDB0214909 Contig-U10711-1 CHF...196P (Link to Original site) CHF196F 627 CHF196Z 748 CHF196P 1355 - - Show CHF196 Library CH (Link to library) Clone ID CHF...Contig-U10711-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/CH/CHF1-D/CHF...196Q.Seq.d/ Representative seq. ID CHF196P (Link to Original site) Representative DNA sequence >CHF196 (CHF196Q) /CSM/CH/CHF...1-D/CHF196Q.Seq.d/ ATAATTAAACAACTCCTCTCATACGACAAATATATAAATATAGATACATAATAGTAATAA TAATAAT

  16. Dicty_cDB: VSF196 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available VS (Link to library) VSF196 (Link to dictyBase) - - - Contig-U14518-1 VSF196E (Link to Original site) VSF196F...(Link to library) Clone ID VSF196 (Link to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig...Contig-U14518-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/VS/VSF1-D/VSF196Q.Seq.d/ Representative...Representative seq. ID VSF196E (Link to Original site) Representative DNA sequence >VSF196 (VSF196Q) /CSM/VS/VSF1-D/VSF196Q...d/ CACACACGTTGTTGTTTACCTAATTTATATTTATTTAATAAATATCATATTTGGAATATT TACATATTACTAAATTTAAAATGGATGAAGATTATG

  17. 32 CFR 196.515 - Compensation.

    Science.gov (United States)

    2010-07-01

    ... NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Discrimination on the Basis of Sex in Employment in Education Programs or Activities Prohibited § 196.515... distinctions in rates of pay or other compensation; (b) Results in the payment of wages to employees of one sex...

  18. 32 CFR 196.430 - Financial assistance.

    Science.gov (United States)

    2010-07-01

    ...) MISCELLANEOUS NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Discrimination on the Basis of Sex in Education Programs or Activities Prohibited § 196... members of a particular sex specified therein; Provided, that the overall effect of the award of such sex...

  19. 32 CFR 196.450 - Athletics.

    Science.gov (United States)

    2010-07-01

    ... Discrimination on the Basis of Sex in Education Programs or Activities Prohibited § 196.450 Athletics. (a... interscholastic, intercollegiate, club, or intramural athletics offered by a recipient, and no recipient shall.... (1) A recipient that operates or sponsors interscholastic, intercollegiate, club, or intramural...

  20. Reference: 196 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available nt journal Ando Kohei|Hatano Kyoko|Ishizaki Yoko|Kato Ko|Kobori Maki|Nakahira Yoichi|Shiina Takashi|Shinmyo Atsuhiko|Takeba Go|Tsunoyama Yuichi ... 196 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u4ria224u15807777i Ishizaki Yoko

  1. 46 CFR 196.40-15 - Load line marks.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Load line marks. 196.40-15 Section 196.40-15 Shipping... Markings on Vessels § 196.40-15 Load line marks. (a) Vessels assigned a load line shall have the deck line and the load line marks permanently marked or embossed as required by Subchapter E (Load Lines) of...

  2. 32 CFR 196.520 - Job classification and structure.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Job classification and structure. 196.520 Section 196.520 National Defense Department of Defense (Continued) OFFICE OF THE SECRETARY OF DEFENSE... Activities Prohibited § 196.520 Job classification and structure. A recipient shall not: (a) Classify a job...

  3. 22 CFR 19.6 - Court orders and divorce decrees.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Court orders and divorce decrees. 19.6 Section 19.6 Foreign Relations DEPARTMENT OF STATE PERSONNEL BENEFITS FOR SPOUSES AND FORMER SPOUSES OF PARTICIPANTS IN THE FOREIGN SERVICE RETIREMENT AND DISABILITY SYSTEM § 19.6 Court orders and divorce decrees. ...

  4. 49 CFR 572.196 - Thorax without arm.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 7 2010-10-01 2010-10-01 false Thorax without arm. 572.196 Section 572.196... Dummy, Small Adult Female § 572.196 Thorax without arm. (a) The thorax is part of the upper torso... (drawing 180-0000) with the arm (180-6000) on the impacted side removed. The dummy's thorax is equipped...

  5. 32 CFR 196.140 - Dissemination of policy.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Dissemination of policy. 196.140 Section 196.140 National Defense Department of Defense (Continued) OFFICE OF THE SECRETARY OF DEFENSE (CONTINUED... FINANCIAL ASSISTANCE Introduction § 196.140 Dissemination of policy. (a) Notification of policy. (1) Each...

  6. 46 CFR 196.37-9 - Carbon dioxide alarm.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Carbon dioxide alarm. 196.37-9 Section 196.37-9 Shipping... Markings for Fire and Emergency Equipment, etc. § 196.37-9 Carbon dioxide alarm. (a) All carbon dioxide alarms shall be conspicuously identified: “WHEN ALARM SOUNDS—VACATE AT ONCE. CARBON DIOXIDE BEING...

  7. 46 CFR 196.37-47 - Portable magazine chests.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Portable magazine chests. 196.37-47 Section 196.37-47... Markings for Fire and Emergency Equipment, etc. § 196.37-47 Portable magazine chests. (a) Portable magazine chests shall be marked in letters at least 3 inches high: PORTABLE MAGAZINE CHEST — FLAMMABLE — KEEP...

  8. 46 CFR 196.85-1 - Magazine operation and control.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Magazine operation and control. 196.85-1 Section 196.85... OPERATIONS Magazine Control § 196.85-1 Magazine operation and control. (a) Keys to magazine spaces and magazine chests shall be kept in the sole control or custody of the Master or one delegated qualified...

  9. An automated flow system incorporating in-line acid dissolution of bismuth metal from a cyclotron irradiated target assembly for use in the isolation of astatine-211

    Energy Technology Data Exchange (ETDEWEB)

    O’Hara, Matthew J.; Krzysko, Anthony J.; Niver, Cynthia M.; Morrison, Samuel S.; Owsley, Stanley L.; Hamlin, Donald K.; Dorman, Eric F.; Scott Wilbur, D.

    2017-04-01

    Astatine-211 (211At) is a promising cyclotron-produced radionuclide being investigated for use in targeted alpha therapy of blood borne and metastatic cancers, as well as treatment of tumor remnants after surgical resections. The isolation of trace quantities of 211At, produced within several grams of a Bi metal cyclotron target, involves a complex, multi-step procedure: (1) Bi metal dissolution in strong HNO3, (2) distillation of the HNO3 to yield Bi salts containing 211At, (3) dissolution of the salts in strong HCl, (4) solvent extraction of 211At from bismuth salts with diisopropyl ether (DIPE), and (5) back-extraction of 211At from DIPE into NaOH, leading to a purified 211At product. Step (1) has been addressed first to begin the process of automating the onerous 211At isolation process. A computer-controlled Bi target dissolution system has been designed. The system performs in-line dissolution of Bi metal from the target assembly using an enclosed target dissolution block, routing the resulting solubilized 211At/Bi mixture to the subsequent process step. The primary parameters involved in Bi metal solubilization (HNO3 concentration and influent flow rate) were optimized prior to evaluation of the system performance on replicate cyclotron irradiated targets. The results indicate that the system performs reproducibly, having nearly quantitative release of 211At from irradiated targets, with cumulative 211At recoveries that follow a sigmoidal function. The predictable nature of the 211At release profile allows the user to tune the system to meet target processing requirements.

  10. Reagents for astatination of biomolecules. 2. Conjugation of anionic boron cage pendant groups to a protein provides a method for direct labeling that is stable to in vivo deastatination.

    Science.gov (United States)

    Wilbur, D Scott; Chyan, Ming-Kuan; Hamlin, Donald K; Vessella, Robert L; Wedge, Timothy J; Hawthorne, M Frederick

    2007-01-01

    Cancer-targeting biomolecules labeled with 211At must be stable to in vivo deastatination, as control of the 211At distribution is critical due to the highly toxic nature of alpha-particle emission. Unfortunately, no astatinated aryl conjugates have shown in vivo stability toward deastatination when (relatively) rapidly metabolized proteins, such as monoclonal antibody Fab' fragments, are labeled. As a means of increasing the in vivo stability of 211At-labeled proteins, we have been investigating antibody conjugates of boron cage moieties. In this investigation, protein-reactive derivatives containing a nido-carborane (2), a bis-nido-carborane derivative (Venus Flytrap Complex, 3), and four 2-nonahydro-closo-decaborate(2-) derivatives (4-7) were prepared and conjugated with an antibody Fab' fragment such that subsequent astatination and in vivo tissue distributions could be obtained. To aid in determination of stability toward in vivo deastatination, the Fab'-borane conjugates were also labeled with 125I, and that material was coinjected with the 211At-labeled Fab'. For comparison, direct labeling of the Fab' with 125I and 211At was conducted. Direct labeling with Na[125I]I and Chloramine-T gave an 89% radiochemical yield. However, direct labeling of the Fab' with Na[211At]At and Chloramine-T resulted in a yield of Studies to optimize the closo-decaborate(2-) conjugates for protein labeling are underway.

  11. 46 CFR 196.15-55 - Requirements for fuel oil.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Requirements for fuel oil. 196.15-55 Section 196.15-55... Test, Drills, and Inspections § 196.15-55 Requirements for fuel oil. (a) It shall be the duty of the chief engineer to cause an entry in the log to be made of each supply of fuel oil received on board...

  12. 21 CFR 133.196 - Swiss cheese for manufacturing.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Swiss cheese for manufacturing. 133.196 Section... Standardized Cheese and Related Products § 133.196 Swiss cheese for manufacturing. Swiss cheese for manufacturing conforms to the definition and standard of identity prescribed for swiss cheese by § 133.195...

  13. 32 CFR 196.455 - Textbooks and curricular material.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Textbooks and curricular material. 196.455... Prohibited § 196.455 Textbooks and curricular material. Nothing in these Title IX regulations shall be interpreted as requiring or prohibiting or abridging in any way the use of particular textbooks or curricular...

  14. 46 CFR 196.37-13 - Fire extinguishing system controls.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Fire extinguishing system controls. 196.37-13 Section... VESSELS OPERATIONS Markings for Fire and Emergency Equipment, etc. § 196.37-13 Fire extinguishing system controls. (a) The control cabinets or spaces containing valves or manifolds for the various fire...

  15. 46 CFR 196.27-1 - Master's and officer's responsibility.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Master's and officer's responsibility. 196.27-1 Section... VESSELS OPERATIONS Lookouts § 196.27-1 Master's and officer's responsibility. (a) Nothing in this part shall exonerate any master or officer in command from the consequences of any neglect to keep a proper...

  16. 46 CFR 196.37-23 - Hand portable fire extinguishers.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Hand portable fire extinguishers. 196.37-23 Section 196... extinguishers. (a) Each hand portable fire extinguisher shall be marked with a number and the location where... of hand portable fire extinguisher is carried, the numbering may be omitted. ...

  17. 22 CFR 196.1 - What is the Fellowship Program?

    Science.gov (United States)

    2010-04-01

    ... FOREIGN AFFAIRS/GRADUATE FOREIGN AFFAIRS FELLOWSHIP PROGRAM § 196.1 What is the Fellowship Program? The Thomas R. Pickering Foreign Affairs/Graduate Foreign Affairs Fellowship Program is designed to attract... 22 Foreign Relations 1 2010-04-01 2010-04-01 false What is the Fellowship Program? 196.1 Section...

  18. G196 epitope tag system: a novel monoclonal antibody, G196, recognizes the small, soluble peptide DLVPR with high affinity.

    Science.gov (United States)

    Tatsumi, Kasumi; Sakashita, Gyosuke; Nariai, Yuko; Okazaki, Kosuke; Kato, Hiroaki; Obayashi, Eiji; Yoshida, Hisashi; Sugiyama, Kanako; Park, Sam-Yong; Sekine, Joji; Urano, Takeshi

    2017-03-07

    The recognition specificity of monoclonal antibodies (mAbs) has made mAbs among the most frequently used tools in both basic science research and in clinical diagnosis and therapies. Precise determination of the epitope allows the development of epitope tag systems to be used with recombinant proteins for various purposes. Here we describe a new family of tag derived from the epitope recognized by a highly specific mAb G196. The minimal epitope was identified as the five amino acid sequence Asp-Leu-Val-Pro-Arg. Permutation analysis was used to characterize the binding requirements of mAb G196, and the variable regions of the mAb G196 were identified and structurally analyzed by X-ray crystallography. Isothermal titration calorimetry revealed the high affinity (Kd = 1.25 nM) of the mAb G196/G196-epitope peptide interaction, and G196-tag was used to detect several recombinant cytosolic and nuclear proteins in human and yeast cells. mAb G196 is valuable for developing a new peptide tagging system for cell biology and biochemistry research.

  19. 30 CFR 19.6 - Specific requirements for approval.

    Science.gov (United States)

    2010-07-01

    ..., EVALUATION, AND APPROVAL OF MINING PRODUCTS ELECTRIC CAP LAMPS § 19.6 Specific requirements for approval. (a... cord and cord armor, 2 and by the general behavior of the lamp equipment during the investigation. The...

  20. 32 CFR 196.445 - Marital or parental status.

    Science.gov (United States)

    2010-07-01

    ...) MISCELLANEOUS NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Discrimination on the Basis of Sex in Education Programs or Activities Prohibited § 196... a student's actual or potential parental, family, or marital status that treats students differently...

  1. Phenotype abnormality: 196 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 196 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u1ria224u702i decreased number... of shoot-borne shoot system in organ named trichome ... trichome ... present in fewer numbers in organism ... shoot-borne shoot system ...

  2. Phenotype-gene: 196 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 196 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u3ria224u1194i decreased sensitivity under influence... http://metadb.riken.jp/db/SciNetS_ria224i/cria224u4ria224u17347412i decreased sensitivity under influence o

  3. 32 CFR 196.400 - Education programs or activities.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Education programs or activities. 196.400... (CONTINUED) MISCELLANEOUS NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Discrimination on the Basis of Sex in Education Programs or Activities...

  4. 38 CFR 17.196 - Aid for hospital care.

    Science.gov (United States)

    2010-07-01

    ... quarters of nursing home care patients or domiciliary members, and meet such other minimum standards as the... 38 Pensions, Bonuses, and Veterans' Relief 1 2010-07-01 2010-07-01 false Aid for hospital care. 17... to States for Care of Veterans in State Homes § 17.196 Aid for hospital care. Aid may be paid to the...

  5. 46 CFR 196.30-20 - Breaking of safety valve seal.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Breaking of safety valve seal. 196.30-20 Section 196.30... OPERATIONS Reports of Accidents, Repairs, and Unsafe Equipment § 196.30-20 Breaking of safety valve seal. (a) If at any time it is necessary to break the seal on a safety valve for any purpose, the Chief...

  6. 22 CFR 196.3 - Grants to post-secondary education institutions.

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Grants to post-secondary education institutions. 196.3 Section 196.3 Foreign Relations DEPARTMENT OF STATE INTERNATIONAL COMMERCIAL ARBITRATION THOMAS R. PICKERING FOREIGN AFFAIRS/GRADUATE FOREIGN AFFAIRS FELLOWSHIP PROGRAM § 196.3 Grants to post...

  7. 22 CFR 196.2 - How is the Fellowship Program administered?

    Science.gov (United States)

    2010-04-01

    ... 22 Foreign Relations 1 2010-04-01 2010-04-01 false How is the Fellowship Program administered? 196.2 Section 196.2 Foreign Relations DEPARTMENT OF STATE INTERNATIONAL COMMERCIAL ARBITRATION THOMAS R. PICKERING FOREIGN AFFAIRS/GRADUATE FOREIGN AFFAIRS FELLOWSHIP PROGRAM § 196.2 How is the Fellowship Program...

  8. Octupole vibration in the superdeformed {sup 196}Pb nucleus; Vibration octupolaire dans le noyau superdeforme {sup 196}Pb

    Energy Technology Data Exchange (ETDEWEB)

    Bouneau, S.; Azaiez, F.; Duprat, J. [Experimental Research Division, Inst. de Physique Nucleaire, Paris-11 Univ., 91 - Orsay (France)] [and others

    1999-11-01

    The study of the superdeformed (SD) {sup 196}Pb nucleus has been revisited using the EUROGAM phase 2 spectrometer. All the three observed excited SD bands were found to decay to the Yrast SD band through, presumably, E1 transitions, allowing relative spin and excited energy assignments. Comparisons with calculation using the random phase approximation suggests that all three excited bands can be interpreted as octupole vibrational structures. (authors) 5 refs., 1 fig.

  9. Independent regulation of vertebral number and vertebral identity by microRNA-196 paralogs.

    Science.gov (United States)

    Wong, Siew Fen Lisa; Agarwal, Vikram; Mansfield, Jennifer H; Denans, Nicolas; Schwartz, Matthew G; Prosser, Haydn M; Pourquié, Olivier; Bartel, David P; Tabin, Clifford J; McGlinn, Edwina

    2015-09-01

    The Hox genes play a central role in patterning the embryonic anterior-to-posterior axis. An important function of Hox activity in vertebrates is the specification of different vertebral morphologies, with an additional role in axis elongation emerging. The miR-196 family of microRNAs (miRNAs) are predicted to extensively target Hox 3' UTRs, although the full extent to which miR-196 regulates Hox expression dynamics and influences mammalian development remains to be elucidated. Here we used an extensive allelic series of mouse knockouts to show that the miR-196 family of miRNAs is essential both for properly patterning vertebral identity at different axial levels and for modulating the total number of vertebrae. All three miR-196 paralogs, 196a1, 196a2, and 196b, act redundantly to pattern the midthoracic region, whereas 196a2 and 196b have an additive role in controlling the number of rib-bearing vertebra and positioning of the sacrum. Independent of this, 196a1, 196a2, and 196b act redundantly to constrain total vertebral number. Loss of miR-196 leads to a collective up-regulation of numerous trunk Hox target genes with a concomitant delay in activation of caudal Hox genes, which are proposed to signal the end of axis extension. Additionally, we identified altered molecular signatures associated with the Wnt, Fgf, and Notch/segmentation pathways and demonstrate that miR-196 has the potential to regulate Wnt activity by multiple mechanisms. By feeding into, and thereby integrating, multiple genetic networks controlling vertebral number and identity, miR-196 is a critical player defining axial formulae.

  10. 78 FR 14512 - Foreign-Trade Zone 196-Fort Worth, TX, Foreign-Trade Subzone 196A-TTI, Inc., Approval of...

    Science.gov (United States)

    2013-03-06

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF COMMERCE Foreign-Trade Zones Board Foreign-Trade Zone 196--Fort Worth, TX, Foreign-Trade Subzone 196A--TTI, Inc... Foreign-Trade Zones (FTZ) Board docketed an application submitted by Alliance Corridor, Inc., grantee of...

  11. 78 FR 2657 - Foreign-Trade Zone 196-Fort Worth, TX, Foreign-Trade Subzone 196A-TTI, Inc.; Application for...

    Science.gov (United States)

    2013-01-14

    ... Foreign-Trade Zones Board Foreign-Trade Zone 196--Fort Worth, TX, Foreign-Trade Subzone 196A--TTI, Inc.; Application for Additional Subzone Site An application has been submitted to the Foreign-Trade Zones Board... Foreign- Trade Zones Act, as amended (19 U.S.C. 81a-81u), and the regulations of the Board (15 CFR part...

  12. MicroRNA-196a as a Potential Diagnostic Biomarker for Esophageal Squamous Cell Carcinoma.

    Science.gov (United States)

    Fendereski, Mona; Zia, Mohammad Farid; Shafiee, Mohammad; Safari, Forousan; Saneie, Mohammad Hosien; Tavassoli, Manoochehr

    2017-02-07

    We observed significant up-regulation of miR-196a in esophageal squamous cell carcinoma (ESCC) as compared with their adjacent normal tissue (p = .002). Receiver operating characteristics curve analysis confirmed the suitability of miR-196a as a potential tumor marker for diagnosis of ESCC. Furthermore, analysis of miR-196a levels in saliva samples determined an average of 27-fold up-regulations in ESCC patients compared with healthy group. Our results suggest that salivary miR-196a may be a suitable noninvasive biomarker for diagnosis of ESCC. In addition, molecular pathway enrichment analysis of microRNA (miR)-196a determined focal adhesion, spliceosome and p53 signaling pathways as the most relevant pathways with miR-196a targetome.

  13. Nested reactor chamber and operation for Hg-196 isotope separation process

    Science.gov (United States)

    Grossman, M.W.

    1991-10-08

    The present invention is directed to an apparatus for use in [sup 196]Hg separation and its method of operation. Specifically, the present invention is directed to a nested reactor chamber useful for [sup 196]Hg isotope separation reactions avoiding the photon starved condition commonly encountered in coaxial reactor systems. 6 figures.

  14. 46 CFR 196.15-30 - Emergency lighting and power systems.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Emergency lighting and power systems. 196.15-30 Section... VESSELS OPERATIONS Test, Drills, and Inspections § 196.15-30 Emergency lighting and power systems. (a) Where fitted, it shall be the duty of the master to see that the emergency lighting and power systems...

  15. 75 FR 64248 - Approval for Manufacturing Authority Foreign-Trade Zone 196 ATC Logistics & Electronics (Cell...

    Science.gov (United States)

    2010-10-19

    ... & Electronics (Cell Phone Kitting) Fort Worth, TX Pursuant to its authority under the Foreign-Trade Zones Act of... following Order: Whereas, ATC Logistics & Electronics (ATCLE), an operator of Foreign-Trade Zone 196, has... procedures within FTZ 196 on behalf of ATC Logistics & Electronics, as described in the application and...

  16. 46 CFR 196.45-1 - Master and chief engineer responsible.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Master and chief engineer responsible. 196.45-1 Section... VESSELS OPERATIONS Carrying of Excess Steam § 196.45-1 Master and chief engineer responsible. (a) It shall be the duty of the master and the engineer in charge of the boilers of any vessel to require that a...

  17. Anisotropies in the HI gas distribution toward 3C 196

    Science.gov (United States)

    Kalberla, P. M. W.; Kerp, J.

    2016-10-01

    Context. The local Galactic Hi gas was found to contain cold neutral medium (CNM) filaments that are aligned with polarized dust emission. These filaments appear to be dominated by the magnetic field and in this case turbulence is expected to show distinct anisotropies. Aims: We use the Galactic Effelsberg-Bonn Hi Survey (EBHIS) to derive 2D turbulence spectra for the Hi distribution in direction to 3C 196 and two more comparison fields. Methods: Prior to Fourier transform we apply a rotational symmetric 50% Tukey window to apodize the data. We derive average as well as position angle dependent power spectra. Anisotropies in the power distribution are defined as the ratio of the spectral power in orthogonal directions. Results: We find strong anisotropies. For a narrow range in position angle, in direction perpendicular to the filaments and the magnetic field, the spectral power is on average more than an order of magnitude larger than parallel. In the most extreme case the anisotropy reaches locally a factor of 130. Anisotropies increase on average with spatial frequency as predicted by Goldreich & Sridhar (1995, ApJ, 438, 763), at the same time the Kolmogorov spectral index remains almost unchanged. The strongest anisotropies are observable for a narrow range in velocity and decay with a power law index close to -8/3, almost identical to the average isotropic spectral index of -2.9 Faraday depth.

  18. 75 FR 15413 - Approval for Processing Authority, Foreign-Trade Zone 196, ATC Logistics & Electronics (Personal...

    Science.gov (United States)

    2010-03-29

    ... & Electronics (Personal Navigation Devices), Fort Worth, Texas Pursuant to its authority under the Foreign-Trade...) adopts the following Order: Whereas, ATC Logistics & Electronics, an operator of Foreign-Trade Zone 196...

  19. miR-196a targets netrin 4 and regulates cell proliferation and migration of cervical cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Jie [Department of Pathology, Liaocheng People’s Hospital, Liaocheng 252000 (China); Zheng, Fangxia [Department of Radiotherapy, Liaocheng People’s Hospital, Liaocheng 252000 (China); Yu, Gang [Department for Disease Control, Tumor Hospital of Liaocheng, Liaocheng 252000 (China); Yin, Yanhua, E-mail: yinyanhuablk@163.com [Department of Pathology, Liaocheng People’s Hospital, Liaocheng 252000 (China); Lu, Qingyang [Department of Pathology, Liaocheng People’s Hospital, Liaocheng 252000 (China)

    2013-11-01

    Highlights: •miR-196a was overexpressed in cervical cancer tissue compared to normal tissue. •miR-196a expression elevated proliferation and migration of cervical cancer cells. •miR-196a inhibited NTN4 expression by binding 3′-UTR region of NTN4 mRNA. •NTN4 inversely correlated with miR-196a expression in cervical tissue and cell line. •NTN4 expression was low in cervical cancer tissue compared to normal tissue. -- Abstract: Recent research has uncovered tumor-suppressive and oncogenic potential of miR-196a in various tumors. However, the expression and mechanism of its function in cervical cancer remains unclear. In this study, we assess relative expression of miR-196a in cervical premalignant lesions, cervical cancer tissues, and four cancer cell lines using quantitative real-time PCR. CaSki and HeLa cells were treated with miR-196a inhibitors, mimics, or pCDNA/miR-196a to investigate the role of miR-196a in cancer cell proliferation and migration. We demonstrated that miR-196a was overexpressed in cervical intraepithelial neoplasia 2–3 and cervical cancer tissue. Moreover, its expression contributes to the proliferation and migration of cervical cancer cells, whereas inhibiting its expression led to a reduction in proliferation and migration. Five candidate targets of miR-196a chosen by computational prediction and Cervical Cancer Gene Database search were measured for their mRNA in both miR-196a-overexpressing and -depleted cancer cells. Only netrin 4 (NTN4) expression displayed an inverse association with miR-196a. Fluorescent reporter assays revealed that miR-196a inhibited NTN4 expression by targeting one binding site in the 3′-untranslated region (3′-UTR) of NTN4 mRNA. Furthermore, qPCR and Western blot assays verified NTN4 expression was downregulated in cervical cancer tissues compared to normal controls, and in vivo mRNA level of NTN4 inversely correlated with miR-196a expression. In summary, our findings provide new insights about the

  20. MicroRNA-196a Is a Putative Diagnostic Biomarker and Therapeutic Target for Laryngeal Cancer

    Science.gov (United States)

    Saito, Koichiro; Inagaki, Koji; Kamimoto, Takahiro; Ito, Yoko; Sugita, Toshiaki; Nakajo, Satoko; Hirasawa, Akira; Iwamaru, Arifumi; Ishikura, Takashi; Hanaoka, Hideki; Okubo, Keisuke; Onozaki, Tokio; Zama, Takeru

    2013-01-01

    Background MicroRNA (miRNA) is an emerging subclass of small non-coding RNAs that regulates gene expression and has a pivotal role for many physiological processes including cancer development. Recent reports revealed the role of miRNAs as ideal biomarkers and therapeutic targets due to their tissue- or disease-specific nature. Head and neck cancer (HNC) is a major cause of cancer-related mortality and morbidity, and laryngeal cancer has the highest incidence in it. However, the molecular mechanisms involved in laryngeal cancer development remain to be known and highly sensitive biomarkers and novel promising therapy is necessary. Methodology/Principal Findings To explore laryngeal cancer-specific miRNAs, RNA from 5 laryngeal surgical specimens including cancer and non-cancer tissues were hybridized to microarray carrying 723 human miRNAs. The resultant differentially expressed miRNAs were further tested by using quantitative real time PCR (qRT-PCR) on 43 laryngeal tissue samples including cancers, noncancerous counterparts, benign diseases and precancerous dysplasias. Significant expressional differences between matched pairs were reproduced in miR-133b, miR-455-5p, and miR-196a, among which miR-196a being the most promising cancer biomarker as validated by qRT-PCR analyses on additional 84 tissue samples. Deep sequencing analysis revealed both quantitative and qualitative deviation of miR-196a isomiR expression in laryngeal cancer. In situ hybridization confirmed laryngeal cancer-specific expression of miR-196a in both cancer and cancer stroma cells. Finally, inhibition of miR-196a counteracted cancer cell proliferation in both laryngeal cancer-derived cells and mouse xenograft model. Conclusions/Significance Our study provided the possibilities that miR-196a might be very useful in diagnosing and treating laryngeal cancer. PMID:23967217

  1. 32 CFR 196.210 - Military and merchant marine educational institutions.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Military and merchant marine educational... OR ACTIVITIES RECEIVING FEDERAL FINANCIAL ASSISTANCE Coverage § 196.210 Military and merchant marine... purpose is the training of individuals for a military service of the United States or for the merchant...

  2. 32 CFR 196.425 - Counseling and use of appraisal and counseling materials.

    Science.gov (United States)

    2010-07-01

    ... 32 National Defense 2 2010-07-01 2010-07-01 false Counseling and use of appraisal and counseling... Programs or Activities Prohibited § 196.425 Counseling and use of appraisal and counseling materials. (a) Counseling. A recipient shall not discriminate against any person on the basis of sex in the counseling or...

  3. 75 FR 30372 - Foreign-Trade Zone 196 Temporary/Interim Manufacturing Authority ATC Logistics & Electronics...

    Science.gov (United States)

    2010-06-01

    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF COMMERCE Foreign-Trade Zones Board Foreign-Trade Zone 196 Temporary/Interim Manufacturing Authority ATC Logistics... Secretary of the Foreign-Trade Zones (FTZ) Board filed an application submitted by the ATC Logistics...

  4. 32 CFR 196.535 - Effect of state or local law or other requirements.

    Science.gov (United States)

    2010-07-01

    ... SECRETARY OF DEFENSE (CONTINUED) MISCELLANEOUS NONDISCRIMINATION ON THE BASIS OF SEX IN EDUCATION PROGRAMS... in Education Programs or Activities Prohibited § 196.535 Effect of state or local law or other... 32 National Defense 2 2010-07-01 2010-07-01 false Effect of state or local law or other...

  5. 28 CFR 19.6 - Responsibility of DOJ organizational units for program implementation and implementation procedures.

    Science.gov (United States)

    2010-07-01

    ...) Each component shall submit a quarterly report to the General Services Staff, Justice Management... Administration DEPARTMENT OF JUSTICE USE OF PENALTY MAIL IN THE LOCATION AND RECOVERY OF MISSING CHILDREN § 19.6... General Services Staff, Justice Management Division (JMD), will be the liaison between the National Center...

  6. 27 CFR 44.196a - To a foreign-trade zone.

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 2 2010-04-01 2010-04-01 false To a foreign-trade zone... Shipment § 44.196a To a foreign-trade zone. Where tobacco products, and cigarette papers and tubes are removed from a factory or an export warehouse for delivery to a foreign-trade zone, under zone restricted...

  7. 78 FR 66330 - Foreign-Trade Zone 196-Fort Worth, Texas, Authorization of Production Activity, Flextronics...

    Science.gov (United States)

    2013-11-05

    ... Foreign-Trade Zones Board Foreign-Trade Zone 196--Fort Worth, Texas, Authorization of Production Activity, Flextronics International USA, Inc. (Mobile Phone Assembly and Kitting), Fort Worth, Texas On June 14, 2013, Flextronics International USA, Inc. submitted a notification of proposed production activity to the Foreign...

  8. Spin vectors of asteroids 21 Lutetia, 196 Philomela, 250 Bettina, 337 Devosa, and 804 Hispania

    Science.gov (United States)

    Michalowski, Tadeusz

    1992-01-01

    Such parameters as shape, orientation of spin axis, prograde or retrograde rotation are important for understanding the collisional evolution of asteroids since the primordial epochs of solar system history. These parameters remain unknown for most asteroids and poorly constrained for all but a few. This work presents results for five asteroids: 21, 196, 250, 337, and 804.

  9. 37 CFR 2.196 - Times for taking action: Expiration on Saturday, Sunday or Federal holiday.

    Science.gov (United States)

    2010-07-01

    ... UNITED STATES PATENT AND TRADEMARK OFFICE, DEPARTMENT OF COMMERCE RULES OF PRACTICE IN TRADEMARK CASES General Information and Correspondence in Trademark Cases § 2.196 Times for taking action: Expiration on... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Times for taking action...

  10. Yeast Interacting Proteins Database: YGR196C, YBR260C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YGR196C FYV8 Protein of unknown function, required for survival upon exposure to K1...n, required for survival upon exposure to K1 killer toxin Rows with this bait as bait Rows with this bait as

  11. 42 CFR 84.196 - Harnesses; installation and construction; minimum requirements.

    Science.gov (United States)

    2010-10-01

    ... 42 Public Health 1 2010-10-01 2010-10-01 false Harnesses; installation and construction; minimum... SERVICES OCCUPATIONAL SAFETY AND HEALTH RESEARCH AND RELATED ACTIVITIES APPROVAL OF RESPIRATORY PROTECTIVE DEVICES Chemical Cartridge Respirators § 84.196 Harnesses; installation and construction; minimum...

  12. 46 CFR 196.37-33 - Instructions for changing steering gear.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Instructions for changing steering gear. 196.37-33... steering gear. (a) Instructions in at least 1/2 inch letters and figures shall be posted in the steering engineroom, relating in order, the different steps to be taken in changing to the emergency steering gear...

  13. 27 CFR 44.196 - To district director of customs for consumption as supplies on commercial vessels and aircraft.

    Science.gov (United States)

    2010-04-01

    ... for consumption as supplies on commercial vessels and aircraft. Where tobacco products, or cigarette... customs for consumption as supplies on commercial vessels and aircraft. 44.196 Section 44.196 Alcohol... (CONTINUED) TOBACCO EXPORTATION OF TOBACCO PRODUCTS AND CIGARETTE PAPERS AND TUBES, WITHOUT PAYMENT OF TAX...

  14. Phosphorylation of the leukemic oncoprotein EVI1 on serine 196 modulates DNA binding, transcriptional repression and transforming ability.

    Directory of Open Access Journals (Sweden)

    Daniel J White

    Full Text Available The EVI1 (ecotropic viral integration site 1 gene at 3q26 codes for a transcriptional regulator with an essential role in haematopoiesis. Overexpression of EVI1 in acute myeloid leukaemia (AML is frequently associated with 3q26 rearrangements and confers extremely poor prognosis. EVI1 mediates transcriptional regulation, signalling, and epigenetic modifications by interacting with DNA, proteins and protein complexes. To explore to what extent protein phosphorylation impacts on EVI1 functions, we analysed endogenous EVI1 protein from a high EVI1 expressing Fanconi anaemia (FA derived AML cell line. Mass spectrometric analysis of immunoprecipitated EVI1 revealed phosphorylation at serine 196 (S196 in the sixth zinc finger of the N-terminal zinc finger domain. Mutated EVI1 with an aspartate substitution at serine 196 (S196D, which mimics serine phosphorylation of this site, exhibited reduced DNA-binding and transcriptional repression from a gene promotor selectively targeted by the N-terminal zinc finger domain. Forced expression of the S196D mutant significantly reduced EVI1 mediated transformation of Rat1 fibroblasts. While EVI1-mediated serial replating of murine haematopoietic progenitors was maintained by EVI1-S196D, this was associated with significantly higher Evi1-trancript levels compared with WT-EVI1 or EVI1-S196A, mimicking S196 non-phosphorylated EVI1. These data suggest that EVI1 function is modulated by phosphorylation of the first zinc finger domain.

  15. MicroRNA-196b Inhibits Cell Growth and Metastasis of Lung Cancer Cells by Targeting Runx2.

    Science.gov (United States)

    Bai, Xiaoxue; Meng, Lin; Sun, Huijie; Li, Zhuo; Zhang, Xiufang; Hua, Shucheng

    2017-01-01

    Lung cancer is one of the most common causes of cancer related deaths worldwide. The role of several microRNAs (miRNAs) including miR-196b in different cancers has already been established. The study was aimed to explore the role of miR-196b in lung cancer and its possible underlying mechanism. Human lung cancer cell line A549 was transfected with miR-196b mimic, miR-196b inhibitor and corresponding controls. Then cell viability, migration, invasion, and apoptosis of A549 lung cancer cells either with overexpression or with suppression of miR-196b were estimated sequentially. Next, dual luciferase activity assay was performed to clarify whether Runx2 was a direct target of miR-196b. Finally, the expressions of main factors associated with epithelial mesenchymal transition (EMT), PI3K/AKT/GSK3β, Smad, and JNK pathways were detected by western blot. MiR-196b expression was significantly decreased in A549, H1650 and H1299 cell lines compared with in WI-38 and HEL-1 cell lines. Overexpression of miR-196b suppressed cell viability, migration, invasion, and induced apoptosis as well as inhibited TGF-β induced EMT process in A549 cells. In addition, Runx2 was a putative target of miR-196b, and Runx2 silence remarkably increased cell apoptosis and abolished the promotive effects of miR-196b suppression on cell viability, migration and invasion. Finally, miR-196b also mediated its action by inactivation of PI3K/AKT/GSK3β, Smad, and JNK pathways by down-regulation of Runx2. MiR-196b functions as a tumor suppressor that inhibited cell growth and metastasis of lung cancer cells by targeting Runx2. These findings provided further evidences for treatment of lung cancer. The Author(s). Published by S. Karger AG, Basel.

  16. Liquid Nitrogen (-196°C effect under pollen of some cultured or ornamental species

    Directory of Open Access Journals (Sweden)

    Sabina GLIGOR

    2006-05-01

    Full Text Available The criopreservation involve the stock of the vegetal material at low temperatures (-196°C in liquid nitrogen, in thermal conditions in which the division of cells and metabolic processes slow down, thus that the samplings may be conserved for long periods without suffering any genetic modifications. This stock technique is applied till present only on 80 vegetal species, keeping their seeds and vitrocultures preponderantly; researches were made regarding the maintenance of pollen in liquid nitrogen.The mature pollen, able to resist a higher degree of desiccation, may be conserved at low temperatures, without criopreservation. It was made researches on criopreservation of rise, maize, wheat, roses, sun flower and soy pollen. Our study purpose was to follow the impact of liquid nitrogen (-196°C about on viability of some cultured and ornamental species. The designed time of criopreservation it was 30 minutes and 7 days, using the TTC (tripheniltetrazole chloride method which allows testing the viability of vegetal material based on dehydrogenase activity.It was observed at Petunia hybrida species, that the pollen viability was low - in relevance with the witness represented from the pollen which was not resigned to the nitrogen liquid treatment - between percentage limits of 3.5-8%, in the case when the vegetal material was submersed 30 minutes in liquid nitrogen and 7.5-14.5% 7 days at (-196°C. The submersing of Nicotiana alata var. grandiflora species at 7 days, determined a low viability with 11.53%. The following two studied species Cucurbita and Hosta were proved to be the most resistant at submersing and maintenance in liquid nitrogen. The most affected pollen was Campsis radicans species. At Datura stramonium species was observed 2.59% a low viability of pollen, after 30 minutes of liquid nitrogen treatment, was 19.56%, after 7 days of submersing, the most pollen granules losing completely their viability.

  17. Probing the O(6) character of {sup 196}Pt with inelastic electron scattering

    Energy Technology Data Exchange (ETDEWEB)

    Aslanidou, Simela; Bassauer, Sergej; Hufnagel, Alexander; Kremer, Christoph; Krugmann, Andreas; Neumann-Cosel, Peter von; Pietralla, Norbert; Singer, Maxim [Institut fuer Kernphysik, Technische Universitaet Darmstadt (Germany)

    2015-07-01

    The Interacting-Boson-Model provides an elegant tool to classify low-lying collective states in medium and heavy mass even-even nuclei. One of its dynamical symmetries is O(6) and a crucial test of this theory is to investigate the monopole transition to the band head of the K=0, σ=N-2 band. A powerful tool to investigate monopole transitions is inelastic electron scattering. An experiment on {sup 196}Pt -claimed to be a perfect O(6) nucleus - has been performed at the superconducting electron linear accelerator S-DALINAC at Darmstadt using the high resolution LINTOTT spectrometer. The experiment and analysis results are presented.

  18. Roman Policies towards Antiochus III and the Greeks from Winter 197/196 B.C. to Autumn 196 B.C.

    Directory of Open Access Journals (Sweden)

    Deutschmann, Eike Hellmut

    2012-01-01

    Full Text Available In the Second Macedonian War (200-196 B.C., the res publica reduced the strength of the enemy King Philip V apparently to establish a new political order in Southern Balkans: Assumedly a pro-Roman balance of forces should prevail there, untainted by influence of another major power. A particular senatorial policy towards the Greeks probably did not exist before the fighting in Hellas came to an end in summer 197 B.C. In the same year, the Seleucid king Antiochus III brought large parts of the west coast of Asia Minor under control and set about crossing the Hellespont. Rome subsequently stylized itself as the guardian of freedom for the Greeks living in Hellas and Asia Minor. The statesmen of the res publica could have perceived Antiochus’ expansion as a threat to the mentioned new order. Therefore, the Roman Policy of Freedom was possibly applied primarily to take action against the Seleucid king. Die res publica verminderte im Zweiten Makedonischen Krieg (200-196 a.c. die Macht des gegnerischen Königs Philipp V - anscheinend um eine neue politische Ordnung im südlichen Balkanraum zu etablieren: Vermutlich sollte dort ein romfreundliches Kräftegleichgewicht vorherrschen, auf das keine andere Großmacht Einfluß hat. Eine speziell an die Griechen gerichtete Politik seitens des römischen Senats gab es wahrscheinlich nicht vor Ende der Kampfhandlungen in Hellas im Sommer 197 a.c. In dem Jahr erweiterte der seleukidische König Antiochos III. seinen Einflussbereich auf große Teile der kleinasiatischen Westküste und schickte sich an, den Hellespont zu überqueren. Rom stilisierte sich in der Folgezeit zum Freiheitsgarant der in Hellas und Kleinasien lebenden Griechen. Antiochos Expansion könnte von den Staatsmännern der res publica als Bedrohung der genannten neuen Ordnung angesehen worden sein. Demzufolge wurde die römische Freiheitspolitik möglicherweise in erster Linie angewendet, um gegen den seleukidischen König vorzugehen.

  19. Conformational analysis of the hydrophobic peptide alphas1-casein(136-196).

    Science.gov (United States)

    Alaimo, M H; Farrell, H M; Germann, M W

    1999-05-18

    Hydrophobic interactions are important in the self-association of milk proteins, including alphas1-casein. The extent to which casein interaction sites are influenced by local secondary structure is not widely known. Both primary amino acid sequence and local secondary structure are shown to affect the self-association of the hydrophobic peptide alphas1-casein(136-196). The peptide is aggregated at low concentrations (7 microM and above), as determined by 1H nuclear magnetic resonance (NMR) measurements at pH 6.0 in phosphate buffer. Increase in temperature is shown to induce side chain mobility (melting) as indicated by both 1H NMR and near-UV circular dichroism (CD) measurements. As determined by far-UV CD, there is also a loss in the global amount of extended structure with increasing temperature, while beta-turn structures and some aromatic dichroism are conserved at temperatures as high as 70 degrees C. Similar retention of structure occurs at pH 2 and in 6 M guanidine HCl. The observed stability of beta-turns and some side chains in alphas1-casein(136-196) supports previous assumptions that hydrophobic, proline-based turns are important interaction sites in the self-association of alphas1-casein, and possibly in the formation of the calcium transport complexes, the casein micelles. It may be speculated that these areas of the peptide represent a 'molten globule-like', heat stable, core structure for alphas1-casein.

  20. Aryl hydrocarbon receptor-dependent regulation of miR-196a expression controls lung fibroblast apoptosis but not proliferation

    Energy Technology Data Exchange (ETDEWEB)

    Hecht, Emelia [Department of Medicine, McGill University, Montreal, Quebec (Canada); Zago, Michela [Research Institute of the McGill University Health Centre, McGill University, Montreal, Quebec (Canada); Sarill, Miles [Department of Medicine, McGill University, Montreal, Quebec (Canada); Rico de Souza, Angela [Research Institute of the McGill University Health Centre, McGill University, Montreal, Quebec (Canada); Gomez, Alvin; Matthews, Jason [Department of Pharmacology and Toxicology, University of Toronto, Toronto, ON (Canada); Hamid, Qutayba; Eidelman, David H. [Department of Medicine, McGill University, Montreal, Quebec (Canada); Research Institute of the McGill University Health Centre, McGill University, Montreal, Quebec (Canada); Baglole, Carolyn J., E-mail: Carolyn.baglole@McGill.ca [Department of Medicine, McGill University, Montreal, Quebec (Canada); Research Institute of the McGill University Health Centre, McGill University, Montreal, Quebec (Canada)

    2014-11-01

    The aryl hydrocarbon receptor (AhR) is a ligand-activated transcription factor implicated in the regulation of apoptosis and proliferation. Although activation of the AhR by xenobiotics such as dioxin inhibits the cell cycle and control apoptosis, paradoxically, AhR expression also promotes cell proliferation and survival independent of exogenous ligands. The microRNA (miRNA) miR-196a has also emerged as a regulator of proliferation and apoptosis but a relationship between the AhR and miR-196a is not known. Therefore, we hypothesized that AhR-dependent regulation of endogenous miR-196a expression would promote cell survival and proliferation. Utilizing lung fibroblasts from AhR deficient (AhR{sup −/−}) and wild-type (AhR{sup +/+}) mice, we show that there is ligand-independent regulation of miRNA, including low miR-196a in AhR{sup −/−} cells. Validation by qRT-PCR revealed a significant decrease in basal expression of miR-196a in AhR{sup −/−} compared to AhR{sup +/+} cells. Exposure to AhR agonists benzo[a]pyrene (B[a]P) and FICZ as well as AhR antagonist CH-223191 decreased miR-196a expression in AhR{sup +/+} fibroblasts concomitant with decreased AhR protein levels. There was increased proliferation only in AhR{sup +/+} lung fibroblasts in response to serum, corresponding to a decrease in p27{sup KIP1} protein, a cyclin-dependent kinase inhibitor. Increasing the cellular levels of miR-196a had no effect on proliferation or expression of p27{sup KIP1} in AhR{sup −/−} fibroblasts but attenuated cigarette smoke-induced apoptosis. This study provides the first evidence that AhR expression is essential for the physiological regulation of cellular miRNA levels- including miR-196a. Future experiments designed to elucidate the functional relationship between the AhR and miR-196a may delineate additional novel ligand-independent roles for the AhR. - Highlights: • The AhR controls proliferation and apoptosis in lung cells. • The AhR regulates the

  1. Insights into the evolution of sorbitol metabolism: phylogenetic analysis of SDR196C family

    Directory of Open Access Journals (Sweden)

    Sola Carvajal Agustín

    2012-08-01

    Full Text Available Abstract Background Short chain dehydrogenases/reductases (SDR are NAD(P(H-dependent oxidoreductases with a highly conserved 3D structure and of an early origin, which has allowed them to diverge into several families and enzymatic activities. The SDR196C family (http://www.sdr-enzymes.org groups bacterial sorbitol dehydrogenases (SDH, which are of great industrial interest. In this study, we examine the phylogenetic relationship between the members of this family, and based on the findings and some sequence conserved blocks, a new and a more accurate classification is proposed. Results The distribution of the 66 bacterial SDH species analyzed was limited to Gram-negative bacteria. Six different bacterial families were found, encompassing α-, β- and γ-proteobacteria. This broad distribution in terms of bacteria and niches agrees with that of SDR, which are found in all forms of life. A cluster analysis of sorbitol dehydrogenase revealed different types of gene organization, although with a common pattern in which the SDH gene is surrounded by sugar ABC transporter proteins, another SDR, a kinase, and several gene regulators. According to the obtained trees, six different lineages and three sublineages can be discerned. The phylogenetic analysis also suggested two different origins for SDH in β-proteobacteria and four origins for γ-proteobacteria. Finally, this subdivision was further confirmed by the differences observed in the sequence of the conserved blocks described for SDR and some specific blocks of SDH, and by a functional divergence analysis, which made it possible to establish new consensus sequences and specific fingerprints for the lineages and sub lineages. Conclusion SDH distribution agrees with that observed for SDR, indicating the importance of the polyol metabolism, as an alternative source of carbon and energy. The phylogenetic analysis pointed to six clearly defined lineages and three sub lineages, and great variability in

  2. Study of dimuon pair production in e+ e- collisions from 196 - 202 GeV

    CERN Document Server

    Flacher, Henning

    2000-01-01

    In this thesis the electroweak process $e^{+} e^{-}$ --> $μ^{+} μ^{-}$ was studied and an inclusive and exclusive cross section were measured. Furthermore the forward-backward asymmetry Afb was determined from the exclusive event sample. The investigated data was recorded·with the detector ALEPH at centre-of-mass energies of 196, 200 and 202 GeV resulting in a total integrated luminosity of 208.1 pb-1. All the measured results are in good agreement with the Standard Model. From the measurements of total cross sections and angular distributions for all the two fermion processes at energies from 130 - 202 GeV limits on processes beyond the Standard Model were derived. For Contact Interactions they were found to be of the order of 10 TeV while for TeV-Scale Quantum Gravity a limit for the ultra-violet cut-off parameter of A::1 TeV could be derived.

  3. Charged Hadron Distributions In 19.6-gev Gold+gold Collisions

    CERN Document Server

    Picha, R

    2005-01-01

    Experimental results from a low-energy heavy ion run in year 2001 at the Relativistic Heavy Ion Collider (RHIC) using the Solenoidal Tracker at RHIC (STAR) detector are presented. From the collisions of gold ions at sNN = 19.6 GeV, six species of particles (π±, K±, p, and p¯) are identified via energy loss mechanism and their transverse mass spectra are analyzed at midrapidity (|y| < 0.5) and m T − m0 < 1.0 GeV/c 2. Rapidity distributions, particle ratios, and hadronic freeze-out conditions are discussed. This study provides a low energy measurement at RHIC which is very close to that at the SPS for cross comparison between collider experiments and fixed target experiments. The analysis provides a good reference to study excitation functions of strangeness production, net baryon, and collective flow inside heavy ion collisions.

  4. The nonoxidative conversion of nitroethane to ethylnitronate in Neurospora crassa 2-nitropropane dioxygenase is catalyzed by histidine 196.

    Science.gov (United States)

    Francis, Kevin; Gadda, Giovanni

    2008-09-02

    The deprotonation of nitroethane catalyzed by Neurospora crassa 2-nitropropane dioxygenase was investigated by measuring the formation and release of ethylnitronate formed in turnover as a function of pH and through mutagenesis studies. Progress curves for the enzymatic reaction obtained by following the increase in absorbance at 228 nm over time were visibly nonlinear, requiring a logarithmic approximation of the initial reaction rates for the determination of the kinetic parameters of the enzyme. The pH dependence of the second-order rate constant k cat/ K m with nitroethane as substrate implicates the presence of a group with a p K a of 8.1 +/- 0.1 that must be unprotonated for nitronate formation. Mutagenesis studies suggest that this group is histidine 196 as evident from the inability of a H196N variant form of the enzyme to catalyze the formation of ethylnitronate from nitroethane. Replacement of histidine 196 with asparagine resulted in an approximately 15-fold increase in the k cat/ K m with ethylnitronate as compared to the wild-type, which results from the inability of the mutant enzyme to undergo nonoxidative turnover. The results presented herein are consistent with a branched catalytic mechanism for the enzyme in which the ethylnitronate intermediate formed from the H196-catalyzed deprotonation of nitroethane partitions between release from the active site and oxidative denitrification to yield acetaldehyde and nitrite.

  5. 15 CFR 19.6 - When will Commerce entities allow a debtor to pay a Commerce debt in installments instead of one...

    Science.gov (United States)

    2010-01-01

    ... 15 Commerce and Foreign Trade 1 2010-01-01 2010-01-01 false When will Commerce entities allow a debtor to pay a Commerce debt in installments instead of one lump sum? 19.6 Section 19.6 Commerce and Foreign Trade Office of the Secretary of Commerce COMMERCE DEBT COLLECTION Procedures To Collect Commerce...

  6. Fracture toughness testing of V-4Cr-4Ti at 25{degrees}C and -196{degrees}C

    Energy Technology Data Exchange (ETDEWEB)

    Li, H.X.; Kurtz, R.J. [Pacific Northwest National Lab., Richland, WA (United States)

    1996-10-01

    Measurements of the fracture toughness of the production-scale heat (832665) of V-4Cr-4Ti have been performed at 25{degrees}C and {minus}196{degrees}C using compact tension (CT) specimens. Test specimens were vacuum annealed at either 1000{degrees}C for 1 hour (HT1) or 1050{degrees}C for two hours (HT2). Specimens given the HT1 treatment were annealed after final machining, whereas the HT2 specimens received the 1050{degrees}C anneal at Teledyne Wah Chang prior to final machining. Following machining HT2 specimens were then vacuum annealed at 180{degrees}C for two hours to remove hydrogen. Specimens treated using HT1 had a partially recrystallized microstructure and those treated using HT2 had a fully recrystallized microstructure. The fracture toughness at 25{degrees}C was determined by J-integral tests and at {minus}196{degrees}C by ASTM E 399 type tests. Toughness values obtained at {minus}196{degrees}C were converted to J-integral values for comparison to the 25{degrees}C data. The 25{degrees}C fracture toughness was very high with none of the specimens giving valid results per ASTM criteria. Specimens fractured by microvoid coalescence. The fracture toughness at {minus}196{degrees}C was much lower than that at 25{degrees}C and the fracture surface showed predominantly cleavage features. The present results show a transition from ductile to brittle behavior with decreasing test temperature which is not observed from one-third scale Charpy impact tests. The fracture toughness at {minus}196{degrees}C was still quite high, however, at about 75 kJ/m{sup 2}. Delaminations in planes normal to the thickness direction were seen at both test temperatures. Fracture surfaces inside the delaminations exhibited nearly 100% cleavage facets. The cause of the brittle delaminations was not determined, but will be a subject for further investigation.

  7. s196wo.m77t and s196wo.h77t: MGD77T data and header file for single-beam bathymetry for field activity S-1-96-WO in Cascadia, Washington from 04/14/1996 to 06/06/1996

    Data.gov (United States)

    U.S. Geological Survey, Department of the Interior — Single-beam bathymetry data along with GPS navigation data was collected as part of the U.S. Geological Survey cruise S-1-96-WO. The cruise was conducted in...

  8. Search for excited electrons in p pmacr collisions at s=1.96TeV

    Science.gov (United States)

    Abazov, V. M.; Abbott, B.; Abolins, M.; Acharya, B. S.; Adams, M.; Adams, T.; Aguilo, E.; Ahn, S. H.; Ahsan, M.; Alexeev, G. D.; Alkhazov, G.; Alton, A.; Alverson, G.; Alves, G. A.; Anastasoaie, M.; Ancu, L. S.; Andeen, T.; Anderson, S.; Andrieu, B.; Anzelc, M. S.; Arnoud, Y.; Arov, M.; Arthaud, M.; Askew, A.; Åsman, B.; Assis Jesus, A. C. S.; Atramentov, O.; Autermann, C.; Avila, C.; Ay, C.; Badaud, F.; Baden, A.; Bagby, L.; Baldin, B.; Bandurin, D. V.; Banerjee, S.; Banerjee, P.; Barberis, E.; Barfuss, A.-F.; Bargassa, P.; Baringer, P.; Barreto, J.; Bartlett, J. F.; Bassler, U.; Bauer, D.; Beale, S.; Bean, A.; Begalli, M.; Begel, M.; Belanger-Champagne, C.; Bellantoni, L.; Bellavance, A.; Benitez, J. A.; Beri, S. B.; Bernardi, G.; Bernhard, R.; Bertram, I.; Besançon, M.; Beuselinck, R.; Bezzubov, V. A.; Bhat, P. C.; Bhatnagar, V.; Biscarat, C.; Blazey, G.; Blekman, F.; Blessing, S.; Bloch, D.; Bloom, K.; Boehnlein, A.; Boline, D.; Bolton, T. A.; Borissov, G.; Bose, T.; Brandt, A.; Brock, R.; Brooijmans, G.; Bross, A.; Brown, D.; Buchanan, N. J.; Buchholz, D.; Buehler, M.; Buescher, V.; Bunichev, V.; Burdin, S.; Burke, S.; Burnett, T. H.; Buszello, C. P.; Butler, J. M.; Calfayan, P.; Calvet, S.; Cammin, J.; Carvalho, W.; Casey, B. C. K.; Cason, N. M.; Castilla-Valdez, H.; Chakrabarti, S.; Chakraborty, D.; Chan, K. M.; Chan, K.; Chandra, A.; Charles, F.; Cheu, E.; Chevallier, F.; Cho, D. K.; Choi, S.; Choudhary, B.; Christofek, L.; Christoudias, T.; Cihangir, S.; Claes, D.; Coadou, Y.; Cooke, M.; Cooper, W. E.; Corcoran, M.; Couderc, F.; Cousinou, M.-C.; Crépé-Renaudin, S.; Cutts, D.; Ćwiok, M.; da Motta, H.; Das, A.; Davies, G.; de, K.; de Jong, S. J.; de La Cruz-Burelo, E.; de Oliveira Martins, C.; Degenhardt, J. D.; Déliot, F.; Demarteau, M.; Demina, R.; Denisov, D.; Denisov, S. P.; Desai, S.; Diehl, H. T.; Diesburg, M.; Dominguez, A.; Dong, H.; Dudko, L. V.; Duflot, L.; Dugad, S. R.; Duggan, D.; Duperrin, A.; Dyer, J.; Dyshkant, A.; Eads, M.; Edmunds, D.; Ellison, J.; Elvira, V. D.; Enari, Y.; Eno, S.; Ermolov, P.; Evans, H.; Evdokimov, A.; Evdokimov, V. N.; Ferapontov, A. V.; Ferbel, T.; Fiedler, F.; Filthaut, F.; Fisher, W.; Fisk, H. E.; Ford, M.; Fortner, M.; Fox, H.; Fu, S.; Fuess, S.; Gadfort, T.; Galea, C. F.; Gallas, E.; Galyaev, E.; Garcia, C.; Garcia-Bellido, A.; Gavrilov, V.; Gay, P.; Geist, W.; Gelé, D.; Gerber, C. E.; Gershtein, Y.; Gillberg, D.; Ginther, G.; Gollub, N.; Gómez, B.; Goussiou, A.; Grannis, P. D.; Greenlee, H.; Greenwood, Z. D.; Gregores, E. M.; Grenier, G.; Gris, Ph.; Grivaz, J.-F.; Grohsjean, A.; Grünendahl, S.; Grünewald, M. W.; Guo, J.; Guo, F.; Gutierrez, P.; Gutierrez, G.; Haas, A.; Hadley, N. J.; Haefner, P.; Hagopian, S.; Haley, J.; Hall, I.; Hall, R. E.; Han, L.; Hansson, P.; Harder, K.; Harel, A.; Harrington, R.; Hauptman, J. M.; Hauser, R.; Hays, J.; Hebbeker, T.; Hedin, D.; Hegeman, J. G.; Heinmiller, J. M.; Heinson, A. P.; Heintz, U.; Hensel, C.; Herner, K.; Hesketh, G.; Hildreth, M. D.; Hirosky, R.; Hobbs, J. D.; Hoeneisen, B.; Hoeth, H.; Hohlfeld, M.; Hong, S. J.; Hossain, S.; Houben, P.; Hu, Y.; Hubacek, Z.; Hynek, V.; Iashvili, I.; Illingworth, R.; Ito, A. S.; Jabeen, S.; Jaffré, M.; Jain, S.; Jakobs, K.; Jarvis, C.; Jesik, R.; Johns, K.; Johnson, C.; Johnson, M.; Jonckheere, A.; Jonsson, P.; Juste, A.; Kajfasz, E.; Kalinin, A. M.; Kalk, J. R.; Kalk, J. M.; Kappler, S.; Karmanov, D.; Kasper, P. A.; Katsanos, I.; Kau, D.; Kaur, R.; Kaushik, V.; Kehoe, R.; Kermiche, S.; Khalatyan, N.; Khanov, A.; Kharchilava, A.; Kharzheev, Y. M.; Khatidze, D.; Kim, T. J.; Kirby, M. H.; Kirsch, M.; Klima, B.; Kohli, J. M.; Konrath, J.-P.; Korablev, V. M.; Kozelov, A. V.; Krop, D.; Kuhl, T.; Kumar, A.; Kunori, S.; Kupco, A.; Kurča, T.; Kvita, J.; Lacroix, F.; Lam, D.; Lammers, S.; Landsberg, G.; Lebrun, P.; Lee, W. M.; Leflat, A.; Lehner, F.; Lellouch, J.; Leveque, J.; Li, J.; Li, Q. Z.; Li, L.; Lietti, S. M.; Lima, J. G. R.; Lincoln, D.; Linnemann, J.; Lipaev, V. V.; Lipton, R.; Liu, Y.; Liu, Z.; Lobodenko, A.; Lokajicek, M.; Love, P.; Lubatti, H. J.; Luna, R.; Lyon, A. L.; Maciel, A. K. A.; Mackin, D.; Madaras, R. J.; Mättig, P.; Magass, C.; Magerkurth, A.; Mal, P. K.; Malbouisson, H. B.; Malik, S.; Malyshev, V. L.; Mao, H. S.; Maravin, Y.; Martin, B.; McCarthy, R.; Melnitchouk, A.; Mendoza, L.; Mercadante, P. G.; Merkin, M.; Merritt, K. W.; Meyer, J.; Meyer, A.; Millet, T.; Mitrevski, J.; Molina, J.; Mommsen, R. K.; Mondal, N. K.; Moore, R. W.; Moulik, T.; Muanza, G. S.; Mulders, M.; Mulhearn, M.; Mundal, O.; Mundim, L.; Nagy, E.; Naimuddin, M.; Narain, M.; Naumann, N. A.; Neal, H. A.; Negret, J. P.; Neustroev, P.; Nilsen, H.; Nogima, H.; Novaes, S. F.; Nunnemann, T.; O'Dell, V.; O'Neil, D. C.; Obrant, G.; Ochando, C.; Onoprienko, D.; Oshima, N.; Osta, J.; Otec, R.

    2008-05-01

    We present the results of a search for the production of an excited state of the electron, e*, in proton-antiproton collisions at s=1.96TeV. The data were collected with the D0 experiment at the Fermilab Tevatron Collider and correspond to an integrated luminosity of approximately 1fb-1. We search for e* in the process p pmacr →e*e, with the e* subsequently decaying to an electron plus photon. No excess above the standard model background is observed. Interpreting our data in the context of a model that describes e* production by four-fermion contact interactions and e* decay via electroweak processes, we set 95% C.L. upper limits on the production cross section ranging from 8.9 to 27 fb, depending on the mass of the excited electron. Choosing the scale for contact interactions to be Λ=1TeV, excited electron masses below 756 GeV are excluded at the 95% C.L.

  9. Search For Electroweak Single Top Quark Production In 1.96 Tev Proton-antiproton Collisions

    CERN Document Server

    Stelzer, B

    2005-01-01

    This thesis describes the first search for electroweak single top quark production in proton-antiproton collisions at a center of mass energy of 1.96 TeV. The data sample used for this analysis corresponds to 162 pb -1 recorded by the upgraded Collider Detector at Fermilab. The search is performed by doing a classic maximum likelihood fit to the H T distribution in data. The kinematic variable H T is the scalar sum of transverse energies of all final state particles in the event. This variable has the advantage that its distribution looks very similar for both contributing (s- channel and t-channel) single top processes, but is different for background processes. The combination of both channels to one signal improves the sensitivity of the search. No significant evidence for electroweak single top quark production is found and we set an upper limit at the 95% confidence level on the combined single top quark production cross section of 17.8 pb.

  10. Low expression of miR-196b enhances the expression of BCR-ABL1 and HOXA9 oncogenes in chronic myeloid leukemogenesis.

    Directory of Open Access Journals (Sweden)

    Yue Liu

    Full Text Available MicroRNAs (miRNAs can function as tumor suppressors or oncogene promoters during tumor development. In this study, low levels of expression of miR-196b were detected in patients with chronic myeloid leukemia. Bisulfite genomic sequencing PCR and methylation-specific PCR were used to examine the methylation status of the CpG islands in the miR-196b promoter in K562 cells, patients with leukemia and healthy individuals. The CpG islands showed more methylation in patients with chronic myeloid leukemia compared with healthy individuals (P<0.05, which indicated that low expression of miR-196b may be associated with an increase in the methylation of CpG islands. The dual-luciferase reporter assay system demonstrated that BCR-ABL1 and HOXA9 are the target genes of miR-196b, which was consistent with predictions from bioinformatics software analyses. Further examination of cell function indicated that miR-196b acts to reduce BCR-ABL1 and HOXA9 protein levels, decrease cell proliferation rate and retard the cell cycle. A low level of expression of miR-196b can cause up-regulation of BCR-ABL1 and HOXA9 expression, which leads to the development of chronic myeloid leukemia. MiR-196b may represent an effective target for chronic myeloid leukemia therapy.

  11. MicroRNA Profiling Identifies miR-196a as Differentially Expressed in Childhood Adrenoleukodystrophy and Adult Adrenomyeloneuropathy.

    Science.gov (United States)

    Shah, Navjot; Singh, Inderjit

    2017-03-01

    X-linked adrenoleukodystrophy (X-ALD) is a peroxisomal disorder caused by mutations in the ABCD1 gene, leading to a defect in the peroxisomal adrenoleukodystrophy protein (ALDP), which inhibits the β-oxidation of very long chain fatty acids (VLCFAs). It is a complex disease where the same mutation in the peroxisomal ABCD1 can lead to clinically diverse phenotypes ranging from the fatal disorder of cerebral ALD (cALD) to mild adult disorder of adrenomyeloneuropathy (AMN). This suggests a role of epigenetic factors/modifier genes in disease progression of X-ALD which is not understood at present. To examine the possible role of microRNA (miRNA) in X-ALD disease mechanisms for differences in cALD and AMN phenotype, we profiled 1008 known miRNA in cALD, AMN, and normal human skin fibroblasts using miScript miRNA PCR array (Qiagen) and selected miRNAs which had differential expression in cALD and AMN fibroblasts. Eleven miRNA which were differentially regulated in cALD and AMN fibroblasts were identified. miR-196a showed a significant differential expression between cALD and AMN and is further characterized for target gene regulation. The predicted role of miR-196a in inhibition of inflammatory signaling factors (IKKα and IKKβ) and ELOVL1 expression suggests the pathological role of altered expression of miR-196a. This study indicates that miR-196a participated in differential regulation of ELOVL1 and inflammatory response between cALD as compared to AMN and may be a possible biomarker to differentiate between cALD and AMN.

  12. A Fully Reconfigurable Low-Noise Biopotential Sensing Amplifier With 1.96 Noise Efficiency Factor.

    Science.gov (United States)

    Tzu-Yun Wang; Min-Rui Lai; Twigg, Christopher M; Sheng-Yu Peng

    2014-06-01

    A fully reconfigurable biopotential sensing amplifier utilizing floating-gate transistors is presented in this paper. By using the complementary differential pairs along with the current reuse technique, the theoretical limit for the noise efficiency factor of the proposed amplifier is below 1.5. Without consuming any extra power, floating-gate transistors are employed to program the low-frequency cutoff corner of the amplifier and to implement the common-mode feedback. A concept proving prototype chip was designed and fabricated in a 0.35 μm CMOS process occupying 0.17 mm (2) silicon area. With a supply voltage of 2.5 V, the measured midband gain is 40.7 dB and the measured input-referred noise is 2.8 μVrms. The chip was tested under several configurations with the amplifier bandwidth being programmed to 100 Hz, 1 kHz , and 10 kHz. The measured noise efficiency factors in these bandwidth settings are 1.96, 2.01, and 2.25, respectively, which are among the best numbers reported to date. The measured common-mode rejection and the supply rejection are above 70 dB . When the bandwidth is configured to be 10 kHz, the dynamic range measured at 1 kHz is 60 dB with total harmonic distortion less than 0.1%. The proposed amplifier is also demonstrated by recording electromyography (EMG), electrocardiography (ECG), electrooculography (EOG), and electroencephalography (EEG) signals from human bodies.

  13. The role of substrate binding pocket residues phenylalanine 176 and phenylalanine 196 on Pseudomonas sp. OX1 toluene o-xylene monooxygenase activity and regiospecificity.

    Science.gov (United States)

    Sönmez, Burcu; Yanık-Yıldırım, K Cansu; Wood, Thomas K; Vardar-Schara, Gönül

    2014-08-01

    Saturation mutagenesis was used to generate eleven substitutions of toluene-o-xylene monooxygenase (ToMO) at alpha subunit (TouA) positions F176 and F196 among which nine were novel: F176H, F176N, F176S, F176T, F196A, F196L, F196T, F196Y, F196H, F196I, and F196V. By testing the substrates phenol, toluene, and naphthalene, these positions were found to influence ToMO oxidation activity and regiospecificity. Specifically, TouA variant F176H was identified that had 4.7-, 4.3-, and 1.8-fold faster hydroxylation activity towards phenol, toluene, and naphthalene, respectively, compared to native ToMO. The F176H variant also produced the novel product hydroquinone (61%) from phenol, made twofold more 2-naphthol from naphthalene (34% vs. 16% by the wild-type ToMO), and had the regiospecificity of toluene changed from 51% to 73% p-cresol. The TouA F176N variant had the most para-hydroxylation capability, forming p-cresol (92%) from toluene and hydroquinone (82%) from phenol as the major product, whereas native ToMO formed 30% o-cresol, 19% m-cresol, and 51% of p-cresol from toluene and 100% catechol from phenol. For naphthalene oxidation, TouA variant F176S exhibited the largest shift in the product distribution by producing threefold more 2-naphthol. Among the other F196 variants, F196L produced catechol from phenol two times faster than the wild-type enzyme. The TouA F196I variant produced twofold less o-cresol and 19% more p-cresol from toluene, and the TouA F196A variant produced 62% more 2-naphthol from naphthalene compared to wild-type ToMO. Both of these positions have never been studied through the saturation mutagenesis and some of the best substitutions uncovered here have never been predicted and characterized for aromatics hydroxylation. © 2014 Wiley Periodicals, Inc.

  14. MiR-196a exerts its oncogenic effect in glioblastoma multiforme by inhibition of IκBα both in vitro and in vivo

    KAUST Repository

    Yang, Guang

    2014-01-23

    BackgroundRecent studies have revealed that miR-196a is upregulated in glioblastoma multiforme (GBM) and that it correlates with the clinical outcome of patients with GBM. However, its potential regulatory mechanisms in GBM have never been reported.MethodsWe used quantitative real-time PCR to assess miR-196a expression levels in 132 GBM specimens in a single institution. Oncogenic capability of miR-196a was detected by apoptosis and proliferation assays in U87MG and T98G cells. Immunohistochemistry was used to determine the expression of IκBα in GBM tissues, and a luciferase reporter assay was carried out to confirm whether IκBα is a direct target of miR-196a. In vivo, xenograft tumors were examined for an antiglioma effect of miR-196a inhibitors.ResultsWe present for the first time evidence that miR-196a could directly interact with IκBα 3′-UTR to suppress IκBα expression and subsequently promote activation of NF-κB, consequently promoting proliferation of and suppressing apoptosis in GBM cells both in vitro and in vivo. Our study confirmed that miR-196a was upregulated in GBM specimens and that high levels of miR-196a were significantly correlated with poor outcome in a large cohort of GBM patients. Our data from human tumor xenografts in nude mice treated with miR-196 inhibitors demonstrated that inhibition of miR-196a could ameliorate tumor growth in vivo.ConclusionsMiR-196a exerts its oncogenic effect in GBM by inhibiting IκBα both in vitro and in vivo. Our findings provide new insights into the pathogenesis of GBM and indicate that miR-196a may predict clinical outcome of GBM patients and serve as a new therapeutic target for GBM. © 2014 © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Neuro-Oncology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  15. ["Running amok"--content analytic study of 196 news presentations from industrialized countries].

    Science.gov (United States)

    Adler, L; Lehmann, K; Räder, K; Schünemann, K F

    1993-12-01

    We performed a content analysis study based on 196 reports in the German press published during the last decade on acts of violence designated as "going berserk" or "running amok (amuck)" and meeting defined criteria. With less than one person per one million men per year running berserk or amok, this is a very rare act of violence, albeit a very dangerous one involving 1.3 deaths and 1.7 injuries per case. Offenders differ from the normal population in regards to the small percentage of women (5%) and high unemployment (40%), and from other violent offenders in that they are normally occupationally well-qualified. Severe psychiatric disorders are overrepresented. A total of 108 cases were classified according to specific syndromes either by specialists or experts on the spot, or on the basis of a description of the signs and symptoms. Of the syndrome-related acts, the most dangerous offences were committed by 10 delusionally ill and 2 psychopathic individuals. 30 less dangerous offenders suffered from paranoid-hallucinatory syndromes. 28 crimes committed in a state of intoxication and 11 "crimes of passion" were the least dangerous. Another 25 persons with an extensive incidence of suicide in the family, without any apparent pre-existing psychiatric disorder, may have gone berserk in the course of a depressive syndrome. Although psychotically ill individuals tend to overreact more often following a minimal slight, under delusions or with no apparent reason at all, on the whole the causes for both the psychotic and other offenders are of a serious nature. Object loss and private disputes on the one hand and social conflicts on the other were of approximately equal significance. The relationship between the offender and his victim is more essential for the course of the occurrence than motives or the type of the psychopathological syndrome. If only family members are attacked, the offenders have usually been inconspicuous, elderly individuals, two thirds of whom can

  16. miR-196b targets c-myc and Bcl-2 expression, inhibits proliferation and induces apoptosis in endometriotic stromal cells.

    Science.gov (United States)

    Abe, Wakana; Nasu, Kaei; Nakada, Chisato; Kawano, Yukie; Moriyama, Masatsugu; Narahara, Hisashi

    2013-03-01

    What is the global expression pattern of microRNAs (miRNAs) in endometriotic stromal cells and is miR-196b involved in the pathogenesis of endometriosis? Several miRNAs are aberrantly expressed in endometriotic cyst stromal cells (ECSCs), including miR-196b whose expression is repressed in endometriotic stromal cells. Although, histologically, endometriotic tissues and normal proliferative endometrium are similar, a number of distinct molecular differences have been reported to date. The anti-apoptotic and excessive proliferative properties of endometriotic cells are considered to be involved in the development and progression of endometriosis. ECSCs and normal endometrial stromal cells (NESCs) were isolated from ovarian endometriotic tissues and eutopic endometrial tissues, respectively and compared. Aberrantly expressed miRNAs in ECSCs were identified by a global miRNA microarray technique. The roles of miR-196b in ECSC proliferation, apoptosis, and c-myc and B-cell lymphoma/leukemia (Bcl)-2 mRNA expression were investigated with precursor hsa-miR-196b transfection. The methylation status of the miR-196b gene in ECSCs and the effect of a DNA demethylating agent on miR-196b expression were also examined. miRNA microarray analysis identified eight down-regulated miRNAs (including miR-196b) and four up-regulated miRNAs in ECSCs. Compulsory expression of miR-196b directed the inhibition of proliferation and the induction of apoptosis in ECSCs. miR-196b was found to suppress c-myc and Bcl-2 mRNA expression in ECSCs, and there was a significant correlation between miR-196b and HOXA10 expression in ECSCs and NESCs. The miR-196b gene was hypermethylated in ECSCs when compared with NESCs, and the treatment with a DNA demethylating agent restored the expression of miR-196b in ECSCs. miRNA expression profiles were investigated only in the stromal component of ectopic and eutopic endometrium samples. In addition to miR-196b, the roles of other miRNAs aberrantly expressed in

  17. Observation of Exclusive Gamma Gamma Production in p pbar Collisions at sqrt{s}=1.96 TeV

    CERN Document Server

    Aaltonen, T.; Alvarez Gonzalez, B.; Amerio, S.; Amidei, D.; Anastassov, A.; Annovi, A.; Antos, J.; Apollinari, G.; Appel, J.A.; Arisawa, T.; Artikov, A.; Asaadi, J.; Ashmanskas, W.; Auerbach, B.; Aurisano, A.; Azfar, F.; Badgett, W.; Bae, T.; Barbaro-Galtieri, A.; Barnes, V.E.; Barnett, B.A.; Barria, P.; Bartos, P.; Bauce, M.; Bedeschi, F.; Behari, S.; Bellettini, G.; Bellinger, J.; Benjamin, D.; Beretvas, A.; Bhatti, A.; Bisello, D.; Bizjak, I.; Bland, K.R.; Blumenfeld, B.; Bocci, A.; Bodek, A.; Bortoletto, D.; Boudreau, J.; Boveia, A.; Brigliadori, L.; Bromberg, C.; Brucken, E.; Budagov, J.; Budd, H.S.; Burkett, K.; Busetto, G.; Bussey, P.; Buzatu, A.; Calamba, A.; Calancha, C.; Camarda, S.; Campanelli, M.; Campbell, M.; Canelli, F.; Carls, B.; Carlsmith, D.; Carosi, R.; Carrillo, S.; Carron, S.; Casal, B.; Casarsa, M.; Castro, A.; Catastini, P.; Cauz, D.; Cavaliere, V.; Cavalli-Sforza, M.; Cerri, A.; Cerrito, L.; Chen, Y.C.; Chertok, M.; Chiarelli, G.; Chlachidze, G.; Chlebana, F.; Cho, K.; Chokheli, D.; Chung, W.H.; Chung, Y.S.; Ciocci, M.A.; Clark, A.; Clarke, C.; Compostella, G.; Convery, M.E.; Conway, J.; Corbo, M.; Cordelli, M.; Cox, C.A.; Cox, D.J.; Crescioli, F.; Cuevas, J.; Culbertson, R.; Dagenhart, D.; d'Ascenzo, N.; Datta, M.; de Barbaro, P.; Dell'Orso, M.; Demortier, L.; Deninno, M.; Devoto, F.; d'Errico, M.; Di Canto, A.; Di Ruzza, B.; Dittmann, J.R.; D'Onofrio, M.; Donati, S.; Dong, P.; Dorigo, M.; Dorigo, T.; Ebina, K.; Elagin, A.; Eppig, A.; Erbacher, R.; Errede, S.; Ershaidat, N.; Eusebi, R.; Farrington, S.; Feindt, M.; Fernandez, J.P.; Field, R.; Flanagan, G.; Forrest, R.; Frank, M.J.; Franklin, M.; Freeman, J.C.; Funakoshi, Y.; Furic, I.; Gallinaro, M.; Garcia, J.E.; Garfinkel, A.F.; Garosi, P.; Gerberich, H.; Gerchtein, E.; Giagu, S.; Giakoumopoulou, V.; Giannetti, P.; Gibson, K.; Ginsburg, C.M.; Giokaris, N.; Giromini, P.; Giurgiu, G.; Glagolev, V.; Glenzinski, D.; Gold, M.; Goldin, D.; Goldschmidt, N.; Golossanov, A.; Gomez, G.; Gomez-Ceballos, G.; Goncharov, M.; Gonzalez, O.; Gorelov, I.; Goshaw, A.T.; Goulianos, K.; Grinstein, S.; Grosso-Pilcher, C.; Group, R.C.; Guimaraes da Costa, J.; Hahn, S.R.; Halkiadakis, E.; Hamaguchi, A.; Han, J.Y.; Happacher, F.; Hara, K.; Hare, D.; Hare, M.; Harr, R.F.; Hatakeyama, K.; Hays, C.; Heck, M.; Heinrich, J.; Herndon, M.; Hewamanage, S.; Hocker, A.; Hopkins, W.; Horn, D.; Hou, S.; Hughes, R.E.; Hurwitz, M.; Husemann, U.; Hussain, N.; Hussein, M.; Huston, J.; Introzzi, G.; Iori, M.; Ivanov, A.; James, E.; Jang, D.; Jayatilaka, B.; Jeon, E.J.; Jindariani, S.; Jones, M.; Joo, K.K.; Jun, S.Y.; Junk, T.R.; Kamon, T.; Karchin, P.E.; Kasmi, A.; Kato, Y.; Ketchum, W.; Keung, J.; Khotilovich, V.; Kilminster, B.; Kim, D.H.; Kim, H.S.; Kim, J.E.; Kim, M.J.; Kim, S.B.; Kim, S.H.; Kim, Y.K.; Kim, Y.J.; Kimura, N.; Kirby, M.; Klimenko, S.; Knoepfel, K.; Kondo, K.; Kong, D.J.; Konigsberg, J.; Kotwal, A.V.; Kreps, M.; Kroll, J.; Krop, D.; Kruse, M.; Krutelyov, V.; Kuhr, T.; Kurata, M.; Kwang, S.; Laasanen, A.T.; Lami, S.; Lammel, S.; Lancaster, M.; Lander, R.L.; Lannon, K.; Lath, A.; Latino, G.; LeCompte, T.; Lee, E.; Lee, H.S.; Lee, J.S.; Lee, S.W.; Leo, S.; Leone, S.; Lewis, J.D.; Limosani, A.; Lin, C.J.; Lindgren, M.; Lipeles, E.; Lister, A.; Litvintsev, D.O.; Liu, C.; Liu, H.; Liu, Q.; Liu, T.; Lockwitz, S.; Loginov, A.; Lucchesi, D.; Lueck, J.; Lujan, P.; Lukens, P.; Lungu, G.; Lys, J.; Lysak, R.; Madrak, R.; Maeshima, K.; Maestro, P.; Malik, S.; Manca, G.; Manousakis-Katsikakis, A.; Margaroli, F.; Marino, C.; Martinez, M.; Mastrandrea, P.; Matera, K.; Mattson, M.E.; Mazzacane, A.; Mazzanti, P.; McFarland, K.S.; McIntyre, P.; McNulty, R.; Mehta, A.; Mehtala, P.; Mesropian, C.; Miao, T.; Mietlicki, D.; Mitra, A.; Miyake, H.; Moed, S.; Moggi, N.; Mondragon, M.N.; Moon, C.S.; Moore, R.; Morello, M.J.; Morlock, J.; Movilla Fernandez, P.; Mukherjee, A.; Muller, Th.; Murat, P.; Mussini, M.; Nachtman, J.; Nagai, Y.; Naganoma, J.; Nakano, I.; Napier, A.; Nett, J.; Neu, C.; Neubauer, M.S.; Nielsen, J.; Nodulman, L.; Noh, S.Y.; Norniella, O.; Oakes, L.; Oh, S.H.; Oh, Y.D.; Oksuzian, I.; Okusawa, T.; Orava, R.; Ortolan, L.; Pagan Griso, S.; Pagliarone, C.; Palencia, E.; Papadimitriou, V.; Paramonov, A.A.; Patrick, J.; Pauletta, G.; Paulini, M.; Paus, C.; Pellett, D.E.; Penzo, A.; Phillips, T.J.; Piacentino, G.; Pianori, E.; Pilot, J.; Pitts, K.; Plager, C.; Pondrom, L.; Poprocki, S.; Potamianos, K.; Prokoshin, F.; Pranko, A.; Ptohos, F.; Punzi, G.; Rahaman, A.; Ramakrishnan, V.; Ranjan, N.; Redondo, I.; Renton, P.; Rescigno, M.; Riddick, T.; Rimondi, F.; Ristori, L.; Robson, A.; Rodrigo, T.; Rodriguez, T.; Rogers, E.; Rolli, S.; Roser, R.; Ruffini, F.; Ruiz, A.; Russ, J.; Rusu, V.; Safonov, A.; Sakumoto, W.K.; Sakurai, Y.; Santi, L.; Sato, K.; Saveliev, V.; Savoy-Navarro, A.; Schlabach, P.; Schmidt, A.; Schmidt, E.E.; Schwarz, T.; Scodellaro, L.; Scribano, A.; Scuri, F.; Seidel, S.; Seiya, Y.; Semenov, A.; Sforza, F.; Shalhout, S.Z.; Shears, T.; Shepard, P.F.; Shimojima, M.; Shochet, M.; Shreyber-Tecker, I.; Simonenko, A.; Sinervo, P.; Sliwa, K.; Smith, J.R.; Snider, F.D.; Soha, A.; Sorin, V.; Song, H.; Squillacioti, P.; Stancari, M.; St. Denis, R.; Stelzer, B.; Stelzer-Chilton, O.; Stentz, D.; Strologas, J.; Strycker, G.L.; Sudo, Y.; Sukhanov, A.; Suslov, I.; Takemasa, K.; Takeuchi, Y.; Tang, J.; Tecchio, M.; Teng, P.K.; Thom, J.; Thome, J.; Thompson, G.A.; Thomson, E.; Toback, D.; Tokar, S.; Tollefson, K.; Tomura, T.; Tonelli, D.; Torre, S.; Torretta, D.; Totaro, P.; Trovato, M.; Ukegawa, F.; Uozumi, S.; Varganov, A.; Vazquez, F.; Velev, G.; Vellidis, C.; Vidal, M.; Vila, I.; Vilar, R.; Vizan, J.; Vogel, M.; Volpi, G.; Wagner, P.; Wagner, R.L.; Wakisaka, T.; Wallny, R.; Wang, S.M.; Warburton, A.; Waters, D.; Wester, W.C., III; Whiteson, D.; Wicklund, A.B.; Wicklund, E.; Wilbur, S.; Wick, F.; Williams, H.H.; Wilson, J.S.; Wilson, P.; Winer, B.L.; Wittich, P.; Wolbers, S.; Wolfe, H.; Wright, T.; Wu, X.; Wu, Z.; Yamamoto, K.; Yamato, D.; Yang, T.; Yang, U.K.; Yang, Y.C.; Yao, W.M.; Yeh, G.P.; Yi, K.; Yoh, J.; Yorita, K.; Yoshida, T.; Yu, G.B.; Yu, I.; Yu, S.S.; Yun, J.C.; Zanetti, A.; Zeng, Y.; Zhou, C.; Zucchelli, S.

    2012-01-01

    We have observed exclusive \\gamma\\gamma production in proton-antiproton collisions at \\sqrt{s}=1.96 TeV, using data from 1.11 \\pm 0.07 fb^{-1} integrated luminosity taken by the Run II Collider Detector at Fermilab. We selected events with two electromagnetic showers, each with transverse energy E_T > 2.5 GeV and pseudorapidity |\\eta| 2.5$ GeV is 2.48^{+0.40}_{-0.35}(stat)^{+0.40}_{-0.51}(syst) pb.

  18. Search for third-generation scalar leptoquarks in pp at square root s=1.96 TeV.

    Science.gov (United States)

    Abazov, V M; Abbott, B; Abolins, M; Acharya, B S; Adams, M; Adams, T; Aguilo, E; Ahn, S H; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Ancu, L S; Andeen, T; Anderson, S; Andrieu, B; Anzelc, M S; Arnoud, Y; Arov, M; Arthaud, M; Askew, A; Asman, B; Assis Jesus, A C S; Atramentov, O; Autermann, C; Avila, C; Ay, C; Badaud, F; Baden, A; Bagby, L; Baldin, B; Bandurin, D V; Banerjee, P; Banerjee, S; Barberis, E; Barfuss, A-F; Bargassa, P; Baringer, P; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Beale, S; Bean, A; Begalli, M; Begel, M; Belanger-Champagne, C; Bellantoni, L; Bellavance, A; Benitez, J A; Beri, S B; Bernardi, G; Bernhard, R; Berntzon, L; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Biscarat, C; Blazey, G; Blekman, F; Blessing, S; Bloch, D; Bloom, K; Boehnlein, A; Boline, D; Bolton, T A; Borissov, G; Bos, K; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Brown, D; Buchanan, N J; Buchholz, D; Buehler, M; Buescher, V; Burdin, S; Burke, S; Burnett, T H; Buszello, C P; Butler, J M; Calfayan, P; Calvet, S; Cammin, J; Caron, S; Carvalho, W; Casey, B C K; Cason, N M; Castilla-Valdez, H; Chakrabarti, S; Chakraborty, D; Chan, K; Chan, K M; Chandra, A; Charles, F; Cheu, E; Chevallier, F; Cho, D K; Choi, S; Choudhary, B; Christofek, L; Christoudias, T; Cihangir, S; Claes, D; Clément, B; Clément, C; Coadou, Y; Cooke, M; Cooper, W E; Corcoran, M; Couderc, F; Cousinou, M-C; Crépé-Renaudin, S; Cutts, D; Cwiok, M; da Motta, H; Das, A; Davies, G; De, K; de Jong, P; de Jong, S J; De La Cruz-Burelo, E; De Oliveira Martins, C; Degenhardt, J D; Déliot, F; Demarteau, M; Demina, R; Denisov, D; Denisov, S P; Desai, S; Diehl, H T; Diesburg, M; Dominguez, A; Dong, H; Dudko, L V; Duflot, L; Dugad, S R; Duggan, D; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Ellison, J; Elvira, V D; Enari, Y; Eno, S; Ermolov, P; Evans, H; Evdokimov, A; Evdokimov, V N; Ferapontov, A V; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Ford, M; Fortner, M; Fox, H; Fu, S; Fuess, S; Gadfort, T; Galea, C F; Gallas, E; Galyaev, E; Garcia, C; Garcia-Bellido, A; Gavrilov, V; Gay, P; Geist, W; Gelé, D; Gerber, C E; Gershtein, Y; Gillberg, D; Ginther, G; Gollub, N; Gómez, B; Goussiou, A; Grannis, P D; Greenlee, H; Greenwood, Z D; Gregores, E M; Grenier, G; Gris, Ph; Grivaz, J-F; Grohsjean, A; Grünendahl, S; Grünewald, M W; Guo, F; Guo, J; Gutierrez, G; Gutierrez, P; Haas, A; Hadley, N J; Haefner, P; Hagopian, S; Haley, J; Hall, I; Hall, R E; Han, L; Hanagaki, K; Hansson, P; Harder, K; Harel, A; Harrington, R; Hauptman, J M; Hauser, R; Hays, J; Hebbeker, T; Hedin, D; Hegeman, J G; Heinmiller, J M; Heinson, A P; Heintz, U; Hensel, C; Herner, K; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hoeth, H; Hohlfeld, M; Hong, S J; Hooper, R; Hossain, S; Houben, P; Hu, Y; Hubacek, Z; Hynek, V; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jakobs, K; Jarvis, C; Jesik, R; Johns, K; Johnson, C; Johnson, M; Jonckheere, A; Jonsson, P; Juste, A; Käfer, D; Kahn, S; Kajfasz, E; Kalinin, A M; Kalk, J M; Kalk, J R; Kappler, S; Karmanov, D; Kasper, J; Kasper, P; Katsanos, I; Kau, D; Kaur, R; Kaushik, V; Kehoe, R; Kermiche, S; Khalatyan, N; Khanov, A; Kharchilava, A; Kharzheev, Y M; Khatidze, D; Kim, H; Kim, T J; Kirby, M H; Kirsch, M; Klima, B; Kohli, J M; Konrath, J-P; Kopal, M; Korablev, V M; Kothari, B; Kozelov, A V; Krop, D; Kryemadhi, A; Kuhl, T; Kumar, A; Kunori, S; Kupco, A; Kurca, T; Kvita, J; Lam, D; Lammers, S; Landsberg, G; Lazoflores, J; Lebrun, P; Lee, W M; Leflat, A; Lehner, F; Lellouch, J; Lesne, V; Leveque, J; Lewis, P; Li, J; Li, L; Li, Q Z; Lietti, S M; Lima, J G R; Lincoln, D; Linnemann, J; Lipaev, V V; Lipton, R; Liu, Y; Liu, Z; Lobo, L; Lobodenko, A; Lokajicek, M; Lounis, A; Love, P; Lubatti, H J; Lyon, A L; Maciel, A K A; Mackin, D; Madaras, R J; Mättig, P; Magass, C; Magerkurth, A; Makovec, N; Mal, P K; Malbouisson, H B; Malik, S; Malyshev, V L; Mao, H S; Maravin, Y; Martin, B; McCarthy, R; Melnitchouk, A; Mendes, A; Mendoza, L; Mercadante, P G; Merkin, M; Merritt, K W; Meyer, A; Meyer, J; Michaut, M; Millet, T; Mitrevski, J; Molina, J; Mommsen, R K; Mondal, N K; Moore, R W; Moulik, T; Muanza, G S; Mulders, M; Mulhearn, M; Mundal, O; Mundim, L; Nagy, E; Naimuddin, M; Narain, M; Naumann, N A; Neal, H A; Negret, J P; Neustroev, P; Nilsen, H; Noeding, C; Nomerotski, A; Novaes, S F; Nunnemann, T; O'Dell, V; O'Neil, D C; Obrant, G; Ochando, C; Onoprienko, D; Oshima, N; Osta, J; Otec, R; Otero Y Garzón, G J; Owen, M; Padley, P; Pangilinan, M; Parashar, N; Park, S-J; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Pawloski, G; Perea, P M; Peters, K; Peters, Y; Pétroff, P; Petteni, M; Piegaia, R; Piper, J; Pleier, M-A; Podesta-Lerma, P L M; Podstavkov, V M; Pogorelov, Y; Pol, M-E; Pompos, A; Pope, B G; Popov, A V; Potter, C; Prado da Silva, W L; Prosper, H B; Protopopescu, S; Qian, J; Quadt, A; Quinn, B; Rakitine, A; Rangel, M S; Rani, K J; Ranjan, K; Ratoff, P N; Renkel, P; Reucroft, S; Rich, P; Rijssenbeek, M; Ripp-Baudot, I; Rizatdinova, F; Robinson, S; Rodrigues, R F; Royon, C; Rubinov, P; Ruchti, R; Safonov, G; Sajot, G; Sánchez-Hernández, A; Sanders, M P; Santoro, A; Savage, G; Sawyer, L; Scanlon, T; Schaile, D; Schamberger, R D; Scheglov, Y; Schellman, H; Schieferdecker, P; Schleiphake, T; Schmitt, C; Schwanenberger, C; Schwartzman, A; Schwienhorst, R; Sekaric, J; Sengupta, S; Severini, H; Shabalina, E; Shamim, M; Shary, V; Shchukin, A A; Shivpuri, R K; Shpakov, D; Siccardi, V; Simak, V; Sirotenko, V; Skubic, P; Slattery, P; Smirnov, D; Smith, R P; Snow, G R; Snow, J; Snyder, S; Söldner-Rembold, S; Sonnenschein, L; Sopczak, A; Sosebee, M; Soustruznik, K; Souza, M; Spurlock, B; Stark, J; Steele, J; Stolin, V; Stone, A; Stoyanova, D A; Strandberg, J; Strandberg, S; Strang, M A; Strauss, M; Ströhmer, R; Strom, D; Strovink, M; Stutte, L; Sumowidagdo, S; Svoisky, P; Sznajder, A; Talby, M; Tamburello, P; Tanasijczuk, A; Taylor, W; Telford, P; Temple, J; Tiller, B; Tissandier, F; Titov, M; Tokmenin, V V; Tomoto, M; Toole, T; Torchiani, I; Trefzger, T; Tsybychev, D; Tuchming, B; Tully, C; Tuts, P M; Unalan, R; Uvarov, L; Uvarov, S; Uzunyan, S; Vachon, B; van den Berg, P J; van Eijk, B; Van Kooten, R; van Leeuwen, W M; Varelas, N; Varnes, E W; Vartapetian, A; Vasilyev, I A; Vaupel, M; Verdier, P; Vertogradov, L S; Verzocchi, M; Villeneuve-Seguier, F; Vint, P; Von Toerne, E; Voutilainen, M; Vreeswijk, M; Wagner, R; Wahl, H D; Wang, L; Wang, M H L S; Warchol, J; Watts, G; Wayne, M; Weber, G; Weber, M; Weerts, H; Wenger, A; Wermes, N; Wetstein, M; White, A; Wicke, D; Wilson, G W; Wimpenny, S J; Wobisch, M; Wood, D R; Wyatt, T R; Xie, Y; Yacoob, S; Yamada, R; Yan, M; Yasuda, T; Yatsunenko, Y A; Yip, K; Yoo, H D; Youn, S W; Yu, C; Yu, J; Yurkewicz, A; Zatserklyaniy, A; Zeitnitz, C; Zhang, D; Zhao, T; Zhou, B; Zhu, J; Zielinski, M; Zieminska, D; Zieminski, A; Zivkovic, L; Zutshi, V; Zverev, E G

    2007-08-10

    We report on a search for charge-1/3 third-generation leptoquarks (LQ) produced in pp collisions at square root s =1.96 TeV using the D0 detector at Fermilab. Third-generation leptoquarks are assumed to be produced in pairs and to decay to a tau neutrino and a b quark with branching fraction B. We place upper limits on sigma(pp --> LQLQ)B2 as a function of the leptoquark mass M(LQ). Assuming B=1, we exclude at the 95% confidence level third-generation scalar leptoquarks with M(LQ)<229 GeV.

  19. Measurement of dijet azimuthal decorrelations at central rapidities in pp collisions at sqrt s =1.96 TeV.

    Science.gov (United States)

    Abazov, V M; Abbott, B; Abolins, M; Acharya, B S; Adams, D L; Adams, M; Adams, T; Agelou, M; Agram, J-L; Ahmed, S N; Ahn, S H; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Anderson, S; Andrieu, B; Arnoud, Y; Askew, A; Asman, B; Atramentov, O; Autermann, C; Avila, C; Babukhadia, L; Bacon, T C; Badaud, F; Baden, A; Baffioni, S; Baldin, B; Balm, P W; Banerjee, S; Barberis, E; Bargassa, P; Baringer, P; Barnes, C; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Bean, A; Beauceron, S; Beaudette, F; Begel, M; Bellavance, A; Beri, S B; Bernardi, G; Bernhard, R; Bertram, I; Besançon, M; Besson, A; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Bhattacharjee, M; Binder, M; Bischoff, A; Black, K M; Blackler, I; Blazey, G; Blekman, F; Blessing, S; Bloch, D; Blumenschein, U; Boehnlein, A; Boeriu, O; Bolton, T A; Bonamy, P; Borcherding, F; Borissov, G; Bos, K; Bose, T; Boswell, C; Brandt, A; Briskin, G; Brock, R; Brooijmans, G; Bross, A; Buchanan, N J; Buchholz, D; Buehler, M; Buescher, V; Burdin, S; Burnett, T H; Busato, E; Butler, J M; Bystricky, J; Canelli, F; Carvalho, W; Casey, B C K; Casey, D; Cason, N M; Castilla-Valdez, H; Chakrabarti, S; Chakraborty, D; Chan, K M; Chandra, A; Chapin, D; Charles, F; Cheu, E; Chevalier, L; Cho, D K; Choi, S; Chopra, S; Christiansen, T; Christofek, L; Claes, D; Clark, A R; Clément, B; Clément, C; Coadou, Y; Colling, D J; Coney, L; Connolly, B; Cooke, M; Cooper, W E; Coppage, D; Corcoran, M; Coss, J; Cothenet, A; Cousinou, M-C; Crépé-Renaudin, S; Cristetiu, M; Cummings, M A C; Cutts, D; da Motta, H; Davies, B; Davies, G; Davis, G A; De, K; de Jong, P; de Jong, S J; De La Cruz-Burelo, E; Martins, C De Oliveira; Dean, S; Del Signore, K; Déliot, F; Delsart, P A; Demarteau, M; Demina, R; Demine, P; Denisov, D; Denisov, S P; Desai, S; Diehl, H T; Diesburg, M; Doidge, M; Dong, H; Doulas, S; Duflot, L; Dugad, S R; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Edwards, T; Ellison, J; Elmsheuser, J; Eltzroth, J T; Elvira, V D; Eno, S; Ermolov, P; Eroshin, O V; Estrada, J; Evans, D; Evans, H; Evdokimov, A; Evdokimov, V N; Fast, J; Fatakia, S N; Fein, D; Feligioni, L; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Fleuret, F; Fortner, M; Fox, H; Freeman, W; Fu, S; Fuess, S; Galea, C F; Gallas, E; Galyaev, E; Gao, M; Garcia, C; Garcia-Bellido, A; Gardner, J; Gavrilov, V; Gay, P; Gelé, D; Gelhaus, R; Genser, K; Gerber, C E; Gershtein, Y; Geurkov, G; Ginther, G; Goldmann, K; Golling, T; Gómez, B; Gounder, K; Goussiou, A; Graham, G; Grannis, P D; Greder, S; Green, J A; Greenlee, H; Greenwood, Z D; Gregores, E M; Grinstein, S; Gris, Ph; Grivaz, J-F; Groer, L; Grünendahl, S; Grünewald, M W; Gu, W; Gurzhiev, S N; Gutierrez, G; Gutierrez, P; Haas, A; Hadley, N J; Haggerty, H; Hagopian, S; Hall, I; Hall, R E; Han, C; Han, L; Hanagaki, K; Hanlet, P; Harder, K; Harrington, R; Hauptman, J M; Hauser, R; Hays, C; Hays, J; Hebbeker, T; Hebert, C; Hedin, D; Heinmiller, J M; Heinson, A P; Heintz, U; Hensel, C; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hohlfeld, M; Hong, S J; Hooper, R; Hou, S; Houben, P; Hu, Y; Huang, J; Huang, Y; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jain, V; Jakobs, K; Jenkins, A; Jesik, R; Jiang, Y; Johns, K; Johnson, M; Johnson, P; Jonckheere, A; Jonsson, P; Jöstlein, H; Juste, A; Kado, M M; Käfer, D; Kahl, W; Kahn, S; Kajfasz, E; Kalinin, A M; Kalk, J; Karmanov, D; Kasper, J; Kau, D; Ke, Z; Kehoe, R; Kermiche, S; Kesisoglou, S; Khanov, A; Kharchilava, A; Kharzheev, Y M; Kim, K H; Klima, B; Klute, M; Kohli, J M; Kopal, M; Korablev, V M; Kotcher, J; Kothari, B; Kotwal, A V; Koubarovsky, A; Kouznetsov, O; Kozelov, A V; Kozminski, J; Krane, J; Krishnaswamy, M R; Krzywdzinski, S; Kubantsev, M; Kuleshov, S; Kulik, Y; Kunori, S; Kupco, A; Kurca, T; Kuznetsov, V E; Lager, S; Lahrichi, N; Landsberg, G; Lazoflores, J; Le Bihan, A-C; Lebrun, P; Lee, S W; Lee, W M; Leflat, A; Leggett, C; Lehner, F; Leonidopoulos, C; Lewis, P; Li, J; Li, Q Z; Li, X; Lima, J G R; Lincoln, D; Linn, S L; Linnemann, J; Lipaev, V V; Lipton, R; Lobo, L; Lobodenko, A; Lokajicek, M; Lounis, A; Lu, J; Lubatti, H J; Lucotte, A; Lueking, L; Luo, C; Lynker, M; Lyon, A L; Maciel, A K A; Madaras, R J; Mättig, P; Magerkurth, A; Magnan, A-M; Maity, M; Makovec, N; Mal, P K; Malik, S; Malyshev, V L; Manankov, V; Mao, H S; Maravin, Y; Marshall, T; Martens, M; Martin, M I; Mattingly, S E K; Mayorov, A A; McCarthy, R; McCroskey, R; McMahon, T; Meder, D; Melanson, H L; Melnitchouk, A; Meng, X; Merkin, M; Merritt, K W; Meyer, A; Miao, C; Miettinen, H; Mihalcea, D; Mitrevski, J; Mokhov, N; Molina, J; Mondal, N K; Montgomery, H E; Moore, R W; Mostafa, M; Muanza, G S; Mulders, M; Mutaf, Y D; Nagy, E; Nang, F; Narain, M; Narasimham, V S; Naumann, N A; Neal, H A; Negret, J P; Nelson, S; Neustroev, P; Noeding, C; Nomerotski, A; Novaes, S F; Nunnemann, T; Nurse, E; O'Dell, V; O'Neil, D C; Oguri, V; Oliveira, N; Olivier, B; Oshima, N; Otero y Garzón, G J; Padley, P; Papageorgiou, K; Parashar, N; Park, J; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Perea, P M; Perez, E; Peters, O; Pétroff, P; Petteni, M; Phaf, L; Piegaia, R; Podesta-Lerma, P L M; Podstavkov, V M; Pogorelov, Y; Pope, B G; Popkov, E; Prado da Silva, W L; Prosper, H B; Protopopescu, S; Przybycien, M B; Qian, J; Quadt, A; Quinn, B; Rani, K J; Rapidis, P A; Ratoff, P N; Reay, N W; Renardy, J-F; Reucroft, S; Rha, J; Ridel, M; Rijssenbeek, M; Ripp-Baudot, I; Rizatdinova, F; Royon, C; Rubinov, P; Ruchti, R; Sabirov, B M; Sajot, G; Sánchez-Hernández, A; Sanders, M P; Santoro, A; Savage, G; Sawyer, L; Scanlon, T; Schamberger, R D; Schellman, H; Schieferdecker, P; Schmitt, C; Schukin, A A; Schwartzman, A; Schwienhorst, R; Sengupta, S; Severini, H; Shabalina, E; Shary, V; Shephard, W D; Shpakov, D; Sidwell, R A; Simak, V; Sirotenko, V; Skow, D; Skubic, P; Slattery, P; Smith, R P; Smolek, K; Snow, G R; Snow, J; Snyder, S; Söldner-Rembold, S; Song, X; Song, Y; Sonnenschein, L; Sopczak, A; Sorín, V; Sosebee, M; Soustruznik, K; Souza, M; Spurlock, B; Stanton, N R; Stark, J; Steele, J; Steinbrück, G; Stevenson, K; Stolin, V; Stone, A; Stoyanova, D A; Strandberg, J; Strang, M A; Strauss, M; Ströhmer, R; Strovink, M; Stutte, L; Sumowidagdo, S; Sznajder, A; Talby, M; Tamburello, P; Taylor, W; Telford, P; Temple, J; Tentindo-Repond, S; Thomas, E; Thooris, B; Tomoto, M; Toole, T; Torborg, J; Towers, S; Trefzger, T; Trincaz-Duvoid, S; Trippe, T G; Tuchming, B; Tully, C; Turcot, A S; Tuts, P M; Uvarov, L; Uvarov, S; Uzunyan, S; Vachon, B; Van Kooten, R; van Leeuwen, W M; Varelas, N; Varnes, E W; Vasilyev, I A; Vaupel, M; Verdier, P; Vertogradov, L S; Verzocchi, M; Villeneuve-Seguier, F; Vlimant, J-R; Von Toerne, E; Vreeswijk, M; Vu Anh, T; Wahl, H D; Walker, R; Wallace, N; Wang, Z-M; Warchol, J; Warsinsky, M; Watts, G; Wayne, M; Weber, M; Weerts, H; Wegner, M; Wermes, N; White, A; White, V; Whiteson, D; Wicke, D; Wijngaarden, D A; Wilson, G W; Wimpenny, S J; Wittlin, J; Wlodek, T; Wobisch, M; Womersley, J; Wood, D R; Wu, Z; Wyatt, T R; Xu, Q; Xuan, N; Yamada, R; Yan, M; Yasuda, T; Yatsunenko, Y A; Yen, Y; Yip, K; Youn, S W; Yu, J; Yurkewicz, A; Zabi, A; Zatserklyaniy, A; Zdrazil, M; Zeitnitz, C; Zhang, B; Zhang, D; Zhang, X; Zhao, T; Zhao, Z; Zheng, H; Zhou, B; Zhou, Z; Zhu, J; Zielinski, M; Zieminska, D; Zieminski, A; Zitoun, R; Zutshi, V; Zverev, E G; Zylberstejn, A

    2005-06-10

    Correlations in the azimuthal angle between the two largest transverse momentum jets have been measured using the D0 detector in p (-)p collisions at a center-of-mass energy sqrt[s]=1.96 TeV. The analysis is based on an inclusive dijet event sample in the central rapidity region corresponding to an integrated luminosity of 150 pb(-1). Azimuthal correlations are stronger at larger transverse momenta. These are well described in perturbative QCD at next-to-leading order in the strong coupling constant, except at large azimuthal differences where contributions with low transverse momentum are significant.

  20. New results on the superdeformed {sup 196}Pb nucleus: The decay of the excited bands to the yrast band

    Energy Technology Data Exchange (ETDEWEB)

    Bouneau, S.; Azaiez, F.; Duprat, J. [IPN, Orsay (France)] [and others

    1996-12-31

    The study of the superdeformed (SD) {sup 196}Pb nucleus has been revisited using the EUROGAM phase 2 spectrometer. In addition to the known yrast and two lowest excited SD bands, a third excited SD band has been seen. All of the three excited bands were found to decay to the yrast SD band through, presumably, E1 transitions, allowing relative spin and excitation energy assignments. Comparisons with calculations using the random-phase approximation suggest that all three excited bands can be interpreted as octupole vibrational structures.

  1. MicroRNA-196a & microRNA-101 expression in Barrett's oesophagus in patients with medically and surgically treated gastro-oesophageal reflux

    Directory of Open Access Journals (Sweden)

    Bright Tim

    2011-02-01

    Full Text Available Abstract Background Proton pump inhibitor (PPI medication and surgical fundoplication are used for the control of gastro-oesophageal reflux in patients with Barrett's oesophagus, but differ in their effectiveness for both acid and bile reflux. This might impact on the inflammatory processes that are associated with progression of Barrett's oesophagus to cancer, and this may be evident in the gene expression profile and microRNA expression pattern in Barrett's oesophagus mucosa. We hypothesised that two miRNAs with inflammatory and oncogenic roles, miR-101 and miR-196a, are differentially expressed in Barrett's oesophagus epithelium in patients with reflux treated medically vs. surgically. Findings Mucosal tissue was obtained at endoscopy from patients with Barrett's oesophagus whose reflux was controlled by proton pump inhibitor (PPI therapy (n = 20 or by fundoplication (n = 19. RNA was extracted and the expression of miR-101 and miR-196a was measured using real-time reverse transcription - polymerase chain reaction. There were no significant differences in miR-101 and miR-196a expression in Barrett's oesophagus epithelium in patients treated by PPI vs. fundoplication (p = 0.768 and 0.211 respectively. Secondary analysis showed a correlation between miR-196a expression and Barrett's oesophagus segment length (p = 0.014. Conclusion The method of reflux treatment did not influence the expression of miR-101 and miR-196a in Barrett's oesophagus. This data does not provide support to the hypothesis that surgical treatment of reflux better prevents cancer development in Barrett's oesophagus. The association between miR-196a expression and Barrett's oesophagus length is consistent with a tumour promoting role for miR-196a in Barrett's oesophagus.

  2. Cathepsin activities and membrane integrity of zebrafish (Danio rerio) oocytes after freezing to -196 degrees C using controlled slow cooling.

    Science.gov (United States)

    Zhang, T; Rawson, D M; Tosti, L; Carnevali, O

    2008-04-01

    This study investigated enzymatic activity of cathepsins and the membrane integrity of zebrafish (Danio rerio) oocytes after freezing to -196 degrees C using controlled slow cooling. Stage III oocytes (>0.5mm), obtained through dissection of anaesthetised female fish and desegregation of ovarian cumulus, were exposed to 2M methanol or 2M DMSO (both prepared in Hank's medium) for 30min at 22 degrees C before being loaded into 0.5ml plastic straws and placed into a programmable cooler. After controlled slow freezing, samples were plunged into liquid nitrogen (LN) and held for at least 10min, and thawed by immersing straws into a 27 degrees C water bath for 10s. Thawed oocytes were washed twice in Hank's medium. Cathepsin activity and membrane integrity of oocytes were assessed both after cryoprotectant treatment at 22 degrees C and after freezing in LN. Cathepsin B and L colorimetric analyses were performed using substrates Z-Arg-ArgNNap and Z-Phe-Arg-4MbetaNA-HCl, respectively, and 2-naphthylamine and 4-methoxy-2-naphthylamine were used as standards. Cathepsin D activity was performed by analysing the level of hydrolytic action on haemoglobin. Oocytes membrane integrity was assessed using 0.2% Trypan blue staining for 5min. Analysis of cathepsin activities showed that whilst the activity of cathepsin B and D was not affected by 2M DMSO treatment, their activity was lowered when treated with 2M methanol. Following freezing to -196 degrees C, the activity of all cathepsins (B, D and L) was significantly decreased in both 2M DMSO and 2M methanol. Trypan blue staining showed that 63.0+/-11.3% and 72.7+/-5.2% oocytes membrane stayed intact after DMSO and methanol treatment for 30min at 22 degrees C, respectively, whilst 14.9+/-2.6% and 1.4+/-0.8% stayed intact after freezing in DMSO and methanol to -196 degrees C. The results indicate that cryoprotectant treatment and freezing modified the activities of lysosomal enzymes involved in oocyte maturation and yolk

  3. Measurement of the t{bar t} cross section at {radical}s = 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Victor Abazov et al.

    2003-07-29

    A measurement of the t{bar t} cross section at {radical}s = 1.96 TeV is carried out on data samples of {approx}40 pb{sup -1} in dilepton channels (e{mu}, ee and {mu}{mu}) and lepton+jets channels using two complementary approaches: a fully topological analysis and a soft-muon-tag. Overall, 17 events are observed with an expected background of 6.5 {+-} 0.6. This excess corresponds to an observation probability of three standard deviations and the measured t{bar t} cross section is: {sigma}{sub p}{bar p}{yields} t{bar t} = 8.5{sub -3.6}{sup +4.5} (stat) {sub -3.5}{sup +6.3} (sys) {+-} 0.8 (lumi) pb.

  4. Production of psi(2S) Mesons in p anti-p Collisions at 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Aaltonen, T.; /Helsinki Inst. of Phys.; Adelman, Jahred A.; /Chicago U., EFI; Akimoto, T.; /Tsukuba U.; Alvarez Gonzalez, B.; /Cantabria Inst. of Phys.; Amerio, S.; /INFN, Padua; Amidei, Dante E.; /Michigan U.; Anastassov, A.; /Northwestern U.; Annovi, Alberto; /Frascati; Antos, Jaroslav; /Comenius U.; Apollinari, G.; /Fermilab; Apresyan, A.; /Purdue U. /Waseda U.

    2009-05-01

    The authors have measured the differential cross section for the inclusive production of {psi}(2S) mesons decaying to {mu}{sup +}{mu}{sup -} that were produced in prompt or B-decay processes from p{bar p} collisions at 1.96 TeV. These measurements have been made using a data set from an integrated luminosity of 1.1 fb{sup -1} collected by the CDF II detector at Fermilab. For events with transverse momentum p{sub T}({psi}(2S)) > 2 GeV/c and rapidity |y({psi}(2S))| < 0.6 we measure the integrated inclusive cross section {sigma}(p{bar p} {yields} {psi}(2S)X) {center_dot} Br({psi}(2S) {yields} {mu}{sup +}{mu}{sup -}) to be 3.29 {+-} 0.04(stat.) {+-} 0.32(syst.) nb.

  5. Search for chargino-neutralino production in ppbar collisions at $\\sqrt{s}$ = 1.96 TeV

    CERN Document Server

    Aaltonen, T; Adelman, J; Affolder, T; Akimoto, T; Albrow, M G; Amerio, S; Amidei, D; Anastassov, A; Anikeev, K; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Aurisano, A; Azfar, F; Azzi-Bacchetta, P; Azzurri, P; Bacchetta, N; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Baroiant, S; Bartsch, V; Bauer, G; Beauchemin, P H; Bedeschi, F; Behari, S; Bellettini, G; Bellinger, J; Belloni, A; Benjamin, D; Beretvas, A; Beringer, J; Berry, T; Bhatti, A; Binkley, M; Bisello, D; Bizjak, I; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bölla, G; Bolshov, A; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, Yu; Budd, H S; Budd, S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Byrum, K L; Cabrera, S; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carillo, S; Carlsmith, D; Carosi, R; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, I; Cho, K; Chokheli, D; Chou, J P; Choudalakis, G; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Cilijak, M; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Coca, M; Compostella, G; Convery, M E; Conway, J; Cooper, B; Copic, K; Cordelli, M; Cortiana, G; Crescioli, F; Cuenca-Almenar, C; Cuevas-Maestro, J; Culbertson, R; Cully, J C; Da Ronco, S; Datta, M; D'Auria, S; Davies, T; Dagenhart, D; De Barbaro, P; De Cecco, S; Deisher, A; De Lentdecker, G; De Lorenzo, G; Dell'Orso, Mauro; Delli Paoli, F; Demortier, L; Deng, J; Deninno, M; De Pedis, D; Derwent, P F; Di Giovanni, G P; Dionisi, C; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Dorr, C; Donati, S; Dong, P; Donini, J; Dorigo, T; Dube, S; Efron, J; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, I; Fedorko, W T; Feild, R G; Feindt, M; Fernández, J P; Field, R; Flanagan, G; Forrest, R; Forrester, S; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; García, J E; Garberson, F; Garfinkel, A F; Gay, C; Gerberich, H; Gerdes, D; Giagu, S; Giannetti, P; Gibson, K; Gimmell, J L; Ginsburg, C; Giokaris, N; Giordani, M; Giromini, P; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Goldstein, J; Golossanov, A; Gómez, G; Gómez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Grinstein, S; Grosso-Pilcher, C; Group, R C; Grundler, U; Guimarães da Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Hamilton, A; Han, B Y; Han, J Y; Handler, R; Happacher, F; Hara, K; Hare, D; Hare, M; Harper, S; Harr, R F; Harris, R M; Hartz, M; Hatakeyama, K; Hauser, J; Hays, C; Heck, M; Heijboer, A; Heinemann, B; Heinrich, J; Henderson, C; Herndon, M; Heuser, J; Hidas, D; Hill, C S; Hirschbuehl, D; Höcker, A; Holloway, A; Hou, S; Houlden, M; Hsu, S C; Huffman, B T; Hughes, R E; Husemann, U; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ivanov, A; Iyutin, B; James, E; Jang, D; Jayatilaka, B; Jeans, D; Jeon, E J; Jindariani, S; Johnson, W; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Karchin, P E; Kato, Y; Kemp, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Klute, M; Knuteson, B; Ko, B R; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kraan, A C; Kraus, J; Kreps, M; Kroll, J; Krumnack, N; Kruse, M; Krutelyov, V; Kubo, T; Kuhlmann, S E; Kuhr, T; Kulkarni, N P; Kusakabe, Y; Kwang, S; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; LeCompte, T; Lee, J; Lee, J; Lee, Y J; Lee, S W; Lefèvre, R; Leonardo, N; Leone, S; Levy, S; Lewis, J D; Lin, C; Lin, C S; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Lu, R S; Lucchesi, D; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Lytken, E; Mack, P; MacQueen, D; Madrak, R; Maeshima, K; Makhoul, K; Mäki, T; Maksimovic, P; Malde, S; Malik, S; Manca, G; Manousakis, A; Margaroli, F; Marginean, R; Marino, C; Marino, C P; Martin, A; Martin, M; Martin, V; Martínez, M; Martinez-Ballarin, R; Maruyama, T; Mastrandrea, P; Masubuchi, T; Matsunaga, H; Mattson, M E; Mazini, R; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtälä, P; Menzemer, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Miao, T; Miladinovic, N; Miles, J; Miller, R; Mills, C; Milnik, M; Mitra, A; Mitselmakher, G; Miyamoto, A; Moed, S; Moggi, N; Mohr, B; Moon, C S; Moore, R; Morello, M; Movilla-Fernández, P A; Mülmenstädt, J; Mukherjee, A; Müller, T; Mumford, R; Murat, P; Mussini, M; Nachtman, J; Nagano, A; Naganoma, J; Nakamura, K; Nakano, I; Napier, A; Necula, V; Neu, C; Neubauer, M S; Nielsen, J; Nodulman, L; Norniella, O; Nurse, E; Oh, S H; Oh, Y D; Oksuzian, I; Okusawa, T; Oldeman, R; Orava, R; Österberg, K; Pagliarone, C; Palencia, E; Papadimitriou, V; Papaikonomou, A; Paramonov, A A; Parks, B; Pashapour, S; Patrick, J; Pauletta, G; Paulini, M; Paus, C; Pellett, D E; Penzo, Aldo L; Phillips, T J; Piacentino, G; Piedra, J; Pinera, L; Pitts, K; Plager, C; Pondrom, L; Portell, X; Poukhov, O; Pounder, N; Prakoshyn, F; Pronko, A; Proudfoot, J; Ptohos, F; Punzi, G; Pursley, J; Rademacker, J; Rahaman, A; Ramakrishnan, V; Ranjan, N; Redondo, I; Reisert, B; Rekovic, V; Renton, P B; Rescigno, M; Richter, S; Rimondi, F; Ristori, L; Robson, A; Rodrigo, T; Rogers, E; Rolli, S; Roser, R; Rossi, M; Rossin, R; Roy, P; Ruiz, A; Russ, J; Rusu, V; Saarikko, H; Safonov, A; Sakumoto, W K; Salamanna, G; Salto, O; Santi, L; Sarkar, S; Sartori, L; Sato, K; Savard, P; Savoy-Navarro, A; Scheidle, T; Schlabach, P; Schmidt, E E; Schmidt, M P; Schmitt, M; Schwarz, T; Scodellaro, L; Scott, A L; Scribano, A; Scuri, F; Sedov, A; Seidel, S; Seiya, Y; Semenov, A; Sexton-Kennedy, L; Sfyrla, A; Shalhout, S Z; Shapiro, M D; Shears, T G; Shepard, P F; Sherman, D; Shimojima, M; Shochet, M; Shon, Y; Shreyber, I; Sidoti, A; Sinervo, P; Sisakian, A; Slaughter, A J; Slaunwhite, J; Sliwa, K; Smith, J R; Snider, F D; Snihur, R; Söderberg, M; Soha, A; Somalwar, S; Sorin, V; Spalding, J; Spinella, F; Spreitzer, T; Squillacioti, P; Stanitzki, M; Staveris-Polykalas, A; Saint-Denis, R; Stelzer, B; Stelzer-Chilton, O; Stentz, D; Strologas, J; Stuart, D; Suh, J S; Sukhanov, A; Sun, H; Suslov, I; Suzuki, T; Taffard, A; Takashima, R; Takeuchi, Y; Tanaka, R; Tecchio, M; Teng, P K; Terashi, K; Thom, J; Thompson, A S; Thomson, E; Tipton, P; Tiwari, V; Tkaczyk, S; Toback, D; Tokar, S; Tollefson, K; Tomura, T; Tonelli, D; Torre, S; Torretta, D; Tourneur, S; Trischuk, W; Tsuno, S; Tu, Y; Turini, N; Ukegawa, F; Uozumi, S; Vallecorsa, S; Van Remortel, N; Varganov, A; Vataga, E; Vázquez, F; Velev, G; Vellidis, C; Veramendi, G; Veszpremi, V; Vidal, M; Vidal, R; Vila, I; Vilar, R; Vine, T; Vogel, M; Vollrath, I; Volobuev, I; Volpi, G; Würthwein, F; Wagner, P; Wagner, R G; Wagner, R L; Wagner, J; Wagner, W; Wallny, R; Wang, S M; Warburton, A; Waters, D; Weinberger, M; Wester, W C; Whitehouse, B; Whiteson, D; Wicklund, A B; Wicklund, E; Williams, G; Williams, H H; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolfe, C; Wright, T; Wu, X; Wynne, S M; Yagil, A; Yamamoto, K; Yamaoka, J; Yamashita, T; Yang, C; Yang, U K; Yang, Y C; Yao, W M; Yeh, G P; Yoh, J; Yorita, K; Yoshida, T; Yu, G B; Yu, I; Yu, S S; Yun, J C; Zanello, L; Zanetti, A; Zaw, I; Zhang, X; Zhou, J; Zucchelli, S

    2007-01-01

    We present the results of a search for associated production of the chargino and neutralino supersymmetric particles using up to 1.1 fb-1 of integrated luminosity collected by the CDF II experiment at the Tevatron ppbar collider at a center-of-mass energy of 1.96 TeV. The search is conducted by analyzing events with a large transverse momentum imbalance and either three charged leptons or two charged leptons of the same electric charge. The numbers of observed events are found to be consistent with standard model expectations. Upper limits on the production cross section are derived in different theoretical models. In one of these models a lower limit on the mass of the chargino is set at 129 GeV/c^2 at the 95% confidence level.

