WorldWideScience

Sample records for assisted gene insertion

  1. Transposon assisted gene insertion technology (TAGIT: a tool for generating fluorescent fusion proteins.

    Directory of Open Access Journals (Sweden)

    James A Gregory

    2010-01-01

    Full Text Available We constructed a transposon (transposon assisted gene insertion technology, or TAGIT that allows the random insertion of gfp (or other genes into chromosomal loci without disrupting operon structure or regulation. TAGIT is a modified Tn5 transposon that uses Kan(R to select for insertions on the chromosome or plasmid, beta-galactosidase to identify in-frame gene fusions, and Cre recombinase to excise the kan and lacZ genes in vivo. The resulting gfp insertions maintain target gene reading frame (to the 5' and 3' of gfp and are integrated at the native chromosomal locus, thereby maintaining native expression signals. Libraries can be screened to identify GFP insertions that maintain target protein function at native expression levels, allowing more trustworthy localization studies. We here use TAGIT to generate a library of GFP insertions in the Escherichia coli lactose repressor (LacI. We identified fully functional GFP insertions and partially functional insertions that bind DNA but fail to repress the lacZ operon. Several of these latter GFP insertions localize to lacO arrays integrated in the E. coli chromosome without producing the elongated cells frequently observed when functional LacI-GFP fusions are used in chromosome tagging experiments. TAGIT thereby faciliates the isolation of fully functional insertions of fluorescent proteins into target proteins expressed from the native chromosomal locus as well as potentially useful partially functional proteins.

  2. Gene Insertion Patterns and Sites

    Science.gov (United States)

    Vain, Philippe; Thole, Vera

    During the past 25 years, the molecular analysis of transgene insertion patterns and sites in plants has greatly contributed to our understanding of the mechanisms underlying transgene integration, expression, and stability in the nuclear genome. Molecular characterization is also an essential step in the safety assessment of genetically modified crops. This chapter describes the standard experimental procedures used to analyze transgene insertion patterns and loci in cereals and grasses transformed using Agrobacterium tumefaciens or direct transfer of DNA. Methods and protocols enabling the determination of the number and configuration of transgenic loci via a combination of inheritance studies, polymerase chain reaction, and Southern analyses are presented. The complete characterization of transgenic inserts in plants is, however, a holistic process relying on a wide variety of experimental approaches. In this chapter, these additional approaches are not detailed but references to relevant bibliographic records are provided.

  3. Angiotensin Converting Enzyme Insertion/Deletion Gene ...

    African Journals Online (AJOL)

    Erah

    Pharmacotherapy Group,. Faculty of Pharmacy, University of Benin,. Benin City, 300001 Nigeria. All rights reserved. Available online at http://www.tjpr.org. Research Article. Angiotensin Converting Enzyme Insertion/Deletion. Gene Polymorphism: An Observational Study among. Diabetic Hypertensive Subjects in Malaysia.

  4. Identification of pathogenic retrotransposon insertions in cancer predisposition genes.

    Science.gov (United States)

    Qian, Yaping; Mancini-DiNardo, Debora; Judkins, Thaddeus; Cox, Hannah C; Brown, Krystal; Elias, Maria; Singh, Nanda; Daniels, Courtney; Holladay, Jayson; Coffee, Bradford; Bowles, Karla R; Roa, Benjamin B

    2017-10-01

    Cancer risks have been previously reported for some retrotransposon element (RE) insertions; however, detection of these insertions is technically challenging and very few oncogenic RE insertions have been reported. Here we evaluate RE insertions identified during hereditary cancer genetic testing using a comprehensive testing strategy. Individuals who had single-syndrome or pan-cancer hereditary cancer genetic testing from February 2004 to March 2017 were included. RE insertions were identified using Sanger sequencing, Next Generation Sequencing, or multiplex quantitative PCR, and further characterized using targeted PCR and sequencing analysis. Personal cancer history, ancestry, and haplotype were evaluated. A total of 37 unique RE insertions were identified in 10 genes, affecting 211 individuals. BRCA2 accounted for 45.9% (17/37) of all unique RE insertions. Several RE insertions were detected with high frequency in populations of conserved ancestry wherein up to 100% of carriers shared a high degree of haplotype conservation, suggesting founder effects. Our comprehensive testing strategy resulted in a substantial increase in the number of reported oncogenic RE insertions, several of which may have possible founder effects. Collectively, these data show that the detection of RE insertions is an important component of hereditary cancer genetic testing and may be more prevalent than previously reported. Copyright © 2017 Myriad Genetics, Inc. Published by Elsevier Inc. All rights reserved.

  5. Angiotensin Converting Enzyme Insertion/Deletion Gene ...

    African Journals Online (AJOL)

    Purpose: This study investigated the influence of angiotensin-1 converting enzyme (ACE) insertiondeletion (ID) gene polymorphism on the treatment responses of type 2 diabetic subjects at varying stages of nephropathy to ACE inhibitors (ACEI) with regard to blood pressure (MAP) and renal response (GFR). Methods: The ...

  6. Variations in angiotensin-converting enzyme gene insertion/deletion ...

    Indian Academy of Sciences (India)

    Unknown

    The pattern of angiotensin-converting enzyme (ACE) gene insertion/deletion (I/D) polymorphism in the Indian population is poorly known. In order to determine the status of the polymorphism, young unrelated male army recruits were screened. The population had cultural and linguistic differences and lived in an ...

  7. Insertion/deletion gene variants of angiotensin converting enzyme ...

    African Journals Online (AJOL)

    The insertion/deletion (I/D) polymorphism in the angiotensin-converting enzyme gene has been reported to be implicated in the predisposition to essential hypertension (EH). This association may depend on ethnic and genetic backgrounds. The objective of this study was to determine if the possible I/D polymorphism in the ...

  8. Enhanced citrate production through gene insertion in Aspergillus niger

    DEFF Research Database (Denmark)

    Jongh, Wian de; Nielsen, Jens

    2007-01-01

    The effect of inserting genes involved in the reductive branch of the tricarboxylic acid (TCA) cycle on citrate production by Aspergillus niger was evaluated. Several different genes were inserted individually and in combination, i.e. malate dehydrogenase (mdh2) from Saccharomyces cerevisiae, two...... truncated, cytosolic targeted, fumarases (Fum1s and FumRs) from S. cerevisiae and Rhizopus oryzae, respectively, and the cytosolic soluble fumarate reductase (Frds1) from S. cerevisiae. Overexpression of these genes in their native strain backgrounds has been reported to lead to alterations...... in the intracellular cytosolic dicarboxylate concentrations. It was found that all the transformant strains had enhanced yield and productivities of citrate compared with the wild-type strain. The transformants also had the ability to produce citrate in trace-manganese-contaminated medium, where the wild type...

  9. Modeling insertional mutagenesis using gene length and expression in murine embryonic stem cells.

    Directory of Open Access Journals (Sweden)

    Alex S Nord

    2007-07-01

    Full Text Available High-throughput mutagenesis of the mammalian genome is a powerful means to facilitate analysis of gene function. Gene trapping in embryonic stem cells (ESCs is the most widely used form of insertional mutagenesis in mammals. However, the rules governing its efficiency are not fully understood, and the effects of vector design on the likelihood of gene-trapping events have not been tested on a genome-wide scale.In this study, we used public gene-trap data to model gene-trap likelihood. Using the association of gene length and gene expression with gene-trap likelihood, we constructed spline-based regression models that characterize which genes are susceptible and which genes are resistant to gene-trapping techniques. We report results for three classes of gene-trap vectors, showing that both length and expression are significant determinants of trap likelihood for all vectors. Using our models, we also quantitatively identified hotspots of gene-trap activity, which represent loci where the high likelihood of vector insertion is controlled by factors other than length and expression. These formalized statistical models describe a high proportion of the variance in the likelihood of a gene being trapped by expression-dependent vectors and a lower, but still significant, proportion of the variance for vectors that are predicted to be independent of endogenous gene expression.The findings of significant expression and length effects reported here further the understanding of the determinants of vector insertion. Results from this analysis can be applied to help identify other important determinants of this important biological phenomenon and could assist planning of large-scale mutagenesis efforts.

  10. Gene therapy of cancer by vaccines carrying inserted immunostimulatory genes

    Czech Academy of Sciences Publication Activity Database

    Bubeník, Jan

    2007-01-01

    Roč. 53, č. 3 (2007), s. 71-73 ISSN 0015-5500 Grant - others:EU-FP6 NoE Clinigene(XE) 018933; Liga proti rakovině, Praha(CZ) XX Institutional research plan: CEZ:AV0Z50520514 Keywords : gene therapy * immunostimulatory genes * vaccine Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.596, year: 2007

  11. An unknown complication of peripherally inserted central venous catheter in a patient with ventricular assist device

    Directory of Open Access Journals (Sweden)

    Parikh M

    2011-01-01

    Full Text Available We report an unknown complication of peripherally inserted central venous catheter in a patient with Ventricular Assist Device. This rare complication led to the failure of the right ventricular assist device, which could be detrimental in patients with dilated cardiomyopathy.

  12. Single gene insertion drives bioalcohol production by a thermophilic archaeon

    Energy Technology Data Exchange (ETDEWEB)

    Basen, M; Schut, GJ; Nguyen, DM; Lipscomb, GL; Benn, RA; Prybol, CJ; Vaccaro, BJ; Poole, FL; Kelly, RM; Adams, MWW

    2014-12-09

    Bioethanol production is achieved by only two metabolic pathways and only at moderate temperatures. Herein a fundamentally different synthetic pathway for bioalcohol production at 70 degrees C was constructed by insertion of the gene for bacterial alcohol dehydrogenase (AdhA) into the archaeon Pyrococcus furiosus. The engineered strain converted glucose to ethanol via acetate and acetaldehyde, catalyzed by the host-encoded aldehyde ferredoxin oxidoreductase (AOR) and heterologously expressed AdhA, in an energy-conserving, redox-balanced pathway. Furthermore, the AOR/AdhA pathway also converted exogenously added aliphatic and aromatic carboxylic acids to the corresponding alcohol using glucose, pyruvate, and/or hydrogen as the source of reductant. By heterologous coexpression of a membrane-bound carbon monoxide dehydrogenase, CO was used as a reductant for converting carboxylic acids to alcohols. Redirecting the fermentative metabolism of P. furiosus through strategic insertion of foreign genes creates unprecedented opportunities for thermophilic bioalcohol production. Moreover, the AOR/AdhA pathway is a potentially game-changing strategy for syngas fermentation, especially in combination with carbon chain elongation pathways.

  13. Systems engineering and technical assistance in support of digital gallium arsenide insertion projects

    Science.gov (United States)

    Butler, Daniel H.

    1992-04-01

    Booz-Allen provided a high level of support, including systems engineering analyses and technical assistance for systems insertion efforts using digital Gallium Arsenide (GaAs). Once insertion candidates were chosen, Booz-Allen supported the insertion efforts by acting as a liaison between the government and GaAs contractors, attending and arranging contractor reviews, providing meeting facilities, and producing presentation materials. A major accomplishment under this contract was the development of a methodology for appraising the likelihood of a successful technology insertion. This methodology is described in detail. Systems analyses and other work performed according to the terms of the statement of work is described as well. The conclusion discusses accomplishments under this project and of the DARPA digital GaAs insertion program generally.

  14. The BDGP gene disruption project: Single transposon insertions associated with 40 percent of Drosophila genes

    Energy Technology Data Exchange (ETDEWEB)

    Bellen, Hugo J.; Levis, Robert W.; Liao, Guochun; He, Yuchun; Carlson, Joseph W.; Tsang, Garson; Evans-Holm, Martha; Hiesinger, P. Robin; Schulze, Karen L.; Rubin, Gerald M.; Hoskins, Roger A.; Spradling, Allan C.

    2004-01-13

    The Berkeley Drosophila Genome Project (BDGP) strives to disrupt each Drosophila gene by the insertion of a single transposable element. As part of this effort, transposons in more than 30,000 fly strains were localized and analyzed relative to predicted Drosophila gene structures. Approximately 6,300 lines that maximize genomic coverage were selected to be sent to the Bloomington Stock Center for public distribution, bringing the size of the BDGP gene disruption collection to 7,140 lines. It now includes individual lines predicted to disrupt 5,362 of the 13,666 currently annotated Drosophila genes (39 percent). Other lines contain an insertion at least 2 kb from others in the collection and likely mutate additional incompletely annotated or uncharacterized genes and chromosomal regulatory elements. The remaining strains contain insertions likely to disrupt alternative gene promoters or to allow gene mis-expression. The expanded BDGP gene disruption collection provides a public resource that will facilitate the application of Drosophila genetics to diverse biological problems. Finally, the project reveals new insight into how transposons interact with a eukaryotic genome and helps define optimal strategies for using insertional mutagenesis as a genomic tool.

  15. Assisted care as a baseline patient risk characteristic affecting the outcome of transcatheter aortic valve insertion.

    Science.gov (United States)

    Traynor, Megan M; Greason, Kevin L; Nkomo, Vuyisile T; Pochettino, Alberto; Holmes, David R; Rihal, Charanjit S; Reeder, Guy S; Bresnahan, John F; Mathew, Verghese

    2017-06-01

    Objective measures of frailty have not been well defined as risk factors for a poor outcome after transcatheter aortic valve insertion. We hypothesized that assisted care as a baseline patient characteristic was a simple objective measure of frailty. We reviewed our experience to assess for an association between assisted care and outcome of operation. We retrospectively reviewed the records of 597 patients operated with transcatheter aortic valve insertion from November 2008 through July 2015. The study cohort included patients with a dichotomous baseline characteristic of receiving assisted care (AC group, n = 60, 10.1%) or not receiving assisted care (NC group, n = 537, 89.9%). The endpoints of the study were operative stroke/death and 1-year survival. The age of the patients was 80.6 ± 9.0 years, male sex was present in 349 (58.5%), and STS predicted risk of mortality was 9.2 ± 6.2%. Alternate access was used in 26 (43.3%) patients in the AC care group and in 220 (41.0%) in the NC group (P = 0.724). Operative stroke/death occurred in 4 (6.7%) patients in the AC group and in 25 (4.7%) in the NC group (P = 0.492). Mortality at 1 year in the AC group was 14.8 ± 5.2% and in the NC group was 12.9 ± 1.7%; (P = 0. 250). Assisted care as a baseline patient characteristic does not result in increased operative stroke/death or 1-year mortality in patients following transcatheter aortic valve insertion. Assisted care should not by itself preclude operation. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  16. Lipids assist the membrane insertion of a BAM-independent outer membrane protein.

    Science.gov (United States)

    Huysmans, Gerard H M; Guilvout, Ingrid; Chami, Mohamed; Nickerson, Nicholas N; Pugsley, Anthony P

    2015-10-14

    Like several other large, multimeric bacterial outer membrane proteins (OMPs), the assembly of the Klebsiella oxytoca OMP PulD does not rely on the universally conserved β-barrel assembly machinery (BAM) that catalyses outer membrane insertion. The only other factor known to interact with PulD prior to or during outer membrane targeting and assembly is the cognate chaperone PulS. Here, in vitro translation-transcription coupled PulD folding demonstrated that PulS does not act during the membrane insertion of PulD, and engineered in vivo site-specific cross-linking between PulD and PulS showed that PulS binding does not prevent membrane insertion. In vitro folding kinetics revealed that PulD is atypical compared to BAM-dependent OMPs by inserting more rapidly into membranes containing E. coli phospholipids than into membranes containing lecithin. PulD folding was fast in diC14:0-phosphatidylethanolamine liposomes but not diC14:0-phosphatidylglycerol liposomes, and in diC18:1-phosphatidylcholine liposomes but not in diC14:1-phosphatidylcholine liposomes. These results suggest that PulD efficiently exploits the membrane composition to complete final steps in insertion and explain how PulD can assemble independently of any protein-assembly machinery. Lipid-assisted assembly in this manner might apply to other large OMPs whose assembly is BAM-independent.

  17. Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

    Science.gov (United States)

    Beauparlant, Marc A; Drouin, Guy

    2014-02-01

    Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

  18. Targeted Mutagenesis, Precise Gene Editing, and Site-Specific Gene Insertion in Maize Using Cas9 and Guide RNA

    National Research Council Canada - National Science Library

    Svitashev, Sergei; Young, Joshua K; Schwartz, Christine; Gao, Huirong; Falco, S Carl; Cigan, A Mark

    2015-01-01

    Targeted mutagenesis, editing of endogenous maize (Zea mays) genes, and site-specific insertion of a trait gene using clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas...

  19. Polymer-based disposable microneedle array with insertion assisted by vibrating motion.

    Science.gov (United States)

    Lee, F-W; Hung, W-H; Ma, C-W; Yang, Y-J

    2016-01-01

    This work presents a disposable polymer-based microneedle array that carries out insertions by mimicking the vibrating motion of a mosquito's proboscis. The proposed device, which comprises a 10:1 high-aspect-ratio parylene microneedle array and a chamber structure, was monolithically realized using a novel fabrication process. The vibrating motion of the microneedles was generated using a piezoelectric actuator. This device can be potentially applied to extract and collect blood by puncturing the dermis layer of human skin. The fabricated device is advantageous because of its biocompatibility, simple fabrication process, and low associated costs. Additionally, the graph of the measured extraction flow rate versus the pressure drop that is presented shows an agreement with the results predicted by analytical models. A 40% reduction of insertion force was demonstrated when the microneedle insertion was assisted by actuator-induced vibratory motions. Buckling analyses for estimating the maximum loads that the microneedle can sustain before failure occurs were also evaluated. Finally, the relationship between the insertion force and the vibration frequency was demonstrated in this study.

  20. Digital assistance of nasogastric tube insertion in intubated patients under general anesthesia: A single-blinded prospective randomized study

    Directory of Open Access Journals (Sweden)

    Alrefaey Kandeel

    2017-01-01

    Conclusions: Digital assistance of NGT insertion in the anesthetized or unconscious patient is an effective, fast, and safe method that can be either used as a routine technique or as a rescue in case of failed other methods.

  1. Tool life of diamond inserts after laser assisted turning of cemented carbides

    Directory of Open Access Journals (Sweden)

    Kieruj Piotr

    2017-01-01

    Full Text Available The paper presents results and discussion on parameters influence on tool life when turning laser cladded cemented carbides under laser assisted machining (LAM conditions. The layers are known as Technolase 30S. This material is widely recognized as hard-to-cut. The experimental investigation was carried out with diamond inserts. The laser power density, feed rate and laser scanning speed were analysed. Flank wear (VBc indicator was measured and cutting tool life was calculated. It was proved that Technolase 30S can be machined with LAM technology. The laser enhanced turning is more efficient than conventional turning and grinding.

  2. Microwave-assisted chemical insertion: a rapid technique for screening cathodes for Mg-ion batteries

    Energy Technology Data Exchange (ETDEWEB)

    Kaveevivitchai, Watchareeya; Huq, Ashfia; Manthiram, Arumugam

    2016-12-19

    We report an ultrafast microwave-assisted solvothermal method for chemical insertion of Mg2+ ions into host materials using magnesium acetate [Mg(CH3COO)2] as a metal-ion source and diethylene glycol (DEG) as a reducing agent. For instance, up to 3 Mg ions per formula unit of a microporous host framework Mo2.5+yVO9+z could be inserted in as little as 30 min at 170–195 °C in air. This process is superior to the traditional method which involves the use of organometallic reagents, such as di-n-butylmagnesium [(C4H9)2Mg] and magnesium bis(2,6-di-tert-butylphenoxide) [Mg-(O-2,6-But2C6H3)2], and requires an inert atmosphere with extremely long reaction times. Considering the lack of robust electrolytes for Mg-ion batteries, this facile approach can be readily used as a rapid screening technique to identify potential Mg-ion electrode hosts without the necessity of fabricating electrodes and assembling electrochemical cells. Due to the mild reaction conditions, the overall structure and morphology of the Mg-ion inserted products are maintained and the compounds can be used successfully as a cathode in Mg-ion batteries. The combined synchrotron X-ray and neutron diffraction Rietveld analysis reveals the structure of the Mg-inserted compounds and gives an insight into the interactions between the Mg ions and the open-tunnel host framework.

  3. Capturing Uncertainty by Modeling Local Transposon Insertion Frequencies Improves Discrimination of Essential Genes.

    Science.gov (United States)

    DeJesus, Michael A; Ioerger, Thomas R

    2015-01-01

    Transposon mutagenesis experiments enable the identification of essential genes in bacteria. Deep-sequencing of mutant libraries provides a large amount of high-resolution data on essentiality. Statistical methods developed to analyze this data have traditionally assumed that the probability of observing a transposon insertion is the same across the genome. This assumption, however, is inconsistent with the observed insertion frequencies from transposon mutant libraries of M. tuberculosis. We propose a modified Binomial model of essentiality that can characterize the insertion probability of individual genes in which we allow local variation in the background insertion frequency in different non-essential regions of the genome. Using the Metropolis-Hastings algorithm, samples of the posterior insertion probabilities were obtained for each gene, and the probability of each gene being essential is estimated. We compared our predictions to those of previous methods and show that, by taking into consideration local insertion frequencies, our method is capable of making more conservative predictions that better match what is experimentally known about essential and non-essential genes.

  4. Angiotensin-converting enzyme insertion/deletion gene ...

    Indian Academy of Sciences (India)

    2016-03-02

    Haemoglobinopathies and Cystic fibrosis,. LR00SP03', Tunis 1007, Tunisia ... of mutations emphasizes the role of genetic background (modifier gene) and environment. (Cutting ... Journal of Genetics, Vol. 95, No. 1, March 2016. 193 ...

  5. Comparing insertion libraries in two Pseudomonas aeruginosa strains to assess gene essentiality.

    Science.gov (United States)

    Liberati, Nicole T; Urbach, Jonathan M; Thurber, Tara K; Wu, Gang; Ausubel, Frederick M

    2008-01-01

    Putative essential genes can be identified by comparing orthologs not disrupted in multiple near-saturated transposon insertion mutation libraries in related strains of the same bacterial species. Methods for identifying all orthologs between two bacterial strains and putative essential orthologs are described. In addition, protocols detailing near-saturation transposon insertion mutagenesis of bacteria are presented, including (1) conjugation-mediated mutagenesis, (2) automated colony picking and liquid handling of mutant cultures, and (3) arbitrary polymerase chain reaction amplification and sequencing of genomic DNA adjacent to transposon insertion sites.

  6. Human Retrotransposon Insertion Polymorphisms Are Associated with Health and Disease via Gene Regulatory Phenotypes

    Directory of Open Access Journals (Sweden)

    Lu Wang

    2017-08-01

    Full Text Available The human genome hosts several active families of transposable elements (TEs, including the Alu, LINE-1, and SVA retrotransposons that are mobilized via reverse transcription of RNA intermediates. We evaluated how insertion polymorphisms generated by human retrotransposon activity may be related to common health and disease phenotypes that have been previously interrogated through genome-wide association studies (GWAS. To address this question, we performed a genome-wide screen for retrotransposon polymorphism disease associations that are linked to TE induced gene regulatory changes. Our screen first identified polymorphic retrotransposon insertions found in linkage disequilibrium (LD with single nucleotide polymorphisms that were previously associated with common complex diseases by GWAS. We further narrowed this set of candidate disease associated retrotransposon polymorphisms by identifying insertions that are located within tissue-specific enhancer elements. We then performed expression quantitative trait loci analysis on the remaining set of candidates in order to identify polymorphic retrotransposon insertions that are associated with gene expression changes in B-cells of the human immune system. This progressive and stringent screen yielded a list of six retrotransposon insertions as the strongest candidates for TE polymorphisms that lead to disease via enhancer-mediated changes in gene regulation. For example, we found an SVA insertion within a cell-type specific enhancer located in the second intron of the B4GALT1 gene. B4GALT1 encodes a glycosyltransferase that functions in the glycosylation of the Immunoglobulin G (IgG antibody in such a way as to convert its activity from pro- to anti-inflammatory. The disruption of the B4GALT1 enhancer by the SVA insertion is associated with down-regulation of the gene in B-cells, which would serve to keep the IgG molecule in a pro-inflammatory state. Consistent with this idea, the B4GALT1 enhancer

  7. Targeted, homology-driven gene insertion in stem cells by ZFN-loaded 'all-in-one' lentiviral vectors

    DEFF Research Database (Denmark)

    Cai, Yujia; Laustsen, Anders; Zhou, Yan

    2016-01-01

    -driven mechanism into safe loci. This insertion mechanism is driven by time-restricted exposure of treated cells to ZFNs. We show targeted gene integration in human stem cells, including CD34+ hematopoietic progenitors and induced pluripotent stem cells (iPSCs). Notably, targeted insertions are identified in 89......% of transduced iPSCs. Our findings demonstrate the applicability of nuclease-loaded 'all-in-one' IDLVs for site-directed gene insertion in stem cell based gene therapies....

  8. Insertion/deletion polymorphism of the ACE gene and adherence to ACE inhibitors

    NARCIS (Netherlands)

    H. Schelleman (Hedi); O.H. Klungel (Olaf); C.M. van Duijn (Cornelia); J.C.M. Witteman (Jacqueline); A. Hofman (Albert); A.C. de Boer (Anthonius); B.H.Ch. Stricker (Bruno)

    2005-01-01

    textabstractAims: We investigated whether the insertion/deletion (I/D) polymorphism of the ACE gene modified the adherence to ACE inhibitors as measured by the discontinuation of an ACE inhibitor, or addition of another antihypertensive drug. Methods: This was a cohort study among 239 subjects who

  9. Anesthesia for left ventricular assist device insertion: a case series and review.

    Science.gov (United States)

    Broussard, David; Donaldson, Emilie; Falterman, Jason; Bates, Michael

    2011-01-01

    From October 2008 to June 2010, a total of 42 patients had the HeartMate II left ventricular assist device inserted surgically at Ochsner Medical Center in New Orleans, LA. A retrospective electronic record review was conducted on this series of patients to analyze elements of perioperative anesthetic care, including general anesthetic care, echocardiographic considerations, and blood product usage. Etomidate was used to induce anesthesia for 34 of 42 patients (81%) in this series, with an average dose of 16.5 mg (±6 mg). The average intraoperative fentanyl dose was 1,318 µg (±631 µg). On average, patients were extubated 91 hours (±72 hours) after arrival to the intensive care unit and left on day 9 (±5 days). The average left ventricular ejection fraction of the patients in this series was 13% (±5%). Sixteen patients were evaluated as having severe right-heart dysfunction preoperatively. Two of 42 patients required surgical closure of echocardiographically identified patent foramen ovale. Twelve of 42 patients underwent surgical correction of tricuspid regurgitation. On average, 3 units (±2.6 units) of fresh frozen plasma were transfused intraoperatively and 10 units postoperatively. Intraoperative red blood cell usage averaged 1.1 units (maximum, 7 units), with an average 9.3 units administered in the first 48 hours postoperatively.

  10. 3D Dynamic Motion Planning for Robot-Assisted Cannula Flexible Needle Insertion into Soft Tissue

    Directory of Open Access Journals (Sweden)

    Yan-Jiang Zhao

    2016-06-01

    Full Text Available In robot-assisted needle-based medical procedures, insertion motion planning is a crucial aspect. 3D dynamic motion planning for a cannula flexible needle is challenging with regard to the nonholonomic motion of the needle tip, the presence of anatomic obstacles or sensitive organs in the needle path, as well as uncertainties due to the dynamic environment caused by the movements and deformations of the organs. The kinematics of the cannula flexible needle is calculated in this paper. Based on a rapid and robust static motion planning algorithm, referred to as greedy heuristic and reachability-guided rapidly-exploring random trees, a 3D dynamic motion planner is developed by using replanning. Aiming at the large detour problem, the convergence problem and the accuracy problem that replanning encounters, three novel strategies are proposed and integrated into the conventional replanning algorithm. Comparisons are made between algorithms with and without the strategies to verify their validity. Simulations showed that the proposed algorithm can overcome the above-noted problems to realize real-time replanning in a 3D dynamic environment, which is appropriate for intraoperative planning.

  11. The NF1 gene contains hotspots for L1 endonuclease-dependent de novo insertion.

    Directory of Open Access Journals (Sweden)

    Katharina Wimmer

    2011-11-01

    Full Text Available Long interspersed (L1 and Alu elements are actively amplified in the human genome through retrotransposition of their RNA intermediates by the -100 still retrotranspositionally fully competent L1 elements. Retrotransposition can cause inherited disease if such an element is inserted near or within a functional gene. Using direct cDNA sequencing as the primary assay for comprehensive NF1 mutation analysis, we uncovered in 18 unrelated index patients splicing alterations not readily explained at the genomic level by an underlying point-mutation or deletion. Improved PCR protocols avoiding allelic drop-out of the mutant alleles uncovered insertions of fourteen Alu elements, three L1 elements, and one poly(T stretch to cause these splicing defects. Taken together, the 18 pathogenic L1 endonuclease-mediated de novo insertions represent the largest number of this type of mutations characterized in a single human gene. Our findings show that retrotransposon insertions account for as many as -0.4% of all NF1 mutations. Since altered splicing was the main effect of the inserted elements, the current finding was facilitated by the use of RNA-based mutation analysis protocols, resulting in improved detection compared to gDNA-based approaches. Six different insertions clustered in a relatively small 1.5-kb region (NF1 exons 21(16-23(18 within the 280-kb NF1 gene. Furthermore, three different specific integration sites, one of them located in this cluster region, were each used twice, i.e. NM_000267.3(NF1:c.1642-1_1642 in intron 14(10c, NM_000267.3(NF1:c.2835_2836 in exon 21(16, and NM_000267.3(NF1:c.4319_4320 in exon 33(25. Identification of three loci that each served twice as integration site for independent retrotransposition events as well as 1.5-kb cluster region harboring six independent insertions supports the notion of non-random insertion of retrotransposons in the human genome. Currently, little is known about which features make sites

  12. Transposable element insertions in long intergenic non-coding RNA genes

    Directory of Open Access Journals (Sweden)

    Sivakumar eKannan

    2015-06-01

    Full Text Available Transposable elements (TE are abundant in mammalian genomes and appear to have contributed to the evolution of their hosts by providing novel regulatory or coding sequences. We analyzed different regions of long intergenic non-coding RNA (lincRNA genes in human and mouse genomes to systematically assess the potential contribution of TEs to the evolution of the structure and regulation of expression of lincRNA genes. Introns of lincRNA genes contain the highest percentage of TE-derived sequences, followed by exons and then promoter regions although the density of TEs is not significantly different between exons and promoters. Higher frequencies of ancient TEs in promoters and exons compared to introns implies that many lincRNA genes emerged before the split of primates and rodents. The content of TE-derived sequences in lincRNA genes is substantially higher than that in protein-coding genes, especially in exons and promoter regions. A significant positive correlation was detected between the content of TEs and evolutionary rate of lincRNAs indicating that inserted TEs are preferentially fixed in fast-evolving lincRNA genes. These results are consistent with the RIDL (Repeat Insertion Domains of LncRNAs hypothesis under which TEs have substantially contributed to the origin, evolution, and in particular functional diversification, of lincRNA genes.

  13. Gene transfer and genome-wide insertional mutagenesis by retroviral transduction in fish stem cells.

    Directory of Open Access Journals (Sweden)

    Qizhi Liu

    Full Text Available Retrovirus (RV is efficient for gene transfer and integration in dividing cells of diverse organisms. RV provides a powerful tool for insertional mutagenesis (IM to identify and functionally analyze genes essential for normal and pathological processes. Here we report RV-mediated gene transfer and genome-wide IM in fish stem cells from medaka and zebrafish. Three RVs were produced for fish cell transduction: rvLegfp and rvLcherry produce green fluorescent protein (GFP and mCherry fluorescent protein respectively under control of human cytomegalovirus immediate early promoter upon any chromosomal integration, whereas rvGTgfp contains a splicing acceptor and expresses GFP only upon gene trapping (GT via intronic in-frame integration and spliced to endogenous active genes. We show that rvLegfp and rvLcherry produce a transduction efficiency of 11~23% in medaka and zebrafish stem cell lines, which is as 30~67% efficient as the positive control in NIH/3T3. Upon co-infection with rvGTgfp and rvLcherry, GFP-positive cells were much fewer than Cherry-positive cells, consistent with rareness of productive gene trapping events versus random integration. Importantly, rvGTgfp infection in the medaka haploid embryonic stem (ES cell line HX1 generated GTgfp insertion on all 24 chromosomes of the haploid genome. Similar to the mammalian haploid cells, these insertion events were presented predominantly in intergenic regions and introns but rarely in exons. RV-transduced HX1 retained the ES cell properties such as stable growth, embryoid body formation and pluripotency gene expression. Therefore, RV is proficient for gene transfer and IM in fish stem cells. Our results open new avenue for genome-wide IM in medaka haploid ES cells in culture.

  14. Gene transfer and genome-wide insertional mutagenesis by retroviral transduction in fish stem cells.

    Science.gov (United States)

    Liu, Qizhi; Wang, Yunzhi; Lin, Fan; Zhang, Lei; Li, Yan; Ge, Ruowen; Hong, Yunhan

    2015-01-01

    Retrovirus (RV) is efficient for gene transfer and integration in dividing cells of diverse organisms. RV provides a powerful tool for insertional mutagenesis (IM) to identify and functionally analyze genes essential for normal and pathological processes. Here we report RV-mediated gene transfer and genome-wide IM in fish stem cells from medaka and zebrafish. Three RVs were produced for fish cell transduction: rvLegfp and rvLcherry produce green fluorescent protein (GFP) and mCherry fluorescent protein respectively under control of human cytomegalovirus immediate early promoter upon any chromosomal integration, whereas rvGTgfp contains a splicing acceptor and expresses GFP only upon gene trapping (GT) via intronic in-frame integration and spliced to endogenous active genes. We show that rvLegfp and rvLcherry produce a transduction efficiency of 11~23% in medaka and zebrafish stem cell lines, which is as 30~67% efficient as the positive control in NIH/3T3. Upon co-infection with rvGTgfp and rvLcherry, GFP-positive cells were much fewer than Cherry-positive cells, consistent with rareness of productive gene trapping events versus random integration. Importantly, rvGTgfp infection in the medaka haploid embryonic stem (ES) cell line HX1 generated GTgfp insertion on all 24 chromosomes of the haploid genome. Similar to the mammalian haploid cells, these insertion events were presented predominantly in intergenic regions and introns but rarely in exons. RV-transduced HX1 retained the ES cell properties such as stable growth, embryoid body formation and pluripotency gene expression. Therefore, RV is proficient for gene transfer and IM in fish stem cells. Our results open new avenue for genome-wide IM in medaka haploid ES cells in culture.

  15. Force Modeling, Identification, and Feedback Control of Robot-Assisted Needle Insertion: A Survey of the Literature.

    Science.gov (United States)

    Yang, Chongjun; Xie, Yu; Liu, Shuang; Sun, Dong

    2018-02-12

    Robot-assisted surgery is of growing interest in the surgical and engineering communities. The use of robots allows surgery to be performed with precision using smaller instruments and incisions, resulting in shorter healing times. However, using current technology, an operator cannot directly feel the operation because the surgeon-instrument and instrument-tissue interaction force feedbacks are lost during needle insertion. Advancements in force feedback and control not only help reduce tissue deformation and needle deflection but also provide the surgeon with better control over the surgical instruments. The goal of this review is to summarize the key components surrounding the force feedback and control during robot-assisted needle insertion. The literature search was conducted during the middle months of 2017 using mainstream academic search engines with a combination of keywords relevant to the field. In total, 166 articles with valuable contents were analyzed and grouped into five related topics. This survey systemically summarizes the state-of-the-art force control technologies for robot-assisted needle insertion, such as force modeling, measurement, the factors that influence the interaction force, parameter identification, and force control algorithms. All studies show force control is still at its initial stage. The influence factors, needle deflection or planning remain open for investigation in future.

  16. Force Modeling, Identification, and Feedback Control of Robot-Assisted Needle Insertion: A Survey of the Literature

    Directory of Open Access Journals (Sweden)

    Chongjun Yang

    2018-02-01

    Full Text Available Robot-assisted surgery is of growing interest in the surgical and engineering communities. The use of robots allows surgery to be performed with precision using smaller instruments and incisions, resulting in shorter healing times. However, using current technology, an operator cannot directly feel the operation because the surgeon-instrument and instrument-tissue interaction force feedbacks are lost during needle insertion. Advancements in force feedback and control not only help reduce tissue deformation and needle deflection but also provide the surgeon with better control over the surgical instruments. The goal of this review is to summarize the key components surrounding the force feedback and control during robot-assisted needle insertion. The literature search was conducted during the middle months of 2017 using mainstream academic search engines with a combination of keywords relevant to the field. In total, 166 articles with valuable contents were analyzed and grouped into five related topics. This survey systemically summarizes the state-of-the-art force control technologies for robot-assisted needle insertion, such as force modeling, measurement, the factors that influence the interaction force, parameter identification, and force control algorithms. All studies show force control is still at its initial stage. The influence factors, needle deflection or planning remain open for investigation in future.

  17. Lentiviral vector-based insertional mutagenesis identifies genes associated with liver cancer

    Science.gov (United States)

    Ranzani, Marco; Cesana, Daniela; Bartholomae, Cynthia C.; Sanvito, Francesca; Pala, Mauro; Benedicenti, Fabrizio; Gallina, Pierangela; Sergi, Lucia Sergi; Merella, Stefania; Bulfone, Alessandro; Doglioni, Claudio; von Kalle, Christof; Kim, Yoon Jun; Schmidt, Manfred; Tonon, Giovanni; Naldini, Luigi; Montini, Eugenio

    2013-01-01

    Transposons and γ-retroviruses have been efficiently used as insertional mutagens in different tissues to identify molecular culprits of cancer. However, these systems are characterized by recurring integrations that accumulate in tumor cells, hampering the identification of early cancer-driving events amongst bystander and progression-related events. We developed an insertional mutagenesis platform based on lentiviral vectors (LVV) by which we could efficiently induce hepatocellular carcinoma (HCC) in 3 different mouse models. By virtue of LVV’s replication-deficient nature and broad genome-wide integration pattern, LVV-based insertional mutagenesis allowed identification of 4 new liver cancer genes from a limited number of integrations. We validated the oncogenic potential of all the identified genes in vivo, with different levels of penetrance. Our newly identified cancer genes are likely to play a role in human disease, since they are upregulated and/or amplified/deleted in human HCCs and can predict clinical outcome of patients. PMID:23314173

  18. Contemporary outcome of unplanned right ventricular assist device for severe right heart failure after continuous-flow left ventricular assist device insertion.

    Science.gov (United States)

    Yoshioka, Daisuke; Takayama, Hiroo; Garan, Reshad A; Topkara, Veli K; Han, Jiho; Kurlansky, Paul; Yuzefpolskaya, Melana; Colombo, Paolo C; Naka, Yoshifumi; Takeda, Koji

    2017-06-01

    The timely use of a right ventricular assist device (RVAD) becomes necessary for severe right heart failure (RHF) after left ventricular assist device (LVAD) insertion. This study evaluates outcomes in patients who required unplanned RVAD support early after continuous-flow (CF) LVAD insertion. We retrospectively reviewed 305 patients who underwent HeartMate II/HeartWare CF-LVAD insertion between 2009 and 2014. Twenty-seven (9%) patients required unplanned RVAD for severe RHF early after LVAD insertion. We compared early and late outcomes in patients with and without RVAD. The median time to RVAD implantation after primary CF-LVAD implantation was 1.0 (0-3) day. Seventeen (63%) patients could be weaned from RVAD after median of 14 (10-18) days. In 278 patients in the isolated LVAD group, overall survival at 3 and 12 months was 95% and 86%, whereas 59% and 54% in the unplanned RVAD group, respectively ( P  RHF at 1 year was 53% in the unplanned RVAD group and 90% in the isolated LVAD group ( P  = 0.002). Among patients who required unplanned RVAD after CF-LVAD implantation, above 60% of the patients could be weaned from RVAD. However, careful attention should be paid to the recurrent or sustained RHF.

  19. Multiple Independent Retroelement Insertions in the Promoter of a Stress Response Gene Have Variable Molecular and Functional Effects in Drosophila.

    Directory of Open Access Journals (Sweden)

    Miriam Merenciano

    2016-08-01

    Full Text Available Promoters are structurally and functionally diverse gene regulatory regions. The presence or absence of sequence motifs and the spacing between the motifs defines the properties of promoters. Recent alternative promoter usage analyses in Drosophila melanogaster revealed that transposable elements significantly contribute to promote diversity. In this work, we analyzed in detail one of the transposable element insertions, named FBti0019985, that has been co-opted to drive expression of CG18446, a candidate stress response gene. We analyzed strains from different natural populations and we found that besides FBti0019985, there are another eight independent transposable elements inserted in the proximal promoter region of CG18446. All nine insertions are solo-LTRs that belong to the roo family. We analyzed the sequence of the nine roo insertions and we investigated whether the different insertions were functionally equivalent by performing 5'-RACE, gene expression, and cold-stress survival experiments. We found that different insertions have different molecular and functional consequences. The exact position where the transposable elements are inserted matters, as they all showed highly conserved sequences but only two of the analyzed insertions provided alternative transcription start sites, and only the FBti0019985 insertion consistently affects CG18446 expression. The phenotypic consequences of the different insertions also vary: only FBti0019985 was associated with cold-stress tolerance. Interestingly, the only previous report of transposable elements inserting repeatedly and independently in a promoter region in D. melanogaster, were also located upstream of a stress response gene. Our results suggest that functional validation of individual structural variants is needed to resolve the complexity of insertion clusters.

  20. Identification of virulence genes in the crucifer anthracnose fungus Colletotrichum higginsianum by insertional mutagenesis.

    Science.gov (United States)

    Liu, Liping; Zhao, Dian; Zheng, Lu; Hsiang, Tom; Wei, Yangdou; Fu, Yanping; Huang, Junbin

    2013-11-01

    To investigate the molecular and genetic mechanisms underlying virulence of Colletotrichum higginsianum on Arabidopsis thaliana, a T-DNA insertion mutant library of C. higginsianum, the causal agent of crucifer anthracnose, was established using Agrobacterium tumefaciens-mediated transformation. Among 875 transformants tested for virulence on Arabidopsis, six mutants with altered virulence, including an appressorial melanin-deficient mutant T734, two mutants defective in penetration, T45 and B30, and three mutants, T679, T732 and T801, that cause hypersensitive reactions on host Arabidopsis, were obtained. Southern blot analysis indicated that the mutants T732 and T734 harbored single-site T-DNA integrations, while B30 harbored two T-DNA insertions. Border flanking sequences of T-DNAs from these mutants were recovered by inverse polymerase chain reaction (PCR) and thermal asymmetric interlaced PCR. Sequence analyses revealed that single T-DNA insertions in mutant T734 targeted the coding region of a gene with unknown function, and in mutant T732 targeted a gene encoding a copper amine oxidase. The two T-DNA insertion sites in mutant B30 were found in the coding region of a gene encoding an exosome component and in the upstream region of a DUF221-domain gene. None of these genes have previously been implicated in virulence of the phytopathogenic fungi. Among these avirulent mutants, T734 showed altered color in colony growth and produced melanin-deficient, albino appressoria. The T-DNA insert in T734 was detected in the coding region of a gene named C. higginsianum melanin-deficiency gene (Ch-MEL1), which is highly similar to a gene encoding a hypothetical protein in Colletotrichum gloeosporioides (GenBank ELA33048). To validate whether the Ch-MEL1 gene was associated with virulence of the mutant T734, a targeted gene disruption and complementation approach was used. The appressoria of ▵Ch-mel1 null mutants were defective in melanization and failed to penetrate

  1. An exonic insertion within Tex14 gene causes spermatogenic arrest in pigs

    Directory of Open Access Journals (Sweden)

    Sironen Anu

    2011-12-01

    Full Text Available Abstract Background Male infertility is an increasing problem in all domestic species including man. Localization and identification of genes involved in defects causing male infertility provide valuable information of specific events in sperm development. Sperm development is a complex process, where diploid spermatogonia develop into haploid, highly specialized spermatozoa. Correct expression and function of various genes and their protein products are required for production of fertile sperm. We have identified an infertility defect in Finnish Yorkshire boars caused by spermatogenic arrest. The aim of this study was to locate the disease associated region using genome wide screen with the PorcineSNP60 Beadchip and identify the causal mutation by candidate gene approach. Results In the Finnish Yorkshire pig population the spermatogenic arrest (SA defect appears to be of genetic origin and causes severe degeneration of germ cells and total absence of spermatozoa. Genome wide scan with the PorcineSNP60 Beadchip localized the SA defect to porcine chromosome 12 in a 2 Mbp region. Sequencing of a candidate gene Tex14 revealed a 51 bp insertion within exon 27, which caused differential splicing of the exon and created a premature translation stop codon. The expression of Tex14 was markedly down regulated in the testis of a SA affected boar compared to control boars and no protein product was identified by Western blotting. The SA insertion sequence was also found within intron 27 in all analyzed animals, thus the insertion appears to be a possible duplication event. Conclusion In this study we report the identification of a causal mutation for infertility caused by spermatogenic arrest at an early meiotic phase. Our results highlight the role of TEX14 specifically in spermatogenesis and the importance of specific genomic remodeling events as causes for inherited defects.

  2. Chromosomal Insertions in the Lactobacillus casei upp Gene That Are Useful for Vaccine Expression

    Science.gov (United States)

    Song, Bai-fen; Ju, Long-zhu

    2014-01-01

    To develop a stable and marker-free Lactobacillus strain useful for the expression of vaccines, we developed a temperature-sensitive suicide plasmid with expression cassettes containing an HCE promoter, a PgsA anchor, the alpha-toxin gene, and an rrnB T1T2 terminator (PPαT) that uses a 5-fluorouracil (5-FU) counterselectable marker for Lactobacillus casei. Three strains containing the correct PPαT expression cassettes were produced via the selective pressure of 5-FU screening. We confirmed that the upp gene was deleted and that the PPαT expression cassettes were inserted into the upp site of L. casei ATCC 393 by genomic PCR amplification and sequencing. 5-FU resistance in recombinant bacteria could be stably inherited for as long as 40 generations following insertion. However, bacteria containing the integrated DNA grew more slowly than wild-type L. casei. An indirect enzyme-linked immunosorbent assay (ELISA) analysis demonstrated that the alpha-toxin gene was expressed. Also, we visualized expression of the protein on the surface of L. casei cells using laser confocal microscopy. These results taken together demonstrate that these recombinant bacteria should provide a safe tool for effective vaccine production. PMID:24657853

  3. An adaptive transposable element insertion in the regulatory region of the EO gene in the domesticated silkworm, Bombyx mori.

    Science.gov (United States)

    Sun, Wei; Shen, Yi-Hong; Han, Min-Jin; Cao, Yun-Feng; Zhang, Ze

    2014-12-01

    Although there are many studies to show a key role of transposable elements (TEs) in adaptive evolution of higher organisms, little is known about the molecular mechanisms. In this study, we found that a partial TE (Taguchi) inserted in the cis-regulatory region of the silkworm ecdysone oxidase (EO) gene, which encodes a crucial enzyme to reduce the titer of molting hormone (20-hydroxyecdysone, 20E). The TE insertion occurred during domestication of silkworm and the frequency of the TE insertion in the domesticated silkworm (Bombyx mori) is high, 54.24%. The linkage disequilibrium in the TE inserted strains of the domesticated silkworm was elevated. Molecular population genetics analyses suggest that this TE insertion is adaptive for the domesticated silkworm. Luminescent reporter assay shows that the TE inserted in the cis-regulatory region of the EO gene functions as a 20E-induced enhancer of the gene expression. Further, phenotypic bioassay indicates that the silkworm with the TE insertion exhibited more stable developmental phenotype than the silkworm without the TE insertion when suffering from food shortage. Thus, the inserted TE in the cis-regulatory region of the EO gene increased developmental uniformity of silkworm individuals through regulating 20E metabolism, partially explaining transformation of a domestication developmental trait in the domesticated silkworm. Our results emphasize the exceptional role of gene expression regulation in developmental transition of domesticated animals. © The Author 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  4. Polymer-based disposable microneedle array with insertion assisted by vibrating motion

    OpenAIRE

    Lee, F.-W.; Hung, W.-H.; Ma, C.-W.; Yang, Y.-J.

    2016-01-01

    This work presents a disposable polymer-based microneedle array that carries out insertions by mimicking the vibrating motion of a mosquito's proboscis. The proposed device, which comprises a 10:1 high-aspect-ratio parylene microneedle array and a chamber structure, was monolithically realized using a novel fabrication process. The vibrating motion of the microneedles was generated using a piezoelectric actuator. This device can be potentially applied to extract and colle...

  5. Site-Specific Insertion Polymorphism of the MITE Alex-1 in the Genus Coffea Suggests Interspecific Gene Flow

    Science.gov (United States)

    Dubreuil-Tranchant, Christine; Guyot, Romain; Guellim, Amira; Duret, Caroline; de la Mare, Marion; Razafinarivo, Norosoa; Poncet, Valérie; Hamon, Serge; Hamon, Perla; de Kochko, Alexandre

    2011-01-01

    Miniature Inverted-repeat Transposable Elements (MITEs) are small nonautonomous class-II transposable elements distributed throughout eukaryotic genomes. We identified a novel family of MITEs (named Alex) in the Coffea canephora genome often associated with expressed sequences. The Alex-1 element is inserted in an intron of a gene at the CcEIN4 locus. Its mobility was demonstrated by sequencing the insertion site in C. canephora accessions and Coffea species. Analysis of the insertion polymorphism of Alex-1 at this locus in Coffea species and in C. canephora showed that there was no relationship between the geographical distribution of the species, their phylogenetic relationships, and insertion polymorphism. The intraspecific distribution of C. canephora revealed an original situation within the E diversity group. These results suggest possibly greater gene flow between species than previously thought. This MITE family will enable the study of the C. canephora genome evolution, phylogenetic relationships, and possible gene flows within the Coffea genus. PMID:21961075

  6. Site-Specific Insertion Polymorphism of the MITE Alex-1 in the Genus Coffea Suggests Interspecific Gene Flow

    Directory of Open Access Journals (Sweden)

    Christine Dubreuil-Tranchant

    2011-01-01

    Full Text Available Miniature Inverted-repeat Transposable Elements (MITEs are small nonautonomous class-II transposable elements distributed throughout eukaryotic genomes. We identified a novel family of MITEs (named Alex in the Coffea canephora genome often associated with expressed sequences. The Alex-1 element is inserted in an intron of a gene at the CcEIN4 locus. Its mobility was demonstrated by sequencing the insertion site in C. canephora accessions and Coffea species. Analysis of the insertion polymorphism of Alex-1 at this locus in Coffea species and in C. canephora showed that there was no relationship between the geographical distribution of the species, their phylogenetic relationships, and insertion polymorphism. The intraspecific distribution of C. canephora revealed an original situation within the E diversity group. These results suggest possibly greater gene flow between species than previously thought. This MITE family will enable the study of the C. canephora genome evolution, phylogenetic relationships, and possible gene flows within the Coffea genus.

  7. Site-Specific Insertion Polymorphism of the MITE Alex-1 in the Genus Coffea Suggests Interspecific Gene Flow.

    Science.gov (United States)

    Dubreuil-Tranchant, Christine; Guyot, Romain; Guellim, Amira; Duret, Caroline; de la Mare, Marion; Razafinarivo, Norosoa; Poncet, Valérie; Hamon, Serge; Hamon, Perla; de Kochko, Alexandre

    2011-01-01

    Miniature Inverted-repeat Transposable Elements (MITEs) are small nonautonomous class-II transposable elements distributed throughout eukaryotic genomes. We identified a novel family of MITEs (named Alex) in the Coffea canephora genome often associated with expressed sequences. The Alex-1 element is inserted in an intron of a gene at the CcEIN4 locus. Its mobility was demonstrated by sequencing the insertion site in C. canephora accessions and Coffea species. Analysis of the insertion polymorphism of Alex-1 at this locus in Coffea species and in C. canephora showed that there was no relationship between the geographical distribution of the species, their phylogenetic relationships, and insertion polymorphism. The intraspecific distribution of C. canephora revealed an original situation within the E diversity group. These results suggest possibly greater gene flow between species than previously thought. This MITE family will enable the study of the C. canephora genome evolution, phylogenetic relationships, and possible gene flows within the Coffea genus.

  8. Molecular evaluation of a novel missense mutation & an insertional truncating mutation in SUMF1 gene

    Directory of Open Access Journals (Sweden)

    Udhaya H Kotecha

    2014-01-01

    Full Text Available Background & objectives: Multiple suphphatase deficiency (MSD is an autosomal recessive disorder affecting the post translational activation of all enzymes of the sulphatase family. To date, approximately 30 different mutations have been identified in the causative gene, sulfatase modifying factor 1 (SUMF1. We describe here the mutation analysis of a case of MSD. Methods: The proband was a four year old boy with developmental delay followed by neuroregression. He had coarse facies, appendicular hypertonia, truncal ataxia and ichthyosis limited to both lower limbs. Radiographs showed dysostosis multiplex. Clinical suspicion of MSD was confirmed by enzyme analysis of four enzymes of the sulphatase group. Results: The patient was compound heterozygote for a c.451A>G (p.K151E substitution in exon 3 and a single base insertion mutation (c.690_691 InsT in exon 5 in the SUMF1 gene. The bioinformatic analysis of the missense mutation revealed no apparent effect on the overall structure. However, the mutated 151-amino acid residue was found to be adjacent to the substrate binding and the active site residues, thereby affecting the substrate binding and/or catalytic activity, resulting in almost complete loss of enzyme function. Conclusions: The two mutations identified in the present case were novel. This is perhaps the first report of an insertion mutation in SUMF1 causing premature truncation of the protein.

  9. Molecular evaluation of a novel missense mutation & an insertional truncating mutation in SUMF1 gene.

    Science.gov (United States)

    Kotecha, Udhaya H; Movva, Sireesha; Sharma, Deepak; Verma, Jyotsna; Puri, Ratna Dua; Verma, Ishwar Chander

    2014-07-01

    Multiple suphphatase deficiency (MSD) is an autosomal recessive disorder affecting the post translational activation of all enzymes of the sulphatase family. To date, approximately 30 different mutations have been identified in the causative gene, sulfatase modifying factor 1 (SUMF1). We describe here the mutation analysis of a case of MSD. The proband was a four year old boy with developmental delay followed by neuroregression. He had coarse facies, appendicular hypertonia, truncal ataxia and ichthyosis limited to both lower limbs. Radiographs showed dysostosis multiplex. Clinical suspicion of MSD was confirmed by enzyme analysis of four enzymes of the sulphatase group. The patient was compound heterozygote for a c.451A>G (p.K151E) substitution in exon 3 and a single base insertion mutation (c.690_691 InsT) in exon 5 in the SUMF1 gene. The bioinformatic analysis of the missense mutation revealed no apparent effect on the overall structure. However, the mutated 151-amino acid residue was found to be adjacent to the substrate binding and the active site residues, thereby affecting the substrate binding and/or catalytic activity, resulting in almost complete loss of enzyme function. The two mutations identified in the present case were novel. This is perhaps the first report of an insertion mutation in SUMF1 causing premature truncation of the protein.

  10. Angiotensin-converting-enzyme gene insertion/deletion polymorphism and response to physical training.

    Science.gov (United States)

    Montgomery, H; Clarkson, P; Barnard, M; Bell, J; Brynes, A; Dollery, C; Hajnal, J; Hemingway, H; Mercer, D; Jarman, P; Marshall, R; Prasad, K; Rayson, M; Saeed, N; Talmud, P; Thomas, L; Jubb, M; World, M; Humphries, S

    1999-02-13

    The function of local renin-angiotensin systems in skeletal muscle and adipose tissue remains largely unknown. A polymorphism of the human angiotensin converting enzyme (ACE) gene has been identified in which the insertion (I) rather than deletion (D) allele is associated with lower ACE activity in body tissues and increased response to some aspects of physical training. We studied the association between the ACE gene insertion or deletion polymorphism and changes in body composition related to an intensive exercise programme, to investigate the metabolic effects of local human renin-angiotensin systems. We used three independent methods (bioimpedance, multiple skinfold-thickness assessment of whole-body composition, magnetic resonance imaging of the mid-thigh) to study changes in body composition in young male army recruits over 10 weeks of intensive physical training. Participants with the II genotype had a greater anabolic response than those with one or more D alleles for fat mass (0.55 vs -0.20 kg, p=0.04 by bioimpedance) and non-fat mass (1.31 vs -0.15 kg, p=0.01 by bioimpedance). Changes in body morphology with training measured by the other methods were also dependent on genotype. II genotype, as a marker of low ACE activity in body tissues, may conserve a positive energy balance during rigorous training, which suggests enhanced metabolic efficiency. This finding may explain some of the survival and functional benefits of therapy with ACE inhibitors.

  11. Statistical methods in detecting differential expressed genes, analyzing insertion tolerance for genes and group selection for survival data

    Science.gov (United States)

    Liu, Fangfang

    The thesis is composed of three independent projects: (i) analyzing transposon-sequencing data to infer functions of genes on bacteria growth (chapter 2), (ii) developing semi-parametric Bayesian method for differential gene expression analysis with RNA-sequencing data (chapter 3), (iii) solving group selection problem for survival data (chapter 4). All projects are motivated by statistical challenges raised in biological research. The first project is motivated by the need to develop statistical models to accommodate the transposon insertion sequencing (Tn-Seq) data, Tn-Seq data consist of sequence reads around each transposon insertion site. The detection of transposon insertion at a given site indicates that the disruption of genomic sequence at this site does not cause essential function loss and the bacteria can still grow. Hence, such measurements have been used to infer the functions of each gene on bacteria growth. We propose a zero-inflated Poisson regression method for analyzing the Tn-Seq count data, and derive an Expectation-Maximization (EM) algorithm to obtain parameter estimates. We also propose a multiple testing procedure that categorizes genes into each of the three states, hypo-tolerant, tolerant, and hyper-tolerant, while controlling false discovery rate. Simulation studies show our method provides good estimation of model parameters and inference on gene functions. In the second project, we model the count data from RNA-sequencing experiment for each gene using a Poisson-Gamma hierarchical model, or equivalently, a negative binomial (NB) model. We derive a full semi-parametric Bayesian approach with Dirichlet process as the prior for the fold changes between two treatment means. An inference strategy using Gibbs algorithm is developed for differential expression analysis. We evaluate our method with several simulation studies, and the results demonstrate that our method outperforms other methods including the popularly applied ones such as edge

  12. Accuracy of robot-guided versus freehand fluoroscopy-assisted pedicle screw insertion in thoracolumbar spinal surgery.

    Science.gov (United States)

    Molliqaj, Granit; Schatlo, Bawarjan; Alaid, Awad; Solomiichuk, Volodymyr; Rohde, Veit; Schaller, Karl; Tessitore, Enrico

    2017-05-01

    OBJECTIVE The quest to improve the safety and accuracy and decrease the invasiveness of pedicle screw placement in spine surgery has led to a markedly increased interest in robotic technology. The SpineAssist from Mazor is one of the most widely distributed robotic systems. The aim of this study was to compare the accuracy of robot-guided and conventional freehand fluoroscopy-guided pedicle screw placement in thoracolumbar surgery. METHODS This study is a retrospective series of 169 patients (83 women [49%]) who underwent placement of pedicle screw instrumentation from 2007 to 2015 in 2 reference centers. Pathological entities included degenerative disorders, tumors, and traumatic cases. In the robot-assisted cohort (98 patients, 439 screws), pedicle screws were inserted with robotic assistance. In the freehand fluoroscopy-guided cohort (71 patients, 441 screws), screws were inserted using anatomical landmarks and lateral fluoroscopic guidance. Patients treated before 2009 were included in the fluoroscopy cohort, whereas those treated since mid-2009 (when the robot was acquired) were included in the robot cohort. Since then, the decision to operate using robotic assistance or conventional freehand technique has been based on surgeon preference and logistics. The accuracy of screw placement was assessed based on the Gertzbein-Robbins scale by a neuroradiologist blinded to treatment group. The radiological slice with the largest visible deviation from the pedicle was chosen for grading. A pedicle breach of 2 mm or less was deemed acceptable (Grades A and B) while deviations greater than 2 mm (Grades C, D, and E) were classified as misplacements. RESULTS In the robot-assisted cohort, a perfect trajectory (Grade A) was observed for 366 screws (83.4%). The remaining screws were Grades B (n = 44 [10%]), C (n = 15 [3.4%]), D (n = 8 [1.8%]), and E (n = 6 [1.4%]). In the fluoroscopy-guided group, a completely intrapedicular course graded as A was found in 76% (n = 335). The

  13. Targeted insertion of the neomycin phosphotransferase gene into the tubulin gene cluster of Trypanosoma brucei

    NARCIS (Netherlands)

    ten Asbroek, A. L.; Ouellette, M.; Borst, P.

    1990-01-01

    Kinetoplastids are unicellular eukaryotes that include important parasites of man, such as trypanosomes and leishmanias. The study of these organisms received a recent boost from the development of transient transformation allowing the short-term expression of genes reintroduced into parasites like

  14. Have we found an optimal insertion site in a Newcastle disease virus vector to express a foreign gene for vaccine and gene therapy purposes?

    Science.gov (United States)

    Using reverse genetics technology, many strains of Newcastle disease virus (NDV) have been developed as vectors to express foreign genes for vaccine and gene therapy purposes. The foreign gene is usually inserted into a non-coding region of the NDV genome as an independent transcription unit. Eval...

  15. Detection of a new 20-bp insertion/deletion (indel) within sheep PRND gene using mathematical expectation (ME) method.

    Science.gov (United States)

    Li, Jie; Zhu, Xichun; Ma, Lin; Xu, Hongwei; Cao, Xin; Luo, Renyun; Chen, Hong; Sun, Xiuzhu; Cai, Yong; Lan, Xianyong

    2017-03-04

    Prion-related protein doppel gene (PRND), as an essential member of the mammalian prion gene family, is associated with the scrapie susceptibility as well as phenotype traits, so the genetic variation of the PRND has been highly concerned recently, including the single nucleiotide polymorphism (SNP) and insertion/deletion (indel). Therefore, the objective of present study was to examine the possible indel variants by mathematical expectation (ME) detection method as well as explore its associations with phenotype traits. A novel 20-bp indel was verified in 623 tested individuals representing 4 diversity sheep breeds. The results showed that 3 genotypes were detected and the minor allelic frequency were 0.008 (Lanzhou Fat-Tail sheep, LFTS), 0.084 (Small Tail Han sheep, STHS), 0.021(Tong sheep, TS) and 0.083 (Hu sheep, HS), respectively. Comparing with the traditional method of detecting samples one by one, the reaction times with ME method was decreased by 36.22% (STHS), 37.00% (HS), 68.67% (TS) and 83.33% (LFTS), respectively. Besides, this locus was significantly associated to cannon circumference index (P = 0.012) and trunk index (P = 0.037) in the Hu sheep breed. Notably, it was not concordance with the present result of DNA sequencing (GCTGTCCCTGCAGGGCTTCT) and dbSNPase of NCBI (NC_443194: g.46184887- 46184906delCTGCTGTCCCTGCAGGGCTT). Consequently, it was the first time to detect the new 20-bp indel of sheep PRND gene by ME strategy, which might provide a valuable theoretical basis for marker-assisted selection in sheep genetics and breeding.

  16. Novel surface layer protein genes in Bacillus sphaericus associated with unusual insertion elements.

    Science.gov (United States)

    Pollmann, Katrin; Raff, Johannes; Schnorpfeil, Michaela; Radeva, Galina; Selenska-Pobell, Sonja

    2005-09-01

    The surface layer (S-layer) protein genes of the uranium mining waste pile isolate Bacillus sphaericus JG-A12 and of its relative B. sphaericus NCTC 9602 were analysed. The almost identical N-termini of the two S-layer proteins possess a unique structure, comprising three N-terminal S-layer homologous (SLH) domains. The central parts of the proteins share a high homology and are related to the S-layer proteins of B. sphaericus CCM 2177 and P-1. In contrast, the C-terminal parts of the S-layer proteins of JG-A12 and NCTC 9602 differ significantly between each other. Surprisingly, the C-terminal part of the S-layer protein of JG-A12 shares a high identity with that of the S-layer protein of B. sphaericus CCM 2177. In both JG-A12 and NCTC 9602 the chromosomal S-layer protein genes are followed by a newly identified putative insertion element comprising three ORFs, which encode a putative transposase, a putative integrase/recombinase and a putative protein containing a DNA binding helix-turn-helix motif, and the S-layer-protein-like gene copies sllA (9602) or sllB (JG-A12). Interestingly, both B. sphaericus strains studied were found to contain an additional, plasmid-located and silent S-layer protein gene with the same sequence as sllA and sllB. The primary structures of the corresponding putative proteins are almost identical in both strains. The N-terminal and central parts of these S-layer proteins share a high identity with those of the chromosomally encoded functional S-layer proteins. Their C-terminal parts, however, differ significantly. These results strongly suggest that the S-layer protein genes have evolved via horizontal transfer of genetic information followed by DNA rearrangements mediated by mobile elements.

  17. Clonal Dominance With Retroviral Vector Insertions Near the ANGPT1 and ANGPT2 Genes in a Human Xenotransplant Mouse Model

    Directory of Open Access Journals (Sweden)

    Reinhard Haemmerle

    2014-01-01

    Full Text Available Insertional leukemogenesis represents the major risk factor of hematopoietic stem cell (HSC based gene therapy utilizing integrating viral vectors. To develop a pre-clinical model for the evaluation of vector-related genotoxicity directly in the relevant human target cells, cord blood CD34+ HSCs were transplanted into immunodeficient NOD.SCID.IL2rg−/− (NSG mice after transduction with an LTR-driven gammaretroviral vector (GV. Furthermore, we specifically investigated the effect of prolonged in vitro culture in the presence of cytokines recently described to promote HSC expansion or maintenance. Clonality of human hematopoiesis in NSG mice was assessed by high throughput insertion site analyses and validated by insertion site-specific PCR depicting a GV typical integration profile with insertion sites resembling to 25% those of clinical studies. No overrepresentation of integrations in the vicinity of cancer-related genes was observed, however, several dominant clones were identified including two clones harboring integrations in the ANGPT1 and near the ANGPT2 genes associated with deregulated ANGPT1- and ANGPT2-mRNA levels. While these data underscore the potential value of the NSG model, our studies also identified short-comings such as overall low numbers of engrafted HSCs, limited in vivo observation time, and the challenges of in-depth insertion site analyses by low contribution of gene modified hematopoiesis.

  18. A 7-bp insertion in the 3' untranslated region suggests the duplication and concerted evolution of the rabbit SRY gene

    Directory of Open Access Journals (Sweden)

    Ferrand Nuno

    2006-04-01

    Full Text Available Abstract In this work we report the genetic polymorphism of a 7-bp insertion in the 3' untranslated region of the rabbit SRY gene. The polymorphic GAATTAA motif was found exclusively in one of the two divergent rabbit Y-chromosomal lineages, suggesting that its origin is more recent than the separation of the O. c. algirus and O. c. cuniculus Y-chromosomes. In addition, the remarkable observation of haplotypes exhibiting 0, 1 and 2 7-bp inserts in essentially all algirus populations suggests that the rabbit SRY gene is duplicated and evolving under concerted evolution.

  19. Genome-wide retroviral insertional tagging of genes involved in cancer in Cdkn2a-deficient mice

    DEFF Research Database (Denmark)

    Lund, Anders H; Turner, Geoffrey; Trubetskoy, Alla

    2002-01-01

    We have used large-scale insertional mutagenesis to identify functional landmarks relevant to cancer in the recently completed mouse genome sequence. We infected Cdkn2a(-/-) mice with Moloney murine leukemia virus (MoMuLV) to screen for loci that can participate in tumorigenesis in collaboration...... retroviral integration sites and mapped them against the mouse genome sequence databases from Celera and Ensembl. In addition to 17 insertions targeting gene loci known to be cancer-related, we identified a total of 37 new common insertion sites (CISs), of which 8 encode components of signaling pathways...... that are involved in cancer. The effectiveness of large-scale insertional mutagenesis in a sensitized genetic background is demonstrated by the preference for activation of MAP kinase signaling, collaborating with Cdkn2a loss in generating the lymphoid and myeloid tumors. Collectively, our results show that large...

  20. Gene-scrambling mutagenesis: generation and analysis of insertional mutations in the alginate regulatory region of Pseudomonas aeruginosa.

    Science.gov (United States)

    Mohr, C D; Deretic, V

    1990-11-01

    A novel method for random mutagenesis of targeted chromosomal regions in Pseudomona aeruginosa was developed. This method can be used with a cloned DNA fragment of indefinite size that contains a putative gene of interest. Cloned DNA is digested to produce small fragments that are then randomly reassembled into long DNA inserts by using cosmid vectors and lambda packaging reaction. This DNA is then transferred into P. aeruginosa and forced into the chromosome via homologous recombination, producing in a single step a random set of insertional mutants along a desired region of the chromosome. Application of this method to extend the analysis of the alginate regulatory region, using a cloned 6.2-kb fragment with the algR gene and the previously uncharacterized flanking regions, produced several insertional mutations. One mutation was obtained in algR, a known transcriptional regulatory of mucoidy in P. aeruginosa. The null mutation of algR was generated in a mucoid derivative of the standard genetic strain PAO responsive to different environmental factors. This mutation was used to demonstrate that the algR gene product was not essential for the regulation of its promoters. Additional insertions were obtained in regions downstream and upstream of algR. A mutation that did not affect mucoidy was generated in a gene located 1 kb upstream of algR. This gene was transcribed in the direction opposite that of algR transcription and encoded a polypeptide of 47 kDa. Partial nucleotide sequence analysis revealed strong homology of its predicted gene product with the human and yeast argininosuccinate lyases. An insertion downstream of algR produced a strain showing reduced induction of mucoidy in response to growth on nitrate as the nitrogen source.

  1. Occam paradox? A variation of tapia syndrome and an unreported complication of guidewire-assisted pedicle screw insertion.

    Science.gov (United States)

    Emohare, Osa; Peterson, Erik; Slinkard, Nathaniel; Janus, Seth; Morgan, Robert

    2013-10-01

    Study Design Case report. Clinical Question The clinical aim is to report on a previously unknown association between guidewire-assisted pedicle screw insertion and neuropraxia of the recurrent laryngeal nerve (RLN), and how this may overlap with the signs of Tapia syndrome; we also report our approach to the clinical management of this patient. Methods A 17-year-old male patient with idiopathic scoliosis experienced Tapia syndrome after posterior instrumentation and arthrodesis at the level of T1-L1. After extubation, the patient had a hoarse voice and difficulty in swallowing. Imaging showed a breach in the cortex of the anterior body of T1 corresponding to the RLN on the right. Results Otolaryngological examination noted right vocal fold immobility, decreased sensation of the endolarynx, and pooling of secretions on flexible laryngoscopy that indicated right-sided cranial nerve X injury and left-sided tongue deviation. Aspiration during a modified barium swallow prompted insertion of a percutaneous endoscopic gastrostomy tube before the patient was sent home. On postoperative day 20, a barium swallow demonstrated reduced aspiration, and the patient reported complete resolution of symptoms. The feeding tube was removed, and the patient resumed a normal diet 1 month later. Tapia syndrome, or persistent unilateral laryngeal and hypoglossal paralysis, is an uncommon neuropraxia, which has previously not been observed in association with a breached vertebral body at T1 along the course of the RLN. Conclusion Tapia syndrome should be a differential diagnostic consideration whenever these symptoms persist postoperatively and spine surgeons should be aware of this as a potential complication of guidewires in spinal instrumentation.

  2. Immunoglobulin Gene Insertions and Deletions in the Affinity Maturation of HIV-1 Broadly Reactive Neutralizing Antibodies

    Science.gov (United States)

    Kepler, Thomas B.; Liao, Hua-Xin; Alam, S. Munir; Bhaskarabhatla, Rekha; Zhang, Ruijun; Stewart, Shelley; Anasti, Kara; Kelsoe, Garnett; Parks, Robert; Lloyd, Krissey E.; Stolarchuk, Christina; Pritchett, Jamie; Solomon, Erika; Friberg, Emma; Morris, Lynn; Karim, Salim S. Abdool; Cohen, Myron S.; Walter, Emmanuel; Moody, M. Anthony; Wu, Xueling; Altae-Tran, Han R.; Georgiev, Ivelin S.; Kwong, Peter D.; Boyd, Scott D.; Fire, Andrew Z.; Mascola, John R.; Haynes, Barton F.

    2014-01-01

    Summary Induction of HIV-1 broad neutralizing antibodies (bnAbs) is a goal of HIV-1 vaccine development but has remained challenging partially due to unusual traits of bnAbs, including high somatic hypermutation (SHM) frequencies and in-frame insertions and deletions (indels). Here we examined the propensity and functional requirement for indels within HIV-1 bnAbs. High-throughput sequencing of the immunoglobulin (Ig) VHDJH genes in HIV-1 infected and uninfected individuals revealed that the indel frequency was elevated among HIV-1-infected subjects, with no unique properties attributable to bnAb-producing individuals. This increased indel occurrence depended only on the frequency of SHM point-mutations. Indel-encoded regions were generally proximal to antigen binding sites. Additionally, reconstruction of a HIV-1 CD4-binding site bnAb clonal lineage revealed that a large compound VHDJH indel was required for bnAb activity. Thus, vaccine development should focus on designing regimens targeted at sustained activation of bnAb lineages to achieve the required SHM and indel events. PMID:25211073

  3. Angiotensin-converting enzyme gene (ACE) insertion/deletion polymorphism in Mexican populations.

    Science.gov (United States)

    Vargas-Alarcón, Gilberto; Hernández-Pacheco, Guadalupe; Rodríguez-Pérez, José Manuel; Pérez-Hernández, Nonanzit; Pavón, Zinnia; Fragoso, José Manuel; Juarez-Cedillo, Teresa; Villarreal-Garza, Cynthia; Granados, Julio

    2003-12-01

    The angiotensin-converting enzyme gene (ACE) insertion/deletion polymorphism was determined in 211 Mexican healthy individuals belonging to different Mexican ethnic groups (98 Mestizos, 64 Teenek, and 49 Nahuas). ACE polymorphism differed among Mexicans with a high frequency of the D allele and the D/D genotype in Mexican Mestizos. The D/D genotype was absent in Teenek and present in only one Nahua individual (2.0%). When comparisons were made, we observed that Caucasian, African, and Asian populations presented the highest frequencies of the D allele, whereas Amerindian (Teenek and Pima) and Australian Aboriginals showed the highest frequencies of the I allele. The distribution of I/D genotype was heterogeneous in all populations: Australian Aboriginals presented the lowest frequency (4.9%), whereas Nahuas presented the highest (73.4%). The present study shows the frequencies of a polymorphism not analyzed previously in Mexican populations and establishes that this polymorphism distinguishes the Amerindian populations of other groups. On the other hand, since ACE alleles have been associated with genetic susceptibility to developing cardiovascular diseases and hypertension, knowledge of the distribution of these alleles could help to define the true significance of ACE polymorphism as a genetic susceptibility marker in the Amerindian populations.

  4. Gene flow and genetic structure in the Galician population (NW Spain) according to Alu insertions.

    Science.gov (United States)

    Varela, Tito A; Fariña, José; Diéguez, Lois Pérez; Lodeiro, Rosa

    2008-12-02

    The most recent Alu insertions reveal different degrees of polymorphism in human populations, and a series of characteristics that make them particularly suitable genetic markers for Human Biology studies. This has led these polymorphisms to be used to analyse the origin and phylogenetic relationships between contemporary human groups. This study analyses twelve Alu sequences in a sample of 216 individuals from the autochthonous population of Galicia (NW Spain), with the aim of studying their genetic structure and phylogenetic position with respect to the populations of Western and Central Europe and North Africa, research that is of special interest in revealing European population dynamics, given the peculiarities of the Galician population due to its geographical situation in western Europe, and its historical vicissitudes. The insertion frequencies of eleven of the Alu elements analysed were within the variability range of European populations, while Yb8NBC125 proved to be the lowest so far recorded to date in Europe. Taking the twelve polymorphisms into account, the GD value for the Galician population was 0.268. The comparative analyses carried out using the MDS, NJ and AMOVA methods reveal the existence of spatial heterogeneity, and identify three population groups that correspond to the geographic areas of Western-Central Europe, Eastern Mediterranean Europe and North Africa. Galicia is shown to be included in the Western-Central European cluster, together with other Spanish populations. When only considering populations from Mediterranean Europe, the Galician population revealed a degree of genetic flow similar to that of the majority of the populations from this geographic area. The results of this study reveal that the Galician population, despite its geographic situation in the western edge of the European continent, occupies an intermediate position in relation to other European populations in general, and Iberian populations in particular. This

  5. Inverse polymerase chain reaction for rapid gene isolation in Arabidopsis thaliana insertion mutants

    NARCIS (Netherlands)

    Vanderhaeghen, R.; Scheres, B.J.G.; Montagu, M. van; Lijsebetten, M. van

    1992-01-01

    Recently, many mutants have been isolated in the model plant Arabidopsis thaliana by the insertion of the Agrobacterium tumefaciens T-DNA into the plant genome. Instead of applying Southern analysis on these insertion mutants and to avoid the construction of mutant- derived genomic libraries,

  6. Insertional mutagenesis and deep profiling reveals gene hierarchies and a Myc/p53-dependent bottleneck in lymphomagenesis.

    Directory of Open Access Journals (Sweden)

    Camille A Huser

    2014-02-01

    Full Text Available Retroviral insertional mutagenesis (RIM is a powerful tool for cancer genomics that was combined in this study with deep sequencing (RIM/DS to facilitate a comprehensive analysis of lymphoma progression. Transgenic mice expressing two potent collaborating oncogenes in the germ line (CD2-MYC, -Runx2 develop rapid onset tumours that can be accelerated and rendered polyclonal by neonatal Moloney murine leukaemia virus (MoMLV infection. RIM/DS analysis of 28 polyclonal lymphomas identified 771 common insertion sites (CISs defining a 'progression network' that encompassed a remarkably large fraction of known MoMLV target genes, with further strong indications of oncogenic selection above the background of MoMLV integration preference. Progression driven by RIM was characterised as a Darwinian process of clonal competition engaging proliferation control networks downstream of cytokine and T-cell receptor signalling. Enhancer mode activation accounted for the most efficiently selected CIS target genes, including Ccr7 as the most prominent of a set of chemokine receptors driving paracrine growth stimulation and lymphoma dissemination. Another large target gene subset including candidate tumour suppressors was disrupted by intragenic insertions. A second RIM/DS screen comparing lymphomas of wild-type and parental transgenics showed that CD2-MYC tumours are virtually dependent on activation of Runx family genes in strong preference to other potent Myc collaborating genes (Gfi1, Notch1. Ikzf1 was identified as a novel collaborating gene for Runx2 and illustrated the interface between integration preference and oncogenic selection. Lymphoma target genes for MoMLV can be classified into (a a small set of master regulators that confer self-renewal; overcoming p53 and other failsafe pathways and (b a large group of progression genes that control autonomous proliferation in transformed cells. These findings provide insights into retroviral biology, human cancer

  7. Single-step generation of gene knockout-rescue system in pluripotent stem cells by promoter insertion with CRISPR/Cas9.

    Science.gov (United States)

    Matsunaga, Taichi; Yamashita, Jun K

    2014-02-07

    Specific gene knockout and rescue experiments are powerful tools in developmental and stem cell biology. Nevertheless, the experiments require multiple steps of molecular manipulation for gene knockout and subsequent rescue procedures. Here we report an efficient and single step strategy to generate gene knockout-rescue system in pluripotent stem cells by promoter insertion with CRISPR/Cas9 genome editing technology. We inserted a tetracycline-regulated inducible gene promoter (tet-OFF/TRE-CMV) upstream of the endogenous promoter region of vascular endothelial growth factor receptor 2 (VEGFR2/Flk1) gene, an essential gene for endothelial cell (EC) differentiation, in mouse embryonic stem cells (ESCs) with homologous recombination. Both homo- and hetero-inserted clones were efficiently obtained through a simple selection with a drug-resistant gene. The insertion of TRE-CMV promoter disrupted endogenous Flk1 expression, resulting in null mutation in homo-inserted clones. When the inserted TRE-CMV promoter was activated with doxycycline (Dox) depletion, Flk1 expression was sufficiently recovered from the downstream genomic Flk1 gene. Whereas EC differentiation was almost completely perturbed in homo-inserted clones, Flk1 rescue with TRE-CMV promoter activation restored EC appearance, indicating that phenotypic changes in EC differentiation can be successfully reproduced with this knockout-rescue system. Thus, this promoter insertion strategy with CRISPR/Cas9 would be a novel attractive method for knockout-rescue experiments. Copyright © 2014 Elsevier Inc. All rights reserved.

  8. Mapping of a Leishmania major gene/locus that confers pentamidine resistance by deletion and insertion of transposable element

    Directory of Open Access Journals (Sweden)

    Coelho Adriano C.

    2004-01-01

    Full Text Available Pentamidine (PEN is an alternative compound to treat antimony-resistant leishmaniasis patients, which cellular target remains unclear. One approach to the identification of prospective targets is to identify genes able to mediate PEN resistance following overexpression. Starting from a genomic library of transfected parasites bearing a multicopy episomal cosmid vector containing wild-type Leishmania major DNA, we isolated one locus capable to render PEN resistance to wild type cells after DNA transfection. In order to map this Leishmania locus, cosmid insert was deleted by two successive sets of partial digestion with restriction enzymes, followed by transfection into wild type cells, overexpression, induction and functional tests in the presence of PEN. To determine the Leishmania gene related to PEN resistance, nucleotide sequencing experiments were done through insertion of the transposon Mariner element of Drosophila melanogaster (mosK into the deleted insert to work as primer island. Using general molecular techniques, we described here this method that permits a quickly identification of a functional gene facilitating nucleotide sequence experiments from large DNA fragments. Followed experiments revealed the presence of a P-Glycoprotein gene in this locus which role in Leishmania metabolism has now been analyzed.

  9. Non-imaging assisted insertion of un-cuffed, non-tunneled internal jugular venous catheters for hemodialysis: Safety and utility in modern day world

    Directory of Open Access Journals (Sweden)

    Manish Rathi

    2016-08-01

    Full Text Available Background: Absolute necessity in acute kidney injury (AKI and ignorance in chronic kidney disease (CKD make the use of un-cuffed, non-tunneled catheters an indispensable vascular access for hemodialysis. Although these catheters should be inserted under radiological guidance, it may not be feasible in certain circumstances. The aim of the present study was to evaluate safety and outcome of non-imaging assisted insertion of these catheters in internal jugular vein (IJV for hemodialysis. Methods: We analyzed 233 attempts of non-imaging assisted un-cuffed, non-tunneled IJV catheterization at our center. The immediate insertion complications, duration of use, rate and type of infection and other complications were assessed. Results: Out of the 233 attempts, 223 (213-right, 10-left were successful. The most common indication was AKI (n = 127, 54.5%, followed by CKD (n = 99, 42.5%. Successful catheterization at first attempt was achieved in 78.9%. Insertion complications were noted in 12.8% and included arterial puncture (5.2%, hematoma (3.0% and malposition (2.1%. Amongst 219 catheters followed for 4825 days, the mean duration of use was 22 days. Catheter related infections occurred in 42 patients with an incidence of 8.7 per 1000 catheter days. Bacteraemia was present in 10/36 cases (27.7%, positive catheter tip cultures in 71.4% cases and staphylococcal species were the most common organism. Cumulative hazard analysis by Cox regression revealed a linear increase in the risk for infection with each week. Conclusion: Non-imaging assisted insertion of uncuffed, non-tunneled catheters is associated with slightly higher rate of insertion complication but comparable outcome in terms of infection rate or days of use. Keywords: Hemodialysis, Internal jugular vein catheterization, Catheter related infection

  10. Analysis of the 227 bp short interspersed nuclear element (SINE) insertion of the promoter of the myostatin (MSTN) gene in different horse breeds

    OpenAIRE

    Stefania Dall'Olio; Emilio Scotti; Luca Fontanesi; Marco Tassinari

    2014-01-01

    The myostatin (MSTN) gene encodes a protein known to be a negative regulator of muscle mass in mammalian species. Different polymorphisms of the horse (Equus caballus) MSTN gene have been identified, including single nucleotide polymorphisms and a short interspersed nuclear element (SINE) insertion of 227 bp within the promoter of the gene. The SINE insertion has been associated with performance traits in Thoroughbred racehorses and it was proposed as a predictor of optimum racing distance. T...

  11. Insertion near the mitochondrial tyrosine tRNA gene in patients with mitochondrial diseases

    Energy Technology Data Exchange (ETDEWEB)

    Goto, Y.; Nonaka, I. [National Institute of Neuroscience, Tokyo (Japan); Horai, S. [National Institute of Genetics, Mishima (Japan)

    1994-09-01

    The 3243 mutation commonly found in patients with mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) has been occasionally detected in patients with chronic progressive external opthalmoplegia (CPEO). To elucidate the molecular mechanism underlying this phenomenon, an extensive mitochondrial (mt) DNA study was performed on such a patient (3243-CPEO). The newly discovered insertion was located in the noncoding region between cytrochrome c oxidase subunit 1 and tyrosine tRNA. The insertion was not found in 58 or 22 CPEO patients with or without mtDNA large-scale deletion but in another 3243-CPEO patient. In addition, the insertion was present in 1 of 116 normal Japanese, who had no 3243 mutation, and in 3 of 68 3243-MELAS patients. These results raise the possibility that the phenotypic expression of the 3243 mutation could be modulated or arranged by additional mtDNA mutations.

  12. Systems Biology-Based Investigation of Cellular Antiviral Drug Targets Identified by Gene-Trap Insertional Mutagenesis.

    Directory of Open Access Journals (Sweden)

    Feixiong Cheng

    2016-09-01

    Full Text Available Viruses require host cellular factors for successful replication. A comprehensive systems-level investigation of the virus-host interactome is critical for understanding the roles of host factors with the end goal of discovering new druggable antiviral targets. Gene-trap insertional mutagenesis is a high-throughput forward genetics approach to randomly disrupt (trap host genes and discover host genes that are essential for viral replication, but not for host cell survival. In this study, we used libraries of randomly mutagenized cells to discover cellular genes that are essential for the replication of 10 distinct cytotoxic mammalian viruses, 1 gram-negative bacterium, and 5 toxins. We herein reported 712 candidate cellular genes, characterizing distinct topological network and evolutionary signatures, and occupying central hubs in the human interactome. Cell cycle phase-specific network analysis showed that host cell cycle programs played critical roles during viral replication (e.g. MYC and TAF4 regulating G0/1 phase. Moreover, the viral perturbation of host cellular networks reflected disease etiology in that host genes (e.g. CTCF, RHOA, and CDKN1B identified were frequently essential and significantly associated with Mendelian and orphan diseases, or somatic mutations in cancer. Computational drug repositioning framework via incorporating drug-gene signatures from the Connectivity Map into the virus-host interactome identified 110 putative druggable antiviral targets and prioritized several existing drugs (e.g. ajmaline that may be potential for antiviral indication (e.g. anti-Ebola. In summary, this work provides a powerful methodology with a tight integration of gene-trap insertional mutagenesis testing and systems biology to identify new antiviral targets and drugs for the development of broadly acting and targeted clinical antiviral therapeutics.

  13. Structure and transcriptional impact of divergent repetitive elements inserted within Phanerochaete chrysosporium strain RP-78 genes

    Science.gov (United States)

    Luis F. Larrondo; Paulo Canessa; Rafael Vicuna; Philip Stewart; Amber Vanden Wymelenberg; Dan Cullen

    2007-01-01

    We describe the structure, organization, and transcriptional impact of repetitive elements within the lignin-degrading basidiomycete, Phanerochaete chrysosporium. Searches of the P. chrysosporium genome revealed five copies of pce1, a 1,750-nt non-autonomous, class II element. Alleles encoding a putative glucosyltransferase and a cytochrome P450 harbor pce insertions...

  14. A large insertion in intron 2 of the TYRP1 gene associated with American Palomino phenotype in American mink.

    Science.gov (United States)

    Cirera, Susanna; Markakis, Marios Nektarios; Kristiansen, Thea; Vissenberg, Kris; Fredholm, Merete; Christensen, Knud; Anistoroaei, Razvan

    2016-04-01

    A number of American mink phenotypes display a range of brownish colours. One of these phenotypes, namely American Palomino (b (P) b (P) ) (AP) has been found to be associated with the tyrosinase-related protein 1 (TYRP1) gene by genotyping microsatellite markers in one sire family. Trials for amplifying the genomic DNA and cDNA at the beginning of intron 2 of AP TYRP1 revealed the presence of a large insertion of approximately eight kb. The insertion most likely disrupts different elements necessary for the splicing of intron 2 of the TYRP1 gene. In AP RNAseq data indicate, however, the presence of the wild-type (wt) transcript at very low levels and Western blot reveals three products when using an antibody raised against middle part of the TYRP1 protein. One individual from another brown mink phenotype-commercially named Dawn-was also investigated at the molecular level by long-range PCR and the same size insertion appears to be present. By this we suggest that certain modifiers of TYRP1 would induce different brown colour degradation, which results in at least two different phases of brown.

  15. Genetically modified VSV(NJ) vector is capable of accommodating a large foreign gene insert and allows high level gene expression.

    Science.gov (United States)

    An, Hwa-Yong; Kim, Gyoung Nyoun; Wu, Kunyu; Kang, C Yong

    2013-01-01

    It is desirable to develop a RNA virus vector capable of accommodating large foreign genes for high level gene expression. Vesicular stomatitis virus (VSV) has been used as a gene expression vector, especially Indiana serotype (VSV(Ind)), but less with New Jersey serotype (VSV(NJ)). Here, we report constructions of genetically modified rVSV(NJ) vector carrying various lengths of human hepatitis C virus (HCV) non-structural (NS) protein genes, level of inserted gene expression and characterization of rVSV(NJ). We modified the M gene of VSV(NJ) by changing methionine to arginine at positions 48 and 51 (rVSV(NJ)-M) (Kim and Kang, 2007) for construction of rVSV(NJ) with various lengths of HCV non-structural genes. The NS polyprotein genes of HCV were inserted between the G and L genes of the rVSV(NJ)-M vector, and recombinant VSV(NJ)-M viruses with HCV gene inserts were recovered by the reverse genetics. The recombinant VSV(NJ)-M vector with the HCV NS genes express high levels of all different forms of the NS proteins. The electron microscopic examination showed that lengths of recombinant VSV(NJ)-M without gene of interests, VSV(NJ)-M with a gene of HCV NS3 and NS4A (VSV(NJ)-M-NS3/4A), VSV(NJ)-M with a gene of HCV NS4AB plus NS5AB (VSV(NJ)-M-NS4AB/5AB), and VSV(NJ)-M carrying a gene of HCV NS3, NS4AB, and NS5AB (VSV(NJ)-M-NS3/4AB/5AB) were 172±10.5 nm, 201±12.5 nm, 226±12.9 nm, and 247±18.2 nm, respectively. The lengths of recombinant VSVs increased approximately 10nm by insertion of 1kb of foreign genes. The diameter of these recombinant viruses also increased slightly by longer HCV gene inserts. Our results showed that the recombinant VSV(NJ)-M vector can accommodate as much as 6000 bases of the foreign gene. We compared the magnitude of the IFN induction in mouse fibroblast L(Y) cells infected with rVSV(NJ) wild type and rVSV(NJ) M mutant viruses and show that the rVSV(NJ) M mutant virus infection induced a higher level of the IFN-β compare to the wild type

  16. Angiotensin-converting enzyme (ACE) gene insertion/deletion polymorphism is not a risk factor for hypertension in SLE nephritis.

    Science.gov (United States)

    Negi, Vir S; Devaraju, Panneer; Gulati, Reena

    2015-09-01

    SLE is a systemic autoimmune disease with high prevalence of hypertension. Around 40-75 % of SLE patients develop nephritis, a major cause of hypertension and mortality. Angiotensin-converting enzyme (ACE) maintains the blood pressure and blood volume homeostasis. An insertion/deletion (I/D) polymorphism in intron 16 of ACE gene was reported to influence the development of hypertension, nephritis, and cardiovascular diseases in different ethnic populations. Despite compelling evidence for the high prevalence of hypertension in individuals with SLE, underlying factors for its development are not well studied. With this background, we analyzed the influence of ACE insertion/deletion polymorphism on susceptibility to SLE, development of nephritis and hypertension, other clinical features and autoantibody phenotype in South Indian SLE patients. Three hundred patients with SLE and 460 age and sex similar ethnicity matched individuals were included as patients and healthy controls, respectively. The ACE gene insertion/deletion polymorphism was analyzed by PCR. Insertion (I) and deletion (D) alleles were observed to be equally distributed among patients (57 and 43 %) and controls (59 and 41 %), respectively. The mutant (D) allele did not confer significant risk for SLE (II vs. ID: p = 0.4, OR 1.15, 95 % CI 0.8-1.6; II vs. DD: p = 0.34, OR 1.22, 95 % CI 0.8-1.85). There was no association of the ACE genotype or the allele with development of lupus nephritis (II vs. ID: p = 0.19, OR 1.41, 95 % CI 0.84-2.36; II vs. DD: p = 0.41, OR 0.74, 95 % CI 0.38-1.41) or hypertension (II vs. ID: p = 0.85, OR 0.9, 95 % CI 0.43-1.8; II vs. DD: p = 0.66, OR 1.217, 95 % CI 0.5-2.8). The presence of mutant allele (D) was not found to influence any clinical features or autoantibody phenotype. The insertion/deletion polymorphism of the ACE gene is not a genetic risk factor for SLE and does not influence development of hypertension or lupus nephritis in South Indian

  17. A new insertion/deletion fragment polymorphism of inhibin-α gene associated with follicular cysts in Large White sows.

    Science.gov (United States)

    Li, Wanhong; Chen, Shuxiong; Li, Hongjiao; Liu, Zhuo; Zhao, Yun; Chen, Lu; Zhou, Xu; Li, Chunjing

    2016-05-18

    Ovarian follicular cysts are anovulatory follicular structures that lead to infertility. Hormones play key roles in the formation and persistence of cysts. Inhibins are heterodimeric gonadal glycoprotein hormones that belong to the transforming growth factor-β superfamily. These hormones suppress the secretion of follicle-stimulating hormone. In this report, partial fragment of inhibin-α (INHA) subunit gene of Large White pig was detected from the genomic DNA by polymerase chain reaction. The sequence showed a 283 bp fragment insertion/deletion (I/D) polymorphism in INHA subunit gene. A total of 49 Large White sows with cystic follicles and 152 normal sows were screened for this polymorphism. The relationship of INHA I/D polymorphisms with follicular cysts was investigated. The distribution of I/D was significantly different between cystic and normal sows, thereby suggesting that the INHA subunit gene might be a potential biological marker for breeding programs in pig.

  18. Association between migraine and ACE gene (insertion/deletion) polymorphism: the BioBIM study.

    Science.gov (United States)

    Palmirotta, Raffaele; Barbanti, Piero; Ludovici, Giorgia; De Marchis, Maria Laura; Ialongo, Cristiano; Egeo, Gabriella; Aurilia, Cinzia; Fofi, Luisa; Abete, Pasquale; Spila, Antonella; Ferroni, Patrizia; Della-Morte, David; Guadagni, Fiorella

    2014-02-01

    In the present case-control study, we investigated the correlation between the common ACE insertion/deletion (I/D) polymorphism and migraine. Genotyping of the ACE I/D variant was performed in 502 Caucasian patients with migraine and 323 age-, sex- and race/ethnicity-matched healthy controls. We investigated associations between ACE genetic variants and sociodemographic and/or clinical features of migraineurs. We found a significant association between ACE insertion/insertion (I/I) polymorphism and lower use of pharmacological prophylaxis in migraine patients with aura and in those with chronic migraine. Moreover, ACE I/I polymorphism was significantly more common in migraine patients with aura who had a negative family history of migraine. Our data suggest that although the ACE I/D polymorphism is not a direct risk factor for migraine, the ACE I/I genotype may influence the clinical feature of this disease being associated with reduced use of prophylactic agents in patients with migraine with aura and in those with chronic migraine.

  19. RNA as a source of transposase for Sleeping Beauty-mediated gene insertion and expression in somatic cells and tissues.

    Science.gov (United States)

    Wilber, Andrew; Frandsen, Joel L; Geurts, Jennifer L; Largaespada, David A; Hackett, Perry B; McIvor, R Scott

    2006-03-01

    Sleeping Beauty (SB) is a DNA transposon capable of mediating gene insertion and long-term expression in vertebrate cells when co-delivered with a source of transposase. In all previous reports of SB-mediated gene insertion in somatic cells, the transposase component has been provided by expression of a co-delivered DNA molecule that has the potential for integration into the host cell genome. Integration and continued expression of a gene encoding SB transposase could be problematic if it led to transposon re-mobilization and reintegration. We addressed this potential problem by supplying the transposase-encoding molecule in the form of mRNA. We show that transposase-encoding mRNA can effectively mediate transposition in vitro in HT1080 cells and in vivo in mouse liver following co-delivery with a recoverable transposon or with a luciferase transposon. We conclude that in vitro-transcribed mRNA can be used as an effective source of transposase for SB-mediated transposition in mammalian cells and tissues.

  20. Molecular cytogenetic mapping of 24 CEPH YACs and 24 gene-specific large insert probes to chromosome 17.

    Science.gov (United States)

    Bärlund, M; Nupponen, N N; Karhu, R; Tanner, M M; Paavola, P; Kallioniemi, O P; Kallioniemi, A

    1998-01-01

    Defining boundaries of chromosomal rearrangements at the molecular level would benefit from landmarks that link the cytogenetic map to physical, genetic, and transcript maps, as well as from large-insert FISH probes for such loci to detect numerical and structural rearrangements in metaphase or interphase cells. Here, we determined the locations of 24 genetically mapped CEPH-Mega YACs along the FLpter scale (fractional length from p-telomere) by quantitative fluorescence in situ hybridization analysis. This generated a set of cytogenetically mapped probes for chromosome 17 with an average spacing of about 5 cM. We then developed large-insert YAC, BAC, PAC, or P1 clones to the following 24 known genes, and determined refined map locations along the same FLpter scale: pter-TP53-TOP3-cen-TNFAIP1-ERBB2-TOP2A- BRCA1-TCF11-NME1-HLF-ZNF147/CL N80-BCL5/MPO/SFRS1-TBX2-PECAM1-DDX5/ PRKCA-ICAM2-GH1/PRKAR1A-GRB2-CDK3 /FKHL13-qter. Taken together, these 48 cytogenetically mapped large-insert probes provide tools for the molecular analysis of chromosome 17 rearrangements, such as mapping amplification, deletion, and translocation breakpoints in this chromosome, in cancer and other diseases.

  1. Enhancement of cell proliferation in various mammalian cell lines by gene insertion of a cyclin-dependent kinase homolog

    Directory of Open Access Journals (Sweden)

    Konstantopoulos Konstantinos

    2007-10-01

    Full Text Available Abstract Background Genomics tools, particularly DNA microarrays, have found application in a number of areas including gene discovery and disease characterization. Despite the vast utility of these tools, little work has been done to explore the basis of distinct cellular properties, especially those important to biotechnology such as growth. And so, with the intent of engineering cell lines by manipulating the expression of these genes, anchorage-independent and anchorage-dependent HeLa cells, displaying markedly different growth characteristics, were analyzed using DNA microarrays. Results Two genes, cyclin-dependent kinase like 3 (cdkl3 and cytochrome c oxidase subunit (cox15, were up-regulated in the faster growing, anchorage-independent (suspension HeLa cells relative to the slower growing, anchorage-dependent (attached HeLa cells. Enhanced expression of either gene in the attached HeLa cells resulted in elevated cell proliferation, though insertion of cdkl3 had a greater impact than that of cox15. Moreover, flow cytometric analysis indicated that cells with an insert of cdkl3 were able to transition from the G0/G1 phases to the S phase faster than control cells. In turn, expression of cox15 was seen to increase the maximum viable cell numbers achieved relative to the control, and to a greater extent than cdkl3. Quantitatively similar results were obtained with two Human Embryonic Kidney-293 (HEK-293 cell lines and a Chinese Hamster Ovary (CHO cell line. Additionally, HEK-293 cells secreting adipocyte complement-related protein of 30 kDa (acrp30 exhibited a slight increase in specific protein production and higher total protein production in response to the insertion of either cdkl3 or cox15. Conclusion These results are consistent with previous studies on the functionalities of cdkl3 and cox15. For instance, the effect of cdkl3 on cell growth is consistent with its homology to the cdk3 gene which is involved in G1 to S phase transition

  2. Agrobacterium tumefaciens-mediated transformation: An efficient tool for insertional mutagenesis and targeted gene disruption in Harpophora oryzae.

    Science.gov (United States)

    Liu, Ning; Chen, Guo-Qing; Ning, Guo-Ao; Shi, Huan-Bin; Zhang, Chu-Long; Lu, Jian-Ping; Mao, Li-Juan; Feng, Xiao-Xiao; Liu, Xiao-Hong; Su, Zhen-Zhu; Lin, Fu-Cheng

    2016-01-01

    The endophytic filamentous fungus Harpophora oryzae is a beneficial endosymbiont isolated from the wild rice. H. oryzae could not only effectively improve growth rate and biomass yield of rice crops, but also induce systemic resistance against the rice blast fungus, Magnaporthe oryzae. In this study, Agrobacterium tumefaciens-mediated transformation (ATMT) was employed and optimized to modify the H. oryzae genes by either random DNA fragment integration or targeted gene replacement. Our results showed that co-cultivation of H. oryzae conidia with A. tumefaciens in the presence of acetosyringone for 48 h at 22 °C could lead to a relatively highest frequency of transformation, and 200 μM acetosyringone (AS) pre-cultivation of A. tumefaciens is also suggested. ATMT-mediated knockout mutagenesis was accomplished with the gene-deletion cassettes using a yeast homologous recombination method with a yeast-Escherichia-Agrobacterium shuttle vector pKOHo. Using the ATMT-mediated knockout mutagenesis, we successfully deleted three genes of H. oryzae (HoATG5, HoATG7, and HoATG8), and then got the null mutants ΔHoatg5, ΔHoatg7, and ΔHoatg8. These results suggest that ATMT is an efficient tool for gene modification including randomly insertional mutagenesis and gene deletion mutagenesis in H. oryzae. Copyright © 2015 Elsevier GmbH. All rights reserved.

  3. The PML gene is linked to a megabase-scale insertion/deletion restriction fragment length polymorphism

    Energy Technology Data Exchange (ETDEWEB)

    Goy, A.; Xiao, Y.H.; Passalaris, T. [Memorial Sloan-Kettering Cancer Center, New York, NY (United States)] [and others

    1995-03-20

    The PML gene located on chromosome band 15q22 is involved with the RAR{alpha} locus (17q21) in a balanced reciprocal translocation uniquely observed in acute promyelocytic leukemia. Physical mapping studies by pulsed-field gel electrophoresis revealed that the PML gene is flanked by two CpG islands that are separated by a variable distance in normal individuals. Several lines of evidence demonstrate that this is the consequence of a large insertion/deletion polymorphism linked to the PML locus: (1) overlapping fragments obtained with a variety of rare-cutting restriction enzymes demonstrated the same variability in distance between the flanking CpG islands; (2) mapping with restriction enzymes insensitive to CpG methylation confirmed that the findings were not a consequence of variable methylation of CpG dinucleotides; (3) the polymorphism followed a Mendelian inheritance pattern. This polymorphism is localized 3{prime} to the PML locus. There are five common alleles, described on the basis of BssHII fragments, ranging from 220 to 350 kb with increments of approximately 30 kb between alleles. Both heterozygous (61%) and homozygous (391%) patterns were observed in normal individuals. Mega-base-scale insertion/deletion restriction fragment length polymorphisms are very rare and have been described initially in the context of multigene families. Such structures have been also reported as likely regions of genetic instability. High-resolution restriction mapping of this particular structure linked to the PML locus is underway. 47 refs., 4 figs., 1 tab.

  4. An artificial restriction DNA cutter for site-selective gene insertion in human cells.

    Science.gov (United States)

    Ito, Kenichiro; Shigi, Narumi; Komiyama, Makoto

    2013-08-04

    With the use of a chemistry-based artificial restriction DNA cutter (combination of Ce(IV)-EDTA and a pair of pcPNA), both an antibiotic-resistance gene and a fluorescent reporter protein gene were incorporated into the targeted site through homologous recombination in human cells.

  5. IS21-558 insertion sequences are involved in the mobility of the multiresistance gene cfr

    DEFF Research Database (Denmark)

    Kehrenberg, Corinna; Aarestrup, Frank Møller; Schwarz, Stefan

    2007-01-01

    was detected on the ca. 43-kb plasmid pSCFS6 in S. warneri and S. simulans isolates. Sequence analysis of a 22,010-bp segment revealed that the new Tn558 variant harbored an additional resistance gene region integrated into the tnpC reading frame. This resistance gene region consisted of the clindamycin...

  6. A novel mitochondrial DNA-like sequence insertion polymorphism in Intron I of the FOXO1A gene.

    Science.gov (United States)

    Giampieri, Claudia; Centurelli, Matteo; Bonafè, Massimiliano; Olivieri, Fabiola; Cardelli, Maurizio; Marchegiani, Francesca; Cavallone, Luca; Giovagnetti, Simona; Mugianesi, Elena; Carrieri, Giuseppina; Lisa, Rosamaria; Cenerelli, Stefano; Testa, Roberto; Boemi, Massimo; Petropoulou, Chariklia; Gonos, Efstathios S; Franceschi, Claudio

    2004-03-03

    The human forkhead box O1A (FOXO1A) gene belongs to the human forkhead gene family and acts downstream of the human insulin signalling pathway. In this study, polymorphisms of the Intron I of FOXO1A gene were studied in Italian healthy people and insulin resistant subjects. No significant association between the germ-line variability in the Intron I of FOXO1A and insulin resistance was observed. Interestingly, during the study, a new 39-bp sequence insertion polymorphism in Intron I of FOXO1A gene was described. The polymorphism was found to co-segregate in a co-dominant Mendelian fashion and to be present in an ethnically distinct population (Greeks). A BLAST search showed that the sequence shares 100% identity with a mtDNA (mitochondrial DNA) sequence coding for the ATP synthase 8 (ATPase8) and ATP synthase 6 (ATPase6) genes. Hence, FOXO1A Intron I is a polymorphic nuclear region involved in the exchange of DNA material between mitochondrial and genomic DNA, which is a well-established mechanism of evolutionary change in eukaryotes.

  7. The success of assisted colonization and assisted gene flow depends on phenology.

    Science.gov (United States)

    Wadgymar, Susana M; Cumming, Matthew N; Weis, Arthur E

    2015-10-01

    Global warming will jeopardize the persistence and genetic diversity of many species. Assisted colonization, or the movement of species beyond their current range boundary, is a conservation strategy proposed for species with limited dispersal abilities or adaptive potential. However, species that rely on photoperiodic and thermal cues for development may experience conflicting signals if transported across latitudes. Relocating multiple, distinct populations may remedy this quandary by expanding genetic variation and promoting evolutionary responses in the receiving habitat--a strategy known as assisted gene flow. To better inform these policies, we planted seeds from latitudinally distinct populations of the annual legume, Chamaecrista fasciculata, in a potential future colonization site north of its current range boundary. Plants were exposed to ambient or elevated temperatures via infrared heating. We monitored several life history traits and estimated patterns of natural selection to determine the adaptive value of plastic responses. To assess the feasibility of assisted gene flow between phenologically distinct populations, we counted flowers each day and estimated the degree of temporal isolation between populations. Increased temperatures advanced each successive phenological trait more than the last, resulting in a compressed life cycle for all but the southern-most population. Warming altered patterns of selection on flowering onset and vegetative biomass. Population performance was dependent on latitude of origin, with the northern-most population performing best under ambient conditions and the southern-most performing most poorly, even under elevated temperatures. Among-population differences in flowering phenology limited the potential for genetic exchange among the northern- and southern-most populations. All plastic responses to warming were neutral or adaptive; however, photoperiodic constraints will likely necessitate evolutionary responses for

  8. Insertion of an Antimicrobial Gene into Agrobacterium and its Further Use in Transforming Tobacco

    OpenAIRE

    GÜREL, Ekrem

    2001-01-01

    In the present work, we first describe the transfer of a novel gene, designated 5W, into the LBA4404 Agrobacterium tumefaciens strain using pPCV91 plasmid through a triparental mating system. The 5W gene was recently isolated from macadamia, a native nut tree species of Australia, and has been shown to have an antimicrobial effect against certain fungi in vitro. Secondly, this gene was tranferred into tobacco (Nicotiana tabacum cv. Xhantii) using leaf explants to develop a system which could ...

  9. High association of angiotensin-converting enzyme (ACE) gene insertion/deletion (I/D) polymorphism with recurrent aphthous stomatitis.

    Science.gov (United States)

    Karakus, Nevin; Yigit, Serbulent; Kalkan, Goknur; Sezer, Saime

    2013-08-01

    Recurrent aphthous stomatitis (RAS) is a common ulcerative disease of the oral mucosa. Oral ulcers are also the most common feature of Behçet's disease (BD). Association of angiotensin-converting enzyme (ACE) gene insertion/deletion (I/D) polymorphism with BD has been reported in Turkish population. The aim of the present study was to investigate the possible association between ACE gene I/D polymorphism and RAS, and evaluate if there was an association with clinical features in a relatively large cohort of Turkish patients. The study included 198 patients affected by RAS and 214 healthy controls. ACE gene I/D polymorphism genotypes were determined using polymerase chain reaction with I and D allele-specific primers. The genotype and allele frequencies of I/D polymorphism showed statistically significant differences between RAS patients and controls (p < 0.0001 and p < 0.0001, respectively). After stratifying RAS patients according to clinical and demographical characteristics, no significant association was observed. In conclusion, the results of this study suggest that I/D polymorphism of the ACE gene was positively associated with predisposition to develop RAS in Turkish population. Further studies with larger populations are recommended.

  10. Platypus globin genes and flanking loci suggest a new insertional model for beta-globin evolution in birds and mammals

    Directory of Open Access Journals (Sweden)

    Warren Wesley C

    2008-07-01

    Full Text Available Abstract Background Vertebrate alpha (α- and beta (β-globin gene families exemplify the way in which genomes evolve to produce functional complexity. From tandem duplication of a single globin locus, the α- and β-globin clusters expanded, and then were separated onto different chromosomes. The previous finding of a fossil β-globin gene (ω in the marsupial α-cluster, however, suggested that duplication of the α-β cluster onto two chromosomes, followed by lineage-specific gene loss and duplication, produced paralogous α- and β-globin clusters in birds and mammals. Here we analyse genomic data from an egg-laying monotreme mammal, the platypus (Ornithorhynchus anatinus, to explore haemoglobin evolution at the stem of the mammalian radiation. Results The platypus α-globin cluster (chromosome 21 contains embryonic and adult α- globin genes, a β-like ω-globin gene, and the GBY globin gene with homology to cytoglobin, arranged as 5'-ζ-ζ'-αD-α3-α2-α1-ω-GBY-3'. The platypus β-globin cluster (chromosome 2 contains single embryonic and adult globin genes arranged as 5'-ε-β-3'. Surprisingly, all of these globin genes were expressed in some adult tissues. Comparison of flanking sequences revealed that all jawed vertebrate α-globin clusters are flanked by MPG-C16orf35 and LUC7L, whereas all bird and mammal β-globin clusters are embedded in olfactory genes. Thus, the mammalian α- and β-globin clusters are orthologous to the bird α- and β-globin clusters respectively. Conclusion We propose that α- and β-globin clusters evolved from an ancient MPG-C16orf35-α-β-GBY-LUC7L arrangement 410 million years ago. A copy of the original β (represented by ω in marsupials and monotremes was inserted into an array of olfactory genes before the amniote radiation (>315 million years ago, then duplicated and diverged to form orthologous clusters of β-globin genes with different expression profiles in different lineages.

  11. Identification of the first deletion-insertion involving the complete structure of GAA gene and part of CCDC40 gene mediated by an Alu element.

    Science.gov (United States)

    Amiñoso, Cinthia; Vallespin, Elena; Fernández, Luís; Arrabal, Luisa F; Desviat, Lourdes R; Pérez, Belen; Santos, Fernando; Solera, Jesús

    2013-04-25

    Pompe disease is an uncommon autosomal recessive glycogen storage disorder caused by deficiency of acid α-glucosidase. Classic infantile form triggers severe cardiomyopathy, hypotonia, and respiratory failure, leading to death within the first two years of life. The majority of patients with Pompe disease have been reported to have point mutations in the GAA gene. We report the first complex deletion-insertion encompassing the complete structure of GAA gene and a large fragment of the gene CCDC40 in a patient with very severe form of Pompe disease. Sequencing analysis of breakpoints allowed us to determine the potential implication of an Alu repeat in the pathogenic mechanism. We suggest that molecular strategy of Pompe disease should include systematic analysis of large rearrangements. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. Angiotensin-converting enzyme gene insertion/deletion polymorphism in migraine patients

    Directory of Open Access Journals (Sweden)

    White Linda R

    2008-03-01

    Full Text Available Abstract Background The main objective of this study was to investigate the angiotensin converting enzyme (ACE genotype as a possible risk factor for migraine (both with and without aura compared to controls. We also wanted to examine whether a clinical response to an ACE inhibitor, lisinopril, or an angiotensin II receptor blocker, candesartan, in migraine prophylaxis was related to ACE genotype. Methods 347 migraine patients aged 18–68 (155 migraine without aura (MoA, 187 migraine with aura (MwA and 5 missing aura subgroup data and 403 healthy non-migrainous controls > 40 years of age were included in the study. A polymerase chain reaction (PCR was performed on the genomic DNA samples to obtain the ACE insertion (I/deletion(D polymorphisms. Results No significant differences between migraine patients and controls were found with regard to ACE genotype and allele distributions. Furthermore, there was no significant difference between the controls and the MwA or MoA subgroups. Conclusion In our sample there is no association between ACE genotype or allele frequency and migraine. In addition, ACE genotype in our experience did not predict the clinical response to lisinopril or candesartan used as migraine prophylactics.

  13. An assistive image-guided surgical robot system using O-arm fluoroscopy for pedicle screw insertion: preliminary and cadaveric study.

    Science.gov (United States)

    Kim, Sungmin; Chung, Jaeheon; Yi, Byung-Ju; Kim, Young Soo

    2010-12-01

    The biplane fluoroscopy guided robot system (BFRS) was developed for surgical robotic systems, minimally invasive surgeries, and cooperative robotic systems, as well as enhanced surgical planning and navigation with preoperative and intraoperative image data. To propose a novel surgical robot system for percutaneous pedicle screw insertion. The BFRS consists of an O-shaped biplane fluoroscope (O-arm), a surgical planning and operating system, and an assistive robot. Each part of the BFRS has a role in conducting percutaneous pedicle screw placements. To evaluate BFRS accuracy, each part was analyzed, and to assess the safety and feasibility of percutaneous pedicle screw insertions with the BFRS, cadaveric studies involving 14 levels in the thoracic and lumbar spine regions were conducted on 2 cadavers. Errors in each part of the system and within the entire system were evaluated. The accuracy of generating coordinates using O-arm images was 0.30±0.15 mm. The robot demonstrated a duplication value of 4.97 μm RMS and an accuracy of 0.358 mm RMS. Total system error was 1.38±0.21 mm. The results of the cadaveric studies show that inserted pedicular screws were adequately located within the spine with no unexpected malpositioning of the screws. The axial angle difference between planned and postoperative data was 2.45±2.56°, and the sagittal angle difference was 0.71±1.21°. The BFRS might be helpful in improving the accuracy of percutaneous pedicular screw insertion procedures. In the future, we will attempt to improve the accuracy and reliability of the BFRS and to determine new clinical applications for the BFRS.

  14. A Novel KRIT1/CCM1 Gene Insertion Mutation Associated with Cerebral Cavernous Malformations in a Chinese Family.

    Science.gov (United States)

    Wang, Hui; Pan, Yunzhu; Zhang, Zaiqiang; Li, Xingang; Xu, Zhe; Suo, Yue; Li, Wei; Wang, Yongjun

    2017-02-01

    Familial cerebral cavernous malformation (FCCM) is a vascular malformation disorder that closely associated with three identified genes: KRIT1/CCM1, MGC4607/CCM2, and PDCD10/CCM3. Here, we present a Chinese family affected by FCCM due to a novel KRIT1/CCM1 insertion mutation. The proband was hospitalized for sudden unconsciousness and underwent surgical treatment. The section of lesions showed classical cavernous-dilated vessels without intervening brain parenchyma, and hemosiderin-laden macrophages were accumulated in the surrounding tissue. In addition, magnetic resonance imaging (MRI) showed severe multiple cerebral cavernous malformation (CCM) lesions in cerebrum, brainstem, and cerebellum in other affected subjects. Especially, for the proband's mother, hundreds of lesions were presented, and a few lesions were found in the expanded lateral ventricle (Evans' index =0.33). Moreover, she showed the similar symptoms of hydrocephalus, including headache, dizziness, and diplopia. It was extremely rare in previous reports. To date, the genetic alterations leading to FCCM in Chinese population remain largely unknown. We investigated genetic defects of this family. Sequence analyses disclosed a novel heterozygous insertion mutation (c.1896_1897insT; p.Pro633SerfsTer22) in KRIT1/CCM1. Moreover, our real-time PCR results revealed that the mRNA level of KRIT1/CCM1 were significantly decreased in FCCM subjects (CCM family =0.42 ± 0.20 vs. healthy control =1.01 ± 0.16, P = 0.004). It indicated that this mutation could cause KRIT1/CCM1 functional mRNA deficiency. It may be closely related with the pathogenesis of FCCM. Our findings provided a new gene mutation profile which will be of great significance in early diagnosis and appropriate clinical surveillance of FCCM patients.

  15. Identification of genes required by Bacillus thuringiensis for survival in soil by transposon-directed insertion site sequencing.

    Science.gov (United States)

    Bishop, Alistair H; Rachwal, Phillip A; Vaid, Alka

    2014-04-01

    Transposon-directed insertion site sequencing was used to identify genes required by Bacillus thuringiensis to survive in non-axenic plant/soil microcosms. A total of 516 genetic loci fulfilled the criteria as conferring survival characteristics. Of these, 127 (24.6 %) were associated with uptake and transport systems; 227 loci (44.0 %) coded for enzymatic properties; 49 (9.5 %) were gene regulation or sensory loci; 40 (7.8 %) were structural proteins found in the cell envelope or had enzymatic activities related to it and 24 (4.7 %) were involved in the production of antibiotics or resistance to them. Eighty-three (16.1 %) encoded hypothetical proteins or those of unknown function. The ability to form spores was a key survival characteristic in the microcosms: bacteria, inoculated in either spore or vegetative form, were able to multiply and colonise the soil, whereas a sporulation-deficient mutant was not. The presence of grass seedlings was critical to colonisation. Bacteria labelled with green fluorescent protein were observed to adhere to plant roots. The sporulation-specific promoter of spo0A, the key regulator of sporulation, was strongly activated in the rhizosphere. In contrast, the vegetative-specific promoters of spo0A and PlcR, a pleiotropic regulator of genes with diverse activities, were only very weakly activated.

  16. Analysis of the 227 bp short interspersed nuclear element (SINE) insertion of the promoter of the myostatin (MSTN) gene in different horse breeds.

    Science.gov (United States)

    Dall'Olio, Stefania; Scotti, Emilio; Fontanesi, Luca; Tassinari, Marco

    2014-01-01

    The myostatin (MSTN) gene encodes a protein known to be a negative regulator of muscle mass in mammalian species. Different polymorphisms of the horse (Equus caballus) MSTN gene have been identified, including single nucleotide polymorphisms and a short interspersed nuclear element (SINE) insertion of 227 bp within the promoter of the gene. The SINE insertion has been associated with performance traits in Thoroughbred racehorses and it was proposed as a predictor of optimum racing distance. The aims of this study were to perform in silico analysis to identify putative gains or abrogation of transcription-factor binding sites (TFBSs) generated by the SINE allele of the promoter and to analyse the frequency of the SINE insertion in horses used for racing (gallop and trot) and other purposes. The SINE insertion was genotyped in 227 horses from 10 breeds belonging to different morphological types (brachimorphic, mesomorphic, meso-dolichomorphic and dolichomorphic). The presence of the insertion was confirmed in the Quarter Horse (SINE allele frequency of 0.81) and in the Thoroughbred (0.51), whereas the SINE allele did not segregate in any of the other analysed breeds. As the SINE MSTN gene polymorphism may be population or breed specific, it is not a useful marker for association studies in all breeds.

  17. Analysis of the 227 bp short interspersed nuclear element (SINE insertion of the promoter of the myostatin (MSTN gene in different horse breeds

    Directory of Open Access Journals (Sweden)

    Stefania Dall'Olio

    2014-09-01

    Full Text Available The myostatin (MSTN gene encodes a protein known to be a negative regulator of muscle mass in mammalian species. Different polymorphisms of the horse (Equus caballus MSTN gene have been identified, including single nucleotide polymorphisms and a short interspersed nuclear element (SINE insertion of 227 bp within the promoter of the gene. The SINE insertion has been associated with performance traits in Thoroughbred racehorses and it was proposed as a predictor of optimum racing distance. The aims of this study were to perform in silico analysis to identify putative gains or abrogation of transcription-factor binding sites (TFBSs generated by the SINE allele of the promoter and to analyse the frequency of the SINE insertion in horses used for racing (gallop and trot and other purposes. The SINE insertion was genotyped in 227 horses from 10 breeds belonging to different morphological types (brachimorphic, mesomorphic, meso-dolichomorphic and dolichomorphic. The presence of the insertion was confirmed in the Quarter Horse (SINE allele frequency of 0.81 and in the Thoroughbred (0.51, whereas the SINE allele did not segregate in any of the other analysed breeds. As the SINE MSTN gene polymorphism may be population or breed specific, it is not a useful marker for association studies in all breeds.

  18. The Hairless Stem Phenotype of Cotton (Gossypium barbadense) Is Linked to a Copia-Like Retrotransposon Insertion in a Homeodomain-Leucine Zipper Gene (HD1).

    Science.gov (United States)

    Ding, Mingquan; Ye, Wuwei; Lin, Lifeng; He, Shae; Du, Xiongming; Chen, Aiqun; Cao, Yuefen; Qin, Yuan; Yang, Fen; Jiang, Yurong; Zhang, Hua; Wang, Xiyin; Paterson, Andrew H; Rong, Junkang

    2015-09-01

    Cotton (Gossypium) stem trichomes are mostly single cells that arise from stem epidermal cells. In this study, a homeodomain-leucine zipper gene (HD1) was found to cosegregate with the dominant trichome locus previously designated as T1 and mapped to chromosome 6. Characterization of HD1 orthologs revealed that the absence of stem trichomes in modern Gossypium barbadense varieties is linked to a large retrotransposon insertion in the ninth exon, 2565 bp downstream from the initial codon in the At subgenome HD1 gene (At-GbHD1). In both the At and Dt subgenomes, reduced transcription of GbHD1 genes is caused by this insertion. The disruption of At-HD1 further affects the expression of downstream GbMYB25 and GbHOX3 genes. Analyses of primitive cultivated accessions identified another retrotransposon insertion event in the sixth exon of At-GbHD1 that might predate the previously identified retrotransposon in modern varieties. Although both retrotransposon insertions results in similar phenotypic changes, the timing of these two retrotransposon insertion events fits well with our current understanding of the history of cotton speciation and dispersal. Taken together, the results of genetics mapping, gene expression and association analyses suggest that GbHD1 is an important component that controls stem trichome development and is a promising candidate gene for the T1 locus. The interspecific phenotypic difference in stem trichome traits also may be attributable to HD1 inactivation associated with retrotransposon insertion. Copyright © 2015 by the Genetics Society of America.

  19. Insertions in the gG Gene of Pseudorabies Virus Reduce Expression of the Upstream Us3 Protein and Inhibit Cell-to-Cell Spread of Virus Infection

    OpenAIRE

    Demmin, Gretchen L.; Clase, Amanda C.; Randall, Jessica A.; Enquist, L.W.; Banfield, Bruce W.

    2001-01-01

    The alphaherpesvirus Us4 gene encodes glycoprotein G (gG), which is conserved in most viruses of the alphaherpesvirus subfamily. In the swine pathogen pseudorabies virus (PRV), mutant viruses with internal deletions and insertions in the gG gene have shown no discernible phenotypes. We report that insertions in the gG locus of the attenuated PRV strain Bartha show reduced virulence in vivo and are defective in their ability to spread from cell to cell in a cell-type-specific manner. Similar i...

  20. VISMapper: ultra-fast exhaustive cartography of viral insertion sites for gene therapy.

    Science.gov (United States)

    Juanes, José M; Gallego, Asunción; Tárraga, Joaquín; Chaves, Felipe J; Marín-Garcia, Pablo; Medina, Ignacio; Arnau, Vicente; Dopazo, Joaquín

    2017-09-20

    The possibility of integrating viral vectors to become a persistent part of the host genome makes them a crucial element of clinical gene therapy. However, viral integration has associated risks, such as the unintentional activation of oncogenes that can result in cancer. Therefore, the analysis of integration sites of retroviral vectors is a crucial step in developing safer vectors for therapeutic use. Here we present VISMapper, a vector integration site analysis web server, to analyze next-generation sequencing data for retroviral vector integration sites. VISMapper can be found at: http://vismapper.babelomics.org . Because it uses novel mapping algorithms VISMapper is remarkably faster than previous available programs. It also provides a useful graphical interface to analyze the integration sites found in the genomic context.

  1. Sleeping Beauty transposon-based system for cellular reprogramming and targeted gene insertion in induced pluripotent stem cells

    Science.gov (United States)

    Grabundzija, Ivana; Wang, Jichang; Sebe, Attila; Erdei, Zsuzsanna; Kajdi, Robert; Devaraj, Anantharam; Steinemann, Doris; Szuhai, Károly; Stein, Ulrike; Cantz, Tobias; Schambach, Axel; Baum, Christopher; Izsvák, Zsuzsanna; Sarkadi, Balázs; Ivics, Zoltán

    2013-01-01

    The discovery of direct cell reprogramming and induced pluripotent stem (iPS) cell technology opened up new avenues for the application of non-viral, transposon-based gene delivery systems. The Sleeping Beauty (SB) transposon is highly advanced for versatile genetic manipulations in mammalian cells. We established iPS cell reprogramming of mouse embryonic fibroblasts and human foreskin fibroblasts by transposition of OSKM (Oct4, Sox2, Klf4 and c-Myc) and OSKML (OSKM + Lin28) expression cassettes mobilized by the SB100X hyperactive transposase. The efficiency of iPS cell derivation with SB transposon system was in the range of that obtained with retroviral vectors. Co-expression of the miRNA302/367 cluster together with OSKM significantly improved reprogramming efficiency and accelerated the temporal kinetics of reprogramming. The iPS cells displayed a stable karyotype, and hallmarks of pluripotency including expression of stem cell markers and the ability to differentiate into embryoid bodies in vitro. We demonstrate Cre recombinase-mediated exchange allowing simultaneous removal of the reprogramming cassette and targeted knock-in of an expression cassette of interest into the transposon-tagged locus in mouse iPS cells. This strategy would allow correction of a genetic defect by site-specific insertion of a therapeutic gene construct into ‘safe harbor’ sites in the genomes of autologous, patient-derived iPS cells. PMID:23275558

  2. [Delta⁰-thalassemia by insertion of 27 base pairs in δ-globin gene with decreased hemoglobin A₂ levels].

    Science.gov (United States)

    González Borrachero, Maria Luisa; de la Fuente-Gonzalo, Félix; González, Fernando Ataúlfo; Nieto, Jorge M; Villegas, Ana; Ropero, Paloma

    2015-04-08

    We describe a novel delta-thalassemia mutation causing decreased hemoglobin (Hb) A2 levels associated with Hb Watts, variant Hb resulting from a trinucleotide deletion in Spain. Hb variant analysis was performed by cation-exchange high performance liquid chromatography (HPLC) and capillary zone electrophoresis. Polymerase chain reaction and DNA sequence analyses were used to identify mutations in the δ- and α-globin genes. Abnormal Hb was observed on capillary zone electrophoresis in Z6 and by cation-exchange HPLC a slower peak than HbA was observed at an retention time of 4.19min. This variant Hb is called Hb Watts [α2 74(EF3)Asp->0 or α2 75(EF4)Asp->0; HBA2:c.226_228delGAC]. The decreased HbA2 percentage owes to an insertion of 27nt between nt 83 and 84 of IVS-I of the δ-globin gene. When analyzing a chromatogram, the possibility of the existence of delta-thalassemia or an HbA2 variant should be considered, apart from alfa-, beta-thalassemia and structural haemoglobinopathies. To this end, each of the peaks and their percentages should be considered to allow for correct interpretation and to avoid misdiagnosis as much as possible. Copyright © 2014 Elsevier España, S.L.U. All rights reserved.

  3. Traditional risk factors and angiotensin-converting enzyme insertion/deletion gene polymorphism in coronary artery disease.

    Science.gov (United States)

    Sahin, S; Ceyhan, K; Benli, I; Ozyurt, H; Naseri, E; Tumuklu, M M; Aydogan, L; Elalmis, A O; Ozugurlu, A F; Onalan, O

    2015-03-20

    We investigated whether the insertion/deletion (I/D) polymorphism in the angiotensin-converting enzyme (ACE) gene and serum ACE levels are associated with traditional risk factors of coronary artery disease (CAD). We enrolled 250 individuals without CAD and 750 individuals suffering from CAD who were angiographically diagnosed. Biochemical risk factors, the ACE (I/D) gene polymorphism, and ACE serum levels were compared. ACE genotypes were determined using real-time polymerase chain reaction. ACE serum levels were determined using an enzyme-linked immunosorbent assay. Lipid parameters were determined spectrophotometrically using an autoanalyzer. Compared to the control group, the CAD group showed significantly higher serum ACE levels (P < 0.001). The highest ACE levels were found in those with the DD genotype. Other genotypes also presented statistically significant differences. We observed a significant difference between the control and coronary patient groups regarding the levels of total cholesterol, triglyceride, high-density lipoprotein-cholesterol, and low-density lipoprotein-cholesterol (P < 0.05). ACE (I/D) genotypes and serum ACE levels may be associated with risk factors and the development of CAD.

  4. The ACE Gene Insertion/Deletion Polymorphism and Cerebrovascular Diseases in Uzbek Patients with Arterial Hypertension

    Directory of Open Access Journals (Sweden)

    Nargiza U. Makhkamova

    2016-09-01

    Full Text Available The aim of the present study was to investigate the association between the ACE gene I/D polymorphism and the development of hypertensive encephalopathy (HE in Uzbek patients with hypertension (HT. Materials and methods: The study included 91 male patients aged from 32 to 74 years (mean age 52.5±9.2 with HT Grade 1, 2 and 3 (ESH/ESC, 2013 [4] and presence of HE. All patients were checked on office BP using Korotkov’s method and ambulatory blood pressure monitoring (ABPM. Intima-media thickness (IMT of the carotid artery was measured by a 7.5MHz high-resolution ultrasound. Genomic DNA was isolated from peripheral blood using the DiatomTM DNA Prep 200 Kit according to the manufacturer's protocol. ACE gene I/D polymorphism genotypes were determined by PCR. Results: Among HT patients with HE, we have identified a statistically significant predominance of ID genotype carriers (65.9% against carriers of the II genotype (18.75 and DD genotype (15.4% (P=0.000; the frequency of I and D alleles was 51.6% and 48.4%, respectively (P>0.05. Comparative analysis showed a possible association between the ID genotype/D allele and HE development in HT patients, according to the general model (OR = 6.36; 95% CI 3.04 -13.31; p=0.000 and multiplicative model (OR = 2.02; 95% CI 1.25 -3.27; p=0.004 of inheritance. High grades of HT were predominant in carriers of the DD genotype. IMT was significantly higher in carriers of the DD genotype than in carriers of the II and ID genotypes. The carriage of D allele was associated with the highest levels of TC, TG, and VLDL-C. Carriers of the DD genotype were characterized by higher values of daytime SBP, nighttime SBP variability and nighttime SBP load.

  5. Biased hypermutation occurred frequently in a gene inserted into the IC323 recombinant measles virus during its persistence in the brains of nude mice

    Energy Technology Data Exchange (ETDEWEB)

    Otani, Sanae [Department of Virology and Graduate School of Medicine, Osaka City University, 1-4-3 Asahimachi, Abeno-ku, Osaka 545-8585 (Japan); Department of Pediatrics, Graduate School of Medicine, Osaka City University, Osaka (Japan); Ayata, Minoru, E-mail: maverick@med.osaka-cu.ac.jp [Department of Virology and Graduate School of Medicine, Osaka City University, 1-4-3 Asahimachi, Abeno-ku, Osaka 545-8585 (Japan); Takeuchi, Kaoru [Laboratory of Environmental Microbiology, Division of Biomedical Science, Faculty of Medicine, University of Tsukuba, Ibaraki (Japan); Takeda, Makoto [Department of Virology 3, National Institute of Infectious Diseases, Tokyo (Japan); Shintaku, Haruo [Department of Pediatrics, Graduate School of Medicine, Osaka City University, Osaka (Japan); Ogura, Hisashi [Department of Virology and Graduate School of Medicine, Osaka City University, 1-4-3 Asahimachi, Abeno-ku, Osaka 545-8585 (Japan)

    2014-08-15

    Measles virus (MV) is the causative agent of measles and its neurological complications, subacute sclerosing panencephalitis (SSPE) and measles inclusion body encephalitis (MIBE). Biased hypermutation in the M gene is a characteristic feature of SSPE and MIBE. To determine whether the M gene is the preferred target of hypermutation, an additional transcriptional unit containing a humanized Renilla reniformis green fluorescent protein (hrGFP) gene was introduced into the IC323 MV genome, and nude mice were inoculated intracerebrally with the virus. Biased hypermutation occurred in the M gene and also in the hrGFP gene when it was inserted between the leader and the N gene, but not between the H and L gene. These results indicate that biased hypermutation is usually found in a gene whose function is not essential for viral proliferation in the brain and that the location of a gene in the MV genome can affect its mutational frequency. - Highlights: • Wild-type MV can cause persistent infections in nude mice. • Biased hypermutation occurred in the M gene. • Biased hypermutation occurred in an inessential gene inserted between the leader and the N gene.