  6. Double parton interactions in photon+3 jet events in ppbar collisions sqrt{s}=1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abazov, V.M.; /Dubna, JINR; Abbott, B.; /Oklahoma U.; Abolins, M.; /Michigan State U.; Acharya, B.S.; /Tata Inst.; Adams, M.; /Illinois U., Chicago; Adams, T.; /Florida State U.; Aguilo, E.; /Simon Fraser U. /York U., Canada; Alexeev, G.D.; /Dubna, JINR; Alkhazov, G.; /St. Petersburg, INP; Alton, A.; /Michigan State U.; Alverson, G.; /Northeastern U. /Rio de Janeiro, CBPF

    2009-12-01

    We have used a sample of photon+3 jets events collected by the D0 experiment with an integrated luminosity of about 1 fb{sup -1} to determine the fraction of events with double parton scattering (f{sub DP}) in a single ppbar collision at {radical}s = 1.96 TeV. The DP fraction and effective cross section (sigma{sub eff}), a process-independent scale parameter related to the parton density inside the nucleon, are measured in three intervals of the second (ordered in p{sub T}) jet transverse momentum pT{sub jet2} within the range 15 < pT{sub jet2} < 30 GeV. In this range, f{sub DP} varies between 0.23 < f{sub DP} < 0.47, while sigma{sub eff} has the average value sigma{sub effave} = 16.4 {+-} 0.3(stat) {+-} 2.3(syst) mb.

  7. Auger electron spectroscopy study of initial stages of oxidation in a copper - 19.6-atomic-percent-aluminum alloy

    Science.gov (United States)

    Ferrante, J.

    1973-01-01

    Auger electron spectroscopy was used to examine the initial stages of oxidation of a polycrystalline copper - 19.6 a/o-aluminum alloy. The growth of the 55-eV aluminum oxide peak and the decay of the 59-, 62-, and 937-eV copper peaks were examined as functions of temperature, exposure, and pressure. Pressures ranged from 1x10 to the minus 7th power to 0.0005 torr of O2. Temperatures ranged from room temperature to 700 C. A completely aluminum oxide surface layer was obtained in all cases. Complete disappearance of the underlying 937-eV copper peak was obtained by heating at 700 C in O2 at 0.0005 torr for 1 hr. Temperature studies indicated that thermally activated diffusion was important to the oxidation studies. The initial stages of oxidation followed a logarithmic growth curve.

  8. Search for Wbb and WH production in pp collisions at square root [s]=1.96 TeV.

    Science.gov (United States)

    Abazov, V M; Abbott, B; Abolins, M; Acharya, B S; Adams, M; Adams, T; Agelou, M; Agram, J-L; Ahn, S H; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Anderson, S; Andrieu, B; Arnoud, Y; Askew, A; Asman, B; Atramentov, O; Autermann, C; Avila, C; Badaud, F; Baden, A; Baldin, B; Balm, P W; Banerjee, S; Barberis, E; Bargassa, P; Baringer, P; Barnes, C; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Bean, A; Beauceron, S; Begel, M; Bellavance, A; Beri, S B; Bernardi, G; Bernhard, R; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Binder, M; Black, K M; Blackler, I; Blazey, G; Blekman, F; Blessing, S; Bloch, D; Blumenschein, U; Boehnlein, A; Boeriu, O; Bolton, T A; Borcherding, F; Borissov, G; Bos, K; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Buchanan, N J; Buchholz, D; Buehler, M; Buescher, V; Burdin, S; Burnett, T H; Busato, E; Butler, J M; Bystricky, J; Carvalho, W; Casey, B C K; Cason, N M; Castilla-Valdez, H; Chakrabarti, S; Chakraborty, D; Chan, K M; Chandra, A; Chapin, D; Charles, F; Cheu, E; Chevalier, L; Cho, D K; Choi, S; Christiansen, T; Christofek, L; Claes, D; Clément, B; Clément, C; Coadou, Y; Cooke, M; Cooper, W E; Coppage, D; Corcoran, M; Coss, J; Cothenet, A; Cousinou, M-C; Crépé-Renaudin, S; Cristetiu, M; Cummings, M A C; Cutts, D; da Motta, H; Davies, B; Davies, G; Davis, G A; De, K; de Jong, P; de Jong, S J; De La Cruz-Burelo, E; De Oliveira Martins, C; Dean, S; Déliot, F; Delsart, P A; Demarteau, M; Demina, R; Demine, P; Denisov, D; Denisov, S P; Desai, S; Diehl, H T; Diesburg, M; Doidge, M; Dong, H; Doulas, S; Duflot, L; Dugad, S R; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Edwards, T; Ellison, J; Elmsheuser, J; Eltzroth, J T; Elvira, V D; Eno, S; Ermolov, P; Eroshin, O V; Estrada, J; Evans, D; Evans, H; Evdokimov, A; Evdokimov, V N; Fast, J; Fatakia, S N; Feligioni, L; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Fortner, M; Fox, H; Freeman, W; Fu, S; Fuess, S; Gadfort, T; Galea, C F; Gallas, E; Galyaev, E; Garcia, C; Garcia-Bellido, A; Gardner, J; Gavrilov, V; Gay, P; Gelé, D; Gelhaus, R; Genser, K; Gerber, C E; Gershtein, Y; Ginther, G; Golling, T; Gómez, B; Gounder, K; Goussiou, A; Grannis, P D; Greder, S; Greenlee, H; Greenwood, Z D; Gregores, E M; Gris, Ph; Grivaz, J-F; Groer, L; Grünendahl, S; Grünewald, M W; Gurzhiev, S N; Gutierrez, G; Gutierrez, P; Haas, A; Hadley, N J; Hagopian, S; Hall, I; Hall, R E; Han, C; Han, L; Hanagaki, K; Harder, K; Harrington, R; Hauptman, J M; Hauser, R; Hays, J; Hebbeker, T; Hedin, D; Heinmiller, J M; Heinson, A P; Heintz, U; Hensel, C; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hohlfeld, M; Hong, S J; Hooper, R; Houben, P; Hu, Y; Huang, J; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jain, V; Jakobs, K; Jenkins, A; Jesik, R; Johns, K; Johnson, M; Jonckheere, A; Jonsson, P; Jöstlein, H; Juste, A; Kado, M M; Käfer, D; Kahl, W; Kahn, S; Kajfasz, E; Kalinin, A M; Kalk, J; Karmanov, D; Kasper, J; Kau, D; Kehoe, R; Kermiche, S; Kesisoglou, S; Khanov, A; Kharchilava, A; Kharzheev, Y M; Kim, K H; Klima, B; Klute, M; Kohli, J M; Kopal, M; Korablev, V M; Kotcher, J; Kothari, B; Koubarovsky, A; Kozelov, A V; Kozminski, J; Krzywdzinski, S; Kuleshov, S; Kulik, Y; Kunori, S; Kupco, A; Kurca, T; Lager, S; Lahrichi, N; Landsberg, G; Lazoflores, J; Le Bihan, A-C; Lebrun, P; Lee, S W; Lee, W M; Leflat, A; Lehner, F; Leonidopoulos, C; Lewis, P; Li, J; Li, Q Z; Lima, J G R; Lincoln, D; Linn, S L; Linnemann, J; Lipaev, V V; Lipton, R; Lobo, L; Lobodenko, A; Lokajicek, M; Lounis, A; Lubatti, H J; Lueking, L; Lynker, M; Lyon, A L; Maciel, A K A; Madaras, R J; Mättig, P; Magerkurth, A; Magnan, A-M; Makovec, N; Mal, P K; Malik, S; Malyshev, V L; Mao, H S; Maravin, Y; Martens, M; Mattingly, S E K; Mayorov, A A; McCarthy, R; McCroskey, R; Meder, D; Melanson, H L; Melnitchouk, A; Merkin, M; Merritt, K W; Meyer, A; Miettinen, H; Mihalcea, D; Mitrevski, J; Mokhov, N; Molina, J; Mondal, N K; Montgomery, H E; Moore, R W; Muanza, G S; Mulders, M; Mutaf, Y D; Nagy, E; Narain, M; Naumann, N A; Neal, H A; Negret, J P; Nelson, S; Neustroev, P; Noeding, C; Nomerotski, A; Novaes, S F; Nunnemann, T; Nurse, E; O'dell, V; O'neil, D C; Oguri, V; Oliveira, N; Oshima, N; Otero Y Garzón, G J; Padley, P; Parashar, N; Park, J; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Perea, P M; Perez, E; Peters, O; Pétroff, P; Petteni, M; Phaf, L; Piegaia, R; Podesta-Lerma, P L M; Podstavkov, V M; Pogorelov, Y; Pope, B G; Prado da Silva, W L; Prosper, H B; Protopopescu, S; Przybycien, M B; Qian, J; Quadt, A; Quinn, B; Rani, K J; Rapidis, P A; Ratoff, P N; Reay, N W; Reucroft, S; Rijssenbeek, M; Ripp-Baudot, I; Rizatdinova, F; Royon, C; Rubinov, P; Ruchti, R; Sajot, G; Sánchez-Hernández, A; Sanders, M P; Santoro, A; Savage, G; Sawyer, L; Scanlon, T; Schamberger, R D; Schellman, H; Schieferdecker, P; Schmitt, C; Schukin, A A; Schwartzman, A; Schwienhorst, R; Sengupta, S; Severini, H; Shabalina, E; Shamim, M; Shary, V; Shephard, W D; Shpakov, D; Sidwell, R A; Simak, V; Sirotenko, V; Skubic, P; Slattery, P; Smith, R P; Smolek, K; Snow, G R; Snow, J; Snyder, S; Söldner-Rembold, S; Song, X; Song, Y; Sonnenschein, L; Sopczak, A; Sosebee, M; Soustruznik, K; Souza, M; Spurlock, B; Stanton, N R; Stark, J; Steele, J; Steinbrück, G; Stevenson, K; Stolin, V; Stone, A; Stoyanova, D A; Strandberg, J; Strang, M A; Strauss, M; Ströhmer, R; Strovink, M; Stutte, L; Sumowidagdo, S; Sznajder, A; Talby, M; Tamburello, P; Taylor, W; Telford, P; Temple, J; Tentindo-Repond, S; Thomas, E; Thooris, B; Tomoto, M; Toole, T; Torborg, J; Towers, S; Trefzger, T; Trincaz-Duvoid, S; Tuchming, B; Tully, C; Turcot, A S; Tuts, P M; Uvarov, L; Uvarov, S; Uzunyan, S; Vachon, B; Van Kooten, R; van Leeuwen, W M; Varelas, N; Varnes, E W; Vasilyev, I A; Vaupel, M; Verdier, P; Vertogradov, L S; Verzocchi, M; Villeneuve-Seguier, F; Vlimant, J-R; Von Toerne, E; Vreeswijk, M; Vu Anh, T; Wahl, H D; Walker, R; Wang, L; Wang, Z-M; Warchol, J; Warsinsky, M; Watts, G; Wayne, M; Weber, M; Weerts, H; Wegner, M; Wermes, N; White, A; White, V; Whiteson, D; Wicke, D; Wijngaarden, D A; Wilson, G W; Wimpenny, S J; Wittlin, J; Wobisch, M; Womersley, J; Wood, D R; Wyatt, T R; Xu, Q; Xuan, N; Yamada, R; Yan, M; Yasuda, T; Yatsunenko, Y A; Yen, Y; Yip, K; Youn, S W; Yu, J; Yurkewicz, A; Zabi, A; Zatserklyaniy, A; Zdrazil, M; Zeitnitz, C; Zhang, D; Zhang, X; Zhao, T; Zhao, Z; Zhou, B; Zhu, J; Zielinski, M; Zieminska, D; Zieminski, A; Zitoun, R; Zutshi, V; Zverev, E G; Zylberstejn, A

    2005-03-11

    We present a search for Wbb production in pp collisions at sqrt[s]=1.96 TeV in events containing one electron, an imbalance in transverse momentum, and two b-tagged jets. Using 174 pb(-1) of integrated luminosity accumulated by the D0 experiment at the Fermilab Tevatron collider, and the standard-model description of such events, we set a 95% C.L. upper limit on Wbb production of 6.6 pb for b quarks with transverse momenta p(b)(T)>20 GeV and bb separation in pseudorapidity-azimuth space DeltaR(bb)>0.75. Restricting the search to optimized bb mass intervals provides upper limits on WH production of 9.0-12.2 pb for Higgs-boson masses of 105-135 GeV.

  9. Measurement of inclusive differential cross sections for pp collisions at (square root)s = 1.96 TeV.

    Science.gov (United States)

    Abazov, V M; Abbott, B; Abolins, M; Acharya, B S; Adams, M; Adams, T; Agelou, M; Agram, J-L; Ahn, S H; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Andeen, T; Anderson, S; Andrieu, B; Arnoud, Y; Askew, A; Asman, B; Assis Jesus, A C S; Atramentov, O; Autermann, C; Avila, C; Badaud, F; Baden, A; Baldin, B; Balm, P W; Banerjee, S; Barberis, E; Bargassa, P; Baringer, P; Barnes, C; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Bean, A; Beauceron, S; Begel, M; Bellavance, A; Beri, S B; Bernardi, G; Bernhard, R; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Binder, M; Biscarat, C; Black, K M; Blackler, I; Blazey, G; Blekman, F; Blessing, S; Bloch, D; Blumenschein, U; Boehnlein, A; Boeriu, O; Bolton, T A; Borcherding, F; Borissov, G; Bos, K; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Buchanan, N J; Buchholz, D; Buehler, M; Buescher, V; Burdin, S; Burnett, T H; Busato, E; Butler, J M; Bystricky, J; Caron, S; Carvalho, W; Casey, B C K; Cason, N M; Castilla-Valdez, H; Chakrabarti, S; Chakraborty, D; Chan, K M; Chandra, A; Chapin, D; Charles, F; Cheu, E; Cho, D K; Choi, S; Choudhary, B; Christiansen, T; Christofek, L; Claes, D; Clément, B; Clément, C; Coadou, Y; Cooke, M; Cooper, W E; Coppage, D; Corcoran, M; Cothenet, A; Cousinou, M-C; Cox, B; Crépé-Renaudin, S; Cristetiu, M; Cutts, D; da Motta, H; Davies, B; Davies, G; Davis, G A; De, K; de Jong, P; de Jong, S J; De La Cruz-Burelo, E; De Oliveira Martins, C; Dean, S; Degenhardt, J D; Déliot, F; Demarteau, M; Demina, R; Demine, P; Denisov, D; Denisov, S P; Desai, S; Diehl, H T; Diesburg, M; Doidge, M; Dong, H; Doulas, S; Dudko, L V; Duflot, L; Dugad, S R; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Edwards, T; Ellison, J; Elmsheuser, J; Elvira, V D; Eno, S; Ermolov, P; Eroshin, O V; Estrada, J; Evans, D; Evans, H; Evdokimov, A; Evdokimov, V N; Fast, J; Fatakia, S N; Feligioni, L; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Fleck, I; Fortner, M; Fox, H; Fu, S; Fuess, S; Gadfort, T; Galea, C F; Gallas, E; Galyaev, E; Garcia, C; Garcia-Bellido, A; Gardner, J; Gavrilov, V; Gay, P; Gelé, D; Gelhaus, R; Genser, K; Gerber, C E; Gershtein, Y; Ginther, G; Golling, T; Gómez, B; Gounder, K; Goussiou, A; Grannis, P D; Greder, S; Greenlee, H; Greenwood, Z D; Gregores, E M; Gris, Ph; Grivaz, J-F; Groer, L; Grünendahl, S; Grünewald, M W; Gurzhiev, S N; Gutierrez, G; Gutierrez, P; Haas, A; Hadley, N J; Hagopian, S; Hall, I; Hall, R E; Han, C; Han, L; Hanagaki, K; Harder, K; Harrington, R; Hauptman, J M; Hauser, R; Hays, J; Hebbeker, T; Hedin, D; Heinmiller, J M; Heinson, A P; Heintz, U; Hensel, C; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hohlfeld, M; Hong, S J; Hooper, R; Houben, P; Hu, Y; Huang, J; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jain, V; Jakobs, K; Jenkins, A; Jesik, R; Johns, K; Johnson, M; Jonckheere, A; Jonsson, P; Juste, A; Käfer, D; Kahl, W; Kahn, S; Kajfasz, E; Kalinin, A M; Kalk, J; Karmanov, D; Kasper, J; Kau, D; Kaur, R; Kehoe, R; Kermiche, S; Kesisoglou, S; Khanov, A; Kharchilava, A; Kharzheev, Y M; Kim, H; Klima, B; Klute, M; Kohli, J M; Kopal, M; Korablev, V M; Kotcher, J; Kothari, B; Koubarovsky, A; Kozelov, A V; Kozminski, J; Kryemadhi, A; Krzywdzinski, S; Kuleshov, S; Kulik, Y; Kumar, A; Kunori, S; Kupco, A; Kurca, T; Kvita, J; Lager, S; Lahrichi, N; Landsberg, G; Lazoflores, J; Le Bihan, A-C; Lebrun, P; Lee, W M; Leflat, A; Lehner, F; Leonidopoulos, C; Leveque, J; Lewis, P; Li, J; Li, Q Z; Lima, J G R; Lincoln, D; Linn, S L; Linnemann, J; Lipaev, V V; Lipton, R; Lobo, L; Lobodenko, A; Lokajicek, M; Lounis, A; Love, P; Lubatti, H J; Lueking, L; Lynker, M; Lyon, A L; Maciel, A K A; Madaras, R J; Mättig, P; Magass, C; Magerkurth, A; Magnan, A-M; Makovec, N; Mal, P K; Malbouisson, H B; Malik, S; Malyshev, V L; Mao, H S; Maravin, Y; Martens, M; Mattingly, S E K; Mayorov, A A; McCarthy, R; McCroskey, R; Meder, D; Melanson, H L; Melnitchouk, A; Mendes, A; Merkin, M; Merritt, K W; Meyer, A; Michaut, M; Miettinen, H; Mitrevski, J; Mokhov, N; Molina, J; Mondal, N K; Moore, R W; Muanza, G S; Mulders, M; Mutaf, Y D; Nagy, E; Narain, M; Naumann, N A; Neal, H A; Negret, J P; Nelson, S; Neustroev, P; Noeding, C; Nomerotski, A; Novaes, S F; Nunnemann, T; Nurse, E; O'Dell, V; O'Neil, D C; Oguri, V; Oliveira, N; Oshima, N; Otero y Garzón, G J; Padley, P; Parashar, N; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Perea, P M; Perez, E; Pétroff, P; Petteni, M; Phaf, L; Piegaia, R; Pleier, M-A; Podesta-Lerma, P L M; Podstavkov, V M; Pogorelov, Y; Pope, B G; Silva, W L Prado da; Prosper, H B; Protopopescu, S; Qian, J; Quadt, A; Quinn, B; Rani, K J; Ranjan, K; Rapidis, P A; Ratoff, P N; Reay, N W; Reucroft, S; Rijssenbeek, M; Ripp-Baudot, I; Rizatdinova, F; Rodrigues, R F; Royon, C; Rubinov, P; Ruchti, R; Rud, V I; Sajot, G; Sánchez-Hernández, A; Sanders, M P; Santoro, A; Savage, G; Sawyer, L; Scanlon, T; Schaile, D; Schamberger, R D; Schellman, H; Schieferdecker, P; Schmitt, C; Schwartzman, A; Schwienhorst, R; Sengupta, S; Severini, H; Shabalina, E; Shamim, M; Shary, V; Shchukin, A A; Shephard, W D; Shivpuri, R K; Shpakov, D; Sidwell, R A; Simak, V; Sirotenko, V; Skubic, P; Slattery, P; Smith, R P; Smolek, K; Snow, G R; Snow, J; Snyder, S; Söldner-Rembold, S; Song, X; Sonnenschein, L; Sopczak, A; Sosebee, M; Soustruznik, K; Souza, M; Spurlock, B; Stanton, N R; Stark, J; Steele, J; Stevenson, K; Stolin, V; Stone, A; Stoyanova, D A; Strandberg, J; Strang, M A; Strauss, M; Ströhmer, R; Strom, D; Strovink, M; Stutte, L; Sumowidagdo, S; Sznajder, A; Talby, M; Tamburello, P; Taylor, W; Telford, P; Temple, J; Thomas, E; Thooris, B; Tomoto, M; Toole, T; Torborg, J; Towers, S; Trefzger, T; Trincaz-Duvoid, S; Tuchming, B; Tully, C; Turcot, A S; Tuts, P M; Uvarov, L; Uvarov, S; Uzunyan, S; Vachon, B; Van Kooten, R; van Leeuwen, W M; Varelas, N; Varnes, E W; Vartapetian, A; Vasilyev, I A; Vaupel, M; Verdier, P; Vertogradov, L S; Verzocchi, M; Villeneuve-Seguier, F; Vlimant, J-R; Von Toerne, E; Vreeswijk, M; Vu, Anh T; Wahl, H D; Walker, R; Wang, L; Wang, Z-M; Warchol, J; Watts, G; Wayne, M; Weber, M; Weerts, H; Wegner, M; Wermes, N; White, A; White, V; Wicke, D; Wijngaarden, D A; Wilson, G W; Wimpenny, S J; Wittlin, J; Wobisch, M; Womersley, J; Wood, D R; Wyatt, T R; Xu, Q; Xuan, N; Yacoob, S; Yamada, R; Yan, M; Yasuda, T; Yatsunenko, Y A; Yen, Y; Yip, K; Yoo, H D; Youn, S W; Yu, J; Yurkewicz, A; Zabi, A; Zatserklyaniy, A; Zdrazil, M; Zeitnitz, C; Zhang, D; Zhang, X; Zhao, T; Zhao, Z; Zhou, B; Zhu, J; Zielinski, M; Zieminska, D; Zieminski, A; Zitoun, R; Zutshi, V; Zverev, E G

    2005-06-17

    We present measurements of the inclusive production cross sections of the Gamma(1S) bottomonium state in pp collisions at (square root)s = 1.96 TeV. Using the Gamma(1S) --> mu(+)mu(-) decay mode for a data sample of 159 +/- 10 pb(-1) collected by the D0 detector at the Fermilab Tevatron collider, we determine the differential cross sections as a function of the Gamma(1S) transverse momentum for three ranges of the Gamma(1S) rapidity: 0 < y(Gamma) < or = 0.6, 0.6 < y(Gamma) < or = 1.2, and 1.2 < y(Gamma) < or = 1.8.

  10. PHENIX results on anisotropic flow in d+Au collisions from 19.6 to 200 GeV

    Science.gov (United States)

    Morrow, Sylvia; Phenix Collaboration

    2017-09-01

    Results on elliptic flow in p+p and p/d/3He+A have raised the question of how small a system can be while still exhibiting collective behavior. In 2016, RHIC operations included d+Au collisions at 200, 62.4, 39, and 19.6 GeV. In this talk we present results on elliptic and triangular flow at midrapidity as a function of transverse momentum and event multiplicity in d+Au collisions at various energies. We compare these results with several theoretical predictions in scenarios including pre-equilibrium flow, hydrodynamic flow, partonic scattering, and purely hadronic scattering in order to assess the role of each stage in the system evolution for producing collective effects in small systems.

  11. Comparing effects of freezing at -196 °C and -20 °C on the viability of mastitis pathogens

    Directory of Open Access Journals (Sweden)

    Inge-Marie Petzer

    2012-02-01

    Full Text Available The aim of this study was to compare the effects of cryopreservation at approximately -196 °C in liquid nitrogen (N and freezing at approximately -20 °C in a freezer, on the viability and survival of eight different mastitogenic bacteria inoculated in milk. Bacteria were frozen at approximately -20 °C in a freezer and cryopreserved at approximately -196 °C in liquid nitrogen. An effective preservation method was needed for follow-up samples from cows identified in the South African National Milk Recording Scheme (NMRS with somatic cell counts above 250 000 cells/mL milk. The organisation responsible for sample collection of the NMRS milk samples also provides producers with liquid nitrogen for their semen flasks at the collection sites. This existing mode of storage and transport could therefore be utilised.Ten samples of each organism were thawed and cultured bi-weekly until week 18 for both temperature treatments. An additional sampling was performed at week 30 for samples frozen at approximately -20 °C. Freezing and cryopreservation did not impair subsequent isolation of Streptococcus dysgalactiae, Streptococcus uberis, Enterococcus faecalis, Staphylococcus aureus (STH (phage type lytic group III or Sta. aureus (STA (phage typed, other than lytic group III. Survival was indicated by the isolation of bacteria from samples, and viability by the strength of growth of the bacteria isolated. The survival of Streptococcus agalactiae decreased after week 12 and Escherichia coli after week 16 of freezing, but both organisms survived under cryogenic preservation until week 18. Coagulase-negative staphylococci survived until week 18 for both freezing and cryogenic preservation.Both storage methods could thus contribute to the improvement of a pro-active approach towards udder health management in South African dairy herds.

  12. Clinical experience with Liraglutide in 196 patients with type 2 diabetes from a tertiary care center in India

    Directory of Open Access Journals (Sweden)

    Parjeet Kaur

    2014-01-01

    Full Text Available Context: GLP-1 receptor agonists (GLP-1 RA are unique antidiabetic agents that have the ability to lower blood glucose without causing hypoglycemia, while at the same time promoting weight loss. Information on the efficacy and safety of GLP-1 RA in the Indian diabetic population is limited. Aims: (1 To evaluate the effect of GLP-1 RA, Liraglutide on glycemic control, and weight in obese Indian patients with type 2 diabetes. (2 To study the adverse event profile of Liraglutide in these patients in real-world clinical setting. Settings and Design: Observational study conducted in a tertiary care hospital. Materials and Methods: Liraglutide was prescribed to 196 obese patients with type 2 diabetes who had poor glycemic control on oral medications ± insulin. The initial dose of Liraglutide was 0.6 mg, which was up-titrated to 1.2 mg after 1 week; further up-titration to 1.8 mg was done based on tolerance. Dipeptidyl peptidase-IV (DPP-IV inhibitors were discontinued and dose of other medications adjusted according to clinical judgment during the study period. Results: Mean age of patients was 49.9 ± 9.6 years. Three month data were available for 175 patients out of a total of 196. At 3 months, glycosylated hemoglobin (HbA1c was 7.6 ± 0.9% vs. 9.2 ± 1.9% at baseline (P = 0.007 and mean body weight was 96.0 ± 16.5 kg vs. 100.1 ± 17.5 kg at baseline (P < 0.001. Most common adverse events were nausea, burping, and eructation (10%. Conclusion: Liraglutide significantly improves glycemic control with low risk of hypoglycemia and is associated with significant weight loss in obese Indian patients with type 2 diabetes mellitus.

  13. Hiljutine maksulahend Euroopa Kohtus - ettevõtja kasuks! : Cadbury Schweppes vs. Ühendkuningriigi maksuhaldur, C-196/04 / Hiie Marrandi

    Index Scriptorium Estoniae

    Marrandi, Hiie

    2006-01-01

    Euroopa Kohtu eelotsusetaotluse alusel tehtud lahendist (12. 09. 2006 C-196/04) Cadbury Schweppes´i ja Suurbritannia maksuhalduri vaidluse kohta, mis puudutas madala maksumääraga territooriumil asuva tütarühingu tulu omistamist Suurbritannia emaühingule

  14. Search for the lightest scalar top quark in events with two leptons in p$\\overline{\\p}$ collisions at $\\sqrt{s}$= 1.96 TeV

    CERN Document Server

    Abazov, V; Acharya, B S; Adams, M; Adams, T; Aguiló, E; Ahn, S H; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Ancu, L S; Andeen, T; Anderson, S; Andrieu, B; Anzelc, M S; Arnoud, Y; Arov, M; Arthaud, M; Askew, A; Åsman, B; Assis-Jesus, A C S; Atramentov, O; Autermann, C; Avila, C; Ay, C; Badaud, F; Baden, A; Bagby, L; Baldin, B; Bandurin, D V; Banerjee, S; Banerjee, P; Barberis, E; Barfuss, A F; Bargassa, P; Baringer, P; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Beale, S; Bean, A; Begalli, M; Begel, M; Belanger-Champagne, C; Bellantoni, L; Bellavance, A; Benítez, J A; Beri, S B; Bernardi, G; Bernhard, R; Berntzon, L; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Biscarat, C; Blazey, G; Blekman, F; Blessing, S; Bloch, D; Bloom, K; Böhnlein, A; Boline, D; Bolton, T A; Borissov, G; Bos, K; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Brown, D; Buchanan, N J; Buchholz, D; Bühler, M; Büscher, V; Burdin, S; Burke, S; Burnett, T H; Buszello, C P; Butler, J M; Calfayan, P; Calvet, S; Cammin, J; Caron, S; Carvalho, W; Casey, B C K; Cason, N M; Castilla-Valdez, H; Chakrabarti, S; Chakraborty, D; Chan, K M; Chan, K; Chandra, A; Charles, F; Cheu, E; Chevallier, F; Cho, D K; Choi, S; Choudhary, B; Christofek, L; Christoudias, T; Cihangir, S; Claes, D; Clement, B; Coadou, Y; Cooke, M; Cooper, W E; Corcoran, M; Couderc, F; Cousinou, M C; Crepe-Renaudin, S; Cutts, D; Cwiok, M; Da Motta, H; Das, A; Davies, G; De, K; De Jong, S J; de Jong, P; De La Cruz-Burelo, E; De Oliveira Martins, C; Degenhardt, J D; Déliot, F; Demarteau, M; Demina, R; Denisov, D; Denisov, S P; Desai, S; Diehl, H T; Diesburg, M; Dominguez, A; Dong, H; Dudko, L V; Duflot, L; Dugad, S R; Duggan, D; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Ellison, J; Elvira, V D; Enari, Y; Eno, S; Ermolov, P; Evans, H; Evdokimov, A; Evdokimov, V N; Ferapontov, A V; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Ford, M; Fortner, M; Fox, H; Fu, S; Fuess, S; Gadfort, T; Galea, C F; Gallas, E; Galyaev, E; García, C; García-Bellido, A; Gavrilov, V; Gay, P; Geist, W; Gelé, D; Gerber, C E; Gershtein, Yu; Gillberg, D; Ginther, G; Gollub, N; Gómez, B; Goussiou, A; Grannis, P D; Greenlee, H; Greenwood, Z D; Gregores, E M; Grenier, G; Gris, P; Grivaz, J F; Grohsjean, A; Grünendahl, S; Grünewald, M W; Guo, J; Guo, F; Gutíerrez, P; Gutíerrez, G; Haas, A; Hadley, N J; Haefner, P; Hagopian, S; Haley, J; Hall, I; Hall, R E; Han, L; Hanagaki, K; Hansson, P; Harder, K; Harel, A; Harrington, R; Hauptman, J M; Hauser, R; Hays, J; Hebbeker, T; Hedin, D; Hegeman, J G; Heinmiller, J M; Heinson, A P; Heintz, U; Hensel, C; Herner, K; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hoeth, H; Hohlfeld, M; Hong, S J; Hooper, R; Hossain, S; Houben, P; Hu, Y; Hubacek, Z; Hynek, V; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jakobs, K; Jarvis, C; Jesik, R; Johns, K; Johnson, C; Johnson, M; Jonckheere, A; Jonsson, P; Juste, A; Käfer, D; Kahn, S; Kajfasz, E; Kalinin, A M; Kalk, J R; Kalk, J M; Kappler, S; Karmanov, D; Kasper, J; Kasper, P; Katsanos, I; Kau, D; Kaur, R; Kaushik, V; Kehoe, R; Kermiche, S; Khalatyan, N; Khanov, A; Kharchilava, A; Kharzheev, Yu M; Khatidze, D; Kim, H; Kim, T J; Kirby, M H; Kirsch, M; Klima, B; Kohli, J M; Konrath, J P; Kopal, M; Korablev, V M; Kozelov, A V; Krop, D; Kryemadhi, A; Kühl, T; Kumar, A; Kunori, S; Kupco, A; Kurca, T; Kvita, J; Lacroix, F; Lam, D; Lammers, S; Landsberg, G L; Lazoflores, J; Lebrun, P; Lee, W M; Leflat, A; Lehner, F; Lellouch, J; Lévêque, J; Lewis, P; Li, J; Li, Q Z; Li, L; Lietti, S M; Lima, J G R; Lincoln, D; Linnemann, J; Lipaev, V V; Lipton, R; Liu, Y; Liu, Z; Lobo, L; Lobodenko, A; Lokajícek, M; Lounis, A; Love, P; Lubatti, H J; Lyon, A L; Maciel, A K A; Mackin, D; Madaras, R J; Mättig, P; Magass, C; Magerkurth, A; Makovec, N; Mal, P K; Malbouisson, H B; Malik, S; Malyshev, V L; Mao, H S; Maravin, Y; Martin, B; McCarthy, R; Melnitchouk, A; Mendes, A; Mendoza, L; Mercadante, P G; Merkin, M; Merritt, K W; Meyer, J; Meyer, A; Michaut, M; Millet, T; Mitrevski, J; Molina, J; Mommsen, R K; Mondal, N K; Moore, R W; Moulik, T; Muanza, G S; Mulders, M; Mulhearn, M; Mundal, O; Mundim, L; Nagy, E; Naimuddin, M; Narain, M; Naumann, N A; Neal, H A; Negret, J P; Neustroev, P; Nilsen, H; Nomerotski, A; Novaes, S F; Nunnemann, T; O'Dell, V; O'Neil, D C; Obrant, G; Ochando, C; Onoprienko, D; Oshima, N; Osta, J; Otec, R; Oteroy-Garzon, G J; Owen, M; Padley, P; Pangilinan, M; Parashar, N; Park, S J; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Pawloski, G; Penning, B; Peters, K; Peters, Y; Petroff, P; Petteni, M; Piegaia, R; Piper, J; Pleier, M A; Podesta-Lerma, P L M; Podstavkov, V M; Pogorelov, Y; Pol, M E; Polozov, P; Pompo, A; Pope, B G; Popov, A V; Potter, C; Prado da Silva, W L; Prosper, H B; Protopopescu, S; Qian, J; Quadt, A; Quinn, B; Rakitine, A; Rangel, M S; Ranjan, K; Ratoff, P N; Renkel, P; Reucroft, S; Rich, P; Rijssenbeek, M; Ripp-Baudot, I; Rizatdinova, F; Robinson, S; Rodrigues, R F; Royon, C; Rubinov, P; Ruchti, R; Safronov, G; Sajot, G; Sánchez-Hernández, A; Sanders, M P; Santoro, A; Savage, G; Sawyer, L; Scanlon, T; Schaile, A D; Schamberger, R D; Scheglov, Y; Schellman, H; Schieferdecker, P; Schliephake, T; Schwanenberger, C; Schwartzman, A; Schwienhorst, R; Sekaric, J; Sen-Gupta, S; Severini, H; Shabalina, E; Shamim, M; Shary, V; Shchukin, A A; Shivpuri, R K; Shpakov, D; Siccardi, V; Simák, V; Sirotenko, V I; Skubic, P; Slattery, P; Smirnov, D; Snow, J; Snow, G R; Snyder, S; Söldner-Rembold, S; Sonnenschein, L; Sopczak, A; Sosebee, M; Soustruznik, K; Souza, M; Spurlock, B; Stark, J; Steele, J; Stolin, V; Stone, A; Stoyanova, D A; Strandberg, J; Strandberg, S; Strang, M A; Strauss, M; Strauss, E; Ströhmer, R; Strom, D; Stutte, L; Sumowidagdo, S; Svoisky, P; Sznajder, A; Talby, M; Tamburello, P; Tanasijczuk, A; Taylor, W; Telford, P; Temple, J; Tiller, B; Tissandier, F; Titov, M; Tokmenin, V V; Toole, T; Torchiani, I; Trefzger, T; Tsybychev, D; Tuchming, B; Tully, C; Tuts, P M; Unalan, R; Uvarov, S; Uvarov, L; Uzunyan, S; Vachon, B; vanden Berg, P J; van Eijk, B; Van Kooten, R; Van Leeuwen, W M; Varelas, N; Varnes, E W; Vasilyev, I A; Vaupel, M; Verdier, P; Vertogradov, L S; Verzocchi, M; Villeneuve-Séguier, F; Vint, P; Vokac, P; Von Törne, E; Voutilainen, M; Vreeswijk, M; Wagner, R; Wahl, H D; Wang, L; SWang, M H L; Warchol, J; Watts, G; Wayne, M; Weber, M; Weber, G; Wenger, A; Wermes, N; Wetstein, M; White, A; Wicke, D; Wilson, G W; Wimpenny, S J; Wobisch, M; Wood, D R; Wyatt, T R; Xie, Y; Yacoob, S; Yamada, R; Yan, M; Yasuda, T; Yatsunenko, Y A; Yip, K; Yoo, H D; Youn, S W; Yu, J; Zatserklyaniy, A; Zeitnitz, C; Zhang, D; Zhao, T; Zhou, B; Zhu, J; Zielinski, M; Zieminska, D; Zieminski, A; Zivkovic, L; Zutshi, V; Zverev, E G

    2008-01-01

    Data collected by the D0 detector at a p-pbar center-of-mass energy of 1.96 TeV at the Fermilab Tevatron Collider have been used to search for pair production of the lightest supersymmetric partner of the top quark decaying into $b \\ell \\tilde{\

  15. Search for Wh Production Using High-PT Isolated Like-Sign Dilepton Events in 1.96-TeV Proton-Antiproton Collisions

    Energy Technology Data Exchange (ETDEWEB)

    Wakisaka, Takayuki [Osaka City Univ. (Japan)

    2009-04-01

    The thesis describes search for the neutral Higgs production associated with the W boson using high-PT isolated like-sign (LS) dilepton events in proton-antiproton collisions at a center-of-mass energy of 1.96 TeV.

  16. miR-196 is an essential early-stage regulator of tail regeneration, upstream of key spinal cord patterning events.

    Science.gov (United States)

    Sehm, Tina; Sachse, Christoph; Frenzel, Corina; Echeverri, Karen

    2009-10-15

    Salamanders have the remarkable ability to regenerate many body parts following catastrophic injuries, including a fully functional spinal cord following a tail amputation. The molecular basis for how this process is so exquisitely well-regulated, assuring a faithful replication of missing structures every time, remains poorly understood. Therefore a study of microRNA expression and function during regeneration in the axolotl, Ambystoma mexicanum, was undertaken. Using microarray-based profiling, it was found that 78 highly conserved microRNAs display significant changes in expression levels during the early stages of tail regeneration, as compared to mature tissue. The role of miR-196, which was highly upregulated in the early tail blastema and spinal cord, was then further analyzed. Inhibition of miR-196 expression in this context resulted in a defect in regeneration, yielding abnormally shortened tails with spinal cord defects in formation of the terminal vesicle. A more detailed characterization of this phenotype revealed downstream components of the miR-196 pathway to include key effectors/regulators of tissue patterning within the spinal cord, including BMP4 and Pax7. As such, our dataset establishes miR-196 as an essential regulator of tail regeneration, acting upstream of key BMP4 and Pax7-based patterning events within the spinal cord.

  17. miR-196a-2 rs11614913 polymorphism is associated with vitiligo by affecting heterodimeric molecular complexes of Tyr and Tyrp1.

    Science.gov (United States)

    Cui, T-T; Yi, X-L; Zhang, W-G; Wei, C; Zhou, F-B; Jian, Z; Wang, G; Gao, T-W; Li, C-Y; Li, K

    2015-10-01

    Tyrosinase and tyrosinase-related protein 1 (Tyr-Tyrp1) complex plays a critical role in the synthesis of melanin intermediates, which involves the production of reactive oxygen species (ROS) and contributes to the development of vitiligo. Based on our previous observation that rs11614913 single nucleotide polymorphism (SNP) in miR-196a-2 could affect the risk of vitiligo by influencing Tyrp1, we hypothesized that the same SNP could also regulate the level of Tyr in vitiligo. The aim of this study was to evaluate the potential association between rs11614913 SNP in miR-196a-2 and serum Tyr level in vitiligo and the regulatory role of miR-196a-2 in the expression of Tyr in melanocytes. The serum Tyr level was detected in 116 patients with vitiligo and 116 controls by ELISA plate assay. The expression level of Tyrp1 and Tyr in PIG1(normal melanocyte cell lines) cells was analyzed by western blotting. The ROS level and apoptosis rate in PIG1 cells transfected with si-Tyr or control siRNA were tested by flow cytometry. The results show that the individuals with TT+TC genotypes in miR-196a-2 and higher Tyr level in serum had an increased risk of vitiligo compared with those who had the CC genotype and lower Tyr level (P vitiligo.

  18. Discovery of porcine miRNA-196a/b may influence porcine adipogenesis in longissimus dorsi muscle by miRNA sequencing.

    Science.gov (United States)

    Liu, Linqing; Qian, Kun; Wang, Chonglong

    2017-04-01

    Intramuscular fat (IMF) is one of the fat traits that has economic importance in the pork industry. Longissimus dorsi muscle contains IMF and is suitable for studying adipogenesis. To discover further potential regulatory miRNAs that may influence adipogenesis, we analyzed miRNA in the longissimus dorsi muscle of Yorkshire (YY, lean-type) and Chinese Wannanhua (WH, fatty) pigs using miRNA sequencing (miRNA-seq). From this dataset, we identified 598 unique miRNAs comprising 325 pre-miRNAs and 273 novel pre-miRNAs through comparison with known miRNAs in miRBase version 21. We found 42 miRNAs including nine up- and 33 down-regulated between the YY and WH pigs. Moreover, we found two miRNAs, miR-196a/b (miR-196a, miR-196b-5p), that had the highest level of expression in WH pigs, and miR-196a/b may influence porcine adipogenesis in longissimus dorsi muscle through an adipocytokine signaling pathway. © 2016 Stichting International Foundation for Animal Genetics.

  19. Erratum to “Neutron–19C scattering: Emergence of universal properties in a finite range potential” [Phys. Lett. B 764 (2017 196

    Directory of Open Access Journals (Sweden)

    M.A. Shalchi

    2017-08-01

    Full Text Available Numerical results for the function (1−EK/E0kcot⁡δ0R, as given in Phys. Lett. B 764 (2017 196, are revised. Fig. 2 and Tables 2 and 3 should be replaced by the following corresponding figure and tables. The conclusions of the original paper remain unchanged.

  20. Biosafety Recommendations for Work with Influenza Viruses Containing a Hemagglutinin from the A/goose/Guangdong/1/96 Lineage.

    Science.gov (United States)

    Gangadharan, Denise; Smith, Jacinta; Weyant, Robbin

    2013-06-28

    The CDC and National Institutes of Health (NIH) Biosafety in Microbiological and Biomedical Laboratories (BMBL) manual describes biosafety recommendations for work involving highly pathogenic avian influenza (HPAI) (US Department of Health and Human Services [HHS], CDC. Biosafety in microbiological and biomedical laboratories, 5th ed. Atlanta, GA: CDC; 2009. HHS publication no. [CDC] 21-1112. Available at http://www.cdc.gov/biosafety/publications/bmbl5). The U.S. Department of Agriculture Guidelines for Avian Influenza Viruses builds on the BMBL manual and provides additional biosafety and biocontainment guidelines for laboratories working with HPAI (US Department of Agriculture, Animal and Plant Health Inspection Service, Agricultural Select Agent Program. Guidelines for avian influenza viruses. Washington, DC: US Department of Agriculture; 2011. Available at http://www.selectagents.gov/Guidelines_for_Avian_Influenza_Viruses.html). The recommendations in this report, which are intended for laboratories in the United States, outline the essential baseline biosafety measures for working with the subset of influenza viruses that contain a hemagglutinin (HA) from the HPAI influenza A/goose/Guangdong/1/96 lineage, including reassortant influenza viruses created in a laboratory setting. All H5N1 influenza virus clades known to infect humans to date have been derived from this lineage (WHO/OIE/FAO H5N1 Evolution Working Group. Continued evolution of highly pathogenic avian influenza A [H5N1]: updated nomenclature. Influenza Other Respir Viruses 2012;6:1-5). In 2009, the NIH Guidelines for Research Involving Recombinant or Synthetic Nucleic Acid Molecules were amended to include specific biosafety and biocontainment recommendations for laboratories working with Recombinant Risk Group 3 influenza viruses, including HPAI H5N1 influenza viruses within the Goose/Guangdong/1/96-like H5 lineage. In February 2013, the NIH guidelines were further revised to provide additional

  1. A combined search for the standard model Higgs boson at s=1.96 TeV

    Science.gov (United States)

    DØ Collaboration; Abazov, V. M.; Abbott, B.; Abolins, M.; Acharya, B. S.; Adams, M.; Adams, T.; Aguilo, E.; Ahn, S. H.; Ahsan, M.; Alexeev, G. D.; Alkhazov, G.; Alton, A.; Alverson, G.; Alves, G. A.; Anastasoaie, M.; Ancu, L. S.; Andeen, T.; Anderson, S.; Andrieu, B.; Anzelc, M. S.; Arnoud, Y.; Arov, M.; Arthaud, M.; Askew, A.; Åsman, B.; Jesus, A. C. S. Assis; Atramentov, O.; Autermann, C.; Avila, C.; Ay, C.; Badaud, F.; Baden, A.; Bagby, L.; Baldin, B.; Banerjee, S.; Banerjee, P.; Barberis, E.; Barfuss, A.-F.; Bargassa, P.; Baringer, P.; Barreto, J.; Bartlett, J. F.; Bassler, U.; Bauer, D.; Beale, S.; Bean, A.; Begalli, M.; Begel, M.; Belanger-Champagne, C.; Bellantoni, L.; Bellavance, A.; Benitez, J. A.; Beri, S. B.; Bernardi, G.; Bernhard, R.; Bertram, I.; Besançon, M.; Beuselinck, R.; Bezzubov, V. A.; Bhat, P. C.; Bhatnagar, V.; Biscarat, C.; Blazey, G.; Blekman, F.; Blessing, S.; Bloch, D.; Bloom, K.; Boehnlein, A.; Boline, D.; Bolton, T. A.; Borissov, G.; Bose, T.; Brandt, A.; Brock, R.; Brooijmans, G.; Bross, A.; Brown, D.; Buchanan, N. J.; Buchholz, D.; Buehler, M.; Buescher, V.; Bunichev, V.; Burdin, S.; Burke, S.; Burnett, T. H.; Buszello, C. P.; Butler, J. M.; Calfayan, P.; Calvet, S.; Cammin, J.; Carvalho, W.; Casey, B. C. K.; Cason, N. M.; Castilla-Valdez, H.; Chakrabarti, S.; Chakraborty, D.; Chan, K. M.; Chan, K.; Chandra, A.; Charles, F.; Cheu, E.; Chevallier, F.; Cho, D. K.; Choi, S.; Choudhary, B.; Christofek, L.; Christoudias, T.; Cihangir, S.; Claes, D.; Coadou, Y.; Cooke, M.; Cooper, W. E.; Corcoran, M.; Couderc, F.; Cousinou, M.-C.; Crépé-Renaudin, S.; Cutts, D.; Ćwiok, M.; da Motta, H.; Das, A.; Davies, G.; de, K.; de Jong, S. J.; de La Cruz-Burelo, E.; de Oliveira Martins, C.; Degenhardt, J. D.; Déliot, F.; Demarteau, M.; Demina, R.; Denisov, D.; Denisov, S. P.; Desai, S.; Diehl, H. T.; Diesburg, M.; Dominguez, A.; Dong, H.; Dudko, L. V.; Duflot, L.; Dugad, S. R.; Duggan, D.; Duperrin, A.; Dyer, J.; Dyshkant, A.; Eads, M.; Edmunds, D.; Ellison, J.; Elmsheuser, J.; Elvira, V. D.; Enari, Y.; Eno, S.; Ermolov, P.; Evans, H.; Evdokimov, A.; Evdokimov, V. N.; Ferapontov, A. V.; Ferbel, T.; Fiedler, F.; Filthaut, F.; Fisher, W.; Fisk, H. E.; Ford, M.; Fortner, M.; Fox, H.; Fu, S.; Fuess, S.; Gadfort, T.; Galea, C. F.; Gallas, E.; Galyaev, E.; Garcia, C.; Garcia-Bellido, A.; Gavrilov, V.; Gay, P.; Geist, W.; Gelé, D.; Gerber, C. E.; Gershtein, Y.; Gillberg, D.; Ginther, G.; Gollub, N.; Gómez, B.; Goussiou, A.; Grannis, P. D.; Greenlee, H.; Greenwood, Z. D.; Gregores, E. M.; Grenier, G.; Gris, Ph.; Grivaz, J.-F.; Grohsjean, A.; Grünendahl, S.; Grünewald, M. W.; Guo, J.; Guo, F.; Gutierrez, P.; Gutierrez, G.; Haas, A.; Hadley, N. J.; Haefner, P.; Hagopian, S.; Haley, J.; Hall, I.; Hall, R. E.; Han, L.; Hanagaki, K.; Hansson, P.; Harder, K.; Harel, A.; Harrington, R.; Hauptman, J. M.; Hauser, R.; Hays, J.; Hebbeker, T.; Hedin, D.; Hegeman, J. G.; Heinmiller, J. M.; Heinson, A. P.; Heintz, U.; Hensel, C.; Herner, K.; Hesketh, G.; Hildreth, M. D.; Hirosky, R.; Hobbs, J. D.; Hoeneisen, B.; Hoeth, H.; Hohlfeld, M.; Hong, S. J.; Hossain, S.; Houben, P.; Hu, Y.; Hubacek, Z.; Hynek, V.; Iashvili, I.; Illingworth, R.; Ito, A. S.; Jabeen, S.; Jaffré, M.; Jain, S.; Jakobs, K.; Jarvis, C.; Jesik, R.; Johns, K.; Johnson, C.; Johnson, M.; Jonckheere, A.; Jonsson, P.; Juste, A.; Käfer, D.; Kajfasz, E.; Kalinin, A. M.; Kalk, J. R.; Kalk, J. M.; Kappler, S.; Karmanov, D.; Kasper, P.; Katsanos, I.; Kau, D.; Kaur, R.; Kaushik, V.; Kehoe, R.; Kermiche, S.; Khalatyan, N.; Khanov, A.; Kharchilava, A.; Kharzheev, Y. M.; Khatidze, D.; Kim, H.; Kim, T. J.; Kirby, M. H.; Kirsch, M.; Klima, B.; Kohli, J. M.; Konrath, J.-P.; Kopal, M.; Korablev, V. M.; Kozelov, A. V.; Krop, D.; Kuhl, T.; Kumar, A.; Kunori, S.; Kupco, A.; Kurča, T.; Kvita, J.; Lacroix, F.; Lam, D.; Lammers, S.; Landsberg, G.; Lebrun, P.; Lee, W. M.; Leflat, A.; Lehner, F.; Lellouch, J.; Leveque, J.; Lewis, P.; Li, J.; Li, Q. Z.; Li, L.; Lietti, S. M.; Lima, J. G. R.; Lincoln, D.; Linnemann, J.; Lipaev, V. V.; Lipton, R.; Liu, Y.; Liu, Z.; Lobo, L.; Lobodenko, A.; Lokajicek, M.; Love, P.; Lubatti, H. J.; Lyon, A. L.; Maciel, A. K. A.; Mackin, D.; Madaras, R. J.; Mättig, P.; Magass, C.; Magerkurth, A.; Mal, P. K.; Malbouisson, H. B.; Malik, S.; Malyshev, V. L.; Mao, H. S.; Maravin, Y.; Martin, B.; McCarthy, R.; Melnitchouk, A.; Mendes, A.; Mendoza, L.; Mercadante, P. G.; Merkin, M.; Merritt, K. W.; Meyer, J.; Meyer, A.; Millet, T.; Mitrevski, J.; Molina, J.; Mommsen, R. K.; Mondal, N. K.; Moore, R. W.; Moulik, T.; Muanza, G. S.; Mulders, M.; Mulhearn, M.; Mundal, O.; Mundim, L.; Nagy, E.; Naimuddin, M.; Narain, M.; Naumann, N. A.; Neal, H. A.; Negret, J. P.; Neustroev, P.; Nilsen, H.; Nogima, H.; Nomerotski, A.; Novaes, S. F.; Nunnemann, T.; O'Dell, V.

    2008-05-01

    We present new results of the search for WH→ℓνbb¯ production in pp¯ collisions at a center-of-mass energy of s=1.96 TeV, based on a dataset with integrated luminosity of 0.44 fb. We combine these new results with previously published searches by the D0 collaboration, for WH and ZH production analyzed in the E̸bb¯ final state, for ZH (→ℓℓbb¯) production, for WH (→WWW) production, and for H (→WW) direct production. No signal-like excess is observed either in the WH analysis or in the combination of all D0 Higgs boson analyses. We set 95% C.L. (expected) upper limits on σ(pp¯→WH)×B(H→bb¯) ranging from 1.6 (2.2) pb to 1.9 (3.3) pb for Higgs boson masses between 105 and 145 GeV, to be compared to the theoretical prediction of 0.13 pb for a Standard Model (SM) Higgs boson with mass m=115 GeV. After combination with the other D0 Higgs boson searches, we obtain for m=115 GeV an observed (expected) limit 8.5 (12.1) times higher than the SM predicted Higgs boson production cross section. For m=160 GeV, the corresponding observed (expected) ratio is 10.2 (9.0).

  2. A combined search for the standard model Higgs boson at √{ s} = 1.96 TeV

    Science.gov (United States)

    Abazov, V. M.; Abbott, B.; Abolins, M.; Acharya, B. S.; Adams, M.; Adams, T.; Aguilo, E.; Ahn, S. H.; Ahsan, M.; Alexeev, G. D.; Alkhazov, G.; Alton, A.; Alverson, G.; Alves, G. A.; Anastasoaie, M.; Ancu, L. S.; Andeen, T.; Anderson, S.; Andrieu, B.; Anzelc, M. S.; Arnoud, Y.; Arov, M.; Arthaud, M.; Askew, A.; Åsman, B.; Jesus, A. C. S. Assis; Atramentov, O.; Autermann, C.; Avila, C.; Ay, C.; Badaud, F.; Baden, A.; Bagby, L.; Baldin, B.; Banerjee, S.; Banerjee, P.; Barberis, E.; Barfuss, A.-F.; Bargassa, P.; Baringer, P.; Barreto, J.; Bartlett, J. F.; Bassler, U.; Bauer, D.; Beale, S.; Bean, A.; Begalli, M.; Begel, M.; Belanger-Champagne, C.; Bellantoni, L.; Bellavance, A.; Benitez, J. A.; Beri, S. B.; Bernardi, G.; Bernhard, R.; Bertram, I.; Besançon, M.; Beuselinck, R.; Bezzubov, V. A.; Bhat, P. C.; Bhatnagar, V.; Biscarat, C.; Blazey, G.; Blekman, F.; Blessing, S.; Bloch, D.; Bloom, K.; Boehnlein, A.; Boline, D.; Bolton, T. A.; Borissov, G.; Bose, T.; Brandt, A.; Brock, R.; Brooijmans, G.; Bross, A.; Brown, D.; Buchanan, N. J.; Buchholz, D.; Buehler, M.; Buescher, V.; Bunichev, V.; Burdin, S.; Burke, S.; Burnett, T. H.; Buszello, C. P.; Butler, J. M.; Calfayan, P.; Calvet, S.; Cammin, J.; Carvalho, W.; Casey, B. C. K.; Cason, N. M.; Castilla-Valdez, H.; Chakrabarti, S.; Chakraborty, D.; Chan, K. M.; Chan, K.; Chandra, A.; Charles, F.; Cheu, E.; Chevallier, F.; Cho, D. K.; Choi, S.; Choudhary, B.; Christofek, L.; Christoudias, T.; Cihangir, S.; Claes, D.; Coadou, Y.; Cooke, M.; Cooper, W. E.; Corcoran, M.; Couderc, F.; Cousinou, M.-C.; Crépé-Renaudin, S.; Cutts, D.; Ćwiok, M.; da Motta, H.; Das, A.; Davies, G.; De, K.; de Jong, S. J.; De La Cruz-Burelo, E.; De Oliveira Martins, C.; Degenhardt, J. D.; Déliot, F.; Demarteau, M.; Demina, R.; Denisov, D.; Denisov, S. P.; Desai, S.; Diehl, H. T.; Diesburg, M.; Dominguez, A.; Dong, H.; Dudko, L. V.; Duflot, L.; Dugad, S. R.; Duggan, D.; Duperrin, A.; Dyer, J.; Dyshkant, A.; Eads, M.; Edmunds, D.; Ellison, J.; Elmsheuser, J.; Elvira, V. D.; Enari, Y.; Eno, S.; Ermolov, P.; Evans, H.; Evdokimov, A.; Evdokimov, V. N.; Ferapontov, A. V.; Ferbel, T.; Fiedler, F.; Filthaut, F.; Fisher, W.; Fisk, H. E.; Ford, M.; Fortner, M.; Fox, H.; Fu, S.; Fuess, S.; Gadfort, T.; Galea, C. F.; Gallas, E.; Galyaev, E.; Garcia, C.; Garcia-Bellido, A.; Gavrilov, V.; Gay, P.; Geist, W.; Gelé, D.; Gerber, C. E.; Gershtein, Y.; Gillberg, D.; Ginther, G.; Gollub, N.; Gómez, B.; Goussiou, A.; Grannis, P. D.; Greenlee, H.; Greenwood, Z. D.; Gregores, E. M.; Grenier, G.; Gris, Ph.; Grivaz, J.-F.; Grohsjean, A.; Grünendahl, S.; Grünewald, M. W.; Guo, J.; Guo, F.; Gutierrez, P.; Gutierrez, G.; Haas, A.; Hadley, N. J.; Haefner, P.; Hagopian, S.; Haley, J.; Hall, I.; Hall, R. E.; Han, L.; Hanagaki, K.; Hansson, P.; Harder, K.; Harel, A.; Harrington, R.; Hauptman, J. M.; Hauser, R.; Hays, J.; Hebbeker, T.; Hedin, D.; Hegeman, J. G.; Heinmiller, J. M.; Heinson, A. P.; Heintz, U.; Hensel, C.; Herner, K.; Hesketh, G.; Hildreth, M. D.; Hirosky, R.; Hobbs, J. D.; Hoeneisen, B.; Hoeth, H.; Hohlfeld, M.; Hong, S. J.; Hossain, S.; Houben, P.; Hu, Y.; Hubacek, Z.; Hynek, V.; Iashvili, I.; Illingworth, R.; Ito, A. S.; Jabeen, S.; Jaffré, M.; Jain, S.; Jakobs, K.; Jarvis, C.; Jesik, R.; Johns, K.; Johnson, C.; Johnson, M.; Jonckheere, A.; Jonsson, P.; Juste, A.; Käfer, D.; Kajfasz, E.; Kalinin, A. M.; Kalk, J. R.; Kalk, J. M.; Kappler, S.; Karmanov, D.; Kasper, P.; Katsanos, I.; Kau, D.; Kaur, R.; Kaushik, V.; Kehoe, R.; Kermiche, S.; Khalatyan, N.; Khanov, A.; Kharchilava, A.; Kharzheev, Y. M.; Khatidze, D.; Kim, H.; Kim, T. J.; Kirby, M. H.; Kirsch, M.; Klima, B.; Kohli, J. M.; Konrath, J.-P.; Kopal, M.; Korablev, V. M.; Kozelov, A. V.; Krop, D.; Kuhl, T.; Kumar, A.; Kunori, S.; Kupco, A.; Kurča, T.; Kvita, J.; Lacroix, F.; Lam, D.; Lammers, S.; Landsberg, G.; Lebrun, P.; Lee, W. M.; Leflat, A.; Lehner, F.; Lellouch, J.; Leveque, J.; Lewis, P.; Li, J.; Li, Q. Z.; Li, L.; Lietti, S. M.; Lima, J. G. R.; Lincoln, D.; Linnemann, J.; Lipaev, V. V.; Lipton, R.; Liu, Y.; Liu, Z.; Lobo, L.; Lobodenko, A.; Lokajicek, M.; Love, P.; Lubatti, H. J.; Lyon, A. L.; Maciel, A. K. A.; Mackin, D.; Madaras, R. J.; Mättig, P.; Magass, C.; Magerkurth, A.; Mal, P. K.; Malbouisson, H. B.; Malik, S.; Malyshev, V. L.; Mao, H. S.; Maravin, Y.; Martin, B.; McCarthy, R.; Melnitchouk, A.; Mendes, A.; Mendoza, L.; Mercadante, P. G.; Merkin, M.; Merritt, K. W.; Meyer, J.; Meyer, A.; Millet, T.; Mitrevski, J.; Molina, J.; Mommsen, R. K.; Mondal, N. K.; Moore, R. W.; Moulik, T.; Muanza, G. S.; Mulders, M.; Mulhearn, M.; Mundal, O.; Mundim, L.; Nagy, E.; Naimuddin, M.; Narain, M.; Naumann, N. A.; Neal, H. A.; Negret, J. P.; Neustroev, P.; Nilsen, H.; Nogima, H.; Nomerotski, A.; Novaes, S. F.; Nunnemann, T.; O'Dell, V.; O'Neil, D. C.; Obrant, G.

    2008-05-01

    We present new results of the search for WH → ℓνbbbar production in ppbar collisions at a center-of-mass energy of √{ s} = 1.96 TeV, based on a dataset with integrated luminosity of 0.44 fb-1. We combine these new results with previously published searches by the D0 collaboration, for WH and ZH production analyzed in the E̸T bbbar final state, for ZH (→ℓ+ℓ- bbbar) production, for WH (→ WWW) production, and for H (→ WW) direct production. No signal-like excess is observed either in the WH analysis or in the combination of all D0 Higgs boson analyses. We set 95% C.L. (expected) upper limits on σ (ppbar → WH) × B (H → bbbar) ranging from 1.6 (2.2) pb to 1.9 (3.3) pb for Higgs boson masses between 105 and 145 GeV, to be compared to the theoretical prediction of 0.13 pb for a Standard Model (SM) Higgs boson with mass mH = 115 GeV. After combination with the other D0 Higgs boson searches, we obtain for mH = 115 GeV an observed (expected) limit 8.5 (12.1) times higher than the SM predicted Higgs boson production cross section. For mH = 160 GeV, the corresponding observed (expected) ratio is 10.2 (9.0).

  3. Identification and decay of /sup 190/W, /sup 196/Os, /sup 230/Ra, and /sup 230/Ac. [Half-life

    Energy Technology Data Exchange (ETDEWEB)

    Katcoff, S.; Gilat, J.; Haustein, P.E.; Franz, E.M.; Morcos, N.A.; Ward, T.E.; Smith, H.A. Jr.; Hill, J.C.; Petry, R.F.

    1976-05-19

    Several new or poorly characterized neutron-rich nuclides were produced and studied at the Brookhaven Medium Energy Intense Neutron facility, MEIN. /sup 190/W decays with T/sub 1/2/ = 30.0 +- 1.5 min, E/sub beta/ = 0.93 +- 0.07 MeV, and ..gamma..'s of 157.6 and 162.1 keV. /sup 196/Os decays with T/sub 1/2/ = 35.0 +- 0.4 min and ..gamma..'s at 126.1, 200.7, 207.0, 257.0, 315.3, 407.6, 522.2, and 628.9 keV. /sup 230/Ra decays with T/sub 1/2/ = 93 +- 2 min to 122 +- 3 sec /sup 230/Ac; ..gamma..-ray energies and intensities are tabulated. A decay scheme is proposed for /sup 190/W, and many of the transitions following the decay of /sup 230/Ac are between known levels in /sup 230/Th.

  4. Frequency of and risk factors associated with lingual lesions in dogs: 1,196 cases (1995-2004).

    Science.gov (United States)

    Dennis, Michelle M; Ehrhart, Nicole; Duncan, Colleen G; Barnes, Ashley B; Ehrhart, E J

    2006-05-15

    To categorize histologic lesions affecting the tongue, determine the frequency with which they develop, and identify risk factors associated with their development in dogs. Retrospective case series. 1,196 dogs. Diagnostic reports of lingual biopsy specimens from dogs evaluated from January 1995 to October 2004 were reviewed. Neoplasia comprised 54% of lingual lesions. Malignant tumors accounted for 64% of lingual neoplasms and included melanoma, squamous cell carcinoma, hemangiosarcoma, and fibrosarcoma. Large-breed dogs, especially Chow Chows and Chinese Shar-Peis, were at increased risk for melanoma. Females of all breeds and Poodles, Labrador Retrievers, and Samoyeds were more likely to have squamous cell carcinomas. Hemangiosarcomas and fibrosarcomas were commonly diagnosed in Border Collies and Golden Retrievers, respectively. Benign neoplasms included squamous papilloma, plasma cell tumor, and granular cell tumor. Small-breed dogs, especially Cocker Spaniels, were at increased risk for plasma cell tumors. Glossitis accounted for 33% of diagnoses; in most cases, the inciting cause was not apparent. Whereas large-breed dogs were more likely to have lingual neoplasia, small-breed dogs were more likely to have glossitis. Calcinosis circumscripta accounted for 4% of lingual lesions and predominately affected young large-breed dogs. The remaining submissions consisted mostly of various degenerative or wound-associated lesions. The frequency of lingual lesions was not evenly distributed across breeds, sexes, or size classes of dogs. Veterinarians should be aware of the commonly reported lingual lesions in dogs so that prompt diagnosis and appropriate management can be initiated.

  5. Search for New Physics in Dielectron Events in 1.96-TeV Proton - Anti-proton Collisions

    Energy Technology Data Exchange (ETDEWEB)

    Ikado, Koji [Waseda Univ., Shinjuku (Japan)

    2004-03-01

    The authors have searched for new physics beyond the Standard Model of elementary particle physics in dielectron decay mode at the CDF (Collider Detector at Fermilab) experiment in {bar p}p collisions at √s = 1.96 TeV. The data were collected during the 2002-2003 runs corresponding to an integrated luminosity of 200 pb-1. Many extensions of the Standard Model have been proposed. Grand Unified Theories (GUT) assumes a larger gauge symmetry group and predict new gauge bosons. GUT has hierarchy problem in it and there have been many attempts to solve the hierarchy problem. Solutions for the hierarchy problem are supersymmetry, technicolor, large extra dimensions, warped extra dimensions and little Higgs models. The authors analyze the differential distribution of dielectron events in terms of their invariant mass and no significant excess is found in very high mass region. They present a 95% confidence level limit on the production cross section times branching ratio for new resonant particles decaying into an electron pair as a function of invariant mass. New resonant particles include new neutral gauge boson Z', Randall-Sundrum graviton, R-parity violating sneutrino, and technicolor particles. They also present limits on the effective Planck scale of large extra dimensions.

  6. Event Shapes in $p\\bar p$ Collisions at $\\sqrt{s} = 1.96$ TeV

    Energy Technology Data Exchange (ETDEWEB)

    Atkins, Scott [Louisiana Tech Univ., Ruston, LA (United States)

    2012-08-01

    This dissertation presents the analysis of nine different event shapes measured in high energy p$\\bar{p}$ collisions. An event shape can be defined as an event-based quantity that measures how the final energies are distributed in the final event. This analysis will test strong interactions as described by Quantum Chromodynamics (QCD), through their implementation in different Monte Carlo-based models. Each of the event shapes provides information about the flow of energy in QCD events and about the hadronic final states that occur in p$\\bar{p}$ particle collisions, thus allowing the study of the dynamics of QCD multijet events. Any deviation of an event shape from zero will be indicative of higher-order effects, meaning that more than the two jets were produced in the event. For each of the event shapes, both normalized differential distributions ( 1/σ dσ/dX) and average event shapes ($\\bar{X}$σ) were measured, where X is the event shape and σ is the cross section. This analysis uses 0.7 fb-1 of data taken between 2004 and 2006 by the DØ detector located at the Fermi National Accelerator Lab (Fermilab) in Batavia, IL, using p$\\bar{p}$ collisions at a center-of-mass energy of √s = 1.96 TeV.

  7. Search for stopped gluinos from pp collisions at square root s = 1.96 TeV.

    Science.gov (United States)

    Abazov, V M; Abbott, B; Abolins, M; Acharya, B S; Adams, M; Adams, T; Aguilo, E; Ahn, S H; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Ancu, L S; Andeen, T; Anderson, S; Andrieu, B; Anzelc, M S; Arnoud, Y; Arov, M; Arthaud, M; Askew, A; Asman, B; Jesus, A C S Assis; Atramentov, O; Autermann, C; Avila, C; Ay, C; Badaud, F; Baden, A; Bagby, L; Baldin, B; Bandurin, D V; Banerjee, P; Banerjee, S; Barberis, E; Barfuss, A-F; Bargassa, P; Baringer, P; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Beale, S; Bean, A; Begalli, M; Begel, M; Belanger-Champagne, C; Bellantoni, L; Bellavance, A; Benitez, J A; Beri, S B; Bernardi, G; Bernhard, R; Berntzon, L; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Biscarat, C; Blazey, G; Blekman, F; Blessing, S; Bloch, D; Bloom, K; Boehnlein, A; Boline, D; Bolton, T A; Borissov, G; Bos, K; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Brown, D; Buchanan, N J; Buchholz, D; Buehler, M; Buescher, V; Burdin, S; Burke, S; Burnett, T H; Buszello, C P; Butler, J M; Calfayan, P; Calvet, S; Cammin, J; Caron, S; Carvalho, W; Casey, B C K; Cason, N M; Castilla-Valdez, H; Chakrabarti, S; Chakraborty, D; Chan, K; Chan, K M; Chandra, A; Charles, F; Cheu, E; Chevallier, F; Cho, D K; Choi, S; Choudhary, B; Christofek, L; Christoudias, T; Cihangir, S; Claes, D; Clément, B; Clément, C; Coadou, Y; Cooke, M; Cooper, W E; Corcoran, M; Couderc, F; Cousinou, M-C; Crépé-Renaudin, S; Cutts, D; Cwiok, M; da Motta, H; Das, A; Davies, G; De, K; de Jong, P; de Jong, S J; De La Cruz-Burelo, E; De Oliveira Martins, C; Degenhardt, J D; Déliot, F; Demarteau, M; Demina, R; Denisov, D; Denisov, S P; Desai, S; Diehl, H T; Diesburg, M; Dominguez, A; Dong, H; Dudko, L V; Duflot, L; Dugad, S R; Duggan, D; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Ellison, J; Elvira, V D; Enari, Y; Eno, S; Ermolov, P; Evans, H; Evdokimov, A; Evdokimov, V N; Ferapontov, A V; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Ford, M; Fortner, M; Fox, H; Fu, S; Fuess, S; Gadfort, T; Galea, C F; Gallas, E; Galyaev, E; Garcia, C; Garcia-Bellido, A; Gavrilov, V; Gay, P; Geist, W; Gelé, D; Gerber, C E; Gershtein, Y; Gillberg, D; Ginther, G; Gollub, N; Gómez, B; Goussiou, A; Grannis, P D; Greenlee, H; Greenwood, Z D; Gregores, E M; Grenier, G; Gris, Ph; Grivaz, J-F; Grohsjean, A; Grünendahl, S; Grünewald, M W; Guo, F; Guo, J; Gutierrez, G; Gutierrez, P; Haas, A; Hadley, N J; Haefner, P; Hagopian, S; Haley, J; Hall, I; Hall, R E; Han, L; Hanagaki, K; Hansson, P; Harder, K; Harel, A; Harrington, R; Hauptman, J M; Hauser, R; Hays, J; Hebbeker, T; Hedin, D; Hegeman, J G; Heinmiller, J M; Heinson, A P; Heintz, U; Hensel, C; Herner, K; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hoeth, H; Hohlfeld, M; Hong, S J; Hooper, R; Hossain, S; Houben, P; Hu, Y; Hubacek, Z; Hynek, V; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jakobs, K; Jarvis, C; Jesik, R; Johns, K; Johnson, C; Johnson, M; Jonckheere, A; Jonsson, P; Juste, A; Käfer, D; Kahn, S; Kajfasz, E; Kalinin, A M; Kalk, J M; Kalk, J R; Kappler, S; Karmanov, D; Kasper, J; Kasper, P; Katsanos, I; Kau, D; Kaur, R; Kaushik, V; Kehoe, R; Kermiche, S; Khalatyan, N; Khanov, A; Kharchilava, A; Kharzheev, Y M; Khatidze, D; Kim, H; Kim, T J; Kirby, M H; Kirsch, M; Klima, B; Kohli, J M; Konrath, J-P; Kopal, M; Korablev, V M; Kothari, B; Kozelov, A V; Krop, D; Kryemadhi, A; Kuhl, T; Kumar, A; Kunori, S; Kupco, A; Kurca, T; Kvita, J; Lam, D; Lammers, S; Landsberg, G; Lazoflores, J; Lebrun, P; Lee, W M; Leflat, A; Lehner, F; Lellouch, J; Lesne, V; Leveque, J; Lewis, P; Li, J; Li, L; Li, Q Z; Lietti, S M; Lima, J G R; Lincoln, D; Linnemann, J; Lipaev, V V; Lipton, R; Liu, Y; Liu, Z; Lobo, L; Lobodenko, A; Lokajicek, M; Lounis, A; Love, P; Lubatti, H J; Lyon, A L; Maciel, A K A; Mackin, D; Madaras, R J; Mättig, P; Magass, C; Magerkurth, A; Makovec, N; Mal, P K; Malbouisson, H B; Malik, S; Malyshev, V L; Mao, H S; Maravin, Y; Martin, B; McCarthy, R; Melnitchouk, A; Mendes, A; Mendoza, L; Mercadante, P G; Merkin, M; Merritt, K W; Meyer, A; Meyer, J; Michaut, M; Millet, T; Mitrevski, J; Molina, J; Mommsen, R K; Mondal, N K; Moore, R W; Moulik, T; Muanza, G S; Mulders, M; Mulhearn, M; Mundal, O; Mundim, L; Nagy, E; Naimuddin, M; Narain, M; Naumann, N A; Neal, H A; Negret, J P; Neustroev, P; Nilsen, H; Noeding, C; Nomerotski, A; Novaes, S F; Nunnemann, T; O'dell, V; O'neil, D C; Obrant, G; Ochando, C; Onoprienko, D; Oshima, N; Osta, J; Otec, R; Y Garzón, G J Otero; Owen, M; Padley, P; Pangilinan, M; Parashar, N; Park, S-J; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Pawloski, G; Perea, P M; Peters, K; Peters, Y; Pétroff, P; Petteni, M; Piegaia, R; Piper, J; Pleier, M-A; Podesta-Lerma, P L M; Podstavkov, V M; Pogorelov, Y; Pol, M-E; Pompos, A; Pope, B G; Popov, A V; Potter, C; da Silva, W L Prado; Prosper, H B; Protopopescu, S; Qian, J; Quadt, A; Quinn, B; Rakitine, A; Rangel, M S; Rani, K J; Ranjan, K; Ratoff, P N; Renkel, P; Reucroft, S; Rich, P; Rijssenbeek, M; Ripp-Baudot, I; Rizatdinova, F; Robinson, S; Rodrigues, R F; Royon, C; Rubinov, P; Ruchti, R; Safronov, G; Sajot, G; Sánchez-Hernández, A; Sanders, M P; Santoro, A; Savage, G; Sawyer, L; Scanlon, T; Schaile, D; Schamberger, R D; Scheglov, Y; Schellman, H; Schieferdecker, P; Schliephake, T; Schmitt, C; Schwanenberger, C; Schwartzman, A; Schwienhorst, R; Sekaric, J; Sengupta, S; Severini, H; Shabalina, E; Shamim, M; Shary, V; Shchukin, A A; Shivpuri, R K; Shpakov, D; Siccardi, V; Simak, V; Sirotenko, V; Skubic, P; Slattery, P; Smirnov, D; Smith, R P; Snow, G R; Snow, J; Snyder, S; Söldner-Rembold, S; Sonnenschein, L; Sopczak, A; Sosebee, M; Soustruznik, K; Souza, M; Spurlock, B; Stark, J; Steele, J; Stolin, V; Stone, A; Stoyanova, D A; Strandberg, J; Strandberg, S; Strang, M A; Strauss, M; Ströhmer, R; Strom, D; Strovink, M; Stutte, L; Sumowidagdo, S; Svoisky, P; Sznajder, A; Talby, M; Tamburello, P; Tanasijczuk, A; Taylor, W; Telford, P; Temple, J; Tiller, B; Tissandier, F; Titov, M; Tokmenin, V V; Tomoto, M; Toole, T; Torchiani, I; Trefzger, T; Tsybychev, D; Tuchming, B; Tully, C; Tuts, P M; Unalan, R; Uvarov, L; Uvarov, S; Uzunyan, S; Vachon, B; van den Berg, P J; van Eijk, B; Van Kooten, R; van Leeuwen, W M; Varelas, N; Varnes, E W; Vartapetian, A; Vasilyev, I A; Vaupel, M; Verdier, P; Vertogradov, L S; Verzocchi, M; Villeneuve-Seguier, F; Vint, P; Von Toerne, E; Voutilainen, M; Vreeswijk, M; Wagner, R; Wahl, H D; Wang, L; Wang, M H L S; Warchol, J; Watts, G; Wayne, M; Weber, G; Weber, M; Weerts, H; Wenger, A; Wermes, N; Wetstein, M; White, A; Wicke, D; Wilson, G W; Wimpenny, S J; Wobisch, M; Wood, D R; Wyatt, T R; Xie, Y; Yacoob, S; Yamada, R; Yan, M; Yasuda, T; Yatsunenko, Y A; Yip, K; Yoo, H D; Youn, S W; Yu, C; Yu, J; Yurkewicz, A; Zatserklyaniy, A; Zeitnitz, C; Zhang, D; Zhao, T; Zhou, B; Zhu, J; Zielinski, M; Zieminska, D; Zieminski, A; Zivkovic, L; Zutshi, V; Zverev, E G

    2007-09-28

    Long-lived, heavy particles are predicted in a number of models beyond the standard model of particle physics. We present the first direct search for such particles' decays, occurring up to 100 h after their production and not synchronized with an accelerator bunch crossing. We apply the analysis to the gluino (g), predicted in split supersymmetry, which after hadronization can become charged and lose enough momentum through ionization to come to rest in dense particle detectors. Approximately 410 pb(-1) of pp collisions at square root(s) = 1.96 TeV collected with the D0 detector during Run II of the Fermilab Tevatron collider are analyzed in search of such "stopped gluinos" decaying into a gluon and a neutralino (chi(1)(0)). Limits are placed on the (gluino cross section) x (probability to stop) x [BR(g --> g chi(1)(0))] as a function of the gluino and chi(1)(0) masses, for gluino lifetimes from 30 micros-100 h.

  8. Measurement of trilinear gauge boson couplings from at {\\boldmath$\\sqrt{s}=1.96$} TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abazov, Victor Mukhamedovich; /Dubna, JINR; Abbott, Braden Keim; /Oklahoma U.; Abolins, Maris A.; /Michigan State U.; Acharya, Bannanje Sripath; /Tata Inst.; Adams, Mark Raymond; /Illinois U., Chicago; Adams, Todd; /Florida State U.; Aguilo, Ernest; /Alberta U. /Simon Fraser U. /York U., Canada /McGill U.; Ahsan, Mahsana; /Kansas State U.; Alexeev, Guennadi D.; /Dubna, JINR; Alkhazov, Georgiy D.; /St. Petersburg, INP; Alton, Andrew K.; /Michigan U. /Augustana Coll., Sioux Falls /Northeastern U.

    2009-07-01

    We present a direct measurement of trilinear gauge boson couplings at gammaWW and ZWW vertices in WW and WZ events produced in p{bar p} collisions at {radical}s = 1.96 TeV. We consider events with one electron or muon, missing transverse energy, and at least two jets. The data were collected using the D0 detector and correspond to 1.1 fb{sup -1} of integrated luminosity. Considering two different relations between the couplings at the gammaWW and ZWW vertices, we measure these couplings at 68% C.L. to be kappa{sub gamma} = 1.07{sub -0.29}{sup +0.26}, lambda = 0.00{sub -0.06}{sup +0.06}, and g{sub 1}{sup Z} = 1.04{sup -0.09}{sup +0.09} in a scenario respecting SU(2){sub L}[direct-product]U(1){sub Y} gauge symmetry and kappa = 1.04{sub -0.11}{sup +0.11} and lambda=0.00{sub -0.06}{sup +0.06} in an 'equal couplings' scenario.

  9. Fragmentation of Jets Produced in Proton-Antiproton Collisions at $\\sqrt{s} = 1.96$ TeV

    Energy Technology Data Exchange (ETDEWEB)

    Jindariani, Sergo R. [Univ. of Florida, Gainesville, FL (United States)

    2007-01-01

    We present the first measurement of two-particle momentum correlations in jets produced in p$\\bar{p}$ collisions at center of mass energy of 1.96 TeV. A comparison of the experimental data to theoretical predictions obtained for partons within the framework of resummed perturbative QCD (Next-to-Leading Log Approximation) shows that the predicted parton momentum correlations survive the hadronization stage of jet fragmentation and are present at the hadron level. We also present the measurement of the intrinsic transverse momenta of particles with respect to jet axis (kT ). Experimental data is compared to the theoretical predictions obtained for partons within the framework of Modified Leading Log Approximation and Next-to-Modified Leading Log Approximation, and shows good agreement in the range of validity of the theoretical predictions. The results of both measurements indicate that the perturbative stage of the jet formation must be dominant and give further support to the hypothesis of Local Parton-Hadron Duality.

  10. Measurement of the Top Quark Mass by Dynamical Likelihood Method using the Lepton plus Jets Events in 1.96 Tev Proton-Antiproton Collisions

    Energy Technology Data Exchange (ETDEWEB)

    Yorita, Kohei [Waseda Univ., Shinjuku (Japan)

    2005-03-01

    We have measured the top quark mass with the dynamical likelihood method (DLM) using the CDF II detector at the Fermilab Tevatron. The Tevatron produces top and anti-top pairs in pp collisions at a center of mass energy of 1.96 TeV. The data sample used in this paper was accumulated from March 2002 through August 2003 which corresponds to an integrated luminosity of 162 pb-1.

  11. Measurement of top quark mass in the all hadronic channel in √s = 1.96 TeF, p$\\bar{p}$ collisions at D0

    Energy Technology Data Exchange (ETDEWEB)

    Lam, David Wai Kui [Univ. of Notre Dame, IN (United States)

    2008-04-01

    A measurement of the top quark mass in proton-antiproton collisions at √s = 1.96 TeV using 1040fb-1 of data collected in D detector at Fermilab is presented. This analysis focuses on the all-hadronic decay mode of the top quark and therefore only events with six or more calorimeter jets in the final state are considered.

  12. Clinical need for a Baha trial in patients with single-sided sensorineural deafness. Analysis of a Baha database of 196 patients.

    Science.gov (United States)

    Desmet, Jolien; Bouzegta, Rajae; Hofkens, Anouk; De Backer, Annemarie; Lambrechts, Peggy; Wouters, Kristien; Claes, Jozef; De Bodt, Marc; Van de Heyning, Paul

    2012-03-01

    A bone-anchored hearing aid (Baha) is used in patients with single-sided sensorineural deafness (SSD) to overcome the head shadow effect. Of all the patients with SSD, treated at our hospital, 196 patients used a Baha on trial between November 2001 and April 2010. The objective of this study is to evaluate what factors determine the decision of a SSD patient whether or not to opt for a Baha device following a Baha trial period. 196 patients with SSD were enrolled for a trial period of 2 weeks at the Antwerp University Hospital, a tertiary referral centre. 93% of these patients suffered from an acquired hearing loss. 44% of all the patients (87/196) chose to wear a Baha device after the trail period, either on an abutment or on a headband. The collected data were analysed to determine correlations between the decision of a patient following a Baha trial period on the one hand, and Fletcher Index ipsi- and contralaterally, bone conduction hearing thresholds at the better hearing ear, aetiology, age at the start of the trial period, duration of hearing loss at the start of the trial period and the type of device used during the trial period, on the other hand. Although 66% of all the patients (109/196) declined the Baha after a trial, reasons not to choose a Baha were diverse and no crucial factors could be found that determine the success of a Baha trial period. Lack of improvement concerning speech understanding in noise was the most important reason mentioned by patients who declined the Baha. The authors advocate that all patients, suffering from SSD, should be offered the opportunity to try a Baha device as no factors could be found that determine the decision of a patient following the trial period.

  13. Measurement of electroweak single top quark production in proton-antiproton collisions at 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Dong, Peter Joseph [Univ. of California, Los Angeles, CA (United States)

    2008-01-01

    The top quark is an extremely massive fundamental particle that is predominantly produced in pairs at particle collider experiments. The Standard Model of particle physics predicts that top quarks can also be produced singly by the electroweak force; however, this process is more difficult to detect because it occurs at a smaller rate and is more difficult to distinguish from background processes. The cross section of this process is related to the Cabbibo-Kobayashi-Maskawa matrix element |V tb|, and measurement of the single top quark production cross section is currently the only method to directly measure this quantity without assuming the number of generations of fermions. This thesis describes a measurement of the cross section of electroweak single top quark production in proton-antiproton collisions at a center-of-mass energy of 1.96 TeV. This analysis uses 2.2 fb-1 of integrated luminosity recorded by the Collider Detector at Fermilab. The search is performed using a matrix element method which calculates the differential cross section for each event for several signal and background hypotheses. These numbers are combined into a single discriminant and used to construct templates from Monte Carlo simulation. A maximum likelihood fit to the data distribution gives a measurement of the cross section. This analysis measures a value of 2.2$+0.8\\atop{-0.7}$ pb, which corresponds to a value of |V tb| = 0.88$+0.16\\atop{-0.14}$experimental±0.7(theoretical). The probability that this result originates from a background fluctuation in the absence of single top production (p-value) is 0.0003, which is equivalent to 3.4 standard deviations in Gaussian statistics. The expected (median) p-value as estimated from pseudo-experiments for this analysis is 0.000003, which corresponds to 4.5 standard deviations in Gaussian statistics.

  14. Relationships between consumption of alcoholic beverages and healthy foods: the French supermarket cohort of 196,000 subjects.

    Science.gov (United States)

    Hansel, Boris; Roussel, Ronan; Diguet, Vincent; Deplaude, Amandine; Chapman, M John; Bruckert, Eric

    2015-02-01

    Moderate alcohol consumption is associated with reduced risk of cardiovascular disease. Related dietary habits and lifestyle may bias assessment of the relationship between alcohol intake and health status. We examined the relationship between key features relating to the consumption of alcoholic beverages and individual profiles of objective food purchases. Data were collected on regular clients of a large supermarket chain implanted across France (n = 196,604). Food items purchased were classified into three categories: (1) healthy foods; (2) unhealthy foods; and (3) others. Wine consumers favoured purchase of healthy foods more often than others, whereas the lowest level of healthy food purchasers was associated with consumption of beer and aniseed-based beverages. Bordeaux wine purchasers spent less in their average budget than the whole population for nine out of the 11 unhealthy food categories. Conversely, the budget was markedly higher in non-alcohol purchasers as compared to the whole population for seven out of the 11 unhealthy foods. The ratio of the budget for healthy to that for unhealthy foods was also distinct between the groups, being highest for wine and lowest for beer. In the subgroup of non-alcohol consumers, this ratio was intermediate but significantly lower relative to values in the five subcategories of wine purchasers. Marked differences in the profile of the purchase of healthy versus unhealthy food products as a function of the subcategory of alcoholic beverage consumed were documented, revealing a critical unidentified confounding feature in analyses of the potential relationship between alcohol consumption and protection against cardiovascular disease. © The European Society of Cardiology 2013 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

  15. Diffractive Dijet Production in $\\bar{p}p$ Collisions at $\\sqrt{s}=1.96$ TeV

    Energy Technology Data Exchange (ETDEWEB)

    Aaltonen, T.; /Helsinki Inst. of Phys.; Albrow, M.; /Fermilab; Alvarez Gonzalez, B.; /Oviedo U. /Cantabria Inst. of Phys.; Amerio, S.; /INFN, Padua; Amidei, D.; /Michigan U.; Anastassov, A.; /Northwestern U. /Fermilab; Annovi, A.; /Frascati; Antos, J.; /Comenius U.; Apollinari, G.; /Fermilab; Appel, J.A.; /Fermilab; Arisawa, T.; /Waseda U. /Dubna, JINR

    2012-06-01

    We report on a study of diffractive dijet production in {bar p}p collisions at {radical}s = 1.96 TeV using the CDF II detector at the Fermilab Tevatron {bar p}p collider. A data sample from 310 pb{sup -1} of integrated luminosity collected by triggering on a high transverse energy jet, E{sub T}{sup jet}, in coincidence with a recoil antiproton detected in a Roman pot spectrometer is used to measure the ratio of single-diffractive to inclusive-dijet event rates as a function of x{sup {bar p}} of the interacting parton in the antiproton, the Bjorken-x, x{sub Bj}{sup {bar p}}, and a Q{sup 2} {approx} (E{sub T}{sup jet}){sup 2} in the ranges 10{sup -3} < x{sub Bj}{sup {bar p}} < 10{sup -1} and 10{sup 2} < Q{sup 2} < 10{sup 4} GeV{sup 2}, respectively. Results are presented for the region of {bar p}-momentum-loss fraction 0.03 < {zeta}{sub {bar p}} < 0.09 and a four-momentum transfer squared t{sub {bar p}} > -4 GeV{sup 2}. The t{sub {bar p}} dependence is measured as a function of Q{sup 2} and x{sub Bj}{sup {bar p}} and compared with that of inclusive single diffraction dissociation. We find weak x{sub Bj}{sup bar p}} and Q{sup 2} dependencies in the ratio of single diffractive to inclusive event rates, and no significant Q{sup 2} dependence in the diffractive t{sub {bar p}} distributions.

  16. Perioperative Outcomes, Complications, and Efficacy of Robotic-Assisted Prolapse Repair: A Single Institution Study of 196 Patients.

    Science.gov (United States)

    Gupta, Priyanka; Ehlert, Michael; Bartley, Jamie; Gilleran, Jason; Killinger, Kim A; Boura, Judith A; Nagaraju, Pradeep; Fischer, Melissa

    2017-09-15

    Abdominal pelvic organ prolapse repair is efficacious for uterovaginal and apical prolapse. We describe the safety and efficacy of robotic prolapse repair in a large teaching institution. Consecutive robotic-assisted prolapse repairs at a single institution between 2006 and 2014 were retrospectively reviewed for patient characteristics, operative information, and outcomes. A total of 196 women (mean age, 61 ± 9 years) underwent robotic prolapse repair (189 sacrocolpopexy, 6 sacrohysteropexy, 1 enterocele repair). Concomitant procedures included hysterectomy (88), midurethral sling (84), and/or Burch colposuspension (7). Mean odds ratio time was 242 ± 69.9 minutes, and median length of stay was 1 day. Intraoperative complications were as follows: cystotomy (4), vaginotomy (4), conversion to open (2), bowel injury/aborted (1), adhesions/aborted (1), and ureteral injury (1). Women with complications had greater blood loss than those without complications (P = 0.0015). Immediate (neuropraxia (3). At median follow-up of 9 months (range, 0-85 months), 14 women had recurrent grade 3 prolapse, and 4 had grade 2 apical prolapse. Nine of 14 women had additional prolapse repair at a mean of 9.5 ± 6.3 months. Vaginal mesh exposure was detected in 12 (6.3%) of 192 women. There were 6 procedures for mesh exposure and 2 procedures for exposed sutures. One mesh erosion into the bladder required open excision. In this large series of robotic prolapse repair, complications are infrequent. Short-term apical outcomes are excellent. Few women required additional compartment repairs within 1 year with 6% rate of mesh exposure.

  17. Study on the top quark pair production mechanism in 1.96 TeV proton-antiproton collisions

    Energy Technology Data Exchange (ETDEWEB)

    Naganoma, Junji [Waseda Univ., Shinjuku (Japan)

    2008-03-01

    The study of the top quark pair production mechanism in proton-antiproton collisions at a center-of-mass energy of 1.96 TeV is described. The main subjects are the measurements of the top quark pair production cross section, the top quark mass and a search for a new particle decaying to the top quark pair. The analyses are based on 1.9 fb-1 of data collected by the Collider Detector at Fermilab (CDF) Run II experiment between March 2002 and May 2007, using the lepton+jets events. The measured top quark pair production cross section is 8.2 ± 0.5 (stat.) ± 0.8 (syst.) ± 0.5 (lum.) pb, which is slightly higher than the standard model prediction at the top mass of 175 GeV/c2. The top quark mass is an important parameter in the standard model, and also in the experimental studies. The measured top quark mass if 171.6 ± 2.0 (stat.) ± 1.3(syst.) GeV/c2. Finally, they report on a search for a new gauge boson decaying to t$\\bar{t}$, which interferes with the standard model gluon in the q$\\bar{q}$ → t$\\bar{t}$ production process. They call such a hypothetical particle a 'Massive Gluon'. The observed t$\\bar{t}$ invariant mass distribution is consistent with the standard model expectations, and also the measured massive gluon coupling strength with quarks is consistent within a statistical fluctuation of the standard model expectation in the wide range of the massive gluon masses and widths. They set the upper and lower limits on the coupling strength of the massive gluon.

  18. A genetic variant in miR-196a2 increased digestive system cancer risks: a meta-analysis of 15 case-control studies.

    Directory of Open Access Journals (Sweden)

    Jing Guo

    Full Text Available BACKGROUND: MicroRNAs (miRNAs negatively regulate the gene expression and act as tumor suppressors or oncogenes in oncogenesis. The association between single nucleotide polymorphism (SNP in miR-196a2 rs11614913 and the susceptibility of digestive system cancers was inconsistent in previous studies. METHODOLOGY/PRINCIPAL FINDINGS: An updated meta-analysis based on 15 independent case-control studies consisting of 4999 cancer patients and 7606 controls was performed to address this association. It was found that miR-196a2 polymorphism significantly elevated the risks of digestive system cancers (CT vs. TT, OR = 1.25, 95% CI = 1.07-1.45; CC vs. TT, OR = 1.38, 95% CI = 1.13-1.67; CC/CT vs. TT, OR = 1.29, 95% CI = 1.10-1.50; CC vs. CT/TT, OR = 1.14, 95% CI = 1.01-1.30; C vs. T, OR = 1.15, 95% CI = 1.05-1.26. We also found that variant in miR-196a2 increased the susceptibility of colorectal cancer (CRC (CT vs. TT, OR = 1.23, 95% CI = 1.04-1.44; CC vs. TT, OR = 1.32, 95% CI = 1.08-1.61; CC/CT vs. TT, OR = 1.25, 95% CI = 1.07-1.46; C vs. T, OR = 1.15, 95% CI = 1.05-1.28, while the association in recessive model (CC vs. CT/TT, OR = 1.16, 95% CI = 0.98-1.38 showed a marginal significance. Additionally, significant association between miR-196a2 polymorphism and increased risk of hepatocellular cancer (HCC was detected. By stratifying tumors on the basis of site of origin, source of controls, ethnicity and allele frequency in controls, elevated cancer risks were observed. CONCLUSION/SIGNIFICANCE: Our findings suggest the significant association between miR-196a2 polymorphism and increased susceptibility of digestive system cancers, especially of CRC, HCC and Asians. Besides, C allele may contribute to increased digestive cancer risks.

  19. $\\beta$-delayed fission, laser spectroscopy and shape-coexistence studies with radioactive At beams

    CERN Multimedia

    We propose to study the $\\beta$-delayed fission, laser spectroscopy and radioactive decay of the newly available pure beams of neutron-deficient and neutron-rich astatine (Z=85) isotopes. The fission probability and the fission fragment distribution of the even-even isotopes $^{194,196}$Po following the $\\beta$-decay of the isotopes $^{194,196}$At will be studied with the Windmill setup. In-source laser spectroscopy will be performed on the entire astatine isotopic chain, using a combination of the Windmill setup, ISOLTRAP MR-ToF and ISOLDE Faraday. Radioactive decay data will be acquired at the Windmill setup throughout those studies and contribute to the global understanding of the phenomenon of shape coexistence in the neutron-deficient lead region.

  20. Physical and underway data collected aboard the KNORR during cruise KN196-01 in the Davis Strait, Gulf of St. Lawrence and others from 2009-09-17 to 2009-10-02 (NODC Accession 0104280)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC accession 0104280 includes physical and underway data collected aboard the KNORR during cruise KN196-01 in the Davis Strait, Gulf of St. Lawrence and others...

  1. Measurement of the single top production cross section in proton-antiproton collisions at 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Tanasijczuk, Andres Jorge [Univ. of Buenos Aires (Argentina)

    2010-03-25

    This thesis describes a search for singly produced top quarks via an electroweak vertex in head-on proton-antiproton collisions at a center of mass energy of √s = 1.96 TeV. The analysis uses a total of 2.3 fb-1 of data collected with the D0 detector at Fermilab, corresponding to two different run periods of the Tevatron collider. Two channels contribute to single top quark production at the Tevatron, the s-channel and the t-channel. In the s-channel, a virtual W boson is produced from the aniquilation of a quark and an antiquark and a top and a bottom quarks are produced from the W decay. The top quark decays almost exclusively into a W boson and a bottom quark. Final states are considered in which the W boson decays leptonically into an electron or a muon plus a neutrino. Thus, at the detector level, the final state characterizing the s-channel contains one lepton, missing energy accounting for the neutrino, and two jets from the two bottom quarks. In the t-channel, the final state has an additional jet coming from a light quark. Clearly, a precise reconstruction of the events requires a precise measurement of the energy of the jets. A multivariate technique, Bayesian neural networks, is used to extract the single top signal from the overwhelming background still left after event selection. A Bayesian likelihood probability is then computed to measure the single top cross section. Assuming the observed excess is due to single top events, the measured single top quark production cross section is σ(p$\\bar{p}$ → tb + X, tqb + X) = 4.70+1.18-0.93 pb. The observed excess is associated with a p-value of (3.2 ± 2.3) x 10-8, assuming the background-only hypothesis. This p-value corresponds to an excess over background of 5.4 standard deviations for a Gaussian density. The p-value computed using the standard model signal cross section of 3.46 pb is (22.7 ± 0.6) x 10-6, corresponding to an expected significance

  2. Measurement of the Single Top Quark Production Cross Section in 1.96-TeV Proton-Antiproton Collisions

    Energy Technology Data Exchange (ETDEWEB)

    Nakamura, Koji [Univ. of Tsukuba (Japan)

    2009-02-01

    Top quarks are predominantly produced in pairs via the strong interaction in $\\bar{p}$p collisions at √s = 1.96 TeV . The top quark has a weak isospin 1/2, composing a weak isospin doublet with the bottom quark. This characteristic predicts not only top quark pair production via strong interaction but also single production together with a bottom quark via weak interaction. However, finding single top quark production is challenging since it is rarely produced (σ singletop = 2.9 pb) against background processes with the same final state like W+jets and t$\\bar{t}$. A measurement of electroweak single top production probes the W-t-b vertex, which provides a direct determination of the Cabbibo-Kobayashi-Maskawa (CKM) matrix element |Vtb|. The sample offers a source of almost 100% polarized top quarks. This thesis describes an optimized search for s-channel single top quark production and a measurement of the single top production cross section using 2.7 fb-1 of data accumulated with the CDF detector. We are using events with one high-pT lepton, large missing ET and two identified b-quark jets where one jet is identified using a secondary vertex tagger, called SecVtx, and the other jet is identified using SecVtx or a jet probability tagger, called JetProb. In this analysis we have developed a kinematics fitter and a likelihood-based separator between signal and background. As a result, we found that the probability (p-value) that the candidate events originate from a background fluctuation in the absence of single top s-channel production is 0.003, which is equivalent to 2.7 σ deviations in Gaussian statistics, and this excess corresponds to the single top s-channel cross section of 2.38-0.84+1.01 pb. An observed value of |Vtb| is 1.43-0.26+0.38(experimental) ± 0.11(theory). We also set the 95% CL. upper limit of σs = 4.15 pb for the s

  3. MIR196A2 rs11614913 C > T polymorphism correlates with an increased risk of hepatopulmonary syndrome in liver cirrhosis: a case-control study in China.

    Science.gov (United States)

    Chen, Hai-Yong; Chen, Yao-Min; Wu, Jian; Yang, Fu-Chun; Lv, Zhen; Xu, Xiao-Feng; Zheng, Shu-Sen; Liao, Sang-Sang; Luo, Yi-Hui

    2017-07-01

    This case-control study is designed to explore the relationship between microRNA-196a2 (MIR196A2) rs11614913 C > T polymorphism and the risk of hepatopulmonary syndrome (HPS) in liver cirrhosis. From January 2013 to January 2015, 163 liver cirrhosis patients with HPS (case group), 264 liver cirrhosis patients without HPS (control group), and 195 healthy people (normal group) were selected. A DNA extraction kit was used to extract plasma DNA from peripheral blood. Polymerase chain reaction-restriction fragment length polymorphism was used to detect the allele and genotype frequencies of MIR196A2 C > T polymorphism. Real-time quantitative polymerase chain reaction was adopted to detect the relative expression of MIR196A. The frequencies of C allele in the case group were higher than those in the control and normal groups (all P  T polymorphism was closely associated with an increased risk of HPS in patients with liver cirrhosis. Compared with the normal group, the relative expression of MIR196A in the case group was significantly increased (P  0.05). In the case group, compared with patients carrying the TT genotype, the relative expression of MIR196A of patients carrying the C allele (CT + CC) evidently increased (P  T polymorphism may contribute to an increased risk of HPS in liver cirrhosis patients. © 2016 The Japan Society of Hepatology.

  4. MAGIC detection of very high energy γ-ray emission from the low-luminosity blazar 1ES 1741+196

    Science.gov (United States)

    Ahnen, M. L.; Ansoldi, S.; Antonelli, L. A.; Antoranz, P.; Arcaro, C.; Babic, A.; Banerjee, B.; Bangale, P.; Barres de Almeida, U.; Barrio, J. A.; Bednarek, W.; Bernardini, E.; Berti, A.; Biasuzzi, B.; Biland, A.; Blanch, O.; Bonnefoy, S.; Bonnoli, G.; Borracci, F.; Bretz, T.; Buson, S.; Carosi, A.; Chatterjee, A.; Clavero, R.; Colin, P.; Colombo, E.; Contreras, J. L.; Cortina, J.; Covino, S.; Da Vela, P.; Dazzi, F.; De Angelis, A.; De Lotto, B.; de Oña Wilhelmi, E.; Di Pierro, F.; Doert, M.; Domínguez, A.; Dominis Prester, D.; Dorner, D.; Doro, M.; Einecke, S.; Eisenacher Glawion, D.; Elsaesser, D.; Engelkemeier, M.; Fallah Ramazani, V.; Fernández-Barral, A.; Fidalgo, D.; Fonseca, M. V.; Font, L.; Frantzen, K.; Fruck, C.; Galindo, D.; García López, R. J.; Garczarczyk, M.; Garrido Terrats, D.; Gaug, M.; Giammaria, P.; Godinović, N.; Gora, D.; Guberman, D.; Hadasch, D.; Hahn, A.; Hayashida, M.; Herrera, J.; Hose, J.; Hrupec, D.; Hughes, G.; Idec, W.; Kodani, K.; Konno, Y.; Kubo, H.; Kushida, J.; La Barbera, A.; Lelas, D.; Lindfors, E.; Lombardi, S.; Longo, F.; López, M.; López-Coto, R.; Majumdar, P.; Makariev, M.; Mallot, K.; Maneva, G.; Manganaro, M.; Mankuzhiyil, N.; Mannheim, K.; Maraschi, L.; Marcote, B.; Mariotti, M.; Martínez, M.; Mazin, D.; Menzel, U.; Miranda, J. M.; Mirzoyan, R.; Moralejo, A.; Moretti, E.; Nakajima, D.; Neustroev, V.; Niedzwiecki, A.; Nievas Rosillo, M.; Nilsson, K.; Nishijima, K.; Noda, K.; Nogués, L.; Paiano, S.; Palacio, J.; Palatiello, M.; Paneque, D.; Paoletti, R.; Paredes, J. M.; Paredes-Fortuny, X.; Pedaletti, G.; Peresano, M.; Perri, L.; Persic, M.; Poutanen, J.; Prada Moroni, P. G.; Prandini, E.; Puljak, I.; Garcia, J. R.; Reichardt, I.; Rhode, W.; Ribó, M.; Rico, J.; Saito, T.; Satalecka, K.; Schroeder, S.; Schweizer, T.; Shore, S. N.; Sillanpää, A.; Sitarek, J.; Snidaric, I.; Sobczynska, D.; Stamerra, A.; Strzys, M.; Surić, T.; Takalo, L.; Takami, H.; Tavecchio, F.; Temnikov, P.; Terzić, T.; Tescaro, D.; Teshima, M.; Torres, D. F.; Toyama, T.; Treves, A.; Vanzo, G.; Verguilov, V.; Vovk, I.; Ward, J. E.; Will, M.; Wu, M. H.; Zanin, R.; Becerra González, J.; Rani, B.; Krauss, F.; Perri, M.; Verrecchia, F.; Reinthal, R.

    2017-06-01

    We present the first detection of the nearby (z = 0.084) low-luminosity BL Lac object 1ES 1741+196 in the very high energy (E > 100 GeV) band. This object lies in a triplet of interacting galaxies. Early predictions had suggested 1ES 1741+196 to be, along with several other high-frequency BL Lac sources, within the reach of MAGIC detectability. Its detection by MAGIC, later confirmed by VERITAS, helps to expand the small population of known TeV BL Lacs. The source was observed with the MAGIC telescopes between 2010 April and 2011 May, collecting 46 h of good quality data. These observations led to the detection of the source at 6.0 σ confidence level, with a steady flux F(>100 GeV) = (6.4 ± 1.7stat ± 2.6syst) × 10-12 ph cm-2s-1 and a differential spectral photon index Γ = 2.4 ± 0.2stat ± 0.2syst in the range of ˜80 GeV-3 TeV. To study the broad-band spectral energy distribution (SED) simultaneous with MAGIC observations, we use KVA, Swift/UVOT and XRT and Fermi/LAT data. One-zone synchrotron-self-Compton (SSC) modelling of the SED of 1ES 1741+196 suggests values for the SSC parameters that are quite common among known TeV BL Lacs except for a relatively low Doppler factor and slope of electron energy distribution. A thermal feature seen in the SED is well matched by a giant elliptical's template. This appears to be the signature of thermal emission from the host galaxy, which is clearly resolved in optical observations.

  5. Search for Randall-Sundrum gravitons with 1 fb-1 of data from ppbar collisions at $\\sqrt{s}$=1.96 TeV

    CERN Document Server

    Abazov, V; Abolins, M; Acharya, B S; Adams, M; Adams, T; Aguiló, E; Ahn, S H; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Ancu, L S; Andeen, T; Anderson, S; Andrieu, B; Anzelc, M S; Arnoud, Y; Arov, M; Arthaud, M; Askew, A; Åsman, B; Assis-Jesus, A C S; Atramentov, O; Autermann, C; Avila, C; Ay, C; Badaud, F; Baden, A; Bagby, L; Baldin, B; Bandurin, D V; Banerjee, S; Banerjee, P; Barberis, E; Barfuss, A F; Bargassa, P; Baringer, P; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Beale, S; Bean, A; Begalli, M; Begel, M; Belanger-Champagne, C; Bellantoni, L; Bellavance, A; Benítez, J A; Beri, S B; Bernardi, G; Bernhard, R; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Biscarat, C; Blazey, G; Blekman, F; Blessing, S; Bloch, D; Bloom, K; Böhnlein, A; Boline, D; Bolton, T A; Borissov, G; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Brown, D; Buchanan, N J; Buchholz, D; Bühler, M; Büscher, V; Bunichev, S; Burdin, S; Burke, S; Burnett, T H; Buszello, C P; Butler, J M; Calfayan, P; Calvet, S; Cammin, J; Carvalho, W; Casey, B C K; Cason, N M; Castilla-Valdez, H; Chakrabarti, S; Chakraborty, D; Chan, K M; Chan, K; Chandra, A; Charles, F; Cheu, E; Chevallier, F; Cho, D K; Choi, S; Choudhary, B; Christofek, L; Christoudias, T; Cihangir, S; Claes, D; Coadou, Y; Cooke, M; Cooper, W E; Corcoran, M; Couderc, F; Cousinou, M C; Crepe-Renaudin, S; Cutts, D; Cwiok, M; Da Motta, H; Das, A; Davies, G; De, K; De Jong, S J; De La Cruz-Burelo, E; De Oliveira Martins, C; Degenhardt, J D; Déliot, F; Demarteau, M; Demina, R; Denisov, D; Denisov, S P; Desai, S; Diehl, H T; Diesburg, M; Dominguez, A; Dong, H; Dudko, L V; Duflot, L; Dugad, S R; Duggan, D; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Ellison, J; Elvira, V D; Enari, Y; Eno, S; Ermolov, P; Evans, H; Evdokimov, A; Evdokimov, V N; Ferapontov, A V; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Ford, M; Fortner, M; Fox, H; Fu, S; Fuess, S; Gadfort, T; Galea, C F; Gallas, E; Galyaev, E; García, C; García-Bellido, A; Gavrilov, V; Gay, P; Geist, W; Gelé, D; Gerber, C E; Gershtein, Yu; Gillberg, D; Ginther, G; Gollub, N; Gómez, B; Goussiou, A; Grannis, P D; Greenlee, H; Greenwood, Z D; Gregores, E M; Grenier, G; Gris, P; Grivaz, J F; Grohsjean, A; Grünendahl, S; Grünewald, M W; Guo, J; Guo, F; Gutíerrez, P; Gutíerrez, G; Haas, A; Hadley, N J; Haefner, P; Hagopian, S; Haley, J; Hall, I; Hall, R E; Han, L; Hanagaki, K; Hansson, P; Harder, K; Harel, A; Harrington, R; Hauptman, J M; Hauser, R; Hays, J; Hebbeker, T; Hedin, D; Hegeman, J G; Heinmiller, J M; Heinson, A P; Heintz, U; Hensel, C; Herner, K; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hoeth, H; Hohlfeld, M; Hong, S J; Hossain, S; Houben, P; Hu, Y; Hubacek, Z; Hynek, V; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jakobs, K; Jarvis, C; Jesik, R; Johns, K; Johnson, C; Johnson, M; Jonckheere, A; Jonsson, P; Juste, A; Käfer, D; Kajfasz, E; Kalinin, A M; Kalk, J R; Kalk, J M; Kappler, S; Karmanov, D; Kasper, P; Katsanos, I; Kau, D; Kaur, R; Kaushik, V; Kehoe, R; Kermiche, S; Khalatyan, N; Khanov, A; Kharchilava, A; Kharzheev, Yu M; Khatidze, D; Kim, H; Kim, T J; Kirby, M H; Kirsch, M; Klima, B; Kohli, J M; Konrath, J P; Kopal, M; Korablev, V M; Kozelov, A V; Krop, D; Kühl, T; Kumar, A; Kunori, S; Kupco, A; Kurca, T; Kvita, J; Lacroix, F; Lam, D; Lammers, S; Landsberg, G; Lebrun, P; Lee, W M; Leflat, A; Lehner, F; Lellouch, J; Lévêque, J; Lewis, P; Li, J; Li, Q Z; Li, L; Lietti, S M; Lima, J G R; Lincoln, D; Linnemann, J; Lipaev, V V; Lipton, R; Liu, Y; Liu, Z; Lobo, L; Lobodenko, A; Lokajícek, M; Love, P; Lubatti, H J; Lyon, A L; Maciel, A K A; Mackin, D; Madaras, R J; Mättig, P; Magass, C; Magerkurth, A; Mal, P K; Malbouisson, H B; Malik, S; Malyshev, V L; Mao, H S; Maravin, Y; Martin, B; McCarthy, R; Melnitchouk, A; Mendes, A; Mendoza, L; Mercadante, P G; Merkin, M; Merritt, K W; Meyer, J; Meyer, A; Millet, T; Mitrevski, J; Molina, J; Mommsen, R K; Mondal, N K; Moore, R W; Moulik, T; Muanza, G S; Mulders, M; Mulhearn, M; Mundal, O; Mundim, L; Nagy, E; Naimuddin, M; Narain, M; Naumann, N A; Neal, H A; Negret, J P; Neustroev, P; Nilsen, H; Nogima, H; Nomerotski, A; Novaes, S F; Nunnemann, T; O'Dell, V; O'Neil, D C; Obrant, G; Ochando, C; Onoprienko, D; Oshima, N; Osta, J; Otec, R; Oteroy-Garzon, G J; Owen, M; Padley, P; Pangilinan, M; Parashar, N; Park, S J; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Pawloski, G; Penning, B; Perfilov, M; Peters, K; Peters, Y; Petroff, P; Petteni, M; Piegaia, R; Piper, J; Pleier, M A; Podesta-Lerma, P L M; Podstavkov, V M; Pogorelov, Y; Pol, M E; Polozov, P; Pope, B G; Popov, A V; Potter, C; Prado da Silva, W L; Prosper, H B; Protopopescu, S; Qian, J; Quadt, A; Quinn, B; Rakitine, A; Rangel, M S; Ranjan, K; Ratoff, P N; Renkel, P; Reucroft, S; Rich, P; Rijssenbeek, M; Ripp-Baudot, I; Rizatdinova, F; Robinson, S; Rodrigues, R F; Rominsky, M; Royon, C; Rubinov, P; Ruchti, R; Safronov, G; Sajot, G; Sánchez-Hernández, A; Sanders, M P; Santoro, A; Savage, G; Sawyer, L; Scanlon, T; Schaile, A D; Schamberger, R D; Scheglov, Y; Schellman, H; Schieferdecker, P; Schliephake, T; Schwanenberger, C; Schwartzman, A; Schwienhorst, R; Sekaric, J; Severini, H; Shabalina, E; Shamim, M; Shary, V; Shchukin, A A; Shivpuri, R K; Siccardi, V; Simák, V; Sirotenko, V; Skubic, P; Slattery, P; Smirnov, D; Snow, J; Snow, G R; Snyder, S; Söldner-Rembold, S; Sonnenschein, L; Sopczak, A; Sosebee, M; Soustruznik, K; Souza, M; Spurlock, B; Stark, J; Steele, J; Stolin, V; Stoyanova, D A; Strandberg, J; Strandberg, S; Strang, M A; Strauss, M; Strauss, E; Ströhmer, R; Strom, D; Stutte, L; Sumowidagdo, S; Svoisky, P; Sznajder, A; Talby, M; Tamburello, P; Tanasijczuk, A; Taylor, W; Temple, J; Tiller, B; Tissandier, F; Titov, M; Tokmenin, V V; Toole, T; Torchiani, I; Trefzger, T; Tsybychev, D; Tuchming, B; Tully, C; Tuts, P M; Unalan, R; Uvarov, S; Uvarov, L; Uzunyan, S; Vachon, B; vanden Berg, P J; Van Kooten, R; Van Leeuwen, W M; Varelas, N; Varnes, E W; Vasilyev, I A; Vaupel, M; Verdier, P; Vertogradov, L S; Verzocchi, M; Villeneuve-Séguier, F; Vint, P; Vokac, P; Von Törne, E; Voutilainen, M; Wagner, R; Wahl, H D; Wang, L; SWang, M H L; Warchol, J; Watts, G; Wayne, M; Weber, M; Weber, G; Wenger, A; Wermes, N; Wetstein, M; White, A; Wicke, D; Wilson, G W; Wimpenny, S J; Wobisch, M; Wood, D R; Wyatt, T R; Xie, Y; Yacoob, S; Yamada, R; Yan, M; Yasuda, T; Yatsunenko, Y A; Yip, K; Yoo, H D; Youn, S W; Yu, J; Zatserklyaniy, A; Zeitnitz, C; Zhao, T; Zhou, B; Zhu, J; Zielinski, M; Zieminska, D; Zieminski, A; Zivkovic, L; Zutshi, V; Zverev, E G

    2007-01-01

    Using 1 fb-1 of data from ppbar collisions at $\\sqrt{s}$=1.96 TeV at the Fermilab Tevatron collider collected by the D0 detector, we search for decays of Kaluza-Klein excitations of the graviton in the Randall-Sundrum model of extra dimensions to $e^+e^-$ and diphotons. We set 95% confidence level upper limits on the production cross section times branching fraction which translate into lower limits on the mass of the lightest excitation between 300 and 900 GeV for values of the coupling k/M(Planck) between 0.01 and 0.1.

  6. Search for Randall-Sundrum Gravitons with 1fb-1 of Data from pp¯ Collisions at s=1.96TeV

    Science.gov (United States)

    Abazov, V. M.; Abbott, B.; Abolins, M.; Acharya, B. S.; Adams, M.; Adams, T.; Aguilo, E.; Ahn, S. H.; Ahsan, M.; Alexeev, G. D.; Alkhazov, G.; Alton, A.; Alverson, G.; Alves, G. A.; Anastasoaie, M.; Ancu, L. S.; Andeen, T.; Anderson, S.; Andrieu, B.; Anzelc, M. S.; Arnoud, Y.; Arov, M.; Arthaud, M.; Askew, A.; Åsman, B.; Assis Jesus, A. C. S.; Atramentov, O.; Autermann, C.; Avila, C.; Ay, C.; Badaud, F.; Baden, A.; Bagby, L.; Baldin, B.; Bandurin, D. V.; Banerjee, S.; Banerjee, P.; Barberis, E.; Barfuss, A.-F.; Bargassa, P.; Baringer, P.; Barreto, J.; Bartlett, J. F.; Bassler, U.; Bauer, D.; Beale, S.; Bean, A.; Begalli, M.; Begel, M.; Belanger-Champagne, C.; Bellantoni, L.; Bellavance, A.; Benitez, J. A.; Beri, S. B.; Bernardi, G.; Bernhard, R.; Bertram, I.; Besançon, M.; Beuselinck, R.; Bezzubov, V. A.; Bhat, P. C.; Bhatnagar, V.; Biscarat, C.; Blazey, G.; Blekman, F.; Blessing, S.; Bloch, D.; Bloom, K.; Boehnlein, A.; Boline, D.; Bolton, T. A.; Borissov, G.; Bose, T.; Brandt, A.; Brock, R.; Brooijmans, G.; Bross, A.; Brown, D.; Buchanan, N. J.; Buchholz, D.; Buehler, M.; Buescher, V.; Bunichev, S.; Burdin, S.; Burke, S.; Burnett, T. H.; Buszello, C. P.; Butler, J. M.; Calfayan, P.; Calvet, S.; Cammin, J.; Carvalho, W.; Casey, B. C. K.; Cason, N. M.; Castilla-Valdez, H.; Chakrabarti, S.; Chakraborty, D.; Chan, K. M.; Chan, K.; Chandra, A.; Charles, F.; Cheu, E.; Chevallier, F.; Cho, D. K.; Choi, S.; Choudhary, B.; Christofek, L.; Christoudias, T.; Cihangir, S.; Claes, D.; Coadou, Y.; Cooke, M.; Cooper, W. E.; Corcoran, M.; Couderc, F.; Cousinou, M.-C.; Crépé-Renaudin, S.; Cutts, D.; Ćwiok, M.; da Motta, H.; Das, A.; Davies, G.; de, K.; de Jong, S. J.; de La Cruz-Burelo, E.; de Oliveira Martins, C.; Degenhardt, J. D.; Déliot, F.; Demarteau, M.; Demina, R.; Denisov, D.; Denisov, S. P.; Desai, S.; Diehl, H. T.; Diesburg, M.; Dominguez, A.; Dong, H.; Dudko, L. V.; Duflot, L.; Dugad, S. R.; Duggan, D.; Duperrin, A.; Dyer, J.; Dyshkant, A.; Eads, M.; Edmunds, D.; Ellison, J.; Elvira, V. D.; Enari, Y.; Eno, S.; Ermolov, P.; Evans, H.; Evdokimov, A.; Evdokimov, V. N.; Ferapontov, A. V.; Ferbel, T.; Fiedler, F.; Filthaut, F.; Fisher, W.; Fisk, H. E.; Ford, M.; Fortner, M.; Fox, H.; Fu, S.; Fuess, S.; Gadfort, T.; Galea, C. F.; Gallas, E.; Galyaev, E.; Garcia, C.; Garcia-Bellido, A.; Gavrilov, V.; Gay, P.; Geist, W.; Gelé, D.; Gerber, C. E.; Gershtein, Y.; Gillberg, D.; Ginther, G.; Gollub, N.; Gómez, B.; Goussiou, A.; Grannis, P. D.; Greenlee, H.; Greenwood, Z. D.; Gregores, E. M.; Grenier, G.; Gris, Ph.; Grivaz, J.-F.; Grohsjean, A.; Grünendahl, S.; Grünewald, M. W.; Guo, J.; Guo, F.; Gutierrez, P.; Gutierrez, G.; Haas, A.; Hadley, N. J.; Haefner, P.; Hagopian, S.; Haley, J.; Hall, I.; Hall, R. E.; Han, L.; Hanagaki, K.; Hansson, P.; Harder, K.; Harel, A.; Harrington, R.; Hauptman, J. M.; Hauser, R.; Hays, J.; Hebbeker, T.; Hedin, D.; Hegeman, J. G.; Heinmiller, J. M.; Heinson, A. P.; Heintz, U.; Hensel, C.; Herner, K.; Hesketh, G.; Hildreth, M. D.; Hirosky, R.; Hobbs, J. D.; Hoeneisen, B.; Hoeth, H.; Hohlfeld, M.; Hong, S. J.; Hossain, S.; Houben, P.; Hu, Y.; Hubacek, Z.; Hynek, V.; Iashvili, I.; Illingworth, R.; Ito, A. S.; Jabeen, S.; Jaffré, M.; Jain, S.; Jakobs, K.; Jarvis, C.; Jesik, R.; Johns, K.; Johnson, C.; Johnson, M.; Jonckheere, A.; Jonsson, P.; Juste, A.; Käfer, D.; Kajfasz, E.; Kalinin, A. M.; Kalk, J. R.; Kalk, J. M.; Kappler, S.; Karmanov, D.; Kasper, P.; Katsanos, I.; Kau, D.; Kaur, R.; Kaushik, V.; Kehoe, R.; Kermiche, S.; Khalatyan, N.; Khanov, A.; Kharchilava, A.; Kharzheev, Y. M.; Khatidze, D.; Kim, H.; Kim, T. J.; Kirby, M. H.; Kirsch, M.; Klima, B.; Kohli, J. M.; Konrath, J.-P.; Kopal, M.; Korablev, V. M.; Kozelov, A. V.; Krop, D.; Kuhl, T.; Kumar, A.; Kunori, S.; Kupco, A.; Kurča, T.; Kvita, J.; Lacroix, F.; Lam, D.; Lammers, S.; Landsberg, G.; Lebrun, P.; Lee, W. M.; Leflat, A.; Lehner, F.; Lellouch, J.; Leveque, J.; Lewis, P.; Li, J.; Li, Q. Z.; Li, L.; Lietti, S. M.; Lima, J. G. R.; Lincoln, D.; Linnemann, J.; Lipaev, V. V.; Lipton, R.; Liu, Y.; Liu, Z.; Lobo, L.; Lobodenko, A.; Lokajicek, M.; Love, P.; Lubatti, H. J.; Lyon, A. L.; Maciel, A. K. A.; Mackin, D.; Madaras, R. J.; Mättig, P.; Magass, C.; Magerkurth, A.; Mal, P. K.; Malbouisson, H. B.; Malik, S.; Malyshev, V. L.; Mao, H. S.; Maravin, Y.; Martin, B.; McCarthy, R.; Melnitchouk, A.; Mendes, A.; Mendoza, L.; Mercadante, P. G.; Merkin, M.; Merritt, K. W.; Meyer, J.; Meyer, A.; Millet, T.; Mitrevski, J.; Molina, J.; Mommsen, R. K.; Mondal, N. K.; Moore, R. W.; Moulik, T.; Muanza, G. S.; Mulders, M.; Mulhearn, M.; Mundal, O.; Mundim, L.; Nagy, E.; Naimuddin, M.; Narain, M.; Naumann, N. A.; Neal, H. A.; Negret, J. P.; Neustroev, P.; Nilsen, H.; Nogima, H.; Nomerotski, A.; Novaes, S. F.; Nunnemann, T.; O'Dell, V.; O'Neil, D. C.