  6. Association of kinase insert domain-containing receptor (KDR gene polymorphism/ haplotypes with recurrent spontaneous abortion and genetic structure

    Directory of Open Access Journals (Sweden)

    Shiva Shahsavari

    2015-12-01

    Full Text Available Background: Recurrent spontaneous abortion is one of the diseases that can lead to physical, psychological, and, economical problems for both individuals and society. Recently a few numbers of genetic polymorphisms in kinase insert domain-containing receptor (KDR gene are examined that can endanger the life of the fetus in pregnant women. Objective: The risk of KDR gene polymorphisms was investigated in Iranian women with idiopathic recurrent spontaneous abortion (RSA. Materials and Methods: A case controlled study was performed. One hundred idiopathic recurrent spontaneous abortion patients with at least two consecutive pregnancy losses before 20 weeks of gestational age with normal karyotypes were included in the study. Also, 100 healthy women with at least one natural pregnancy were studied as control group. Two functional SNPs located in KDR gene; rs1870377 (Q472H, and rs2305948 (V297I as well as one tag SNP in the intron region (rs6838752 were genotyped by using PCR based restriction fragment length polymorphism (PCR-RFLP technique. Haplotype frequency was determined for these three SNPs’ genotypes. Analysis of genetic STRUCTURE and K means clustering were performed to study genetic variation. Results: Functional SNP (rs1870377 was highly linked to tag SNP (rs6838752 (D´ value=0. 214; χ2 = 16.44, p<0. 001. K means clustering showed that k = 8 as the best fit for the optimal number of genetic subgroups in our studied materials. This result was in agreement with Neighbor Joining cluster analysis. Conclusion: In our study, the allele and genotype frequencies were not associated with RSA between patient and control individuals. Inconsistent results in different populations with different allele frequencies among RSA patients and controls may be due to ethnic variation and used sample size.

  7. Effects of Assisted Reproduction Technology on Placental Imprinted Gene Expression

    Science.gov (United States)

    Katagiri, Yukiko; Aoki, Chizu; Tamaki-Ishihara, Yuko; Fukuda, Yusuke; Kitamura, Mamoru; Matsue, Yoichi; So, Akiko; Morita, Mineto

    2010-01-01

    We used placental tissue to compare the imprinted gene expression of IGF2, H19, KCNQ1OT1, and CDKN1C of singletons conceived via assisted reproduction technology (ART) with that of spontaneously conceived (SC) singletons. Of 989 singletons examined (ART n = 65; SC n = 924), neonatal weight was significantly lower (P < .001) in the ART group than in the SC group, but placental weight showed no significant difference. Gene expression analyzed by real-time PCR was similar for both groups with appropriate-for-date (AFD) birth weight. H19 expression was suppressed in fetal growth retardation (FGR) cases in the ART and SC groups compared with AFD cases (P < .02 and P < .05, resp.). In contrast, CDKN1C expression was suppressed in FGR cases in the ART group (P < .01), while KCNQ1OT1 expression was hyperexpressed in FGR cases in the SC group (P < .05). As imprinted gene expression patterns differed between the ART and SC groups, we speculate that ART modifies epigenetic status even though the possibilities always exist. PMID:20706653

  8. Characterization of genomic variations in SNPs of PE_PGRS genes reveals deletions and insertions in extensively drug resistant (XDR) M. tuberculosis strains from Pakistan

    KAUST Repository

    Kanji, Akbar

    2015-03-01

    Background: Mycobacterium tuberculosis (MTB) PE_PGRS genes belong to the PE multi-gene family. Although the function of the members of the PE_PGRS multi-gene family is not yet known, it is hypothesized that the PE_PGRS genes may be associated with genetic variability. Material and methods: Whole genome sequencing analysis was performed on (n= 37) extensively drug resistant (XDR) MTB strains from Pakistan which included Central Asian (n= 23), East African Indian (n= 2), X3 (n= 1), T group (n= 3) and Orphan (n= 8) MTB strains. Results: By analyzing 42 PE_PGRS genes, 111 SNPs were identified, of which 13 were non-synonymous SNPs (nsSNPs). The nsSNPs identified in the PE_PGRS genes were as follows: 6, 9, 10 and 55 present in each of the CAS, EAI, Orphan, T1 and X3 XDR MTB strains studied. Deletions in PE_PGRS genes: 19, 21 and 23 were observed in 7 (35.0%) CAS1 and 3 (37.5%) in Orphan XDR MTB strains, while deletions in the PE_PGRS genes: 49 and 50 were observed in 36 (95.0%) CAS1 and all CAS, CAS2 and Orphan XDR MTB strains. An insertion in PE_PGRS6 gene was observed in all CAS, EAI3 and Orphan, while insertions in the PE_PGRS genes 19 and 33 were observed in 19 (95%) CAS1 and all CAS, CAS2, EAI3 and Orphan XDR MTB strains. Conclusion: Genetic diversity in PE_PGRS genes contributes to antigenic variability and may result in increased immunogenicity of strains. This is the first study identifying variations in nsSNPs, Insertions and Deletions in the PE_PGRS genes of XDR-TB strains from Pakistan. It highlights common genetic variations which may contribute to persistence.

  9. Lack of relationship between an insertion/deletion polymorphism in the angiotensin I-converting enzyme gene and diabetic nephropathy and proliferative retinopathy in IDDM patients

    DEFF Research Database (Denmark)

    Tarnow, L; Cambien, Francois; Rossing, P

    1995-01-01

    Genotypic abnormalities of the renin-angiotensin system have been suggested as a risk factor for the development of diabetic nephropathy and proliferative retinopathy. We studied the relationship between an insertion(I)/deletion (D) polymorphism in the angiotensin-converting enzyme (ACE) gene in ...

  10. Specific PCR detection of Fusarium oxysporum f. sp. vasinfectum California Race 4 based on a unique Tfo1 insertion event in the PHO gene

    Science.gov (United States)

    A highly virulent race 4 (Cal race 4) of Fusarium oxysporum f. sp. vasinfectum (Fov) was identified in California cotton fields in 2001, and has since been found in increasing numbers of fields. Cal race 4 isolates contain a unique Tfo1 transposon insertion in the PHO gene that was not found in othe...

  11. Insertion of vaccinia virus C7L host range gene into NYVAC-B genome potentiates immune responses against HIV-1 antigens

    National Research Council Canada - National Science Library

    Nájera, José Luis; Gómez, Carmen Elena; García-Arriaza, Juan; Sorzano, Carlos Oscar; Esteban, Mariano

    2010-01-01

    ... while maintaining an attenuated phenotype in mice. In an effort to improve the immunogenicity of NYVAC, we have developed a novel poxvirus vector by inserting the VACV host-range C7L gene into the genome of NYVAC-B, a recombinant virus that expresses...

  12. Minos-insertion mutant of the Drosophila GBA gene homologue showed abnormal phenotypes of climbing ability, sleep and life span with accumulation of hydroxy-glucocerebroside.

    Science.gov (United States)

    Kawasaki, Haruhisa; Suzuki, Takahiro; Ito, Kumpei; Takahara, Tsubasa; Goto-Inoue, Naoko; Setou, Mitsutoshi; Sakata, Kazuki; Ishida, Norio

    2017-05-30

    Gaucher's disease in humans is considered a deficiency of glucocerebrosidase (GlcCerase) that result in the accumulation of its substrate, glucocerebroside (GlcCer). Although mouse models of Gaucher's disease have been reported from several laboratories, these models are limited due to the perinatal lethality of GlcCerase gene. Here, we examined phenotypes of Drosophila melanogaster homologues genes of the human Gaucher's disease gene by using Minos insertion. One of two Minos insertion mutants to unknown function gene (CG31414) accumulates the hydroxy-GlcCer in whole body of Drosophila melanogaster. This mutant showed abnormal phenotypes of climbing ability and sleep, and short lifespan. These abnormal phenotypes are very similar to that of Gaucher's disease in human. In contrast, another Minos insertion mutant (CG31148) and its RNAi line did not show such severe phenotype as observed in CG31414 gene mutation. The data suggests that Drosophila CG31414 gene mutation might be useful for unraveling the molecular mechanism of Gaucher's disease. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Insertion of an SVA-E retrotransposon into the CASP8 gene is associated with protection against prostate cancer.

    Science.gov (United States)

    Stacey, Simon N; Kehr, Birte; Gudmundsson, Julius; Zink, Florian; Jonasdottir, Aslaug; Gudjonsson, Sigurjon A; Sigurdsson, Asgeir; Halldorsson, Bjarni V; Agnarsson, Bjarni A; Benediktsdottir, Kristrun R; Aben, Katja K H; Vermeulen, Sita H; Cremers, Ruben G; Panadero, Angeles; Helfand, Brian T; Cooper, Phillip R; Donovan, Jenny L; Hamdy, Freddie C; Jinga, Viorel; Okamoto, Ichiro; Jonasson, Jon G; Tryggvadottir, Laufey; Johannsdottir, Hrefna; Kristinsdottir, Anna M; Masson, Gisli; Magnusson, Olafur T; Iordache, Paul D; Helgason, Agnar; Helgason, Hannes; Sulem, Patrick; Gudbjartsson, Daniel F; Kong, Augustine; Jonsson, Eirikur; Barkardottir, Rosa B; Einarsson, Gudmundur V; Rafnar, Thorunn; Thorsteinsdottir, Unnur; Mates, Ioan N; Neal, David E; Catalona, William J; Mayordomo, José I; Kiemeney, Lambertus A; Thorleifsson, Gudmar; Stefansson, Kari

    2016-03-01

    Transcriptional and splicing anomalies have been observed in intron 8 of the CASP8 gene (encoding procaspase-8) in association with cutaneous basal-cell carcinoma (BCC) and linked to a germline SNP rs700635. Here, we show that the rs700635[C] allele, which is associated with increased risk of BCC and breast cancer, is protective against prostate cancer [odds ratio (OR) = 0.91, P = 1.0 × 10(-6)]. rs700635[C] is also associated with failures to correctly splice out CASP8 intron 8 in breast and prostate tumours and in corresponding normal tissues. Investigation of rs700635[C] carriers revealed that they have a human-specific short interspersed element-variable number of tandem repeat-Alu (SINE-VNTR-Alu), subfamily-E retrotransposon (SVA-E) inserted into CASP8 intron 8. The SVA-E shows evidence of prior activity, because it has transduced some CASP8 sequences during subsequent retrotransposition events. Whole-genome sequence (WGS) data were used to tag the SVA-E with a surrogate SNP rs1035142[T] (r(2) = 0.999), which showed associations with both the splicing anomalies (P = 6.5 × 10(-32)) and with protection against prostate cancer (OR = 0.91, P = 3.8 × 10(-7)). © The Author 2016. Published by Oxford University Press.

  14. Toward the analysis of the Petunia MADS box gene family by reverse and forward transposon insertion mutagenesis approaches: B, C, and D Floral organ identity functions require SEPALLATA-Like MADS box genes in Petunia

    NARCIS (Netherlands)

    Vandenbussche, M.; Zethof, J.; Souer, E.; Koes, R.; Tornielli, G.B.; Pezzotti, M.; Ferrario, S.I.T.; Angenent, G.C.; Gerats, T.

    2003-01-01

    We have initiated a systematic functional analysis of the MADS box, intervening region, K domain, C domain-type MADS box gene family in petunia. The starting point for this has been a reverse-genetics approach, aiming to select for transposon insertions into any MADS box gene. We have developed and

  15. Genome and gene alterations by insertions and deletions in the evolution of human and chimpanzee chromosome 22

    Directory of Open Access Journals (Sweden)

    Volfovsky Natalia

    2009-01-01

    Full Text Available Abstract Background Understanding structure and function of human genome requires knowledge of genomes of our closest living relatives, the primates. Nucleotide insertions and deletions (indels play a significant role in differentiation that underlies phenotypic differences between humans and chimpanzees. In this study, we evaluated distribution, evolutionary history, and function of indels found by comparing syntenic regions of the human and chimpanzee genomes. Results Specifically, we identified 6,279 indels of 10 bp or greater in a ~33 Mb alignment between human and chimpanzee chromosome 22. After the exclusion of those in repetitive DNA, 1,429 or 23% of indels still remained. This group was characterized according to the local or genome-wide repetitive nature, size, location relative to genes, and other genomic features. We defined three major classes of these indels, using local structure analysis: (i those indels found uniquely without additional copies of indel sequence in the surrounding (10 Kb region, (ii those with at least one exact copy found nearby, and (iii those with similar but not identical copies found locally. Among these classes, we encountered a high number of exactly repeated indel sequences, most likely due to recent duplications. Many of these indels (683 of 1,429 were in proximity of known human genes. Coding sequences and splice sites contained significantly fewer of these indels than expected from random expectations, suggesting that selection is a factor in limiting their persistence. A subset of indels from coding regions was experimentally validated and their impacts were predicted based on direct sequencing in several human populations as well as chimpanzees, bonobos, gorillas, and two subspecies of orangutans. Conclusion Our analysis demonstrates that while indels are distributed essentially randomly in intergenic and intronic genomic regions, they are significantly under-represented in coding sequences. There are

  16. Insertion of a nuclear factor kappa B DNA nuclear-targeting sequence potentiates suicide gene therapy efficacy in lung cancer cell lines

    DEFF Research Database (Denmark)

    Cramer, F; Christensen, C L; Poulsen, T T

    2012-01-01

    Lung cancer currently causes the majority of cancer-related deaths worldwide and new treatments are in high demand. Gene therapy could be a promising treatment but currently lacks sufficient efficiency for clinical use, primarily due to limited cellular and nuclear DNA delivery. In the present...... improve plasmid nuclear delivery and enhance the therapeutic effect of a validated transcriptionally cancer-targeted suicide gene therapy system. A clear correlation between the number of inserted NFκB-binding sites and the therapeutic effect of the suicide system was observed in both small cell lung....... This is to our knowledge the first time a DTS strategy has been implemented for suicide gene therapy....

  17. Angiotensin-Converting Enzyme Gene Insertion/Deletion Polymorphism and Small Vessel Cerebral Stroke in Indian Population

    Directory of Open Access Journals (Sweden)

    Puttachandra Prabhakar

    2014-01-01

    Full Text Available Background. Hypertension is an established risk factor for small-vessel cerebral stroke and the renin-angiotensin system plays an important role in the maintenance of blood pressure. We aimed at evaluating the contribution of the angiotensin-converting enzyme (ACE gene insertion/deletion (I/D polymorphism to the risk of small-vessel stroke in south Indian population. Materials and Methods. We investigated 128 patients diagnosed with small-vessel stroke and 236 age, and gender-matched healthy controls. ACE I/D polymorphism was detected by polymerase chain reaction. Results. Hypertension was significantly more prevalent in the patient group and was associated with 6-fold increase in risk for stroke. ACE genotypes were in Hardy-Weinberg equilibrium in both patients and controls. Prevalence of DD, ID, and II genotypes in cases (34.4%, 43.7%, and 28% did not differ significantly from controls (31.8%, 43.2%, and 25%. The polymorphism was not associated with small-vessel stroke (OR: 1.34; 95% CI: 0.52–1.55. However, diastolic blood pressure was associated with the ACE I/D genotypes in the patients. (DD; 90.2±14.2> ID; 86.2±11.9> II; 82.3±7.8 mm Hg,  P=0.047. Conclusion. Our study showed that hypertension, but not ACE I/D polymorphism, increased the risk of small-vessel stroke.

  18. Phenological mismatch and the effectiveness of assisted gene flow.

    Science.gov (United States)

    Wadgymar, Susana M; Weis, Arthur E

    2017-06-01

    The persistence of narrowly adapted species under climate change will depend on their ability to migrate apace with their historical climatic envelope or to adapt in place to maintain fitness. This second path to persistence can only occur if there is sufficient genetic variance for response to new selection regimes. Inadequate levels of genetic variation can be remedied through assisted gene flow (AGF), that is the intentional introduction of individuals genetically adapted to localities with historic climates similar to the current or future climate experienced by the resident population. However, the timing of reproduction is frequently adapted to local conditions. Phenological mismatch between residents and migrants can reduce resident × migrant mating frequencies, slowing the introgression of migrant alleles into the resident genetic background and impeding evolutionary rescue efforts. Focusing on plants, we devised a method to estimate the frequency of resident × migrant matings based on flowering schedules and applied it in an experiment that mimicked the first generation of an AGF program with Chamaecrista fasciculata, a prairie annual, under current and expected future temperature regimes. Phenological mismatch reduced the potential for resident × migrant matings by 40-90%, regardless of thermal treatment. The most successful migrant sires were the most resident like in their flowering time, further biasing the genetic admixture between resident and migrant populations. Other loci contributing to local adaptation-heat-tolerance genes, for instance-may be in linkage disequilibrium with phenology when residents and migrants are combined into a single mating pool. Thus, introgression of potentially adaptive migrant alleles into the resident genetic background is slowed when selection acts against migrant phenology. Successful AGF programs may require sustained high immigration rates or preliminary breeding programs when phenologically matched migrant

  19. A simple, flexible and efficient PCR-fusion/Gateway cloning procedure for gene fusion, site-directed mutagenesis, short sequence insertion and domain deletions and swaps

    Directory of Open Access Journals (Sweden)

    Etchells J Peter

    2009-10-01

    Full Text Available Abstract Background The progress and completion of various plant genome sequencing projects has paved the way for diverse functional genomic studies that involve cloning, modification and subsequent expression of target genes. This requires flexible and efficient procedures for generating binary vectors containing: gene fusions, variants from site-directed mutagenesis, addition of protein tags together with domain swaps and deletions. Furthermore, efficient cloning procedures, ideally high throughput, are essential for pyramiding of multiple gene constructs. Results Here, we present a simple, flexible and efficient PCR-fusion/Gateway cloning procedure for construction of binary vectors for a range of gene fusions or variants with single or multiple nucleotide substitutions, short sequence insertions, domain deletions and swaps. Results from selected applications of the procedure which include ORF fusion, introduction of Cys>Ser mutations, insertion of StrepII tag sequence and domain swaps for Arabidopsis secondary cell wall AtCesA genes are demonstrated. Conclusion The PCR-fusion/Gateway cloning procedure described provides an elegant, simple and efficient solution for a wide range of diverse and complicated cloning tasks. Through streamlined cloning of sets of gene fusions and modification variants into binary vectors for systematic functional studies of gene families, our method allows for efficient utilization of the growing sequence and expression data.

  20. A simple, flexible and efficient PCR-fusion/Gateway cloning procedure for gene fusion, site-directed mutagenesis, short sequence insertion and domain deletions and swaps

    Science.gov (United States)

    Atanassov, Ivan I; Atanassov, Ilian I; Etchells, J Peter; Turner, Simon R

    2009-01-01

    Background The progress and completion of various plant genome sequencing projects has paved the way for diverse functional genomic studies that involve cloning, modification and subsequent expression of target genes. This requires flexible and efficient procedures for generating binary vectors containing: gene fusions, variants from site-directed mutagenesis, addition of protein tags together with domain swaps and deletions. Furthermore, efficient cloning procedures, ideally high throughput, are essential for pyramiding of multiple gene constructs. Results Here, we present a simple, flexible and efficient PCR-fusion/Gateway cloning procedure for construction of binary vectors for a range of gene fusions or variants with single or multiple nucleotide substitutions, short sequence insertions, domain deletions and swaps. Results from selected applications of the procedure which include ORF fusion, introduction of Cys>Ser mutations, insertion of StrepII tag sequence and domain swaps for Arabidopsis secondary cell wall AtCesA genes are demonstrated. Conclusion The PCR-fusion/Gateway cloning procedure described provides an elegant, simple and efficient solution for a wide range of diverse and complicated cloning tasks. Through streamlined cloning of sets of gene fusions and modification variants into binary vectors for systematic functional studies of gene families, our method allows for efficient utilization of the growing sequence and expression data. PMID:19863796

  1. Generation of gene edited birds in one generation using sperm transfection assisted gene editing (STAGE).

    Science.gov (United States)

    Cooper, Caitlin A; Challagulla, Arjun; Jenkins, Kristie A; Wise, Terry G; O'Neil, Terri E; Morris, Kirsten R; Tizard, Mark L; Doran, Timothy J

    2017-06-01

    Generating transgenic and gene edited mammals involves in vitro manipulation of oocytes or single cell embryos. Due to the comparative inaccessibility of avian oocytes and single cell embryos, novel protocols have been developed to produce transgenic and gene edited birds. While these protocols are relatively efficient, they involve two generation intervals before reaching complete somatic and germline expressing transgenic or gene edited birds. Most of this work has been done with chickens, and many protocols require in vitro culturing of primordial germ cells (PGCs). However, for many other bird species no methodology for long term culture of PGCs exists. Developing methodologies to produce germline transgenic or gene edited birds in the first generation would save significant amounts of time and resource. Furthermore, developing protocols that can be readily adapted to a wide variety of avian species would open up new research opportunities. Here we report a method using sperm as a delivery mechanism for gene editing vectors which we call sperm transfection assisted gene editing (STAGE). We have successfully used this method to generate GFP knockout embryos and chickens, as well as generate embryos with mutations in the doublesex and mab-3 related transcription factor 1 (DMRT1) gene using the CRISPR/Cas9 system. The efficiency of the method varies from as low as 0% to as high as 26% with multiple factors such as CRISPR guide efficiency and mRNA stability likely impacting the outcome. This straightforward methodology could simplify gene editing in many bird species including those for which no methodology currently exists.

  2. Insights into the mechanism of magnetic particle assisted gene delivery.

    Science.gov (United States)

    Ang, D; Nguyen, Q V; Kayal, S; Preiser, P R; Rawat, R S; Ramanujan, R V

    2011-03-01

    In magnetic particle assisted gene delivery DNA is complexed with polymer-coated aggregated magnetic nanoparticles (AMNPs) to effect transfection. In vitro studies based on COS-7 cells were carried out using pEGFP-N1 and pMIR-REPORT-complexed, polyethylenimine (PEI)-coated iron oxide magnetic nanoparticles (MNPs). PEI-coated AMNPs (PEI-AMNPs) with average individual particle diameters of 8, 16 and 30 nm were synthesized. Normal, reverse and retention magnetic transfection experiments and cell wounding assays were performed. Our results show that the optimum magnetic field yields maximum transfection efficiency with good viability. The results of the normal, reverse and retention magnetic transfection experiments show that the highest transfection efficiency was achieved in normal magnetic transfection mode due to clustering of the PEI-AMNPs on the cells. Cell wounding assay results suggest that the mechanism of magnetic transfection is endocytosis rather than cell wounding. Copyright © 2010 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

  3. Determinism and randomness in the evolution of introns and sine inserts in mouse and human mitochondrial solute carrier and cytokine receptor genes.

    Science.gov (United States)

    Cianciulli, Antonia; Calvello, Rosa; Panaro, Maria A

    2015-04-01

    In the homologous genes studied, the exons and introns alternated in the same order in mouse and human. We studied, in both species: corresponding short segments of introns, whole corresponding introns and complete homologous genes. We considered the total number of nucleotides and the number and orientation of the SINE inserts. Comparisons of mouse and human data series showed that at the level of individual relatively short segments of intronic sequences the stochastic variability prevails in the local structuring, but at higher levels of organization a deterministic component emerges, conserved in mouse and human during the divergent evolution, despite the ample re-editing of the intronic sequences and the fact that processes such as SINE spread had taken place in an independent way in the two species. Intron conservation is negatively correlated with the SINE occupancy, suggesting that virus inserts interfere with the conservation of the sequences inherited from the common ancestor. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. The Hairless Stem Phenotype of Cotton (Gossypium barbadense) Is Linked to a Copia-Like Retrotransposon Insertion in a Homeodomain-Leucine Zipper Gene (HD1)

    OpenAIRE

    Ding, Mingquan; Ye, Wuwei; Lin, Lifeng; He, Shae; Du, Xiongming; Chen, Aiqun; Cao, Yuefen; Qin, Yuan; Yang, Fen; Jiang, Yurong; Zhang, Hua; Wang, Xiyin; Paterson, Andrew H.; Rong, Junkang

    2015-01-01

    Cotton (Gossypium) stem trichomes are mostly single cells that arise from stem epidermal cells. In this study, a homeodomain-leucine zipper gene (HD1) was found to cosegregate with the dominant trichome locus previously designated as T1 and mapped to chromosome 6. Characterization of HD1 orthologs revealed that the absence of stem trichomes in modern Gossypium barbadense varieties is linked to a large retrotransposon insertion in the ninth exon, 2565 bp downstream from the initial codon in th...

  5. Insertional Mutagenesis by CRISPR/Cas9 Ribonucleoprotein Gene Editing in Cells Targeted for Point Mutation Repair Directed by Short Single-Stranded DNA Oligonucleotides.

    Science.gov (United States)

    Rivera-Torres, Natalia; Banas, Kelly; Bialk, Pawel; Bloh, Kevin M; Kmiec, Eric B

    2017-01-01

    CRISPR/Cas9 and single-stranded DNA oligonucleotides (ssODNs) have been used to direct the repair of a single base mutation in human genes. Here, we examine a method designed to increase the precision of RNA guided genome editing in human cells by utilizing a CRISPR/Cas9 ribonucleoprotein (RNP) complex to initiate DNA cleavage. The RNP is assembled in vitro and induces a double stranded break at a specific site surrounding the mutant base designated for correction by the ssODN. We use an integrated mutant eGFP gene, bearing a single base change rendering the expressed protein nonfunctional, as a single copy target in HCT 116 cells. We observe significant gene correction activity of the mutant base, promoted by the RNP and single-stranded DNA oligonucleotide with validation through genotypic and phenotypic readout. We demonstrate that all individual components must be present to obtain successful gene editing. Importantly, we examine the genotype of individually sorted corrected and uncorrected clonally expanded cell populations for the mutagenic footprint left by the action of these gene editing tools. While the DNA sequence of the corrected population is exact with no adjacent sequence modification, the uncorrected population exhibits heterogeneous mutagenicity with a wide variety of deletions and insertions surrounding the target site. We designate this type of DNA aberration as on-site mutagenicity. Analyses of two clonal populations bearing specific DNA insertions surrounding the target site, indicate that point mutation repair has occurred at the level of the gene. The phenotype, however, is not rescued because a section of the single-stranded oligonucleotide has been inserted altering the reading frame and generating truncated proteins. These data illustrate the importance of analysing mutagenicity in uncorrected cells. Our results also form the basis of a simple model for point mutation repair directed by a short single-stranded DNA oligonucleotides and

  6. Insertion of a nuclear factor kappa B DNA nuclear-targeting sequence potentiates suicide gene therapy efficacy in lung cancer cell lines.

    Science.gov (United States)

    Cramer, F; Christensen, C L; Poulsen, T T; Badding, M A; Dean, D A; Poulsen, H S

    2012-10-01

    Lung cancer currently causes the majority of cancer-related deaths worldwide and new treatments are in high demand. Gene therapy could be a promising treatment but currently lacks sufficient efficiency for clinical use, primarily due to limited cellular and nuclear DNA delivery. In the present study, we investigated whether it was possible to exploit the endogenous nuclear-shuttling activity by the nuclear factor kappa B (NFκB) system, which is highly prominent in many cancers as well as lung cancer. We observed that insertion of a DNA nuclear-targeting sequence (DTS) recognized by NFκB could improve plasmid nuclear delivery and enhance the therapeutic effect of a validated transcriptionally cancer-targeted suicide gene therapy system. A clear correlation between the number of inserted NFκB-binding sites and the therapeutic effect of the suicide system was observed in both small cell lung cancer (SCLC) and non-SCLC cell lines. The effect was observed to be due to elevated nuclear translocation of the suicide gene-encoding plasmids. The results show that a significant improvement of gene therapeutic efficiency can be obtained by increasing the intracellular trafficking of therapeutic DNA. This is to our knowledge the first time a DTS strategy has been implemented for suicide gene therapy.

  7. A "White" Anthocyanin-less Pomegranate (Punica granatum L.) Caused by an Insertion in the Coding Region of the Leucoanthocyanidin Dioxygenase (LDOX; ANS) Gene.

    Science.gov (United States)

    Ben-Simhon, Zohar; Judeinstein, Sylvie; Trainin, Taly; Harel-Beja, Rotem; Bar-Ya'akov, Irit; Borochov-Neori, Hamutal; Holland, Doron

    2015-01-01

    Color is an important determinant of pomegranate fruit quality and commercial value. To understand the genetic factors controlling color in pomegranate, chemical, molecular and genetic characterization of a "white" pomegranate was performed. This unique accession is lacking the typical pomegranate color rendered by anthocyanins in all tissues of the plant, including flowers, fruit (skin and arils) and leaves. Steady-state gene-expression analysis indicated that none of the analyzed "white" pomegranate tissues are able to synthesize mRNA corresponding to the PgLDOX gene (leucoanthocyanidin dioxygenase, also called ANS, anthocyanidin synthase), which is one of the central structural genes in the anthocyanin-biosynthesis pathway. HPLC analysis revealed that none of the "white" pomegranate tissues accumulate anthocyanins, whereas other flavonoids, corresponding to biochemical reactions upstream of LDOX, were present. Molecular analysis of the "white" pomegranate revealed the presence of an insertion and an SNP within the coding region of PgLDOX. It was found that the SNP does not change amino acid sequence and is not fully linked with the "white" phenotype in all pomegranate accessions from the collection. On the other hand, genotyping of pomegranate accessions from the collection and segregating populations for the "white" phenotype demonstrated its complete linkage with the insertion, inherited as a recessive single-gene trait. Taken together, the results indicate that the insertion in PgLDOX is responsible for the "white" anthocyanin-less phenotype. These data provide the first direct molecular, genetic and chemical evidence for the effect of a natural modification in the LDOX gene on color accumulation in a fruit-bearing woody perennial deciduous tree. This modification can be further utilized to elucidate the physiological role of anthocyanins in protecting the tree organs from harmful environmental conditions, such as temperature and UV radiation.

  8. Insertion devices

    CERN Document Server

    Bahrdt, J

    2006-01-01

    The interaction of an insertion device with the electron beam in a storage ring is discussed. The radiation property including brightness, ux and polarization of an ideal and real planar and helical / elliptical device is described. The magnet design of planar, helical, quasiperiodic devices and of devices with a reduced on axis power density are resumed.

  9. Calorimeter insertion

    CERN Multimedia

    2006-01-01

    Calorimeter insertion between toroids in the ATLAS experiment detector Calorimeters are surrounding the inner detector. Calorimeters will absorb and measure the energies of the most charged and neutral particles after the collisions. The saved energy in the calorimeter is detected and converted to signals that are taken out with data taking electronics.

  10. Insertional Mutagenesis and Deep Profiling Reveals Gene Hierarchies and a Myc/p53-Dependent Bottleneck in Lymphomagenesis

    NARCIS (Netherlands)

    Huser, C.A.; Gilroy, K.L.; De Ridder, J.; Kilbey, A.; Borland, G.; Mackay, N.; Jenkins, A.; Bell, M.; Herzyk, P.; Van der Weyden, L.

    2014-01-01

    Retroviral insertional mutagenesis (RIM) is a powerful tool for cancer genomics that was combined in this study with deep sequencing (RIM/DS) to facilitate a comprehensive analysis of lymphoma progression. Transgenic mice expressing two potent collaborating oncogenes in the germ line (CD2-MYC,

  11. Deletion/insertion polymorphism of the angiotensin-converting enzyme gene and white matter hyperintensities in dementia: A pilot study.

    NARCIS (Netherlands)

    Purandare, N.; Oude Voshaar, R.C.; Davidson, Y.; Gibbons, L.; Hardicre, J.; Byrne, J.; McCollum, C.N.; Jackson, A.; Burns, A.; Mann, D.M.

    2006-01-01

    OBJECTIVES: To examine the association between the angiotensin-converting enzyme (ACE) deletion/insertion (D/I) polymorphism and white matter hyperintensities (WMHs) in patients with dementia. DESIGN: Observational pilot study with adjustment for potential confounders using analysis of covariance.

  12. Familial retinoblastoma due to intronic LINE-1 insertion causes aberrant and noncanonical mRNA splicing of the RB1 gene.

    Science.gov (United States)

    Rodríguez-Martín, Carlos; Cidre, Florencia; Fernández-Teijeiro, Ana; Gómez-Mariano, Gema; de la Vega, Leticia; Ramos, Patricia; Zaballos, Ángel; Monzón, Sara; Alonso, Javier

    2016-05-01

    Retinoblastoma (RB, MIM 180200) is the paradigm of hereditary cancer. Individuals harboring a constitutional mutation in one allele of the RB1 gene have a high predisposition to develop RB. Here, we present the first case of familial RB caused by a de novo insertion of a full-length long interspersed element-1 (LINE-1) into intron 14 of the RB1 gene that caused a highly heterogeneous splicing pattern of RB1 mRNA. LINE-1 insertion was inferred by mRNA studies and full-length sequenced by massive parallel sequencing. Some of the aberrant mRNAs were produced by noncanonical acceptor splice sites, a new finding that up to date has not been described to occur upon LINE-1 retrotransposition. Our results clearly show that RNA-based strategies have the potential to detect disease-causing transposon insertions. It also confirms that the incorporation of new genetic approaches, such as massive parallel sequencing, contributes to characterize at the sequence level these unique and exceptional genetic alterations.

  13. An unusual insertion/deletion in the gene encoding the. beta. -subunit of propionyl-CoA carboxylase is a frequent mutation in Caucasian propionic acidemia

    Energy Technology Data Exchange (ETDEWEB)

    Tahara, T.; Kraus, J.P.; Rosenberg, L.E. (Yale Univ. School of Medicine, New Haven, CT (USA))

    1990-02-01

    Propionic acidemia is an inherited disorder of organic acid metabolism that is caused by deficiency of propionly-CoA carboxylase. Affected patients fall into two complementation groups, pccA and pccBC (subgroups B, C, and BC), resulting from deficiency of the nonidentical {alpha} and {beta} subunits of PCC, respectively. The authors have detected an unusual insertion/deletion in the DNA of patients from the pccBC and pccC subgroups that replaces 14 nucleotides in the coding sequence of the {beta} subunit with 12 nucleotides unrelated to this region of the gene. Among 14 unrelated Caucasian patients in the pccBc complementation group, this unique mutation was found in 8 of 28 mutant alleles examined. Mutant allele-specific oligonucleotide hybridization to amplified genomic DNAs revealed that the inserted 12 nucleotides do not originate in an {approx}1000-bp region around the mutation. In the course of the investigation, they identified another mutation in the same exon: a 3-bp in-frame deletion that eliminates one of two isoleucine codons immediately preceding the Msp I site. Two unrelated patients were compound heterozygotes for this single-codon deletion and for the insertion/deletion described above. They conclude that either there is a propensity for the PCC {beta}-subunit gene to undergo mutations of this sort at this position or, more likely, the mutations in all of the involved Caucasian patients have a common origin in preceding generations.

  14. Postnatal Development of Spasticity Following Transgene Insertion in the Mouse βIV Spectrin Gene (SPTBN4).

    Science.gov (United States)

    Kichkin, Eva; Visvanathan, Archunan; Lovicu, Frank J; Shu, Daisy Y; Das, Shannon J; Reddel, Stephen W; McCann, Emily P; Zhang, Katharine Y; Williams, Kelly L; Blair, Ian P; Phillips, William D

    2017-01-01

    The L25 mouse line was generated by random genomic insertion of a lens-specific transgene. Inbreeding of L25 hemizygotes revealed an unanticipated spastic phenotype in the hind limbs. The goals were to characterize the motor phenotype in the L25 mice and to map the transgene insert site within the mouse genome. Six pairs of L25+/- mice were repeatedly mated. Beginning at weaning, all progeny were inspected for body weight and motor signs twice weekly until they displayed predefined ethical criteria for termination. The transgene insert site was determined by whole genome sequencing. Western blotting was used to compare the expression levels of beta-IV spectrin protein in the brain. Matings of hemizygous L25+/- × L25+/- mice yielded 20% (29/148) affected weanlings, identified by an abnormal retraction of the hind limbs when lifted by the tail, and a fine tremor. Affected mice were less mobile and grew more slowly than wild-type littermates. All affected mice required termination due to >15% loss of body weight (50% survival age 92 days). At the endpoint, mice showed varying degrees of spastic paresis or spastic paralysis localised to the hind limbs. Motor endplates remained fully innervated. Genome sequencing confirmed that the transgene was inserted in the locus of βIV spectrin of L25 mice. Western blotting indicated that this random insertion had greatly reduced the expression of βIV spectrin protein in the affected L25 mice. The results confirm the importance of βIV spectrin for maintaining central motor pathway control of the hind limbs, and provide a developmental time course for the phenotype.

  15. Unusual accelerated rate of deletions and insertions in toxin genes in the venom glands of the pygmy copperhead (Austrelaps labialis) from Kangaroo island.

    Science.gov (United States)

    Doley, Robin; Tram, Nguyen Ngoc Bao; Reza, Md Abu; Kini, R Manjunatha

    2008-02-28

    Toxin profiling helps in cataloguing the toxin present in the venom as well as in searching for novel toxins. The former helps in understanding potential pharmacological profile of the venom and evolution of toxins, while the latter contributes to understanding of novel mechanisms of toxicity and provide new research tools or prototypes of therapeutic agents. The pygmy copperhead (Austrelaps labialis) is one of the less studied species. In this present study, an attempt has been made to describe the toxin profile of A. labialis from Kangaroo Island using the cDNA library of its venom glands. We sequenced 658 clones which represent the common families of toxin genes present in snake venom. They include (a) putative long-chain and short-chain neurotoxins, (b) phospholipase A2, (c) Kunitz-type protease inhibitor, (d) CRISPs, (e) C-type lectins and (f) Metalloproteases. In addition, we have also identified a novel protein with two Kunitz-type domains in tandem similar to bikunin. Interestingly, the cDNA library reveals that most of the toxin families (17 out of 43 toxin genes; approximately 40%) have truncated transcripts due to insertion or deletion of nucleotides. These truncated products might not be functionally active proteins. However, cellular transcripts from the same venom glands are not affected. This unusual higher rate of deletion and insertion of nucleotide in toxin genes may be responsible for the lower toxicity of A. labialis venom of Kangroo Island and have significant effect on evolution of toxin genes.

  16. A single base insertion in the putative transmembrane domain of the tyrosinase gene as a cause for tyrosinase-negative oculocutaneous albinism

    Energy Technology Data Exchange (ETDEWEB)

    Chintamaneni, C.D.; Kobayashi, Y.; Kwon, B.S. (Indiana Univ. School of Medicine, Indianapolis (United States)); Halaban, R. (Yale Univ. School of Medicine, New Haven, CT (United States)); Witkop, C.J. Jr. (Univ. of Minnesota, Minneapolis (United States))

    1991-06-15

    The authors have determined a molecular defect to be the likely basis for inactivity of the tyrosinase from a patient with tyrosinase-negative oculocutaneous albinism. A single base (thymine) was inserted in exon 5 of the tyrosinase gene following codon 471 in the putative transmembrane coding region. This insertion caused a shift in the reading frame of 19 amino acids at the 3{prime} end and introduced a premature termination signal that would be expected to truncate the protein by 21 amino acids at the carboxyl terminus. The albino tyrosinase was not recognized by antibodies directed to the carboxyl terminus of tyrosinase. Furthermore, as shown by gel electrophoresis of the immunoprecipitated protein, the tyrosinase was {approx} 3kDa smaller than normal. Similar immunoprecipitation data were obtained when cloned normal and mutant tyrosinases were expressed in COS-1 cells.

  17. Multi-species sequence comparison reveals dynamic evolution of the elastin gene that has involved purifying selection and lineage-specific insertions/deletions

    Directory of Open Access Journals (Sweden)

    Green Eric D

    2004-05-01

    Full Text Available Abstract Background The elastin gene (ELN is implicated as a factor in both supravalvular aortic stenosis (SVAS and Williams Beuren Syndrome (WBS, two diseases involving pronounced complications in mental or physical development. Although the complete spectrum of functional roles of the processed gene product remains to be established, these roles are inferred to be analogous in human and mouse. This view is supported by genomic sequence comparison, in which there are no large-scale differences in the ~1.8 Mb sequence block encompassing the common region deleted in WBS, with the exception of an overall reversed physical orientation between human and mouse. Results Conserved synteny around ELN does not translate to a high level of conservation in the gene itself. In fact, ELN orthologs in mammals show more sequence divergence than expected for a gene with a critical role in development. The pattern of divergence is non-conventional due to an unusually high ratio of gaps to substitutions. Specifically, multi-sequence alignments of eight mammalian sequences reveal numerous non-aligning regions caused by species-specific insertions and deletions, in spite of the fact that the vast majority of aligning sites appear to be conserved and undergoing purifying selection. Conclusions The pattern of lineage-specific, in-frame insertions/deletions in the coding exons of ELN orthologous genes is unusual and has led to unique features of the gene in each lineage. These differences may indicate that the gene has a slightly different functional mechanism in mammalian lineages, or that the corresponding regions are functionally inert. Identified regions that undergo purifying selection reflect a functional importance associated with evolutionary pressure to retain those features.

  18. Identification of IS1R and IS10R elements inserted into ompk36 porin gene of two multidrug-resistant Klebsiella pneumoniae hospital strains.

    Science.gov (United States)

    Lev, Anastasia I; Astashkin, Evgeny I; Shaikhutdinova, Rima Z; Platonov, Mikhail E; Kartsev, Nikolay N; Volozhantsev, Nikolay V; Ershova, Olga N; Svetoch, Edward A; Fursova, Nadezhda K

    2017-05-01

    Hospital Klebsiella pneumoniae strains (n = 196) were collected in 2012-16 from the patients of a Moscow neurosurgical intensive care unit. Klebsiella pneumoniae strains were multidrug-resistant and carried beta-lactamase genes blaSHV (97.4% of strains), blaCTX-M (84.7%), blaTEM (56.1%), blaOXA-48-like (49.0%) and blaNDM-1 (one strain), class 1 integrons (43.4% of strains) and porin protein ompK36 gene (100% of strains). The ompK36 porin protein gene disruption by insertion sequence (IS) elements and OmpK36 production loss in two strains were detected in this study. Outer membrane proteins were isolated according to Carlone et al. (Rapid microprocedure for isolating detergent-insoluble outer membrane proteins from Haemophilus species. J Clin Microbiol 1986;24:330-2). The IS10R element belonging to the IS4 family, IS10 group was detected at the position of the 41st nucleotide of the ompK36 gene in K. pneumoniae strain KPB-2304K/15 (the first report for a certain IS element in K. pneumoniae). The IS1R element belonging to the IS1 family was identified at the position of the 86th nucleotide of the ompK36 gene in the K. pneumoniae strain KPB-367K/15 (novel insertion site for IS1 element into ompK36 gene). DNA transfer of the intact ompK36 gene into the strain KPB-367K/15 by vector plasmid restored OmpK36 porin protein production and resulted in a decrease of imipenem minimal inhibitory concentration. Such data confirm the importance of IS elements in ongoing multidrug-resistant evolution in hospital Klebsiella. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  19. Physical mapping of transposon Tn5 insertions defines a gene cluster functional in nitrous oxide respiration by Pseudomonas stutzeri.

    OpenAIRE

    Viebrock, A; Zumft, W G

    1987-01-01

    By transposon Tn5 mutagenesis, 19 strains of Pseudomonas stutzeri were acquired that had defects in nitrous oxide respiration (Nos- phenotype). A physical map of the mutants showed nearly random Tn5 insertions into genomic DNA within a single region ca. 8 kilobases long. Mutants were characterized immunochemically, enzymatically, and chemically. Several functions related to the synthesis and regulation of nitrous oxide reductase were associated with this DNA region, indicating that in P. stut...

  20. Targeted next-generation sequencing detects point mutations, insertions, deletions and balanced chromosomal rearrangements as well as identifies novel leukemia-specific fusion genes in a single procedure.

    Science.gov (United States)

    Grossmann, V; Kohlmann, A; Klein, H-U; Schindela, S; Schnittger, S; Dicker, F; Dugas, M; Kern, W; Haferlach, T; Haferlach, C

    2011-04-01

    DNA sequence enrichment from complex genomic samples using microarrays enables targeted next-generation sequencing (NGS). In this study, we combined 454 shotgun pyrosequencing with long oligonucleotide sequence capture arrays. We demonstrate the detection of mutations including point mutations, deletions and insertions in a cohort of 22 patients presenting with acute leukemias and myeloid neoplasms. Importantly, this one-step methodological procedure also allowed the detection of balanced chromosomal aberrations, including translocations and inversions. Moreover, the genomic representation of only one of the partner genes of a chimeric fusion on the capture platform also permitted identification of the novel fusion partner genes. Using acute myeloid leukemias harboring RUNX1 abnormalities as a model system, three novel chromosomal fusion sequences and KCNMA1 as a novel RUNX1 fusion partner gene were detected. This assay has the strong potential to become an important method for the comprehensive genetic characterization of particular leukemias and other malignancies harboring complex genomes.

  1. Suppression of leaky expression of adenovirus genes by insertion of microRNA-targeted sequences in the replication-incompetent adenovirus vector genome

    Directory of Open Access Journals (Sweden)

    Kahori Shimizu

    2014-01-01

    Full Text Available Leaky expression of adenovirus (Ad genes occurs following transduction with a conventional replication-incompetent Ad vector, leading to an induction of cellular immunity against Ad proteins and Ad protein-induced toxicity, especially in the late phase following administration. To suppress the leaky expression of Ad genes, we developed novel Ad vectors by incorporating four tandem copies of sequences with perfect complementarity to miR-122a or miR-142-3p into the 3′-untranslated region (UTR of the E2A, E4, or pIX gene, which were mainly expressed from the Ad vector genome after transduction. These Ad vectors easily grew to high titers comparable to those of a conventional Ad vector in conventional 293 cells. The leaky expression of these Ad genes in mouse organs was significantly suppressed by 2- to 100-fold, compared with a conventional Ad vector, by insertion of the miRNA-targeted sequences. Notably, the Ad vector carrying the miR-122a–targeted sequences into the 3′-UTR of the E4 gene expressed higher and longer-term transgene expression and more than 20-fold lower levels of all the Ad early and late genes examined in the liver than a conventional Ad vector. miR-122a–mediated suppression of the E4 gene expression in the liver significantly reduced the hepatotoxicity which an Ad vector causes via both adaptive and non-adaptive immune responses.

  2. Angiotensin-converting enzyme insertion/deletion gene polymorphism in Egyptian children with systemic lupus erythematosus: a possible relation to proliferative nephritis.

    Science.gov (United States)

    Hammad, A; Yahia, S; Laimon, W; Hamed, S M; Shouma, A; Shalaby, N M; Abdel-Hady, D; Ghanem, R; El-Farahaty, R M; El-Bassiony, S R; Hammad, E M

    2017-06-01

    Introduction Angiotensin-converting enzyme (ACE) is crucial in the pathogenesis of systemic lupus erythematosus through angiotensin II which regulates vascular tone and endothelial functions. Objectives To study the frequency of ACE insertion/deletion (I/D) gene polymorphism in Egyptian children with systemic lupus erythematosus and its possible relation to the renal pathology in cases with lupus nephritis. Subjects and methods The frequency of ACE gene insertion/deletion polymorphism genotypes was determined in 78 Egyptian children with systemic lupus erythematosus and compared to a matched group of 140 healthy controls using polymerase chain reaction. Results The DD genotype of the ACE gene was higher in systemic lupus erythematosus patients when compared to controls ( Plupus erythematosus patients in comparison to controls ( P lupus nephritis group, the DD genotype was significantly higher in those with proliferative lupus nephritis when compared to those with non-proliferative lupus nephritis ( P = 0.02; OR = 1.45; 95% CI = 1.4-1.6). Also, patients with proliferative lupus nephritis showed a higher frequency of the D allele ( P lupus erythematosus and occurrence of proliferative nephritis in Egyptian children.

  3. Generation of mariner-based transposon insertion mutant library of Bacillus sphaericus 2297 and investigation of genes involved in sporulation and mosquito-larvicidal crystal protein synthesis.

    Science.gov (United States)

    Wu, Yiming; Hu, Xiaomin; Ge, Yong; Zheng, Dasheng; Yuan, Zhiming

    2012-05-01

    Bacillus sphaericus has been used with great success in mosquito control programs worldwide. Under conditions of nutrient limitation, it undergoes sporulation via a series of well defined morphological stages. However, only a small number of genes involved in sporulation have been identified. To identify genes associated with sporulation, and to understand the relationship between sporulation and crystal protein synthesis, a random mariner-based transposon insertion mutant library of B. sphaericus strain 2297 was constructed and seven sporulation-defective mutants were selected. Sequencing of the DNA flanking of the transposon insertion identified several genes involved in sporulation. The morphologies of mutants were determined by electron microscopy and synthesis of crystal proteins was analyzed by SDS-PAGE and Western blot. Four mutants blocked at early stages of sporulation failed to produce crystal proteins and had lower larvicidal activity. However, the other three mutants were blocked at later stages and were able to form crystal proteins, and the larvicidal activity was similar to wild type. These results indicated that crystal protein synthesis in B. sphaericus is dependent on sporulation initiation. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  4. A highly polymorphic insertion in the Y-chromosome amelogenin gene can be used for evolutionary biology, population genetics and sexing in Cetacea and Artiodactyla

    Directory of Open Access Journals (Sweden)

    Crouau-Roy Brigitte

    2008-10-01

    Full Text Available Abstract Background The early radiation of the Cetartiodactyla is complex, and unambiguous molecular characters are needed to clarify the positions of hippotamuses, camels and pigs relative to the remaining taxa (Cetacea and Ruminantia. There is also a need for informative genealogic markers for Y-chromosome population genetics as well as a sexing method applicable to all species from this group. We therefore studied the sequence variation of a partial sequence of the evolutionary conserved amelogenin gene to assess its potential use in each of these fields. Results and discussion We report a large interstitial insertion in the Y amelogenin locus in most of the Cetartiodactyla lineages (cetaceans and ruminants. This sex-linked size polymorphism is the result of a 460–465 bp inserted element in intron 4 of the amelogenin gene of Ruminants and Cetaceans. Therefore, this polymorphism can easily be used in a sexing assay for these species. When taking into account this shared character in addition to nucleotide sequence, gene genealogy follows sex-chromosome divergence in Cetartiodactyla whereas it is more congruent with zoological history when ignoring these characters. This could be related to a loss of homology between chromosomal copies given the old age of the insertion. The 1 kbp Amel-Y amplified fragment is also characterized by high nucleotide diversity (64 polymorphic sites spanning over 1 kbp in seven haplotypes which is greater than for other Y-chromosome sequence markers studied so far but less than the mitochondrial control region. Conclusion The gender-dependent polymorphism we have identified is relevant not only for phylogenic inference within the Cetartiodactyla but also for Y-chromosome based population genetics and gender determination in cetaceans and ruminants. One single protocol can therefore be used for studies in population and evolutionary genetics, reproductive biotechnologies, and forensic science.

  5. Insertion/deletion polymorphism in the angiotensin-I-converting enzyme gene is associated with coronary heart disease in IDDM patients with diabetic nephropathy

    DEFF Research Database (Denmark)

    Tarnow, L; Cambien, Francois; Rossing, P

    1995-01-01

    Insulin-dependent diabetic (IDDM) patients with diabetic nephropathy have a highly increased morbidity and mortality from coronary heart disease. An insertion (I) /deletion (D) polymorphism in the angiotensin-I-converting enzyme (ACE) gene has been shown to be associated with coronary heart disease...... regression analysis of the risk factors associated with coronary heart disease in univariate analysis revealed that the II genotype acts as an independent protective factor against coronary heart disease, odds ratio II/DD + ID 0.27 (95% confidence interval 0.07-0.97, p

  6. A glycine insertion in the estrogen-related receptor (ERR) is associated with enhanced expression of three cytochrome P450 genes in transgenic Drosophila melanogaster.

    Science.gov (United States)

    Sun, Weilin; Valero, M Carmen; Seong, Keon Mook; Steele, Laura D; Huang, I-Ting; Lee, Chien-Hui; Clark, John M; Qiu, Xinghui; Pittendrigh, Barry R

    2015-01-01

    Insecticide-resistant Drosophila melanogaster strains represent a resource for the discovery of the underlying molecular mechanisms of cytochrome P450 constitutive over-expression, even if some of these P450s are not directly involved in the resistance phenotype. For example, in select 4,4'-dichlorodiphenyltrichloroethane (DDT) resistant strains the glucocorticoid receptor-like (GR-like) potential transcription factor binding motifs (TFBMs) have previously been shown to be associated with constitutively differentially-expressed cytochrome P450s, Cyp12d1, Cyp6g2 and Cyp9c1. However, insects are not known to have glucocorticoids. The only ortholog to the mammalian glucocorticoid receptor (GR) in D. melanogaster is an estrogen-related receptor (ERR) gene, which has two predicted alternative splice isoforms (ERRa and ERRb). Sequencing of ERRa and ERRb in select DDT susceptible and resistant D. melanogaster strains has revealed a glycine (G) codon insertion which was only observed in the ligand binding domain of ERR from the resistant strains tested (ERR-G). Transgenic flies, expressing the ERRa-G allele, constitutively over-expressed Cyp12d1, Cyp6g2 and Cyp9c1. Only Cyp12d1 and Cyp6g2 were over-expressed in the ERRb-G transgenic flies. Phylogenetic studies show that the G-insertion appeared to be located in a less conserved domain in ERR and this insertion is found in multiple species across the Sophophora subgenera.

  7. A glycine insertion in the estrogen-related receptor (ERR is associated with enhanced expression of three cytochrome P450 genes in transgenic Drosophila melanogaster.

    Directory of Open Access Journals (Sweden)

    Weilin Sun

    Full Text Available Insecticide-resistant Drosophila melanogaster strains represent a resource for the discovery of the underlying molecular mechanisms of cytochrome P450 constitutive over-expression, even if some of these P450s are not directly involved in the resistance phenotype. For example, in select 4,4'-dichlorodiphenyltrichloroethane (DDT resistant strains the glucocorticoid receptor-like (GR-like potential transcription factor binding motifs (TFBMs have previously been shown to be associated with constitutively differentially-expressed cytochrome P450s, Cyp12d1, Cyp6g2 and Cyp9c1. However, insects are not known to have glucocorticoids. The only ortholog to the mammalian glucocorticoid receptor (GR in D. melanogaster is an estrogen-related receptor (ERR gene, which has two predicted alternative splice isoforms (ERRa and ERRb. Sequencing of ERRa and ERRb in select DDT susceptible and resistant D. melanogaster strains has revealed a glycine (G codon insertion which was only observed in the ligand binding domain of ERR from the resistant strains tested (ERR-G. Transgenic flies, expressing the ERRa-G allele, constitutively over-expressed Cyp12d1, Cyp6g2 and Cyp9c1. Only Cyp12d1 and Cyp6g2 were over-expressed in the ERRb-G transgenic flies. Phylogenetic studies show that the G-insertion appeared to be located in a less conserved domain in ERR and this insertion is found in multiple species across the Sophophora subgenera.

  8. The Dominant white, Dun and Smoky Color Variants in Chicken Are Associated With Insertion/Deletion Polymorphisms in the PMEL17 Gene

    Science.gov (United States)

    Kerje, Susanne; Sharma, Preety; Gunnarsson, Ulrika; Kim, Hyun; Bagchi, Sonchita; Fredriksson, Robert; Schütz, Karin; Jensen, Per; von Heijne, Gunnar; Okimoto, Ron; Andersson, Leif

    2004-01-01

    Dominant white, Dun, and Smoky are alleles at the Dominant white locus, which is one of the major loci affecting plumage color in the domestic chicken. Both Dominant white and Dun inhibit the expression of black eumelanin. Smoky arose in a White Leghorn homozygous for Dominant white and partially restores pigmentation. PMEL17 encodes a melanocyte-specific protein and was identified as a positional candidate gene due to its role in the development of eumelanosomes. Linkage analysis of PMEL17 and Dominant white using a red jungle fowl/White Leghorn intercross revealed no recombination between these loci. Sequence analysis showed that the Dominant white allele was exclusively associated with a 9-bp insertion in exon 10, leading to an insertion of three amino acids in the PMEL17 transmembrane region. Similarly, a deletion of five amino acids in the transmembrane region occurs in the protein encoded by Dun. The Smoky allele shared the 9-bp insertion in exon 10 with Dominant white, as expected from its origin, but also had a deletion of 12 nucleotides in exon 6, eliminating four amino acids from the mature protein. These mutations are, together with the recessive silver mutation in the mouse, the only PMEL17 mutations with phenotypic effects that have been described so far in any species. PMID:15579702

  9. Characterization of genomic variations in SNPs of PE_PGRS genes reveals deletions and insertions in extensively drug resistant (XDR) M. tuberculosis strains from Pakistan

    KAUST Repository

    Kanji, Akbar

    2015-01-21

    Background Mycobacterium tuberculosis (MTB) PE_PGRS genes belong to the PE multigene family. Although the function of PE_PGRS genes is unknown, it is hypothesized that the PE_PGRS genes may be associated with antigenic variability in MTB. Material and methods Whole genome sequencing analysis was performed on (n = 37) extensively drug-resistant (XDR) MTB strains from Pakistan, which included Lineage 1 (East African Indian, n = 2); Other lineage 1 (n = 3); Lineage 3 (Central Asian, n = 24); Other lineage 3 (n = 4); Lineage 4 (X3, n = 1) and T group (n = 3) MTB strains. Results There were 107 SNPs identified from the analysis of 42 PE_PGRS genes; of these, 13 were non-synonymous SNPs (nsSNPs). The nsSNPs identified in PE_PGRS genes – 6, 9 and 10 – were common in all EAI, CAS, Other lineages (1 and 3), T1 and X3. Deletions (DELs) in PE_PGRS genes – 3 and 19 – were observed in 17 (80.9%) CAS1 and 6 (85.7%) in Other lineages (1 and 3) XDR MTB strains, while DELs in the PE_PGRS49 were observed in all CAS1, CAS, CAS2 and Other lineages (1 and 3) XDR MTB strains. All CAS, EAI and Other lineages (1 and 3) strains showed insertions (INS) in PE_PGRS6 gene, while INS in the PE_PGRS genes 19 and 33 were observed in 20 (95.2%) CAS1, all CAS, CAS2, EAI and Other lineages (1 and 3) XDR MTB strains. Conclusion Genetic diversity in PE_PGRS genes contributes to antigenic variability and may result in increased immunogenicity of strains. This is the first study identifying variations in nsSNPs and INDELs in the PE_PGRS genes of XDR-TB strains from Pakistan. It highlights common genetic variations which may contribute to persistence.

  10. Gene-assisted selection: applications of association genetics for forest tree breeding

    Science.gov (United States)

    Philip L. Wilcox; Craig E. Echt; Rowland D. Burdon

    2007-01-01

    This chapter describes application of association genetics in forest tree species for the purposes of selection. We use the term gene-assisted selection (GAS) to denote application of marker-trait associations determined via association genetics, which we anticipate will be based on poly morph isms associated with expressed genes. The salient features of forest trees...

  11. Marker assisted introgression of opaque2 gene into herbicide ...

    African Journals Online (AJOL)

    opaque2 while 3% were non-opaque2. Both methods of conventional breeding using light table and marker assisted selection (MAS) were comparable. However, the application of SSR markers and the. FTA technology offers the breeder a fast, time saving, reliable and less labour intensive method of screening QPM maize ...

  12. A Noise Trimming and Positional Significance of Transposon Insertion System to Identify Essential Genes in Yersinia pestis

    Science.gov (United States)

    Yang, Zheng Rong; Bullifent, Helen L.; Moore, Karen; Paszkiewicz, Konrad; Saint, Richard J.; Southern, Stephanie J.; Champion, Olivia L.; Senior, Nicola J.; Sarkar-Tyson, Mitali; Oyston, Petra C. F.; Atkins, Timothy P.; Titball, Richard W.

    2017-02-01

    Massively parallel sequencing technology coupled with saturation mutagenesis has provided new and global insights into gene functions and roles. At a simplistic level, the frequency of mutations within genes can indicate the degree of essentiality. However, this approach neglects to take account of the positional significance of mutations - the function of a gene is less likely to be disrupted by a mutation close to the distal ends. Therefore, a systematic bioinformatics approach to improve the reliability of essential gene identification is desirable. We report here a parametric model which introduces a novel mutation feature together with a noise trimming approach to predict the biological significance of Tn5 mutations. We show improved performance of essential gene prediction in the bacterium Yersinia pestis, the causative agent of plague. This method would have broad applicability to other organisms and to the identification of genes which are essential for competitiveness or survival under a broad range of stresses.

  13. Murine leukemias with retroviral insertions at Lmo2 are predictive of the leukemias induced in SCID-X1 patients following retroviral gene therapy.

    Directory of Open Access Journals (Sweden)

    Utpal P Davé

    2009-05-01

    Full Text Available Five X-linked severe combined immunodeficiency patients (SCID-X1 successfully treated with autologous bone marrow stem cells infected ex vivo with an IL2RG-containing retrovirus subsequently developed T-cell leukemia and four contained insertional mutations at LMO2. Genetic evidence also suggests a role for IL2RG in tumor formation, although this remains controversial. Here, we show that the genes and signaling pathways deregulated in murine leukemias with retroviral insertions at Lmo2 are similar to those deregulated in human leukemias with high LMO2 expression and are highly predictive of the leukemias induced in SCID-X1 patients. We also provide additional evidence supporting the notion that IL2RG and LMO2 cooperate in leukemia induction but are not sufficient and require additional cooperating mutations. The highly concordant nature of the genetic events giving rise to mouse and human leukemias with mutations at Lmo2 are an encouraging sign to those wanting to use mice to model human cancer and may help in designing safer methods for retroviral gene therapy.

  14. Microarray Analysis of Transposon Insertion Mutants in Bacillus Anthracis: Global Identification of Genes Required for Sporulation and Germination

    Science.gov (United States)

    2007-02-01

    conditionally essential genes in mycobacteria . Proc. Natl. Acad. Sci. USA 98:12712–12717. 19. Sassetti, C. M., D. H. Boyd, and E. J. Rubin. 2003. Genes...Worsham, P. L., and M. R. Sowers. 1999. Isolation of an asporogenic (spoOA) protective antigen-producing strain of Bacillus anthracis. Can. J

  15. Unusual accelerated rate of deletions and insertions in toxin genes in the venom glands of the pygmy copperhead (Austrelaps labialis from kangaroo island

    Directory of Open Access Journals (Sweden)

    Kini R Manjunatha

    2008-02-01

    Full Text Available Abstract Background Toxin profiling helps in cataloguing the toxin present in the venom as well as in searching for novel toxins. The former helps in understanding potential pharmacological profile of the venom and evolution of toxins, while the latter contributes to understanding of novel mechanisms of toxicity and provide new research tools or prototypes of therapeutic agents. Results The pygmy copperhead (Austrelaps labialis is one of the less studied species. In this present study, an attempt has been made to describe the toxin profile of A. labialis from Kangaroo Island using the cDNA library of its venom glands. We sequenced 658 clones which represent the common families of toxin genes present in snake venom. They include (a putative long-chain and short-chain neurotoxins, (b phospholipase A2, (c Kunitz-type protease inhibitor, (d CRISPs, (e C-type lectins and (f Metalloproteases. In addition, we have also identified a novel protein with two Kunitz-type domains in tandem similar to bikunin. Conclusion Interestingly, the cDNA library reveals that most of the toxin families (17 out of 43 toxin genes; ~40% have truncated transcripts due to insertion or deletion of nucleotides. These truncated products might not be functionally active proteins. However, cellular trancripts from the same venom glands are not affected. This unusual higher rate of deletion and insertion of nucleotide in toxin genes may be responsible for the lower toxicity of A. labialis venom of Kangroo Island and have significant effect on evolution of toxin genes.

  16. CRISPR/Cas9-Mediated Insertion of loxP Sites in the Mouse Dock7 Gene Provides an Effective Alternative to Use of Targeted Embryonic Stem Cells

    Directory of Open Access Journals (Sweden)

    Kathleen A. Bishop

    2016-07-01

    Full Text Available Targeted gene mutation in the mouse is a primary strategy to understand gene function and relation to phenotype. The Knockout Mouse Project (KOMP had an initial goal to develop a public resource of mouse embryonic stem (ES cell clones that carry null mutations in all genes. Indeed, many useful novel mouse models have been generated from publically accessible targeted mouse ES cell lines. However, there are limitations, including incorrect targeting or cassette structure, and difficulties with germline transmission of the allele from chimeric mice. In our experience, using a small sample of targeted ES cell clones, we were successful ∼50% of the time in generating germline transmission of a correctly targeted allele. With the advent of CRISPR/Cas9 as a mouse genome modification tool, we assessed the efficiency of creating a conditional targeted allele in one gene, dedicator of cytokinesis 7 (Dock7, for which we were unsuccessful in generating a null allele using a KOMP targeted ES cell clone. The strategy was to insert loxP sites to flank either exons 3 and 4, or exons 3 through 7. By coinjecting Cas9 mRNA, validated sgRNAs, and oligonucleotide donors into fertilized eggs from C57BL/6J mice, we obtained a variety of alleles, including mice homozygous for the null alleles mediated by nonhomologous end joining, alleles with one of the two desired loxP sites, and correctly targeted alleles with both loxP sites. We also found frequent mutations in the inserted loxP sequence, which is partly attributable to the heterogeneity in the original oligonucleotide preparation.

  17. Characterization of the Staphylococcus aureus rRNA Methyltransferase Encoded by orfX, the Gene Containing the Staphylococcal Chromosome Cassette mec (SCCmec) Insertion Site*

    Science.gov (United States)

    Boundy, Sam; Safo, Martin K.; Wang, Lei; Musayev, Faik N.; O'Farrell, Heather C.; Rife, Jason P.; Archer, Gordon L.

    2013-01-01

    The gene orfX is conserved among all staphylococci, and its complete sequence is maintained upon insertion of the staphylococcal chromosome cassette mec (SCCmec) genomic island, containing the gene encoding resistance to β-lactam antibiotics (mecA), into its C terminus. The function of OrfX has not been determined. We show that OrfX was constitutively produced during growth, that orfX could be inactivated without altering bacterial growth, and that insertion of SCCmec did not alter gene expression. We solved the crystal structure of OrfX at 1.7 Å and found that it belongs to the S-adenosyl-l-methionine (AdoMet)-dependent α/β-knot superfamily of SPOUT methyltransferases (MTases), with a high structural homology to YbeA, the gene product of the Escherichia coli 70 S ribosomal MTase RlmH. MTase activity was confirmed by demonstrating the OrfX-dependent methylation of the Staphylococcus aureus 70 S ribosome. When OrfX was crystallized in the presence of its AdoMet substrate, we found that each monomer of the homodimeric structure bound AdoMet in its active site. Solution studies using isothermal titration calorimetry confirmed that each monomer bound AdoMet but with different binding affinities (Kd = 52 ± 0.4 and 606 ± 2 μm). In addition, the structure shows that the AdoMet-binding pocket, formed by a deep trefoil knot, contains a bound phosphate molecule, which is the likely nucleotide methylation site. This study represents the first characterization of a staphylococcal ribosomal MTase and provides the first crystal structure of a member of the α/β-knot superfamily of SPOUT MTases in the RlmH or COG1576 family with bound AdoMet. PMID:23150671

  18. A genetic mechanism for emergence of races in Fusarium oxysporum f. sp. lycopersici: inactivation of avirulence gene AVR1 by transposon insertion.

    Directory of Open Access Journals (Sweden)

    Keigo Inami

    Full Text Available Compatible/incompatible interactions between the tomato wilt fungus Fusarium oxysporum f. sp. lycopersici (FOL and tomato Solanum lycopersicum are controlled by three avirulence genes (AVR1-3 in FOL and the corresponding resistance genes (I-I3 in tomato. The three known races (1, 2 and 3 of FOL carry AVR genes in different combinations. The current model to explain the proposed order of mutations in AVR genes is: i FOL race 2 emerged from race 1 by losing the AVR1 and thus avoiding host resistance mediated by I (the resistance gene corresponding to AVR1, and ii race 3 emerged when race 2 sustained a point mutation in AVR2, allowing it to evade I2-mediated resistance of the host. Here, an alternative mechanism of mutation of AVR genes was determined by analyses of a race 3 isolate, KoChi-1, that we recovered from a Japanese tomato field in 2008. Although KoChi-1 is race 3, it has an AVR1 gene that is truncated by the transposon Hormin, which belongs to the hAT family. This provides evidence that mobile genetic elements may be one of the driving forces underlying race evolution. KoChi-1 transformants carrying a wild type AVR1 gene from race 1 lost pathogenicity to cultivars carrying I, showing that the truncated KoChi-1 avr1 is not functional. These results imply that KoChi-1 is a new race 3 biotype and propose an additional path for emergence of FOL races: Race 2 emerged from race 1 by transposon-insertion into AVR1, not by deletion of the AVR1 locus; then a point mutation in race 2 AVR2 resulted in emergence of race 3.

  19. Essential Genes for In Vitro Growth of the Endophyte Herbaspirillum seropedicae SmR1 as Revealed by Transposon Insertion Site Sequencing.

    Science.gov (United States)

    Rosconi, Federico; de Vries, Stefan P W; Baig, Abiyad; Fabiano, Elena; Grant, Andrew J

    2016-11-15

    The interior of plants contains microorganisms (referred to as endophytes) that are distinct from those present at the root surface or in the surrounding soil. Herbaspirillum seropedicae strain SmR1, belonging to the betaproteobacteria, is an endophyte that colonizes crops, including rice, maize, sugarcane, and sorghum. Different approaches have revealed genes and pathways regulated during the interactions of H. seropedicae with its plant hosts. However, functional genomic analysis of transposon (Tn) mutants has been hampered by the lack of genetic tools. Here we successfully employed a combination of in vivo high-density mariner Tn mutagenesis and targeted Tn insertion site sequencing (Tn-seq) in H. seropedicae SmR1. The analysis of multiple gene-saturating Tn libraries revealed that 395 genes are essential for the growth of H. seropedicae SmR1 in tryptone-yeast extract medium. A comparative analysis with the Database of Essential Genes (DEG) showed that 25 genes are uniquely essential in H. seropedicae SmR1. The Tn mutagenesis protocol developed and the gene-saturating Tn libraries generated will facilitate elucidation of the genetic mechanisms of the H. seropedicae endophytic lifestyle. A focal point in the study of endophytes is the development of effective biofertilizers that could help to reduce the input of agrochemicals in croplands. Besides the ability to promote plant growth, a good biofertilizer should be successful in colonizing its host and competing against the native microbiota. By using a systematic Tn-based gene-inactivation strategy and massively parallel sequencing of Tn insertion sites (Tn-seq), it is possible to study the fitness of thousands of Tn mutants in a single experiment. We have applied the combination of these techniques to the plant-growth-promoting endophyte Herbaspirillum seropedicae SmR1. The Tn mutant libraries generated will enable studies into the genetic mechanisms of H. seropedicae-plant interactions. The approach that we

  20. MECP2, a gene associated with Rett syndrome in humans, shows conserved coding regions, independent Alu insertions, and a novel transcript across primate evolution.

    Science.gov (United States)

    Viana, Maria Carolina; Menezes, Albert Nobre; Moreira, Miguel Angelo M; Pissinatti, Alcides; Seuánez, Héctor N

    2015-07-07

    The methyl-CpG Binding Protein two gene (MECP2) encodes a multifunctional protein comprising two isoforms involved in nuclear organization and regulation of splicing and mRNA template activity. This gene is normally expressed in all tissues, with a higher expression level in the brain during neuronal maturation. Loss of MECP2 function is the primary cause of Rett syndrome (RTT) in humans, a dominant, X-linked disorder dramatically affecting neural and motor development. We investigated the molecular evolution of MECP2 in several primate taxa including 36 species in 16 genera of neotropical (platyrrhine) primates. The coding region of the MECP2_e2 isoform showed a high level of evolutionary conservation among humans and other primates, with amino acid substitutions in 14 codons and one in-frame insertion of a single serine codon, between codons 357 and 358, in Ateles paniscus. Most substitutions occurred in noncritical regions of MECP2 and the majority of the algorithms used for analyzing selection did not provide evidence of positive selection. Conversely, we found 48 sites under negative selection in different regions, 23 of which were consistently found by three different algorithms. Similar to an inverted Alu insert found previously in a lesser ape at a parallel location, one Alu insertion of approximately 300 bp in Cebus and Sapajus was found in intron 3. Phylogenetic reconstruction of the intron 3 data provided a topology that was coincident with the consensus arrangement of the primate taxa. RNAseq data in the neotropical primate Callimico goeldii revealed a novel transcript consisting of a noncontinuous region of the human-homologous intron 2 in this species; this transcript accounted for two putative polypeptides. Despite the remarkable evolutionary conservation of MECP2, one in-frame codon insertion was observed in A. paniscus, and one region of intron 3 was affected by a trans-specific Alu retrotransposition in two neotropical primate genera. Moreover

  1. Effect of polystyrene and polyether imide cell culture inserts with different roughness on chondrocyte metabolic activity and gene expression profiles of aggrecan and collagen.

    Science.gov (United States)

    König, Josephine; Kohl, Benjamin; Kratz, Karl; Jung, Friedrich; Lendlein, Andreas; Ertel, Wolfgang; Schulze-Tanzil, Gundula

    2013-01-01

    In vitro cultured autologous chondrocytes can be used for implantation to support cartilage repair. For this purpose, a very small number of autologous cells harvested from a biopsy have to be expanded in monolayer culture. Commercially available polymer surfaces lead to chondrocyte dedifferentiation. Hence, the demanding need for optimized polymers and surface topologies supporting chondrocytes' differentiated phenotypes in vitro arises. In this study we explored the effect of tailored cell culture plate inserts prepared from polystyrene (PS) and polyether imide (PEI) exhibiting three different roughness levels (R0, RI, RII) on chondrocyte morphology, metabolism and gene expression profile. As a control, commercially available tissue culture plastic (TCP) dishes were included. Primary porcine articular chondrocytes were seeded on tailored PS and PEI inserts with three different roughness levels. The metabolic activity of the chondrocytes was determined after 24 hours using alamar blue assay. Chondrocyte gene expression profiles (aggrecan, type I and type II collagen) were monitored after 48 hours using Real Time Detection (RTD)-PCR. Chondrocytes cultured on PS and PEI surfaces formed cell clusters after 24 and 48 hours, which was not observed on TCP. The metabolic activity of chondrocytes cultured on PS was lower than of chondrocytes cultured on PEI, but also lower than on TCP. Gene expression analyses revealed an elevated expression of cartilage-specific aggrecan and an impaired expression of both collagen types by chondrocytes on PS and PEI compared with TCP. In summary, PEI is a biocompatible biomaterial suitable for chondrocyte culturing, which can be further chemically functionalized for generating specific surface interactions or covalent binding of biomolecules.

  2. Association of insertion/deletion polymorphism of angiotensin-converting enzyme gene among Malay male hypertensive subjects in response to ACE inhibitors.

    Science.gov (United States)

    Heidari, Farzad; Vasudevan, Ramachandran; Mohd Ali, Siti Zubaidah; Ismail, Patimah; Etemad, Ali; Pishva, Seyyed Reza; Othman, Fauziah; Abu Bakar, Suhaili

    2015-12-01

    Several studies show that the insertion/deletion (I/D) polymorphism of the angiotensin-converting enzyme (ACE) gene has been associated with hypertension in various populations. The present study sought to determine the association of the I/D gene polymorphism among Malay male essential hypertensive subjects in response to ACE inhibitors (enalapril and lisinopril). A total of 72 patients with newly diagnosed hypertension and 72 healthy subjects were recruited in this study. Blood pressure was recorded from 0 to 24 weeks of treatment with enalapril or lisinopril. Genotyping of the I/D polymorphism was carried out using a standard PCR method. Statistically significant association of the D allele of the ACE gene was observed between the case and control subjects (p ACE gene. Patients carrying the DD genotype had higher blood pressure-lowering response when treated with ACE inhibitors enalapril or lisinopril than those carrying ID and II genotypes, suggesting that the D allele may be a possible genetic marker for essential hypertension among Malay male subjects. © The Author(s) 2014.

  3. Influence of insertion protocol and implant shoulder design on inflammatory infiltration and gene expression in peri-implant soft tissue during nonsubmerged dental implant healing.

    Science.gov (United States)

    Mueller, Cornelia Katharina; Thorwarth, Michael; Schultze-Mosgau, Stefan

    2010-05-01

    This study aimed at elucidating the influence of insertion protocol and implant shoulder design on peri-implant soft tissue healing. One month after removal of all maxillary premolars in 12 minipigs, 4 implants were installed in each quadrant. According to implant shoulder design, 3 groups were established: 1) rough, 0.4 mm; 2) smooth, 3 mm; and 3) smooth, 0.4 mm. One quadrant was randomized to flapless insertion, and the other was used for flap surgery in each animal. Mucosa biopsies were retrieved 1, 2, 4, and 12 weeks after surgery and subjected to a leukocyte count as well as pangenomic gene expression analysis. Flapless surgery shortened the period of postsurgical inflammation as shown by the leukocyte count and induced early constructive remodeling as indicated by the microarray. Regarding design of the implant shoulder, leukocyte count values were lowest for group 3. Flapless surgery in combination with group 3 implants appears to enhance peri-implant soft tissue healing. Copyright (c) 2010 Mosby, Inc. All rights reserved.

  4. Insertion of an SVA-E retrotransposon into the CASP8 gene is associated with protection against prostate cancer

    NARCIS (Netherlands)

    Stacey, S.N.; Kehr, B.; Gudmundsson, J.; Zink, F.; Jonasdottir, A.; Gudjonsson, S.A.; Sigurdsson, A.; Halldorsson, B.V.; Agnarsson, B.A.; Benediktsdottir, K.R.; Aben, K.K.; Vermeulen, S.H.; Cremers, R.G.; Panadero, A.; Helfand, B.T.; Cooper, P.R.; Donovan, J.L.; Hamdy, F.C.; Jinga, V.; Okamoto, I.; Jonasson, J.G.; Tryggvadottir, L.; Johannsdottir, H.; Kristinsdottir, A.M.; Masson, G.; Magnusson, O.T.; Iordache, P.D.; Helgason, A.; Helgason, H.; Sulem, P.; Gudbjartsson, D.F.; Kong, A.; Jonsson, E.; Barkardottir, R.B.; Einarsson, G.V.; Rafnar, T.; Thorsteinsdottir, U.; Mates, I.N.; Neal, D.E.; Catalona, W.J.; Mayordomo, J.I.; Kiemeney, L.A.; Thorleifsson, G.; Stefansson, K.

    2016-01-01

    Transcriptional and splicing anomalies have been observed in intron 8 of the CASP8 gene (encoding procaspase-8) in association with cutaneous basal-cell carcinoma (BCC) and linked to a germline SNP rs700635. Here, we show that the rs700635[C] allele, which is associated with increased risk of BCC

  5. Treacher Collins syndrome may result from insertions, deletions or splicing mutations, which introduce a termination codon into the gene

    NARCIS (Netherlands)

    Gladwin, A. J.; Dixon, J.; Loftus, S. K.; Edwards, S.; Wasmuth, J. J.; Hennekam, R. C.; Dixon, M. J.

    1996-01-01

    Treacher Collins syndrome is an autosomal dominant disorder of craniofacial development the features of which include conductive hearing loss and cleft palate. Recently, the Treacher Collins syndrome gene (TCOF1) has been positionally cloned and a series of five mutations within the coding sequence

  6. A large insertion in intron 2 of the TYRP1 gene associated with American Palomino phenotype in American mink

    DEFF Research Database (Denmark)

    Cirera Salicio, Susanna; Markakis, Marios Nektarios; Kristiansen, Thea

    2016-01-01

    A number of American mink phenotypes display a range of brownish colours. One of these phenotypes, namely American Palomino (b (P) b (P) ) (AP) has been found to be associated with the tyrosinase-related protein 1 (TYRP1) gene by genotyping microsatellite markers in one sire family. Trials...

  7. A transposable element insertion in the susceptibility gene CsaMLO8 results in hypocotyl resistance to powdery mildew in cucumber.

    Science.gov (United States)

    Berg, Jeroen A; Appiano, Michela; Santillán Martínez, Miguel; Hermans, Freddy W K; Vriezen, Wim H; Visser, Richard G F; Bai, Yuling; Schouten, Henk J

    2015-10-09

    Powdery mildew (PM) is an important disease of cucumber (Cucumis sativus L.). CsaMLO8 was previously identified as a candidate susceptibility gene for PM in cucumber, for two reasons: 1) This gene clusters phylogenetically in clade V, which has previously been shown to harbour all known MLO-like susceptibility genes for PM identified in dicot species; 2) This gene co-localizes with a QTL on chromosome 5 for hypocotyl-specific resistance to PM. CsaMLO8 alleles from susceptible and resistant cucumber were cloned and transformed to mlo-mutant tomato. Cucumber seedlings were inoculated with Podosphaera xanthii, tissues were studied for CsaMLO8 expression at several timepoints post inoculation using qRT-PCR. The occurrence of the observed loss-of-function allele of CsaMLO8 in resequenced cucumber accessions was studied in silico. We cloned CsaMLO8 alleles from susceptible and resistant cucumber genotypes, the latter carrying the QTL for hypocotyl resistance. We found that insertion of a non-autonomous Class LTR retrotransposable element in the resistant genotype leads to aberrant splicing of CsaMLO8 mRNA. Heterologous expression of the wild-type allele of CsaMLO8 in a tomato mlo-mutant restored PM susceptibility. However, heterologous expression of the CsaMLO8 allele cloned from the resistant cucumber genotype failed to restore PM susceptibility. Furthermore we showed that inoculation of susceptible cucumber with the PM pathogen Podosphaera xanthii induced transcriptional upregulation of CsaMLO8 in hypocotyl tissue, but not in cotyledon or leaf tissue. This coincides with the observation that the QTL at the CsaMLO8-locus causes full resistance in hypocotyl tissue, but only partial resistance in cotyledons and true leafs. We studied the occurrence of the loss-of-function allele of CsaMLO8 in cucumber germplasm by an in silico approach using resequencing data of a collection of 115 cucumber accessions, and found that this allele was present in 31 out of 115 accessions

  8. The insertion and deletion (I28005D) polymorphism of the angiotensin I converting enzyme gene is a risk factor for osteoarthritis in an Asian Indian population.

    Science.gov (United States)

    Poornima, Subhadra; Subramanyam, Krishna; Khan, Imran Ali; Hasan, Qurratulain

    2015-12-01

    Angiotensin I converting enzyme (ACE) insertion and deletion (I/D) polymorphism has been implicated in the pathogenesis of osteoarthritis (OA). In recent years, numerous genetic factors have been identified and implicated in OA. In this Asian Indian population-based study, we aimed to evaluate the relationship between ACE (I28005D) gene polymorphism and primary OA. We performed a case-control association study to identify and explore the correlation between clinically, radiologically diagnosed individuals with primary knee OA and the ACE I/D polymorphism. Genomic DNA was isolated from 200 samples, including 100 OA cases and 100 healthy volunteers. DNA was amplified by polymerase chain reaction (PCR) using I and D allele-specific primers. PCR products were assessed via UV visualization of products electrophoresed on 2% agarose gels. The groups differed significantly in genotype distributions (p risk factor for early onset primary knee OA. © The Author(s) 2014.

  9. Identification of an extensive gene cluster among a family of PPOs in Trifolium pratense L. (red clover using a large insert BAC library

    Directory of Open Access Journals (Sweden)

    Thomas Ann

    2009-07-01

    Full Text Available Abstract Background Polyphenol oxidase (PPO activity in plants is a trait with potential economic, agricultural and environmental impact. In relation to the food industry, PPO-induced browning causes unacceptable discolouration in fruit and vegetables: from an agriculture perspective, PPO can protect plants against pathogens and environmental stress, improve ruminant growth by increasing nitrogen absorption and decreasing nitrogen loss to the environment through the animal's urine. The high PPO legume, red clover, has a significant economic and environmental role in sustaining low-input organic and conventional farms. Molecular markers for a range of important agricultural traits are being developed for red clover and improved knowledge of PPO genes and their structure will facilitate molecular breeding. Results A bacterial artificial chromosome (BAC library comprising 26,016 BAC clones with an average 135 Kb insert size, was constructed from Trifolium pratense L. (red clover, a diploid legume with a haploid genome size of 440–637 Mb. Library coverage of 6–8 genome equivalents ensured good representation of genes: the library was screened for polyphenol oxidase (PPO genes. Two single copy PPO genes, PPO4 and PPO5, were identified to add to a family of three, previously reported, paralogous genes (PPO1–PPO3. Multiple PPO1 copies were identified and characterised revealing a subfamily comprising three variants PPO1/2, PPO1/4 and PPO1/5. Six PPO genes clustered within the genome: four separate BAC clones could be assembled onto a predicted 190–510 Kb single BAC contig. Conclusion A PPO gene family in red clover resides as a cluster of at least 6 genes. Three of these genes have high homology, suggesting a more recent evolutionary event. This PPO cluster covers a longer region of the genome than clusters detected in rice or previously reported in tomato. Full-length coding sequences from PPO4, PPO5, PPO1/5 and PPO1/4 will facilitate

  10. The relationship between angiotensin-converting enzyme gene insertion/deletion polymorphism and digestive cancer risk: Insights from a meta-analysis.

    Science.gov (United States)

    Yang, Hualing; Cai, Chengfu; Ye, Linyang; Rao, Yiqing; Wang, Qingxiang; Hu, Dan; Huang, Xi

    2015-12-01

    The gene encoding angiotensin-converting enzyme (ACE) has been implicated in the development of several malignancies. We aimed to meta-analyze the association of ACE gene insertion/deletion (I/D) polymorphism with digestive cancer risk and seek possible sources of between-study heterogeneity. Two authors independently assessed eligibility of each retrieved publication and gathered relevant data. Risk estimates were expressed as odds ratio (OR) and 95% confidence interval (CI). Sixteen publications were qualified for analysis, involving 2903 digestive cancer cases and 10,833 controls. Overall analyses failed to show any significance for digestive cancer risk. There was moderate heterogeneity and lower publication bias for overall comparisons. In subgroup analyses, ACE gene II genotype was associated with a 15% reduced risk (OR=0.85, 95% CI: 0.57-1.27, p=0.434) for gastric cancer, but a 16% increased risk (OR=1.16, 95% CI: 0.89-1.52, p=0.273) for colorectal cancer. By source of controls, the I allele appeared to be a protective factor against digestive cancer in population-based studies (OR=0.87, 95% CI: 0.75-1.00, p=0.055) but a risk-conferring factor in hospital-based studies (OR=1.17, 95% CI: 1.01-1.35, p=0.033). Our findings suggested that ACE gene I allele might be a protective factor against gastric cancer, necessitating further confirmation in large, population-based studies. © The Author(s) 2015.

  11. Insertion of an esterase gene into a specific locust pathogen (Metarhizium acridum enables it to infect caterpillars.

    Directory of Open Access Journals (Sweden)

    Sibao Wang

    2011-06-01

    Full Text Available An enduring theme in pathogenic microbiology is poor understanding of the mechanisms of host specificity. Metarhizium is a cosmopolitan genus of invertebrate pathogens that contains generalist species with broad host ranges such as M. robertsii (formerly known as M. anisopliae var. anisopliae as well as specialists such as the acridid-specific grasshopper pathogen M. acridum. During growth on caterpillar (Manduca sexta cuticle, M. robertsii up-regulates a gene (Mest1 that is absent in M. acridum and most other fungi. Disrupting M. robertsii Mest1 reduced virulence and overexpression increased virulence to caterpillars (Galleria mellonella and M. sexta, while virulence to grasshoppers (Melanoplus femurrubrum was unaffected. When Mest1 was transferred to M. acridum under control of its native M. robertsii promoter, the transformants killed and colonized caterpillars in a similar fashion to M. robertsii. MEST1 localized exclusively to lipid droplets in M. robertsii conidia and infection structures was up-regulated during nutrient deprivation and had esterase activity against lipids with short chain fatty acids. The mobilization of stored lipids was delayed in the Mest1 disruptant mutant. Overall, our results suggest that expression of Mest1 allows rapid hydrolysis of stored lipids, and promotes germination and infection structure formation by M. robertsii during nutrient deprivation and invasion, while Mest1 expression in M. acridum broadens its host range by bypassing the regulatory signals found on natural hosts that trigger the mobilization of endogenous nutrient reserves. This study suggests that speciation in an insect pathogen could potentially be driven by host shifts resulting from changes in a single gene.

  12. Nucleotide diversity of the ZmPox3 maize peroxidase gene: Relationships between a MITE insertion in exon 2 and variation in forage maize digestibility

    Directory of Open Access Journals (Sweden)

    Rigau Joan

    2004-07-01

    Full Text Available Abstract Background Polymorphisms were investigated within the ZmPox3 maize peroxidase gene, possibly involved in lignin biosynthesis because of its colocalization with a cluster of QTL related to lignin content and cell wall digestibility. The purpose of this study was to identify, on the basis of 37 maize lines chosen for their varying degrees of cell wall digestibility and representative of temperate regions germplasm, ZmPox3 haplotypes or individual polymorphisms possibly associated with digestibility. Results Numerous haplotypes with high diversity were identified. Frequency of nucleotide changes was high with on average one SNP every 57 bp. Nucleotide diversity was not equally distributed among site categories: the estimated π was on average eight times higher for silent sites than for non-synonymous sites. Numerous sites were in linkage disequilibrium that decayed with increasing physical distance. A zmPox3 mutant allele, carrying an insertion of a transposable element in the second exon, was found in lines derived from the early flint inbred line, F7. This element possesses many structural features of miniature inverted-repeat transposable elements (MITE. The mutant allele encodes a truncated protein lacking important functional sites. An ANOVA performed with a subset of 31 maize lines indicated that the transposable element was significantly associated with cell wall digestibility. This association was confirmed using an additional set of 25 flint lines related to F7. Moreover, RT-PCR experiments revealed a decreased amount of corresponding mRNA in plants with the MITE insertion. Conclusion These results showed that ZmPox3 could possibly be involved in monolignol polymerisation, and that a deficiency in ZmPox3 peroxidase activity seemingly has a negative effect on cell wall digestibility. Also, genetic diversity analyses of ZmPox3 indicated that this peroxidase could be a relevant target for grass digestibility improvement using

  13. Spontaneous asj-2J mutant mouse as a model for generalized arterial calcification of infancy: a large deletion/insertion mutation in the Enpp1 gene.

    Directory of Open Access Journals (Sweden)

    Qiaoli Li

    Full Text Available Generalized arterial calcification of infancy (GACI, an autosomal recessive disorder caused by mutations in the ENPP1 gene, manifests with extensive mineralization of the cardiovascular system. The affected individuals in most cases die within the first year of life, and there is currently no effective treatment for this disorder. In this study, we characterized a spontaneous mutant mouse, asj-2J, as a model for GACI. These mice were identified as part of a phenotypic deviant search in a large-scale production colony of BALB/cJ mice at The Jackson Laboratory. They demonstrated a characteristic gait due to stiffening of the joints, with phenotypic similarity to a previously characterized asj ("ages with stiffened joints" mouse, caused by a missense mutation in the Enpp1 gene. Complementation testing indicated that asj-2J and asj were allelic. PCR-based mutation detection strategy revealed in asj-2J mice a large, 40,035 bp, deletion spanning from intron 1 to the 3'-untranslated region of the Enpp1 gene, coupled with a 74 bp insertion. This was accompanied with a significant reduction in the plasma PPi concentration and reduced PPi/Pi ratio. As a consequence, extensive aberrant mineralization affecting the arterial vasculature, a number of internal organs, and the dermal sheath of vibrissae, a progressive biomarker of the ectopic mineralization process, was demonstrated by a combination of micro computed tomography, histopathology with calcium-specific stains, and direct chemical assay of calcium. Comparison of the asj and asj-2J mice demonstrated that the latter ones, particularly when placed on an acceleration diet high in phosphate and low in magnesium, had more extensive mineralization. Thus, the asj-2J mouse serves as a novel model for GACI, a currently intractable disorder.

  14. Disruption of bbe02 by Insertion of a Luciferase Gene Increases Transformation Efficiency of Borrelia burgdorferi and Allows Live Imaging in Lyme Disease Susceptible C3H Mice.

    Directory of Open Access Journals (Sweden)

    Kamfai Chan

    Full Text Available Lyme disease is the most prevalent tick-borne disease in North America and Europe. The causative agent, Borrelia burgdorferi persists in the white-footed mouse. Infection with B. burgdorferi can cause acute to persistent multisystemic Lyme disease in humans. Some disease manifestations are also exhibited in the mouse model of Lyme disease. Genetic manipulation of B. burgdorferi remains difficult. First, B. burgdorferi contains a large number of endogenous plasmids with unique sequences encoding unknown functions. The presence of these plasmids needs to be confirmed after each genetic manipulation. Second, the restriction modification defense systems, including that encoded by bbe02 gene lead to low transformation efficiency in B. burgdorferi. Therefore, studying the molecular basis of Lyme pathogenesis is a challenge. Furthermore, investigation of the role of a specific B. burgdorferi protein throughout infection requires a large number of mice, making it labor intensive and expensive. To overcome the problems associated with low transformation efficiency and to reduce the number of mice needed for experiments, we disrupted the bbe02 gene of a highly infectious and pathogenic B. burgdorferi strain, N40 D10/E9 through insertion of a firefly luciferase gene. The bbe02 mutant shows higher transformation efficiency and maintains luciferase activity throughout infection as detected by live imaging of mice. Infectivity and pathogenesis of this mutant were comparable to the wild-type N40 strain. This mutant will serve as an ideal parental strain to examine the roles of various B. burgdorferi proteins in Lyme pathogenesis in the mouse model in the future.

  15. Prevalence of angiotensin converting enzyme (ACE gene insertion/deletion polymorphism in South Indian population with hypertension and chronic kidney disease

    Directory of Open Access Journals (Sweden)

    R Shanmuganathan

    2015-01-01

    Full Text Available Context: Chronic Kidney Disease (CKD is associated with a high risk of developing further severe complications such as, cardiovascular disease and eventually End Stage Renal Disease (ESRD leading to death. Hypertension plays a key role in the progression of renal failure and is also a chief risk factor for the occurrence of End Stage Renal Disease (ESRD. Aim: This study investigates the possible association of insertion (I and deletion (D polymorphism of ACE gene in patients of Chronic Kidney Disease (CKD with and without hypertension (HT. Settings and Design: Total 120 participants with 30 members in each group (Control, HT, CKD and CKD-HT were chosen followed by informed consent. Materials and Methods: Blood samples were collected and subjected to biochemical analyses and nested PCR amplification was performed to genotype the DNA, for ACE I/D using specific primers. Statistical Analysis: Statistical analyses were performed using SPSS version 13. Allele and genotypic frequency was calculated by direct gene counting method. Comparison of the different genotypes was done by using Chi square test. Odd′s ratios were calculated with a 95% confidence interval limit. Results: The ACE genotype were distributed as II, 27 (90%; DD, 2 (6.67% and ID, 1 (3.33% in control, II, 1 (3.33%; DD, 5 (16.67% and ID, 24 (80% in HT, II, 4 (13.33%; DD, 24 (80% and ID, 2 (6.67% in CKD and II, 0 (0%; DD, 2 (6.67% and ID, 28 (93.33% in CKD-HT group. Conclusions: D allele of ACE gene confers a greater role in genetic variations underlying CKD and hypertension. This result suggest that CKD patients should be offered analysis for defects in ACE I/D polymorphisms, especially if they are hypertensive.

  16. Two Y genes can replace the entire Y chromosome for assisted reproduction in the mouse.

    Science.gov (United States)

    Yamauchi, Yasuhiro; Riel, Jonathan M; Stoytcheva, Zoia; Ward, Monika A

    2014-01-03

    The Y chromosome is thought to be important for male reproduction. We have previously shown that, with the use of assisted reproduction, live offspring can be obtained from mice lacking the entire Y chromosome long arm. Here, we demonstrate that live mouse progeny can also be generated by using germ cells from males with the Y chromosome contribution limited to only two genes, the testis determinant factor Sry and the spermatogonial proliferation factor Eif2s3y. Sry is believed to function primarily in sex determination during fetal life. Eif2s3y may be the only Y chromosome gene required to drive mouse spermatogenesis, allowing formation of haploid germ cells that are functional in assisted reproduction. Our findings are relevant, but not directly translatable, to human male infertility cases.

  17. A simple Gateway-assisted construction system of TALEN genes for plant genome editing.

    Science.gov (United States)

    Kusano, Hiroaki; Onodera, Hitomi; Kihira, Miho; Aoki, Hiromi; Matsuzaki, Hikaru; Shimada, Hiroaki

    2016-07-25

    TALEN is an artificial nuclease being applied for sequence-specific genome editing. For the plant genome editing, a pair of TALEN genes is expressed in the cells, and a binary plasmid for Agrobacterium-mediated transformation should be assembled. We developed a novel procedure using the Gateway-assisted plasmids, named Emerald-Gateway TALEN system. We constructed entry vectors, pPlat plasmids, for construction of a desired TALEN gene using Platinum Gate TALEN kit. We also created destination plasmid, pDual35SGw1301, which allowed two TALEN genes to both DNA strands to recruit using Gateway technology. Resultant TALEN genes were evaluated by the single-strand annealing (SSA) assay in E. coli cells. By this assay, the TALENs recognized the corresponding targets in the divided luciferase gene, and induced a specific recombination to generate an active luciferase gene. Using the TALEN genes constructed, we created a transformant potato cells in which a site-specific mutation occurred at the target site of the GBSS gene. This suggested that our system worked effectively and was applicable as a convenient tool for the plant genome editing.

  18. Identification of the novel lincosamide resistance gene lnu(E) truncated by ISEnfa5-cfr-ISEnfa5 insertion in Streptococcus suis: de novo synthesis and confirmation of functional activity in Staphylococcus aureus.

    Science.gov (United States)

    Zhao, Qin; Wendlandt, Sarah; Li, Hui; Li, Jun; Wu, Congming; Shen, Jianzhong; Schwarz, Stefan; Wang, Yang

    2014-01-01

    The novel lincosamide resistance gene lnu(E), truncated by insertion of an ISEnfa5-cfr-ISEnfa5 segment, was identified in Streptococcus suis. The gene lnu(E) encodes a 173-amino-acid protein with ≤69.4% identity to other lincosamide nucleotidyltransferases. The lnu(E) gene and its promoter region were de novo synthesized, and Staphylococcus aureus RN4220 carrying a shuttle vector with the cloned lnu(E) gene showed a 16-fold increase in the lincomycin MIC. Mass spectrometry experiments demonstrated that Lnu(E) catalyzed the nucleotidylation of lincomycin.

  19. Association between insertion/deletion polymorphism in angiotensin-converting enzyme gene and acute lung injury/acute respiratory distress syndrome: a meta-analysis

    Directory of Open Access Journals (Sweden)

    Matsuda Akihisa

    2012-08-01

    Full Text Available Abstract Background A previous meta-analysis reported a positive association between an insertion/deletion (I/D polymorphism in the angiotensin-converting enzyme gene (ACE and the risk of acute lung injury (ALI/acute respiratory distress syndrome (ARDS. Here, we updated this meta-analysis and additionally assessed the association of this polymorphism with ALI/ARDS mortality. Methods We searched electronic databases through October 2011 for the terms “angiotensin-converting enzyme gene”, “acute lung injury”, and “acute respiratory distress syndrome,” and reviewed all studies that reported the relationship of the I/D polymorphism in ACE with ALI/ARDS in humans. Seven studies met the inclusion criteria, comprising 532 ALI/ARDS patients, 3032 healthy controls, and 1432 patients without ALI/ARDS. We used three genetic models: the allele, dominant, and recessive models. Results The ACE I/D polymorphism was not associated with susceptibility to ALI/ARDS for any genetic model. However, the ACE I/D polymorphism was associated with the mortality risk of ALI/ARDS in Asian subjects ( Pallele Pdominant = 0.001, Precessive = 0.002. This finding remained significant after correction for multiple comparisons. Conclusions There is a possible association between the ACE I/D polymorphism genotype and the mortality risk of ALI/ARDS in Asians.

  20. Quantitative assessment of the association between the angiotensin-converting enzyme gene insertion/deletion polymorphism and digestive system cancer risk.

    Science.gov (United States)

    Wang, J; Yang, S; Guo, F H; Mao, X; Zhou, H; Dong, Y Q; Wang, Z M; Luo, F

    2015-11-13

    The angiotensin-converting enzyme (ACE) gene insertion/deletion (I/D) polymorphism has been reported to be associated with digestive system cancer; however, the results from previous studies have been conflicting. The present study aimed to investigate the association between the ACE I/D polymorphism and the risk of digestive system cancer using a meta-analysis of previously published studies. Databases were systematically searched to identify relevant studies published prior to December 2014. We estimated the pooled OR with its 95%CI to assess the association. The meta-analysis consisted of thirteen case-control studies that included 2557 patients and 4356 healthy controls. Meta-analysis results based on all the studies showed no significant association between the ACE I/D polymorphism and the risk of digestive system cancer (DD vs II: OR = 0.85, 95%CI = 0.59-1.24; DI vs II: OR = 0.94, 95%CI = 0.78-1.15; dominant model: OR = 0.96, 95%CI = 0.81- 1.15; recessive model: OR = 1.06, 95%CI = 0.76-1.48). Subgroup analyses by race and cancer type did not detect an association between the ACE I/D polymorphism and digestive system cancer risk. However, when the analyses were restricted to smaller studies (N digestive system cancer. Further large and well-designed studies are needed to confirm these conclusions.

  1. A retrotransposon insertion in the 5' regulatory domain of Ptf1a results in ectopic gene expression and multiple congenital defects in Danforth's short tail mouse.

    Directory of Open Access Journals (Sweden)

    Francesca Lugani

    Full Text Available Danforth's short tail mutant (Sd mouse, first described in 1930, is a classic spontaneous mutant exhibiting defects of the axial skeleton, hindgut, and urogenital system. We used meiotic mapping in 1,497 segregants to localize the mutation to a 42.8-kb intergenic segment on chromosome 2. Resequencing of this region identified an 8.5-kb early retrotransposon (ETn insertion within the highly conserved regulatory sequences upstream of Pancreas Specific Transcription Factor, 1a (Ptf1a. This mutation resulted in up to tenfold increased expression of Ptf1a as compared to wild-type embryos at E9.5 but no detectable changes in the expression levels of other neighboring genes. At E9.5, Sd mutants exhibit ectopic Ptf1a expression in embryonic progenitors of every organ that will manifest a developmental defect: the notochord, the hindgut, and the mesonephric ducts. Moreover, at E 8.5, Sd mutant mice exhibit ectopic Ptf1a expression in the lateral plate mesoderm, tail bud mesenchyme, and in the notochord, preceding the onset of visible defects such as notochord degeneration. The Sd heterozygote phenotype was not ameliorated by Ptf1a haploinsufficiency, further suggesting that the developmental defects result from ectopic expression of Ptf1a. These data identify disruption of the spatio-temporal pattern of Ptf1a expression as the unifying mechanism underlying the multiple congenital defects in Danforth's short tail mouse. This striking example of an enhancer mutation resulting in profound developmental defects suggests that disruption of conserved regulatory elements may also contribute to human malformation syndromes.

  2. Associations of ACE Gene Insertion/Deletion Polymorphism, ACE Activity, and ACE mRNA Expression with Hypertension in a Chinese Population

    Science.gov (United States)

    He, Qingfang; Fan, Chunhong; Yu, Min; Wallar, Gina; Zhang, Zuo-Feng; Wang, Lixin; Zhang, Xinwei; Hu, Ruying

    2013-01-01

    Background The present study was designed to explore the association of angiotensin converting enzyme (ACE) gene insertion/deletion (I/D, rs4646994) polymorphism, plasma ACE activity, and circulating ACE mRNA expression with essential hypertension (EH) in a Chinese population. In addition, a new detection method for circulating ACE mRNA expression was explored. Methods The research was approved by the ethics committee of Zhejiang Provincial Center for Disease Prevention and Control. Written informed consent was obtained prior to the investigation. 221 hypertensives (cases) and 221 normotensives (controls) were interviewed, subjected to a physical examination, and provided blood for biochemical and genetic tests. The ACE mRNA expression was analyzed by real time fluorescent quantitative Reverse Transcription PCR (FQ-RT-PCR). We performed logistic regression to assess associations of ACE I/D genotypes, ACE activity, and ACE mRNA expression levels with hypertension. Results The results of the multivariate logistic regression analysis showed that the additive model (ID, DD versus II) of the ACE genotype revealed an association with hypertension with adjusted OR of 1.43(95% CI: 1.04-1.97), and ACE ID genotype with adjusted OR of 1.72(95% CI: 1.01-2.92), DD genotype with adjusted OR of 1.94(95% CI: 1.01-3.73), respectively. In addition, our data also indicate that plasma ACE activity (adjusted OR was 1.13(95% CI: 1.08-1.18)) was significantly related to hypertension. However, the plasma ACE mRNA expressions were not different between the cases and controls. Conclusion ACE I/D polymorphism and ACE activity revealed significant influence on hypertension, while circulating ACE mRNA expression was not important factors associated with hypertension in this Chinese population. The detection of circulating ACE mRNA expression by FQ-RT-PCR might be a useful method for early screening and monitoring of EH. PMID:24098401

  3. Characterization of three active transposable elements recently inserted in three independent DFR-A alleles and one high-copy DNA transposon isolated from the Pink allele of the ANS gene in onion (Allium cepa L.).

    Science.gov (United States)

    Kim, Sunggil; Park, Jee Young; Yang, Tae-Jin

    2015-06-01

    Intact retrotransposon and DNA transposons inserted in a single gene were characterized in onions (Allium cepa) and their transcription and copy numbers were estimated in this study. While analyzing diverse onion germplasm, large insertions in the DFR-A gene encoding dihydroflavonol 4-reductase (DFR) involved in the anthocyanin biosynthesis pathway were found in two accessions. A 5,070-bp long terminal repeat (LTR) retrotransposon inserted in the active DFR-A (R4) allele was identified from one of the large insertions and designated AcCOPIA1. An intact ORF encoded typical domains of copia-like LTR retrotransposons. However, AcCOPIA1 contained atypical 'TG' and 'TA' dinucleotides at the ends of the LTRs. A 4,615-bp DNA transposon was identified in the other large insertion. This DNA transposon, designated AcCACTA1, contained an ORF coding for a transposase showing homology with the CACTA superfamily transposable elements (TEs). Another 5,073-bp DNA transposon was identified from the DFR-A (TRN) allele. This DNA transposon, designated AchAT1, belonged to the hAT superfamily with short 4-bp terminal inverted repeats (TIRs). Finally, a 6,258-bp non-autonomous DNA transposon, designated AcPINK, was identified in the ANS-p allele encoding anthocyanidin synthase, the next downstream enzyme to DFR in the anthocyanin biosynthesis pathway. AcPINK also possessed very short 3-bp TIRs. Active transcription of AcCOPIA1, AcCACTA1, and AchAT1 was observed through RNA-Seq analysis and RT-PCR. The copy numbers of AcPINK estimated by mapping the genomic DNA reads produced by NextSeq 500 were predominantly high compared with the other TEs. A series of evidence indicated that these TEs might have transposed in these onion genes very recently, providing a stepping stone for elucidation of enormously large-sized onion genome structure.

  4. Macrophage-Specific in Vivo Gene Editing Using Cationic Lipid-Assisted Polymeric Nanoparticles.

    Science.gov (United States)

    Luo, Ying-Li; Xu, Cong-Fei; Li, Hong-Jun; Cao, Zhi-Ting; Liu, Jing; Wang, Ji-Long; Du, Xiao-Jiao; Yang, Xian-Zhu; Gu, Zhen; Wang, Jun

    2018-01-09

    The CRISPR/Cas9 gene editing technology holds promise for the treatment of multiple diseases. However, the inability to perform specific gene editing in targeted tissues and cells, which may cause off-target effects, is one of the critical bottlenecks for therapeutic application of CRISPR/Cas9. Herein, macrophage-specific promoter-driven Cas9 expression plasmids (pM458 and pM330) were constructed and encapsulated in cationic lipid-assisted PEG-b-PLGA nanoparticles (CLAN). The obtained nanoparticles encapsulating the CRISPR/Cas9 plasmids were able to specifically express Cas9 in macrophages as well as their precursor monocytes both in vitro and in vivo. More importantly, after further encoding a guide RNA targeting Ntn1 (sgNtn1) into the plasmid, the resultant CLANpM330/sgNtn1 successfully disrupted the Ntn1 gene in macrophages and their precursor monocytes in vivo, which reduced expression of netrin-1 (encoded by Ntn1) and subsequently improved type 2 diabetes (T2D) symptoms. Meanwhile, the Ntn1 gene was not disrupted in other cells due to specific expression of Cas9 by the CD68 promoter. This strategy provides alternative avenues for specific in vivo gene editing with the CRISPR/Cas9 system.

  5. Long-distance effects of insertional mutagenesis.

    Directory of Open Access Journals (Sweden)

    Ruchi Singhal

    2011-01-01

    Full Text Available Most common systems of genetic engineering of mammalian cells are associated with insertional mutagenesis of the modified cells. Insertional mutagenesis is also a popular approach to generate random alterations for gene discovery projects. A better understanding of the interaction of the structural elements within an insertional mutagen and the ability of such elements to influence host genes at various distances away from the insertion site is a matter of considerable practical importance.We observed that, in the context of a lentiviral construct, a transcript, which is initiated at an internal CMV promoter/enhancer region and incorporates a splice donor site, is able to extend past a collinear viral LTR and trap exons of host genes, while the polyadenylation signal, which is naturally present in the LTR, is spliced out. Unexpectedly, when a vector, which utilizes this phenomenon, was used to produce mutants with elevated activity of NF-κB, we found mutants, which owed their phenotype to the effect of the insert on a gene located tens or even hundreds of kilobases away from the insertion site. This effect did not result from a CMV-driven transcript, but was sensitive to functional suppression of the insert. Interestingly, despite the long-distance effect, expression of loci most closely positioned to the insert appeared unaffected.We concluded that a polyadenylation signal in a retroviral LTR, when occurring within an intron, is an inefficient barrier against the formation of a hybrid transcript, and that a vector containing a strong enhancer may selectively affect the function of genes far away from its insertion site. These phenomena have to be considered when experimental or therapeutic transduction is performed. In particular, the long-distance effects of insertional mutagenesis bring into question the relevance of the lists of disease-associated retroviral integration targets, which did not undergo functional validation.

  6. Genes and Gene Therapy

    Science.gov (United States)

    ... correctly, a child can have a genetic disorder. Gene therapy is an experimental technique that uses genes to ... or prevent disease. The most common form of gene therapy involves inserting a normal gene to replace an ...

  7. Cumulative Risk on the Oxytocin Receptor Gene (OXTR) Predicts Empathic Communication by Physician Assistant Students.

    Science.gov (United States)

    Floyd, Kory; Generous, Mark Alan; Clark, Lou; McLeod, Ian; Simon, Albert

    2017-10-01

    In the relationship between patients and health care providers, few communicative features are as significant as the providers' ability to express empathy. A robust empirical literature describes the importance of physician communication skills-particularly those that convey empathy-yet few studies have examined empathic communication by physician assistants, who provide primary care for an increasing number of Americans. The present study examines the empathic communication of physician assistant students in interactions with standardized patients. Over a 6-month period, each student conducted three clinical interviews, each of which was evaluated for empathic communication by the patients, the students' clinical instructors, and third-party observers. Students also provided saliva samples for genotyping six single-nucleotide polymorphisms on the oxytocin receptor gene (OXTR) that are linked empirically to empathic behavior. Consistent with recent research, this study adopted a cumulative risk approach wherein students were scored for their number of risky alleles on the single-nucleotide polymorphisms. Results indicated that cumulative risk on OXTR receptor gene predicted lower patient empathy scores as rated by instructors and observers, but not by standardized patients.

  8. High-resolution definition of the Vibrio cholerae essential gene set with hidden Markov model-based analyses of transposon-insertion sequencing data.

    Science.gov (United States)

    Chao, Michael C; Pritchard, Justin R; Zhang, Yanjia J; Rubin, Eric J; Livny, Jonathan; Davis, Brigid M; Waldor, Matthew K

    2013-10-01

    The coupling of high-density transposon mutagenesis to high-throughput DNA sequencing (transposon-insertion sequencing) enables simultaneous and genome-wide assessment of the contributions of individual loci to bacterial growth and survival. We have refined analysis of transposon-insertion sequencing data by normalizing for the effect of DNA replication on sequencing output and using a hidden Markov model (HMM)-based filter to exploit heretofore unappreciated information inherent in all transposon-insertion sequencing data sets. The HMM can smooth variations in read abundance and thereby reduce the effects of read noise, as well as permit fine scale mapping that is independent of genomic annotation and enable classification of loci into several functional categories (e.g. essential, domain essential or 'sick'). We generated a high-resolution map of genomic loci (encompassing both intra- and intergenic sequences) that are required or beneficial for in vitro growth of the cholera pathogen, Vibrio cholerae. This work uncovered new metabolic and physiologic requirements for V. cholerae survival, and by combining transposon-insertion sequencing and transcriptomic data sets, we also identified several novel noncoding RNA species that contribute to V. cholerae growth. Our findings suggest that HMM-based approaches will enhance extraction of biological meaning from transposon-insertion sequencing genomic data.

  9. Regional Fluctuation in the Functional Consequence of LINE-1 Insertion in the Mitf Gene: The Black Spotting Phenotype Arisen from the Mitfmi-bw Mouse Lacking Melanocytes.

    Directory of Open Access Journals (Sweden)

    Kazuhisa Takeda

    Full Text Available Microphthalmia-associated transcription factor (Mitf is a key regulator for differentiation of melanoblasts, precursors to melanocytes. The mouse homozygous for the black-eyed white (Mitfmi-bw allele is characterized by the white-coat color and deafness with black eyes due to the lack of melanocytes. The Mitfmi-bw allele carries LINE-1, a retrotransposable element, which results in the Mitf deficiency. Here, we have established the black spotting mouse that was spontaneously arisen from the homozygous Mitfmi-bw mouse lacking melanocytes. The black spotting mouse shows multiple black patches on the white coat, with age-related graying. Importantly, each black patch also contains hair follicles lacking melanocytes, whereas the white-coat area completely lacks melanocytes. RT-PCR analyses of the pigmented patches confirmed that the LINE-1 insertion is retained in the Mitf gene of the black spotting mouse, thereby excluding the possibility of the somatic reversion of the Mitfmi-bw allele. The immunohistochemical analysis revealed that the staining intensity for beta-catenin was noticeably lower in hair follicles lacking melanocytes of the homozygous Mitfmi-bw mouse and the black spotting mouse, compared to the control mouse. In contrast, the staining intensity for beta-catenin and cyclin D1 was higher in keratinocytes of the black spotting mouse, compared to keratinocytes of the control mouse and the Mitfmi-bw mouse. Moreover, the keratinocyte layer appears thicker in the Mitfmi-bw mouse, with the overexpression of Ki-67, a marker for cell proliferation. We also show that the presumptive black spots are formed by embryonic day 15.5. Thus, the black spotting mouse provides the unique model to explore the molecular basis for the survival and death of developing melanoblasts and melanocyte stem cells in the epidermis. These results indicate that follicular melanocytes are responsible for maintaining the epidermal homeostasis; namely, the present study

  10. Factor IX[sub Madrid 2]: A deletion/insertion in Facotr IX gene which abolishes the sequence of the donor junction at the exon IV-intron d splice site

    Energy Technology Data Exchange (ETDEWEB)

    Solera, J. (Unidades de Genetica Molecular, Madrid (Spain)); Magallon, M.; Martin-Villar, J. (Hemofilia Hospital, Madrid (Spain)); Coloma, A. (Departamento deBioquimica de la Facultad de Medicina de la Universidad Autonoma, Madrid (Spain))

    1992-02-01

    DNA from a patient with severe hemophilia B was evaluated by RFLP analysis, producing results which suggested the existence of a partial deletion within the factor IX gene. The deletion was further localized and characterized by PCR amplification and sequencing. The altered allele has a 4,442-bp deletion which removes both the donor splice site located at the 5[prime] end of intron d and the two last coding nucleotides located at the 3[prime] end of exon IV in the normal factor IX gene; this fragment has been inserted in inverted orientation. Two homologous sequences have been discovered at the ends of the deleted DNA fragment.

  11. Genotyping of the 19-bp insertion/deletion polymorphism in the 5' flank of beta-hydroxylase gene by dissociation analysis of allele-specific PCR products

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Werge, Thomas

    2005-01-01

    and a conventional approach based upon agarose gel electrophoresis of amplified fragments revealed complete concordance between the two procedures. The insights obtained in this study may be utilized to develop assays based upon dissociation analysis of PCR products for genotyping of other insertion...

  12. Use of pentapeptide-insertion scanning mutagenesis for functional mapping of the plum pox virus helper component proteinase suppressor of gene silencing.

    Science.gov (United States)

    Varrelmann, Mark; Maiss, Edgar; Pilot, Ruth; Palkovics, Laszlo

    2007-03-01

    Helper component proteinase (HC-Pro) of Plum pox virus is a multifunctional potyvirus protein that has been examined intensively. In addition to its involvement in aphid transmission, genome amplification and long-distance movement, it is also one of the better-studied plant virus suppressors of RNA silencing. The first systematic analysis using pentapeptide-insertion scanning mutagenesis of the silencing suppression function of a potyvirus HC-Pro is presented here. Sixty-three in-frame insertion mutants, each containing five extra amino acids inserted randomly within the HC-Pro protein, were analysed for their ability to suppress transgene-induced RNA silencing using Agrobacterium infiltration in transgenic Nicotiana benthamiana plants expressing green fluorescent protein. A functional map was obtained, consisting of clearly defined regions with different classes of silencing-suppression activity (wild-type, restricted and disabled). This map confirmed that the N-terminal part of the protein, which is indispensable for aphid transmission, is dispensable for silencing suppression and supports the involvement of the central region in silencing suppression, in addition to its role in maintenance of genome amplification and synergism with other viruses. Moreover, evidence is provided that the C-terminal part of the protein, previously known to be necessary mainly for proteolytic activity, also participates in silencing suppression. Pentapeptide-insertion scanning mutagenesis has been shown to be a fast and powerful tool to functionally characterize plant virus proteins.

  13. Maternal homozygocity for a 14 base pair insertion in exon 8 of the HLA-G gene and carriage of HLA class II alleles restricting HY immunity predispose to unexplained secondary recurrent miscarriage and low birth weight in children born to these patients

    DEFF Research Database (Denmark)

    Christiansen, Ole B; Kolte, Astrid M; Dahl, Mette

    2012-01-01

    Homozygous carriage of a 14 base pair (bp) insertion in exon 8 of the HLA-G gene may be associated with low levels of soluble HLA-G and recurrent miscarriage (RM). We investigated the G14bp insertion(ins)/deletion(del) polymorphism in 339 women with unexplained RM and 125 control women. In all...

  14. GLASS: assisted and standardized assessment of gene variations from Sanger sequence trace data.

    Science.gov (United States)

    Pal, Karol; Bystry, Vojtech; Reigl, Tomas; Demko, Martin; Krejci, Adam; Touloumenidou, Tasoula; Stalika, Evangelia; Tichy, Boris; Ghia, Paolo; Stamatopoulos, Kostas; Pospisilova, Sarka; Malcikova, Jitka; Darzentas, Nikos

    2017-12-01

    Sanger sequencing is still being employed for sequence variant detection by many laboratories, especially in a clinical setting. However, chromatogram interpretation often requires manual inspection and in some cases, considerable expertise. We present GLASS, a web-based Sanger sequence trace viewer, editor, aligner and variant caller, built to assist with the assessment of variations in 'curated' or user-provided genes. Critically, it produces a standardized variant output as recommended by the Human Genome Variation Society. GLASS is freely available at http://bat.infspire.org/genomepd/glass/ with source code at https://github.com/infspiredBAT/GLASS. nikos.darzentas@gmail.com or malcikova.jitka@fnbrno.cz. Supplementary data are available at Bioinformatics online.

  15. HRAS, EGFR, MET, and RON Genes Are Recurrently Activated by Provirus Insertion in Liver Tumors Induced by the Retrovirus Myeloblastosis-Associated Virus 2

    Czech Academy of Sciences Publication Activity Database

    Pečenka, Vladimír; Pajer, Petr; Karafiát, Vít; Kašparová, P.; Dudlová, J.; Dvořák, Michal

    2017-01-01

    Roč. 91, č. 20 (2017), č. článku e00467-17. ISSN 0022-538X R&D Projects: GA MŠk LO1419; GA ČR GA301/09/1727 Institutional support: RVO:68378050 Keywords : avian tetroviruses * insertional mutagenesis * retroviral oncogenesis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.663, year: 2016

  16. Tie rod insertion test

    CERN Multimedia

    B. LEVESY

    2002-01-01

    The superconducting coil is inserted in the outer vaccum tank and supported by a set of tie rods. These tie rods are made of titanium alloy. This test reproduce the final insertion of the tie rods inside the outer vacuum tank.

  17. Prolactin promoter gene as marker assisted selection (MAS for the control of broodiness of Kampung chicken

    Directory of Open Access Journals (Sweden)

    Tike Sartika

    2004-12-01

    Full Text Available Preliminary research about MAS (Marker Assisted Selection was conducted to detect broodiness trait of Kampung chicken. MAS currently is very important in situations, where the accuracy of selection is low, such as, traits with low heritability, e.g. broodiness trait and egg production. Prolactin promoter was selected as a marker gene for broodiness because it plays a critical part in the neuroendocrine cascade which is triggered at the onset of broodiness. DNA samples were collected from low and highbroodiness samples on basic population (G0 each 24 samples, and from selected population (G3 each 28 samples. As control population without broody behavior was used 16 samples White Leghorn (WL chicken. Prolactin promoter gene was amplified using polymerase chain reaction (PCR. PCR product was analyzed using electrophoresis agarose gel 2%. The results showed four types of bands represent in the Kampung chicken, three types called as wild type band and one type as the WL band. The chickens with low and high broodiness on G0 generation have 75 and 87.5% of wild type band while in the G3 generation was decreased to 25 and 75%. Conclusions of the research indicated that the selected breed of the Kampung chicken on G3 generation increased WL band like White Leghorn chicken as much as 31,25% from the G0 generation.

  18. Association mapping and marker-assisted selection of the lettuce dieback resistance gene Tvr1.

    Science.gov (United States)

    Simko, Ivan; Pechenick, Dov A; McHale, Leah K; Truco, María José; Ochoa, Oswaldo E; Michelmore, Richard W; Scheffler, Brian E

    2009-11-23

    Lettuce (Lactuca saliva L.) is susceptible to dieback, a soilborne disease caused by two viruses from the family Tombusviridae. Susceptibility to dieback is widespread in romaine and leaf-type lettuce, while modern iceberg cultivars are resistant to this disease. Resistance in iceberg cultivars is conferred by Tvr1 - a single, dominant gene that provides durable resistance. This study describes fine mapping of the resistance gene, analysis of nucleotide polymorphism and linkage disequilibrium in the Tvr1 region, and development of molecular markers for marker-assisted selection. A combination of classical linkage mapping and association mapping allowed us to pinpoint the location of the Tvr1 resistance gene on chromosomal linkage group 2. Nine molecular markers, based on expressed sequence tags (EST), were closely linked to Tvr1 in the mapping population, developed from crosses between resistant (Salinas and Salinas 88) and susceptible (Valmaine) cultivars. Sequencing of these markers from a set of 68 cultivars revealed a relatively high level of nucleotide polymorphism (theta = 6.7 x 10-3) and extensive linkage disequilibrium (r(2) = 0.124 at 8 cM) in this region. However, the extent of linkage disequilibrium was affected by population structure and the values were substantially larger when the analysis was performed only for romaine (r(2) = 0.247) and crisphead (r(2) = 0.345) accessions. The association mapping approach revealed that one of the nine markers (Cntg10192) in the Tvr1 region matched exactly with resistant and susceptible phenotypes when tested on a set of 200 L. sativa accessions from all horticultural types of lettuce. The marker-trait association was also confirmed on two accessions of Lactuca serriola - a wild relative of cultivated lettuce. The combination of three single-nucleotide polymorphisms (SNPs) at the Cntg10192 marker identified four haplotypes. Three of the haplotypes were associated with resistance and one of them was always associated

  19. Distribution of Insertion- and Deletion-Associated Genetic Polymorphisms among Four Mycobacterium tuberculosis Phospholipase C Genes and Associations with Extrathoracic Tuberculosis: a Population-Based Study

    OpenAIRE

    Kong, Y.; Cave, M. D.; Yang, D.; Zhang, L.; Marrs, C. F.; Foxman, B.; Bates, J. H.; Wilson, F.; Mukasa, L. N.; Yang, Z. H.

    2005-01-01

    The Mycobacterium tuberculosis genome contains four phospholipase C (PLC)-encoding genes, designated plcA, plcB, plcC, and plcD, respectively. Each of the four genes contributes to the overall PLC activity of M. tuberculosis. PLC is hypothesized to contribute to M. tuberculosis virulence. Infection of M. tuberculosis strains carrying a truncated plcD gene is associated with the occurrence of extrathoracic tuberculosis. However, whether the other three plc genes are also associated with extrat...

  20. β-Thalassemia due to intronic LINE-1 insertion in the β-globin gene (HBB): molecular mechanisms underlying reduced transcript levels of the β-globin(L1) allele.

    Science.gov (United States)

    Lanikova, Lucie; Kucerova, Jana; Indrak, Karel; Divoka, Martina; Issa, Jean-Pierre; Papayannopoulou, Thalia; Prchal, Josef T; Divoky, Vladimir

    2013-10-01

    We describe the molecular etiology of β(+)-thalassemia that is caused by the insertion of the full-length transposable element LINE-1 (L1) into the intron-2 of the β-globin gene (HBB). The transcript level of the affected β-globin gene was severely reduced. The remaining transcripts consisted of full-length, correctly processed β-globin mRNA and a minute amount of three aberrantly spliced transcripts with a decreased half-life due to activation of the nonsense-mediated decay pathway. The lower steady-state amount of mRNA produced by the β-globin(L1) allele also resulted from a reduced rate of transcription and decreased production of full-length β-globin primary transcripts. The promoter and enhancer sequences of the β-globin(L1) allele were hypermethylated; however, treatment with a demethylating agent did not restore the impaired transcription. A histone deacetylase inhibitor partially reactivated the β-globin(L1) transcription despite permanent β-globin(L1) promoter CpG methylation. This result indicates that the decreased rate of transcription from the β-globin(L1) allele is associated with an altered chromatin structure. Therefore, the molecular defect caused by intronic L1 insertion in the β-globin gene represents a novel etiology of β-thalassemia. © 2013 WILEY PERIODICALS, INC.

  1. Insertion of the LINE-1 element in the C-MYC gene and immunoreactivity of C-MYC, p53, p21 and p27 proteins in different morphological patterns of the canine TVT

    OpenAIRE

    C.R.O. Lima; Faleiro,M.B.R.; Rabelo,R.E.; V.A.S. Vulcani; Rubini,M.R.; Torres,F.A.G.; Moura,V.M.B.D.

    2016-01-01

    ABSTRACT The canine transmissible venereal tumor (TVT) affects the external genitalia of dogs by the natural transplant of viable tumor cells. Thus, this research aimed to diagnose and characterize TVT morphological patterns, identify the insertion of the LINE-1 element in C-MYC gene, by means of the polymerase chain reaction (PCR), and evaluate the immunohistochemical expression of C-MYC, p53, p21 and p27 proteins. The relationship between C-MYC and p53 proteins and their interference on the...

  2. Flow cytometry-assisted cloning of specific sequence motifs from complex 16S rRNA gene libraries

    DEFF Research Database (Denmark)

    Nielsen, J. L.; Schramm, A.; Engh, G. van den

    2004-01-01

    A How cytometry method was developed for rapid screening and recovery of cloned DNA containing common sequence motifs. This approach, termed fluorescence-activated cell sorting-assisted cloning, was used to recover sequences affiliated with a unique lineage within the Bacteroidetes not abundant i...... in a clone library of environmental 16S rRNA genes....

  3. Insertional Polymorphism and Antiquity of PDR1 Retrotransposon Insertions in Pisum Species

    Science.gov (United States)

    Jing, Runchun; Knox, Maggie R.; Lee, Jennifer M.; Vershinin, Alexander V.; Ambrose, Michael; Ellis, T. H. Noel; Flavell, Andrew J.

    2005-01-01

    Sequences flanking 73 insertions of the retrotransposon PDR1 have been characterized, together with an additional 270 flanking regions from one side alone, from a diverse collection of Pisum germ plasm. Most of the identified flanking sequences are repetitious DNAs but more than expected (7%) lie within nuclear gene protein-coding regions. The approximate age of 52 of the PDR1 insertions has been determined by measuring sequence divergence among LTR pairs. These data show that PDR1 transpositions occurred within the last 5 MY, with a peak at 1–2.5 MYA. The insertional polymorphism of 68 insertions has been assessed across 47 selected Pisum accessions, representing the diversity of the genus. None of the insertions are fixed, showing that PDR1 insertions can persist in a polymorphic state for millions of years in Pisum. The insertional polymorphism data have been compared with the age estimations to ask what rules control the proliferation of PDR1 insertions in Pisum. Relatively recent insertions ( ∼2.5 MYA) are mostly found in small subsets of Pisum. Finally, the average age estimate for PDR1 insertions, together with an existing data set for PDR1 retrotransposon SSAP markers, has been used to derive an estimate of the effective population size for Pisum of ∼7.5 × 105. PMID:16085698

  4. Greig cephalopolysyndactyly (GCPS) contiguous gene syndrome in a boy with a 14 Mb deletion in region 7p13-14 caused by a paternal balanced insertion (5; 7).

    Science.gov (United States)

    Schulz, Solveig; Volleth, Marianne; Muschke, Petra; Wieland, Ilse; Wieacker, Peter

    2008-01-01

    We report on a six years old boy with several features of Greig cephalopolysyndactyly syndrome (GCPS) including craniofacial dysmorphism, hypertelorism, heart defect, preaxial hexadactyly of toes, partial agenesis of corpus callosum, and severe developmental delay. Greig cephalopolysyndactyly (GCPS) can be caused by GLI3 deletions. In patients with large deletions which include additional genes, it is termed Greig cephalopolysyndactyly-contiguous gene syndrome (GCPS-CGS). It is generally believed that the deletion size correlates with disease severity. Nearly all cases appear to be a result of GLI3 de novo deletions. Chromosome analysis of our patient revealed a large deletion in chromosome 7(p13-p14). Unlike most previously described cases, we found that this deletion resulted from a paternal balanced insertional translocation of 7p13-14 into the long arm of chromosome 5.

  5. A transposable element insertion in the susceptibility gene CsaMLO8 results in hypocotyl resistance to powdery mildew in cucumber

    NARCIS (Netherlands)

    Berg, J.A.; Appiano, M.; Santillán Martínez, M.I.; Hemans, F.W.K.; Vriezen, W.H.; Visser, R.G.F.; Bai, Y.; Schouten, H.J.

    2015-01-01

    Background - Powdery mildew (PM) is an important disease of cucumber (Cucumis sativus L.). CsaMLO8 was previously identified as a candidate susceptibility gene for PM in cucumber, for two reasons: 1) This gene clusters phylogenetically in clade V, which has previously been shown to harbour all known

  6. Comparing Leaf and Root Insertion

    Directory of Open Access Journals (Sweden)

    Jaco Geldenhuys

    2010-07-01

    Full Text Available We consider two ways of inserting a key into a binary search tree: leaf insertion which is the standard method, and root insertion which involves additional rotations. Although the respective cost of constructing leaf and root insertion binary search trees trees, in terms of comparisons, are the same in the average case, we show that in the worst case the construction of a root insertion binary search tree needs approximately 50% of the number of comparisons required by leaf insertion.

  7. Insertion/deletion polymorphism of the angiotensin-converting enzyme gene and the risk of hypertension among residents of two cities, South-South Nigeria

    Directory of Open Access Journals (Sweden)

    Mary Esien Kooffreh

    2014-01-01

    Conclusion: The I/D polymorphism of the angiotensin-converting enzyme gene was a risk factor for hypertension in the sample population of Calabar and Uyo. This research will form baseline information for subsequent molecular studies in this population.

  8. The LHC Insertion Magnets

    CERN Document Server

    Ostojic, R

    2002-01-01

    The Large Hadron Collider comprises eight insertions, four of which are dedicated to the LHC experiments while the others are used for the major collider systems. The various functions of the insertions are fulfilled by a variety of magnet systems, most of them based on the technology of NbTi superconductors cooled by superfluid helium at 1.9 K. A number of stand-alone magnets in the matching sections are operated at 4.5 K, while in the high radiation areas specialised resistive magnets are used. In this paper, we review the concepts underlying the design of the LHC insertions, and report on the design, procurement and testing of the various specialised magnet systems.

  9. ISABELLE insertion quadrupoles

    Energy Technology Data Exchange (ETDEWEB)

    Kaugerts, J.; Polk, I.; Sampson, W.; Dahl, P.F.

    1979-01-01

    Beam focussing and control at the beam intersection regions of ISABELLE is accomplished by a number of superconducting insertion quadrupoles. These magnets differ from the standard ISABELLE quadrupoles in various ways. In particular, the requirements of limited space near the intersections and aperture for beam extraction impose constraints on their configuration. To achieve optimum beam focussing and provide tuning flexibility calls for stronger quadrupole trim windings than those in the standard quadrupoles. The magnetic and mechanical design of the insertion quadrupoles and their associated correction and steering windings to accomplish the above tasks is presented.

  10. The Composite Insertion Electrode

    DEFF Research Database (Denmark)

    Atlung, Sven; Zachau-Christiansen, Birgit; West, Keld

    1984-01-01

    . The theoretical basis for such electrodes is discussedand, using a simplified model, equations are derived to describe the distribution of potential and current duringdischarge/charge operation. Under the assumption that the insertion compound particles are small enough to ensureequilibrium, and that the local...... electrode potential depends linearly on the degree of insertion, these equations are solvedto obtain analytical expressions for the discharge curve. It is shown that the parameters which determine the dischargebehavior for a given discharge current are simply related to the effective ionic and electronic...... conductivities, the thicknessof the electrode, the volume fractions, and the slope of the potential curve....

  11. Colistin- and carbapenem-resistant Klebsiella oxytoca harboring blaVIM-2 and an insertion in the mgrB gene isolated from blood culture.

    Science.gov (United States)

    Simon, Michaela; Melzl, Holger; Hiergeist, Andreas; Richert, Katharina; Falgenhauer, Linda; Pfeifer, Yvonne; Gerlach, Roman G; Fuchs, Kornelius; Reischl, Udo; Gessner, André; Jantsch, Jonathan

    2017-02-01

    A carbapenemase-producing colistin-resistant Klebsiella oxytoca isolate was recovered from a blood culture of a female patient without previous report of risk factors to obtain multidrug-resistant Gram-negative bacilli. A combination of biochemical and molecular methods was used to identify the resistance mechanism of this isolate. Carbapenemase production was mediated by Verona integron-encoded metallo-β-lactamase (VIM)-2. Colistin resistance was not due to plasmid- borne mcr-1 gene, but we found an integration of IS5-like sequence in the mgrB gene of K. oxytoca. This gene is known to be an important regulator of the PhoPQ two-component system, and the disruption of this gene is most likely the cause of lipid A modification resulting in colistin resistance of our isolate. To the best of our knowledge this constitutes the first report of a carbapenemase-producing K. oxytoca with colistin resistance, a case that demonstrates the limited treatment options for infections with multidrug-resistant organisms. Copyright © 2017 Elsevier GmbH. All rights reserved.