    2008-03-01

    We search for decays of Kaluza-Klein excitations of the graviton in the Randall-Sundrum model of extra dimensions to e+e- and γγ in 1fb-1 of pp¯ collisions at s=1.96TeV collected by the D0 detector at the Fermilab Tevatron. We set 95% confidence level upper limits on the production cross section times branching fraction, which translate into lower limits on the mass of the lightest excitation between 300 and 900 GeV for values of the coupling k/M¯Pl between 0.01 and 0.1.

  7. Search for the lightest scalar top quark in events with two leptons in ppbar collisions at √{ s} = 1.96 TeV

    Science.gov (United States)

    Abazov, V. M.; Abbott, B.; Abolins, M.; Acharya, B. S.; Adams, M.; Adams, T.; Aguilo, E.; Ahn, S. H.; Ahsan, M.; Alexeev, G. D.; Alkhazov, G.; Alton, A.; Alverson, G.; Alves, G. A.; Anastasoaie, M.; Ancu, L. S.; Andeen, T.; Anderson, S.; Andrieu, B.; Anzelc, M. S.; Arnoud, Y.; Arov, M.; Arthaud, M.; Askew, A.; Åsman, B.; Assis Jesus, A. C. S.; Atramentov, O.; Autermann, C.; Avila, C.; Ay, C.; Badaud, F.; Baden, A.; Bagby, L.; Baldin, B.; Bandurin, D. V.; Banerjee, S.; Banerjee, P.; Barberis, E.; Barfuss, A.-F.; Bargassa, P.; Baringer, P.; Barreto, J.; Bartlett, J. F.; Bassler, U.; Bauer, D.; Beale, S.; Bean, A.; Begalli, M.; Begel, M.; Belanger-Champagne, C.; Bellantoni, L.; Bellavance, A.; Benitez, J. A.; Beri, S. B.; Bernardi, G.; Bernhard, R.; Berntzon, L.; Bertram, I.; Besançon, M.; Beuselinck, R.; Bezzubov, V. A.; Bhat, P. C.; Bhatnagar, V.; Biscarat, C.; Blazey, G.; Blekman, F.; Blessing, S.; Bloch, D.; Bloom, K.; Boehnlein, A.; Boline, D.; Bolton, T. A.; Borissov, G.; Bos, K.; Bose, T.; Brandt, A.; Brock, R.; Brooijmans, G.; Bross, A.; Brown, D.; Buchanan, N. J.; Buchholz, D.; Buehler, M.; Buescher, V.; Burdin, S.; Burke, S.; Burnett, T. H.; Buszello, C. P.; Butler, J. M.; Calfayan, P.; Calvet, S.; Cammin, J.; Caron, S.; Carvalho, W.; Casey, B. C. K.; Cason, N. M.; Castilla-Valdez, H.; Chakrabarti, S.; Chakraborty, D.; Chan, K. M.; Chan, K.; Chandra, A.; Charles, F.; Cheu, E.; Chevallier, F.; Cho, D. K.; Choi, S.; Choudhary, B.; Christofek, L.; Christoudias, T.; Cihangir, S.; Claes, D.; Clément, B.; Coadou, Y.; Cooke, M.; Cooper, W. E.; Corcoran, M.; Couderc, F.; Cousinou, M.-C.; Crépé-Renaudin, S.; Cutts, D.; Ćwiok, M.; da Motta, H.; Das, A.; Davies, G.; De, K.; de Jong, S. J.; de Jong, P.; De La Cruz-Burelo, E.; De Oliveira Martins, C.; Degenhardt, J. D.; Déliot, F.; Demarteau, M.; Demina, R.; Denisov, D.; Denisov, S. P.; Desai, S.; Diehl, H. T.; Diesburg, M.; Dominguez, A.; Dong, H.; Dudko, L. V.; Duflot, L.; Dugad, S. R.; Duggan, D.; Duperrin, A.; Dyer, J.; Dyshkant, A.; Eads, M.; Edmunds, D.; Ellison, J.; Elvira, V. D.; Enari, Y.; Eno, S.; Ermolov, P.; Evans, H.; Evdokimov, A.; Evdokimov, V. N.; Ferapontov, A. V.; Ferbel, T.; Fiedler, F.; Filthaut, F.; Fisher, W.; Fisk, H. E.; Ford, M.; Fortner, M.; Fox, H.; Fu, S.; Fuess, S.; Gadfort, T.; Galea, C. F.; Gallas, E.; Galyaev, E.; Garcia, C.; Garcia-Bellido, A.; Gavrilov, V.; Gay, P.; Geist, W.; Gelé, D.; Gerber, C. E.; Gershtein, Y.; Gillberg, D.; Ginther, G.; Gollub, N.; Gómez, B.; Goussiou, A.; Grannis, P. D.; Greenlee, H.; Greenwood, Z. D.; Gregores, E. M.; Grenier, G.; Gris, Ph.; Grivaz, J.-F.; Grohsjean, A.; Grünendahl, S.; Grünewald, M. W.; Guo, J.; Guo, F.; Gutierrez, P.; Gutierrez, G.; Haas, A.; Hadley, N. J.; Haefner, P.; Hagopian, S.; Haley, J.; Hall, I.; Hall, R. E.; Han, L.; Hanagaki, K.; Hansson, P.; Harder, K.; Harel, A.; Harrington, R.; Hauptman, J. M.; Hauser, R.; Hays, J.; Hebbeker, T.; Hedin, D.; Hegeman, J. G.; Heinmiller, J. M.; Heinson, A. P.; Heintz, U.; Hensel, C.; Herner, K.; Hesketh, G.; Hildreth, M. D.; Hirosky, R.; Hobbs, J. D.; Hoeneisen, B.; Hoeth, H.; Hohlfeld, M.; Hong, S. J.; Hooper, R.; Hossain, S.; Houben, P.; Hu, Y.; Hubacek, Z.; Hynek, V.; Iashvili, I.; Illingworth, R.; Ito, A. S.; Jabeen, S.; Jaffré, M.; Jain, S.; Jakobs, K.; Jarvis, C.; Jesik, R.; Johns, K.; Johnson, C.; Johnson, M.; Jonckheere, A.; Jonsson, P.; Juste, A.; Käfer, D.; Kahn, S.; Kajfasz, E.; Kalinin, A. M.; Kalk, J. R.; Kalk, J. M.; Kappler, S.; Karmanov, D.; Kasper, J.; Kasper, P.; Katsanos, I.; Kau, D.; Kaur, R.; Kaushik, V.; Kehoe, R.; Kermiche, S.; Khalatyan, N.; Khanov, A.; Kharchilava, A.; Kharzheev, Y. M.; Khatidze, D.; Kim, H.; Kim, T. J.; Kirby, M. H.; Kirsch, M.; Klima, B.; Kohli, J. M.; Konrath, J.-P.; Kopal, M.; Korablev, V. M.; Kozelov, A. V.; Krop, D.; Kryemadhi, A.; Kuhl, T.; Kumar, A.; Kunori, S.; Kupco, A.; Kurča, T.; Kvita, J.; Lacroix, F.; Lam, D.; Lammers, S.; Landsberg, G.; Lazoflores, J.; Lebrun, P.; Lee, W. M.; Leflat, A.; Lehner, F.; Lellouch, J.; Leveque, J.; Lewis, P.; Li, J.; Li, Q. Z.; Li, L.; Lietti, S. M.; Lima, J. G. R.; Lincoln, D.; Linnemann, J.; Lipaev, V. V.; Lipton, R.; Liu, Y.; Liu, Z.; Lobo, L.; Lobodenko, A.; Lokajicek, M.; Lounis, A.; Love, P.; Lubatti, H. J.; Lyon, A. L.; Maciel, A. K. A.; Mackin, D.; Madaras, R. J.; Mättig, P.; Magass, C.; Magerkurth, A.; Makovec, N.; Mal, P. K.; Malbouisson, H. B.; Malik, S.; Malyshev, V. L.; Mao, H. S.; Maravin, Y.; Martin, B.; McCarthy, R.; Melnitchouk, A.; Mendes, A.; Mendoza, L.; Mercadante, P. G.; Merkin, M.; Merritt, K. W.; Meyer, J.; Meyer, A.; Michaut, M.; Millet, T.; Mitrevski, J.; Molina, J.; Mommsen, R. K.; Mondal, N. K.; Moore, R. W.; Moulik, T.; Muanza, G. S.; Mulders, M.; Mulhearn, M.; Mundal, O.; Mundim, L.; Nagy, E.; Naimuddin, M.; Narain, M.; Naumann, N. A.

    2008-01-01

    Data collected by the D0 detector at a ppbar center-of-mass energy of 1.96 TeV at the Fermilab Tevatron Collider have been used to search for pair production of the lightest supersymmetric partner of the top quark decaying into bℓν˜. The search is performed in the ℓℓ‧ = eμ and μμ final states. No evidence for this process has been found in data samples of approximately 400 pb-1. The domain in the [ M (t˜1) , M (ν˜)] plane excluded at the 95% C.L. is substantially extended by this search.

  8. Search for particles decaying into a Z boson and a photon in pp¯ collisions at s=1.96 TeV

    Science.gov (United States)

    DØ Collaboration; Abazov, V. M.; Abbott, B.; Abolins, M.; Acharya, B. S.; Adams, M.; Adams, T.; Agelou, M.; Agram, J.-L.; Ahn, S. H.; Ahsan, M.; Alexeev, G. D.; Alkhazov, G.; Alton, A.; Alverson, G.; Alves, G. A.; Anastasoaie, M.; Andeen, T.; Anderson, S.; Andrieu, B.; Anzelc, M. S.; Arnoud, Y.; Arov, M.; Askew, A.; Åsman, B.; Assis Jesus, A. C. S.; Atramentov, O.; Autermann, C.; Avila, C.; Ay, C.; Badaud, F.; Baden, A.; Bagby, L.; Baldin, B.; Bandurin, D. V.; Banerjee, P.; Banerjee, S.; Barberis, E.; Bargassa, P.; Baringer, P.; Barnes, C.; Barreto, J.; Bartlett, J. F.; Bassler, U.; Bauer, D.; Bean, A.; Begalli, M.; Begel, M.; Belanger-Champagne, C.; Bellantoni, L.; Bellavance, A.; Benitez, J. A.; Beri, S. B.; Bernardi, G.; Bernhard, R.; Berntzon, L.; Bertram, I.; Besançon, M.; Beuselinck, R.; Bezzubov, V. A.; Bhat, P. C.; Bhatnagar, V.; Binder, M.; Biscarat, C.; Black, K. M.; Blackler, I.; Blazey, G.; Blekman, F.; Blessing, S.; Bloch, D.; Bloom, K.; Blumenschein, U.; Boehnlein, A.; Boeriu, O.; Bolton, T. A.; Borcherding, F.; Borissov, G.; Bos, K.; Bose, T.; Brandt, A.; Brock, R.; Brooijmans, G.; Bross, A.; Brown, D.; Buchanan, N. J.; Buchholz, D.; Buehler, M.; Buescher, V.; Burdin, S.; Burke, S.; Burnett, T. H.; Busato, E.; Buszello, C. P.; Butler, J. M.; Calfayan, P.; Calvet, S.; Cammin, J.; Caron, S.; Carvalho, W.; Casey, B. C. K.; Cason, N. M.; Castilla-Valdez, H.; Chakrabarti, S.; Chakraborty, D.; Chan, K. M.; Chandra, A.; Chapin, D.; Charles, F.; Cheu, E.; Chevallier, F.; Cho, D. K.; Choi, S.; Choudhary, B.; Christofek, L.; Claes, D.; Clément, B.; Clément, C.; Coadou, Y.; Cooke, M.; Cooper, W. E.; Coppage, D.; Corcoran, M.; Cousinou, M.-C.; Cox, B.; Crépé-Renaudin, S.; Cutts, D.; Ćwiok, M.; da Motta, H.; Das, A.; Das, M.; Davies, B.; Davies, G.; Davis, G. A.; de, K.; de Jong, P.; de Jong, S. J.; de La Cruz-Burelo, E.; de Oliveira Martins, C.; Degenhardt, J. D.; Déliot, F.; Demarteau, M.; Demina, R.; Demine, P.; Denisov, D.; Denisov, S. P.; Desai, S.; Diehl, H. T.; Diesburg, M.; Doidge, M.; Dominguez, A.; Dong, H.; Dudko, L. V.; Duflot, L.; Dugad, S. R.; Duperrin, A.; Dyer, J.; Dyshkant, A.; Eads, M.; Edmunds, D.; Edwards, T.; Ellison, J.; Elmsheuser, J.; Elvira, V. D.; Eno, S.; Ermolov, P.; Estrada, J.; Evans, H.; Evdokimov, A.; Evdokimov, V. N.; Fatakia, S. N.; Feligioni, L.; Ferapontov, A. V.; Ferbel, T.; Fiedler, F.; Filthaut, F.; Fisher, W.; Fisk, H. E.; Fleck, I.; Ford, M.; Fortner, M.; Fox, H.; Fu, S.; Fuess, S.; Gadfort, T.; Galea, C. F.; Gallas, E.; Galyaev, E.; Garcia, C.; Garcia-Bellido, A.; Gardner, J.; Gavrilov, V.; Gay, A.; Gay, P.; Gelé, D.; Gelhaus, R.; Gerber, C. E.; Gershtein, Y.; Gillberg, D.; Ginther, G.; Gollub, N.; Gómez, B.; Gounder, K.; Goussiou, A.; Grannis, P. D.; Greenlee, H.; Greenwood, Z. D.; Gregores, E. M.; Grenier, G.; Gris, Ph.; Grivaz, J.-F.; Grünendahl, S.; Grünewald, M. W.; Guo, F.; Guo, J.; Gutierrez, G.; Gutierrez, P.; Haas, A.; Hadley, N. J.; Haefner, P.; Hagopian, S.; Haley, J.; Hall, I.; Hall, R. E.; Han, L.; Hanagaki, K.; Harder, K.; Harel, A.; Harrington, R.; Hauptman, J. M.; Hauser, R.; Hays, J.; Hebbeker, T.; Hedin, D.; Hegeman, J. G.; Heinmiller, J. M.; Heinson, A. P.; Heintz, U.; Hensel, C.; Hesketh, G.; Hildreth, M. D.; Hirosky, R.; Hobbs, J. D.; Hoeneisen, B.; Hoeth, H.; Hohlfeld, M.; Hong, S. J.; Hooper, R.; Houben, P.; Hu, Y.; Hubacek, Z.; Hynek, V.; Iashvili, I.; Illingworth, R.; Ito, A. S.; Jabeen, S.; Jaffré, M.; Jain, S.; Jakobs, K.; Jarvis, C.; Jenkins, A.; Jesik, R.; Johns, K.; Johnson, C.; Johnson, M.; Jonckheere, A.; Jonsson, P.; Juste, A.; Käfer, D.; Kahn, S.; Kajfasz, E.; Kalinin, A. M.; Kalk, J. M.; Kalk, J. R.; Kappler, S.; Karmanov, D.; Kasper, J.; Kasper, P.; Katsanos, I.; Kau, D.; Kaur, R.; Kehoe, R.; Kermiche, S.; Kesisoglou, S.; Khalatyan, N.; Khanov, A.; Kharchilava, A.; Kharzheev, Y. M.; Khatidze, D.; Kim, H.; Kim, T. J.; Kirby, M. H.; Klima, B.; Kohli, J. M.; Konrath, J.-P.; Kopal, M.; Korablev, V. M.; Kotcher, J.; Kothari, B.; Koubarovsky, A.; Kozelov, A. V.; Kozminski, J.; Kryemadhi, A.; Krzywdzinski, S.; Kuhl, T.; Kumar, A.; Kunori, S.; Kupco, A.; Kurča, T.; Kvita, J.; Lager, S.; Lammers, S.; Landsberg, G.; Lazoflores, J.; Le Bihan, A.-C.; Lebrun, P.; Lee, W. M.; Leflat, A.; Lehner, F.; Lesne, V.; Leveque, J.; Lewis, P.; Li, J.; Li, Q. Z.; Lima, J. G. R.; Lincoln, D.; Linnemann, J.; Lipaev, V. V.; Lipton, R.; Liu, Z.; Lobo, L.; Lobodenko, A.; Lokajicek, M.; Lounis, A.; Love, P.; Lubatti, H. J.; Lynker, M.; Lyon, A. L.; Maciel, A. K. A.; Madaras, R. J.; Mättig, P.; Magass, C.; Magerkurth, A.; Magnan, A.-M.; Makovec, N.; Mal, P. K.; Malbouisson, H. B.; Malik, S.; Malyshev, V. L.; Mao, H. S.; Maravin, Y.; Martens, M.; Mattingly, S. E. K.; McCarthy, R.; McCroskey, R.; Meder, D.; Melnitchouk, A.; Mendes, A.; Mendoza, L.; Merkin, M.

    2006-10-01

    We present the results of a search for a new particle X produced in pp¯ collisions at s=1.96 TeV and subsequently decaying to Zγ. The search uses 0.3 fb-1 of data collected with the DØ detector at the Fermilab Tevatron Collider. We set limits on the production cross section times the branching fraction σ(pp¯→X)×B(X→Zγ) that range from 0.4 to 3.5 pb at the 95% C.L. for X with invariant masses between 100 and 1000 GeV/c, over a wide range of X decay widths.

  9. Search for particles decaying into a Z boson and a photon in ppbar collisions at √{ s} = 1.96 TeV

    Science.gov (United States)

    Abazov, V. M.; Abbott, B.; Abolins, M.; Acharya, B. S.; Adams, M.; Adams, T.; Agelou, M.; Agram, J.-L.; Ahn, S. H.; Ahsan, M.; Alexeev, G. D.; Alkhazov, G.; Alton, A.; Alverson, G.; Alves, G. A.; Anastasoaie, M.; Andeen, T.; Anderson, S.; Andrieu, B.; Anzelc, M. S.; Arnoud, Y.; Arov, M.; Askew, A.; Åsman, B.; Assis Jesus, A. C. S.; Atramentov, O.; Autermann, C.; Avila, C.; Ay, C.; Badaud, F.; Baden, A.; Bagby, L.; Baldin, B.; Bandurin, D. V.; Banerjee, P.; Banerjee, S.; Barberis, E.; Bargassa, P.; Baringer, P.; Barnes, C.; Barreto, J.; Bartlett, J. F.; Bassler, U.; Bauer, D.; Bean, A.; Begalli, M.; Begel, M.; Belanger-Champagne, C.; Bellantoni, L.; Bellavance, A.; Benitez, J. A.; Beri, S. B.; Bernardi, G.; Bernhard, R.; Berntzon, L.; Bertram, I.; Besançon, M.; Beuselinck, R.; Bezzubov, V. A.; Bhat, P. C.; Bhatnagar, V.; Binder, M.; Biscarat, C.; Black, K. M.; Blackler, I.; Blazey, G.; Blekman, F.; Blessing, S.; Bloch, D.; Bloom, K.; Blumenschein, U.; Boehnlein, A.; Boeriu, O.; Bolton, T. A.; Borcherding, F.; Borissov, G.; Bos, K.; Bose, T.; Brandt, A.; Brock, R.; Brooijmans, G.; Bross, A.; Brown, D.; Buchanan, N. J.; Buchholz, D.; Buehler, M.; Buescher, V.; Burdin, S.; Burke, S.; Burnett, T. H.; Busato, E.; Buszello, C. P.; Butler, J. M.; Calfayan, P.; Calvet, S.; Cammin, J.; Caron, S.; Carvalho, W.; Casey, B. C. K.; Cason, N. M.; Castilla-Valdez, H.; Chakrabarti, S.; Chakraborty, D.; Chan, K. M.; Chandra, A.; Chapin, D.; Charles, F.; Cheu, E.; Chevallier, F.; Cho, D. K.; Choi, S.; Choudhary, B.; Christofek, L.; Claes, D.; Clément, B.; Clément, C.; Coadou, Y.; Cooke, M.; Cooper, W. E.; Coppage, D.; Corcoran, M.; Cousinou, M.-C.; Cox, B.; Crépé-Renaudin, S.; Cutts, D.; Ćwiok, M.; da Motta, H.; Das, A.; Das, M.; Davies, B.; Davies, G.; Davis, G. A.; De, K.; de Jong, P.; de Jong, S. J.; De La Cruz-Burelo, E.; De Oliveira Martins, C.; Degenhardt, J. D.; Déliot, F.; Demarteau, M.; Demina, R.; Demine, P.; Denisov, D.; Denisov, S. P.; Desai, S.; Diehl, H. T.; Diesburg, M.; Doidge, M.; Dominguez, A.; Dong, H.; Dudko, L. V.; Duflot, L.; Dugad, S. R.; Duperrin, A.; Dyer, J.; Dyshkant, A.; Eads, M.; Edmunds, D.; Edwards, T.; Ellison, J.; Elmsheuser, J.; Elvira, V. D.; Eno, S.; Ermolov, P.; Estrada, J.; Evans, H.; Evdokimov, A.; Evdokimov, V. N.; Fatakia, S. N.; Feligioni, L.; Ferapontov, A. V.; Ferbel, T.; Fiedler, F.; Filthaut, F.; Fisher, W.; Fisk, H. E.; Fleck, I.; Ford, M.; Fortner, M.; Fox, H.; Fu, S.; Fuess, S.; Gadfort, T.; Galea, C. F.; Gallas, E.; Galyaev, E.; Garcia, C.; Garcia-Bellido, A.; Gardner, J.; Gavrilov, V.; Gay, A.; Gay, P.; Gelé, D.; Gelhaus, R.; Gerber, C. E.; Gershtein, Y.; Gillberg, D.; Ginther, G.; Gollub, N.; Gómez, B.; Gounder, K.; Goussiou, A.; Grannis, P. D.; Greenlee, H.; Greenwood, Z. D.; Gregores, E. M.; Grenier, G.; Gris, Ph.; Grivaz, J.-F.; Grünendahl, S.; Grünewald, M. W.; Guo, F.; Guo, J.; Gutierrez, G.; Gutierrez, P.; Haas, A.; Hadley, N. J.; Haefner, P.; Hagopian, S.; Haley, J.; Hall, I.; Hall, R. E.; Han, L.; Hanagaki, K.; Harder, K.; Harel, A.; Harrington, R.; Hauptman, J. M.; Hauser, R.; Hays, J.; Hebbeker, T.; Hedin, D.; Hegeman, J. G.; Heinmiller, J. M.; Heinson, A. P.; Heintz, U.; Hensel, C.; Hesketh, G.; Hildreth, M. D.; Hirosky, R.; Hobbs, J. D.; Hoeneisen, B.; Hoeth, H.; Hohlfeld, M.; Hong, S. J.; Hooper, R.; Houben, P.; Hu, Y.; Hubacek, Z.; Hynek, V.; Iashvili, I.; Illingworth, R.; Ito, A. S.; Jabeen, S.; Jaffré, M.; Jain, S.; Jakobs, K.; Jarvis, C.; Jenkins, A.; Jesik, R.; Johns, K.; Johnson, C.; Johnson, M.; Jonckheere, A.; Jonsson, P.; Juste, A.; Käfer, D.; Kahn, S.; Kajfasz, E.; Kalinin, A. M.; Kalk, J. M.; Kalk, J. R.; Kappler, S.; Karmanov, D.; Kasper, J.; Kasper, P.; Katsanos, I.; Kau, D.; Kaur, R.; Kehoe, R.; Kermiche, S.; Kesisoglou, S.; Khalatyan, N.; Khanov, A.; Kharchilava, A.; Kharzheev, Y. M.; Khatidze, D.; Kim, H.; Kim, T. J.; Kirby, M. H.; Klima, B.; Kohli, J. M.; Konrath, J.-P.; Kopal, M.; Korablev, V. M.; Kotcher, J.; Kothari, B.; Koubarovsky, A.; Kozelov, A. V.; Kozminski, J.; Kryemadhi, A.; Krzywdzinski, S.; Kuhl, T.; Kumar, A.; Kunori, S.; Kupco, A.; Kurča, T.; Kvita, J.; Lager, S.; Lammers, S.; Landsberg, G.; Lazoflores, J.; Le Bihan, A.-C.; Lebrun, P.; Lee, W. M.; Leflat, A.; Lehner, F.; Lesne, V.; Leveque, J.; Lewis, P.; Li, J.; Li, Q. Z.; Lima, J. G. R.; Lincoln, D.; Linnemann, J.; Lipaev, V. V.; Lipton, R.; Liu, Z.; Lobo, L.; Lobodenko, A.; Lokajicek, M.; Lounis, A.; Love, P.; Lubatti, H. J.; Lynker, M.; Lyon, A. L.; Maciel, A. K. A.; Madaras, R. J.; Mättig, P.; Magass, C.; Magerkurth, A.; Magnan, A.-M.; Makovec, N.; Mal, P. K.; Malbouisson, H. B.; Malik, S.; Malyshev, V. L.; Mao, H. S.; Maravin, Y.; Martens, M.; Mattingly, S. E. K.; McCarthy, R.; McCroskey, R.; Meder, D.; Melnitchouk, A.; Mendes, A.; Mendoza, L.; Merkin, M.; Merritt, K. W.

    2006-10-01

    We present the results of a search for a new particle X produced in ppbar collisions at √{ s} = 1.96 TeV and subsequently decaying to Zγ. The search uses 0.3 fb-1 of data collected with the DØ detector at the Fermilab Tevatron Collider. We set limits on the production cross section times the branching fraction σ (ppbar → X) × B (X → Zγ) that range from 0.4 to 3.5 pb at the 95% C.L. for X with invariant masses between 100 and 1000 GeV /c2, over a wide range of X decay widths.

  10. Search for scalar leptoquarks in the acoplanar jet topology in pp¯ collisions at s=1.96 TeV

    Science.gov (United States)

    DØ Collaboration; Abazov, V. M.; Abbott, B.; Abolins, M.; Acharya, B. S.; Adams, M.; Adams, T.; Agelou, M.; Agram, J.-L.; Ahn, S. H.; Ahsan, M.; Alexeev, G. D.; Alkhazov, G.; Alton, A.; Alverson, G.; Alves, G. A.; Anastasoaie, M.; Andeen, T.; Anderson, S.; Andrieu, B.; Anzelc, M. S.; Arnoud, Y.; Arov, M.; Askew, A.; Åsman, B.; Assis Jesus, A. C. S.; Atramentov, O.; Autermann, C.; Avila, C.; Ay, C.; Badaud, F.; Baden, A.; Bagby, L.; Baldin, B.; Bandurin, D. V.; Banerjee, P.; Banerjee, S.; Barberis, E.; Bargassa, P.; Baringer, P.; Barnes, C.; Barreto, J.; Bartlett, J. F.; Bassler, U.; Bauer, D.; Bean, A.; Begalli, M.; Begel, M.; Belanger-Champagne, C.; Bellantoni, L.; Bellavance, A.; Benitez, J. A.; Beri, S. B.; Bernardi, G.; Bernhard, R.; Berntzon, L.; Bertram, I.; Besançon, M.; Beuselinck, R.; Bezzubov, V. A.; Bhat, P. C.; Bhatnagar, V.; Binder, M.; Biscarat, C.; Black, K. M.; Blackler, I.; Blazey, G.; Blekman, F.; Blessing, S.; Bloch, D.; Bloom, K.; Blumenschein, U.; Boehnlein, A.; Boeriu, O.; Bolton, T. A.; Borissov, G.; Bos, K.; Bose, T.; Brandt, A.; Brock, R.; Brooijmans, G.; Bross, A.; Brown, D.; Buchanan, N. J.; Buchholz, D.; Buehler, M.; Buescher, V.; Burdin, S.; Burke, S.; Burnett, T. H.; Busato, E.; Buszello, C. P.; Butler, J. M.; Calfayan, P.; Calvet, S.; Cammin, J.; Caron, S.; Carvalho, W.; Casey, B. C. K.; Cason, N. M.; Castilla-Valdez, H.; Chakrabarti, S.; Chakraborty, D.; Chan, K. M.; Chandra, A.; Chapin, D.; Charles, F.; Cheu, E.; Chevallier, F.; Cho, D. K.; Choi, S.; Choudhary, B.; Christofek, L.; Claes, D.; Clément, B.; Clément, C.; Coadou, Y.; Cooke, M.; Cooper, W. E.; Coppage, D.; Corcoran, M.; Cousinou, M.-C.; Cox, B.; Crépé-Renaudin, S.; Cutts, D.; Ćwiok, M.; da Motta, H.; Das, A.; Das, M.; Davies, B.; Davies, G.; Davis, G. A.; de, K.; de Jong, P.; de Jong, S. J.; de La Cruz-Burelo, E.; de Oliveira Martins, C.; Degenhardt, J. D.; Déliot, F.; Demarteau, M.; Demina, R.; Demine, P.; Denisov, D.; Denisov, S. P.; Desai, S.; Diehl, H. T.; Diesburg, M.; Doidge, M.; Dominguez, A.; Dong, H.; Dudko, L. V.; Duflot, L.; Dugad, S. R.; Duperrin, A.; Dyer, J.; Dyshkant, A.; Eads, M.; Edmunds, D.; Edwards, T.; Ellison, J.; Elmsheuser, J.; Elvira, V. D.; Eno, S.; Ermolov, P.; Estrada, J.; Evans, H.; Evdokimov, A.; Evdokimov, V. N.; Fatakia, S. N.; Feligioni, L.; Ferapontov, A. V.; Ferbel, T.; Fiedler, F.; Filthaut, F.; Fisher, W.; Fisk, H. E.; Fleck, I.; Ford, M.; Fortner, M.; Fox, H.; Fu, S.; Fuess, S.; Gadfort, T.; Galea, C. F.; Gallas, E.; Galyaev, E.; Garcia, C.; Garcia-Bellido, A.; Gardner, J.; Gavrilov, V.; Gay, A.; Gay, P.; Gelé, D.; Gelhaus, R.; Gerber, C. E.; Gershtein, Y.; Gillberg, D.; Ginther, G.; Gollub, N.; Gómez, B.; Goussiou, A.; Grannis, P. D.; Greenlee, H.; Greenwood, Z. D.; Gregores, E. M.; Grenier, G.; Gris, Ph.; Grivaz, J.-F.; Grünendahl, S.; Grünewald, M. W.; Guo, F.; Guo, J.; Gutierrez, G.; Gutierrez, P.; Haas, A.; Hadley, N. J.; Haefner, P.; Hagopian, S.; Haley, J.; Hall, I.; Hall, R. E.; Han, L.; Hanagaki, K.; Harder, K.; Harel, A.; Harrington, R.; Hauptman, J. M.; Hauser, R.; Hays, J.; Hebbeker, T.; Hedin, D.; Hegeman, J. G.; Heinmiller, J. M.; Heinson, A. P.; Heintz, U.; Hensel, C.; Hesketh, G.; Hildreth, M. D.; Hirosky, R.; Hobbs, J. D.; Hoeneisen, B.; Hoeth, H.; Hohlfeld, M.; Hong, S. J.; Hooper, R.; Houben, P.; Hu, Y.; Hubacek, Z.; Hynek, V.; Iashvili, I.; Illingworth, R.; Ito, A. S.; Jabeen, S.; Jaffré, M.; Jain, S.; Jakobs, K.; Jarvis, C.; Jenkins, A.; Jesik, R.; Johns, K.; Johnson, C.; Johnson, M.; Jonckheere, A.; Jonsson, P.; Juste, A.; Käfer, D.; Kahn, S.; Kajfasz, E.; Kalinin, A. M.; Kalk, J. M.; Kalk, J. R.; Kappler, S.; Karmanov, D.; Kasper, J.; Kasper, P.; Katsanos, I.; Kau, D.; Kaur, R.; Kehoe, R.; Kermiche, S.; Kesisoglou, S.; Khalatyan, N.; Khanov, A.; Kharchilava, A.; Kharzheev, Y. M.; Khatidze, D.; Kim, H.; Kim, T. J.; Kirby, M. H.; Klima, B.; Kohli, J. M.; Konrath, J.-P.; Kopal, M.; Korablev, V. M.; Kotcher, J.; Kothari, B.; Koubarovsky, A.; Kozelov, A. V.; Kozminski, J.; Krop, D.; Kryemadhi, A.; Kuhl, T.; Kumar, A.; Kunori, S.; Kupco, A.; Kurča, T.; Kvita, J.; Lager, S.; Lammers, S.; Landsberg, G.; Lazoflores, J.; Le Bihan, A.-C.; Lebrun, P.; Lee, W. M.; Leflat, A.; Lehner, F.; Lesne, V.; Leveque, J.; Lewis, P.; Li, J.; Li, Q. Z.; Lima, J. G. R.; Lincoln, D.; Linnemann, J.; Lipaev, V. V.; Lipton, R.; Liu, Z.; Lobo, L.; Lobodenko, A.; Lokajicek, M.; Lounis, A.; Love, P.; Lubatti, H. J.; Lynker, M.; Lyon, A. L.; Maciel, A. K. A.; Madaras, R. J.; Mättig, P.; Magass, C.; Magerkurth, A.; Magnan, A.-M.; Makovec, N.; Mal, P. K.; Malbouisson, H. B.; Malik, S.; Malyshev, V. L.; Mao, H. S.; Maravin, Y.; Martens, M.; Mattingly, S. E. K.; McCarthy, R.; Meder, D.; Melnitchouk, A.; Mendes, A.; Mendoza, L.; Merkin, M.; Merritt, K. W.; Meyer, A.; Meyer, J.; Michaut, M.

    2006-09-01

    A search for leptoquarks has been performed in 310 pb-1 of data from pp¯ collisions at a center-of-mass energy of 1.96 TeV, collected by the D0 detector at the Fermilab Tevatron Collider. The topology analyzed consists of acoplanar jets with missing transverse energy. The data show good agreement with standard model expectations, and a lower mass limit of 136 GeV has been set at the 95% C.L. for a scalar leptoquark decaying exclusively into a quark and a neutrino.

  11. Search for scalar leptoquarks in the acoplanar jet topology in ppbar collisions at √{ s} = 1.96 TeV

    Science.gov (United States)

    Abazov, V. M.; Abbott, B.; Abolins, M.; Acharya, B. S.; Adams, M.; Adams, T.; Agelou, M.; Agram, J.-L.; Ahn, S. H.; Ahsan, M.; Alexeev, G. D.; Alkhazov, G.; Alton, A.; Alverson, G.; Alves, G. A.; Anastasoaie, M.; Andeen, T.; Anderson, S.; Andrieu, B.; Anzelc, M. S.; Arnoud, Y.; Arov, M.; Askew, A.; Åsman, B.; Assis Jesus, A. C. S.; Atramentov, O.; Autermann, C.; Avila, C.; Ay, C.; Badaud, F.; Baden, A.; Bagby, L.; Baldin, B.; Bandurin, D. V.; Banerjee, P.; Banerjee, S.; Barberis, E.; Bargassa, P.; Baringer, P.; Barnes, C.; Barreto, J.; Bartlett, J. F.; Bassler, U.; Bauer, D.; Bean, A.; Begalli, M.; Begel, M.; Belanger-Champagne, C.; Bellantoni, L.; Bellavance, A.; Benitez, J. A.; Beri, S. B.; Bernardi, G.; Bernhard, R.; Berntzon, L.; Bertram, I.; Besançon, M.; Beuselinck, R.; Bezzubov, V. A.; Bhat, P. C.; Bhatnagar, V.; Binder, M.; Biscarat, C.; Black, K. M.; Blackler, I.; Blazey, G.; Blekman, F.; Blessing, S.; Bloch, D.; Bloom, K.; Blumenschein, U.; Boehnlein, A.; Boeriu, O.; Bolton, T. A.; Borissov, G.; Bos, K.; Bose, T.; Brandt, A.; Brock, R.; Brooijmans, G.; Bross, A.; Brown, D.; Buchanan, N. J.; Buchholz, D.; Buehler, M.; Buescher, V.; Burdin, S.; Burke, S.; Burnett, T. H.; Busato, E.; Buszello, C. P.; Butler, J. M.; Calfayan, P.; Calvet, S.; Cammin, J.; Caron, S.; Carvalho, W.; Casey, B. C. K.; Cason, N. M.; Castilla-Valdez, H.; Chakrabarti, S.; Chakraborty, D.; Chan, K. M.; Chandra, A.; Chapin, D.; Charles, F.; Cheu, E.; Chevallier, F.; Cho, D. K.; Choi, S.; Choudhary, B.; Christofek, L.; Claes, D.; Clément, B.; Clément, C.; Coadou, Y.; Cooke, M.; Cooper, W. E.; Coppage, D.; Corcoran, M.; Cousinou, M.-C.; Cox, B.; Crépé-Renaudin, S.; Cutts, D.; Ćwiok, M.; da Motta, H.; Das, A.; Das, M.; Davies, B.; Davies, G.; Davis, G. A.; De, K.; de Jong, P.; de Jong, S. J.; De La Cruz-Burelo, E.; De Oliveira Martins, C.; Degenhardt, J. D.; Déliot, F.; Demarteau, M.; Demina, R.; Demine, P.; Denisov, D.; Denisov, S. P.; Desai, S.; Diehl, H. T.; Diesburg, M.; Doidge, M.; Dominguez, A.; Dong, H.; Dudko, L. V.; Duflot, L.; Dugad, S. R.; Duperrin, A.; Dyer, J.; Dyshkant, A.; Eads, M.; Edmunds, D.; Edwards, T.; Ellison, J.; Elmsheuser, J.; Elvira, V. D.; Eno, S.; Ermolov, P.; Estrada, J.; Evans, H.; Evdokimov, A.; Evdokimov, V. N.; Fatakia, S. N.; Feligioni, L.; Ferapontov, A. V.; Ferbel, T.; Fiedler, F.; Filthaut, F.; Fisher, W.; Fisk, H. E.; Fleck, I.; Ford, M.; Fortner, M.; Fox, H.; Fu, S.; Fuess, S.; Gadfort, T.; Galea, C. F.; Gallas, E.; Galyaev, E.; Garcia, C.; Garcia-Bellido, A.; Gardner, J.; Gavrilov, V.; Gay, A.; Gay, P.; Gelé, D.; Gelhaus, R.; Gerber, C. E.; Gershtein, Y.; Gillberg, D.; Ginther, G.; Gollub, N.; Gómez, B.; Goussiou, A.; Grannis, P. D.; Greenlee, H.; Greenwood, Z. D.; Gregores, E. M.; Grenier, G.; Gris, Ph.; Grivaz, J.-F.; Grünendahl, S.; Grünewald, M. W.; Guo, F.; Guo, J.; Gutierrez, G.; Gutierrez, P.; Haas, A.; Hadley, N. J.; Haefner, P.; Hagopian, S.; Haley, J.; Hall, I.; Hall, R. E.; Han, L.; Hanagaki, K.; Harder, K.; Harel, A.; Harrington, R.; Hauptman, J. M.; Hauser, R.; Hays, J.; Hebbeker, T.; Hedin, D.; Hegeman, J. G.; Heinmiller, J. M.; Heinson, A. P.; Heintz, U.; Hensel, C.; Hesketh, G.; Hildreth, M. D.; Hirosky, R.; Hobbs, J. D.; Hoeneisen, B.; Hoeth, H.; Hohlfeld, M.; Hong, S. J.; Hooper, R.; Houben, P.; Hu, Y.; Hubacek, Z.; Hynek, V.; Iashvili, I.; Illingworth, R.; Ito, A. S.; Jabeen, S.; Jaffré, M.; Jain, S.; Jakobs, K.; Jarvis, C.; Jenkins, A.; Jesik, R.; Johns, K.; Johnson, C.; Johnson, M.; Jonckheere, A.; Jonsson, P.; Juste, A.; Käfer, D.; Kahn, S.; Kajfasz, E.; Kalinin, A. M.; Kalk, J. M.; Kalk, J. R.; Kappler, S.; Karmanov, D.; Kasper, J.; Kasper, P.; Katsanos, I.; Kau, D.; Kaur, R.; Kehoe, R.; Kermiche, S.; Kesisoglou, S.; Khalatyan, N.; Khanov, A.; Kharchilava, A.; Kharzheev, Y. M.; Khatidze, D.; Kim, H.; Kim, T. J.; Kirby, M. H.; Klima, B.; Kohli, J. M.; Konrath, J.-P.; Kopal, M.; Korablev, V. M.; Kotcher, J.; Kothari, B.; Koubarovsky, A.; Kozelov, A. V.; Kozminski, J.; Krop, D.; Kryemadhi, A.; Kuhl, T.; Kumar, A.; Kunori, S.; Kupco, A.; Kurča, T.; Kvita, J.; Lager, S.; Lammers, S.; Landsberg, G.; Lazoflores, J.; Le Bihan, A.-C.; Lebrun, P.; Lee, W. M.; Leflat, A.; Lehner, F.; Lesne, V.; Leveque, J.; Lewis, P.; Li, J.; Li, Q. Z.; Lima, J. G. R.; Lincoln, D.; Linnemann, J.; Lipaev, V. V.; Lipton, R.; Liu, Z.; Lobo, L.; Lobodenko, A.; Lokajicek, M.; Lounis, A.; Love, P.; Lubatti, H. J.; Lynker, M.; Lyon, A. L.; Maciel, A. K. A.; Madaras, R. J.; Mättig, P.; Magass, C.; Magerkurth, A.; Magnan, A.-M.; Makovec, N.; Mal, P. K.; Malbouisson, H. B.; Malik, S.; Malyshev, V. L.; Mao, H. S.; Maravin, Y.; Martens, M.; Mattingly, S. E. K.; McCarthy, R.; Meder, D.; Melnitchouk, A.; Mendes, A.; Mendoza, L.; Merkin, M.; Merritt, K. W.; Meyer, A.; Meyer, J.; Michaut, M.; Miettinen, H.; Millet, T.

    2006-09-01

    A search for leptoquarks has been performed in 310 pb-1 of data from ppbar collisions at a center-of-mass energy of 1.96 TeV, collected by the D0 detector at the Fermilab Tevatron Collider. The topology analyzed consists of acoplanar jets with missing transverse energy. The data show good agreement with standard model expectations, and a lower mass limit of 136 GeV has been set at the 95% C.L. for a scalar leptoquark decaying exclusively into a quark and a neutrino.

  12. Search for the lightest scalar top quark in events with two leptons in pp¯ collisions at s=1.96 TeV

    Science.gov (United States)

    DØ Collaboration; Abazov, V. M.; Abbott, B.; Abolins, M.; Acharya, B. S.; Adams, M.; Adams, T.; Aguilo, E.; Ahn, S. H.; Ahsan, M.; Alexeev, G. D.; Alkhazov, G.; Alton, A.; Alverson, G.; Alves, G. A.; Anastasoaie, M.; Ancu, L. S.; Andeen, T.; Anderson, S.; Andrieu, B.; Anzelc, M. S.; Arnoud, Y.; Arov, M.; Arthaud, M.; Askew, A.; Åsman, B.; Assis Jesus, A. C. S.; Atramentov, O.; Autermann, C.; Avila, C.; Ay, C.; Badaud, F.; Baden, A.; Bagby, L.; Baldin, B.; Bandurin, D. V.; Banerjee, S.; Banerjee, P.; Barberis, E.; Barfuss, A.-F.; Bargassa, P.; Baringer, P.; Barreto, J.; Bartlett, J. F.; Bassler, U.; Bauer, D.; Beale, S.; Bean, A.; Begalli, M.; Begel, M.; Belanger-Champagne, C.; Bellantoni, L.; Bellavance, A.; Benitez, J. A.; Beri, S. B.; Bernardi, G.; Bernhard, R.; Berntzon, L.; Bertram, I.; Besançon, M.; Beuselinck, R.; Bezzubov, V. A.; Bhat, P. C.; Bhatnagar, V.; Biscarat, C.; Blazey, G.; Blekman, F.; Blessing, S.; Bloch, D.; Bloom, K.; Boehnlein, A.; Boline, D.; Bolton, T. A.; Borissov, G.; Bos, K.; Bose, T.; Brandt, A.; Brock, R.; Brooijmans, G.; Bross, A.; Brown, D.; Buchanan, N. J.; Buchholz, D.; Buehler, M.; Buescher, V.; Burdin, S.; Burke, S.; Burnett, T. H.; Buszello, C. P.; Butler, J. M.; Calfayan, P.; Calvet, S.; Cammin, J.; Caron, S.; Carvalho, W.; Casey, B. C. K.; Cason, N. M.; Castilla-Valdez, H.; Chakrabarti, S.; Chakraborty, D.; Chan, K. M.; Chan, K.; Chandra, A.; Charles, F.; Cheu, E.; Chevallier, F.; Cho, D. K.; Choi, S.; Choudhary, B.; Christofek, L.; Christoudias, T.; Cihangir, S.; Claes, D.; Clément, B.; Coadou, Y.; Cooke, M.; Cooper, W. E.; Corcoran, M.; Couderc, F.; Cousinou, M.-C.; Crépé-Renaudin, S.; Cutts, D.; Ćwiok, M.; da Motta, H.; Das, A.; Davies, G.; de, K.; de Jong, S. J.; de Jong, P.; de La Cruz-Burelo, E.; de Oliveira Martins, C.; Degenhardt, J. D.; Déliot, F.; Demarteau, M.; Demina, R.; Denisov, D.; Denisov, S. P.; Desai, S.; Diehl, H. T.; Diesburg, M.; Dominguez, A.; Dong, H.; Dudko, L. V.; Duflot, L.; Dugad, S. R.; Duggan, D.; Duperrin, A.; Dyer, J.; Dyshkant, A.; Eads, M.; Edmunds, D.; Ellison, J.; Elvira, V. D.; Enari, Y.; Eno, S.; Ermolov, P.; Evans, H.; Evdokimov, A.; Evdokimov, V. N.; Ferapontov, A. V.; Ferbel, T.; Fiedler, F.; Filthaut, F.; Fisher, W.; Fisk, H. E.; Ford, M.; Fortner, M.; Fox, H.; Fu, S.; Fuess, S.; Gadfort, T.; Galea, C. F.; Gallas, E.; Galyaev, E.; Garcia, C.; Garcia-Bellido, A.; Gavrilov, V.; Gay, P.; Geist, W.; Gelé, D.; Gerber, C. E.; Gershtein, Y.; Gillberg, D.; Ginther, G.; Gollub, N.; Gómez, B.; Goussiou, A.; Grannis, P. D.; Greenlee, H.; Greenwood, Z. D.; Gregores, E. M.; Grenier, G.; Gris, Ph.; Grivaz, J.-F.; Grohsjean, A.; Grünendahl, S.; Grünewald, M. W.; Guo, J.; Guo, F.; Gutierrez, P.; Gutierrez, G.; Haas, A.; Hadley, N. J.; Haefner, P.; Hagopian, S.; Haley, J.; Hall, I.; Hall, R. E.; Han, L.; Hanagaki, K.; Hansson, P.; Harder, K.; Harel, A.; Harrington, R.; Hauptman, J. M.; Hauser, R.; Hays, J.; Hebbeker, T.; Hedin, D.; Hegeman, J. G.; Heinmiller, J. M.; Heinson, A. P.; Heintz, U.; Hensel, C.; Herner, K.; Hesketh, G.; Hildreth, M. D.; Hirosky, R.; Hobbs, J. D.; Hoeneisen, B.; Hoeth, H.; Hohlfeld, M.; Hong, S. J.; Hooper, R.; Hossain, S.; Houben, P.; Hu, Y.; Hubacek, Z.; Hynek, V.; Iashvili, I.; Illingworth, R.; Ito, A. S.; Jabeen, S.; Jaffré, M.; Jain, S.; Jakobs, K.; Jarvis, C.; Jesik, R.; Johns, K.; Johnson, C.; Johnson, M.; Jonckheere, A.; Jonsson, P.; Juste, A.; Käfer, D.; Kahn, S.; Kajfasz, E.; Kalinin, A. M.; Kalk, J. R.; Kalk, J. M.; Kappler, S.; Karmanov, D.; Kasper, J.; Kasper, P.; Katsanos, I.; Kau, D.; Kaur, R.; Kaushik, V.; Kehoe, R.; Kermiche, S.; Khalatyan, N.; Khanov, A.; Kharchilava, A.; Kharzheev, Y. M.; Khatidze, D.; Kim, H.; Kim, T. J.; Kirby, M. H.; Kirsch, M.; Klima, B.; Kohli, J. M.; Konrath, J.-P.; Kopal, M.; Korablev, V. M.; Kozelov, A. V.; Krop, D.; Kryemadhi, A.; Kuhl, T.; Kumar, A.; Kunori, S.; Kupco, A.; Kurča, T.; Kvita, J.; Lacroix, F.; Lam, D.; Lammers, S.; Landsberg, G.; Lazoflores, J.; Lebrun, P.; Lee, W. M.; Leflat, A.; Lehner, F.; Lellouch, J.; Leveque, J.; Lewis, P.; Li, J.; Li, Q. Z.; Li, L.; Lietti, S. M.; Lima, J. G. R.; Lincoln, D.; Linnemann, J.; Lipaev, V. V.; Lipton, R.; Liu, Y.; Liu, Z.; Lobo, L.; Lobodenko, A.; Lokajicek, M.; Lounis, A.; Love, P.; Lubatti, H. J.; Lyon, A. L.; Maciel, A. K. A.; Mackin, D.; Madaras, R. J.; Mättig, P.; Magass, C.; Magerkurth, A.; Makovec, N.; Mal, P. K.; Malbouisson, H. B.; Malik, S.; Malyshev, V. L.; Mao, H. S.; Maravin, Y.; Martin, B.; McCarthy, R.; Melnitchouk, A.; Mendes, A.; Mendoza, L.; Mercadante, P. G.; Merkin, M.; Merritt, K. W.; Meyer, J.; Meyer, A.; Michaut, M.; Millet, T.; Mitrevski, J.; Molina, J.; Mommsen, R. K.; Mondal, N. K.; Moore, R. W.; Moulik, T.; Muanza, G. S.; Mulders, M.; Mulhearn, M.; Mundal, O.; Mundim, L.; Nagy, E.; Naimuddin, M.; Narain, M.

    2008-01-01

    Data collected by the D0 detector at a pp¯ center-of-mass energy of 1.96 TeV at the Fermilab Tevatron Collider have been used to search for pair production of the lightest supersymmetric partner of the top quark decaying into bℓν˜. The search is performed in the ℓℓ=eμ and μμ final states. No evidence for this process has been found in data samples of approximately 400 pb-1. The domain in the [M(t),M(ν˜)] plane excluded at the 95% C.L. is substantially extended by this search.

  13. Search for scalar leptoquarks in the acoplanar jet topology in p anti-p collisions at s**(1/2) = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abazov, V.M.; Abbott, B.; Abolins, M.; Acharya, B.S.; Adams, M.; Adams, T.; Agelou, M.; Agram, J.-L.; Ahn, S.H.; Ahsan, M.; Alexeev, G.D.; /Buenos Aires U. /Rio de

    2006-07-01

    A search for leptoquarks has been performed in 310 pb{sup -1} of data from p{bar p} collisions at a center-of-mass energy of 1.96 TeV, collected by the D0 detector at the Fermilab Tevatron Collider. The topology analyzed consists of acoplanar jets with missing transverse energy. The data show good agreement with standard model expectations, and a lower mass limit of 136 GeV has been set at the 95% C.L. for a scalar leptoquark decaying exclusively into a quark and a neutrino.

  14. Search for Large Extra Dimensions via Single Photons Plus Missing Energy Final States at √s = 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Carrera, Edgar Fernando [Florida State Univ., Tallahassee, FL (United States)

    2008-12-01

    This dissertation presents a search for large extra dimensions in the single photon plus missing transverse energy final states. We use a data sample of approximately 2.7 fb-1 of p$\\bar{p}$ collisions at √s = 1.96 TeV (recorded with the D- detector) to investigate direct Kaluza Klein graviton production and set limits, at the 95% C.L., on the fundamental mass scale MD from 970 GeV to 816 GeV for two to eight extra dimensions.

  15. Search for Large Extra Dimensions in the Production of Jets and Missing Transverse Energy in ppbar Collisions at s**(1/2) = 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abulencia, A.; Acosta, D.; Adelman, Jahred A.; Affolder, T.; Akimoto, T.; Albrow, M.G.; Ambrose, D.; Amerio, S.; Amidei, D.; Anastassov, A.; Anikeev, K.; /Taiwan, Inst.

    2006-04-01

    The authors present the results of a search for new physics in the jets plus missing transverse energy data sample collected from 368 pb{sup -1} of p{bar p} collisions at {radical}s = 1.96 TeV recorded by the Collider Detector at Fermilab. They compare the number of events observed in the data with a data-based estimate of the standard model backgrounds contributing to this signature. They observe no significant excess of events, and they interpret this null result in terms of lower limits on the fundamental Planck scale for a large extra dimensions scenario.

  16. Measurement of the W + γ Production in Proton - Anti-proton Collisions at √s = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Kirby, Michael H. [Duke Univ., Durham, NC (United States)

    2004-01-01

    The authors present a measurement of the $\\bar{p}$p → Wγ + X → evγ + X production cross section using data form the Collider Detector at Fermilab. The p$\\bar{p}$ collisions were provided by the Tevatron Collider at a center of mass energy of 1.96 TeV. Electroweak theory includes the trilinear vector boson coupling, WWγ, which contributes to the evγ final state. The electron decay channel of the W provides a clean sample to study the production of diboson pairs. The measurement of the production cross section tests the structure of the non-Abelian character of Electroweak theory.

  17. Inclusive high-p$\\perp$ b$\\bar{b}$cross section measurement at √s = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Galyaev, Eugene N. [Univ. of Notre Dame, IN (United States)

    2006-11-01

    The Run II physics program at the Tevatron started in the spring of 2001 with protons and antiprotons colliding at an energy of √s = 1.96 TeV, and is continuing with about 1.2 fb-1 of data currently collected by the CDF and D0 experiments. A measurement of the b-jet cross section as function of jet transverse momentum p$\\perp$ has been performed using 312 pb-1 of D0 data. The results for this measurement were obtained and are presented herein. A neural network algorithm was used to identify b jets.

  18. Search for Higgs boson production in proton-antiproton collisions at √s = 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Kusakabe, Yoshiaki [Waseda Univ., Shinjuku (Japan)

    2006-12-01

    We performed a search for Standard Model Higgs boson production in association with W boson (p$\\bar{p}$ → W±H → ℓvb$\\bar{b}$) in p$\\bar{p}$ collisions at √s = 1.96 TeV. The search uses the data collected between February 2002 and February 2006 at Collider Detector at Fermilab (CDF), which corresponds to an integrated luminosity of about 1 fb-1. The experimental final state of WH → ℓvb$\\bar{b}$ process is lepton (e±±), missing transverse energy and two jets. The largest background in lepton+jets events is W+light flavor process, therefore the identification of jets as b-jets reduces this kind of background significantly. We used displaced SECondary VerTeX b-tagging (SECVTX) technique, which utilizes the signature that b-jets have secondary vertex displaced away from primary vertex because of the long life time of B-mesons. However, there is still much contamination in SECVTX b-tagged jets. Finite resolution of secondary vertex tracking measurements results in false tags, and c-jets are also identified as b-jets due to the long life time of D-mesons frequently. For the purpose of increasing the purity of the SECVTX b-tagged jets, we applied Neural Network to SECVTX tagged jets for the first time by using secondary vertex variables and some variables independent of it. Neural Network filter rejects 65% of light flavor jets and 50% of c-jets from the SECVTX tagged jets. We improved the sensitivity of the Higgs boson signal search by 10% with Neural Network b-tagging technique. Events with one high pT electron or muon, large missing transverse energy and either single SECVTX b-tagged jet which passes the Neural Network filter or at least two SECVTX b-tagged jets are selected. The number of selected events and dijet mass distributions are consistent with the Standard Model background expectations. Therefore we set an upper limit on σ(p$\\bar{p}$ → WH) • Br(H → b$\\bar{b}$) as 3.9 to 1

  19. Tungsten Inert Gas and Friction Stir Welding Characteristics of 4-mm-Thick 2219-T87 Plates at Room Temperature and -196 °C

    Science.gov (United States)

    Lei, Xuefeng; Deng, Ying; Yin, Zhimin; Xu, Guofu

    2014-06-01

    2219-T87 aluminum alloy is widely used for fabricating liquid rocket propellant storage tank, due to its admirable cryogenic property. Welding is the dominant joining method in the manufacturing process of aerospace components. In this study, the tungsten inert gas welding and friction stir welding (FSW) characteristics of 4-mm-thick 2219-T87 alloy plate at room temperature (25 °C) and deep cryogenic temperature (-196 °C) were investigated by property measurements and microscopy methods. The studied 2219 base alloy exhibits a low strength plane anisotropy and excellent room temperature and cryogenic mechanical properties. The ultimate tensile strength values of TIG and FSW welding joints can reach 265 and 353 MPa at room temperature, and 342 and 438 MPa at -196 °C, respectively. The base metal consists of elongated deformed grains and many nano-scaled θ (Al2Cu) aging precipitates. Fusion zone and heat-affected zone (HAZ) of the TIG joint are characterized by coarsening dendritic grains and equiaxed recrystallized grains, respectively. The FSW-welded joint consists of the weld nugget zone, thermo-mechanically affected zone (TMAZ), and HAZ. In the weld nugget zone, a micro-scaled sub-grain structure is the main microstructure characteristic. The TMAZ and HAZ are both characterized by coarsened aging precipitates and elongated deformed grains. The excellent FSW welding properties are attributed to the preservation of the working structures and homogenous chemical compositions.

  20. Hysteresis and Instability in Some IPRT Sensors Within Temperature Ranges Extending from -196 ^{circ }\\hbox {C} to 150 ^{circ }\\hbox {C}

    Science.gov (United States)

    Rusby, R. L.; Machin, D.

    2017-08-01

    Industrial platinum resistance thermometer (IPRT) sensors or probes suffer from some instability on cycling over significant ranges of temperature and, specifically, from hysteresis in which the resistance tends to follow different paths for increasing temperatures compared with decreasing temperatures. The effect is well known, and cases of quite large hysteresis have been reported in the literature. Therefore, in establishing calibration and measurement capabilities for IPRT calibrations it is important to include an assessment of the performance which can be expected of a `typical good' IPRT and to include this in the overall uncertainty which the laboratory can expect to achieve in such calibrations, even though the effect itself is outside the laboratory's control. This paper presents results which have been obtained in cycling IPRT probes from four sources within various temperature ranges of current interest at NPL, between -196 ^{circ }\\hbox {C} and 150 ^{circ }\\hbox {C}, to see what levels of hysteresis may be expected. The cycles were carried out quite quickly in order to detect the hysteresis before it was mitigated by relaxation effects, but the time dependence was not itself studied. In most cases, hysteresis was {<}0.0025 ^{circ }\\hbox {C} between 0 ^{circ }\\hbox {C} and 100 ^{circ }\\hbox {C}, and {<}0.0035 ^{circ }\\hbox {C} when the range extended down to -80 ^{circ }\\hbox {C} or up to 150 ^{circ }\\hbox {C}. Greater instability occurred when the sensors were cooled to -196 ^{circ }\\hbox {C}.

  1. Measurement of the Top Quark Pair Production Cross Section in p anti-p collisions at √s = 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Otero y Garzon, Gustavo J. [Univ. of Illinois, Chicago, IL (United States)

    2006-03-01

    The subject of this thesis is the measurement of the rate at which a top-antitop quark pair is produced in pp collisions at a center of mass energy of ps = 1:96 TeV. The data are collected with the D detector, a multi-purpose detector operating at the Fermilab Tevatron collider during Run II. A measurement of the top quark pair (t$\\bar{t}$) production cross section ( σt$\\bar{t}$) in p$\\bar{p}$ collisions at a center of mass energy of 1.96 TeV is presented. The measurement is based on data recorded by the D0 Detector at the Fermilab Tevatron Collider, and preselected in the e+jets (366 pb-1) and μ+jets (363 pb-1) channels. The cross section is extracted by applying a lifetime-tagging technique to the data, and yields σt$\\bar{t}$ = 6.96$+1.07\\atop{-0.98}$(stat + syst) ± 0.45(lumi) pb; for a top quark mass mt =175 GeV, in good agreement with the Standard Model prediction.

  2. Search for a fourth generation b'-quark at LEP-II at sqrt{s}=196-209 GeV

    CERN Document Server

    Abdallah, J.; Adam, W.; Adzic, P.; Albrecht, T.; Alemany-Fernandez, R.; Allmendinger, T.; Allport, P.P.; Amaldi, U.; Amapane, N.; Amato, S.; Anashkin, E.; Andreazza, A.; Andringa, S.; Anjos, N.; Antilogus, P.; Apel, W-D.; Arnoud, Y.; Ask, S.; Asman, B.; Augustin, J.E.; Augustinus, A.; Baillon, P.; Ballestrero, A.; Bambade, P.; Barbier, R.; Bardin, D.; Barker, G.J.; Baroncelli, A.; Battaglia, M.; Baubillier, M.; Becks, K-H.; Begalli, M.; Behrmann, A.; Ben-Haim, E.; Benekos, N.; Benvenuti, A.; Berat, C.; Berggren, M.; Berntzon, L.; Bertrand, D.; Besancon, M.; Besson, N.; Bloch, D.; Blom, M.; Bluj, M.; Bonesini, M.; Boonekamp, M.; Booth, P.S.L.; Borisov, G.; Botner, O.; Bouquet, B.; Bowcock, T.J.V.; Boyko, I.; Bracko, M.; Brenner, R.; Brodet, E.; Bruckman, P.; Brunet, J.M.; Buschbeck, B.; Buschmann, P.; Calvi, M.; Camporesi, T.; Canale, V.; Carena, F.; Castro, Nuno Filipe; Cavallo, F.; Chapkin, M.; Charpentier, Ph.; Charpentier, Ph.; Checchia, P.; Chierici, R.; Chudoba, J.; Chliapnikov, P.; Chudoba, J.; Chung, S.U.; Cieslik, K.; Collins, P.; Contri, R.; Cosme, G.; Cossutti, F.; Costa, M.J.; Crennell, D.; Cuevas, J.; D'Hondt, J.; Dalmau, J.; da Silva, T.; Da Silva, W.; Della Ricca, G.; De Angelis, A.; De Boer, W.; De Clercq, C.; De Lotto, B.; De Maria, N.; De Min, A.; de Paula, L.; Di Ciaccio, L.; Di Simone, A.; Doroba, K.; Eigen, G.; Ekelof, T.; Ellert, M.; Elsing, M.; Santo, M.C.Espirito; Fanourakis, G.; Feindt, M.; Fernandez, J.; Ferrer, A.; Ferro, F.; Flagmeyer, U.; Foeth, H.; Fokitis, E.; Fulda-Quenzer, F.; Fuster, J.; Gandelman, M.; Garcia, C.; Gavillet, Ph.; Gazis, E.; Gomez-Ceballos, G.; Goncalves, P.; Graziani, E.; Grosdidier, G.; Grzelak, K.; Guy, J.; Haag, C.; Hallgren, A.; Hamacher, K.; Hamilton, K.; Haug, S.; Hauler, F.; Hedberg, V.; Hennecke, M.; Herr, H.; Hoffman, J.; Holmgren, S-O.; Holt, P.J.; Houlden, M.A.; Jackson, John Neil; Jarlskog, G.; Jarry, P.; Jeans, D.; Johansson, Erik Karl; Johansson, P.D.; Jonsson, P.; Joram, C.; Jungermann, L.; Kapusta, F.; Katsanevas, S.; Katsoufis, E.; Kernel, G.; Kerzel, U.; King, B.T.; Kjaer, N.J.; Kluit, P.; Kokkinias, P.; Kourkoumelis, C.; Kouznetsov, O.; Krumstein, Z.; Kucharczyk, M.; Lamsa, J.; Leder, G.; Ledroit, F.; Leinonen, L.; Leitner, R.; Lemonne, J.; Lepeltier, V.; Lesiak, T.; Liebig, W.; Liko, D.; Lipniacka, A.; Lopes, J.H.; Lopez, J.M.; Loukas, D.; Lutz, P.; Lyons, L.; MacNaughton, J.; Malek, A.; Maltezos, S.; Mandl, F.; Marco, J.; Marco, R.; Marechal, B.; Margoni, M.; Marin, J-C.; Mariotti, C.; Markou, A.; Martinez-Rivero, C.; Masik, J.; Mastroyiannopoulos, N.; Matorras, F.; Matteuzzi, C.; Mazzucato, F.; Mazzucato, M.; Nulty, R.Mc; Meroni, C.; Migliore, E.; Mitaroff, W.; Mjoernmark, U.; Moa, T.; Moch, M.; Monge, R.; Montenegro, J.; Moraes, D.; Moreno, S.; Morettini, P.; Mueller, U.; Muenich, K.; Mulders, M.; Mundim, L.; Murray, W.; Muryn, B.; Myatt, G.; Myklebust, T.; Nassiakou, M.; Navarria, F.; Nawrocki, K.; Nicolaidou, R.; Oliveira, O.; Oblakowska-Mucha, A.; Obraztsov, V.; Oliveira, O.; Oliveira, S.M.; Olshevski, A.; Onofre, A.; Orava, R.; Osterberg, K.; Ouraou, A.; Oyanguren, A.; Paganoni, M.; Paiano, S.; Palacios, J.P.; Palka, H.; Papadopoulou, Th.D.; Pape, L.; Parkes, C.; Parodi, F.; Parzefall, U.; Passeri, A.; Passon, O.; Peralta, L.; Perepelitsa, V.; Perrotta, A.; Petrolini, A.; Piedra, J.; Pieri, L.; Pierre, F.; Pimenta, M.; Piotto, E.; Poireau, V.; Pol, M.E.; Polok, G.; Pozdniakov, V.; Pukhaeva, N.; Pullia, A.; Rames, J.; Read, A.; Rebecchi, P.; Rehn, J.; Reid, D.; Reinhardt, R.; Renton, P.; Richard, F.; Ridky, J.; Rivero, M.; Rodriguez, D.; Romero, A.; Ronchese, P.; Roudeau, P.; Sadovsky, A.; Rovelli, T.; Ruhlmann-Kleider, V.; Ryabtchikov, D.; Sadovsky, A.; Salmi, L.; Salt, J.; Sander, C.; Santos, R.; Savoy-Navarro, A.; Schwickerath, U.; Sekulin, R.; Siebel, M.; Sopczak, A.; Sisakian, A.; Smadja, G.; Smirnova, O.; Sokolov, A.; Sopczak, A.; Sosnowski, R.; Spassov, T.; Stanitzki, M.; Stocchi, A.; Strauss, J.; Stugu, B.; Szczekowski, M.; Szeptycka, M.; Szumlak, T.; Tabarelli, T.; Taffard, A.C.; Tegenfeldt, F.; Timmermans, Jan; Tkatchev, L.; Tobin, M.; Todorovova, S.; Tome, B.; Tonazzo, A.; Tortosa, P.; Travnicek, P.; Treille, D.; Tristram, G.; Trochimczuk, M.; Troncon, C.; Valenti, G.; Turluer, M-L.; Tyapkin, I.A.; Tyapkin, P.; Tzamarias, S.; Uvarov, V.; Valenti, G.; Van Dam, Piet; Van Eldik, J.; van Remortel, N.; Van Vulpen, I.; Vegni, G.; Veloso, F.; Venus, W.; Verdier, P.; Verzi, V.; Vilanova, D.; Vitale, L.; Vrba, V.; Wahlen, H.; Washbrook, A.J.; Weiser, C.; Zalewska, A.; Wicke, D.; Wickens, J.; Wilkinson, G.; Winter, M.; Witek, M.; Yushchenko, O.; Zalewska, A.; Zalewski, P.; Zavrtanik, D.; Zhuravlov, V.; Zimine, N.I.; Zintchenko, A.

    2007-01-01

    A search for the pair production of fourth generation b'-quarks was performed using data taken by the DELPHI detector at LEP-II. The analysed data were collected at centre-of-mass energies ranging from 196 to 209 GeV, corresponding to an integrated luminosity of 420 pb^{-1}. No evidence for a signal was found. Upper limits on BR(b' -> bZ) and BR(b' -> cW) were obtained for b' masses ranging from 96 to 103 GeV/c^2. These limits, together with the theoretical branching ratios predicted by a sequential four generations model, were used to constrain the value of R_{CKM}=|V_{cb'}/V_{tb'}V_{tb}|, where V_{cb'}, V_{tb'} and V_{tb} are elements of the extended CKM matrix.

  3. Studies of high-transverse momentum jet substructure and top quarks produced in 1.96 TeV proton-antiproton collisions

    Science.gov (United States)

    Aaltonen, T.; Alon, R.; Amerio, S.; Amidei, D.; Anastassov, A.; Annovi, A.; Antos, J.; Apollinari, G.; Appel, J. A.; Arisawa, T.; Artikov, A.; Asaadi, J.; Ashmanskas, W.; Auerbach, B.; Aurisano, A.; Azfar, F.; Badgett, W.; Bae, T.; Barbaro-Galtieri, A.; Barnes, V. E.; Barnett, B. A.; Barria, P.; Bartos, P.; Bauce, M.; Bedeschi, F.; Behari, S.; Bellettini, G.; Bellinger, J.; Benjamin, D.; Beretvas, A.; Bhatti, A.; Bland, K. R.; Blumenfeld, B.; Bocci, A.; Bodek, A.; Bortoletto, D.; Boudreau, J.; Boveia, A.; Brigliadori, L.; Bromberg, C.; Brucken, E.; Budagov, J.; Budd, H. S.; Burkett, K.; Busetto, G.; Bussey, P.; Butti, P.; Buzatu, A.; Calamba, A.; Camarda, S.; Campanelli, M.; Canelli, F.; Carls, B.; Carlsmith, D.; Carosi, R.; Carrillo, S.; Casal, B.; Casarsa, M.; Castro, A.; Catastini, P.; Cauz, D.; Cavaliere, V.; Cerri, A.; Cerrito, L.; Chen, Y. C.; Chertok, M.; Chiarelli, G.; Chlachidze, G.; Cho, K.; Chokheli, D.; Clark, A.; Clarke, C.; Convery, M. E.; Conway, J.; Corbo, M.; Cordelli, M.; Cox, C. A.; Cox, D. J.; Cremonesi, M.; Cruz, D.; Cuevas, J.; Culbertson, R.; d'Ascenzo, N.; Datta, M.; de Barbaro, P.; Demortier, L.; Deninno, M.; D'Errico, M.; Devoto, F.; Di Canto, A.; Di Ruzza, B.; Dittmann, J. R.; Donati, S.; D'Onofrio, M.; Dorigo, M.; Driutti, A.; Duchovni, E.; Ebina, K.; Edgar, R.; Elagin, A.; Erbacher, R.; Errede, S.; Esham, B.; Farrington, S.; Fernández Ramos, J. P.; Field, R.; Flanagan, G.; Forrest, R.; Franklin, M.; Freeman, J. C.; Frisch, H.; Funakoshi, Y.; Galloni, C.; Garfinkel, A. F.; Garosi, P.; Gerberich, H.; Gerchtein, E.; Giagu, S.; Giakoumopoulou, V.; Gibson, K.; Ginsburg, C. M.; Giokaris, N.; Giromini, P.; Glagolev, V.; Glenzinski, D.; Gold, M.; Goldin, D.; Golossanov, A.; Gomez, G.; Gomez-Ceballos, G.; Goncharov, M.; González López, O.; Gorelov, I.; Goshaw, A. T.; Goulianos, K.; Gramellini, E.; Grosso-Pilcher, C.; Group, R. C.; Guimaraes da Costa, J.; Hahn, S. R.; Han, J. Y.; Happacher, F.; Hara, K.; Hare, M.; Harr, R. F.; Harrington-Taber, T.; Hatakeyama, K.; Hays, C.; Heinrich, J.; Herndon, M.; Hocker, A.; Hong, Z.; Hopkins, W.; Hou, S.; Hughes, R. E.; Husemann, U.; Hussein, M.; Huston, J.; Introzzi, G.; Iori, M.; Ivanov, A.; James, E.; Jang, D.; Jayatilaka, B.; Jeon, E. J.; Jindariani, S.; Jones, M.; Joo, K. K.; Jun, S. Y.; Junk, T. R.; Kambeitz, M.; Kamon, T.; Karchin, P. E.; Kasmi, A.; Kato, Y.; Ketchum, W.; Keung, J.; Kilminster, B.; Kim, D. H.; Kim, H. S.; Kim, J. E.; Kim, M. J.; Kim, S. H.; Kim, S. B.; Kim, Y. J.; Kim, Y. K.; Kimura, N.; Kirby, M.; Knoepfel, K.; Kondo, K.; Kong, D. J.; Konigsberg, J.; Kotwal, A. V.; Kreps, M.; Kroll, J.; Kruse, M.; Kuhr, T.; Kurata, M.; Laasanen, A. T.; Lammel, S.; Lancaster, M.; Lannon, K.; Latino, G.; Lee, H. S.; Lee, J. S.; Leo, S.; Leone, S.; Lewis, J. D.; Limosani, A.; Lipeles, E.; Lister, A.; Liu, H.; Liu, Q.; Liu, T.; Lockwitz, S.; Loginov, A.; Lucchesi, D.; Lucà, A.; Lueck, J.; Lujan, P.; Lukens, P.; Lungu, G.; Lys, J.; Lysak, R.; Madrak, R.; Maestro, P.; Malik, S.; Manca, G.; Manousakis-Katsikakis, A.; Marchese, L.; Margaroli, F.; Marino, P.; Matera, K.; Mattson, M. E.; Mazzacane, A.; Mazzanti, P.; McNulty, R.; Mehta, A.; Mehtala, P.; Mesropian, C.; Miao, T.; Mietlicki, D.; Mitra, A.; Miyake, H.; Moed, S.; Moggi, N.; Moon, C. S.; Moore, R.; Morello, M. J.; Mukherjee, A.; Muller, Th.; Murat, P.; Mussini, M.; Nachtman, J.; Nagai, Y.; Naganoma, J.; Nakano, I.; Napier, A.; Nett, J.; Neu, C.; Nigmanov, T.; Nodulman, L.; Noh, S. Y.; Norniella, O.; Oakes, L.; Oh, S. H.; Oh, Y. D.; Oksuzian, I.; Okusawa, T.; Orava, R.; Ortolan, L.; Pagliarone, C.; Palencia, E.; Palni, P.; Papadimitriou, V.; Parker, W.; Pauletta, G.; Paulini, M.; Paus, C.; Perez, G.; Phillips, T. J.; Piacentino, G.; Pianori, E.; Pilot, J.; Pitts, K.; Plager, C.; Pondrom, L.; Poprocki, S.; Potamianos, K.; Pranko, A.; Prokoshin, F.; Ptohos, F.; Punzi, G.; Redondo Fernández, I.; Renton, P.; Rescigno, M.; Rimondi, F.; Ristori, L.; Robson, A.; Rodriguez, T.; Rolli, S.; Ronzani, M.; Roser, R.; Rosner, J. L.; Ruffini, F.; Ruiz, A.; Russ, J.; Rusu, V.; Sakumoto, W. K.; Sakurai, Y.; Santi, L.; Sato, K.; Saveliev, V.; Savoy-Navarro, A.; Schlabach, P.; Schmidt, E. E.; Schwarz, T.; Scodellaro, L.; Scuri, F.; Seidel, S.; Seiya, Y.; Semenov, A.; Sforza, F.; Shalhout, S. Z.; Shears, T.; Shepard, P. F.; Shimojima, M.; Shochet, M.; Shreyber-Tecker, I.; Simonenko, A.; Sinervo, P.; Sliwa, K.; Smith, J. R.; Snider, F. D.; Song, H.; Sorin, V.; St. Denis, R.; Stancari, M.; Stentz, D.; Strologas, J.; Sudo, Y.; Sukhanov, A.; Suslov, I.; Takemasa, K.; Takeuchi, Y.; Tang, J.; Tecchio, M.; Teng, P. K.; Thom, J.; Thomson, E.; Thukral, V.; Toback, D.; Tokar, S.; Tollefson, K.; Tomura, T.; Tonelli, D.; Torre, S.; Torretta, D.; Totaro, P.; Trovato, M.; Ukegawa, F.; Uozumi, S.; Vázquez, F.; Velev, G.; Vellidis, C.; Vernieri, C.; Vidal, M.; Vilar, R.; Vizán, J.; Vogel, M.; Volpi, G.; Wagner, P.; Wallny, R.; Wang, S. M.; Waters, D.; Wester, W. C.; Whiteson, D.; Wicklund, A. B.; Wilbur, S.; Williams, H. H.; Wilson, J. S.; Wilson, P.; Winer, B. L.; Wittich, P.; Wolbers, S.; Wolfe, H.; Wright, T.; Wu, X.; Wu, Z.; Yamamoto, K.; Yamato, D.; Yang, T.; Yang, U. K.; Yang, Y. C.; Yao, W.-M.; Yeh, G. P.; Yi, K.; Yoh, J.; Yorita, K.; Yoshida, T.; Yu, G. B.; Yu, I.; Zanetti, A. M.; Zeng, Y.; Zhou, C.; Zucchelli, S.; CDF Collaboration

    2015-02-01

    Results of a study of the substructure of the highest transverse momentum (pT) jets observed by the CDF Collaboration are presented. Events containing at least one jet with pT>400 GeV /c in a sample corresponding to an integrated luminosity of 5.95 fb-1 , collected in 1.96 TeV proton-antiproton collisions at the Fermilab Tevatron collider, are selected. A study of the jet mass, angularity, and planar-flow distributions is presented, and the measurements are compared with predictions of perturbative quantum chromodynamics. A search for boosted top-quark production is also described, leading to a 95% confidence level upper limit of 38 fb on the production cross section of top quarks with pT>400 GeV /c .

  4. Studies of high-transverse momentum jet substructure and top quarks produced in 1.96 TeV proton-antiproton collisions

    CERN Document Server

    Aaltonen, Timo Antero; Amerio, Silvia; Amidei, Dante E; Anastassov, Anton Iankov; Annovi, Alberto; Antos, Jaroslav; Apollinari, Giorgio; Appel, Jeffrey A; Arisawa, Tetsuo; Artikov, Akram Muzafarovich; Asaadi, Jonathan A; Ashmanskas, William Joseph; Auerbach, Benjamin; Aurisano, Adam J; Azfar, Farrukh A; Badgett, William Farris; Bae, Taegil; Barbaro-Galtieri, Angela; Barnes, Virgil E; Barnett, Bruce Arnold; Barria, Patrizia; Bartos, Pavol; Bauce, Matteo; Bedeschi, Franco; Behari, Satyajit; Bellettini, Giorgio; Bellinger, James Nugent; Benjamin, Douglas P; Beretvas, Andrew F; Bhatti, Anwar Ahmad; Bland, Karen Renee; Blumenfeld, Barry J; Bocci, Andrea; Bodek, Arie; Bortoletto, Daniela; Boudreau, Joseph Francis; Boveia, Antonio; Brigliadori, Luca; Bromberg, Carl Michael; Brucken, Erik; Budagov, Ioulian A; Budd, Howard Scott; Burkett, Kevin Alan; Busetto, Giovanni; Bussey, Peter John; Butti, Pierfrancesco; Buzatu, Adrian; Calamba, Aristotle; Camarda, Stefano; Campanelli, Mario; Canelli, Florencia; Carls, Benjamin; Carlsmith, Duncan L; Carosi, Roberto; Carrillo Moreno, Salvador; Casal Larana, Bruno; Casarsa, Massimo; Castro, Andrea; Catastini, Pierluigi; Cauz, Diego; Cavaliere, Viviana; Cavalli-Sforza, Matteo; Cerri, Alessandro; Cerrito, Lucio; Chen, Yen-Chu; Chertok, Maxwell Benjamin; Chiarelli, Giorgio; Chlachidze, Gouram; Cho, Kihyeon; Chokheli, Davit; Clark, Allan Geoffrey; Clarke, Christopher Joseph; Convery, Mary Elizabeth; Conway, John Stephen; Corbo, Matteo; Cordelli, Marco; Cox, Charles Alexander; Cox, David Jeremy; Cremonesi, Matteo; Cruz Alonso, Daniel; Cuevas Maestro, Javier; Culbertson, Raymond Lloyd; D'Ascenzo, Nicola; Datta, Mousumi; de Barbaro, Pawel; Demortier, Luc M; Deninno, Maria Maddalena; D'Errico, Maria; Devoto, Francesco; Di Canto, Angelo; Di Ruzza, Benedetto; Dittmann, Jay Richard; Donati, Simone; D'Onofrio, Monica; Dorigo, Mirco; Driutti, Anna; Duchovni, Ehud; Ebina, Koji; Edgar, Ryan Christopher; Elagin, Andrey L; Erbacher, Robin D; Errede, Steven Michael; Esham, Benjamin; Farrington, Sinead Marie; Fernández Ramos, Juan Pablo; Field, Richard D; Flanagan, Gene U; Forrest, Robert David; Franklin, Melissa EB; Freeman, John Christian; Frisch, Henry J; Funakoshi, Yujiro; Galloni, Camilla; Garfinkel, Arthur F; Garosi, Paola; Gerberich, Heather Kay; Gerchtein, Elena A; Giagu, Stefano; Giakoumopoulou, Viktoria Athina; Gibson, Karen Ruth; Ginsburg, Camille Marie; Giokaris, Nikos D; Giromini, Paolo; Glagolev, Vladimir; Glenzinski, Douglas Andrew; Gold, Michael S; Goldin, Daniel; Golossanov, Alexander; Gomez, Gervasio; Gomez-Ceballos, Guillelmo; Goncharov, Maxim T; González López, Oscar; Gorelov, Igor V; Goshaw, Alfred T; Goulianos, Konstantin A; Gramellini, Elena; Grinstein, Sebastian; Grosso-Pilcher, Carla; Group, Robert Craig; Guimaraes da Costa, Joao; Hahn, Stephen R; Han, Ji-Yeon; Happacher, Fabio; Hara, Kazuhiko; Hare, Matthew Frederick; Harr, Robert Francis; Harrington-Taber, Timothy; Hatakeyama, Kenichi; Hays, Christopher Paul; Heinrich, Joel G; Herndon, Matthew Fairbanks; Hocker, James Andrew; Hong, Ziqing; Hopkins, Walter Howard; Hou, Suen Ray; Hughes, Richard Edward; Husemann, Ulrich; Hussein, Mohammad; Huston, Joey Walter; Introzzi, Gianluca; Iori, Maurizio; Ivanov, Andrew Gennadievich; James, Eric B; Jang, Dongwook; Jayatilaka, Bodhitha Anjalike; Jeon, Eun-Ju; Jindariani, Sergo Robert; Jones, Matthew T; Joo, Kyung Kwang; Jun, Soon Yung; Junk, Thomas R; Kambeitz, Manuel; Kamon, Teruki; Karchin, Paul Edmund; Kasmi, Azeddine; Kato, Yukihiro; Ketchum, Wesley Robert; Keung, Justin Kien; Kilminster, Benjamin John; Kim, DongHee; Kim, Hyunsoo; Kim, Jieun; Kim, Min Jeong; Kim, Shin-Hong; Kim, Soo Bong; Kim, Young-Jin; Kim, Young-Kee; Kimura, Naoki; Kirby, Michael H; Knoepfel, Kyle James; Kondo, Kunitaka; Kong, Dae Jung; Konigsberg, Jacobo; Kotwal, Ashutosh Vijay; Kreps, Michal; Kroll, IJoseph; Kruse, Mark Charles; Kuhr, Thomas; Kurata, Masakazu; Laasanen, Alvin Toivo; Lammel, Stephan; Lancaster, Mark; Lannon, Kevin Patrick; Latino, Giuseppe; Lee, Hyun Su; Lee, Jaison; Leo, Sabato; Leone, Sandra; Lewis, Jonathan D; Limosani, Antonio; Lipeles, Elliot David; Lister, Alison; Liu, Hao; Liu, Qiuguang; Liu, Tiehui Ted; Lockwitz, Sarah E; Loginov, Andrey Borisovich; Lucchesi, Donatella; Lucà, Alessandra; Lueck, Jan; Lujan, Paul Joseph; Lukens, Patrick Thomas; Lungu, Gheorghe; Lys, Jeremy E; Lysak, Roman; Madrak, Robyn Leigh; Maestro, Paolo; Malik, Sarah Alam; Manca, Giulia; Manousakis-Katsikakis, Arkadios; Marchese, Luigi; Margaroli, Fabrizio; Marino, Christopher Phillip; Martínez-Perez, Mario; Matera, Keith; Mattson, Mark Edward; Mazzacane, Anna; Mazzanti, Paolo; McNulty, Ronan; Mehta, Andrew; Mehtala, Petteri; Mesropian, Christina; Miao, Ting; Mietlicki, David John; Mitra, Ankush; Miyake, Hideki; Moed, Shulamit; Moggi, Niccolo; Moon, Chang-Seong; Moore, Ronald Scott; Morello, Michael Joseph; Mukherjee, Aseet; Muller, Thomas; Murat, Pavel A; Mussini, Manuel; Nachtman, Jane Marie; Nagai, Yoshikazu; Naganoma, Junji; Nakano, Itsuo; Napier, Austin; Nett, Jason Michael; Neu, Christopher Carl; Nigmanov, Turgun S; Nodulman, Lawrence J; Noh, Seoyoung; Norniella Francisco, Olga; Oakes, Louise Beth; Oh, Seog Hwan; Oh, Young-do; Oksuzian, Iuri Artur; Okusawa, Toru; Orava, Risto Olavi; Ortolan, Lorenzo; Pagliarone, Carmine Elvezio; Palencia, Jose Enrique; Palni, Prabhakar; Papadimitriou, Vaia; Parker, William Chesluk; Pauletta, Giovanni; Paulini, Manfred; Paus, Christoph Maria Ernst; Perez, Gilad; Phillips, Thomas J; Piacentino, Giovanni M; Pianori, Elisabetta; Pilot, Justin Robert; Pitts, Kevin T; Plager, Charles; Pondrom, Lee G; Poprocki, Stephen; Potamianos, Karolos Jozef; Pranko, Aliaksandr Pavlovich; Prokoshin, Fedor; Ptohos, Fotios K; Punzi, Giovanni; Redondo Fernández, Ignacio; Renton, Peter B; Rescigno, Marco; Rimondi, Franco; Ristori, Luciano; Robson, Aidan; Rodriguez, Tatiana Isabel; Rolli, Simona; Ronzani, Manfredi; Roser, Robert Martin; Rosner, Jonathan L; Ruffini, Fabrizio; Ruiz Jimeno, Alberto; Russ, James S; Rusu, Vadim Liviu; Sakumoto, Willis Kazuo; Sakurai, Yuki; Santi, Lorenzo; Sato, Koji; Saveliev, Valeri; Savoy-Navarro, Aurore; Schlabach, Philip; Schmidt, Eugene E; Schwarz, Thomas A; Scodellaro, Luca; Scuri, Fabrizio; Seidel, Sally C; Seiya, Yoshihiro; Semenov, Alexei; Sforza, Federico; Shalhout, Shalhout Zaki; Shears, Tara G; Shepard, Paul F; Shimojima, Makoto; Shochet, Melvyn J; Shreyber-Tecker, Irina; Simonenko, Alexander V; Sinervo, Pekka; Sliwa, Krzysztof Jan; Smith, John Rodgers; Snider, Frederick Douglas; Song, Hao; Sorin, Maria Veronica; St Denis, Richard Dante; Stancari, Michelle Dawn; Stentz, Dale James; Strologas, John; Sudo, Yuji; Sukhanov, Alexander I; Suslov, Igor M; Takemasa, Ken-ichi; Takeuchi, Yuji; Tang, Jian; Tecchio, Monica; Teng, Ping-Kun; Thom, Julia; Thomson, Evelyn Jean; Thukral, Vaikunth; Toback, David A; Tokar, Stanislav; Tollefson, Kirsten Anne; Tomura, Tomonobu; Tonelli, Diego; Torre, Stefano; Torretta, Donatella; Totaro, Pierluigi; Trovato, Marco; Ukegawa, Fumihiko; Uozumi, Satoru; Velev, Gueorgui; Vellidis, Konstantinos; Vernieri, Caterina; Vidal Marono, Miguel; Vilar Cortabitarte, Rocio; Vizán Garcia, Jesus Manuel; Vogel, Marcelo; Volpi, Guido; Vázquez-Valencia, Elsa Fabiola; Wagner, Peter; Wallny, Rainer S; Wang, Song-Ming; Waters, David S; Wester, William Carl; Whiteson, Daniel O; Wicklund, Arthur Barry; Wilbur, Scott; Williams, Hugh H; Wilson, Jonathan Samuel; Wilson, Peter James; Winer, Brian L; Wittich, Peter; Wolbers, Stephen A; Wolfe, Homer; Wright, Thomas Roland; Wu, Xin; Wu, Zhenbin; Yamamoto, Kazuhiro; Yamato, Daisuke; Yang, Tingjun; Yang, Un-Ki; Yang, Yu Chul; Yao, Wei-Ming; Yeh, Gong Ping; Yi, Kai; Yoh, John; Yorita, Kohei; Yoshida, Takuo; Yu, Geum Bong; Yu, Intae; Zanetti, Anna Maria; Zeng, Yu; Zhou, Chen; Zucchelli, Stefano

    2015-02-19

    Results of a study of the substructure of the highest transverse momentum (pT) jets observed by the CDF collaboration are presented. Events containing at least one jet with pT > 400 GeV/c in a sample corresponding to an integrated luminosity of 5.95 inverse fb, collected in 1.96 TeV proton-antiproton collisions at the Fermilab Tevatron collider, are selected. A study of the jet mass, angularity, and planar-flow distributions is presented, and the measurements are compared with predictions of perturbative quantum chromodynamics. A search for boosted top-quark production is also described, leading to a 95% confidence level upper limit of 38 fb on the production cross section of top quarks with pT > 400 GeV/c.

  5. Mass and lifetime measurements of bottom and charm baryons in $p\\bar p$ collisions at $\\sqrt{s}= 1.96 TeV

    CERN Document Server

    Aaltonen, Timo Antero; Amidei, Dante E; Anastassov, Anton Iankov; Annovi, Alberto; Antos, Jaroslav; Apollinari, Giorgio; Appel, Jeffrey A; Arisawa, Tetsuo; Artikov, Akram Muzafarovich; Asaadi, Jonathan A; Ashmanskas, William Joseph; Auerbach, Benjamin; Aurisano, Adam J; Azfar, Farrukh A; Badgett, William Farris; Bae, Taegil; Barbaro-Galtieri, Angela; Barnes, Virgil E; Barnett, Bruce Arnold; Barria, Patrizia; Bartos, Pavol; Bauce, Matteo; Bedeschi, Franco; Behari, Satyajit; Bellettini, Giorgio; Bellinger, James Nugent; Benjamin, Douglas P; Beretvas, Andrew F; Bhatti, Anwar Ahmad; Bland, Karen Renee; Blumenfeld, Barry J; Bocci, Andrea; Bodek, Arie; Bortoletto, Daniela; Boudreau, Joseph Francis; Boveia, Antonio; Brigliadori, Luca; Bromberg, Carl Michael; Brucken, Erik; Budagov, Ioulian A; Budd, Howard Scott; Burkett, Kevin Alan; Busetto, Giovanni; Bussey, Peter John; Butti, Pierfrancesco; Buzatu, Adrian; Calamba, Aristotle; Camarda, Stefano; Campanelli, Mario; Canelli, Florencia; Carls, Benjamin; Carlsmith, Duncan L; Carosi, Roberto; Carrillo Moreno, Salvador; Casal Larana, Bruno; Casarsa, Massimo; Castro, Andrea; Catastini, Pierluigi; Cauz, Diego; Cavaliere, Viviana; Cavalli-Sforza, Matteo; Cerri, Alessandro; Cerrito, Lucio; Chen, Yen-Chu; Chertok, Maxwell Benjamin; Chiarelli, Giorgio; Chlachidze, Gouram; Cho, Kihyeon; Chokheli, Davit; Clark, Allan Geoffrey; Clarke, Christopher Joseph; Convery, Mary Elizabeth; Conway, John Stephen; Corbo, Matteo; Cordelli, Marco; Cox, Charles Alexander; Cox, David Jeremy; Cremonesi, Matteo; Cruz Alonso, Daniel; Cuevas Maestro, Javier; Culbertson, Raymond Lloyd; D'Ascenzo, Nicola; Datta, Mousumi; de Barbaro, Pawel; Demortier, Luc M; Deninno, Maria Maddalena; D'Errico, Maria; Devoto, Francesco; Di Canto, Angelo; Di Ruzza, Benedetto; Dittmann, Jay Richard; Donati, Simone; D'Onofrio, Monica; Dorigo, Mirco; Driutti, Anna; Ebina, Koji; Edgar, Ryan Christopher; Elagin, Andrey L; Erbacher, Robin D; Errede, Steven Michael; Esham, Benjamin; Farrington, Sinead Marie; Fernández Ramos, Juan Pablo; Field, Richard D; Flanagan, Gene U; Forrest, Robert David; Franklin, Melissa EB; Freeman, John Christian; Frisch, Henry J; Funakoshi, Yujiro; Galloni, Camilla; Garfinkel, Arthur F; Garosi, Paola; Gerberich, Heather Kay; Gerchtein, Elena A; Giagu, Stefano; Giakoumopoulou, Viktoria Athina; Gibson, Karen Ruth; Ginsburg, Camille Marie; Giokaris, Nikos D; Giromini, Paolo; Giurgiu, Gavril A; Glagolev, Vladimir; Glenzinski, Douglas Andrew; Gold, Michael S; Goldin, Daniel; Golossanov, Alexander; Gomez, Gervasio; Gomez-Ceballos, Guillelmo; Goncharov, Maxim T; González López, Oscar; Gorelov, Igor V; Goshaw, Alfred T; Goulianos, Konstantin A; Gramellini, Elena; Grinstein, Sebastian; Grosso-Pilcher, Carla; Group, Robert Craig; Guimaraes da Costa, Joao; Hahn, Stephen R; Han, Ji-Yeon; Happacher, Fabio; Hara, Kazuhiko; Hare, Matthew Frederick; Harr, Robert Francis; Harrington-Taber, Timothy; Hatakeyama, Kenichi; Hays, Christopher Paul; Heinrich, Joel G; Herndon, Matthew Fairbanks; Hocker, James Andrew; Hong, Ziqing; Hopkins, Walter Howard; Hou, Suen Ray; Hughes, Richard Edward; Husemann, Ulrich; Hussein, Mohammad; Huston, Joey Walter; Introzzi, Gianluca; Iori, Maurizio; Ivanov, Andrew Gennadievich; James, Eric B; Jang, Dongwook; Jayatilaka, Bodhitha Anjalike; Jeon, Eun-Ju; Jindariani, Sergo Robert; Jones, Matthew T; Joo, Kyung Kwang; Jun, Soon Yung; Junk, Thomas R; Kambeitz, Manuel; Kamon, Teruki; Karchin, Paul Edmund; Kasmi, Azeddine; Kato, Yukihiro; Ketchum, Wesley Robert; Keung, Justin Kien; Kilminster, Benjamin John; Kim, DongHee; Kim, Hyunsoo; Kim, Jieun; Kim, Min Jeong; Kim, Shin-Hong; Kim, Soo Bong; Kim, Young-Jin; Kim, Young-Kee; Kimura, Naoki; Kirby, Michael H; Knoepfel, Kyle James; Kondo, Kunitaka; Kong, Dae Jung; Konigsberg, Jacobo; Kotwal, Ashutosh Vijay; Kreps, Michal; Kroll, IJoseph; Kruse, Mark Charles; Kuhr, Thomas; Kurata, Masakazu; Laasanen, Alvin Toivo; Lammel, Stephan; Lancaster, Mark; Lannon, Kevin Patrick; Latino, Giuseppe; Lee, Hyun Su; Lee, Jaison; Leo, Sabato; Leone, Sandra; Lewis, Jonathan D; Limosani, Antonio; Lipeles, Elliot David; Lister, Alison; Liu, Hao; Liu, Qiuguang; Liu, Tiehui Ted; Lockwitz, Sarah E; Loginov, Andrey Borisovich; Lucchesi, Donatella; Lucà, Alessandra; Lueck, Jan; Lujan, Paul Joseph; Lukens, Patrick Thomas; Lungu, Gheorghe; Lys, Jeremy E; Lysak, Roman; Madrak, Robyn Leigh; Maestro, Paolo; Malik, Sarah Alam; Manca, Giulia; Manousakis-Katsikakis, Arkadios; Marchese, Luigi; Margaroli, Fabrizio; Marino, Christopher Phillip; Martínez-Perez, Mario; Matera, Keith; Mattson, Mark Edward; Mazzacane, Anna; Mazzanti, Paolo; McNulty, Ronan; Mehta, Andrew; Mehtala, Petteri; Mesropian, Christina; Miao, Ting; Mietlicki, David John; Mitra, Ankush; Miyake, Hideki; Moed, Shulamit; Moggi, Niccolo; Moon, Chang-Seong; Moore, Ronald Scott; Morello, Michael Joseph; Mukherjee, Aseet; Muller, Thomas; Murat, Pavel A; Mussini, Manuel; Nachtman, Jane Marie; Nagai, Yoshikazu; Naganoma, Junji; Nakano, Itsuo; Napier, Austin; Nett, Jason Michael; Neu, Christopher Carl; Nigmanov, Turgun S; Nodulman, Lawrence J; Noh, Seoyoung; Norniella Francisco, Olga; Oakes, Louise Beth; Oh, Seog Hwan; Oh, Young-do; Oksuzian, Iuri Artur; Okusawa, Toru; Orava, Risto Olavi; Ortolan, Lorenzo; Pagliarone, Carmine Elvezio; Palencia, Jose Enrique; Palni, Prabhakar; Papadimitriou, Vaia; Parker, William Chesluk; Pauletta, Giovanni; Paulini, Manfred; Paus, Christoph Maria Ernst; Phillips, Thomas J; Piacentino, Giovanni M; Pianori, Elisabetta; Pilot, Justin Robert; Pitts, Kevin T; Plager, Charles; Pondrom, Lee G; Poprocki, Stephen; Potamianos, Karolos Jozef; Pranko, Aliaksandr Pavlovich; Prokoshin, Fedor; Ptohos, Fotios K; Punzi, Giovanni; Ranjan, Niharika; Redondo Fernández, Ignacio; Renton, Peter B; Rescigno, Marco; Rimondi, Franco; Ristori, Luciano; Robson, Aidan; Rodriguez, Tatiana Isabel; Rolli, Simona; Ronzani, Manfredi; Roser, Robert Martin; Rosner, Jonathan L; Ruffini, Fabrizio; Ruiz Jimeno, Alberto; Russ, James S; Rusu, Vadim Liviu; Sakumoto, Willis Kazuo; Sakurai, Yuki; Santi, Lorenzo; Sato, Koji; Saveliev, Valeri; Savoy-Navarro, Aurore; Schlabach, Philip; Schmidt, Eugene E; Schwarz, Thomas A; Scodellaro, Luca; Scuri, Fabrizio; Seidel, Sally C; Seiya, Yoshihiro; Semenov, Alexei; Sforza, Federico; Shalhout, Shalhout Zaki; Shears, Tara G; Shepard, Paul F; Shimojima, Makoto; Shochet, Melvyn J; Shreyber-Tecker, Irina; Simonenko, Alexander V; Sliwa, Krzysztof Jan; Smith, John Rodgers; Snider, Frederick Douglas; Song, Hao; Sorin, Maria Veronica; St Denis, Richard Dante; Stancari, Michelle Dawn; Stentz, Dale James; Strologas, John; Sudo, Yuji; Sukhanov, Alexander I; Suslov, Igor M; Takemasa, Ken-ichi; Takeuchi, Yuji; Tang, Jian; Tecchio, Monica; Teng, Ping-Kun; Thom, Julia; Thomson, Evelyn Jean; Thukral, Vaikunth; Toback, David A; Tokar, Stanislav; Tollefson, Kirsten Anne; Tomura, Tomonobu; Tonelli, Diego; Torre, Stefano; Torretta, Donatella; Totaro, Pierluigi; Trovato, Marco; Ukegawa, Fumihiko; Uozumi, Satoru; Velev, Gueorgui; Vellidis, Konstantinos; Vernieri, Caterina; Vidal Marono, Miguel; Vilar Cortabitarte, Rocio; Vizán Garcia, Jesus Manuel; Vogel, Marcelo; Volpi, Guido; Vázquez-Valencia, Elsa Fabiola; Wagner, Peter; Wallny, Rainer S; Wang, Song-Ming; Waters, David S; Wester, William Carl; Whiteson, Daniel O; Wicklund, Arthur Barry; Wilbur, Scott; Williams, Hugh H; Wilson, Jonathan Samuel; Wilson, Peter James; Winer, Brian L; Wittich, Peter; Wolbers, Stephen A; Wolfe, Homer; Wright, Thomas Roland; Wu, Xin; Wu, Zhenbin; Yamamoto, Kazuhiro; Yamato, Daisuke; Yang, Tingjun; Yang, Un-Ki; Yang, Yu Chul; Yao, Wei-Ming; Yeh, Gong Ping; Yi, Kai; Yoh, John; Yorita, Kohei; Yoshida, Takuo; Yu, Geum Bong; Yu, Intae; Zanetti, Anna Maria; Zeng, Yu; Zhou, Chen; Zucchelli, Stefano

    2014-04-22

    We report on mass and lifetime measurements of several ground state charmed and bottom baryons, using a data sample corresponding to 9.6 $\\textrm{fb}^{-1}$ from $p\\bar p$ collisions at $\\sqrt{s}=1.96$ TeV, and recorded with the Collider Detector at Fermilab. Baryon candidates are reconstructed from data collected with an online event selection designed for the collection of long-lifetime heavy-flavor decay products and a second event selection designed to collect $J/\\psi \\rightarrow \\mu^+ \\, \\mu^-$ candidates. First evidence for the process $\\Omega_b^- \\rightarrow \\Omega_c^0 \\, \\pi^-$ is presented with a significance of $3.3\\sigma$. We measure the following baryon masses: \\begin{eqnarray} M(\\Xi_c^{0}) = 2470.85\\pm0.24(stat)\\pm0.55(syst) \\, MeV/c^2, \

  6. Search for dark matter in events with one jet and missing transverse energy in pp¯ collisions at √s=1.96 TeV.

    Science.gov (United States)

    Aaltonen, T; Alvarez González, B; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Apollinari, G; Appel, J A; Arisawa, T; Artikov, A; Asaadi, J; Ashmanskas, W; Auerbach, B; Aurisano, A; Azfar, F; Badgett, W; Bae, T; Bai, Y; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Barria, P; Bartos, P; Bauce, M; Bedeschi, F; Behari, S; Bellettini, G; Bellinger, J; Benjamin, D; Beretvas, A; Bhatti, A; Bisello, D; Bizjak, I; Bland, K R; Blumenfeld, B; Bocci, A; Bodek, A; Bortoletto, D; Boudreau, J; Boveia, A; Brigliadori, L; Bromberg, C; Brucken, E; Budagov, J; Budd, H S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Calamba, A; Calancha, C; Camarda, S; Campanelli, M; Campbell, M; Canelli, F; Carls, B; Carlsmith, D; Carosi, R; Carrillo, S; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavaliere, V; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, K; Chokheli, D; Chung, W H; Chung, Y S; Ciocci, M A; Clark, A; Clarke, C; Compostella, G; Convery, M E; Conway, J; Corbo, M; Cordelli, M; Cox, C A; Cox, D J; Crescioli, F; Cuevas, J; Culbertson, R; Dagenhart, D; d'Ascenzo, N; Datta, M; de Barbaro, P; Dell'Orso, M; Demortier, L; Deninno, M; Devoto, F; d'Errico, M; Di Canto, A; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Donati, S; Dong, P; Dorigo, M; Dorigo, T; Ebina, K; Elagin, A; Eppig, A; Erbacher, R; Errede, S; Ershaidat, N; Eusebi, R; Farrington, S; Feindt, M; Fernandez, J P; Field, R; Flanagan, G; Forrest, R; Fox, P J; Frank, M J; Franklin, M; Freeman, J C; Funakoshi, Y; Furic, I; Gallinaro, M; Garcia, J E; Garfinkel, A F; Garosi, P; Gerberich, H; Gerchtein, E; Giagu, S; Giakoumopoulou, V; Giannetti, P; Gibson, K; Ginsburg, C M; Giokaris, N; Giromini, P; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldin, D; Goldschmidt, N; Golossanov, A; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Grinstein, S; Grosso-Pilcher, C; Group, R C; Guimaraes da Costa, J; Hahn, S R; Halkiadakis, E; Hamaguchi, A; Han, J Y; Happacher, F; Hara, K; Hare, D; Hare, M; Harnik, R; Harr, R F; Hatakeyama, K; Hays, C; Heck, M; Heinrich, J; Herndon, M; Hewamanage, S; Hocker, A; Hopkins, W; Horn, D; Hou, S; Hughes, R E; Hurwitz, M; Husemann, U; Hussain, N; Hussein, M; Huston, J; Introzzi, G; Iori, M; Ivanov, A; James, E; Jang, D; Jayatilaka, B; Jeon, E J; Jindariani, S; Jones, M; Joo, K K; Jun, S Y; Junk, T R; Kamon, T; Karchin, P E; Kasmi, A; Kato, Y; Ketchum, W; Keung, J; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kim, Y J; Kimura, N; Kirby, M; Klimenko, S; Knoepfel, K; Kondo, K; Kong, D J; Konigsberg, J; Kotwal, A V; Kreps, M; Kroll, J; Krop, D; Kruse, M; Krutelyov, V; Kuhr, T; Kurata, M; Kwang, S; Laasanen, A T; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lecompte, T; Lee, E; Lee, H S; Lee, J S; Lee, S W; Leo, S; Leone, S; Lewis, J D; Limosani, A; Lin, C-J; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, C; Liu, H; Liu, Q; Liu, T; Lockwitz, S; Loginov, A; Lucchesi, D; Lueck, J; Lujan, P; Lukens, P; Lungu, G; Lys, J; Lysak, R; Madrak, R; Maeshima, K; Maestro, P; Malik, S; Manca, G; Manousakis-Katsikakis, A; Margaroli, F; Marino, C; Martínez, M; Mastrandrea, P; Matera, K; Mattson, M E; Mazzacane, A; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtala, P; Mesropian, C; Miao, T; Mietlicki, D; Mitra, A; Miyake, H; Moed, S; Moggi, N; Mondragon, M N; Moon, C S; Moore, R; Morello, M J; Morlock, J; Movilla Fernandez, P; Mukherjee, A; Muller, Th; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Naganoma, J; Nakano, I; Napier, A; Nett, J; Neu, C; Neubauer, M S; Nielsen, J; Nodulman, L; Noh, S Y; Norniella, O; Oakes, L; Oh, S H; Oh, Y D; Oksuzian, I; Okusawa, T; Orava, R; Ortolan, L; Pagan Griso, S; Pagliarone, C; Palencia, E; Papadimitriou, V; Paramonov, A A; Patrick, J; Pauletta, G; Paus, C; Pellett, D E; Penzo, A; Phillips, T J; Piacentino, G; Pianori, E; Pilot, J; Pitts, K; Plager, C; Pondrom, L; Poprocki, S; Potamianos, K; Prokoshin, F; Pranko, A; Ptohos, F; Punzi, G; Rahaman, A; Ramakrishnan, V; Ranjan, N; Redondo, I; Renton, P; Rescigno, M; Riddick, T; Rimondi, F; Ristori, L; Robson, A; Rodrigo, T; Rodriguez, T; Rogers, E; Rolli, S; Roser, R; Ruffini, F; Ruiz, A; Russ, J; Rusu, V; Safonov, A; Sakumoto, W K; Sakurai, Y; Santi, L; Sato, K; Saveliev, V; Savoy-Navarro, A; Schlabach, P; Schmidt, A; Schmidt, E E; Schwarz, T; Scodellaro, L; Scribano, A; Scuri, F; Seidel, S; Seiya, Y; Semenov, A; Sforza, F; Shalhout, S Z; Shears, T; Shepard, P F; Shimojima, M; Shochet, M; Shreyber-Tecker, I; Simonenko, A; Sinervo, P; Sliwa, K; Smith, J R; Snider, F D; Soha, A; Sorin, V; Song, H; Squillacioti, P; Stancari, M; St Denis, R; Stelzer, B; Stelzer-Chilton, O; Stentz, D; Strologas, J; Strycker, G L; Sudo, Y; Sukhanov, A; Suslov, I; Takemasa, K; Takeuchi, Y; Tang, J; Tecchio, M; Teng, P K; Thom, J; Thome, J; Thompson, G A; Thomson, E; Toback, D; Tokar, S; Tollefson, K; Tomura, T; Tonelli, D; Torre, S; Torretta, D; Totaro, P; Trovato, M; Ukegawa, F; Uozumi, S; Varganov, A; Vázquez, F; Velev, G; Vellidis, C; Vidal, M; Vila, I; Vilar, R; Vizán, J; Vogel, M; Volpi, G; Wagner, P; Wagner, R L; Wakisaka, T; Wallny, R; Wang, S M; Warburton, A; Waters, D; Wester, W C; Whiteson, D; Wicklund, A B; Wicklund, E; Wilbur, S; Wick, F; Williams, H H; Wilson, J S; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolfe, H; Wright, T; Wu, X; Wu, Z; Yamamoto, K; Yamato, D; Yang, T; Yang, U K; Yang, Y C; Yao, W-M; Yeh, G P; Yi, K; Yoh, J; Yorita, K; Yoshida, T; Yu, G B; Yu, I; Yu, S S; Yun, J C; Zanetti, A; Zeng, Y; Zhou, C; Zucchelli, S

    2012-05-25

    We present the results of a search for dark matter production in the monojet signature. We analyze a sample of Tevatron pp[over ¯] collisions at √s=1.96 TeV corresponding to an integrated luminosity of 6.7 fb(-1) recorded by the CDF II detector. In events with large missing transverse energy and one energetic jet, we find good agreement between the standard model prediction and the observed data. We set 90% confidence level upper limits on the dark matter production rate. The limits are translated into bounds on nucleon-dark matter scattering rates which are competitive with current direct detection bounds on spin-independent interaction below a dark matter candidate mass of 5 GeV/c(2), and on spin-dependent interactions up to masses of 200 GeV/c(2).

  7. Search for chargino-neutralino production in p anti-p collisions at s**(1/2) = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    2007-07-01

    We present the results of a search for associated production of the chargino and neutralino supersymmetric particles using up to 1.1 fb{sup -1} of integrated luminosity collected by the CDF II experiment at the Tevatron p{bar p} collider at a center-of-mass energy of 1.96 TeV. The search is conducted by analyzing events with a large transverse momentum imbalance and either three charged leptons or two charged leptons of the same electric charge. The numbers of observed events are found to be consistent with standard model expectations. Upper limits on the production cross section are derived in different theoretical models. In one of these models a lower limit on the mass of the chargino is set at 129 GeV/c{sup 2} at the 95% confidence level.

  8. Measurement of the ttbar production cross section in ppbar collisions at sqrt{s} = 1.96 TeV using kinematic characteristics of lepton + jets events

    CERN Document Server

    Abazov, V M; Abolins, M; Acharya, B S; Adams, M; Adams, T; Aguiló, E; Ahn, S H; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Ancu, L S; Andeen, T; Anderson, S; Andrieu, B; Anzelc, M S; Arnoud, Y; Arov, M; Arthaud, M; Askew, A; Åsman, B; Assis-Jesus, A C S; Atramentov, O; Autermann, C; Avila, C; Ay, C; Badaud, F; Baden, A; Bagby, L; Baldin, B; Bandurin, D V; Banerjee, S; Banerjee, P; Barberis, E; Barfuss, A F; Bargassa, P; Baringer, P; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Beale, S; Bean, A; Begalli, M; Begel, M; Belanger-Champagne, C; Bellantoni, L; Bellavance, A; Benítez, J A; Beri, S B; Bernardi, G; Bernhard, R; Berntzon, L; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Biscarat, C; Blazey, G; Blekman, F; Blessing, S; Bloch, D; Bloom, K; Böhnlein, A; Boline, D; Bolton, T A; Borissov, G; Bos, K; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Brown, D; Buchanan, N J; Buchholz, D; Bühler, M; Büscher, V; Burdin, S; Burke, S; Burnett, T H; Buszello, C P; Butler, J M; Calfayan, P; Calvet, S; Cammin, J; Caron, S; Carvalho, W; Casey, B C K; Cason, N M; Castilla-Valdez, H; Chakrabarti, S; Chakraborty, D; Chan, K M; Chan, K; Chandra, A; Charles, F; Cheu, E; Chevallier, F; Cho, D K; Choi, S; Choudhary, B; Christofek, L; Christoudias, T; Cihangir, S; Claes, D; Clément, C; Clement, B; Coadou, Y; Cooke, M; Cooper, W E; Corcoran, M; Couderc, F; Cousinou, M C; Crepe-Renaudin, S; Cutts, D; Cwiok, M; Da Motta, H; Das, A; Davies, G; De, K; De Jong, S J; de Jong, P; De La Cruz-Burelo, E; De Oliveira Martins, C; Degenhardt, J D; Déliot, F; Demarteau, M; Demina, R; Denisov, D; Denisov, S P; Desai, S; Diehl, H T; Diesburg, M; Dominguez, A; Dong, H; Dudko, L V; Duflot, L; Dugad, S R; Duggan, D; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Ellison, J; Elvira, V D; Enari, Y; Eno, S; Ermolov, P; Evans, H; Evdokimov, A; Evdokimov, V N; Ferapontov, A V; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Ford, M; Fortner, M; Fox, H; Fu, S; Fuess, S; Gadfort, T; Galea, C F; Gallas, E; Galyaev, E; García, C; García-Bellido, A; Gavrilov, V; Gay, P; Geist, W; Gelé, D; Gerber, C E; Gershtein, Yu; Gillberg, D; Ginther, G; Gollub, N; Gómez, B; Goussiou, A; Grannis, P D; Greenlee, H; Greenwood, Z D; Gregores, E M; Grenier, G; Gris, P; Grivaz, J F; Grohsjean, A; Grünendahl, S; Grünewald, M W; Guo, J; Guo, F; Gutíerrez, P; Gutíerrez, G; Haas, A; Hadley, N J; Haefner, P; Hagopian, S; Haley, J; Hall, I; Hall, R E; Han, L; Hanagaki, K; Hansson, P; Harder, K; Harel, A; Harrington, R; Hauptman, J M; Hauser, R; Hays, J; Hebbeker, T; Hedin, D; Hegeman, J G; Heinmiller, J M; Heinson, A P; Heintz, U; Hensel, C; Herner, K; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hoeth, H; Hohlfeld, M; Hong, S J; Hooper, R; Hossain, S; Houben, P; Hu, Y; Hubacek, Z; Hynek, V; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jakobs, K; Jarvis, C; Jesik, R; Johns, K; Johnson, C; Johnson, M; Jonckheere, A; Jonsson, P; Juste, A; Käfer, D; Kahn, S; Kajfasz, E; Kalinin, A M; Kalk, J R; Kalk, J M; Kappler, S; Karmanov, D; Kasper, J; Kasper, P; Katsanos, I; Kau, D; Kaur, R; Kaushik, V; Kehoe, R; Kermiche, S; Khalatyan, N; Khanov, A; Kharchilava, A I; Kharzheev, Yu M; Khatidze, D; Kim, H; Kim, T J; Kirby, M H; Kirsch, M; Klima, B; Kohli, J M; Konrath, J P; Kopal, M; Korablev, V M; Kothari, B; Kozelov, A V; Krop, D; Kryemadhi, A; Kühl, T; Kumar, A; Kunori, S; Kupco, A; Kurca, T; Kvita, J; Lacroix, F; Lam, D; Lammers, S; Landsberg, G L; Lazoflores, J; Lebrun, P; Lee, W M; Leflat, A; Lehner, F; Lellouch, J; Lesne, V; Lévêque, J; Lewis, P; Li, J; Li, Q Z; Li, L; Lietti, S M; Lima, J G R; Lincoln, D; Linnemann, J; Lipaev, V V; Lipton, R; Liu, Y; Liu, Z; Lobo, L; Lobodenko, A; Lokajícek, M; Lounis, A; Love, P; Lubatti, H J; Lyon, A L; Maciel, A K A; Mackin, D; Madaras, R J; Mättig, P; Magass, C; Magerkurth, A; Makovec, N; Mal, P K; Malbouisson, H B; Malik, S; Malyshev, V L; Mao, H S; Maravin, Y; Martin, B; McCarthy, R; Melnitchouk, A; Mendes, A; Mendoza, L; Mercadante, P G; Merkin, M; Merritt, K W; Meyer, J; Meyer, A; Michaut, M; Millet, T; Mitrevski, J; Molina, J; Mommsen, R K; Mondal, N K; Moore, R W; Moulik, T; Muanza, G S; Mulders, M; Mulhearn, M; Mundal, O; Mundim, L; Nagy, E; Naimuddin, M; Narain, M; Naumann, N A; Neal, H A; Negret, J P; Neustroev, P; Nilsen, H; Nomerotski, A; Novaes, S F; Nunnemann, T; O'Dell, V; O'Neil, D C; Obrant, G; Ochando, C; Onoprienko, D; Oshima, N; Osta, J; Otec, R; Oteroy-Garzon, G J; Owen, M; Padley, P; Pangilinan, M; Parashar, N; Park, S J; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Pawloski, G; Penning, B; Perea, P M; Peters, K; Peters, Y; Petroff, P; Petteni, M; Piegaia, R; Piper, J; Pleier, M A; Podesta-Lerma, P L M; Podstavkov, V M; Pogorelov, Y; Pol, M E; Polozov, P; Pompo, A; Pope, B G; Popov, A V; Potter, C; Prado da Silva, W L; Prosper, H B; Protopopescu, S D; Qian, J; Quadt, A; Quinn, B; Rakitine, A; Rangel, M S; Rani, K J; Ranjan, K; Ratoff, P N; Renkel, P; Reucroft, S; Rich, P; Rijssenbeek, M; Ripp-Baudot, I; Rizatdinova, F K; Robinson, S; Rodrigues, R F; Royon, C; Rubinov, P; Ruchti, R; Safronov, G; Sajot, G; Sánchez-Hernández, A; Sanders, M P; Santoro, A F S; Savage, G; Sawyer, L; Scanlon, T; Schaile, A D; Schamberger, R D; Scheglov, Y; Schellman, H; Schieferdecker, P; Schliephake, T; Schmitt, C; Schwanenberger, C; Schwartzman, A; Schwienhorst, R; Sekaric, J; Sen-Gupta, S; Severini, H; Shabalina, E; Shamim, M; Shary, V; Shchukin, A A; Shivpuri, R K; Shpakov, D; Siccardi, V; Simák, V; Sirotenko, V I; Skubic, P L; Slattery, P F; Smirnov, D; Smith, R P; Snow, J; Snow, G R; Snyder, S; Söldner-Rembold, S; Sonnenschein, L; Sopczak, A; Sosebee, M; Soustruznik, K; Souza, M; Spurlock, B; Stark, J; Steele, J; Stolin, V; Stone, A; Stoyanova, D A; Strandberg, J; Strandberg, S; Strang, M A; Strauss, M; Strauss, E; Ströhmer, R; Strom, D; Strovink, M; Stutte, L; Sumowidagdo, S; Svoisky, P; Sznajder, A; Talby, M; Tamburello, P; Tanasijczuk, A; Taylor, W; Telford, P; Temple, J; Tiller, B; Tissandier, F; Titov, M; Tokmenin, V V; Tomoto, M; Toole, T; Torchiani, I; Trefzger, T; Tsybychev, D; Tuchming, B; Tully, C; Tuts, P M; Unalan, R; Uvarov, S; Uvarov, L; Uzunyan, S; Vachon, B; Van den Berg, P J; van Eijk, B; Van Kooten, R; Van Leeuwen, W M; Varelas, N; Varnes, E W; Vartapetian, A H; Vasilyev, I A; Vaupel, M; Verdier, P; Vertogradov, L S; Verzocchi, M; Villeneuve-Séguier, F; Vint, P; Vlimant, J R; Vokac, P; Von Törne, E; Voutilainen, M; Vreeswijk, M; Wagner, R; Wahl, H D; Wang, L; Wang, M H L; Warchol, J; Watts, G; Wayne, M; Weber, M; Weber, G; Weerts, H; Wenger, A; Wermes, N; Wetstein, M; White, A; Wicke, D; Wilson, G W; Wimpenny, S J; Wobisch, M; Wood, D R; Wyatt, T R; Xie, Y; Yacoob, S; Yamada, R; Yan, M; Yasuda, T; Yatsunenko, Y A; Yip, K; Yoo, H D; Youn, S W; Yu, J; Yu, C; Yurkewicz, A; Zatserklyaniy, A; Zeitnitz, C; Zhang, D; Zhao, T; Zhou, B; Zhu, J; Zielinski, M; Zieminska, D; Zieminski, A; Zivkovic, L; Zutshi, V; Zverev, E G

    2007-01-01

    We present a measurement of the top quark pair production cross section in ppbar collisions at sqrt(s)=1.96 TeV utilizing 425 pb-1 of data collected with the D0 detector at the Fermilab Tevatron Collider. We consider the final state of the top quark pair containing one high-pT electron or muon and at least four jets. We exploit specific kinematic features of ttbar events to extract the cross section. For a top quark mass of 175 GeV, we measure sigma_ttbar = 6.4 +1.3-1.2(stat} +/- 0.7(syst)+/- 0.4(lum) pb in good agreement with the standard model prediction.

  9. Search for Neutral Higgs Bosons Decaying to Tau Pairs in pp¯ Collisions at s=1.96TeV

    Science.gov (United States)

    Abazov, V. M.; Abbott, B.; Abolins, M.; Acharya, B. S.; Adams, M.; Adams, T.; Agelou, M.; Agram, J.-L.; Ahn, S. H.; Ahsan, M.; Alexeev, G. D.; Alkhazov, G.; Alton, A.; Alverson, G.; Alves, G. A.; Anastasoaie, M.; Andeen, T.; Anderson, S.; Andrieu, B.; Anzelc, M. S.; Arnoud, Y.; Arov, M.; Askew, A.; Åsman, B.; Jesus, A. C. S. Assis; Atramentov, O.; Autermann, C.; Avila, C.; Ay, C.; Badaud, F.; Baden, A.; Bagby, L.; Baldin, B.; Bandurin, D. V.; Banerjee, P.; Banerjee, S.; Barberis, E.; Bargassa, P.; Baringer, P.; Barnes, C.; Barreto, J.; Bartlett, J. F.; Bassler, U.; Bauer, D.; Bean, A.; Begalli, M.; Begel, M.; Belanger-Champagne, C.; Bellantoni, L.; Bellavance, A.; Benitez, J. A.; Beri, S. B.; Bernardi, G.; Bernhard, R.; Berntzon, L.; Bertram, I.; Besançon, M.; Beuselinck, R.; Bezzubov, V. A.; Bhat, P. C.; Bhatnagar, V.; Binder, M.; Biscarat, C.; Black, K. M.; Blackler, I.; Blazey, G.; Blekman, F.; Blessing, S.; Bloch, D.; Bloom, K.; Blumenschein, U.; Boehnlein, A.; Boeriu, O.; Bolton, T. A.; Borcherding, F.; Borissov, G.; Bos, K.; Bose, T.; Brandt, A.; Brock, R.; Brooijmans, G.; Bross, A.; Brown, D.; Buchanan, N. J.; Buchholz, D.; Buehler, M.; Buescher, V.; Burdin, S.; Burke, S.; Burnett, T. H.; Busato, E.; Buszello, C. P.; Butler, J. M.; Calfayan, P.; Calvet, S.; Cammin, J.; Caron, S.; Carvalho, W.; Casey, B. C. K.; Cason, N. M.; Castilla-Valdez, H.; Chakrabarti, S.; Chakraborty, D.; Chan, K. M.; Chandra, A.; Chapin, D.; Charles, F.; Cheu, E.; Chevallier, F.; Cho, D. K.; Choi, S.; Choudhary, B.; Christofek, L.; Claes, D.; Clément, B.; Clément, C.; Coadou, Y.; Cooke, M.; Cooper, W. E.; Coppage, D.; Corcoran, M.; Cousinou, M.-C.; Cox, B.; Crépé-Renaudin, S.; Cutts, D.; Ćwiok, M.; da Motta, H.; Das, A.; Das, M.; Davies, B.; Davies, G.; Davis, G. A.; de, K.; de Jong, P.; de Jong, S. J.; Cruz-Burelo, E. De La; Martins, C. De Oliveira; Degenhardt, J. D.; Déliot, F.; Demarteau, M.; Demina, R.; Demine, P.; Denisov, D.; Denisov, S. P.; Desai, S.; Diehl, H. T.; Diesburg, M.; Doidge, M.; Dominguez, A.; Dong, H.; Dudko, L. V.; Duflot, L.; Dugad, S. R.; Duperrin, A.; Dyer, J.; Dyshkant, A.; Eads, M.; Edmunds, D.; Edwards, T.; Ellison, J.; Elmsheuser, J.; Elvira, V. D.; Eno, S.; Ermolov, P.; Estrada, J.; Evans, H.; Evdokimov, A.; Evdokimov, V. N.; Fatakia, S. N.; Feligioni, L.; Ferapontov, A. V.; Ferbel, T.; Fiedler, F.; Filthaut, F.; Fisher, W.; Fisk, H. E.; Fleck, I.; Ford, M.; Fortner, M.; Fox, H.; Fu, S.; Fuess, S.; Gadfort, T.; Galea, C. F.; Gallas, E.; Galyaev, E.; Garcia, C.; Garcia-Bellido, A.; Gardner, J.; Gavrilov, V.; Gay, A.; Gay, P.; Gelé, D.; Gelhaus, R.; Gerber, C. E.; Gershtein, Y.; Gillberg, D.; Ginther, G.; Gollub, N.; Gómez, B.; Gounder, K.; Goussiou, A.; Grannis, P. D.; Greenlee, H.; Greenwood, Z. D.; Gregores, E. M.; Grenier, G.; Gris, Ph.; Grivaz, J.-F.; Grünendahl, S.; Grünewald, M. W.; Guo, F.; Guo, J.; Gutierrez, G.; Gutierrez, P.; Haas, A.; Hadley, N. J.; Haefner, P.; Hagopian, S.; Haley, J.; Hall, I.; Hall, R. E.; Han, L.; Hanagaki, K.; Harder, K.; Harel, A.; Harrington, R.; Hauptman, J. M.; Hauser, R.; Hays, J.; Hebbeker, T.; Hedin, D.; Hegeman, J. G.; Heinmiller, J. M.; Heinson, A. P.; Heintz, U.; Hensel, C.; Hesketh, G.; Hildreth, M. D.; Hirosky, R.; Hobbs, J. D.; Hoeneisen, B.; Hoeth, H.; Hohlfeld, M.; Hong, S. J.; Hooper, R.; Houben, P.; Hu, Y.; Hubacek, Z.; Hynek, V.; Iashvili, I.; Illingworth, R.; Ito, A. S.; Jabeen, S.; Jaffré, M.; Jain, S.; Jakobs, K.; Jarvis, C.; Jenkins, A.; Jesik, R.; Johns, K.; Johnson, C.; Johnson, M.; Jonckheere, A.; Jonsson, P.; Juste, A.; Käfer, D.; Kahn, S.; Kajfasz, E.; Kalinin, A. M.; Kalk, J. M.; Kalk, J. R.; Kappler, S.; Karmanov, D.; Kasper, J.; Kasper, P.; Katsanos, I.; Kau, D.; Kaur, R.; Kehoe, R.; Kermiche, S.; Kesisoglou, S.; Khalatyan, N.; Khanov, A.; Kharchilava, A.; Kharzheev, Y. M.; Khatidze, D.; Kim, H.; Kim, T. J.; Kirby, M. H.; Klima, B.; Kohli, J. M.; Konrath, J.-P.; Kopal, M.; Korablev, V. M.; Kotcher, J.; Kothari, B.; Koubarovsky, A.; Kozelov, A. V.; Kozminski, J.; Kryemadhi, A.; Krzywdzinski, S.; Kuhl, T.; Kumar, A.; Kunori, S.; Kupco, A.; Kurča, T.; Kvita, J.; Lager, S.; Lammers, S.; Landsberg, G.; Lazoflores, J.; Le Bihan, A.-C.; Lebrun, P.; Lee, W. M.; Leflat, A.; Lehner, F.; Lesne, V.; Leveque, J.; Lewis, P.; Li, J.; Li, Q. Z.; Lima, J. G. R.; Lincoln, D.; Linnemann, J.; Lipaev, V. V.; Lipton, R.; Liu, Z.; Lobo, L.; Lobodenko, A.; Lokajicek, M.; Lounis, A.; Love, P.; Lubatti, H. J.; Lynker, M.; Lyon, A. L.; Maciel, A. K. A.; Madaras, R. J.; Mättig, P.; Magass, C.; Magerkurth, A.; Magnan, A.-M.; Makovec, N.; Mal, P. K.; Malbouisson, H. B.; Malik, S.; Malyshev, V. L.; Mao, H. S.; Maravin, Y.; Martens, M.; Mattingly, S. E. K.; McCarthy, R.; McCroskey, R.; Meder, D.; Melnitchouk, A.; Mendes, A.; Mendoza, L.; Merkin, M.; Merritt, K. W.

    2006-09-01

    A search for the production of neutral Higgs bosons Φ decaying into τ+τ- final states in pp¯ collisions at a center-of-mass energy of 1.96 TeV is presented. The data, corresponding to an integrated luminosity of approximately 325pb-1, were collected by the D0 experiment at the Fermilab Tevatron Collider. Since no excess compared to the expectation from standard model processes is found, limits on the production cross section times branching ratio are set. The results are combined with those obtained from the D0 search for Φb(b¯)→bb¯b(b¯) and are interpreted in the minimal supersymmetric standard model.

  10. Search for squark production in events with jets, hadronically decaying tau leptons and missing transverse energy at s**(1/2) = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abazov, V.M.; /Dubna, JINR; Abbott, B.; /Oklahoma U.; Abolins, M.; /Michigan State U.; Acharya, B.S.; /Tata Inst.; Adams, M.; /Illinois U., Chicago; Adams, T.; /Florida State U.; Aguilo, E.; /Alberta U. /Simon Fraser U. /York U., Canada /McGill U.; Ahsan, M.; /Kansas State U.; Alexeev, G.D.; /Dubna, JINR; Alkhazov, G.; /St. Petersburg, INP; Alton, A.; /Michigan U. /Northeastern U.

    2009-05-01

    A search for supersymmetric partners of quarks is performed in the topology of multijet events accompanied by at least one tau lepton decaying hadronically and large missing transverse energy. Approximately 1 fb-1 of ppbar collision data from the Fermilab Tevatron Collider at a center of mass energy of 1.96 TeV recorded by the D0 detector is analyzed. Results are combined with the previously published D0 inclusive search for squarks and gluinos. No evidence of physics beyond the standard model is found and lower limits on the squark mass up to 410 GeV are derived in the framework of minimal supergravity with tan(beta)=15, A{sub 0}=-2m{sub 0} and mu<0, in the region where decays to tau leptons dominate. Gaugino masses m{sub 1/2} are excluded up to 172 GeV.

  11. Search for excited and exotic electrons in the egamma decay channel in pp collisions at sqrt[s] = 1.96 TeV.

    Science.gov (United States)

    Acosta, D; Adelman, J; Affolder, T; Akimoto, T; Albrow, M G; Ambrose, D; Amerio, S; Amidei, D; Anastassov, A; Anikeev, K; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Arisawa, T; Arguin, J-F; Artikov, A; Ashmanskas, W; Attal, A; Azfar, F; Azzi-Bacchetta, P; Bacchetta, N; Bachacou, H; Badgett, W; Barbaro-Galtieri, A; Barker, G J; Barnes, V E; Barnett, B A; Baroiant, S; Barone, M; Bauer, G; Bedeschi, F; Behari, S; Belforte, S; Bellettini, G; Bellinger, J; Ben-Haim, E; Benjamin, D; Beretvas, A; Bhatti, A; Binkley, M; Bisello, D; Bishai, M; Blair, R E; Blocker, C; Bloom, K; Blumenfeld, B; Bocci, A; Bodek, A; Bolla, G; Bolshov, A; Booth, P S L; Bortoletto, D; Boudreau, J; Bourov, S; Bromberg, C; Brubaker, E; Budagov, J; Budd, H S; Burkett, K; Busetto, G; Bussey, P; Byrum, K L; Cabrera, S; Campanelli, M; Campbell, M; Canepa, A; Casarsa, M; Carlsmith, D; Carron, S; Carosi, R; Cavalli-Sforza, M; Castro, A; Catastini, P; Cauz, D; Cerri, A; Cerri, C; Cerrito, L; Chapman, J; Chen, C; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, I; Cho, K; Chokheli, D; Chu, M L; Chuang, S; Chung, J Y; Chung, W-H; Chung, Y S; Ciobanu, C I; Ciocci, M A; Clark, A G; Clark, D; Coca, M; Connolly, A; Convery, M; Conway, J; Cooper, B; Cordelli, M; Cortiana, G; Cranshaw, J; Cuevas, J; Culbertson, R; Currat, C; Cyr, D; Dagenhart, D; Da Ronco, S; D'Auria, S; de Barbaro, P; De Cecco, S; De Lentdecker, G; Dell'Agnello, S; Dell'Orso, M; Demers, S; Demortier, L; Deninno, M; De Pedis, D; Derwent, P F; Dionisi, C; Dittmann, J R; Doksus, P; Dominguez, A; Donati, S; Donega, M; Donini, J; D'Onofrio, M; Dorigo, T; Drollinger, V; Ebina, K; Eddy, N; Ely, R; Erbacher, R; Erdmann, M; Errede, D; Errede, S; Eusebi, R; Fang, H-C; Farrington, S; Fedorko, I; Feild, R G; Feindt, M; Fernandez, J P; Ferretti, C; Field, R D; Fiori, I; Flanagan, G; Flaugher, B; Flores-Castillo, L R; Foland, A; Forrester, S; Foster, G W; Franklin, M; Freeman, J C; Frisch, H; Fujii, Y; Furic, I; Gajjar, A; Gallas, A; Galyardt, J; Gallinaro, M; Garfinkel, A F; Gay, C; Gerberich, H; Gerdes, D W; Gerchtein, E; Giagu, S; Giannetti, P; Gibson, A; Gibson, K; Ginsburg, C; Giolo, K; Giordani, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Goldstein, D; Goldstein, J; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Gotra, Y; Goulianos, K; Gresele, A; Griffiths, M; Grosso-Pilcher, C; Grundler, U; Guenther, M; da Costa, J Guimaraes; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Hamilton, A; Han, B-Y; Handler, R; Happacher, F; Hara, K; Hare, M; Harr, R F; Harris, R M; Hartmann, F; Hatakeyama, K; Hauser, J; Hays, C; Hayward, H; Heider, E; Heinemann, B; Heinrich, J; Hennecke, M; Herndon, M; Hill, C; Hirschbuehl, D; Hocker, A; Hoffman, K D; Holloway, A; Hou, S; Houlden, M A; Huffman, B T; Huang, Y; Hughes, R E; Huston, J; Ikado, K; Incandela, J; Introzzi, G; Iori, M; Ishizawa, Y; Issever, C; Ivanov, A; Iwata, Y; Iyutin, B; James, E; Jang, D; Jarrell, J; Jeans, D; Jensen, H; Jeon, E J; Jones, M; Joo, K K; Jun, S; Junk, T; Kamon, T; Kang, J; Karagoz Unel, M; Karchin, P E; Kartal, S; Kato, Y; Kemp, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, M S; Kim, S B; Kim, S H; Kim, T H; Kim, Y K; King, B T; Kirby, M; Kirsch, L; Klimenko, S; Knuteson, B; Ko, B R; Kobayashi, H; Koehn, P; Kong, D J; Kondo, K; Konigsberg, J; Kordas, K; Korn, A; Korytov, A; Kotelnikov, K; Kotwal, A V; Kovalev, A; Kraus, J; Kravchenko, I; Kreymer, A; Kroll, J; Kruse, M; Krutelyov, V; Kuhlmann, S E; Kuznetsova, N; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, J; Lancaster, M; Lander, R; Lannon, K; Lath, A; Latino, G; Lauhakangas, R; Lazzizzera, I; Le, Y; Lecci, C; Lecompte, T; Lee, J; Lee, J; Lee, S W; Lefevre, R; Leonardo, N; Leone, S; Lewis, J D; Li, K; Lin, C; Lin, C S; Lindgren, M; Liss, T M; Litvintsev, D O; Liu, T; Liu, Y; Lockyer, N S; Loginov, A; Loreti, M; Loverre, P; Lu, R-S; Lucchesi, D; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Macqueen, D; Madrak, R; Maeshima, K; Maksimovic, P; Malferrari, L; Manca, G; Marginean, R; Martin, M; Martin, A; Martin, V; Martínez, M; Maruyama, T; Matsunaga, H; Mattson, M; Mazzanti, P; McFarland, K S; McGivern, D; McIntyre, P M; McNamara, P; NcNulty, R; Menzemer, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Miao, T; Miladinovic, N; Miller, L; Miller, R; Miller, J S; Miquel, R; Miscetti, S; Mitselmakher, G; Miyamoto, A; Miyazaki, Y; Moggi, N; Mohr, B; Moore, R; Morello, M; Mukherjee, A; Mulhearn, M; Muller, T; Mumford, R; Munar, A; Murat, P; Nachtman, J; Nahn, S; Nakamura, I; Nakano, I; Napier, A; Napora, R; Naumov, D; Necula, V; Niell, F; Nielsen, J; Nelson, C; Nelson, T; Neu, C; Neubauer, M S; Newman-Holmes, C; Nicollerat, A-S; Nigmanov, T; Nodulman, L; Norniella, O; Oesterberg, K; Ogawa, T; Oh, S H; Oh, Y D; Ohsugi, T; Okusawa, T; Oldeman, R; Orava, R; Orejudos, W; Pagliarone, C; Palencia, E; Palmonari, F; Paoletti, R; Papadimitriou, V; Pashapour, S; Patrick, J; Pauletta, G; Paulini, M; Pauly, T; Paus, C; Pellett, D; Penzo, A; Phillips, T J; Piacentino, G; Piedra, J; Pitts, K T; Plager, C; Pompos, A; Pondrom, L; Pope, G; Poukhov, O; Prakoshyn, F; Pratt, T; Pronko, A; Proudfoot, J; Ptohos, F; Punzi, G; Rademacker, J; Rakitine, A; Rappoccio, S; Ratnikov, F; Ray, H; Reichold, A; Reisert, B; Rekovic, V; Renton, P; Rescigno, M; Rimondi, F; Rinnert, K; Ristori, L; Robertson, W J; Robson, A; Rodrigo, T; Rolli, S; Rosenson, L; Roser, R; Rossin, R; Rott, C; Russ, J; Ruiz, A; Ryan, D; Saarikko, H; Sabik, S; Safonov, A; St Denis, R; Sakumoto, W K; Salamanna, G; Saltzberg, D; Sanchez, C; Sansoni, A; Santi, L; Sarkar, S; Sato, K; Savard, P; Savoy-Navarro, A; Schlabach, P; Schmidt, E E; Schmidt, M P; Schmitt, M; Scodellaro, L; Scribano, A; Scuri, F; Sedov, A; Seidel, S; Seiya, Y; Semeria, F; Sexton-Kennedy, L; Sfiligoi, I; Shapiro, M D; Shears, T; Shepard, P F; Shimojima, M; Shochet, M; Shon, Y; Shreyber, I; Sidoti, A; Siegrist, J; Siket, M; Sill, A; Sinervo, P; Sisakyan, A; Skiba, A; Slaughter, A J; Sliwa, K; Smirnov, D; Smith, J R; Snider, F D; Snihur, R; Somalwar, S V; Spalding, J; Spezziga, M; Spiegel, L; Spinella, F; Spiropulu, M; Squillacioti, P; Stadie, H; Stefanini, A; Stelzer, B; Stelzer-Chilton, O; Strologas, J; Stuart, D; Sukhanov, A; Sumorok, K; Sun, H; Suzuki, T; Taffard, A; Tafirout, R; Takach, S F; Takano, H; Takashima, R; Takeuchi, Y; Takikawa, K; Tanaka, M; Tanaka, R; Tanimoto, N; Tapprogge, S; Tecchio, M; Teng, P K; Terashi, K; Tesarek, R J; Tether, S; Thom, J; Thompson, A S; Thomson, E; Tipton, P; Tiwari, V; Tkaczyk, S; Toback, D; Tollefson, K; Tomura, T; Tonelli, D; Tönnesmann, M; Torre, S; Torretta, D; Tourneur, S; Trischuk, W; Tseng, J; Tsuchiya, R; Tsuno, S; Tsybychev, D; Turini, N; Turner, M; Ukegawa, F; Unverhau, T; Uozumi, S; Usynin, D; Vacavant, L; Vaiciulis, A; Varganov, A; Vataga, E; Vejcik, S; Velev, G; Veszpremi, V; Veramendi, G; Vickey, T; Vidal, R; Vila, I; Vilar, R; Vollrath, I; Volobouev, I; von der Mey, M; Wagner, P; Wagner, R G; Wagner, R L; Wagner, W; Wallny, R; Walter, T; Yamashita, T; Yamamoto, K; Wan, Z; Wang, M J; Wang, S M; Warburton, A; Ward, B; Waschke, S; Waters, D; Watts, T; Weber, M; Wester, W C; Whitehouse, B; Wicklund, A B; Wicklund, E; Williams, H H; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolter, M; Worcester, M; Worm, S; Wright, T; Wu, X; Würthwein, F; Wyatt, A; Yagil, A; Yang, U K; Yao, W; Yeh, G P; Yi, K; Yoh, J; Yoon, P; Yorita, K; Yoshida, T; Yu, I; Yu, S; Yu, Z; Yun, J C; Zanello, L; Zanetti, A; Zaw, I; Zetti, F; Zhou, J; Zsenei, A; Zucchelli, S

    2005-03-18

    We present a search for excited and exotic electrons (e(*)) decaying to an electron and a photon, both with high transverse momentum. We use 202 pb(-1) of data collected in pp collisions at sqrt[s] = 1.96 TeV with the Collider Detector at Fermilab II detector. No signal above standard model expectation is seen for associated ee(*) production. We discuss the e(*) sensitivity in the parameter space of the excited electron mass M(e(*)) and the compositeness energy scale Lambda. In the contact interaction model, we exclude 132 GeV/c(2)

  12. Search for first-generation scalar leptoquarks in p anti-p collisions at s**(1/2) = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Acosta, D; Adelman, J; Affolder, T

    2005-06-01

    We report on a search for pair production of first-generation scalar leptoquarks (LQ) in pp collisions at {radical}(s)=1.96 TeV using an integrated luminosity of 203 pb{sup -1} collected at the Fermilab Tevatron collider by the CDF experiment. We observe no evidence for LQ production in the topologies arising from LQLQ{yields}eqeq and LQLQ{yields}eq{nu}q, and derive 95% C.L. upper limits on the LQ production cross section. The results are combined with those obtained from a separately reported CDF search in the topology arising from LQLQ{yields}{nu}q{nu}q and 95% C.L. lower limits on the LQ mass as a function of {beta}=BR(LQ{yields}eq) are derived. The limits are 236, 205 and 145 GeV/c{sup 2} for {beta}=1, {beta}=0.5 and {beta}=0.1, respectively.

  13. Search for heavy metastable particles decaying to jet pairs in pp collisions at sqrt{s} = 1.96 TeV

    CERN Document Server

    Aaltonen, T.

    2012-01-01

    A search is performed for heavy metastable particles that decay into jet pairs with a macroscopic lifetime (ctau ~ 1 cm) in \\ppbar\\ collisions at sqrt{s} = 1.96 TeV using data from the CDF II detector at Fermilab corresponding to an integrated luminosity of 3.2 fb^-1. To estimate the standard model background a data-driven approach is used. Probability density functions are constructed to model secondary vertices from known processes. No statistically significant excess is observed above the background. Limits on the production cross section in a hidden valley benchmark phenomenology are set for various Higgs boson masses as well as metastable particle masses and lifetimes.

  14. Search for Anomalous Kinematics of Top Dilepton Events in Proton - Anti-proton Collisions at √s = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Ivanov, Andrew Gennadievich [Univ. of Rochester, NY (United States)

    2004-01-01

    The author presents a search for anomalous kinematics of t$\\bar{t}$ dilepton events in p$\\bar{p}$ collisions at √s = 1.96 TeV using 193 pb-1 of data collected with the CDF II detector. They developed a new a priori technique designed to silate the subset in a data sample revealing the largest deviation from Standard Model expectations and to quantify the significance of this departure. In the four-variable space considered, no particular subset shows a significant discrepancy and they find that the probability to obtain a data sample less consistent with the Standard Model than what is observed is 1.0-4.5%.

  15. Search for Scalar Top Quark Production in $p\\bar{p}$ Collisions at $\\sqrt{s}=1.96$ TeV

    Energy Technology Data Exchange (ETDEWEB)

    Aaltonen, T.; /Helsinki Inst. of Phys.; Alvarez Gonzalez, B.; /Oviedo U. /Cantabria Inst. of Phys.; Amerio, S.; /INFN, Padua; Amidei, D.; /Michigan U.; Anastassov, A.; /Northwestern U. /Fermilab; Annovi, A.; /Frascati; Antos, J.; /Comenius U.; Apollinari, G.; /Fermilab; Appel, J.A.; /Fermilab; Arisawa, T.; /Waseda U.; Artikov, A.; /Dubna, JINR /Texas A-M

    2012-03-01

    We report on a search for the supersymmetric partner of the top quark (scalar top) decaying into a charm quark and a neutralino in p{bar p} collisions at {radical}s = 1.96 TeV. The data sample, collected by the CDF II detector at the Fermilab Tevatron, corresponds to an integrated luminosity of 2.6 fb{sup -1}. Candidate events are selected by requiring two or more jets and a large imbalance in the transverse momentum. To enhance the analysis sensitivity, at least one of the jets is required to be identified as originating from a charm quark using an algorithm specifically designed for this analysis. The selected events are in good agreement with standard model predictions. In the case of large mass splitting between the scalar top quark and the neutralino we exclude a scalar top quark mass below 180 GeV/c{sup 2} at 95% confidence level.

  16. Search for squark production in events with jets, hadronically decaying tau leptons and missing transverse energy at {radical}(s)=1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abazov, V.M. [Joint Institute for Nuclear Research, Dubna (Russian Federation); Abbott, B. [University of Oklahoma, Norman, OK 73019 (United States); Abolins, M. [Michigan State University, East Lansing, MI 48824 (United States); Acharya, B.S. [Tata Institute of Fundamental Research, Mumbai (India); Adams, M. [University of Illinois at Chicago, Chicago, IL 60607 (United States); Adams, T. [Florida State University, Tallahassee, FL 32306 (United States); Aguilo, E. [University of Alberta, Edmonton, Alberta, and Simon Fraser University, Burnaby, British Columbia, and York University, Toronto, Ontario, and McGill University, Montreal, Quebec (Canada); Ahsan, M. [Kansas State University, Manhattan, KS 66506 (United States); Alexeev, G.D. [Joint Institute for Nuclear Research, Dubna (Russian Federation); Alkhazov, G. [Petersburg Nuclear Physics Institute, St. Petersburg (Russian Federation); Alton, A. [University of Michigan, Ann Arbor, MI 48109 (United States); Alverson, G. [Northeastern University, Boston, MA 02115 (United States); Alves, G.A. [LAFEX, Centro Brasileiro de Pesquisas Fisicas, Rio de Janeiro (Brazil); Ancu, L.S. [Radboud University Nijmegen/NIKHEF, Nijmegen (Netherlands); Andeen, T.; Anzelc, M.S. [Northwestern University, Evanston, IL 60208 (United States); Aoki, M. [Fermi National Accelerator Laboratory, Batavia, IL 60510 (United States); Arnoud, Y. [LPSC, Universite Joseph Fourier Grenoble 1, CNRS/IN2P3, Institut National Polytechnique de Grenoble, Grenoble (France); Arov, M. [Louisiana Tech University, Ruston, LA 71272 (United States); Arthaud, M. [CEA, Irfu, SPP, Saclay (France)] (and others)

    2009-09-14

    A search for supersymmetric partners of quarks is performed in the topology of multijet events accompanied by at least one tau lepton decaying hadronically and large missing transverse energy. Approximately 1 fb{sup -1} of pp-bar collision data from the Fermilab Tevatron Collider at a center of mass energy of 1.96 TeV recorded by the DO detector is analyzed. Results are combined with the previously published DO inclusive search for squarks and gluinos. No evidence of physics beyond the Standard Model is found and lower limits on the squark mass up to 410 GeV are derived in the framework of minimal supergravity with tan{beta}=15, A{sub 0}=-2m{sub 0} and {mu}<0, in the region where decays to tau leptons dominate. Gaugino masses m{sub 1/2} are excluded up to 172 GeV.

  17. Structural and preliminary molecular dynamics studies of the Rhodobacter sphaeroides reaction center and its mutant form L(M196)H + H(M202)L

    Science.gov (United States)

    Klyashtorny, V. G.; Fufina, T. Yu.; Vasilieva, L. G.; Shuvalov, V. A.; Gabdulkhakov, A. G.

    2014-07-01

    Pigment-protein interactions are responsible for the high efficiency of the light-energy transfer and conversion in photosynthesis. The reaction center (RC) from the purple bacterium Rhodobacter sphaeroides is the most convenient model for studying the mechanisms of primary processes of photosynthesis. Site-directed mutagenesis can be used to study the effect of the protein environment of electron-transfer cofactors on the optical properties, stability, pigment composition, and functional activity of RC. The preliminary analysis of RC was performed by computer simulation of the amino acid substitutions L(M196)H + H(M202)L at the pigment-protein interface and by estimating the stability of the threedimensional structure of the mutant RC by the molecular dynamics method. The doubly mutated reaction center was overexpressed, purified, and crystallized. The three-dimensional structure of this mutant was determined by X-ray crystallography and compared with the molecular dynamics model.

  18. Determination of the strong coupling constant from the inclusive jet cross section in ppbar collisions at sqrt(s)=1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abazov, V.M.; /Dubna, JINR; Abbott, B.; /Oklahoma U.; Abolins, M.; /Michigan State U.; Acharya, B.S.; /Tata Inst.; Adams, M.; /Illinois U., Chicago; Adams, T.; /Florida State U.; Aguilo, E.; /Alberta U. /Simon Fraser U. /York U., Canada /McGill U.; Ahsan, M.; /Kansas State U.; Alexeev, G.D.; /Dubna, JINR; Alkhazov, G.; /St. Petersburg, INP; Alton, A.; /Michigan U. /Northeastern U.

    2009-11-01

    We determine the strong coupling constant {alpha}{sub s} and its energy dependence from the p{sub T} dependence of the inclusive jet cross section in p{bar p} collisions at {radical}s = 1.96 TeV. The strong coupling constant is determined over the transverse momentum range 50 < p{sub T} < 145 GeV. Using perturbative QCD calculations to order {Omicron}({alpha}{sub s}{sup 3}) combined with {Omicron}({alpha}{sub s}{sup 4}) contributions from threshold corrections, we obtain {alpha}{sub s}(M{sub Z}) = 0.1173{sub -0.0049}{sup +0.0041}. This is the most precise result obtained at a hadron-hadron collider.

  19. Search for Gluino-Mediated Sbottom Production in p anti-p Collisions at s**(1/2) = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Aaltonen, T.; /Helsinki Inst. of Phys.; Adelman, Jahred A.; /Chicago U., EFI; Akimoto, T.; /Tsukuba U.; Alvarez Gonzalez, B.; /Cantabria Inst. of Phys.; Amerio, S.; /INFN, Padua; Amidei, Dante E.; /Michigan U.; Anastassov, A.; /Northwestern U.; Annovi, Alberto; /Frascati; Antos, Jaroslav; /Comenius U.; Apollinari, G.; /Fermilab; Apresyan, A.; /Purdue U. /Waseda U.

    2009-03-01

    We report on a search for the supersymmetric partner of the bottom quark produced from gluino decays in data from 2.5 fb{sup -1} of integrated luminosity collected by the Collider Detector at Fermilab at {radical}s = 1.96 TeV. Candidate events are selected requiring two or more jets and large missing transverse energy. At least two of the jets are required to be tagged as originating from a b quark to enhance the sensitivity. The results are in good agreement with the prediction of the standard model processes, giving no evidence for gluino decay to sbottom quarks. This result constrains the gluino-pair-production cross section to be less than 40 fb at 95% credibility level for a gluino mass of 350 GeV/c{sup 2}.

  20. Top quark pair production cross section measurements in p anti-p collisions at s**(1/2) = 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Cabrera, S.; /Valencia U., IFIC

    2006-07-01

    The CDF and D0 experiments have measured the t{bar t} production cross section in p{bar p} collisions at {radical}s = 1.96 TeV from different final states using a wide variety of techniques. CDF has combined 6 measurements using data samples with integrated luminosities up to 760 pb{sup -1}: {sigma}{sub t{bar t}} = 7.3 {+-} 0.5(stat) {+-} 0.6(syst) {+-} 0.4(lum) pb in good agreement with the theoretical calculations: 6.7 {+-} 0.8 pb for a top mass of 175 GeV/c{sup 2}. The experimental precision of the current CDF combined result is comparable for the first time to the accuracy of the QCD NLO theory: {approx} 12%.

  1. First observation of dijet events with an antiproton tag at √s = 1.96 TeV using the D0 Forward Proton Detector

    Energy Technology Data Exchange (ETDEWEB)

    Strang, Michael Allen [Univ. of Texas, Arlington, TX (United States)

    2005-08-01

    The Forward Proton Detector (FPD) is a new sub-system of the D0 detector, a 5000 ton particle physics detector located at the Fermilab Tevatron proton-antiproton collider. The FPD was implemented for the Tevatron Run II and gives access to a wide range of diffractive scattering processes, where one or both of the beam particles remain intact. The analysis described in this thesis makes use of the dipole spectrometer of the FPD to tag outgoing antiprotons in events that have a dijet signature in the central D0 calorimeter. Properties of jets with a diffractive tag signature are compared to jets without such a signature yielding the first observation of tagged diffractive dijets at a 1.96 TeV center-of-mass energy.

  2. Search for the Higgs boson in H --> WW(*) decays in pp collisions at square root of 1.96 TeV.

    Science.gov (United States)

    Abazov, V M; Abbott, B; Abolins, M; Acharya, B S; Adams, M; Adams, T; Agelou, M; Agram, J-L; Ahn, S H; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Andeen, T; Anderson, S; Andrieu, B; Arnoud, Y; Arov, M; Askew, A; Asman, B; Assis Jesus, A C S; Atramentov, O; Autermann, C; Avila, C; Badaud, F; Baden, A; Bagby, L; Baldin, B; Balm, P W; Banerjee, P; Banerjee, S; Barberis, E; Bargassa, P; Baringer, P; Barnes, C; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Bean, A; Beauceron, S; Begalli, M; Begel, M; Bellavance, A; Beri, S B; Bernardi, G; Bernhard, R; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Binder, M; Biscarat, C; Black, K M; Blackler, I; Blazey, G; Blekman, F; Blessing, S; Bloch, D; Blumenschein, U; Boehnlein, A; Boeriu, O; Bolton, T A; Borcherding, F; Borissov, G; Bos, K; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Buchanan, N J; Buchholz, D; Buehler, M; Buescher, V; Burdin, S; Burke, S; Burnett, T H; Busato, E; Buszello, C P; Butler, J M; Cammin, J; Caron, S; Carvalho, W; Casey, B C K; Cason, N M; Castilla-Valdez, H; Chakrabarti, S; Chakraborty, D; Chan, K M; Chandra, A; Chapin, D; Charles, F; Cheu, E; Cho, D K; Choi, S; Choudhary, B; Christiansen, T; Christofek, L; Claes, D; Clément, B; Clément, C; Coadou, Y; Cooke, M; Cooper, W E; Coppage, D; Corcoran, M; Cothenet, A; Cousinou, M-C; Cox, B; Crépé-Renaudin, S; Cutts, D; da Motta, H; Das, M; Davies, B; Davies, G; Davis, G A; De, K; de Jong, P; de Jong, S J; De La Cruz-Burelo, E; De Oliveira Martins, C; Dean, S; Degenhardt, J D; Déliot, F; Demarteau, M; Demina, R; Demine, P; Denisov, D; Denisov, S P; Desai, S; Diehl, H T; Diesburg, M; Doidge, M; Dong, H; Doulas, S; Dudko, L V; Duflot, L; Dugad, S R; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Edwards, T; Ellison, J; Elmsheuser, J; Elvira, V D; Eno, S; Ermolov, P; Estrada, J; Evans, H; Evdokimov, A; Evdokimov, V N; Fast, J; Fatakia, S N; Feligioni, L; Ferapontov, A V; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Fleck, I; Fortner, M; Fox, H; Fu, S; Fuess, S; Gadfort, T; Galea, C F; Gallas, E; Galyaev, E; Garcia, C; Garcia-Bellido, A; Gardner, J; Gavrilov, V; Gay, A; Gay, P; Gelé, D; Gelhaus, R; Genser, K; Gerber, C E; Gershtein, Y; Gillberg, D; Ginther, G; Golling, T; Gollub, N; Gómez, B; Gounder, K; Goussiou, A; Grannis, P D; Greder, S; Greenlee, H; Greenwood, Z D; Gregores, E M; Gris, Ph; Grivaz, J-F; Grünendahl, S; Grünewald, M W; Gutierrez, G; Gutierrez, P; Haas, A; Hadley, N J; Hagopian, S; Haley, J; Hall, I; Hall, R E; Han, C; Han, L; Hanagaki, K; Harder, K; Harel, A; Harrington, R; Hauptman, J M; Hauser, R; Hays, J; Hebbeker, T; Hedin, D; Heinmiller, J M; Heinson, A P; Heintz, U; Hensel, C; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hohlfeld, M; Hong, S J; Hooper, R; Houben, P; Hu, Y; Huang, J; Hynek, V; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jain, V; Jakobs, K; Jarvis, C; Jenkins, A; Jesik, R; Johns, K; Johnson, M; Jonckheere, A; Jonsson, P; Juste, A; Käfer, D; Kahn, S; Kajfasz, E; Kalinin, A M; Kalk, J; Karmanov, D; Kasper, J; Katsanos, I; Kau, D; Kaur, R; Kehoe, R; Kermiche, S; Kesisoglou, S; Khanov, A; Kharchilava, A; Kharzheev, Y M; Kim, H; Kim, T J; Klima, B; Kohli, J M; Konrath, J-P; Kopal, M; Korablev, V M; Kotcher, J; Kothari, B; Koubarovsky, A; Kozelov, A V; Kozminski, J; Kryemadhi, A; Krzywdzinski, S; Kulik, Y; Kumar, A; Kunori, S; Kupco, A; Kurca, T; Kvita, J; Lager, S; Lahrichi, N; Landsberg, G; Lazoflores, J; Le Bihan, A-C; Lebrun, P; Lee, W M; Leflat, A; Lehner, F; Leonidopoulos, C; Lesne, V; Leveque, J; Lewis, P; Li, J; Li, Q Z; Lima, J G R; Lincoln, D; Linn, S L; Linnemann, J; Lipaev, V V; Lipton, R; Lobo, L; Lobodenko, A; Lokajicek, M; Lounis, A; Love, P; Lubatti, H J; Lueking, L; Lynker, M; Lyon, A L; Maciel, A K A; Madaras, R J; Mättig, P; Magass, C; Magerkurth, A; Magnan, A-M; Makovec, N; Mal, P K; Malbouisson, H B; Malik, S; Malyshev, V L; Mao, H S; Maravin, Y; Martens, M; Mattingly, S E K; McCarthy, R; McCroskey, R; Meder, D; Melnitchouk, A; Mendes, A; Mendoza, L; Merkin, M; Merritt, K W; Meyer, A; Meyer, J; Michaut, M; Miettinen, H; Mitrevski, J; Molina, J; Mondal, N K; Monk, J; Moore, R W; Moulik, T; Muanza, G S; Mulders, M; Mundim, L; Mutaf, Y D; Nagy, E; Naimuddin, M; Narain, M; Naumann, N A; Neal, H A; Negret, J P; Nelson, S; Neustroev, P; Noeding, C; Nomerotski, A; Novaes, S F; Nunnemann, T; Nurse, E; O'dell, V; O'neil, D C; Oguri, V; Oliveira, N; Oshima, N; Otero Y Garzón, G J; Padley, P; Parashar, N; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Pawloski, G; Perea, P M; Perez, E; Pétroff, P; Petteni, M; Piegaia, R; Pleier, M-A; Podesta-Lerma, P L M; Podstavkov, V M; Pogorelov, Y; Pol, M-E; Pompos, A; Pope, B G; Prado da Silva, W L; Prosper, H B; Protopopescu, S; Qian, J; Quadt, A; Quinn, B; Rani, K J; Ranjan, K; Rapidis, P A; Ratoff, P N; Reucroft, S; Rijssenbeek, M; Ripp-Baudot, I; Rizatdinova, F; Robinson, S; Rodrigues, R F; Royon, C; Rubinov, P; Ruchti, R; Rud, V I; Sajot, G; Sánchez-Hernández, A; Sanders, M P; Santoro, A; Savage, G; Sawyer, L; Scanlon, T; Schaile, D; Schamberger, R D; Scheglov, Y; Schellman, H; Schieferdecker, P; Schmitt, C; Schwanenberger, C; Schwartzman, A; Schwienhorst, R; Sengupta, S; Severini, H; Shabalina, E; Shamim, M; Shary, V; Shchukin, A A; Shephard, W D; Shivpuri, R K; Shpakov, D; Sidwell, R A; Simak, V; Sirotenko, V; Skubic, P; Slattery, P; Smith, R P; Smolek, K; Snow, G R; Snow, J; Snyder, S; Söldner-Rembold, S; Song, X; Sonnenschein, L; Sopczak, A; Sosebee, M; Soustruznik, K; Souza, M; Spurlock, B; Stanton, N R; Stark, J; Steele, J; Stevenson, K; Stolin, V; Stone, A; Stoyanova, D A; Strandberg, J; Strang, M A; Strauss, M; Ströhmer, R; Strom, D; Strovink, M; Stutte, L; Sumowidagdo, S; Sznajder, A; Talby, M; Tamburello, P; Taylor, W; Telford, P; Temple, J; Titov, M; Tomoto, M; Toole, T; Torborg, J; Towers, S; Trefzger, T; Trincaz-Duvoid, S; Tsybychev, D; Tuchming, B; Tully, C; Turcot, A S; Tuts, P M; Uvarov, L; Uvarov, S; Uzunyan, S; Vachon, B; van den Berg, P J; Van Kooten, R; van Leeuwen, W M; Varelas, N; Varnes, E W; Vartapetian, A; Vasilyev, I A; Vaupel, M; Verdier, P; Vertogradov, L S; Verzocchi, M; Villeneuve-Seguier, F; Vlimant, J-R; Von Toerne, E; Vreeswijk, M; Vu Anh, T; Wahl, H D; Wang, L; Warchol, J; Watts, G; Wayne, M; Weber, M; Weerts, H; Wermes, N; Wetstein, M; White, A; White, V; Wicke, D; Wijngaarden, D A; Wilson, G W; Wimpenny, S J; Wobisch, M; Womersley, J; Wood, D R; Wyatt, T R; Xie, Y; Xu, Q; Xuan, N; Yacoob, S; Yamada, R; Yan, M; Yasuda, T; Yatsunenko, Y A; Yen, Y; Yip, K; Yoo, H D; Youn, S W; Yu, J; Yurkewicz, A; Zabi, A; Zatserklyaniy, A; Zdrazil, M; Zeitnitz, C; Zhang, D; Zhao, T; Zhao, Z; Zhou, B; Zhu, J; Zielinski, M; Zieminska, D; Zieminski, A; Zitoun, R; Zutshi, V; Zverev, E G

    2006-01-13

    We present a search for the standard model Higgs boson in H --> WW(*) decays with e+e-, e+/-mu-/+, and mu+mu- final states in pp collisions at a center-of-mass energy of square root of s = 1.96 TeV. The data, collected from April 2002 to June 2004 with the D0 detector, correspond to an integrated luminosity of 300-325 pb(-1), depending on the final state. The number of events observed is consistent with the expectation from backgrounds. Limits from the combination of all three channels on the Higgs boson production cross section times branching ratio sigma x BR(H --> WW(*) are presented.

  3. Measurement of the WW production cross section in pp collisions at square root[s]=1.96 TeV.

    Science.gov (United States)

    Abazov, V M; Abbott, B; Abolins, M; Acharya, B S; Adams, M; Adams, T; Agelou, M; Agram, J-L; Ahn, S H; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Anderson, S; Andrieu, B; Arnoud, Y; Askew, A; Asman, B; Atramentov, O; Autermann, C; Avila, C; Badaud, F; Baden, A; Baldin, B; Balm, P W; Banerjee, S; Barberis, E; Bargassa, P; Baringer, P; Barnes, C; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Bean, A; Beauceron, S; Begel, M; Bellavance, A; Beri, S B; Bernardi, G; Bernhard, R; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Binder, M; Black, K M; Blackler, I; Blazey, G; Blekman, F; Blessing, S; Bloch, D; Blumenschein, U; Boehnlein, A; Boeriu, O; Bolton, T A; Borcherding, F; Borissov, G; Bos, K; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Buchanan, N J; Buchholz, D; Buehler, M; Buescher, V; Burdin, S; Burnett, T H; Busato, E; Butler, J M; Bystricky, J; Carvalho, W; Casey, B C K; Cason, N M; Castilla-Valdez, H; Chakrabarti, S; Chakraborty, D; Chan, K M; Chandra, A; Chapin, D; Charles, F; Cheu, E; Chevalier, L; Cho, D K; Choi, S; Christiansen, T; Christofek, L; Claes, D; Clément, B; Clément, C; Coadou, Y; Cooke, M; Cooper, W E; Coppage, D; Corcoran, M; Coss, J; Cothenet, A; Cousinou, M-C; Crépé-Renaudin, S; Cristetiu, M; Cummings, M A C; Cutts, D; da Motta, H; Davies, B; Davies, G; Davis, G A; De, K; de Jong, P; de Jong, S J; De La Cruz-Burelo, E; De Oliveria Martins, C; Dean, S; Déliot, F; Delsart, P A; Demarteau, M; Demina, R; Demine, P; Denisov, D; Denisov, S P; Desai, S; Diehl, H T; Diesburg, M; Doidge, M; Dong, H; Doulas, S; Duflot, L; Dugad, S R; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Edwards, T; Ellison, J; Elmsheuser, J; Eltzroth, J T; Elvira, V D; Eno, S; Ermolov, P; Eroshin, O V; Estrada, J; Evans, D; Evans, H; Evdokimov, A; Evdokimov, V N; Fast, J; Fatakia, S N; Feligioni, L; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Fortner, M; Fox, H; Freeman, W; Fu, S; Fuess, S; Gadfort, T; Galea, C F; Gallas, E; Galyaev, E; Garcia, C; Garcia-Bellido, A; Gardner, J; Gavrilov, V; Gay, P; Gelé, D; Gelhaus, R; Genser, K; Gerber, C E; Gershtein, Y; Ginther, G; Golling, T; Gómez, B; Gounder, K; Goussiou, A; Grannis, P D; Greder, S; Greenlee, H; Greenwood, Z D; Gregores, E M; Gris, Ph; Grivaz, J-F; Groer, L; Grünendahl, S; Grünewald, M W; Gurzhiev, S N; Gutierrez, G; Gutierrez, P; Haas, A; Hadley, N J; Hagopian, S; Hall, I; Hall, R E; Han, C; Han, L; Hanagaki, K; Harder, K; Harrington, R; Hauptman, J M; Hauser, R; Hays, J; Hebbeker, T; Hedin, D; Heinmiller, J M; Heinson, A P; Heintz, U; Hensel, C; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hohlfeld, M; Hong, S J; Hooper, R; Houben, P; Hu, Y; Huang, J; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jain, V; Jakobs, K; Jenkins, A; Jesik, R; Johns, K; Johnson, M; Jonckheere, A; Jonsson, P; Jöstlein, H; Juste, A; Kado, M M; Käfer, D; Kahl, W; Kahn, S; Kajfasz, E; Kalinin, A M; Kalk, J; Karmanov, D; Kasper, J; Kau, D; Kehoe, R; Kermiche, S; Kesisoglou, S; Khanov, A; Kharchilava, A; Kharzheev, Y M; Kim, K H; Klima, B; Klute, M; Kohli, J M; Kopal, M; Korablev, V M; Kotcher, J; Kothari, B; Koubarovsky, A; Kozelov, A V; Kozminski, J; Krzywdzinski, S; Kuleshov, S; Kulik, Y; Kunori, S; Kupco, A; Kurca, T; Lager, S; Lahrichi, N; Landsberg, G; Lazoflores, J; Le Bihan, A-C; Lebrun, P; Lee, S W; Lee, W M; Leflat, A; Lehner, F; Leonidopoulos, C; Lewis, P; Li, J; Li, Q Z; Lima, J G R; Lincoln, D; Linn, S L; Linnemann, J; Lipaev, V V; Lipton, R; Lobo, L; Lobodenko, A; Lokajicek, M; Lounis, A; Lubatti, H J; Lueking, L; Lynker, M; Lyon, A L; Maciel, A K A; Madaras, R J; Mättig, P; Magerkurth, A; Magnan, A-M; Makovec, N; Mal, P K; Malik, S; Malyshev, V L; Mao, H S; Maravin, Y; Martens, M; Mattingly, S E K; Mayorov, A A; McCarthy, R; McCroskey, R; Meder, D; Melanson, H L; Melnitchouk, A; Merkin, M; Merritt, K W; Meyer, A; Miettinen, H; Mihalcea, D; Mitrevski, J; Mokhov, N; Molina, J; Mondal, N K; Montgomery, H E; Moore, R W; Muanza, G S; Mulders, M; Mutaf, Y D; Nagy, E; Narain, M; Naumann, N A; Neal, H A; Negret, J P; Nelson, S; Neustroev, P; Noeding, C; Nomerotski, A; Novaes, S F; Nunnemann, T; Nurse, E; O'Dell, V; O'Neil, D C; Oguri, V; Oliveira, N; Oshima, N; Otero y Garzón, G J; Padley, P; Parashar, N; Park, J; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Perea, P M; Perez, E; Peters, O; Pétroff, P; Petteni, M; Phaf, L; Piegaia, R; Podesta-Lerma, P L M; Podstavkov, V M; Pogorelov, Y; Pope, B G; Prado da Silva, W L; Prosper, H B; Protopopescu, S; Przybycien, M B; Qian, J; Quadt, A; Quinn, B; Rani, K J; Rapidis, P A; Ratoff, P N; Reay, N W; Reucroft, S; Rijssenbeek, M; Ripp-Baudot, I; Rizatdinova, F; Royon, C; Rubinov, P; Ruchti, R; Sajot, G; Sánchez-Hernández, A; Sanders, M P; Santoro, A; Savage, G; Sawyer, L; Scanlon, T; Schamberger, R D; Schellman, H; Schieferdecker, P; Schmitt, C; Schukin, A A; Schwartzman, A; Schwienhorst, R; Sengupta, S; Severini, H; Shabalina, E; Shamim, M; Shary, V; Shephard, W D; Shpakov, D; Sidwell, R A; Simak, V; Sirotenko, V; Skubic, P; Slattery, P; Smith, R P; Smolek, K; Snow, G R; Snow, J; Snyder, S; Söldner-Rembold, S; Song, X; Song, Y; Sonnenschein, L; Sopczak, A; Sosebee, M; Soustruznik, K; Souza, M; Spurlock, B; Stanton, N R; Stark, J; Steele, J; Steinbrück, G; Stevenson, K; Stolin, V; Stone, A; Stoyanova, D A; Strandberg, J; Strang, M A; Strauss, M; Ströhmer, R; Strovink, M; Stutte, L; Sumowidagdo, S; Sznajder, A; Talby, M; Tamburello, P; Taylor, W; Telford, P; Temple, J; Tentindo-Repond, S; Thomas, E; Thooris, B; Tomoto, M; Toole, T; Torborg, J; Towers, S; Trefzger, T; Trincaz-Duvoid, S; Tuchming, B; Tully, C; Turcot, A S; Tuts, P M; Uvarov, L; Uvarov, S; Uzunyan, S; Vachon, B; Van Kooten, R; van Leeuwen, W M; Varelas, N; Varnes, E W; Vasilyev, I A; Vaupel, M; Verdier, P; Vertogradov, L S; Verzocchi, M; Villeneuve-Seguier, F; Vlimant, J-R; Von Toerne, E; Vreeswijk, M; Vu Anh, T; Wahl, H D; Walker, R; Wang, L; Wang, Z-M; Warchol, J; Warsinsky, M; Watts, G; Wayne, M; Weber, M; Weerts, H; Wegner, M; Wermes, N; White, A; White, V; Whiteson, D; Wicke, D; Wijngaarden, D A; Wilson, G W; Wimpenny, S J; Wittlin, J; Wobisch, M; Womersley, J; Wood, D R; Wyatt, T R; Xu, Q; Xuan, N; Yamada, R; Yan, M; Yasuda, T; Yatsunenko, Y A; Yen, Y; Yip, K; Youn, S W; Yu, J; Yurkewicz, A; Zabi, A; Zatserklyaniy, A; Zdrazil, M; Zeitnitz, C; Zhang, D; Zhang, X; Zhao, T; Zhao, Z; Zhou, B; Zhu, J; Zielinski, M; Zieminska, D; Zieminski, A; Zitoun, R; Zutshi, V; Zverev, E G; Zylberstejn, A

    2005-04-22

    We present a measurement of the W boson pair-production cross section in pp collisions at a center-of-mass energy of sqrt[s]=1.96 TeV. The data, collected with the Run II D0 detector at Fermilab, correspond to an integrated luminosity of 224-252 pb(-1) depending on the final state (ee, emu, or mumu). We observe 25 candidates with a background expectation of 8.1+/-0.6(stat)+/-0.6(syst)+/-0.5(lum) events. The probability for an upward fluctuation of the background to produce the observed signal is 2.3x10(-7), equivalent to 5.2 standard deviations. The measurement yields a cross section of 13.8(+4.3)(-3.8)(stat)+1.2-0.9(syst)+/-0.9(lum) pb, in agreement with predictions from the standard model.

  4. Search for neutral, long-lived particles decaying into two muons in pp[over] collisions at sqrt[s]=1.96 TeV.

    Science.gov (United States)

    Abazov, V M; Abbott, B; Abolins, M; Acharya, B S; Adams, M; Adams, T; Agelou, M; Ahn, S H; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Andeen, T; Anderson, S; Andrieu, B; Anzelc, M S; Arnoud, Y; Arov, M; Askew, A; Asman, B; Jesus, A C S Assis; Atramentov, O; Autermann, C; Avila, C; Ay, C; Badaud, F; Baden, A; Bagby, L; Baldin, B; Bandurin, D V; Banerjee, P; Banerjee, S; Barberis, E; Bargassa, P; Baringer, P; Barnes, C; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Bean, A; Begalli, M; Begel, M; Belanger-Champagne, C; Bellantoni, L; Bellavance, A; Benitez, J A; Beri, S B; Bernardi, G; Bernhard, R; Berntzon, L; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Binder, M; Biscarat, C; Black, K M; Blackler, I; Blazey, G; Blekman, F; Blessing, S; Bloch, D; Bloom, K; Blumenschein, U; Boehnlein, A; Boeriu, O; Bolton, T A; Borissov, G; Bos, K; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Brown, D; Buchanan, N J; Buchholz, D; Buehler, M; Buescher, V; Burdin, S; Burke, S; Burnett, T H; Busato, E; Buszello, C P; Butler, J M; Calfayan, P; Calvet, S; Cammin, J; Caron, S; Carvalho, W; Casey, B C K; Cason, N M; Castilla-Valdez, H; Chakraborty, D; Chan, K M; Chandra, A; Charles, F; Cheu, E; Chevallier, F; Cho, D K; Choi, S; Choudhary, B; Christofek, L; Claes, D; Clément, B; Clément, C; Coadou, Y; Cooke, M; Cooper, W E; Coppage, D; Corcoran, M; Cousinou, M-C; Cox, B; Crépé-Renaudin, S; Cutts, D; Cwiok, M; da Motta, H; Das, A; Das, M; Davies, B; Davies, G; Davis, G A; De, K; de Jong, P; de Jong, S J; Cruz-Burelo, E De La; Martins, C De Oliveira; Degenhardt, J D; Déliot, F; Demarteau, M; Demina, R; Demine, P; Denisov, D; Denisov, S P; Desai, S; Diehl, H T; Diesburg, M; Doidge, M; Dominguez, A; Dong, H; Dudko, L V; Duflot, L; Dugad, S R; Duggan, D; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Edwards, T; Ellison, J; Elmsheuser, J; Elvira, V D; Eno, S; Ermolov, P; Evans, H; Evdokimov, A; Evdokimov, V N; Fatakia, S N; Feligioni, L; Ferapontov, A V; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Fleck, I; Ford, M; Fortner, M; Fox, H; Fu, S; Fuess, S; Gadfort, T; Galea, C F; Gallas, E; Galyaev, E; Garcia, C; Garcia-Bellido, A; Gardner, J; Gavrilov, V; Gay, A; Gay, P; Gelé, D; Gelhaus, R; Gerber, C E; Gershtein, Y; Gillberg, D; Ginther, G; Gollub, N; Gómez, B; Goussiou, A; Grannis, P D; Greenlee, H; Greenwood, Z D; Gregores, E M; Grenier, G; Gris, Ph; Grivaz, J-F; Grünendahl, S; Grünewald, M W; Guo, F; Guo, J; Gutierrez, G; Gutierrez, P; Haas, A; Hadley, N J; Haefner, P; Hagopian, S; Haley, J; Hall, I; Hall, R E; Han, L; Hanagaki, K; Harder, K; Harel, A; Harrington, R; Hauptman, J M; Hauser, R; Hays, J; Hebbeker, T; Hedin, D; Hegeman, J G; Heinmiller, J M; Heinson, A P; Heintz, U; Hensel, C; Herner, K; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hoeth, H; Hohlfeld, M; Hong, S J; Hooper, R; Houben, P; Hu, Y; Hubacek, Z; Hynek, V; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jakobs, K; Jarvis, C; Jenkins, A; Jesik, R; Johns, K; Johnson, C; Johnson, M; Jonckheere, A; Jonsson, P; Juste, A; Käfer, D; Kahn, S; Kajfasz, E; Kalinin, A M; Kalk, J M; Kalk, J R; Kappler, S; Karmanov, D; Kasper, J; Kasper, P; Katsanos, I; Kau, D; Kaur, R; Kehoe, R; Kermiche, S; Khalatyan, N; Khanov, A; Kharchilava, A; Kharzheev, Y M; Khatidze, D; Kim, H; Kim, T J; Kirby, M H; Klima, B; Kohli, J M; Konrath, J-P; Kopal, M; Korablev, V M; Kotcher, J; Kothari, B; Koubarovsky, A; Kozelov, A V; Kozminski, J; Krop, D; Kryemadhi, A; Kuhl, T; Kumar, A; Kunori, S; Kupco, A; Kurca, T; Kvita, J; Lammers, S; Landsberg, G; Lazoflores, J; Bihan, A-C Le; Lebrun, P; Lee, W M; Leflat, A; Lehner, F; Lesne, V; Leveque, J; Lewis, P; Li, J; Li, Q Z; Lima, J G R; Lincoln, D; Linnemann, J; Lipaev, V V; Lipton, R; Liu, Z; Lobo, L; Lobodenko, A; Lokajicek, M; Lounis, A; Love, P; Lubatti, H J; Lynker, M; Lyon, A L; Maciel, A K A; Madaras, R J; Mättig, P; Magass, C; Magerkurth, A; Magnan, A-M; Makovec, N; Mal, P K; Malbouisson, H B; Malik, S; Malyshev, V L; Mao, H S; Maravin, Y; Martens, M; McCarthy, R; Meder, D; Melnitchouk, A; Mendes, A; Mendoza, L; Merkin, M; Merritt, K W; Meyer, A; Meyer, J; Michaut, M; Miettinen, H; Millet, T; Mitrevski, J; Molina, J; Mondal, N K; Monk, J; Moore, R W; Moulik, T; Muanza, G S; Mulders, M; Mulhearn, M; Mundim, L; Mutaf, Y D; Nagy, E; Naimuddin, M; Narain, M; Naumann, N A; Neal, H A; Negret, J P; Neustroev, P; Noeding, C; Nomerotski, A; Novaes, S F; Nunnemann, T; O'dell, V; O'neil, D C; Obrant, G; Oguri, V; Oliveira, N; Oshima, N; Otec, R; Y Garzón, G J Otero; Owen, M; Padley, P; Parashar, N; Park, S-J; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Pawloski, G; Perea, P M; Perez, E; Peters, K; Pétroff, P; Petteni, M; Piegaia, R; Piper, J; Pleier, M-A; Podesta-Lerma, P L M; Podstavkov, V M; Pogorelov, Y; Pol, M-E; Pompos, A; Pope, B G; Popov, A V; Potter, C; da Silva, W L Prado; Prosper, H B; Protopopescu, S; Qian, J; Quadt, A; Quinn, B; Rangel, M S; Rani, K J; Ranjan, K; Ratoff, P N; Renkel, P; Reucroft, S; Rijssenbeek, M; Ripp-Baudot, I; Rizatdinova, F; Robinson, S; Rodrigues, R F; Royon, C; Rubinov, P; Ruchti, R; Rud, V I; Sajot, G; Sánchez-Hernández, A; Sanders, M P; Santoro, A; Savage, G; Sawyer, L; Scanlon, T; Schaile, D; Schamberger, R D; Scheglov, Y; Schellman, H; Schieferdecker, P; Schmitt, C; Schwanenberger, C; Schwartzman, A; Schwienhorst, R; Sekaric, J; Sengupta, S; Severini, H; Shabalina, E; Shamim, M; Shary, V; Shchukin, A A; Shephard, W D; Shivpuri, R K; Shpakov, D; Siccardi, V; Sidwell, R A; Simak, V; Sirotenko, V; Skubic, P; Slattery, P; Smith, R P; Snow, G R; Snow, J; Snyder, S; Söldner-Rembold, S; Song, X; Sonnenschein, L; Sopczak, A; Sosebee, M; Soustruznik, K; Souza, M; Spurlock, B; Stark, J; Steele, J; Stolin, V; Stone, A; Stoyanova, D A; Strandberg, J; Strandberg, S; Strang, M A; Strauss, M; Ströhmer, R; Strom, D; Strovink, M; Stutte, L; Sumowidagdo, S; Sznajder, A; Talby, M; Tamburello, P; Taylor, W; Telford, P; Temple, J; Tiller, B; Titov, M; Tokmenin, V V; Tomoto, M; Toole, T; Torchiani, I; Towers, S; Trefzger, T; Trincaz-Duvoid, S; Tsybychev, D; Tuchming, B; Tully, C; Turcot, A S; Tuts, P M; Unalan, R; Uvarov, L; Uvarov, S; Uzunyan, S; Vachon, B; van den Berg, P J; Kooten, R Van; van Leeuwen, W M; Varelas, N; Varnes, E W; Vartapetian, A; Vasilyev, I A; Vaupel, M; Verdier, P; Vertogradov, L S; Verzocchi, M; Villeneuve-Seguier, F; Vint, P; Vlimant, J-R; Toerne, E Von; Voutilainen, M; Vreeswijk, M; Wahl, H D; Wang, L; Wang, M H L S; Warchol, J; Watts, G; Wayne, M; Weber, M; Weerts, H; Wermes, N; Wetstein, M; White, A; Wicke, D; Wilson, G W; Wimpenny, S J; Wobisch, M; Womersley, J; Wood, D R; Wyatt, T R; Xie, Y; Xuan, N; Yacoob, S; Yamada, R; Yan, M; Yasuda, T; Yatsunenko, Y A; Yip, K; Yoo, H D; Youn, S W; Yu, C; Yu, J; Yurkewicz, A; Zatserklyaniy, A; Zeitnitz, C; Zhang, D; Zhao, T; Zhou, B; Zhu, J; Zielinski, M; Zieminska, D; Zieminski, A; Zutshi, V; Zverev, E G

    2006-10-20

    We present a search for a neutral particle, pair produced in pp[over] collisions at sqrt[s]=1.96 TeV, which decays into two muons and lives long enough to travel at least 5 cm before decaying. The analysis uses approximately 380 pb(-1) of data recorded with the D0 detector. The background is estimated to be about one event. No candidates are observed, and limits are set on the pair-production cross section times branching fraction into dimuons + X for such particles. For a mass of 10 GeV and lifetime of 4x10(-11) s, we exclude values greater than 0.14 pb (95% C.L.). These results are used to limit the interpretation of NuTeV's excess of dimuon events.

  5. Study of Zgamma events and limits on anomalous ZZgamma and Zgammagamma couplings in pp collisions at square root s = 1.96 TeV.

    Science.gov (United States)

    Abazov, V M; Abbott, B; Abolins, M; Acharya, B S; Adams, M; Adams, T; Agelou, M; Agram, J-L; Ahn, S H; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Andeen, T; Anderson, S; Andrieu, B; Arnoud, Y; Askew, A; Asman, B; Jesus, A C S Assis; Atramentov, O; Autermann, C; Avila, C; Badaud, F; Baden, A; Baldin, B; Balm, P W; Banerjee, S; Barberis, E; Bargassa, P; Baringer, P; Barnes, C; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Bean, A; Beauceron, S; Begel, M; Bellavance, A; Beri, S B; Bernardi, G; Bernhard, R; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Binder, M; Biscarat, C; Black, K M; Blackler, I; Blazey, G; Blekman, F; Blessing, S; Bloch, D; Blumenschein, U; Boehnlein, A; Boeriu, O; Bolton, T A; Borcherding, F; Borissov, G; Bos, K; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Buchanan, N J; Buchholz, D; Buehler, M; Buescher, V; Burdin, S; Burnett, T H; Busato, E; Butler, J M; Bystricky, J; Caron, S; Carvalho, W; Casey, B C K; Cason, N M; Castilla-Valdez, H; Chakrabarti, S; Chakraborty, D; Chan, K M; Chandra, A; Chapin, D; Charles, F; Cheu, E; Cho, D K; Choi, S; Choudhary, B; Christiansen, T; Christofek, L; Claes, D; Clément, B; Clément, C; Coadou, Y; Cooke, M; Cooper, W E; Coppage, D; Corcoran, M; Cothenet, A; Cousinou, M-C; Cox, B; Crépé-Renaudin, S; Cristetiu, M; Cutts, D; da Motta, H; Davies, B; Davies, G; Davis, G A; De, K; de Jong, P; de Jong, S J; De La Cruz-Burelo, E; De Oliveira Martins, C; Dean, S; Degenhardt, J D; Déliot, F; Demarteau, M; Demina, R; Demine, P; Denisov, D; Denisov, S P; Desai, S; Diehl, H T; Diesburg, M; Doidge, M; Dong, H; Doulas, S; Dudko, L V; Duflot, L; Dugad, S R; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Edwards, T; Ellison, J; Elmsheuser, J; Elvira, V D; Eno, S; Ermolov, P; Eroshin, O V; Estrada, J; Evans, D; Evans, H; Evdokimov, A; Evdokimov, V N; Fast, J; Fatakia, S N; Feligioni, L; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Fleck, I; Fortner, M; Fox, H; Fu, S; Fuess, S; Gadfort, T; Galea, C F; Gallas, E; Galyaev, E; Garcia, C; Garcia-Bellido, A; Gardner, J; Gavrilov, V; Gay, P; Gelé, D; Gelhaus, R; Genser, K; Gerber, C E; Gershtein, Y; Ginther, G; Golling, T; Gómez, B; Gounder, K; Goussiou, A; Grannis, P D; Greder, S; Greenlee, H; Greenwood, Z D; Gregores, E M; Gris, Ph; Grivaz, J-F; Groer, L; Grünendahl, S; Grünewald, M W; Gurzhiev, S N; Gutierrez, G; Gutierrez, P; Haas, A; Hadley, N J; Hagopian, S; Hall, I; Hall, R E; Han, C; Han, L; Hanagaki, K; Harder, K; Harrington, R; Hauptman, J M; Hauser, R; Hays, J; Hebbeker, T; Hedin, D; Heinmiller, J M; Heinson, A P; Heintz, U; Hensel, C; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hohlfeld, M; Hong, S J; Hooper, R; Houben, P; Hu, Y; Huang, J; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jain, V; Jakobs, K; Jenkins, A; Jesik, R; Johns, K; Johnson, M; Jonckheere, A; Jonsson, P; Juste, A; Käfer, D; Kahl, W; Kahn, S; Kajfasz, E; Kalinin, A M; Kalk, J; Karmanov, D; Kasper, J; Kau, D; Kaur, R; Kehoe, R; Kermiche, S; Kesisoglou, S; Khanov, A; Kharchilava, A; Kharzheev, Y M; Kim, H; Klima, B; Klute, M; Kohli, J M; Kopal, M; Korablev, V M; Kotcher, J; Kothari, B; Koubarovsky, A; Kozelov, A V; Kozminski, J; Kryemadhi, A; Krzywdzinski, S; Kuleshov, S; Kulik, Y; Kumar, A; Kunori, S; Kupco, A; Kurca, T; Kvita, J; Lager, S; Lahrichi, N; Landsberg, G; Lazoflores, J; Le Bihan, A-C; Lebrun, P; Lee, W M; Leflat, A; Lehner, F; Leonidopoulos, C; Leveque, J; Lewis, P; Li, J; Li, Q Z; Lima, J G R; Lincoln, D; Linn, S L; Linnemann, J; Lipaev, V V; Lipton, R; Lobo, L; Lobodenko, A; Lokajicek, M; Lounis, A; Love, P; Lubatti, H J; Lueking, L; Lynker, M; Lyon, A L; Maciel, A K A; Madaras, R J; Mättig, P; Magass, C; Magerkurth, A; Magnan, A-M; Makovec, N; Mal, P K; Malbouisson, H B; Malik, S; Malyshev, V L; Mao, H S; Maravin, Y; Martens, M; Mattingly, S E K; Mayorov, A A; McCarthy, R; McCroskey, R; Meder, D; Melanson, H L; Melnitchouk, A; Mendes, A; Merkin, M; Merritt, K W; Meyer, A; Michaut, M; Miettinen, H; Mitrevski, J; Mokhov, N; Molina, J; Mondal, N K; Moore, R W; Muanza, G S; Mulders, M; Mutaf, Y D; Nagy, E; Narain, M; Naumann, N A; Neal, H A; Negret, J P; Nelson, S; Neustroev, P; Noeding, C; Nomerotski, A; Novaes, S F; Nunnemann, T; Nurse, E; O'Dell, V; O'Neil, D C; Oguri, V; Oliveira, N; Oshima, N; Otero Y Garzón, G J; Padley, P; Parashar, N; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Perea, P M; Perez, E; Pétroff, P; Petteni, M; Phaf, L; Piegaia, R; Pleier, M-A; Podesta-Lerma, P L M; Podstavkov, V M; Pogorelov, Y; Pope, B G; Prado da Silva, W L; Prosper, H B; Protopopescu, S; Qian, J; Quadt, A; Quinn, B; Rani, K J; Ranjan, K; Rapidis, P A; Ratoff, P N; Reay, N W; Reucroft, S; Rijssenbeek, M; Ripp-Baudot, I; Rizatdinova, F; Rodrigues, R F; Royon, C; Rubinov, P; Ruchti, R; Rud, V I; Sajot, G; Sánchez-Hernández, A; Sanders, M P; Santoro, A; Savage, G; Sawyer, L; Scanlon, T; Schaile, D; Schamberger, R D; Schellman, H; Schieferdecker, P; Schmitt, C; Schwartzman, A; Schwienhorst, R; Sengupta, S; Severini, H; Shabalina, E; Shamim, M; Shary, V; Shchukin, A A; Shephard, W D; Shivpuri, R K; Shpakov, D; Sidwell, R A; Simak, V; Sirotenko, V; Skubic, P; Slattery, P; Smith, R P; Smolek, K; Snow, G R; Snow, J; Snyder, S; Söldner-Rembold, S; Song, X; Sonnenschein, L; Sopczak, A; Sosebee, M; Soustruznik, K; Souza, M; Spurlock, B; Stanton, N R; Stark, J; Steele, J; Stevenson, K; Stolin, V; Stone, A; Stoyanova, D A; Strandberg, J; Strang, M A; Strauss, M; Ströhmer, R; Strom, D; Strovink, M; Stutte, L; Sumowidagdo, S; Sznajder, A; Talby, M; Tamburello, P; Taylor, W; Telford, P; Temple, J; Thomas, E; Thooris, B; Tomoto, M; Toole, T; Torborg, J; Towers, S; Trefzger, T; Trincaz-Duvoid, S; Tuchming, B; Tully, C; Turcot, A S; Tuts, P M; Uvarov, L; Uvarov, S; Uzunyan, S; Vachon, B; Van Kooten, R; van Leeuwen, W M; Varelas, N; Varnes, E W; Vartapetian, A; Vasilyev, I A; Vaupel, M; Verdier, P; Vertogradov, L S; Verzocchi, M; Villeneuve-Seguier, F; Vlimant, J-R; Von Toerne, E; Vreeswijk, M; Vu Anh, T; Wahl, H D; Walker, R; Wang, L; Wang, Z-M; Warchol, J; Watts, G; Wayne, M; Weber, M; Weerts, H; Wegner, M; Wermes, N; White, A; White, V; Wicke, D; Wijngaarden, D A; Wilson, G W; Wimpenny, S J; Wittlin, J; Wobisch, M; Womersley, J; Wood, D R; Wyatt, T R; Xu, Q; Xuan, N; Yacoob, S; Yamada, R; Yan, M; Yasuda, T; Yatsunenko, Y A; Yen, Y; Yip, K; Yoo, H D; Youn, S W; Yu, J; Yurkewicz, A; Zabi, A; Zatserklyaniy, A; Zdrazil, M; Zeitnitz, C; Zhang, D; Zhang, X; Zhao, T; Zhao, Z; Zhou, B; Zhu, J; Zielinski, M; Zieminska, D; Zieminski, A; Zitoun, R; Zutshi, V; Zverev, E G

    2005-07-29

    We present a measurement of the Zgamma production cross section and limits on anomalous ZZgamma and Zgammagamma couplings for form-factor scales of lambda = 750 and 1000 GeV. The measurement is based on 138 (152) candidates in the eegamma (mumugamma) final state using 320(290) pb(-1) of pp(-1) collisions at square root of s = 1.96 TeV. The 95% C.L. limits on real and imaginary parts of individual anomalous couplings are /h(10,30)Z/ < 0.23, /h(20,40)Z/ < 0.020, /h(10,30)gamma/ < 0.23, and /h(20,40)gamma/ < 0.019 for lambda = 1000 GeV.

  6. Search for pair production of scalar bottom quarks in pp collisions at square root of s = 1.96 TeV.

    Science.gov (United States)

    Abazov, V M; Abbott, B; Abolins, M; Acharya, B S; Adams, M; Adams, T; Agelou, M; Ahn, S H; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Andeen, T; Anderson, S; Andrieu, B; Anzelc, M S; Arnoud, Y; Arov, M; Askew, A; Asman, B; Jesus, A C S Assis; Atramentov, O; Autermann, C; Avila, C; Ay, C; Badaud, F; Baden, A; Bagby, L; Baldin, B; Bandurin, D V; Banerjee, P; Banerjee, S; Barberis, E; Bargassa, P; Baringer, P; Barnes, C; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Bean, A; Begalli, M; Begel, M; Belanger-Champagne, C; Bellantoni, L; Bellavance, A; Benitez, J A; Beri, S B; Bernardi, G; Bernhard, R; Berntzon, L; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Binder, M; Biscarat, C; Black, K M; Blackler, I; Blazey, G; Blekman, F; Blessing, S; Bloch, D; Bloom, K; Blumenschein, U; Boehnlein, A; Boeriu, O; Bolton, T A; Borissov, G; Bos, K; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Brown, D; Buchanan, N J; Buchholz, D; Buehler, M; Buescher, V; Burdin, S; Burke, S; Burnett, T H; Busato, E; Buszello, C P; Butler, J M; Calfayan, P; Calvet, S; Cammin, J; Caron, S; Carvalho, W; Casey, B C K; Cason, N M; Castilla-Valdez, H; Chakraborty, D; Chan, K M; Chandra, A; Charles, F; Cheu, E; Chevallier, F; Cho, D K; Choi, S; Choudhary, B; Christofek, L; Claes, D; Clément, B; Clément, C; Coadou, Y; Cooke, M; Cooper, W E; Coppage, D; Corcoran, M; Cousinou, M-C; Cox, B; Crépé-Renaudin, S; Cutts, D; Cwiok, M; da Motta, H; Das, A; Das, M; Davies, B; Davies, G; Davis, G A; De, K; de Jong, P; de Jong, S J; De La Cruz-Burelo, E; De Oliveira Martins, C; Degenhardt, J D; Déliot, F; Demarteau, M; Demina, R; Demine, P; Denisov, D; Denisov, S P; Desai, S; Diehl, H T; Diesburg, M; Doidge, M; Dominguez, A; Dong, H; Dudko, L V; Duflot, L; Dugad, S R; Duggan, D; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Edwards, T; Ellison, J; Elmsheuser, J; Elvira, V D; Eno, S; Ermolov, P; Evans, H; Evdokimov, A; Evdokimov, V N; Fatakia, S N; Feligioni, L; Ferapontov, A V; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Fleck, I; Ford, M; Fortner, M; Fox, H; Fu, S; Fuess, S; Gadfort, T; Galea, C F; Gallas, E; Galyaev, E; Garcia, C; Garcia-Bellido, A; Gardner, J; Gavrilov, V; Gay, A; Gay, P; Gelé, D; Gelhaus, R; Gerber, C E; Gershtein, Y; Gillberg, D; Ginther, G; Gollub, N; Gómez, B; Goussiou, A; Grannis, P D; Greenlee, H; Greenwood, Z D; Gregores, E M; Grenier, G; Gris, Ph; Grivaz, J-F; Grünendahl, S; Grünewald, M W; Guo, F; Guo, J; Gutierrez, G; Gutierrez, P; Haas, A; Hadley, N J; Haefner, P; Hagopian, S; Haley, J; Hall, I; Hall, R E; Han, L; Hanagaki, K; Harder, K; Harel, A; Harrington, R; Hauptman, J M; Hauser, R; Hays, J; Hebbeker, T; Hedin, D; Hegeman, J G; Heinmiller, J M; Heinson, A P; Heintz, U; Hensel, C; Herner, K; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hoeth, H; Hohlfeld, M; Hong, S J; Hooper, R; Houben, P; Hu, Y; Hubacek, Z; Hynek, V; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jakobs, K; Jarvis, C; Jenkins, A; Jesik, R; Johns, K; Johnson, C; Johnson, M; Jonckheere, A; Jonsson, P; Juste, A; Käfer, D; Kahn, S; Kajfasz, E; Kalinin, A M; Kalk, J M; Kalk, J R; Kappler, S; Karmanov, D; Kasper, J; Kasper, P; Katsanos, I; Kau, D; Kaur, R; Kehoe, R; Kermiche, S; Khalatyan, N; Khanov, A; Kharchilava, A; Kharzheev, Y M; Khatidze, D; Kim, H; Kim, T J; Kirby, M H; Klima, B; Kohli, J M; Konrath, J-P; Kopal, M; Korablev, V M; Kotcher, J; Kothari, B; Koubarovsky, A; Kozelov, A V; Kozminski, J; Krop, D; Kryemadhi, A; Kuhl, T; Kumar, A; Kunori, S; Kupco, A; Kurca, T; Kvita, J; Lammers, S; Landsberg, G; Lazoflores, J; Le Bihan, A-C; Lebrun, P; Lee, W M; Leflat, A; Lehner, F; Lesne, V; Leveque, J; Lewis, P; Li, J; Li, Q Z; Lima, J G R; Lincoln, D; Linnemann, J; Lipaev, V V; Lipton, R; Liu, Z; Lobo, L; Lobodenko, A; Lokajicek, M; Lounis, A; Love, P; Lubatti, H J; Lynker, M; Lyon, A L; Maciel, A K A; Madaras, R J; Mättig, P; Magass, C; Magerkurth, A; Magnan, A-M; Makovec, N; Mal, P K; Malbouisson, H B; Malik, S; Malyshev, V L; Mao, H S; Maravin, Y; Martens, M; McCarthy, R; Meder, D; Melnitchouk, A; Mendes, A; Mendoza, L; Merkin, M; Merritt, K W; Meyer, A; Meyer, J; Michaut, M; Miettinen, H; Millet, T; Mitrevski, J; Molina, J; Mondal, N K; Monk, J; Moore, R W; Moulik, T; Muanza, G S; Mulders, M; Mulhearn, M; Mundim, L; Mutaf, Y D; Nagy, E; Naimuddin, M; Narain, M; Naumann, N A; Neal, H A; Negret, J P; Neustroev, P; Noeding, C; Nomerotski, A; Novaes, S F; Nunnemann, T; O'Dell, V; O'Neil, D C; Obrant, G; Oguri, V; Oliveira, N; Oshima, N; Otec, R; Y Garzón, G J Otero; Owen, M; Padley, P; Parashar, N; Park, S-J; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Pawloski, G; Perea, P M; Perez, E; Peters, K; Pétroff, P; Petteni, M; Piegaia, R; Piper, J; Pleier, M-A; Podesta-Lerma, P L M; Podstavkov, V M; Pogorelov, Y; Pol, M-E; Pompos, A; Pope, B G; Popov, A V; Potter, C; Prado da Silva, W L; Prosper, H B; Protopopescu, S; Qian, J; Quadt, A; Quinn, B; Rangel, M S; Rani, K J; Ranjan, K; Ratoff, P N; Renkel, P; Reucroft, S; Rijssenbeek, M; Ripp-Baudot, I; Rizatdinova, F; Robinson, S; Rodrigues, R F; Royon, C; Rubinov, P; Ruchti, R; Rud, V I; Sajot, G; Sánchez-Hernández, A; Sanders, M P; Santoro, A; Savage, G; Sawyer, L; Scanlon, T; Schaile, D; Schamberger, R D; Scheglov, Y; Schellman, H; Schieferdecker, P; Schmitt, C; Schwanenberger, C; Schwartzman, A; Schwienhorst, R; Sekaric, J; Sengupta, S; Severini, H; Shabalina, E; Shamim, M; Shary, V; Shchukin, A A; Shephard, W D; Shivpuri, R K; Shpakov, D; Siccardi, V; Sidwell, R A; Simak, V; Sirotenko, V; Skubic, P; Slattery, P; Smith, R P; Snow, G R; Snow, J; Snyder, S; Söldner-Rembold, S; Song, X; Sonnenschein, L; Sopczak, A; Sosebee, M; Soustruznik, K; Souza, M; Spurlock, B; Stark, J; Steele, J; Stolin, V; Stone, A; Stoyanova, D A; Strandberg, J; Strandberg, S; Strang, M A; Strauss, M; Ströhmer, R; Strom, D; Strovink, M; Stutte, L; Sumowidagdo, S; Sznajder, A; Talby, M; Tamburello, P; Taylor, W; Telford, P; Temple, J; Tiller, B; Titov, M; Tokmenin, V V; Tomoto, M; Toole, T; Torchiani, I; Towers, S; Trefzger, T; Trincaz-Duvoid, S; Tsybychev, D; Tuchming, B; Tully, C; Turcot, A S; Tuts, P M; Unalan, R; Uvarov, L; Uvarov, S; Uzunyan, S; Vachon, B; van den Berg, P J; Van Kooten, R; van Leeuwen, W M; Varelas, N; Varnes, E W; Vartapetian, A; Vasilyev, I A; Vaupel, M; Verdier, P; Vertogradov, L S; Verzocchi, M; Villeneuve-Seguier, F; Vint, P; Vlimant, J-R; Von Toerne, E; Voutilainen, M; Vreeswijk, M; Wahl, H D; Wang, L; Wang, M H L S; Warchol, J; Watts, G; Wayne, M; Weber, M; Weerts, H; Wermes, N; Wetstein, M; White, A; Wicke, D; Wilson, G W; Wimpenny, S J; Wobisch, M; Womersley, J; Wood, D R; Wyatt, T R; Xie, Y; Xuan, N; Yacoob, S; Yamada, R; Yan, M; Yasuda, T; Yatsunenko, Y A; Yip, K; Yoo, H D; Youn, S W; Yu, C; Yu, J; Yurkewicz, A; Zatserklyaniy, A; Zeitnitz, C; Zhang, D; Zhao, T; Zhou, B; Zhu, J; Zielinski, M; Zieminska, D; Zieminski, A; Zutshi, V; Zverev, E G

    2006-10-27

    A search for direct production of scalar bottom quarks (b) is performed with 310 pb(-1) of data collected by the D0 experiment in pp collisions at square root s = 1.96 TeV at the Fermilab Tevatron Collider. The topology analyzed consists of two b jets and an imbalance in transverse momentum due to undetected neutralinos (chi(1)0), with chi(1)0 assumed to be the lightest supersymmetric particle. We find the data consistent with standard model expectations, and set a 95% C.L. exclusion domain in the (m(b), m(chi(1)0)) mass plane, improving significantly upon the results from run I of the Tevatron.

  7. Search for neutral Higgs bosons decaying to tau pairs in pp[over ] collisions at sqrt[s]=1.96 TeV.

    Science.gov (United States)

    Abazov, V M; Abbott, B; Abolins, M; Acharya, B S; Adams, M; Adams, T; Agelou, M; Agram, J-L; Ahn, S H; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Andeen, T; Anderson, S; Andrieu, B; Anzelc, M S; Arnoud, Y; Arov, M; Askew, A; Asman, B; Assis Jesus, A C S; Atramentov, O; Autermann, C; Avila, C; Ay, C; Badaud, F; Baden, A; Bagby, L; Baldin, B; Bandurin, D V; Banerjee, P; Banerjee, S; Barberis, E; Bargassa, P; Baringer, P; Barnes, C; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Bean, A; Begalli, M; Begel, M; Belanger-Champagne, C; Bellantoni, L; Bellavance, A; Benitez, J A; Beri, S B; Bernardi, G; Bernhard, R; Berntzon, L; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Binder, M; Biscarat, C; Black, K M; Blackler, I; Blazey, G; Blekman, F; Blessing, S; Bloch, D; Bloom, K; Blumenschein, U; Boehnlein, A; Boeriu, O; Bolton, T A; Borcherding, F; Borissov, G; Bos, K; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Brown, D; Buchanan, N J; Buchholz, D; Buehler, M; Buescher, V; Burdin, S; Burke, S; Burnett, T H; Busato, E; Buszello, C P; Butler, J M; Calfayan, P; Calvet, S; Cammin, J; Caron, S; Carvalho, W; Casey, B C K; Cason, N M; Castilla-Valdez, H; Chakrabarti, S; Chakraborty, D; Chan, K M; Chandra, A; Chapin, D; Charles, F; Cheu, E; Chevallier, F; Cho, D K; Choi, S; Choudhary, B; Christofek, L; Claes, D; Clément, B; Clément, C; Coadou, Y; Cooke, M; Cooper, W E; Coppage, D; Corcoran, M; Cousinou, M-C; Cox, B; Crépé-Renaudin, S; Cutts, D; Cwiok, M; da Motta, H; Das, A; Das, M; Davies, B; Davies, G; Davis, G A; De, K; de Jong, P; de Jong, S J; De La Cruz-Burelo, E; De Oliveira Martins, C; Degenhardt, J D; Déliot, F; Demarteau, M; Demina, R; Demine, P; Denisov, D; Denisov, S P; Desai, S; Diehl, H T; Diesburg, M; Doidge, M; Dominguez, A; Dong, H; Dudko, L V; Duflot, L; Dugad, S R; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Edwards, T; Ellison, J; Elmsheuser, J; Elvira, V D; Eno, S; Ermolov, P; Estrada, J; Evans, H; Evdokimov, A; Evdokimov, V N; Fatakia, S N; Feligioni, L; Ferapontov, A V; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Fleck, I; Ford, M; Fortner, M; Fox, H; Fu, S; Fuess, S; Gadfort, T; Galea, C F; Gallas, E; Galyaev, E; Garcia, C; Garcia-Bellido, A; Gardner, J; Gavrilov, V; Gay, A; Gay, P; Gelé, D; Gelhaus, R; Gerber, C E; Gershtein, Y; Gillberg, D; Ginther, G; Gollub, N; Gómez, B; Gounder, K; Goussiou, A; Grannis, P D; Greenlee, H; Greenwood, Z D; Gregores, E M; Grenier, G; Gris, Ph; Grivaz, J-F; Grünendahl, S; Grünewald, M W; Guo, F; Guo, J; Gutierrez, G; Gutierrez, P; Haas, A; Hadley, N J; Haefner, P; Hagopian, S; Haley, J; Hall, I; Hall, R E; Han, L; Hanagaki, K; Harder, K; Harel, A; Harrington, R; Hauptman, J M; Hauser, R; Hays, J; Hebbeker, T; Hedin, D; Hegeman, J G; Heinmiller, J M; Heinson, A P; Heintz, U; Hensel, C; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hoeth, H; Hohlfeld, M; Hong, S J; Hooper, R; Houben, P; Hu, Y; Hubacek, Z; Hynek, V; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jakobs, K; Jarvis, C; Jenkins, A; Jesik, R; Johns, K; Johnson, C; Johnson, M; Jonckheere, A; Jonsson, P; Juste, A; Käfer, D; Kahn, S; Kajfasz, E; Kalinin, A M; Kalk, J M; Kalk, J R; Kappler, S; Karmanov, D; Kasper, J; Kasper, P; Katsanos, I; Kau, D; Kaur, R; Kehoe, R; Kermiche, S; Kesisoglou, S; Khalatyan, N; Khanov, A; Kharchilava, A; Kharzheev, Y M; Khatidze, D; Kim, H; Kim, T J; Kirby, M H; Klima, B; Kohli, J M; Konrath, J-P; Kopal, M; Korablev, V M; Kotcher, J; Kothari, B; Koubarovsky, A; Kozelov, A V; Kozminski, J; Kryemadhi, A; Krzywdzinski, S; Kuhl, T; Kumar, A; Kunori, S; Kupco, A; Kurca, T; Kvita, J; Lager, S; Lammers, S; Landsberg, G; Lazoflores, J; Le Bihan, A-C; Lebrun, P; Lee, W M; Leflat, A; Lehner, F; Lesne, V; Leveque, J; Lewis, P; Li, J; Li, Q Z; Lima, J G R; Lincoln, D; Linnemann, J; Lipaev, V V; Lipton, R; Liu, Z; Lobo, L; Lobodenko, A; Lokajicek, M; Lounis, A; Love, P; Lubatti, H J; Lynker, M; Lyon, A L; Maciel, A K A; Madaras, R J; Mättig, P; Magass, C; Magerkurth, A; Magnan, A-M; Makovec, N; Mal, P K; Malbouisson, H B; Malik, S; Malyshev, V L; Mao, H S; Maravin, Y; Martens, M; Mattingly, S E K; McCarthy, R; McCroskey, R; Meder, D; Melnitchouk, A; Mendes, A; Mendoza, L; Merkin, M; Merritt, K W; Meyer, A; Meyer, J; Michaut, M; Miettinen, H; Millet, T; Mitrevski, J; Molina, J; Mondal, N K; Monk, J; Moore, R W; Moulik, T; Muanza, G S; Mulders, M; Mulhearn, M; Mundim, L; Mutaf, Y D; Nagy, E; Naimuddin, M; Narain, M; Naumann, N A; Neal, H A; Negret, J P; Nelson, S; Neustroev, P; Noeding, C; Nomerotski, A; Novaes, S F; Nunnemann, T; O'Dell, V; O'Neil, D C; Obrant, G; Oguri, V; Oliveira, N; Oshima, N; Otec, R; Otero y Garzón, G J; Owen, M; Padley, P; Parashar, N; Park, S-J; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Pawloski, G; Perea, P M; Perez, E; Peters, K; Pétroff, P; Petteni, M; Piegaia, R; Pleier, M-A; Podesta-Lerma, P L M; Podstavkov, V M; Pogorelov, Y; Pol, M-E; Pompos, A; Pope, B G; Popov, A V; Prado da Silva, W L; Prosper, H B; Protopopescu, S; Qian, J; Quadt, A; Quinn, B; Rani, K J; Ranjan, K; Rapidis, P A; Ratoff, P N; Renkel, P; Reucroft, S; Rijssenbeek, M; Ripp-Baudot, I; Rizatdinova, F; Robinson, S; Rodrigues, R F; Royon, C; Rubinov, P; Ruchti, R; Rud, V I; Sajot, G; Sánchez-Hernández, A; Sanders, M P; Santoro, A; Savage, G; Sawyer, L; Scanlon, T; Schaile, D; Schamberger, R D; Scheglov, Y; Schellman, H; Schieferdecker, P; Schmitt, C; Schwanenberger, C; Schwartzman, A; Schwienhorst, R; Sengupta, S; Severini, H; Shabalina, E; Shamim, M; Shary, V; Shchukin, A A; Shephard, W D; Shivpuri, R K; Shpakov, D; Siccardi, V; Sidwell, R A; Simak, V; Sirotenko, V; Skubic, P; Slattery, P; Smith, R P; Snow, G R; Snow, J; Snyder, S; Söldner-Rembold, S; Song, X; Sonnenschein, L; Sopczak, A; Sosebee, M; Soustruznik, K; Souza, M; Spurlock, B; Stark, J; Steele, J; Stevenson, K; Stolin, V; Stone, A; Stoyanova, D A; Strandberg, J; Strang, M A; Strauss, M; Ströhmer, R; Strom, D; Strovink, M; Stutte, L; Sumowidagdo, S; Sznajder, A; Talby, M; Tamburello, P; Taylor, W; Telford, P; Temple, J; Tiller, B; Titov, M; Tokmenin, V V; Tomoto, M; Toole, T; Torchiani, I; Towers, S; Trefzger, T; Trincaz-Duvoid, S; Tsybychev, D; Tuchming, B; Tully, C; Turcot, A S; Tuts, P M; Unalan, R; Uvarov, L; Uvarov, S; Uzunyan, S; Vachon, B; van den Berg, P J; Kooten, R Van; van Leeuwen, W M; Varelas, N; Varnes, E W; Vartapetian, A; Vasilyev, I A; Vaupel, M; Verdier, P; Vertogradov, L S; Verzocchi, M; Villeneuve-Seguier, F; Vint, P; Vlimant, J-R; Von Toerne, E; Voutilainen, M; Vreeswijk, M; Wahl, H D; Wang, L; Warchol, J; Watts, G; Wayne, M; Weber, M; Weerts, H; Wermes, N; Wetstein, M; White, A; Wicke, D; Wilson, G W; Wimpenny, S J; Wobisch, M; Womersley, J; Wood, D R; Wyatt, T R; Xie, Y; Xuan, N; Yacoob, S; Yamada, R; Yan, M; Yasuda, T; Yatsunenko, Y A; Yip, K; Yoo, H D; Youn, S W; Yu, C; Yu, J; Yurkewicz, A; Zatserklyaniy, A; Zeitnitz, C; Zhang, D; Zhao, T; Zhao, Z; Zhou, B; Zhu, J; Zielinski, M; Zieminska, D; Zieminski, A; Zutshi, V; Zverev, E G

    2006-09-22

    A search for the production of neutral Higgs bosons Phi decaying into tau(+)tau(-) final states in pp[over ] collisions at a center-of-mass energy of 1.96 TeV is presented. The data, corresponding to an integrated luminosity of approximately 325 pb(-1), were collected by the D0 experiment at the Fermilab Tevatron Collider. Since no excess compared to the expectation from standard model processes is found, limits on the production cross section times branching ratio are set. The results are combined with those obtained from the D0 search for Phib(b[over ])-->bb[over ]b(b[over ]) and are interpreted in the minimal supersymmetric standard model.

  8. Search for V+A current in top quark decay in p anti-p collisions at s**(1/2) = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abulencia, A.; Adelman, J.; Affolder, T.; Akimoto, T.; Albrow, M.G.; Ambrose, D.; Amerio, S.; Amidei, D.; Anastassov, A.; Anikeev, K.; Annovi, A.; /Taiwan, Inst. Phys.

    2006-08-01

    The authors report an upper limit on the fraction of V + A current, f{sub V+A}, in top quark decays, using approximately 700 pb{sup -1} of p{bar p} collisions at {radical}s = 1.96 TeV acquired by the upgraded Collider Detector at Fermilab. For the decay t {yields} wb {yields} {ell}vb (where {ell} = e or {mu}), the invariant mass of the charged lepton and the bottom quark jet is sensitive to the polarization of the W boson. They determine f{sub V+A} = -0.06 {+-} 0.25 given a top quark mass of 175 GeV/c{sup 2}. They set an upper limit on f{sub V+A} of 0.29 at the 95% confidence level, which represents an improvement by a factor of two on the previous best direct limit.

  9. Search for V + A current in top quark decay in p anti-p collisions at s**(1/2) = 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abulencia, A.; Adelman, J.; Affolder, T.; Akimoto, T.; Albrow, M.G.; Ambrose, D.; Amerio, S.; Amidei, D.; Anastassov, A.; Anikeev, K.; Annovi, A.; Antos, J.; Aoki, M.; Apollinari, G.; Arguin, J.-F.; Arisawa, T.; Artikov, A.; Ashmanskas, W.; Attal, A.; Azfar, F.; Azzi-Bacchetta, P.

    2006-09-01

    The authors report an upper limit on the fraction of V + A current, f{sub V+A}, in top quark decays, using approximately 700 pb{sup -1} of p{bar p} collisions at {radical}s = 1.96 TeV acquired by the upgraded Collider Detector at Fermilab. For the decay t {yields} Wb {yields} {ell}{nu}b (where {ell} = e or {mu}), the invariant mass of the charged lepton and the bottom quark jet is sensitive to the polarization of the W boson. They determine f{sub V+A} = -0.06 {+-} 0.25 given a top quark mass of 175 GeV/c{sup 2}. They set an upper limit on f{sub V+A} of 0.29 at the 95% confidence level, which represents an improvement by a factor of two on the previous best direct limit.

  10. Measurement of the Three-jet Mass Cross Section in $p\\bar{p}$ Collisions at $\\sqrt{s}=1.96$ TeV

    Energy Technology Data Exchange (ETDEWEB)

    Hubacek, Zdenek [Czech Technical Univ., Prague (Czech Republic)

    2010-06-01

    This thesis describes the measurement of the inclusive three-jet cross section in proton-antiproton collisions at √s = 1.96 TeV measured at the D0 experiment at the Fermilab Tevatron Collider in the Fermi National Accelerator Laboratory, Batavia, Illinois, USA. The cross section as a function of three-jet invariant mass is provided in three regions of the third jet transverse momentum and three regions of jet rapidities. It utilizes a data sample collected in the so called Run IIa data taking period (2002-2006) corresponding to the integrated luminosity of about 0.7 fb-1. The results are used to test the next-to-leading order predictions of Quantum chromodynamics computed using the latest parton distribution functions.

  11. Search for associated production of z and Higgs bosons in proton-antiproton collisions at 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    BackusMayes, John Alexander [Univ. of Washington, Seattle, WA (United States)

    2010-01-01

    We present a search for associated production of Z and Higgs bosons in 4.2 fb-1 of $\\bar{p}$p collisions at √s = 1.96 TeV, produced in RunII of the Tevatron and recorded by the D0 detector. The search is performed in events containing at least two muons and at least two jets. The ZH signal is distinguished from the expected backgrounds by means of multivariate classifiers known as random forests. Binned random forest output distributions are used in comparing the data to background-only and signal+background hypotheses. No excess is observed in the data, so we set upper limits on ZH production with a 95% confidence level.

  12. Measurement of the $WZ$ Cross Section and Triple Gauge Couplings in $p \\bar p$ Collisions at $\\sqrt{s} = 1.96$ TeV

    CERN Document Server

    Aaltonen, T.; Amerio, S.; Amidei, D.; Anastassov, A.; Annovi, A.; Antos, J.; Apollinari, G.; Appel, J.A.; Arisawa, T.; Artikov, A.; Asaadi, J.; Ashmanskas, W.; Auerbach, B.; Aurisano, A.; Azfar, F.; Badgett, W.; Bae, T.; Barbaro-Galtieri, A.; Barnes, V.E.; Barnett, B.A.; Barria, P.; Bartos, P.; Bauce, M.; Bedeschi, F.; Behari, S.; Bellettini, G.; Bellinger, J.; Benjamin, D.; Beretvas, A.; Bhatti, A.; Bisello, D.; Bizjak, I.; Bland, K.R.; Blumenfeld, B.; Bocci, A.; Bodek, A.; Bortoletto, D.; Boudreau, J.; Boveia, A.; Brigliadori, L.; Bromberg, C.; Brucken, E.; Budagov, J.; Budd, H.S.; Burkett, K.; Busetto, G.; Bussey, P.; Buzatu, A.; Calamba, A.; Calancha, C.; Camarda, S.; Campanelli, M.; Campbell, M.; Canelli, F.; Carls, B.; Carlsmith, D.; Carosi, R.; Carrillo, S.; Carron, S.; Casal, B.; Casarsa, M.; Castro, A.; Catastini, P.; Cauz, D.; Cavaliere, V.; Cavalli-Sforza, M.; Cerri, A.; Cerrito, L.; Chen, Y.C.; Chertok, M.; Chiarelli, G.; Chlachidze, G.; Chlebana, F.; Cho, K.; Chokheli, D.; Chung, W.H.; Chung, Y.S.; Ciocci, M.A.; Clark, A.; Clarke, C.; Compostella, G.; Convery, M.E.; Conway, J.; Corbo, M.; Cordelli, M.; Cox, C.A.; Cox, D.J.; Crescioli, F.; Cuevas, J.; Culbertson, R.; Dagenhart, D.; d'Ascenzo, N.; Datta, M.; de Barbaro, P.; Dell'Orso, M.; Demortier, L.; Deninno, M.; Devoto, F.; d'Errico, M.; Di Canto, A.; Di Ruzza, B.; Dittmann, J.R.; D'Onofrio, M.; Donati, S.; Dong, P.; Dorigo, M.; Dorigo, T.; Ebina, K.; Elagin, A.; Eppig, A.; Erbacher, R.; Errede, S.; Ershaidat, N.; Eusebi, R.; Farrington, S.; Feindt, M.; Fernandez, J.P.; Field, R.; Flanagan, G.; Forrest, R.; Frank, M.J.; Franklin, M.; Freeman, J.C.; Funakoshi, Y.; Furic, I.; Gallinaro, M.; Garcia, J.E.; Garfinkel, A.F.; Garosi, P.; Gerberich, H.; Gerchtein, E.; Giagu, S.; Giakoumopoulou, V.; Giannetti, P.; Gibson, K.; Ginsburg, C.M.; Giokaris, N.; Giromini, P.; Giurgiu, G.; Glagolev, V.; Glenzinski, D.; Gold, M.; Goldin, D.; Goldschmidt, N.; Golossanov, A.; Gomez, G.; Gomez-Ceballos, G.; Goncharov, M.; Gonzalez, O.; Gorelov, I.; Goshaw, A.T.; Goulianos, K.; Grinstein, S.; Grosso-Pilcher, C.; Group, R.C.; Guimaraes da Costa, J.; Hahn, S.R.; Halkiadakis, E.; Hamaguchi, A.; Han, J.Y.; Happacher, F.; Hara, K.; Hare, D.; Hare, M.; Harr, R.F.; Hatakeyama, K.; Hays, C.; Heck, M.; Heinrich, J.; Herndon, M.; Hewamanage, S.; Hidas, D.; Hocker, A.; Hopkins, W.; Horn, D.; Hou, S.; Hughes, R.E.; Hurwitz, M.; Husemann, U.; Hussain, N.; Hussein, M.; Huston, J.; Introzzi, G.; Iori, M.; Ivanov, A.; James, E.; Jang, D.; Jayatilaka, B.; Jeon, E.J.; Jindariani, S.; Jones, M.; Joo, K.K.; Jun, S.Y.; Junk, T.R.; Kamon, T.; Karchin, P.E.; Kasmi, A.; Kato, Y.; Ketchum, W.; Keung, J.; Khotilovich, V.; Kilminster, B.; Kim, D.H.; Kim, H.S.; Kim, J.E.; Kim, M.J.; Kim, S.B.; Kim, S.H.; Kim, Y.K.; Kim, Y.J.; Kimura, N.; Kirby, M.; Klimenko, S.; Knoepfel, K.; Kondo, K.; Kong, D.J.; Konigsberg, J.; Kotwal, A.V.; Kreps, M.; Kroll, J.; Krop, D.; Kruse, M.; Krutelyov, V.; Kuhr, T.; Kurata, M.; Kwang, S.; Laasanen, A.T.; Lami, S.; Lammel, S.; Lancaster, M.; Lander, R.L.; Lannon, K.; Lath, A.; Latino, G.; LeCompte, T.; Lee, E.; Lee, H.S.; Lee, J.S.; Lee, S.W.; Leo, S.; Leone, S.; Lewis, J.D.; Limosani, A.; Lin, C.J.; Lindgren, M.; Lipeles, E.; Lister, A.; Litvintsev, D.O.; Liu, C.; Liu, H.; Liu, Q.; Liu, T.; Lockwitz, S.; Loginov, A.; Lucchesi, D.; Lueck, J.; Lujan, P.; Lukens, P.; Lungu, G.; Lys, J.; Lysak, R.; Madrak, R.; Maeshima, K.; Maestro, P.; Malik, S.; Manca, G.; Manousakis-Katsikakis, A.; Margaroli, F.; Marino, C.; Martinez, M.; Mastrandrea, P.; Matera, K.; Mattson, M.E.; Mazzacane, A.; Mazzanti, P.; McFarland, K.S.; McIntyre, P.; McNulty, R.; Mehta, A.; Mehtala, P.; Mesropian, C.; Miao, T.; Mietlicki, D.; Mitra, A.; Miyake, H.; Moed, S.; Moggi, N.; Mondragon, M.N.; Moon, C.S.; Moore, R.; Morello, M.J.; Morlock, J.; Movilla Fernandez, P.; Mukherjee, A.; Muller, Th.; Murat, P.; Mussini, M.; Nachtman, J.; Nagai, Y.; Naganoma, J.; Nakano, I.; Napier, A.; Nett, J.; Neu, C.; Neubauer, M.S.; Nielsen, J.; Nodulman, L.; Noh, S.Y.; Norniella, O.; Oakes, L.; Oh, S.H.; Oh, Y.D.; Oksuzian, I.; Okusawa, T.; Orava, R.; Ortolan, L.; Pagan Griso, S.; Pagliarone, C.; Palencia, E.; Papadimitriou, V.; Paramonov, A.A.; Patrick, J.; Pauletta, G.; Paulini, M.; Paus, C.; Pellett, D.E.; Penzo, A.; Phillips, T.J.; Piacentino, G.; Pianori, E.; Pilot, J.; Pitts, K.; Plager, C.; Pondrom, L.; Poprocki, S.; Potamianos, K.; Prokoshin, F.; Pranko, A.; Ptohos, F.; Punzi, G.; Pursley, J.; Rahaman, A.; Ramakrishnan, V.; Ranjan, N.; Redondo, I.; Renton, P.; Rescigno, M.; Riddick, T.; Rimondi, F.; Ristori, L.; Robson, A.; Rodrigo, T.; Rodriguez, T.; Rogers, E.; Rolli, S.; Roser, R.; Ruffini, F.; Ruiz, A.; Russ, J.; Rusu, V.; Safonov, A.; Sakumoto, W.K.; Sakurai, Y.; Santi, L.; Sato, K.; Saveliev, V.; Savoy-Navarro, A.; Schlabach, P.; Schmidt, A.; Schmidt, E.E.; Schwarz, T.; Scodellaro, L.; Scribano, A.; Scuri, F.; Seidel, S.; Seiya, Y.; Semenov, A.; Sforza, F.; Shalhout, S.Z.; Shears, T.; Shepard, P.F.; Shimojima, M.; Shochet, M.; Shreyber-Tecker, I.; Simonenko, A.; Sinervo, P.; Sliwa, K.; Smith, J.R.; Snider, F.D.; Soha, A.; Sorin, V.; Song, H.; Squillacioti, P.; Stancari, M.; St. Denis, R.; Stelzer, B.; Stelzer-Chilton, O.; Stentz, D.; Strologas, J.; Strycker, G.L.; Sudo, Y.; Sukhanov, A.; Suslov, I.; Takemasa, K.; Takeuchi, Y.; Tang, J.; Tecchio, M.; Teng, P.K.; Thom, J.; Thome, J.; Thompson, G.A.; Thomson, E.; Toback, D.; Tokar, S.; Tollefson, K.; Tomura, T.; Tonelli, D.; Torre, S.; Torretta, D.; Totaro, P.; Trovato, M.; Ukegawa, F.; Uozumi, S.; Vanguri, R.; Varganov, A.; Vazquez, F.; Velev, G.; Vellidis, C.; Vidal, M.; Vila, I.; Vilar, R.; Vizan, J.; Vogel, M.; Volpi, G.; Wagner, P.; Wagner, R.L.; Wakisaka, T.; Wallny, R.; Wang, S.M.; Warburton, A.; Waters, D.; Wester, W.C., III; Whiteson, D.; Wicklund, A.B.; Wicklund, E.; Wilbur, S.; Wick, F.; Williams, H.H.; Wilson, J.S.; Wilson, P.; Winer, B.L.; Wittich, P.; Wolbers, S.; Wolfe, H.; Wright, T.; Wu, X.; Wu, Z.; Yamamoto, K.; Yamato, D.; Yang, T.; Yang, U.K.; Yang, Y.C.; Yao, W.M.; Yeh, G.P.; Yi, K.; Yoh, J.; Yorita, K.; Yoshida, T.; Yu, G.B.; Yu, I.; Yu, S.S.; Yun, J.C.; Zanetti, A.; Zeng, Y.; Zhou, C.; Zucchelli, S.

    2012-01-01

    This Letter describes the current most precise measurement of the $WZ$ production cross section as well as limits on anomalous $WWZ$ couplings at a center-of-mass energy of 1.96 TeV in proton-antiproton collisions at the Collider Detector at Fermilab (CDF). The $WZ$ candidates are reconstructed from decays containing three charged leptons and missing energy from a neutrino, where the charged leptons are either electrons or muons. Using data collected by the CDF II detector (7.1 fb$^{-1}$ of integrated luminosity), 64 candidate events are observed with the expected background contributing $8 \\pm 1$ events. The measured total cross section $\\sigma (p \\bar p \\to WZ) = 3.93_{-0.53}^{+0.60}(\\text{stat})_{-0.46}^{+0.59}(\\text{syst}) $ pb is in good agreement with the standard model prediction of $3.50\\pm 0.21$. The same sample is used to set limits on anomalous $WWZ$ couplings.

  13. Signature-based search for delayed photons in exclusive photon plus missing transverse energy events from pp¯ collisions with s=1.96TeV

    Science.gov (United States)

    Aaltonen, T.; Amerio, S.; Amidei, D.; Anastassov, A.; Annovi, A.; Antos, J.; Apollinari, G.; Appel, J. A.; Arisawa, T.; Artikov, A.; Asaadi, J.; Ashmanskas, W.; Auerbach, B.; Aurisano, A.; Azfar, F.; Badgett, W.; Bae, T.; Barbaro-Galtieri, A.; Barnes, V. E.; Barnett, B. A.; Barria, P.; Bartos, P.; Bauce, M.; Bedeschi, F.; Behari, S.; Bellettini, G.; Bellinger, J.; Benjamin, D.; Beretvas, A.; Bhatti, A.; Bland, K. R.; Blumenfeld, B.; Bocci, A.; Bodek, A.; Bortoletto, D.; Boudreau, J.; Boveia, A.; Brigliadori, L.; Bromberg, C.; Brucken, E.; Budagov, J.; Budd, H. S.; Burkett, K.; Busetto, G.; Bussey, P.; Butti, P.; Buzatu, A.; Calamba, A.; Camarda, S.; Campanelli, M.; Canelli, F.; Carls, B.; Carlsmith, D.; Carosi, R.; Carrillo, S.; Casal, B.; Casarsa, M.; Castro, A.; Catastini, P.; Cauz, D.; Cavaliere, V.; Cavalli-Sforza, M.; Cerri, A.; Cerrito, L.; Chen, Y. C.; Chertok, M.; Chiarelli, G.; Chlachidze, G.; Cho, K.; Chokheli, D.; Ciocci, M. A.; Clark, A.; Clarke, C.; Convery, M. E.; Conway, J.; Corbo, M.; Cordelli, M.; Cox, C. A.; Cox, D. J.; Cremonesi, M.; Cruz, D.; Cuevas, J.; Culbertson, R.; d'Ascenzo, N.; Datta, M.; De Barbaro, P.; Demortier, L.; Deninno, M.; d'Errico, M.; Devoto, F.; Di Canto, A.; Di Ruzza, B.; Dittmann, J. R.; D'Onofrio, M.; Donati, S.; Dorigo, M.; Driutti, A.; Ebina, K.; Edgar, R.; Elagin, A.; Erbacher, R.; Errede, S.; Esham, B.; Eusebi, R.; Farrington, S.; Fernández Ramos, J. P.; Field, R.; Flanagan, G.; Forrest, R.; Franklin, M.; Freeman, J. C.; Frisch, H.; Funakoshi, Y.; Garfinkel, A. F.; Garosi, P.; Gerberich, H.; Gerchtein, E.; Giagu, S.; Giakoumopoulou, V.; Gibson, K.; Ginsburg, C. M.; Giokaris, N.; Giromini, P.; Giurgiu, G.; Glagolev, V.; Glenzinski, D.; Gold, M.; Goldin, D.; Golossanov, A.; Gomez, G.; Gomez-Ceballos, G.; Goncharov, M.; González López, O.; Gorelov, I.; Goshaw, A. T.; Goulianos, K.; Gramellini, E.; Grinstein, S.; Grosso-Pilcher, C.; Group, R. C.; Guimaraes da Costa, J.; Hahn, S. R.; Han, J. Y.; Happacher, F.; Hara, K.; Hare, M.; Harr, R. F.; Harrington-Taber, T.; Hatakeyama, K.; Hays, C.; Heinrich, J.; Herndon, M.; Hocker, A.; Hong, Z.; Hopkins, W.; Hou, S.; Hughes, R. E.; Husemann, U.; Hussein, M.; Huston, J.; Introzzi, G.; Iori, M.; Ivanov, A.; James, E.; Jang, D.; Jayatilaka, B.; Jeon, E. J.; Jindariani, S.; Jones, M.; Joo, K. K.; Jun, S. Y.; Junk, T. R.; Kambeitz, M.; Kamon, T.; Karchin, P. E.; Kasmi, A.; Kato, Y.; Ketchum, W.; Keung, J.; Kilminster, B.; Kim, D. H.; Kim, H. S.; Kim, J. E.; Kim, M. J.; Kim, S. B.; Kim, S. H.; Kim, Y. J.; Kim, Y. K.; Kimura, N.; Kirby, M.; Knoepfel, K.; Kondo, K.; Kong, D. J.; Konigsberg, J.; Kotwal, A. V.; Kreps, M.; Kroll, J.; Kruse, M.; Kuhr, T.; Kurata, M.; Laasanen, A. T.; Lammel, S.; Lancaster, M.; Lannon, K.; Latino, G.; Lee, H. S.; Lee, J. S.; Leo, S.; Leone, S.; Lewis, J. D.; Limosani, A.; Lipeles, E.; Lister, A.; Liu, H.; Liu, Q.; Liu, T.; Lockwitz, S.; Loginov, A.; Lucà, A.; Lucchesi, D.; Lueck, J.; Lujan, P.; Lukens, P.; Lungu, G.; Lys, J.; Lysak, R.; Madrak, R.; Maestro, P.; Malik, S.; Manca, G.; Manousakis-Katsikakis, A.; Margaroli, F.; Marino, P.; Martínez, M.; Matera, K.; Mattson, M. E.; Mazzacane, A.; Mazzanti, P.; McNulty, R.; Mehta, A.; Mehtala, P.; Mesropian, C.; Miao, T.; Mietlicki, D.; Mitra, A.; Miyake, H.; Moed, S.; Moggi, N.; Moon, C. S.; Moore, R.; Morello, M. J.; Mukherjee, A.; Muller, Th.; Murat, P.; Mussini, M.; Nachtman, J.; Nagai, Y.; Naganoma, J.; Nakano, I.; Napier, A.; Nett, J.; Neu, C.; Nigmanov, T.; Nodulman, L.; Noh, S. Y.; Norniella, O.; Oakes, L.; Oh, S. H.; Oh, Y. D.; Oksuzian, I.; Okusawa, T.; Orava, R.; Ortolan, L.; Pagliarone, C.; Palencia, E.; Palni, P.; Papadimitriou, V.; Parker, W.; Pauletta, G.; Paulini, M.; Paus, C.; Phillips, T. J.; Piacentino, G.; Pianori, E.; Pilot, J.; Pitts, K.; Plager, C.; Pondrom, L.; Poprocki, S.; Potamianos, K.; Pranko, A.; Prokoshin, F.; Ptohos, F.; Punzi, G.; Ranjan, N.; Redondo Fernández, I.; Renton, P.; Rescigno, M.; Rimondi, F.; Ristori, L.; Robson, A.; Rodriguez, T.; Rolli, S.; Ronzani, M.; Roser, R.; Rosner, J. L.; Ruffini, F.; Ruiz, A.; Russ, J.; Rusu, V.; Sakumoto, W. K.; Sakurai, Y.; Santi, L.; Sato, K.; Saveliev, V.; Savoy-Navarro, A.; Schlabach, P.; Schmidt, E. E.; Schwarz, T.; Scodellaro, L.; Scuri, F.; Seidel, S.; Seiya, Y.; Semenov, A.; Sforza, F.; Shalhout, S. Z.; Shears, T.; Shepard, P. F.; Shimojima, M.; Shochet, M.; Shreyber-Tecker, I.; Simonenko, A.; Sinervo, P.; Sliwa, K.; Smith, J. R.; Snider, F. D.; Song, H.; Sorin, V.; Stancari, M.; Denis, R. St.; Stelzer, B.; Stelzer-Chilton, O.; Stentz, D.; Strologas, J.; Sudo, Y.; Sukhanov, A.; Suslov, I.; Takemasa, K.; Takeuchi, Y.; Tang, J.; Tecchio, M.; Teng, P. K.; Thom, J.; Thomson, E.; Thukral, V.; Toback, D.; Tokar, S.; Tollefson, K.; Tomura, T.; Tonelli, D.; Torre, S.; Torretta, D.; Totaro, P.; Trovato, M.; Ukegawa, F.; Uozumi, S.; Vázquez, F.; Velev, G.; Vellidis, C.; Vernieri, C.; Vidal, M.; Vilar, R.; Vizán, J.; Vogel, M.; Volpi, G.; Wagner, P.; Wallny, R.; Wang, S. M.; Warburton, A.; Waters, D.; Wester, W. C., III; Whiteson, D.; Wicklund, A. B.; Wilbur, S.; Williams, H. H.; Wilson, J. S.; Wilson, P.; Winer, B. L.; Wittich, P.; Wolbers, S.; Wolfe, H.; Wright, T.; Wu, X.; Wu, Z.; Yamamoto, K.; Yamato, D.; Yang, T.; Yang, U. K.; Yang, Y. C.; Yao, W.-M.; Yeh, G. P.; Yi, K.; Yoh, J.; Yorita, K.; Yoshida, T.; Yu, G. B.; Yu, I.; Zanetti, A. M.; Zeng, Y.; Zhou, C.; Zucchelli, S.

    2013-08-01

    We present the first signature-based search for delayed photons using an exclusive photon plus missing transverse energy final state. Events are reconstructed in a data sample from the CDF II detector corresponding to 6.3fb-1 of integrated luminosity from s=1.96TeV proton-antiproton collisions. Candidate events are selected if they contain a photon with an arrival time in the detector larger than expected from a promptly produced photon. The mean number of events from standard model sources predicted by the data-driven background model based on the photon timing distribution is 286±24. A total of 322 events are observed. A p value of 12% is obtained, showing consistency of the data with standard model predictions.