  12. Identification of pathogenicity-related genes in the vascular wilt fungus verticillium dahliae by agrobacterium tumefaciens-mediated t-DNA insertional mutagenesis.

    Science.gov (United States)

    Verticillium dahliae is the causal agent of vascular wilt in many economically important crops worldwide. Identification of genes that underpin pathogenicity or virulence may suggest targets for alternative control methods for this fungus. In this study, Agrobacterium tumefaciens-mediated transform...

  13. Insertion in Persian

    Science.gov (United States)

    Kambuziya, Aliyeh Kord-e Zafaranlu; Dehghan, Masoud

    2011-01-01

    This paper investigates epenthesis process in Persian to catch some results in relating to vowel and consonant insertion in Persian lexicon. This survey has a close relationship to the description of epenthetic consonants and the conditions in which these consonants are used. Since no word in Persian may begin with a vowel, so that hiatus can't be…

  14. Inserting the CMS solenoid

    CERN Multimedia

    Maximilien Brice

    2005-01-01

    The huge superconducting solenoid for CMS is inserted into the cryostat barrel. CMS uses the world's largest thin solenoid, in terms of energy stored, and is 12 m long, with a diameter of 6 m and weighing 220 tonnes. When turned on the magnet will produce a field strength of 4 T using superconducting niobium-titanium material at 4.5 K.

  15. Pixel detector insertion

    CERN Multimedia

    CMS

    2015-01-01

    Insertion of the Pixel Tracker, the 66-million-channel device used to pinpoint the vertex of each colliding proton pair, located at the heart of the detector. The geometry of CMS is a cylinder lying on its side (22 meters long and 15 meters high in dia

  16. Cas9 Nickase-Assisted RNA Repression Enables Stable and Efficient Manipulation of Essential Metabolic Genes in Clostridium cellulolyticum.

    Science.gov (United States)

    Xu, Tao; Li, Yongchao; He, Zhili; Van Nostrand, Joy D; Zhou, Jizhong

    2017-01-01

    Essential gene functions remain largely underexplored in bacteria. Clostridium cellulolyticum is a promising candidate for consolidated bioprocessing; however, its genetic manipulation to reduce the formation of less-valuable acetate is technically challenging due to the essentiality of acetate-producing genes. Here we developed a Cas9 nickase-assisted chromosome-based RNA repression to stably manipulate essential genes in C. cellulolyticum. Our plasmid-based expression of antisense RNA (asRNA) molecules targeting the phosphotransacetylase (pta) gene successfully reduced the enzymatic activity by 35% in cellobiose-grown cells, metabolically decreased the acetate titer by 15 and 52% in wildtype transformants on cellulose and xylan, respectively. To control both acetate and lactate simultaneously, we transformed the repression plasmid into lactate production-deficient mutant and found the plasmid delivery reduced acetate titer by more than 33%, concomitant with negligible lactate formation. The strains with pta gene repression generally diverted more carbon into ethanol. However, further testing on chromosomal integrants that were created by double-crossover recombination exhibited only very weak repression because DNA integration dramatically lessened gene dosage. With the design of a tandem repetitive promoter-driven asRNA module and the use of a new Cas9 nickase genome editing tool, a chromosomal integrant (LM3P) was generated in a single step and successfully enhanced RNA repression, with a 27% decrease in acetate titer on cellulose in antibiotic-free medium. These results indicate the effectiveness of tandem promoter-driven RNA repression modules in promoting gene repression in chromosomal integrants. Our combinatorial method using a Cas9 nickase genome editing tool to integrate the gene repression module demonstrates easy-to-use and high-efficiency advantages, paving the way for stably manipulating genes, even essential ones, for functional characterization and

  17. Cas9 Nickase-Assisted RNA Repression Enables Stable and Efficient Manipulation of Essential Metabolic Genes in Clostridium cellulolyticum

    Directory of Open Access Journals (Sweden)

    Tao Xu

    2017-09-01

    Full Text Available Essential gene functions remain largely underexplored in bacteria. Clostridium cellulolyticum is a promising candidate for consolidated bioprocessing; however, its genetic manipulation to reduce the formation of less-valuable acetate is technically challenging due to the essentiality of acetate-producing genes. Here we developed a Cas9 nickase-assisted chromosome-based RNA repression to stably manipulate essential genes in C. cellulolyticum. Our plasmid-based expression of antisense RNA (asRNA molecules targeting the phosphotransacetylase (pta gene successfully reduced the enzymatic activity by 35% in cellobiose-grown cells, metabolically decreased the acetate titer by 15 and 52% in wildtype transformants on cellulose and xylan, respectively. To control both acetate and lactate simultaneously, we transformed the repression plasmid into lactate production-deficient mutant and found the plasmid delivery reduced acetate titer by more than 33%, concomitant with negligible lactate formation. The strains with pta gene repression generally diverted more carbon into ethanol. However, further testing on chromosomal integrants that were created by double-crossover recombination exhibited only very weak repression because DNA integration dramatically lessened gene dosage. With the design of a tandem repetitive promoter-driven asRNA module and the use of a new Cas9 nickase genome editing tool, a chromosomal integrant (LM3P was generated in a single step and successfully enhanced RNA repression, with a 27% decrease in acetate titer on cellulose in antibiotic-free medium. These results indicate the effectiveness of tandem promoter-driven RNA repression modules in promoting gene repression in chromosomal integrants. Our combinatorial method using a Cas9 nickase genome editing tool to integrate the gene repression module demonstrates easy-to-use and high-efficiency advantages, paving the way for stably manipulating genes, even essential ones, for functional

  18. Efficient CRISPR/Cas9-assisted gene targeting enables rapid and precise genetic manipulation of mammalian neural stem cells.

    Science.gov (United States)

    Bressan, Raul Bardini; Dewari, Pooran Singh; Kalantzaki, Maria; Gangoso, Ester; Matjusaitis, Mantas; Garcia-Diaz, Claudia; Blin, Carla; Grant, Vivien; Bulstrode, Harry; Gogolok, Sabine; Skarnes, William C; Pollard, Steven M

    2017-02-15

    Mammalian neural stem cell (NSC) lines provide a tractable model for discovery across stem cell and developmental biology, regenerative medicine and neuroscience. They can be derived from foetal or adult germinal tissues and continuously propagated in vitro as adherent monolayers. NSCs are clonally expandable, genetically stable, and easily transfectable - experimental attributes compatible with targeted genetic manipulations. However, gene targeting, which is crucial for functional studies of embryonic stem cells, has not been exploited to date in NSC lines. Here, we deploy CRISPR/Cas9 technology to demonstrate a variety of sophisticated genetic modifications via gene targeting in both mouse and human NSC lines, including: (1) efficient targeted transgene insertion at safe harbour loci (Rosa26 and AAVS1); (2) biallelic knockout of neurodevelopmental transcription factor genes; (3) simple knock-in of epitope tags and fluorescent reporters (e.g. Sox2-V5 and Sox2-mCherry); and (4) engineering of glioma mutations (TP53 deletion; H3F3A point mutations). These resources and optimised methods enable facile and scalable genome editing in mammalian NSCs, providing significant new opportunities for functional genetic analysis. © 2017. Published by The Company of Biologists Ltd.

  19. Lack of association of insertion/deletion polymorphism in ...

    African Journals Online (AJOL)

    In the present preliminary study the insertion/deletion polymorphism within angiotensin converting enzyme gene is not likely to be associated with nephropathy in type 2 diabetic patients of Punjabi population of Pakistan. Key words: Angiotensin converting enzymes, insertion/deletion polymorphism, albuminuria and type 2 ...

  20. Study of miRNA Based Gene Regulation, Involved in Solid Cancer, by the Assistance of Argonaute Protein

    Directory of Open Access Journals (Sweden)

    Surya Narayan Rath

    2016-09-01

    Full Text Available Solid tumor is generally observed in tissues of epithelial or endothelial cells of lung, breast, prostate, pancreases, colorectal, stomach, and bladder, where several genes transcription is regulated by the microRNAs (miRNAs. Argonaute (AGO protein is a family of protein which assists in miRNAs to bind with mRNAs of the target genes. Hence, study of the binding mechanism between AGO protein and miRNAs, and also with miRNAs-mRNAs duplex is crucial for understanding the RNA silencing mechanism. In the current work, 64 genes and 23 miRNAs have been selected from literatures, whose deregulation is well established in seven types of solid cancer like lung, breast, prostate, pancreases, colorectal, stomach, and bladder cancer. In silico study reveals, miRNAs namely, miR-106a, miR-21, and miR-29b-2 have a strong binding affinity towards PTEN, TGFBR2, and VEGFA genes, respectively, suggested as important factors in RNA silencing mechanism. Furthermore, interaction between AGO protein (PDB ID-3F73, chain A with selected miRNAs and with miRNAs-mRNAs duplex were studied computationally to understand their binding at molecular level. The residual interaction and hydrogen bonding are inspected in Discovery Studio 3.5 suites. The current investigation throws light on understanding miRNAs based gene silencing mechanism in solid cancer.

  1. Lack of any association between insertion/deletion (I/D) polymorphisms in the angiotensin-converting enzyme gene and digestive system cancer risk: a meta-analysis.

    Science.gov (United States)

    Liu, Jin-Fei; Xie, Hao-Jun; Cheng, Tian-Ming

    2013-01-01

    To investigate the association between the gene polymorphisms of angiotensin-converting enzyme (ACE) and digestive system cancer risk. A search was performed in Pubmed, Medline, ISI Web of Science and Chinese Biomedical (CBM) databases, covering all studies until Sep 1st, 2013. Statistical analysis was performed by using Revman5.2 and STATA 12.0. A total of 15 case-control studies comprising 2,390 digestive system cancer patients and 9,706 controls were identified. No significant association was found between the I/D polymorphism and digestive cancer risk (OR =0.93, 95%CI = (0.75, 1.16), P =0.53 for DD+DI vs. II). In the subgroup analysis by ethnicity and cancer type, no significant associations were found for the comparison of DD+DI vs. II. Results from other comparative genetic models also indicated a lack of associations between this polymorphism and digestive system cancer risks. This meta-analysis suggested that the ACE D/I polymorphism might not contribute to the risk of digestive system cancer.

  2. Homoeologous GSL-ELONG gene replacement for manipulation of aliphatic glucosinolates in Brassica rapa L. by marker assisted selection

    Directory of Open Access Journals (Sweden)

    Arvind H. Hirani

    2013-03-01

    Full Text Available Aliphatic glucosinolates are the predominant sulphur-rich plant secondary metabolites in economically important Brassica crops. Glucosinolates and their hydrolysis products are involved in plant-microbe, plant-insect, plant-animal and plant-human interactions. It is, therefore, important to manipulate glucosinolate profiles and contents in Brassica species. In this study, aliphatic glucosinolates were genetically manipulated through homoeologous recombination in backcross lines followed by marker assisted selection in B. rapa. A resynthesized B. napus line, from a cross between B. rapa and B. oleracea, was backcrossed with Chinese cabbage doubled haploid line, RI16. Marker assisted selection for non-functional gene was performed in each backcross generations. Advanced backcross progenies (BC3F2 were developed to identify homoeologous gene replacement and/or introgression. Reduction in 5C aliphatic glucosinolates (gluconapoleiferin, glucoalyssin and glucobrassicanapin was observed in BC3F2 progenies of the recurrent parent that carried the GSL-ELONG gene. The GSL-ELONG positive backcross progenies were also screened by the A-genome and BraGSL-ELONG gene specific marker, which linked with 5C aliphatic glucosinolates. The A-genome specific marker was absent in the plants of advanced backcross progenies which showed reduction in 5C aliphatic glucosinolates. The results suggest that the functional allele had been replaced by the non-functional GSL-ELONG allele from B. oleracea. Some advanced backcross progenies (BC3F2 positive for the GSL-ELONG allele and the A-genome specific SCAR marker BraMAM1-1 did not show reduction in 5C aliphatic glucosinolates, suggesting that GSL-ELONG allele is recessive. Replacement of the functional locus in the A genome by non-functional counterpart in the C genome reduced the content of 5C aliphatic glucosinolates in B. rapa seeds with 20 micromoles per gram.

  3. Insertion of the LINE-1 element in the C-MYC gene and immunoreactivity of C-MYC, p53, p21 and p27 proteins in different morphological patterns of the canine TVT

    Directory of Open Access Journals (Sweden)

    C.R.O. Lima

    2016-06-01

    Full Text Available ABSTRACT The canine transmissible venereal tumor (TVT affects the external genitalia of dogs by the natural transplant of viable tumor cells. Thus, this research aimed to diagnose and characterize TVT morphological patterns, identify the insertion of the LINE-1 element in C-MYC gene, by means of the polymerase chain reaction (PCR, and evaluate the immunohistochemical expression of C-MYC, p53, p21 and p27 proteins. The relationship between C-MYC and p53 proteins and their interference on the expression of p21 and p27 were also studied. For that, 20 samples of naturally occurring TVT were used, subjected to cytopathological, histopathological and immunohistochemical analysis, and to molecular diagnosis of neoplasia. The increased tissue expression and the correlation among C-MYC, p53, p21 and p27 proteins indicate reduction and/or loss of their functionality in the TVT microenvironment, with consequent apoptotic suppression, maintenance of cell growth and progression of neoplasia.

  4. Comparison of Insertional RNA Editing in Myxomycetes

    Science.gov (United States)

    Chen, Cai; Frankhouser, David; Bundschuh, Ralf

    2012-01-01

    RNA editing describes the process in which individual or short stretches of nucleotides in a messenger or structural RNA are inserted, deleted, or substituted. A high level of RNA editing has been observed in the mitochondrial genome of Physarum polycephalum. The most frequent editing type in Physarum is the insertion of individual Cs. RNA editing is extremely accurate in Physarum; however, little is known about its mechanism. Here, we demonstrate how analyzing two organisms from the Myxomycetes, namely Physarum polycephalum and Didymium iridis, allows us to test hypotheses about the editing mechanism that can not be tested from a single organism alone. First, we show that using the recently determined full transcriptome information of Physarum dramatically improves the accuracy of computational editing site prediction in Didymium. We use this approach to predict genes in the mitochondrial genome of Didymium and identify six new edited genes as well as one new gene that appears unedited. Next we investigate sequence conservation in the vicinity of editing sites between the two organisms in order to identify sites that harbor the information for the location of editing sites based on increased conservation. Our results imply that the information contained within only nine or ten nucleotides on either side of the editing site (a distance previously suggested through experiments) is not enough to locate the editing sites. Finally, we show that the codon position bias in C insertional RNA editing of these two organisms is correlated with the selection pressure on the respective genes thereby directly testing an evolutionary theory on the origin of this codon bias. Beyond revealing interesting properties of insertional RNA editing in Myxomycetes, our work suggests possible approaches to be used when finding sequence motifs for any biological process fails. PMID:22383871

  5. Ultrasound-assisted non-viral gene transfer of AQP1 to the irradiated minipig parotid gland restores fluid secretion

    Science.gov (United States)

    Wang, Z; Zourelias, L; Wu, C; Edwards, PC; Trombetta, M; Passineau, MJ

    2015-01-01

    Rationale Xerostomia is a common side effect of ionizing radiation used to treat head and neck cancer. A groundbreaking Phase I human clinical trial utilizing Adenoviral gene transfer of Aquaporin-1 (AQP1) to a single salivary gland of individuals suffering from radiation-induced xerostomia has recently been reported. Unfortunately, the limitations of the Adenoviral vector system utilized in this pioneering trial preclude its advancement to a Phase II trial and we have thus undertaken to evaluate the therapeutic potential of ultrasound-assisted non-viral gene transfer (UAGT) as an alternative means of delivering AQP1 gene therapy to the salivary gland by comparing head-to-head with the canonical Adenoviral vector in a swine model. Findings Swine irradiated unilaterally with a 10Gy electron beam targeted at the parotid gland suffered from significant, sustained hyposalivation that was bilateral, despite irradiation being confined to the targeted gland. Unilateral AQP1 gene therapy with UAGT resulted in bilateral restoration of stimulated salivary flow at 48 hours and one week post-treatment (1.62+/−0.48ml, 1.87+/−0.45ml) to pre-injury levels (1.34+/−0.14ml) in a manner comparable to Adenoviral delivery (2.32+/−0.6ml, 1.33+/−0.97ml). Conclusions UAGT can replace the Adenoviral vector as a means of delivering AQP1 gene therapy in the irradiated swine model and is a candidate for advancement to a Phase I human clinical trial. PMID:25871828

  6. MMEJ-assisted gene knock-in using TALENs and CRISPR-Cas9 with the PITCh systems.

    Science.gov (United States)

    Sakuma, Tetsushi; Nakade, Shota; Sakane, Yuto; Suzuki, Ken-Ichi T; Yamamoto, Takashi

    2016-01-01

    Programmable nucleases enable engineering of the genome by utilizing endogenous DNA double-strand break (DSB) repair pathways. Although homologous recombination (HR)-mediated gene knock-in is well established, it cannot necessarily be applied in every cell type and organism because of variable HR frequencies. We recently reported an alternative method of gene knock-in, named the PITCh (Precise Integration into Target Chromosome) system, assisted by microhomology-mediated end-joining (MMEJ). MMEJ harnesses independent machinery from HR, and it requires an extremely short homologous sequence (5-25 bp) for DSB repair, resulting in precise gene knock-in with a more easily constructed donor vector. Here we describe a streamlined protocol for PITCh knock-in, including the design and construction of the PITCh vectors, and their delivery to either human cell lines by transfection or to frog embryos by microinjection. The construction of the PITCh vectors requires only a few days, and the entire process takes ∼ 1.5 months to establish knocked-in cells or ∼ 1 week from injection to early genotyping in frog embryos.

  7. Insertional mutagenesis in mice deficient for p15Ink4b, p16Ink4a, p21Cip1, and p27Kip1 reveals cancer gene interactions and correlations with tumor phenotypes

    DEFF Research Database (Denmark)

    Kool, Jaap; Uren, Anthony G; Martins, Carla P

    2010-01-01

    -throughput murine leukemia virus insertional mutagenesis screens in mice that are deficient for one or two CDK inhibitors. We retrieved 9,117 retroviral insertions from 476 lymphomas to define hundreds of loci that are mutated more frequently than expected by chance. Many of these loci are skewed toward a specific...

  8. Introgression of LTP2 gene through marker assisted backcross in barley (Hordeum vulgare L.

    Directory of Open Access Journals (Sweden)

    Krzysztof Mikołajczak

    2016-11-01

    Conclusions: BC6 lines developed in this study can serve as a unique and adequate plant material to dissect the role of LTP2 gene. Due to its role in lipid transfer, the LTP2 may be crucial in lipidome modification in response to abiotic stress.

  9. Mono-allelic retrotransposon insertion addresses epigenetic transcriptional repression in human genome.

    Science.gov (United States)

    Byun, Hyang-Min; Heo, Kyu; Mitchell, Kasey J; Yang, Allen S

    2012-02-02

    Retrotransposons have been extensively studied in plants and animals and have been shown to have an impact on human genome dynamics and evolution. Their ability to move within genomes gives retrotransposons to affect genome instability. we examined the polymorphic inserted AluYa5, evolutionary young Alu, in the progesterone receptor gene to determine the effects of Alu insertion on molecular environment. We used mono-allelic inserted cell lines which carry both Alu-present and Alu-absent alleles. To determine the epigenetic change and gene expression, we performed restriction enzyme digestion, Pyrosequencing, and Chromatin Immunoprecipitation. We observed that the polymorphic insertion of evolutionally young Alu causes increasing levels of DNA methylation in the surrounding genomic area and generates inactive histone tail modifications. Consequently the Alu insertion deleteriously inactivates the neighboring gene expression. The mono-allelic Alu insertion cell line clearly showed that polymorphic inserted repetitive elements cause the inactivation of neighboring gene expression, bringing aberrant epigenetic changes.

  10. Mechanisms for Complex Chromosomal Insertions.

    Science.gov (United States)

    Gu, Shen; Szafranski, Przemyslaw; Akdemir, Zeynep Coban; Yuan, Bo; Cooper, Mitchell L; Magriñá, Maria A; Bacino, Carlos A; Lalani, Seema R; Breman, Amy M; Smith, Janice L; Patel, Ankita; Song, Rodger H; Bi, Weimin; Cheung, Sau Wai; Carvalho, Claudia M B; Stankiewicz, Paweł; Lupski, James R

    2016-11-01

    Chromosomal insertions are genomic rearrangements with a chromosome segment inserted into a non-homologous chromosome or a non-adjacent locus on the same chromosome or the other homologue, constituting ~2% of nonrecurrent copy-number gains. Little is known about the molecular mechanisms of their formation. We identified 16 individuals with complex insertions among 56,000 individuals tested at Baylor Genetics using clinical array comparative genomic hybridization (aCGH) and fluorescence in situ hybridization (FISH). Custom high-density aCGH was performed on 10 individuals with available DNA, and breakpoint junctions were fine-mapped at nucleotide resolution by long-range PCR and DNA sequencing in 6 individuals to glean insights into potential mechanisms of formation. We observed microhomologies and templated insertions at the breakpoint junctions, resembling the breakpoint junction signatures found in complex genomic rearrangements generated by replication-based mechanism(s) with iterative template switches. In addition, we analyzed 5 families with apparently balanced insertion in one parent detected by FISH analysis and found that 3 parents had additional small copy-number variants (CNVs) at one or both sides of the inserting fragments as well as at the inserted sites. We propose that replicative repair can result in interchromosomal complex insertions generated through chromothripsis-like chromoanasynthesis involving two or three chromosomes, and cause a significant fraction of apparently balanced insertions harboring small flanking CNVs.

  11. Mechanisms for Complex Chromosomal Insertions.

    Directory of Open Access Journals (Sweden)

    Shen Gu

    2016-11-01

    Full Text Available Chromosomal insertions are genomic rearrangements with a chromosome segment inserted into a non-homologous chromosome or a non-adjacent locus on the same chromosome or the other homologue, constituting ~2% of nonrecurrent copy-number gains. Little is known about the molecular mechanisms of their formation. We identified 16 individuals with complex insertions among 56,000 individuals tested at Baylor Genetics using clinical array comparative genomic hybridization (aCGH and fluorescence in situ hybridization (FISH. Custom high-density aCGH was performed on 10 individuals with available DNA, and breakpoint junctions were fine-mapped at nucleotide resolution by long-range PCR and DNA sequencing in 6 individuals to glean insights into potential mechanisms of formation. We observed microhomologies and templated insertions at the breakpoint junctions, resembling the breakpoint junction signatures found in complex genomic rearrangements generated by replication-based mechanism(s with iterative template switches. In addition, we analyzed 5 families with apparently balanced insertion in one parent detected by FISH analysis and found that 3 parents had additional small copy-number variants (CNVs at one or both sides of the inserting fragments as well as at the inserted sites. We propose that replicative repair can result in interchromosomal complex insertions generated through chromothripsis-like chromoanasynthesis involving two or three chromosomes, and cause a significant fraction of apparently balanced insertions harboring small flanking CNVs.

  12. Insertion device and method for accurate and repeatable target insertion

    Science.gov (United States)

    Gubeli, III, Joseph F.; Shinn, Michelle D.; Bevins, Michael E.; Dillon-Townes, Lawrence; Neil, George R.

    2017-07-04

    The present invention discloses a device and a method for inserting and positioning a target within a free electron laser, particle accelerator, or other such device that generates or utilizes a beam of energy or particles. The system includes a three-point registration mechanism that insures angular and translational accuracy and repeatability of positioning upon multiple insertions within the same structure.

  13. jMHC: software assistant for multilocus genotyping of gene families using next-generation amplicon sequencing.

    Science.gov (United States)

    Stuglik, Michał T; Radwan, Jacek; Babik, Wiesław

    2011-07-01

    Genotyping of multilocus gene families, such as the major histocompatibility complex (MHC), may be challenging because of problems with assigning alleles to loci and copy number variation among individuals. Simultaneous amplification and genotyping of multiple loci may be necessary, and in such cases, next-generation deep amplicon sequencing offers a great promise as a genotyping method of choice. Here, we describe jMHC, a computer program developed for analysing and assisting in the visualization of deep amplicon sequencing data. Software operates on FASTA files; therefore, output from any sequencing technology may be used. jMHC was designed specifically for MHC studies but it may be useful for analysing amplicons derived from other multigene families or for genotyping other polymorphic systems. The program is written in Java with user-friendly graphical interface (GUI) and can be run on Microsoft Windows, Linux OS and Mac OS. © 2011 Blackwell Publishing Ltd.

  14. Relocation of a rust resistance gene R 2 and its marker-assisted gene pyramiding in confection sunflower (Helianthus annuus L.).

    Science.gov (United States)

    Qi, L L; Ma, G J; Long, Y M; Hulke, B S; Gong, L; Markell, S G

    2015-03-01

    The rust resistance gene R 2 was reassigned to linkage group 14 of the sunflower genome. DNA markers linked to R 2 were identified and used for marker-assisted gene pyramiding in a confection type genetic background. Due to the frequent evolution of new pathogen races, sunflower rust is a recurring threat to sunflower production worldwide. The inbred line Morden Cross 29 (MC29) carries the rust resistance gene, R 2 , conferring resistance to numerous races of rust fungus in the US, Canada, and Australia, and can be used as a broad-spectrum resistance resource. Based on phenotypic assessments and SSR marker analyses on the 117 F2 individuals derived from a cross of HA 89 with MC29 (USDA), R 2 was mapped to linkage group (LG) 14 of the sunflower, and not to the previously reported location on LG9. The closest SSR marker HT567 was located at 4.3 cM distal to R 2 . Furthermore, 36 selected SNP markers from LG14 were used to saturate the R 2 region. Two SNP markers, NSA_002316 and SFW01272, flanked R 2 at a genetic distance of 2.8 and 1.8 cM, respectively. Of the three closely linked markers, SFW00211 amplified an allele specific for the presence of R 2 in a marker validation set of 46 breeding lines, and SFW01272 was also shown to be diagnostic for R 2 . These newly developed markers, together with the previously identified markers linked to the gene R 13a , were used to screen 524 F2 individuals from a cross of a confection R 2 line and HA-R6 carrying R 13a . Eleven homozygous double-resistant F2 plants with the gene combination of R 2 and R 13a were obtained. This double-resistant line will be extremely useful in confection sunflower, where few rust R genes are available, risking evolution of new virulence phenotypes and further disease epidemics.

  15. Association between leukaemia inhibitory factor gene polymorphism and pregnancy outcomes after assisted reproduction techniques.

    Science.gov (United States)

    Oliveira, Joao Batista A; Vagnini, Laura D; Petersen, Claudia G; Renzi, Adriana; Oliveira-Pelegrin, Gabriela R; Mauri, Ana L; Ricci, Juliana; Massaro, Fabiana C; Dieamant, Felipe; Cavagna, Mario; Baruffi, Ricardo L R; Franco, Jose G

    2016-01-01

    Certain gene polymorphisms are associated with implantation failure and pregnancy loss. Studies of leukaemia inhibitory factor (LIF) gene polymorphisms are scarce. The LIF single nucleotide polymorphism (SNP) thymine (T)/guanine (G) (rs929271) was studied in women to determine whether an association existed with pregnancy outcomes after intracytoplasmic sperm injection (ICSI); 411 women who underwent ICSI were recruited. DNA was extracted from the peripheral blood, and the LIF gene SNP T/G (rs929271) was genotyped using real-time polymerase chain reaction. Participants were divided into three groups according to their LIF genotype: T/T (n = 168), T/G (n = 202) and G/G (n = 41). All IVF and ICSI procedures were carried out under the same clinical and laboratory conditions. The ICSI cumulative results (from fresh plus frozen cycles) of each genotype group were analysed. The G/G genotype in women was associated with a higher implantation rate (T/T: 15.9%, T/G: 16.2%, G/G: 27.0%; P Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.

  16. Insertions or Deletions (Indels) in the rrn 16S-23S rRNA Gene Internal Transcribed Spacer Region (ITS) Compromise the Typing and Identification of Strains within the Acinetobacter calcoaceticus-baumannii (Acb) Complex and Closely Related Members

    Science.gov (United States)

    Maslunka, Christopher; Gifford, Bianca; Tucci, Joseph; Gürtler, Volker; Seviour, Robert J.

    2014-01-01

    To determine whether ITS sequences in the rrn operon are suitable for identifying individual Acinetobacter Acb complex members, we analysed length and sequence differences between multiple ITS copies within the genomes of individual strains. Length differences in ITS reported previously between A. nosocomialis BCRC15417T (615 bp) and other strains (607 bp) can be explained by presence of an insertion (indel 13i/1) in the longer ITS variant. The same Indel 13i/1 was also found in ITS sequences of ten strains of A. calcoaceticus, all 639 bp long, and the 628 bp ITS of Acinetobacter strain BENAB127. Four additional indels (13i/2–13i/5) were detected in Acinetobacter strain c/t13TU 10090 ITS length variants (608, 609, 620, 621 and 630 bp). These ITS variants appear to have resulted from horizontal gene transfer involving other Acinetobacter species or in some cases unrelated bacteria. Although some ITS copies in strain c/t13TU 10090 are of the same length (620 bp) as those in Acinetobacter strains b/n1&3, A. pittii (10 strains), A. calcoaceticus and A. oleivorans (not currently acknowledged as an Acb member), their individual ITS sequences differ. Thus ITS length by itself can not by itself be used to identify Acb complex strains. A shared indel in ITS copies in two separate Acinetobacter species compromises the specificity of ITS targeted probes, as shown with the Aun-3 probe designed to target the ITS in A. pitti. The presence of indel 13i/5 in the ITS of Acinetobacter strain c/t13TU means it too responded positively to this probe. Thus, neither ITS sequencing nor the currently available ITS targeted probes can distinguish reliably between Acb member species. PMID:25141005

  17. Laser-induced Stress Wave-assisted Gene Transfection with Cationic Liposome

    Science.gov (United States)

    Terakawa, Mitsuhiro; Otsuka, Risa; Sato, Shunichi; Satoh, Yasushi; Takishima, Kunio; Ashida, Hiroshi; Okano, Hideyuki; Obara, Minoru

    2007-12-01

    We showed that efficiency of gene transfer using laser-induced stress waves (LISWs) can be drastically enhanced by modifying plasmid DNA with cationic liposome. Cultured NIH 3T3 cells were covered with a suspension including plasmid DNA that had been modified with Lipofectamine, and a laser target was placed over the suspension. The cells were exposed to stress waves generated by irradiation of the laser target with 6-ns laser pulses. The cells showed a significantly higher transfection efficiency compared with that of cells treated with LISWs alone or Lipofectamine alone.

  18. Direct visualization of electroporation-assisted in vivo gene delivery to tumors using intravital microscopy – spatial and time dependent distribution

    Directory of Open Access Journals (Sweden)

    Dachs Gabi U

    2004-11-01

    Full Text Available Abstract Background Electroporation is currently receiving much attention as a way to increase drug and DNA delivery. Recent studies demonstrated the feasibility of electrogene therapy using a range of therapeutic genes for the treatment of experimental tumors. However, the transfection efficiency of electroporation-assisted DNA delivery is still low compared to viral methods and there is a clear need to optimize this approach. In order to optimize treatment, knowledge about spatial and time dependency of gene expression following delivery is of utmost importance in order to improve gene delivery. Intravital microscopy of tumors growing in dorsal skin fold window chambers is a useful method for monitoring gene transfection, since it allows non-invasive dynamic monitoring of gene expression in tumors in a live animal. Methods Intravital microscopy was used to monitor real time spatial distribution of the green fluorescent protein (GFP and time dependence of transfection efficiency in syngeneic P22 rat tumor model. DNA alone, liposome-DNA complexes and electroporation-assisted DNA delivery using two different sets of electric pulse parameters were compared. Results Electroporation-assisted DNA delivery using 8 pulses, 600 V/cm, 5 ms, 1 Hz was superior to other methods and resulted in 22% increase in fluorescence intensity in the tumors up to 6 days post-transfection, compared to the non-transfected area in granulation tissue. Functional GFP was detected within 5 h after transfection. Cells expressing GFP were detected throughout the tumor, but not in the surrounding tissue that was not exposed to electric pulses. Conclusions Intravital microscopy was demonstrated to be a suitable method for monitoring time and spatial distribution of gene expression in experimental tumors and provided evidence that electroporation-assisted gene delivery using 8 pulses, 600 V/cm, 5 ms, 1 Hz is an effective method, resulting in early onset and homogenous

  19. Targeted gene transfer in eucaryotic cells by dye-assisted laser optoporation.

    Science.gov (United States)

    Palumbo, G; Caruso, M; Crescenzi, E; Tecce, M F; Roberti, G; Colasanti, A

    1996-10-01

    The blue beam of an Argon laser (488 nm) has been focused on the cell membrane in the presence of phenol-red, an usual component of cell culture media, through a 100 x objective. At the site of the beam impact, due probably to local temperature changes, the cell membrane modifies its permeability. As a consequence of the hit, circular areas, whose radius may be apparently regulated by changing the irradiation time and/or the radiation intensity (energy), appear on the wall, last for a short time and fade spontaneously within 1-2 minutes. No evident sings of cell injury or hurt have been observed afterward. Plasmid DNA, purposely added to culture fluid, easily slips in the cytoplasm; utilizing such approach, thereafter indicated as "optoporation', we have successfully transfected two genes, namely beta-galactosidase and chloramphenicol-acetyl-transferase in murine NIH3T3 fibroblasts. Therefore optoporation represents an additional procedure for gene transfer with several advantages over already available methods: (1) it only takes advantage of the presence of phenol-red, a normal cell medium component, with no need of addition of extraneous substances; (2) it is a very mild treatment virtually suitable for any cell type and (3) it allows transfection of selected cells even in the presence of cells of different type (providing that they are morphologically distinguishable).

  20. Combining M-FISH and Quantum Dot technology for fast chromosomal assignment of transgenic insertions

    Directory of Open Access Journals (Sweden)

    Yusuf Mohammed

    2011-12-01

    Full Text Available Abstract Background Physical mapping of transgenic insertions by Fluorescence in situ Hybridization (FISH is a reliable and cost-effective technique. Chromosomal assignment is commonly achieved either by concurrent G-banding or by a multi-color FISH approach consisting of iteratively co-hybridizing the transgenic sequence of interest with one or more chromosome-specific probes at a time, until the location of the transgenic insertion is identified. Results Here we report a technical development for fast chromosomal assignment of transgenic insertions at the single cell level in mouse and rat models. This comprises a simplified 'single denaturation mixed hybridization' procedure that combines multi-color karyotyping by Multiplex FISH (M-FISH, for simultaneous and unambiguous identification of all chromosomes at once, and the use of a Quantum Dot (QD conjugate for the transgene detection. Conclusions Although the exploitation of the unique optical properties of QD nanocrystals, such as photo-stability and brightness, to improve FISH performance generally has been previously investigated, to our knowledge this is the first report of a purpose-designed molecular cytogenetic protocol in which the combined use of QDs and standard organic fluorophores is specifically tailored to assist gene transfer technology.

  1. Gene analysis using mass spectrometric cleaved amplified polymorphic sequence (MS-CAPS) with matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF).

    Science.gov (United States)

    Kajiwara, Hideyuki

    2015-01-01

    Mass spectrometric cleaved amplified polymorphic sequence (MS-CAPS) is a method for detecting genes using a combination of short PCR and matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS). MS-CAPS can identify a single nucleotide polymorphism (SNP) in less than one hour and is suitable for plants, animals, bacteria, and food.

  2. Development of a gene-centered ssr atlas as a resource for papaya (Carica papaya) marker-assisted selection and population genetic studies.

    Science.gov (United States)

    Vidal, Newton Medeiros; Grazziotin, Ana Laura; Ramos, Helaine Christine Cancela; Pereira, Messias Gonzaga; Venancio, Thiago Motta

    2014-01-01

    Carica papaya (papaya) is an economically important tropical fruit. Molecular marker-assisted selection is an inexpensive and reliable tool that has been widely used to improve fruit quality traits and resistance against diseases. In the present study we report the development and validation of an atlas of papaya simple sequence repeat (SSR) markers. We integrated gene predictions and functional annotations to provide a gene-centered perspective for marker-assisted selection studies. Our atlas comprises 160,318 SSRs, from which 21,231 were located in genic regions (i.e. inside exons, exon-intron junctions or introns). A total of 116,453 (72.6%) of all identified repeats were successfully mapped to one of the nine papaya linkage groups. Primer pairs were designed for markers from 9,594 genes (34.5% of the papaya gene complement). Using papaya-tomato orthology assessments, we assembled a list of 300 genes (comprising 785 SSRs) potentially involved in fruit ripening. We validated our atlas by screening 73 SSR markers (including 25 fruit ripening genes), achieving 100% amplification rate and uncovering 26% polymorphism rate between the parental genotypes (Sekati and JS12). The SSR atlas presented here is the first comprehensive gene-centered collection of annotated and genome positioned papaya SSRs. These features combined with thousands of high-quality primer pairs make the atlas an important resource for the papaya research community.

  3. Development of a gene-centered ssr atlas as a resource for papaya (Carica papaya marker-assisted selection and population genetic studies.

    Directory of Open Access Journals (Sweden)

    Newton Medeiros Vidal

    Full Text Available Carica papaya (papaya is an economically important tropical fruit. Molecular marker-assisted selection is an inexpensive and reliable tool that has been widely used to improve fruit quality traits and resistance against diseases. In the present study we report the development and validation of an atlas of papaya simple sequence repeat (SSR markers. We integrated gene predictions and functional annotations to provide a gene-centered perspective for marker-assisted selection studies. Our atlas comprises 160,318 SSRs, from which 21,231 were located in genic regions (i.e. inside exons, exon-intron junctions or introns. A total of 116,453 (72.6% of all identified repeats were successfully mapped to one of the nine papaya linkage groups. Primer pairs were designed for markers from 9,594 genes (34.5% of the papaya gene complement. Using papaya-tomato orthology assessments, we assembled a list of 300 genes (comprising 785 SSRs potentially involved in fruit ripening. We validated our atlas by screening 73 SSR markers (including 25 fruit ripening genes, achieving 100% amplification rate and uncovering 26% polymorphism rate between the parental genotypes (Sekati and JS12. The SSR atlas presented here is the first comprehensive gene-centered collection of annotated and genome positioned papaya SSRs. These features combined with thousands of high-quality primer pairs make the atlas an important resource for the papaya research community.

  4. Gas turbine vane cooling air insert

    Energy Technology Data Exchange (ETDEWEB)

    North, W.E.; Hultgren, K.G.; Dishman, C.D.; Van Heusden, G.S.

    1992-09-08

    This patent describes a gas turbine. It comprises turbine vanes, each of the vanes supplied with cooling air and having: an airfoil portion forming a first cavity having an insert disposed therein for directing the flow of the cooling air, the insert having first and second insert ends; a shroud portion from which the airfoil portion extends, the insert attached to the shroud portion at the first insert end; an insert extension extending through a portion of the insert and extending beyond the first insert end, the insert extension and the insert forming an annular gap therebetween separating the insert from the insert extension; a plate covering at least a portion of the shroud, the plate having a first hole formed therein through which the insert extension extends; and at least a first seal extending between the insert extension and the insert, and sealing the annular gap therebetween. This patent also describes a method of making a gas turbine. It comprises welding a first tubular insert adjacent its first end to a vane outer shroud; partially inserting a second tubular insert into the first tubular member and attaching the second tubular insert thereto; placing a plate having a hole formed therein on the outer shroud so that the hole surrounds the second tubular insert; and attaching the second tubular insert to the plate by placing a first seal between the first and second tubular inserts and attaching the first seal to each of the first and second tubular inserts, and placing a second seal between the second tubular insert and the plate and welding the second seal to the second tubular insert and the plate.

  5. [Intracavitary electrocardiogram during the insertion of peripherally inserted central catheters].

    Science.gov (United States)

    Ortiz-Miluy, Gloria; Sánchez-Guerra, Carmen

    2013-01-01

    To evaluate the applicability, feasibility and accuracy of the IC-ECG with column of saline technique for verifying the final tip position of peripherally inserted central catheters (PICC) by specialist nurses. A total of 99 consecutive PICC were inserted. Patients with no superficial ECG P wave, atrial fibrillation, or a pacemaker were excluded. The IC-ECG technique was performed on 84 patients. A chest x-ray was performed after insertion in all cases, in order to compare images with IC-ECG. The technique showed an applicability of 84.4%, an feasibility of 88%, and an accuracy of 87.8%. The IC-ECG technique for verification of catheter PICC tip locations with column of saline is easy to apply, is cost-effective, is achievable by nurses, and does not involve any risk for patients. The technique involves a learning curve, and it must be performed by qualified health care professionals. The technique is performed during the insertion of the catheter, so verification of the tip is made in situ. It reduces future re-insertions due to wrong positioning of the tip. Copyright © 2013 Elsevier España, S.L. All rights reserved.

  6. Velamentous and Furcate Cord Insertion with Placenta Accreta in an IVF Pregnancy with Unicornuate Uterus

    Directory of Open Access Journals (Sweden)

    Mehmet Tunç Canda

    2013-01-01

    Full Text Available Velamentous and furcate cord insertion with concomitant placenta accreta is a very rare and life-threatening event of pregnancy for both the mother and the fetus. Obstetricians should be cautious about umbilical cord insertion and placental adherence abnormalities in pregnancies conceived by assisted reproductive technologies (ART particularly in women with Müllerian anomalies.

  7. Velamentous and Furcate Cord Insertion with Placenta Accreta in an IVF Pregnancy with Unicornuate Uterus.

    Science.gov (United States)

    Canda, Mehmet Tunç; Demir, Namık; Doganay, Latife

    2013-01-01

    Velamentous and furcate cord insertion with concomitant placenta accreta is a very rare and life-threatening event of pregnancy for both the mother and the fetus. Obstetricians should be cautious about umbilical cord insertion and placental adherence abnormalities in pregnancies conceived by assisted reproductive technologies (ART) particularly in women with Müllerian anomalies.

  8. Analysis of the Sherlock II tip location system for inserting peripherally inserted central venous catheters.

    Science.gov (United States)

    Lelkes, Valdis; Kumar, Abhishek; Shukla, Pratik A; Contractor, Sohail; Rutan, Thomas

    2013-01-01

    Peripherally inserted central catheters (PICCs) are frequently placed at the bedside. The purpose of our study was to evaluate the efficacy of the Sherlock II tip location system (Bard Access Systems, Salt Lake City, UT), which offers electromagnetic detection of the PICC tip to assist the operator in guiding the tip to a desired location. We performed a retrospective review of patients who had a bedside PICC using the Sherlock II tip location system. Three hundred seventy-five of 384 patients (97.7%) had the catheter tip positioned appropriately. Our results suggest that the Sherlock II tip location system is an efficacious system for bedside PICC placement. Published by Elsevier Inc.

  9. A novel seven-octapeptide repeat insertion in the prion protein gene (PRNP) in a Dutch pedigree with Gerstmann-Sträussler-Scheinker disease phenotype: comparison with similar cases from the literature

    NARCIS (Netherlands)

    Jansen, Casper; Voet, Willem; Head, Mark W.; Parchi, Piero; Yull, Helen; Verrips, Aad; Wesseling, Pieter; Meulstee, Jan; Baas, Frank; van Gool, Willem A.; Ironside, James W.; Rozemuller, Annemieke J. M.

    2011-01-01

    Human prion diseases can be sporadic, inherited or acquired by infection and show considerable phenotypic heterogeneity. We describe the clinical, histopathological and pathological prion protein (PrP(Sc)) characteristics of a Dutch family with a novel 7-octapeptide repeat insertion (7-OPRI) in

  10. A novel seven-octapeptide repeat insertion in the prion protein gene (PRNP) in a Dutch pedigree with Gerstmann-Straussler-Scheinker disease phenotype: comparison with similar cases from the literature

    NARCIS (Netherlands)

    Jansen, C.; Voet, W.; Head, M.W.; Parchi, P.; Yull, H.; Verrips, A.; Wesseling, P.; Meulstee, J.; Baas, F.; Gool, W.A. van; Ironside, J.W.; Rozemuller, A.J.

    2011-01-01

    Human prion diseases can be sporadic, inherited or acquired by infection and show considerable phenotypic heterogeneity. We describe the clinical, histopathological and pathological prion protein (PrP(Sc)) characteristics of a Dutch family with a novel 7-octapeptide repeat insertion (7-OPRI) in

  11. The polymorphic insertion of the luteinizing hormone receptor “insLQ” show a negative association to LHR gene expression and to the follicular fluid hormonal profile in human small antral follicles

    DEFF Research Database (Denmark)

    Borgbo, T.; Chrudimska, J.; Macek, M.

    2018-01-01

    The luteinizing hormone receptor (LHCGR) has a little studied polymorphic 6 bp insertion (rs4539842/insLQ). This study has evaluated the insLQ polymorphism in relation to potential associations with hormonal characteristics of human small antral follicles (hSAFs). In total, 310 hSAFs were collected...

  12. A plasmid containing the human metallothionein II gene can function as an antibody-assisted electrophoretic biosensor for heavy metals.

    Science.gov (United States)

    Wooten, Dennis C; Starr, Clarise R; Lyon, Wanda J

    2016-01-01

    Different forms of heavy metals affect biochemical systems in characteristic ways that cannot be detected with typical metal analysis methods like atomic absorption spectrometry. Further, using living systems to analyze interaction of heavy metals with biochemical systems can be laborious and unreliable. To generate a reliable easy-to-use biologically-based biosensor system, the entire human metallothionein-II (MT-II) gene was incorporated into a plasmid (pUC57-MT) easily replicated in Escherichia coli. In this system, a commercial polyclonal antibody raised against human metal-responsive transcription factor-1 protein (MTF-1 protein) could modify the electrophoretic migration patterns (i.e. cause specific decreases in agarose gel electrophoretic mobility) of the plasmid in the presence or absence of heavy metals other than zinc (Zn). In the study here, heavy metals, MTF-1 protein, and polyclonal anti-MTF-1 antibody were used to assess pUC57-MT plasmid antibody-assisted electrophoretic mobility. Anti-MTF-1 antibody bound both MTF-1 protein and pUC57-MT plasmid in a non-competitive fashion such that it could be used to differentiate specific heavy metal binding. The results showed that antibody-inhibited plasmid migration was heavy metal level-dependent. Zinc caused a unique mobility shift pattern opposite to that of other metals tested, i.e. Zn blocked the antibody ability to inhibit plasmid migration, despite a greatly increased affinity for DNA by the antibody when Zn was present. The Zn effect was reversed/modified by adding MTF-1 protein. Additionally, antibody inhibition of plasmid mobility was resistant to heat pre-treatment and trypsinization, indicating absence of residual DNA extraction-resistant bacterial DNA binding proteins. DNA binding by anti-DNA antibodies may be commonly enhanced by xenobiotic heavy metals and elevated levels of Zn, thus making them potentially effective tools for assessment of heavy metal bioavailability in aqueous solutions and

  13. Concepts for stereoselective acrylate insertion

    KAUST Repository

    Neuwald, Boris

    2013-01-23

    Various phosphinesulfonato ligands and the corresponding palladium complexes [{((PaO)PdMeCl)-μ-M}n] ([{( X1-Cl)-μ-M}n], (PaO) = κ2- P,O-Ar2PC6H4SO2O) with symmetric (Ar = 2-MeOC6H4, 2-CF3C6H4, 2,6-(MeO)2C6H3, 2,6-(iPrO)2C 6H3, 2-(2′,6′-(MeO)2C 6H3)C6H4) and asymmetric substituted phosphorus atoms (Ar1 = 2,6-(MeO)2C6H 3, Ar2 = 2′-(2,6-(MeO)2C 6H3)C6H4; Ar1 = 2,6-(MeO)2C6H3, Ar2 = 2-cHexOC 6H4) were synthesized. Analyses of molecular motions and dynamics by variable temperature NMR studies and line shape analysis were performed for the free ligands and the complexes. The highest barriers of ΔGa = 44-64 kJ/mol were assigned to an aryl rotation process, and the flexibility of the ligand framework was found to be a key obstacle to a more effective stereocontrol. An increase of steric bulk at the aryl substituents raises the motional barriers but diminishes insertion rates and regioselectivity. The stereoselectivity of the first and the second methyl acrylate (MA) insertion into the Pd-Me bond of in situ generated complexes X1 was investigated by NMR and DFT methods. The substitution pattern of the ligand clearly affects the first MA insertion, resulting in a stereoselectivity of up to 6:1 for complexes with an asymmetric substituted phosphorus. In the consecutive insertion, the stereoselectivity is diminished in all cases. DFT analysis of the corresponding insertion transition states revealed that a selectivity for the first insertion with asymmetric (P aO) complexes is diminished in the consecutive insertions due to uncooperatively working enantiomorphic and chain end stereocontrol. From these observations, further concepts are developed. © 2012 American Chemical Society.

  14. Assessment of Tools for Marker-Assisted Selection in a Marine Commercial Species: Significant Association between MSTN-1 Gene Polymorphism and Growth Traits

    Directory of Open Access Journals (Sweden)

    Irma Sánchez-Ramos

    2012-01-01

    Full Text Available Growth is a priority trait from the point of view of genetic improvement. Molecular markers linked to quantitative trait loci (QTL have been regarded as useful for marker-assisted selection in complex traits as growth. Polymorphisms have been studied in five candidate genes influencing growth in gilthead seabream (Sparus aurata: the growth hormone (GH, insulin-like growth factor-1 (IGF-1, myostatin (MSTN-1, prolactin (PRL, and somatolactin (SL genes. Specimens evaluated were from a commercial broodstock comprising 131 breeders (from which 36 males and 44 females contributed to the progeny. In all samples eleven gene fragments, covering more than 13,000 bp, generated by PCR-RFLP, were analyzed; tests were made for significant associations between these markers and growth traits. ANOVA results showed a significant association between MSTN-1 gene polymorphism and growth traits. Pairwise tests revealed several RFLPs in the MSTN-1 gene with significant heterogeneity of genotypes among size groups. PRL and MSTN-1 genes presented linkage disequilibrium. The MSTN-1 gene was mapped in the centromeric region of a medium-size acrocentric chromosome pair.

  15. Assessment of tools for marker-assisted selection in a marine commercial species: significant association between MSTN-1 gene polymorphism and growth traits.

    Science.gov (United States)

    Sánchez-Ramos, Irma; Cross, Ismael; Mácha, Jaroslav; Martínez-Rodríguez, Gonzalo; Krylov, Vladimir; Rebordinos, Laureana

    2012-01-01

    Growth is a priority trait from the point of view of genetic improvement. Molecular markers linked to quantitative trait loci (QTL) have been regarded as useful for marker-assisted selection in complex traits as growth. Polymorphisms have been studied in five candidate genes influencing growth in gilthead seabream (Sparus aurata): the growth hormone (GH), insulin-like growth factor-1 (IGF-1), myostatin (MSTN-1), prolactin (PRL), and somatolactin (SL) genes. Specimens evaluated were from a commercial broodstock comprising 131 breeders (from which 36 males and 44 females contributed to the progeny). In all samples eleven gene fragments, covering more than 13,000 bp, generated by PCR-RFLP, were analyzed; tests were made for significant associations between these markers and growth traits. ANOVA results showed a significant association between MSTN-1 gene polymorphism and growth traits. Pairwise tests revealed several RFLPs in the MSTN-1 gene with significant heterogeneity of genotypes among size groups. PRL and MSTN-1 genes presented linkage disequilibrium. The MSTN-1 gene was mapped in the centromeric region of a medium-size acrocentric chromosome pair.

  16. Allelic prevalence of intron 3 insertion/deletion genetic ...

    African Journals Online (AJOL)

    Allelic prevalence of intron 3 insertion/deletion genetic polymorphism of DNA double-strand break repair gene XRCC4 in four healthy Iranian populations. ... Conclusion: Although there is a significant heterogeneity between Iranian populations, the Del allele shows high prevalence among Iranian populations, which is ...

  17. NOVEL INSERTION SEQUENCE-LIKE ELEMENT IS982 IN LACTOCOCCI

    NARCIS (Netherlands)

    YU, WZ; MIERAU, [No Value; MARS, A; JOHNSON, E; DUNNY, G; MCKAY, LL

    A novel insertion sequence-like (IS) element, designated IS982, was found on the lactose plasmid, pSK11L, from Lactococcus lactis subsp. cremoris SK11 and was located between the origin of replication and the oligopeptide transport gene cluster. The 1003-base pair (bp) IS982 was flanked by 18-bp

  18. Transposable element insertions have strongly affected human evolution

    Science.gov (United States)

    Britten, Roy J.

    2010-01-01

    Comparison of a full collection of the transposable element (TE) sequences of vertebrates with genome sequences shows that the human genome makes 655 perfect full-length matches. The cause is that the human genome contains many active TEs that have caused TE inserts in relatively recent times. These TE inserts in the human genome are several types of young Alus (AluYa5, AluYb8, AluYc1, etc.). Work in many laboratories has shown that such inserts have many effects including changes in gene expression, increases in recombination, and unequal crossover. The time of these very effective changes in the human lineage genome extends back about 4 million years according to these data and very likely much earlier. Rapid human lineage-specific evolution, including brain size is known to have also occurred in the last few million years. Alu insertions likely underlie rapid human lineage evolution. They are known to have many effects. Examples are listed in which TE sequences have influenced human-specific genes. The proposed model is that the many TE insertions created many potentially effective changes and those selected were responsible for a part of the striking human lineage evolution. The combination of the results of these events that were selected during human lineage evolution was apparently effective in producing a successful and rapidly evolving species. PMID:21041622

  19. Patterns of transposable element expression and insertion in cancer

    Directory of Open Access Journals (Sweden)

    Evan A Clayton

    2016-11-01

    Full Text Available Human transposable element (TE activity in somatic tissues causes mutations that can contribute to tumorigenesis. Indeed, TE insertion mutations have been implicated in the etiology of a number of different cancer types. Nevertheless, the full extent of somatic TE activity, along with its relationship to tumorigenesis, have yet to be fully explored. Recent developments in bioinformatics software make it possible to analyze TE expression levels and TE insertional activity directly from transcriptome (RNA-seq and whole genome (DNA-seq next-generation sequence data. We applied these new sequence analysis techniques to matched normal and primary tumor patient samples from the Cancer Genome Atlas (TCGA in order to analyze the patterns of TE expression and insertion for three cancer types: breast invasive carcinoma, head and neck squamous cell carcinoma, and lung adenocarcinoma. Our analysis focused on the three most abundant families of active human TEs: Alu, SVA and L1. We found evidence for high levels of somatic TE activity for these three families in normal and cancer samples across diverse tissue types. Abundant transcripts for all three TE families were detected in both normal and cancer tissues along with an average of ~80 unique TE insertions per individual patient/tissue. We observed an increase in L1 transcript expression and L1 insertional activity in primary tumor samples for all three cancer types. Tumor-specific TE insertions are enriched for private mutations, consistent with a potentially causal role in tumorigenesis. We used genome feature analysis to investigate two specific cases of putative cancer-causing TE mutations in further detail. An Alu insertion in an upstream enhancer of the CBL tumor suppressor gene is associated with down-regulation of the gene in a single breast cancer patient, and an L1 insertion in the first exon of the BAALC gene also disrupts its expression in head and neck squamous cell carcinoma. Our results are

  20. The first LHC insertion quadrupole

    CERN Multimedia

    2004-01-01

    An important milestone was reached in December 2003 at the CERN Magnet Assembly Facility. The team from the Accelerator Technology - Magnet and Electrical Systems group, AT-MEL, completed the first special superconducting quadrupole for the LHC insertions which house the experiments and major collider systems. The magnet is 8 metres long and contains two matching quadrupole magnets and an orbit corrector, a dipole magnet, used to correct errors in quadrupole alignment. All were tested in liquid helium and reached the ultimate performance criteria required for the LHC. After insertion in the cryostat, the superconducting magnet will be installed as the Q9 quadrupole in sector 7-8, the first sector of the LHC to be put in place in 2004. Members of the quadrupole team, from the AT-MEL group, gathered around the Q9 quadrupole at its inauguration on 12 December 2003 in building 181.

  1. Genotyping for Glycophorin GYP(B-A-B) Hybrid Genes Using a Single Nucleotide Polymorphism-Based Algorithm by Matrix-Assisted Laser Desorption/Ionisation, Time-of-Flight Mass Spectrometry.

    Science.gov (United States)

    Wei, Ling; Lopez, Genghis H; Ji, Yanli; Condon, Jennifer A; Irwin, Darryl L; Luo, Guangping; Hyland, Catherine A; Flower, Robert L

    2016-10-01

    The genetic basis for five GP(B-A-B) MNS system hybrid glycophorin blood group antigens results from rearrangement between the homologous GYPA and GYPB genes. Each hybrid glycophorin displays a characteristic profile of antigens. Currently, no commercial serological reagents are currently available to serologically type for these antigens. The aim of this study was to develop a single nucleotide polymorphism (SNP) mapping genotyping technique to allow characterisation of various GYP(B-A-B) hybrid alleles. Matrix-assisted laser desorption/ionisation time-of-flight (MALDI-TOF) mass spectrometry (MS) assays were designed to genotype five GYP(B-A-B) hybrid alleles. Eight nucleotide positions were targeted and incorporated into the SNP mapping protocol. The allelic frequencies were calculated using peak areas. Sanger sequencing was performed to resolve a GYP*Hop 3' breakpoint. Observed allelic peak area ratios either coincided with the expected ratio or were skewed (above or below) from the expected ratio with switching occurring at and after the expected break point to generate characteristic mass spectral plots for each hybrid. Sequencing showed that the GYP*Hop crossover in the intron 3 region, for this example, was identical to that for GYP*Bun reference sequence. An analytical algorithm using MALDI-TOF MS genotyping platform defined GYPA inserts for five GYP(B-A-B) hybrids. The SNP mapping technique described here demonstrates proof of concept that this technology is viable for genotyping hybrid glycophorins, GYP(A-B-A), GYP(A-B) and GYP(B-A), and addresses the gap in current typing technologies.

  2. Development of a high-efficient transformation system of Bacillus pumilus strain DX01 to facilitate gene isolation via gfp-tagged insertional mutagenesis and visualize bacterial colonization of rice roots.

    Science.gov (United States)

    Shen, Xinqian; Chen, Yunpeng; Liu, Tong; Hu, Xiaolu; Gu, Zhenfang

    2013-09-01

    A Tn5 transposition vector, pMOD-tet-egfp, was constructed and used for the random insertional mutagenesis of Bacillus pumilus. Various parameters were investigated to increase the transformation efficiency B. pumilus DX01 via Tn5 transposition complexes (transposome): bacterial growth phase, type of electroporation buffer, electric field strength, and recovery medium. Transformation efficiency was up to 3 × 10(4) transformants/μg of DNA under the optimized electroporation conditions, and a total of 1,467 gfp-tagged transformants were obtained. Fluorescence-activated cell sorting analysis showed that all gfp-tagged bacterial cells expressed GFP, indicating that foreign DNA has been successfully integrated into the genome of B. pumilus and expressed. Finally, flanking DNA sequences were isolated from several transformants and colonization of rice roots by B. pumilus DX01 was also studied. The method developed here will be useful for creating an insertion mutant library of gram-positive bacteria, thus facilitating their molecular genetic and cytological studies.

  3. Large-scale analysis of differential gene expression in coffee genotypes resistant and susceptible to leaf miner–toward the identification of candidate genes for marker assisted-selection

    Science.gov (United States)

    2014-01-01

    Background A successful development of herbivorous insects into plant tissues depends on coordination of metabolic processes. Plants have evolved complex mechanisms to recognize such attacks, and to trigger a defense response. To understand the transcriptional basis of this response, we compare gene expression profiles of two coffee genotypes, susceptible and resistant to leaf miner (Leucoptera coffella). A total of 22000 EST sequences from the Coffee Genome Database were selected for a microarray analysis. Fluorescence probes were synthesized using mRNA from the infested and non-infested coffee plants. Array hybridization, scanning and data normalization were performed using Nimble Scan® e ArrayStar® platforms. Genes with foldchange values +/-2 were considered differentially expressed. A validation of 18 differentially expressed genes was performed in infected plants using qRT-PCR approach. Results The microarray analysis indicated that resistant plants differ in gene expression profile. We identified relevant transcriptional changes in defense strategies before insect attack. Expression changes (>2.00-fold) were found in resistant plants for 2137 genes (1266 up-regulated and 873 down-regulated). Up-regulated genes include those responsible for defense mechanisms, hypersensitive response and genes involved with cellular function and maintenance. Also, our analyses indicated that differential expression profiles between resistant and susceptible genotypes are observed in the absence of leaf-miner, indicating that defense is already build up in resistant plants, as a priming mechanism. Validation of selected genes pointed to four selected genes as suitable candidates for markers in assisted-selection of novel cultivars. Conclusions Our results show evidences that coffee defense responses against leaf-miner attack are balanced with other cellular functions. Also analyses suggest a major metabolic reconfiguration that highlights the complexity of this response. PMID

  4. Peripherally-inserted Central Catheter (PICC Insertion in Neonates: Apnea and Radiocontrasts Complications

    Directory of Open Access Journals (Sweden)

    Eissa Bilehjani

    2015-01-01

    Full Text Available The importance of pain management throughout minimally-invasive procedures such as peripherally-inserted central catheter (PICC insertion is an inevitable fact. However, administration of varied analgesics, especially opioids, in specific age ranges such as neonate could be of immense concern. Most of these patients are on different medications, especially those hospitalized in the ICUs or with critical conditions. Neonates receiving continuous opioid infusions might also require an additional opioid bolus to control the associated pain (1. Importantly, it should be taken into consideration that administration of opioids or even a light sedation would increase the risk of delayed apnea in this group of patients (2. Factors contributing to this complication include ex-premature infants (gestational age<37 weeks, premature infants younger than 46 weeks’ postconceptual age and anemia (hematocrit< 30% (3, 4. Hence, it is recommended to use other supplementary analgesic techniques including local or topical anesthesia, especially in neonates having previously received continuous or bolus opioids. Furthermore, supplementary techniques assisting the confirmation of proper placement such as overpenetrating the radiograph, lateral X-rays and positioning the infant for a lateral oblique radiograph (right side elevated at a 10°–15° angle are frequently used by clinicians to avoid administration of radiocontrasts and their associated complications. In the latter technique, catheter visualization could be enhanced as the PICC will not be superimposed over the mediastinal structures (5, 6.

  5. Elucidation of the Molecular Interaction between miRNAs and the Gene, Involved in Acute Myeloid Leukemia, by the Assistance of Argonaute Protein through a Computational Approach

    Directory of Open Access Journals (Sweden)

    Rohit Pritam Das

    2015-06-01

    Full Text Available Acute myeloid leukemia is a well characterized blood cancer in which the unnatural growth of immature white blood cell takes place, where several genes transcription is regulated by the micro RNAs (miRNAs. Argonaute (AGO protein is a protein family that binds to the miRNAs and mRNA complex where a strong binding affinity is crucial for its RNA silencing function. By understanding pattern recognition between the miRNAs-mRNA complex and its binding affinity with AGO protein, one can decipher the regulation of a particular gene and develop suitable siRNA for the same in disease condition. In the current work, HOXA9 gene has been selected from literature, whose deregulation is well-established in acute myeloid leukemia. Four miRNAs (mir-145, mir-126, let-7a, and mir-196b have been selected to target mRNA of HOXA9 (NCBI accession No. NM_152739.3. The binding interaction between mRNAs and mRNA of HOXA9 gene was studied computationally. From result, it was observed mir-145 has highest affinity for HOXA9 gene. Furthermore, the interaction between miRNAs-mRNA duplex of all chosen miRNAs are docked with AGO protein (PDB ID: 3F73, chain A to study their interaction at molecular level through an in silico approach. The residual interaction and hydrogen bonding are inspected in Discovery Studio 3.5 suites. The current investigation throws light on understanding of AGO-assisted miRNA based gene silencing mechanism in HOXA9 gene associated in acute myeloid leukemia computationally.

  6. Novel prion protein insert mutation associated with prolonged neurodegenerative illness.

    Science.gov (United States)

    Lewis, V; Collins, S; Hill, A F; Boyd, A; McLean, C A; Smith, M; Masters, C L

    2003-05-27

    Mutations in the prion protein gene (PRNP) are found in approximately 13 to 15% of persons classified as dying from a transmissible spongiform encephalopathy. Point and octapeptide repeat insert and deletion mutations are described in the open reading frame (ORF) of PRNP. The authors present a clinicopathologic study of a patient with a family history of a lengthy and progressive neurodegenerative disorder associated with a novel large octapeptide repeat insert mutation. Neuropathologic examination, including immunohistochemistry for the prion protein, was undertaken. The ORF of PRNP was amplified by PCR, cloned, and sequenced. Homogenate of cerebral tissue underwent Western blot analysis for the prion protein before and after proteinase K treatment. The proband died after a 16-year illness commencing at age 29 years. Confident premortem clinical diagnosis was not achieved despite a brain biopsy. Autopsy examination of the brain confirmed a spongiform encephalopathy. Prion protein immunohistochemistry revealed occasional granular deposits in the cerebellar granular layer. The proband was found to harbor a novel PRNP 168 base pair (bp) insert mutation. The authors have identified a novel 168 bp octapeptide repeat insert mutation. Prion protein immunohistochemistry differs from previous cases harboring seven octapeptide repeat and other long insert mutations. Optimization of PRNP analysis, especially PCR conditions, is essential to avoid overlooking this type of mutation and delay the correct molecular genetic diagnosis.

  7. Targeted introgression of a wheat stem rust resistance gene by DNA marker-assisted chromosome engineering genetics

    Science.gov (United States)

    In wheat (Triticum aestivum L.), stem rust resistance gene Sr39, derived from Aegilops speltoides Tausch, is highly resistant to multiple stem rust races including TTKSK (Ug99). However, the gene has not been used in wheat breeding because of linkage drag associated with the large 2S chromosome segm...

  8. Improvement of the insertion axis for cochlear implantation with a robot-based system.

    Science.gov (United States)

    Torres, Renato; Kazmitcheff, Guillaume; De Seta, Daniele; Ferrary, Evelyne; Sterkers, Olivier; Nguyen, Yann

    2017-02-01

    It has previously reported that alignment of the insertion axis along the basal turn of the cochlea was depending on surgeon' experience. In this experimental study, we assessed technological assistances, such as navigation or a robot-based system, to improve the insertion axis during cochlear implantation. A preoperative cone beam CT and a mastoidectomy with a posterior tympanotomy were performed on four temporal bones. The optimal insertion axis was defined as the closest axis to the scala tympani centerline avoiding the facial nerve. A neuronavigation system, a robot assistance prototype, and software allowing a semi-automated alignment of the robot were used to align an insertion tool with an optimal insertion axis. Four procedures were performed and repeated three times in each temporal bone: manual, manual navigation-assisted, robot-based navigation-assisted, and robot-based semi-automated. The angle between the optimal and the insertion tool axis was measured in the four procedures. The error was 8.3° ± 2.82° for the manual procedure (n = 24), 8.6° ± 2.83° for the manual navigation-assisted procedure (n = 24), 5.4° ± 3.91° for the robot-based navigation-assisted procedure (n = 24), and 3.4° ± 1.56° for the robot-based semi-automated procedure (n = 12). A higher accuracy was observed with the semi-automated robot-based technique than manual and manual navigation-assisted (p robot-based system reduces both the error and the variability of the alignment with a defined optimal axis.