  14. Search for Pair Production of Strongly Interacting Particles Decaying to Pairs of Jets in pp¯ Collisions at s=1.96TeV

    Science.gov (United States)

    Aaltonen, T.; Albin, E.; Amerio, S.; Amidei, D.; Anastassov, A.; Annovi, A.; Antos, J.; Apollinari, G.; Appel, J. A.; Arisawa, T.; Artikov, A.; Asaadi, J.; Ashmanskas, W.; Auerbach, B.; Aurisano, A.; Azfar, F.; Badgett, W.; Bae, T.; Barbaro-Galtieri, A.; Barnes, V. E.; Barnett, B. A.; Barria, P.; Bartos, P.; Bauce, M.; Bedeschi, F.; Behari, S.; Bellettini, G.; Bellinger, J.; Benjamin, D.; Beretvas, A.; Bhatti, A.; Bland, K. R.; Blumenfeld, B.; Bocci, A.; Bodek, A.; Bortoletto, D.; Boudreau, J.; Boveia, A.; Brigliadori, L.; Bromberg, C.; Brucken, E.; Budagov, J.; Budd, H. S.; Burkett, K.; Busetto, G.; Bussey, P.; Butti, P.; Buzatu, A.; Calamba, A.; Camarda, S.; Campanelli, M.; Canelli, F.; Carls, B.; Carlsmith, D.; Carosi, R.; Carrillo, S.; Casal, B.; Casarsa, M.; Castro, A.; Catastini, P.; Cauz, D.; Cavaliere, V.; Cavalli-Sforza, M.; Cerri, A.; Cerrito, L.; Chen, Y. C.; Chertok, M.; Chiarelli, G.; Chlachidze, G.; Cho, K.; Chokheli, D.; Ciocci, M. A.; Clark, A.; Clarke, C.; Convery, M. E.; Conway, J.; Corbo, M.; Cordelli, M.; Cox, C. A.; Cox, D. J.; Cremonesi, M.; Cruz, D.; Cuevas, J.; Culbertson, R.; d'Ascenzo, N.; Datta, M.; De Barbaro, P.; Demortier, L.; Deninno, M.; Devoto, F.; d'Errico, M.; Di Canto, A.; Di Ruzza, B.; Dittmann, J. R.; D'Onofrio, M.; Donati, S.; Dorigo, M.; Driutti, A.; Ebina, K.; Edgar, R.; Elagin, A.; Erbacher, R.; Errede, S.; Esham, B.; Eusebi, R.; Farrington, S.; Fernández Ramos, J. P.; Field, R.; Flanagan, G.; Forrest, R.; Franklin, M.; Freeman, J. C.; Frisch, H.; Funakoshi, Y.; Garfinkel, A. F.; Garosi, P.; Gerberich, H.; Gerchtein, E.; Giagu, S.; Giakoumopoulou, V.; Gibson, K.; Ginsburg, C. M.; Giokaris, N.; Giromini, P.; Giurgiu, G.; Glagolev, V.; Glenzinski, D.; Gold, M.; Goldin, D.; Golossanov, A.; Gomez, G.; Gomez-Ceballos, G.; Goncharov, M.; González López, O.; Gorelov, I.; Goshaw, A. T.; Goulianos, K.; Gramellini, E.; Grinstein, S.; Grosso-Pilcher, C.; Group, R. C.; Guimaraes da Costa, J.; Hahn, S. R.; Han, J. Y.; Happacher, F.; Hara, K.; Hare, M.; Harr, R. F.; Harrington-Taber, T.; Hatakeyama, K.; Hays, C.; Heinrich, J.; Herndon, M.; Hocker, A.; Hong, Z.; Hopkins, W.; Hou, S.; Hughes, R. E.; Husemann, U.; Hussein, M.; Huston, J.; Introzzi, G.; Iori, M.; Ivanov, A.; James, E.; Jang, D.; Jayatilaka, B.; Jeon, E. J.; Jindariani, S.; Jones, M.; Joo, K. K.; Jun, S. Y.; Junk, T. R.; Kambeitz, M.; Kamon, T.; Karchin, P. E.; Kasmi, A.; Kato, Y.; Ketchum, W.; Keung, J.; Kilminster, B.; Kim, D. H.; Kim, H. S.; Kim, J. E.; Kim, M. J.; Kim, S. B.; Kim, S. H.; Kim, Y. K.; Kim, Y. J.; Kimura, N.; Kirby, M.; Knoepfel, K.; Kondo, K.; Kong, D. J.; Konigsberg, J.; Kotwal, A. V.; Kreps, M.; Kroll, J.; Kruse, M.; Kuhr, T.; Kurata, M.; Laasanen, A. T.; Lammel, S.; Lancaster, M.; Lannon, K.; Latino, G.; Lee, H. S.; Lee, J. S.; Leo, S.; Leone, S.; Lewis, J. D.; Limosani, A.; Lipeles, E.; Liu, H.; Liu, Q.; Liu, T.; Lockwitz, S.; Loginov, A.; Lucchesi, D.; Lueck, J.; Lujan, P.; Lukens, P.; Lungu, G.; Lys, J.; Lysak, R.; Madrak, R.; Maestro, P.; Malik, S.; Manca, G.; Manousakis-Katsikakis, A.; Margaroli, F.; Marino, P.; Martínez, M.; Matera, K.; Mattson, M. E.; Mazzacane, A.; Mazzanti, P.; McNulty, R.; Mehta, A.; Mehtala, P.; Mesropian, C.; Miao, T.; Mietlicki, D.; Mitra, A.; Miyake, H.; Moed, S.; Moggi, N.; Moon, C. S.; Moore, R.; Morello, M. J.; Mukherjee, A.; Muller, Th.; Murat, P.; Mussini, M.; Nachtman, J.; Nagai, Y.; Naganoma, J.; Nakano, I.; Napier, A.; Nett, J.; Neu, C.; Nigmanov, T.; Nodulman, L.; Noh, S. Y.; Norniella, O.; Oakes, L.; Oh, S. H.; Oh, Y. D.; Oksuzian, I.; Okusawa, T.; Orava, R.; Ortolan, L.; Pagliarone, C.; Palencia, E.; Palni, P.; Papadimitriou, V.; Parker, W.; Pauletta, G.; Paulini, M.; Paus, C.; Phillips, T. J.; Piacentino, G.; Pianori, E.; Pilot, J.; Pitts, K.; Plager, C.; Pondrom, L.; Poprocki, S.; Potamianos, K.; Prokoshin, F.; Pranko, A.; Ptohos, F.; Punzi, G.; Ranjan, N.; Redondo Fernández, I.; Renton, P.; Rescigno, M.; Riddick, T.; Rimondi, F.; Ristori, L.; Robson, A.; Rodriguez, T.; Rolli, S.; Ronzani, M.; Roser, R.; Rosner, J. L.; Ruffini, F.; Ruiz, A.; Russ, J.; Rusu, V.; Safonov, A.; Sakumoto, W. K.; Sakurai, Y.; Santi, L.; Sato, K.; Saveliev, V.; Savoy-Navarro, A.; Schlabach, P.; Schmidt, E. E.; Schwarz, T.; Scodellaro, L.; Scuri, F.; Seidel, S.; Seiya, Y.; Semenov, A.; Sforza, F.; Shalhout, S. Z.; Shears, T.; Shepard, P. F.; Shimojima, M.; Shochet, M.; Shreyber-Tecker, I.; Simonenko, A.; Sinervo, P.; Sliwa, K.; Smith, J. R.; Snider, F. D.; Sorin, V.; Song, H.; Stancari, M.; Denis, R. St.; Stelzer, B.; Stelzer-Chilton, O.; Stentz, D.; Strologas, J.; Sudo, Y.; Sukhanov, A.; Suslov, I.; Takemasa, K.; Takeuchi, Y.; Tang, J.; Tecchio, M.; Teng, P. K.; Thom, J.; Thomson, E.; Thukral, V.; Toback, D.; Tokar, S.; Tollefson, K.; Tomura, T.; Tonelli, D.; Torre, S.; Torretta, D.; Totaro, P.; Trovato, M.; Ukegawa, F.; Uozumi, S.; Vázquez, F.; Velev, G.; Vellidis, C.; Vernieri, C.; Vidal, M.; Vilar, R.; Vizán, J.; Vogel, M.; Volpi, G.; Wagner, P.; Wallny, R.; Wang, S. M.; Warburton, A.; Waters, D.; Wester, W. C., III; Whiteson, D.; Wicklund, A. B.; Wilbur, S.; Williams, H. H.; Wilson, J. S.; Wilson, P.; Winer, B. L.; Wittich, P.; Wolbers, S.; Wolfe, H.; Wright, T.; Wu, X.; Wu, Z.; Yamamoto, K.; Yamato, D.; Yang, T.; Yang, U. K.; Yang, Y. C.; Yao, W.-M.; Yeh, G. P.; Yi, K.; Yoh, J.; Yorita, K.; Yoshida, T.; Yu, G. B.; Yu, I.; Zanetti, A. M.; Zeng, Y.; Zhou, C.; Zucchelli, S.

    2013-07-01

    We present a search for the pair production of a narrow nonstandard-model strongly interacting particle that decays to a pair of quarks or gluons, leading to a final state with four hadronic jets. We consider both nonresonant production via an intermediate gluon as well as resonant production via a distinct nonstandard-model intermediate strongly interacting particle. We use data collected by the CDF experiment in proton-antiproton collisions at s=1.96TeV corresponding to an integrated luminosity of 6.6fb-1. We find the data to be consistent with nonresonant production. We report limits on σ(pp¯→jjjj) as a function of the masses of the hypothetical intermediate particles. Upper limits on the production cross sections for nonstandard-model particles in several resonant and nonresonant processes are also derived.

  15. Search for Higgs bosons decaying to tau(+)tau(-) pairs in p(p)over-bar collisions at root s=1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abazov, V.M.; Abazov, V. M.; Abbott, B.; Achary, B. S.; Adams, M.; Adams, T.; Alexeev, G. D.; Alkhazov, G.; Alton, A.; Alverson, G.; Alves, G. A.; Aoki, M.; Arov, M.; Askew, A.; Asman, B.; Atramentov, O.; Avila, C.; BackusMayes, J.; Badaud, F.; Bagby, L.; Baldin, B.; Bandurin, D. V.; Banerjee, S.; Barberis, E.; Baringer, P.; Barreto, J.; Bartlett, J. F.; Bassler, U.; Bazterra, V.; Beale, S.; Bean, A.; Begalli, M.; Begel, M.; Belanger-Champagne, C.; Bellantoni, L.; Beri, S. B.; Bernardi, G.; Bernhard, R.; Bertram, I.; Besancon, M.; Beuselinck, R.; Bezzubov, V. A.; Bhat, P. C.; Bhatnagar, V.; Blazey, G.; Blessing, S.; Bloom, K.; Boehnlein, A.; Boline, D.; Boos, E. E.; Borissov, G.; Bose, T.; Brandt, A.; Brandt, O.; Brock, R.; Brooijmans, G.; Bross, A.; Brown, D.; Brown, J.; Bu, X. B.; Buehler, M.; Buescher, V.; Bunichev, V.; Burdin, S.; Burnett, T. H.; Buszello, C. P.; Calpas, B.; Camacho-Perez, E.; Carrasco-Lizarraga, M. A.; Casey, B. C. K.; Castilla-Valdez, H.; Chakrabarti, S.; Chakraborty, D.; Chan, K. M.; Chandra, A.; Chen, G.; Chevalier-Thery, S.; Cho, D. K.; Cho, S. W.; Choi, S.; Choudhary, B.; Cihangir, S.; Claes, D.; Clutter, J.; Cooke, M.; Cooper, W. E.; Corcoran, M.; Couderc, F.; Cousinou, M. -C.; Croc, A.; Cutts, D.; Das, A.; Davies, G.; De, K.; de Jong, S. J.; De La Cruz-Burelo, E.; Deliot, F.; Demarteau, M.; Demina, R.; Denisov, D.; Denisov, S. P.; Desai, S.; Deterre, C.; DeVaughan, K.; Diehl, H. T.; Diesburg, M.; Ding, P. F.; Dominguez, A.; Dorland, T.; Dubey, A.; Dudko, L. V.; Duggan, D.; Duperrin, A.; Dutt, S.; Dyshkant, A.; Eads, M.; Edmunds, D.; Ellison, J.; Elvira, V. D.; Enari, Y.; Evans, H.; Evdokimov, A.; Evdokimov, V. N.; Facini, G.; Ferbel, T.; Fiedler, F.; Filthaut, F.; Fisher, W.; Fisk, H. E.; Fortner, M.; Fox, H.; Fuess, S.; Garcia-Bellido, A.; Gavrilov, V.; Gay, P.; Geng, W.; Gerbaudo, D.; Gerber, C. E.; Gershtein, Y.; Ginther, G.; Golovanov, G.; Goussiou, A.; Grannis, P. D.; Greder, S.; Greenlee, H.; Greenwood, Z. D.; Gregores, E. M.; Grenier, G.; Gris, Ph.; Grivaz, J. -F.; Grohsjea, A.; Gruenendahl, S.; Gruenewald, M. W.; Guillemin, T.; Guo, F.; Gutierrez, G.; Gutierrez, P.; Haas, A.; Hagopia, S.; Haley, J.; Hang, L.; Harder, K.; Harein, A.; Hauptman, J. M.; Hays, J.; Head, T.; Hebbeker, T.; Hedin, D.; Hegab, H.; Heinson, A. P.; Heintz, U.; Hensel, C.; Heredia-De La Cruz, I.; Herner, K.; Hesketh, G.; Hildreth, M. D.; Hirosky, R.; Hoangau, T.; Hobbs, J. D.; Hoeneisen, B.; Hohlfeld, M.; Hubacek, Z.; Huske, N.; Hynek, V.; Lashvili, I.; Ilchenko, Y.; Illingworth, R.; Ito, A. S.; Jabeen, S.; Jaffre, M.; Jamin, D.; Jayasinghe, A.; Jesik, R.; Johns, K.; Johnson, M.; Johnston, D.; Jonckheere, A.; Jonsson, P.; Joshi, J.; Jung, A. W.; Juste, A.; Kaadze, K.; Kajfasz, E.; Karmanov, D.; Kasper, P. A.; Katsanos, I. I.; Kehoe, R.; Kermiche, S.; Khalatyan, N.; Khanov, A.; Kharchilava, A.; Kharzheev, Y. N.; Kirby, M. H.; Kohli, J. M.; Kozelov, A. V.; Kraus, J.; Kulikov, S.; Kumar, A.; Kupco, A.; Kurca, T.; Kuzmin, V. A.; Kvita, J.; Lammers, S.; Landsberg, G.; Lebrun, P.; Lee, H. S.; Lee, S. W.; Lee, W. M.; Lellouch, J.; Li, L.; Li, Q. Z.; Lietti, S. M.; Lim, J. K.; Lincoln, D.; Linnemann, J.; Lipaev, V. V.; Lipton, R.; Liu, Y.; Liu, Z.; Lobodenko, A.; Lokajicek, M.; de Sa, R. Lopes; Lubatti, H. J.; Luna-Garcia, R.; Lyon, A. L.; Maciel, A. K. A.; Mackin, D.; Madar, R.; Magana-Villalba, R.; Malik, S.; Malyshev, V. L.; Maravin, Y.; Martinez-Ortega, J.; McCarthy, R.; McGivern, C. L.; Meijer, M. M.; Melnitchouk, A.; Menezes, D.; Mercadante, P. G.; Merkin, M.; Meyer, A.; Meyer, J.; et al.

    2012-02-01

    We present a search for the production of neutral Higgs bosons decaying into {tau}{sup +}{tau}{sup -} pairs in p{bar p} collisions at a center-of-mass energy of 1.96 TeV. The data, corresponding to an integrated luminosity of 5.4 fb{sup -1}, were collected by the D0 experiment at the Fermilab Tevatron Collider. We set upper limits at the 95% C.L. on the product of production cross section and branching ratio for a scalar resonance decaying into {tau}{sup +}{tau}{sup -} pairs, and we interpret these limits as limits on the production of Higgs bosons in the minimal supersymmetric standard model (MSSM) and as constraints in the MSSM parameter space.

  16. Search for a Heavy Top-Like Quark in $p\\bar{p}$ Collisions at $\\sqrt{s} = 1.96$ TeV at the Tevatron

    Energy Technology Data Exchange (ETDEWEB)

    Cox, David J. [Univ. of California, Davis, CA (United States)

    2012-01-01

    We present the results of a search for pair production of a heavy top-like (t') quark decaying to Wq final states using data corresponding to an integrated luminosity of 5.6 fb-1 collected by the CDF II detector in pp collisions at $\\sqrt{s} = 1.96$ TeV center of mass energy. A search for t' → Wb in events containing a lepton and four or more jets is conducted. By performing a fit to the two-dimensional distribution of total transverse energy versus reconstructed t' quark mass, we set upper limits on the t't' pair production cross section and exclude a standard model fourth-generation t' quark decaying to Wb with mass below 358 GeV/c2 at 95% CL.

  17. Measurement of the differential cross section d\\sigma/dt in elastic $p\\bar{p}$ scattering at sqrt(s)=1.96 TeV

    CERN Document Server

    Abazov, V M; Acharya, B S; Adams, M; Adams, T; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Aoki, M; Askew, A; Atkins, S; Augsten, K; Avila, C; Badaud, F; Bagby, L; Baldin, B; Bandurin, D V; Banerjee, S; Barberis, E; Baringer, P; Barreto, J; Bartlett, J F; Bassler, U; Bazterra, V; Bean, A; Begalli, M; Bellantoni, L; Beri, S B; Bernardi, G; Bernhard, R; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatia, S; Bhatnagar, V; Blazey, G; Blessing, S; Bloom, K; Boehnlein, A; Boline, D; Boos, E E; Borissov, G; Bose, T; Brandt, A; Brandt, O; Brock, R; Brooijmans, G; Bross, A; Brown, D; Brown, J; Bu, X B; Buehler, M; Buescher, V; Bunichev, V; Burdin, S; Buszello, C P; Camacho-Pérez, E; Carvalho, W; Casey, B C K; Castilla-Valdez, H; Caughron, S; Chakrabarti, S; Chakraborty, D; Chan, K M; Chandra, A; Chapon, E; Chen, G; Chevalier-Théry, S; Cho, D K; Cho, S W; Choi, S; Choudhary, B; Cihangir, S; Claes, D; Clutter, J; Cooke, M; Cooper, W E; Corcoran, M; Couderc, F; Cousinou, M -C; Croc, A; Cutts, D; Das, A; Davies, G; de Jong, S J; De La Cruz-Burelo, E; Martins, C De Oliveira; Déliot, F; Demina, R; Denisov, D; Denisov, S P; Desai, S; Deterre, C; DeVaughan, K; Diehl, H T; Diesburg, M; Ding, P F; Dominguez, A; Dubey, A; Dudko, L V; Duggan, D; Duperrin, A; Dutt, S; Dyshkant, A; Eads, M; Edmunds, D; Ellison, J; Elvira, V D; Enari, Y; Evans, H; Evdokimov, A; Evdokimov, V N; Facini, G; Feng, L; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Fortner, M; Fox, H; Fuess, S; Garcia-Bellido, A; García-González, J A; García-Guerra, G A; Gavrilov, V; Gay, P; Geng, W; Gerbaudo, D; Gerber, C E; Gershtein, Y; Ginther, G; Golovanov, G; Goussiou, A; Grannis, P D; Greder, S; Greenlee, H; Gregores, E M; Grenier, G; Gris, Ph; Grivaz, J -F; Grohsjean, A; Grünendahl, S; Grünewald, M W; Guillemin, T; Gutierrez, G; Gutierrez, P; Haas, A; Hagopian, S; Haley, J; Han, L; Harder, K; Harel, A; Hauptman, J M; Hays, J; Head, T; Hebbeker, T; Hedin, D; Hegab, H; Heinson, A P; Heintz, U; Hensel, C; La Cruz, I Heredia-De; Herner, K; Hesketh, G; Hildreth, M D; Hirosky, R; Hoang, T; Hobbs, J D; Hoeneisen, B; Hohlfeld, M; Howley, I; Hubacek, Z; Hynek, V; Iashvili, I; Ilchenko, Y; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jayasinghe, A; Jesik, R; Johns, K; Johnson, E; Johnson, M; Jonckheere, A; Jonsson, P; Joshi, J; Jung, A W; Juste, A; Kaadze, K; Kajfasz, E; Karmanov, D; Kasper, P A; Katsanos, I; Kehoe, R; Kermiche, S; Khalatyan, N; Khanov, A; Kharchilava, A; Kharzheev, Y N; Kiselevich, I; Kohli, J M; Kozelov, A V; Kraus, J; Kulikov, S; Kumar, A; Kupco, A; Kurča, T; Kuzmin, V A; Lammers, S; Landsberg, G; Lebrun, P; Lee, H S; Lee, S W; Lee, W M; Lellouch, J; Li, H; Li, L; Li, Q Z; Lim, J K; Lincoln, D; Linnemann, J; Lipaev, V V; Lipton, R; Liu, H; Liu, Y; Lobodenko, A; Lokajicek, M; de Sa, R Lopes; Lubatti, H J; Luna-Garcia, R; Lyon, A L; Maciel, A K A; Madar, R; Magaña-Villalba, R; Malik, S; Malyshev, V L; Maravin, Y; Martínez-Ortega, J; McCarthy, R; McGivern, C L; Meijer, M M; Melnitchouk, A; Mendoza, L; Menezes, D; Mercadante, P G; Merkin, M; Meyer, A; Meyer, J; Miconi, F; Molina, J; Mondal, N K; da Motta, H; Mulhearn, M; Mundim, L; Nagy, E; Naimuddin, M; Narain, M; Nayyar, R; Neal, H A; Negret, J P; Neustroev, P; Novaes, S F; Nunnemann, T; Obrant, G; Oguri, V; Orduna, J; Osman, N; Osta, J; Padilla, M; Pal, A; Parashar, N; Parihar, V; Park, S K; Partridge, R; Parua, N; Patwa, A; Penning, B; Perfilov, M; Peters, Y; Petridis, K; Petrillo, G; Pétroff, P; Pleier, M -A; Podesta-Lerma, P L M; Podstavkov, V M; Pol, M -E; Popov, A V; da Silva, W L Prado; Prewitt, M; Price, D; Prokopenko, N; Qian, J; Quadt, A; Quinn, B; Rangel, M S; Ranjan, K; Ratoff, P N; Razumov, I; Renkel, P; Ripp-Baudot, I; Rizatdinova, F; Rominsky, M; Ross, A; Royon, C; Rubinov, P; Ruchti, R; Sajot, G; Salcido, P; Sánchez-Hernández, A; Sanders, M P; Sanghi, B; Santoro, A; Santos, A S; Savage, G; Sawyer, L; Scanlon, T; Schamberger, R D; Scheglov, Y; Schellman, H; Schlobohm, S; Schwanenberger, C; Schwienhorst, R; Sekaric, J; Severini, H; Shabalina, E; Shary, V; Shaw, S; Shchukin, A A; Shivpuri, R K; Simak, V; Skubic, P; Slattery, P; Smirnov, D; Smith, K J; Snow, G R; Snow, J; Snyder, S; Söldner-Rembold, S; Sonnenschein, L; Soustruznik, K; Stark, J; Stoyanova, D A; Strang, M A; Strauss, M; Stutte, L; Suter, L; Svoisky, P; Takahashi, M; Titov, M; Tokmenin, V V; Tsai, Y -T; Tschann-Grimm, K; Tsybychev, D; Tuchming, B; Tully, C; Uvarov, L; Uvarov, S; Uzunyan, S; Van Kooten, R; van Leeuwen, W M; Varelas, N; Varnes, E W; Vasilyev, I A; Verdier, P; Verkheev, A Y; Vertogradov, L S; Verzocchi, M; Vesterinen, M; Vilanova, D; Vokac, P; Wahl, H D; Wang, M H L S; Warchol, J; Watts, G; Wayne, M; Weichert, J; Welty-Rieger, L; White, A; Wicke, D; Williams, M R J; Wilson, G W; Wobisch, M; Wood, D R; Wyatt, T R; Xie, Y; Yamada, R; Yang, W -C; Yasuda, T; Yatsunenko, Y A; Ye, W; Ye, Z; Yin, H; Yip, K; Youn, S W; Zennamo, J; Zhao, T; Zhao, T G; Zhou, B; Zhu, J; Zielinski, M; Zieminska, D; Zivkovic, L

    2012-01-01

    We present a measurement of the elastic differential cross section $d\\sigma(p\\bar{p}\\rightarrow p\\bar{p})/dt$ as a function of the four-momentum-transfer squared t. The data sample corresponds to an integrated luminosity of $\\approx 31 nb^{-1}$ collected with the D0 detector using dedicated Tevatron $p\\bar{p} $ Collider operating conditions at sqrt(s) = 1.96 TeV and covers the range $0.26 <|t|< 1.2 GeV^2$. For $|t|<0.6 GeV^2$, d\\sigma/dt is described by an exponential function of the form $Ae^{-b|t|}$ with a slope parameter $ b = 16.86 \\pm 0.10(stat) \\pm 0.20(syst) GeV^{-2}$. A change in slope is observed at $|t| \\approx 0.6 GeV^2$, followed by a more gradual |t| dependence with increasing values of |t|.

  18. Generation of an isogenic, gene-corrected control cell line of the spinocerebellar ataxia type 2 patient-derived iPSC line H196.

    Science.gov (United States)

    Marthaler, Adele G; Schmid, Benjamin; Tubsuwan, Alisa; Poulsen, Ulla B; Engelbrecht, Alexander F; Mau-Holzmann, Ulrike A; Hyttel, Poul; Nielsen, Jørgen E; Nielsen, Troels T; Holst, Bjørn

    2016-01-01

    Spinocerebellar ataxia type 2 (SCA2) is a neurodegenerative disease primarily affecting the cerebellum. Very little is known about the molecular mechanisms underlying the disease and, to date, no cure or treatment is available. We have successfully generated bona fide induced pluripotent stem cell (iPSC) lines of SCA2 patients in order to study a disease-specific phenotype. Here, we demonstrate the gene correction of the iPSC line H196 clone 7 where we have exchanged the expanded CAG repeat of the ATXN2 gene with the normal length found in healthy alleles. This gene corrected cell line will provide the ideal control to model SCA2 by iPSC technology. Copyright © 2015. Published by Elsevier B.V.

  19. Search for chargino-neutralino production in p anti-p collisions at 1.96-TeV with high-p(T) leptons

    Energy Technology Data Exchange (ETDEWEB)

    Aaltonen, T.; /Helsinki Inst. of Phys.; Adelman, J.; /Chicago U., EFI; Akimoto, T.; /Tsukuba U.; Albrow, M.G.; /Fermilab; Alvarez Gonzalez, B.; /Cantabria U., Santander; Amerio, S.; /Padua U.; Amidei, D.; /Michigan U.; Anastassov, A.; /Rutgers U., Piscataway; Annovi, A.; /Frascati; Antos, J.; /Comenius U.; Aoki, M.; /Illinois U., Urbana /Fermilab

    2007-11-01

    The authors present a search for the associated production of charginos and neutralinos in p{bar p} collisions at {radical}s = 1.96 TeV. The data were collected at the Collider Detector at Fermilab (CDF II) and correspond to integrated luminosities between 0.7 and 1.0 fb{sup -1}. They look for final states with one high-p{sub T} electron or muon, and two additional leptons. The results are consistent with the standard model expectations, and they set limits on the cross section as a function of the chargino mass in three different supersymmetric scenarios. For a specific MSSM scenario with no slepton mixing they set a 95% C.L. limit at 151 GeV/c{sup 2}.

  20. Search for a neutral Higgs boson decaying to a W boson pair in p antip collisions at s**(1/2) = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abulencia, A.; Acosta, D.; Adelman, Jahred A.; Affolder, T.; Akimoto, T.; Albrow, M.G.; Ambrose, D.; Amerio, S.; Amidei, D.; Anastassov, A.; Anikeev, K.; /Illinois U.,

    2006-05-01

    The authors present the results of a search for standard model Higgs boson production with decay to WW*, identified through the leptonic final states e{sup +}e{sup -} {bar {nu}}{nu}, e{sup {+-}}{mu}{sup {-+}} {bar {nu}}{nu} and {mu}{sup +} {mu}{sup -} {bar {nu}}{nu}. This search uses 360 pb{sup -1} of data collected from p{bar p} collisions at {radical}s = 1.96 TeV by the upgraded Collider Detector at Fermilab (CDF II). They observe no signal excess and set 95% confidence level upper limits on the production cross section times branching ratio for the Higgs boson to WW* or any new scalar particle with similar decay products. These upper limits range from 5.5 to 3.2 pb for Higgs boson masses between 120 and 200 GeV/c{sup 2}.

  1. Measurement of the $WZ$ Cross Section and Triple Gauge Couplings in $p \\bar p$ Collisions at $\\sqrt{s} = 1.96$ TeV

    Energy Technology Data Exchange (ETDEWEB)

    Aaltonen, T.; /Helsinki Inst. of Phys.; Alvarez Gonzalez, B.; /Oviedo U. /Cantabria Inst. of Phys.; Amerio, S.; /INFN, Padua; Amidei, D.; /Michigan U.; Anastassov, A.; /Northwestern U. /Fermilab; Annovi, A.; /Frascati; Antos, J.; /Comenius U.; Apollinari, G.; /Fermilab; Appel, J.A.; /Fermilab; Arisawa, T.; /Waseda U.; Artikov, A.; /Dubna, JINR /Texas A-M

    2012-02-01

    This Letter describes the current most precise measurement of the WZ production cross section as well as limits on anomalous WWZ couplings at a center-of-mass energy of 1.96 TeV in proton-antiproton collisions. The WZ candidates are reconstructed from decays containing three charged leptons and missing energy from a neutrino, where the charged leptons are either electrons or muons. Using data collected by the CDF II detector (7.1 fb{sup -1} of integrated luminosity), 64 candidate events are observed with the expected background contributing 8 {+-} 1 events. The measured total cross section {sigma}(p{bar p} {yields} WZ) = 3.93{sub -0.53}{sup +0.60}(stat){sub -0.46}{sup +0.59}(syst) pb is in good agreement with the standard model prediction of 3.50 {+-} 0.21. The same sample is used to set limits on anomalous WWZ couplings.

  2. Search for Scalar Top Quark Production in p-pbar Collisions at sqrt(s)=1.96 TeV

    CERN Document Server

    Aaltonen, T.; Amerio, S.; Amidei, D.; Anastassov, A.; Annovi, A.; Antos, J.; Apollinari, G.; Appel, J.A.; Arisawa, T.; Artikov, A.; Asaadi, J.; Ashmanskas, W.; Auerbach, B.; Aurisano, A.; Azfar, F.; Badgett, W.; Bae, T.; Barbaro-Galtieri, A.; Barnes, V.E.; Barnett, B.A.; Barria, P.; Bartos, P.; Bauce, M.; Bedeschi, F.; Behari, S.; Bellettini, G.; Bellinger, J.; Benjamin, D.; Beretvas, A.; Bhatti, A.; Bisello, D.; Bizjak, I.; Bland, K.R.; Blumenfeld, B.; Bocci, A.; Bodek, A.; Bortoletto, D.; Boudreau, J.; Boveia, A.; Brigliadori, L.; Bromberg, C.; Brucken, E.; Budagov, J.; Budd, H.S.; Burkett, K.; Busetto, G.; Bussey, P.; Buzatu, A.; Calamba, A.; Calancha, C.; Camarda, S.; Campanelli, M.; Campbell, M.; Canelli, F.; Carls, B.; Carlsmith, D.; Carosi, R.; Carrillo, S.; Carron, S.; Casal, B.; Casarsa, M.; Castro, A.; Catastini, P.; Cauz, D.; Cavaliere, V.; Cavalli-Sforza, M.; Cerri, A.; Cerrito, L.; Chen, Y.C.; Chertok, M.; Chiarelli, G.; Chlachidze, G.; Chlebana, F.; Cho, K.; Chokheli, D.; Chung, W.H.; Chung, Y.S.; Ciocci, M.A.; Clark, A.; Clarke, C.; Compostella, G.; Convery, M.E.; Conway, J.; Corbo, M.; Cordelli, M.; Cox, C.A.; Cox, D.J.; Crescioli, F.; Cuevas, J.; Culbertson, R.; Dagenhart, D.; d'Ascenzo, N.; Datta, M.; de Barbaro, P.; Dell'Orso, M.; Demortier, L.; Deninno, M.; Devoto, F.; d'Errico, M.; Di Canto, A.; Di Ruzza, B.; Dittmann, J.R.; D'Onofrio, M.; Donati, S.; Dong, P.; Dorigo, M.; Dorigo, T.; Ebina, K.; Elagin, A.; Eppig, A.; Erbacher, R.; Errede, S.; Ershaidat, N.; Eusebi, R.; Farrington, S.; Feindt, M.; Fernandez, J.P.; Field, R.; Flanagan, G.; Forrest, R.; Frank, M.J.; Franklin, M.; Freeman, J.C.; Funakoshi, Y.; Furic, I.; Gallinaro, M.; Garcia, J.E.; Garfinkel, A.F.; Garosi, P.; Gerberich, H.; Gerchtein, E.; Giagu, S.; Giakoumopoulou, V.; Giannetti, P.; Gibson, K.; Ginsburg, C.M.; Giokaris, N.; Giromini, P.; Giurgiu, G.; Glagolev, V.; Glenzinski, D.; Gold, M.; Goldin, D.; Goldschmidt, N.; Golossanov, A.; Gomez, G.; Gomez-Ceballos, G.; Goncharov, M.; Gonzalez, O.; Gorelov, I.; Goshaw, A.T.; Goulianos, K.; Grinstein, S.; Grosso-Pilcher, C.; Group, R.C.; Guimaraes da Costa, J.; Hahn, S.R.; Halkiadakis, E.; Hamaguchi, A.; Han, J.Y.; Happacher, F.; Hara, K.; Hare, D.; Hare, M.; Harr, R.F.; Hatakeyama, K.; Hays, C.; Heck, M.; Heinrich, J.; Herndon, M.; Hewamanage, S.; Hocker, A.; Hopkins, W.; Horn, D.; Hou, S.; Hughes, R.E.; Hurwitz, M.; Husemann, U.; Hussain, N.; Hussein, M.; Huston, J.; Introzzi, G.; Iori, M.; Ivanov, A.; James, E.; Jang, D.; Jayatilaka, B.; Jeon, E.J.; Jindariani, S.; Jones, M.; Joo, K.K.; Jun, S.Y.; Junk, T.R.; Kamon, T.; Karchin, P.E.; Kasmi, A.; Kato, Y.; Ketchum, W.; Keung, J.; Khotilovich, V.; Kilminster, B.; Kim, D.H.; Kim, H.S.; Kim, J.E.; Kim, M.J.; Kim, S.B.; Kim, S.H.; Kim, Y.K.; Kim, Y.J.; Kimura, N.; Kirby, M.; Klimenko, S.; Knoepfel, K.; Kondo, K.; Kong, D.J.; Konigsberg, J.; Kotwal, A.V.; Kreps, M.; Kroll, J.; Krop, D.; Kruse, M.; Krutelyov, V.; Kuhr, T.; Kurata, M.; Kwang, S.; Laasanen, A.T.; Lami, S.; Lammel, S.; Lancaster, M.; Lander, R.L.; Lannon, K.; Lath, A.; Latino, G.; LeCompte, T.; Lee, E.; Lee, H.S.; Lee, J.S.; Lee, S.W.; Leo, S.; Leone, S.; Lewis, J.D.; Limosani, A.; Lin, C.J.; Lindgren, M.; Lipeles, E.; Lister, A.; Litvintsev, D.O.; Liu, C.; Liu, H.; Liu, Q.; Liu, T.; Lockwitz, S.; Loginov, A.; Lucchesi, D.; Lueck, J.; Lujan, P.; Lukens, P.; Lungu, G.; Lys, J.; Lysak, R.; Madrak, R.; Maeshima, K.; Maestro, P.; Malik, S.; Manca, G.; Manousakis-Katsikakis, A.; Margaroli, F.; Marino, C.; Martinez, M.; Mastrandrea, P.; Matera, K.; Mattson, M.E.; Mazzacane, A.; Mazzanti, P.; McFarland, K.S.; McIntyre, P.; McNulty, R.; Mehta, A.; Mehtala, P.; Mesropian, C.; Miao, T.; Mietlicki, D.; Mitra, A.; Miyake, H.; Moed, S.; Moggi, N.; Mondragon, M.N.; Moon, C.S.; Moore, R.; Morello, M.J.; Morlock, J.; Movilla Fernandez, P.; Mukherjee, A.; Muller, Th.; Murat, P.; Mussini, M.; Nachtman, J.; Nagai, Y.; Naganoma, J.; Nakano, I.; Napier, A.; Nett, J.; Neu, C.; Neubauer, M.S.; Nielsen, J.; Nodulman, L.; Noh, S.Y.; Norniella, O.; Oakes, L.; Oh, S.H.; Oh, Y.D.; Oksuzian, I.; Okusawa, T.; Orava, R.; Ortolan, L.; Pagan Griso, S.; Pagliarone, C.; Palencia, E.; Papadimitriou, V.; Paramonov, A.A.; Patrick, J.; Pauletta, G.; Paulini, M.; Paus, C.; Pellett, D.E.; Penzo, A.; Phillips, T.J.; Piacentino, G.; Pianori, E.; Pilot, J.; Pitts, K.; Plager, C.; Pondrom, L.; Poprocki, S.; Potamianos, K.; Prokoshin, F.; Pranko, A.; Ptohos, F.; Punzi, G.; Rahaman, A.; Ramakrishnan, V.; Ranjan, N.; Redondo, I.; Renton, P.; Rescigno, M.; Riddick, T.; Rimondi, F.; Ristori, L.; Robson, A.; Rodrigo, T.; Rodriguez, T.; Rogers, E.; Rolli, S.; Roser, R.; Ruffini, F.; Ruiz, A.; Russ, J.; Rusu, V.; Safonov, A.; Sakumoto, W.K.; Sakurai, Y.; Santi, L.; Sato, K.; Saveliev, V.; Savoy-Navarro, A.; Schlabach, P.; Schmidt, A.; Schmidt, E.E.; Schwarz, T.; Scodellaro, L.; Scribano, A.; Scuri, F.; Seidel, S.; Seiya, Y.; Semenov, A.; Sforza, F.; Shalhout, S.Z.; Shears, T.; Shepard, P.F.; Shimojima, M.; Shochet, M.; Shreyber-Tecker, I.; Simonenko, A.; Sinervo, P.; Sliwa, K.; Smith, J.R.; Snider, F.D.; Soha, A.; Sorin, V.; Song, H.; Squillacioti, P.; Stancari, M.; St. Denis, R.; Stelzer, B.; Stelzer-Chilton, O.; Stentz, D.; Strologas, J.; Strycker, G.L.; Sudo, Y.; Sukhanov, A.; Suslov, I.; Takemasa, K.; Takeuchi, Y.; Tang, J.; Tecchio, M.; Teng, P.K.; Thom, J.; Thome, J.; Thompson, G.A.; Thomson, E.; Toback, D.; Tokar, S.; Tollefson, K.; Tomura, T.; Tonelli, D.; Torre, S.; Torretta, D.; Totaro, P.; Trovato, M.; Ukegawa, F.; Uozumi, S.; Varganov, A.; Vazquez, F.; Velev, G.; Vellidis, C.; Vidal, M.; Vila, I.; Vilar, R.; Vizan, J.; Vogel, M.; Volpi, G.; Wagner, P.; Wagner, R.L.; Wakisaka, T.; Wallny, R.; Wang, S.M.; Warburton, A.; Waters, D.; Wester, W.C., III; Whiteson, D.; Wicklund, A.B.; Wicklund, E.; Wilbur, S.; Wick, F.; Williams, H.H.; Wilson, J.S.; Wilson, P.; Winer, B.L.; Wittich, P.; Wolbers, S.; Wolfe, H.; Wright, T.; Wu, X.; Wu, Z.; Yamamoto, K.; Yamato, D.; Yang, T.; Yang, U.K.; Yang, Y.C.; Yao, W.M.; Yeh, G.P.; Yi, K.; Yoh, J.; Yorita, K.; Yoshida, T.; Yu, G.B.; Yu, I.; Yu, S.S.; Yun, J.C.; Zanetti, A.; Zeng, Y.; Zhou, C.; Zucchelli, S.

    2012-01-01

    We report on a search for the supersymmetric partner of the top quark (scalar top) decaying into a charm quark and a neutralino in p-pbar collisions at sqrt(s)=1.96 TeV. The data sample, collected by the CDFII detector at the Fermilab Tevatron, corresponds to an integrated luminosity of 2.6 fb-1. Candidate events are selected by requiring two or more jets and a large imbalance in the transverse momentum. To enhance the analysis sensitivity, at least one of the jets is required to be identified as originating from a charm quark using an algorithm specifically designed for this analysis. The selected events are in good agreement with standard model predictions. In the case of large mass splitting between the scalar top quark and the neutralino we exclude a scalar top quark mass below 180 GeV at 95% confidence level.

  3. Measurement of spin correlation between top and antitop quarks produced in $p\\bar{p}$ collisions at $\\sqrt{s} = 1.96$ TeV

    CERN Document Server

    Abazov, Victor Mukhamedovich; Acharya, Bannanje Sripath; Adams, Mark Raymond; Adams, Todd; Agnew, James P; Alexeev, Guennadi D; Alkhazov, Georgiy D; Alton, Andrew K; Askew, Andrew Warren; Atkins, Scott; Augsten, Kamil; Aushev, Volodymyr; Aushev, Yegor; Avila, Carlos A; Badaud, Frederique; Bagby, Linda F; Baldin, Boris; Bandurin, Dmitry V; Banerjee, Sunanda; Barberis, Emanuela; Baringer, Philip S; Bartlett, JFrederick; Bassler, Ursula Rita; Bazterra, Victor; Bean, Alice L; Begalli, Marcia; Bellantoni, Leo; Beri, Suman B; Bernardi, Gregorio; Bernhard, Ralf Patrick; Bertram, Iain A; Besancon, Marc; Beuselinck, Raymond; Bhat, Pushpalatha C; Bhatia, Sudeep; Bhatnagar, Vipin; Blazey, Gerald Charles; Blessing, Susan K; Bloom, Kenneth A; Boehnlein, Amber S; Boline, Daniel Dooley; Boos, Edward E; Borissov, Guennadi; Borysova, Maryna; Brandt, Andrew; Brandt, Oleg; Brock, Raymond L; Bross, Alan D; Brown, Duncan Paul; Bu, Xue-Bing; Buehler, Marc; Buescher, Volker; Bunichev, Viacheslav Yevgenyevich; Burdin, Sergey; Buszello, Claus Peter; Camacho-Perez, Enrique; Casey, Brendan Cameron Kieran; Castilla-Valdez, Heriberto; Caughron, Seth Aaron; Chakrabarti, Subhendu; Chan, Kwok Ming Leo; Chandra, Avdhesh; Chapon, Emilien; Chen, Guo; Cho, Sung-Woong; Choi, Suyong; Choudhary, Brajesh C; Cihangir, Selcuk; Claes, Daniel R; Clutter, Justace Randall; Cooke, Michael P; Cooper, William Edward; Corcoran, Marjorie D; Couderc, Fabrice; Cousinou, Marie-Claude; Cuth, Jakub; Cutts, David; Das, Amitabha; Davies, Gavin John; de Jong, Sijbrand Jan; De La Cruz-Burelo, Eduard; Deliot, Frederic; Demina, Regina; Denisov, Dmitri S; Denisov, Sergei P; Desai, Satish Vijay; Deterre, Cecile; DeVaughan, Kayle Otis; Diehl, HThomas; Diesburg, Michael; Ding, Pengfei; Dominguez, DAaron M; Dubey, Abhinav Kumar; Dudko, Lev V; Duperrin, Arnaud; Dutt, Suneel; Eads, Michael T; Edmunds, Daniel L; Ellison, John A; Elvira, VDaniel; Enari, Yuji; Evans, Harold G; Evdokimov, Anatoly V; Evdokimov, Valeri N; Faure, Alexandre; Feng, Lei; Ferbel, Thomas; Fiedler, Frank; Filthaut, Frank; Fisher, Wade Cameron; Fisk, HEugene; Fortner, Michael R; Fox, Harald; Franc, Jiri; Fuess, Stuart C; Garbincius, Peter H; Garcia-Bellido, Aran; Garcia-Gonzalez, Jose Andres; Gavrilov, Vladimir B; Geng, Weigang; Gerber, Cecilia Elena; Gershtein, Yuri S; Ginther, George E; Gogota, Olga; Golovanov, Georgy Anatolievich; Grannis, Paul D; Greder, Sebastien; Greenlee, Herbert B; Grenier, Gerald Jean; Gris, Phillipe Luc; Grivaz, Jean-Francois; Grohsjean, Alexander; Gruenendahl, Stefan; Gruenewald, Martin Werner; Guillemin, Thibault; Gutierrez, Gaston R; Gutierrez, Phillip; Haley, Joseph Glenn Biddle; Han, Liang; Harder, Kristian; Harel, Amnon; Hauptman, John Michael; Hays, Jonathan M; Head, Tim; Hebbeker, Thomas; Hedin, David R; Hegab, Hatim; Heinson, Ann; Heintz, Ulrich; Hensel, Carsten; Heredia-De La Cruz, Ivan; Herner, Kenneth Richard; Hesketh, Gavin G; Hildreth, Michael D; Hirosky, Robert James; Hoang, Trang; Hobbs, John D; Hoeneisen, Bruce; Hogan, Julie; Hohlfeld, Mark; Holzbauer, Jenny Lyn; Howley, Ian James; Hubacek, Zdenek; Hynek, Vlastislav; Iashvili, Ia; Ilchenko, Yuriy; Illingworth, Robert A; Ito, Albert S; Jabeen, Shabnam; Jaffre, Michel J; Jayasinghe, Ayesh; Jeong, Min-Soo; Jesik, Richard L; Jiang, Peng; Johns, Kenneth Arthur; Johnson, Emily; Johnson, Marvin E; Jonckheere, Alan M; Jonsson, Per Martin; Joshi, Jyoti; Jung, Andreas Werner; Juste, Aurelio; Kajfasz, Eric; Karacheban, Olena; Karmanov, Dmitriy Y; Katsanos, Ioannis; Kaur, Manbir; Kehoe, Robert Leo Patrick; Kermiche, Smain; Khalatyan, Norayr; Khanov, Alexander; Kharchilava, Avto; Kharzheev, Yuri N; Kiselevich, Ivan Lvovich; Kohli, Jatinder M; Kozelov, Alexander V; Kraus, James Alexander; Kumar, Ashish; Kupco, Alexander; Kurca, Tibor; Kuzmin, Valentin Alexandrovich; Lammers, Sabine Wedam; Lebrun, Patrice; Lee, Hyeon-Seung; Lee, Seh-Wook; Lee, William M; Lei, Xiaowen; Lellouch, Jeremie; Li, Dikai; Li, Hengne; Li, Liang; Li, Qi-Zhong; Lim, Jeong Ku; Lincoln, Donald W; Linnemann, James Thomas; Lipaev, Vladimir V; Lipton, Ronald J; Liu, Huanzhao; Liu, Yanwen; Lobodenko, Alexandre; Lokajicek, Milos; Lopes de Sa, Rafael; Luna-Garcia, Rene; Lyon, Adam Leonard; Maciel, Arthur KA; Madar, Romain; Magana-Villalba, Ricardo; Malik, Sudhir; Malyshev, Vladimir L; Mansour, Jason; Martinez-Ortega, Jorge; McCarthy, Robert L; Mcgivern, Carrie Lynne; Meijer, Melvin M; Melnitchouk, Alexander S; Menezes, Diego D; Mercadante, Pedro Galli; Merkin, Mikhail M; Meyer, Arnd; Meyer, Jorg Manfred; Miconi, Florian; Mondal, Naba K; Mulhearn, Michael James; Nagy, Elemer; Narain, Meenakshi; Nayyar, Ruchika; Neal, Homer A; Negret, Juan Pablo; Neustroev, Petr V; Nguyen, Huong Thi; Nunnemann, Thomas P; Hernandez Orduna, Jose de Jesus; Osman, Nicolas Ahmed; Osta, Jyotsna; Pal, Arnab; Parashar, Neeti; Parihar, Vivek; Park, Sung Keun; Partridge, Richard A; Parua, Nirmalya; Patwa, Abid; Penning, Bjoern; Perfilov, Maxim Anatolyevich; Peters, Reinhild Yvonne Fatima; Petridis, Konstantinos; Petrillo, Gianluca; Petroff, Pierre; Pleier, Marc-Andre; Podstavkov, Vladimir M; Popov, Alexey V; Prewitt, Michelle; Price, Darren; Prokopenko, Nikolay N; Qian, Jianming; Quadt, Arnulf; Quinn, Gene Breese; Ratoff, Peter N; Razumov, Ivan A; Ripp-Baudot, Isabelle; Rizatdinova, Flera; Rominsky, Mandy Kathleen; Ross, Anthony; Royon, Christophe; Rubinov, Paul Michael; Ruchti, Randal C; Sajot, Gerard; Sanchez-Hernandez, Alberto; Sanders, Michiel P; Santos, Angelo Souza; Savage, David G; Savitskyi, Mykola; Sawyer, HLee; Scanlon, Timothy P; Schamberger, RDean; Scheglov, Yury A; Schellman, Heidi M; Schott, Matthias; Schwanenberger, Christian; Schwienhorst, Reinhard H; Sekaric, Jadranka; Severini, Horst; Shabalina, Elizaveta K; Shary, Viacheslav V; Shaw, Savanna; Shchukin, Andrey A; Simak, Vladislav J; Skubic, Patrick Louis; Slattery, Paul F; Smirnov, Dmitri V; Snow, Gregory R; Snow, Joel Mark; Snyder, Scott Stuart; Soldner-Rembold, Stefan; Sonnenschein, Lars; Soustruznik, Karel; Stark, Jan; Stefaniuk, Nazar; Stoyanova, Dina A; Strauss, Michael G; Suter, Louise; Svoisky, Peter V; Titov, Maxim; Tokmenin, Valeriy V; Tsai, Yun-Tse; Tsybychev, Dmitri; Tuchming, Boris; Tully, Christopher George T; Uvarov, Lev; Uvarov, Sergey L; Uzunyan, Sergey A; Van Kooten, Richard J; van Leeuwen, Willem M; Varelas, Nikos; Varnes, Erich W; Vasilyev, Igor A; Verkheev, Alexander Yurievich; Vertogradov, Leonid S; Verzocchi, Marco; Vesterinen, Mika; Vilanova, Didier; Vokac, Petr; Wahl, Horst D; Wang, Michael HLS; Warchol, Jadwiga; Watts, Gordon Thomas; Wayne, Mitchell R; Weichert, Jonas; Welty-Rieger, Leah Christine; Williams, Mark Richard James; Wilson, Graham Wallace; Wobisch, Markus; Wood, Darien Robert; Wyatt, Terence R; Xie, Yunhe; Yamada, Ryuji; Yang, Siqi; Yasuda, Takahiro; Yatsunenko, Yuriy A; Ye, Wanyu; Ye, Zhenyu; Yin, Hang; Yip, Kin; Youn, Sungwoo; Yu, Jiaming; Zennamo, Joseph; Zhao, Tianqi Gilbert; Zhou, Bing; Zhu, Junjie; Zielinski, Marek; Zieminska, Daria; Zivkovic, Lidija

    2016-06-10

    We present a measurement of the correlation between the spins of t and tbar quarks produced in proton-antiproton collisions at the Tevatron Collider at a center-of-mass energy of 1.96 TeV. We apply a matrix element technique to dilepton and single-lepton+jets final states in data accumulated with the D0 detector that correspond to an integrated luminosity of 9.7 fb$^{-1}$. The measured value of the correlation coefficient in the off-diagonal basis, $O_{off} = 0.89 \\pm 0.22$ (stat + syst), is in agreement with the standard model prediction, and represents evidence for a top-antitop quark spin correlation difference from zero at a level of 4.2 standard deviations.

  4. Measurement of the Cross Section for Prompt Isolated Diphoton Production in p\\bar p Collisions at \\sqrt{s} = 1.96 TeV

    CERN Document Server

    Aaltonen, T.; Amerio, S.; Amidei, D.; Anastassov, A.; Annovi, A.; Antos, J.; Apollinari, G.; Appel, J.A.; Apresyan, A.; Arisawa, T.; Artikov, A.; Asaadi, J.; Ashmanskas, W.; Auerbach, B.; Aurisano, A.; Azfar, F.; Badgett, W.; Barbaro-Galtieri, A.; Barnes, V.E.; Barnett, B.A.; Barria, P.; Bartos, P.; Bauce, M.; Bauer, G.; Bedeschi, F.; Beecher, D.; Behari, S.; Bellettini, G.; Bellinger, J.; Benjamin, D.; Beretvas, A.; Bhatti, A.; Binkley, M.; Bisello, D.; Bizjak, I.; Bland, K.R.; Blumenfeld, B.; Bocci, A.; Bodek, A.; Bortoletto, D.; Boudreau, J.; Boveia, A.; Brau, B.; Brigliadori, L.; Brisuda, A.; Bromberg, C.; Brucken, E.; Bucciantonio, M.; Budagov, J.; Budd, H.S.; Budd, S.; Burkett, K.; Busetto, G.; Bussey, P.; Buzatu, A.; Calancha, C.; Camarda, S.; Campanelli, M.; Campbell, M.; Canelli, F.; Canepa, A.; Carls, B.; Carlsmith, D.; Carosi, R.; Carrillo, S.; Carron, S.; Casal, B.; Casarsa, M.; Castro, A.; Catastini, P.; Cauz, D.; Cavaliere, V.; Cavalli-Sforza, M.; Cerri, A.; Cerrito, L.; Chen, Y.C.; Chertok, M.; Chiarelli, G.; Chlachidze, G.; Chlebana, F.; Cho, K.; Chokheli, D.; Chou, J.P.; Chung, W.H.; Chung, Y.S.; Ciobanu, C.I.; Ciocci, M.A.; Clark, A.; Compostella, G.; Convery, M.E.; Conway, J.; Corbo, M.; Cordelli, M.; Cox, C.A.; Cox, D.J.; Crescioli, F.; Cuenca Almenar, C.; Cuevas, J.; Culbertson, R.; Dagenhart, D.; d'Ascenzo, N.; Datta, M.; de Barbaro, P.; De Cecco, S.; De Lorenzo, G.; Dell'Orso, M.; Deluca, C.; Demortier, L.; Deng, J.; Deninno, M.; Devoto, F.; d'Errico, M.; Di Canto, A.; Di Ruzza, B.; Dittmann, J.R.; D'Onofrio, M.; Donati, S.; Dong, P.; Dorigo, M.; Dorigo, T.; Ebina, K.; Elagin, A.; Eppig, A.; Erbacher, R.; Errede, D.; Errede, S.; Ershaidat, N.; Eusebi, R.; Fang, H.C.; Farrington, S.; Feindt, M.; Fernandez, J.P.; Ferrazza, C.; Field, R.; Flanagan, G.; Forrest, R.; Frank, M.J.; Franklin, M.; Freeman, J.C.; Funakoshi, Y.; Furic, I.; Gallinaro, M.; Galyardt, J.; Garcia, J.E.; Garfinkel, A.F.; Garosi, P.; Gerberich, H.; Gerchtein, E.; Giagu, S.; Giakoumopoulou, V.; Giannetti, P.; Gibson, K.; Ginsburg, C.M.; Giokaris, N.; Giromini, P.; Giunta, M.; Giurgiu, G.; Glagolev, V.; Glenzinski, D.; Gold, M.; Goldin, D.; Goldschmidt, N.; Golossanov, A.; Gomez, G.; Gomez-Ceballos, G.; Goncharov, M.; Gonzalez, O.; Gorelov, I.; Goshaw, A.T.; Goulianos, K.; Gresele, A.; Grinstein, S.; Grosso-Pilcher, C.; Group, R.C.; Guimaraes da Costa, J.; Gunay-Unalan, Z.; Haber, C.; Hahn, S.R.; Halkiadakis, E.; Hamaguchi, A.; Han, J.Y.; Happacher, F.; Hara, K.; Hare, D.; Hare, M.; Harr, R.F.; Hatakeyama, K.; Hays, C.; Heck, M.; Heinrich, J.; Herndon, M.; Hewamanage, S.; Hidas, D.; Hocker, A.; Hopkins, W.; Horn, D.; Hou, S.; Hughes, R.E.; Hurwitz, M.; Husemann, U.; Hussain, N.; Hussein, M.; Huston, J.; Introzzi, G.; Iori, M.; Ivanov, A.; James, E.; Jang, D.; Jayatilaka, B.; Jeon, E.J.; Jha, M.K.; Jindariani, S.; Johnson, W.; Jones, M.; Joo, K.K.; Jun, S.Y.; Junk, T.R.; Kamon, T.; Karchin, P.E.; Kato, Y.; Ketchum, W.; Keung, J.; Khotilovich, V.; Kilminster, B.; Kim, D.H.; Kim, H.S.; Kim, H.W.; Kim, J.E.; Kim, M.J.; Kim, S.B.; Kim, S.H.; Kim, Y.K.; Kimura, N.; Kirby, M.; Klimenko, S.; Kondo, K.; Kong, D.J.; Konigsberg, J.; Kotwal, A.V.; Kreps, M.; Kroll, J.; Krop, D.; Krumnack, N.; Kruse, M.; Krutelyov, V.; Kuhr, T.; Kurata, M.; Kwang, S.; Laasanen, A.T.; Lami, S.; Lammel, S.; Lancaster, M.; Lander, R.L.; Lannon, K.; Lath, A.; Latino, G.; Lazzizzera, I.; LeCompte, T.; Lee, E.; Lee, H.S.; Lee, J.S.; Lee, S.W.; Leo, S.; Leone, S.; Lewis, J.D.; Lin, C.J.; Linacre, J.; Lindgren, M.; Lipeles, E.; Lister, A.; Litvintsev, D.O.; Liu, C.; Liu, Q.; Liu, T.; Lockwitz, S.; Lockyer, N.S.; Loginov, A.; Lucchesi, D.; Lueck, J.; Lujan, P.; Lukens, P.; Lungu, G.; Lys, J.; Lysak, R.; Madrak, R.; Maeshima, K.; Makhoul, K.; Maksimovic, P.; Malik, S.; Manca, G.; Manousakis-Katsikakis, A.; Margaroli, F.; Marino, C.; Martinez, M.; Martinez-Ballarin, R.; Mastrandrea, P.; Mathis, M.; Mattson, M.E.; Mazzanti, P.; McFarland, K.S.; McIntyre, P.; McNulty, R.; Mehta, A.; Mehtala, P.; Menzione, A.; Mesropian, C.; Miao, T.; Mietlicki, D.; Mitra, A.; Miyake, H.; Moed, S.; Moggi, N.; Mondragon, M.N.; Moon, C.S.; Moore, R.; Morello, M.J.; Morlock, J.; Movilla Fernandez, P.; Mukherjee, A.; Muller, Th.; Murat, P.; Mussini, M.; Nachtman, J.; Nagai, Y.; Naganoma, J.; Nakano, I.; Napier, A.; Nett, J.; Neu, C.; Neubauer, M.S.; Nielsen, J.; Nodulman, L.; Norniella, O.; Nurse, E.; Oakes, L.; Oh, S.H.; Oh, Y.D.; Oksuzian, I.; Okusawa, T.; Orava, R.; Ortolan, L.; Griso, S.Pagan; Pagliarone, C.; Palencia, E.; Papadimitriou, V.; Paramonov, A.A.; Patrick, J.; Pauletta, G.; Paulini, M.; Paus, C.; Pellett, D.E.; Penzo, A.; Phillips, T.J.; Piacentino, G.; Pianori, E.; Pilot, J.; Pitts, K.; Plager, C.; Pondrom, L.; Potamianos, K.; Poukhov, O.; Prokoshin, F.; Pronko, A.; Ptohos, F.; Pueschel, E.; Punzi, G.; Pursley, J.; Rahaman, A.; Ramakrishnan, V.; Ranjan, N.; Redondo, I.; Renton, P.; Rescigno, M.; Rimondi, F.; Ristori, L.; Robson, A.; Rodrigo, T.; Rodriguez, T.; Rogers, E.; Rolli, S.; Roser, R.; Rossi, M.; Rubbo, F.; Ruffini, F.; Ruiz, A.; Russ, J.; Rusu, V.; Safonov, A.; Sakumoto, W.K.; Sakurai, Y.; Santi, L.; Sartori, L.; Sato, K.; Saveliev, V.; Savoy-Navarro, A.; Schlabach, P.; Schmidt, A.; Schmidt, E.E.; Schmidt, M.P.; Schmitt, M.; Schwarz, T.; Scodellaro, L.; Scribano, A.; Scuri, F.; Sedov, A.; Seidel, S.; Seiya, Y.; Semenov, A.; Sforza, F.; Sfyrla, A.; Shalhout, S.Z.; Shears, T.; Shepard, P.F.; Shimojima, M.; Shiraishi, S.; Shochet, M.; Shreyber, I.; Simonenko, A.; Sinervo, P.; Sissakian, A.; Sliwa, K.; Smith, J.R.; Snider, F.D.; Soha, A.; Somalwar, S.; Sorin, V.; Squillacioti, P.; Stancari, M.; Stanitzki, M.; Denis, R.St.; Stelzer, B.; Stelzer-Chilton, O.; Stentz, D.; Strologas, J.; Strycker, G.L.; Sudo, Y.; Sukhanov, A.; Suslov, I.; Takemasa, K.; Takeuchi, Y.; Tang, J.; Tecchio, M.; Teng, P.K.; Thom, J.; Thome, J.; Thompson, G.A.; Thomson, E.; Ttito-Guzman, P.; Tkaczyk, S.; Toback, D.; Tokar, S.; Tollefson, K.; Tomura, T.; Tonelli, D.; Torre, S.; Torretta, D.; Totaro, P.; Trovato, M.; Tu, Y.; Ukegawa, F.; Uozumi, S.; Varganov, A.; Vazquez, F.; Velev, G.; Vellidis, C.; Vidal, M.; Vila, I.; Vilar, R.; Vizan, J.; Vogel, M.; Volpi, G.; Wagner, P.; Wagner, R.L.; Wakisaka, T.; Wallny, R.; Wang, S.M.; Warburton, A.; Waters, D.; Weinberger, M.; Wester, W.C., III; Whitehouse, B.; Whiteson, D.; Wicklund, A.B.; Wicklund, E.; Wilbur, S.; Wick, F.; Williams, H.H.; Wilson, J.S.; Wilson, P.; Winer, B.L.; Wittich, P.; Wolbers, S.; Wolfe, H.; Wright, T.; Wu, X.; Wu, Z.; Yamamoto, K.; Yamaoka, J.; Yang, T.; Yang, U.K.; Yang, Y.C.; Yao, W.M.; Yeh, G.P.; Yi, K.; Yoh, J.; Yorita, K.; Yoshida, T.; Yu, G.B.; Yu, I.; Yu, S.S.; Yun, J.C.; Zanetti, A.; Zeng, Y.; Zucchelli, S.

    2011-01-01

    This letter reports a measurement of the cross section of prompt isolated photon pair production in p\\bar p collisions at a total energy \\sqrt{s} = 1.96 TeV using data of 5.36/fb integrated luminosity collected with the CDF II detector at the Fermilab Tevatron. The measured cross section, differential in basic kinematic variables, is compared with three perturbative QCD predictions, a Leading Order (LO) parton shower calculation and two Next-to-Leading Order (NLO) calculations. The NLO calculations reproduce most aspects of the data. By including photon radiation from quarks before and after hard scattering, the parton shower prediction becomes competitive with the NLO predictions.

  5. Search for Gauge Mediated SUSY Breaking in Diphoton Events in proton anti-proton Collisions at √s = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Minsuk [Kyungpook National Univ., Daegu (Korea, Republic of)

    2004-12-01

    The authors present the results of a search for anomalous production of diphoton events with large missing transverse energy using the Collider Detector at Fermilab. In 202 pb-1 of p$\\bar{p}$ collisions at √s = 1.96 TeV they observe no candidate events, with an expected standard model background of 0.27 ± 0.07(stat) ± 0.10(syst) events. The results exclude a lightest chargino of mass less than 167 GeV/c2, and lightest neutralino of 93 GeV/c2 at 95% confidence level in a gauge-mediated supersymmetry-breaking model with a light gravitino.

  6. First measurement of sigma (p anti-p ---> Z) . Br (Z ---> tau tau) at s**(1/2) = 1.96- TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abazov, V.M.; Abbott, B.; Abolins, M.; Acharya, B.S.; Adams, M.; Adams, T.; Agelou, M.; Agram, J.-L.; Ahn, S.H.; Ahsan, M.; Alexeev, G.D.; Alkhazov, G.; Alton, A.; Alverson, G.; Alves, G.A.; Anastasoaie, M.; Andeen, T.; Anderson, S.; Andrieu, B.; Arnoud, Y.; Askew, A.; /Buenos Aires U. /Rio de Janeiro, CBPF /Rio de Janeiro State U. /Sao

    2004-12-01

    The authors present a measurement of the cross section for Z production times the branching fraction to {tau} leptons, {sigma} {center_dot} Br(Z {yields} {tau}{sup +}{tau}{sup -}), in p{bar p} collisions at {radical}s = 1.96 TeV in the channel in which one {tau} decays into {mu}{nu}{sub {mu}}{nu}{sub {tau}}, and the other into hadrons + {nu}{sub {tau}} or e{nu}{sub e}{nu}{sub {tau}}. The data sample corresponds to an integrated luminosity of 226 pb{sup -1} collected with the D0 detector at the Fermilab Tevatron collider. The final sample contains 2008 candidate events with an estimated background of 55%. From this they obtain {sigma} {center_dot} Br(Z {yields} {tau}{sup +}{tau}{sup -}) = 237 {+-} 15(stat) {+-} 18(sys) {+-} 15(lum) pb, in agreement with the standard model prediction.

  7. Search for high-mass resonances decaying to e mu in p anti-p collisions at s**(1/2) = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abulencia, A.; Acosta, D.; Adelman, Jahred A.; Affolder, T.; Akimoto, T.; Albrow, M.G.; Ambrose, D.; Amerio, S.; Amidei, D.; Anastassov, A.; Anikeev, K.; /Taiwan, Inst.

    2006-03-01

    The authors describe a general search for resonances decaying to a neutral e{mu} final state in p{bar p} collisions at a center-of-mass energy of 1.96 TeV. Using a data sample representing 344 pb{sup -1} of integrated luminosity recorded by the CDF II experiment, they compare Standard Model predictions with the number of observed events for invariant masses between 50 and 800 GeV/c{sup 2}. Finding no significant excess (5 events observed vs. 7.7 {+-} 0.8 expected for M{sub e{mu}} > 100 GeV/c{sup 2}), they set limits on sneutrino and Z{prime} masses as functions of lepton family number violating couplings.

  8. Gold nanoparticles production using reactor and cyclotron based methods in assessment of (196,198)Au production yields by (197)Au neutron absorption for therapeutic purposes.

    Science.gov (United States)

    Khorshidi, Abdollah

    2016-11-01

    Medical nano-gold radioisotopes is produced regularly using high-flux nuclear reactors, and an accelerator-driven neutron activator can turn out higher yield of (197)Au(n,γ)(196,198)Au reactions. Here, nano-gold production via radiative/neutron capture was investigated using irradiated Tehran Research Reactor flux and also simulated proton beam of Karaj cyclotron in Iran. (197)Au nano-solution, including 20nm shaped spherical gold and water, was irradiated under Tehran reactor flux at 2.5E+13n/cm(2)/s for (196,198)Au activity and production yield estimations. Meanwhile, the yield was examined using 30MeV proton beam of Karaj cyclotron via simulated new neutron activator containing beryllium target, bismuth moderator around the target, and also PbF2 reflector enclosed the moderator region. Transmutation in (197)Au nano-solution samples were explored at 15 and 25cm distances from the target. The neutron flux behavior inside the water and bismuth moderators was investigated for nano-gold particles transmutation. The transport of fast neutrons inside bismuth material as heavy nuclei with a lesser lethargy can be contributed in enhanced nano-gold transmutation with long duration time than the water moderator in reactor-based method. Cyclotron-driven production of βeta-emitting radioisotopes for brachytherapy applications can complete the nano-gold production technology as a safer approach as compared to the reactor-based method. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Susceptibility to HIV-1 infection is influenced by toll like receptor-2 (-196 to -174) polymorphism in a north Indian population.

    Science.gov (United States)

    Vidyant, Sanjukta; Chatterjee, Animesh; Agarwal, Vikas; Dhole, Tapan N

    2017-08-01

    Toll like receptors (TLRs) are pattern recognition receptors that recognize molecular patterns of pathogens and play an important role in innate immunity. Recent studies have identified that a single nucleotide polymorphism (SNP) in the TLR gene impairs the response to TLR ligands in some individuals and is associated with susceptibility to various infectious diseases. The present study aimed to investigate the role of four SNPs in the TLR2 gene [-196 to -174 Ins/Del, 2258 G/A (Arg753Gln), 2029 C/T (Arg677Trp) and 1892 C/A (Pro631His)] with respect to susceptibility and progression to HIV-1 in North Indian individuals. The study population consisted of 160 HIV-1 seropositive patients stratified on the basis of disease severity (stages I, II and III) and 270 HIV-1 seronegative individuals. The subjects were genotyped for TLR2 gene polymorphism by polymerase chain reaction restriction fragment length polymorphism. In the present study, we found that the TLR2 Del mutant genotype [odds ratio (OR) = 2.138; p = 0.001] and allele (OR = 1.562; p = 0.002) was at a higher frequency in patients with HIV-1 infection compared to healthy controls and was significantly associated with the risk of HIV-1 infection and disease susceptibility. Furthermore, we also found that TLR2 Del homozygous genotype was at a lower frequency in stage III (19.35%) compared to stage I (50.87%; OR = 1.901) and stage II (43.05%; OR = 1.514) and was associated with a reduced risk of HIV-1 disease progression. The present study reports for the first time that the TLR2-196 to -174 Ins/Del polymorphism is a risk factor for HIV-1 transmission in HIV-1 infected North Indian individuals. Copyright © 2017 John Wiley & Sons, Ltd.

  10. Measurement of Z+ γ production and search for anomalous triple gauge couplings in proton-antiproton collisions at √S = 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Deng, Jianrong [Duke Univ., Durham, NC (United States)

    2008-01-01

    The author presents a measurement of p$\\bar{p}$ → Zγ + X → e+e-γ + X production using proton-antiproton collisions data collected at the Collider Detector at Fermilab at a center of mass energy of 1.96 TeV. Zγ production provides a direct test of the triple neutral gauge couplings. A measurement of Zγ production cross section and search for anomalous ZZγ and Zγγ couplings are presented. The data presented are from 1.1 fb-1 of p$\\bar{p}$ integrated luminosity collected at the CDF Detector. Electrons from Z decays are selected with Et > 20 Gev. Photons (Et > 7 GeV) are required to be well-separated from the electrons. There are 390 eeγ candidate events found with 1.1 fb-1 of data, compared to the SM prediction of 375.3 ± 25.2 events. The Standard Model prediction for the cross section for p$\\bar{p}$ → e+e-γ + X production at √s = 1.96 TeV is 4.5 ± 0.4 pb. The measured cross section is 4.7 ± 0.6 pb. The cross section and kinematic distributions of the eeγ events are in good agreement with theoretical predictions. Limits on the ZZγ and Zγγ couplings are extracted using the photon Et distribution of eeγ events with meeγ > 100 GeV/c2. These are the first limits measured using CDF Run II data. These limits provide important test of the interaction of the photon and the Z boson.

  11. Final Report for grant entitled "Production of Astatine-211 for U.S. Investigators"

    Energy Technology Data Exchange (ETDEWEB)

    Wilbur, Daniel Scott

    2012-12-12

    Alpha-particle emitting radionuclides hold great promise in the therapy of cancer, but few alpha-emitters are available to investigators to evaluate. Of the alpha-emitters that have properties amenable for use in humans, 211At is of particular interest as it does not have alpha-emitting daughter radionuclides. Thus, there is a high interest in having a source of 211At for sale to investigators in the US. Production of 211At is accomplished on a cyclotron using an alpha-particle beam irradiation of bismuth metal. Unfortunately, there are few cyclotrons available that can produce an alpha particle beam for that production. The University of Washington has a cyclotron, one of three in the U.S., that is currently producing 211At. In the proposed studies, the things necessary for production and shipment of 211At to other investigators will be put into place at UW. Of major importance is the efficient production and isolation of 211At in a form that can be readily used by other investigators. In the studies, production of 211At on the UW cyclotron will be optimized by determining the best beam energy and the highest beam current to maximize 211At production. As it would be very difficult for most investigators to isolate the 211At from the irradiated target, the 211At-isolation process will be optimized and automated to more safely and efficiently obtain the 211At for shipment. Additional tasks to make the 211At available for distribution include obtaining appropriate shipping vials and containers, putting into place the requisite standard operating procedures for Radiation Safety compliance at the levels of 211At activity to be produced / shipped, and working with the Department of Energy, Isotope Development and Production for Research and Applications Program, to take orders, make shipments and be reimbursed for costs of production and shipment.

  12. Production of Astatine-211 at the Duke University Medical Center for its regional distribution

    Energy Technology Data Exchange (ETDEWEB)

    Zalutsky, Michael [Duke University Medical Center, Durham, NC (United States)

    2016-01-01

    Systemic targeted radiation therapy and radioimmunotherapy continue to be important tools in the treatment of certain cancers. Because of their high energy and short path length, alpha particle emitters such as 211At are more effective than either external beam x- ray or in vivo beta radiation in delivering potentially curative doses of radiation. The limited clinical trials that have been conducted to date have yielded encouraging responses in some patients, e.g., malignant brain tumors. In order to escalate the additional necessary research and development in radiochemistry, radiobiology and efficacy evaluation of alpha particle radiotherapeutics, it is universally agreed that access to an affordable, reliable supply of 211At is warranted. In conjunction with the Department of Energy's intent to enhance stable and radioactive isotope availability for research applications, it is the primary objective of this project to improve 211At production and purification capabilities at Duke so that this radionuclide can be supplied to researchers at other institutions throughout the US.The most widely used 211At production method involves the α,2n reaction on Bismuth using a cyclotron with beams ≤ 28 MeV. Yields can be enhanced with use of an internal target that allows for a higher alpha fluence plus efficient heat dissipation in the target. Both of these items are in place at Duke; however, in order to support production for multi-institutional use, irradiation campaigns in excess of 50 µAp and four hours duration will be needed. Further, post-irradiation processing equipment is lacking that will enable the distribution process. Financial support is sought for i) a shielded, ventilated processing/containment hood; ii) development of a post-irradiation target retrieval system; iii) fabrication of a 211At distillation and recovery module and iv) a performance review and, where needed, an enhancement of seven major subsystems that comprise the CS-30 Cyclotron. With these modifications in place, routine production of ≥200 mCi of At-211 should be readily achievable, given our methodological development of At-211 target preparation, internal target irradiation and dry distillation to recover the radionuclide.

  13. Evaluation of Plasma MicroRNAs as Diagnostic and Prognostic Biomarkers in Pancreatic Adenocarcinoma: miR-196a and miR-210 Could Be Negative and Positive Prognostic Markers, Respectively

    Directory of Open Access Journals (Sweden)

    Qi Yu

    2017-01-01

    Full Text Available Background. Identifying diagnostic and prognostic biomarkers that could be targeted in the therapy of pancreatic cancer is essential. Objective. Investigations were conducted with respect to plasma miRNA (miR-21, miR-210, miR-155, miR-196a, miR-20a, and miR-25 expression and clinicopathologic factors to evaluate the prognostic value of miRNAs in pancreatic ductal adenocarcinoma (PDAC. Methods. Plasma miRNAs were detected by real-time quantitative PCR, and the association with clinicopathologic factors was subsequently performed by univariate and multivariate analyses. Results. Six miRNAs expressed significantly higher in PDAC patients than in normal individuals were identified. Receiver operating characteristic (ROC curves were constructed. It was evident that miRNA expression associated with PDAC, lymph node metastasis, serosal infiltration, and comprehensive therapy reached significance for overall survival. High miR-196a expression was associated with poor survival (P=0.001, whereas high miR-210 expression was significantly associated with improved survival (P=0.003. Multivariate survival analysis indicated that the miR-210 and miR-196a expression signature, lymph node metastasis, and comprehensive therapy were independent factors affecting overall survival. Conclusions. MiRNA expression profile is distinctive in PDAC. Aberrant expression of certain miRNAs was remarkably involved in shaping the overall survival time, which include miR-196a overexpression and decreased miR-210 expression.

  14. Association study of tumor necrosis factor receptor type 2 M196R and toll-like receptor 2 Arg753Gln polymorphisms with acne vulgaris in a Chinese Han ethnic group.

    Science.gov (United States)

    Tian, Li-Ming; Xie, Hong-Fu; Yang, Ting; Hu, Yao-Hua; Li, Ji; Wang, Wei-Zhen

    2010-01-01

    Inflammatory cytokines such as tumor necrosis factor receptor 2 (TNFR2) and Toll-like receptor 2 (TLR2) are the main responsible mediators of inflammatory acne. Factors affecting their production may possibly influence the degree of inflammatory response and hence may account for the clinical severity of acne. However, the roles of TNFR2 and TLR2 in the pathophysiology of acne vulgaris are poorly understood. We therefore investigated the relationship between acne vulgaris susceptibility and the polymorphisms in the TNFR2 M196R as well as TLR2 Arg753Gln gene. A total of 93 acne vulgaris patients and 90 healthy subjects from the Chinese Han ethnic group were enrolled in the study. The polymerase chain reaction restriction fragment length polymorphism technique was adopted to analyze the single-nucleotide polymorphisms of the TNFR2 M196R and TLR2 Arg753Gln gene, and to examine the association between acne vulgaris and the polymorphisms in the TNFR2 M196R as well as TLR2 Arg753Gln gene. The relationship between different genotypes and the susceptibility to acne vulgaris was analyzed. There is a significant difference in the frequency of TNFR2 M196R genetic polymorphisms between the moderate-acne to severe-acne subgroups and the control group (p acne subgroup and control group (p acne vulgaris in Chinese Han patients, further supporting the contribution of inflammatory cytokines to the pathogenesis of acne.

  15. Physical and underway data collected aboard the KNORR during cruise KN196-02 in the Davis Strait from 2009-10-06 to 2009-10-29 (NODC Accession 0104281)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — NODC accession 0104281 includes physical and underway data collected aboard the KNORR during cruise KN196-02 in the Davis Strait from 2009-10-06 to 2009-10-29. These...

  16. The NRT2.5 and NRT2.6 genes are involved in growth promotion of Arabidopsis by the plant growth-promoting rhizobacterium (PGPR) strain Phyllobacterium brassicacearum STM196.

    Science.gov (United States)

    Kechid, Maya; Desbrosses, Guilhem; Rokhsi, Wafaa; Varoquaux, Fabrice; Djekoun, Abdelhamid; Touraine, Bruno

    2013-04-01

    The Phyllobacterium brassicacearum STM196 strain stimulates Arabidopsis thaliana growth and antagonizes high nitrate inhibition of lateral root development. A previous study identified two STM196-responsive genes, NRT2.5 and NRT2.6 (Mantelin et al., 2006, Planta 223: 591-603). We investigated the role of NRT2.5 and NRT2.6 in the plant response to STM196 using single and double Arabidopsis mutants. The single mutants were also crossed with an nrt2.1 mutant, lacking the major nitrate root transporter, to distinguish the effects of NRT2.5 and NRT2.6 from potential indirect effects of nitrate pools. The nrt2.5 and nrt2.6 mutations abolished the plant growth and root system architecture responses to STM196. The determination of nitrate content revealed that NRT2.5 and NRT2.6 do not play an important role in nitrate distribution between plant organs. Conversely, NRT2.5 and NRT2.6 appeared to play a role in the plant response independent of nitrate uptake. Using a nitrate reductase mutant, it was confirmed that the NRT2.5/NRT2.6-dependent plant signalling pathway is independent of nitrate-dependent regulation of root development. Our findings demonstrate that NRT2.5 and NRT2.6, which are preferentially expressed in leaves, play an essential role in plant growth promotion by the rhizospheric bacterium STM196. No claim to original US government works. New Phytologist © 2013 New Phytologist Trust.

  17. Measurement of vector boson plus D*(2010)+ meson production in p ¯p collisions at √{s }=1.96 TeV

    Science.gov (United States)

    Aaltonen, T.; Amerio, S.; Amidei, D.; Anastassov, A.; Annovi, A.; Antos, J.; Apollinari, G.; Appel, J. A.; Arisawa, T.; Artikov, A.; Asaadi, J.; Ashmanskas, W.; Auerbach, B.; Aurisano, A.; Azfar, F.; Badgett, W.; Bae, T.; Barbaro-Galtieri, A.; Barnes, V. E.; Barnett, B. A.; Barria, P.; Bartos, P.; Bauce, M.; Bedeschi, F.; Behari, S.; Bellettini, G.; Bellinger, J.; Benjamin, D.; Beretvas, A.; Bhatti, A.; Bland, K. R.; Blumenfeld, B.; Bocci, A.; Bodek, A.; Bortoletto, D.; Boudreau, J.; Boveia, A.; Brigliadori, L.; Bromberg, C.; Brucken, E.; Budagov, J.; Budd, H. S.; Burkett, K.; Busetto, G.; Bussey, P.; Butti, P.; Buzatu, A.; Calamba, A.; Camarda, S.; Campanelli, M.; Canelli, F.; Carls, B.; Carlsmith, D.; Carosi, R.; Carrillo, S.; Casal, B.; Casarsa, M.; Castro, A.; Catastini, P.; Cauz, D.; Cavaliere, V.; Cerri, A.; Cerrito, L.; Chen, Y. C.; Chertok, M.; Chiarelli, G.; Chlachidze, G.; Cho, K.; Chokheli, D.; Clark, A.; Clarke, C.; Convery, M. E.; Conway, J.; Corbo, M.; Cordelli, M.; Cox, C. A.; Cox, D. J.; Cremonesi, M.; Cruz, D.; Cuevas, J.; Culbertson, R.; d'Ascenzo, N.; Datta, M.; de Barbaro, P.; Demortier, L.; Deninno, M.; D'Errico, M.; Devoto, F.; Di Canto, A.; Di Ruzza, B.; Dittmann, J. R.; Donati, S.; D'Onofrio, M.; Dorigo, M.; Driutti, A.; Ebina, K.; Edgar, R.; Elagin, A.; Erbacher, R.; Errede, S.; Esham, B.; Farrington, S.; Fernández Ramos, J. P.; Field, R.; Flanagan, G.; Forrest, R.; Franklin, M.; Freeman, J. C.; Frisch, H.; Funakoshi, Y.; Galloni, C.; Garfinkel, A. F.; Garosi, P.; Gerberich, H.; Gerchtein, E.; Giagu, S.; Giakoumopoulou, V.; Gibson, K.; Ginsburg, C. M.; Giokaris, N.; Giromini, P.; Glagolev, V.; Glenzinski, D.; Gold, M.; Goldin, D.; Golossanov, A.; Gomez, G.; Gomez-Ceballos, G.; Goncharov, M.; González López, O.; Gorelov, I.; Goshaw, A. T.; Goulianos, K.; Gramellini, E.; Grosso-Pilcher, C.; Group, R. C.; Guimaraes da Costa, J.; Hahn, S. R.; Han, J. Y.; Happacher, F.; Hara, K.; Hare, M.; Harr, R. F.; Harrington-Taber, T.; Hatakeyama, K.; Hays, C.; Heinrich, J.; Herndon, M.; Hocker, A.; Hong, Z.; Hopkins, W.; Hou, S.; Hughes, R. E.; Husemann, U.; Hussein, M.; Huston, J.; Introzzi, G.; Iori, M.; Ivanov, A.; James, E.; Jang, D.; Jayatilaka, B.; Jeon, E. J.; Jindariani, S.; Jones, M.; Joo, K. K.; Jun, S. Y.; Junk, T. R.; Kambeitz, M.; Kamon, T.; Karchin, P. E.; Kasmi, A.; Kato, Y.; Ketchum, W.; Keung, J.; Kilminster, B.; Kim, D. H.; Kim, H. S.; Kim, J. E.; Kim, M. J.; Kim, S. H.; Kim, S. B.; Kim, Y. J.; Kim, Y. K.; Kimura, N.; Kirby, M.; Knoepfel, K.; Kondo, K.; Kong, D. J.; Konigsberg, J.; Kotwal, A. V.; Kreps, M.; Kroll, J.; Kruse, M.; Kuhr, T.; Kurata, M.; Laasanen, A. T.; Lammel, S.; Lancaster, M.; Lannon, K.; Latino, G.; Lee, H. S.; Lee, J. S.; Leo, S.; Leone, S.; Lewis, J. D.; Limosani, A.; Lipeles, E.; Lister, A.; Liu, H.; Liu, Q.; Liu, T.; Lockwitz, S.; Loginov, A.; Lucchesi, D.; Lucà, A.; Lueck, J.; Lujan, P.; Lukens, P.; Lungu, G.; Lys, J.; Lysak, R.; Madrak, R.; Maestro, P.; Malik, S.; Manca, G.; Manousakis-Katsikakis, A.; Marchese, L.; Margaroli, F.; Marino, P.; Matera, K.; Mattson, M. E.; Mazzacane, A.; Mazzanti, P.; McNulty, R.; Mehta, A.; Mehtala, P.; Mesropian, C.; Miao, T.; Mietlicki, D.; Mitra, A.; Miyake, H.; Moed, S.; Moggi, N.; Moon, C. S.; Moore, R.; Morello, M. J.; Mukherjee, A.; Muller, Th.; Murat, P.; Mussini, M.; Nachtman, J.; Nagai, Y.; Naganoma, J.; Nakano, I.; Napier, A.; Nett, J.; Neu, C.; Nigmanov, T.; Nodulman, L.; Noh, S. Y.; Norniella, O.; Oakes, L.; Oh, S. H.; Oh, Y. D.; Oksuzian, I.; Okusawa, T.; Orava, R.; Ortolan, L.; Pagliarone, C.; Palencia, E.; Palni, P.; Papadimitriou, V.; Parker, W.; Pauletta, G.; Paulini, M.; Paus, C.; Phillips, T. J.; Piacentino, G.; Pianori, E.; Pilot, J.; Pitts, K.; Plager, C.; Pondrom, L.; Poprocki, S.; Potamianos, K.; Pranko, A.; Prokoshin, F.; Ptohos, F.; Punzi, G.; Redondo Fernández, I.; Renton, P.; Rescigno, M.; Rimondi, F.; Ristori, L.; Robson, A.; Rodriguez, T.; Rolli, S.; Ronzani, M.; Roser, R.; Rosner, J. L.; Ruffini, F.; Ruiz, A.; Russ, J.; Rusu, V.; Sakumoto, W. K.; Sakurai, Y.; Santi, L.; Sato, K.; Saveliev, V.; Savoy-Navarro, A.; Schlabach, P.; Schmidt, E. E.; Schwarz, T.; Scodellaro, L.; Scuri, F.; Seidel, S.; Seiya, Y.; Semenov, A.; Sforza, F.; Shalhout, S. Z.; Shears, T.; Shepard, P. F.; Shimojima, M.; Shochet, M.; Shreyber-Tecker, I.; Simonenko, A.; Sliwa, K.; Smith, J. R.; Snider, F. D.; Song, H.; Sorin, V.; Denis, R. St.; Stancari, M.; Stentz, D.; Strologas, J.; Sudo, Y.; Sukhanov, A.; Suslov, I.; Takemasa, K.; Takeuchi, Y.; Tang, J.; Tecchio, M.; Teng, P. K.; Thom, J.; Thomson, E.; Thukral, V.; Toback, D.; Tokar, S.; Tollefson, K.; Tomura, T.; Tonelli, D.; Torre, S.; Torretta, D.; Totaro, P.; Trovato, M.; Ukegawa, F.; Uozumi, S.; Vázquez, F.; Velev, G.; Vellidis, C.; Vernieri, C.; Vidal, M.; Vilar, R.; Vizán, J.; Vogel, M.; Volpi, G.; Wagner, P.; Wallny, R.; Wang, S. M.; Waters, D.; Wester, W. C.; Whiteson, D.; Wicklund, A. B.; Wilbur, S.; Williams, H. H.; Wilson, J. S.; Wilson, P.; Winer, B. L.; Wittich, P.; Wolbers, S.; Wolfe, H.; Wright, T.; Wu, X.; Wu, Z.; Yamamoto, K.; Yamato, D.; Yang, T.; Yang, U. K.; Yang, Y. C.; Yao, W.-M.; Yeh, G. P.; Yi, K.; Yoh, J.; Yorita, K.; Yoshida, T.; Yu, G. B.; Yu, I.; Zanetti, A. M.; Zeng, Y.; Zhou, C.; Zucchelli, S.; CDF Collaboration

    2016-03-01

    A measurement of vector boson (V ) production in conjunction with a D*(2010)+meson is presented. Using a data sample corresponding to 9.7 fb-1 of proton-antiproton collisions at center-of-mass energy √{s }=1.96 TeV produced by the Fermilab Tevatron, we reconstruct V +D*+ samples with the CDF II detector. The D*+ is fully reconstructed in the D*(2010)+→D0(→K-π+)π+ decay mode. This technique is sensitive to the associated production of vector boson plus charm or bottom mesons. We measure the ratio of production cross sections σ (W +D*)/σ (W )=[1.75 ±0.13 (stat ) ±0.09 (stat ) ]% and σ (Z +D*)/σ (Z )=[1.5 ±0.4 (stat ) ±0.2 (stat ) ]% and perform a differential measurement of d σ (W +D*)/d pT(D*). Event properties are utilized to determine the fraction of V +D*(2010)+ events originating from different production processes. The results are in agreement with the predictions obtained with the pythia program, limiting possible contribution from non-standard-model physics processes.

  18. Measurement of the Bc± production cross section in p p ¯ collisions at √{s }=1.96 TeV

    Science.gov (United States)

    Aaltonen, T.; Amerio, S.; Amidei, D.; Anastassov, A.; Annovi, A.; Antos, J.; Apollinari, G.; Appel, J. A.; Arisawa, T.; Artikov, A.; Asaadi, J.; Ashmanskas, W.; Auerbach, B.; Aurisano, A.; Azfar, F.; Badgett, W.; Bae, T.; Barbaro-Galtieri, A.; Barnes, V. E.; Barnett, B. A.; Barria, P.; Bartos, P.; Bauce, M.; Bedeschi, F.; Behari, S.; Bellettini, G.; Bellinger, J.; Benjamin, D.; Beretvas, A.; Bhatti, A.; Bland, K. R.; Blumenfeld, B.; Bocci, A.; Bodek, A.; Bortoletto, D.; Boudreau, J.; Boveia, A.; Brigliadori, L.; Bromberg, C.; Brucken, E.; Budagov, J.; Budd, H. S.; Burkett, K.; Busetto, G.; Bussey, P.; Butti, P.; Buzatu, A.; Calamba, A.; Camarda, S.; Campanelli, M.; Canelli, F.; Carls, B.; Carlsmith, D.; Carosi, R.; Carrillo, S.; Casal, B.; Casarsa, M.; Castro, A.; Catastini, P.; Cauz, D.; Cavaliere, V.; Cerri, A.; Cerrito, L.; Chen, Y. C.; Chertok, M.; Chiarelli, G.; Chlachidze, G.; Cho, K.; Chokheli, D.; Clark, A.; Clarke, C.; Convery, M. E.; Conway, J.; Corbo, M.; Cordelli, M.; Cox, C. A.; Cox, D. J.; Cremonesi, M.; Cruz, D.; Cuevas, J.; Culbertson, R.; d'Ascenzo, N.; Datta, M.; de Barbaro, P.; Demortier, L.; Deninno, M.; D'Errico, M.; Devoto, F.; Di Canto, A.; Di Ruzza, B.; Dittmann, J. R.; Donati, S.; D'Onofrio, M.; Dorigo, M.; Driutti, A.; Ebina, K.; Edgar, R.; Erbacher, R.; Errede, S.; Esham, B.; Farrington, S.; Fernández Ramos, J. P.; Field, R.; Flanagan, G.; Forrest, R.; Franklin, M.; Freeman, J. C.; Frisch, H.; Funakoshi, Y.; Galloni, C.; Garfinkel, A. F.; Garosi, P.; Gerberich, H.; Gerchtein, E.; Giagu, S.; Giakoumopoulou, V.; Gibson, K.; Ginsburg, C. M.; Giokaris, N.; Giromini, P.; Glagolev, V.; Glenzinski, D.; Gold, M.; Goldin, D.; Golossanov, A.; Gomez, G.; Gomez-Ceballos, G.; Goncharov, M.; González López, O.; Gorelov, I.; Goshaw, A. T.; Goulianos, K.; Gramellini, E.; Grosso-Pilcher, C.; Guimaraes da Costa, J.; Hahn, S. R.; Han, J. Y.; Happacher, F.; Hara, K.; Hare, M.; Harr, R. F.; Harrington-Taber, T.; Hartz, M.; Hatakeyama, K.; Hays, C.; Heinrich, J.; Herndon, M.; Hocker, A.; Hong, Z.; Hopkins, W.; Hou, S.; Hughes, R. E.; Husemann, U.; Hussein, M.; Huston, J.; Introzzi, G.; Iori, M.; Ivanov, A.; James, E.; Jang, D.; Jayatilaka, B.; Jeon, E. J.; Jindariani, S.; Jones, M.; Joo, K. K.; Jun, S. Y.; Junk, T. R.; Kambeitz, M.; Kamon, T.; Karchin, P. E.; Kasmi, A.; Kato, Y.; Ketchum, W.; Keung, J.; Kilminster, B.; Kim, D. H.; Kim, H. S.; Kim, J. E.; Kim, M. J.; Kim, S. H.; Kim, S. B.; Kim, Y. J.; Kim, Y. K.; Kimura, N.; Kirby, M.; Knoepfel, K.; Kondo, K.; Kong, D. J.; Konigsberg, J.; Kotwal, A. V.; Kreps, M.; Kroll, J.; Kruse, M.; Kuhr, T.; Kurata, M.; Laasanen, A. T.; Lammel, S.; Lancaster, M.; Lannon, K.; Latino, G.; Lee, H. S.; Lee, J. S.; Leo, S.; Leone, S.; Lewis, J. D.; Limosani, A.; Lipeles, E.; Lister, A.; Liu, Q.; Liu, T.; Lockwitz, S.; Loginov, A.; Lucchesi, D.; Lucà, A.; Lueck, J.; Lujan, P.; Lukens, P.; Lungu, G.; Lys, J.; Lysak, R.; Madrak, R.; Maestro, P.; Malik, S.; Manca, G.; Manousakis-Katsikakis, A.; Marchese, L.; Margaroli, F.; Marino, P.; Matera, K.; Mattson, M. E.; Mazzacane, A.; Mazzanti, P.; McNulty, R.; Mehta, A.; Mehtala, P.; Mesropian, C.; Miao, T.; Mietlicki, D.; Mitra, A.; Miyake, H.; Moed, S.; Moggi, N.; Moon, C. S.; Moore, R.; Morello, M. J.; Mukherjee, A.; Muller, Th.; Murat, P.; Mussini, M.; Nachtman, J.; Nagai, Y.; Naganoma, J.; Nakano, I.; Napier, A.; Nett, J.; Nigmanov, T.; Nodulman, L.; Noh, S. Y.; Norniella, O.; Oakes, L.; Oh, S. H.; Oh, Y. D.; Okusawa, T.; Orava, R.; Ortolan, L.; Pagliarone, C.; Palencia, E.; Palni, P.; Papadimitriou, V.; Parker, W.; Pauletta, G.; Paulini, M.; Paus, C.; Phillips, T. J.; Piacentino, G.; Pianori, E.; Pilot, J.; Pitts, K.; Plager, C.; Pondrom, L.; Poprocki, S.; Potamianos, K.; Pranko, A.; Prokoshin, F.; Ptohos, F.; Punzi, G.; Redondo Fernández, I.; Renton, P.; Rescigno, M.; Rimondi, F.; Ristori, L.; Robson, A.; Rodriguez, T.; Rolli, S.; Ronzani, M.; Roser, R.; Rosner, J. L.; Ruffini, F.; Ruiz, A.; Russ, J.; Rusu, V.; Sakumoto, W. K.; Sakurai, Y.; Santi, L.; Sato, K.; Saveliev, V.; Savoy-Navarro, A.; Schlabach, P.; Schmidt, E. E.; Schwarz, T.; Scodellaro, L.; Scuri, F.; Seidel, S.; Seiya, Y.; Semenov, A.; Sforza, F.; Shalhout, S. Z.; Shears, T.; Shepard, P. F.; Shimojima, M.; Shochet, M.; Shreyber-Tecker, I.; Simonenko, A.; Sliwa, K.; Smith, J. R.; Snider, F. D.; Song, H.; Sorin, V.; St. Denis, R.; Stancari, M.; Stentz, D.; Strologas, J.; Sudo, Y.; Sukhanov, A.; Suslov, I.; Takemasa, K.; Takeuchi, Y.; Tang, J.; Tecchio, M.; Teng, P. K.; Thom, J.; Thomson, E.; Thukral, V.; Toback, D.; Tokar, S.; Tollefson, K.; Tomura, T.; Tonelli, D.; Torre, S.; Torretta, D.; Totaro, P.; Trovato, M.; Ukegawa, F.; Uozumi, S.; Vázquez, F.; Velev, G.; Vellidis, C.; Vernieri, C.; Vidal, M.; Vilar, R.; Vizán, J.; Vogel, M.; Volpi, G.; Wagner, P.; Wallny, R.; Wang, S. M.; Waters, D.; Wester, W. C.; Whiteson, D.; Wicklund, A. B.; Wilbur, S.; Williams, H. H.; Wilson, J. S.; Wilson, P.; Winer, B. L.; Wittich, P.; Wolbers, S.; Wolfe, H.; Wright, T.; Wu, X.; Wu, Z.; Yamamoto, K.; Yamato, D.; Yang, T.; Yang, U. K.; Yang, Y. C.; Yao, W.-M.; Yeh, G. P.; Yi, K.; Yoh, J.; Yorita, K.; Yoshida, T.; Yu, G. B.; Yu, I.; Zanetti, A. M.; Zeng, Y.; Zhou, C.; Zucchelli, S.; CDF Collaboration

    2016-03-01

    We describe a measurement of the ratio of the cross sections times branching fractions of the Bc+ meson in the decay mode Bc+→J /ψ μ+ν to the B+ meson in the decay mode B+→J /ψ K+ in proton-antiproton collisions at center-of-mass energy √{s }=1.96 TeV . The measurement is based on the complete CDF Run II data set, which comes from an integrated luminosity of 8.7 fb-1. The ratio of the production cross sections times branching fractions for Bc+ and B+ mesons with momentum transverse to the beam greater than 6 GeV /c and rapidity magnitude smaller than 0.6 is 0.211 ±0.012 (stat)-0.020 +0.021(syst ) . Using the known B+→J /ψ K+ branching fraction, the known B+ production cross section, and a selection of the predicted Bc+→J /ψ μ+ν branching fractions, the range for the total Bc+ production cross section is estimated.

  19. Characterization of Vadose Zone Sediments Below the T Tank Farm: Boreholes C4104, C4105, 299-W10-196, and RCRA Borehole 299-W11-39

    Energy Technology Data Exchange (ETDEWEB)

    Serne, R. Jeffrey; Bjornstad, Bruce N.; Horton, Duane G.; Lanigan, David C.; Schaef, Herbert T.; Lindenmeier, Clark W.; Lindberg, Michael J.; Clayton, Ray E.; Legore, Virginia L.; Geiszler, Keith N.; Baum, Steven R.; Valenta, Michelle M.; Kutnyakov, Igor V.; Vickerman, Tanya S.; Orr, Robert D.; Brown, Christopher F.

    2008-09-11

    This report was revised in September 2008 to remove acid-extractable sodium data from Tables 4.8, 4.28, and 4.52. The sodium data was removed due to potential contamination introduced during the acid extraction process. The rest of the text remains unchanged from the original report issued in September 2004. The overall goal of the Tank Farm Vadose Zone Project, led by CH2M HILL Hanford Group, Inc., is to define risks from past and future single-shell tank farm activities at Hanford. To meet this goal, CH2M HILL Hanford Group, Inc. tasked scientists from Pacific Northwest National Laboratory to perform detailed analyses on vadose zone sediments from within Waste Management Area (WMA) T-TX-TY. This report is the second of two reports written to present the results of these analyses. Specifically, this report contains all the geologic, geochemical, and selected physical characterization data collected on vadose zone sediment recovered from boreholes C4104 and C4105 in the T Tank Farm, and from borehole 299-W-11-39 installed northeast of the T Tank Farm. Finally, the measurements on sediments from borehole C4104 are compared with a nearby borehole drilled in 1993, 299- W10-196, through the tank T-106 leak plume.

  20. Study of vector boson plus $D^{*}(2010)^+$ meson production in $\\bar{p}p$ collisions at $\\sqrt{s}=1.96\\, {\\rm TeV}$

    CERN Document Server

    Aaltonen, Timo Antero; Amidei, Dante E; Anastassov, Anton Iankov; Annovi, Alberto; Antos, Jaroslav; Apollinari, Giorgio; Appel, Jeffrey A; Arisawa, Tetsuo; Artikov, Akram Muzafarovich; Asaadi, Jonathan A; Ashmanskas, William Joseph; Auerbach, Benjamin; Aurisano, Adam J; Azfar, Farrukh A; Badgett, William Farris; Bae, Taegil; Barbaro-Galtieri, Angela; Barnes, Virgil E; Barnett, Bruce Arnold; Barria, Patrizia; Bartos, Pavol; Bauce, Matteo; Bedeschi, Franco; Behari, Satyajit; Bellettini, Giorgio; Bellinger, James Nugent; Benjamin, Douglas P; Beretvas, Andrew F; Bhatti, Anwar Ahmad; Bland, Karen Renee; Blumenfeld, Barry J; Bocci, Andrea; Bodek, Arie; Bortoletto, Daniela; Boudreau, Joseph Francis; Boveia, Antonio; Brigliadori, Luca; Bromberg, Carl Michael; Brucken, Erik; Budagov, Ioulian A; Budd, Howard Scott; Burkett, Kevin Alan; Busetto, Giovanni; Bussey, Peter John; Butti, Pierfrancesco; Buzatu, Adrian; Calamba, Aristotle; Camarda, Stefano; Campanelli, Mario; Canelli, Florencia; Carls, Benjamin; Carlsmith, Duncan L; Carosi, Roberto; Carrillo Moreno, Salvador; Casal Larana, Bruno; Casarsa, Massimo; Castro, Andrea; Catastini, Pierluigi; Cauz, Diego; Cavaliere, Viviana; Cerri, Alessandro; Cerrito, Lucio; Chen, Yen-Chu; Chertok, Maxwell Benjamin; Chiarelli, Giorgio; Chlachidze, Gouram; Cho, Kihyeon; Chokheli, Davit; Clark, Allan Geoffrey; Clarke, Christopher Joseph; Convery, Mary Elizabeth; Conway, John Stephen; Corbo, Matteo; Cordelli, Marco; Cox, Charles Alexander; Cox, David Jeremy; Cremonesi, Matteo; Cruz Alonso, Daniel; Cuevas Maestro, Javier; Culbertson, Raymond Lloyd; D'Ascenzo, Nicola; Datta, Mousumi; de Barbaro, Pawel; Demortier, Luc M; Deninno, Maria Maddalena; D'Errico, Maria; Devoto, Francesco; Di Canto, Angelo; Di Ruzza, Benedetto; Dittmann, Jay Richard; Donati, Simone; D'Onofrio, Monica; Dorigo, Mirco; Driutti, Anna; Ebina, Koji; Edgar, Ryan Christopher; Elagin, Andrey L; Erbacher, Robin D; Errede, Steven Michael; Esham, Benjamin; Farrington, Sinead Marie; Fernández Ramos, Juan Pablo; Field, Richard D; Flanagan, Gene U; Forrest, Robert David; Franklin, Melissa EB; Freeman, John Christian; Frisch, Henry J; Funakoshi, Yujiro; Galloni, Camilla; Garfinkel, Arthur F; Garosi, Paola; Gerberich, Heather Kay; Gerchtein, Elena A; Giagu, Stefano; Giakoumopoulou, Viktoria Athina; Gibson, Karen Ruth; Ginsburg, Camille Marie; Giokaris, Nikos D; Giromini, Paolo; Glagolev, Vladimir; Glenzinski, Douglas Andrew; Gold, Michael S; Goldin, Daniel; Golossanov, Alexander; Gomez, Gervasio; Gomez-Ceballos, Guillelmo; Goncharov, Maxim T; González López, Oscar; Gorelov, Igor V; Goshaw, Alfred T; Goulianos, Konstantin A; Gramellini, Elena; Grosso-Pilcher, Carla; Group, Robert Craig; Guimaraes da Costa, Joao; Hahn, Stephen R; Han, Ji-Yeon; Happacher, Fabio; Hara, Kazuhiko; Hare, Matthew Frederick; Harr, Robert Francis; Harrington-Taber, Timothy; Hatakeyama, Kenichi; Hays, Christopher Paul; Heinrich, Joel G; Herndon, Matthew Fairbanks; Hocker, James Andrew; Hong, Ziqing; Hopkins, Walter Howard; Hou, Suen Ray; Hughes, Richard Edward; Husemann, Ulrich; Hussein, Mohammad; Huston, Joey Walter; Introzzi, Gianluca; Iori, Maurizio; Ivanov, Andrew Gennadievich; James, Eric B; Jang, Dongwook; Jayatilaka, Bodhitha Anjalike; Jeon, Eun-Ju; Jindariani, Sergo Robert; Jones, Matthew T; Joo, Kyung Kwang; Jun, Soon Yung; Junk, Thomas R; Kambeitz, Manuel; Kamon, Teruki; Karchin, Paul Edmund; Kasmi, Azeddine; Kato, Yukihiro; Ketchum, Wesley Robert; Keung, Justin Kien; Kilminster, Benjamin John; Kim, DongHee; Kim, Hyunsoo; Kim, Jieun; Kim, Min Jeong; Kim, Shin-Hong; Kim, Soo Bong; Kim, Young-Jin; Kim, Young-Kee; Kimura, Naoki; Kirby, Michael H; Knoepfel, Kyle James; Kondo, Kunitaka; Kong, Dae Jung; Konigsberg, Jacobo; Kotwal, Ashutosh Vijay; Kreps, Michal; Kroll, IJoseph; Kruse, Mark Charles; Kuhr, Thomas; Kurata, Masakazu; Laasanen, Alvin Toivo; Lammel, Stephan; Lancaster, Mark; Lannon, Kevin Patrick; Latino, Giuseppe; Lee, Hyun Su; Lee, Jaison; Leo, Sabato; Leone, Sandra; Lewis, Jonathan D; Limosani, Antonio; Lipeles, Elliot David; Lister, Alison; Liu, Hao; Liu, Qiuguang; Liu, Tiehui Ted; Lockwitz, Sarah E; Loginov, Andrey Borisovich; Lucchesi, Donatella; Lucà, Alessandra; Lueck, Jan; Lujan, Paul Joseph; Lukens, Patrick Thomas; Lungu, Gheorghe; Lys, Jeremy E; Lysak, Roman; Madrak, Robyn Leigh; Maestro, Paolo; Malik, Sarah Alam; Manca, Giulia; Manousakis-Katsikakis, Arkadios; Marchese, Luigi; Margaroli, Fabrizio; Marino, Christopher Phillip; Matera, Keith; Mattson, Mark Edward; Mazzacane, Anna; Mazzanti, Paolo; McNulty, Ronan; Mehta, Andrew; Mehtala, Petteri; Mesropian, Christina; Miao, Ting; Mietlicki, David John; Mitra, Ankush; Miyake, Hideki; Moed, Shulamit; Moggi, Niccolo; Moon, Chang-Seong; Moore, Ronald Scott; Morello, Michael Joseph; Mukherjee, Aseet; Muller, Thomas; Murat, Pavel A; Mussini, Manuel; Nachtman, Jane Marie; Nagai, Yoshikazu; Naganoma, Junji; Nakano, Itsuo; Napier, Austin; Nett, Jason Michael; Neu, Christopher Carl; Nigmanov, Turgun S; Nodulman, Lawrence J; Noh, Seoyoung; Norniella Francisco, Olga; Oakes, Louise Beth; Oh, Seog Hwan; Oh, Young-do; Oksuzian, Iuri Artur; Okusawa, Toru; Orava, Risto Olavi; Ortolan, Lorenzo; Pagliarone, Carmine Elvezio; Palencia, Jose Enrique; Palni, Prabhakar; Papadimitriou, Vaia; Parker, William Chesluk; Pauletta, Giovanni; Paulini, Manfred; Paus, Christoph Maria Ernst; Phillips, Thomas J; Piacentino, Giovanni M; Pianori, Elisabetta; Pilot, Justin Robert; Pitts, Kevin T; Plager, Charles; Pondrom, Lee G; Poprocki, Stephen; Potamianos, Karolos Jozef; Pranko, Aliaksandr Pavlovich; Prokoshin, Fedor; Ptohos, Fotios K; Punzi, Giovanni; Redondo Fernández, Ignacio; Renton, Peter B; Rescigno, Marco; Rimondi, Franco; Ristori, Luciano; Robson, Aidan; Rodriguez, Tatiana Isabel; Rolli, Simona; Ronzani, Manfredi; Roser, Robert Martin; Rosner, Jonathan L; Ruffini, Fabrizio; Ruiz Jimeno, Alberto; Russ, James S; Rusu, Vadim Liviu; Sakumoto, Willis Kazuo; Sakurai, Yuki; Santi, Lorenzo; Sato, Koji; Saveliev, Valeri; Savoy-Navarro, Aurore; Schlabach, Philip; Schmidt, Eugene E; Schwarz, Thomas A; Scodellaro, Luca; Scuri, Fabrizio; Seidel, Sally C; Seiya, Yoshihiro; Semenov, Alexei; Sforza, Federico; Shalhout, Shalhout Zaki; Shears, Tara G; Shepard, Paul F; Shimojima, Makoto; Shochet, Melvyn J; Shreyber-Tecker, Irina; Simonenko, Alexander V; Sliwa, Krzysztof Jan; Smith, John Rodgers; Snider, Frederick Douglas; Song, Hao; Sorin, Maria Veronica; St Denis, Richard Dante; Stancari, Michelle Dawn; Stentz, Dale James; Strologas, John; Sudo, Yuji; Sukhanov, Alexander I; Suslov, Igor M; Takemasa, Ken-ichi; Takeuchi, Yuji; Tang, Jian; Tecchio, Monica; Teng, Ping-Kun; Thom, Julia; Thomson, Evelyn Jean; Thukral, Vaikunth; Toback, David A; Tokar, Stanislav; Tollefson, Kirsten Anne; Tomura, Tomonobu; Tonelli, Diego; Torre, Stefano; Torretta, Donatella; Totaro, Pierluigi; Trovato, Marco; Ukegawa, Fumihiko; Uozumi, Satoru; Velev, Gueorgui; Vellidis, Konstantinos; Vernieri, Caterina; Vidal Marono, Miguel; Vilar Cortabitarte, Rocio; Vizán Garcia, Jesus Manuel; Vogel, Marcelo; Volpi, Guido; Vázquez-Valencia, Elsa Fabiola; Wagner, Peter; Wallny, Rainer S; Wang, Song-Ming; Waters, David S; Wester, William Carl; Whiteson, Daniel O; Wicklund, Arthur Barry; Wilbur, Scott; Williams, Hugh H; Wilson, Jonathan Samuel; Wilson, Peter James; Winer, Brian L; Wittich, Peter; Wolbers, Stephen A; Wolfe, Homer; Wright, Thomas Roland; Wu, Xin; Wu, Zhenbin; Yamamoto, Kazuhiro; Yamato, Daisuke; Yang, Tingjun; Yang, Un-Ki; Yang, Yu Chul; Yao, Wei-Ming; Yeh, Gong Ping; Yi, Kai; Yoh, John; Yorita, Kohei; Yoshida, Takuo; Yu, Geum Bong; Yu, Intae; Zanetti, Anna Maria; Zeng, Yu; Zhou, Chen; Zucchelli, Stefano

    2016-03-21

    A study of vector boson ($V$) production in conjunction with a $D^{*}(2010)^+$ meson is presented. Using a data sample correponding to $9.7\\, {\\rm fb}^{-1}$ of proton-antiproton collisions at center-of-mass energy $\\sqrt{s}=1.96\\rm~ TeV$ produced by the Fermilab Tevatron, we reconstruct $V+D^{*+}$ samples with the CDF~II detector. The $D^{*+}$ is fully reconstructed in the $D^{*}(2010)^+ \\rightarrow D^{0}(\\to K^-\\pi^+)\\pi^+$ decay mode. This technique is sensitive to the associated production of vector boson plus charm or bottom mesons. We measure the ratio of production cross sections $\\sigma(W+D^{*})/\\sigma(W)$ = $[1.75\\pm 0.13 {\\rm (stat)}\\pm 0.09 {\\rm (syst)}]\\% $ and $\\sigma(Z+D^{*})/\\sigma(Z)$ = $[1.5\\pm 0.4 {\\rm (stat)} \\pm 0.2 {\\rm (syst)}]\\% $. Event properties are utilized to determine the fraction of $V+D^{*}(2010)^+$ events originating from different production processes. The results are in agreement with the predictions obtained with the {\\sc pythia} program, limiting possible contribution from n...

  1. Search for anomalous production of multi-lepton events in p anti-p collisions at s**(1/2) = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abulencia, A.; Adelman, Jahred A.; Affolder, T.; Akimoto, T.; Albrow, M.G.; Ambrose, D.; Amerio, S.; Amidei, D.; Anastassov, A.; Anikeev, K.; Annovi, A.; /Taiwan, Inst.

    2007-01-01

    The authors report a search for the anomalous production of events with multiple charged leptons in p{bar p} collisions at {radical}s = 1.96 TeV using a data sample corresponding to an integrated luminosity of 346 pb{sup -1} collected by the CDF II detector at the Fermilab Tevatron. The search is divided into three-lepton and four-or-more-lepton data samples. They observe six events in the three-lepton sample and zero events in the {ge}4-lepton sample. Both numbers of events are consistent with standard model background expectations. Within the framework of an R-parity violating supergravity model, the results are interpreted as mass limits on the lightest neutralino ({bar {chi}}{sub 1}{sup 0}) and chargino ({bar {chi}}{sub 1}{sup {+-}}) particles. For one particular choice of model parameters, the limits are M({bar {chi}}{sub 1}{sup 0}) > 110 GeV/c{sup 2} and M({bar {chi}}{sub 1}{sup {+-}}) > 203 GeV/c{sup 2} at 95% confidence level; the variation of these mass limits with model parameters is presented.

  2. Search for New Particles Leading to Z+jets Final States in p anti-p Collisions at s**(1/2) = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Aaltonen, T.; /Helsinki Inst. of Phys.; Abulencia, A.; /Illinois U., Urbana; Adelman, J.; /Chicago U.; Affolder, Anthony Allen; /UC, Santa Barbara; Akimoto, T.; /Tsukuba U.; Albrow, Michael G.; /Fermilab; Amerio, S.; /Padua U.; Amidei, Dante E.; /Michigan U.; Anastassov, A.; /Rutgers U., Piscataway; Anikeev, Konstantin V.; /Fermilab; Annovi, A.; /Frascati /Comenius U.

    2007-06-01

    We present the results of a search for new particles that lead to a Z boson plus jets in p{bar p} collisions at {radical}s = 1.96 TeV using the Collider Detector at Fermilab (CDF II). A data sample with a luminosity of 1.06 fb{sup -1} collected using Z boson decays to ee and {mu}{mu} is used. We describe a completely data-based method to predict the dominant background from standard-model Z+jet events. This method can be similarly applied to other analyses requiring background predictions in multi-jet environments, as shown when validating the method by predicting the background from W+jets in t{bar t} production. No significant excess above the background prediction is observed, and a limit is set using a fourth generation quark model to quantify the acceptance. Assuming BR(b{prime} {yields} bZ) = 100% and using a leading-order calculation of the b{prime} cross section, b{prime} quark masses below 268 GeV/c2 are excluded at 95% confidence level.

  3. Measurement of the photon plus b-jet production differential cross section in $p\\bar{p}$ collisions at $\\sqrt{s}$ =1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abazov, V. M.; Abbott, B; Acharya, B S; Adams, M; Adams, T; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Aoki, M; Askew, A; Atkins, S; Augsten, K; Avila, C; Badaud, F; Bagby, L; Baldin, B; Bandurin, D V; Banerjee, S; Barberis, E; Baringer, P; Barreto, J; Bartlett, J F; Bartosik, N; Bassler, U; Bazterra, V; Bean, A; Begalli, M; Bellantoni, L; Beri, S B; Bernardi, G; Bernhard, R; Bertram, I; Besancon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatia, S; Bhatnagar, V; Blazeay, G; Blessing, S; Bloom, K; Boehnlein, A; Boline, D; Boos, E E; Borissov, G; Bose, T; Brandt, A; Brandt, O; Brock, R; Brooijmans, G; Bross, A; Brown, D; Brown, J; Bu, X B; Buehler, M; Buescher, V; Bunichev, V; Burdin, S; Buszello, C P; Camacho-Perez, E; Casey, B C. K.; Castilla-Valdez, H; Caughron, S; Chakrabarti, S; Chakraborty, D; Chan, K M; Chandra, A; Chapon, E; Chen, G; Chevalier-Thery, S; Cho, D K; Cho, S W; Choi, S; Choudhary, B; Cihangir, S; Claes, D; Clutter, J; Cooke, M; Cooper, W E; Corcoran, M; Couderc, F; Cousinou, M -C; Croc, A; Cutts, D; Das, A; Davies, G; de Jong, S J; De La Cruz-Burelo, E; Deliot, F; Demina, R; Denisov, D; Denisov, S P; Desai, S; Deterre, C; DeVaughan, K; Diehl, H T; Diesburg, M; Ding, P F; Dominguez, A; Dubey, A; Dudko, L V; Duggan, D; Duperrin, A; Dutt, S; Dyshkant, A; Eads, M; Edmunds, D; Ellison, J; Elvira, V D; Enari, Y; Evans, H; Evdokimov, A; Evdokimov, V N; Facini, G; Feng, L; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Fortner, M; Fox, H; Fuess, S; Garcia-Bellido, A; Garcia-Gonzalez, J A; Garcia-Guerra, G A; Gavrilov, V; Gay, R; Geng, W; Gerbaudo, D; Gerber, C E; Gershtein, Y; Ginther, G; Golovanov, G; Goussiou, A; Grannis, P D; Greder, S; Greenlee, H; Grenier, G; Gris, Ph; Grivaz, J -F; Grohsjean, A; Gruenendahl, S; Gruenewald, M W; Guillemin, T; Gutierrez, G; Gutierrez, P; Haas, A; Hagopian, S; Haley, J; Han, L; Harder, K; Harel, A; Hauptman, J M; Hays, J; Head, T; Hebbeker, T; Hedin, D; Hegab, H; Heinson, A P; Heintz, U; Hensel, C; Heredia-De La Cruz, I; Herner, K; Hesketh, G; Hildreth, M D; Hirosky, R; Hoang, T; Hobbs, J D; Hoeneisen, B; Hohlfeld, M; Howley, I; Hubacek, Z; Hynek, V; Iashvili, I; Ilchenko, Y; Illingworth, R; Ito, A S; Jabeen, S; Jaffre, M; Jayasinghe, A; Jesik, R; Johns, K; Johnson, E; Johnson, M; Jonckheere, A; Jonsson, R; Joshi, J; Jung, A W; Juste, A; Kaadze, K; Kajfasz, E; Karmanov, D; Kasper, P A; Katsanos, I; Kehoe, R; Kermiche, S; Khalatyan, N; Khanov, A; Kharchilava, A; Kharzheev, Y N; Kiselevich, I; Kohli, J M; Kozelov, A V; Kraus, J; Kulikov, S; Kumar, A; Kupco, A; Kurca, T; Kuzmin, V A; Lammers, S; Landsberg, G; Lebrun, P; Lee, H S; Lee, S W; Lee, W M; Lellouch, J; Li, H; Li, L; Li, Q Z; Lim, J K; Lincoln, D; Linnemann, J; Lipaev, V V; Lipton, R; Liu, H; Liu, Y; Lobodenko, A; Lokajicek, M; de Sa, R Lopes; Lubatti, H J; Luna-Garcia, R; Lyon, A L; Maciel, A K. A.; Madar, R; Magana-Villalba, R; Malik, S; Malyshev, V L; Maravin, Y; Martinez-Ortega, J; McCarthy, R; McGivern, C L; Meijer, M M; Melnitchouk, A; Menezes, D; Mercadante, P G; Merkin, M; Meyer, A; Meyer, J; et al.

    2012-07-24

    We present measurements of the differential cross section dσ/dργτ for the inclusive production of a photon in association with a b -quark jet for photons with rapidities |yγ| < 1.0 and 30 < ργτ < 300 GeV , as well as for photons with 1.5 <|yγ| < 2.5 and 30 < ργτ < 200 GeV, where ργτ is the photon transverse momentum. The b -quark jets are required to have pT > 15 GeV and rapidity |yjet| < 1.5. The results are based on data corresponding to an integrated luminosity of 8.7 fb-1, recorded with the D0 detector at the Fermilab Tevatron $p\\bar{p}$ Collider at $\\sqrt{s}$ =1.96 TeV. The measured cross sections are compared with next-to-leading order perturbative QCD calculations using different sets of parton distribution functions as well as to predictions based on the kT-factorization QCD approach, and those from the SHERPA and PYTHIA Monte Carlo event generators.