  9. Marker-assisted selection for leaf rust resistance genes Lr19 and Lr24 in wheat (Triticum aestivum L.).

    Science.gov (United States)

    Singh, Rajender; Datta, Dibendu; Priyamvada; Singh, Somvir; Tiwari, Ratan

    2004-01-01

    Leaf rust caused by Puccinia recondita f.sp. tritici is a wheat disease of worldwide importance. Wheat genotypes known to carry specific rust resistance genes and segregating lines that originated from various cross combinations and derived from distinct F2 lineage, so as to represent a diverse genetic background, were included in the present study for validation of molecular markers for Lr19 and Lr24. STS markers detected the presence of the leaf rust resistance gene Lr19 in a Thatcher NIL (Tc*Lrl9) and Inia66//CMH81A575 and of the gene Lr24 in the genotypes Arkan, Blue Boy II, Agent and CI 17907. Validation of molecular markers for Lr19 and Lr24 in parental lines, followed by successful detection of these genes in F3 lines from various cross combinations, was carried out. The molecular test corresponded well with the host-pathogen interaction test response of these lines.

  10. Mono-allelic retrotransposon insertion addresses epigenetic transcriptional repression in human genome

    Directory of Open Access Journals (Sweden)

    Byun Hyang-Min

    2012-02-01

    Full Text Available Abstract Background Retrotransposons have been extensively studied in plants and animals and have been shown to have an impact on human genome dynamics and evolution. Their ability to move within genomes gives retrotransposons to affect genome instability. Methods we examined the polymorphic inserted AluYa5, evolutionary young Alu, in the progesterone receptor gene to determine the effects of Alu insertion on molecular environment. We used mono-allelic inserted cell lines which carry both Alu-present and Alu-absent alleles. To determine the epigenetic change and gene expression, we performed restriction enzyme digestion, Pyrosequencing, and Chromatin Immunoprecipitation. Results We observed that the polymorphic insertion of evolutionally young Alu causes increasing levels of DNA methylation in the surrounding genomic area and generates inactive histone tail modifications. Consequently the Alu insertion deleteriously inactivates the neighboring gene expression. Conclusion The mono-allelic Alu insertion cell line clearly showed that polymorphic inserted repetitive elements cause the inactivation of neighboring gene expression, bringing aberrant epigenetic changes.

  11. Mars Observer Orbit Insertion Briefing

    Science.gov (United States)

    1993-01-01

    Steve Wall is the host of this video entitled, "Return to the Red Planet". Live animation of the Mars Observer orbiting Mars is presented. Steve Wall explains the spacecraft insertion maneuver and also explains the purpose for the Mars Observer launch. Live coverage of the Cape Canaveral launch of the Mars Observer is also presented. Suzanne Dodd, Chief of the Mission Planning team describes the burn start and how the spacecraft will be captured by Mars' gravity. Glenn Cunningham, Mars Observer Project Manager, gives background information on the Mars Observer and describes the organizations behind the Mars Observer Spacecraft, such as the Deep Space Network, the Mission Operation Support Office, Science Investigators, the Flight Engineering Office, Operations Office, and the Ground Data System Office. Dr. William Piotrowski, Acting Director, Solar System Exploration Division, NASA, talks about the purpose of the Mars Pathfinder which is to develop the technology and systems for landing small science packages on Mars. Mr. Roger Gibbs, Former Mars Observer Spacecraft Systems Engineer, tells us how the Mars Observer was built and describes the structural elements on the Mars Observer. The 11-month cruise period for the spacecraft is given by Joseph Beerer, Manager of the Engineering office. The thrust for the Mars Orbit Insertion is described by Ronald Klemetson, Technical Manager, Propulsion Subsystem Jet Propulsion Laboratory (JPL). George Chen, Lead Engineer Attitude and Articulation Subsystem Spacecraft Team, explains the importance of the attitude control engines on the Spacecraft. Marvin Traxler, Manager of Tracking and Data Acquisition, describes how searching for a signal from the Mars Observer works. See NONP-NASA-VT-2000081555 for a continuation of this discussion with Marvin Traxler.

  12. Development and dissection of diagnostic SNP markers for the downy mildew resistance genes Pl Arg and Pl 8 and maker-assisted gene pyramiding in sunflower (Helianthus annuus L.).

    Science.gov (United States)

    Qi, L L; Talukder, Z I; Hulke, B S; Foley, M E

    2017-06-01

    Diagnostic DNA markers are an invaluable resource in breeding programs for successful introgression and pyramiding of disease resistance genes. Resistance to downy mildew (DM) disease in sunflower is mediated by Pl genes which are known to be effective against the causal fungus, Plasmopara halstedii. Two DM resistance genes, Pl Arg and Pl 8 , are highly effective against P. halstedii races in the USA, and have been previously mapped to the sunflower linkage groups (LGs) 1 and 13, respectively, using simple sequence repeat (SSR) markers. In this study, we developed high-density single nucleotide polymorphism (SNP) maps encompassing the Pl arg and Pl 8 genes and identified diagnostic SNP markers closely linked to these genes. The specificity of the diagnostic markers was validated in a highly diverse panel of 548 sunflower lines. Dissection of a large marker cluster co-segregated with Pl Arg revealed that the closest SNP markers NSA_007595 and NSA_001835 delimited Pl Arg to an interval of 2.83 Mb on the LG1 physical map. The SNP markers SFW01497 and SFW06597 delimited Pl 8 to an interval of 2.85 Mb on the LG13 physical map. We also developed sunflower lines with homozygous, three gene pyramids carrying Pl Arg , Pl 8 , and the sunflower rust resistance gene R 12 using the linked SNP markers from a segregating F2 population of RHA 340 (carrying Pl 8 )/RHA 464 (carrying Pl Arg and R 12 ). The high-throughput diagnostic SNP markers developed in this study will facilitate marker-assisted selection breeding, and the pyramided sunflower lines will provide durable resistance to downy mildew and rust diseases.

  13. Association of Angiotensin-Converting Enzyme Intron 16 Insertion/Deletion and Angiotensin II Type 1 Receptor A1166C Gene Polymorphisms with Preeclampsia in South East of Iran

    Directory of Open Access Journals (Sweden)

    Saeedeh Salimi

    2011-01-01

    Full Text Available Some evidence suggests that a variety of genetic factors contributed in pathogenesis of the preeclampsia. The aim of this study was to assess the association between the angiotensin-converting enzyme (ACE I/D and angiotensin II type1 receptor A1166C polymorphisms with preeclampsia. This study was performed in 125 preeclamptic pregnant women and 132 controls. The I/D Polymorphism of the ACE gene was assessed by polymerase chain reaction and the A1166C Polymorphism of the AT1R gene was determined by restriction fragment length polymorphism. The genotype and allele frequencies of I/D polymorphism differed between two groups. The risk of preeclampsia was 3.2-fold in pregnant women with D allele (OR, 3.2 [95% CI, 1.1 to 3.8]; P=0.01. The distribution of the AT1R gene A1166C polymorphism was similar in affected and control groups. Our results supported that presence of the I/D polymorphism of ACE gene is a marker for the increased risk of preeclampsia.

  14. Sequential cooling insert for turbine stator vane

    Energy Technology Data Exchange (ETDEWEB)

    Jones, Russel B

    2017-04-04

    A sequential flow cooling insert for a turbine stator vane of a small gas turbine engine, where the impingement cooling insert is formed as a single piece from a metal additive manufacturing process such as 3D metal printing, and where the insert includes a plurality of rows of radial extending impingement cooling air holes alternating with rows of radial extending return air holes on a pressure side wall, and where the insert includes a plurality of rows of chordwise extending second impingement cooling air holes on a suction side wall. The insert includes alternating rows of radial extending cooling air supply channels and return air channels that form a series of impingement cooling on the pressure side followed by the suction side of the insert.

  15. High-fidelity Glucagon-CreER mouse line generated by CRISPR-Cas9 assisted gene targeting

    Directory of Open Access Journals (Sweden)

    Amanda M. Ackermann

    2017-03-01

    Conclusions: We successfully derived a Gcg-CreERT2 mouse line that expresses CreERT2 in pancreatic α-cells and enteroendocrine L-cells without disrupting preproglucagon gene expression. These mice will be a useful tool for performing temporally controlled genetic manipulation specifically in these cell types.

  16. Genome-scale metabolic network validation of Shewanella oneidensis using transposon insertion frequency analysis.

    Directory of Open Access Journals (Sweden)

    Hong Yang

    2014-09-01

    Full Text Available Transposon mutagenesis, in combination with parallel sequencing, is becoming a powerful tool for en-masse mutant analysis. A probability generating function was used to explain observed miniHimar transposon insertion patterns, and gene essentiality calls were made by transposon insertion frequency analysis (TIFA. TIFA incorporated the observed genome and sequence motif bias of the miniHimar transposon. The gene essentiality calls were compared to: 1 previous genome-wide direct gene-essentiality assignments; and, 2 flux balance analysis (FBA predictions from an existing genome-scale metabolic model of Shewanella oneidensis MR-1. A three-way comparison between FBA, TIFA, and the direct essentiality calls was made to validate the TIFA approach. The refinement in the interpretation of observed transposon insertions demonstrated that genes without insertions are not necessarily essential, and that genes that contain insertions are not always nonessential. The TIFA calls were in reasonable agreement with direct essentiality calls for S. oneidensis, but agreed more closely with E. coli essentiality calls for orthologs. The TIFA gene essentiality calls were in good agreement with the MR-1 FBA essentiality predictions, and the agreement between TIFA and FBA predictions was substantially better than between the FBA and the direct gene essentiality predictions.

  17. Association between the DRD2-141C Insertion/Deletion polymorphism and schizophrenia Associação entre o polimorfismo -141C Ins/Del do gene do DRD2 e esquizofrenia

    Directory of Open Access Journals (Sweden)

    Quirino Cordeiro

    2009-06-01

    Full Text Available Epidemiological studies have demonstrated that the genetic component is an important risk factor for the development of schizophrenia. The genes that codify the different compounds of the dopaminergic system have created interest for molecular investigations in patients with schizophrenia because the antipsychotic drugs, especially those of first generation, act on this cerebral system. Thus the aim of the present study was to investigate the possible association between the -141 Ins/Del (rs1799732 polymorphism of the dopamine receptor type 2 (DRD2 and schizophrenia. The distribution of the alleles and genotypes of the studied polymorphism was investigated in a sample of 229 patients and 733 controls. There were statistical differences in the allelic (χ2=9.78; p=0.001 and genotypic genotypic (χ2=12.74; p=0.001 distributions between patients and controls. Thus the -141C Ins/Del polymorphism of the DRD2 gene (allele Ins was associated to the SCZ phenotype in the investigated sample.Estudos epidemiológicos têm demonstrado que o componente genético é um importante fator de risco para o desenvolvimento de esquizofrenia. Os genes que codificam os diferentes componentes do sistema dopaminérgico passaram a despertar interesse para os estudos moleculares em pacientes com esquizofrenia, devido ao fato dos antipsicóticos, em especial os de primeira geração, exercerem sua ação nesse sistema. Assim, o objetivo do presente estudo foi investigar a possível associação entre polimorfismo -141C Ins/Del (rs1799732 do gene do receptor dopaminérgico tipo 2 (DRD2 e esquizofrenia. Um total de 229 pacientes e 733 controles pareados para sexo e idade foi selecionado com o objetivo de investigar a distribuição dos alelos e genótipos do polimorfismo investigado entre os grupos de pacientes e controles. Houve diferença estatisticamente significante nas distribuições alélica (χ2=9,78; p=0,001 e genotípica (χ2=12,74; p=0,001 entre pacientes e

  18. A HTS dipole insert coil constructed

    CERN Document Server

    Ballarino, A; Rey, J M; Stenvall, A; Sorbi, M; Tixador, P

    2013-01-01

    This report is the deliverable report 7.4.1 “A HTS dipole insert coil constructed“. The report has three parts: “Design report for the HTS dipole insert”, “One insert pancake prototype coil constructed with the setup for a high field test”, and “All insert components ordered”. The three report parts show that, although the insert construction will be only completed by end 2013, all elements are present for a successful completion and that, given the important investments done by the participants, there is a full commitment of all of them to finish the project

  19. Optimization of gene-assisted selection in small-sized populations: comparison of deterministic and stochastic approaches

    OpenAIRE

    Costard, Anne D.; Jean-Michel Claude Elsen

    2011-01-01

    Many of the models used to optimize selection processes in livestock make the assumption that the population is of infinite size and are built on deterministic equations. The finite size case should however be considered explicitly when selection involves one identified gene. Indeed, drift can cause the loss of a favorable allele if its initial frequency is low. In this paper, a stochastic approach was developed to simultaneously optimize selection on two traits in a limited size population: ...

  20. Gene Sequence Based Clustering Assists in Dereplication of Pseudoalteromonas luteoviolacea Strains with Identical Inhibitory Activity and Antibiotic Production

    DEFF Research Database (Denmark)

    Vynne, Nikolaj Grønnegaard; Månsson, Maria; Gram, Lone

    2012-01-01

    Some microbial species are chemically homogenous, and the same secondary metabolites are found in all strains. In contrast, we previously found that five strains of P. luteoviolacea were closely related by 16S rRNA gene sequence but produced two different antibiotic profiles. The purpose of the p......Some microbial species are chemically homogenous, and the same secondary metabolites are found in all strains. In contrast, we previously found that five strains of P. luteoviolacea were closely related by 16S rRNA gene sequence but produced two different antibiotic profiles. The purpose...... of the present study was to determine whether such bioactivity differences could be linked to genotypes allowing methods from phylogenetic analysis to aid in selection of strains for biodiscovery. Thirteen P. luteoviolacea strains divided into three chemotypes based on production of known antibiotics and four...... correlation to chemotypes and inhibition profiles, while clustering based on concatenated 16S rRNA, gyrB, and recA gene sequences resulted in three clusters, two of which uniformly consisted of strains of identical chemotype and inhibition profile. A major time sink in natural products discovery is the effort...

  1. Development of Needle Insertion Manipulator for Central Venous Catheterization

    Science.gov (United States)

    Kobayashi, Yo; Hong, Jaesung; Hamano, Ryutaro; Hashizume, Makoto; Okada, Kaoru; Fujie, Masakatsu G.

    Central venous catheterization is a procedure, which a doctor insert a catheter into the patient’s vein for transfusion. Since there are risks of bleeding from arterial puncture or pneumothorax from pleural puncture. Physicians are strictly required to make needle reach up into the vein and to stop the needle in the middle of vein. We proposed a robot system for assisting the venous puncture, which can relieve the difficulties in conventional procedure, and the risks of complication. This paper reports the design structuring and experimental results of needle insertion manipulator. First, we investigated the relationship between insertion force and angle into the vein. The results indicated that the judgment of perforation using the reaction force is possible in case where the needling angle is from 10 to 20 degree. The experiment to evaluate accuracy of the robot also revealed that it has beyond 0.5 mm accuracy. We also evaluated the positioning accuracy in the ultrasound images. The results displays that the accuracy is beyond 1.0 mm and it has enough for venous puncture. We also carried out the venous puncture experiment to the phantom and confirm our manipulator realized to make needle reach up into the vein.

  2. ADC's Insertion Devices and Magnetic Measurement Systems Capabilities

    Science.gov (United States)

    Deyhim, A.; Kulesza, J.

    2013-03-01

    In this paper Advance Design Consulting USA, Inc. (ADC) will discuss ADC's major improved capabilities for building Wiggler Insertion Devices, Undulator Planar Devices, Elliptical Polarizing Undulators (EPU), In-Vacuum Undulators (IVU), Cryogenically Cooled in-vacuum Undulators (CPMU), Super Conductive Undulator, and Insertion Device Magnetic Measurement Systems. ADC has designed, built and delivered Insertion Devices and Magnetic Measurement Systems to such facilities as MAX-lab (two EPUs, a Planar, and Measurement System), ALBA and ASP (Wigglers), BNL (CPMU), SSRF (two IVUs and a Measurement System), PAL (one IVU and Measurement System), NSRRC (one 4m EPU), and SRC (Planar and EPU). ADC's magnetic field measurement system is a sophisticated and sensitive machine for the measurement of magnetic fields in undulators (Planar and EPU), wigglers and in-vacuum ID units. The magnetic fields are measured using 3 axis hall-effect probes, mounted orthogonally, to a thin wand. The wand is mounted to a carriage that rides on vacuum air bearings. The base is granite. A flip coil is provided on two vertical towers with X, Y and Theta axes. Special software is provided to assist in homing, movement, and data collection and analysis.

  3. A Plasmid Containing the Human Metallothionein II Gene Can Function as an Antibody-assisted Electrophoretic Biosensor for Heavy Metals

    Science.gov (United States)

    2015-01-16

    and EcoR1 restriction endonuclease sites (this resulted in a 3547-bp plasmid). This ‘new’ plasmid was re-named pUC57-MT to further clarify that the...pUC57-MT plasmid was cut into two restriction fragments with BamH1 and EcoR1 endonucleases , the anti-MTF- 1 antibody preparation was able to bind both...cloned into a pUC57 plasmid at the EcoRV restriction site within the multiple cloning site of the plasmid; thus, the MT-II gene was located between BamH1

  4. Intradermal normal saline solution, self-selected music, and insertion difficulty effects on intravenous insertion pain.

    Science.gov (United States)

    Jacobson, A F

    1999-01-01

    To examine the effect of listening to self-selected music versus an intradermal injection of normal saline solution on the intensity and distress of intravenous (IV) catheter insertion pain. Prospective, randomized, controlled study. Inpatient and outpatient units in 2 university-affiliated southwestern medical centers. One hundred ten adult inpatients and outpatients undergoing IV therapy. Pain intensity, pain distress, and IV insertion difficulty visual analog scales. Patients were randomly assigned to receive an intradermal injection of normal saline solution, listen with headphones to self-selected music, or be in a control group for IV insertion. A MANOVA revealed no statistically significant multivariate or univariate differences in pain by treatment group, but significantly higher pain distress scores with failed IV insertions. The pain intensity and distress scores were significantly higher in the saline solution group when compared with the music and control groups combined. Insertion difficulty was significantly positively correlated with pain intensity and distress for the entire sample, with weak, nonsignificant correlations in the music group. Intradermal unpreserved saline solution contributes to greater pain intensity and distress, greater insertion difficulty, and a higher failure rate than the use of music or routine IV insertion. Listening to preferred music attenuates the effect of insertion difficulty on IV insertion pain. Intravenous insertion attempts were unsuccessful in more than one third of the subjects, resulting in higher pain distress scores. Further research is needed on interventions to reduce IV insertion pain and on factors contributing to IV insertion failure.

  5. Gene

    Data.gov (United States)

    U.S. Department of Health & Human Services — Gene integrates information from a wide range of species. A record may include nomenclature, Reference Sequences (RefSeqs), maps, pathways, variations, phenotypes,...

  6. Marker-assisted selection for the rice blast resistance gene Pi-ar in a backcross population

    Directory of Open Access Journals (Sweden)

    Leila Garcês de Araújo

    2010-01-01

    Full Text Available A doubled-haploid (DH population, obtained by anther culture of F1 plants from a cross between a highlysusceptible rice cultivar Lijiangxintuanheigu and the resistant somaclone (SC09, of the cultivar Araguaia, was used to identifyRAPD markers linked to the blast resistance gene Pi-ar. The 86 DH plants, inoculated with the race IB-9 of Magnaportheoryzae, segregated in 1:1 ratio of resistant and susceptible plants. Of the 67 primers used 31 produced DNA profiles thatdifferentiated resistant and susceptible bulks as well as the parental cultivars. The resistance gene was found linked to theprimer OPS162072 (‘AGGGGGTTCC’ at a distance of 3.6 cM. The selection efficiency of this primer was assessed in a BC3 F1population derived from another cross between a susceptible cultivar IAC 201 and SC09. The marker OPS16 showedefficiency of 86.9%, when six resistant and two susceptible plants were considered as negatives in RAPD analysis.

  7. Marker assisted separation of resistance genes Rph22 and Rym16 (Hb) from an associated yield penalty in a barley: Hordeum bulbosum introgression line.

    Science.gov (United States)

    Johnston, Paul A; Meiyalaghan, Vijitha; Forbes, Merle E; Habekuß, Antje; Butler, Ruth C; Pickering, Richard

    2015-06-01

    The resistance genes Rph22 and Rym16 (Hb) transferred into barley from Hordeum bulbosum have been separated from a large yield penalty locus that was present in the original introgression line '182Q20'. The Hordeum bulbosum introgression line '182Q20' possesses resistance to barley leaf rust (Rph22) and Barley mild mosaic virus (Rym16 (Hb) ) located on chromosome 2HL. Unfortunately, this line also carries a considerable yield penalty compared with its barley genetic background 'Golden Promise'. Quantitative trait locus (QTL) mapping of the components of yield (total yield, thousand grain weight, hectolitre weight, percentage screenings and screened yield) was performed using 75 recombinant lines derived from the original '182Q20' introgression line. A QTL for the yield penalty was located in the proximal region of the introgressed segment. Marker assisted selection targeting intraspecific recombination events between overlapping H. bulbosum introgression segments was used to develop the lines '372E' and '372H' which feature genetically small introgressions around Rph22. Further yield trials validated the separation of both Rph22 and Rym16 (Hb) from the proximal yield penalty. These results, combined with molecular markers closely linked to Rph22 and Rym16 (Hb) , make these resistance genes more attractive for barley breeding.

  8. Teres major muscle - insertion footprint.

    Science.gov (United States)

    Dancker, Malte; Lambert, Simon; Brenner, Erich

    2017-05-01

    Teres major muscle (TM) and latissimus dorsi muscle (LD) are frequently used in muscle transfers around the shoulder girdle. Some authors have suggested harvesting techniques in which the muscle is detached in continuity with a bone segment. Information on the bony attachment footprint of these muscles is lacking. The purpose of this study was to investigate the region of attachment of the TM to facilitate safe and complete harvesting with a bone segment where it is indicated, and to determine the relationship of the TM footprint with that of the LD. Twenty-eight upper extremities of 14 human cadavers (six female, eight male) were investigated during the students' dissection course in the winter term 2012. The attachment footprints were photographed and the images were processed with ImageJ Version 1.46r. The TM attachment footprint at the crest of the lesser tubercle had an average dimension of 187 ± 89 mm2 . It was 49.6 ± 7.9 mm long and 7.4 ± 2.5 mm wide. The bony attachment of the LD within the bicipital groove, just below the tendon of the long head of the biceps muscle, had an area of 94 ± 37 mm2 . It was 36.5 ± 8 mm long and 3.7 ± 1.2 mm wide. Both muscles were separated by 4.4 ± 1.7 mm and their attachments overlapped in the craniocaudal direction by 24.4 ± 12.4 mm. Earlier studies have investigated the dimensions of the muscles' tendons close to the attachment not the bony attachment itself. The dimension of the attachment of the TM was larger than that of the LD. The ratio between the footprint areas was approximately 2:1. This information should be considered by surgeons undertaking transfers, which include a bony segment of the muscle insertion. © 2017 The Authors. Journal of Anatomy published by John Wiley & Sons Ltd on behalf of Anatomical Society.

  9. Central Solenoid Insert Technical Specification

    Energy Technology Data Exchange (ETDEWEB)

    Martovetsky, Nicolai N [ORNL; Smirnov, Alexandre [ORNL

    2011-09-01

    The US ITER Project Office (USIPO) is responsible for the ITER central solenoid (CS) contribution to the ITER project. The Central Solenoid Insert (CSI) project will allow ITER validation the appropriate lengths of the conductors to be used in the full-scale CS coils under relevant conditions. The ITER Program plans to build and test a CSI to verify the performance of the CS conductor. The CSI is a one-layer solenoid with an inner diameter of 1.48 m and a height of 4.45 m between electric terminal ends. The coil weight with the terminals is approximately 820 kg without insulation. The major goal of the CSI is to measure the temperature margin of the CS under the ITER direct current (DC) operating conditions, including determining sensitivity to load cycles. Performance of the joints, ramp rate sensitivity, and stability against thermal or electromagnetic disturbances, electrical insulation, losses, and instrumentation are addressed separately and therefore are not major goals in this project. However, losses and joint performance will be tested during the CSI testing campaign. The USIPO will build the CSI that will be tested at the Central Solenoid Model Coil (CSMC) Test Facility at the Japan Atomic Energy Agency (JAEA), Naka, Japan. The industrial vendors (the Suppliers) will report to the USIPO (the Company). All approvals to proceed will be issued by the Company, which in some cases, as specified in this document, will also require the approval of the ITER Organization. Responsibilities and obligations will be covered by respective contracts between the USIPO, called Company interchangeably, and the industrial Prime Contractors, called Suppliers. Different stages of work may be performed by more than one Prime Contractor, as described in this specification. Technical requirements of the contract between the Company and the Prime Contractor will be covered by the Fabrication Specifications developed by the Prime Contractor based on this document and approved by

  10. Phylogenetic associations of ISAa1 and IS150-like insertion sequences in Actinobacillus actinomycetemcomitans

    DEFF Research Database (Denmark)

    Hayashida, H; Poulsen, Knud; Takagi, O

    2000-01-01

    The distribution and number of two insertion sequences (ISs), ISAa1 and an IS150-like element, in the genomes of a collection of Actinobacillus actinomycetemcomitans strains previously subjected to population genetic analysis were determined to obtain information about their stability and biologi...... to housekeeping genes, but no evidence of structural disruption of genes or integrations that may be presumed to influence pathogenic potential....

  11. Evolutionary study of plastid and mitochondrial DNA insertions into the nucleus of flowering plants

    NARCIS (Netherlands)

    Noutsos, C.

    2007-01-01

    The aim of this study was to characterize the structure of functional and non-functional nuclear inserts of organelle DNA as well the expression of photosynthetic genes which are transferred during endosymbiosis into the nucleus with the final scope to determine the impact of organelle DNA on gene

  12. An efficient method for sonication assisted Agrobacterium-mediated transformation of coat protein (CP) coding genes into papaya (Carica papaya L.).

    Science.gov (United States)

    Jiang, Ling; Maoka, Tetsuo; Komori, Sadao; Fukamachi, Hiroshi; Kato, Hidenori; Ogawa, Kazunori

    2004-06-01

    An efficient method for the production of transgenic papaya was developed via Sonication Assisted Agrobacterium-mediated Transformation (SAAT) of somatic embryos. The plasmid pGA482G was modified to contain gene PTi-Epj-TL-PLDMV with CP coding sequence of PLDMV Japan strain and chimeric gene PTi-NP-YKT with multiple CP coding sequences from PRSV Taiwan strain, PRSV Hawaii strain and PRSV Thailand strain, respectively. Disarmed Agrobacterium tumefaciens strain LBA4404 carrying the binary plasmid pGA482G with the CP genes and nptII gene was used to transform embryo calli of papaya variety Sunset to produce transgenic papaya plants. The experiment was focused on the screening of effective transformation method. The engineered Agrobacterium grown overnight was diluted with an infection media of high osmotic pressure (1/2 MS medium contain 6% sucrose and 1% glucose, pH 5.7) and adjusted to optical density OD600nm = 0.15-0.20, embryonic calli were immerged in it for 30 min and treated with 5 s, 15 s, and 20 s sonication respectively during the infection. Results indicated that 15 s sonication treatment improved the transformation efficiency dramatically. After 15 s sonication treatment on embryo calli loaded in 15 ml sterile plastic tubes, 21 putative transgenic lines were produced from 80 pieces embryonic calli (26.3%) transformed by Agrobacterium [pGA482G/CPG] and 8 putative transgenic lines was produced from 48 pieces embryonic calli (16.7%) transferred by Agrobacterium [pGA482G/CPB], while only a single line came out of 64 pieces embryonic calli (1.6%) transformed by Agrobacterium [pGA482G/CPG] and none from 25 pieces embryonic calli transformed by Agrobacterium [pGA482G/CPB] in the non-treatment control. Results also showed that the best concentration of selection antibiotic was 120 mg/L kanamycin. A total of 42 resistant shoots were produced from 421 pieces of original embryonic calli in 9 months. The presence of the CP genes in the transgenic plants and their

  13. Transposon insertion libraries for the characterization of mutants from the kiwifruit pathogen Pseudomonas syringae pv. actinidiae

    Science.gov (United States)

    Mesarich, Carl H.; Rees-George, Jonathan; Gardner, Paul P.; Ghomi, Fatemeh Ashari; Gerth, Monica L.; Andersen, Mark T.; Rikkerink, Erik H. A.; Fineran, Peter C.

    2017-01-01

    Pseudomonas syringae pv. actinidiae (Psa), the causal agent of kiwifruit canker, is one of the most devastating plant diseases of recent times. We have generated two mini-Tn5-based random insertion libraries of Psa ICMP 18884. The first, a ‘phenotype of interest’ (POI) library, consists of 10,368 independent mutants gridded into 96-well plates. By replica plating onto selective media, the POI library was successfully screened for auxotrophic and motility mutants. Lipopolysaccharide (LPS) biosynthesis mutants with ‘Fuzzy-Spreader’-like morphologies were also identified through a visual screen. The second, a ‘mutant of interest’ (MOI) library, comprises around 96,000 independent mutants, also stored in 96-well plates, with approximately 200 individuals per well. The MOI library was sequenced on the Illumina MiSeq platform using Transposon-Directed Insertion site Sequencing (TraDIS) to map insertion sites onto the Psa genome. A grid-based PCR method was developed to recover individual mutants, and using this strategy, the MOI library was successfully screened for a putative LPS mutant not identified in the visual screen. The Psa chromosome and plasmid had 24,031 and 1,236 independent insertion events respectively, giving insertion frequencies of 3.65 and 16.6 per kb respectively. These data suggest that the MOI library is near saturation, with the theoretical probability of finding an insert in any one chromosomal gene estimated to be 97.5%. However, only 47% of chromosomal genes had insertions. This surprisingly low rate cannot be solely explained by the lack of insertions in essential genes, which would be expected to be around 5%. Strikingly, many accessory genes, including most of those encoding type III effectors, lacked insertions. In contrast, 94% of genes on the Psa plasmid had insertions, including for example, the type III effector HopAU1. These results suggest that some chromosomal sites are rendered inaccessible to transposon insertion, either

  14. Marker-Assisted Development and Evaluation of Near-Isogenic Lines for Broad-Spectrum Powdery Mildew Resistance Gene Pm2b Introgressed into Different Genetic Backgrounds of Wheat

    Directory of Open Access Journals (Sweden)

    Hongxing Xu

    2017-07-01

    Full Text Available At present, most of released wheat cultivars or breeding lines in China are susceptible to powdery mildew (Pm (caused by Blumeria graminis f. sp. tritici, Bgt, so there is an urgent need to rapidly transfer effective and broad-spectrum Pm resistance genes into elite cultivars/lines. Near-isogenic lines (NILs with short target gene region are very important in molecular breeding and map-based cloning and can be developed by combining marker-assisted selection and conventional phenotypic identification. However, no Pm gene NILs were reported by using this method in the previous studies. A new broad-spectrum dominant resistance gene Pm2b, derived from the Chinese wheat breeding line KM2939, conferred high resistance to Pm at both the seedling and adult stages. In this study, with the aid of forward and background selection (FS and BS using molecular markers, the Pm2b gene was introgressed into three elite susceptible commercial cultivars Shimai 15, Shixin 828, and Kenong 199 through the back-crossing procedure. With the appropriate backcrossing generations, selected population sizes and marker number for BS, the homozygous resistant BC3F2:3 NILs of Pm2b gene in the three genetic backgrounds with the highest recipient genome composition of about 99%, confirmed by simple sequence repeat markers and 660K single nucleotide polymorphic array, were developed and evaluated for the powdery mildew resistance and agronomic traits. The different resistance and similar or improved agronomic performance between Pm2b NILs and their corresponding recurrent parents indicated their potential value in the marker-assisted breeding of the Pm2b gene. Moreover, the development of four flanked diagnostic markers (CFD81, BWM25, BWM20, and BWM21 of the Pm2 gene can effectively assist the forward selection and accelerate the transfer and use of this resistance gene.

  15. Optimization of gene-assisted selection in small-sized populations: comparison of deterministic and stochastic approaches

    Directory of Open Access Journals (Sweden)

    Anne D. Costard

    2011-07-01

    Full Text Available Many of the models used to optimize selection processes in livestock make the assumption that the population is of infinite size and are built on deterministic equations. The finite size case should however be considered explicitly when selection involves one identified gene. Indeed, drift can cause the loss of a favorable allele if its initial frequency is low. In this paper, a stochastic approach was developed to simultaneously optimize selection on two traits in a limited size population: a quantitative trait with underlying polygenic variation and a monogenic trait. We outline the interests of considering the limited size of the population in stochastic modeling with a simple example. Such stochastic models raise some technical problems (uncertain convergence to the maximum, computational burden which could obliterate their usefulness as compared to simpler but approximate deterministic models which can be used when the population size is large. By way of this simple example, we show the feasibility of the optimization of this type of model using a genetic algorithm and demonstrate its interest compared with the corresponding deterministic model which assumes that the population is of infinite size.

  16. Optimization of gene-assisted selection in small-sized populations: comparison of deterministic and stochastic approaches.

    Science.gov (United States)

    Costard, Anne D; Elsen, Jean-Michel

    2011-01-01

    Many of the models used to optimize selection processes in livestock make the assumption that the population is of infinite size and are built on deterministic equations. The finite size case should however be considered explicitly when selection involves one identified gene. Indeed, drift can cause the loss of a favorable allele if its initial frequency is low. In this paper, a stochastic approach was developed to simultaneously optimize selection on two traits in a limited size population: a quantitative trait with underlying polygenic variation and a monogenic trait. We outline the interests of considering the limited size of the population in stochastic modeling with a simple example. Such stochastic models raise some technical problems (uncertain convergence to the maximum, computational burden) which could obliterate their usefulness as compared to simpler but approximate deterministic models which can be used when the population size is large. By way of this simple example, we show the feasibility of the optimization of this type of model using a genetic algorithm and demonstrate its interest compared with the corresponding deterministic model which assumes that the population is of infinite size.

  17. HB+ inserted into the CMS Solenoid

    CERN Multimedia

    Tejinder S. Virdee, CERN

    2006-01-01

    The first half of the barrel hadron calorimeter (HB+) has been inserted into the superconducting solenoid of CMS, in preparation for the magnet test and cosmic challenge. The operation went smoothly, lasting a couple of days.

  18. Prescription Custom Orthotics and Shoe Inserts

    Science.gov (United States)

    ... cost more than shoe inserts purchased in a retail store, but the additional cost is usually well worth ... supports that you can order online or at retail stores. Unless the device has been prescribed by a ...

  19. Bulkhead insert for an internal combustion engine

    Energy Technology Data Exchange (ETDEWEB)

    Maki, Clifford E.; Chottiner, Jeffrey Eliot; Williams, Rick L.; Thibault, Mark W.; Ervin, James Douglas; Boileau, James Maurice; McKeough, Bryan

    2017-08-01

    An engine includes a cylinder block defining at least one main bearing bulkhead adjacent to a cylinder, and a crankshaft rotatably housed within the block by a main bearing. A bulkhead insert has a cap portion, and an insert portion provided within the bulkhead. The insert portion has having first and second end regions connected by first and second straps. Each strap having a flanged beam cross section. The first and second ends of the insert portion are configured to connect a main bearing cap column to a cylinder head column. Each of the first and second end regions define at least one protrusion having a surface substantially normal to engine combustion and reactive loads. The cap portion is configured to mate with the first end region at the main bearing cap column and support the main bearing.

  20. Immediate postabortal insertion of intrauterine devices.

    Science.gov (United States)

    Grimes, D; Schulz, K; Stanwood, N

    2004-10-18

    Insertion of an intrauterine device (IUD) immediately after an abortion has several potential advantages. The woman is known not to be pregnant, a major concern for clinicians. For example, many clinicians refuse to insert an IUD in a woman who is not menstruating. After induced abortion, a woman's motivation to use contraception may be high. However, insertion of an IUD immediately after a pregnancy ends carries potential risks as well. For example, the risk of spontaneous expulsion may be increased due to recent cervical dilation. To assess the safety and efficacy of IUD insertion immediately after spontaneous or induced abortion. We used MEDLINE, Popline, and EMBASE computer searches, supplemented by review articles and contacts with investigators. We sought all randomized controlled trials that had at least one treatment arm that involved IUD insertion immediately after an induced abortion or after curettage for spontaneous abortion. We identified 12 trials which described random assignment but excluded three from this review. Two of these revealed unethical research conduct, and one used alternate assignment to treatments. We evaluated the methodological quality of each report and abstracted information onto a data collection form. We focused on gross discontinuation rates (single-decrement life table analysis) for accidental pregnancy, perforation, expulsion, and pelvic inflammatory disease. We entered the data into RevMan 3.1 for analysis of Peto odds ratios. In large multicenter trials, the TCu 220C device proved superior to either the Lippes Loop D or the Copper 7 IUDs for immediate postabortal insertion. In single-center trials, the Nova T IUD had a significantly higher discontinuation rate for pregnancy than did the Multiload 250 (OR 4.5; 95% CI 1.0-19.8), while the Nova T had a significantly lower discontinuation rate for pregnancy than did the TCu 200 (OR 0.3; 95% CI 0.1-0.9). The levonorgestrel-releasing device was more effective in preventing

  1. Non-insertional tendinopathy of the subscapularis

    OpenAIRE

    Dierckman, Brian D.; Shah, Nirav R.; Larose, Connor R.; Stacey Gerbrandt; Getelman, Mark H.

    2013-01-01

    Purpose: (1) Describe a previously unreported finding involving the intra-articular portion of the subscapularis, the Conrad lesion. (2) Describe a novel classification system for the spectrum of non-insertional tendinopathy of the subscapularis. (3) Report the outcomes of surgical treatment of this spectrum of pathology. Materials and Methods: Outcomes of 34 patients (23 males and 11 females, mean age 60.5 ± 7.5) with non-insertional tendinopathy of the subscapularis treated arthroscopic...

  2. Comparison of four techniques of nasogastric tube insertion in anaesthetised, intubated patients: A randomized controlled trial

    Directory of Open Access Journals (Sweden)

    Mohan Chandra Mandal

    2014-01-01

    Full Text Available Background and Aims: Insertion of nasogastric tubes (NGTs in anaesthetised, intubated patients with a conventional method is sometimes difficult. Different techniques of NGT insertion have been tried with varying degree of success. The aim of this prospective, randomised, open-label study was to evaluate three modified techniques of NGT insertion comparing with the conventional method in respect of success rate, time taken for insertion and the adverse events. Methods: In the operation theatre of general surgery, the patients were randomly allocated into four groups: Group C (control group, n = 54, Group W (ureteral guide wire group, n = 54, Group F (neck flexion with lateral pressure, n = 54 and Group R (reverse Sellick′s manoeuvre, n = 54. The number of attempts for successful NGT insertion, time taken for insertion and adverse events were noted. Results: All the three modified techniques were found more successful than the conventional method on the first attempt. The least time taken for insertion was noted in the reverse Sellick′s method. However, on intergroup analysis, neck flexion and reverse Sellick′s methods were comparable but significantly faster than the other two methods with respect to time taken for insertion. Conclusion: Reverse Sellick′s manoeuver, neck flexion with lateral neck pressure and guide wire-assisted techniques are all better alternatives to the conventional method for successful, quick and reliable NGT insertion with permissible adverse events in anaesthetised, intubated adult patients. Further studies after eliminating major limitations of the present study are warranted to establish the superiority of any one of these modified techniques.

  3. A novel intergenic ETnII-β insertion mutation causes multiple malformations in polypodia mice.

    Directory of Open Access Journals (Sweden)

    Jessica A Lehoczky

    Full Text Available Mouse early transposon insertions are responsible for ~10% of spontaneous mutant phenotypes. We previously reported the phenotypes and genetic mapping of Polypodia, (Ppd, a spontaneous, X-linked dominant mutation with profound effects on body plan morphogenesis. Our new data shows that mutant mice are not born in expected Mendelian ratios secondary to loss after E9.5. In addition, we refined the Ppd genetic interval and discovered a novel ETnII-β early transposon insertion between the genes for Dusp9 and Pnck. The ETn inserted 1.6 kb downstream and antisense to Dusp9 and does not disrupt polyadenylation or splicing of either gene. Knock-in mice engineered to carry the ETn display Ppd characteristic ectopic caudal limb phenotypes, showing that the ETn insertion is the Ppd molecular lesion. Early transposons are actively expressed in the early blastocyst. To explore the consequences of the ETn on the genomic landscape at an early stage of development, we compared interval gene expression between wild-type and mutant ES cells. Mutant ES cell expression analysis revealed marked upregulation of Dusp9 mRNA and protein expression. Evaluation of the 5' LTR CpG methylation state in adult mice revealed no correlation with the occurrence or severity of Ppd phenotypes at birth. Thus, the broad range of phenotypes observed in this mutant is secondary to a novel intergenic ETn insertion whose effects include dysregulation of nearby interval gene expression at early stages of development.

  4. ESSENTIALS: Software for Rapid Analysis of High Throughput Transposon Insertion Sequencing Data

    Science.gov (United States)

    Zomer, Aldert; Burghout, Peter; Bootsma, Hester J.; Hermans, Peter W. M.; van Hijum, Sacha A. F. T.

    2012-01-01

    High-throughput analysis of genome-wide random transposon mutant libraries is a powerful tool for (conditional) essential gene discovery. Recently, several next-generation sequencing approaches, e.g. Tn-seq/INseq, HITS and TraDIS, have been developed that accurately map the site of transposon insertions by mutant-specific amplification and sequence readout of DNA flanking the transposon insertions site, assigning a measure of essentiality based on the number of reads per insertion site flanking sequence or per gene. However, analysis of these large and complex datasets is hampered by the lack of an easy to use and automated tool for transposon insertion sequencing data. To fill this gap, we developed ESSENTIALS, an open source, web-based software tool for researchers in the genomics field utilizing transposon insertion sequencing analysis. It accurately predicts (conditionally) essential genes and offers the flexibility of using different sample normalization methods, genomic location bias correction, data preprocessing steps, appropriate statistical tests and various visualizations to examine the results, while requiring only a minimum of input and hands-on work from the researcher. We successfully applied ESSENTIALS to in-house and published Tn-seq, TraDIS and HITS datasets and we show that the various pre- and post-processing steps on the sequence reads and count data with ESSENTIALS considerably improve the sensitivity and specificity of predicted gene essentiality. PMID:22900082

  5. Bidirectional Conditional Insertion Sort algorithm; An efficient progress on the classical insertion sort

    OpenAIRE

    Mohammed, Adnan Saher; Amrahov, Şahin Emrah; Çelebi, Fatih V.

    2016-01-01

    In this paper, we proposed a new efficient sorting algorithm based on insertion sort concept. The proposed algorithm called Bidirectional Conditional Insertion Sort (BCIS). It is in-place sorting algorithm and it has remarkably efficient average case time complexity when compared with classical insertion sort (IS). By comparing our new proposed algorithm with the Quicksort algorithm, BCIS indicated faster average case time for relatively small size arrays up to 1500 elements. Furthermore, BCI...

  6. Assisted Reproductive Technology affects developmental kinetics, H19 Imprinting Control Region methylation and H19 gene expression in individual mouse embryos

    Directory of Open Access Journals (Sweden)

    Dandolo Luisa

    2007-10-01

    Full Text Available Abstract Background In the last few years, an increase in imprinting anomalies has been reported in children born from Assisted Reproductive Technology (ART. Various clinical and experimental studies also suggest alterations of embryo development after ART. Therefore, there is a need for studying early epigenetic anomalies which could result from ART manipulations, especially on single embryos. In this study, we evaluated the impact of superovulation, in vitro fertilization (IVF and embryo culture conditions on proper genomic imprinting and blastocyst development in single mouse embryos. In this study, different experimental groups were established to obtain embryos from superovulated and non-superovulated females, either from in vivo or in vitro fertilized oocytes, themselves grown in vitro or not. The embryos were cultured either in M16 medium or in G1.2/G2.2 sequential medium. The methylation status of H19 Imprinting Control Region (ICR and H19 promoter was assessed, as well as the gene expression level of H19, in individual blastocysts. In parallel, we have evaluated embryo cleavage kinetics and recorded morphological data. Results We show that: 1. The culture medium influences early embryo development with faster cleavage kinetics for culture in G1.2/G2.2 medium compared to M16 medium. 2. Epigenetic alterations of the H19 ICR and H19 PP are influenced by the fertilization method since methylation anomalies were observed only in the in vitro fertilized subgroup, however to different degrees according to the culture medium. 3. Superovulation clearly disrupted H19 gene expression in individual blastocysts. Moreover, when embryos were cultured in vitro after either in vivo or in vitro fertilization, the percentage of blastocysts which expressed H19 was higher in G1.2/G2.2 medium compared to M16. Conclusion Compared to previous reports utilizing pools of embryos, our study enables us to emphasize a high individual variability of blastocysts in

  7. High-density mapping of the major FHB resistance gene Fhb7 derived from Thinopyrum ponticum and its pyramiding with Fhb1 by marker-assisted selection.

    Science.gov (United States)

    Guo, Jun; Zhang, Xiuli; Hou, Yanlin; Cai, Jinjin; Shen, Xiaorong; Zhou, Tingting; Xu, Huihui; Ohm, Herbert W; Wang, Hongwei; Li, Anfei; Han, Fangpu; Wang, Honggang; Kong, Lingrang

    2015-11-01

    Wheat lines with shortened Th. ponticum chromatin carrying Fhb7 and molecular markers linked to Fhb7 will accelerate the transfer of Fhb7 to breeding lines and provide an important resource for future map-based cloning of this gene. Fusarium head blight is a major wheat disease globally. A major FHB resistance gene, designated as Fhb7, derived from Thinopyrum ponticum, was earlier transferred to common wheat, but was not used in wheat breeding due to linkage drag. The aims of this study were to (1) saturate this FHB resistance gene region; (2) develop and characterize secondary translocation lines with shortened Thinopyrum segments carrying Fhb7 using ph1b; (3) pyramid Fhb7 and Fhb1 by marker-assisted selection. Fhb7 was mapped in a 1.7 cM interval that was flanked by molecular markers XsdauK66 and Xcfa2240 with SSR, diversity arrays technology, EST-derived and conserved markers. KS24-2 carrying Fhb7 was analyzed with molecular markers and genomic in situ hybridization, confirming it was a 7DS.7el2L Robertsonian translocation. To reduce the Thinopyrum chromatin segments carrying Fhb7, a BC1F2 population (Chinese Spring ph1bph1b*2/KS24-2) was developed and genotyped with the markers linked to Fhb7. Two new translocation lines (SDAU1881 and SDAU1886) carrying Fhb7 on shortened alien segments (approximately 16.1 and 17.3% of the translocation chromosome, respectively) were developed. Furthermore, four wheat lines (SDAU1902, SDAU1903, SDAU1904, and SDAU1906) with the pyramided markers flanking Fhb1 and Fhb7 were developed and the FHB responses indicated lines with mean NDS ranging from 1.3 to 1.6 had successfully combined Fhb7 and Fhb1. Three new molecular markers associated with Fhb7 were identified and validated in 35 common wheat varieties. The translocation lines with shortened alien segments carrying Fhb7 (and Fhb1) and the markers closely linked to Fhb7 will be useful for improving wheat scab resistance.

  8. Insertion Sort is O(n log n)

    OpenAIRE

    Bender, Michael A.; Farach-Colton, Martin; Mosteiro, Miguel

    2004-01-01

    Traditional Insertion Sort runs in O(n^2) time because each insertion takes O(n) time. When people run Insertion Sort in the physical world, they leave gaps between items to accelerate insertions. Gaps help in computers as well. This paper shows that Gapped Insertion Sort has insertion times of O(log n) with high probability, yielding a total running time of O(n log n) with high probability.

  9. Hamstring tendons insertion - an anatomical study

    Directory of Open Access Journals (Sweden)

    Cristiano Antonio Grassi

    2013-09-01

    Full Text Available OBJECTIVE: To study the anatomy of the hamstring tendons insertion and anatomical rela-tionships. METHODS: Ten cadaver knees with medial and anterior intact structures were selected. The dissection was performed from anteromedial access to exposure of the insertion of the flexor tendons (FT, tibial plateau (TP and tibial tuberosity (TT. A needle of 40 × 12 and a caliper were used to measure the distance of the tibial plateau of the knee flexor tendons insertion at 15 mm from the medial border of the patellar tendon and tibial tuberosity to the insertion of the flexor tendons of the knee. The angle between tibial plateau and the insertion of the flexor tendons of the knee (A-TP-FT was calculated using Image Pro Plus software. RESULTS: The mean distance TP-FT was 41 ± 4.6 mm. The distance between the TT-FT was 6.88 ± 1 mm. The (A-TP-FT was 20.3 ± 4.9°. CONCLUSION: In the anterior tibial flexor tendons are about 40 mm from the plateau with an average of 20°.

  10. Angiotensin-converting enzyme insertion/deletion gene ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 95; Issue 1 ... Biochemistry Laboratory, Children's Hospital, Research Laboratory 'Haemoglobinopathies and Cystic fibrosis, LR00SP03', Tunis 1007, Tunisia; Department of Pediatrics, Hedi Chaker Hospital, Sfax 3000, Tunisia; Department of Pediatrics, Farhat Hached Hospital, ...

  11. Variations in angiotensin-converting enzyme gene insertion/deletion ...

    Indian Academy of Sciences (India)

    deletion (I/D) polymorphism in the Indian population is poorly known. In order to determine the status of the polymorphism, young unrelated male army recruits were screened. The population had cultural and linguistic differences and lived in an ...

  12. Model base SRAF insertion check with OPC verify tools

    Science.gov (United States)

    Hung, Chi-Yuan; Deng, Zexi; Gao, Gensheng; Zhang, Liguo; Liu, Qingwei

    2006-05-01

    With the critical dimension of IC design decreases dramatically, to meet the yield target of the manufacture process, resolution enhancement technologies become extremely important nowadays. For 90nm technology node and below, sub rule assistant feature (SRAF) are usually employed to enhance the robustness of the micro lithography process. SRAF is really a powerful methodology to push the process limit for given equipment conditions. However, there is also a drawback of the SRAF. It is very hard to check the reasonability of the SRAF location, especially when SRAF is applied on full chips. This work is trying to demonstrate a model-based approach to do full-chip check of the SRAF insertion rule. First, we try to capture the lithography process information through real empirical wafer data. Then we try to check every SRAFs location and to find any hot spot that has the risk of being printed out on the wafer. Based on this approach, we can then not only apply full chip check to reduce the printability of SRAF. Furthermore, combined with DRC tools, we can find SRAFs that are inserted unreasonably and then apply modification on them.

  13. Rack Insertion End Effector (RIEE) automation

    Science.gov (United States)

    Malladi, Narasimha

    1993-01-01

    NASA is developing a mechanism to manipulate and insert Racks into the Space Station Logistic modules. The mechanism consists of the following: a base with three motorized degrees of freedom, a 3 section motorized boom that goes from 15 to 44 feet in length, and a Rack Insertion End Effector (RIEE) with 5 hand wheels for precise alignment. The robotics section was tasked with the automation of the RIEE unit. In this report, for the automation of the RIEE unit, application of the Perceptics Vision System was conceptually developed to determine the position and orientation of the RIEE relative to the logistic module, and a MathCad program is written to display the needed displacements for precise alignment and final insertion of the Rack. The uniqueness of this report is that the whole report is in fact a MathCad program including text, derivations, and executable equations with example inputs and outputs.

  14. Insertional mutagenesis by a hybrid piggyBac and sleeping beauty transposon in the rat.

    Science.gov (United States)

    Furushima, Kenryo; Jang, Chuan-Wei; Chen, Diane W; Xiao, Ningna; Overbeek, Paul A; Behringer, Richard R

    2012-12-01

    A hybrid piggyBac/Sleeping Beauty transposon-based insertional mutagenesis system that can be mobilized by simple breeding was established in the rat. These transposons were engineered to include gene trap sequences and a tyrosinase (Tyr) pigmentation reporter to rescue the albinism of the genetic background used in the mutagenesis strategy. Single-copy transposon insertions were transposed into the rat genome by co-injection of plasmids carrying the transposon and RNA encoding piggyBac transposase into zygotes. The levels of transgenic Tyr expression were influenced by chromosomal context, leading to transgenic rats with different pigmentation that enabled visual genotyping. Transgenic rats designed to ubiquitously express either piggyBac or Sleeping Beauty transposase were generated by standard zygote injection also on an albino background. Bigenic rats carrying single-copy transposons at known loci and transposase transgenes exhibited coat color mosaicism, indicating somatic transposition. PiggyBac or Sleeping Beauty transposase bigenic rats bred with wild-type albino rats yielded offspring with pigmentation distinct from the initial transposon insertions as a consequence of germline transposition to new loci. The germline transposition frequency for Sleeping Beauty and piggyBac was ∼10% or about one new insertion per litter. Approximately 50% of the insertions occurred in introns. Chimeric transcripts containing endogenous and gene trap sequences were identified in Gabrb1 mutant rats. This mutagenesis system based on simple crosses and visual genotyping can be used to generate a collection of single-gene mutations in the rat.

  15. Insertional Mutagenesis by a Hybrid PiggyBac and Sleeping Beauty Transposon in the Rat

    Science.gov (United States)

    Furushima, Kenryo; Jang, Chuan-Wei; Chen, Diane W.; Xiao, Ningna; Overbeek, Paul A.; Behringer, Richard R.

    2012-01-01

    A hybrid piggyBac/Sleeping Beauty transposon-based insertional mutagenesis system that can be mobilized by simple breeding was established in the rat. These transposons were engineered to include gene trap sequences and a tyrosinase (Tyr) pigmentation reporter to rescue the albinism of the genetic background used in the mutagenesis strategy. Single-copy transposon insertions were transposed into the rat genome by co-injection of plasmids carrying the transposon and RNA encoding piggyBac transposase into zygotes. The levels of transgenic Tyr expression were influenced by chromosomal context, leading to transgenic rats with different pigmentation that enabled visual genotyping. Transgenic rats designed to ubiquitously express either piggyBac or Sleeping Beauty transposase were generated by standard zygote injection also on an albino background. Bigenic rats carrying single-copy transposons at known loci and transposase transgenes exhibited coat color mosaicism, indicating somatic transposition. PiggyBac or Sleeping Beauty transposase bigenic rats bred with wild-type albino rats yielded offspring with pigmentation distinct from the initial transposon insertions as a consequence of germline transposition to new loci. The germline transposition frequency for Sleeping Beauty and piggyBac was ∼10% or about one new insertion per litter. Approximately 50% of the insertions occurred in introns. Chimeric transcripts containing endogenous and gene trap sequences were identified in Gabrb1 mutant rats. This mutagenesis system based on simple crosses and visual genotyping can be used to generate a collection of single-gene mutations in the rat. PMID:23023007

  16. Novel Principles of Gamma-Retroviral Insertional Transcription Activation in Murine Leukemia Virus-induced End-stage Tumors

    DEFF Research Database (Denmark)

    Sokol, Martin; Wabl, Matthias; Rius Ruiz, Irene

    2014-01-01

    Background Insertional mutagenesis screens of retrovirus-induced mouse tumors have proven valuable in human cancer research and for understanding adverse effects of retroviral-based gene therapies. In previous studies, the assignment of mouse genes to individual retroviral integration sites has b......, and for understanding fundamental cellular regulatory principles and retroviral biology.......Background Insertional mutagenesis screens of retrovirus-induced mouse tumors have proven valuable in human cancer research and for understanding adverse effects of retroviral-based gene therapies. In previous studies, the assignment of mouse genes to individual retroviral integration sites has...

  17. Spinal ultrasound versus palpation for epidural catheter insertion in labour: A randomised controlled trial.

    Science.gov (United States)

    Arzola, Cristian; Mikhael, Rafeek; Margarido, Clarita; Carvalho, Jose C A

    2015-07-01

    Ultrasound imaging of the spine is thought to reduce failed and traumatic neuraxial procedures. Most of the evidence supporting this assumption has been produced in the context of an expert sonographer performing the ultrasound assessment, and it remains unknown whether this technique is useful when used by multiple individual operators. To invesstigate the impact of preprocedural spinal ultrasound on the ease of insertion of labour epidurals by a group of trainees. We hypothesised that the ultrasound-assisted technique would improve the ease of insertion when compared with the conventional palpation technique. A randomised controlled trial. Academic hospital in Toronto, Canada. A group of 17 second-year anaesthesia residents and five anaesthesia fellows underwent a training programme in ultrasound assessment of the spine. Parturients with easily palpable lumbar spines were randomised to either ultrasound or palpation group. Residents and fellows performed both the assessment (ultrasound or palpation) and the epidural procedure. ease of insertion of epidural catheter composed of the time taken to insert the epidural catheter, number of interspace levels attempted and number of needle passes. total procedural time (assessment and insertion); first pass success rate; number of attempts required to thread the epidural catheter; failure of epidural analgesia; and patient satisfaction. We analysed 128 epidural catheter insertions (residents 84, fellows 44). There was no difference in median (interquartile range, IQR) epidural insertion time between the ultrasound and palpation groups [174 (120 to 241) versus 180 (130 to 322.5) s, respectively; P = 0.14]. The number of interspace levels attempted and needle passes were also similar in both groups. The total procedural time was longer in the ultrasound group. The use of preprocedural spinal ultrasound by a cohort of anaesthesia trainees did not improve the ease of insertion of labour epidural catheters in patients

  18. Circular permutant GFP insertion folding reporters

    Science.gov (United States)

    Waldo, Geoffrey S [Santa Fe, NM; Cabantous, Stephanie [Los Alamos, NM

    2008-06-24

    Provided are methods of assaying and improving protein folding using circular permutants of fluorescent proteins, including circular permutants of GFP variants and combinations thereof. The invention further provides various nucleic acid molecules and vectors incorporating such nucleic acid molecules, comprising polynucleotides encoding fluorescent protein circular permutants derived from superfolder GFP, which polynucleotides include an internal cloning site into which a heterologous polynucleotide may be inserted in-frame with the circular permutant coding sequence, and which when expressed are capable of reporting on the degree to which a polypeptide encoded by such an inserted heterologous polynucleotide is correctly folded by correlation with the degree of fluorescence exhibited.

  19. Inter- and intra-individual variation in allele-specific DNA methylation and gene expression in children conceived using assisted reproductive technology.

    Directory of Open Access Journals (Sweden)

    Nahid Turan

    2010-07-01

    Full Text Available Epidemiological studies have reported a higher incidence of rare disorders involving imprinted genes among children conceived using assisted reproductive technology (ART, suggesting that ART procedures may be disruptive to imprinted gene methylation patterns. We examined intra- and inter-individual variation in DNA methylation at the differentially methylated regions (DMRs of the IGF2/H19 and IGF2R loci in a population of children conceived in vitro or in vivo. We found substantial variation in allele-specific methylation at both loci in both groups. Aberrant methylation of the maternal IGF2/H19 DMR was more common in the in vitro group, and the overall variance was also significantly greater in the in vitro group. We estimated the number of trophoblast stem cells in each group based on approximation of the variance of the binomial distribution of IGF2/H19 methylation ratios, as well as the distribution of X chromosome inactivation scores in placenta. Both of these independent measures indicated that placentas of the in vitro group were derived from fewer stem cells than the in vivo conceived group. Both IGF2 and H19 mRNAs were significantly lower in placenta from the in vitro group. Although average birth weight was lower in the in vitro group, we found no correlation between birth weight and IGF2 or IGF2R transcript levels or the ratio of IGF2/IGF2R transcript levels. Our results show that in vitro conception is associated with aberrant methylation patterns at the IGF2/H19 locus. However, very little of the inter- or intra-individual variation in H19 or IGF2 mRNA levels can be explained by differences in maternal DMR DNA methylation, in contrast to the expectations of current transcriptional imprinting models. Extraembryonic tissues of embryos cultured in vitro appear to be derived from fewer trophoblast stem cells. It is possible that this developmental difference has an effect on placental and fetal growth.

  20. Insertional Achilles tendinitis and Haglund's deformity.

    Science.gov (United States)

    Kang, Steve; Thordarson, David B; Charlton, Timothy P

    2012-06-01

    Haglund's deformity is an enlargement of the posterosuperior prominence of the calcaneus, which is frequently associated with insertional Achilles tendinitis. To our knowledge, no study has been done successfully correlating the characteristics of a Haglund's deformity with insertional Achilles tendinitis. The purpose of our study was to analyze the characteristics of a Haglund's deformity in patients with and without insertional Achilles tendinitis to see if there was a correlation. The study was a retrospective radiographic review of a single surgeon's patients with insertional Achilles tendinitis from 2005 to 2008. Our study population consisted of 44 patients, 48 heels (22 male, 22 female) with insertional Achilles tendinitis, with a mean age of 52 (range, 23 to 79) years. Our control population consisted of 50 patients (25 males, 25 females) and 50 heels without insertional Achilles tendinitis with a mean age of 55.6 (range, 18 to 89) years. We introduced two new measurements of the Haglund's deformity in this study: the Haglund's deformity height and peak angle. A standing lateral foot or ankle radiograph was analyzed for each patient and the following measurements were made: Haglund deformity height and peak angle; Bohler's angle; Fowler-Philip angle; and parallel pitch sign. We also looked for the presence of calcification in the study group and the length and width of the calcification. Unpaired t-test was used to analyze the measurements between the groups. Ten patients' radiographs were re-measured and correlation coefficients were obtained to assess the reliability of the measuring techniques. For the insertional Achilles tendinitis group, the mean Haglund's deformity height was 9.6 (range, 5.3 to 15.3) mm and the mean Haglund's deformity peak angle was 105 (range, 87 to 123) degrees. Calcification was present in 35 of 48 or (73%) of patients with a mean length of 13.3 (range, 3.2 to 41.9) mm and mean width of 4.5 (range, 1.0 to 10.4) mm. In the control

  1. Ty1-copia elements reveal diverse insertion sites linked to polymorphisms among flax (Linum usitatissimum L.) accessions.

    Science.gov (United States)

    Galindo-González, Leonardo; Mhiri, Corinne; Grandbastien, Marie-Angèle; Deyholos, Michael K

    2016-12-07

    Initial characterization of the flax genome showed that Ty1-copia retrotransposons are abundant, with several members being recently inserted, and in close association with genes. Recent insertions indicate a potential for ongoing transpositional activity that can create genomic diversity among accessions, cultivars or varieties. The polymorphisms generated constitute a good source of molecular markers that may be associated with phenotype if the insertions alter gene activity. Flax, where accessions are bred mainly for seed nutritional properties or for fibers, constitutes a good model for studying the relationship of transpositional activity with diversification and breeding. In this study, we estimated copy number and used a type of transposon display known as Sequence-Specific Amplification Polymorphisms (SSAPs), to characterize six families of Ty1-copia elements across 14 flax accessions. Polymorphic insertion sites were sequenced to find insertions that could potentially alter gene expression, and a preliminary test was performed with selected genes bearing transposable element (TE) insertions. Quantification of six families of Ty1-copia elements indicated different abundances among TE families and between flax accessions, which suggested diverse transpositional histories. SSAPs showed a high level of polymorphism in most of the evaluated retrotransposon families, with a trend towards higher levels of polymorphism in low-copy number families. Ty1-copia insertion polymorphisms among cultivars allowed a general distinction between oil and fiber types, and between spring and winter types, demonstrating their utility in diversity studies. Characterization of polymorphic insertions revealed an overwhelming association with genes, with insertions disrupting exons, introns or within 1 kb of coding regions. A preliminary test on the potential transcriptional disruption by TEs of four selected genes evaluated in three different tissues, showed one case of significant

  2. Peripherally inserted central catheters in infants and children - indications, techniques, complications and clinical recommendations

    DEFF Research Database (Denmark)

    Westergaard, B; Classen, V; Walther-Larsen, S

    2013-01-01

    Venous access required both for blood sampling and for the delivery of medicines and nutrition is an integral element in the care of sick infants and children. Peripherally inserted central catheters (PICCs) have been shown to be a valuable alternative to traditional central venous devices...... of perioperative complications. Assisted visualisation, preferably with ultrasound, yields high rates of insertion success. With good catheter care, rates of mechanical, infectious and thrombotic complications are low and compare favourably with those of traditional central venous catheters. Even in the case...... of the current literature. Although the literature is heterogeneous with few randomised studies, PICCs emerge as a safe and valuable option for intermediate- to long-term central venous access in children both in and out of hospital. Insertion can often be performed in light or no sedation, with little risk...

  3. Patients Comprehension of Pharmaceutical Package Inserts ...

    African Journals Online (AJOL)

    Purpose: To investigate the knowledge and attitude of outpatients regarding pharmaceutical package inserts (PPIs) in Karachi, Pakistan. Methods: The study design was cross-sectional and conducted from August to December 2013. A previously validated questionnaire was adopted, modified and revalidated. Outpatients ...

  4. Aspects of insertion in random trees

    NARCIS (Netherlands)

    Bagchi, Arunabha; Reingold, E.M.

    1982-01-01

    A method formulated by Yao and used by Brown has yielded bounds on the fraction of nodes with specified properties in trees bult by a sequence of random internal nodes in a random tree built by binary search and insertion, and show that in such a tree about bounds better than those now known. We

  5. SOLVENTLESS MIGRATORY-INSERTION REACTIONS OF ...

    African Journals Online (AJOL)

    Preferred Customer

    Solventless migratory-insertion reactions of substituted cyclopentadienyl iron complexes. Bull. Chem. Soc. Ethiop. 2009, 23(3). 401. A homemade glass heating device was pre-calibrated with crystals of known melting points. An optical microscope fitted with a JVC Digital Camera was used to monitor the reaction, performed ...

  6. Intraoperative precautionary insertion of external ventricular ...

    African Journals Online (AJOL)

    Only eight cases (19%) needed permanent CSF shunting, seven of which were ependymomas and medulloblastomas. None of the cases in this series acquired any EVD related infection, nor did those who required subsequent permanent CSF diversion. Conclusion: Intra-operative insertion of EVD catheter during surgery ...

  7. Atomistic Galois insertions for flow sensitive integrity

    DEFF Research Database (Denmark)

    Nielson, Flemming; Nielson, Hanne Riis

    2017-01-01

    and to obtain full automation we shall explore the over-approximating nature of static analysis. We demonstrate that the use of atomistic Galois insertions constitutes a stable framework in which to obtain sound and fully automatic enforcement of flow sensitive integrity. The framework is illustrated...

  8. Anaesthetic management for ventriculoperitoneal shunt insertion in ...

    African Journals Online (AJOL)

    http://creativecommons.org/licenses/by-nc/3.0. Anaesthetic management for ventriculoperitoneal shunt insertion in an infant with Dandy–Walker Syndrome. Alastair Wayne Moodleya*, Steven Nelac , Eduard Oosthuizenac and Christina Lundgrenbc. aDepartment of Anaesthesia, Charlotte Maxeke Johannesburg Academic ...

  9. Dental Assistants

    Science.gov (United States)

    ... State & Area Data Explore resources for employment and wages by state and area for dental assistants. Similar Occupations Compare the job duties, education, job growth, and pay of dental assistants with ...

  10. Assistive Technology

    Science.gov (United States)

    ... Page Resize Text Printer Friendly Online Chat Assistive Technology Assistive technology (AT) is any service or tool that helps ... be difficult or impossible. For older adults, such technology may be a walker to improve mobility or ...

  11. Design and preliminary analysis of a vaginal inserter for speculum-free cervical cancer screening.

    Science.gov (United States)

    Asiedu, Mercy Nyamewaa; Agudogo, Júlia; Krieger, Marlee S; Miros, Robert; Proeschold-Bell, Rae Jean; Schmitt, John W; Ramanujam, Nimmi

    2017-01-01

    Cervical cancer screening usually requires use of a speculum to provide a clear view of the cervix. The speculum is one potential barrier to screening due to fear of pain, discomfort and embarrassment. The aim of this paper is to present and demonstrate the feasibility of a tampon-sized inserter and the POCkeT Colposcope, a miniature pen sized-colposcope, for comfortable, speculum-free and potentially self-colposcopy. We explored different designs using 3D computer-aided design (CAD) software and performed mechanical testing simulations on each. Designs were rapid prototyped and tested using a custom vaginal phantom across a range of vaginal pressures and uterine tilts to select an optimal design. Two final designs were tested with fifteen volunteers to assess cervix visualization, comfort and usability compared to the speculum and the optimal design, the curved-tip inserter, was selected for testing in volunteers. We present a vaginal inserter as an alternative to the standard speculum for use with the POCkeT Colposcope. The device has a slim tubular body with a funnel-like curved tip measuring approximately 2.5 cm in diameter. The inserter has a channel through which a 2 megapixel (MP) mini camera with LED illumination fits to enable image capture. Mechanical finite element testing simulations with an applied pressure of 15 cm H2O indicated a high factor of safety (90.9) for the inserter. Testing of the device with a custom vaginal phantom, across a range of supine vaginal pressures and uterine tilts (retroverted, anteverted and sideverted), demonstrated image capture with a visual area comparable to the speculum for a normal/axial positioned uteri and significantly better than the speculum for anteverted and sideverted uteri (p<0.00001). Volunteer studies with self-insertion and physician-assisted cervix image capture showed adequate cervix visualization for 83% of patients. In addition, questionnaire responses from volunteers indicated a 92.3% overall

  12. Creation of a Dense Transposon Insertion Library Using Bacterial Conjugation in Enterobacterial Strains Such As Escherichia Coli or Shigella flexneri.

    Science.gov (United States)

    Freed, Nikki E

    2017-09-23

    Transposon mutagenesis is a method that allows gene disruption via the random genomic insertion of a piece of DNA called a transposon. The protocol below outlines a method for high efficiency transfer between bacterial strains of a plasmid harboring a transposon containing a kanamycin resistance marker. The plasmid-borne transposase is encoded by a variant tnp gene that inserts the transposon into the genome of the recipient strain with very low insertional bias. This method thus allows the creation of large mutant libraries in which transposons have been inserted into unique genomic positions in a recipient strain of either Escherichia coli or Shigella flexneri bacteria. By using bacterial conjugation, as opposed to other methods such as electroporation or chemical transformation, large libraries with hundreds of thousands of unique clones can be created. This yields high-density insertion libraries, with insertions occurring as frequently as every 4-6 base pairs in non-essential genes. This method is superior to other methods as it allows for an inexpensive, easy to use, and high efficiency method for the creation of a dense transposon insertion library. The transposon library can be used in downstream applications such as transposon sequencing (Tn-Seq), to infer genetic interaction networks, or more simply, in mutational (forward genetic) screens.

  13. A critical appraisal of medication package inserts

    Directory of Open Access Journals (Sweden)

    Pranjit Narzaree

    2015-10-01

    Full Text Available Introduction: Package Inserts (PIs refers to officially specified document that accompanies a drug for relevant, updated and unbiased information for rational drug use based on regulatory guidelines as per section 6.2 and 6.3 of schedule D of Indian Drug and cosmetic Act 1945. But some studies had shown non-uniformity with suboptimal level of informations which frequently can lead to medication errors. Hence this study was conducted to evaluate the completeness of PIs.Aim: To critically evaluate package inserts of allopathic medicines.Material and Methods: 100 allopathic drug PIs were collected from pharmacies in Rohtak and were checked for the presence of each heading as per schedule D criteria, followed by scrutiny of the information included under the heading. Indian guidelines were also compared with US FDA guidelines for PIs.Scoring of package inserts: The informations were evaluated for completeness and scored as 1 if present otherwise scored as zero for no information or partial information. Scores for each heading were calculated by totaling the scores of all the package inserts. The total scores were expressed as absolute numbers and percentages.Results:  On an average PIs analyzed for the completeness of the criteria scored 10 (Mean± SD = 9.73±2.48 out of 16. Absence of common layout and headings caused inconvenience. In comparison to US FDA guidelines it lacked, disclaimer statement, boxed warning, revision date, approval date, toll-free number etc.Conclusion: PIs don’t seem to be serving effectively because of multiple deficiencies like completeness, uniformity, absence of headings.Keywords: Critical appraisal, package inserts.

  14. Consolidation and disposal of PWR fuel inserts

    Energy Technology Data Exchange (ETDEWEB)

    Wakeman, B.H. (Virginia Electric and Power Co., Glen Allen, VA (United States))

    1992-08-01

    Design and licensing of the Surry Power Station Independent Spent Fuel Storage Installation was initiated in 1982 by Virginia Power as part of a comprehensive strategy to increase spent fuel storage capacity at the Station. Designed to use large, metal dry storage casks, the Surry Installation will accommodate 84 such casks with a total storage capacity of 811 MTU of spent pressurized water reactor fuel assemblies. Virginia Power provided three storage casks for testing at the Idaho National Engineerinq Laboratory's Test Area North and the testing results have been published by the Electric Power Research Institute. Sixty-nine spent fuel assemblies were transported in truck casks from the Surry Power Station to Test Area North for testing in the three casks. Because of restrictions imposed by the cask testing equipment at Test Area North, the irradiated insert components stored in these fuel assemblies at Surry were removed prior to transport of the fuel assemblies. Retaining these insert components proved to be a problem because of a shortage of spent fuel assemblies in the spent fuel storage pool that did not already contain insert components. In 1987 Virginia Power contracted with Chem-Nuclear Systems, Inc. to process and dispose of 136 irradiated insert components consisting of 125 burnable poison rod assemblies, 10 thimble plugging devices and 1 part-length rod cluster control assembly. This work was completed in August and September 1987, culminating in the disposal at the Barnwell, SC low-level radioactive waste facility of two CNS 3-55 liners containing the consolidated insert components.

  15. Assistive Technologies

    Science.gov (United States)

    Auat Cheein, Fernando A., Ed.

    2012-01-01

    This book offers the reader new achievements within the Assistive Technology field made by worldwide experts, covering aspects such as assistive technology focused on teaching and education, mobility, communication and social interactivity, among others. Each chapter included in this book covers one particular aspect of Assistive Technology that…

  16. Projection-based visual guidance for robot-aided RF needle insertion.

    Science.gov (United States)

    Wen, Rong; Chui, Chee-Kong; Ong, Sim-Heng; Lim, Kah-Bin; Chang, Stephen Kin-Yong

    2013-11-01

    The use of projector-based augmented reality (AR) in surgery may enable surgeons to directly view anatomical models and surgical data from the patient's surface (skin). It has the advantages of a consistent viewing focus on the patient, an extended field of view and augmented interaction. This paper presents an AR guidance mechanism with a projector-camera system to provide the surgeon with direct visual feedback for supervision of robotic needle insertion in radiofrequency (RF) ablation treatment. The registration of target organ models to specific positions on the patient body is performed using a surface-matching algorithm and point-based registration. An algorithm based on the extended Kalman filter and spatial transformation is used to intraoperatively compute the virtual needle's depth in the patient's body for AR display. Experiments of this AR system on a mannequin were conducted to evaluate AR visualization and accuracy of virtual RF needle insertion. The average accuracy of 1.86 mm for virtual needle insertion met the clinical requirement of 2 mm or better. The feasibility of augmented interaction with a surgical robot using the proposed open AR interface with active visual feedback was demonstrated. The experimental results demonstrate that this guidance system is effective in assisting a surgeon to perform a robot-assisted radiofrequency ablation procedure. The novelty of the work lies in establishing a navigational procedure for percutaneous surgical augmented intervention integrating a projection-based AR guidance and robotic implementation for surgical needle insertion.

  17. The Impact of Peptide Insertions on Adeno-Associated Viral Vector Fate

    OpenAIRE

    Uhrig, Silke

    2010-01-01

    Recombinant adeno-associated viral (rAAV) vectors possess a number of attractive properties including low immunogenicity, high stability, longevity of transgene expression and the potential to integrate site-specifically without known side-effects. The major limitation regarding the use of AAV vectors for gene therapy is the broad tissue tropism of AAV following in vivo gene tranfer application. Recently, genetic modification of the AAV capsid by insertion of receptor-specific ligands (AAV ta...

  18. Co-incident insertion enables high efficiency genome engineering in mouse embryonic stem cells.

    Science.gov (United States)

    Shy, Brian R; MacDougall, Matthew S; Clarke, Ryan; Merrill, Bradley J

    2016-09-19

    CRISPR/Cas9 nucleases have enabled powerful, new genome editing capabilities; however, the preponderance of non-homologous end joining (NHEJ) mediated repair events over homology directed repair (HDR) in most cell types limits the ability to engineer precise changes in mammalian genomes. Here, we increase the efficiency of isolating precise HDR-mediated events in mouse embryonic stem (ES) cells by more than 20-fold through the use of co-incidental insertion (COIN) of independent donor DNA sequences. Analysis of on:off-target frequencies at the Lef1 gene revealed that bi-allelic insertion of a PGK-Neo cassette occurred more frequently than expected. Using various selection cassettes targeting multiple loci, we show that the insertion of a selectable marker at one control site frequently coincided with an insertion at an unlinked, independently targeted site, suggesting enrichment of a sub-population of HDR-proficient cells. When individual cell events were tracked using flow cytometry and fluorescent protein markers, individual cells frequently performed either a homology-dependent insertion event or a homology-independent event, but rarely both types of insertions in a single cell. Thus, when HDR-dependent selection donors are used, COIN enriches for HDR-proficient cells among heterogeneous cell populations. When combined with a self-excising selection cassette, COIN provides highly efficient and scarless genome editing. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Housing Assistance

    Directory of Open Access Journals (Sweden)

    Emma Baker

    2013-07-01

    Full Text Available In Australia, an increasing number of households face problems of access to suitable housing in the private market. In response, the Federal and State Governments share responsibility for providing housing assistance to these, mainly low-income, households. A broad range of policy instruments are used to provide and maintain housing assistance across all housing tenures, for example, assisting entry into homeownership, providing affordability assistance in the private rental market, and the provision of socially owned and managed housing options. Underlying each of these interventions is the premise that secure, affordable, and appropriate housing provides not only shelter but also a number of nonshelter benefits to individuals and their households. Although the nonshelter outcomes of housing are well acknowledged in Australia, the understanding of the nonshelter outcomes of housing assistance is less clear. This paper explores nonshelter outcomes of three of the major forms of housing assistance provided by Australian governments—low-income mortgage assistance, social housing, and private rent assistance. It is based upon analysis of a survey of 1,353 low-income recipients of housing assistance, and specifically measures the formulation of health and well-being, financial stress, and housing satisfaction outcomes across these three assistance types. We find clear evidence that health, finance, and housing satisfaction outcomes are associated with quite different factors for individuals in these three major housing assistance types.

  20. Long-term T-DNA insert stability and transgene expression consistency in field propagated sugarcane.

    Science.gov (United States)

    Caffall, Kerry Hosmer; He, Chengkun; Smith-Jones, Michele; Mayo, Kristin; Mai, Pearl; Dong, Shujie; Ke, John; Dunder, Erik; Yarnall, Michele; Whinna, Rachel; DeMaio, Joe; Gu, Weining; Sheldon, Judith; Allen, Martin; Costello, Tricia; Setliff, Kristin; Jain, Rakesh; Snyder, Ada; Lovelady, Clark; Rawls, Eric; Palmer, Eric; Zhang, Yan; Bate, Nicholas; Shi, Liang; Jepson, Ian

    2017-03-01

    This study addresses T-DNA insert stability and transgene expression consistency in multiple cycles of field propagated sugarcane. T-DNA inserts are stable; no transgene rearrangements were observed. AmCYAN1 and PMI protein accumulation levels were maintained. There was no evidence that production of either protein declined across generations and no transgene silencing was observed in three commercial sugarcane varieties through commercially relevant ratooning, propagation-by-setts, and micro-propagation generation processes over 4 years of field testing. Long term transgene expression consistency and T-DNA insert stability can be achieved in sugarcane, suggesting that it is highly probable that transgenic sugarcane can be successfully commercialized. This study addresses T-DNA insert stability and transgene expression consistency in multiple cycles of field propagated sugarcane. These data are critical supporting information needed for successful commercialization of GM sugarcane. Here seventeen transgenic events, containing the AmCYAN1 gene driven by a CMP promoter and the E. coli PMI gene driven by either a CMP or Ubi promoter, were used to monitor T-DNA insert stability and consistency of transgene encoded protein accumulation through commercially relevant ratooning, propagation-by-setts, and micro-propagation generation processes. The experiments were conducted in three commercial sugarcane varieties over 4 years of field testing. DNA gel blot analysis showed that the T-DNA inserts are stable; no transgene rearrangements were observed. Quantitative ELISA showed no evidence of decreasing AmCYAN1 and PMI protein levels across generations and no transgene silencing was observed. These results indicate that long term transgene expression consistency and T-DNA insert stability can be achieved in sugarcane, suggesting that it is highly probable that transgenic sugarcane can be successfully commercialized.

  1. Clinical Application of Insertion Force Sensor System for Coil Embolization of Intracranial Aneurysms.

    Science.gov (United States)

    Matsubara, Noriaki; Miyachi, Shigeru; Izumi, Takashi; Yamada, Hiroyuki; Marui, Naoki; Ota, Keisuke; Tajima, Hayato; Shintai, Kazunori; Ito, Masashi; Imai, Tasuku; Nishihori, Masahiro; Wakabayashi, Toshihiko

    2017-09-01

    In endovascular embolization for intracranial aneurysms, it is important to properly control the coil insertion force. However, the force can only be subjectively detected by the subtle feedback experienced by neurointerventionists at their fingertips. The authors envisioned a system that would objectively sense and quantify that force. In this article, coil insertion force was measured in cases of intracranial aneurysm using this sensor, and its actual clinical application was investigated. The sensor consists of a hemostatic valve (Y-connector). A little flexure was intentionally added in the device, and it creates a bend in the delivery wire. The sensor measures the change in the position of the bent wire depending on the insertion force and translates it into a force value. Using this, embolization was performed for 10 unruptured intracranial aneurysms. The sensor adequately recorded the force, and it reflected the operators' usual clinical experience. The presence of the sensor did not affect the procedures. The sensor enabled the operators to objectively note and evaluate the insertion force and better cooperative handling was possible. Additionally, other members of the intervention team shared the information. Force records demonstrated the characteristic patterns according to every stage of coiling (framing, filling, and finishing). The force sensor system adequately measured coil insertion force in intracranial aneurysm coil embolization procedures. The safety of this sensor was demonstrated in clinical application for the limited number of patients. This system is useful adjunct for assisting during coil embolization for an intracranial aneurysm. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. A macaque's-eye view of human insertions and deletions: differences in mechanisms.

    Directory of Open Access Journals (Sweden)

    Erika M Kvikstad

    2007-09-01

    Full Text Available Insertions and deletions (indels cause numerous genetic diseases and lead to pronounced evolutionary differences among genomes. The macaque sequences provide an opportunity to gain insights into the mechanisms generating these mutations on a genome-wide scale by establishing the polarity of indels occurring in the human lineage since its divergence from the chimpanzee. Here we apply novel regression techniques and multiscale analyses to demonstrate an extensive regional indel rate variation stemming from local fluctuations in divergence, GC content, male and female recombination rates, proximity to telomeres, and other genomic factors. We find that both replication and, surprisingly, recombination are significantly associated with the occurrence of small indels. Intriguingly, the relative inputs of replication versus recombination differ between insertions and deletions, thus the two types of mutations are likely guided in part by distinct mechanisms. Namely, insertions are more strongly associated with factors linked to recombination, while deletions are mostly associated with replication-related features. Indel as a term misleadingly groups the two types of mutations together by their effect on a sequence alignment. However, here we establish that the correct identification of a small gap as an insertion or a deletion (by use of an outgroup is crucial to determining its mechanism of origin. In addition to providing novel insights into insertion and deletion mutagenesis, these results will assist in gap penalty modeling and eventually lead to more reliable genomic alignments.

  3. Human transposon insertion profiling: Analysis, visualization and identification of somatic LINE-1 insertions in ovarian cancer

    Science.gov (United States)

    Tang, Zuojian; Steranka, Jared P.; Ma, Sisi; Grivainis, Mark; Rodić, Nemanja; Huang, Cheng Ran Lisa; Shih, Ie-Ming; Wang, Tian-Li; Fenyö, David

    2017-01-01

    Mammalian genomes are replete with interspersed repeats reflecting the activity of transposable elements. These mobile DNAs are self-propagating, and their continued transposition is a source of both heritable structural variation as well as somatic mutation in human genomes. Tailored approaches to map these sequences are useful to identify insertion alleles. Here, we describe in detail a strategy to amplify and sequence long interspersed element-1 (LINE-1, L1) retrotransposon insertions selectively in the human genome, transposon insertion profiling by next-generation sequencing (TIPseq). We also report the development of a machine-learning–based computational pipeline, TIPseqHunter, to identify insertion sites with high precision and reliability. We demonstrate the utility of this approach to detect somatic retrotransposition events in high-grade ovarian serous carcinoma. PMID:28096347

  4. Comparison of conventional Injection Mould Inserts to Additively Manufactured Inserts using Life Cycle Assessment

    DEFF Research Database (Denmark)

    Hofstätter, Thomas; Bey, Niki; Mischkot, Michael

    2016-01-01

    Polymer Additive Manufacturing can be used to produce soft tooling inserts for injection moulding. Compared to conventional tooling, the energy and time consumption during production are significantly lower. As the life time of such inserts is significantly shorter than the life time of traditional...... of their potential environmental impact and yield throughout the development and pilot phase. Insert geometry is particularly advantageous for pilot production and small production sizes. In this research, Life Cycle Assessment is used to compare the environmental impact of soft tooling by Additive Manufacturing...... (using Digital Light Processing) and three traditional methods for the manufacture of inserts (milling of brass, steel, and aluminium) for injection moulds during the pre-production phase....

  5. An ImprovedBrome mosaic virusSilencing Vector: Greater Insert Stability and More Extensive VIGS.

    Science.gov (United States)

    Ding, Xin Shun; Mannas, Stephen W; Bishop, Bethany A; Rao, Xiaolan; Lecoultre, Mitchell; Kwon, Soonil; Nelson, Richard S

    2018-01-01

    Virus-induced gene silencing (VIGS) is used extensively for gene function studies in plants. VIGS is inexpensive and rapid compared with silencing conducted through stable transformation, but many virus-silencing vectors, especially in grasses, induce only transient silencing phenotypes. A major reason for transient phenotypes is the instability of the foreign gene fragment (insert) in the vector during VIGS. Here, we report the development of a Brome mosaic virus (BMV)-based vector that better maintains inserts through modification of the original BMV vector RNA sequence. Modification of the BMV RNA3 sequence yielded a vector, BMVCP5, that better maintained phytoene desaturase and heat shock protein70-1 ( HSP70-1 ) inserts in Nicotiana benthamiana and maize ( Zea mays ). Longer maintenance of inserts was correlated with greater target gene silencing and more extensive visible silencing phenotypes displaying greater tissue penetration and involving more leaves. The modified vector accumulated similarly to the original vector in N. benthamiana after agroinfiltration, thus maintaining a high titer of virus in this intermediate host used to produce virus inoculum for grass hosts. For HSP70 , silencing one family member led to a large increase in the expression of another family member, an increase likely related to the target gene knockdown and not a general effect of virus infection. The cause of the increased insert stability in the modified vector is discussed in relationship to its recombination and accumulation potential. The modified vector will improve functional genomic studies in grasses, and the conceptual methods used to improve the vector may be applied to other VIGS vectors. © 2018 American Society of Plant Biologists. All Rights Reserved.

  6. Plasmids containing insertion elements are potential transposons.

    OpenAIRE

    Ohtsubo, E; Zenilman, M; Ohtsubo, H

    1980-01-01

    We studied in vivo recombination between the plasmid pHS1, a temperature-sensitive replication mutant carrying tetracycline resistance, and pSM1, a small plasmid carrying one copy of the insertion element IS1. Recombinant plasmids were found by selection for tetracycline resistance at 42 degrees C. Their formation was independent of recA function. Analysis of the physical structures of various recombinant DNA molecules with electron microscopy and restriction endonucleases revealed that pSMI ...

  7. Aspergillus arachnoiditis post intrathecal baclofen pump insertion.

    Science.gov (United States)

    Vivek, V; Kavar, B; Hogg, M; Eisen, D P; Butzkueven, H

    2013-08-01

    This report describes an unusual fungal infection of an intrathecal baclofen pump which, to our knowledge, has not been reported previously. We describe a 39-year-old man with severe lower limb spasticity due to secondary progressive multiple sclerosis that was managed with insertion of an intrathecal baclofen pump. He subsequently presented with distinct neurological decline secondary to an intrathecal baclofen pump infection with Aspergillus terreus. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

  8. Thought insertion, cognitivism, and inner space.

    Science.gov (United States)

    Thornton, Tim

    2002-08-01

    Whatever its underlying causes, even the description of the phenomenon of thought insertion, of the content of the delusion, presents difficulty. It may seem that the best hope of a description comes from a broadly cognitivist approach to the mind which construes content-laden mental states as internal mental representations within what is literally an inner space: the space of the brain or nervous system. Such an approach objectifies thoughts in a way which might seem to hold out the prospect of describing the ''alienated'' relation to one's own thoughts that seems to be present in thought insertion.1 Firstly, I examine the general structure of cognitivist accounts of intentional or content-laden mental states. I raise the general difficulty of explaining how free-standing, and thus world-independent, inner states can still have bearing on the outer world. Secondly, I briefly examine Frith's model for explaining thought insertion and other passivity phenomena by postulating a failure of an internal monitoring mechanism of inner states. I question what account can be given of non-pathological cases and raise two specific objects. Cognitivist accounts of the mind face a general, and possibly insuperable, challenge: explaining the intentionality of mental states in non-intentional, nonquestion-begging terms. There have so far been no satisfactory solutions. Cognitivist accounts of passivity phenomena in terms of a failure of internal monitoring face two objections. Firstly, accounting for non-pathological cases generates an infinite regress. Secondly, no account can be given of the paradoxical nature of utterances of the form of Moore's paradox: ''it is raining but I do not believe it''. A cognitivist approach presents an alienated account of thought in normal, non-pathological cases and is no help in accounting for thought insertion.

  9. Experimental insertions made of two symmetric triplets

    CERN Document Server

    D'Amico, T E

    1998-01-01

    The reported study is based on the analytical treatment developed for an experimental collider insertion made of two symmetric triplets,the inner triplet located near the interaction point (IP) and th e outer triplet preceding a regular lattice. These two triplets are assumed to be symmetric in their geometry and quadrupole strengths, but not in their Twiss parameters. The method is applied to an i nsertion of the type of an experimental LHC insertion. The drift between the IP and the first quadrupole is fixed and the inner triplet is constrained to achieve a beta-crossing with equal and opposit e slopes (alpha-values) in the two planes. The outer triplet acts then as a FODO transformer from beta-crossing to beta-crossing in order to match the lattice. The analysis provides in a given paramet er interval all the existing solutions for the distance between triplets and the total insertion length, as functions of one gradient and the quadrupole separation in the inner triplet. The variation of the quadrupole st...

  10. Cognitive-behavioral interventions for IV insertion pain.

    Science.gov (United States)

    Jacobson, Ann F

    2006-12-01

    INSERTION OF AN IV CATHETER is a commonly performed and painful procedure. The use of cognitive-behavioral interventions (CBIs) may decrease pain by diverting the patient's attention to stimuli other than pain. THIS RANDOMIZED, CONTROLLED TRIAL examined the effect of three CBIs--music, kaleidoscope, and guided imagery--on IV insertion pain in 324 patients. NO STATISTICALLY SIGNIFICANT differences in IV insertion pain were found among the treatment and control groups or between choosing versus being assigned a CBI. Insertion attempts were more difficult in women, and insertion difficulty was correlated with pain intensity and pain distress. Pain intensity was related to insertion site and catheter gauge.

  11. Development of in vitro transposon assisted signal sequence trapping and its use in screening Bacillus halodurans C125 and Sulfolobus solfataricus P2 gene libraries

    DEFF Research Database (Denmark)

    Becker, F.; Schnorr, K.; Wilting, R.

    2004-01-01

    minitransposon enabling translational fusions between 'bla and target genes. Fusion of TnSig in the correct reading frame to a protein carrying transmembrane domains or signal peptides resulted in ampicillin resistance of the corresponding clone. Prokaryotic gene libraries from the alkaliphilic bacterium...... in the cell. Genes for secreted proteins, transmembrane proteins and lipoproteins were successfully identified by this method. In contrast to previous transposon based identification strategies, the method described here is fast and versatile and essentially enables any selectable marker compatible library...... to be tagged. It is suited for identifying genes encoding extracytosolic proteins in gene libraries of a wide range of prokaryotic organisms....

  12. Marker Assisted Transfer of Two Powdery Mildew Resistance Genes PmTb7A.1 and PmTb7A.2 from Triticum boeoticum (Boiss. to Triticum aestivum (L..

    Directory of Open Access Journals (Sweden)

    Ahmed Fawzy Abdelnaby Elkot

    Full Text Available Powdery mildew (PM, caused by Blumeria graminis f. sp. tritici, is one of the important wheat diseases, worldwide. Two PM resistance genes, designated as PmTb7A.1 and PmTb7A.2, were identified in T. boeoticum acc. pau5088 and mapped on chromosome 7AL approximately 48cM apart. Two resistance gene analogue (RGA-STS markers Ta7AL-4556232 and 7AL-4426363 were identified to be linked to the PmTb7A.1 and PmTb7A.2, at a distance of 0.6cM and 6.0cM, respectively. In the present study, following marker assisted selection (MAS, the two genes were transferred to T. aestivum using T. durum as bridging species. As many as 12,317 florets of F1 of the cross T. durum /T. boeoticum were pollinated with T. aestivum lines PBW343-IL and PBW621 to produce 61 and 65 seeds, respectively, of three-way F1. The resulting F1s of the cross T. durum/T. boeoticum//T. aestivum were screened with marker flanking both the PM resistance genes PmTb7A.1 and PmTb7A.2 (foreground selection and the selected plants were backcrossed to generate BC1F1. Marker assisted selection was carried both in BC1F1 and the BC2F1 generations. Introgression of alien chromatin in BC2F1 plants varied from 15.4-62.9 percent. Out of more than 110 BC2F1 plants showing introgression for markers linked to the two PM resistance genes, 40 agronomically desirable plants were selected for background selection for the carrier chromosome to identify the plants with minimum of the alien introgression. Cytological analysis showed that most plants have chromosome number ranging from 40-42. The BC2F2 plants homozygous for the two genes have been identified. These will be crossed to generate lines combining both the PM resistance genes but with minimal of the alien introgression. The PM resistance gene PmTb7A.1 maps in a region very close to Sr22, a stem rust resistance gene effective against the race Ug99. Analysis of selected plants with markers linked to Sr22 showed introgression of Sr22 from T. boeoticum in

  13. Time- and Cost-Efficient Identification of T-DNA Insertion Sites through Targeted Genomic Sequencing

    Science.gov (United States)

    Lepage, Étienne; Zampini, Éric; Boyle, Brian; Brisson, Normand

    2013-01-01

    Forward genetic screens enable the unbiased identification of genes involved in biological processes. In Arabidopsis, several mutant collections are publicly available, which greatly facilitates such practice. Most of these collections were generated by agrotransformation of a T-DNA at random sites in the plant genome. However, precise mapping of T-DNA insertion sites in mutants isolated from such screens is a laborious and time-consuming task. Here we report a simple, low-cost and time efficient approach to precisely map T-DNA insertions simultaneously in many different mutants. By combining sequence capture, next-generation sequencing and 2D-PCR pooling, we developed a new method that allowed the rapid localization of T-DNA insertion sites in 55 out of 64 mutant plants isolated in a screen for gyrase inhibition hypersensitivity. PMID:23951038

  14. Experimental testing of exchangeable cutting inserts cutting ability

    OpenAIRE

    Čep, Robert; Janásek, Adam; Čepová, Lenka; Petrů, Jana; Hlavatý, Ivo; Car, Zlatan; Hatala, Michal

    2013-01-01

    The article deals with experimental testing of the cutting ability of exchangeable cutting inserts. Eleven types of exchangeable cutting inserts from five different manufacturers were tested. The tested cutting inserts were of the same shape and were different especially in material and coating types. The main aim was both to select a suitable test for determination of the cutting ability of exchangeable cutting inserts and to design such testing procedure that could make it possible...

  15. Photograph of moon after transearth insertion

    Science.gov (United States)

    1969-01-01

    This photograph of the moon was taken after transearth insertion when the Apollo 10 spacecraft was high above the lunar equator near 27 degrees east longitude. North is about 20 degrees left of the top of the photograph. Apollo Landing Site 3 is on the lighted side of the terminator in a dark area just north of the equator. Apollo Landing Site 2 is near the lower left margin of the Sea of Tranquility (Mare Tranquillitatis), which is the large, dark area near the center of the photograph.

  16. Quantitative insertion-site sequencing (QIseq) for high throughput phenotyping of transposon mutants.

    Science.gov (United States)

    Bronner, Iraad F; Otto, Thomas D; Zhang, Min; Udenze, Kenneth; Wang, Chengqi; Quail, Michael A; Jiang, Rays H Y; Adams, John H; Rayner, Julian C

    2016-07-01

    Genetic screening using random transposon insertions has been a powerful tool for uncovering biology in prokaryotes, where whole-genome saturating screens have been performed in multiple organisms. In eukaryotes, such screens have proven more problematic, in part because of the lack of a sensitive and robust system for identifying transposon insertion sites. We here describe quantitative insertion-site sequencing, or QIseq, which uses custom library preparation and Illumina sequencing technology and is able to identify insertion sites from both the 5' and 3' ends of the transposon, providing an inbuilt level of validation. The approach was developed using piggyBac mutants in the human malaria parasite Plasmodium falciparum but should be applicable to many other eukaryotic genomes. QIseq proved accurate, confirming known sites in >100 mutants, and sensitive, identifying and monitoring sites over a >10,000-fold dynamic range of sequence counts. Applying QIseq to uncloned parasites shortly after transfections revealed multiple insertions in mixed populations and suggests that >4000 independent mutants could be generated from relatively modest scales of transfection, providing a clear pathway to genome-scale screens in P. falciparum QIseq was also used to monitor the growth of pools of previously cloned mutants and reproducibly differentiated between deleterious and neutral mutations in competitive growth. Among the mutants with fitness defects was a mutant with a piggyBac insertion immediately upstream of the kelch protein K13 gene associated with artemisinin resistance, implying mutants in this gene may have competitive fitness costs. QIseq has the potential to enable the scale-up of piggyBac-mediated genetics across multiple eukaryotic systems. © 2016 Bronner et al.; Published by Cold Spring Harbor Laboratory Press.

  17. Instability of the insertional mutation in CftrTgH(neoimHgu cystic fibrosis mouse model

    Directory of Open Access Journals (Sweden)

    Dorin Julia R

    2004-04-01

    Full Text Available Abstract Background A major boost to the cystic fibrosis disease research was given by the generation of various mouse models using gene targeting in embryonal stem cells. Moreover, the introduction of the same mutation on different inbred strains generating congenic strains facilitated the search for modifier genes. From the original CftrTgH(neoimHgu CF mouse model we have generated using strict brother × sister mating two inbred CftrTgH(neoimHgu mouse lines (CF/1 and CF/3. Thereafter, the insertional mutation was introgressed from CF/3 into three inbred backgrounds (C57BL/6, BALB/c, DBA/2J generating congenic animals. In every backcross cycle germline transmission of the insertional mutation was monitored by direct probing the insertion via Southern RFLP. In order to bypass this time consuming procedure we devised an alternative PCR based protocol whereby mouse strains are differentiated at the Cftr locus by Cftr intragenic microsatellite genotypes that are tightly linked to the disrupted locus. Results Using this method we were able to identify animals carrying the insertional mutation based upon the differential haplotypic backgrounds of the three inbred strains and the mutant CftrTgH(neoimHgu at the Cftr locus. Moreover, this method facilitated the identification of the precise vector excision from the disrupted Cftr locus in two out of 57 typed animals. This reversion to wild type status took place without any loss of sequence revealing the instability of insertional mutations during the production of congenic animals. Conclusions We present intragenic microsatellite markers as a tool for fast and efficient identification of the introgressed locus of interest in the recipient strain during congenic animal breeding. Moreover, the same genotyping method allowed the identification of a vector excision event, posing questions on the stability of insertional mutations in mice.

  18. Can Peripheral Central Venous Lines be inserted safely and ...

    African Journals Online (AJOL)

    Background: Primary care settings often lack facilities for radiological evaluation of the position of supra-and infra-clavicularly inserted central venous catheters. If peripherally inserted central venous lines could reliably be successfully inserted this would make the need for immediate confirmatory radiological studies less ...

  19. 21 CFR 886.5420 - Contact lens inserter/remover.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Contact lens inserter/remover. 886.5420 Section 886.5420 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) MEDICAL DEVICES OPHTHALMIC DEVICES Therapeutic Devices § 886.5420 Contact lens inserter/remover. (a) Identification. A contact lens inserter...

  20. Rampant nuclear insertion of mtDNA across diverse lineages within Orthoptera (Insecta).

    Science.gov (United States)

    Song, Hojun; Moulton, Matthew J; Whiting, Michael F

    2014-01-01

    Nuclear mitochondrial pseudogenes (numts) are non-functional fragments of mtDNA inserted into the nuclear genome. Numts are prevalent across eukaryotes and a positive correlation is known to exist between the number of numts and the genome size. Most numt surveys have relied on model organisms with fully sequenced nuclear genomes, but such analyses have limited utilities for making a generalization about the patterns of numt accumulation for any given clade. Among insects, the order Orthoptera is known to have the largest nuclear genome and it is also reported to include several species with a large number of numts. In this study, we use Orthoptera as a case study to document the diversity and abundance of numts by generating numts of three mitochondrial loci across 28 orthopteran families, representing the phylogenetic diversity of the order. We discover that numts are rampant in all lineages, but there is no discernable and consistent pattern of numt accumulation among different lineages. Likewise, we do not find any evidence that a certain mitochondrial gene is more prone to nuclear insertion than others. We also find that numt insertion must have occurred continuously and frequently throughout the diversification of Orthoptera. Although most numts are the result of recent nuclear insertion, we find evidence of very ancient numt insertion shared by highly divergent families dating back to the Jurassic period. Finally, we discuss several factors contributing to the extreme prevalence of numts in Orthoptera and highlight the importance of exploring the utility of numts in evolutionary studies.

  1. Rampant nuclear insertion of mtDNA across diverse lineages within Orthoptera (Insecta.

    Directory of Open Access Journals (Sweden)

    Hojun Song

    Full Text Available Nuclear mitochondrial pseudogenes (numts are non-functional fragments of mtDNA inserted into the nuclear genome. Numts are prevalent across eukaryotes and a positive correlation is known to exist between the number of numts and the genome size. Most numt surveys have relied on model organisms with fully sequenced nuclear genomes, but such analyses have limited utilities for making a generalization about the patterns of numt accumulation for any given clade. Among insects, the order Orthoptera is known to have the largest nuclear genome and it is also reported to include several species with a large number of numts. In this study, we use Orthoptera as a case study to document the diversity and abundance of numts by generating numts of three mitochondrial loci across 28 orthopteran families, representing the phylogenetic diversity of the order. We discover that numts are rampant in all lineages, but there is no discernable and consistent pattern of numt accumulation among different lineages. Likewise, we do not find any evidence that a certain mitochondrial gene is more prone to nuclear insertion than others. We also find that numt insertion must have occurred continuously and frequently throughout the diversification of Orthoptera. Although most numts are the result of recent nuclear insertion, we find evidence of very ancient numt insertion shared by highly divergent families dating back to the Jurassic period. Finally, we discuss several factors contributing to the extreme prevalence of numts in Orthoptera and highlight the importance of exploring the utility of numts in evolutionary studies.

  2. Presence of extensive Wolbachia symbiont insertions discovered in the genome of its host Glossina morsitans morsitans.

    Directory of Open Access Journals (Sweden)

    Corey Brelsfoard

    2014-04-01

    Full Text Available Tsetse flies (Glossina spp. are the cyclical vectors of Trypanosoma spp., which are unicellular parasites responsible for multiple diseases, including nagana in livestock and sleeping sickness in humans in Africa. Glossina species, including Glossina morsitans morsitans (Gmm, for which the Whole Genome Sequence (WGS is now available, have established symbiotic associations with three endosymbionts: Wigglesworthia glossinidia, Sodalis glossinidius and Wolbachia pipientis (Wolbachia. The presence of Wolbachia in both natural and laboratory populations of Glossina species, including the presence of horizontal gene transfer (HGT events in a laboratory colony of Gmm, has already been shown. We herein report on the draft genome sequence of the cytoplasmic Wolbachia endosymbiont (cytWol associated with Gmm. By in silico and molecular and cytogenetic analysis, we discovered and validated the presence of multiple insertions of Wolbachia (chrWol in the host Gmm genome. We identified at least two large insertions of chrWol, 527,507 and 484,123 bp in size, from Gmm WGS data. Southern hybridizations confirmed the presence of Wolbachia insertions in Gmm genome, and FISH revealed multiple insertions located on the two sex chromosomes (X and Y, as well as on the supernumerary B-chromosomes. We compare the chrWol insertions to the cytWol draft genome in an attempt to clarify the evolutionary history of the HGT events. We discuss our findings in light of the evolution of Wolbachia infections in the tsetse fly and their potential impacts on the control of tsetse populations and trypanosomiasis.

  3. Development of Insertion and Deletion Markers based on Biparental Resequencing for Fine Mapping Seed Weight in Soybean

    Directory of Open Access Journals (Sweden)

    Ying-hui Li

    2014-11-01

    Full Text Available As a complement to single nucleotide polymorphisms (SNPs and simple sequence repeats (SSRs, biallelic insertions and deletions (InDels represent powerful molecular markers with desirable features for filling the gap in current genetic linkage maps. In this study, 28,908 small InDel polymorphisms (1–5 base pair, bp distributed genome-wide were identified and annotated by comparison of a whole-genome resequencing data set from two soybean [ (L. Merr.] genotypes, cultivar Zhonghunag13 (ZH and line Zhongpin03-5373 (ZP. The physical distribution of InDel polymorphisms in soybean genome was uneven, and matched closely with the distribution of previously annotated genes. The average density of InDel in the arm region was significantly higher than that in the pericentromeric region. The genomic regions that were fixed between the two elites were elucidated. With this information, five InDel markers within a putative quantitative trait locus (QTL for seed weight (SW, , were developed and used to genotype 254 recombinant inbred lines (RILs derived from the cross of ZP × ZH. Adding these five InDel markers to previously used SNP and SSR markers facilitated the discovery of further recombination events allowing fine-mapping the QTL to a 0.5 Mbp region. Our study clearly underlines the high value of InDel markers for map-based cloning and marker-assisted selection in soybean.

  4. Construction of Small-Insert and Large-Insert Metagenomic Libraries.

    Science.gov (United States)

    Simon, Carola; Daniel, Rolf

    2017-01-01

    The vast majority of the Earth's biological diversity is hidden in uncultured and yet uncharacterized microbial genomes. The construction of metagenomic libraries is a cultivation-independent molecular approach to assess this unexplored genetic reservoir. High numbers of novel biocatalysts have been identified by function-based or sequence-based screening of metagenomic libraries derived from various environments. Here, we describe detailed protocols for the construction of metagenomic small-insert and large-insert libraries in plasmids and fosmids, respectively, from environmental DNA.

  5. Lithium Insertion Chemistry of Some Iron Vanadates

    Energy Technology Data Exchange (ETDEWEB)

    Patoux, Sebastien; Richardson, Thomas J.

    2007-02-02

    Lithium insertion into various iron vanadates has been investigated. Fe{sub 2}V{sub 4}O{sub 13} and Fe{sub 4}(V{sub 2}O{sub 7}){sub 3} {center_dot} 3H{sub 2}O have discharge capacities approaching 200 mAh/g above 2.0 V vs. Li{sup +}/Li. Although the potential profiles change significantly between the first and subsequent discharges, capacity retention is unexpectedly good. Other phases, structurally related to FeVO{sub 4}, containing copper and/or sodium ions were also studied. One of these, {beta}-Cu{sub 3}Fe{sub 4}(VO{sub 4}){sub 6}, reversibly consumes almost 10 moles of electrons per formula unit (ca. 240 mAh g{sup -1}) between 3.6 and 2.0 V vs. Li{sup +}/Li, in a non-classical insertion process. It is proposed that both copper and vanadium are electrochemically active, whereas iron(III) reacts to form LiFe{sup III}O{sub 2}. The capacity of the Cu{sub 3}Fe{sub 4}(VO{sub 4}){sub 6}/Li system is nearly independent of cycling rate, stabilizing after a few cycles at 120-140 mAh g{sup -1}. Iron vanadates exhibit better capacities than their phosphate analogues, whereas the latter display more constant discharge potentials.

  6. Polymeric Biodegradable Stent Insertion in the Esophagus

    Directory of Open Access Journals (Sweden)

    Kai Yang

    2016-04-01

    Full Text Available Esophageal stent insertion has been used as a well-accepted and effective alternative to manage and improve the quality of life for patients diagnosed with esophageal diseases and disorders. Current stents are either permanent or temporary and are fabricated from either metal or plastic. The partially covered self-expanding metal stent (SEMS has a firm anchoring effect and prevent stent migration, however, the hyperplastic tissue reaction cause stent restenosis and make it difficult to remove. A fully covered SEMS and self-expanding plastic stent (SEPS reduced reactive hyperplasia but has a high migration rate. The main advantage that polymeric biodegradable stents (BDSs have over metal or plastic stents is that removal is not require and reduce the need for repeated stent insertion. But the slightly lower radial force of BDS may be its main shortcoming and a post-implant problem. Thus, strengthening support of BDS is a content of the research in the future. BDSs are often temporarily effective in esophageal stricture to relieve dysphagia. In the future, it can be expect that biodegradable drug-eluting stents (DES will be available to treat benign esophageal stricture, perforations or leaks with additional use as palliative modalities for treating malignant esophageal stricture, as the bridge to surgery or to maintain luminal patency during neoadjuvant chemoradiation.

  7. Cigarette Mouth Insertion Depths Among Chinese Smokers

    Directory of Open Access Journals (Sweden)

    Hu Q

    2014-12-01

    Full Text Available Vent blocking - where filter ventilation holes are intentionally or unintentionally, partly or completely covered by smokers’ lips during smoking - is an aspect of smoking behavior which can alter mainstream smoke yields. This study was designed to determine if, and to what extent ventilation holes were blocked by smokers’ lips in two cohorts of Chinese smokers. In this study, two groups of samples were collected. One group (1742 butts was collected randomly from public places in six chosen cities. Another (1037 butts was obtained by collecting the butts from identified smokers in Kunming. In this paper, the mouth insertion depth among Chinese smokers was studied for the first time by a staining method employing ninhydrin in ethanol. The results indicate that Chinese smokers exhibit a mouth insertion depth ranging from 1 to 17 mm with an average value of 7.5 AA± 2 mm. In this study, 95% of the ventilated filters examined showed that the vent zone was neither completely nor partially covered by smokers’ lips.

  8. Sons conceived by assisted reproduction techniques inherit deletions in the azoospermia factor (AZF) region of the Y chromosome and the DAZ gene copy number

    DEFF Research Database (Denmark)

    Mau Kai, C; Juul, A; McElreavey, K

    2008-01-01

    number, supplemented with haplogroup typing in deleted patients, were performed, in combination with clinical assessments in 264 fathers and their sons conceived by assisted reproduction techniques (ART), and in 168 fertile men with normal sperm concentration. RESULTS: In the ART fathers group...

  9. Large genomic fragment deletions and insertions in mouse using CRISPR/Cas9.

    Directory of Open Access Journals (Sweden)

    Luqing Zhang

    Full Text Available ZFN, TALENs and CRISPR/Cas9 system have been used to generate point mutations and large fragment deletions and insertions in genomic modifications. CRISPR/Cas9 system is the most flexible and fast developing technology that has been extensively used to make mutations in all kinds of organisms. However, the most mutations reported up to date are small insertions and deletions. In this report, CRISPR/Cas9 system was used to make large DNA fragment deletions and insertions, including entire Dip2a gene deletion, about 65kb in size, and β-galactosidase (lacZ reporter gene insertion of larger than 5kb in mouse. About 11.8% (11/93 are positive for 65kb deletion from transfected and diluted ES clones. High targeting efficiencies in ES cells were also achieved with G418 selection, 46.2% (12/26 and 73.1% (19/26 for left and right arms respectively. Targeted large fragment deletion efficiency is about 21.4% of live pups or 6.0% of injected embryos. Targeted insertion of lacZ reporter with NEO cassette showed 27.1% (13/48 of targeting rate by ES cell transfection and 11.1% (2/18 by direct zygote injection. The procedures have bypassed in vitro transcription by directly co-injection of zygotes or co-transfection of embryonic stem cells with circular plasmid DNA. The methods are technically easy, time saving, and cost effective in generating mouse models and will certainly facilitate gene function studies.

  10. Insertion of coherence requests for debugging a multiprocessor

    Science.gov (United States)

    Blumrich, Matthias A.; Salapura, Valentina

    2010-02-23

    A method and system are disclosed to insert coherence events in a multiprocessor computer system, and to present those coherence events to the processors of the multiprocessor computer system for analysis and debugging purposes. The coherence events are inserted in the computer system by adding one or more special insert registers. By writing into the insert registers, coherence events are inserted in the multiprocessor system as if they were generated by the normal coherence protocol. Once these coherence events are processed, the processing of coherence events can continue in the normal operation mode.

  11. Recurrent AAV2-related insertional mutagenesis in human hepatocellular carcinomas.

    Science.gov (United States)

    Nault, Jean-Charles; Datta, Shalini; Imbeaud, Sandrine; Franconi, Andrea; Mallet, Maxime; Couchy, Gabrielle; Letouzé, Eric; Pilati, Camilla; Verret, Benjamin; Blanc, Jean-Frédéric; Balabaud, Charles; Calderaro, Julien; Laurent, Alexis; Letexier, Mélanie; Bioulac-Sage, Paulette; Calvo, Fabien; Zucman-Rossi, Jessica

    2015-10-01

    Hepatocellular carcinomas (HCCs) are liver tumors related to various etiologies, including alcohol intake and infection with hepatitis B (HBV) or C (HCV) virus. Additional risk factors remain to be identified, particularly in patients who develop HCC without cirrhosis. We found clonal integration of adeno-associated virus type 2 (AAV2) in 11 of 193 HCCs. These AAV2 integrations occurred in known cancer driver genes, namely CCNA2 (cyclin A2; four cases), TERT (telomerase reverse transcriptase; one case), CCNE1 (cyclin E1; three cases), TNFSF10 (tumor necrosis factor superfamily member 10; two cases) and KMT2B (lysine-specific methyltransferase 2B; one case), leading to overexpression of the target genes. Tumors with viral integration mainly developed in non-cirrhotic liver (9 of 11 cases) and without known risk factors (6 of 11 cases), suggesting a pathogenic role for AAV2 in these patients. In conclusion, AAV2 is a DNA virus associated with oncogenic insertional mutagenesis in human HCC.

  12. Prognostic value of the insertion/deletion polymorphism of the ACE gene in type 2 diabetic subjects: results from the Non-insulin-dependent Diabetes, Hypertension, Microalbuminuria or Proteinuria, Cardiovascular Events, and Ramipril (DIABHYCAR), Diabete de type 2, Nephropathie et Genetique (DIAB2NEPHROGENE), and Survie, Diabete de type 2 et Genetique (SURDIAGENE) studies.

    Science.gov (United States)

    Hadjadj, Samy; Fumeron, Frédéric; Roussel, Ronan; Saulnier, Pierre-Jean; Gallois, Yves; Ankotche, Amos; Travert, Florence; Abi Khalil, Charbel; Miot, Aurélie; Alhenc-Gelas, François; Lievre, Michel; Marre, Michel

    2008-09-01

    We tested whether determination of the ACE insertion/deletion polymorphism is useful for renal and cardiovascular prognoses of type 2 diabetic subjects. The French participants (3,126 of 4,912) in the Non-Insulin-Dependent Diabetes, Hypertension, Microalbuminuria or Proteinuria, Cardiovascular Events, and Ramipril (DIABHYCAR) trial were studied for their prognosis over 4 years according to their ACE insertion/deletion polymorphism. We used two cohorts of French type 2 diabetic patients for replication: a 3-year follow-up study (n = 917; Survie, Diabete de type 2 et Genetique [SURDIAGENE] study) and a case-control study on diabetic nephropathy (n = 1,277; Diabete de type 2, Nephropathie et Genetique [DIAB2NEPHROGENE] study). We investigated the effect of the insertion/deletion polymorphism on the primary outcome in the DIABHYCAR trial (defined as the first of the following events to occur: cardiovascular death, nonfatal myocardial infarction, stroke, heart failure leading to hospital admission, or end-stage renal failure) and its components. In DIABHYCAR, the primary outcome and most of its components were not affected by the ACE insertion/deletion genotype. Only renal outcome was favored by the I allele (P = 0.03). The risk of myocardial infarction was not affected by ACE genotype, but the probability of fatal outcome increased with the number of D alleles (P < 0.03). In SURDIAGENE, the association between the ACE I allele and renal outcome was not replicated. In DIAB2NEPHROGENE, no association was found with nephropathy. We were not able to demonstrate the manifest usefulness of the ACE insertion/deletion polymorphism for the prognosis of type 2 diabetic subjects.

  13. Rectal foreign body insertion as a rare cause of persistent lumbosacral plexus injury.

    Science.gov (United States)

    Meister, F A; Amygdalos, I; Neumann, U P; Lurje, G

    2017-07-01

    Rectal foreign body insertion is a common condition in emergency surgery, which often requires surgical intervention. Here we report a clinical case of rectal foreign body insertion as a rare cause of persistent lumbosacral plexus injury. A 72-year-old man presented to the emergency department complaining of acute bilateral paraplegia with loss of sensation in both legs, as well as total urinary retention. The patient underwent abdominal computed tomography, which showed a rectal foreign body measuring 13 × 11.5 × 10 cm in the lower abdomen and pelvis. Extraluminal assistance through a median laparotomy was required after unsuccessful attempts at transanal recovery alone. After removal of the foreign body, the rectal wall and anorectal sphincter were massively dilated, with severe bruising of the rectal mucosa on proctoscopy. A protective loop-ileostomy was performed. The sacral plexus is located posteriorly in the pelvis. Physiologically, the nerves are well protected by surrounding anatomical structures. Post-traumatic lumbosacral plexus injuries with paraplegia, urinary retention and anorectal sphincter insufficiency occur quite frequently after heavy traffic accidents. Lumbosacral plexus injury as a result of rectal foreign body insertion is rare. Severe neurological deficits through rectal foreign body insertion are rare but known medical conditions. To the best of our knowledge, this is the first reported case of severe and persistent post-traumatic lumbosacral plexus injury through a rectal foreign body.

  14. Peripherally inserted central catheters in infants and children - indications, techniques, complications and clinical recommendations.

    Science.gov (United States)

    Westergaard, B; Classen, V; Walther-Larsen, S

    2013-03-01

    Venous access required both for blood sampling and for the delivery of medicines and nutrition is an integral element in the care of sick infants and children. Peripherally inserted central catheters (PICCs) have been shown to be a valuable alternative to traditional central venous devices in adults and neonates. However, the evidence may not extrapolate directly to older paediatric patients. In this study, we therefore review the indications, methods of insertion and complications of PICC lines for children beyond the neonatal age to provide clinical recommendations based on a search of the current literature. Although the literature is heterogeneous with few randomised studies, PICCs emerge as a safe and valuable option for intermediate- to long-term central venous access in children both in and out of hospital. Insertion can often be performed in light or no sedation, with little risk of perioperative complications. Assisted visualisation, preferably with ultrasound, yields high rates of insertion success. With good catheter care, rates of mechanical, infectious and thrombotic complications are low and compare favourably with those of traditional central venous catheters. Even in the case of occlusion or infection, fibrinolytics and antibiotic locks often allow the catheter to be retained. © 2012 The Acta Anaesthesiologica Scandinavica Foundation.

  15. Generation and analysis of a barcode-tagged insertion mutant library in the fission yeast Schizosaccharomyces pombe

    Science.gov (United States)

    2012-01-01

    Background Barcodes are unique DNA sequence tags that can be used to specifically label individual mutants. The barcode-tagged open reading frame (ORF) haploid deletion mutant collections in the budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe allow for high-throughput mutant phenotyping because the relative growth of mutants in a population can be determined by monitoring the proportions of their associated barcodes. While these mutant collections have greatly facilitated genome-wide studies, mutations in essential genes are not present, and the roles of these genes are not as easily studied. To further support genome-scale research in S. pombe, we generated a barcode-tagged fission yeast insertion mutant library that has the potential of generating viable mutations in both essential and non-essential genes and can be easily analyzed using standard molecular biological techniques. Results An insertion vector containing a selectable ura4+ marker and a random barcode was used to generate a collection of 10,000 fission yeast insertion mutants stored individually in 384-well plates and as six pools of mixed mutants. Individual barcodes are flanked by Sfi I recognition sites and can be oligomerized in a unique orientation to facilitate barcode sequencing. Independent genetic screens on a subset of mutants suggest that this library contains a diverse collection of single insertion mutations. We present several approaches to determine insertion sites. Conclusions This collection of S. pombe barcode-tagged insertion mutants is well-suited for genome-wide studies. Because insertion mutations may eliminate, reduce or alter the function of essential and non-essential genes, this library will contain strains with a wide range of phenotypes that can be assayed by their associated barcodes. The design of the barcodes in this library allows for barcode sequencing using next generation or standard benchtop cloning approaches. PMID:22554201

  16. Generation and analysis of a barcode-tagged insertion mutant library in the fission yeast Schizosaccharomyces pombe

    Directory of Open Access Journals (Sweden)

    Chen Bo-Ruei

    2012-05-01

    Full Text Available Abstract Background Barcodes are unique DNA sequence tags that can be used to specifically label individual mutants. The barcode-tagged open reading frame (ORF haploid deletion mutant collections in the budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe allow for high-throughput mutant phenotyping because the relative growth of mutants in a population can be determined by monitoring the proportions of their associated barcodes. While these mutant collections have greatly facilitated genome-wide studies, mutations in essential genes are not present, and the roles of these genes are not as easily studied. To further support genome-scale research in S. pombe, we generated a barcode-tagged fission yeast insertion mutant library that has the potential of generating viable mutations in both essential and non-essential genes and can be easily analyzed using standard molecular biological techniques. Results An insertion vector containing a selectable ura4+ marker and a random barcode was used to generate a collection of 10,000 fission yeast insertion mutants stored individually in 384-well plates and as six pools of mixed mutants. Individual barcodes are flanked by Sfi I recognition sites and can be oligomerized in a unique orientation to facilitate barcode sequencing. Independent genetic screens on a subset of mutants suggest that this library contains a diverse collection of single insertion mutations. We present several approaches to determine insertion sites. Conclusions This collection of S. pombe barcode-tagged insertion mutants is well-suited for genome-wide studies. Because insertion mutations may eliminate, reduce or alter the function of essential and non-essential genes, this library will contain strains with a wide range of phenotypes that can be assayed by their associated barcodes. The design of the barcodes in this library allows for barcode sequencing using next generation or standard benchtop cloning

  17. Impact of equine assisted reproductive technologies (standard embryo transfer or intracytoplasmic sperm injection (ICSI) with in vitro culture and embryo transfer) on placenta and foal morphometry and placental gene expression.

    Science.gov (United States)

    Valenzuela, Orlando A; Couturier-Tarrade, Anne; Choi, Young-Ho; Aubrière, Marie-Christine; Ritthaler, Justin; Chavatte-Palmer, Pascale; Hinrichs, Katrin

    2017-07-24

    Assisted reproductive technologies (ARTs) such as intracytoplasmic sperm injection (ICSI), in vitro embryo culture and embryo transfer (ET) may be associated with alterations in fetal and placental development. In horses, ET has been used for decades. More recently, in vitro embryo production by ICSI and in vitro culture, followed by embryo transfer (ICSI-C) has become an accepted method for clinical foal production. However, no information is available on the effects of ICSI-C or even of standard ET itself on placental and neonatal parameters in horses. We therefore evaluated placental and neonatal morphology and placental gene expression in reining- and cutting-type American Quarter Horse foals produced using different technologies. Thirty foals and placentas (naturally conceived (NC), ET and ICSI-C; 10 in each group) were examined morphometrically. The only parameter that differed significantly between groups was the length of the foal upper hindlimb, which was longer in ET and ICSI-C than in NC foals. Evaluation of placental mRNA expression for 17 genes related to growth and vascularisation showed no difference in gene expression between groups. These data indicate that within this population, use of ARTs was not associated with meaningful changes in foal or placental morphometry or in expression of the placental genes evaluated.

  18. Non-insertional tendinopathy of the subscapularis.

    Science.gov (United States)

    Dierckman, Brian D; Shah, Nirav R; Larose, Connor R; Gerbrandt, Stacey; Getelman, Mark H

    2013-07-01

    (1) Describe a previously unreported finding involving the intra-articular portion of the subscapularis, the Conrad lesion. (2) Describe a novel classification system for the spectrum of non-insertional tendinopathy of the subscapularis. (3) Report the outcomes of surgical treatment of this spectrum of pathology. Outcomes of 34 patients (23 males and 11 females, mean age 60.5 ± 7.5) with non-insertional tendinopathy of the subscapularis treated arthroscopically were retrospectively reviewed. All patients had anterior shoulder pain with no weakness during belly-press testing and no subscapularis footprint involvement on magnetic resonance imaging. All patients were managed with subscapularis tendon debridement and side-to-side repair along with treatment of concomitant pathology. Seven patients had a Type I lesion (so-called Conrad lesion) - a nodule on the leading edge of the subscapularis. Eighteen patients had a Type II lesion - a visible split tear with degeneration in the upper ½ of the intra-articular tendon. Nine patients had a Type III lesion - more extensive splitting in the tendon with advanced tendon degeneration. At a mean follow-up of 24 months, 97% of patients were completely satisfied. Significant improvements were seen in forward elevation (152 ± 12° to 172 ± 5°, P < 0.001) and visual analog scale pain scores (5.9 ± 1.7-0.6 ± 1.0, P < 0.001). Internal rotation strength and external rotation motion at the side were maintained. ASES scores averaged 95.4 ± 7.4, disabilities of arm, shoulder and hand scores averaged 6.19 ± 9.8, Western Ontario Rotator Cuff scores averaged 91.7 ± 9.3 and the average University of California at Los Angeles score was 33.1 ± 2.4. We present a previously unreported finding of the subscapularis, the Conrad lesion, along with a novel classification system for non-insertional tendinopathy of the subscapularis. Arthroscopic treatment of this spectrum of tendinopathy along with concomitant shoulder pathology eliminated

  19. NarJ chaperone binds on two distinct sites of the aponitrate reductase of Escherichia coli to coordinate molybdenum cofactor insertion and assembly.

    Science.gov (United States)

    Vergnes, Alexandra; Pommier, Janine; Toci, René; Blasco, Francis; Giordano, Gérard; Magalon, Axel

    2006-01-27

    Understanding when and how metal cofactor insertion occurs into a multisubunit metalloenzyme is of fundamental importance. Molybdenum cofactor insertion is a tightly controlled process that involves specific interactions between the proteins that promote cofactor delivery, enzyme-specific chaperones, and the apoenzyme. In the assembly pathway of the multisubunit molybdoenzyme, membrane-bound nitrate reductase A from Escherichia coli, a NarJ-assisted molybdenum cofactor (Moco) insertion step, must precede membrane anchoring of the apoenzyme. Here, we have shown that the NarJ chaperone interacts at two distinct binding sites of the apoenzyme, one interfering with its membrane anchoring and another one being involved in molybdenum cofactor insertion. The presence of the two NarJ-binding sites within NarG is required to ensure productive formation of active nitrate reductase. Our findings supported the view that enzyme-specific chaperones play a central role in the biogenesis of multisubunit molybdoenzymes by coordinating subunits assembly and molybdenum cofactor insertion.

  20. CT-based, fiducial-free frameless stereotaxy for difficult ventriculoperitoneal shunt insertion: experience in 26 consecutive patients.

    Science.gov (United States)

    Reig, Adam S; Stevenson, Charles B; Tulipan, Noel B

    2010-01-01

    Patients with small or dysmorphic ventricles requiring ventriculoperitoneal shunt (VPS) insertion for hydrocephalus can be challenging. The 'freehand' technique does not always provide for accurate catheter insertion, particularly in patients with slit ventricles, complex hydrocephalus or displaced ventricles. Consequently, many surgeons use stereotaxy for assistance. We have employed a frameless stereotactic technique, obviating the need for fiducials or preoperative MRI, for difficult ventricular catheter placement over the past 1.5 years with excellent results. We describe our experience with frameless stereotactic VPS insertion. We retrospectively reviewed the charts of 26 patients who underwent frameless stereotactic VPS insertion. All patients had preoperative CT scans using a navigation protocol and were registered into the Stealth Station via the face tracer program. Catheters were inserted using the Medtronic frameless trajectory guide kit. We recorded demographic data, operative time, complications and follow-up. The mean patient age was 31 years. The average operative time was 46 min. There were 3 complications. The average follow-up was 5 months. Twenty-one patients had postoperative imaging, with 20 having excellent catheter positioning. Our results confirm that frameless stereotactic VPS without fiducial marker placement is a feasible technique for catheter insertion in patients who have small/dysmorphic ventricles. In experienced hands, there is negligible added operative time and a low complication rate. (c) 2010 S. Karger AG, Basel.

  1. Mini-Mu insertions in the tetracycline resistance determinant from Proteus mirabilis

    Directory of Open Access Journals (Sweden)

    Magalhães V.D.

    1997-01-01

    Full Text Available The inducible tetracycline resistance determinant isolated from Proteus mirabilis cloned into the plasmid pACYC177 was mutagenized by insertion of a mini-Mu-lac phage in order to define the regions in the cloned sequences encoding the structural and regulatory proteins. Three different types of mutants were obtained: one lost the resistance phenotype and became Lac+; another expressed the resistance at lower levels and constitutively; the third was still dependent on induction but showed a lower minimal inhibitory concentration. The mutant phenotypes and the locations of the insertions indicate that the determinant is composed of a repressor gene and a structural gene which are not transcribed divergently as are other known tetracycline determinants isolated from Gram-negative bacteria

  2. Impact of Orthodontic Decompensation on Bone Insertion

    Directory of Open Access Journals (Sweden)

    Fabio Pinto Guedes

    2014-01-01

    Full Text Available There has always been concern in determining the relationship between orthodontic tooth movement and the consequent biological costs to the periodontium and tooth root. The possibility of evaluating the tooth and bone morphology by CBCT allows more accurate analysis of qualitative and quantitative aspects of these processes. This paper presents a case report of a 20-year-old male patient with Class III malocclusion and hyperdivergent facial pattern, who was surgically treated. A significant amount of labial movement of mandibular incisors was performed during orthodontic treatment before surgery. CBCT was used for evaluation of buccal and lingual bone plates before and after tooth decompensation. The changes in the bone insertion level of maxillary and mandibular incisors in the present case encourage a reflection on the treatment protocol in individuals with dentoskeletal discrepancies.

  3. Polymorphic Alu insertions among Mayan populations.

    Science.gov (United States)

    Herrera, R J; Rojas, D P; Terreros, M C

    2007-01-01

    The Mayan homeland within Mesoamerica spans five countries: Belize, El Salvador, Guatemala, Honduras and Mexico. There are indications that the people we call the Maya migrated from the north to the highlands of Guatemala as early as 4000 B.C. Their existence was village-based and agricultural. The culture of these Preclassic Mayans owes much to the earlier Olmec civilization, which flourished in the southern portion of North America. In this study, four different Mayan groups were examined to assess their genetic variability. Ten polymorphic Alu insertion (PAI) loci were employed to ascertain the genetic affinities among these Mayan groups. North American, African, European and Asian populations were also examined as reference populations. Our results suggest that the Mayan groups examined in this study are not genetically homogeneous.

  4. Reinforcing cast iron with composite insert

    Directory of Open Access Journals (Sweden)

    Dulska A.

    2017-03-01

    Full Text Available The paper presents a proprietary method of making composite cast iron (eutectic locally reinforced with ceramics. The research included making casts with a ceramic layer, its percentage of the surface was 30%. The research included abrasive wear resistance according to ASTM G 65-00. As a result of the research it has been found that the infiltration of the molten metal into the ceramic preform mainly affects the correct production of the cast with local reinforcement. The research results also have proven that the application of a lattice ceramic insert placed in the mould is the most appropriate option, due to the even distribution of the particles in the cast and obtaining a sound cast.

  5. Regulatory perspective on incomplete control rod insertions

    Energy Technology Data Exchange (ETDEWEB)

    Chatterton, M.

    1997-01-01

    The incomplete control rod insertions experienced at South Texas Unit 1 and Wolf Creek are of safety concern to the NRC staff because they represent potential precursors to loss of shutdown margin. Even before it was determined if these events were caused by the control rods or by the fuel there was an apparent correlation of the problem with high burnup fuel. It was determined that there was also a correlation between high burnup and high drag forces as well as with rod drop time histories and lack of rod recoil. The NRC staff initial actions were aimed at getting a perspective on the magnitude of the problem as far as the number of plants and the amount of fuel that could be involved, as well as the safety significance in terms of shutdown margin. As tests have been performed and data has been analyzed the focus has shifted more toward understanding the problem and the ways to eliminate it. At this time the staff`s understanding of the phenomena is that it was a combination of factors including burnup, power history and temperature. The problem appears to be very sensitive to these factors, the interaction of which is not clearly understood. The model developed by Westinghouse provides a possible explanation but there is not sufficient data to establish confidence levels and sensitivity studies involving the key parameters have not been done. While several fixes to the problem have been discussed, no definitive fixes have been proposed. Without complete understanding of the phenomena, or fixes that clearly eliminate the problem the safety concern remains. The safety significance depends on the amount of shutdown margin lost due to incomplete insertion of the control rods. Were the control rods to stick high in the core, the reactor could not be shutdown by the control rods and other means such as emergency boration would be required.

  6. Automated insertion of preformed cochlear implant electrodes: evaluation of curling behaviour and insertion forces on an artificial cochlear model.