  4. Inclusive Search for New Physics with Like-Sign Dilepton Events in ppbar Collisions at sqrt{s} = 1.96 TeV

    CERN Document Server

    Abulencia, A; Affolder, T; Akimoto, T; Albrow, M G; Ambrose, D; Amerio, S; Amidei, D; Anastassov, A; Anikeev, K; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Arguin, J F; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Azfar, F; Azzi-Bacchetta, P; Azzurri, P; Bacchetta, N; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Baroiant, S; Bartsch, V; Bauer, G; Bedeschi, F; Behari, S; Belforte, S; Bellettini, G; Bellinger, J; Belloni, A; Benjamin, D; Beretvas, A; Beringer, J; Berry, T; Bhatti, A; Binkley, M; Bisello, D; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bolshov, A; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, Yu A; Budd, H S; Budd, S; Budroni, S; Burkett, K; Busetto, G; Bussey, P; Byrum, K L; Bölla, G; Cabrerao, S; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carilloi, S; Carlsmith, D; Carosi, R; Carron, S; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavalli-Sforza, M; Cerri, A; Cerritom, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, I; Cho, K; Chokheli, D; Chou, J P; Choudalakis, G; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Ciljak, M; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Coca, M; Compostella, G; Convery, M E; Conway, J; Cooper, B; Copic, K; Cordelli, M; Cortiana, G; Crescioli, F; Cuenca Almenaro, C; Cuevasl, J; Culbertson, R; Cully, J C; Cyr, D; D'Auria, S; D'Onofrio, M; Da Ronco, S; Dagenhart, D; Datta, M; Davies, T; De Barbaro, P; De Cecco, S; De Lentdeckerc, G; De Pedis, D; Deisher, A; Dell'Orso, Mauro; Delli Paoli, F; Demortier, L; Deng, J; Deninno, M; Derwent, P F; Di Giovanni, G P; Di Ruzza, B; Di Turo, P; Dionisi, C; Dittmann, J R; Donati, S; Donega, M; Dong, P; Donini, J; Dorigo, T; Drr, C; Dube, S; Efron, J; Erbacher, R; Errede, S; Errede, D; Eusebi, R; Fang, H C; Farrington, S; Fedorko, I; Fedorko, W T; Feild, R G; Feindt, M; Fernández, J P; Field, R; Flanagan, G; Foland, A; Forrester, S; Foster, G W; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; Garberson, F; García, J E; Garfinkel, A F; Gay, C; Gerberich, H; Gerdes, D; Giagu, S; Giannetti, P; Gibson, A; Gibson, K; Gimmell, J L; Ginsburg, C; Giokarisa, N; Giordani, M; Giromini, P; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Goldsteinb, J; Golossanov, A; Goncharov, M; Gonzlez, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Griffiths, M; Grinstein, S; Grosso-Pilcher, C; Group, R C; Grundler, U; Guimaraesda Costa, J; Gunay-Unalan, Z; Gómez, G; Gómez-Ceballos, G; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Hamilton, A; Han, B Y; Han, J Y; Handler, R; Happacher, F; Hara, K; Hare, M; Harper, S; Harr, R F; Harris, R M; Hartz, M; Hatakeyama, K; Hauser, J; Heijboer, A; Heinemann, B; Heinrich, J; Henderson, C; Herndon, M; Heuser, J; Hidas, D; Hillb, C S; Hirschbuehl, D; Holloway, A; Hou, S; Houlden, M; Hsu, S C; Huffman, B T; Hughes, R E; Husemann, U; Huston, J; Höcker, A; Incandela, J; Introzzi, G; Iori, M; Ishizawa, Y; Ivanov, A; Iyutin, B; James, E; Jang, D; Jayatilaka, B; Jeans, D; Jensen, H; Jeon, E J; Jindariani, S; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Karchin, P E; Kato, Y; Kemp, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Klute, M; Knuteson, B; Ko, B R; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kovalev, A; Kraan, A C; Kraus, J; Kravchenko, I; Kreps, M; Kroll, J; Krumnack, N; Kruse, M; Krutelyov, V; Kubo, T; Kuhlmann, S E; Kuhr, T; Kusakabe, Y; Kwang, S; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; Le Compte, T; Lee, J; Lee, Y J; Leen, S W; Lefèvre, R; Leonardo, N; Leone, S; Levy, S; Lewis, J D; Lin, C; Lin, C S; Lindgren, M; Lipeles, E

    2007-01-01

    We present a search for anomalous production of events with two high-momentum leptons (electron or muon) of the same electric charge in \\ppbar collisions at a center-of-mass energy of 1.96 TeV. We use a data sample corresponding to 1 \\invfb of integrated luminosity recorded by the CDF II detector. We perform an inclusive selection with one lepton with transverse momentum above 20 GeV/$c$ and a second one above 10 GeV/$c$. The standard model backgrounds for this signature are small. Many extensions to the standard model, such as Supersymmetry and models with heavy Majorana particles decaying into leptons, predict the production of two leptons of the same electric charge. This search has better acceptance and examines between a factor of three and ten more integrated luminosity compared to earlier searches in the same channel, resulting in a significant increase in sensitivity. We predict $33.2\\pm4.7$ events in our data sample and observe 44; the probability to observe an excess this large or larger is 9%. We a...

  5. Zgamma production and limits on anomalous ZZgamma and Zgammagamma couplings in ppbar collisions at $\\sqrt{s}$ = 1.96 TeV

    CERN Document Server

    Abazov, V M; Abolins, M; Acharya, B S; Adams, M; Adams, T; Aguiló, E; Ahn, S H; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Ancu, L S; Andeen, T; Anderson, S; Andrieu, B; Anzelc, M S; Arnoud, Y; Arov, M; Arthaud, M; Askew, A; Åsman, B; Assis-Jesus, A C S; Atramentov, O; Autermann, C; Avila, C; Ay, C; Badaud, F; Baden, A; Bagby, L; Baldin, B; Bandurin, D V; Banerjee, P; Banerjee, S; Barberis, E; Barfuss, A F; Bargassa, P; Baringer, P; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Beale, S; Bean, A; Begalli, M; Begel, M; Belanger-Champagne, C; Bellantoni, L; Bellavance, A; Benítez, J A; Beri, S B; Bernardi, G; Bernhard, R; Berntzon, L; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Biscarat, C; Blazey, G; Blekman, F; Blessing, S; Bloch, D; Bloom, K; Böhnlein, A; Boline, D; Bolton, T A; Borissov, G; Bos, K; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Brown, D; Buchanan, N J; Buchholz, D; Bühler, M; Büscher, V; Burdin, S; Burke, S; Burnett, T H; Buszello, C P; Butler, J M; Calfayan, P; Calvet, S; Cammin, J; Caron, S; Carvalho, W; Casey, B C K; Cason, N M; Castilla-Valdez, H; Chakrabarti, S; Chakraborty, D; Chan, K; Chan, K M; Chandra, A; Charles, F; Cheu, E; Chevallier, F; Cho, D K; Choi, S; Choudhary, B; Christofek, L; Christoudias, T; Cihangir, S; Claes, D; Clement, B; Clément, C; Coadou, Y; Cooke, M; Cooper, W E; Corcoran, M; Couderc, F; Cousinou, M C; Crepe-Renaudin, S; Cutts, D; Cwiok, M; Da Motta, H; Das, A; Davies, G; De, K; de Jong, P; De Jong, S J; De La Cruz-Burelo, E; De Oliveira Martins, C; Degenhardt, J D; Déliot, F; Demarteau, M; Demina, R; Denisov, D; Denisov, S P; Desai, S; Diehl, H T; Diesburg, M; Dominguez, A; Dong, H; Dudko, L V; Duflot, L; Dugad, S R; Duggan, D; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Ellison, J; Elvira, V D; Enari, Y; Eno, S; Ermolov, P; Evans, H; Evdokimov, A; Evdokimov, V N; Ferapontov, A V; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Ford, M; Fortner, M; Fox, H; Fu, S; Fuess, S; Gadfort, T; Galea, C F; Gallas, E; Galyaev, E; García, C; García-Bellido, A; Gavrilov, V; Gay, P; Geist, W; Gelé, D; Gerber, C E; Gershtein, Yu; Gillberg, D; Ginther, G; Gollub, N; Gómez, B; Goussiou, A; Grannis, P D; Greenlee, H; Greenwood, Z D; Gregores, E M; Grenier, G; Gris, P; Grivaz, J F; Grohsjean, A; Grünendahl, S; Grünewald, M W; Guo, F; Guo, J; Gutíerrez, G; Gutíerrez, P; Haas, A; Hadley, N J; Haefner, P; Hagopian, S; Haley, J; Hall, I; Hall, R E; Han, L; Hanagaki, K; Hansson, P; Harder, K; Harel, A; Harrington, R; Hauptman, J M; Hauser, R; Hays, J; Hebbeker, T; Hedin, D; Hegeman, J G; Heinmiller, J M; Heinson, A P; Heintz, U; Hensel, C; Herner, K; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hoeth, H; Hohlfeld, M; Hong, S J; Hooper, R; Hossain, S; Houben, P; Hu, Y; Hubacek, Z; Hynek, V; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jakobs, K; Jarvis, C; Jesik, R; Johns, K; Johnson, C; Johnson, M; Jonckheere, A; Jonsson, P; Juste, A; Käfer, D; Kahn, S; Kajfasz, E; Kalinin, A M; Kalk, J M; Kalk, J R; Kappler, S; Karmanov, D; Kasper, J; Kasper, P; Katsanos, I; Kau, D; Kaur, R; Kaushik, V; Kehoe, R; Kermiche, S; Khalatyan, N; Khanov, A; Kharchilava, A I; Kharzheev, Yu M; Khatidze, D; Kim, H; Kim, T J; Kirby, M H; Kirsch, M; Klima, B; Kohli, J M; Konrath, J P; Kopal, M; Korablev, V M; Kothari, B; Kozelov, A V; Krop, D; Kryemadhi, A; Kühl, T; Kumar, A; Kunori, S; Kupco, A; Kurca, T; Kvita, J; Lam, D; Lammers, S; Landsberg, G L; Lazoflores, J; Lebrun, P; Lee, W M; Leflat, A; Lehner, F; Lellouch, J; Lesne, V; Lévêque, J; Lewis, P; Li, J; Li, L; Li, Q Z; Lietti, S M; Lima, J G R; Lincoln, D; Linnemann, J; Lipaev, V V; Lipton, R; Liu, Y; Liu, Z; Lobo, L; Lobodenko, A; Lokajícek, M; Lounis, A; Love, P; Lubatti, H J; Lyon, A L; Maciel, A K A; Mackin, D; Madaras, R J; Mättig, P; Magass, C; Magerkurth, A; Makovec, N; Mal, P K; Malbouisson, H B; Malik, S; Malyshev, V L; Mao, H S; Maravin, Y; Martin, B; McCarthy, R; Melnitchouk, A; Mendes, A; Mendoza, L; Mercadante, P G; Merkin, M; Merritt, K W; Meyer, A; Meyer, J; Michaut, M; Millet, T; Mitrevski, J; Molina, J; Mommsen, R K; Mondal, N K; Moore, R W; Moulik, T; Muanza, G S; Mulders, M; Mulhearn, M; Mundal, O; Mundim, L; Nagy, E; Naimuddin, M; Narain, M; Naumann, N A; Neal, H A; Negret, J P; Neustroev, P; Nilsen, H; Nöding, C; Nomerotski, A; Novaes, S F; Nunnemann, T; O'Dell, V; O'Neil, D C; Obrant, G; Ochando, C; Onoprienko, D; Oshima, N; Osta, J; Otec, R; Oteroy-Garzon, G J; Owen, M; Padley, P; Pangilinan, M; Parashar, N; Park, S J; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Pawloski, G; Perea, P M; Peters, K; Peters, Y; Petroff, P; Petteni, M; Piegaia, R; Piper, J; Pleier, M A; Podesta-Lerma, P L M; Podstavkov, V M; Pogorelov, Y; Pol, M E; Pompos, A; Pope, B G; Popov, A V; Potter, C; Prado da Silva, W L; Prosper, H B; Protopopescu, S D; Qian, J; Quadt, A; Quinn, B; Rakitine, A; Rangel, M S; Rani, K J; Ranjan, K; Ratoff, P N; Renkel, P; Reucroft, S; Rich, P; Rijssenbeek, M; Ripp-Baudot, I; Rizatdinova, F K; Robinson, S; Rodrigues, R F; Royon, C; Rubinov, P; Ruchti, R; Safronov, G; Sajot, G; Sánchez-Hernández, A; Sanders, M P; Santoro, A F S; Savage, G; Sawyer, L; Scanlon, T; Schaile, A D; Schamberger, R D; Scheglov, Y; Schellman, H; Schieferdecker, P; Schliephake, T; Schmitt, C; Schwanenberger, C; Schwartzman, A; Schwienhorst, R; Sekaric, J; Sen-Gupta, S; Severini, H; Shabalina, E; Shamim, M; Shary, V; Shchukin, A A; Shivpuri, R K; Shpakov, D; Siccardi, V; Simák, V; Sirotenko, V I; Skubic, P L; Slattery, P F; Smirnov, D; Smith, R P; Snow, G R; Snow, J; Snyder, S; Söldner-Rembold, S; Sonnenschein, L; Sopczak, A; Sosebee, M; Soustruznik, K; Souza, M; Spurlock, B; Stark, J; Steele, J; Stolin, V; Stone, A; Stoyanova, D A; Strandberg, J; Strandberg, S; Strang, M A; Strauss, M; Ströhmer, R; Strom, D; Strovink, M; Stutte, L; Sumowidagdo, S; Svoisky, P; Sznajder, A; Talby, M; Tamburello, P; Tanasijczuk, A; Taylor, W; Telford, P; Temple, J; Tiller, B; Tissandier, F; Titov, M; Tokmenin, V V; Tomoto, M; Toole, T; Torchiani, I; Trefzger, T; Tsybychev, D; Tuchming, B; Tully, C; Tuts, P M; Unalan, R; Uvarov, L; Uvarov, S; Uzunyan, S; Vachon, B; Van den Berg, P J; van Eijk, B; Van Kooten, R; Van Leeuwen, W M; Varelas, N; Varnes, E W; Vartapetian, A H; Vasilyev, I A; Vaupel, M; Verdier, P; Vertogradov, L S; Verzocchi, M; Villeneuve-Séguier, F; Vint, P; Von Törne, E; Voutilainen, M; Vreeswijk, M; Wagner, R; Wahl, H D; Wang, L; Wang, M H L; Warchol, J; Watts, G; Wayne, M; Weber, G; Weber, M; Weerts, H; Wenger, A; Wermes, N; Wetstein, M; White, A; Wicke, D; Wilson, G W; Wimpenny, S J; Wobisch, M; Wood, D R; Wyatt, T R; Xie, Y; Yacoob, S; Yamada, R; Yan, M; Yasuda, T; Yatsunenko, Y A; Yip, K; Yoo, H D; Youn, S W; Yu, C; Yu, J; Yurkewicz, A; Zatserklyaniy, A; Zeitnitz, C; Zhang, D; Zhao, T; Zhou, B; Zhu, J; Zielinski, M; Zieminska, D; Zieminski, A; Zivkovic, L; Zutshi, V; Zverev, E G

    2007-01-01

    We present a study of eegamma and mumugamma events using over 1 fb-1 of data collected with the D0 detector at the Fermilab Tevatron ppbar Collider at $\\sqrt{s}$ = 1.96 TeV. Having observed 453 (515) candidates in the eegamma (mumugamma) final state, we measure the Zgamma production cross section for a photon with transverse energy ET > 7 GeV, separation between the photon and leptons Delta R(lgamma} > 0.7, and invariant mass of the di-lepton pair M(ll) > 30 GeV, to be 4.96 +/- 0.30(stat. + syst.) +/- 0.30(lumi.) pb, in agreement with the standard model prediction of 4.74 +/- 0.22 pb. This is the most precise Zgamma cross section measurement at a hadron collider. We set limits on anomalous trilinear Zgammagamma and ZZgamma gauge boson couplings of -0.085 < h(30)^(gamma) < 0.084, -0.0053 < h(40)^(gamma) < 0.0054 and -0.083 < h(30)^(Z) < 0.082, -0.0053 < h(40)^(Z) < 0.0054 at the 95% C.L. for the form-factor scale Lambda = 1.2 TeV.

  6. Search for Charged Higgs in t$\\bar{t}$ Decay Products from Proton-Antiproton Collisions at √s = 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Eusebi, Ricardo [Univ. of Rochester, NY (United States)

    2005-10-01

    This dissertation reports the results of a search for charged Higgs bosons in the decays of t$\\bar{t}$ pairs produced in p$\\bar{p}$ collisions at a center-of-mass energy of 1.96 TeV. The search is performed on a data sample recorded by the upgraded Collider Detector at Fermilab and corresponding to an integrated luminosity of 193 pb-1. The search is based on the relative rates of events in the different t$\\bar{t}$ decay channels. Results are obtained in the context of different models. In the context of the minimal supersymmetric extension of the Standard Model (MSSM), for which they fully account for radiative and Yukawa coupling corrections, regions in the (mH±, tan (β)) plane are excluded. In the Tauonic Higgs Model in which the charged Higgs is assumed to decay exclusively to $\\bar{τ}$, the BR(t → H+b) is constrained to be less than 0.4 at 95% C.L. If no assumption is made on the charged Higgs decay, the BR(t → H+b) is constrained to be less than 0.90 at 95% C.L. No evidence for charged Higgs production is found.

  7. Measurement of the pp¯→WZ+X cross section at s=1.96TeV and limits on WWZ trilinear gauge couplings

    Science.gov (United States)

    Abazov, V. M.; Abbott, B.; Abolins, M.; Acharya, B. S.; Adams, M.; Adams, T.; Aguilo, E.; Ahn, S. H.; Ahsan, M.; Alexeev, G. D.; Alkhazov, G.; Alton, A.; Alverson, G.; Alves, G. A.; Anastasoaie, M.; Ancu, L. S.; Andeen, T.; Anderson, S.; Andrieu, B.; Anzelc, M. S.; Arnoud, Y.; Arov, M.; Arthaud, M.; Askew, A.; Åsman, B.; Jesus, A. C. S. Assis; Atramentov, O.; Autermann, C.; Avila, C.; Ay, C.; Badaud, F.; Baden, A.; Bagby, L.; Baldin, B.; Bandurin, D. V.; Banerjee, S.; Banerjee, P.; Barberis, E.; Barfuss, A.-F.; Bargassa, P.; Baringer, P.; Barreto, J.; Bartlett, J. F.; Bassler, U.; Bauer, D.; Beale, S.; Bean, A.; Begalli, M.; Begel, M.; Belanger-Champagne, C.; Bellantoni, L.; Bellavance, A.; Benitez, J. A.; Beri, S. B.; Bernardi, G.; Bernhard, R.; Berntzon, L.; Bertram, I.; Besançon, M.; Beuselinck, R.; Bezzubov, V. A.; Bhat, P. C.; Bhatnagar, V.; Biscarat, C.; Blazey, G.; Blekman, F.; Blessing, S.; Bloch, D.; Bloom, K.; Boehnlein, A.; Boline, D.; Bolton, T. A.; Borissov, G.; Bose, T.; Brandt, A.; Brock, R.; Brooijmans, G.; Bross, A.; Brown, D.; Buchanan, N. J.; Buchholz, D.; Buehler, M.; Buescher, V.; Bunichev, S.; Burdin, S.; Burke, S.; Burnett, T. H.; Buszello, C. P.; Butler, J. M.; Calfayan, P.; Calvet, S.; Cammin, J.; Carvalho, W.; Casey, B. C. K.; Cason, N. M.; Castilla-Valdez, H.; Chakrabarti, S.; Chakraborty, D.; Chan, K. M.; Chan, K.; Chandra, A.; Charles, F.; Cheu, E.; Chevallier, F.; Cho, D. K.; Choi, S.; Choudhary, B.; Christofek, L.; Christoudias, T.; Cihangir, S.; Claes, D.; Clément, B.; Coadou, Y.; Cooke, M.; Cooper, W. E.; Corcoran, M.; Couderc, F.; Cousinou, M.-C.; Crépé-Renaudin, S.; Cutts, D.; Ćwiok, M.; da Motta, H.; Das, A.; Davies, G.; de, K.; de Jong, S. J.; de La Cruz-Burelo, E.; de Oliveira Martins, C.; Degenhardt, J. D.; Déliot, F.; Demarteau, M.; Demina, R.; Denisov, D.; Denisov, S. P.; Desai, S.; Diehl, H. T.; Diesburg, M.; Dominguez, A.; Dong, H.; Dudko, L. V.; Duflot, L.; Dugad, S. R.; Duggan, D.; Duperrin, A.; Dyer, J.; Dyshkant, A.; Eads, M.; Edmunds, D.; Ellison, J.; Elvira, V. D.; Enari, Y.; Eno, S.; Ermolov, P.; Evans, H.; Evdokimov, A.; Evdokimov, V. N.; Ferapontov, A. V.; Ferbel, T.; Fiedler, F.; Filthaut, F.; Fisher, W.; Fisk, H. E.; Ford, M.; Fortner, M.; Fox, H.; Fu, S.; Fuess, S.; Gadfort, T.; Galea, C. F.; Gallas, E.; Galyaev, E.; Garcia, C.; Garcia-Bellido, A.; Gavrilov, V.; Gay, P.; Geist, W.; Gelé, D.; Gerber, C. E.; Gershtein, Y.; Gillberg, D.; Ginther, G.; Gollub, N.; Gómez, B.; Goussiou, A.; Grannis, P. D.; Greenlee, H.; Greenwood, Z. D.; Gregores, E. M.; Grenier, G.; Gris, Ph.; Grivaz, J.-F.; Grohsjean, A.; Grünendahl, S.; Grünewald, M. W.; Guo, J.; Guo, F.; Gutierrez, P.; Gutierrez, G.; Haas, A.; Hadley, N. J.; Haefner, P.; Hagopian, S.; Haley, J.; Hall, I.; Hall, R. E.; Han, L.; Hanagaki, K.; Hansson, P.; Harder, K.; Harel, A.; Harrington, R.; Hauptman, J. M.; Hauser, R.; Hays, J.; Hebbeker, T.; Hedin, D.; Hegeman, J. G.; Heinmiller, J. M.; Heinson, A. P.; Heintz, U.; Hensel, C.; Herner, K.; Hesketh, G.; Hildreth, M. D.; Hirosky, R.; Hobbs, J. D.; Hoeneisen, B.; Hoeth, H.; Hohlfeld, M.; Hong, S. J.; Hossain, S.; Houben, P.; Hu, Y.; Hubacek, Z.; Hynek, V.; Iashvili, I.; Illingworth, R.; Ito, A. S.; Jabeen, S.; Jaffré, M.; Jain, S.; Jakobs, K.; Jarvis, C.; Jesik, R.; Johns, K.; Johnson, C.; Johnson, M.; Jonckheere, A.; Jonsson, P.; Juste, A.; Käfer, D.; Kahn, S.; Kajfasz, E.; Kalinin, A. M.; Kalk, J. R.; Kalk, J. M.; Kappler, S.; Karmanov, D.; Kasper, J.; Kasper, P.; Katsanos, I.; Kau, D.; Kaur, R.; Kaushik, V.; Kehoe, R.; Kermiche, S.; Khalatyan, N.; Khanov, A.; Kharchilava, A.; Kharzheev, Y. M.; Khatidze, D.; Kim, H.; Kim, T. J.; Kirby, M. H.; Kirsch, M.; Klima, B.; Kohli, J. M.; Konrath, J.-P.; Kopal, M.; Korablev, V. M.; Kozelov, A. V.; Krop, D.; Kuhl, T.; Kumar, A.; Kunori, S.; Kupco, A.; Kurča, T.; Kvita, J.; Lacroix, F.; Lam, D.; Lammers, S.; Landsberg, G.; Lebrun, P.; Lee, W. M.; Leflat, A.; Lehner, F.; Lellouch, J.; Leveque, J.; Lewis, P.; Li, J.; Li, Q. Z.; Li, L.; Lietti, S. M.; Lima, J. G. R.; Lincoln, D.; Linnemann, J.; Lipaev, V. V.; Lipton, R.; Liu, Y.; Liu, Z.; Lobo, L.; Lobodenko, A.; Lokajicek, M.; Lounis, A.; Love, P.; Lubatti, H. J.; Lyon, A. L.; Maciel, A. K. A.; Mackin, D.; Madaras, R. J.; Mättig, P.; Magass, C.; Magerkurth, A.; Makovec, N.; Mal, P. K.; Malbouisson, H. B.; Malik, S.; Malyshev, V. L.; Mao, H. S.; Maravin, Y.; Martin, B.; McCarthy, R.; Melnitchouk, A.; Mendes, A.; Mendoza, L.; Mercadante, P. G.; Merkin, M.; Merritt, K. W.; Meyer, J.; Meyer, A.; Michaut, M.; Millet, T.; Mitrevski, J.; Molina, J.; Mommsen, R. K.; Mondal, N. K.; Moore, R. W.; Moulik, T.; Muanza, G. S.; Mulders, M.; Mulhearn, M.; Mundal, O.; Mundim, L.; Nagy, E.; Naimuddin, M.; Narain, M.; Naumann, N. A.; Neal, H. A.; Negret, J. P.; Neustroev, P.; Nilsen, H.

    2007-12-01

    We present measurements of the process pp¯→WZ+X→ℓ'νℓ'ℓℓ¯ at s=1.96TeV, where ℓ and ℓ' are electrons or muons. Using 1fb-1 of data from the D0 experiment, we observe 13 candidates with an expected background of 4.5±0.6 events and measure a cross section σ(WZ)=2.7-1.3+1.7pb. From the number of observed events and the Z boson transverse momentum distribution, we limit the trilinear WWZ gauge couplings to -0.17≤λZ≤0.21(ΔκZ=0) at the 95% C.L. for a form factor scale Λ=2TeV. Further, assuming that Δg1Z=ΔκZ, we find -0.12≤ΔκZ≤0.29(λZ=0) at the 95% C.L. These are the most restrictive limits on the WWZ couplings available to date.

  8. Search for ZZ and Zγ* Production in p pmacr Collisions at s=1.96TeV and Limits on Anomalous ZZZ and ZZγ* Couplings

    Science.gov (United States)

    Abazov, V. M.; Abbott, B.; Abolins, M.; Acharya, B. S.; Adams, M.; Adams, T.; Aguilo, E.; Ahn, S. H.; Ahsan, M.; Alexeev, G. D.; Alkhazov, G.; Alton, A.; Alverson, G.; Alves, G. A.; Anastasoaie, M.; Ancu, L. S.; Andeen, T.; Anderson, S.; Andrieu, B.; Anzelc, M. S.; Arnoud, Y.; Arov, M.; Arthaud, M.; Askew, A.; Åsman, B.; Assis Jesus, A. C. S.; Atramentov, O.; Autermann, C.; Avila, C.; Ay, C.; Badaud, F.; Baden, A.; Bagby, L.; Baldin, B.; Bandurin, D. V.; Banerjee, S.; Banerjee, P.; Barberis, E.; Barfuss, A.-F.; Bargassa, P.; Baringer, P.; Barreto, J.; Bartlett, J. F.; Bassler, U.; Bauer, D.; Beale, S.; Bean, A.; Begalli, M.; Begel, M.; Belanger-Champagne, C.; Bellantoni, L.; Bellavance, A.; Benitez, J. A.; Beri, S. B.; Bernardi, G.; Bernhard, R.; Bertram, I.; Besançon, M.; Beuselinck, R.; Bezzubov, V. A.; Bhat, P. C.; Bhatnagar, V.; Biscarat, C.; Blazey, G.; Blekman, F.; Blessing, S.; Bloch, D.; Bloom, K.; Boehnlein, A.; Boline, D.; Bolton, T. A.; Borissov, G.; Bose, T.; Brandt, A.; Brock, R.; Brooijmans, G.; Bross, A.; Brown, D.; Buchanan, N. J.; Buchholz, D.; Buehler, M.; Buescher, V.; Bunichev, V.; Burdin, S.; Burke, S.; Burnett, T. H.; Buszello, C. P.; Butler, J. M.; Calfayan, P.; Calvet, S.; Cammin, J.; Carvalho, W.; Casey, B. C. K.; Cason, N. M.; Castilla-Valdez, H.; Chakrabarti, S.; Chakraborty, D.; Chan, K. M.; Chan, K.; Chandra, A.; Charles, F.; Cheu, E.; Chevallier, F.; Cho, D. K.; Choi, S.; Choudhary, B.; Christofek, L.; Christoudias, T.; Cihangir, S.; Claes, D.; Coadou, Y.; Cooke, M.; Cooper, W. E.; Corcoran, M.; Couderc, F.; Cousinou, M.-C.; Crépé-Renaudin, S.; Cutts, D.; Ćwiok, M.; da Motta, H.; Das, A.; Davies, G.; de, K.; de Jong, S. J.; de La Cruz-Burelo, E.; de Oliveira Martins, C.; Degenhardt, J. D.; Déliot, F.; Demarteau, M.; Demina, R.; Denisov, D.; Denisov, S. P.; Desai, S.; Diehl, H. T.; Diesburg, M.; Dominguez, A.; Dong, H.; Dudko, L. V.; Duflot, L.; Dugad, S. R.; Duggan, D.; Duperrin, A.; Dyer, J.; Dyshkant, A.; Eads, M.; Edmunds, D.; Ellison, J.; Elvira, V. D.; Enari, Y.; Eno, S.; Ermolov, P.; Evans, H.; Evdokimov, A.; Evdokimov, V. N.; Ferapontov, A. V.; Ferbel, T.; Fiedler, F.; Filthaut, F.; Fisher, W.; Fisk, H. E.; Ford, M.; Fortner, M.; Fox, H.; Fu, S.; Fuess, S.; Gadfort, T.; Galea, C. F.; Gallas, E.; Galyaev, E.; Garcia, C.; Garcia-Bellido, A.; Gavrilov, V.; Gay, P.; Geist, W.; Gelé, D.; Gerber, C. E.; Gershtein, Y.; Gillberg, D.; Ginther, G.; Gollub, N.; Gómez, B.; Goussiou, A.; Grannis, P. D.; Greenlee, H.; Greenwood, Z. D.; Gregores, E. M.; Grenier, G.; Gris, Ph.; Grivaz, J.-F.; Grohsjean, A.; Grünendahl, S.; Grünewald, M. W.; Guo, J.; Guo, F.; Gutierrez, P.; Gutierrez, G.; Haas, A.; Hadley, N. J.; Haefner, P.; Hagopian, S.; Haley, J.; Hall, I.; Hall, R. E.; Han, L.; Hanagaki, K.; Hansson, P.; Harder, K.; Harel, A.; Harrington, R.; Hauptman, J. M.; Hauser, R.; Hays, J.; Hebbeker, T.; Hedin, D.; Hegeman, J. G.; Heinmiller, J. M.; Heinson, A. P.; Heintz, U.; Hensel, C.; Herner, K.; Hesketh, G.; Hildreth, M. D.; Hirosky, R.; Hobbs, J. D.; Hoeneisen, B.; Hoeth, H.; Hohlfeld, M.; Hong, S. J.; Hossain, S.; Houben, P.; Hu, Y.; Hubacek, Z.; Hynek, V.; Iashvili, I.; Illingworth, R.; Ito, A. S.; Jabeen, S.; Jaffré, M.; Jain, S.; Jakobs, K.; Jarvis, C.; Jesik, R.; Johns, K.; Johnson, C.; Johnson, M.; Jonckheere, A.; Jonsson, P.; Juste, A.; Käfer, D.; Kajfasz, E.; Kalinin, A. M.; Kalk, J. R.; Kalk, J. M.; Kappler, S.; Karmanov, D.; Kasper, P.; Katsanos, I.; Kau, D.; Kaur, R.; Kaushik, V.; Kehoe, R.; Kermiche, S.; Khalatyan, N.; Khanov, A.; Kharchilava, A.; Kharzheev, Y. M.; Khatidze, D.; Kim, H.; Kim, T. J.; Kirby, M. H.; Kirsch, M.; Klima, B.; Kohli, J. M.; Konrath, J.-P.; Kopal, M.; Korablev, V. M.; Kozelov, A. V.; Krop, D.; Kuhl, T.; Kumar, A.; Kunori, S.; Kupco, A.; Kurča, T.; Kvita, J.; Lacroix, F.; Lam, D.; Lammers, S.; Landsberg, G.; Lebrun, P.; Lee, W. M.; Leflat, A.; Lehner, F.; Lellouch, J.; Leveque, J.; Lewis, P.; Li, J.; Li, Q. Z.; Li, L.; Lietti, S. M.; Lima, J. G. R.; Lincoln, D.; Linnemann, J.; Lipaev, V. V.; Lipton, R.; Liu, Y.; Liu, Z.; Lobo, L.; Lobodenko, A.; Lokajicek, M.; Love, P.; Lubatti, H. J.; Lyon, A. L.; Maciel, A. K. A.; Mackin, D.; Madaras, R. J.; Mättig, P.; Magass, C.; Magerkurth, A.; Mal, P. K.; Malbouisson, H. B.; Malik, S.; Malyshev, V. L.; Mao, H. S.; Maravin, Y.; Martin, B.; McCarthy, R.; Melnitchouk, A.; Mendes, A.; Mendoza, L.; Mercadante, P. G.; Merkin, M.; Merritt, K. W.; Meyer, J.; Meyer, A.; Millet, T.; Mitrevski, J.; Molina, J.; Mommsen, R. K.; Mondal, N. K.; Moore, R. W.; Moulik, T.; Muanza, G. S.; Mulders, M.; Mulhearn, M.; Mundal, O.; Mundim, L.; Nagy, E.; Naimuddin, M.; Narain, M.; Naumann, N. A.; Neal, H. A.; Negret, J. P.; Neustroev, P.; Nilsen, H.; Nogima, H.; Nomerotski, A.; Novaes, S. F.; Nunnemann, T.; O'Dell, V.; O'Neil, D. C.

    2008-04-01

    We present a study of μμμμ, eeee, and μμee events using 1fb-1 of data collected with the D0 detector at the Fermilab Tevatron p pmacr Collider at s=1.96TeV. Requiring the lepton pair masses to be greater than 30 GeV, we observe one event, consistent with the expected background of 0.13±0.03 events and with the predicted standard model ZZ and Zγ* production of 1.71±0.15 events. We set an upper limit on the ZZ and Zγ* cross section of 4.4 pb at the 95% C.L. We also derive limits on anomalous neutral trilinear ZZZ and ZZγ* gauge couplings. The one-parameter 95% C.L. coupling limits with a form-factor scale Λ=1.2TeV are -0.28

  9. Measurements of the B Production Cross Section in Proton-Antiproton Collisions at √s = 1.96 TeV using semileptonic decays of b hadrons

    Energy Technology Data Exchange (ETDEWEB)

    Kraus, James Alexander [Univ. of Illinois, Urbana-Champaign, IL (United States)

    2006-07-01

    The authors present a measurement of the cross section of b hadron (Hb) production in p$\\bar{p}$ collisions at √s = 1.96 TeV using the CDF II detector at the Fermilab Tevatron. They use 83 pb-1 of data taken between october 2002 and May 2003 that was collected with a trigger sensitive to high momentum muons and displaced tracks. They use partially reconstructed decays in the following modes: Hb → μ- $\\bar{v}$μD0X, D0 → K-π+, and Hb → μ-$\\bar{v}$μD*+ X, D*+ → D0π+, D0 → K- π+, and their charge conjugates. They correct for the backgrounds from c$\\bar{c}$ and b$\\bar{b}$ decays, for trigger and reconstruction efficiencies, and for detector acceptance. They report the total cross section above a minimum transverse momentum (pT) of 9 GeV/c for the rapidity range |y| ≤ 0.6.

  10. Search for Excited and Exotic Muons in the mu+gamma Decay Channel in p-pbar Collisions at sqrt{s} = 1.96 TeV

    CERN Document Server

    Abulencia, A; Adelman, J; Affolder, T; Akimoto, T; Albrow, M G; Ambrose, D; Amerio, S; Amidei, D; Anastassov, A; Anikeev, K; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Arguin, J F; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Azfar, F; Azzi-Bacchetta, P; Azzurri, P; Bacchetta, N; Bachacou, H; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Baroiant, S; Bartsch, V; Bauer, G; Bedeschi, F; Behari, S; Belforte, S; Bellettini, G; Bellinger, J; Belloni, A; Ben Haim, E; Benjamin, D; Beretvas, A; Beringer, J; Berry, T; Bhatti, A; Binkley, M; Bisello, D; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bölla, G; Bolshov, A; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Bromberg, C; Brubaker, E; Budagov, Yu A; Budd, H S; Budd, S; Burkett, K; Busetto, G; Bussey, P; Byrum, K L; Cabrera, S; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carlsmith, D; Carosi, R; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chapman, J; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, I; Cho, K; Chokheli, D; Chou, J P; Chu, P H; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Ciljak, M; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Coca, M; Compostella, G; Convery, M E; Conway, J; Cooper, B; Copic, K; Cordelli, M; Cortiana, G; Crescioli, F; Cruz, A; Cuenca-Almenar, C; Cuevas-Maestro, J; Culbertson, R; Cyr, D; Da Ronco, S; D'Auria, S; D'Onofrio, M; Dagenhart, D; De Barbaro, P; De Cecco, S; Deisher, A; De Lentdecker, G; Dell'Orso, Mauro; Delli Paoli, F; Demers, S; Demortier, L; Deng, J; Deninno, M; De Pedis, D; Derwent, P F; Di Giovanni, G P; Di Ruzza, B; Dionisi, C; Dittmann, J R; Di Turo, P; Dorr, C; Donati, S; Donega, M; Dong, P; Donini, J; Dorigo, T; Dube, S; Ebina, K; Efron, J; Ehlers, J; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, I; Fedorko, W T; Feild, R G; Feindt, M; Fernández, J P; Field, R; Flanagan, G; Flores-Castillo, L R; Foland, A; Forrester, S; Foster, G W; Franklin, M; Freeman, J C; Frisch, H J; Furic, I; Gallinaro, M; Galyardt, J; García, J E; García-Sciveres, M; Garfinkel, A F; Gay, C; Gerberich, H; Gerdes, D; Giagu, S; Giannetti, P; Gibson, A; Gibson, K; Ginsburg, C; Giokaris, N; Giolo, K; Giordani, M; Giromini, P; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Goldstein, J; Gómez, G; Gómez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Gotra, Yu; Goulianos, K; Gresele, A; Griffiths, M; Grinstein, S; Grosso-Pilcher, C; Grundler, U; Guimarães da Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, S R; Hahn, K; Halkiadakis, E; Hamilton, A; Han, B Y; Han, J Y; Handler, R; Happacher, F; Hara, K; Hare, M; Harper, S; Harr, R F; Harris, R M; Hatakeyama, K; Hauser, J; Hays, C; Heijboer, A; Heinemann, B; Heinrich, J; Herndon, M; Hidas, D; Hill, C S; Hirschbuehl, D; Höcker, A; Holloway, A; Hou, S; Houlden, M; Hsu, S C; Huffman, B T; Hughes, R E; Huston, J; Incandela, J R; Introzzi, G; Iori, M; Ishizawa, Y; Ivanov, A; Iyutin, B; James, E; Jang, D; Jayatilaka, B; Jeans, D; Jensen, H; Jeon, E J; Jindariani, S; Jones, M; Joo, K K; Jun, S Y; Junk, T R; Kamon, T; Kang, J; Karchin, P E; Kato, Y; Kemp, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kirsch, L; Klimenko, S; Klute, M; Knuteson, B; Ko, B R; Kobayashi, H; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kovalev, A; Kraan, A C; Kraus, J; Kravchenko, I; Kreps, M; Kroll, J; Krumnack, N; Kruse, M; Krutelyov, V; Kuhlmann, S E; Kusakabe, Y; Kwang, S; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; LeCompte, T; Lee, J; Lee, Y J; Lee, S W; Lefèvre, R; Leonardo, N; Leone, S; Levy, S; Lewis, J D; Lin, C; Lin, C S; Lindgren, M; Lipeles, E; Liss, T M; Lister, A; Litvintsev, D O; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Loverre, P F; Lu, R S; Lucchesi, D; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Lytken, E; Mack, P; MacQueen, D; Madrak, R; Maeshima, K; Mäki, T; Maksimovic, P; Malde, S; Manca, G; Margaroli, F; Marginean, R; Marino, C; Martin, A; Martin, V; Martínez, M; Maruyama, T; Mastrandrea, P; Matsunaga, H; Mattson, M E; Mazini, R; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Menzemer, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Von der Mey, M; Miao, T; Miladinovic, N; Miles, J; Miller, R; Miller, J S; Mills, C; Milnik, M; Miquel, R; Mitra, A; Mitselmakher, G; Miyamoto, A; Moggi, N; Mohr, B; Moore, R; Morello, M; Movilla-Fernández, P A; Mülmenstädt, J; Mukherjee, A; Müller, T; Mumford, R; Murat, P; Nachtman, J; Naganoma, J; Nahn, S; Nakano, I; Napier, A; Naumov, D; Necula, V; Neu, C; Neubauer, M S; Nielsen, J; Nigmanov, T; Nodulman, L; Norniella, O; Nurse, E; Ogawa, T; Oh, S H; Oh, Y D; Okusawa, T; Oldeman, R; Orava, R; Österberg, K; Pagliarone, C; Palencia, E; Paoletti, R; Papadimitriou, V; Paramonov, A A; Parks, B; Pashapour, S; Patrick, J; Pauletta, G; Paulini, M; Paus, C; Pellett, D E; Penzo, Aldo L; Phillips, T J; Piacentino, G; Piedra, J; Pinera, L; Pitts, K; Plager, C; Pondrom, L; Portell, X; Poukhov, O; Pounder, N; Prakoshyn, F; Pronko, A; Proudfoot, J; Ptohos, F; Punzi, G; Pursley, J; Rademacker, J; Rahaman, A; Rakitine, A; Rappoccio, S; Ratnikov, F; Reisert, B; Rekovic, V; Van Remortel, N; Renton, P B; Rescigno, M; Richter, S; Rimondi, F; Ristori, L; Robertson, W J; Robson, A; Rodrigo, T; Rogers, E; Rolli, S; Roser, R; Rossi, M; Rossin, R; Rott, C; Ruiz, A; Russ, J; Rusu, V; Saarikko, H; Sabik, S; Safonov, A; Sakumoto, W K; Salamanna, G; Salto, O; Saltzberg, D; Sánchez, C; Santi, L; Sarkar, S; Sartori, L; Sato, K; Savard, P; Savoy-Navarro, A; Scheidle, T; Schlabach, P; Schmidt, E E; Schmidt, M P; Schmitt, M; Schwarz, T; Scodellaro, L; Scott, A L; Scribano, A; Scuri, F; Sedov, A; Seidel, S; Seiya, Y; Semenov, A; Sexton-Kennedy, L; Sfiligoi, I; Shapiro, M D; Shears, T G; Shepard, P F; Sherman, D; Shimojima, M; Shochet, M; Shon, Y; Shreyber, I; Sidoti, A; Sinervo, P; Sisakian, A; Sjölin, J; Skiba, A; Slaughter, A J; Sliwa, K; Smith, J R; Snider, F D; Snihur, R; Söderberg, M; Soha, A; Somalwar, S; Sorin, V; Spalding, J; Spezziga, M; Spinella, F; Spreitzer, T; Squillacioti, P; Stanitzki, M; Staveris-Polykalas, A; Saint-Denis, R; Stelzer, B; Stelzer-Chilton, O; Stentz, D; Strologas, J; Stuart, D; Suh, J S; Sukhanov, A; Sumorok, K; Sun, H; Suzuki, T; Taffard, A; Takashima, R; Takeuchi, Y; Takikawa, K; Tanaka, M; Tanaka, R; Tanimoto, N; Tecchio, M; Teng, P K; Terashi, K; Tether, S; Thom, J; Thompson, A S; Thomson, E; Tipton, P; Tiwari, V; Tkaczyk, S; Toback, D; Tokar, S; Tollefson, K; Tomura, T; Tonelli, D; Tonnesmann, M; Torre, S; Torretta, D; Tourneur, S; Trischuk, W; Tsuchiya, R; Tsuno, S; Turini, N; Ukegawa, F; Unverhau, T; Uozumi, S; Usynin, D; Vaiciulis, A W; Vallecorsa, S; Varganov, A; Vataga, E; Velev, G; Veramendi, G; Veszpremi, V; Vidal, R; Vila, I; Vilar, R; Vine, T; Vollrath, I; Volobuev, I P; Volpi, G; Würthwein, F; Wagner, P; Wagner, R G; Wagner, R L; Wagner, W; Wallny, R; Walter, T; Wan, Z; Wang, S M; Warburton, A; Waschke, S; Waters, D; Wester, W C; Whitehouse, B; Whiteson, D; Wicklund, A B; Wicklund, E; Williams, G; Williams, H H; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolfe, C; Wright, T; Wu, X; Wynne, S M; Yagil, A; Yamamoto, K; Yamaoka, J; Yamashita, T; Yang, C; Yang, U K; Yang, Y C; Yao, W M; Yeh, G P; Yoh, J; Yorita, K; Yoshida, T; Yu, G B; Yu, I; Yu, S S; Yun, J C; Zanello, L; Zanetti, A; Zaw, I; Zetti, F; Zhang, X; Zhou, J; Zucchelli, S

    2006-01-01

    We present a search for excited and exotic muon states mu*, conducted using an integrated luminosity of 371 pb^{-1} of data collected in p-pbar collisions at sqrt{s} = 1.96 TeV at the Tevatron with the CDF II detector. We search for associated production of mu+mu* followed by the decay mu* -> mu+gamma, resulting in the mu+mu+gamma final state. We compare the data to model predictions as a function of the mass of the excited muon M(mu*), the compositeness energy scale Lambda, and the gauge coupling factor f. No signal above the standard model expectation is observed in the mu+gamma mass spectrum. In the contact interaction model, we exclude 107 < M(mu*) < 853 GeV/c^2 for Lambda = M(mu*); in the gauge-mediated model, we exclude 100 < M(mu) < 410 GeV/c^2 for f/Lambda = 0.01/GeV. These 95% confidence level exclusions extend previous limits and are the first hadron collider results on mu* production in the gauge-mediated model.

  11. Search for pair production of supersymmetric top quarks in dilepton events from pp collisions at sqrt[s]=1.96  TeV.

    Science.gov (United States)

    Aaltonen, T; Adelman, J; Akimoto, T; Alvarez González, B; Amerio, S; Amidei, D; Anastassov, A; Annovi, A; Antos, J; Apollinari, G; Apresyan, A; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Aurisano, A; Azfar, F; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Barria, P; Bartsch, V; Bauer, G; Beauchemin, P-H; Bedeschi, F; Beecher, D; Behari, S; Bellettini, G; Bellinger, J; Benjamin, D; Beretvas, A; Beringer, J; Bhatti, A; Binkley, M; Bisello, D; Bizjak, I; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bolla, G; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Bridgeman, A; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, J; Budd, H S; Budd, S; Burke, S; Burkett, K; Busetto, G; Bussey, P; Buzatu, A; Byrum, K L; Cabrera, S; Calancha, C; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carls, B; Carlsmith, D; Carosi, R; Carrillo, S; Carron, S; Casal, B; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavaliere, V; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, K; Chokheli, D; Chou, J P; Choudalakis, G; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Chwalek, T; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Compostella, G; Convery, M E; Conway, J; Cordelli, M; Cortiana, G; Cox, C A; Cox, D J; Crescioli, F; Cuenca Almenar, C; Cuevas, J; Culbertson, R; Cully, J C; Dagenhart, D; Datta, M; Davies, T; de Barbaro, P; De Cecco, S; Deisher, A; De Lorenzo, G; Dell'orso, M; Deluca, C; Demortier, L; Deng, J; Deninno, M; Derwent, P F; Di Canto, A; di Giovanni, G P; Dionisi, C; Di Ruzza, B; Dittmann, J R; D'Onofrio, M; Donati, S; Dong, P; Donini, J; Dorigo, T; Dube, S; Efron, J; Elagin, A; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, W T; Feild, R G; Feindt, M; Fernandez, J P; Ferrazza, C; Field, R; Flanagan, G; Forrest, R; Frank, M J; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; Garberson, F; Garcia, J E; Garfinkel, A F; Garosi, P; Genser, K; Gerberich, H; Gerdes, D; Gessler, A; Giagu, S; Giakoumopoulou, V; Giannetti, P; Gibson, K; Gimmell, J L; Ginsburg, C M; Giokaris, N; Giordani, M; Giromini, P; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Golossanov, A; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Grinstein, S; Grosso-Pilcher, C; Group, R C; Grundler, U; Guimaraes da Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Han, B-Y; Han, J Y; Happacher, F; Hara, K; Hare, D; Hare, M; Harper, S; Harr, R F; Harris, R M; Hartz, M; Hatakeyama, K; Hays, C; Heck, M; Heijboer, A; Heinrich, J; Henderson, C; Herndon, M; Heuser, J; Hewamanage, S; Hidas, D; Hill, C S; Hirschbuehl, D; Hocker, A; Hou, S; Houlden, M; Hsu, S-C; Huffman, B T; Hughes, R E; Husemann, U; Hussein, M; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ivanov, A; James, E; Jang, D; Jayatilaka, B; Jeon, E J; Jha, M K; Jindariani, S; Johnson, W; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Kar, D; Karchin, P E; Kato, Y; Kephart, R; Ketchum, W; Keung, J; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, H W; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Knuteson, B; Ko, B R; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kreps, M; Kroll, J; Krop, D; Krumnack, N; Kruse, M; Krutelyov, V; Kubo, T; Kuhr, T; Kulkarni, N P; Kurata, M; Kwang, S; Laasanen, A T; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; Lecompte, T; Lee, E; Lee, H S; Lee, S W; Leone, S; Lewis, J D; Lin, C-S; Linacre, J; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, C; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Lovas, L; Lucchesi, D; Luci, C; Lueck, J; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Macqueen, D; Madrak, R; Maeshima, K; Makhoul, K; Maki, T; Maksimovic, P; Malde, S; Malik, S; Manca, G; Manousakis-Katsikakis, A; Margaroli, F; Marino, C; Marino, C P; Martin, A; Martin, V; Martínez, M; Martínez-Ballarín, R; Maruyama, T; Mastrandrea, P; Masubuchi, T; Mathis, M; Mattson, M E; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtala, P; Menzione, A; Merkel, P; Mesropian, C; Miao, T; Miladinovic, N; Miller, R; Mills, C; Milnik, M; Mitra, A; Mitselmakher, G; Miyake, H; Moggi, N; Moon, C S; Moore, R; Morello, M J; Morlock, J; Movilla Fernandez, P; Mülmenstädt, J; Mukherjee, A; Muller, Th; Mumford, R; Murat, P; Mussini, M; Nachtman, J; Nagai, Y; Nagano, A; Naganoma, J; Nakamura, K; Nakano, I; Napier, A; Necula, V; Nett, J; Neu, C; Neubauer, M S; Neubauer, S; Nielsen, J; Nodulman, L; Norman, M; Norniella, O; Nurse, E; Oakes, L; Oh, S H; Oh, Y D; Oksuzian, I; Okusawa, T; Orava, R; Osterberg, K; Pagan Griso, S; Palencia, E; Papadimitriou, V; Papaikonomou, A; Paramonov, A A; Parks, B; Pashapour, S; Patrick, J; Pauletta, G; Paulini, M; Paus, C; Peiffer, T; Pellett, D E; Penzo, A; Phillips, T J; Piacentino, G; Pianori, E; Pinera, L; Pitts, K; Plager, C; Pondrom, L; Poukhov, O; Pounder, N; Prakoshyn, F; Pronko, A; Proudfoot, J; Ptohos, F; Pueschel, E; Punzi, G; Pursley, J; Rademacker, J; Rahaman, A; Ramakrishnan, V; Ranjan, N; Redondo, I; Renton, P; Renz, M; Rescigno, M; Richter, S; Rimondi, F; Ristori, L; Robson, A; Rodrigo, T; Rodriguez, T; Rogers, E; Rolli, S; Roser, R; Rossi, M; Rossin, R; Roy, P; Ruiz, A; Russ, J; Rusu, V; Rutherford, B; Saarikko, H; Safonov, A; Sakumoto, W K; Saltó, O; Santi, L; Sarkar, S; Sartori, L; Sato, K; Savoy-Navarro, A; Schlabach, P; Schmidt, A; Schmidt, E E; Schmidt, M A; Schmidt, M P; Schmitt, M; Schwarz, T; Scodellaro, L; Scribano, A; Scuri, F; Sedov, A; Seidel, S; Seiya, Y; Semenov, A; Sexton-Kennedy, L; Sforza, F; Sfyrla, A; Shalhout, S Z; Shears, T; Shepard, P F; Shimojima, M; Shiraishi, S; Shochet, M; Shon, Y; Shreyber, I; Sinervo, P; Sisakyan, A; Slaughter, A J; Slaunwhite, J; Sliwa, K; Smith, J R; Snider, F D; Snihur, R; Soha, A; Somalwar, S; Sorin, V; Spreitzer, T; Squillacioti, P; Stanitzki, M; St Denis, R; Stelzer, B; Stelzer-Chilton, O; Stentz, D; Strologas, J; Strycker, G L; Suh, J S; Sukhanov, A; Suslov, I; Suzuki, T; Taffard, A; Takashima, R; Takeuchi, Y; Tanaka, R; Tecchio, M; Teng, P K; Terashi, K; Thom, J; Thompson, A S; Thompson, G A; Thomson, E; Tipton, P; Ttito-Guzmán, P; Tkaczyk, S; Toback, D; Tokar, S; Tollefson, K; Tomura, T; Tonelli, D; Torre, S; Torretta, D; Totaro, P; Tourneur, S; Trovato, M; Tsai, S-Y; Tu, Y; Turini, N; Ukegawa, F; Vallecorsa, S; van Remortel, N; Varganov, A; Vataga, E; Vázquez, F; Velev, G; Vellidis, C; Vidal, M; Vidal, R; Vila, I; Vilar, R; Vine, T; Vogel, M; Volobouev, I; Volpi, G; Wagner, P; Wagner, R G; Wagner, R L; Wagner, W; Wagner-Kuhr, J; Wakisaka, T; Wallny, R; Wang, S M; Warburton, A; Waters, D; Weinberger, M; Weinelt, J; Wester, W C; Whitehouse, B; Whiteson, D; Wicklund, A B; Wicklund, E; Wilbur, S; Williams, G; Williams, H H; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolfe, C; Wright, T; Wu, X; Würthwein, F; Xie, S; Yagil, A; Yamamoto, K; Yamaoka, J; Yang, U K; Yang, Y C; Yao, W M; Yeh, G P; Yoh, J; Yorita, K; Yoshida, T; Yu, G B; Yu, I; Yu, S S; Yun, J C; Zanello, L; Zanetti, A; Zhang, X; Zheng, Y; Zucchelli, S

    2010-06-25

    We present the results of a search for pair production of the supersymmetric partner of the top quark (the top squark t{1}) decaying to a b quark and a chargino χ{1}{±} with a subsequent χ{1}{±} decay into a neutralino χ{1}{0}, lepton ℓ, and neutrino ν. Using a data sample corresponding to 2.7  fb{-1} of integrated luminosity of pp collisions at sqrt[s]=1.96  TeV collected by the CDF II detector, we reconstruct the mass of top squark candidate events and fit the observed mass spectrum to a combination of standard model processes and t{1}t{1} signal. We find no evidence for t{1}t{1} production and set 95% C.L. limits on the masses of the top squark and the neutralino for several values of the chargino mass and the branching ratio B(χ{1}{±}→χ{1}{0}ℓ{±}ν).

  12. Measurements of differential cross sections of Z/{gamma}*+jets+X events in pp-bar collisions at {radical}(s)=1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abazov, V.M. [Joint Institute for Nuclear Research, Dubna (Russian Federation); Abbott, B. [University of Oklahoma, Norman, OK 73019 (United States); Abolins, M. [Michigan State University, East Lansing, MI 48824 (United States); Acharya, B.S. [Tata Institute of Fundamental Research, Mumbai (India); Adams, M. [University of Illinois at Chicago, Chicago, IL 60607 (United States); Adams, T. [Florida State University, Tallahassee, FL 32306 (United States); Aguilo, E. [University of Alberta, Edmonton, Alberta (Canada); Simon Fraser University, Burnaby, British Columbia (Canada); York University, Toronto, Ontario (Canada); McGill University, Montreal, Quebec (Canada); Ahsan, M. [Kansas State University, Manhattan, KS 66506 (United States); Alexeev, G.D. [Joint Institute for Nuclear Research, Dubna (Russian Federation); Alkhazov, G. [Petersburg Nuclear Physics Institute, St. Petersburg (Russian Federation); Alton, A. [Michigan State University, East Lansing, MI 48824 (United States); Alverson, G. [Northeastern University, Boston, MA 02115 (United States); Alves, G.A. [LAFEX, Centro Brasileiro de Pesquisas Fisicas, Rio de Janeiro (Brazil); Ancu, L.S. [Radboud University Nijmegen/NIKHEF, Nijmegen (Netherlands); Andeen, T.; Anzelc, M.S. [Northwestern University, Evanston, IL 60208 (United States); Aoki, M. [Fermi National Accelerator Laboratory, Batavia, IL 60510 (United States); Arnoud, Y. [LPSC, Universite Joseph Fourier Grenoble 1, CNRS/IN2P3, Institut National Polytechnique de Grenoble, Grenoble (France); Arov, M. [Louisiana Tech University, Ruston, LA 71272 (United States); Arthaud, M. [CEA, Irfu, SPP, Saclay (France)] (and others)

    2009-07-06

    We present cross section measurements for Z/{gamma}*+jets+X production, differential in the transverse momenta of the three leading jets. The data sample was collected with the DO detector at the Fermilab Tevatron pp-bar collider at a center-of-mass energy of 1.96 TeV and corresponds to an integrated luminosity of 1 fb{sup -1}. Leading and next-to-leading order perturbative QCD predictions are compared with the measurements, and agreement is found within the theoretical and experimental uncertainties. We also make comparisons with the predictions of four event generators. Two parton-shower-based generators show significant shape and normalization differences with respect to the data. In contrast, two generators combining tree-level matrix elements with a parton shower give a reasonable description of the shapes observed in data, but the predicted normalizations show significant differences with respect to the data, reflecting large scale uncertainties. For specific choices of scales, the normalizations for either generator can be made to agree with the measurements.

  13. Search for pair production of first-generation leptoquarks in pp-bar collisions at sq root(s)=1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abazov, V.M. [Joint Institute for Nuclear Research, Dubna (Russian Federation); Abbott, B. [University of Oklahoma, Norman, OK 73019 (United States); Abolins, M. [Michigan State University, East Lansing, MI 48824 (United States); Acharya, B.S. [Tata Institute of Fundamental Research, Mumbai (India); Adams, M. [University of Illinois at Chicago, Chicago, IL 60607 (United States); Adams, T. [Florida State University, Tallahassee, FL 32306 (United States); Aguilo, E. [University of Alberta, Edmonton, Alberta, and Simon Fraser University, Burnaby, British Columbia, and York University, Toronto, Ontario, and McGill University, Montreal, Quebec (Canada); Ahsan, M. [Kansas State University, Manhattan, KS 66506 (United States); Alexeev, G.D. [Joint Institute for Nuclear Research, Dubna (Russian Federation); Alkhazov, G. [Petersburg Nuclear Physics Institute, St. Petersburg (Russian Federation); Alton, A. [University of Michigan, Ann Arbor, MI 48109 (United States); Alverson, G. [Northeastern University, Boston, MA 02115 (United States); Alves, G.A. [LAFEX, Centro Brasileiro de Pesquisas Fisicas, Rio de Janeiro (Brazil); Ancu, L.S. [Radboud University Nijmegen/NIKHEF, Nijmegen (Netherlands); Andeen, T.; Anzelc, M.S. [Northwestern University, Evanston, IL 60208 (United States); Aoki, M. [Fermi National Accelerator Laboratory, Batavia, IL 60510 (United States); Arnoud, Y. [LPSC, Universite Joseph Fourier Grenoble 1, CNRS/IN2P3, Institut National Polytechnique de Grenoble, Grenoble (France); Arov, M. [Louisiana Tech University, Ruston, LA 71272 (United States); Arthaud, M. [CEA, Irfu, SPP, Saclay (France)

    2009-11-02

    A search for pair production of first-generation leptoquarks (LQ) is performed with data collected by the DO experiment in pp-bar collisions at sq root(s)=1.96 TeV at the Fermilab Tevatron Collider. In a sample of data corresponding to approx1 fb{sup -1} the search has been performed on the final states with two electrons and two jets or one electron, two jets and missing transverse energy. We find our data consistent with standard model expectations. The results are combined with those found in a previous analysis of events with two jets and missing transverse energy to obtain scalar LQ mass limits. We set 95% C.L. lower limits on a scalar LQ mass of 299 GeV, 284 GeV and 216 GeV for beta=1, beta=0.5 and beta=0.02 respectively, where beta is the LQ branching ratio in the eq channel. This improves the results obtained with a lower luminosity sample from Run II of the Tevatron. Lower limits on vector LQ masses with different couplings from 357 GeV to 464 GeV for beta=0.5 are also set using this analysis.

  14. Search for pair production of first-generation leptoquarks in p pbar collisions at sqrt(s)=1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abazov, : V.

    2009-07-01

    A search for pair production of first-generation leptoquarks (LQ) is performed with data collected by the D0 experiment in p{bar p} collisions at {radical}s = 1.96 TeV at the Fermilab Tevatron Collider. In a sample of data corresponding to {approx} 1 fb{sup -1} the search has been performed on the final states with two electrons and two jets or one electron, two jets and missing transverse energy. We find our data consistent with standard model expectations. The results are combined with those found in a previous analysis of events with two jets and missing transverse energy to obtain scalar LQ mass limits. We set 95% C.L. lower limits on a scalar LQ mass of 299 GeV, 284 GeV and 216 GeV for {beta} = 1, {beta} = 0.5 and {beta} = 0.02 respectively, where {beta} is the LQ branching ratio in the eq channel. This improves the results obtained with a lower luminosity sample from Run II of the Tevatron. Lower limits on vector LQ masses with different couplings from 357 GeV to 464 GeV for {beta} = 0.5 are also set using this analysis.

  15. Search for single vector-like quarks in $p\\bar{p}$ collisions at $\\sqrt{s} = 1.96$ TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abazov, Victor Mukhamedovich; /Dubna, JINR; Abbott, Braden Keim; /Oklahoma U.; Acharya, Bannanje Sripath; /Tata Inst.; Adams, Mark Raymond; /Illinois U., Chicago; Adams, Todd; /Florida State U.; Alexeev, Guennadi D.; /Dubna, JINR; Alkhazov, Georgiy D.; /St. Petersburg, INP; Alton, Andrew K.; /Michigan U. /Augustana Coll., Sioux Falls; Alverson, George O.; /Northeastern U.; Alves, Gilvan Augusto; /Rio de Janeiro, CBPF; Ancu, Lucian Stefan; /Nijmegen U. /Fermilab

    2010-10-01

    We present a search for hypothetical vector-like quarks in p{bar p} collisions at {radical}s = 1.96 TeV. The data were collected by the D0 detector at the Fermilab Tevatron Collider and correspond to an integrated luminosity of 5.4 fb{sup -1}. We select events with a final state composed of a W or Z boson and a jet consistent with a heavy object decay. We observe no significant excess in comparison to the background prediction and set limits on production cross sections for vector-like quarks decaying to W+jet and Z+jet. Assuming a vector-like quark to standard model quark coupling parameter {tilde {kappa}}{sub qQ} of unity, we exclude vector-like quarks with mass below 693 GeV for decays to W+jet and mass below 449 GeV for decays to Z+jet. These are the most stringent mass limits for electroweak single vector-like quark production at hadron colliders.

  16. Azimuthal decorrelations and multiple parton interactions in photon+2 jet and photon+3 jet events in ppbar collisions at sqrt{s}=1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abazov, Victor Mukhamedovich; /Dubna, JINR; Abbott, Braden Keim; /Oklahoma U.; Acharya, Bannanje Sripath; /Tata Inst.; Adams, Mark Raymond; /Illinois U., Chicago; Adams, Todd; /Florida State U.; Alexeev, Guennadi D.; /Dubna, JINR; Alkhazov, Georgiy D.; /St. Petersburg, INP; Alton, Andrew K.; /Michigan U. /Augustana Coll., Sioux Falls; Alverson, George O.; /Northeastern U.; Alves, Gilvan Augusto; /Rio de Janeiro, CBPF; Ancu, Lucian Stefan; /Nijmegen U. /Serpukhov, IHEP

    2011-01-01

    Samples of inclusive {gamma} + 2 jet and {gamma} + 3 jet events collected by the D0 experiment with an integrated luminosity of about 1 fb{sup -1} in p{bar p} collisions at {radical}s = 1.96 TeV are used to measure cross sections as a function of the angle in the plane transverse to the beam direction between the transverse momentum (p{sub T}) of the {gamma} + leading jet system (jets are ordered in p{sub T}) and p{sub T} of the other jet for {gamma} + 2 jet, or p{sub T} sum of the two other jets for {gamma} + 3 jet events. The results are compared to different models of multiple parton interactions (MPI) in the pythia and sherpa Monte Carlo (MC) generators. The data indicate a contribution from events with double parton (DP) interactions and are well described by predictions provided by the pythia MPI models with p{sub T}-ordered showers and by sherpa with the default MPI model. The {gamma} + 2 jet data are also used to determine the fraction of events with DP interactions as a function of the azimuthal angle and as a function of the second jet p{sub T}.

  17. Search for Exotic S=-2 Baryons in proton-antiproton Collisions at sqrt(s) = 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abulencia, A.; Adelman, J.; Affolder, T.; Akimoto, T.; Albrow, M.G.; Ambrose, D.; Amerio, S.; Amidei, D.; Anastassov, A.; Anikeev, K.; Annovi, A.; /Taiwan, Inst. Phys.

    2006-12-01

    A search for a manifestly exotic S = -2 baryon state decaying to {Xi}{sup -}{pi}{sup -}, and its neutral partner decaying to {Xi}{sup -}{pi}{sup +}, has been performed using 220 pb{sup -1} of p{bar p} collisions at {radical}s = 1.96 TeV collected by the Collider Detector at Fermilab. The {Xi}{sup -} trajectories were measured in a silicon tracker before their decay, resulting in a sample with low background and excellent position resolution. No evidence was found for S = -2 pentaquark candidates in the invariant mass range of 1600-2100 MeV/c{sup 2}. Upper limits on the product of pentaquark production cross section times its branching fraction to {Xi}{sup -}{pi}{sup +,-}, relative to the cross section of the well established {Xi}(1530) resonance, are presented for neutral and doubly negative candidates with p{sub T} > 2 GeV/c and |y| < 1 as a function of pentaquark mass. At 1862 MeV/c{sup 2}, these upper limits for neutral and doubly negative final states were found to be 3.2% and 1.7% at the 90% confidence level, respectively.

  18. Measurement of the ttbar Production Cross Section in ppbar Collisions at sqrt(s)=1.96 TeV using Soft Electron b-Tagging

    Energy Technology Data Exchange (ETDEWEB)

    Aaltonen, T.; /Helsinki Inst. of Phys.; Adelman, J.; /Chicago U., EFI; Akimoto, T.; /Tsukuba U.; Alvarez Gonzalez, B.; /Cantabria Inst. of Phys.; Amerio, S.; /INFN, Padua; Amidei, D.; /Michigan U.; Anastassov, A.; /Northwestern U.; Annovi, A.; /Frascati; Antos, J.; /Comenius U.; Apollinari, G.; /Fermilab; Apresyan, A.; /Purdue U. /Waseda U.

    2010-02-01

    We present a measurement of the top quark pair production cross section in p{bar p} collisions at {radical}s = 1.96 TeV using a data sample corresponding to 1.7 fb{sup -1} of integrated luminosity collected with the Collider Detector at Fermilab. We reconstruct t{bar t} events in the lepton+jets channel, consisting of e{nu}+jets and {mu}{nu}+jets final states. The dominant background is the production of W bosons in association with multiple jets. To suppress this background, we identify electrons from the semileptonic decay of heavy-flavor jets ('soft electron tags'). From a sample of 2196 candidate events, we obtain 120 tagged events with a background expectation of 51 {+-} 3 events, corresponding to a cross section of {sigma}{sub t{bar t}} = 7.8 {+-} 2.4 (stat) {+-} 1.6 (syst) {+-} 0.5 (lumi) pb. We assume a top-quark mass of 175 GeV/c{sup 2}. This is the first measurement of the t{bar t} cross section with soft electron tags in Run II of the Tevatron.

  19. Search for standard model Higgs bosons decaying to w-boson pairs in proton-anti-proton collisions at √s= 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Hidas, Dean Andrew [Duke Univ., Durham, NC (United States)

    2008-01-01

    This thesis describes a search for standard model Higgs bosons decaying to W boson pairs in proton-anti-proton collisions at a center of mass energy of 1.96 TeV using the CDF II detector. The decay to W bosons is dominant for Higgs masses greater than about 135 GeV. The final state examined consists of two leptons and missing transverse energy from the leptonic decay of one or more W bosons. The signal production mechanisms included are gluon fusion, associated production with a W or Z boson, and vector boson fusion. Matrix element calculations and artificial neural networks are used to discriminate signal from background for Higgs masses in the range 110 ≤MH ≤ 200 GeV. No significant excess of events is observed at any of the Higgs masses investigated. Upper limits on the standard model Higgs cross section are set at 95% confidence for each Higgs mass investigated, the most stringent limit being 1.63 times the predicted standard model cross section for a Higgs mass of 160 GeV.

  20. Search for Standard Model Higgs Boson Produced in Association with a Top-Antitop Quark Pair in 1.96 TeV Proton-Antiproton Collisions

    Energy Technology Data Exchange (ETDEWEB)

    Lai, Stanley T. [Univ. of Toronto, ON (Canada)

    2007-01-01

    This thesis describes the first search for Standard Model Higgs boson production in association with a top-antitop quark pair in proton-antiproton collisions at a centre of mass energy of 1.96 TeV. The integrated luminosity for othis search corresponds to 319 pb-1 of data recorded by the Collider Detector at Fermilab. We outline the even selection criteria, evaluate the even acceptance and estimate backgrounds from Standard Model sources. These events are observed that satisfy our event selection, while 2.16 ± 0.66 events are expected from background processes. no significant excess of events above background is thus observed, and we set 95% confidence level upper limits on the production cross section for this process as a function of the Higgs mass. For a Higgs boson mass of 115 GeV/c2 we find that σ$t\\bar{t}H$ x BR (Hbb) < 690 fb at 95% C.L. These are the first limits set for $t\\bar{t}H$ production. This search also allows us to anticipate the challenges and necessary strategies needed for future searches of $t\\bar{t}H$ production.

  1. Search for heavy, long-lived particles that decay to photons in $p \\bar{p}$ collisions at $\\sqrt{s}$ = 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Wagner, Peter [Texas A & M Univ., College Station, TX (United States)

    2007-08-01

    This dissertation presents the results of the first search for heavy, neutral, longlived particles that decay to photons at a hadron collider. We use a sample of +jet+missing transverse energy events in $p \\bar{p}$ collisions at √s = 1.96 TeV taken with the Collider Detector at Fermilab. Candidate events are selected based on the arrival time of a high-energy photon at the electromagnetic calorimeter as measured with a timing system that was recently installed. The final result is that we find 2 events, using 570±34 pb-1 of data collected during 2004-2005 at the Fermilab Tevatron, consistent with the background estimate of 1.3±0.7 events. While our search strategy does not rely on model-specific dynamics, we interpret this result in terms of cross section limits in a supersymmetric model with $\\vec{X}$$0\\atop{1}$ eG and set a world-best e 01 mass reach of 101 GeV/c2 at e = 5 ns. We can exclude any γ+jet+missing transverse energy signal that would produce more than 5.5 events.

  2. Searches for a High mass Higgs boson produced in $p\\bar{p}$ collisions at $\\sqrt{s}=1.96$ TeV

    Energy Technology Data Exchange (ETDEWEB)

    Pagan Griso, Simone [Univ. of Padua (Italy)

    2010-03-01

    In this Thesis the electro-weak spontaneous symmetry breaking of the Standard Model (SM) is studied by searching for the scalar Higgs particle in the proton antiproton collisions of the Tevatron collider, at the center of mass energy √s = 1.96 TeV. We report on the inclusive search for the Higgs boson decaying to two W bosons in the final state characterized by two charged leptons (e or μ) and two neutrinos. The analysis of 4.8 fb$^{-1}$ of data recorded by the Collider Detector at Fermilab (CDF) shows no evidence of its production. We set 95% Confidence Level upper limits on the production cross section as a function of the mass $m_H$ in the range 110 to 200 GeV/$c^2$. For $m_H$ = 165 GeV/$c^2$ the observed limit is 1.3 times the SM predicted cross section (σH); the expected limit, in absence of signal, is 1.2+0.6 -0.4σ(H). These limits are the most stringent ones set by a single experiment up to date, for $m_H$ > 130 GeV/c2.

  3. Search for a Higgs-like boson decaying to two photons in $p\\bar{p}$ collisions at $\\sqrt{s} = 1.96$ TeV

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Guo [Univ. of Kansas, Lawrence, KS (United States)

    2013-01-01

    We present a search for the Standard Model (SM) Higgs boson decaying to two photons using the 9.6 fb-1 of p$\\bar{p}$ collisions at √s = 1.96 TeV collected by the D0 detector at the Tevatron from July 2002 to September 2011. The data corresponds to the complete data-set in the RunII period of the Tevatron. This thesis employs a multivariate technique, boosted decision trees, to optimize the discrimination of signal from background. No significant excess of data above theoretical prediction is observed, so limits on the ratio of the production cross section times the branching ratio to the SM value are set at 95% confidence level as a function of hypothetical Higgs boson mass. The expected and observed limits on this ratio are 8.7 and 12.8 respectively at 125 GeV. We also interpret the data in the fermiophobic Higgs model. The result has reached a sensitivity of 114 GeV, and we set a lower limit on the fermiophobic Higgs mass of MHf > 113 GeV.

  4. Search for the supersymmetric partner of the top quark in ppbar collisions at sqrt(s) = 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Aaltonen, T.; /Helsinki Inst. of Phys.; Alvarez Gonzalez, B.; /Oviedo U. /Cantabria Inst. of Phys.; Amerio, S.; /INFN, Padua; Amidei, D.; /Michigan U.; Anastassov, A.; /Northwestern U.; Annovi, A.; /Frascati; Antos, J.; /Comenius U.; Apollinari, G.; /Fermilab; Appel, J.A.; /Fermilab; Apresyan, A.; /Purdue U.; Arisawa, T.; /Waseda U. /Dubna, JINR

    2010-09-01

    We present a search for the lightest supersymmetric partner of the top quark in proton-antiproton collisions at a center-of-mass energy {radical}s = 1.96 TeV. This search was conducted within the framework of the R-parity conserving minimal supersymmetric extension of the standard model, assuming the stop decays dominantly to a lepton, a sneutrino, and a bottom quark. We searched for events with two oppositely-charged leptons, at least one jet, and missing transverse energy in a data sample corresponding to an integrated luminosity of 1 fb{sup -1} collected by the CDF experiment. No significant evidence of a stop quark signal was found. Exclusion limits at 95% confidence level in the stop quark versus sneutrino mass plane are set. Stop quark masses up to 180 GeV/c{sup 2} are excluded for sneutrino masses around 45 GeV/c{sup 2}, and sneutrino masses up to 116 GeV/c{sup 2} are excluded for stop quark masses around 150 GeV/c{sup 2}.

  5. Search for a dijet resonance in events with jets and missing transverse energy in pp¯ collisions at s=1.96TeV

    Science.gov (United States)

    Aaltonen, T.; Amerio, S.; Amidei, D.; Anastassov, A.; Annovi, A.; Antos, J.; Apollinari, G.; Appel, J. A.; Arisawa, T.; Artikov, A.; Asaadi, J.; Ashmanskas, W.; Auerbach, B.; Aurisano, A.; Azfar, F.; Badgett, W.; Bae, T.; Barbaro-Galtieri, A.; Barnes, V. E.; Barnett, B. A.; Barria, P.; Bartos, P.; Bauce, M.; Bedeschi, F.; Behari, S.; Bellettini, G.; Bellinger, J.; Benjamin, D.; Beretvas, A.; Bhatti, A.; Bland, K. R.; Blumenfeld, B.; Bocci, A.; Bodek, A.; Bortoletto, D.; Boudreau, J.; Boveia, A.; Brigliadori, L.; Bromberg, C.; Brucken, E.; Budagov, J.; Budd, H. S.; Burkett, K.; Busetto, G.; Bussey, P.; Butti, P.; Buzatu, A.; Calamba, A.; Camarda, S.; Campanelli, M.; Canelli, F.; Carls, B.; Carlsmith, D.; Carosi, R.; Carrillo, S.; Casal, B.; Casarsa, M.; Castro, A.; Catastini, P.; Cauz, D.; Cavaliere, V.; Cavalli-Sforza, M.; Cerri, A.; Cerrito, L.; Chen, Y. C.; Chertok, M.; Chiarelli, G.; Chlachidze, G.; Cho, K.; Chokheli, D.; Clark, A.; Clarke, C.; Convery, M. E.; Conway, J.; Corbo, M.; Cordelli, M.; Cox, C. A.; Cox, D. J.; Cremonesi, M.; Cruz, D.; Cuevas, J.; Culbertson, R.; d'Ascenzo, N.; Datta, M.; de Barbaro, P.; Demortier, L.; Deninno, M.; D'Errico, M.; Devoto, F.; Di Canto, A.; Di Ruzza, B.; Dittmann, J. R.; Donati, S.; D'Onofrio, M.; Dorigo, M.; Driutti, A.; Ebina, K.; Edgar, R.; Elagin, A.; Erbacher, R.; Errede, S.; Esham, B.; Farrington, S.; Fernández Ramos, J. P.; Field, R.; Flanagan, G.; Forrest, R.; Franklin, M.; Freeman, J. C.; Frisch, H.; Funakoshi, Y.; Galloni, C.; Garfinkel, A. F.; Garosi, P.; Gerberich, H.; Gerchtein, E.; Giagu, S.; Giakoumopoulou, V.; Gibson, K.; Ginsburg, C. M.; Giokaris, N.; Giromini, P.; Giurgiu, G.; Glagolev, V.; Glenzinski, D.; Gold, M.; Goldin, D.; Golossanov, A.; Gomez, G.; Gomez-Ceballos, G.; Goncharov, M.; González López, O.; Gorelov, I.; Goshaw, A. T.; Goulianos, K.; Gramellini, E.; Grinstein, S.; Grosso-Pilcher, C.; Group, R. C.; Guimaraes da Costa, J.; Hahn, S. R.; Han, J. Y.; Happacher, F.; Hara, K.; Hare, M.; Harr, R. F.; Harrington-Taber, T.; Hatakeyama, K.; Hays, C.; Heinrich, J.; Herndon, M.; Hocker, A.; Hong, Z.; Hopkins, W.; Hou, S.; Hughes, R. E.; Husemann, U.; Hussein, M.; Huston, J.; Introzzi, G.; Iori, M.; Ivanov, A.; James, E.; Jang, D.; Jayatilaka, B.; Jeon, E. J.; Jindariani, S.; Jones, M.; Joo, K. K.; Jun, S. Y.; Junk, T. R.; Kambeitz, M.; Kamon, T.; Karchin, P. E.; Kasmi, A.; Kato, Y.; Ketchum, W.; Keung, J.; Kilminster, B.; Kim, D. H.; Kim, H. S.; Kim, J. E.; Kim, M. J.; Kim, S. H.; Kim, S. B.; Kim, Y. J.; Kim, Y. K.; Kimura, N.; Kirby, M.; Knoepfel, K.; Kondo, K.; Kong, D. J.; Konigsberg, J.; Kotwal, A. V.; Kreps, M.; Kroll, J.; Kruse, M.; Kuhr, T.; Kurata, M.; Laasanen, A. T.; Lammel, S.; Lancaster, M.; Lannon, K.; Latino, G.; Lee, H. S.; Lee, J. S.; Leo, S.; Leone, S.; Lewis, J. D.; Limosani, A.; Lipeles, E.; Lister, A.; Liu, H.; Liu, Q.; Liu, T.; Lockwitz, S.; Loginov, A.; Lucchesi, D.; Lucà, A.; Lueck, J.; Lujan, P.; Lukens, P.; Lungu, G.; Lys, J.; Lysak, R.; Madrak, R.; Maestro, P.; Malik, S.; Manca, G.; Manousakis-Katsikakis, A.; Marchese, L.; Margaroli, F.; Marino, P.; Martínez, M.; Matera, K.; Mattson, M. E.; Mazzacane, A.; Mazzanti, P.; McNulty, R.; Mehta, A.; Mehtala, P.; Mesropian, C.; Miao, T.; Mietlicki, D.; Mitra, A.; Miyake, H.; Moed, S.; Moggi, N.; Moon, C. S.; Moore, R.; Morello, M. J.; Mukherjee, A.; Muller, Th.; Murat, P.; Mussini, M.; Nachtman, J.; Nagai, Y.; Naganoma, J.; Nakano, I.; Napier, A.; Nett, J.; Neu, C.; Nigmanov, T.; Nodulman, L.; Noh, S. Y.; Norniella, O.; Oakes, L.; Oh, S. H.; Oh, Y. D.; Oksuzian, I.; Okusawa, T.; Orava, R.; Ortolan, L.; Pagliarone, C.; Palencia, E.; Palni, P.; Papadimitriou, V.; Parker, W.; Pauletta, G.; Paulini, M.; Paus, C.; Phillips, T. J.; Piacentino, G.; Pianori, E.; Pilot, J.; Pitts, K.; Plager, C.; Pondrom, L.; Poprocki, S.; Potamianos, K.; Pranko, A.; Prokoshin, F.; Ptohos, F.; Punzi, G.; Ranjan, N.; Redondo Fernández, I.; Renton, P.; Rescigno, M.; Rimondi, F.; Ristori, L.; Robson, A.; Rodriguez, T.; Rolli, S.; Ronzani, M.; Roser, R.; Rosner, J. L.; Ruffini, F.; Ruiz, A.; Russ, J.; Rusu, V.; Sakumoto, W. K.; Sakurai, Y.; Santi, L.; Sato, K.; Saveliev, V.; Savoy-Navarro, A.; Schlabach, P.; Schmidt, E. E.; Schwarz, T.; Scodellaro, L.; Scuri, F.; Seidel, S.; Seiya, Y.; Semenov, A.; Sforza, F.; Shalhout, S. Z.; Shears, T.; Shepard, P. F.; Shimojima, M.; Shochet, M.; Shreyber-Tecker, I.; Simonenko, A.; Sliwa, K.; Smith, J. R.; Snider, F. D.; Song, H.; Sorin, V.; St. Denis, R.; Stancari, M.; Stentz, D.; Strologas, J.; Sudo, Y.; Sukhanov, A.; Suslov, I.; Takemasa, K.; Takeuchi, Y.; Tang, J.; Tecchio, M.; Teng, P. K.; Thom, J.; Thomson, E.; Thukral, V.; Toback, D.; Tokar, S.; Tollefson, K.; Tomura, T.; Tonelli, D.; Torre, S.; Torretta, D.; Totaro, P.; Trovato, M.; Ukegawa, F.; Uozumi, S.; Vázquez, F.; Velev, G.; Vellidis, C.; Vernieri, C.; Vidal, M.; Vilar, R.; Vizán, J.; Vogel, M.; Volpi, G.; Wagner, P.; Wallny, R.; Wang, S. M.; Waters, D.; Wester, W. C., III; Whiteson, D.; Wicklund, A. B.; Wilbur, S.; Williams, H. H.; Wilson, J. S.; Wilson, P.; Winer, B. L.; Wittich, P.; Wolbers, S.; Wolfe, H.; Wright, T.; Wu, X.; Wu, Z.; Yamamoto, K.; Yamato, D.; Yang, T.; Yang, U. K.; Yang, Y. C.; Yao, W.-M.; Yeh, G. P.; Yi, K.; Yoh, J.; Yorita, K.; Yoshida, T.; Yu, G. B.; Yu, I.; Zanetti, A. M.; Zeng, Y.; Zhou, C.; Zucchelli, S.

    2013-11-01

    We report on a search for a dijet resonance in events with only two or three jets and a large imbalance in the total event transverse momentum. This search is sensitive to the possible production of a new particle in association with a W or Z boson, where the boson decays leptonically with one or more neutrinos in the final state. We use the full data set collected by the CDF II detector at the Tevatron collider at a proton-antiproton center-of-mass energy of 1.96 TeV. These data correspond to an integrated luminosity of 9.1fb-1. We study the invariant mass distribution of the two jets with highest transverse energy. We find good agreement between data and standard model background expectations and measure the combined cross section for WW, WZ, and ZZ production to be 13.8-2.7+3.0pb. No significant anomalies are observed in the mass spectrum, and 95% credibility level upper limits are set on the production rates of a potential new particle in association with a W or Z boson.

  6. Search for new physics in high mass electron-positron events in p anti-p collisions at s**(1/2) = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Aaltonen, T.; Abulencia, A.; Adelman, J.; Affolder, Anthony Allen; Akimoto, T.; Albrow, Michael G.; Amerio, S.; Amidei, Dante E.; Anastassov, A.; Anikeev, K.; Annovi, A. /Taiwan, Inst. Phys. /Argonne /Barcelona, IFAE /Baylor U. /INFN, Bologna /Bologna U. /Brandeis U. /UC, Davis /UCLA /UC, San Diego /UC, Santa Barbara

    2007-07-01

    We report the results of a search for a narrow resonance in electron-positron events in the invariant mass range of 150-950 GeV/c{sup 2} using 1.3 fb{sup -1} of p{bar p} collision data at {radical}s=1.96 TeV collected by the CDF II detector at Fermilab. No significant evidence of such a resonance is observed and we interpret the results to exclude the standard model-like Z{prime} with a mass below 923 GeV/c{sup 2} and the Randall-Sundrum graviton with a mass below 807 GeV/c{sup 2} for k/{bar M}{sub pl} = 0.1, both at the 95% confidence level. Combining with di-photon data excludes the Randall-Sundrum graviton for masses below 889 GeV/c{sup 2} for k/{bar M}{sub pl} = 0.1

  7. Measurement of the t anti-t production cross section in p anti-p collisions at √s = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Ray, Heather Lynn [Univ. of Michigan, Ann Arbor, MI (United States)

    2004-01-01

    The direct observation of the top quark was first achieved at the Tevatron proton anti-proton collider at Fermilab. This discovery completed the third generation quark sector where the top quark is expected to accompany the bottom quark in the weak isospin doublet. This dissertation discusses the experimental verification of the production cross section as predicted by the Standard Model. A measurement of the t$\\bar{t}$ production cross section using 107.9 pb-1 of p$\\bar{p}$ collisions at √s = 1.96 TeV collected with the Collider Detector at Fermilab between March of 2003 and June of 2003 is presented. The measurement focuses on the t$\\bar{t}$ production in the ''lepton plus jets'' final state in which one of the W bosons from the t$\\bar{t}$ decay subsequently decays leptonically to an electron or a muon, and the other decays hadronically. The B-tagging technique which utilizes the precision silicon detector tracking is used to enhance the signal for t$\\bar{t}$ events relative to the background through identification of the bottom quark from its measurable lifetime. The t$\\bar{t}$ production cross section is measured to be σt$\\bar{t}$ = 4.5 ± 1.4(stat) ± 0.8(sys) pb.

  8. Search for t-Channel Single Top Quark Production in p$\\bar{p}$ Collisions at 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Perea, Philip Michael [Univ. of California, Riverside, CA (United States)

    2006-06-01

    I have performed a search for t-channel single top quark production in p$\\bar{p}$ single number sub collisions at 1.96 TeV on a 366 pb-1 dataset collected with the D0 detector from 2002-2005. The analysis is restricted to the leptonic decay of the W boson from the top quark to an electron or muon, tq$\\bar{b}$ → lvlb q$\\bar{b}$ (l = e,μ). A powerful b-quark tagging algorithm derived from neural networks is used to identify b jets and significantly reduce background. I further use neural networks to discriminate signal from background, and apply a binned likelihood calculation to the neural network output distributions to derive the final limits. No direct observation of single top quark production has been made, and I report expected/measured 95% confidence level limits of 3.5/8.0 pb.

  9. Search for charged Higgs bosons in decays of top quarks in proton - antiproton collisions at √s = 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Geum Bong [Univ. of Rochester, NY (United States)

    2009-01-01

    In this dissertation we report on the first direct search for charged Higgs bosons in decays of top quarks in p$\\bar{p}$ collisions at √s = 1.96 TeV. The search uses a data sample with an integrated luminosity of 2.2 fb-1 collected by the CDF II detector at Fermilab and looks for a resonance in the invariant mass distribution of two jets in the lepton+jets sample of t$\\bar{t}$ candidates. We observe no evidence of charged Higgs bosons in top quark decays; hence 95% C.L. upper limits on the branching ratio are placed at β(t → H+b) < 0.1 to 0.3 for charged Higgs boson masses of 60 to 150 GeV/c2 assuming β(H+ → c$\\bar{s}$) = 1.0 and β(t → Wb)+β(t → H+b) = 1.0. The upper limits on β(t → H+b) are also used as model independent limits on the decay branching ratio of top quarks to any charged scalar bosons beyond the standard model.

  10. Search for the Higgs Boson Decaying to Two Tau Leptons in $p\\bar{p}$ Collisions at a Center of Mass Energy of 1.96 Tev

    Energy Technology Data Exchange (ETDEWEB)

    Elagin, Andrey Lvovich [Texas A & M Univ., College Station, TX (United States)

    2011-12-01

    A search for the Higgs boson decaying to $\\tau\\tau$ using 7.8~fb$^{-1}$ of $p\\bar{p}$ collisions at 1.96~TeV collected with CDF II detector is presented. The search is sensitive to four production mechanisms of the Higgs boson: ggH, WH, ZH and VBF. Modes where one tau decay leptonically, and another decay, hadronically, are considered. Two novel techniques are developed and used in the search. A Probabilistic Particle Flow Algorithm is used for energy measurements of the hadronic tau candidates. The signal is discriminated from backgrounds by the Missing Mass Calculator, which allows for full invariant mass reconstruction of $\\tau\\tau$ pair. The data are found to be consistent with the background only hypothesis. Therefore a 95\\% confidence level upper limit on the Standard Model Higgs boson cross section was set. At $M_H$$=$120~GeV/$c^2$ observed limit is 14.9$\\times\\sigma_{SM}\\times Br (H → ττ)$.

  11. Top pair production cross section at s**(1/2) = 1.96 TeV and a search for v + a current in top quark decay

    Energy Technology Data Exchange (ETDEWEB)

    Cabrera, S.; /Valencia U., IFIC

    2006-09-01

    Possible effects from physics beyond the Standard Model have been investigated in top quark decays from a data sample enriched in t{bar t} events produced in p{bar p} collisions at {radical}s = 1.96 TeV with an integrated luminosity of approximately 700 pb{sup -1} and collected with the CDF II detector. The combined t{bar t} production cross section measurement 7.3 {+-} 0.9 pb agrees with the QCD NLO predictions: 6.7 {+-} 0.8 pb assuming m{sub top} = 175 GeV/c{sup 2}. The fraction of the V + A current in top quark decay, f{sub V+A}, is determined using the invariant mass of the charged lepton and the bottom quark jet in the decay chain t {yields} Wb {yields} {ell}{nu}b (where {ell} = e or {mu}). The measured value f{sub V+A} = - 0.06 {+-} 0.25 under the assumption m{sub top} = 175 GeV/c{sup 2} is in agreement with the Standard Model. They set an upper limit on f{sub V+A} of 0.29 at the 95% confidence level.

  12. Measurement of Event Shapes in Proton-Antiproton Collisions at Center-of-Mass Energy 1.96 TeV

    CERN Document Server

    Aaltonen, T.; Amerio, S.; Amidei, D.; Anastassov, A.; Annovi, A.; Antos, J.; Apollinari, G.; Appel, J.A.; Apresyan, A.; Arisawa, T.; Artikov, A.; Asaadi, J.; Ashmanskas, W.; Auerbach, B.; Aurisano, A.; Azfar, F.; Badgett, W.; Barbaro-Galtieri, A.; Barnes, V.E.; Barnett, B.A.; Barria, P.; Bartos, P.; Bauce, M.; Bauer, G.; Bedeschi, F.; Beecher, D.; Behari, S.; Bellettini, G.; Bellinger, J.; Benjamin, D.; Beretvas, A.; Bhatti, A.; Binkley, M.; Bisello, D.; Bizjak, I.; Bland, K.R.; Blumenfeld, B.; Bocci, A.; Bodek, A.; Bortoletto, D.; Boudreau, J.; Boveia, A.; Brau, B.; Brigliadori, L.; Brisuda, A.; Bromberg, C.; Brucken, E.; Bucciantonio, M.; Budagov, J.; Budd, H.S.; Budd, S.; Burkett, K.; Busetto, G.; Bussey, P.; Buzatu, A.; Calancha, C.; Camarda, S.; Campanelli, M.; Campbell, M.; Canelli, F.; Canepa, A.; Carls, B.; Carlsmith, D.; Carosi, R.; Carrillo, S.; Carron, S.; Casal, B.; Casarsa, M.; Castro, A.; Catastini, P.; Cauz, D.; Cavaliere, V.; Cavalli-Sforza, M.; Cerri, A.; Cerrito, L.; Chen, Y.C.; Chertok, M.; Chiarelli, G.; Chlachidze, G.; Chlebana, F.; Cho, K.; Chokheli, D.; Chou, J.P.; Chung, W.H.; Chung, Y.S.; Ciobanu, C.I.; Ciocci, M.A.; Clark, A.; Compostella, G.; Convery, M.E.; Conway, J.; Corbo, M.; Cordelli, M.; Cox, C.A.; Cox, D.J.; Crescioli, F.; Cuenca Almenar, C.; Cuevas, J.; Culbertson, R.; Dagenhart, D.; d'Ascenzo, N.; Datta, M.; de Barbaro, P.; De Cecco, S.; De Lorenzo, G.; Dell'Orso, M.; Deluca, C.; Demortier, L.; Deng, J.; Deninno, M.; Devoto, F.; d'Errico, M.; Di Canto, A.; Di Ruzza, B.; Dittmann, J.R.; D'Onofrio, M.; Donati, S.; Dong, P.; Dorigo, M.; Dorigo, T.; Ebina, K.; Elagin, A.; Eppig, A.; Erbacher, R.; Errede, D.; Errede, S.; Ershaidat, N.; Eusebi, R.; Fang, H.C.; Farrington, S.; Feindt, M.; Fernandez, J.P.; Ferrazza, C.; Field, R.; Flanagan, G.; Forrest, R.; Frank, M.J.; Franklin, M.; Freeman, J.C.; Funakoshi, Y.; Furic, I.; Gallinaro, M.; Galyardt, J.; Garcia, J.E.; Garfinkel, A.F.; Garosi, P.; Gerberich, H.; Gerchtein, E.; Giagu, S.; Giakoumopoulou, V.; Giannetti, P.; Gibson, K.; Ginsburg, C.M.; Giokaris, N.; Giromini, P.; Giunta, M.; Giurgiu, G.; Glagolev, V.; Glenzinski, D.; Gold, M.; Goldin, D.; Goldschmidt, N.; Golossanov, A.; Gomez, G.; Gomez-Ceballos, G.; Goncharov, M.; Gonzalez, O.; Gorelov, I.; Goshaw, A.T.; Goulianos, K.; Grinstein, S.; Grosso-Pilcher, C.; Group, R.C.; Guimaraes da Costa, J.; Gunay-Unalan, Z.; Haber, C.; Hahn, S.R.; Halkiadakis, E.; Hamaguchi, A.; Han, J.Y.; Happacher, F.; Hara, K.; Hare, D.; Hare, M.; Harr, R.F.; Hatakeyama, K.; Hays, C.; Heck, M.; Heinrich, J.; Herndon, M.; Hewamanage, S.; Hidas, D.; Hocker, A.; Hopkins, W.; Horn, D.; Hou, S.; Hughes, R.E.; Hurwitz, M.; Husemann, U.; Hussain, N.; Hussein, M.; Huston, J.; Introzzi, G.; Iori, M.; Ivanov, A.; James, E.; Jang, D.; Jayatilaka, B.; Jeon, E.J.; Jha, M.K.; Jindariani, S.; Johnson, W.; Jones, M.; Joo, K.K.; Jun, S.Y.; Junk, T.R.; Kamon, T.; Karchin, P.E.; Kato, Y.; Ketchum, W.; Keung, J.; Khotilovich, V.; Kilminster, B.; Kim, D.H.; Kim, H.S.; Kim, H.W.; Kim, J.E.; Kim, M.J.; Kim, S.B.; Kim, S.H.; Kim, Y.K.; Kimura, N.; Kirby, M.; Klimenko, S.; Kondo, K.; Kong, D.J.; Konigsberg, J.; Kotwal, A.V.; Kreps, M.; Kroll, J.; Krop, D.; Krumnack, N.; Kruse, M.; Krutelyov, V.; Kuhr, T.; Kurata, M.; Kwang, S.; Laasanen, A.T.; Lami, S.; Lammel, S.; Lancaster, M.; Lander, R.L.; Lannon, K.; Lath, A.; Latino, G.; LeCompte, T.; Lee, E.; Lee, H.S.; Lee, J.S.; Lee, S.W.; Leo, S.; Leone, S.; Lewis, J.D.; Limosani, A.; Lin, C.J.; Linacre, J.; Lindgren, M.; Lipeles, E.; Lister, A.; Litvintsev, D.O.; Liu, C.; Liu, Q.; Liu, T.; Lockwitz, S.; Lockyer, N.S.; Loginov, A.; Lucchesi, D.; Lueck, J.; Lujan, P.; Lukens, P.; Lungu, G.; Lys, J.; Lysak, R.; Madrak, R.; Maeshima, K.; Makhoul, K.; Maksimovic, P.; Malik, S.; Manca, G.; Manousakis-Katsikakis, A.; Margaroli, F.; Marino, C.; Martinez, M.; Martinez-Ballarin, R.; Mastrandrea, P.; Mathis, M.; Mattson, M.E.; Mazzanti, P.; McFarland, K.S.; McIntyre, P.; McNulty, R.; Mehta, A.; Mehtala, P.; Menzione, A.; Mesropian, C.; Miao, T.; Mietlicki, D.; Mitra, A.; Miyake, H.; Moed, S.; Moggi, N.; Mondragon, M.N.; Moon, C.S.; Moore, R.; Morello, M.J.; Morlock, J.; Movilla Fernandez, P.; Mukherjee, A.; Muller, Th.; Murat, P.; Mussini, M.; Nachtman, J.; Nagai, Y.; Naganoma, J.; Nakano, I.; Napier, A.; Nett, J.; Neu, C.; Neubauer, M.S.; Nielsen, J.; Nodulman, L.; Norniella, O.; Nurse, E.; Oakes, L.; Oh, S.H.; Oh, Y.D.; Oksuzian, I.; Okusawa, T.; Orava, R.; Ortolan, L.; Griso, S.Pagan; Pagliarone, C.; Palencia, E.; Papadimitriou, V.; Paramonov, A.A.; Patrick, J.; Pauletta, G.; Paulini, M.; Paus, C.; Pellett, D.E.; Penzo, A.; Phillips, T.J.; Piacentino, G.; Pianori, E.; Pilot, J.; Pitts, K.; Plager, C.; Pondrom, L.; Potamianos, K.; Poukhov, O.; Prokoshin, F.; Pronko, A.; Ptohos, F.; Pueschel, E.; Punzi, G.; Pursley, J.; Rahaman, A.; Ramakrishnan, V.; Ranjan, N.; Rao, K.; Redondo, I.; Renton, P.; Rescigno, M.; Rimondi, F.; Ristori, L.; Robson, A.; Rodrigo, T.; Rodriguez, T.; Rogers, E.; Rolli, S.; Roser, R.; Rossi, M.; Rubbo, F.; Ruffini, F.; Ruiz, A.; Russ, J.; Rusu, V.; Safonov, A.; Sakumoto, W.K.; Sakurai, Y.; Santi, L.; Sartori, L.; Sato, K.; Saveliev, V.; Savoy-Navarro, A.; Schlabach, P.; Schmidt, A.; Schmidt, E.E.; Schmidt, M.P.; Schmitt, M.; Schwarz, T.; Scodellaro, L.; Scribano, A.; Scuri, F.; Sedov, A.; Seidel, S.; Seiya, Y.; Semenov, A.; Sforza, F.; Sfyrla, A.; Shalhout, S.Z.; Shears, T.; Shepard, P.F.; Shimojima, M.; Shiraishi, S.; Shochet, M.; Shreyber, I.; Simonenko, A.; Sinervo, P.; Sissakian, A.; Sliwa, K.; Smith, J.R.; Snider, F.D.; Soha, A.; Somalwar, S.; Sorin, V.; Squillacioti, P.; Stancari, M.; Stanitzki, M.; Denis, R.St.; Stelzer, B.; Stelzer-Chilton, O.; Stentz, D.; Strologas, J.; Strycker, G.L.; Sudo, Y.; Sukhanov, A.; Suslov, I.; Takemasa, K.; Takeuchi, Y.; Tang, J.; Tecchio, M.; Teng, P.K.; Thom, J.; Thome, J.; Thompson, G.A.; Thomson, E.; Ttito-Guzman, P.; Tkaczyk, S.; Toback, D.; Tokar, S.; Tollefson, K.; Tomura, T.; Tonelli, D.; Torre, S.; Torretta, D.; Totaro, P.; Trovato, M.; Tu, Y.; Ukegawa, F.; Uozumi, S.; Varganov, A.; Vazquez, F.; Velev, G.; Vellidis, C.; Vidal, M.; Vila, I.; Vilar, R.; Vizan, J.; Vogel, M.; Volpi, G.; Wagner, P.; Wagner, R.L.; Wakisaka, T.; Wallny, R.; Wang, S.M.; Warburton, A.; Waters, D.; Weinberger, M.; Wester, W.C., III; Whitehouse, B.; Whiteson, D.; Wicklund, A.B.; Wicklund, E.; Wilbur, S.; Wick, F.; Williams, H.H.; Wilson, J.S.; Wilson, P.; Winer, B.L.; Wittich, P.; Wolbers, S.; Wolfe, H.; Wright, T.; Wu, X.; Wu, Z.; Yamamoto, K.; Yamaoka, J.; Yang, T.; Yang, U.K.; Yang, Y.C.; Yao, W.M.; Yeh, G.P.; Yi, K.; Yoh, J.; Yorita, K.; Yoshida, T.; Yu, G.B.; Yu, I.; Yu, S.S.; Yun, J.C.; Zanetti, A.; Zeng, Y.; Zucchelli, S.

    2011-01-01

    A study of event shape observables in proton-antiproton collisions at 1.96 TeV is presented. The data for this analysis were recorded by the CDF II detector at the Tevatron collider. The variables studied are the transverse thrust and thrust minor, both defined in the plane perpendicular to the beam direction. The observables are measured using energies from unclustered calorimeter cells. In addition to studies of the differential distributions, we present the dependence of event shape mean values on the leading jet transverse energy. Data are compared with pythia Tune A and to resummed parton level predictions that were matched to fixed order results at NLO accuracy (NLO+NLL). Predictions from pythia Tune A agree fairly well with the data. However, the underlying event contributes significantly to these observables, making it difficult to make direct comparisons to the NLO+NLL predictions, which do not account for the underlying event. To overcome this difficulty, we introduce a new observable, a weighted di...

  13. Measurement of the double differential diject mass cross section in p$\\bar{p}$ collisions at √(s) = 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Rominsky, Mandy Kathleen [Univ. of Oklahoma, Norman, OK (United States)

    2009-01-01

    This thesis presents the analysis of the double differential dijet mass cross section, measured at the D0 detector in Batavia, IL, using p$\\bar{p}$ collisions at a center of mass energy of √s = 1.96 TeV. The dijet mass was calculated using the two highest pT jets in the event, with approximately 0.7 fb-1 of data collected between 2004 and 2005. The analysis was presented in bins of dijet mass (MJJ) and rapidity (y), and extends the measurement farther in MJJ and y than any previous measurement. Corrections due to detector effects were calculated using a Monte Carlo simulation and applied to data. The errors on the measurement consist of statistical and systematic errors, of which the Jet Energy Scale was the largest. The final result was compared to next-to-leading order theory and good agreement was found. These results may be used in the determination of the proton parton distribution functions and to set limits on new physics.

  14. Measurement of the Top Quark Mass in ppbar Collisions at $\\sqrt{s}$ = 1.96 TeV using the Decay Length Technique

    CERN Document Server

    Abulencia, A

    2006-01-01

    We report the first measurement of the top quark mass using the decay length technique in ppbar collisions at a center-of-mass energy of 1.96 TeV. This technique uses the measured flight distance of the b hadron to infer the mass of the top quark in lepton plus jets events with missing transverse energy. It relies solely on tracking and avoids the jet energy scale uncertainty that is common to all other methods used so far. We apply our novel method to a 695 pb^-1 data sample recorded by the CDF II detector at Fermilab and extract a measurement of m_t = 180.7^{+15.5}_{-13.4} (stat.) \\pm 8.6 (syst.) GeV/c^2. While the uncertainty of this result is larger than that of other measurements, the dominant uncertainties in the decay length technique are uncorrelated with those in other methods. This result can help reduce the overall uncertainty when combined with other existing measurements of the top quark mass.

  15. Search for the supersymmetric partner of the top quark in ppbar collisions at sqrt(s) = 1.96 TeV

    CERN Document Server

    Aaltonen, T.; Amerio, S.; Amidei, D.; Anastassov, A.; Annovi, A.; Antos, J.; Apollinari, G.; Appel, J.A.; Apresyan, A.; Arisawa, T.; Artikov, A.; Asaadi, J.; Ashmanskas, W.; Auerbach, B.; Aurisano, A.; Azfar, F.; Badgett, W.; Barbaro-Galtieri, A.; Barnes, V.E.; Barnett, B.A.; Barria, P.; Bartos, P.; Bauce, M.; Bauer, G.; Bedeschi, F.; Beecher, D.; Behari, S.; Bellettini, G.; Bellinger, J.; Benjamin, D.; Beretvas, A.; Bhatti, A.; Binkley, M.; Bisello, D.; Bizjak, I.; Bland, K.R.; Blocker, C.; Blumenfeld, B.; Bocci, A.; Bodek, A.; Bortoletto, D.; Boudreau, J.; Boveia, A.; Brau, B.; Brigliadori, L.; Brisuda, A.; Bromberg, C.; Brucken, E.; Bucciantonio, M.; Budagov, J.; Budd, H.S.; Budd, S.; Burkett, K.; Busetto, G.; Bussey, P.; Buzatu, A.; Cabrera, S.; Calancha, C.; Camarda, S.; Campanelli, M.; Campbell, M.; Canelli, F.; Canepa, A.; Carls, B.; Carlsmith, D.; Carosi, R.; Carrillo, S.; Carron, S.; Casal, B.; Casarsa, M.; Castro, A.; Catastini, P.; Cauz, D.; Cavaliere, V.; Cavalli-Sforza, M.; Cerri, A.; Cerrito, L.; Chen, Y.C.; Chertok, M.; Chiarelli, G.; Chlachidze, G.; Chlebana, F.; Cho, K.; Chokheli, D.; Chou, J.P.; Chung, W.H.; Chung, Y.S.; Ciobanu, C.I.; Ciocci, M.A.; Clark, A.; Clark, D.; Compostella, G.; Convery, M.E.; Conway, J.; Corbo, M.; Cordelli, M.; Cox, C.A.; Cox, D.J.; Crescioli, F.; Cuenca Almenar, C.; Cuevas, J.; Culbertson, R.; Dagenhart, D.; d'Ascenzo, N.; Datta, M.; de Barbaro, P.; De Cecco, S.; De Lorenzo, G.; Dell'Orso, M.; Deluca, C.; Demortier, L.; Deng, J.; Deninno, M.; Devoto, F.; d'Errico, M.; Di Canto, A.; Di Ruzza, B.; Dittmann, J.R.; D'Onofrio, M.; Donati, S.; Dong, P.; Dorigo, T.; Ebina, Koji; Elagin, A.; Eppig, A.; Erbacher, R.; Errede, D.; Errede, S.; Ershaidat, N.; Eusebi, R.; Fang, H.C.; Farrington, S.; Feindt, M.; Fernandez, J.P.; Ferrazza, C.; Field, R.; Flanagan, G.; Forrest, R.; Frank, M.J.; Franklin, M.; Freeman, J.C.; Furic, I.; Gallinaro, M.; Galyardt, J.; Garcia, J.E.; Garfinkel, A.F.; Garosi, P.; Gerberich, H.; Gerchtein, E.; Giagu, S.; Giakoumopoulou, V.; Giannetti, P.; Gibson, K.; Ginsburg, C.M.; Giokaris, N.; Giromini, P.; Giunta, M.; Giurgiu, G.; Glagolev, V.; Glenzinski, D.; Gold, M.; Goldin, D.; Goldschmidt, N.; Golossanov, A.; Gomez, G.; Gomez-Ceballos, G.; Goncharov, M.; Gonzalez, O.; Gorelov, I.; Goshaw, A.T.; Goulianos, K.; Gresele, A.; Grinstein, S.; Grosso-Pilcher, C.; Group, R.C.; Guimaraes da Costa, J.; Gunay-Unalan, Z.; Haber, C.; Hahn, S.R.; Halkiadakis, E.; Hamaguchi, A.; Han, J.Y.; Happacher, F.; Hara, K.; Hare, D.; Hare, M.; Harr, R.F.; Hatakeyama, K.; Hays, C.; Heck, M.; Heinrich, J.; Herndon, M.; Hewamanage, S.; Hidas, D.; Hocker, A.; Hopkins, W.; Horn, D.; Hou, S.; Hughes, R.E.; Hurwitz, M.; Husemann, U.; Hussain, N.; Hussein, M.; Huston, J.; Introzzi, G.; Iori, M.; Ivanov, A.; James, E.; Jang, D.; Jayatilaka, B.; Jeon, E.J.; Jha, M.K.; Jindariani, S.; Johnson, W.; Jones, M.; Joo, K.K.; Jun, S.Y.; Junk, T.R.; Kamon, T.; Karchin, P.E.; Kato, Y.; Ketchum, W.; Keung, J.; Khotilovich, V.; Kilminster, B.; Kim, D.H.; Kim, H.S.; Kim, H.W.; Kim, J.E.; Kim, M.J.; Kim, S.B.; Kim, S.H.; Kim, Y.K.; Kimura, N.; Klimenko, S.; Kondo, K.; Kong, D.J.; Konigsberg, J.; Korytov, A.; Kotwal, A.V.; Kreps, M.; Kroll, J.; Krop, D.; Krumnack, N.; Kruse, M.; Krutelyov, V.; Kuhr, T.; Kurata, M.; Kwang, S.; Laasanen, A.T.; Lami, S.; Lammel, S.; Lancaster, M.; Lander, R.L.; Lannon, K.; Lath, A.; Latino, G.; Lazzizzera, I.; LeCompte, T.; Lee, E.; Lee, H.S.; Lee, J.S.; Lee, S.W.; Leo, S.; Leone, S.; Lewis, J.D.; Lin, C.J.; Linacre, J.; Lindgren, M.; Lipeles, E.; Lister, A.; Litvintsev, D.O.; Liu, C.; Liu, Q.; Liu, T.; Lockwitz, S.; Lockyer, N.S.; Loginov, A.; Lucchesi, D.; Lueck, J.; Lujan, P.; Lukens, P.; Lungu, G.; Lys, J.; Lysak, R.; Madrak, R.; Maeshima, K.; Makhoul, K.; Maksimovic, P.; Malik, S.; Manca, G.; Manousakis-Katsikakis, A.; Margaroli, F.; Marino, C.; Martinez, M.; Martinez-Ballarin, R.; Mastrandrea, P.; Mathis, M.; Mattson, M.E.; Mazzanti, P.; McFarland, K.S.; McIntyre, P.; McNulty, R.; Mehta, A.; Mehtala, P.; Menzione, A.; Mesropian, C.; Miao, T.; Mietlicki, D.; Mitra, A.; Miyake, H.; Moed, S.; Moggi, N.; Mondragon, M.N.; Moon, C.S.; Moore, R.; Morello, M.J.; Morlock, J.; Movilla Fernandez, P.; Mukherjee, A.; Muller, Th.; Murat, P.; Mussini, M.; Nachtman, J.; Nagai, Y.; Naganoma, J.; Nakano, I.; Napier, A.; Nett, J.; Neu, C.; Neubauer, M.S.; Nielsen, J.; Nodulman, L.; Norniella, O.; Nurse, E.; Oakes, L.; Oh, S.H.; Oh, Y.D.; Oksuzian, I.; Okusawa, T.; Orava, R.; Ortolan, L.; Griso, S.Pagan; Pagliarone, C.; Palencia, E.; Papadimitriou, V.; Paramonov, A.A.; Patrick, J.; Pauletta, G.; Paulini, M.; Paus, C.; Pellett, D.E.; Penzo, A.; Phillips, T.J.; Piacentino, G.; Pianori, E.; Pilot, J.; Pitts, K.; Plager, C.; Pondrom, L.; Potamianos, K.; Poukhov, O.; Prokoshin, F.; Pronko, A.; Ptohos, F.; Pueschel, E.; Punzi, G.; Pursley, J.; Rahaman, A.; Ramakrishnan, V.; Ranjan, N.; Redondo, I.; Renton, P.; Rescigno, M.; Rimondi, F.; Ristori, L.; Robson, A.; Rodrigo, T.; Rodriguez, T.; Rogers, E.; Rolli, S.; Roser, R.; Rossi, M.; Ruffini, F.; Ruiz, A.; Russ, J.; Rusu, V.; Safonov, A.; Sakumoto, W.K.; Santi, L.; Sartori, L.; Sato, K.; Saveliev, V.; Savoy-Navarro, A.; Schlabach, P.; Schmidt, A.; Schmidt, E.E.; Schmidt, M.P.; Schmitt, M.; Schwarz, T.; Scodellaro, L.; Scribano, A.; Scuri, F.; Sedov, A.; Seidel, S.; Seiya, Y.; Semenov, A.; Sforza, F.; Sfyrla, A.; Shalhout, S.Z.; Shears, T.; Shepard, P.F.; Shimojima, M.; Shiraishi, S.; Shochet, M.; Shreyber, I.; Simonenko, A.; Sinervo, P.; Sissakian, A.; Sliwa, K.; Smith, J.R.; Snider, F.D.; Soha, A.; Somalwar, S.; Sorin, V.; Squillacioti, P.; Stanitzki, M.; Denis, R.St.; Stelzer, B.; Stelzer-Chilton, O.; Stentz, D.; Strologas, J.; Strycker, G.L.; Sudo, Y.; Sukhanov, A.; Suslov, I.; Takemasa, K.; Takeuchi, Y.; Tang, J.; Tecchio, M.; Teng, P.K.; Thom, J.; Thome, J.; Thompson, G.A.; Thomson, E.; Ttito-Guzman, P.; Tkaczyk, S.; Toback, D.; Tokar, S.; Tollefson, K.; Tomura, T.; Tonelli, D.; Torre, S.; Torretta, D.; Totaro, P.; Trovato, M.; Tu, Y.; Turini, N.; Ukegawa, F.; Uozumi, S.; Varganov, A.; Vataga, E.; Vazquez, F.; Velev, G.; Vellidis, C.; Vidal, M.; Vila, I.; Vilar, R.; Vogel, M.; Volpi, G.; Wagner, P.; Wagner, R.L.; Wakisaka, T.; Wallny, R.; Wang, S.M.; Warburton, A.; Waters, D.; Weinberger, M.; Wester, W.C., III; Whitehouse, B.; Whiteson, D.; Wicklund, A.B.; Wicklund, E.; Wilbur, S.; Wick, F.; Williams, H.H.; Wilson, J.S.; Wilson, P.; Winer, B.L.; Wittich, P.; Wolbers, S.; Wolfe, H.; Wright, T.; Wu, X.; Wu, Z.; Yamamoto, K.; Yamaoka, J.; Yang, T.; Yang, U.K.; Yang, Y.C.; Yao, W.M.; Yeh, G.P.; Yi, K.; Yoh, J.; Yorita, K.; Yoshida, T.; Yu, G.B.; Yu, I.; Yu, S.S.; Yun, J.C.; Zanetti, A.; Zeng, Y.; Zucchelli, S.

    2010-01-01

    We present a search for the lightest supersymmetric partner of the top quark in proton-antiproton collisions at a center-of-mass energy sqrt(s)=1.96 TeV. This search was conducted within the framework of the R-parity conserving minimal supersymmetric extension of the standard model, assuming the stop decays dominantly to a lepton, a sneutrino, and a bottom quark. We searched for events with two oppositely-charged leptons, at least one jet, and missing transverse energy in a data sample corresponding to an integrated luminosity of 1fb^-1 collected by the CDF experiment. No significant evidence of a stop quark signal was found. Exclusion limits at 95% confidence level in the stop quark versus sneutrino mass plane are set. Stop quark masses up to 180 GeV/c^2 are excluded for sneutrino masses around 45 GeV/c^2, and sneutrino masses up to 116 GeV/c^2 are excluded for stop quark masses around 150 GeV/c^2.

  16. Search for the Flavor Changing Neutral Current Decay t → Z q at √(s) = 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Gimmell, Jennifer Lindsay [Univ. of Rochester, NY (United States)

    2009-01-01

    This thesis reports the results of a search for the flavor changing neutral current decay of the top quark, t → Zq, in decays of t$\\bar{t}$ pairs produced in p$\\bar{p}$ collisions at a center-of-mass energy of 1.96 TeV. This search is performed on a data sample recorded by the Collider Detector at Fermilab (CDF), corresponding to an integrated luminosity of 1.9 fb-1. This search follows a previous CDF analysis that resulted in an upper limit for the branching fraction β(t → Zq) of 10.4% at 95% C.L. using a dataset equivalent to 1.1 fb-1 of integrated luminosity. This thesis extends to 1.9 fb-1 of data, and has improved sensitivity to the small signal with the introduction of a template fit technique that includes systematic uncertainties by a linear interpolation between templates. Using a Feldman-Cousins construction, an upper limit at 95% C.L. is set on β(t → Zq) of 3.7%, with the expected upper limit in absence of a signal is 5.0 ± 2.2% for a top mass of 175 GeV/c2.

  17. t anti-t production cross section measurement using soft electron tagging in p anti-p collisions at √s = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Chou, John Paul [Harvard Univ., Cambridge, MA (United States)

    2008-09-01

    We measure the production cross section of t$\\bar{t}$ events in p$\\bar{p}$ collisions at √s = 1.96 TeV. The data was collected by the CDF experiment in Run 2 of the Tevatron accelerator at the Fermi National Accelerator Laboratory between 2002 and 2007. 1.7 fb-1 of data was recorded during this time period. We reconstruct t$\\bar{t}$ events in the lepton+jets channel, whereby one W boson - resulting from the decay of the top quark pairs - decays leptonically and the other hadronically. The dominant background to this process is the production of W bosons in association with multiple jets. To distinguish t$\\bar{t}$ from background, we identify soft electrons from the semileptonic decay of heavy flavor jets produced in t$\\bar{t}$ events. We measure a cross section of σ$\\bar{p}$ = 7.8 ± 2.4(stat) ± 1.6(syst) ± 0.5(lumi).

  18. WW production cross section measurement and limits on anomalous trilinear gauge couplings at √(s) = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Cooke, Michael P. [Rice Univ., Houston, TX (United States)

    2008-04-01

    The cross section for WW production is measured and limits on anomalous WWγ and WWZ trilinear gauge couplings are set using WW → ee/eμ/μμ events collected by the Run II D0 detector at the Fermilab Tevatron Collider corresponding to 1 fb-1 of integrated luminosity at √s = 1.96 TeV. Across the three final states, 108 candidate events are observed with 40.8± 3.8 total background expected, consistent with σ(p$\\bar{p}$ → WW) = 11.6 ± 1.8(stat) ± 0.7(syst) ± 0.7(lumi) pb. Using a set of SU(2)L Ⓧ U(1)Y conserving constraints, the one-dimensional 95% C.L. limits on trilinear gauge couplings are -0.63 < Δκγ< 0.99, -0.15 < Λγ < 0.19, and -0.14 < Δg1Z < 0.34.

  19. Search for New Heavy Particles Decaying to Z0 Z0 to llll, lljj in p pbar Collisions at Sqrt(s) = 1.96 TeV

    CERN Document Server

    Aaltonen, T.; Amerio, S.; Amidei, D.; Anastassov, A.; Annovi, A.; Antos, J.; Apollinari, G.; Appel, J.A.; Apresyan, A.; Arisawa, T.; Artikov, A.; Asaadi, J.; Ashmanskas, W.; Auerbach, B.; Aurisano, A.; Azfar, F.; Badgett, W.; Barbaro-Galtieri, A.; Barnes, V.E.; Barnett, B.A.; Barria, P.; Bartos, P.; Bauce, M.; Bauer, G.; Bedeschi, F.; Beecher, D.; Behari, S.; Bellettini, G.; Bellinger, J.; Benjamin, D.; Beretvas, A.; Bhatti, A.; Binkley, M.; Bisello, D.; Bizjak, I.; Bland, K.R.; Blumenfeld, B.; Bocci, A.; Bodek, A.; Bortoletto, D.; Boudreau, J.; Boveia, A.; Brau, B.; Brigliadori, L.; Brisuda, A.; Bromberg, C.; Brucken, E.; Bucciantonio, M.; Budagov, J.; Budd, H.S.; Budd, S.; Burkett, K.; Busetto, G.; Bussey, P.; Buzatu, A.; Calancha, C.; Camarda, S.; Campanelli, M.; Campbell, M.; Canelli, F.; Canepa, A.; Carls, B.; Carlsmith, D.; Carosi, R.; Carrillo, S.; Carron, S.; Casal, B.; Casarsa, M.; Castro, A.; Catastini, P.; Cauz, D.; Cavaliere, V.; Cavalli-Sforza, M.; Cerri, A.; Cerrito, L.; Chen, Y.C.; Chertok, M.; Chiarelli, G.; Chlachidze, G.; Chlebana, F.; Cho, K.; Chokheli, D.; Chou, J.P.; Chung, W.H.; Chung, Y.S.; Ciobanu, C.I.; Ciocci, M.A.; Clark, A.; Compostella, G.; Convery, M.E.; Conway, J.; Corbo, M.; Cordelli, M.; Cox, C.A.; Cox, D.J.; Crescioli, F.; Cuenca Almenar, C.; Cuevas, J.; Culbertson, R.; Dagenhart, D.; d'Ascenzo, N.; Datta, M.; de Barbaro, P.; De Cecco, S.; De Lorenzo, G.; Dell'Orso, M.; Deluca, C.; Demortier, L.; Deng, J.; Deninno, M.; Devoto, F.; d'Errico, M.; Di Canto, A.; Di Ruzza, B.; Dittmann, J.R.; D'Onofrio, M.; Donati, S.; Dong, P.; Dorigo, M.; Dorigo, T.; Ebina, K.; Elagin, A.; Eppig, A.; Erbacher, R.; Errede, D.; Errede, S.; Ershaidat, N.; Eusebi, R.; Fang, H.C.; Farrington, S.; Feindt, M.; Fernandez, J.P.; Ferrazza, C.; Field, R.; Flanagan, G.; Forrest, R.; Frank, M.J.; Franklin, M.; Freeman, J.C.; Funakoshi, Y.; Furic, I.; Gallinaro, M.; Galyardt, J.; Garcia, J.E.; Garfinkel, A.F.; Garosi, P.; Gerberich, H.; Gerchtein, E.; Giagu, S.; Giakoumopoulou, V.; Giannetti, P.; Gibson, K.; Ginsburg, C.M.; Giokaris, N.; Giromini, P.; Giunta, M.; Giurgiu, G.; Glagolev, V.; Glenzinski, D.; Gold, M.; Goldin, D.; Goldschmidt, N.; Golossanov, A.; Gomez, G.; Gomez-Ceballos, G.; Goncharov, M.; Gonzalez, O.; Gorelov, I.; Goshaw, A.T.; Goulianos, K.; Grinstein, S.; Grosso-Pilcher, C.; Group, R.C.; Guimaraes da Costa, J.; Gunay-Unalan, Z.; Haber, C.; Hahn, S.R.; Halkiadakis, E.; Hamaguchi, A.; Han, J.Y.; Happacher, F.; Hara, K.; Hare, D.; Hare, M.; Harr, R.F.; Hatakeyama, K.; Hays, C.; Heck, M.; Heinrich, J.; Herndon, M.; Hewamanage, S.; Hidas, D.; Hocker, A.; Hopkins, W.; Horn, D.; Hou, S.; Hughes, R.E.; Hurwitz, M.; Husemann, U.; Hussain, N.; Hussein, M.; Huston, J.; Introzzi, G.; Iori, M.; Ivanov, A.; James, E.; Jang, D.; Jayatilaka, B.; Jeon, E.J.; Jha, M.K.; Jindariani, S.; Johnson, W.; Jones, M.; Joo, K.K.; Jun, S.Y.; Junk, T.R.; Kamon, T.; Karchin, P.E.; Kato, Y.; Ketchum, W.; Keung, J.; Khotilovich, V.; Kilminster, B.; Kim, D.H.; Kim, H.S.; Kim, H.W.; Kim, J.E.; Kim, M.J.; Kim, S.B.; Kim, S.H.; Kim, Y.K.; Kimura, N.; Kirby, M.; Klimenko, S.; Kondo, K.; Kong, D.J.; Konigsberg, J.; Kotwal, A.V.; Kreps, M.; Kroll, J.; Krop, D.; Krumnack, N.; Kruse, M.; Krutelyov, V.; Kuhr, T.; Kurata, M.; Kwang, S.; Laasanen, A.T.; Lami, S.; Lammel, S.; Lancaster, M.; Lander, R.L.; Lannon, K.; Lath, A.; Latino, G.; LeCompte, T.; Lee, E.; Lee, H.S.; Lee, J.S.; Lee, S.W.; Leo, S.; Leone, S.; Lewis, J.D.; Limosani, A.; Lin, C.J.; Linacre, J.; Lindgren, M.; Lipeles, E.; Lister, A.; Litvintsev, D.O.; Liu, C.; Liu, Q.; Liu, T.; Lockwitz, S.; Lockyer, N.S.; Loginov, A.; Lucchesi, D.; Lueck, J.; Lujan, P.; Lukens, P.; Lungu, G.; Lys, J.; Lysak, R.; Madrak, R.; Maeshima, K.; Makhoul, K.; Maksimovic, P.; Malik, S.; Manca, G.; Manousakis-Katsikakis, A.; Margaroli, F.; Marino, C.; Martinez, M.; Martinez-Ballarin, R.; Mastrandrea, P.; Mathis, M.; Mattson, M.E.; Mazzanti, P.; McFarland, K.S.; McIntyre, P.; McNulty, R.; Mehta, A.; Mehtala, P.; Menzione, A.; Mesropian, C.; Miao, T.; Mietlicki, D.; Mitra, A.; Miyake, H.; Moed, S.; Moggi, N.; Mondragon, M.N.; Moon, C.S.; Moore, R.; Morello, M.J.; Morlock, J.; Movilla Fernandez, P.; Mukherjee, A.; Muller, Th.; Murat, P.; Mussini, M.; Nachtman, J.; Nagai, Y.; Naganoma, J.; Nakano, I.; Napier, A.; Nett, J.; Neu, C.; Neubauer, M.S.; Nielsen, J.; Nodulman, L.; Norniella, O.; Nurse, E.; Oakes, L.; Oh, S.H.; Oh, Y.D.; Oksuzian, I.; Okusawa, T.; Orava, R.; Ortolan, L.; Griso, S.Pagan; Pagliarone, C.; Palencia, E.; Papadimitriou, V.; Paramonov, A.A.; Patrick, J.; Pauletta, G.; Paulini, M.; Paus, C.; Pellett, D.E.; Penzo, A.; Phillips, T.J.; Piacentino, G.; Pianori, E.; Pilot, J.; Pitts, K.; Plager, C.; Pondrom, L.; Potamianos, K.; Poukhov, O.; Prokoshin, F.; Pronko, A.; Ptohos, F.; Pueschel, E.; Punzi, G.; Pursley, J.; Rahaman, A.; Ramakrishnan, V.; Ranjan, N.; Rao, K.; Redondo, I.; Renton, P.; Rescigno, M.; Rimondi, F.; Ristori, L.; Robson, A.; Rodrigo, T.; Rodriguez, T.; Rogers, E.; Rolli, S.; Roser, R.; Rossi, M.; Rubbo, F.; Ruffini, F.; Ruiz, A.; Russ, J.; Rusu, V.; Safonov, A.; Sakumoto, W.K.; Sakurai, Y.; Santi, L.; Sartori, L.; Sato, K.; Saveliev, V.; Savoy-Navarro, A.; Schlabach, P.; Schmidt, A.; Schmidt, E.E.; Schmidt, M.P.; Schmitt, M.; Schwarz, T.; Scodellaro, L.; Scribano, A.; Scuri, F.; Sedov, A.; Seidel, S.; Seiya, Y.; Semenov, A.; Sforza, F.; Sfyrla, A.; Shalhout, S.Z.; Shears, T.; Shepard, P.F.; Shimojima, M.; Shiraishi, S.; Shochet, M.; Shreyber, I.; Simonenko, A.; Sinervo, P.; Sissakian, A.; Sliwa, K.; Smith, J.R.; Snider, F.D.; Soha, A.; Somalwar, S.; Sorin, V.; Squillacioti, P.; Stancari, M.; Stanitzki, M.; Denis, R.St.; Stelzer, B.; Stelzer-Chilton, O.; Stentz, D.; Strologas, J.; Strycker, G.L.; Sudo, Y.; Sukhanov, A.; Suslov, I.; Takemasa, K.; Takeuchi, Y.; Tang, J.; Tecchio, M.; Teng, P.K.; Thom, J.; Thome, J.; Thompson, G.A.; Thomson, E.; Ttito-Guzman, P.; Tkaczyk, S.; Toback, D.; Tokar, S.; Tollefson, K.; Tomura, T.; Tonelli, D.; Torre, S.; Torretta, D.; Totaro, P.; Trovato, M.; Tu, Y.; Ukegawa, F.; Uozumi, S.; Varganov, A.; Vazquez, F.; Velev, G.; Vellidis, C.; Vidal, M.; Vila, I.; Vilar, R.; Vizan, J.; Vogel, M.; Volpi, G.; Wagner, P.; Wagner, R.L.; Wakisaka, T.; Wallny, R.; Wang, S.M.; Warburton, A.; Waters, D.; Weinberger, M.; Wester, W.C., III; Whitehouse, B.; Whiteson, D.; Wicklund, A.B.; Wicklund, E.; Wilbur, S.; Wick, F.; Williams, H.H.; Wilson, J.S.; Wilson, P.; Winer, B.L.; Wittich, P.; Wolbers, S.; Wolfe, H.; Wright, T.; Wu, X.; Wu, Z.; Yamamoto, K.; Yamaoka, J.; Yang, T.; Yang, U.K.; Yang, Y.C.; Yao, W.M.; Yeh, G.P.; Yi, K.; Yoh, J.; Yorita, K.; Yoshida, T.; Yu, G.B.; Yu, I.; Yu, S.S.; Yun, J.C.; Zanetti, A.; Zeng, Y.; Zucchelli, S.

    2011-01-01

    We report on a search for anomalous production of Z boson pairs through a massive resonance decay in data corresponding to 2.5-2.9 fb^-1 of integrated luminosity in p pbar collisions at 1.96 TeV using the CDF II detector at the Fermilab Tevatron. This analysis, with more data and channels where the Z bosons decay to muons or jets, supersedes the 1.1 fb^-1 four-electron channel result previously published by CDF. In order to maintain high efficiency for muons, we use a new forward tracking algorithm and muon identification requirements optimized for these high signal-to-background channels. Predicting the dominant backgrounds in each channel entirely from sideband data samples, we observe four-body invariant mass spectra above 300 GeV/c^2 that are consistent with background. We set limits using the acceptance for a massive graviton resonance that are 7-20 times stronger than the previously published direct limits on resonant ZZ production.

  20. Search for Supersymmetry Using Diphoton Events in p anti-p Collisions at a center of mass energy of 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Eun Sin [Texas A & M Univ., College Station, TX (United States)

    2010-05-01

    This dissertation presents the results of a search for supersymmetry in protonantiproton collisions with a center of mass energy of 1.96 TeV studied with the Collider Detector at Fermilab. Our strategy is to select collisions with two photons in the nal state that have the properties of being the decays of very massive supersymmetric particles. This includes looking for large total energy from the decayed particles as well as for the presence of particles that leave the detector without interacting. We nd no events using 2.6 fb-1 of data collected during the 2004-2008 collider run of the Fermilab Tevatron which is consistent with the background estimate of 1.4 0.4 events. Since there is no evidence of new particles we set cross section limits in a gaugemediated supersymmetry model with X$\\tilde{o}$1→ eG, where the X$\\tilde{o}$1 and eG are the lightest neutralino and the gravitino (the lightest supersymmetric particle), respectively. We set limits on models as a function of the X$\\tilde{o}$1 mass and lifetime, producing the world's most sensitive search for X$\\tilde{o}$1 by excluding masses up to 149 GeV=c2 for X$\\tilde{o}$1 lifetimes much less than 1 ns.

  1. Search for Scalar Bottom Quarks from Gluino Decays in Proton - Anti-proton Collisions at a Center-of-Mass Energy of 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Rott, Carsten [Purdue Univ., West Lafayette, IN (United States)

    2004-12-01

    The authors have performed a search for the scalar bottom quark ($\\tilde{b}$1) from gluino ($\\tilde{g}$) decays in an R-parity conserving SUSY scenario with m$\\tilde{g}$ > m$\\tilde{b}1$, by investigating a final state of large missing transverse energy, with three or more jets, and some of them from the hadronization of b-quarks. A data sample of 156 pb-1 collected by the Collider Detector at Fermilab at a center-of-mass energy of √s = 1.96 TeV was used. For the final selection, jets containing secondary displaced vertices were required. This analysis has been performed ''blind'', in that the inspection of the signal region was only made after the Standard Model prediction was finalized. Comparing data with SUSY predictions, they can exclude masses of the gluino and sbottom of up to 280 and 240 GeV/c2 respectively.

  2. Search for a two-Higgs-boson doublet using a simplified model in $p\\bar{p}$ collisions at $\\sqrt{s}=1.96$ TeV

    CERN Document Server

    Aaltonen, T.; Alvarez Gonzalez, B.; Amerio, S.; Amidei, D.; Anastassov, A.; Annovi, A.; Antos, J.; Apollinari, G.; Appel, J.A.; Arisawa, T.; Artikov, A.; Asaadi, J.; Ashmanskas, W.; Auerbach, B.; Aurisano, A.; Azfar, F.; Badgett, W.; Bae, T.; Barbaro-Galtieri, A.; Barnes, V.E.; Barnett, B.A.; Barria, P.; Bartos, P.; Bauce, M.; Bedeschi, F.; Behari, S.; Bellettini, G.; Bellinger, J.; Benjamin, D.; Beretvas, A.; Bhatti, A.; Bisello, D.; Bizjak, I.; Bland, K.R.; Blumenfeld, B.; Bocci, A.; Bodek, A.; Bortoletto, D.; Boudreau, J.; Boveia, A.; Brigliadori, L.; Bromberg, C.; Brucken, E.; Budagov, J.; Budd, H.S.; Burkett, K.; Busetto, G.; Bussey, P.; Buzatu, A.; Calamba, A.; Calancha, C.; Camarda, S.; Campanelli, M.; Campbell, M.; Canelli, F.; Carls, B.; Carlsmith, D.; Carosi, R.; Carrillo, S.; Carron, S.; Casal, B.; Casarsa, M.; Castro, A.; Catastini, P.; Cauz, D.; Cavaliere, V.; Cavalli-Sforza, M.; Cerri, A.; Cerrito, L.; Chen, Y.C.; Chertok, M.; Chiarelli, G.; Chlachidze, G.; Chlebana, F.; Cho, K.; Chokheli, D.; Chung, W.H.; Chung, Y.S.; Ciocci, M.A.; Clark, A.; Clarke, C.; Compostella, G.; Convery, M.E.; Conway, J.; Corbo, M.; Cordelli, M.; Cox, C.A.; Cox, D.J.; Crescioli, F.; Cuevas, J.; Culbertson, R.; Dagenhart, D.; d'Ascenzo, N.; Datta, M.; de Barbaro, P.; Dell'Orso, M.; Demortier, L.; Deninno, M.; Devoto, F.; d'Errico, M.; Di Canto, A.; Di Ruzza, B.; Dittmann, J.R.; D'Onofrio, M.; Donati, S.; Dong, P.; Dorigo, M.; Dorigo, T.; Ebina, K.; Elagin, A.; Eppig, A.; Erbacher, R.; Errede, S.; Ershaidat, N.; Eusebi, R.; Farrington, S.; Feindt, M.; Fernandez, J.P.; Field, R.; Flanagan, G.; Forrest, R.; Frank, M.J.; Franklin, M.; Freeman, J.C.; Funakoshi, Y.; Furic, I.; Gallinaro, M.; Garcia, J.E.; Garfinkel, A.F.; Garosi, P.; Gerberich, H.; Gerchtein, E.; Giagu, S.; Giakoumopoulou, V.; Giannetti, P.; Gibson, K.; Ginsburg, C.M.; Giokaris, N.; Giromini, P.; Giurgiu, G.; Glagolev, V.; Glenzinski, D.; Gold, M.; Goldin, D.; Goldschmidt, N.; Golossanov, A.; Gomez, G.; Gomez-Ceballos, G.; Goncharov, M.; Gonzalez, O.; Gorelov, I.; Goshaw, A.T.; Goulianos, K.; Grinstein, S.; Grosso-Pilcher, C.; Group, R.C.; Guimaraes da Costa, J.; Hahn, S.R.; Halkiadakis, E.; Hamaguchi, A.; Han, J.Y.; Happacher, F.; Hara, K.; Hare, D.; Hare, M.; Harr, R.F.; Hatakeyama, K.; Hays, C.; Heck, M.; Heinrich, J.; Herndon, M.; Hewamanage, S.; Hocker, A.; Hopkins, W.; Horn, D.; Hou, S.; Hughes, R.E.; Hurwitz, M.; Husemann, U.; Hussain, N.; Hussein, M.; Huston, J.; Introzzi, G.; Iori, M.; Ivanov, A.; James, E.; Jang, D.; Jayatilaka, B.; Jeon, E.J.; Jindariani, S.; Johnstone, A.; Jones, M.; Joo, K.K.; Jun, S.Y.; Junk, T.R.; Kamon, T.; Karchin, P.E.; Kasmi, A.; Kato, Y.; Ketchum, W.; Keung, J.; Khotilovich, V.; Kilminster, B.; Kim, D.H.; Kim, H.S.; Kim, J.E.; Kim, M.J.; Kim, S.B.; Kim, S.H.; Kim, Y.K.; Kim, Y.J.; Kimura, N.; Kirby, M.; Klimenko, S.; Knoepfel, K.; Kondo, K.; Kong, D.J.; Konigsberg, J.; Kotwal, A.V.; Kreps, M.; Kroll, J.; Krop, D.; Kruse, M.; Krutelyov, V.; Kuhr, T.; Kurata, M.; Kwang, S.; Laasanen, A.T.; Lami, S.; Lammel, S.; Lancaster, M.; Lander, R.L.; Lannon, K.; Lath, A.; Latino, G.; LeCompte, T.; Lee, E.; Lee, H.S.; Lee, J.S.; Lee, S.W.; Leo, S.; Leone, S.; Lewis, J.D.; Limosani, A.; Lin, C.J.; Lindgren, M.; Lipeles, E.; Lister, A.; Litvintsev, D.O.; Liu, C.; Liu, H.; Liu, Q.; Liu, T.; Lockwitz, S.; Loginov, A.; Lucchesi, D.; Lueck, J.; Lujan, P.; Lukens, P.; Lungu, G.; Lys, J.; Lysak, R.; Madrak, R.; Maeshima, K.; Maestro, P.; Malik, S.; Manca, G.; Manousakis-Katsikakis, A.; Margaroli, F.; Marino, C.; Martinez, M.; Mastrandrea, P.; Matera, K.; Mattson, M.E.; Mazzacane, A.; Mazzanti, P.; McFarland, K.S.; McIntyre, P.; McNulty, R.; Mehta, A.; Mehtala, P.; Mesropian, C.; Miao, T.; Mietlicki, D.; Mitra, A.; Miyake, H.; Moed, S.; Moggi, N.; Mondragon, M.N.; Moon, C.S.; Moore, R.; Morello, M.J.; Morlock, J.; Movilla Fernandez, P.; Mukherjee, A.; Muller, Th.; Murat, P.; Mussini, M.; Nachtman, J.; Nagai, Y.; Naganoma, J.; Nakano, I.; Napier, A.; Nett, J.; Neu, C.; Neubauer, M.S.; Nielsen, J.; Nodulman, L.; Noh, S.Y.; Norniella, O.; Oakes, L.; Oh, S.H.; Oh, Y.D.; Oksuzian, I.; Okusawa, T.; Orava, R.; Ortolan, L.; Pagan Griso, S.; Pagliarone, C.; Palencia, E.; Papadimitriou, V.; Paramonov, A.A.; Patrick, J.; Pauletta, G.; Paulini, M.; Paus, C.; Pellett, D.E.; Penzo, A.; Phillips, T.J.; Piacentino, G.; Pianori, E.; Pilot, J.; Pitts, K.; Plager, C.; Pondrom, L.; Poprocki, S.; Potamianos, K.; Prokoshin, F.; Pranko, A.; Ptohos, F.; Punzi, G.; Rahaman, A.; Ramakrishnan, V.; Ranjan, N.; Rao, K.; Redondo, I.; Renton, P.; Rescigno, M.; Riddick, T.; Rimondi, F.; Ristori, L.; Robson, A.; Rodrigo, T.; Rodriguez, T.; Rogers, E.; Rolli, S.; Roser, R.; Ruffini, F.; Ruiz, A.; Russ, J.; Rusu, V.; Safonov, A.; Sakumoto, W.K.; Sakurai, Y.; Santi, L.; Sato, K.; Saveliev, V.; Savoy-Navarro, A.; Schlabach, P.; Schmidt, A.; Schmidt, E.E.; Schwarz, T.; Scodellaro, L.; Scribano, A.; Scuri, F.; Seidel, S.; Seiya, Y.; Semenov, A.; Sforza, F.; Shalhout, S.Z.; Shears, T.; Shepard, P.F.; Shimojima, M.; Shochet, M.; Shreyber-Tecker, I.; Simonenko, A.; Sinervo, P.; Sliwa, K.; Smith, J.R.; Snider, F.D.; Soha, A.; Sorin, V.; Song, H.; Squillacioti, P.; Stancari, M.; St. Denis, R.; Stelzer, B.; Stelzer-Chilton, O.; Stentz, D.; Strologas, J.; Strycker, G.L.; Sudo, Y.; Sukhanov, A.; Suslov, I.; Takemasa, K.; Takeuchi, Y.; Tang, J.; Tecchio, M.; Teng, P.K.; Thom, J.; Thome, J.; Thompson, G.A.; Thomson, E.; Toback, D.; Tokar, S.; Tollefson, K.; Tomura, T.; Tonelli, D.; Torre, S.; Torretta, D.; Totaro, P.; Trovato, M.; Truong, A.; Ukegawa, F.; Uozumi, S.; Varganov, A.; Vazquez, F.; Velev, G.; Vellidis, C.; Vidal, M.; Vila, I.; Vilar, R.; Vizan, J.; Vogel, M.; Volpi, G.; Wagner, P.; Wagner, R.L.; Wakisaka, T.; Wallny, R.; Wang, S.M.; Warburton, A.; Waters, D.; Wester, W.C., III; Whiteson, D.; Wicklund, A.B.; Wicklund, E.; Wilbur, S.; Wick, F.; Williams, H.H.; Wilson, J.S.; Wilson, P.; Winer, B.L.; Wittich, P.; Wolbers, S.; Wolfe, H.; Wright, T.; Wu, X.; Wu, Z.; Yamamoto, K.; Yamato, D.; Yang, T.; Yang, U.K.; Yang, Y.C.; Yao, W.M.; Yeh, G.P.; Yi, K.; Yoh, J.; Yorita, K.; Yoshida, T.; Yu, G.B.; Yu, I.; Yu, S.S.; Yun, J.C.; Zanetti, A.; Zeng, Y.; Zhou, C.; Zucchelli, S.

    2013-03-18

    We present a search for new particles in an extension to the standard model that includes a heavy Higgs boson ($H^0$), a lighter charged Higgs boson ($H^\\pm$), and an even-lighter Higgs boson $h^0$, with decays leading to a $W$-boson pair and a bottom-antibottom quark pair in the final state. We use events with exactly one lepton, missing transverse momentum, and at least four jets in data corresponding to an integrated luminosity of 8.7 fb$^{-1}$ collected by the CDF II detector in proton-antiproton collisions at $\\sqrt{s}=1.96$ TeV. We find the data to be consistent with standard model predictions and report the results in terms of a simplified Higgs-cascade-decay model, setting 95% confidence level upper limits on the product of cross-section and branching fraction from 1.3 pb to 15 fb as a function of $H^0$ and $H^\\pm$ masses for $m_h^{0}=126$ GeV$/c^2$.

  3. Measurements of the t$\\bar{t}$ Production Cross Section at √s = 1.96-TeV and Top Mass in the Dielectron Channel

    Energy Technology Data Exchange (ETDEWEB)

    Kozminski, Joseph Francis [Michigan State Univ., East Lansing, MI (United States)

    2005-05-01

    The first measurement of the top-antitop production cross section in proton-antiproton collisions at √s = 1.96 TeV using 243 pb-1 of data collected with the D0 detector at Fermilab is presented. In this analysis, only the dielectron final state is considered. Five events are observed, and 0.93 background events are expected. The measured cross section, after accounting for the expected branching ratio to the dielectron channel, is σt$\\bar{t}$ = 14.9$+9.4\\atop{-7.0}$(stat)$+2.5\\atop{-1.8}${sup +2.5}(syst) ± 1.0 (lumi) pb, which agrees with the predicted cross section for top quarks with a mass of 175 GeV. In addition, a first-pass at a measurement of the top mass using the neutrino-weighting method is presented. This measurement is also performed in the dielectron channel using the five events observed in the cross section measurement.

  4. Association of miR-146a, miR-149, miR-196a2, and miR-499 Polymorphisms with Ossification of the Posterior Longitudinal Ligament of the Cervical Spine.

    Directory of Open Access Journals (Sweden)

    Jae Joon Lim

    Full Text Available Ossification of the posterior longitudinal ligament (OPLL of the spine is considered a multifactorial and polygenic disease. We aimed to investigate the association between four single nucleotide polymorphisms (SNPs of pre-miRNAs [miR-146aC>G (rs2910164, miR-149T>C (rs2292832, miR-196a2T>C (rs11614913, and miR-499A>G (rs3746444] and the risk of cervical OPLL in the Korean population.The genotypic frequencies of these four SNPs were analyzed in 207 OPLL patients and 200 controls by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP assay.For four SNPs in pre-miRNAs, no significant differences were found between OPLL patients and controls. However, subgroup analysis based on OPLL subgroup (continuous: continuous type plus mixed type, segmental: segmental and localized type showed that miR-499GG genotype was associated with an increased risk of segmental type OPLL (adjusted odds ratio = 4.314 with 95% confidence interval: 1.109-16.78. In addition, some allele combinations (C-T-T-G, G-T-T-A, and G-T-C-G of miR-146a/-149/-196a2/-499 and combined genotypes (miR-149TC/miR-196a2TT were associated with increased OPLL risk, whereas the G-T-T-G and G-C-C-G allele combinations were associated with decreased OPLL risk.The results indicate that GG genotype of miR-499 is associated with significantly higher risks of OPLL in the segmental OPLL group. The miR-146a/-149/-196a2/-499 allele combinations may be a genetic risk factor for cervical OPLL in the Korean population.

  5. Monte Carlo Study of the Measurement of the top - anti-top Production Cross-Section in the Muon + Jets Channel with the D0-Detector at s**(1/2) = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Meyer, Jorg Manfred; /Bonn U.

    2004-03-01

    A measurement of the t{bar t} production cross section at {radical}s = 1.96 TeV with the D0 detector using simulated events is performed. The final state containing a muon and jets is examined including all methods of measuring signal efficiencies and the estimation of the background contributions. Especially, the identification efficiency and properties of muons are studied.

  6. Search for Randall-Sundrum gravitons in the dielectron and diphoton final states with 5.4 fb-1 of data from pp̅ collisions at √s=1.96 TeV

    NARCIS (Netherlands)

    Abazov, V.M.; et al., [Unknown; Ancu, L.S.; de Jong, S.J.; Filthaut, F.; Houben, P.; Meijer, M.M.; Svoisky, P.

    2010-01-01

    Using 5.4  fb-1 of integrated luminosity from pp̅ collisions at √s=1.96  TeV collected by the D0 detector at the Fermilab Tevatron Collider, we search for decays of the lightest Kaluza-Klein mode of the graviton in the Randall-Sundrum model to ee and γγ. We set 95% C.L. lower limits on the mass of

  7. Measurement of the D+-meson production cross section at low transverse momentum in p p ¯ collisions at √{s }=1.96 TeV

    Science.gov (United States)

    Aaltonen, T.; Amerio, S.; Amidei, D.; Anastassov, A.; Annovi, A.; Antos, J.; Apollinari, G.; Appel, J. A.; Arisawa, T.; Artikov, A.; Asaadi, J.; Ashmanskas, W.; Auerbach, B.; Aurisano, A.; Azfar, F.; Badgett, W.; Bae, T.; Barbaro-Galtieri, A.; Barnes, V. E.; Barnett, B. A.; Barria, P.; Bartos, P.; Bauce, M.; Bedeschi, F.; Behari, S.; Bellettini, G.; Bellinger, J.; Benjamin, D.; Beretvas, A.; Bhatti, A.; Bland, K. R.; Blumenfeld, B.; Bocci, A.; Bodek, A.; Bortoletto, D.; Boudreau, J.; Boveia, A.; Brigliadori, L.; Bromberg, C.; Brucken, E.; Budagov, J.; Budd, H. S.; Burkett, K.; Busetto, G.; Bussey, P.; Butti, P.; Buzatu, A.; Calamba, A.; Camarda, S.; Campanelli, M.; Canelli, F.; Carls, B.; Carlsmith, D.; Carosi, R.; Carrillo, S.; Casal, B.; Casarsa, M.; Castro, A.; Catastini, P.; Cauz, D.; Cavaliere, V.; Cerri, A.; Cerrito, L.; Chen, Y. C.; Chertok, M.; Chiarelli, G.; Chlachidze, G.; Cho, K.; Chokheli, D.; Clark, A.; Clarke, C.; Convery, M. E.; Conway, J.; Corbo, M.; Cordelli, M.; Cox, C. A.; Cox, D. J.; Cremonesi, M.; Cruz, D.; Cuevas, J.; Culbertson, R.; d'Ascenzo, N.; Datta, M.; de Barbaro, P.; Demortier, L.; Deninno, M.; D'Errico, M.; Devoto, F.; Di Canto, A.; Di Ruzza, B.; Dittmann, J. R.; Donati, S.; D'Onofrio, M.; Dorigo, M.; Driutti, A.; Ebina, K.; Edgar, R.; Erbacher, R.; Errede, S.; Esham, B.; Farrington, S.; Fernández Ramos, J. P.; Field, R.; Flanagan, G.; Forrest, R.; Franklin, M.; Freeman, J. C.; Frisch, H.; Funakoshi, Y.; Galloni, C.; Garfinkel, A. F.; Garosi, P.; Gerberich, H.; Gerchtein, E.; Giagu, S.; Giakoumopoulou, V.; Gibson, K.; Ginsburg, C. M.; Giokaris, N.; Giromini, P.; Glagolev, V.; Glenzinski, D.; Gold, M.; Goldin, D.; Golossanov, A.; Gomez, G.; Gomez-Ceballos, G.; Goncharov, M.; González López, O.; Gorelov, I.; Goshaw, A. T.; Goulianos, K.; Gramellini, E.; Grosso-Pilcher, C.; Guimaraes da Costa, J.; Hahn, S. R.; Han, J. Y.; Happacher, F.; Hara, K.; Hare, M.; Harr, R. F.; Harrington-Taber, T.; Hatakeyama, K.; Hays, C.; Heinrich, J.; Herndon, M.; Hocker, A.; Hong, Z.; Hopkins, W.; Hou, S.; Hughes, R. E.; Husemann, U.; Hussein, M.; Huston, J.; Introzzi, G.; Iori, M.; Ivanov, A.; James, E.; Jang, D.; Jayatilaka, B.; Jeon, E. J.; Jindariani, S.; Jones, M.; Joo, K. K.; Jun, S. Y.; Junk, T. R.; Kambeitz, M.; Kamon, T.; Karchin, P. E.; Kasmi, A.; Kato, Y.; Ketchum, W.; Keung, J.; Kilminster, B.; Kim, D. H.; Kim, H. S.; Kim, J. E.; Kim, M. J.; Kim, S. H.; Kim, S. B.; Kim, Y. J.; Kim, Y. K.; Kimura, N.; Kirby, M.; Kondo, K.; Kong, D. J.; Konigsberg, J.; Kotwal, A. V.; Kreps, M.; Kroll, J.; Kruse, M.; Kuhr, T.; Kurata, M.; Laasanen, A. T.; Lammel, S.; Lancaster, M.; Lannon, K.; Latino, G.; Lee, H. S.; Lee, J. S.; Leo, S.; Leone, S.; Lewis, J. D.; Limosani, A.; Lipeles, E.; Lister, A.; Liu, Q.; Liu, T.; Lockwitz, S.; Loginov, A.; Lucchesi, D.; Lucà, A.; Lueck, J.; Lujan, P.; Lukens, P.; Lungu, G.; Lys, J.; Lysak, R.; Madrak, R.; Maestro, P.; Malik, S.; Manca, G.; Manousakis-Katsikakis, A.; Marchese, L.; Margaroli, F.; Marino, P.; Matera, K.; Mattson, M. E.; Mazzacane, A.; Mazzanti, P.; McNulty, R.; Mehta, A.; Mehtala, P.; Mesropian, C.; Miao, T.; Mietlicki, D.; Mitra, A.; Miyake, H.; Moed, S.; Moggi, N.; Moon, C. S.; Moore, R.; Morello, M. J.; Mukherjee, A.; Muller, Th.; Murat, P.; Mussini, M.; Nachtman, J.; Nagai, Y.; Naganoma, J.; Nakano, I.; Napier, A.; Nett, J.; Nigmanov, T.; Nodulman, L.; Noh, S. Y.; Norniella, O.; Oakes, L.; Oh, S. H.; Oh, Y. D.; Okusawa, T.; Orava, R.; Ortolan, L.; Pagliarone, C.; Palencia, E.; Palni, P.; Papadimitriou, V.; Parker, W.; Pauletta, G.; Paulini, M.; Paus, C.; Phillips, T. J.; Piacentino, G.; Pianori, E.; Pilot, J.; Pitts, K.; Plager, C.; Pondrom, L.; Poprocki, S.; Potamianos, K.; Pranko, A.; Prokoshin, F.; Ptohos, F.; Punzi, G.; Redondo Fernández, I.; Renton, P.; Rescigno, M.; Rimondi, F.; Ristori, L.; Robson, A.; Rodriguez, T.; Rolli, S.; Ronzani, M.; Roser, R.; Rosner, J. L.; Ruffini, F.; Ruiz, A.; Russ, J.; Rusu, V.; Sakumoto, W. K.; Sakurai, Y.; Santi, L.; Sato, K.; Saveliev, V.; Savoy-Navarro, A.; Schlabach, P.; Schmidt, E. E.; Schwarz, T.; Scodellaro, L.; Scuri, F.; Seidel, S.; Seiya, Y.; Semenov, A.; Sforza, F.; Shalhout, S. Z.; Shears, T.; Shepard, P. F.; Shimojima, M.; Shochet, M.; Shreyber-Tecker, I.; Simonenko, A.; Sliwa, K.; Smith, J. R.; Snider, F. D.; Song, H.; Sorin, V.; St. Denis, R.; Stancari, M.; Stentz, D.; Strologas, J.; Sudo, Y.; Sukhanov, A.; Suslov, I.; Takemasa, K.; Takeuchi, Y.; Tang, J.; Tecchio, M.; Teng, P. K.; Thom, J.; Thomson, E.; Thukral, V.; Toback, D.; Tokar, S.; Tollefson, K.; Tomura, T.; Tonelli, D.; Torre, S.; Torretta, D.; Totaro, P.; Trovato, M.; Ukegawa, F.; Uozumi, S.; Vázquez, F.; Velev, G.; Vellidis, C.; Vernieri, C.; Vidal, M.; Vilar, R.; Vizán, J.; Vogel, M.; Volpi, G.; Wagner, P.; Wallny, R.; Wang, S. M.; Waters, D.; Wester, W. C.; Whiteson, D.; Wicklund, A. B.; Wilbur, S.; Williams, H. H.; Wilson, J. S.; Wilson, P.; Winer, B. L.; Wittich, P.; Wolbers, S.; Wolfe, H.; Wright, T.; Wu, X.; Wu, Z.; Yamamoto, K.; Yamato, D.; Yang, T.; Yang, U. K.; Yang, Y. C.; Yao, W.-M.; Yeh, G. P.; Yi, K.; Yoh, J.; Yorita, K.; Yoshida, T.; Yu, G. B.; Yu, I.; Zanetti, A. M.; Zeng, Y.; Zhou, C.; Zucchelli, S.; CDF Collaboration

    2017-05-01

    We report on a measurement of the D+-meson production cross section as a function of transverse momentum (pT) in proton-antiproton (p p ¯) collisions at 1.96 TeV center-of-mass energy, using the full data set collected by the Collider Detector at Fermilab in Tevatron Run II and corresponding to 10 fb-1 of integrated luminosity. We use D+→K-π+π+ decays fully reconstructed in the central rapidity region |y |<1 with transverse momentum down to 1.5 GeV /c , a range previously unexplored in p p ¯ collisions. Inelastic p p ¯-scattering events are selected online using minimally biasing requirements followed by an optimized offline selection. The K-π+π+ mass distribution is used to identify the D+ signal, and the D+ transverse impact-parameter distribution is used to separate prompt production, occurring directly in the hard-scattering process, from secondary production from b -hadron decays. We obtain a prompt D+ signal of 2950 candidates corresponding to a total cross section σ (D+,1.5

  8. Search for Fermiophobic Higgs using the 3γ+X Final State in 1.96-TeV Proton-Antiproton Collisions

    Energy Technology Data Exchange (ETDEWEB)

    Hamaguchi, Atsunari [Osaka Univ. (Japan)

    2012-01-01

    We search for a fermiophobic Higgs boson using 3γ+X events in p$\\bar{p}$ collisions at √ s = 1.96 TeV. In the Standard Model (SM), the Higgs boson is introduced to explain the electroweak symmetry breaking (EWSB) and the origin of fermion masses. The minimal extension of the SM contains an additional Higgs doublet, the “two Higgs doublet model” (2HDM). In this model a fermiophobic Higgs boson (hf) which signifies very suppressed or zero coupling to the fermions, may arise in a paticular version of the 2HDM called type I. The data were collected with the CDF-II detector at the Fermilab Tevatron collider and correspond to an integrated luminosity of 6.0 fb -1. We estimate the fake-photon backgrounds and Direct Triphoton Production(DTP) backgrounds. The expected number of signal events is 17.7 for the fermiophobic higgs of the mass 75 GeV/c2 and H± of the mass 120 GeV/c2. The expected number of backgrounds is 1.9±0.9, From these results, we obtain the expected limits on σ(p$\\bar{p}$ → H±hf ) × Br(H± → W*hf ) × (Br(hf → γγ))2 of 8.0 fb for the fermiophobic Higgs of 75 GeV/c2 and H± of the mass 120 GeV/c2 at the 95% confidence level, while the observed limit is 10 fb.

  9. A measurement of the top quark mass in 1.96 TeV proton-antiproton collisions using a novel matrix element method

    Energy Technology Data Exchange (ETDEWEB)

    Freeman, John C [Univ. of California, Berkeley, CA (United States)

    2007-01-01

    A measurement of the top quark mass in t$\\bar{t}$ → l + jets candidate events, obtained from p$\\bar{p}$ collisions at √s = 1.96 TeV at the Fermilab Tevatron using the CDF II detector, is presented. The measurement approach is that of a matrix element method. For each candidate event, a two dimensional likelihood is calculated in the top pole mass and a constant scale factor, 'JES', where JES multiplies the input particle jet momenta and is designed to account for the systematic uncertainty of the jet momentum reconstruction. As with all matrix elements techniques, the method involves an integration using the Standard Model matrix element for tt production and decay. however, the technique presented is unique in that the matrix element is modified to compensate for kinematic assumptions which are made to reduce computation time. Background events are dealt with through use of an event observable which distinguishes signal from background, as well as through a cut on the value of an event's maximum likelihood. Results are based on a 955 pb-1 data sample, using events with a high-pT lepton and exactly four high-energy jets, at least one of which is tagged as coming from a b quark; 149 events pass all the selection requirements. They find Mmeas = 169.8 ± 2.3(stat.) ± 1.4(syst.) GeV/c2.

  10. Search for Doubly Charged Higgs Boson Pair Production in p(p)over-bar Collisions at root s=1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abazov, V.M.; Abbott, B.; Acharya, B. S.; Adams, M.; Adams, T.; Alexeev, G. D.; Alkhazov, G.; Alton, A.; Alverson, G.; Alves, G. A.; Aoki, M.; Arov, M.; Askew, A.; Asman, B.; Atramentov, O.; Avila, C.; BackusMayes, J.; Badaud, F.; Bagby, L.; Baldin, B.; Bandurin, D. V.; Banerjee, S.; Barberis, E.; Baringer, P.; Barreto, J.; Bartlett, J. F.; Bassler, U.; Bazterra, V.; Beale, S.; Bean, A.; Begalli, M.; Begel, M.; Belanger-Champagne, C.; Bellantoni, L.; Beri, S. B.; Bernardi, G.; Bernhard, R.; Bertram, I.; Besancon, M.; Beuselinck, R.; Bezzubov, V. A.; Bhat, P. C.; Bhatnagar, V.; Blazey, G.; Blessing, S.; Bloom, K.; Boehnlein, A.; Boline, D.; Boos, E. E.; Borissov, G.; Bose, T.; Brandt, A.; Brandt, O.; Brock, R.; Brooijmans, G.; Bross, A.; Brown, D.; Brown, J.; Bu, X. B.; Buehler, M.; Buescher, V.; Bunichev, V.; Burdin, S.; Burnett, T. H.; Buszello, C. P.; Calpas, B.; Camacho-Perez, E.; Carrasco-Lizarraga, M. A.; Casey, B. C. K.; Castilla-Valdez, H.; Chakrabarti, S.; Chakraborty, D.; Chan, K. M.; Chandra, A.; Chen, G.; Chevalier-Thery, S.; Cho, D. K.; Cho, S. W.; Choi, S.; Choudhary, B.; Cihangir, S.; Claes, D.; Clutter, J.; Cooke, M.; Cooper, W. E.; Corcoran, M.; Couderc, F.; Cousinou, M. -C.; Croc, A.; Cutts, D.; Das, A.; Davies, G.; De, K.; de Jong, S. J.; De La Cruz-Burelo, E.; Deliot, F.; Demarteau, M.; Demina, R.; Denisov, D.; Denisov, S. P.; Desai, S.; Deterre, C.; DeVaughan, K.; Diehl, H. T.; Diesburg, M.; Ding, P. F.; Dominguez, A.; Dorland, T.; Dubey, A.; Dudko, L. V.; Duggan, D.; Duperrin, A.; Dutt, S.; Dyshkant, A.; Eads, M.; Edmunds, D.; Ellison, J.; Elvira, V. D.; Enari, Y.; Evans, H.; Evdokimov, A.; Evdokimov, V. N.; Facini, G.; Ferbel, T.; Fiedler, F.; Filthaut, F.; Fisher, W.; Fisk, H. E.; Fortner, M.; Fox, H.; Fuess, S.; Garcia-Bellido, A.; Gavrilov, V.; Gay, P.; Geng, W.; Gerbaudo, D.; Gerber, C. E.; Gershtein, Y.; Ginther, G.; Golovanov, G.; Goussiou, A.; Grannis, P. D.; Greder, S.; Greenlee, H.; Greenwood, Z. D.; Gregores, E. M.; Grenier, G.; Gris, Ph; Grivaz, J. -F.; Grohsjean, A.; Gruenendahl, S.; Gruenewald, M. W.; Guillemin, T.; Guo, F.; Gutierrez, G.; Gutierrez, P.; Haas, A.; Hagopian, S.; Haley, J.; Han, L.; Harder, K.; Harel, A.; Hauptman, J. M.; Hays, J.; Head, T.; Hebbeker, T.; Hedin, D.; Hegab, H.; Heinson, A. P.; Heintz, U.; Hensel, C.; Heredia-De La Cruz, I.; Herner, K.; Hesketh, G.; Hildreth, M. D.; Hirosky, R.; Hoang, T.; Hobbs, J. D.; Hoeneisen, B.; Hohlfeld, M.; Hubacek, Z.; Huske, N.; Hynek, V.; Iashvili, I.; Ilchenko, Y.; Illingworth, R.; Ito, A. S.; Jabeen, S.; Jaffre, M.; Jamin, D.; Jayasinghe, A.; Jesik, R.; Johns, K.; Johnson, M.; Johnston, D.; Jonckheere, A.; Jonsson, P.; Joshi, J.; Jung, A. W.; Juste, A.; Kaadze, K.; Kajfasz, E.; Karmanov, D.; Kasper, P. A.; Katsanos, I.; Kehoe, R.; Kermiche, S.; Khalatyan, N.; Khanov, A.; Kharchilava, A.; Kharzheev, Y. N.; Kirby, M. H.; Kohli, J. M.; Kozelov, A. V.; Kraus, J.; Kulikov, S.; Kumar, A.; Kupco, A.; Kurca, T.; Kuzmin, V. A.; Kvita, J.; Lammers, S.; Landsberg, G.; Lebrun, P.; Lee, H. S.; Lee, S. W.; Lee, W. M.; Lellouch, J.; Li, L.; Li, Q. Z.; Lietti, S. M.; Lim, J. K.; Lincoln, D.; Linnemann, J.; Lipaev, V. V.; Lipton, R.; Liu, Y.; Liu, Z.; Lobodenko, A.; Lokajicek, M.; de Sa, R. Lopes; Lubatti, H. J.; Luna-Garcia, R.; Lyon, A. L.; Maciel, A. K. A.; Mackin, D.; Madar, R.; Magana-Villalba, R.; Malik, S.; Malyshev, V. L.; Maravin, Y.; Martinez-Ortega, J.; McCarthy, R.; McGivern, C. L.; Meijer, M. M.; Melnitchouk, A.; Menezes, D.; Mercadante, P. G.; Merkin, M.; Meyer, A.; Meyer, J.; Miconi, F.; Mondal, N. K.; Muanza, G. S.; Mulhearn, M.; Nagy, E.; Naimuddin, M.; Narain, M.; Nayyar, R.; Neal, H. A.; Negret, J. P.; Neustroev, P.; Novaes, S. F.; Nunnemann, T.; Obrant, G.; Orbaker, D.; Orduna, J.; Osman, N.; Osta, J.; et. al.

    2012-01-10

    We present a search for pair production of doubly-charged Higgs bosons in the processes q{bar q} {yields} H{sup 2+}H{sup 2-} decaying through H{sup {+-}{+-}} {yields} {tau}{sup {+-}}{tau}{sup {+-}}, {mu}{sup {+-}}{tau}{sup {+-}}, {mu}{sup {+-}}{mu}{sup {+-}}. The search is performed in p{bar p} collisions at a center-of-mass energy of {radical}s = 1.96 TeV using an integrated luminosity of up to 7.0 fb{sup -1} collected by the D0 experiment at the Fermilab Tevatron Collider. The results are used to set 95% C.L. limits on the pair production cross section of doubly-charged Higgs bosons and on their mass for different H{sup {+-}{+-}} branching fractions. Models predicting different H{sup {+-}{+-}} decays are investigated. Assuming B(H{sup {+-}{+-}} {yields} {tau}{sup {+-}}{tau}{sup {+-}}) = 1 yields an observed (expected) lower limit on the mass of a left-handed H{sub L}{sup {+-}{+-}} boson of 128 (116) GeV and assuming {Beta}(H{sup {+-}{+-}} {yields} {mu}{sup {+-}}{tau}{sup {+-}}) = 1 the corresponding limits are 144 (149) GeV. In a model with {Beta}(H{sup {+-}{+-}} {yields} {tau}{sup {+-}}{tau}{sup {+-}}) = {Beta}(H{sup {+-}{+-}} {yields} {mu}{sup {+-}}{tau}{sup {+-}}) = {Beta}(H{sup {+-}{+-}} {yields} {mu}{sup {+-}}{mu}{sup {+-}}) = 1/3, we obtain M(H{sub L}{sup {+-}{+-}}) > 130 (138) GeV.

  11. Prognostic value of different cut-off levels of Ki-67 in breast cancer: a systematic review and meta-analysis of 64,196 patients.

    Science.gov (United States)

    Petrelli, Fausto; Viale, G; Cabiddu, M; Barni, S

    2015-10-01

    A proliferative marker, expressed as the percentage of cells in a cell cycle, has been developed and used as a discriminant of more aggressive malignant phenotypes in early breast cancer (BC). The marker is usually expressed by the immunohistochemical staining of the cell cycle antigen Ki-67. It has not, however, yet been definitely evaluated, due to methodological concerns, which specific Ki-67 cut-off provide the strongest prognostic information in resected BC. We conducted a meta-analysis to explore the prognostic value of different cut-off levels of Ki-67 in terms of overall survival (OS) and disease-free survival (DFS) in early BC. The databases of PubMed, the ISI Web of Science, EMBASE, SCOPUS, the Cochrane Central Register of Controlled Trials, and CINHAL were used to identify the relevant literature. Data from studies reporting a hazard ratio (HR) and a 95 % confidence interval (CI) calculated as a multivariate analysis were pooled in a meta-analysis, with metaregression used to test for trends in predefined subgroups. All the statistical tests were 2-sided. Forty-one studies encompassing 64,196 BC patients were included in the analysis. Overall, n = 25 studies were available for the OS analysis. The pooled HR for high versus low Ki-67 was 1.57 (95 % CI 1.33-1.87, P low Ki-67 was 1.50 (95 % CI 1.34-1.69, P cut-off of Ki-67 staining ≥ 25 % was used, the pooled HR for OS was 2.05 (95 % CI 1.66-2.53, P low Ki-67 was similar and significant (HR = 1.51, 95 % CI 1.25-1.81, P cut-off >25 % is associated with a greater risk of death compared with lower expression rates.

  12. A Measurement of the Top Quark Mass in 1.96 TeV Proton-Antiproton Collisions Using a Novel Matrix Element Method

    Energy Technology Data Exchange (ETDEWEB)

    Freeman, John [Univ. of California, Berkeley, CA (United States)

    2007-01-01

    A measurement of the top quark mass in t$\\bar{t}$ → l + jets candidate events, obtained from p$\\bar{p}$ collisions at √s = 1.96 TeV at the Fermilab Tevatron using the CDF II detector, is presented. The measurement approach is that of a matrix element method. For each candidate event, a two dimensional likelihood is calculated in the top pole mass and a constant scale factor, 'JES', where JES multiplies the input particle jet momenta and is designed to account for the systematic uncertainty of the jet momentum reconstruction. As with all matrix element techniques, the method involves an integration using the Standard Model matrix element for t$\\bar{t}$ production and decay. However, the technique presented is unique in that the matrix element is modified to compensate for kinematic assumptions which are made to reduce computation time. Background events are dealt with through use of an event observable which distinguishes signal from background, as well as through a cut on the value of an event's maximum likelihood. Results are based on a 955 pb-1 data sample, using events with a high-pT lepton and exactly four high-energy jets, at least one of which is tagged as coming from a b quark; 149 events pass all the selection requirements. They find Mmeas = 169.8 ± 2.3(stat.) ± 1.4(syst.) GeV/c2.

  13. PO, Box 196, Jimma, Ethiopia

    African Journals Online (AJOL)

    2003-11-01

    Nov 1, 2003 ... enlargement was tuberculous lymph adenities (66.3%), followed by reactive lymph node hyperplasia (19.2%). Among ... for about two-third of lymph node enlargements in South Western parts of this country. .... Lymph node Granulo- Tb adenitis Reactive Pyogenic Non-hodgkin's Hodgkin's Metastatic Total'.

  14. 191 - 196 _Olurukooba et al.,

    African Journals Online (AJOL)

    User

    of the ethyl acetate fraction in mice study showed that the ethyl acetate fra activity. Key words: Acute toxicity, Antiplasmodial,. INTRODUCTION. Malaria is an infectious disease that has contin cause mortality and morbidity in the tropics an tropics (Igweet al., 2012).Malaria is transmit people through the bites of infected female ...

  15. Association of the miR-196a2 C>T and miR-499 A>G polymorphisms with hepatitis B virus-related hepatocellular carcinoma risk: an updated meta-analysis

    Directory of Open Access Journals (Sweden)

    Zhu SL

    2016-04-01

    Full Text Available Shao-Liang Zhu,1,* Jian-Hong Zhong,1,* Wen-Feng Gong,1,* Hang Li,2 Le-Qun Li11Department of Hepatobiliary Surgery, 2Department of Ultrasound, Affiliated Tumor Hospital of Guangxi Medical University, Nanning, People’s Republic of China*These authors contributed equally to this workBackground: This study meta-analyzed data on the possible association of the miR-196a2 C>T (rs11614913 and miR-499 A>G (rs3746444 polymorphisms with risk of hepatitis B virus (HBV-related hepatocellular carcinoma (HCC.Methods: Databases in PubMed, EMBASE, Web of Science, China BioMedicine, and Google Scholar were systematically searched to identify relevant studies. Meta-analyses were performed to examine the association of the miR-196a2 C>T and miR-499 A>G polymorphisms with HBV-related HCC risk. Odds ratios (ORs and 95% confidence intervals (95% CIs were calculated.Results: A total of 13 studies involving 3,964 cases and 5,875 healthy controls were included. Random-effect meta-analysis showed that the T allele and TT genotype of miR-196a2 C>T were associated with significantly lower HBV-related HCC risk (allelic model, OR =0.84, 95% CI =0.71–0.99, P=0.04; homozygous model, OR =0.68, 95% CI =0.47–0.98, P=0.04. In contrast, miR-499 A>G showed no significant association with HBV-related HCC risk in either overall pooled analysis or ethnic subgroup analysis according to any of the four genetic models. Based on analysis of ethnic subgroups, neither miR-196a2 C>T nor miR-499 A>G was significantly associated with risk of HBV-related HCC in Chinese population.Conclusion: The polymorphism miR-196a2 C>T, but not miR-499 A>G, may be associated with decreased HBV-related HCC risk. These conclusions should be verified in large, well-designed studies.Keywords: microRNA, single nucleotide polymorphisms, hepatitis B virus related, meta-analysis, hepatocellular carcinoma

  16. Mass and lifetime measurements of bottom and charm baryons in pp ¯ collisions at √s =1.96 TeV

    Science.gov (United States)

    Aaltonen, T.; Amerio, S.; Amidei, D.; Anastassov, A.; Annovi, A.; Antos, J.; Apollinari, G.; Appel, J. A.; Arisawa, T.; Artikov, A.; Asaadi, J.; Ashmanskas, W.; Auerbach, B.; Aurisano, A.; Azfar, F.; Badgett, W.; Bae, T.; Barbaro-Galtieri, A.; Barnes, V. E.; Barnett, B. A.; Barria, P.; Bartos, P.; Bauce, M.; Bedeschi, F.; Behari, S.; Bellettini, G.; Bellinger, J.; Benjamin, D.; Beretvas, A.; Bhatti, A.; Bland, K. R.; Blumenfeld, B.; Bocci, A.; Bodek, A.; Bortoletto, D.; Boudreau, J.; Boveia, A.; Brigliadori, L.; Bromberg, C.; Brucken, E.; Budagov, J.; Budd, H. S.; Burkett, K.; Busetto, G.; Bussey, P.; Butti, P.; Buzatu, A.; Calamba, A.; Camarda, S.; Campanelli, M.; Canelli, F.; Carls, B.; Carlsmith, D.; Carosi, R.; Carrillo, S.; Casal, B.; Casarsa, M.; Castro, A.; Catastini, P.; Cauz, D.; Cavaliere, V.; Cavalli-Sforza, M.; Cerri, A.; Cerrito, L.; Chen, Y. C.; Chertok, M.; Chiarelli, G.; Chlachidze, G.; Cho, K.; Chokheli, D.; Clark, A.; Clarke, C.; Convery, M. E.; Conway, J.; Corbo, M.; Cordelli, M.; Cox, C. A.; Cox, D. J.; Cremonesi, M.; Cruz, D.; Cuevas, J.; Culbertson, R.; d'Ascenzo, N.; Datta, M.; de Barbaro, P.; Demortier, L.; Deninno, M.; D'Errico, M.; Devoto, F.; Di Canto, A.; Di Ruzza, B.; Dittmann, J. R.; Donati, S.; D'Onofrio, M.; Dorigo, M.; Driutti, A.; Ebina, K.; Edgar, R.; Elagin, A.; Erbacher, R.; Errede, S.; Esham, B.; Farrington, S.; Fernández Ramos, J. P.; Field, R.; Flanagan, G.; Forrest, R.; Franklin, M.; Freeman, J. C.; Frisch, H.; Funakoshi, Y.; Galloni, C.; Garfinkel, A. F.; Garosi, P.; Gerberich, H.; Gerchtein, E.; Giagu, S.; Giakoumopoulou, V.; Gibson, K.; Ginsburg, C. M.; Giokaris, N.; Giromini, P.; Giurgiu, G.; Glagolev, V.; Glenzinski, D.; Gold, M.; Goldin, D.; Golossanov, A.; Gomez, G.; Gomez-Ceballos, G.; Goncharov, M.; González López, O.; Gorelov, I.; Goshaw, A. T.; Goulianos, K.; Gramellini, E.; Grinstein, S.; Grosso-Pilcher, C.; Group, R. C.; Guimaraes da Costa, J.; Hahn, S. R.; Han, J. Y.; Happacher, F.; Hara, K.; Hare, M.; Harr, R. F.; Harrington-Taber, T.; Hatakeyama, K.; Hays, C.; Heinrich, J.; Herndon, M.; Hocker, A.; Hong, Z.; Hopkins, W.; Hou, S.; Hughes, R. E.; Husemann, U.; Hussein, M.; Huston, J.; Introzzi, G.; Iori, M.; Ivanov, A.; James, E.; Jang, D.; Jayatilaka, B.; Jeon, E. J.; Jindariani, S.; Jones, M.; Joo, K. K.; Jun, S. Y.; Junk, T. R.; Kambeitz, M.; Kamon, T.; Karchin, P. E.; Kasmi, A.; Kato, Y.; Ketchum, W.; Keung, J.; Kilminster, B.; Kim, D. H.; Kim, H. S.; Kim, J. E.; Kim, M. J.; Kim, S. H.; Kim, S. B.; Kim, Y. J.; Kim, Y. K.; Kimura, N.; Kirby, M.; Knoepfel, K.; Kondo, K.; Kong, D. J.; Konigsberg, J.; Kotwal, A. V.; Kreps, M.; Kroll, J.; Kruse, M.; Kuhr, T.; Kurata, M.; Laasanen, A. T.; Lammel, S.; Lancaster, M.; Lannon, K.; Latino, G.; Lee, H. S.; Lee, J. S.; Leo, S.; Leone, S.; Lewis, J. D.; Limosani, A.; Lipeles, E.; Lister, A.; Liu, H.; Liu, Q.; Liu, T.; Lockwitz, S.; Loginov, A.; Lucchesi, D.; Lucà, A.; Lueck, J.; Lujan, P.; Lukens, P.; Lungu, G.; Lys, J.; Lysak, R.; Madrak, R.; Maestro, P.; Malik, S.; Manca, G.; Manousakis-Katsikakis, A.; Marchese, L.; Margaroli, F.; Marino, P.; Martínez, M.; Matera, K.; Mattson, M. E.; Mazzacane, A.; Mazzanti, P.; McNulty, R.; Mehta, A.; Mehtala, P.; Mesropian, C.; Miao, T.; Mietlicki, D.; Mitra, A.; Miyake, H.; Moed, S.; Moggi, N.; Moon, C. S.; Moore, R.; Morello, M. J.; Mukherjee, A.; Muller, Th.; Murat, P.; Mussini, M.; Nachtman, J.; Nagai, Y.; Naganoma, J.; Nakano, I.; Napier, A.; Nett, J.; Neu, C.; Nigmanov, T.; Nodulman, L.; Noh, S. Y.; Norniella, O.; Oakes, L.; Oh, S. H.; Oh, Y. D.; Oksuzian, I.; Okusawa, T.; Orava, R.; Ortolan, L.; Pagliarone, C.; Palencia, E.; Palni, P.; Papadimitriou, V.; Parker, W.; Pauletta, G.; Paulini, M.; Paus, C.; Phillips, T. J.; Piacentino, G.; Pianori, E.; Pilot, J.; Pitts, K.; Plager, C.; Pondrom, L.; Poprocki, S.; Potamianos, K.; Pranko, A.; Prokoshin, F.; Ptohos, F.; Punzi, G.; Ranjan, N.; Redondo Fernández, I.; Renton, P.; Rescigno, M.; Rimondi, F.; Ristori, L.; Robson, A.; Rodriguez, T.; Rolli, S.; Ronzani, M.; Roser, R.; Rosner, J. L.; Ruffini, F.; Ruiz, A.; Russ, J.; Rusu, V.; Sakumoto, W. K.; Sakurai, Y.; Santi, L.; Sato, K.; Saveliev, V.; Savoy-Navarro, A.; Schlabach, P.; Schmidt, E. E.; Schwarz, T.; Scodellaro, L.; Scuri, F.; Seidel, S.; Seiya, Y.; Semenov, A.; Sforza, F.; Shalhout, S. Z.; Shears, T.; Shepard, P. F.; Shimojima, M.; Shochet, M.; Shreyber-Tecker, I.; Simonenko, A.; Sliwa, K.; Smith, J. R.; Snider, F. D.; Song, H.; Sorin, V.; St. Denis, R.; Stancari, M.; Stentz, D.; Strologas, J.; Sudo, Y.; Sukhanov, A.; Suslov, I.; Takemasa, K.; Takeuchi, Y.; Tang, J.; Tecchio, M.; Teng, P. K.; Thom, J.; Thomson, E.; Thukral, V.; Toback, D.; Tokar, S.; Tollefson, K.; Tomura, T.; Tonelli, D.; Torre, S.; Torretta, D.; Totaro, P.; Trovato, M.; Ukegawa, F.; Uozumi, S.; Velev, G.; Vellidis, C.; Vernieri, C.; Vidal, M.; Vilar, R.; Vizán, J.; Vogel, M.; Volpi, G.; Vázquez, F.; Wagner, P.; Wallny, R.; Wang, S. M.; Waters, D.; Wester, W. C.; Whiteson, D.; Wicklund, A. B.; Wilbur, S.; Williams, H. H.; Wilson, J. S.; Wilson, P.; Winer, B. L.; Wittich, P.; Wolbers, S.; Wolfe, H.; Wright, T.; Wu, X.; Wu, Z.; Yamamoto, K.; Yamato, D.; Yang, T.; Yang, U. K.; Yang, Y. C.; Yao, W.-M.; Yeh, G. P.; Yi, K.; Yoh, J.; Yorita, K.; Yoshida, T.; Yu, G. B.; Yu, I.; Zanetti, A. M.; Zeng, Y.; Zhou, C.; Zucchelli, S.; CDF Collaboration

    2014-04-01

    We report on mass and lifetime measurements of several ground state charmed and bottom baryons, using a data sample corresponding to 9.6 fb-1 from pp ¯ collisions at √s =1.96 TeV and recorded with the Collider Detector at Fermilab. Baryon candidates are reconstructed from data collected with an online event selection designed for the collection of long-lifetime heavy-flavor decay products and a second event selection designed to collect J/ψ→ μ+μ- candidates. First evidence for the process Ωb-→Ωc0π- is presented with a significance of 3.3σ. We measure the following baryon masses: M(Ξc0) =2470.85±0.24(stat)±0.55(syst) MeV/c2,M(Ξc+)=2468.00±0.18(stat)±0.51(syst) MeV/c2,M(Λb)=5620.15±0.31(stat)±0.47(syst) MeV/c2,M(Ξb-)=5793.4±1.8(stat)±0.7(syst) MeV/c2,M(Ξb0)=5788.7±4.3(stat)±1.4(syst) MeV/c2,andM(Ωb-)=6047.5±3.8(stat)±0.6(syst) MeV/c2. The isospin splitting of the Ξb-,0 states is found to be M(Ξb-)-M(Ξb0)=4.7±4.7(stat)±0.7(syst) MeV /c2. The isospin splitting of the Ξc0,+ states is found to be M(Ξc0)-M(Ξc+)=2.85±0.30(stat)±0.04(syst) MeV /c2. The following lifetime measurements are made: τ(Λb)=1.565±0.035(stat)±0.020(syst) ps ,τ(Ξb-)=1.32±0.14(stat)±0.02(syst) ps ,τ(Ωb-)=1.66-0.40+0.53(stat)±0.02(syst) ps

  17. Measurement of top anti-top cross section in proton - anti-proton collider at √s = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Mal, Prolay Kumar [Tata Inst. of Fundamental Research, Bombay (India)

    2005-04-01

    Discovery of the top quark in 1995 at the Fermilab Tevatron collider concluded a long search following the 1977 discovery of bottom (b) quark [1] and represents another triumph of the Standard Model (SM) of elementary particles. Top quark is one of the fundamental fermions in the Standard Model of electroweak interactions and is the weak-isospin partner of the bottom quark. A precise measurement of top pair production cross-section would be a test of Quantum Chromodynamics (QCD) prediction. Presently, Tevatron is the world's highest energy collider where protons (p) and anti-protons ($\\bar{p}$) collide at a centre of mass energy √s of 1.96 TeV. At Tevatron top (t) and anti-top ($\\bar{t}$) quarks are predominantly pair produced through strong interactions--quark annihilation (≅ 85%) and gluon fusion (≅ 15%). Due to the large mass of top quark, t or $\\bar{t}$ decays (~ 10-25 sec) before hadronization and in SM framework, it decays to a W boson and a b quark with ~ 100% branching ratio (BR). The subsequent decay of W boson determines the major signatures of t$\\bar{t}$ decay. If both W bosons (coming from t and $\\bar{t}$ decays) decay into leptons (viz., eve, μvμ or τcτ) the corresponding t$\\bar{t}$ decay is called dileptonic decay. Of all dileptonic decay modes of t$\\bar{t}$, the t$\\bar{t}$ → WWb$\\bar{b}$ → eveμvμb$\\bar{b}$ (eμ channel) decay mode has the smallest background contamination from Z0 production or Drell-Yan process; simultaneously, it has the highest BR (~ 3.16%) [2] amongst all dileptonic decay modes of t$\\bar{t}$. During Run I (1992-1996) of Tevatron, three eμ candidate events were detected by D0 experiment, out of 80 candidate events (inclusive of all decay modes of t$\\bar{t}$). Due to the rarity of the t$\\bar{t}$ events, the measured cross-section has large uncertainty in its value (viz., 5.69 ± 1.21(stat) ± 1.04(sys) pb {at} √s = 1

  18. Measurement of W + γ Production in the W to Muon Decay Channel in Proton - Anti-proton Collisions at √s = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Tanimoto, Naho [Okayama Univ. (Japan)

    2005-03-01

    The production cross section and the kinematic properties of the decay products of Wγ in the W → μv decay channel from p$\\bar{p}$ collisions at √s = 1.96 TeV are presented. The measurement use the high pT muon data from the upgraded Collider Detector at Fermilab (CDF). The data were collected between March 2002 and September 2003. The total integrated luminosities are 192 pb-1 with the muon detector which covers the pseudorapidity region of |η| ≤ 0.6 and 175 pb-1 with the muon detector covering the region 0.6 ≤ |η| ≤ 1.0. In the Standard Model the μvγ final states occur due to Wγ → μvγ production and via muon Bremsstrahlung, W → μv → μvγ. W bosons are selected in their muon decay mode. Additionally, photons with transverse energy above 7 GeV, pseudorapidity in the central region (|η| < 1.1) and muon-photon angular separation ΔR(μ,γ) > 0.7 are selected. The author observes a total of 128 Wγ candidates, whereas the Standard Model expectation is 142.4 ± 9.5 events. The Wγ production cross section is found to be σ(p$\\bar{p}$ → μvγ) = 16.3 ± 2.3(stat.) ± 1.8(syst.) ± 1.2(lum.) [pb]. The theoretical prediction for this cross section is σ(p$\\bar{p}$ → lvγ) = 19.3 ± 1.4(th.) [pb]. The Standard Model predictions for several kinematic + variables are compared with data for ETγ > 7 GeV and ΔR(μ,γ) > 0.7. The measured cross section and the photon and W boson production kinematics are found to agree with the Standard Model predictions.

  19. Measurement of the Cross Section for Production of Prompt Diphoton in proton anti-proton Collisions at √s = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Yan-wen [Univ. of Geneva (Switzerland)

    2004-01-01

    This thesis presents the measurement of prompt diphoton production rate in proton-antiproton collisions at a center-of-mass energy of 1.96 TeV using the upgraded Collider Detector at Fermilab (CDF II). This process deserves some attention for the following reasons. The H → γγ decay mode is an important channel for the Standard Model (SM) Higgs boson searches in the low mass region (MH < 130 GeV) at the forth coming LHC. In many models involving physics beyond the SM, cascade decays of heavy new particles generate a γγ signature. Some examples are supersymmetry with a light gravitino, radiative decays to a higgsino-LSP and models with large symmetry groups. The QCD production of prompt photon pairs with large invariant mass is the irreducible background to these searches. The rate is huge and requires to be quantitatively evaluated prior to any of the possible discoveries. In a hadronic collider environment such as LHC, prompt photon signals are contaminated by the production of neutral mesons which decay to multiple collinear photons. The experience of classifying background of neutral meson is very important. The process can be used to test the Next-to-Leading Order (NLO) calculation of Quantum Chromodynamics (QCD). The 4-momentum of particles in the di-photon final state can be precisely determined due to the fine energy resolution of the electromagnetic calorimeters. The imbalance in the transverse momentum of the two photons reflects the transverse motion of the colliding partons. At collider energies, most of the transverse momentum of the incoming partons can be attributed to multiple soft gluon emissions prior to the collision, of which the effect to di-photon production can be resummed by Collins-Soper-Sterman (CSS) formalism. The Tevatron data can be used to test the resummation formalisms. They have used 207 pb-1 of data collected by CDF II detector during the February 2002 to September 2003 running period to study the diphoton

  20. Search for W' →> t$\\bar{b}$ in p$\\bar{p}$Collisions at √(s)=1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Cully, James Clark [Univ. of Michigan, Ann Arbor, MI (United States)

    2009-01-01

    We present a search for a narrow resonance in the t$\\bar{b}$ mass spectrum using 1.9 fb-1 of p$\\bar{p}$ collisions at √s = 1.96 TeV recorded with the CDF II detector at the Fermilab Tevatron. We select events with a lepton, neutrino candidate, and two or three jets from which to construct the t$\\bar{b}$ mass. We quantify the result using the model of a massive Standard Model-like charged-boson (W') decaying to t$\\bar{b}$, but we are generally sensitive to the presence of any narrow state decaying to the third generation. For a purely right-handed W' with Standard Model couplings, we set a new limit at 95% confidence of σ(p$\\bar{p}$ → W'R) x BR(W'R → t$\\bar{b}$) < 0.28 pb and MW'R > 800 GeV/c2. The limit increases to MW'R > 825 GeV/c2 if decay to right-handed neutrinos is forbidden. These results are shown in Table 7 and plotted in Figure 7.1. The best prior search found MW' Ge 768 GeV/c2 if leptonic decays are forbidden [16]. For a simple W' model with effective coupling gW', the cross-section is proportional to gW'4. Relaxing the assumption of the universal weak coupling (gW' = gW), our cross-section limits can be rewritten as upper limits on gW', as a function of MW'. This is relevant to both the right-handed W' model as well as a left-handed W' model in which the W'L-W interference is negligible. The excluded region of the gW'-MW' plane is shown in Figure 7.2, with gW' in units of gW. At MW' = 300 GeV/c2, we limit (95% C.L.) the effective coupling to be less than 0.40 of the standard weak coupling.

  1. Search for Higgs Boson Production in Association with a W Boson in 1.96-TeV Proton - Antiproton Collisions

    Energy Technology Data Exchange (ETDEWEB)

    Masubuchi, Tatusya [Univ. of Tsukuba (Japan)

    2008-02-01

    We have searched for the Standard Model Higgs boson production in association with a W± boson. This search is based on the data collected between February 2002 and May 2007, corresponding to an integrated luminosity of 1.9 fb-1 collected by the Collider Detector at Fermilab (CDF) at the Tevatron which is a p$\\bar{p}$ collider at a center of mass energy 1.96 TeV. W+Higgs channel is one of the most promising channels for the Higgs search at Tevatron in the low Higgs mass region (mH < 135 GeV/c2), where Higgs boson decays into b$\\bar{b}$ dominantly. The detection of lepton from the W boson decay makes the W+Higgs events much cleaner than the direct Higgs production events which have the largest production cross section. Experimentally we select events with a high pT lepton, high missing transverse energy and two b-quark jets. This signature is same as for the W+jets background which has a huge cross section. To reduce the W+jets background, b-jet identification algorithms are applied to at least one jet. The expected signal events in 1.9fb-1 are 1.82 ± 0.15 and 1.68 ± 0.20 for one b-tagged events and two b-tagged events, respectively. The observed data is 805 for one b-tagged events and 173 for two b-tagged events. They are consistent with the Standard Model background expectation. After selecting the events, Neural Network (NN) discriminant technique is performed to distinguish the signal events from still residual backgrounds. We see no evidence for a Higgs signal in the dijet mass distribution and in the NN output distribution. We set a 95% confidence level upper limit on the W+Higgs production cross section times the branching ratio of the Higgs decaying into a b$\\bar{b}$ pair. We obtained σ(p$\\bar{p}$ → W±H) x BR(H → b$\\bar{b}$) < 1.4 to 0.9 pb for Higgs masses from 110 GeV/c2 to 150 GeV/c2 using the NN output distribution. The limits are about 10

  2. A Measurement of Z Boson Production and Rapidity Distribution in Proton-Antiproton Collisions at √s = 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Robson, Aidan [Univ. of Oxford (United Kingdom). Particle Physics Dept.

    2004-12-25

    High-precision measurements are made of Z boson production in proton-antiproton collisions at √s = 1.96 TeV recorded by the Collider Detector at Fermilab, using the electron decay channel. The cross-section times branching ratio is measured to be σZ · Br(Z → e+e-) = (255.7 ± 2.4stat ± 5.2sys ± 15.2lum)pb in a dataset of 194 pb-1 collected between March 2002 and June 2003. This agrees well with theoretical predictions. The cross-section for W boson production in the electron channel has also been measured in the subset of this dataset of 72 pb-1 collected up until January 2003. Using this smaller dataset the ratio of cross-sections is determined to be R ≡ σW · Br(W → eν)/σZ · Br(Z → ee) = 10.82 ± 0.18stat ± 0.16sys. Combining these results with measurements made in the muon channel gives R = 10.92 ± 0.15stat ± 0.14sys (e + μ channels), from which the branching ratio of the W to electrons and muons, and the total width of the W, have been extracted: Br(W → lν) = 0.1089 ± 0.0022 (l = e,μ); Γ(W) = 2078.8 ± 41.4 MeV, which are in good agreement with the Standard Model values and with other measurements. The CKM quark mixing matrix element |Vcs| has been extracted: |Vcs| = 0.967 ± 0.030. The rapidity distribution dσ/dy for Z → ee has also been measured over close to the full kinematic range using 194 pb-1 of data, and is found to be in good agreement with the NNLO prediction.

  3. Search for Higgs Boson Production in Association with the W boson in 1.96-TeV Proton-Antiproton Collisions

    Energy Technology Data Exchange (ETDEWEB)

    Ishizawa, Yoshio [Univ. of Tsukuba (Japan)

    2005-09-01

    A search for the Standard Model Higgs boson was carried out in WH → ℓvb$\\bar{b}$ process in p$\\bar{p}$ collisions at a center of mass energy of 1.96 TeV, where W, H, ℓ, v, b and p denote either a W+ or W- boson, Higgs boson, lepton (electron or muon), neutrino, bottom quark and proton, respectively. The data were collected with the Collider Detector at Fermilab from February 2002 to August 2004. The corresponding integrated luminosity is 319 pb-1. We select events containing a single high-pT electron or muon, a large imbalance of the total transverse energy from a neutrino and two b quark jets. The main backgrounds are the W + light flavor/gluon jets and W + heavy flavor jets processes. Requiring the secondary vertex b-tagging enables us to reject the W + light flavor/gluon jets events effectively. After all event selections, they observe 187 events which is in agreement with the Standard Model background expectation of 175.2 ± 26.3 events, and there is no significant excess originating from the Higgs boson in the reconstructed dijet invariant mass distribution. They thus set a 95% confidence level upper limit on the production cross section times branching ratio decaying into bb, σ(p$\\bar{p}$ → W H) x Br(H → b$\\bar{b}$). The detection efficiency for the W H events, which is necessary for calculating the upper limit, is determined by the Monte Carlo except for the lepton identification efficiency, the lepton trigger efficiency and the b-tagging efficiency which are estimated from the CDF real data. The resultant 95% confidence level upper limits are 10.0 pb to 2.8 pb using at least one b-tagging method and 9.7 pb to 6.6 pb using double b-tagging method for the Higgs boson mass region 110 GeV/c2 to 150 GeV/c2, where the Standard Model prediction is approximately one or two order of magnitude lower than the results.

  4. Diffractive processes in antiproton-proton collision at √s = 1.96 TeV in the D0 experiment

    Energy Technology Data Exchange (ETDEWEB)

    Otec, Roman [Czech Technical Univ., Prague (Czech Republic)

    2006-01-01

    A first study of single diffractive central high-pT dijet events in p$\\bar{p}$ collisions at center-of-mass energy √s = 1.96 TeV is presented, using data recorded by the D0 detector at the Tevatron during RunIIa in 2002-2004. The total integrated luminosity corresponding to the data sample is 398 pb-1. A diffractive sample is selected using a rapidity gap approach. A precise definition of the rapidity gap constitutes the first part of the thesis. The rapidity gap is defined by means of two parts of the D0 detector--luminosity detectors and calorimeter. Luminosity detectors serve as a basic indicators of diffractive candidates and the calorimeter is used to confirm the low energy activity in the forward region (a rapidity gap). Presented studies of energy deposited in forward part of calorimeter by various types of events yield two rapidity gap definitions. Both of them use a fixed rapidity interval in calorimeter |η| ϵ [2.6,5.2] and introduce an upper limit on the energy deposited in this region. First definition, which corresponds to the lowest systematical errors, uses a limit of 10 GeV, an energy limit in the second definition is set to 3 GeV. This alternative definition corresponds to the lowest contamination of diffractive sample by non-diffractive events, on the other hand it is accompanied with rejection of high percentage of diffractive candidates. Using the gap definition dijet diffractive data are then selected and compared to inclusive dijet events in various distributions. The main focus is to measure the difference in azimuthal angles between two leading jets in events with at least two high pt central jets. This variable is sensitive to the dynamics of the process. Indeed, the results show the different behavior of ΔΦ distributions between the inclusive and diffractive samples. It is also shown that this difference is bigger for lower pT jets. Other distributions presented in the thesis show that most

  5. Measurement of the inclusive jet cross section in proton-antiproton collisions at the center-of-mass energy of 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Voutilainen, Mikko Antero [Univ. of Helsinki (Finland)

    2008-07-01

    This thesis studies the high-energy collisions of protons and antiprotons. The data used in the measurement were collected during 2004-2005 with the D0 detector at the Tevatron Collider of the Fermi National Accelerator Laboratory and correspond to 0.7 fb-1 of integrated luminosity. High energy hadron collisions usually produce collimated sprays of particles called jets. The energy of the jets is measured using a liquid Argon-Uranium calorimeter and the production angle is determined with the help of silicon microstrip and scintillating fiber trackers. The inclusive jet cross section in proton-antiproton collisions is measured as a function of jet transverse momentum pT in six bins of jet rapidity at the center-of-mass energy √s = 1.96 TeV. The measurement covers jet transerve momenta from 50 GeV up to 600 GeV and jet rapidities up to |y| = 2.4. The data are collected using a set of seven single jet triggers. Event and jet cuts are applied to remove non-physical backgrounds and cosmic-ray interactions. The data are corrected for jet energy calibration, cut and trigger efficiencies and finite jet pT resolution. The corrections are determined from data and the methods are tested with Monte Carlo simulation. The main experimental challenges in the measurement are the calibration of jet energies and the determination of the jet pT resolution. New methods are developed for the jet energy calibration that take into account physical differences between the {gamma}+jet and dijet calibration samples arising from quark and gluon jet differences. The uncertainty correlations are studied and provided as a set of uncertainty sources. The production of particle jets in hadron collisions is described by the theory of quantum chromodynamics (QCD). When the transverse jet momentum is large, the contributions from long-distance physics processes are small and the production rates of jets can be predicted by perturbative QCD. The

  6. Characterization of Vadose Zone Sediments Below the T Tank Farm: Boreholes C4104, C4105, 299-W10-196 and RCRA Borehole 299-W11-39

    Energy Technology Data Exchange (ETDEWEB)

    Serne, R JEFFREY.; Bjornstad, Bruce N.; Horton, Duane G.; Lanigan, David C.; Lindenmeier, Clark W.; Lindberg, Michael J.; Clayton, Ray E.; LeGore, Virginia L.; Geiszler, Keith N.; Baum, Steven R.; Valenta, Michelle M.; Kutnyakov, Igor V.; Vickerman, Tanya S.; Orr, Robert D.; Brown, Christopher F.

    2004-09-01

    This report contains geologic, geochemical, and physical characterization data collected on sediment recovered from boreholes C4104 and C4105 in the T Tank Farm, and 299-W-11-39 installed northeast of the T Tank Farm. The measurements on sediments from borehole C4104 are compared to a nearby borehole 299-W10-196 placed through the plume from the 1973 T-106 tank leak. This report also presents the data in the context of sediment types, the vertical extent of contamination, the migration potential of the contaminants, and the likely source of the contamination in the vadose zone and groundwater below the T Tank Farm. Sediment samples were characterized for: moisture content, gamma-emission radionuclides, one-to-one water extracts (which provide soil pH, electrical conductivity, cation, trace metal, radionuclide and anion data), total carbon and inorganic carbon content, and 8 M nitric acid extracts (which provide a measure of the total leachable sediment content of contaminants). Overall, our analyses showed that common ion exchange is a key mechanism that influences the distribution of contaminants within that portion of the vadose zone affected by tank liquor. We observed slight elevated pH values in samples from borehole C4104. The sediments from the three boreholes, C4104, C4105, and 299-W10-196 do show that sodium-, nitrate-, and sulfate-dominated fluids are present below tank T-106 and have formed a salt plume. The fluids are more dilute than tank fluids observed below tanks at the SX and BX Tank Farms and slightly less than those from the most saline porewater found in contaminated TX tank farm sediments. The boreholes could not penetrate below the gravel-rich strata of the Ringold Formation Wooded Island member (Rwi) (refusal was met at about 130 ft bgs); therefore, we could not identify the maximum vertical penetration of the tank related plumes. The moisture content, pH, electrical conductivity, nitrate, and technetium-99 profiles versus depth in the three

  7. Measurement of $WZ$ production and searches for anomalous top quark decays and Higgs boson production using tri-lepton final states in $p\\bar{p}$ collisions at $\\sqrt{s} = 1.96~\\rm{TeV}$

    Energy Technology Data Exchange (ETDEWEB)

    McGivern, Carrie Lynne [Univ. of Kansas, Lawrence, KS (United States)

    2012-01-01

    We present the results of three analyses; a $WZ$ production cross section measurement, a search for new physics in anomalous top quark decays, and the search for the standard model Higgs boson, all with final states of three or more leptons -- either electrons or muons -- plus an imbalance of transverse momentum using Tevatron proton and anti-proton collisions at a center--of--mass energy of $\\sqrt{s}$ = 1.96 TeV with the D0 detector at the Fermi National Accelerator Laboratory in Chicago, IL. The first analysis reports a measurement of the $WZ \\rightarrow \\ell^{\\prime}\

  8. Search for neutral Higgs bosons of the minimal supersymmetric standard model decaying to tau pairs in pp collisions at square root of s = 1.96 TeV.

    Science.gov (United States)

    Abulencia, A; Acosta, D; Adelman, J; Affolder, T; Akimoto, T; Albrow, M G; Ambrose, D; Amerio, S; Amidei, D; Anastassov, A; Anikeev, K; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Arguin, J-F; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Azfar, F; Azzi-Bacchetta, P; Azzurri, P; Bacchetta, N; Bachacou, H; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Baroiant, S; Bartsch, V; Bauer, G; Bedeschi, F; Behari, S; Belforte, S; Bellettini, G; Bellinger, J; Belloni, A; Ben-Haim, E; Benjamin, D; Beretvas, A; Beringer, J; Berry, T; Bhatti, A; Binkley, M; Bisello, D; Bishai, M; Blair, R E; Blocker, C; Bloom, K; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bolla, G; Bolshov, A; Bortoletto, D; Boudreau, J; Bourov, S; Boveia, A; Brau, B; Bromberg, C; Brubaker, E; Budagov, J; Budd, H S; Budd, S; Burkett, K; Busetto, G; Bussey, P; Byrum, K L; Cabrera, S; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carlsmith, D; Carosi, R; Carron, S; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chapman, J; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, I; Cho, K; Chokheli, D; Chou, J P; Chu, P H; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Ciljak, M; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Coca, M; Connolly, A; Convery, M E; Conway, J; Cooper, B; Copic, K; Cordelli, M; Cortiana, G; Cruz, A; Cuevas, J; Culbertson, R; Cyr, D; Daronco, S; D'Auria, S; D'onofrio, M; Dagenhart, D; de Barbaro, P; De Cecco, S; Deisher, A; De Lentdecker, G; Dell'Orso, M; Demers, S; Demortier, L; Deng, J; Deninno, M; De Pedis, D; Derwent, P F; Dionisi, C; Dittmann, J; Dituro, P; Dörr, C; Dominguez, A; Donati, S; Donega, M; Dong, P; Donini, J; Dorigo, T; Dube, S; Ebina, K; Efron, J; Ehlers, J; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, I; Fedorko, W T; Feild, R G; Feindt, M; Fernandez, J P; Field, R; Flanagan, G; Flores-Castillo, L R; Foland, A; Forrester, S; Foster, G W; Franklin, M; Freeman, J C; Fujii, Y; Furic, I; Gajjar, A; Gallinaro, M; Galyardt, J; Garcia, J E; Garcia Sciveres, M; Garfinkel, A F; Gay, C; Gerberich, H; Gerchtein, E; Gerdes, D; Giagu, S; Giannetti, P; Gibson, A; Gibson, K; Ginsburg, C; Giolo, K; Giordani, M; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Goldstein, J; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Gotra, Y; Goulianos, K; Gresele, A; Griffiths, M; Grinstein, S; Grosso-Pilcher, C; Grundler, U; Guimaraes da Costa, J; Haber, C; Hahn, S R; Hahn, K; Halkiadakis, E; Hamilton, A; Han, B-Y; Handler, R; Happacher, F; Hara, K; Hare, M; Harper, S; Harr, R F; Harris, R M; Hatakeyama, K; Hauser, J; Hays, C; Hayward, H; Heijboer, A; Heinemann, B; Heinrich, J; Hennecke, M; Herndon, M; Heuser, J; Hidas, D; Hill, C S; Hirschbuehl, D; Hocker, A; Holloway, A; Hou, S; Houlden, M; Hsu, S-C; Huffman, B T; Hughes, R E; Huston, J; Ikado, K; Incandela, J; Introzzi, G; Iori, M; Ishizawa, Y; Ivanov, A; Iyutin, B; James, E; Jang, D; Jayatilaka, B; Jeans, D; Jensen, H; Jeon, E J; Jones, M; Joo, K K; Jun, S Y; Junk, T R; Kamon, T; Kang, J; Karagoz-Unel, M; Karchin, P E; Kato, Y; Kemp, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, M S; Kim, S B; Kim, S H; Kim, Y K; Kirby, M; Kirsch, L; Klimenko, S; Klute, M; Knuteson, B; Ko, B R; Kobayashi, H; Kondo, K; Kong, D J; Konigsberg, J; Kordas, K; Korytov, A; Kotwal, A V; Kovalev, A; Kraus, J; Kravchenko, I; Kreps, M; Kreymer, A; Kroll, J; Krumnack, N; Kruse, M; Krutelyov, V; Kuhlmann, S E; Kusakabe, Y; Kwang, S; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; Lecci, C; Lecompte, T; Lee, J; Lee, J; Lee, S W; Lefèvre, R; Leonardo, N; Leone, S; Levy, S; Lewis, J D; Li, K; Lin, C; Lin, C S; Lindgren, M; Lipeles, E; Liss, T M; Lister, A; Litvintsev, D O; Liu, T; Liu, Y; Lockyer, N S; Loginov, A; Loreti, M; Loverre, P; Lu, R-S; Lucchesi, D; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Lytken, E; Mack, P; Macqueen, D; Madrak, R; Maeshima, K; Maksimovic, P; Manca, G; Margaroli, F; Marginean, R; Marino, C; Martin, A; Martin, M; Martin, V; Martínez, M; Maruyama, T; Matsunaga, H; Mattson, M E; Mazini, R; Mazzanti, P; McFarland, K S; McGivern, D; McIntyre, P; McNamara, P; McNulty, R; Mehta, A; Menzemer, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; von der Mey, M; Miao, T; Miladinovic, N; Miles, J; Miller, R; Miller, J S; Mills, C; Milnik, M; Miquel, R; Miscetti, S; Mitselmakher, G; Miyamoto, A; Moggi, N; Mohr, B; Moore, R; Morello, M; Movilla Fernandez, P; Mülmenstädt, J; Mukherjee, A; Mulhearn, M; Muller, Th; Mumford, R; Murat, P; Nachtman, J; Nahn, S; Nakano, I; Napier, A; Naumov, D; Necula, V; Neu, C; Neubauer, M S; Nielsen, J; Nigmanov, T; Nodulman, L; Norniella, O; Ogawa, T; Oh, S H; Oh, Y D; Okusawa, T; Oldeman, R; Orava, R; Osterberg, K; Pagliarone, C; Palencia, E; Paoletti, R; Papadimitriou, V; Papikonomou, A; Paramonov, A A; Parks, B; Pashapour, S; Patrick, J; Pauletta, G; Paulini, M; Paus, C; Pellett, D E; Penzo, A; Phillips, T J; Piacentino, G; Piedra, J; Pitts, K; Plager, C; Pondrom, L; Pope, G; Portell, X; Poukhov, O; Pounder, N; Prakoshyn, F; Pronko, A; Proudfoot, J; Ptohos, F; Punzi, G; Pursley, J; Rademacker, J; Rahaman, A; Rakitin, A; Rappoccio, S; Ratnikov, F; Reisert, B; Rekovic, V; van Remortel, N; Renton, P; Rescigno, M; Richter, S; Rimondi, F; Rinnert, K; Ristori, L; Robertson, W J; Robson, A; Rodrigo, T; Rogers, E; Rolli, S; Roser, R; Rossi, M; Rossin, R; Rott, C; Ruiz, A; Russ, J; Rusu, V; Ryan, D; Saarikko, H; Sabik, S; Safonov, A; Sakumoto, W K; Salamanna, G; Salto, O; Saltzberg, D; Sanchez, C; Santi, L; Sarkar, S; Sato, K; Savard, P; Savoy-Navarro, A; Scheidle, T; Schlabach, P; Schmidt, E E; Schmidt, M P; Schmitt, M; Schwarz, T; Scodellaro, L; Scott, A L; Scribano, A; Scuri, F; Sedov, A; Seidel, S; Seiya, Y; Semenov, A; Semeria, F; Sexton-Kennedy, L; Sfiligoi, I; Shapiro, M D; Shears, T; Shepard, P F; Sherman, D; Shimojima, M; Shochet, M; Shon, Y; Shreyber, I; Sidoti, A; Sill, A; Sinervo, P; Sisakyan, A; Sjolin, J; Skiba, A; Slaughter, A J; Sliwa, K; Smirnov, D; Smith, J R; Snider, F D; Snihur, R; Soderberg, M; Soha, A; Somalwar, S; Sorin, V; Spalding, J; Spinella, F; Squillacioti, P; Stanitzki, M; Staveris-Polykalas, A; St Denis, R; Stelzer, B; Stelzer-Chilton, O; Stentz, D; Strologas, J; Stuart, D; Suh, J S; Sukhanov, A; Sumorok, K; Sun, H; Suzuki, T; Taffard, A; Tafirout, R; Takashima, R; Takeuchi, Y; Takikawa, K; Tanaka, M; Tanaka, R; Tecchio, M; Teng, P K; Terashi, K; Tether, S; Thom, J; Thompson, A S; Thomson, E; Tipton, P; Tiwari, V; Tkaczyk, S; Toback, D; Tollefson, K; Tomura, T; Tonelli, D; Tönnesmann, M; Torre, S; Torretta, D; Tourneur, S; Trischuk, W; Tsuchiya, R; Tsuno, S; Turini, N; Ukegawa, F; Unverhau, T; Uozumi, S; Usynin, D; Vacavant, L; Vaiciulis, A; Vallecorsa, S; Varganov, A; Vataga, E; Velev, G; Veramendi, G; Veszpremi, V; Vickey, T; Vidal, R; Vila, I; Vilar, R; Vollrath, I; Volobouev, I; Würthwein, F; Wagner, P; Wagner, R G; Wagner, R L; Wagner, W; Wallny, R; Walter, T; Wan, Z; Wang, M J; Wang, S M; Warburton, A; Ward, B; Waschke, S; Waters, D; Watts, T; Weber, M; Wester, W C; Whitehouse, B; Whiteson, D; Wicklund, A B; Wicklund, E; Williams, H H; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolfe, C; Worm, S; Wright, T; Wu, X; Wynne, S M; Yagil, A; Yamamoto, K; Yamaoka, J; Yamashita, Y; Yang, C; Yang, U K; Yao, W M; Yeh, G P; Yoh, J; Yorita, K; Yoshida, T; Yu, I; Yu, S S; Yun, J C; Zanello, L; Zanetti, A; Zaw, I; Zetti, F; Zhang, X; Zhou, J; Zucchelli, S

    2006-01-13

    We present a search for neutral supersymmetric Higgs bosons decaying to tau pairs produced in pp collisions at square root of s = 1.96 TeV. The data, corresponding to 310 pb(-1) integrated luminosity, were collected with the Collider Detector at Fermilab in run II of the Tevatron. No significant excess above the standard model backgrounds is observed. We set exclusion limits on the production cross section times branching fraction to tau pairs for Higgs boson masses in the range from 90 to 250 GeV/c2.

  9. Search for Randall-Sundrum gravitons in the dielectron and diphoton final states with 5.4fb$^{-1}$ of data from $p\\bar{p}$ collisions at $\\sqrt{s}=1.96$ TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abazov, Victor Mukhamedovich; /Dubna, JINR; Abbott, Braden Keim; /Oklahoma U.; Abolins, Maris A.; /Michigan State U.; Acharya, Bannanje Sripath; /Tata Inst.; Adams, Mark Raymond; /Illinois U., Chicago; Adams, Todd; /Florida State U.; Aguilo, Ernest; /York U., Canada; Alexeev, Guennadi D.; /Dubna, JINR; Alkhazov, Georgiy D.; /St. Petersburg, INP; Alton, Andrew K.; /Michigan U. /Augustana Coll., Sioux Falls; Alverson, George O.; /Northeastern U. /Rio de Janeiro, CBPF

    2010-04-01

    Using 5.4 fb{sup -1} of integrated luminosity from p{bar p} collisions at {radical}s = 1.96 TeV collected by the D0 detector at the Fermilab Tevatron Collider, we search for decays of the lightest Kaluza-Klein mode of the graviton in the Randall-Sundrum model to ee and {gamma}{gamma}. We set 95% C.L. lower limits on the mass of the lightest graviton between 560 GeV and 1050 GeV for values of the coupling k/{bar M}{sub Pl} between 0.01 and 0.1.

  10. Search for the flavor-changing neutral current decay B0s--> mu(+) mu(-) in pp Collisions at sqrt[s] = 1.96 TeV with the D0 detector.

    Science.gov (United States)

    Abazov, V M; Abbott, B; Abolins, M; Acharya, B S; Adams, M; Adams, T; Agelou, M; Agram, J-L; Ahn, S H; Ahsan, M; Alexeev, G D; Alkhazov, G; Alton, A; Alverson, G; Alves, G A; Anastasoaie, M; Anderson, S; Andrieu, B; Arnoud, Y; Askew, A; Asman, B; Atramentov, O; Autermann, C; Avila, C; Badaud, F; Baden, A; Baldin, B; Balm, P W; Banerjee, S; Barberis, E; Bargassa, P; Baringer, P; Barnes, C; Barreto, J; Bartlett, J F; Bassler, U; Bauer, D; Bean, A; Beauceron, S; Begel, M; Bellavance, A; Beri, S B; Bernardi, G; Bernhard, R; Bertram, I; Besançon, M; Beuselinck, R; Bezzubov, V A; Bhat, P C; Bhatnagar, V; Binder, M; Black, K M; Blackler, I; Blazey, G; Blekman, F; Blessing, S; Bloch, D; Blumenschein, U; Boehnlein, A; Boeriu, O; Bolton, T A; Borcherding, F; Borissov, G; Bos, K; Bose, T; Brandt, A; Brock, R; Brooijmans, G; Bross, A; Buchanan, N J; Buchholz, D; Buehler, M; Buescher, V; Burdin, S; Burnett, T H; Busato, E; Butler, J M; Bystricky, J; Carvalho, W; Casey, B C K; Cason, N M; Castilla-Valdez, H; Chakrabarti, S; Chakraborty, D; Chan, K M; Chandra, A; Chapin, D; Charles, F; Cheu, E; Chevalier, L; Cho, D K; Choi, S; Christiansen, T; Christofek, L; Claes, D; Clément, B; Clément, C; Coadou, Y; Cooke, M; Cooper, W E; Coppage, D; Corcoran, M; Coss, J; Cothenet, A; Cousinou, M-C; Crépé-Renaudin, S; Cristetiu, M; Cummings, M A C; Cutts, D; da Motta, H; Davies, B; Davies, G; Davis, G A; De, K; de Jong, P; de Jong, S J; De La Cruz-Burelo, E; De Oliveira Martins, C; Dean, S; Déliot, F; Delsart, P A; Demarteau, M; Demina, R; Demine, P; Denisov, D; Denisov, S P; Desai, S; Diehl, H T; Diesburg, M; Doidge, M; Dong, H; Doulas, S; Duflot, L; Dugad, S R; Duperrin, A; Dyer, J; Dyshkant, A; Eads, M; Edmunds, D; Edwards, T; Ellison, J; Elmsheuser, J; Eltzroth, J T; Elvira, V D; Eno, S; Ermolov, P; Eroshin, O V; Estrada, J; Evans, D; Evans, H; Evdokimov, A; Evdokimov, V N; Fast, J; Fatakia, S N; Feligioni, L; Ferbel, T; Fiedler, F; Filthaut, F; Fisher, W; Fisk, H E; Fortner, M; Fox, H; Freeman, W; Fu, S; Fuess, S; Gadfort, T; Galea, C F; Gallas, E; Galyaev, E; Garcia, C; Garcia-Bellido, A; Gardner, J; Gavrilov, V; Gay, P; Gelé, D; Gelhaus, R; Genser, K; Gerber, C E; Gershtein, Y; Ginther, G; Golling, T; Gómez, B; Gounder, K; Goussiou, A; Grannis, P D; Greder, S; Greenlee, H; Greenwood, Z D; Gregores, E M; Gris, Ph; Grivaz, J-F; Groer, L; Grünendahl, S; Grünewald, M W; Gurzhiev, S N; Gutierrez, G; Gutierrez, P; Haas, A; Hadley, N J; Hagopian, S; Hall, I; Hall, R E; Han, C; Han, L; Hanagaki, K; Harder, K; Harrington, R; Hauptman, J M; Hauser, R; Hays, J; Hebbeker, T; Hedin, D; Heinmiller, J M; Heinson, A P; Heintz, U; Hensel, C; Hesketh, G; Hildreth, M D; Hirosky, R; Hobbs, J D; Hoeneisen, B; Hohlfeld, M; Hong, S J; Hooper, R; Houben, P; Hu, Y; Huang, J; Iashvili, I; Illingworth, R; Ito, A S; Jabeen, S; Jaffré, M; Jain, S; Jain, V; Jakobs, K; Jenkins, A; Jesik, R; Johns, K; Johnson, M; Jonckheere, A; Jonsson, P; Jöstlein, H; Juste, A; Kado, M M; Käfer, D; Kahl, W; Kahn, S; Kajfasz, E; Kalinin, A M; Kalk, J; Karmanov, D; Kasper, J; Kau, D; Kehoe, R; Kermiche, S; Kesisoglou, S; Khanov, A; Kharchilava, A; Kharzheev, Y M; Kim, K H; Klima, B; Klute, M; Kohli, J M; Kopal, M; Korablev, V M; Kotcher, J; Kothari, B; Koubarovsky, A; Kozelov, A V; Kozminski, J; Krzywdzinski, S; Kuleshov, S; Kulik, Y; Kunori, S; Kupco, A; Kurca, T; Lager, S; Lahrichi, N; Landsberg, G; Lazoflores, J; Le Bihan, A-C; Lebrun, P; Lee, S W; Lee, W M; Leflat, A; Lehner, F; Leonidopoulos, C; Lewis, P; Li, J; Li, Q Z; Lima, J G R; Lincoln, D; Linn, S L; Linnemann, J; Lipaev, V V; Lipton, R; Lobo, L; Lobodenko, A; Lokajicek, M; Lounis, A; Lubatti, H J; Lueking, L; Lynker, M; Lyon, A L; Maciel, A K A; Madaras, R J; Mättig, P; Magerkurth, A; Magnan, A-M; Makovec, N; Mal, P K; Malik, S; Malyshev, V L; Mao, H S; Maravin, Y; Martens, M; Mattingly, S E K; Mayorov, A A; McCarthy, R; McCroskey, R; Meder, D; Melanson, H L; Melnitchouk, A; Merkin, M; Merritt, K W; Meyer, A; Miettinen, H; Mihalcea, D; Mitrevski, J; Mokhov, N; Molina, J; Mondal, N K; Montgomery, H E; Moore, R W; Muanza, G S; Mulders, M; Mutaf, Y D; Nagy, E; Narain, M; Naumann, N A; Neal, H A; Negret, J P; Nelson, S; Neustroev, P; Noeding, C; Nomerotski, A; Novaes, S F; Nunnemann, T; Nurse, E; O'dell, V; O'neil, D C; Oguri, V; Oliveira, N; Oshima, N; Otero Y Garzón, G J; Padley, P; Parashar, N; Park, J; Park, S K; Parsons, J; Partridge, R; Parua, N; Patwa, A; Perea, P M; Perez, E; Peters, O; Pétroff, P; Petteni, M; Phaf, L; Piegaia, R; Podesta-Lerma, P L M; Podstavkov, V M; Pogorelov, Y; Pope, B G; Prado da Silva, W L; Prosper, H B; Protopopescu, S; Przybycien, M B; Qian, J; Quadt, A; Quinn, B; Rani, K J; Rapidis, P A; Ratoff, P N; Reay, N W; Reucroft, S; Rijssenbeek, M; Ripp-Baudot, I; Rizatdinova, F; Royon, C; Rubinov, P; Ruchti, R; Sajot, G; Sánchez-Hernández, A; Sanders, M P; Santoro, A; Savage, G; Sawyer, L; Scanlon, T; Schamberger, R D; Schellman, H; Schieferdecker, P; Schmitt, C; Schukin, A A; Schwartzman, A; Schwienhorst, R; Sengupta, S; Severini, H; Shabalina, E; Shamim, M; Shary, V; Shephard, W D; Shpakov, D; Sidwell, R A; Simak, V; Sirotenko, V; Skubic, P; Slattery, P; Smith, R P; Smolek, K; Snow, G R; Snow, J; Snyder, S; Söldner-Rembold, S; Song, X; Song, Y; Sonnenschein, L; Sopczak, A; Sosebee, M; Soustruznik, K; Souza, M; Spurlock, B; Stanton, N R; Stark, J; Steele, J; Steinbrück, G; Stevenson, K; Stolin, V; Stone, A; Stoyanova, D A; Strandberg, J; Strang, M A; Strauss, M; Ströhmer, R; Strovink, M; Stutte, L; Sumowidagdo, S; Sznajder, A; Talby, M; Tamburello, P; Taylor, W; Telford, P; Temple, J; Tentindo-Repond, S; Thomas, E; Thooris, B; Tomoto, M; Toole, T; Torborg, J; Towers, S; Trefzger, T; Trincaz-Duvoid, S; Tuchming, B; Tully, C; Turcot, A S; Tuts, P M; Uvarov, L; Uvarov, S; Uzunyan, S; Vachon, B; Van Kooten, R; van Leeuwen, W M; Varelas, N; Varnes, E W; Vasilyev, I A; Vaupel, M; Verdier, P; Vertogradov, L S; Verzocchi, M; Villeneuve-Seguier, F; Vlimant, J-R; Von Toerne, E; Vreeswijk, M; Vu Anh, T; Wahl, H D; Walker, R; Wang, L; Wang, Z-M; Warchol, J; Warsinsky, M; Watts, G; Wayne, M; Weber, M; Weerts, H; Wegner, M; Wermes, N; White, A; White, V; Whiteson, D; Wicke, D; Wijngaarden, D A; Wilson, G W; Wimpenny, S J; Wittlin, J; Wobisch, M; Womersley, J; Wood, D R; Wyatt, T R; Xu, Q; Xuan, N; Yamada, R; Yan, M; Yasuda, T; Yatsunenko, Y A; Yen, Y; Yip, K; Youn, S W; Yu, J; Yurkewicz, A; Zabi, A; Zatserklyaniy, A; Zdrazil, M; Zeitnitz, C; Zhang, D; Zhang, X; Zhao, T; Zhao, Z; Zhou, B; Zhu, J; Zielinski, M; Zieminska, D; Zieminski, A; Zitoun, R; Zutshi, V; Zverev, E G; Zylberstejn, A

    2005-02-25

    We present the results of a search for the flavor-changing neutral current decay B(0)(s)--> mu(+) mu(-) using a data set with integrated luminosity of 240 pb(-1) of pp collisions at sqrt[s] = 1.96 TeV collected with the D0 detector in run II of the Fermilab Tevatron collider. We find the upper limit on the branching fraction to be B(B(0)(s)--> mu(+) mu(-)) mu(+) mu(-) in the signal region. This limit is the most stringent upper bound on the branching fraction B(0)(s)--> mu(+) mu(-) to date.

  11. Measurement of the t $\\bar{t}$ Cross-Section Using the Dimuon Channel in p$\\bar{p}$ Collisions at √s = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    McCroskey, Robert Crampton [Univ. of Arizona, Tucson, AZ (United States)

    2004-01-01

    The author has measured the t$\\bar{t}$ production cross section at √s = 1.96 TeV using data collected by the D0 experiment at Fermilab. The integrated luminosity of the data set is 140 pb-1 and a total of four candidate events are seen, with an expected background of 2.61 events. The measured cross section of σt$\\bar{t}$ = 11.1$+22.1\\atop{-9.3}$(stat.)$+4.3\\atop{-4.5}$(sys.) pb is in agreement with a NNLO calculation of 6.77 pb.

  12. Measurement of the Bs Lifetime in Fully and Partially Reconstructed Bs -> Ds- (phi pi-)X Decays in pbar-p Collisions at sqrt(s) = 1.96 TeV

    CERN Document Server

    Aaltonen, T.; Amerio, S.; Amidei, D.; Anastassov, A.; Annovi, A.; Antos, J.; Apollinari, G.; Appel, J.A.; Apresyan, A.; Arisawa, T.; Artikov, A.; Asaadi, J.; Ashmanskas, W.; Auerbach, B.; Aurisano, A.; Azfar, F.; Badgett, W.; Barbaro-Galtieri, A.; Barnes, V.E.; Barnett, B.A.; Barria, P.; Bartos, P.; Bauce, M.; Bauer, G.; Bedeschi, F.; Beecher, D.; Behari, S.; Bellettini, G.; Bellinger, J.; Benjamin, D.; Beretvas, A.; Bhatti, A.; Binkley, M.; Bisello, D.; Bizjak, I.; Bland, K.R.; Blumenfeld, B.; Bocci, A.; Bodek, A.; Bortoletto, D.; Boudreau, J.; Boveia, A.; Brau, B.; Brigliadori, L.; Brisuda, A.; Bromberg, C.; Brucken, E.; Bucciantonio, M.; Budagov, J.; Budd, H.S.; Budd, S.; Burkett, K.; Busetto, G.; Bussey, P.; Buzatu, A.; Calancha, C.; Camarda, S.; Campanelli, M.; Campbell, M.; Canelli, F.; Canepa, A.; Carls, B.; Carlsmith, D.; Carosi, R.; Carrillo, S.; Carron, S.; Casal, B.; Casarsa, M.; Castro, A.; Catastini, P.; Cauz, D.; Cavaliere, V.; Cavalli-Sforza, M.; Cerri, A.; Cerrito, L.; Chen, Y.C.; Chertok, M.; Chiarelli, G.; Chlachidze, G.; Chlebana, F.; Cho, K.; Chokheli, D.; Chou, J.P.; Chung, W.H.; Chung, Y.S.; Ciobanu, C.I.; Ciocci, M.A.; Clark, A.; Compostella, G.; Convery, M.E.; Conway, J.; Corbo, M.; Cordelli, M.; Cox, C.A.; Cox, D.J.; Crescioli, F.; Cuenca Almenar, C.; Cuevas, J.; Culbertson, R.; Dagenhart, D.; d'Ascenzo, N.; Datta, M.; de Barbaro, P.; De Cecco, S.; Deisher, A.; De Lorenzo, G.; Dell'Orso, M.; Deluca, C.; Demortier, L.; Deng, J.; Deninno, M.; Devoto, F.; d'Errico, M.; Di Canto, A.; Di Ruzza, B.; Dittmann, J.R.; D'Onofrio, M.; Donati, S.; Dong, P.; Dorigo, T.; Ebina, K.; Elagin, A.; Eppig, A.; Erbacher, R.; Errede, D.; Errede, S.; Ershaidat, N.; Eusebi, R.; Fang, H.C.; Farrington, S.; Feindt, M.; Fernandez, J.P.; Ferrazza, C.; Field, R.; Flanagan, G.; Forrest, R.; Frank, M.J.; Franklin, M.; Freeman, J.C.; Furic, I.; Gallinaro, M.; Galyardt, J.; Garcia, J.E.; Garfinkel, A.F.; Garosi, P.; Gerberich, H.; Gerchtein, E.; Giagu, S.; Giakoumopoulou, V.; Giannetti, P.; Gibson, K.; Ginsburg, C.M.; Giokaris, N.; Giromini, P.; Giunta, M.; Giurgiu, G.; Glagolev, V.; Glenzinski, D.; Gold, M.; Goldin, D.; Goldschmidt, N.; Golossanov, A.; Gomez, G.; Gomez-Ceballos, G.; Goncharov, M.; Gonzalez, O.; Gorelov, I.; Goshaw, A.T.; Goulianos, K.; Gresele, A.; Grinstein, S.; Grosso-Pilcher, C.; Group, R.C.; Guimaraes da Costa, J.; Gunay-Unalan, Z.; Haber, C.; Hahn, S.R.; Halkiadakis, E.; Hamaguchi, A.; Han, J.Y.; Happacher, F.; Hara, K.; Hare, D.; Hare, M.; Harr, R.F.; Hatakeyama, K.; Hays, C.; Heck, M.; Heinrich, J.; Herndon, M.; Hewamanage, S.; Hidas, D.; Hocker, A.; Hopkins, W.; Horn, D.; Hou, S.; Hughes, R.E.; Hurwitz, M.; Husemann, U.; Hussain, N.; Hussein, M.; Huston, J.; Introzzi, G.; Iori, M.; Ivanov, A.; James, E.; Jang, D.; Jayatilaka, B.; Jeon, E.J.; Jha, M.K.; Jindariani, S.; Johnson, W.; Jones, M.; Joo, K.K.; Jun, S.Y.; Junk, T.R.; Kamon, T.; Karchin, P.E.; Kato, Y.; Ketchum, W.; Keung, J.; Khotilovich, V.; Kilminster, B.; Kim, D.H.; Kim, H.S.; Kim, H.W.; Kim, J.E.; Kim, M.J.; Kim, S.B.; Kim, S.H.; Kim, Y.K.; Kimura, N.; Kirby, M.; Klimenko, S.; Kondo, K.; Kong, D.J.; Konigsberg, J.; Kotwal, A.V.; Kreps, M.; Kroll, J.; Krop, D.; Krumnack, N.; Kruse, M.; Krutelyov, V.; Kuhr, T.; Kurata, M.; Kwang, S.; Laasanen, A.T.; Lami, S.; Lammel, S.; Lancaster, M.; Lander, R.L.; Lannon, K.; Lath, A.; Latino, G.; Lazzizzera, I.; LeCompte, T.; Lee, E.; Lee, H.S.; Lee, J.S.; Lee, S.W.; Leo, S.; Leone, S.; Lewis, J.D.; Lin, C.J.; Linacre, J.; Lindgren, M.; Lipeles, E.; Lister, A.; Litvintsev, D.O.; Liu, C.; Liu, Q.; Liu, T.; Lockwitz, S.; Lockyer, N.S.; Loginov, A.; Lucchesi, D.; Lueck, J.; Lujan, P.; Lukens, P.; Lungu, G.; Lys, J.; Lysak, R.; Madrak, R.; Maeshima, K.; Makhoul, K.; Maksimovic, P.; Malik, S.; Manca, G.; Manousakis-Katsikakis, A.; Margaroli, F.; Marino, C.; Martinez, M.; Martinez-Ballarin, R.; Mastrandrea, P.; Mathis, M.; Mattson, M.E.; Mazzanti, P.; McFarland, K.S.; McIntyre, P.; McNulty, R.; Mehta, A.; Mehtala, P.; Menzione, A.; Mesropian, C.; Miao, T.; Mietlicki, D.; Mitra, A.; Miyake, H.; Moed, S.; Moggi, N.; Mondragon, M.N.; Moon, C.S.; Moore, R.; Morello, M.J.; Morlock, J.; Movilla Fernandez, P.; Mulmenstadt, J.; Mukherjee, A.; Muller, Th.; Murat, P.; Mussini, M.; Nachtman, J.; Nagai, Y.; Naganoma, J.; Nakano, I.; Napier, A.; Nett, J.; Neu, C.; Neubauer, M.S.; Nielsen, J.; Nodulman, L.; Norniella, O.; Nurse, E.; Oakes, L.; Oh, S.H.; Oh, Y.D.; Oksuzian, I.; Okusawa, T.; Orava, R.; Ortolan, L.; Griso, S.Pagan; Pagliarone, C.; Palencia, E.; Papadimitriou, V.; Paramonov, A.A.; Patrick, J.; Pauletta, G.; Paulini, M.; Paus, C.; Pellett, D.E.; Penzo, A.; Phillips, T.J.; Piacentino, G.; Pianori, E.; Pilot, J.; Pitts, K.; Plager, C.; Pondrom, L.; Potamianos, K.; Poukhov, O.; Prokoshin, F.; Pronko, A.; Ptohos, F.; Pueschel, E.; Punzi, G.; Pursley, J.; Rahaman, A.; Ramakrishnan, V.; Ranjan, N.; Redondo, I.; Renton, P.; Rescigno, M.; Rimondi, F.; Ristori, L.; Robson, A.; Rodrigo, T.; Rodriguez, T.; Rogers, E.; Rolli, S.; Roser, R.; Rossi, M.; Rubbo, F.; Ruffini, F.; Ruiz, A.; Russ, J.; Rusu, V.; Safonov, A.; Sakumoto, W.K.; Santi, L.; Sartori, L.; Sato, K.; Saveliev, V.; Savoy-Navarro, A.; Schlabach, P.; Schmidt, A.; Schmidt, E.E.; Schmidt, M.P.; Schmitt, M.; Schwarz, T.; Scodellaro, L.; Scribano, A.; Scuri, F.; Sedov, A.; Seidel, S.; Seiya, Y.; Semenov, A.; Sforza, F.; Sfyrla, A.; Shalhout, S.Z.; Shapiro, M.D.; Shears, T.; Shepard, P.F.; Shimojima, M.; Shiraishi, S.; Shochet, M.; Shreyber, I.; Simonenko, A.; Sinervo, P.; Sissakian, A.; Sliwa, K.; Smith, J.R.; Snider, F.D.; Soha, A.; Somalwar, S.; Sorin, V.; Squillacioti, P.; Stanitzki, M.; Denis, R.St.; Stelzer, B.; Stelzer-Chilton, O.; Stentz, D.; Strologas, J.; Strycker, G.L.; Sudo, Y.; Sukhanov, A.; Suslov, I.; Takemasa, K.; Takeuchi, Y.; Tang, J.; Tecchio, M.; Teng, P.K.; Thom, J.; Thome, J.; Thompson, G.A.; Thomson, E.; Ttito-Guzman, P.; Tkaczyk, S.; Toback, D.; Tokar, S.; Tollefson, K.; Tomura, T.; Tonelli, D.; Torre, S.; Torretta, D.; Totaro, P.; Trovato, M.; Tu, Y.; Turini, N.; Ukegawa, F.; Uozumi, S.; Varganov, A.; Vataga, E.; Vazquez, F.; Velev, G.; Vellidis, C.; Vidal, M.; Vila, I.; Vilar, R.; Vogel, M.; Volpi, G.; Wagner, P.; Wagner, R.L.; Wakisaka, T.; Wallny, R.; Wang, S.M.; Warburton, A.; Waters, D.; Weinberger, M.; Wester, W.C., III; Whitehouse, B.; Whiteson, D.; Wicklund, A.B.; Wicklund, E.; Wilbur, S.; Wick, F.; Williams, H.H.; Wilson, J.S.; Wilson, P.; Winer, B.L.; Wittich, P.; Wolbers, S.; Wolfe, H.; Wright, T.; Wu, X.; Wu, Z.; Yamamoto, K.; Yamaoka, J.; Yang, T.; Yang, U.K.; Yang, Y.C.; Yao, W.M.; Yeh, G.P.; Yi, K.; Yoh, J.; Yorita, K.; Yoshida, T.; Yu, G.B.; Yu, I.; Yu, S.S.; Yun, J.C.; Zanetti, A.; Zeng, Y.; Zucchelli, S.

    2011-01-01

    We present a measurement of the Bs lifetime in fully and partially reconstructed Bs -> Ds(phi pi)X decays in 1.3 fb-1 of pbar-p collisions at sqrt(s) = 1.96 TeV collected by the CDF II detector at the Fermilab Tevatron. We measure tau(Bs) = 1.518 +/- 0.041 (stat.) +/- 0.027 (syst.) ps. The ratio of this result and the world average B0 lifetime yields tau(Bs)/tau(B0) = 0.99 +/-0.03, which is in agreement with recent theoretical predictions.

  13. Search for Production of Heavy Particles Decaying to Top Quarks and Invisible Particles in $p\\bar{p}$ collisions at $\\sqrt{s}=1.96$ TeV

    CERN Document Server

    Aaltonen, T.; Amerio, S.; Amidei, D.; Anastassov, A.; Annovi, A.; Antos, J.; Apollinari, G.; Appel, J.A.; Apresyan, A.; Arisawa, T.; Artikov, A.; Asaadi, J.; Ashmanskas, W.; Auerbach, B.; Aurisano, A.; Azfar, F.; Badgett, W.; Barbaro-Galtieri, A.; Barnes, V.E.; Barnett, B.A.; Barria, P.; Bartos, P.; Bauce, M.; Bauer, G.; Bedeschi, F.; Beecher, D.; Behari, S.; Bellettini, G.; Bellinger, J.; Benjamin, D.; Beretvas, A.; Bhatti, A.; Binkley, M.; Bisello, D.; Bizjak, I.; Bland, K.R.; Blumenfeld, B.; Bocci, A.; Bodek, A.; Bortoletto, D.; Boudreau, J.; Boveia, A.; Brau, B.; Brigliadori, L.; Brisuda, A.; Bromberg, C.; Brucken, E.; Bucciantonio, M.; Budagov, J.; Budd, H.S.; Budd, S.; Burkett, K.; Busetto, G.; Bussey, P.; Buzatu, A.; Calancha, C.; Camarda, S.; Campanelli, M.; Campbell, M.; Canelli, F.; Canepa, A.; Carls, B.; Carlsmith, D.; Carosi, R.; Carrillo, S.; Carron, S.; Casal, B.; Casarsa, M.; Castro, A.; Catastini, P.; Cauz, D.; Cavaliere, V.; Cavalli-Sforza, M.; Cerri, A.; Cerrito, L.; Chen, Y.C.; Chertok, M.; Chiarelli, G.; Chlachidze, G.; Chlebana, F.; Cho, K.; Chokheli, D.; Chou, J.P.; Chung, W.H.; Chung, Y.S.; Ciobanu, C.I.; Ciocci, M.A.; Clark, A.; Compostella, G.; Convery, M.E.; Conway, J.; Corbo, M.; Cordelli, M.; Cox, C.A.; Cox, D.J.; Crescioli, F.; Cuenca Almenar, C.; Cuevas, J.; Culbertson, R.; Dagenhart, D.; d'Ascenzo, N.; Datta, M.; de Barbaro, P.; De Cecco, S.; De Lorenzo, G.; Dell'Orso, M.; Deluca, C.; Demortier, L.; Deng, J.; Deninno, M.; Devoto, F.; d'Errico, M.; Di Canto, A.; Di Ruzza, B.; Dittmann, J.R.; D'Onofrio, M.; Donati, S.; Dong, P.; Dorigo, M.; Dorigo, T.; Ebina, K.; Elagin, A.; Eppig, A.; Erbacher, R.; Errede, D.; Errede, S.; Ershaidat, N.; Eusebi, R.; Fang, H.C.; Farrington, S.; Feindt, M.; Fernandez, J.P.; Ferrazza, C.; Field, R.; Flanagan, G.; Forrest, R.; Frank, M.J.; Franklin, M.; Freeman, J.C.; Funakoshi, Y.; Furic, I.; Gallinaro, M.; Galyardt, J.; Garcia, J.E.; Garfinkel, A.F.; Garosi, P.; Gerberich, H.; Gerchtein, E.; Giagu, S.; Giakoumopoulou, V.; Giannetti, P.; Gibson, K.; Ginsburg, C.M.; Giokaris, N.; Giromini, P.; Giunta, M.; Giurgiu, G.; Glagolev, V.; Glenzinski, D.; Gold, M.; Goldin, D.; Goldschmidt, N.; Golossanov, A.; Gomez, G.; Gomez-Ceballos, G.; Goncharov, M.; Gonzalez, O.; Gorelov, I.; Goshaw, A.T.; Goulianos, K.; Grinstein, S.; Grosso-Pilcher, C.; Group, R.C.; Guimaraes da Costa, J.; Gunay-Unalan, Z.; Haber, C.; Hahn, S.R.; Halkiadakis, E.; Hamaguchi, A.; Han, J.Y.; Happacher, F.; Hara, K.; Hare, D.; Hare, M.; Harr, R.F.; Hatakeyama, K.; Hays, C.; Heck, M.; Heinrich, J.; Herndon, M.; Hewamanage, S.; Hidas, D.; Hocker, A.; Hopkins, W.; Horn, D.; Hou, S.; Hughes, R.E.; Hurwitz, M.; Husemann, U.; Hussain, N.; Hussein, M.; Huston, J.; Introzzi, G.; Iori, M.; Ivanov, A.; James, E.; Jang, D.; Jayatilaka, B.; Jeon, E.J.; Jha, M.K.; Jindariani, S.; Johnson, W.; Jones, M.; Joo, K.K.; Jun, S.Y.; Junk, T.R.; Kamon, T.; Karchin, P.E.; Kato, Y.; Ketchum, W.; Keung, J.; Khotilovich, V.; Kilminster, B.; Kim, D.H.; Kim, H.S.; Kim, H.W.; Kim, J.E.; Kim, M.J.; Kim, S.B.; Kim, S.H.; Kim, Y.K.; Kimura, N.; Kirby, M.; Klimenko, S.; Kondo, K.; Kong, D.J.; Konigsberg, J.; Kotwal, A.V.; Kreps, M.; Kroll, J.; Krop, D.; Krumnack, N.; Kruse, M.; Krutelyov, V.; Kuhr, T.; Kurata, M.; Kwang, S.; Laasanen, A.T.; Lami, S.; Lammel, S.; Lancaster, M.; Lander, R.L.; Lannon, K.; Lath, A.; Latino, G.; LeCompte, T.; Lee, E.; Lee, H.S.; Lee, J.S.; Lee, S.W.; Leo, S.; Leone, S.; Lewis, J.D.; Limosani, A.; Lin, C.J.; Linacre, J.; Lindgren, M.; Lipeles, E.; Lister, A.; Litvintsev, D.O.; Liu, C.; Liu, Q.; Liu, T.; Lockwitz, S.; Lockyer, N.S.; Loginov, A.; Lucchesi, D.; Lueck, J.; Lujan, P.; Lukens, P.; Lungu, G.; Lys, J.; Lysak, R.; Madrak, R.; Maeshima, K.; Makhoul, K.; Maksimovic, P.; Malik, S.; Manca, G.; Manousakis-Katsikakis, A.; Margaroli, F.; Marino, C.; Martinez, M.; Martinez-Ballarin, R.; Mastrandrea, P.; Mathis, M.; Mattson, M.E.; Mazzanti, P.; McFarland, K.S.; McIntyre, P.; McNulty, R.; Mehta, A.; Mehtala, P.; Menzione, A.; Mesropian, C.; Miao, T.; Mietlicki, D.; Mitra, A.; Miyake, H.; Moed, S.; Moggi, N.; Mondragon, M.N.; Moon, C.S.; Moore, R.; Morello, M.J.; Morlock, J.; Movilla Fernandez, P.; Mukherjee, A.; Muller, Th.; Murat, P.; Mussini, M.; Nachtman, J.; Nagai, Y.; Naganoma, J.; Nakano, I.; Napier, A.; Nett, J.; Neu, C.; Neubauer, M.S.; Nielsen, J.; Nodulman, L.; Norniella, O.; Nurse, E.; Oakes, L.; Oh, S.H.; Oh, Y.D.; Oksuzian, I.; Okusawa, T.; Orava, R.; Ortolan, L.; Griso, S.Pagan; Pagliarone, C.; Palencia, E.; Papadimitriou, V.; Paramonov, A.A.; Patrick, J.; Pauletta, G.; Paulini, M.; Paus, C.; Pellett, D.E.; Penzo, A.; Phillips, T.J.; Piacentino, G.; Pianori, E.; Pilot, J.; Pitts, K.; Plager, C.; Pondrom, L.; Potamianos, K.; Poukhov, O.; Prokoshin, F.; Pronko, A.; Ptohos, F.; Pueschel, E.; Punzi, G.; Pursley, J.; Rahaman, A.; Ramakrishnan, V.; Ranjan, N.; Rao, K.; Redondo, I.; Renton, P.; Rescigno, M.; Rimondi, F.; Ristori, L.; Robson, A.; Rodrigo, T.; Rodriguez, T.; Rogers, E.; Rolli, S.; Roser, R.; Rossi, M.; Rubbo, F.; Ruffini, F.; Ruiz, A.; Russ, J.; Rusu, V.; Safonov, A.; Sakumoto, W.K.; Sakurai, Y.; Santi, L.; Sartori, L.; Sato, K.; Saveliev, V.; Savoy-Navarro, A.; Schlabach, P.; Schmidt, A.; Schmidt, E.E.; Schmidt, M.P.; Schmitt, M.; Schwarz, T.; Scodellaro, L.; Scribano, A.; Scuri, F.; Sedov, A.; Seidel, S.; Seiya, Y.; Semenov, A.; Sforza, F.; Sfyrla, A.; Shalhout, S.Z.; Shears, T.; Shepard, P.F.; Shimojima, M.; Shiraishi, S.; Shochet, M.; Shreyber, I.; Simonenko, A.; Sinervo, P.; Sissakian, A.; Sliwa, K.; Smith, J.R.; Snider, F.D.; Soha, A.; Somalwar, S.; Sorin, V.; Squillacioti, P.; Stancari, M.; Stanitzki, M.; Denis, R.St.; Stelzer, B.; Stelzer-Chilton, O.; Stentz, D.; Strologas, J.; Strycker, G.L.; Sudo, Y.; Sukhanov, A.; Suslov, I.; Takemasa, K.; Takeuchi, Y.; Tang, J.; Tecchio, M.; Teng, P.K.; Thom, J.; Thome, J.; Thompson, G.A.; Thomson, E.; Ttito-Guzman, P.; Tkaczyk, S.; Toback, D.; Tokar, S.; Tollefson, K.; Tomura, T.; Tonelli, D.; Torre, S.; Torretta, D.; Totaro, P.; Trovato, M.; Tu, Y.; Ukegawa, F.; Uozumi, S.; Varganov, A.; Vazquez, F.; Velev, G.; Vellidis, C.; Vidal, M.; Vila, I.; Vilar, R.; Vizan, J.; Vogel, M.; Volpi, G.; Wagner, P.; Wagner, R.L.; Wakisaka, T.; Wallny, R.; Wang, S.M.; Warburton, A.; Waters, D.; Weinberger, M.; Wester, W.C., III; Whitehouse, B.; Whiteson, D.; Wicklund, A.B.; Wicklund, E.; Wilbur, S.; Wick, F.; Williams, H.H.; Wilson, J.S.; Wilson, P.; Winer, B.L.; Wittich, P.; Wolbers, S.; Wolfe, H.; Wright, T.; Wu, X.; Wu, Z.; Yamamoto, K.; Yamaoka, J.; Yang, T.; Yang, U.K.; Yang, Y.C.; Yao, W.M.; Yeh, G.P.; Yi, K.; Yoh, J.; Yorita, K.; Yoshida, T.; Yu, G.B.; Yu, I.; Yu, S.S.; Yun, J.C.; Zanetti, A.; Zeng, Y.; Zucchelli, S.

    2011-01-01

    We present a search for a new particle $T'$ decaying to top quark via $T^{\\prime} \\rightarrow t + X$, where $X$ is an invisible particle. In a data sample with 4.8 fb$^{-1}$ of integrated luminosity collected by the CDF II detector at Fermilab in $p\\bar{p}$ collisions with $\\sqrt{s}=1.96$ TeV, we search for pair production of $T'$ in the lepton+jets channel, $p\\bar{p} \\rightarrow t\\bar{t} +X+X \\rightarrow \\ell\

  14. Measurement of the Cross Section for Direct-Photon Production in Association with a Heavy Quark in pp¯ Collisions at s=1.96TeV

    Science.gov (United States)

    Aaltonen, T.; Amerio, S.; Amidei, D.; Anastassov, A.; Annovi, A.; Antos, J.; Apollinari, G.; Appel, J. A.; Arisawa, T.; Artikov, A.; Asaadi, J.; Ashmanskas, W.; Auerbach, B.; Aurisano, A.; Azfar, F.; Badgett, W.; Bae, T.; Barbaro-Galtieri, A.; Barnes, V. E.; Barnett, B. A.; Barria, P.; Bartos, P.; Bauce, M.; Bedeschi, F.; Behari, S.; Bellettini, G.; Bellinger, J.; Benjamin, D.; Beretvas, A.; Bhatti, A.; Bland, K. R.; Blumenfeld, B.; Bocci, A.; Bodek, A.; Bortoletto, D.; Boudreau, J.; Boveia, A.; Brigliadori, L.; Bromberg, C.; Brucken, E.; Budagov, J.; Budd, H. S.; Burkett, K.; Busetto, G.; Bussey, P.; Butti, P.; Buzatu, A.; Calamba, A.; Camarda, S.; Campanelli, M.; Canelli, F.; Carls, B.; Carlsmith, D.; Carosi, R.; Carrillo, S.; Casal, B.; Casarsa, M.; Castro, A.; Catastini, P.; Cauz, D.; Cavaliere, V.; Cavalli-Sforza, M.; Cerri, A.; Cerrito, L.; Chen, Y. C.; Chertok, M.; Chiarelli, G.; Chlachidze, G.; Cho, K.; Chokheli, D.; Ciocci, M. A.; Clark, A.; Clarke, C.; Convery, M. E.; Conway, J.; Corbo, M.; Cordelli, M.; Cox, C. A.; Cox, D. J.; Cremonesi, M.; Cruz, D.; Cuevas, J.; Culbertson, R.; d'Ascenzo, N.; Datta, M.; De Barbaro, P.; Demortier, L.; Deninno, M.; d'Errico, M.; Devoto, F.; Di Canto, A.; Di Ruzza, B.; Dittmann, J. R.; D'Onofrio, M.; Donati, S.; Dorigo, M.; Driutti, A.; Ebina, K.; Edgar, R.; Elagin, A.; Erbacher, R.; Errede, S.; Esham, B.; Eusebi, R.; Farrington, S.; Fernández Ramos, J. P.; Field, R.; Flanagan, G.; Forrest, R.; Franklin, M.; Freeman, J. C.; Frisch, H.; Funakoshi, Y.; Garfinkel, A. F.; Garosi, P.; Gerberich, H.; Gerchtein, E.; Giagu, S.; Giakoumopoulou, V.; Gibson, K.; Ginsburg, C. M.; Giokaris, N.; Giromini, P.; Giurgiu, G.; Glagolev, V.; Glenzinski, D.; Gold, M.; Goldin, D.; Golossanov, A.; Gomez, G.; Gomez-Ceballos, G.; Goncharov, M.; González López, O.; Gorelov, I.; Goshaw, A. T.; Goulianos, K.; Gramellini, E.; Grinstein, S.; Grosso-Pilcher, C.; Group, R. C.; Guimaraes da Costa, J.; Hahn, S. R.; Han, J. Y.; Happacher, F.; Hara, K.; Hare, M.; Harr, R. F.; Harrington-Taber, T.; Hatakeyama, K.; Hays, C.; Heinrich, J.; Herndon, M.; Hocker, A.; Hong, Z.; Hopkins, W.; Hou, S.; Hughes, R. E.; Husemann, U.; Hussein, M.; Huston, J.; Introzzi, G.; Iori, M.; Ivanov, A.; James, E.; Jang, D.; Jayatilaka, B.; Jeon, E. J.; Jindariani, S.; Jones, M.; Joo, K. K.; Jun, S. Y.; Junk, T. R.; Kambeitz, M.; Kamon, T.; Karchin, P. E.; Kasmi, A.; Kato, Y.; Ketchum, W.; Keung, J.; Kilminster, B.; Kim, D. H.; Kim, H. S.; Kim, J. E.; Kim, M. J.; Kim, S. B.; Kim, S. H.; Kim, Y. J.; Kim, Y. K.; Kimura, N.; Kirby, M.; Knoepfel, K.; Kondo, K.; Kong, D. J.; Konigsberg, J.; Kotwal, A. V.; Kreps, M.; Kroll, J.; Kruse, M.; Kuhr, T.; Kurata, M.; Laasanen, A. T.; Lammel, S.; Lancaster, M.; Lannon, K.; Latino, G.; Lee, H. S.; Lee, J. S.; Leo, S.; Leone, S.; Lewis, J. D.; Limosani, A.; Lipeles, E.; Lister, A.; Liu, H.; Liu, Q.; Liu, T.; Lockwitz, S.; Loginov, A.; Lucà, A.; Lucchesi, D.; Lueck, J.; Lujan, P.; Lukens, P.; Lungu, G.; Lys, J.; Lysak, R.; Madrak, R.; Maestro, P.; Malik, S.; Manca, G.; Manousakis-Katsikakis, A.; Margaroli, F.; Marino, P.; Martínez, M.; Matera, K.; Mattson, M. E.; Mazzacane, A.; Mazzanti, P.; McNulty, R.; Mehta, A.; Mehtala, P.; Mesropian, C.; Miao, T.; Mietlicki, D.; Mitra, A.; Miyake, H.; Moed, S.; Moggi, N.; Moon, C. S.; Moore, R.; Morello, M. J.; Mukherjee, A.; Muller, Th.; Murat, P.; Mussini, M.; Nachtman, J.; Nagai, Y.; Naganoma, J.; Nakano, I.; Napier, A.; Nett, J.; Neu, C.; Nigmanov, T.; Nodulman, L.; Noh, S. Y.; Norniella, O.; Oakes, L.; Oh, S. H.; Oh, Y. D.; Oksuzian, I.; Okusawa, T.; Orava, R.; Ortolan, L.; Pagliarone, C.; Palencia, E.; Palni, P.; Papadimitriou, V.; Parker, W.; Pauletta, G.; Paulini, M.; Paus, C.; Phillips, T. J.; Piacentino, G.; Pianori, E.; Pilot, J.; Pitts, K.; Plager, C.; Pondrom, L.; Poprocki, S.; Potamianos, K.; Pranko, A.; Prokoshin, F.; Ptohos, F.; Punzi, G.; Ranjan, N.; Redondo Fernández, I.; Renton, P.; Rescigno, M.; Rimondi, F.; Ristori, L.; Robson, A.; Rodriguez, T.; Rolli, S.; Ronzani, M.; Roser, R.; Rosner, J. L.; Ruffini, F.; Ruiz, A.; Russ, J.; Rusu, V.; Sakumoto, W. K.; Sakurai, Y.; Santi, L.; Sato, K.; Saveliev, V.; Savoy-Navarro, A.; Schlabach, P.; Schmidt, E. E.; Schwarz, T.; Scodellaro, L.; Scuri, F.; Seidel, S.; Seiya, Y.; Semenov, A.; Sforza, F.; Shalhout, S. Z.; Shears, T.; Shepard, P. F.; Shimojima, M.; Shochet, M.; Shreyber-Tecker, I.; Simonenko, A.; Sinervo, P.; Sliwa, K.; Smith, J. R.; Snider, F. D.; Song, H.; Sorin, V.; Stancari, M.; St. Denis, R.; Stelzer, B.; Stelzer-Chilton, O.; Stentz, D.; Strologas, J.; Sudo, Y.; Sukhanov, A.; Suslov, I.; Takemasa, K.; Takeuchi, Y.; Tang, J.; Tecchio, M.; Teng, P. K.; Thom, J.; Thomson, E.; Thukral, V.; Toback, D.; Tokar, S.; Tollefson, K.; Tomura, T.; Tonelli, D.; Torre, S.; Torretta, D.; Totaro, P.; Trovato, M.; Ukegawa, F.; Uozumi, S.; Vázquez, F.; Velev, G.; Vellidis, C.; Vernieri, C.; Vidal, M.; Vilar, R.; Vizán, J.; Vogel, M.; Volpi, G.; Wagner, P.; Wallny, R.; Wang, S. M.; Warburton, A.; Waters, D.; Wester, W. C., III; Whiteson, D.; Wicklund, A. B.; Wilbur, S.; Williams, H. H.; Wilson, J. S.; Wilson, P.; Winer, B. L.; Wittich, P.; Wolbers, S.; Wolfe, H.; Wright, T.; Wu, X.; Wu, Z.; Yamamoto, K.; Yamato, D.; Yang, T.; Yang, U. K.; Yang, Y. C.; Yao, W.-M.; Yeh, G. P.; Yi, K.; Yoh, J.; Yorita, K.; Yoshida, T.; Yu, G. B.; Yu, I.; Zanetti, A. M.; Zeng, Y.; Zhou, C.; Zucchelli, S.

    2013-07-01

    We report on a measurement of the cross section for direct-photon production in association with a heavy quark using the full data set of s=1.96TeV proton-antiproton collisions corresponding to 9.1fb-1 of integrated luminosity collected by the CDF II detector at the Fermilab Tevatron. The measurements are performed as a function of the photon transverse momentum, covering a photon transverse momentum between 30 and 300 GeV, photon rapidities |yγ|20GeV, and jet rapidities |yjet|<1.5. The results are compared with several theoretical predictions.

  15. Measurement of the cross section for direct-photon production in association with a heavy quark in $p\\bar{p}$ collisions at $\\sqrt{s}$ = 1.96 TeV

    CERN Document Server

    Aaltonen, T.; Amidei, D.; Anastassov, A.; Annovi, A.; Antos, J.; Apollinari, G.; Appel, J.A.; Arisawa, T.; Artikov, A.; Asaadi, J.; Ashmanskas, W.; Auerbach, B.; Aurisano, A.; Azfar, F.; Badgett, W.; Bae, T.; Barbaro-Galtieri, A.; Barnes, V.E.; Barnett, B.A.; Barria, P.; Bartos, P.; Bauce, M.; Bedeschi, F.; Behari, S.; Bellettini, G.; Bellinger, J.; Benjamin, D.; Beretvas, A.; Bhatti, A.; Bland, K.R.; Blumenfeld, B.; Bocci, A.; Bodek, A.; Bortoletto, D.; Boudreau, J.; Boveia, A.; Brigliadori, L.; Bromberg, C.; Brucken, E.; Budagov, J.; Budd, H.S.; Burkett, K.; Busetto, G.; Bussey, P.; Butti, P.; Buzatu, A.; Calamba, A.; Camarda, S.; Campanelli, M.; Canelli, F.; Carls, B.; Carlsmith, D.; Carosi, R.; Carrillo, S.; Casal, B.; Casarsa, M.; Castro, A.; Catastini, P.; Cauz, D.; Cavaliere, V.; Cavalli-Sforza, M.; Cerri, A.; Cerrito, L.; Chen, Y.C.; Chertok, M.; Chiarelli, G.; Chlachidze, G.; Cho, K.; Chokheli, D.; Ciocci, M.A.; Clark, A.; Clarke, C.; Convery, M.E.; Conway, J.; Corbo, M.; Cordelli, M.; Cox, C.A.; Cox, D.J.; Cremonesi, M.; Cruz, D.; Cuevas, J.; Culbertson, R.; d'Ascenzo, N.; Datta, M.; de Barbaro, P.; Demortier, L.; Deninno, M.; d'Errico, M.; Devoto, F.; Di Canto, A.; Di Ruzza, B.; Dittmann, J.R.; D'Onofrio, M.; Donati, S.; Dorigo, M.; Driutti, A.; Ebina, K.; Edgar, R.; Elagin, A.; Erbacher, R.; Errede, S.; Esham, B.; Eusebi, R.; Farrington, S.; Fernandez Ramos, J.P.; Field, R.; Flanagan, G.; Forrest, R.; Franklin, M.; Freeman, J.C.; Frisch, H.; Funakoshi, Y.; Garfinkel, A.F.; Garosi, P.; Gerberich, H.; Gerchtein, E.; Giagu, S.; Giakoumopoulou, V.; Gibson, K.; Ginsburg, C.M.; Giokaris, N.; Giromini, P.; Giurgiu, G.; Glagolev, V.; Glenzinski, D.; Gold, M.; Goldin, D.; Golossanov, A.; Gomez, G.; Gomez-Ceballos, G.; Goncharov, M.; Gonzalez Lopez, O.; Gorelov, I.; Goshaw, A.T.; Goulianos, K.; Gramellini, E.; Grinstein, S.; Grosso-Pilcher, C.; Group, R.C.; Guimaraes da Costa, J.; Hahn, S.R.; Han, J.Y.; Happacher, F.; Hara, K.; Hare, M.; Harr, R.F.; Harrington-Taber, T.; Hatakeyama, K.; Hays, C.; Heinrich, J.; Herndon, M.; Hocker, A.; Hong, Z.; Hopkins, W.; Hou, S.; Hughes, R.E.; Husemann, U.; Hussein, M.; Huston, J.; Introzzi, G.; Iori, M.; Ivanov, A.; James, E.; Jang, D.; Jayatilaka, B.; Jeon, E.J.; Jindariani, S.; Jones, M.; Joo, K.K.; Jun, S.Y.; Junk, T.R.; Kambeitz, M.; Kamon, T.; Karchin, P.E.; Kasmi, A.; Kato, Y.; Ketchum, W.; Keung, J.; Kilminster, B.; Kim, D.H.; Kim, H.S.; Kim, J.E.; Kim, M.J.; Kim, S.B.; Kim, S.H.; Kim, Y.J.; Kim, Y.K.; Kimura, N.; Kirby, M.; Knoepfel, K.; Kondo, K.; Kong, D.J.; Konigsberg, J.; Kotwal, A.V.; Kreps, M.; Kroll, J.; Kruse, M.; Kuhr, T.; Kurata, M.; Laasanen, A.T.; Lammel, S.; Lancaster, M.; Lannon, K.; Latino, G.; Lee, H.S.; Lee, J.S.; Leo, S.; Leone, S.; Lewis, J.D.; Limosani, A.; Lipeles, E.; Lister, A.; Liu, H.; Liu, Q.; Liu, T.; Lockwitz, S.; Loginov, A.; Lucchesi, D.; Lueck, J.; Lujan, P.; Lukens, P.; Lungu, G.; Lys, J.; Lysak, R.; Madrak, R.; Maestro, P.; Malik, S.; Manca, G.; Manousakis-Katsikakis, A.; Margaroli, F.; Marino, P.; Martinez, M.; Matera, K.; Mattson, M.E.; Mazzacane, A.; Mazzanti, P.; McNulty, R.; Mehta, A.; Mehtala, P.; Mesropian, C.; Miao, T.; Mietlicki, D.; Mitra, A.; Miyake, H.; Moed, S.; Moggi, N.; Moon, C.S.; Moore, R.; Morello, M.J.; Mukherjee, A.; Muller, Th.; Murat, P.; Mussini, M.; Nachtman, J.; Nagai, Y.; Naganoma, J.; Nakano, I.; Napier, A.; Nett, J.; Neu, C.; Nigmanov, T.; Nodulman, L.; Noh, S.Y.; Norniella, O.; Oakes, L.; Oh, S.H.; Oh, Y.D.; Oksuzian, I.; Okusawa, T.; Orava, R.; Ortolan, L.; Pagliarone, C.; Palencia, E.; Palni, P.; Papadimitriou, V.; Parker, W.; Pauletta, G.; Paulini, M.; Paus, C.; Phillips, T.J.; Piacentino, G.; Pianori, E.; Pilot, J.; Pitts, K.; Plager, C.; Pondrom, L.; Poprocki, S.; Potamianos, K.; Pranko, A.; Prokoshin, F.; Ptohos, F.; Punzi, G.; Ranjan, N.; Redondo Fernandez, I.; Renton, P.; Rescigno, M.; Rimondi, F.; Ristori, L.; Robson, A.; Rodriguez, T.; Rolli, S.; Ronzani, M.; Roser, R.; Rosner, J.L.; Ruffini, F.; Ruiz, A.; Russ, J.; Rusu, V.; Sakumoto, W.K.; Sakurai, Y.; Santi, L.; Sato, K.; Saveliev, V.; Savoy-Navarro, A.; Schlabach, P.; Schmidt, E.E.; Schwarz, T.; Scodellaro, L.; Scuri, F.; Seidel, S.; Seiya, Y.; Semenov, A.; Sforza, F.; Shalhout, S.Z.; Shears, T.; Shepard, P.F.; Shimojima, M.; Shochet, M.; Shreyber-Tecker, I.; Simonenko, A.; Sinervo, P.; Sliwa, K.; Smith, J.R.; Snider, F.D.; Song, H.; Sorin, V.; Stancari, M.; St. Denis, R.; Stelzer, B.; Stelzer-Chilton, O.; Stentz, D.; Strologas, J.; Sudo, Y.; Sukhanov, A.; Suslov, I.; Takemasa, K.; Takeuchi, Y.; Tang, J.; Tecchio, M.; Teng, P.K.; Thom, J.; Thomson, E.; Thukral, V.; Toback, D.; Tokar, S.; Tollefson, K.; Tomura, T.; Tonelli, D.; Torre, S.; Torretta, D.; Totaro, P.; Trovato, M.; Ukegawa, F.; Uozumi, S.; Vazquez, F.; Velev, G.; Vellidis, C.; Vernieri, C.; Vidal, M.; Vilar, R.; Vizan, J.; Vogel, M.; Volpi, G.; Wagner, P.; Wallny, R.; Wang, S.M.; Warburton, A.; Waters, D.; Wester, W.C., III; Whiteson, D.; Wicklund, A.B.; Wilbur, S.; Williams, H.H.; Wilson, J.S.; Wilson, P.; Winer, B.L.; Wittich, P.; Wolbers, S.; Wolfe, H.; Wright, T.; Wu, X.; Wu, Z.; Yamamoto, K.; Yamato, D.; Yang, T.; Yang, U.K.; Yang, Y.C.; Yao, W.M.; Yeh, G.P.; Yi, K.; Yoh, J.; Yorita, K.; Yoshida, T.; Yu, G.B.; Yu, I.; Zanetti, A.M.; Zeng, Y.; Zhou, C.; Zucchelli, S.

    2013-07-25

    We report on a measurement of the cross section for direct-photon production in association with a heavy quark using the full data set of $\\sqrt{s}=1.96$ TeV proton-antiproton collisions corresponding to 9.1 fb$^{-1}$ of integrated luminosity collected by the CDF II detector at the Fermilab Tevatron. The measurements are performed as a function of the photon transverse momentum, covering photon transverse momentum between 30 and 300 GeV, photon rapidities $|y^{\\gamma}|20$ GeV, and jet rapidities $|y^{jet}|<1.5$. The results are compared with several theoretical predictions.

  16. Measurement of the $W+b$-jet and $W+c$-jet differential production cross sections in $p\\bar{p}$ collisions at $\\sqrt{s}=1.96$ TeV

    CERN Document Server

    Abazov, Victor Mukhamedovich; Acharya, Bannanje Sripath; Adams, Mark Raymond; Adams, Todd; Agnew, James P; Alexeev, Guennadi D; Alkhazov, Georgiy D; Alton, Andrew K; Askew, Andrew Warren; Atkins, Scott; Augsten, Kamil; Avila, Carlos A; Badaud, Frederique; Bagby, Linda F; Baldin, Boris; Bandurin, Dmitry V; Banerjee, Sunanda; Barberis, Emanuela; Baringer, Philip S; Bartlett, JFrederick; Bassler, Ursula Rita; Bazterra, Victor; Bean, Alice L; Begalli, Marcia; Bellantoni, Leo; Beri, Suman B; Bernardi, Gregorio; Bernhard, Ralf Patrick; Bertram, Iain A; Besancon, Marc; Beuselinck, Raymond; Bhat, Pushpalatha C; Bhatia, Sudeep; Bhatnagar, Vipin; Blazey, Gerald Charles; Blessing, Susan K; Bloom, Kenneth A; Boehnlein, Amber S; Boline, Daniel Dooley; Boos, Edward E; Borissov, Guennadi; Borysova, Maryna; Borysov, Oleksandr; Brandt, Andrew; Brandt, Oleg; Brock, Raymond L; Bross, Alan D; Brown, Duncan Paul; Bu, Xue-Bing; Buehler, Marc; Buescher, Volker; Bunichev, Viacheslav Yevgenyevich; Burdin, Sergey; Buszello, Claus Peter; Camacho-Perez, Enrique; Casey, Brendan Cameron Kieran; Castilla-Valdez, Heriberto; Caughron, Seth Aaron; Chakrabarti, Subhendu; Chan, Kwok Ming Leo; Chandra, Avdhesh; Chapon, Emilien; Chen, Guo; Cho, Sung-Woong; Choi, Suyong; Choudhary, Brajesh C; Cihangir, Selcuk; Claes, Daniel R; Clutter, Justace Randall; Cooke, Michael P; Cooper, William Edward; Corcoran, Marjorie D; Couderc, Fabrice; Cousinou, Marie-Claude; Cutts, David; Das, Amitabha; Davies, Gavin John; de Jong, Sijbrand Jan; De La Cruz-Burelo, Eduard; Deliot, Frederic; Demina, Regina; Denisov, Dmitri S; Denisov, Sergei P; Desai, Satish Vijay; Deterre, Cecile; DeVaughan, Kayle Otis; Diehl, HThomas; Diesburg, Michael; Ding, Pengfei; Dominguez, DAaron M; Dubey, Abhinav Kumar; Dudko, Lev V; Duperrin, Arnaud; Dutt, Suneel; Eads, Michael T; Edmunds, Daniel L; Ellison, John A; Elvira, VDaniel; Enari, Yuji; Evans, Harold G; Evdokimov, Valeri N; Faure, Alexandre; Feng, Lei; Ferbel, Thomas; Fiedler, Frank; Filthaut, Frank; Fisher, Wade Cameron; Fisk, HEugene; Fortner, Michael R; Fox, Harald; Fuess, Stuart C; Garbincius, Peter H; Garcia-Bellido, Aran; Garcia-Gonzalez, Jose Andres; Gavrilov, Vladimir B; Geng, Weigang; Gerber, Cecilia Elena; Gershtein, Yuri S; Ginther, George E; Gogota, Olga; Golovanov, Georgy Anatolievich; Grannis, Paul D; Greder, Sebastien; Greenlee, Herbert B; Grenier, Gerald Jean; Gris, Phillipe Luc; Grivaz, Jean-Francois; Grohsjean, Alexander; Gruenendahl, Stefan; Gruenewald, Martin Werner; Guillemin, Thibault; Gutierrez, Gaston R; Gutierrez, Phillip; Haley, Joseph Glenn Biddle; Han, Liang; Harder, Kristian; Harel, Amnon; Hauptman, John Michael; Hays, Jonathan M; Head, Tim; Hebbeker, Thomas; Hedin, David R; Hegab, Hatim; Heinson, Ann; Heintz, Ulrich; Hensel, Carsten; Heredia-De La Cruz, Ivan; Herner, Kenneth Richard; Hesketh, Gavin G; Hildreth, Michael D; Hirosky, Robert James; Hoang, Trang; Hobbs, John D; Hoeneisen, Bruce; Hogan, Julie; Hohlfeld, Mark; Holzbauer, Jenny Lyn; Howley, Ian James; Hubacek, Zdenek; Hynek, Vlastislav; Iashvili, Ia; Ilchenko, Yuriy; Illingworth, Robert A; Ito, Albert S; Jabeen, Shabnam; Jaffre, Michel J; Jayasinghe, Ayesh; Jeong, Min-Soo; Jesik, Richard L; Jiang, Peng; Johns, Kenneth Arthur; Johnson, Emily; Johnson, Marvin E; Jonckheere, Alan M; Jonsson, Per Martin; Joshi, Jyoti; Jung, Andreas Werner; Juste, Aurelio; Kajfasz, Eric; Karmanov, Dmitriy Y; Katsanos, Ioannis; Kaur, Manbir; Kehoe, Robert Leo Patrick; Kermiche, Smain; Khalatyan, Norayr; Khanov, Alexander; Kharchilava, Avto; Kharzheev, Yuri N; Kiselevich, Ivan Lvovich; Kohli, Jatinder M; Kozelov, Alexander V; Kraus, James Alexander; Kumar, Ashish; Kupco, Alexander; Kurca, Tibor; Kuzmin, Valentin Alexandrovich; Lammers, Sabine Wedam; Lebrun, Patrice; Lee, Hyun-Su; Lee, Seh-Wook; Lee, William M; Lei, Xiaowen; Lellouch, Jeremie; Li, Dikai; Li, Hengne; Li, Liang; Li, Qi-Zhong; Lim, Jeong Ku; Lincoln, Donald W; Linnemann, James Thomas; Lipaev, Vladimir V; Lipton, Ronald J; Liu, Huanzhao; Liu, Yanwen; Lobodenko, Alexandre; Lokajicek, Milos; Lopes de Sa, Rafael; Luna-Garcia, Rene; Lyon, Adam Leonard; Maciel, Arthur KA; Madar, Romain; Magana-Villalba, Ricardo; Malik, Sudhir; Malyshev, Vladimir L; Mansour, Jason; Martinez-Ortega, Jorge; McCarthy, Robert L; Mcgivern, Carrie Lynne; Meijer, Melvin M; Melnitchouk, Alexander S; Menezes, Diego D; Mercadante, Pedro Galli; Merkin, Mikhail M; Meyer, Arnd; Meyer, Jorg Manfred; Miconi, Florian; Mondal, Naba K; Mulhearn, Michael James; Nagy, Elemer; Narain, Meenakshi; Nayyar, Ruchika; Neal, Homer A; Negret, Juan Pablo; Neustroev, Petr V; Nguyen, Huong Thi; Nunnemann, Thomas P; Orduna, Jose de Jesus Hernandez; Osman, Nicolas Ahmed; Osta, Jyotsna; Pal, Arnab; Parashar, Neeti; Parihar, Vivek; Park, Sung Keun; Partridge, Richard A; Parua, Nirmalya; Patwa, Abid; Penning, Bjoern; Perfilov, Maxim Anatolyevich; Peters, Reinhild Yvonne Fatima; Petridis, Konstantinos; Petrillo, Gianluca; Petroff, Pierre; Pleier, Marc-Andre; Podstavkov, Vladimir M; Popov, Alexey V; Prewitt, Michelle; Price, Darren; Prokopenko, Nikolay N; Qian, Jianming; Quadt, Arnulf; Quinn, Gene Breese; Ratoff, Peter N; Razumov, Ivan A; Ripp-Baudot, Isabelle; Rizatdinova, Flera; Rominsky, Mandy Kathleen; Ross, Anthony; Royon, Christophe; Rubinov, Paul Michael; Ruchti, Randal C; Sajot, Gerard; Sanchez-Hernandez, Alberto; Sanders, Michiel P; Santos, Angelo Souza; Savage, David G; Savitskyi, Mykola; Sawyer, HLee; Scanlon, Timothy P; Schamberger, RDean; Scheglov, Yury A; Schellman, Heidi M; Schwanenberger, Christian; Schwienhorst, Reinhard H; Sekaric, Jadranka; Severini, Horst; Shabalina, Elizaveta K; Shary, Viacheslav V; Shaw, Savanna; Shchukin, Andrey A; Simak, Vladislav J; Skubic, Patrick Louis; Slattery, Paul F; Smirnov, Dmitri V; Snow, Gregory R; Snow, Joel Mark; Snyder, Scott Stuart; Soldner-Rembold, Stefan; Sonnenschein, Lars; Soustruznik, Karel; Stark, Jan; Stoyanova, Dina A; Strauss, Michael G; Suter, Louise; Svoisky, Peter V; Titov, Maxim; Tokmenin, Valeriy V; Tsai, Yun-Tse; Tsybychev, Dmitri; Tuchming, Boris; Tully, Christopher George T; Uvarov, Lev; Uvarov, Sergey L; Uzunyan, Sergey A; Van Kooten, Richard J; van Leeuwen, Willem M; Varelas, Nikos; Varnes, Erich W; Vasilyev, Igor A; Verkheev, Alexander Yurievich; Vertogradov, Leonid S; Verzocchi, Marco; Vesterinen, Mika; Vilanova, Didier; Vokac, Petr; Wahl, Horst D; Wang, Michael HLS; Warchol, Jadwiga; Watts, Gordon Thomas; Wayne, Mitchell R; Weichert, Jonas; Welty-Rieger, Leah Christine; Williams, Mark Richard James; Wilson, Graham Wallace; Wobisch, Markus; Wood, Darien Robert; Wyatt, Terence R; Xie, Yunhe; Yamada, Ryuji; Yang, Siqi; Yasuda, Takahiro; Yatsunenko, Yuriy A; Ye, Wanyu; Ye, Zhenyu; Yin, Hang; Yip, Kin; Youn, Sungwoo; Yu, Jiaming; Zennamo, Joseph; Zhao, Tianqi Gilbert; Zhou, Bing; Zhu, Junjie; Zielinski, Marek; Zieminska, Daria; Zivkovic, Lidija

    2015-01-01

    We present a measurement of the cross sections for the associated production of a $W$ boson with at least one heavy quark jet, $b$ or $c$, in proton-antiproton collisions. Data corresponding to an integrated luminosity of 8.7 fb$^{-1}$ recorded with the D0 detector at the Fermilab Tevatron \\ppbar Collider at $\\sqrt{s}=1.96$ TeV are used to measure the cross sections differentially as a function of the jet transverse momenta in the range 20 to 150 GeV. These results are compared to calculations of perturbative QCD theory as well as predictions from Monte Carlo generators.

  17. Measurement of the $W+b$-jet and $W+c$-jet differential production cross sections in $p\\bar{p}$ collisions at $\\sqrt{s}=1.96$ TeV

    CERN Document Server

    Abazov, Victor Mukhamedovich; Acharya, Bannanje Sripath; Adams, Mark Raymond; Adams, Todd; Agnew, James P; Alexeev, Guennadi D; Alkhazov, Georgiy D; Alton, Andrew K; Askew, Andrew Warren; Atkins, Scott; Augsten, Kamil; Avila, Carlos A; Badaud, Frederique; Bagby, Linda F; Baldin, Boris; Bandurin, Dmitry V; Banerjee, Sunanda; Barberis, Emanuela; Baringer, Philip S; Bartlett, JFrederick; Bassler, Ursula Rita; Bazterra, Victor; Bean, Alice L; Begalli, Marcia; Bellantoni, Leo; Beri, Suman B; Bernardi, Gregorio; Bernhard, Ralf Patrick; Bertram, Iain A; Besancon, Marc; Beuselinck, Raymond; Bhat, Pushpalatha C; Bhatia, Sudeep; Bhatnagar, Vipin; Blazey, Gerald Charles; Blessing, Susan K; Bloom, Kenneth A; Boehnlein, Amber S; Boline, Daniel Dooley; Boos, Edward E; Borissov, Guennadi; Borysova, Maryna; Borysov, Oleksandr; Brandt, Andrew; Brandt, Oleg; Brock, Raymond L; Bross, Alan D; Brown, Duncan Paul; Bu, Xue-Bing; Buehler, Marc; Buescher, Volker; Bunichev, Viacheslav Yevgenyevich; Burdin, Sergey; Buszello, Claus Peter; Camacho-Perez, Enrique; Casey, Brendan Cameron Kieran; Castilla-Valdez, Heriberto; Caughron, Seth Aaron; Chakrabarti, Subhendu; Chan, Kwok Ming Leo; Chandra, Avdhesh; Chapon, Emilien; Chen, Guo; Cho, Sung-Woong; Choi, Suyong; Choudhary, Brajesh C; Cihangir, Selcuk; Claes, Daniel R; Clutter, Justace Randall; Cooke, Michael P; Cooper, William Edward; Corcoran, Marjorie D; Couderc, Fabrice; Cousinou, Marie-Claude; Cutts, David; Das, Amitabha; Davies, Gavin John; de Jong, Sijbrand Jan; De La Cruz-Burelo, Eduard; Deliot, Frederic; Demina, Regina; Denisov, Dmitri S; Denisov, Sergei P; Desai, Satish Vijay; Deterre, Cecile; DeVaughan, Kayle Otis; Diehl, HThomas; Diesburg, Michael; Ding, Pengfei; Dominguez, DAaron M; Dubey, Abhinav Kumar; Dudko, Lev V; Duperrin, Arnaud; Dutt, Suneel; Eads, Michael T; Edmunds, Daniel L; Ellison, John A; Elvira, VDaniel; Enari, Yuji; Evans, Harold G; Evdokimov, Valeri N; Faure, Alexandre; Feng, Lei; Ferbel, Thomas; Fiedler, Frank; Filthaut, Frank; Fisher, Wade Cameron; Fisk, HEugene; Fortner, Michael R; Fox, Harald; Fuess, Stuart C; Garbincius, Peter H; Garcia-Bellido, Aran; Garcia-Gonzalez, Jose Andres; Gavrilov, Vladimir B; Geng, Weigang; Gerber, Cecilia Elena; Gershtein, Yuri S; Ginther, George E; Gogota, Olga; Golovanov, Georgy Anatolievich; Grannis, Paul D; Greder, Sebastien; Greenlee, Herbert B; Grenier, Gerald Jean; Gris, Phillipe Luc; Grivaz, Jean-Francois; Grohsjean, Alexander; Gruenendahl, Stefan; Gruenewald, Martin Werner; Guillemin, Thibault; Gutierrez, Gaston R; Gutierrez, Phillip; Haley, Joseph Glenn Biddle; Han, Liang; Harder, Kristian; Harel, Amnon; Hauptman, John Michael; Hays, Jonathan M; Head, Tim; Hebbeker, Thomas; Hedin, David R; Hegab, Hatim; Heinson, Ann; Heintz, Ulrich; Hensel, Carsten; Heredia-De La Cruz, Ivan; Herner, Kenneth Richard; Hesketh, Gavin G; Hildreth, Michael D; Hirosky, Robert James; Hoang, Trang; Hobbs, John D; Hoeneisen, Bruce; Hogan, Julie; Hohlfeld, Mark; Holzbauer, Jenny Lyn; Howley, Ian James; Hubacek, Zdenek; Hynek, Vlastislav; Iashvili, Ia; Ilchenko, Yuriy; Illingworth, Robert A; Ito, Albert S; Jabeen, Shabnam; Jaffre, Michel J; Jayasinghe, Ayesh; Jeong, Min-Soo; Jesik, Richard L; Jiang, Peng; Johns, Kenneth Arthur; Johnson, Emily; Johnson, Marvin E; Jonckheere, Alan M; Jonsson, Per Martin; Joshi, Jyoti; Jung, Andreas Werner; Juste, Aurelio; Kajfasz, Eric; Karmanov, Dmitriy Y; Katsanos, Ioannis; Kaur, Manbir; Kehoe, Robert Leo Patrick; Kermiche, Smain; Khalatyan, Norayr; Khanov, Alexander; Kharchilava, Avto; Kharzheev, Yuri N; Kiselevich, Ivan Lvovich; Kohli, Jatinder M; Kozelov, Alexander V; Kraus, James Alexander; Kumar, Ashish; Kupco, Alexander; Kurca, Tibor; Kuzmin, Valentin Alexandrovich; Lammers, Sabine Wedam; Lebrun, Patrice; Lee, Hyeon-Seung; Lee, Seh-Wook; Lee, William M; Lei, Xiaowen; Lellouch, Jeremie; Li, Dikai; Li, Hengne; Li, Liang; Li, Qi-Zhong; Lim, Jeong Ku; Lincoln, Donald W; Linnemann, James Thomas; Lipaev, Vladimir V; Lipton, Ronald J; Liu, Huanzhao; Liu, Yanwen; Lobodenko, Alexandre; Lokajicek, Milos; Lopes de Sa, Rafael; Luna-Garcia, Rene; Lyon, Adam Leonard; Maciel, Arthur KA; Madar, Romain; Magana-Villalba, Ricardo; Malik, Sudhir; Malyshev, Vladimir L; Mansour, Jason; Martinez-Ortega, Jorge; McCarthy, Robert L; Mcgivern, Carrie Lynne; Meijer, Melvin M; Melnitchouk, Alexander S; Menezes, Diego D; Mercadante, Pedro Galli; Merkin, Mikhail M; Meyer, Arnd; Meyer, Jorg Manfred; Miconi, Florian; Mondal, Naba K; Mulhearn, Michael James; Nagy, Elemer; Narain, Meenakshi; Nayyar, Ruchika; Neal, Homer A; Negret, Juan Pablo; Neustroev, Petr V; Nguyen, Huong Thi; Nunnemann, Thomas P; Hernandez Orduna, Jose de Jesus; Osman, Nicolas Ahmed; Osta, Jyotsna; Pal, Arnab; Parashar, Neeti; Parihar, Vivek; Park, Sung Keun; Partridge, Richard A; Parua, Nirmalya; Patwa, Abid; Penning, Bjoern; Perfilov, Maxim Anatolyevich; Peters, Reinhild Yvonne Fatima; Petridis, Konstantinos; Petrillo, Gianluca; Petroff, Pierre; Pleier, Marc-Andre; Podstavkov, Vladimir M; Popov, Alexey V; Prewitt, Michelle; Price, Darren; Prokopenko, Nikolay N; Qian, Jianming; Quadt, Arnulf; Quinn, Gene Breese; Ratoff, Peter N; Razumov, Ivan A; Ripp-Baudot, Isabelle; Rizatdinova, Flera; Rominsky, Mandy Kathleen; Ross, Anthony; Royon, Christophe; Rubinov, Paul Michael; Ruchti, Randal C; Sajot, Gerard; Sanchez-Hernandez, Alberto; Sanders, Michiel P; Santos, Angelo Souza; Savage, David G; Savitskyi, Mykola; Sawyer, HLee; Scanlon, Timothy P; Schamberger, RDean; Scheglov, Yury A; Schellman, Heidi M; Schwanenberger, Christian; Schwienhorst, Reinhard H; Sekaric, Jadranka; Severini, Horst; Shabalina, Elizaveta K; Shary, Viacheslav V; Shaw, Savanna; Shchukin, Andrey A; Simak, Vladislav J; Skubic, Patrick Louis; Slattery, Paul F; Smirnov, Dmitri V; Snow, Gregory R; Snow, Joel Mark; Snyder, Scott Stuart; Soldner-Rembold, Stefan; Sonnenschein, Lars; Soustruznik, Karel; Stark, Jan; Stoyanova, Dina A; Strauss, Michael G; Suter, Louise; Svoisky, Peter V; Titov, Maxim; Tokmenin, Valeriy V; Tsai, Yun-Tse; Tsybychev, Dmitri; Tuchming, Boris; Tully, Christopher George T; Uvarov, Lev; Uvarov, Sergey L; Uzunyan, Sergey A; Van Kooten, Richard J; van Leeuwen, Willem M; Varelas, Nikos; Varnes, Erich W; Vasilyev, Igor A; Verkheev, Alexander Yurievich; Vertogradov, Leonid S; Verzocchi, Marco; Vesterinen, Mika; Vilanova, Didier; Vokac, Petr; Wahl, Horst D; Wang, Michael HLS; Warchol, Jadwiga; Watts, Gordon Thomas; Wayne, Mitchell R; Weichert, Jonas; Welty-Rieger, Leah Christine; Williams, Mark Richard James; Wilson, Graham Wallace; Wobisch, Markus; Wood, Darien Robert; Wyatt, Terence R; Xie, Yunhe; Yamada, Ryuji; Yang, Siqi; Yasuda, Takahiro; Yatsunenko, Yuriy A; Ye, Wanyu; Ye, Zhenyu; Yin, Hang; Yip, Kin; Youn, Sungwoo; Yu, Jiaming; Zennamo, Joseph; Zhao, Tianqi Gilbert; Zhou, Bing; Zhu, Junjie; Zielinski, Marek; Zieminska, Daria; Zivkovic, Lidija

    2015-04-09

    We present a measurement of the cross sections for the associated production of a $W$ boson with at least one heavy quark jet, $b$ or $c$, in proton-antiproton collisions. Data corresponding to an integrated luminosity of 8.7 fb$^{-1}$ recorded with the D0 detector at the Fermilab Tevatron \\ppbar Collider at $\\sqrt{s}=1.96$ TeV are used to measure the cross sections differentially as a function of the jet transverse momenta in the range 20 to 150 GeV. These results are compared to calculations of perturbative QCD theory as well as predictions from Monte Carlo generators.

  18. Search for new physics in lepton + photon + x events with 929 pb**-1 of p anti-p collisions at s**(1/2) = 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Loginov, A.; /Moscow, ITEP

    2006-10-01

    The authors present results of a search in 929 {+-} 56 pb{sup -1} of p{bar p} collisions at 1.96 TeV for the anomalous production of events containing a charged lepton ({ell}, either e or {mu}) and a photon ({gamma}), both with high transverse momentum, accompanied by additional signatures, X, including missing transverse energy (E{sub T}) and additional leptons and photons. They use the same selection criteria as in the previous CDF Run I search, but with an order-magnitude larger data set, a higher p{bar p} collision energy, and the CDF II detector.

  19. Measurement of 1/σ dσ/dy for Z/γ* → e+e- at √s= 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Yan, Ming [Univ. of Maryland, College Park, MD (United States)

    2007-03-01

    The author presents the measurement of p$\\bar{p}$ → Z/γ* → e+e- + X inclusive differential cross section as a function of boson rapidity. The data, which correspond to an integrated luminosity of 0.4 fb-1, were collected with D0 detector at Tevatron p$\\bar{p}$ collider. At the Run II energy of √s = 1.96 TeV, Z bosons are produced with rapidity out to ± 3. The cross section is measured in a mass range between 71 to 111 GeV for the allowed kinematic range.

  20. A Precision Measurement of the $B_{s}$ Lifetime in $p\\bar{p}$ Collisions at $\\sqrt{s} = 1.96$ TeV Using Partially and Fully Reconstructed Modes

    Energy Technology Data Exchange (ETDEWEB)

    Deisher, Amanda Jean [Univ. of California, Berkeley, CA (United States)

    2008-01-01

    We present a measurement of the Bs lifetime in fully and partially reconstructed $B_{s} \\to D_{s}(\\phi\\pi)X$ decays in ~ 1.3 fb$^-1$ of $p\\bar{p}$ collisions at $\\sqrt{s} = 1.96$ TeV collected by the CDF II detector at the Fermilab Tevatron. We measure cT ( Bs ) = 455.0 ± 12.2 (stat.) ± 8.2 (syst.) µm. The ratio of this result and the world average B0 lifetime yields T ( Bs ) / T ( B0 ) = 0.99 ± 0.03, which is in agreement with recent theoretical predictions.

  1. Measurement of the top quark pair production cross-section in dimuon final states in proton-antiproton collisions at 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Konrath, Jens Peter [Albert Ludwigs Univ., Freiburg (Germany)

    2008-10-24

    Particle physics deals with the fundamental building blocks of matter and their interactions. The vast number of subatomic particles can be reduced to twelve fundamental fermions, which interact by the exchange of spin-1 particles as described in the Standard Model (SM) of particle physics. The SM provides the best description of the subatomic world to date, despite the fact it does not include gravitation. Following the relation Λ = h/p, where h is Planck's constant, for the examination of physics at subatomic scales with size Λ probes with high momenta p are necessary. These high energies are accessible through particle colliders. Here, particles are accelerated and brought to collision at interaction points at which detectors are installed to record these particle collisions. Until the anticipated start-up of the Large Hadron Collider at CERN, the Tevatron collider at Fermilab near Chicago is the highest energy collider operating in the world, colliding protons and anti-protons at a center-of-mass energy of √s = 1.96 TeV. Its two interaction points are covered by the multi purpose particle detectors D0 and CDF. During the first data-taking period, known as Run I, the Tevatron operated at a center-of-mass energy of 1.8 TeV. This run period lasted from 1992 to 1996. During this period, the long-predicted top quark was discovered. From 1996 and 2001, the accelerator was upgraded to deliver higher instantaneous luminosities at its current center-of-mass energy. At the same time, the experiments were upgraded to take full advantage of the upgraded accelerator complex. The Tevatron is currently the only accelerator in the world with a sufficient energy to produce top quarks. Studying top quark production, decay and properties is an important part of the D0 and CDF physics programs. Because of its large mass, the top quark is a unique probe of the Standard Model, and an interesting environment to search for new physics. In this thesis, a measurement of the

  2. Identifying beauty quarks and measurement of the production cross-section of top quark pairs at {radical}s = 1.96 TeV in the D0 experiment; Etiquetage des quarks beaux et mesure de la section efficace de production de paires de quarks top a {radical}s=1,96 TeV dans l'experience DO

    Energy Technology Data Exchange (ETDEWEB)

    Greder, S

    2004-10-15

    The work presented in this thesis concerns the measurement of the top-anti-top production cross-section in the lepton + jets channel (electron and muon). The analysed data have been collected with the D0 detector between 2001 and 2004 at a center-of-mass energy of 1.96 TeV, at the Tevatron proton-antiproton collider located at Fermilab. These data correspond to an integrated luminosity of 160 pb-1 in each channel. Each top quark decays into a W boson and a b quark. The first part of this work has been focused on the elaboration of an algorithm, JLIP, aimed at identifying jets arising from b quark s decay products. This algorithm uses the impact parameter of the track s to assign a jet a probability that it originates from the primary interaction point. Its efficiency for top-anti-top events is about 45% with a rejected background of 99.7%. The second part of this work deals with the pre-selection step that allows isolating events which are likely to be compatible with a W+jets topology. Multi-jets and W+jets backgrounds are estimated from real data and simulation. The top pair production cross-section is extracted from candidate events that have at least three jets, one among them being tagged by the algorithm JLIP. Sources of systematics uncertainties have been studied in detail. Our results are the following, for the lepton + jets channel: {sigma}(tt-bar) = 8.28 (+1.31-1.21, stat) (+1.53-1.27, syst) (+0.53-0.53, lumi) pb. Results have been compared with the theoretical expectations and with other measurements performed in the D0 and CDF experiments. (author)

  3. Search for a High-Mass Higgs Boson Produced in Proton Anti-Proton Collisions at $\\sqrt{s} = 1.96$ Tev with an Hadronic t in the Final State

    Energy Technology Data Exchange (ETDEWEB)

    D' Errico, Maria [Univ. of Padua (Italy)

    2011-01-01

    In this Thesis a search for Higgs boson production has been performed analysing data gathered by the Collider Detector at Fermilab (CDF) from proton-antiproton (p$\\bar{p}$) collisions at the center of mass energy √s = 1.96 TeV. Event selection has been optimized on Higgs decaying into W+W- bosons in order to reconstruct final states with two charged leptons formed by either an electron and a tau or a muon and a tau focusing on taus decaying into hadrons. No evidence of Higgs production has been found analysing 4.8 fb-1 of data and an up- per limit has been set on the production cross section as a function of the mass mH in the range from 130 to 200 GeV/c2 with a 95% Confidence Level. For a Higgs mass hypothesis of 160 GeV/c2 the observed limit is 33.5 times the Standard Model predicted cross section σSM while the expected upper limit for the same mass is 19.6×σSM. The high recorded luminosity along with the development of new analysis techniques are expected to improve the CDF sensitivity to the search for Higgs boson with hadronic taus reconstructed in the final state, in the mass range 130 to 200 GeV/c2.

  4. Energy dependence of acceptance-corrected dielectron excess mass spectrum at mid-rapidity in Au+Au collisions at sNN=19.6 and 200 GeV

    Directory of Open Access Journals (Sweden)

    L. Adamczyk

    2015-11-01

    Full Text Available The acceptance-corrected dielectron excess mass spectra, where the known hadronic sources have been subtracted from the inclusive dielectron mass spectra, are reported for the first time at mid-rapidity |yee|<1 in minimum-bias Au+Au collisions at sNN=19.6 and 200 GeV. The excess mass spectra are consistently described by a model calculation with a broadened ρ spectral function for Mee<1.1 GeV/c2. The integrated dielectron excess yield at sNN=19.6 GeV for 0.4

  5. Study of direct photon production with heavy flavor jets in $p\\overline{p}$ collisions at $\\sqrt{s}=1.96$ TeV with DZero detector

    Energy Technology Data Exchange (ETDEWEB)

    Kaur, Manbir [Punjab U.

    2017-01-01

    corresponding to an integrated luminosity of $8.7$~fb$^{-1}$ at $\\sqrt{s}=$1.96~\\TeV collected with the \\DO detector at the Fermilab Tevatron Collider. %In this measurement, we follow an inclusive approach by allowing the final state with any additional jet(s) on top of the studied $b$-quark jets. Inclusive $\\gamma+2~b$-jet production may also originate from partonic subprocesses involving parton fragmentation into a photon. However, photon isolation requirements significantly reduces the contributions from such processes. The large data sample and use of advanced photon and $b$-jet identification tools enable us to measure the $\\gamma+2~b$-jet production cross section differentially as a function of $\\Ptg$. This allows for probing the dynamics of the production process over a wide kinematic range not studied before in other measurements of a vector boson + $b$-jet final state. The measured cross sections and their ratios are compared to the NLO perturbative Q CD calculations as well as predictions based on the $k_{\\rm T}$-factorization approach and those from the {\\sc sherpa} and {\\sc pythia} Monte Carlo event generators. We also measure the ratio of cross sections, $\\sigma(p\\bar{p}\\rightarrow Z+2~b~\\text{jets})$/$\\sigma(p\\bar{p}\\rightarrow Z+\\text{2~jets})$, for associated production of a $Z$ boson with at least two jets. This measurement uses data corresponding to an integrated luminosity of 9.7 fb$^{-1}$ collected by the \\DO experiment. The measured integrated ratio is in agreement with predictions from NLO perturbative QCD and the Monte Carlo event generators {\\sc alpgen} and {\\sc pythia}. A good theoretical description of this process is essential since it forms a major background for a variety of physics processes, including standard model Higgs boson production in association with a $Z$ boson, $ZH(H\\rightarrow b\\bar{b})$, and searches for supersymmetric partners of the $b$ quark. These results will improve our theoretical understanding as we search

  6. Studying Z/γ*+Jet Production in proton-antiproton collisions at √s = 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Nilsen, Henrik Wold [Albert Ludwigs Univ. of Freiburg (Germany)

    2009-07-01

    The production of jets in association with a Z/γ* boson is an example of an important class of processes at hadron colliders, namely vector boson + jet (V + jet) production. Comparisons of measurements of this class of processes with theory predictions constitute an important, fundamental test of the Standard Model of particle physics, and of the theory of QCD in particular. While having a smaller cross section than other V +jet processes, Z/γ*(→ e+e-) + jets production, with Z/γ* {yields} e+e-+μ-, has a distinct experimental signature allowing for measurements characterized by low backgrounds and a direct, precise measurement of the properties of the decay products of the Z/γ* boson. In this thesis, several new measurements of the properties of jets produced in association with a Z/γ* boson in p$\\bar{p}$ collisions at √s = 1.96 TeV are presented. The cross section for Z/γ*(→ e+e-) + N jet production (N ≤ 3) is measured, differential in the transverse momentum of the Nth jet in the event, normalized to the inclusive Z/γ* cross section. Also, the cross section for Z/γ*(→e+e-) + N jets (N ≥ 1) is measured, differential in the difference in azimuthal angle between the di-electron system and any jet in the event, normalized to unity. The data used in the measurements were collected by the D0 experiment located at the Tevatron Collider of the Fermi National Accelerator Laboratory and correspond to an integrated luminosity of 1.04 fb-1. The measured jet transverse momentum spectra are compared with the predictions of perturbative calculations at the next-to-leading order in the strong coupling constant. Given the low sensitivity of the calculations to model parameters, these comparisons represent a stringent test of perturbative QCD. One of the main goals currently being pursued in particle physics is the discovery of the only

  7. Search for new physics in electron-tau final states in proton - antiproton collisions at 1.96 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Noeding, Carsten [Albert Ludwigs Univ. of Freiburg (Germany)

    2006-04-01

    large energy regimes. Hence there are strong reasons to believe that the Standard Model is only a low-energy approximation to a more fundamental theory. One of the best studied candidates for an extension of the Standard Model is supersymmetry, which predicts the existence of a supersymmetric partner for each fundamental particle that differs only in spin. To allow different masses for Standard Model particles and their corresponding supersymmetric partners, supersymmetry must be broken. The mechanism behind supersymmetry breaking is currently unknown, however, various hypotheses exist. Supersymmetric models do not only solve the problem of the large quantum corrections to the Higgs boson mass, but they also allow the unification of the coupling constants at a common scale. In addition, certain supersymmetric models provide a suitable candidate for cold dark matter, which represents a large fraction of mass in our universe. Searches for supersymmetric particles have been performed by the four LEP experiments (ALEPH, DELPHI, L3, OPAL) up to the kinematic limit. Since no evidence for supersymmetric particles has been found, lower limits on their masses have been derived. The search for supersymmetry is now continuing at the Tevatron collider, located at the Fermi National Accelerator Laboratory in Batavia, Illinois. Two dedicated detector systems, CDF and D0, are installed at the Tevatron to analyze proton-antiproton collisions at a center-of-mass energy of 1.96 TeV. A particular promising discovery channel for supersymmetry within the Tevatron energy range is the trilepton channel. In this channel, the lighter supersymmetric partners of the Higgs and gauge bosons, the charginos and neutralinos, decay into final states with leptons or hadrons and missing energy. Using the leptonic final states, the signal can be separated from the large Standard Model background. Supersymmetry requires an extension of the Standard Model Higgs sector, leading to more than one neutral Higgs

  8. Measurement of the t anti-t production cross section in p anti-p collisions at s**(1/2) = 1.96-TeV using secondary vertex b tagging

    Energy Technology Data Exchange (ETDEWEB)

    Abazov, V.M.; Abbott, B.; Abolins, M.; Acharya, B.S.; Adams, M.; Adams, T.; Aguilo, E.; Ahn, S.H.; Ahsan, M.; Alexeev, G.D.; Alkhazov, G.; /Buenos Aires U. /Rio de

    2006-11-01

    We report a new measurement of the t{bar t} production cross section in p{bar p} collisions at a center-of-mass energy of 1.96 TeV using events with one charged lepton (electron or muon), missing transverse energy, and jets. Using 425 pb{sup -1} of data collected using the D0 detector at the Fermilab Tevatron Collider, and enhancing the t{bar t} content of the sample by tagging b jets with a secondary vertex tagging algorithm, the t{bar t} production cross section is measured to be: {sigma}{sub p{bar p} {yields} t{bar t}+X} = 6.6 {+-} 0.9(stat + syst) {+-} 0.4(lum) pb. This cross section is the most precise D0 measurement to date for t{bar t} production and is in good agreement with standard model expectations.

  9. Differential cross section d{\\sigma}/d(cos {\\theta}t) for top-quark-pair-production in p-pbar collisions at sqrt{s} = 1.96 TeV

    CERN Document Server

    Aaltonen, T.; Amidei, D.; Anastassov, A.; Annovi, A.; Antos, J.; Apollinari, G.; Appel, J.A.; Arisawa, T.; Artikov, A.; Asaadi, J.; Ashmanskas, W.; Auerbach, B.; Aurisano, A.; Azfar, F.; Badgett, W.; Bae, T.; Barbaro-Galtieri, A.; Barnes, V.E.; Barnett, B.A.; Barria, P.; Bartos, P.; Bauce, M.; Bedeschi, F.; Behari, S.; Bellettini, G.; Bellinger, J.; Benjamin, D.; Beretvas, A.; Bhatti, A.; Bland, K.R.; Blumenfeld, B.; Bocci, A.; Bodek, A.; Bortoletto, D.; Boudreau, J.; Boveia, A.; Brigliadori, L.; Bromberg, C.; Brucken, E.; Budagov, J.; Budd, H.S.; Burkett, K.; Busetto, G.; Bussey, P.; Butti, P.; Buzatu, A.; Calamba, A.; Camarda, S.; Campanelli, M.; Canelli, F.; Carls, B.; Carlsmith, D.; Carosi, R.; Carrillo, S.; Casal, B.; Casarsa, M.; Castro, A.; Catastini, P.; Cauz, D.; Cavaliere, V.; Cavalli-Sforza, M.; Cerri, A.; Cerrito, L.; Chen, Y.C.; Chertok, M.; Chiarelli, G.; Chlachidze, G.; Cho, K.; Chokheli, D.; Ciocci, M.A.; Clark, A.; Clarke, C.; Convery, M.E.; Conway, J.; Corbo, M.; Cordelli, M.; Cox, C.A.; Cox, D.J.; Cremonesi, M.; Cruz, D.; Cuevas, J.; Culbertson, R.; d'Ascenzo, N.; Datta, M.; de Barbaro, P.; Demortier, L.; Deninno, M.; d'Errico, M.; Devoto, F.; Di Canto, A.; Di Ruzza, B.; Dittmann, J.R.; D'Onofrio, M.; Donati, S.; Dorigo, M.; Driutti, A.; Ebina, K.; Edgar, R.; Elagin, A.; Erbacher, R.; Errede, S.; Esham, B.; Eusebi, R.; Farrington, S.; Fernandez Ramos, J.P.; Field, R.; Flanagan, G.; Forrest, R.; Franklin, M.; Freeman, J.C.; Frisch, H.; Funakoshi, Y.; Garfinkel, A.F.; Garosi, P.; Gerberich, H.; Gerchtein, E.; Giagu, S.; Giakoumopoulou, V.; Gibson, K.; Ginsburg, C.M.; Giokaris, N.; Giromini, P.; Giurgiu, G.; Glagolev, V.; Glenzinski, D.; Gold, M.; Goldin, D.; Golossanov, A.; Gomez, G.; Gomez-Ceballos, G.; Goncharov, M.; Gonzalez Lopez, O.; Gorelov, I.; Goshaw, A.T.; Goulianos, K.; Gramellini, E.; Grinstein, S.; Grosso-Pilcher, C.; Group, R.C.; Guimaraes da Costa, J.; Hahn, S.R.; Han, J.Y.; Happacher, F.; Hara, K.; Hare, M.; Harr, R.F.; Harrington-Taber, T.; Hatakeyama, K.; Hays, C.; Heinrich, J.; Herndon, M.; Hocker, A.; Hong, Z.; Hopkins, W.; Hou, S.; Hughes, R.E.; Husemann, U.; Hussein, M.; Huston, J.; Introzzi, G.; Iori, M.; Ivanov, A.; James, E.; Jang, D.; Jayatilaka, B.; Jeon, E.J.; Jindariani, S.; Jones, M.; Joo, K.K.; Jun, S.Y.; Junk, T.R.; Kambeitz, M.; Kamon, T.; Karchin, P.E.; Kasmi, A.; Kato, Y.; Ketchum, W.; Keung, J.; Kilminster, B.; Kim, D.H.; Kim, H.S.; Kim, J.E.; Kim, M.J.; Kim, S.B.; Kim, S.H.; Kim, Y.J.; Kim, Y.K.; Kimura, N.; Kirby, M.; Knoepfel, K.; Kondo, K.; Kong, D.J.; Konigsberg, J.; Kotwal, A.V.; Kreps, M.; Kroll, J.; Kruse, M.; Kuhr, T.; Kurata, M.; Laasanen, A.T.; Lammel, S.; Lancaster, M.; Lannon, K.; Latino, G.; Lee, H.S.; Lee, J.S.; Leo, S.; Leone, S.; Lewis, J.D.; Limosani, A.; Lipeles, E.; Lister, A.; Liu, H.; Liu, Q.; Liu, T.; Lockwitz, S.; Loginov, A.; Luca, A.; Lucchesi, D.; Lueck, J.; Lujan, P.; Lukens, P.; Lungu, G.; Lys, J.; Lysak, R.; Madrak, R.; Maestro, P.; Malik, S.; Manca, G.; Manousakis-Katsikakis, A.; Margaroli, F.; Marino, P.; Martinez, M.; Matera, K.; Mattson, M.E.; Mazzacane, A.; Mazzanti, P.; McNulty, R.; Mehta, A.; Mehtala, P.; Mesropian, C.; Miao, T.; Mietlicki, D.; Mitra, A.; Miyake, H.; Moed, S.; Moggi, N.; Moon, C.S.; Moore, R.; Morello, M.J.; Mukherjee, A.; Muller, Th.; Murat, P.; Mussini, M.; Nachtman, J.; Nagai, Y.; Naganoma, J.; Nakano, I.; Napier, A.; Nett, J.; Neu, C.; Nigmanov, T.; Nodulman, L.; Noh, S.Y.; Norniella, O.; Oakes, L.; Oh, S.H.; Oh, Y.D.; Oksuzian, I.; Okusawa, T.; Orava, R.; Ortolan, L.; Pagliarone, C.; Palencia, E.; Palni, P.; Papadimitriou, V.; Parker, W.; Pauletta, G.; Paulini, M.; Paus, C.; Phillips, T.J.; Piacentino, G.; Pianori, E.; Pilot, J.; Pitts, K.; Plager, C.; Pondrom, L.; Poprocki, S.; Potamianos, K.; Pranko, A.; Prokoshin, F.; Ptohos, F.; Punzi, G.; Ranjan, N.; Redondo Fernandez, I.; Renton, P.; Rescigno, M.; Rimondi, F.; Ristori, L.; Robson, A.; Rodriguez, T.; Rolli, S.; Ronzani, M.; Roser, R.; Rosner, J.L.; Ruffini, F.; Ruiz, A.; Russ, J.; Rusu, V.; Sakumoto, W.K.; Sakurai, Y.; Santi, L.; Sato, K.; Saveliev, V.; Savoy-Navarro, A.; Schlabach, P.; Schmidt, E.E.; Schwarz, T.; Scodellaro, L.; Scuri, F.; Seidel, S.; Seiya, Y.; Semenov, A.; Sforza, F.; Shalhout, S.Z.; Shears, T.; Shepard, P.F.; Shimojima, M.; Shochet, M.; Shreyber-Tecker, I.; Simonenko, A.; Sinervo, P.; Sliwa, K.; Smith, J.R.; Snider, F.D.; Song, H.; Sorin, V.; Stancari, M.; St. Denis, R.; Stelzer, B.; Stelzer-Chilton, O.; Stentz, D.; Strologas, J.; Sudo, Y.; Sukhanov, A.; Suslov, I.; Takemasa, K.; Takeuchi, Y.; Tang, J.; Tecchio, M.; Teng, P.K.; Thom, J.; Thomson, E.; Thukral, V.; Toback, D.; Tokar, S.; Tollefson, K.; Tomura, T.; Tonelli, D.; Torre, S.; Torretta, D.; Totaro, P.; Trovato, M.; Ukegawa, F.; Uozumi, S.; Vazquez, F.; Velev, G.; Vellidis, C.; Vernieri, C.; Vidal, M.; Vilar, R.; Vizan, J.; Vogel, M.; Volpi, G.; Wagner, P.; Wallny, R.; Wang, S.M.; Warburton, A.; Waters, D.; Wester, W.C., III; Whiteson, D.; Wicklund, A.B.; Wilbur, S.; Williams, H.H.; Wilson, J.S.; Wilson, P.; Winer, B.L.; Wittich, P.; Wolbers, S.; Wolfe, H.; Wright, T.; Wu, X.; Wu, Z.; Yamamoto, K.; Yamato, D.; Yang, T.; Yang, U.K.; Yang, Y.C.; Yao, W.M.; Yeh, G.P.; Yi, K.; Yoh, J.; Yorita, K.; Yoshida, T.; Yu, G.B.; Yu, I.; Zanetti, A.M.; Zeng, Y.; Zhou, C.; Zucchelli, S.

    2013-10-30

    We report a measurement of the differential cross section, d{\\sigma}/d(cos {\\theta}t), for top-quark-pair production as a function of the top-quark production angle in proton-antiproton collisions at sqrt{s} = 1.96 TeV. This measurement is performed using data collected with the CDF II detector at the Tevatron, corresponding to an integrated luminosity of 9.4/fb. We employ the Legendre polynomials to characterize the shape of the differential cross section at the parton level. The observed Legendre coefficients are in good agreement with the prediction of the next-to-leading-order standard-model calculation, with the exception of an excess linear-term coefficient, a1 = 0.40 +- 0.12, compared to the standard-model prediction of a1 = 0.15^{+0.07}_{-0.03}.

  10. Measurement of differential production cross section for $Z/\\gamma^*$ bosons in association with jets in $p\\bar{p}$ collisions at $\\sqrt{s}=1.96$ TeV

    CERN Document Server

    Aaltonen, Timo Antero; Amidei, Dante E; Anastassov, Anton Iankov; Annovi, Alberto; Antos, Jaroslav; Apollinari, Giorgio; Appel, Jeffrey A; Arisawa, Tetsuo; Artikov, Akram Muzafarovich; Asaadi, Jonathan A; Ashmanskas, William Joseph; Auerbach, Benjamin; Aurisano, Adam J; Azfar, Farrukh A; Badgett, William Farris; Bae, Taegil; Barbaro-Galtieri, Angela; Barnes, Virgil E; Barnett, Bruce Arnold; Barria, Patrizia; Bartos, Pavol; Bauce, Matteo; Bedeschi, Franco; Behari, Satyajit; Bellettini, Giorgio; Bellinger, James Nugent; Benjamin, Douglas P; Beretvas, Andrew F; Bhatti, Anwar Ahmad; Bland, Karen Renee; Blumenfeld, Barry J; Bocci, Andrea; Bodek, Arie; Bortoletto, Daniela; Boudreau, Joseph Francis; Boveia, Antonio; Brigliadori, Luca; Bromberg, Carl Michael; Brucken, Erik; Budagov, Ioulian A; Budd, Howard Scott; Burkett, Kevin Alan; Busetto, Giovanni; Bussey, Peter John; Butti, Pierfrancesco; Buzatu, Adrian; Calamba, Aristotle; Camarda, Stefano; Campanelli, Mario; Canelli, Florencia; Carls, Benjamin; Carlsmith, Duncan L; Carosi, Roberto; Carrillo Moreno, Salvador; Casal Larana, Bruno; Casarsa, Massimo; Castro, Andrea; Catastini, Pierluigi; Cauz, Diego; Cavaliere, Viviana; Cerri, Alessandro; Cerrito, Lucio; Chen, Yen-Chu; Chertok, Maxwell Benjamin; Chiarelli, Giorgio; Chlachidze, Gouram; Cho, Kihyeon; Chokheli, Davit; Clark, Allan Geoffrey; Clarke, Christopher Joseph; Convery, Mary Elizabeth; Conway, John Stephen; Corbo, Matteo; Cordelli, Marco; Cox, Charles Alexander; Cox, David Jeremy; Cremonesi, Matteo; Cruz Alonso, Daniel; Cuevas Maestro, Javier; Culbertson, Raymond Lloyd; D'Ascenzo, Nicola; Datta, Mousumi; de Barbaro, Pawel; Demortier, Luc M; Deninno, Maria Maddalena; D'Errico, Maria; Devoto, Francesco; Di Canto, Angelo; Di Ruzza, Benedetto; Dittmann, Jay Richard; Donati, Simone; D'Onofrio, Monica; Dorigo, Mirco; Driutti, Anna; Ebina, Koji; Edgar, Ryan Christopher; Elagin, Andrey L; Erbacher, Robin D; Errede, Steven Michael; Esham, Benjamin; Farrington, Sinead Marie; Fernández Ramos, Juan Pablo; Field, Richard D; Flanagan, Gene U; Forrest, Robert David; Franklin, Melissa EB; Freeman, John Christian; Frisch, Henry J; Funakoshi, Yujiro; Galloni, Camilla; Garfinkel, Arthur F; Garosi, Paola; Gerberich, Heather Kay; Gerchtein, Elena A; Giagu, Stefano; Giakoumopoulou, Viktoria Athina; Gibson, Karen Ruth; Ginsburg, Camille Marie; Giokaris, Nikos D; Giromini, Paolo; Glagolev, Vladimir; Glenzinski, Douglas Andrew; Gold, Michael S; Goldin, Daniel; Golossanov, Alexander; Gomez, Gervasio; Gomez-Ceballos, Guillelmo; Goncharov, Maxim T; González López, Oscar; Gorelov, Igor V; Goshaw, Alfred T; Goulianos, Konstantin A; Gramellini, Elena; Grosso-Pilcher, Carla; Group, Robert Craig; Guimaraes da Costa, Joao; Hahn, Stephen R; Han, Ji-Yeon; Happacher, Fabio; Hara, Kazuhiko; Hare, Matthew Frederick; Harr, Robert Francis; Harrington-Taber, Timothy; Hatakeyama, Kenichi; Hays, Christopher Paul; Heinrich, Joel G; Herndon, Matthew Fairbanks; Hocker, James Andrew; Hong, Ziqing; Hopkins, Walter Howard; Hou, Suen Ray; Hughes, Richard Edward; Husemann, Ulrich; Hussein, Mohammad; Huston, Joey Walter; Introzzi, Gianluca; Iori, Maurizio; Ivanov, Andrew Gennadievich; James, Eric B; Jang, Dongwook; Jayatilaka, Bodhitha Anjalike; Jeon, Eun-Ju; Jindariani, Sergo Robert; Jones, Matthew T; Joo, Kyung Kwang; Jun, Soon Yung; Junk, Thomas R; Kambeitz, Manuel; Kamon, Teruki; Karchin, Paul Edmund; Kasmi, Azeddine; Kato, Yukihiro; Ketchum, Wesley Robert; Keung, Justin Kien; Kilminster, Benjamin John; Kim, DongHee; Kim, Hyunsoo; Kim, Jieun; Kim, Min Jeong; Kim, Shin-Hong; Kim, Soo Bong; Kim, Young-Jin; Kim, Young-Kee; Kimura, Naoki; Kirby, Michael H; Knoepfel, Kyle James; Kondo, Kunitaka; Kong, Dae Jung; Konigsberg, Jacobo; Kotwal, Ashutosh Vijay; Kreps, Michal; Kroll, IJoseph; Kruse, Mark Charles; Kuhr, Thomas; Kurata, Masakazu; Laasanen, Alvin Toivo; Lammel, Stephan; Lancaster, Mark; Lannon, Kevin Patrick; Latino, Giuseppe; Lee, Hyun Su; Lee, Jaison; Leo, Sabato; Leone, Sandra; Lewis, Jonathan D; Limosani, Antonio; Lipeles, Elliot David; Lister, Alison; Liu, Hao; Liu, Qiuguang; Liu, Tiehui Ted; Lockwitz, Sarah E; Loginov, Andrey Borisovich; Lucchesi, Donatella; Lucà, Alessandra; Lueck, Jan; Lujan, Paul Joseph; Lukens, Patrick Thomas; Lungu, Gheorghe; Lys, Jeremy E; Lysak, Roman; Madrak, Robyn Leigh; Maestro, Paolo; Malik, Sarah Alam; Manca, Giulia; Manousakis-Katsikakis, Arkadios; Marchese, Luigi; Margaroli, Fabrizio; Marino, Christopher Phillip; Matera, Keith; Mattson, Mark Edward; Mazzacane, Anna; Mazzanti, Paolo; McNulty, Ronan; Mehta, Andrew; Mehtala, Petteri; Mesropian, Christina; Miao, Ting; Mietlicki, David John; Mitra, Ankush; Miyake, Hideki; Moed, Shulamit; Moggi, Niccolo; Moon, Chang-Seong; Moore, Ronald Scott; Morello, Michael Joseph; Mukherjee, Aseet; Muller, Thomas; Murat, Pavel A; Mussini, Manuel; Nachtman, Jane Marie; Nagai, Yoshikazu; Naganoma, Junji; Nakano, Itsuo; Napier, Austin; Nett, Jason Michael; Neu, Christopher Carl; Nigmanov, Turgun S; Nodulman, Lawrence J; Noh, Seoyoung; Norniella Francisco, Olga; Oakes, Louise Beth; Oh, Seog Hwan; Oh, Young-do; Oksuzian, Iuri Artur; Okusawa, Toru; Orava, Risto Olavi; Ortolan, Lorenzo; Pagliarone, Carmine Elvezio; Palencia, Jose Enrique; Palni, Prabhakar; Papadimitriou, Vaia; Parker, William Chesluk; Pauletta, Giovanni; Paulini, Manfred; Paus, Christoph Maria Ernst; Phillips, Thomas J; Pianori, Elisabetta; Pilot, Justin Robert; Pitts, Kevin T; Plager, Charles; Pondrom, Lee G; Poprocki, Stephen; Potamianos, Karolos Jozef; Pranko, Aliaksandr Pavlovich; Prokoshin, Fedor; Ptohos, Fotios K; Punzi, Giovanni; Redondo Fernández, Ignacio; Renton, Peter B; Rescigno, Marco; Rimondi, Franco; Ristori, Luciano; Robson, Aidan; Rodriguez, Tatiana Isabel; Rolli, Simona; Ronzani, Manfredi; Roser, Robert Martin; Rosner, Jonathan L; Ruffini, Fabrizio; Ruiz Jimeno, Alberto; Russ, James S; Rusu, Vadim Liviu; Sakumoto, Willis Kazuo; Sakurai, Yuki; Santi, Lorenzo; Sato, Koji; Saveliev, Valeri; Savoy-Navarro, Aurore; Schlabach, Philip; Schmidt, Eugene E; Schwarz, Thomas A; Scodellaro, Luca; Scuri, Fabrizio; Seidel, Sally C; Seiya, Yoshihiro; Semenov, Alexei; Sforza, Federico; Shalhout, Shalhout Zaki; Shears, Tara G; Shepard, Paul F; Shimojima, Makoto; Shochet, Melvyn J; Shreyber-Tecker, Irina; Simonenko, Alexander V; Sliwa, Krzysztof Jan; Smith, John Rodgers; Snider, Frederick Douglas; Song, Hao; Sorin, Maria Veronica; St Denis, Richard Dante; Stancari, Michelle Dawn; Stentz, Dale James; Strologas, John; Sudo, Yuji; Sukhanov, Alexander I; Suslov, Igor M; Takemasa, Ken-ichi; Takeuchi, Yuji; Tang, Jian; Tecchio, Monica; Teng, Ping-Kun; Thom, Julia; Thomson, Evelyn Jean; Thukral, Vaikunth; Toback, David A; Tokar, Stanislav; Tollefson, Kirsten Anne; Tomura, Tomonobu; Tonelli, Diego; Torre, Stefano; Torretta, Donatella; Totaro, Pierluigi; Trovato, Marco; Ukegawa, Fumihiko; Uozumi, Satoru; Velev, Gueorgui; Vellidis, Konstantinos; Vernieri, Caterina; Vidal Marono, Miguel; Vilar Cortabitarte, Rocio; Vizán Garcia, Jesus Manuel; Vogel, Marcelo; Volpi, Guido; Vázquez-Valencia, Elsa Fabiola; Wagner, Peter; Wallny, Rainer S; Wang, Song-Ming; Waters, David S; Wester, William Carl; Whiteson, Daniel O; Wicklund, Arthur Barry; Wilbur, Scott; Williams, Hugh H; Wilson, Jonathan Samuel; Wilson, Peter James; Winer, Brian L; Wittich, Peter; Wolbers, Stephen A; Wolfe, Homer; Wright, Thomas Roland; Wu, Xin; Wu, Zhenbin; Yamamoto, Kazuhiro; Yamato, Daisuke; Yang, Tingjun; Yang, Un-Ki; Yang, Yu Chul; Yao, Wei-Ming; Yeh, Gong Ping; Yi, Kai; Yoh, John; Yorita, Kohei; Yoshida, Takuo; Yu, Geum Bong; Yu, Intae; Zanetti, Anna Maria; Zeng, Yu; Zhou, Chen; Zucchelli, Stefano

    2015-01-06

    Differential cross sections for the production of $Z$ bosons or off-shell photons $\\gamma^*$ in association with jets are measured in proton-antiproton collisions at center-of-mass energy $\\sqrt{s}=1.96$ TeV using the full data set collected with the Collider Detector at Fermilab in Tevatron Run II, and corresponding to 9.6 fb$^{-1}$ of integrated luminosity. Results include first measurements at CDF of differential cross sections in events with a $Z/\\gamma^*$ boson and three or more jets, the inclusive cross section for production of $Z/\\gamma^*$ and four or more jets, and cross sections as functions of various angular observables in lower jet-multiplicity final states. Measured cross sections are compared to several theoretical predictions.

  11. Search for the pair production of scalar top quarks in the acoplanar charm jet final state in p anti-p collisions at s**(1/2) = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Abazov, V.M.; Abbott, B.; Abolins, M.; Acharya, B.S.; Adams, M.; Adams, T.; Aguilo, E.; Ahn, S.H.; Ahsan, M.; Alexeev, G.D.; Alkhazov, G.; /Buenos Aires U. /Rio de

    2006-11-01

    A search for the pair production of scalar top quarks, {bar t}, has been performed in 360 pb{sup -1} of data from p{bar p} collisions at a center-of-mass energy of 1.96 TeV, collected by the D0 detector at the Fermilab Tevatron collider. The {bar t} decay mode considered is {bar t} {yields} c{bar {chi}}{sub 1}{sup 0}, where {bar {chi}}{sub 1}{sup 0} is the lightest supersymmetric particle. The topology analyzed therefore consists of a pair of acoplanar heavy-flavor jets with missing transverse energy. The data show good agreement with the standard model expectation, and a 95% C.L. exclusion domain in the (m{sub {tilde t}}, m{sub {tilde {chi}}{sub 1}{sup 0}}) plane has been determined, extending the domain excluded by previous experiments.

  12. Measurement of differential production cross sections for Z /γ* bosons in association with jets in p p ¯ collisions at √{s }=1.96 TeV

    Science.gov (United States)

    Aaltonen, T.; Amerio, S.; Amidei, D.; Anastassov, A.; Annovi, A.; Antos, J.; Apollinari, G.; Appel, J. A.; Arisawa, T.; Artikov, A.; Asaadi, J.; Ashmanskas, W.; Auerbach, B.; Aurisano, A.; Azfar, F.; Badgett, W.; Bae, T.; Barbaro-Galtieri, A.; Barnes, V. E.; Barnett, B. A.; Barria, P.; Bartos, P.; Bauce, M.; Bedeschi, F.; Behari, S.; Bellettini, G.; Bellinger, J.; Benjamin, D.; Beretvas, A.; Bhatti, A.; Bland, K. R.; Blumenfeld, B.; Bocci, A.; Bodek, A.; Bortoletto, D.; Boudreau, J.; Boveia, A.; Brigliadori, L.; Bromberg, C.; Brucken, E.; Budagov, J.; Budd, H. S.; Burkett, K.; Busetto, G.; Bussey, P.; Butti, P.; Buzatu, A.; Calamba, A.; Camarda, S.; Campanelli, M.; Canelli, F.; Carls, B.; Carlsmith, D.; Carosi, R.; Carrillo, S.; Casal, B.; Casarsa, M.; Castro, A.; Catastini, P.; Cauz, D.; Cavaliere, V.; Cerri, A.; Cerrito, L.; Chen, Y. C.; Chertok, M.; Chiarelli, G.; Chlachidze, G.; Cho, K.; Chokheli, D.; Clark, A.; Clarke, C.; Convery, M. E.; Conway, J.; Corbo, M.; Cordelli, M.; Cox, C. A.; Cox, D. J.; Cremonesi, M.; Cruz, D.; Cuevas, J.; Culbertson, R.; d'Ascenzo, N.; Datta, M.; de Barbaro, P.; Demortier, L.; Deninno, M.; D'Errico, M.; Devoto, F.; Di Canto, A.; Di Ruzza, B.; Dittmann, J. R.; Donati, S.; D'Onofrio, M.; Dorigo, M.; Driutti, A.; Ebina, K.; Edgar, R.; Elagin, A.; Erbacher, R.; Errede, S.; Esham, B.; Farrington, S.; Fernández Ramos, J. P.; Field, R.; Flanagan, G.; Forrest, R.; Franklin, M.; Freeman, J. C.; Frisch, H.; Funakoshi, Y.; Galloni, C.; Garfinkel, A. F.; Garosi, P.; Gerberich, H.; Gerchtein, E.; Giagu, S.; Giakoumopoulou, V.; Gibson, K.; Ginsburg, C. M.; Giokaris, N.; Giromini, P.; Glagolev, V.; Glenzinski, D.; Gold, M.; Goldin, D.; Golossanov, A.; Gomez, G.; Gomez-Ceballos, G.; Goncharov, M.; González López, O.; Gorelov, I.; Goshaw, A. T.; Goulianos, K.; Gramellini, E.; Grosso-Pilcher, C.; Group, R. C.; Guimaraes da Costa, J.; Hahn, S. R.; Han, J. Y.; Happacher, F.; Hara, K.; Hare, M.; Harr, R. F.; Harrington-Taber, T.; Hatakeyama, K.; Hays, C.; Heinrich, J.; Herndon, M.; Hocker, A.; Hong, Z.; Hopkins, W.; Hou, S.; Hughes, R. E.; Husemann, U.; Hussein, M.; Huston, J.; Introzzi, G.; Iori, M.; Ivanov, A.; James, E.; Jang, D.; Jayatilaka, B.; Jeon, E. J.; Jindariani, S.; Jones, M.; Joo, K. K.; Jun, S. Y.; Junk, T. R.; Kambeitz, M.; Kamon, T.; Karchin, P. E.; Kasmi, A.; Kato, Y.; Ketchum, W.; Keung, J.; Kilminster, B.; Kim, D. H.; Kim, H. S.; Kim, J. E.; Kim, M. J.; Kim, S. H.; Kim, S. B.; Kim, Y. J.; Kim, Y. K.; Kimura, N.; Kirby, M.; Knoepfel, K.; Kondo, K.; Kong, D. J.; Konigsberg, J.; Kotwal, A. V.; Kreps, M.; Kroll, J.; Kruse, M.; Kuhr, T.; Kurata, M.; Laasanen, A. T.; Lammel, S.; Lancaster, M.; Lannon, K.; Latino, G.; Lee, H. S.; Lee, J. S.; Leo, S.; Leone, S.; Lewis, J. D.; Limosani, A.; Lipeles, E.; Lister, A.; Liu, H.; Liu, Q.; Liu, T.; Lockwitz, S.; Loginov, A.; Lucchesi, D.; Lucà, A.; Lueck, J.; Lujan, P.; Lukens, P.; Lungu, G.; Lys, J.; Lysak, R.; Madrak, R.; Maestro, P.; Malik, S.; Manca, G.; Manousakis-Katsikakis, A.; Marchese, L.; Margaroli, F.; Marino, P.; Matera, K.; Mattson, M. E.; Mazzacane, A.; Mazzanti, P.; McNulty, R.; Mehta, A.; Mehtala, P.; Mesropian, C.; Miao, T.; Mietlicki, D.; Mitra, A.; Miyake, H.; Moed, S.; Moggi, N.; Moon, C. S.; Moore, R.; Morello, M. J.; Mukherjee, A.; Muller, Th.; Murat, P.; Mussini, M.; Nachtman, J.; Nagai, Y.; Naganoma, J.; Nakano, I.; Napier, A.; Nett, J.; Neu, C.; Nigmanov, T.; Nodulman, L.; Noh, S. Y.; Norniella, O.; Oakes, L.; Oh, S. H.; Oh, Y. D.; Oksuzian, I.; Okusawa, T.; Orava, R.; Ortolan, L.; Pagliarone, C.; Palencia, E.; Palni, P.; Papadimitriou, V.; Parker, W.; Pauletta, G.; Paulini, M.; Paus, C.; Phillips, T. J.; Pianori, E.; Pilot, J.; Pitts, K.; Plager, C.; Pondrom, L.; Poprocki, S.; Potamianos, K.; Pranko, A.; Prokoshin, F.; Ptohos, F.; Punzi, G.; Redondo Fernández, I.; Renton, P.; Rescigno, M.; Rimondi, F.; Ristori, L.; Robson, A.; Rodriguez, T.; Rolli, S.; Ronzani, M.; Roser, R.; Rosner, J. L.; Ruffini, F.; Ruiz, A.; Russ, J.; Rusu, V.; Sakumoto, W. K.; Sakurai, Y.; Santi, L.; Sato, K.; Saveliev, V.; Savoy-Navarro, A.; Schlabach, P.; Schmidt, E. E.; Schwarz, T.; Scodellaro, L.; Scuri, F.; Seidel, S.; Seiya, Y.; Semenov, A.; Sforza, F.; Shalhout, S. Z.; Shears, T.; Shepard, P. F.; Shimojima, M.; Shochet, M.; Shreyber-Tecker, I.; Simonenko, A.; Sliwa, K.; Smith, J. R.; Snider, F. D.; Song, H.; Sorin, V.; St. Denis, R.; Stancari, M.; Stentz, D.; Strologas, J.; Sudo, Y.; Sukhanov, A.; Suslov, I.; Takemasa, K.; Takeuchi, Y.; Tang, J.; Tecchio, M.; Teng, P. K.; Thom, J.; Thomson, E.; Thukral, V.; Toback, D.; Tokar, S.; Tollefson, K.; Tomura, T.; Tonelli, D.; Torre, S.; Torretta, D.; Totaro, P.; Trovato, M.; Ukegawa, F.; Uozumi, S.; Velev, G.; Vellidis, C.; Vernieri, C.; Vidal, M.; Vilar, R.; Vizán, J.; Vogel, M.; Volpi, G.; Vázquez, F.; Wagner, P.; Wallny, R.; Wang, S. M.; Waters, D.; Wester, W. C.; Whiteson, D.; Wicklund, A. B.; Wilbur, S.; Williams, H. H.; Wilson, J. S.; Wilson, P.; Winer, B. L.; Wittich, P.; Wolbers, S.; Wolfe, H.; Wright, T.; Wu, X.; Wu, Z.; Yamamoto, K.; Yamato, D.; Yang, T.; Yang, U. K.; Yang, Y. C.; Yao, W.-M.; Yeh, G. P.; Yi, K.; Yoh, J.; Yorita, K.; Yoshida, T.; Yu, G. B.; Yu, I.; Zanetti, A. M.; Zeng, Y.; Zhou, C.; Zucchelli, S.; CDF Collaboration

    2015-01-01

    Differential cross sections for the production of Z bosons or off-shell photons γ* in association with jets are measured in proton-antiproton collisions at center-of-mass energy √{s }=1.96 TeV using the full data set collected with the Collider Detector at Fermilab in Tevatron run II and corresponding to 9.6 fb-1 of integrated luminosity. Results include first measurements at CDF of differential cross sections in events with a Z /γ* boson and three or more jets, the inclusive cross section for production of Z /γ* and four or more jets, and cross sections as functions of various angular observables in lower jet-multiplicity final states. Measured cross sections are compared to several theoretical predictions.

  13. Measurement of the production and differential cross sections of W+W- bosons in association with jets in p p ¯ collisions at √{s }=1.96 TeV

    Science.gov (United States)

    Aaltonen, T.; Amerio, S.; Amidei, D.; Anastassov, A.; Annovi, A.; Antos, J.; Apollinari, G.; Appel, J. A.; Arisawa, T.; Artikov, A.; Asaadi, J.; Ashmanskas, W.; Auerbach, B.; Aurisano, A.; Azfar, F.; Badgett, W.; Bae, T.; Barbaro-Galtieri, A.; Barnes, V. E.; Barnett, B. A.; Barria, P.; Bartos, P.; Bauce, M.; Bedeschi, F.; Behari, S.; Bellettini, G.; Bellinger, J.; Benjamin, D.; Beretvas, A.; Bhatti, A.; Bland, K. R.; Blumenfeld, B.; Bocci, A.; Bodek, A.; Bortoletto, D.; Boudreau, J.; Boveia, A.; Brigliadori, L.; Bromberg, C.; Brucken, E.; Budagov, J.; Budd, H. S.; Burkett, K.; Busetto, G.; Bussey, P.; Butti, P.; Buzatu, A.; Calamba, A.; Camarda, S.; Campanelli, M.; Canelli, F.; Carls, B.; Carlsmith, D.; Carosi, R.; Carrillo, S.; Casal, B.; Casarsa, M.; Castro, A.; Catastini, P.; Cauz, D.; Cavaliere, V.; Cerri, A.; Cerrito, L.; Chen, Y. C.; Chertok, M.; Chiarelli, G.; Chlachidze, G.; Cho, K.; Chokheli, D.; Clark, A.; Clarke, C.; Convery, M. E.; Conway, J.; Corbo, M.; Cordelli, M.; Cox, C. A.; Cox, D. J.; Cremonesi, M.; Cruz, D.; Cuevas, J.; Culbertson, R.; d'Ascenzo, N.; Datta, M.; de Barbaro, P.; Demortier, L.; Deninno, M.; D'Errico, M.; Devoto, F.; Di Canto, A.; Di Ruzza, B.; Dittmann, J. R.; Donati, S.; D'Onofrio, M.; Dorigo, M.; Driutti, A.; Ebina, K.; Edgar, R.; Elagin, A.; Erbacher, R.; Errede, S.; Esham, B.; Farrington, S.; Fernández Ramos, J. P.; Field, R.; Flanagan, G.; Forrest, R.; Franklin, M.; Freeman, J. C.; Frisch, H.; Funakoshi, Y.; Galloni, C.; Garfinkel, A. F.; Garosi, P.; Gerberich, H.; Gerchtein, E.; Giagu, S.; Giakoumopoulou, V.; Gibson, K.; Ginsburg, C. M.; Giokaris, N.; Giromini, P.; Glagolev, V.; Glenzinski, D.; Gold, M.; Goldin, D.; Golossanov, A.; Gomez, G.; Gomez-Ceballos, G.; Goncharov, M.; González López, O.; Gorelov, I.; Goshaw, A. T.; Goulianos, K.; Gramellini, E.; Grosso-Pilcher, C.; Group, R. C.; Guimaraes da Costa, J.; Hahn, S. R.; Han, J. Y.; Happacher, F.; Hara, K.; Hare, M.; Harr, R. F.; Harrington-Taber, T.; Hatakeyama, K.; Hays, C.; Heinrich, J.; Herndon, M.; Hocker, A.; Hong, Z.; Hopkins, W.; Hou, S.; Hughes, R. E.; Husemann, U.; Hussein, M.; Huston, J.; Introzzi, G.; Iori, M.; Ivanov, A.; James, E.; Jang, D.; Jayatilaka, B.; Jeon, E. J.; Jindariani, S.; Jones, M.; Joo, K. K.; Jun, S. Y.; Junk, T. R.; Kambeitz, M.; Kamon, T.; Karchin, P. E.; Kasmi, A.; Kato, Y.; Ketchum, W.; Keung, J.; Kilminster, B.; Kim, D. H.; Kim, H. S.; Kim, J. E.; Kim, M. J.; Kim, S. H.; Kim, S. B.; Kim, Y. J.; Kim, Y. K.; Kimura, N.; Kirby, M.; Knoepfel, K.; Kondo, K.; Kong, D. J.; Konigsberg, J.; Kotwal, A. V.; Kreps, M.; Kroll, J.; Kruse, M.; Kuhr, T.; Kurata, M.; Laasanen, A. T.; Lammel, S.; Lancaster, M.; Lannon, K.; Latino, G.; Lee, H. S.; Lee, J. S.; Leo, S.; Leone, S.; Lewis, J. D.; Limosani, A.; Lipeles, E.; Lister, A.; Liu, H.; Liu, Q.; Liu, T.; Lockwitz, S.; Loginov, A.; Lucchesi, D.; Lucà, A.; Lueck, J.; Lujan, P.; Lukens, P.; Lungu, G.; Lys, J.; Lysak, R.; Madrak, R.; Maestro, P.; Malik, S.; Manca, G.; Manousakis-Katsikakis, A.; Marchese, L.; Margaroli, F.; Marino, P.; Matera, K.; Mattson, M. E.; Mazzacane, A.; Mazzanti, P.; McNulty, R.; Mehta, A.; Mehtala, P.; Mesropian, C.; Miao, T.; Mietlicki, D.; Mitra, A.; Miyake, H.; Moed, S.; Moggi, N.; Moon, C. S.; Moore, R.; Morello, M. J.; Mukherjee, A.; Muller, Th.; Murat, P.; Mussini, M.; Nachtman, J.; Nagai, Y.; Naganoma, J.; Nakano, I.; Napier, A.; Nett, J.; Neu, C.; Nigmanov, T.; Nodulman, L.; Noh, S. Y.; Norniella, O.; Oakes, L.; Oh, S. H.; Oh, Y. D.; Oksuzian, I.; Okusawa, T.; Orava, R.; Ortolan, L.; Pagliarone, C.; Palencia, E.; Palni, P.; Papadimitriou, V.; Parker, W.; Pauletta, G.; Paulini, M.; Paus, C.; Phillips, T. J.; Piacentino, G.; Pianori, E.; Pilot, J.; Pitts, K.; Plager, C.; Pondrom, L.; Poprocki, S.; Potamianos, K.; Pranko, A.; Prokoshin, F.; Ptohos, F.; Punzi, G.; Redondo Fernández, I.; Renton, P.; Rescigno, M.; Rimondi, F.; Ristori, L.; Robson, A.; Rodriguez, T.; Rolli, S.; Ronzani, M.; Roser, R.; Rosner, J. L.; Ruffini, F.; Ruiz, A.; Russ, J.; Rusu, V.; Sakumoto, W. K.; Sakurai, Y.; Santi, L.; Sato, K.; Saveliev, V.; Savoy-Navarro, A.; Schlabach, P.; Schmidt, E. E.; Schwarz, T.; Scodellaro, L.; Scuri, F.; Seidel, S.; Seiya, Y.; Semenov, A.; Sforza, F.; Shalhout, S. Z.; Shears, T.; Shepard, P. F.; Shimojima, M.; Shochet, M.; Shreyber-Tecker, I.; Simonenko, A.; Sliwa, K.; Smith, J. R.; Snider, F. D.; Song, H.; Sorin, V.; St. Denis, R.; Stancari, M.; Stentz, D.; Strologas, J.; Sudo, Y.; Sukhanov, A.; Suslov, I.; Takemasa, K.; Takeuchi, Y.; Tang, J.; Tecchio, M.; Teng, P. K.; Thom, J.; Thomson, E.; Thukral, V.; Toback, D.; Tokar, S.; Tollefson, K.; Tomura, T.; Tonelli, D.; Torre, S.; Torretta, D.; Totaro, P.; Trovato, M.; Ukegawa, F.; Uozumi, S.; Vázquez, F.; Velev, G.; Vellidis, C.; Vernieri, C.; Vidal, M.; Vilar, R.; Vizán, J.; Vogel, M.; Volpi, G.; Wagner, P.; Wallny, R.; Wang, S. M.; Waters, D.; Wester, W. C.; Whiteson, D.; Wicklund, A. B.; Wilbur, S.; Williams, H. H.; Wilson, J. S.; Wilson, P.; Winer, B. L.; Wittich, P.; Wolbers, S.; Wolfe, H.; Wright, T.; Wu, X.; Wu, Z.; Yamamoto, K.; Yamato, D.; Yang, T.; Yang, U. K.; Yang, Y. C.; Yao, W.-M.; Yeh, G. P.; Yi, K.; Yoh, J.; Yorita, K.; Yoshida, T.; Yu, G. B.; Yu, I.; Zanetti, A. M.; Zeng, Y.; Zhou, C.; Zucchelli, S.; CDF Collaboration

    2015-06-01

    We present a measurement of the W -boson-pair production cross section in p p ¯ collisions at 1.96 TeV center-of-mass energy and the first measurement of the differential cross section as a function of jet multiplicity and leading-jet energy. The W+W- cross section is measured in the final state comprising two charged leptons and neutrinos, where either charged lepton can be an electron or a muon. Using data collected by the CDF experiment corresponding to 9.7 fb-1 of integrated luminosity, a total of 3027 collision events consistent with W+W- production are observed with an estimated background contribution of 1790 ±190 events. The measured total cross section is σ (p p ¯ →W+W-)=14.0 ±0.6 (stat)-1.0+1.2(syst)±0.8 (lumi) pb , consistent with the standard model prediction.

  14. Invariant-mass distribution of jet pairs produced in association with a W boson in pp ¯ collisions at √s =1.96 TeV using the full CDF Run II data set

    Science.gov (United States)

    Aaltonen, T.; Amerio, S.; Amidei, D.; Anastassov, A.; Annovi, A.; Antos, J.; Apollinari, G.; Appel, J. A.; Arisawa, T.; Artikov, A.; Asaadi, J.; Ashmanskas, W.; Auerbach, B.; Aurisano, A.; Azfar, F.; Badgett, W.; Bae, T.; Barbaro-Galtieri, A.; Barnes, V. E.; Barnett, B. A.; Barria, P.; Bartos, P.; Bauce, M.; Bedeschi, F.; Behari, S.; Bellettini, G.; Bellinger, J.; Benjamin, D.; Beretvas, A.; Bhatti, A.; Bland, K. R.; Blumenfeld, B.; Bocci, A.; Bodek, A.; Bortoletto, D.; Boudreau, J.; Boveia, A.; Brigliadori, L.; Bromberg, C.; Brucken, E.; Budagov, J.; Budd, H. S.; Burkett, K.; Busetto, G.; Bussey, P.; Butti, P.; Buzatu, A.; Calamba, A.; Camarda, S.; Campanelli, M.; Canelli, F.; Carls, B.; Carlsmith, D.; Carosi, R.; Carrillo, S.; Casal, B.; Casarsa, M.; Castro, A.; Catastini, P.; Cauz, D.; Cavaliere, V.; Cavalli-Sforza, M.; Cerri, A.; Cerrito, L.; Chen, Y. C.; Chertok, M.; Chiarelli, G.; Chlachidze, G.; Cho, K.; Chokheli, D.; Clark, A.; Clarke, C.; Convery, M. E.; Conway, J.; Corbo, M.; Cordelli, M.; Cox, C. A.; Cox, D. J.; Cremonesi, M.; Cruz, D.; Cuevas, J.; Culbertson, R.; d'Ascenzo, N.; Datta, M.; de Barbaro, P.; Demortier, L.; Deninno, M.; D'Errico, M.; Devoto, F.; Di Canto, A.; Di Ruzza, B.; Dittmann, J. R.; Donati, S.; D'Onofrio, M.; Dorigo, M.; Driutti, A.; Ebina, K.; Edgar, R.; Elagin, A.; Erbacher, R.; Errede, S.; Esham, B.; Farrington, S.; Fernández Ramos, J. P.; Field, R.; Flanagan, G.; Forrest, R.; Franklin, M.; Freeman, J. C.; Frisch, H.; Funakoshi, Y.; Galloni, C.; Garfinkel, A. F.; Garosi, P.; Gerberich, H.; Gerchtein, E.; Giagu, S.; Giakoumopoulou, V.; Gibson, K.; Ginsburg, C. M.; Giokaris, N.; Giromini, P.; Giurgiu, G.; Glagolev, V.; Glenzinski, D.; Gold, M.; Goldin, D.; Golossanov, A.; Gomez, G.; Gomez-Ceballos, G.; Goncharov, M.; González López, O.; Gorelov, I.; Goshaw, A. T.; Goulianos, K.; Gramellini, E.; Grinstein, S.; Grosso-Pilcher, C.; Group, R. C.; Guimaraes da Costa, J.; Hahn, S. R.; Han, J. Y.; Happacher, F.; Hara, K.; Hare, M.; Harr, R. F.; Harrington-Taber, T.; Hatakeyama, K.; Hays, C.; Heinrich, J.; Herndon, M.; Hocker, A.; Hong, Z.; Hopkins, W.; Hou, S.; Hughes, R. E.; Husemann, U.; Hussein, M.; Huston, J.; Introzzi, G.; Iori, M.; Ivanov, A.; James, E.; Jang, D.; Jayatilaka, B.; Jeon, E. J.; Jindariani, S.; Jones, M.; Joo, K. K.; Jun, S. Y.; Junk, T. R.; Kambeitz, M.; Kamon, T.; Karchin, P. E.; Kasmi, A.; Kato, Y.; Ketchum, W.; Keung, J.; Kilminster, B.; Kim, D. H.; Kim, H. S.; Kim, J. E.; Kim, M. J.; Kim, S. H.; Kim, S. B.; Kim, Y. J.; Kim, Y. K.; Kimura, N.; Kirby, M.; Knoepfel, K.; Kondo, K.; Kong, D. J.; Konigsberg, J.; Kotwal, A. V.; Kreps, M.; Kroll, J.; Kruse, M.; Kuhr, T.; Kurata, M.; Laasanen, A. T.; Lammel, S.; Lancaster, M.; Lannon, K.; Latino, G.; Lee, H. S.; Lee, J. S.; Leo, S.; Leone, S.; Lewis, J. D.; Limosani, A.; Lipeles, E.; Lister, A.; Liu, H.; Liu, Q.; Liu, T.; Lockwitz, S.; Loginov, A.; Lucchesi, D.; Lucà, A.; Lueck, J.; Lujan, P.; Lukens, P.; Lungu, G.; Lys, J.; Lysak, R.; Madrak, R.; Maestro, P.; Malik, S.; Manca, G.; Manousakis-Katsikakis, A.; Marchese, L.; Margaroli, F.; Marino, P.; Martínez, M.; Matera, K.; Mattson, M. E.; Mazzacane, A.; Mazzanti, P.; McNulty, R.; Mehta, A.; Mehtala, P.; Mesropian, C.; Miao, T.; Mietlicki, D.; Mitra, A.; Miyake, H.; Moed, S.; Moggi, N.; Moon, C. S.; Moore, R.; Morello, M. J.; Mukherjee, A.; Muller, Th.; Murat, P.; Mussini, M.; Nachtman, J.; Nagai, Y.; Naganoma, J.; Nakano, I.; Napier, A.; Nett, J.; Neu, C.; Nigmanov, T.; Nodulman, L.; Noh, S. Y.; Norniella, O.; Oakes, L.; Oh, S. H.; Oh, Y. D.; Oksuzian, I.; Okusawa, T.; Orava, R.; Ortolan, L.; Pagliarone, C.; Palencia, E.; Palni, P.; Papadimitriou, V.; Parker, W.; Pauletta, G.; Paulini, M.; Paus, C.; Phillips, T. J.; Piacentino, G.; Pianori, E.; Pilot, J.; Pitts, K.; Plager, C.; Pondrom, L.; Poprocki, S.; Potamianos, K.; Pranko, A.; Prokoshin, F.; Ptohos, F.; Punzi, G.; Ranjan, N.; Redondo Fernández, I.; Renton, P.; Rescigno, M.; Rimondi, F.; Ristori, L.; Robson, A.; Rodriguez, T.; Rolli, S.; Ronzani, M.; Roser, R.; Rosner, J. L.; Ruffini, F.; Ruiz, A.; Russ, J.; Rusu, V.; Sakumoto, W. K.; Sakurai, Y.; Santi, L.; Sato, K.; Saveliev, V.; Savoy-Navarro, A.; Schlabach, P.; Schmidt, E. E.; Schwarz, T.; Scodellaro, L.; Scuri, F.; Seidel, S.; Seiya, Y.; Semenov, A.; Sforza, F.; Shalhout, S. Z.; Shears, T.; Shepard, P. F.; Shimojima, M.; Shochet, M.; Shreyber-Tecker, I.; Simonenko, A.; Sliwa, K.; Smith, J. R.; Snider, F. D.; Song, H.; Sorin, V.; St. Denis, R.; Stancari, M.; Stentz, D.; Strologas, J.; Sudo, Y.; Sukhanov, A.; Suslov, I.; Takemasa, K.; Takeuchi, Y.; Tang, J.; Tecchio, M.; Teng, P. K.; Thom, J.; Thomson, E.; Thukral, V.; Toback, D.; Tokar, S.; Tollefson, K.; Tomura, T.; Tonelli, D.; Torre, S.; Torretta, D.; Totaro, P.; Trovato, M.; Ukegawa, F.; Uozumi, S.; Velev, G.; Vellidis, C.; Vernieri, C.; Vidal, M.; Vilar, R.; Vizán, J.; Vogel, M.; Volpi, G.; Vázquez, F.; Wagner, P.; Wallny, R.; Wang, S. M.; Waters, D.; Wester, W. C.; Whiteson, D.; Wicklund, A. B.; Wilbur, S.; Williams, H. H.; Wilson, J. S.; Wilson, P.; Winer, B. L.; Wittich, P.; Wolbers, S.; Wolfe, H.; Wright, T.; Wu, X.; Wu, Z.; Yamamoto, K.; Yamato, D.; Yang, T.; Yang, U. K.; Yang, Y. C.; Yao, W.-M.; Yeh, G. P.; Yi, K.; Yoh, J.; Yorita, K.; Yoshida, T.; Yu, G. B.; Yu, I.; Zanetti, A. M.; Zeng, Y.; Zhou, C.; Zucchelli, S.; CDF Collaboration

    2014-05-01

    We report on a study of the dijet invariant-mass distribution in events with one identified lepton, a significant imbalance in the total event transverse momentum, and two jets. This distribution is sensitive to the possible production of a new particle in association with a W boson, where the boson decays leptonically. We use the full data set of proton-antiproton collisions at 1.96 TeV center-of-mass energy collected by the Collider Detector at the Fermilab Tevatron, corresponding to an integrated luminosity of 8.9 fb-1. The data are found to be consistent with standard model expectations, and a 95% confidence level upper limit is set on the production cross section of a W boson in association with a new particle decaying into two jets.

  15. Measurement of the t anti-t production cross section in p anti-p collisions at s**(1/2) = 1.96-TeV using missing E(T) + jets events with secondary vertex b-tagging

    Energy Technology Data Exchange (ETDEWEB)

    Abulencia, A.; Acosta, D.; Adelman, Jahred A.; Affolder, T.; Akimoto, T.; Albrow, M.G.; Ambrose, D.; Amerio, S.; Amidei, D.; Anastassov, A.; Anikeev, K.; /Taiwan, Inst.

    2006-03-01

    The authors present a measurement of the t{bar t} production cross section in p{bar p} collisions at {radical}s = 1.96 TeV which uses events with an inclusive signature of significant missing transverse energy and jets. This is the first measurement which makes no explicit lepton identification requirements, so that sensitivity to W {yields} {tau}{nu} decays is maintained. Heavy flavor jets from top quark decay are identified with a secondary vertex tagging algorithm. From 311 pb{sup -1} of data collected by the Collider Detector at Fermilab they measure a production cross section of 5.8 {+-} 1.2(stat.){sub -0.7}{sup +0.9}(syst.) pb for a top quark mass of 178 GeV/c{sup 2}, in agreement with previous determinations and standard model predictions.

  16. Measurement of inclusive jet cross-sections in Z/gamma*(---> e+ e-) + jets production in p anti-p collisions at s**(1/2) = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Aaltonen, T.; /Helsinki Inst. of Phys.; Adelman, J.; /Chicago U., EFI; Akimoto, T.; /Tsukuba U.; Albrow, M.G.; /Fermilab; Alvarez Gonzalez, B.; /Cantabria U., Santander; Amerio, S.; /Padua U.; Amidei, D.; /Michigan U.; Anastassov, A.; /Rutgers U., Piscataway; Annovi, A.; /Frascati; Antos, J.; /Comenius U.; Aoki, M.; /Illinois U., Urbana /Fermilab

    2007-11-01

    Inclusive jet cross sections in Z/{gamma}* events, with Z/{gamma}* decaying into an electron-positron pair, are measured as a function of jet transverse momentum and jet multiplicity in p{bar p} collisions at {radical}s - 1.96 TeV with the upgraded Collider Detector at Fermilab in Run II, based on an integrated luminosity of 1.7 fb{sup -1}. The measurements cover the rapidity region |y{sup jet}| < 2.1 and the transverse momentum range p{sub T}{sup jet} > 30 GeV/c. Next-to-leading order perturbative QCD predictions are in good agreement with the measured cross sections.

  17. Measurement of $d\\sigma/dy$ of Drell-Yan $e^+e^-$ pairs in the $Z$ Mass Region from $p\\bar{p}$ Collisions at $\\sqrt{s}=1.96$ TeV

    Energy Technology Data Exchange (ETDEWEB)

    Aaltonen, Timo Antero; /Helsinki Inst. of Phys.; Adelman, Jahred A.; /Chicago U., EFI; Gonzalez, Barbara Alvarez; /Cantabria Inst. of Phys.; Amerio, Silvia; /Padua U., CISAS; Amidei, Dante E.; /Michigan U. /INFN, Padua; Anastassov, Anton Iankov; /Northwestern U.; Annovi, Alberto; /Frascati; Antos, Jaroslav; /Comenius U.; Apollinari, Giorgio; /Fermilab; Appel, Jeffrey A.; /Fermilab; Apresyan, Artur; /Purdue U. /Waseda U.

    2010-03-01

    We report on a CDF measurement of the total cross section and rapidity distribution, d{sigma}/dy, for q{bar q} {yields} {gamma}{sup *}/Z {yields} e{sup +} e {sup -} events in the Z boson mass region (66 < M {sub ee} < 116 GeV/c {sub 2}) produced in p{bar p} collisions at {radical}s = 1.96 TeV with 2.1 fb{sup -1} of integrated luminosity. The measured cross section of 257 {+-} 16pb and d{sigma}/dy distribution are compared with Next-to-Leading-Order (NLO) and Next-to-Next-to-Leading-Order (NNLO) QCD theory predictions with CTEQ and MRST/MSTW parton distribution functions (PDFs). There is good agreement between the experimental total cross section and d{sigma}/dy measurements with theoretical calcualtion with the most recent NNLO PDFs.

  18. Measurement of the k(T) Distribution of Particles in Jets Produced in p anti-p Collisions at s**(1/2) = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Aaltonen, T.; /Helsinki Inst. of Phys.; Adelman, J.; /Chicago U., EFI; Akimoto, T.; /Tsukuba U.; Alvarez Gonzalez, B.; /CSIC, Catalunya; Amerio, S.; /INFN, Padua; Amidei, Dante E.; /Michigan U.; Anastassov, A.; /Northwestern U.; Annovi, Alberto; /Frascati; Antos, J.; /Comenius U.; Apollinari, G.; /Fermilab; Apresyan, A.; /Purdue U. /Waseda U.

    2008-11-01

    We present a measurement of the transverse momentum with respect to the jet axis (k{sub T}) of particles in jets produced in p{bar p} collisions at {radical}s = 1.96 TeV. Results are obtained for charged particles within a cone of opening angle 0.5 radians around the jet axis in events with dijet invariant masses between 66 and 737 GeV/c{sup 2}. The experimental data are compared to theoretical predictions obtained for fragmentation partons within the framework of resummed perturbative QCD using the modified leading log and next-to-modified leading log approximations. The comparison shows that trends in data are successfully described by the theoretical predictions, indicating that the perturbative QCD stage of jet fragmentation is dominant in shaping basic jet characteristics.

  19. Measurement of d sigma/dy of Drell-Yan e+ e- pairs in the Z Mass Region from p anti-p Collisions at s88(1/2) = 1.96-TeV

    Energy Technology Data Exchange (ETDEWEB)

    Aaltonen, T.; /Helsinki Inst. of Phys.; Adelman, J.; /Chicago U., EFI; Akimoto, T.; /Tsukuba U.; Alvarez Gonzalez, B.; /Cantabria Inst. of Phys.; Amerio, S.; /Padua U. /INFN, Padua; Amidei, D.; /Michigan U.; Anastassov, A.; /Northwestern U.; Annovi, A.; /Frascati; Antos, J.; /Comenius U.; Apollinari, G.; /Fermilab; Apresyan, A.; /Purdue U. /Waseda U.

    2009-08-01

    We report on a CDF measurement of the total cross section and rapidity distribution, d{sigma}/dy, for q{bar q} {yields} {gamma}*/Z {yields} e{sup +}e{sup -} events in the Z boson mass region (66 < M{sub ee} < 116 GeV/c{sup 2}) produced in p{bar p} collisions at {radical}s = 1.96 TeV with 2.1 fb{sup -1} of integrated luminosity. The measured cross section of 256 {+-} 16 pb and d{sigma}/dy distribution are compared with Next-to-Leading-Order and Next-to-Next-to-Leading-Order QCD theory predictions with CTEQ and MRST parton distribution functions (PDFs). There is good agreement between data and theory except at large rapidity for which further tuning of PDF models may be needed.

  20. Measurement of the Shape of the Boson-Transverse Momentum Distribution in pp¯→Z/γ*→e+e-+X Events Produced at s=1.96TeV

    Science.gov (United States)

    Abazov, V. M.; Abbott, B.; Abolins, M.; Acharya, B. S.; Adams, M.; Adams, T.; Aguilo, E.; Ahn, S. H.; Ahsan, M.; Alexeev, G. D.; Alkhazov, G.; Alton, A.; Alverson, G.; Alves, G. A.; Anastasoaie, M.; Ancu, L. S.; Andeen, T.; Anderson, S.; Andrieu, B.; Anzelc, M. S.; Arnoud, Y.; Arov, M.; Arthaud, M.; Askew, A.; Åsman, B.; Jesus, A. C. S. Assis; Atramentov, O.; Autermann, C.; Avila, C.; Ay, C.; Badaud, F.; Baden, A.; Bagby, L.; Baldin, B.; Bandurin, D. V.; Banerjee, S.; Banerjee, P.; Barberis, E.; Barfuss, A.-F.; Bargassa, P.; Baringer, P.; Barreto, J.; Bartlett, J. F.; Bassler, U.; Bauer, D.; Beale, S.; Bean, A.; Begalli, M.; Begel, M.; Belanger-Champagne, C.; Bellantoni, L.; Bellavance, A.; Benitez, J. A.; Beri, S. B.; Bernardi, G.; Bernhard, R.; Bertram, I.; Besançon, M.; Beuselinck, R.; Bezzubov, V. A.; Bhat, P. C.; Bhatnagar, V.; Biscarat, C.; Blazey, G.; Blekman, F.; Blessing, S.; Bloch, D.; Bloom, K.; Boehnlein, A.; Boline, D.; Bolton, T. A.; Borissov, G.; Bose, T.; Brandt, A.; Brock, R.; Brooijmans, G.; Bross, A.; Brown, D.; Buchanan, N. J.; Buchholz, D.; Buehler, M.; Buescher, V.; Bunichev, V.; Burdin, S.; Burke, S.; Burnett, T. H.; Buszello, C. P.; Butler, J. M.; Calfayan, P.; Calvet, S.; Cammin, J.; Carvalho, W.; Casey, B. C. K.; Cason, N. M.; Castilla-Valdez, H.; Chakrabarti, S.; Chakraborty, D.; Chan, K. M.; Chan, K.; Chandra, A.; Charles, F.; Cheu, E.; Chevallier, F.; Cho, D. K.; Choi, S.; Choudhary, B.; Christofek, L.; Christoudias, T.; Cihangir, S.; Claes, D.; Coadou, Y.; Cooke, M.; Cooper, W. E.; Corcoran, M.; Couderc, F.; Cousinou, M.-C.; Crépé-Renaudin, S.; Cutts, D.; Ćwiok, M.; da Motta, H.; Das, A.; Davies, G.; de, K.; de Jong, S. J.; de La Cruz-Burelo, E.; de Oliveira Martins, C.; Degenhardt, J. D.; Déliot, F.; Demarteau, M.; Demina, R.; Denisov, D.; Denisov, S. P.; Desai, S.; Diehl, H. T.; Diesburg, M.; Dominguez, A.; Dong, H.; Dudko, L. V.; Duflot, L.; Dugad, S. R.; Duggan, D.; Duperrin, A.; Dyer, J.; Dyshkant, A.; Eads, M.; Edmunds, D.; Ellison, J.; Elvira, V. D.; Enari, Y.; Eno, S.; Ermolov, P.; Evans, H.; Evdokimov, A.; Evdokimov, V. N.; Ferapontov, A. V.; Ferbel, T.; Fiedler, F.; Filthaut, F.; Fisher, W.; Fisk, H. E.; Ford, M.; Fortner, M.; Fox, H.; Fu, S.; Fuess, S.; Gadfort, T.; Galea, C. F.; Gallas, E.; Galyaev, E.; Garcia, C.; Garcia-Bellido, A.; Gavrilov, V.; Gay, P.; Geist, W.; Gelé, D.; Gerber, C. E.; Gershtein, Y.; Gillberg, D.; Ginther, G.; Gollub, N.; Gómez, B.; Goussiou, A.; Grannis, P. D.; Greenlee, H.; Greenwood, Z. D.; Gregores, E. M.; Grenier, G.; Gris, Ph.; Grivaz, J.-F.; Grohsjean, A.; Grünendahl, S.; Grünewald, M. W.; Guo, J.; Guo, F.; Gutierrez, P.; Gutierrez, G.; Haas, A.; Hadley, N. J.; Haefner, P.; Hagopian, S.; Haley, J.; Hall, I.; Hall, R. E.; Han, L.; Hanagaki, K.; Hansson, P.; Harder, K.; Harel, A.; Harrington, R.; Hauptman, J. M.; Hauser, R.; Hays, J.; Hebbeker, T.; Hedin, D.; Hegeman, J. G.; Heinmiller, J. M.; Heinson, A. P.; Heintz, U.; Hensel, C.; Herner, K.; Hesketh, G.; Hildreth, M. D.; Hirosky, R.; Hobbs, J. D.; Hoeneisen, B.; Hoeth, H.; Hohlfeld, M.; Hong, S. J.; Hossain, S.; Houben, P.; Hu, Y.; Hubacek, Z.; Hynek, V.; Iashvili, I.; Illingworth, R.; Ito, A. S.; Jabeen, S.; Jaffré, M.; Jain, S.; Jakobs, K.; Jarvis, C.; Jesik, R.; Johns, K.; Johnson, C.; Johnson, M.; Jonckheere, A.; Jonss