    Science.gov (United States)

    Rau, Thomas S; Hussong, Andreas; Leinung, Martin; Lenarz, Thomas; Majdani, Omid

    2010-03-01

    As a substantial part of our concept of a minimally invasive cochlear implant (CI) surgery, we developed an automated insertion tool. Studies on an artificial scala tympani model were performed in order to evaluate force application when using the insertion tool. Contour electrodes were automatically inserted into a transparent cochlea model in Advance Off-Stylet technique. Occurring forces were measured by the use of a load cell and correlated with observed intracochlear movement of the electrode carriers. Mean insertion forces were measured up to 20 mN comparable to previous studies on temporal bones. The most influencing factor is the implant's 2D curling behaviour in comparison to the 3D helical shape of the cochlea. The study confirms the functionality and reliability of the automated insertion tool for insertion of preformed CI. Improved insertion strategies considering patient-specific anatomy become possible.

  7. Extraperitoneal colostomy in laparoscopic abdominoperineal resection using a hand inserted from the perineal side.

    Science.gov (United States)

    Shiraishi, Takuya; Tomizawa, Naoki; Ando, Tatsumasa; Arakawa, Kazuhisa; Kobayashi, Katsumi; Muroya, Ken; Kurosaki, Ryo; Sato, Hiroaki; Suto, Yuji; Kato, Ryuji; Ozawa, Naoya; Sunose, Yutaka; Takeyoshi, Izumi

    2014-01-01

    Extraperitoneal colostomy is considered to be more effective at preventing post-colostomy complications than intraperitoneal colostomy. However, this operation is difficult via laparoscopic surgery alone. We present an extraperitoneal colostomy technique using a hand inserted from the perineal side. Extraperitoneal colostomy was performed in five patients. After the rectum was resected, a hand was inserted into the abdominal cavity from the perineal side, and pneumoperitoneum was created. The peritoneum was dissected to make the extraperitoneal route, and the proximal colon was passed along this route with fingers and laparoscopic manipulation. All procedures were completed without tissue damage or hemorrhage. No patient developed a hernia or ileus postoperatively. Laparoscopic abdominoperineal resection for an extraperitoneal colostomy is difficult via laparoscopic ports only. It can be simplified by operating with manual assistance via the perineal wound. © 2014 Japan Society for Endoscopic Surgery, Asia Endosurgery Task Force and Wiley Publishing Asia Pty Ltd.

  8. A large insertion in bHLH transcription factor BrTT8 resulting in yellow seed coat in Brassica rapa.

    Directory of Open Access Journals (Sweden)

    Xia Li

    Full Text Available Yellow seed is a desirable quality trait of the Brassica oilseed species. Previously, several seed coat color genes have been mapped in the Brassica species, but the molecular mechanism is still unknown. In the present investigation, map-based cloning method was used to identify a seed coat color gene, located on A9 in B. rapa. Blast analysis with the Arabidopsis genome showed that there were 22 Arabidopsis genes in this region including at4g09820 to at4g10620. Functional complementation test exhibited a phenotype reversion in the Arabidopsis thaliana tt8-1 mutant and yellow-seeded plant. These results suggested that the candidate gene was a homolog of TRANSPARENT TESTA8 (TT8 locus. BrTT8 regulated the accumulation of proanthocyanidins (PAs in the seed coat. Sequence analysis of two alleles revealed a large insertion of a new class of transposable elements, Helitron in yellow sarson. In addition, no mRNA expression of BrTT8 was detected in the yellow-seeded line. It indicated that the natural transposon might have caused the loss in function of BrTT8. BrTT8 encodes a basic/helix-loop-helix (bHLH protein that shares a high degree of similarity with other bHLH proteins in the Brassica. Further expression analysis also revealed that BrTT8 was involved in controlling the late biosynthetic genes (LBGs of the flavonoid pathway. Our present findings provided with further studies could assist in understanding the molecular mechanism involved in seed coat color formation in Brassica species, which is an important oil yielding quality trait.

  9. Characterization of large-insert DNA libraries from soil for environmental genomic studies of Archaea

    DEFF Research Database (Denmark)

    Treusch, Alexander H; Kletzin, Arnulf; Raddatz, Guenter

    2004-01-01

    Complex genomic libraries are increasingly being used to retrieve complete genes, operons or large genomic fragments directly from environmental samples, without the need to cultivate the respective microorganisms. We report on the construction of three large-insert fosmid libraries in total cove......, are presented and discussed. We thereby extend the genomic information of uncultivated crenarchaeota from soil and offer hints to specific metabolic traits present in this group....

  10. Efficacy and complications of enteral feeding tube insertion after liver transplantation.

    Science.gov (United States)

    Chun, J H; Ahn, J Y; Jung, H-Y; Jung Park, H; Kim, G H; Lee, J H; Choi, K-S; Jung, K W; Kim, D H; Choi, K D; Song, H J; Lee, G H; Kim, J H; Song, G W; Kim, J-H

    2015-03-01

    Adequate nutritional support for patients undergoing major surgery significantly affects postoperative recovery. Data on enteral feeding after liver transplantation (LT) are scarce. The aim of this work was to determine the efficacy and complications of feeding tubes inserted with the use of fluoroscopic assistance, endoscopic assistance, or transperitoneal jejunostomy in patients who underwent LT. From January 2008 to August 2013, 2,058 LTs were performed at Asan Medical Center, Seoul, Korea. Enteral feeding tubes were inserted in 155 patients (7.5%) after LT: with the use of fluoroscopic placement in 81 (52%), endoscopic placement in 49 (32%), and transperitoneal jejunostomy in 25 (16%). We retrospectively analyzed the efficacy and complications of enteral feeding tubes. The median age was 55 years (interquartile range [IQR] 49-60). Enteral feeding indications were a high risk of gastric aspiration (n = 90), gastric stasis (n = 27), pneumonia (n = 23), gastrointestinal bleeding (n = 12), and bowel rest (n = 3). Median enteral feeding durations were 14.5 days (IQR 8.0-30.7) for fluoroscopic placement, 20.0 days (IQR 8.0-40.0) for endoscopic placement, and 37.5 days (IQR 18.2-86.2) for transperitoneal jejunostomy. Times to establishment of oral feeding were 13.0 days (IQR 6.2-25.7) for fluoroscopic placement, 24.0 days (IQR 10.5-43.5) for endoscopic placement, and 37.0 days (IQR 17.0-64.2) for transperitoneal jejunostomy. After tube insertion, tube dislocation and blockage occurred in 34 patients (22%) and 16 patients (25%), respectively. Enteral feeding tube insertion in patients who can not maintain a nasogastric tube or start oral intake for a long time is important for nutritional support after LT. Proper feeding method selection according to patient condition can help patients by improving nutritional support after major operations such as LT. Copyright © 2015 Elsevier Inc. All rights reserved.

  11. Ethylenediamine functionalized-single-walled nanotube (f-SWNT)-assisted in vitro delivery of the oncogene suppressor p53 gene to breast cancer MCF-7 cells.

    Science.gov (United States)

    Karmakar, Alokita; Bratton, Stacie M; Dervishi, Enkeleda; Ghosh, Anindya; Mahmood, Meena; Xu, Yang; Saeed, Lamya Mohammed; Mustafa, Thikra; Casciano, Dan; Radominska-Pandya, Anna; Biris, Alexandru S

    2011-01-01

    A gene delivery concept based on ethylenediamine-functionalized single-walled carbon nanotubes (f-SWCNTs) using the oncogene suppressor p53 gene as a model gene was successfully tested in vitro in MCF-7 breast cancer cells. The f-SWCNTs-p53 complexes were introduced into the cell medium at a concentration of 20 μg mL(-1) and cells were exposed for 24, 48, and 72 hours. Standard ethidium bromide and acridine orange assays were used to detect apoptotic cells and indicated that a significantly larger percentage of the cells (approx 40%) were dead after 72 hours of exposure to f-SWCNTs-p53 as compared to the control cells, which were exposed to only p53 or f-SWCNTs, respectively. To further support the uptake and expression of the genes within the cells, green fluorescent protein-tagged p53, attached to the f-SWCNTs was added to the medium and the complex was observed to be strongly expressed in the cells. Moreover, caspase 3 activity was found to be highly enhanced in cells incubated with the f-SWCNTs-p53 complex, indicating strongly induced apoptosis. This system could be the foundation for novel gene delivery platforms based on the unique structural and morphological properties of multi-functional nanomaterials.

  12. LINE1 insertions as a genomic risk factor for schizophrenia: Preliminary evidence from an affected family.

    Science.gov (United States)

    Guffanti, Guia; Gaudi, Simona; Klengel, Torsten; Fallon, James H; Mangalam, Harry; Madduri, Ravi; Rodriguez, Alex; DeCrescenzo, Paula; Glovienka, Emily; Sobell, Janet; Klengel, Claudia; Pato, Michele; Ressler, Kerry J; Pato, Carlos; Macciardi, Fabio

    2016-06-01

    Recent studies show that human-specific LINE1s (L1HS) play a key role in the development of the central nervous system (CNS) and its disorders, and that their transpositions within the human genome are more common than previously thought. Many polymorphic L1HS, that is, present or absent across individuals, are not annotated in the current release of the genome and are customarily termed "non-reference L1s." We developed an analytical workflow to identify L1 polymorphic insertions with next-generation sequencing (NGS) using data from a family in which SZ segregates. Our workflow exploits two independent algorithms to detect non-reference L1 insertions, performs local de novo alignment of the regions harboring predicted L1 insertions and resolves the L1 subfamily designation from the de novo assembled sequence. We found 110 non-reference L1 polymorphic loci exhibiting Mendelian inheritance, the vast majority of which are already reported in dbRIP and/or euL1db, thus, confirming their status as non-reference L1 polymorphic insertions. Four previously undetected L1 polymorphic loci were confirmed by PCR amplification and direct sequencing of the insert. A large fraction of our non-reference L1s is located within the open reading frame of protein-coding genes that belong to pathways already implicated in the pathogenesis of schizophrenia. The finding of these polymorphic variants among SZ offsprings is intriguing and suggestive of putative pathogenic role. Our data show the utility of NGS to uncover L1 polymorphic insertions, a neglected type of genetic variants with the potential to influence the risk to develop schizophrenia like SNVs and CNVs. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  13. Role of XDHC in Molybdenum Cofactor Insertion into Xanthine Dehydrogenase of Rhodobacter capsulatus

    Science.gov (United States)

    Leimkühler, Silke; Klipp, Werner

    1999-01-01

    Rhodobacter capsulatus xanthine dehydrogenase (XDH) is composed of two subunits, XDHA and XDHB. Immediately downstream of xdhB, a third gene was identified, designated xdhC, which is cotranscribed with xdhAB. Interposon mutagenesis revealed that the xdhC gene product is required for XDH activity. However, XDHC is not a subunit of active XDH, which forms an α2β2 heterotetramer in R. capsulatus. It was shown that XDHC neither is a transcriptional regulator for xdh gene expression nor influences XDH stability. To analyze the function of XDHC for XDH in R. capsulatus, inactive XDH was purified from an xdhC mutant strain. Analysis of the molybdenum cofactor content of this enzyme demonstrated that in the absence of XDHC, no molybdopterin cofactor MPT is present in the XDHAB tetramer. In contrast, absorption spectra of inactive XDH isolated from the xdhC mutant revealed the presence of iron-sulfur clusters and flavin adenine dinucleotide, demonstrating that XDHC is not required for the insertion of these cofactors. The absence of MPT from XDH isolated from an xdhC mutant indicates that XDHC either acts as a specific MPT insertase or might be a specific chaperone facilitating the insertion of MPT and/or folding of XDH during or after cofactor insertion. PMID:10217763

  14. An intronic LINE-1 insertion in MERTK is strongly associated with retinopathy in Swedish Vallhund dogs.

    Science.gov (United States)

    Everson, Richard; Pettitt, Louise; Forman, Oliver P; Dower-Tylee, Olivia; McLaughlin, Bryan; Ahonen, Saija; Kaukonen, Maria; Komáromy, András M; Lohi, Hannes; Mellersh, Cathryn S; Sansom, Jane; Ricketts, Sally L

    2017-01-01

    The domestic dog segregates a significant number of inherited progressive retinal diseases, several of which mirror human retinal diseases and which are collectively termed progressive retinal atrophy (PRA). In 2014, a novel form of PRA was reported in the Swedish Vallhund breed, and the disease was mapped to canine chromosome 17. The causal mutation was not identified, but expression analyses of the retinas of affected Vallhunds demonstrated a 6-fold increased expression of the MERTK gene compared to unaffected dogs. Using 24 retinopathy cases and 97 controls with no clinical signs of retinopathy, we replicated the chromosome 17 association in Swedish Vallhunds from the UK and aimed to elucidate the causal variant underlying this association using whole genome sequencing (WGS) of an affected dog. This revealed a 6-8 kb insertion in intron 1 of MERTK that was not present in WGS of 49 dogs of other breeds. Sequencing and BLASTN analysis of the inserted segment was consistent with the insertion comprising a full-length intact LINE-1 retroelement. Testing of the LINE-1 insertion for association with retinopathy in the UK set of 24 cases and 97 controls revealed a strong statistical association (P-value 6.0 x 10-11) that was subsequently replicated in the original Finnish study set (49 cases and 89 controls (P-value 4.3 x 10-19). In a pooled analysis of both studies (73 cases and 186 controls), the LINE-1 insertion was associated with a ~20-fold increased risk of retinopathy (odds ratio 23.41, 95% confidence intervals 10.99-49.86, P-value 1.3 x 10-27). Our study adds further support for regulatory disruption of MERTK in Swedish Vallhund retinopathy; however, further work is required to establish a functional overexpression model. Future work to characterise the mechanism by which this intronic mutation disrupts gene regulation will further improve the understanding of MERTK biology and its role in retinal function.

  15. Whole genome computational comparative genomics: A fruitful approach for ascertaining Alu insertion polymorphisms.

    Science.gov (United States)

    Wang, Jianxin; Song, Lei; Gonder, M Katherine; Azrak, Sami; Ray, David A; Batzer, Mark A; Tishkoff, Sarah A; Liang, Ping

    2006-01-03

    Alu elements are the most active and predominant type of short interspersed elements (SINEs) in the human genome. Recently inserted polymorphic (for presence/absence) Alu elements contribute to genome diversity among different human populations, and they are useful genetic markers for population genetic studies. The objective of this study is to identify polymorphic Alu insertions through an in silico comparative genomics approach and to analyze their distribution pattern throughout the human genome. By computationally comparing the public and Celera sequence assemblies of the human genome, we identified a total of 800 polymorphic Alu elements. We used polymerase chain reaction-based assays to screen a randomly selected set of 16 of these 800 Alu insertion polymorphisms using a human diversity panel to demonstrate the efficiency of our approach. Based on sequence analysis of the 800 Alu polymorphisms, we report three new Alu subfamilies, Ya3, Ya4b, and Yb11, with Yb11 being the smallest known Alu subfamily. Analysis of retrotransposition activity revealed Yb11, Ya8, Ya5, Yb9, and Yb8 as the most active Alu subfamilies and the maintenance of a very low level of retrotransposition activity or recent gene conversion events involving S subfamilies. The 800 polymorphic Alu insertions are characterized by the presence of target site duplications (TSDs) and longer than average polyA-tail length. Their pre-integration sites largely follow an extended "NT-AARA" motif. Among chromosomes, the density of Alu insertion polymorphisms is positively correlated with the Alu-site availability and is inversely correlated with the densities of older Alu elements and genes.

  16. Marker-assisted identification of restorer gene(s) in iso-cytoplasmic restorer lines of WA cytoplasm in rice and assessment of their fertility restoration potential across environments.

    Science.gov (United States)

    Kumar, Amit; Bhowmick, Prolay Kumar; Singh, Vikram Jeet; Malik, Manoj; Gupta, Ashish Kumar; Seth, R; Nagarajan, M; Krishnan, S Gopala; Singh, Ashok Kumar

    2017-10-01

    Iso-cytoplasmic restorers possess the same male sterile cytoplasm as the cytoplasmic male sterile (CMS) lines, thereby minimizing the potential cyto-nuclear conflict in the hybrids. Restoration of fertility of the wild abortive CMS is governed by two major genes namely, Rf3 and Rf4. Therefore, assessing the allelic status of these restorer genes in the iso-cytoplasmic restorers using molecular markers will not only help in estimating the efficiency of these genes either alone or in combination, in fertility restoration in the hybrids in different environments, but will also be useful in determining the efficacy of these markers. In the present study, the efficiency of molecular markers in identifying genotypes carrying restorer allele of the gene(s) Rf3 and Rf4, restoring male fertility of WA cytoplasm in rice was assessed in a set of 100 iso-cytoplasmic rice restorers using gene linked as well as candidate gene based markers. In order to validate the efficacy of markers in identifying the restorers, a sub-set of selected 25 iso-cytoplasmic rice restorers were crossed with four different cytoplasmic male sterile lines namely, IR 79156A, IR 58025A, Pusa 6A and RTN 12A, and the pollen and spikelet fertility of the F1s were evaluated at three different locations. Marker analysis showed that Rf4 was the predominant fertility restorer gene in the iso-cytoplasmic restorers and Rf3 had a synergistic effect on fertility restoration. The efficiency of gene based markers, DRCG-RF4-14 and DRRM-RF3-10 for Rf4 (87%) and Rf3 (84%) genes was higher than respective gene-linked SSR markers RM6100 (80%) and RM3873 (82%). It is concluded that the gene based markers can be effectively used in identifying fertility restorer lines obviating the need for making crosses and evaluating the F1s. Though gene based markers are more efficient, there is a need to identify functional polymorphisms which can provide 100% efficiency. Three iso-cytoplasmic restorers namely, PRR 300, PRR 363 and

  17. Species-Level Identification of Actinomyces Isolates Causing Invasive Infections: Multiyear Comparison of Vitek MS (Matrix-Assisted Laser Desorption Ionization–Time of Flight Mass Spectrometry) to Partial Sequencing of the 16S rRNA Gene

    Science.gov (United States)

    Gregson, D.; Church, D. L.

    2016-01-01

    Actinomyces species are uncommon but important causes of invasive infections. The ability of our regional clinical microbiology laboratory to report species-level identification of Actinomyces relied on molecular identification by partial sequencing of the 16S ribosomal gene prior to the implementation of the Vitek MS (matrix-assisted laser desorption ionization–time of flight mass spectrometry [MALDI-TOF MS]) system. We compared the use of the Vitek MS to that of 16S rRNA gene sequencing for reliable species-level identification of invasive infections caused by Actinomyces spp. because limited data had been published for this important genera. A total of 115 cases of Actinomyces spp., either alone or as part of a polymicrobial infection, were diagnosed between 2011 and 2014. Actinomyces spp. were considered the principal pathogen in bloodstream infections (n = 17, 15%), in skin and soft tissue abscesses (n = 25, 22%), and in pulmonary (n = 26, 23%), bone (n = 27, 23%), intraabdominal (n = 16, 14%), and central nervous system (n = 4, 3%) infections. Compared to sequencing and identification from the SmartGene Integrated Database Network System (IDNS), Vitek MS identified 47/115 (41%) isolates to the correct species and 10 (9%) isolates to the correct genus. However, the Vitek MS was unable to provide identification for 43 (37%) isolates while 15 (13%) had discordant results. Phylogenetic analyses of the 16S rRNA sequences demonstrate high diversity in recovered Actinomyces spp. and provide additional information to compare/confirm discordant identifications between MALDI-TOF and 16S rRNA gene sequences. This study highlights the diversity of clinically relevant Actinomyces spp. and provides an important typing comparison. Based on our analysis, 16S rRNA gene sequencing should be used to rapidly identify Actinomyces spp. until MALDI-TOF databases are optimized. PMID:26739153

  18. Species-Level Identification of Actinomyces Isolates Causing Invasive Infections: Multiyear Comparison of Vitek MS (Matrix-Assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry) to Partial Sequencing of the 16S rRNA Gene.

    Science.gov (United States)

    Lynch, T; Gregson, D; Church, D L

    2016-03-01

    Actinomyces species are uncommon but important causes of invasive infections. The ability of our regional clinical microbiology laboratory to report species-level identification of Actinomyces relied on molecular identification by partial sequencing of the 16S ribosomal gene prior to the implementation of the Vitek MS (matrix-assisted laser desorption ionization-time of flight mass spectrometry [MALDI-TOF MS]) system. We compared the use of the Vitek MS to that of 16S rRNA gene sequencing for reliable species-level identification of invasive infections caused by Actinomyces spp. because limited data had been published for this important genera. A total of 115 cases of Actinomyces spp., either alone or as part of a polymicrobial infection, were diagnosed between 2011 and 2014. Actinomyces spp. were considered the principal pathogen in bloodstream infections (n = 17, 15%), in skin and soft tissue abscesses (n = 25, 22%), and in pulmonary (n = 26, 23%), bone (n = 27, 23%), intraabdominal (n = 16, 14%), and central nervous system (n = 4, 3%) infections. Compared to sequencing and identification from the SmartGene Integrated Database Network System (IDNS), Vitek MS identified 47/115 (41%) isolates to the correct species and 10 (9%) isolates to the correct genus. However, the Vitek MS was unable to provide identification for 43 (37%) isolates while 15 (13%) had discordant results. Phylogenetic analyses of the 16S rRNA sequences demonstrate high diversity in recovered Actinomyces spp. and provide additional information to compare/confirm discordant identifications between MALDI-TOF and 16S rRNA gene sequences. This study highlights the diversity of clinically relevant Actinomyces spp. and provides an important typing comparison. Based on our analysis, 16S rRNA gene sequencing should be used to rapidly identify Actinomyces spp. until MALDI-TOF databases are optimized. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  19. Ocular inserts - Advancement in therapy of eye diseases

    Directory of Open Access Journals (Sweden)

    Anita Kumari

    2010-01-01

    Full Text Available The ocular insert represents a significant advancement in the therapy of eye disease. Ocular inserts are defined as sterile, thin, multilayered, drug-impregnated, solid or semisolid consistency devices placed into the cul-de-sac or conjuctival sac, whose size and shape are especially designed for ophthalmic application. They are composed of a polymeric support that may or may not contain a drug. The drug can later be incorporated as dispersion or a solution in the polymeric support. They offer several advantages as increased ocular residence and sustained release of medication into the eye. The insert includes a body portion sized to position within a lachrymal canaliculus of the eyelid. The inserts are classified according to their solubility as insoluble, soluble, or bioerodible inserts. The release of drug from the insert depends upon the diffusion, osmosis, and bioerosion of the drug, and this article is an attempt to present a brief about this newer drug delivery system.

  20. A rapid detection method for PAI-1 promoter insertion/deletion polymorphism (4G/5G

    Directory of Open Access Journals (Sweden)

    Annichino-Bizzacchi Joyce M.

    1998-01-01

    Full Text Available Plasminogen activator inhibitor-1 (PAI-1 is an important inhibitor of fibrinolysis, and increased levels of PAI-1 are associated with atheroma and myocardial infarction. A common 4G/5G insertion/deletion polymorphism located in the promoter region of PAI-1 gene has been described associated with PAI-1 activity in plasma levels. Genotyping of this polymorphism is commonly conducted with an allele-specific oligonucleotide melting technique. In the present study, we describe a quick, easy method for genotyping 4G/5G polymorphism in the promoter region of the PAI-1 gene.

  1. Insertion torque versus mechanical resistance of mini-implants inserted in different cortical thickness

    Science.gov (United States)

    Santos, Renata de Faria; Ruellas, Antonio Carlos de Oliveira; Fernandes, Daniel Jogaib; Elias, Carlos Nelson

    2014-01-01

    Objective This study aimed to measure insertion torque, tip mechanical resistance to fracture and transmucosal neck of mini-implants (MI) (Conexão Sistemas de PróteseT), as well as to analyze surface morphology. Methods Mechanical tests were carried out to measure the insertion torque of MIs in different cortical thicknesses, and tip mechanical resistance to fracture as well as transmucosal neck of MIs. Surface morphology was assessed by scanning electron microscopy (SEM) before and after the mechanical tests. Results Values of mechanical resistance to fracture (22.14 N.cm and 54.95 N.cm) were higher and statistically different (P 0.05) to torsional fracture in the tip of MI (22.14 N.cm) when 3 mm cortical thickness (16.11 N.cm) and dense bone (23.95 N.cm) were used. Torsional fracture of the transmucosal neck (54.95 N.cm) was higher and statistically different (P mini-implants tested presented adequate surface morphology. The resistance of mini-implants to fracture safely allows placement in 1 and 2-mm cortical thickness. However, in 3-mm cortical thickness and dense bones, pre-drilling with a bur is recommended before insertion. PMID:25162571

  2. Gene Sequence Based Clustering Assists in Dereplication of Pseudoalteromonas luteoviolacea Strains with Identical Inhibitory Activity and Antibiotic Production

    Directory of Open Access Journals (Sweden)

    Lone Gram

    2012-08-01

    Full Text Available Some microbial species are chemically homogenous, and the same secondary metabolites are found in all strains. In contrast, we previously found that five strains of P. luteoviolacea were closely related by 16S rRNA gene sequence but produced two different antibiotic profiles. The purpose of the present study was to determine whether such bioactivity differences could be linked to genotypes allowing methods from phylogenetic analysis to aid in selection of strains for biodiscovery. Thirteen P. luteoviolacea strains divided into three chemotypes based on production of known antibiotics and four antibacterial profiles based on inhibition assays against Vibrio anguillarum and Staphylococcus aureus. To determine whether chemotype and inhibition profile are reflected by phylogenetic clustering we sequenced 16S rRNA, gyrB and recA genes. Clustering based on 16S rRNA gene sequences alone showed little correlation to chemotypes and inhibition profiles, while clustering based on concatenated 16S rRNA, gyrB, and recA gene sequences resulted in three clusters, two of which uniformly consisted of strains of identical chemotype and inhibition profile. A major time sink in natural products discovery is the effort spent rediscovering known compounds, and this study indicates that phylogeny clustering of bioactive species has the potential to be a useful dereplication tool in biodiscovery efforts.

  3. Transgenic plums expressing the plum pox virus (PPV) coat protein gene do not assist the development of PPV recombinants under field conditions

    Science.gov (United States)

    The serological and molecular variability of Plum pox virus (PPV) detected in transgenic plum trees harboring PPV capsid gene versus those found in conventional plums were analyzed. Strain characterization was serologically determined by TAS-ELISA using PPV-D and PPV-M specific monoclonal antibodie...

  4. Genomic imprinting and assisted reproduction

    Directory of Open Access Journals (Sweden)

    Chaillet J Richard

    2004-10-01

    Full Text Available Abstract Imprinted genes exhibit a parent-of-origin specific pattern of expression. Such genes have been shown to be targets of molecular defects in particular genetic syndromes such as Beckwith-Wiedemann and Angelman syndromes. Recent reports have raised concern about the possibility that assisted reproduction techniques, such as in vitro fertilization or intracytoplasmic sperm injection, might cause genomic imprinting disorders. The number of reported cases of those disorders is still too small to draw firm conclusions and the safety of these widely used assisted reproduction techniques needs to be further evaluated.

  5. Effect of vibration frequency on biopsy needle insertion force.

    Science.gov (United States)

    Tan, Lei; Qin, Xuemei; Zhang, Qinhe; Zhang, Hongcai; Dong, Hongjian; Guo, Tuodang; Liu, Guowei

    2017-05-01

    Needle insertion is critical in many clinical medicine procedures, such as biopsy, brachytherapy, and injection therapy. A platform with two degrees of freedom was set up to study the effect of vibration frequency on needle insertion force. The gel phantom deformation at the needle cutting edge and the Voigt model are utilized to develop a dynamic model to explain the relationship between the insertion force and needle-tip velocity. The accuracy of this model was verified by performing needle insertions into phantom gel. The effect of vibration on insertion force can be explained as the vibration increasing the needle-tip velocity and subsequently increasing the insertion force. In a series of needle insertion experiments with different vibration frequencies, the peak forces were selected for comparison to explore the effect of vibration frequency on needle insertion force. The experimental results indicate that the insertion force at 500Hz increases up to 17.9% compared with the force at 50Hz. Copyright © 2017 IPEM. Published by Elsevier Ltd. All rights reserved.

  6. Hollow polymer microneedles array resistance and insertion tests.

    Science.gov (United States)

    Lhernould, Marion Sausse; Deleers, Michel; Delchambre, Alain

    2015-03-01

    Microneedles are developed in order to become the transdermal administration method of the future. They however still face numerous challenges. This paper addresses the challenge to effectively insert the microneedle arrays into membranes. A recently proposed model membrane and test method for microneedles insertion, published in International Journal of Pharmaceutics, is used in this aim. A moulded 4 by 4 hollow polymer microneedle array developed at the Université Libre de Bruxelles is tested for insertion using this model. Results show that the array is extremely resistant to insertion, it can withstand very high forces and even multiple insertions without blunting. Different insertion tests were performed on a folded in eight Parafilm® film because it exhibits excellent similarity to porcine skin. The insertion force, the insertion speed and the holding time of the array against membranes must be optimised in order to get efficient reliable insertions at, at least, 500μm depth. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. The ATLAS Insertable B-Layer Project

    CERN Document Server

    Miucci, A; The ATLAS collaboration

    2014-01-01

    The ATLAS experiment will upgrade its Pixel Detector with the installation of a new pixel layer in 2013-14. The new sub-detector, named Insertable B-layer (IBL), will be installed between the existing Pixel Detector and a new smaller radius beam-pipe at a radius of 3.3 cm. To cope with the high radiation and pixel occupancy due to the proximity to the interaction point, a new read-out chip and two different silicon sensor technologies (planar and 3D) have been de- veloped. Furthermore, the physics performance should be improved through the reduction of pixel size while a low material budget should be imposed. A new mechanical support using lightweight staves and a CO2 based cooling system is used. An overview of the IBL project and the status of the production of staves and the qualification of the assembly procedure, the loaded module electrical integrity and the read-out chain will be presented.

  8. Genetic variation for oviposition behavior in Drosophila melanogaster. I. Quantitative genetic analysis of insertion behavior.

    Science.gov (United States)

    Kamping, A; van Delden, W

    1990-09-01

    The genetic basis of egg insertion behavior was analyzed in two Drosophila melanogaster strains (N and E strain), which were homozygous for the Slow allele of the alcohol dehydrogenase locus. The E strain had been selected for increased tolerance to ethanol. This study originated from the observation that nearly all of the eggs laid by females of the E strain were inserted, while in the control strain (N strain) which was kept on regular food, considerable variation for egg insertion occurred. Crosses between the E and the N strains were made, and quantitative genetic tests were performed. It was shown that the inheritance of egg insertion is polygenic, some of the genes are probably sex linked, and in-laying is partly dominant over on-laying. The heritability of the trait, derived from mother-daughter regression analysis, was .59 +/- .18. The repeatability was high. Bidirectional selection in the E strain was unsuccessful, but an asymmetrical response to selection was obtained in the N strain and in lines derived from crosses between the N and the E strains. Selection for in-laying was more successful than for on-laying. The realized heritability in the former lines was .35 +/- .10.

  9. Insight into the molecular requirements for pathogenicity of Fusarium oxysporum f. sp. lycopersici through large-scale insertional mutagenesis

    NARCIS (Netherlands)

    Michielse, C.B.; van Wijk, R.; Reijnen, L.; Cornelissen, B.J.C.; Rep, M.

    2009-01-01

    Background: Fusarium oxysporum f. sp. lycopersici is the causal agent of vascular wilt disease in tomato. In order to gain more insight into the molecular processes in F. oxysporum necessary for pathogenesis and to uncover the genes involved, we used Agrobacterium-mediated insertional mutagenesis to

  10. Interference of an apcA insertion with complementary chromatic adaptation in the diazotrophic Synechocystis sp. strain BO 8402

    NARCIS (Netherlands)

    Neuschaefer-Rube, O.; Böger, P.; Ernst, A.

    2002-01-01

    Complementary chromatic adaptation was studied in two unicellular diazotrophic Synechocystis-type cyanobacteria. strains BO 8402 and BO 9201. Strain BO 8402 was isolated from Lake Constance as a mutant lacking phycobilisomes due to an insertion sequence element in the gene apcA. encoding

  11. Peroxisome Proliferator-Activated Receptor γ and C/EBPα Synergistically Activate Key Metabolic Adipocyte Genes by Assisted Loading

    DEFF Research Database (Denmark)

    Madsen, Maria Stahl; Siersbæk, Rasmus; Boergesen, Michael

    2014-01-01

    Peroxisome proliferator-activated receptor gamma (PPAR gamma) and CCAAT/enhancer binding protein alpha (C/EBP alpha) are key activators of adipogenesis. They mutually induce the expression of each other and have been reported to cooperate in activation of a few adipocyte genes. Recently, genome......-wide profiling revealed a high degree of overlap between PPAR gamma and C/EBP alpha binding in adipocytes, suggesting that cooperativeness could be mediated through common binding sites. To directly investigate the interplay between PPAR gamma and C/EBP alpha at shared binding sites, we established...... a fibroblastic model system in which PPAR gamma and C/EBP alpha can be independently expressed. Using RNA sequencing, we demonstrate that coexpression of PPAR gamma and C/EBP alpha leads to synergistic activation of many key metabolic adipocyte genes. This is associated with extensive C/EBP alpha...

  12. Dual-probe electrochemical DNA biosensor based on the "Y" junction structure and restriction endonuclease assisted cyclic enzymatic amplification for detection of double-strand DNA of PML/RARα related fusion gene.

    Science.gov (United States)

    Wang, Kun; Lei, Yun; Zhong, Guang-Xian; Zheng, Yan-Jie; Sun, Zhou-Liang; Peng, Hua-Ping; Chen, Wei; Liu, Ai-Lin; Chen, Yuan-Zhong; Lin, Xin-Hua

    2015-09-15

    Taking advantage of "Y" junction structure and restriction endonuclease assisted cyclic enzymatic amplification, a dual-probe electrochemical DNA (DE-DNA) biosensor was designed to detect double-stranded DNA (dsDNA) of acute promyelocytic leukemia (APL) related gene. Two groups of detection probes were designed, and each group was composed of a biotinylated capture probe and an assisted probe. They were separately complementary with two strands of target dsDNA in order to prevent the reannealing of the two separate strands from target dsDNA. First, thiol functionalized capture probes (C1 and C2) were severally assembled onto two different gold electrodes, followed by hybridizing with target dsDNA (S1a-S1b) and assistant probes to form two Y-junction-structure ternary complexes. Subsequently, restriction sites on the ternary complexes were digested by Rsa I, which can release S1a, S1b and biotins from the electrode surfaces. Meanwhile, the released S1a and S1b can further hybridize with the unhybridized corresponding detection probes and then initiate another new hybridization-cleavage-separation cycle. Finally, the current signals were produced by the enzyme-catalyzed reaction of streptavidin-horse reddish peroxidase (streptavidin-HRP). The distinct difference in current signals between different sequences allowed detection of target dsDNA down to a low detection limit of 47 fM and presented excellent specificity with discriminating only a single-base mismatched dsDNA sequence. Moreover, this biosensor was also used for assay of polymerase chain reaction (PCR) samples with satisfactory results. According to the results, the power of the DE-DNA biosensor as a promising tool for the detection of APL and other diseases. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Clinical information in drug package inserts in India

    Directory of Open Access Journals (Sweden)

    Shivkar Y

    2009-01-01

    Full Text Available Background: It is widely recognized that accurate and reliable product information is essential for the safe and effective use of medications. Pharmaceutical companies are the primary source of most drug information, including package inserts. Package inserts are printed leaflets accompanying marketed drug products and contain information approved by the regulatory agencies. Studies on package inserts in India, in 1996, had shown that crucial information was often missing and they lacked uniformity. Aim: To assess the presentation and completeness of clinically important information provided in the currently available package inserts in India. Materials and Methods: Package inserts accompanying allopathic drug products marketed by pharmaceutical companies in India were collected. These package inserts were analyzed for the content of clinically important information in various sections. Statistical Analysis: The results were expressed as absolute numbers and percentages. Results: Preliminary analyses revealed that most package inserts did contain information under headings, such as, therapeutic indications, contraindications, undesirable effects, etc., listed in the Drugs and Cosmetics Rules 1945. The findings indicated considerable improvement in package inserts since 1996. However, on critical evaluation it was revealed that clinically important information was not well presented and was often incomplete. Information with regard to pediatric and geriatric use was present in only 44% and 13% of the package inserts, respectively. Only five of the inserts had information on the most frequent adverse drug reactions associated with the drug. Also, information on interactions and overdosage was often missing. Conclusion: Although the package inserts appear to have improved over the past decade there is still a definite need to further refine the clinical information contained, to minimize the risks to patients. This could be brought about by self

  14. The Insertion/Deletion Polymorphism of the Angiotensin Converting Enzyme (ACE) in Parkinson’s Disease

    Science.gov (United States)

    Papapetropoulos, Spiridon; Glynos, Kostantinos; Zhou, Zongmin; Orfanos, Stylianos E; Mitsi, Georgia; Papapetropoulos, Andreas

    2008-01-01

    Parkinson’s disease (PDI is a neurodegenerative disorder of unknown etiology. Both genetic and environmental factors are thought to be implicated to some extent. The ACE gene insertion/deletion (I/D) polymorphism has been associated with common neurodegenerative disorders that share similar clinical and neuropathological features with PD (Alzheimer’s disease). In this study we set out to examine the role of the ACE gene insertion/deletion (I/D) polymorphism in Parkinson’s disease (PD). We conducted a case-control association study among 77 PD patients and 50 non-PD controls from Greece. The genotype frequencies for II, ID, and DD were 39, 48, and 13%, respectively, in the PD group and 32, 50, and 18% in the control group. Although the DD frequency was higher in the case group statistical significance was not reached. We conclude that although disease modifying effects cannot be excluded, the ACE insertion/deletion polymorphism is unlikely to be an important determinant of susceptibility to PD in this population. PMID:19452013

  15. 21 CFR 310.515 - Patient package inserts for estrogens.

    Science.gov (United States)

    2010-04-01

    ... package inserts for estrogens. (a) Requirement for a patient package insert. FDA concludes that the safe... the Federal Food, Drug, and Cosmetic Act. (b) Distribution requirements. (1) For estrogen drug...) Exemptions. This section does not apply to estrogen-progestogen oral contraceptives. Labeling requirements...

  16. Prophylactic Antibiotics Use at IUCD Insertion and Pelvic Infection in ...

    African Journals Online (AJOL)

    The Mirena Intrauterine system was not used. The antibiotic used was oral Azithromycin. (Zithromax, Pfizer). In their Sexual history, the users did not report any change in sexual partners or habits after insertion of the device. They were followed up for three months after insertion. Results: Thirty-one clients were seen during ...

  17. Ultrasonic Guided Insertion of Central Venous Catheter in Infants ...

    African Journals Online (AJOL)

    Background/Purpose: ultrasound is licensed for application of regional blocks and insertion of vascular access. We aimed to compare ultrasonic guided (USG) and anatomical landmark technique (ALT) for insertion of central venous catheter (CVC) as regard success rate and rate of complications in infants and children.

  18. Enhancement of heat transfer using varying width twisted tape inserts

    African Journals Online (AJOL)

    user

    width twisted tape inserts, ASME Transactions, Vol. 122, pp. 143-149. Naphon P., 2006. Heat transfer and pressure drop in the horizontal double pipes with and without twisted tape insert, International communications in Heat and Mass Transfer, Vol. 33, pp. 166-175. Promvonge P. and Eiamsa-ard S., 2007. Heat transfer ...

  19. Inactivation of a transgene due to transposition of insertion ...

    Indian Academy of Sciences (India)

    Agrobacterium strains harbour insertion sequences, which are known to transpose into genomes as well as into Ti plasmids. In this study we report the inactivation of a transgene due to transposition of the A. tumefaciens insertion sequence IS136. The transposition was discovered following transformation of plant tissues, ...

  20. Single-copy insertion of transgenes in Caenorhabditis elegans

    DEFF Research Database (Denmark)

    Frøkjaer-Jensen, Christian; Davis, M Wayne; Hopkins, Christopher E

    2008-01-01

    developed a method that inserts a single copy of a transgene into a defined site. Mobilization of a Mos1 transposon generates a double-strand break in noncoding DNA. The break is repaired by copying DNA from an extrachromosomal template into the chromosomal site. Homozygous single-copy insertions can...

  1. A G-protein-coupled chemokine receptor: A putative insertion site for a multi-pathogen recombinant capripoxvirus vaccine strategy.

    Science.gov (United States)

    Cêtre-Sossah, Catherine; Dickmu, Simon; Kwiatek, Olivier; Albina, Emmanuel

    2017-09-01

    Capripoxviruses (CaPVs) have been shown to be ideal viral vectors for the development of recombinant multivalent vaccines to enable delivery of immunogenic genes from ruminant pathogens. So far, the viral thymidine kinase (TK) gene is the only gene used to generate recombinants. A putative non-essential gene encoding a G-protein-coupled chemokine receptor subfamily homologue (GPCR) was targeted as an additional insertion site. Peste des petits ruminants (PPR) was chosen as a disease model. A new recombinant CaPV expressing the viral attachment hemagglutinin (H) of the PPR virus (PPRV) in the GPCR insertion site (rKS1-HPPR-GPCR) was generated in the backbone North African isolate KS1 strain of lumpy skin disease virus (LSDV). Comparison with the recombinant CaPV expressing the H of PPRV in the TK gene (rKS1-HPPR-TK) shown to induce protection against both PPR and LSD in both sheep and goats was assessed. The suitability of the GPCR gene to be a putative additional insertion site in the CaPV genome is evaluated and discussed. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Fluoroscopic insertion of post-pyloric feeding tubes: success rates and complications

    Energy Technology Data Exchange (ETDEWEB)

    Thurley, P.D.; Hopper, M.A. [Department of Clinical Radiology, Nottingham University Hospitals NHS Trust, Nottingham (United Kingdom); Jobling, J.C. [Department of Clinical Radiology, Nottingham University Hospitals NHS Trust, Nottingham (United Kingdom)], E-mail: craig.jobling@nuh.nhs.uk; Teahon, K. [Department of Clinical Radiology, Nottingham University Hospitals NHS Trust, Nottingham (United Kingdom)

    2008-05-15

    Aim: To examine the success and complication rates of radiological placement of post-pyloric feeding tubes, including those inserted with the assistance of a guide-wire. Materials and Methods: Two hundred referrals (156 patients), between the dates of 5 April 2002 and 10 September 2004, were identified retrospectively from computerized records. Subsequently, the radiology reports and patients' notes were reviewed to evaluate the indications for post-pyloric feeding, success of placement, use of a guide-wire, and any complications. Results: A post-pyloric tube was placed in the distal duodenum/jejunum in 183 (91.5%) patients and in the proximal duodenum or distal stomach in six (3%). A tube could not be inserted in 11 (5.5%) patients, and 51 (25.5%) of the insertions required the use of a guide-wire. Immediate complications were recorded in seven patients (3.5%): vomiting (n = 5); hypotension and apnoea requiring naloxone (n = 1) and hypoxia requiring endotracheal intubation (n = 1). Conclusion: Radiological placement of post-pyloric feeding tubes has a success rate comparable with endoscopically placed tubes, and it rarely involves significant technique-related complications.

  3. Insertion Process of Ceramic Nanoporous Microneedles by Means of a Novel Mechanical Applicator Design

    Directory of Open Access Journals (Sweden)

    Xavier H. M. Hartmann

    2015-11-01

    Full Text Available Arrays of microneedles (MNAs are integrated in an out-of-plane fashion with a base plate and can serve as patches for the release of drugs and vaccines. We used soft-lithography and micromolding to manufacture ceramic nanoporous (npMNAs. Failure modes of ceramic npMNAs are as yet poorly understood and the question remained: is our npMNA platform technology ready for microneedle (MN assembly into patches? We investigated npMNAs by microindentation, yielding average crack fracture forces above the required insertion force for a single MN to penetrate human skin. We further developed a thumb pressure-actuated applicator-assisted npMNA insertion method, which enables anchoring of MNs in the skin by an adhesive in one handling step. Using a set of simple artificial skin models, we found a puncture efficiency of this insertion method a factor three times higher than by applying thumb pressure on the npMNA base plate directly. In addition, this new method facilitated zero MN-breakage due to a well-defined force distribution exerted onto the MNs and the closely surrounding area prior to bringing the adhesive into contact with the skin. Owing to the fact that such parameter space exists, we can conclude that npMNAs by soft lithography are a platform technology for MN assembly into a patch.

  4. Gas turbine nozzle vane insert and methods of installation

    Science.gov (United States)

    Miller, William John; Predmore, Daniel Ross; Placko, James Michael

    2002-01-01

    A pair of hollow elongated insert bodies are disposed in one or more of the nozzle vane cavities of a nozzle stage of a gas turbine. Each insert body has an outer wall portion with apertures for impingement-cooling of nozzle wall portions in registration with the outer wall portion. The insert bodies are installed into the cavity separately and spreaders flex the bodies toward and to engage standoffs against wall portions of the nozzle whereby the designed impingement gap between the outer wall portions of the insert bodies and the nozzle wall portions is achieved. The spreaders are secured to the inner wall portions of the insert bodies and the bodies are secured to one another and to the nozzle vane by welding or brazing.

  5. Central vascular catheter insertion in the NICU: a Lean approach.

    Science.gov (United States)

    Liu, Xinran; Suresh, Gautham

    2014-01-01

    To apply Lean principles to the process of inserting central lines into neonates in the NICU. The authors used standard interviews and live observations to obtain concrete data on the current process of central line insertions. Recommendations for improvement were then suggested based on Lean principles. NICU care providers. Non-value-added time (waste), provider confidence, and variation in placing central lines. There was large variation in how providers inserted central lines, and providers were least confident with placing peripherally inserted central catheter lines (55 percent confident). Live observations showed that 53 percent of the current process consisted of waste, with the line insertion and radiography phases of the process as the most wasteful. Lean principles can be applied to a neonatal clinical setting and can be an effective methodology for NICU care providers to improve the way that we care for our patients.

  6. Turbine airfoil having near-wall cooling insert

    Energy Technology Data Exchange (ETDEWEB)

    Martin, Jr., Nicholas F.; Wiebe, David J.

    2017-09-12

    A turbine airfoil is provided with at least one insert positioned in a cavity in an airfoil interior. The insert extends along a span-wise extent of the turbine airfoil and includes first and second opposite faces. A first near-wall cooling channel is defined between the first face and a pressure sidewall of an airfoil outer wall. A second near-wall cooling channel is defined between the second face and a suction sidewall of the airfoil outer wall. The insert is configured to occupy an inactive volume in the airfoil interior so as to displace a coolant flow in the cavity toward the first and second near-wall cooling channels. A locating feature engages the insert with the outer wall for supporting the insert in position. The locating feature is configured to control flow of the coolant through the first or second near-wall cooling channel.

  7. The Ig heavy chain switch region is a hotspot for insertion of transfected DNA

    Energy Technology Data Exchange (ETDEWEB)

    Baar, J.; Shulman, M.J. [Univ. of Toronto, Ontario (Canada)

    1995-08-15

    The Ig heavy chain switch usually occurs by breaking and rejoining DNA in the switch (S) regions, which consist of tandemly repeated sequences 5{prime} of the constant region exons. Various studies have suggested that S DNA can also recombine with non-S sequences. To measure the frequency of such recombination events, the hybridoma cell line igm692, a deletion mutant that lacks the C{mu}1 and C{mu}2 exons and the 3{prime} end of the S{mu} region, was transfected with a fragment bearing the C{mu}1-2 exons, but no S{mu} DNA. Insertion of this fragment into the residual VDJ-C{mu} intron of igm692 can restore a functional {mu} gene, yielding a transformant that is detected as a plaque-forming cell (PFC). PFCs comprise {approximately}8 x 10{sup -7} of the surviving transfected cells. In 10 of 12 PFCs, the C{mu}1-2 fragment inserted into the 2.5-kb residual S{mu} region, whereas insertion in two cases occurred in the 3.5-kb segment 5{prime} of S{mu}. Using a PCR assay to measure the frequency of insertion of the tranferred fragment elsewhere in the hybridoma genome, we found that {approximately}9% of the surviving tranfected cells had stably acquired the C{mu}1-2 fragment. These results indicate that the S{mu} region is {approximately}100-fold more recombinogenic than the average genomic site, and {approximately}7-fold more recombinogenic than the non-S{mu} segment of the residual VDJ-C{mu}, i.e., the S{mu} region is a hotspot for insertion of transfected DNA.

  8. Characterization of DNA repair deficient strains of Chlamydomonas reinhardtii generated by insertional mutagenesis.

    Directory of Open Access Journals (Sweden)

    Andrea Plecenikova

    Full Text Available While the mechanisms governing DNA damage response and repair are fundamentally conserved, cross-kingdom comparisons indicate that they differ in many aspects due to differences in life-styles and developmental strategies. In photosynthetic organisms these differences have not been fully explored because gene-discovery approaches are mainly based on homology searches with known DDR/DNA repair proteins. Here we performed a forward genetic screen in the green algae Chlamydomonas reinhardtii to identify genes deficient in DDR/DNA repair. We isolated five insertional mutants that were sensitive to various genotoxic insults and two of them exhibited altered efficiency of transgene integration. To identify genomic regions disrupted in these mutants, we established a novel adaptor-ligation strategy for the efficient recovery of the insertion flanking sites. Four mutants harbored deletions that involved known DNA repair factors, DNA Pol zeta, DNA Pol theta, SAE2/COM1, and two neighbouring genes encoding ERCC1 and RAD17. Deletion in the last mutant spanned two Chlamydomonas-specific genes with unknown function, demonstrating the utility of this approach for discovering novel factors involved in genome maintenance.

  9. Insertion of retrotransposons at chromosome ends: adaptive response to chromosome maintenance

    Directory of Open Access Journals (Sweden)

    Geraldine eServant

    2016-01-01

    Full Text Available The telomerase complex is a specialized reverse transcriptase that inserts tandem DNA arrays at the linear chromosome ends and contributes to the protection of the genetic information in eukaryotic genomes. Telomerases are phylogenetically related to retrotransposons, encoding also the reverse transcriptase activity required for the amplification of their sequences throughout the genome. Intriguingly the telomerase gene is lost from the drosophila genome and tandem retrotransposons replace telomeric sequences at the chromosome extremities. This observation suggests the versatility of reverse transcriptase activity in counteracting the chromosome shortening associated with genome replication and that retrotransposons can provide this activity in case of a dysfunctional telomerase. In this review paper, we describe the major classes of retroelements present in eukaryotic genomes in order to point out the differences and similarities with the telomerase complex. In a second part, we discuss the insertion of retroelements at the ends of chromosomes as an adaptive response for dysfunctional telomeres.

  10. Genome sequence of the basal haplorrhine primate Tarsius syrichta reveals unusual insertions

    Science.gov (United States)

    Schmitz, Jürgen; Noll, Angela; Raabe, Carsten A.; Churakov, Gennady; Voss, Reinhard; Kiefmann, Martin; Rozhdestvensky, Timofey; Brosius, Jürgen; Baertsch, Robert; Clawson, Hiram; Roos, Christian; Zimin, Aleksey; Minx, Patrick; Montague, Michael J.; Wilson, Richard K.; Warren, Wesley C.

    2016-01-01

    Tarsiers are phylogenetically located between the most basal strepsirrhines and the most derived anthropoid primates. While they share morphological features with both groups, they also possess uncommon primate characteristics, rendering their evolutionary history somewhat obscure. To investigate the molecular basis of such attributes, we present here a new genome assembly of the Philippine tarsier (Tarsius syrichta), and provide extended analyses of the genome and detailed history of transposable element insertion events. We describe the silencing of Alu monomers on the lineage leading to anthropoids, and recognize an unexpected abundance of long terminal repeat-derived and LINE1-mobilized transposed elements (Tarsius interspersed elements; TINEs). For the first time in mammals, we identify a complete mitochondrial genome insertion within the nuclear genome, then reveal tarsier-specific, positive gene selection and posit population size changes over time. The genomic resources and analyses presented here will aid efforts to more fully understand the ancient characteristics of primate genomes. PMID:27708261

  11. U-Insertion/Deletion mRNA-Editing Holoenzyme: Definition in Sight.

    Science.gov (United States)

    Aphasizheva, Inna; Aphasizhev, Ruslan

    2016-02-01

    RNA editing is a process that alters DNA-encoded sequences and is distinct from splicing, 5' capping, and 3' additions. In 30 years since editing was discovered in mitochondria of trypanosomes, several functionally and evolutionarily unrelated mechanisms have been described in eukaryotes, archaea, and viruses. Editing events are predominantly post-transcriptional and include nucleoside insertions and deletions, and base substitutions and modifications. Here, we review the mechanism of uridine insertion/deletion mRNA editing in kinetoplastid protists typified by Trypanosoma brucei. This type of editing corrects frameshifts, introduces translation punctuation signals, and often adds hundreds of uridines to create protein-coding sequences. We focus on protein complexes responsible for editing reactions and their interactions with other elements of the mitochondrial gene expression pathway. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. CRISPR/Cas9-Assisted Transformation-Efficient Reaction (CRATER) for Near-Perfect Selective Transformation

    Science.gov (United States)

    Rothschild, Lynn J.; Greenberg, Daniel T.; Takahashi, Jack R.; Thompson, Kirsten A.; Maheshwari, Akshay J.; Kent, Ryan E.; McCutcheon, Griffin; Shih, Joseph D.; Calvet, Charles; Devlin, Tyler D.; hide

    2015-01-01

    The CRISPR (Clustered, Regularly Interspaced, Short Palindromic Repeats)/Cas9 system has revolutionized genome editing by providing unprecedented DNA-targeting specificity. Here we demonstrate that this system can be also applied in vitro to fundamental cloning steps to facilitate efficient plasmid selection for transformation and selective gene insertion into plasmid vectors by cleaving unwanted plasmid byproducts with a single-guide RNA (sgRNA)-Cas9 nuclease complex. Using fluorescent and chromogenic proteins as reporters, we demonstrate that CRISPR/Cas9 cleavage excludes multiple plasmids as well as unwanted ligation byproducts resulting in an unprecedented increase in the transformation success rate from approximately 20% to nearly 100%. Thus, this CRISPR/Cas9-Assisted Transformation-Efficient Reaction (CRATER) protocol is a novel, inexpensive, and convenient application to conventional molecular cloning to achieve near-perfect selective transformation.

  13. Percutaneous Sacroiliac Screw Placement: A Prospective Randomized Comparison of Robot-assisted Navigation Procedures with a Conventional Technique

    Directory of Open Access Journals (Sweden)

    Jun-Qiang Wang

    2017-01-01

    Conclusions: Accuracy of the robot-assisted technique was superior to that of the freehand technique. Robot-assisted navigation is safe for unstable posterior pelvic ring stabilization, especially in S1, but also in S2. SI screw insertion with robot-assisted navigation is clinically feasible.

  14. Recessive inheritance of population-specific intronic LINE-1 insertion causes a rotor syndrome phenotype.

    Science.gov (United States)

    Kagawa, Tatehiro; Oka, Akira; Kobayashi, Yoshinao; Hiasa, Yoichi; Kitamura, Tsuneo; Sakugawa, Hiroshi; Adachi, Yukihiko; Anzai, Kazuya; Tsuruya, Kota; Arase, Yoshitaka; Hirose, Shunji; Shiraishi, Koichi; Shiina, Takashi; Sato, Tadayuki; Wang, Ting; Tanaka, Masayuki; Hayashi, Hideki; Kawabe, Noboru; Robinson, Peter N; Zemojtel, Tomasz; Mine, Tetsuya

    2015-03-01

    Sequences of long-interspersed elements (LINE-1, L1) make up ∼17% of the human genome. De novo insertions of retrotransposition-active L1s can result in genetic diseases. It has been recently shown that the homozygous inactivation of two adjacent genes SLCO1B1 and SLCO1B3 encoding organic anion transporting polypeptides OATP1B1 and OATP1B3 causes a benign recessive disease presenting with conjugated hyperbilirubinemia, Rotor syndrome. Here, we examined SLCO1B1 and SLCO1B3 genes in six Japanese diagnosed with Rotor syndrome on the basis of laboratory data and laparoscopy. All six Japanese patients were homozygous for the c.1738C>T nonsense mutation in SLCO1B1 and homozygous for the insertion of a ∼6.1-kbp L1 retrotransposon in intron 5 of SLCO1B3, which altogether make up a Japanese-specific haplotype. RNA analysis revealed that the L1 insertion induced deleterious splicing resulting in SLCO1B3 transcripts lacking exon 5 or exons 5-7 and containing premature stop codons. The expression of OATP1B1 and OATP1B3 proteins was not detected in liver tissues. This is the first documented case of a population-specific polymorphic intronic L1 transposon insertion contributing to molecular etiology of recessive genetic disease. Since L1 activity in human genomes is currently seen as a major source of individual genetic variation, further investigations are warranted to determine whether this phenomenon results in other autosomal-recessive diseases. © 2014 WILEY PERIODICALS, INC.

  15. Rapid development of molecular markers by next-generation sequencing linked to a gene conferring phomopsis stem blight disease resistance for marker-assisted selection in lupin (Lupinus angustifolius L.) breeding.

    Science.gov (United States)

    Yang, Huaan; Tao, Ye; Zheng, Zequn; Shao, Di; Li, Zhenzhong; Sweetingham, Mark W; Buirchell, Bevan J; Li, Chengdao

    2013-02-01

    Selection for phomopsis stem blight disease (PSB) resistance is one of the key objectives in lupin (Lupinus angustifolius L.) breeding programs. A cross was made between cultivar Tanjil (resistant to PSB) and Unicrop (susceptible). The progeny was advanced into F(8) recombinant inbred lines (RILs). The RIL population was phenotyped for PSB disease resistance. Twenty plants from the RIL population representing disease resistance and susceptibility was subjected to next-generation sequencing (NGS)-based restriction site-associated DNA sequencing on the NGS platform Solexa HiSeq2000, which generated 7,241 single nucleotide polymorphisms (SNPs). Thirty-three SNP markers showed the correlation between the marker genotypes and the PSB disease phenotype on the 20 representative plants, which were considered as candidate markers linked to a putative R gene for PSB resistance. Seven candidate markers were converted into sequence-specific PCR markers, which were designated as PhtjM1, PhtjM2, PhtjM3, PhtjM4, PhtjM5, PhtjM6 and PhtjM7. Linkage analysis of the disease phenotyping data and marker genotyping data on a F(8) population containing 187 RILs confirmed that all the seven converted markers were associated with the putative R gene within the genetic distance of 2.1 CentiMorgan (cM). One of the PCR markers, PhtjM3, co-segregated with the R gene. The seven established PCR markers were tested in the 26 historical and current commercial cultivars released in Australia. The numbers of "false positives" (showing the resistance marker allele band but lack of the putative R gene) for each of the seven PCR markers ranged from nil to eight. Markers PhtjM4 and PhtjM7 are recommended in marker-assisted selection for PSB resistance in the Australian national lupin breeding program due to its wide applicability on breeding germplasm and close linkage to the putative R gene. The results demonstrated that application of NGS technology is a rapid and cost-effective approach in

  16. Counterbalancing clinical supervision and independent practice: case studies in learning thoracic epidural catheter insertion.

    Science.gov (United States)

    Johnson, T

    2010-12-01

    Thoracic epidural catheter placement is an example of a demanding and high-risk clinical skill that junior anaesthetists need to learn by experience and under the supervision of consultants. This learning is known to present challenges that require further study. Ten consultant and 10 trainee anaesthetists in a teaching hospital were interviewed about teaching and learning this skill in the operating theatre, and a phenomenological analysis of their experience was performed. Trainee participation was limited by time pressure, lack of familiarity with consultants, and consultants' own need for clinical experience. There was a particular tension between safe and effective consultant practice and permitting trainees' independence. Three distinct stages of participation and assistance were identified from reports of ideal practice: early (part-task or basic procedure, consultant always present giving instruction and feedback), middle (independent practice with straightforward cases without further instruction), and late (skill extension and transfer). Learning assistance provided by consultants varied, but it was often not matched to the trainees' stages of learning. Negotiation of participation and assistance was recognized as being useful, but it did not happen routinely. There are many obstacles to trainees' participation in thoracic epidural catheter insertion, and learning assistance is not matched to need. A more explicit understanding of stages of learning is required to benefit the learning of this and other advanced clinical skills.

  17. The use of genes for performance enhancement: doping or therapy?

    National Research Council Canada - National Science Library

    Oliveira, R S; Collares, T F; Smith, K R; Collares, T V; Seixas, F K

    2011-01-01

    ...) to enhance athletic performance. In such 'gene doping', exogenous genetic sequences are inserted into a specific tissue, altering cellular gene activity or leading to the expression of a protein product...

  18. Long-distance activation of the Myc protooncogene by provirus insertion in Mlvi-1 or Mlvi-4 in rat T-cell lymphomas.

    OpenAIRE

    Lazo, P A; Lee, J S; Tsichlis, P N

    1990-01-01

    T-cell lymphomas induced by Moloney murine leukemia virus frequently have proviruses integrated at the Mlvi-4 and Mlvi-1 loci, which map approximately 30 and 270 kilobases 3' of the promoter region of the Myc protooncogene, respectively. Provirus insertion in these loci is responsible for the activation of adjacent genes. To determine whether Myc expression was also affected by these provirus insertions, we constructed T-cell hybrids between two rat thymic lymphomas containing a provirus in M...

  19. Method of joining a vane cavity insert to a nozzle segment of a gas turbine

    Science.gov (United States)

    Burdgick, Steven Sebastian

    2002-01-01

    An insert containing apertures for impingement cooling a nozzle vane of a nozzle segment in a gas turbine is inserted into one end of the vane. The leading end of the insert is positioned slightly past a rib adjacent the opposite end of the vane through which the insert is inserted. The end of the insert is formed or swaged into conformance with the inner margin of the rib. The insert is then brazed or welded to the rib.

  20. OryGenesDB: a database for rice reverse genetics

    NARCIS (Netherlands)

    Droc, G.; Ruiz, M.; Larmande, P.; Pereira, A.B.; Piffanelli, P.; Morel, J.B.; Dievart, A.; Courtois, B.; Guiderdoni, E.; Perin, C.

    2006-01-01

    Insertional mutant databases containing Flanking Sequence Tags (FSTs) are becoming key resources for plant functional genomics. We have developed OryGenesDB (http://orygenesdb.cirad.fr/), a database dedicated to rice reverse genetics. Insertion mutants of rice genes are catalogued by Flanking

  1. Luteal phase support in assisted reproductive technology treatment: focus on Endometrin® (progesterone vaginal insert

    Directory of Open Access Journals (Sweden)

    Jerome H Check

    2009-05-01

    Full Text Available Jerome H CheckThe University of Medicine and Dentistry of New Jersey, Robert Wood Johnson Medical School at Camden, Cooper Hospital/University Medical Center, Department of Obstetrics and Gynecology, Division of Reproductive Endocrinology and Infertility, Camden, New Jersey, USAAbstract: Supplementation of progesterone in the luteal phase and continuance of progesterone therapy during the first trimester has been found in several studies to have benefits in promoting fertility, preventing miscarriages and even preventing pre-term labor. Though it can be administered orally, intramuscularly or even sublingually, a very effective route with fewer side effects can be achieved by an intravaginal route. The first vaginal preparations were not made commercially but were compounded by pharmacies. This had the disadvantage of lack of control by the Food and Drug Administration (FDA ensuring efficacy of the preparations. Furthermore there was a lack of precise dosing leading to batch to batch variation. The first commercially approved vaginal progesterone preparation in the United States was a vaginal gel which has proven very effective. The main side effect was accumulation of a buildup of the vaginal gel sometimes leading to irritation. Natural micronized progesterone for vaginal administration with the brand name of Utrogestan A® had been approved even before the gel in certain European countries. Endometrin® vaginal tablets are the newest natural progesterone approved by the FDA. Comparisons to the vaginal gel and to intramuscular progesterone have shown similar efficacy especially in studies following controlled ovarian hyperstimulation and oocyte egg retrieval and embryo transfer. Larger studies are needed to compare side effects.Keywords: progesterone vaginal tablets, luteal phase, miscarriage, pregnancy rates

  2. Intracochlear Pressure Transients During Cochlear Implant Electrode Insertion.

    Science.gov (United States)

    Greene, Nathaniel T; Mattingly, Jameson K; Banakis Hartl, Renee M; Tollin, Daniel J; Cass, Stephen P

    2016-12-01

    Cochlear implant (CI) electrode insertion into the round window induces pressure transients in the cochlear fluid comparable to high-intensity sound transients. Many patients receiving a CI have some remaining functional hearing at low frequencies; thus, devices and surgical techniques have been developed to use this residual hearing. To maintain functional acoustic hearing, it is important to retain function of any hair cells and auditory nerve fibers innervating the basilar membrane; however, in a subset of patients, residual low-frequency hearing is lost after CI insertion. Here, we test the hypothesis that transient intracochlear pressure spikes are generated during CI electrode insertion, which could cause damage and compromise residual hearing. Human cadaveric temporal bones were prepared with an extended facial recess. Pressures in the scala vestibuli and tympani were measured with fiber-optic pressure sensors inserted into the cochlea near the oval and round windows, whereas CI electrodes (five styles from two manufacturers) were inserted into the cochlea via a round window approach. Pressures in the scala tympani tended to be larger in magnitude than pressures in the scala vestibuli, consistent with electrode insertion into the scala tympani. CI electrode insertion produced a range of pressure transients in the cochlea that could occur alone or as part of a train of spikes with equivalent peak sound pressure levels in excess of 170 dB sound pressure level. Instances of pressure transients varied with electrode styles. Results suggest electrode design, insertion mechanism, and surgical technique affect the magnitude and rate of intracochlear pressure transients during CI electrode insertion. Pressure transients showed intensities similar to those elicited by high-level sounds and thus could cause damage to the basilar membrane and/or hair cells.

  3. Redefining Zone II: Anatomy of the Flexor Digitorum Superficialis Insertion.

    Science.gov (United States)

    Nicholson, Luke T; Hill, Jeffrey R; McKnight, Braden; Heckmann, Nathanael; Stevanovic, Milan; Ghiassi, Alidad

    2017-10-01

    Flexor zone II is defined as the region spanning the proximal aspect of the A1 pulley to the insertion of the flexor digitorum superficialis (FDS) tendon. Descriptions of the FDS insertion are inconsistent in the literature, but zones of injury are frequently determined with reference to superficial landmarks. The purpose of this study was to describe the footprint of the FDS insertion and define its relationship to the proximal interphalangeal (PIP) skin crease. The FDS insertion on the index, middle, ring, and small fingers was dissected in 6 matched pairs of fresh-frozen cadaveric hands. A Kirschner wire was used to mark the level of the PIP skin crease on bone before measurements of the FDS footprint and its position relative to the PIP skin crease were made using digital calipers. The radial and ulnar FDS slips inserted a mean distance of 3.22 mm from the distal aspect of the PIP skin crease and varied by digit. The mean distal extent of the FDS insertion was 8.29 mm. The mean length of the insertion of each FDS slip was 5.15 mm and the mean width was 1.9 mm. The radial and ulnar FDS slips insert on average 3.22 mm distal to the PIP skin crease and vary by digit. Knowledge of the FDS insertion is clinically relevant when differentiating between flexor zone I and zone II injuries, planning surgical approaches to the finger, and in guiding patient expectations for surgery given the variability in outcome based on zone of injury.

  4. TOPAAS, a Tomato and Potato Assembly Assistance System for Selection and Finishing of Bacterial Artificial Chromosomes1[W

    Science.gov (United States)

    Peters, Sander A.; van Haarst, Jan C.; Jesse, Taco P.; Woltinge, Dennis; Jansen, Kim; Hesselink, Thamara; van Staveren, Marjo J.; Abma-Henkens, Marleen H.C.; Klein-Lankhorst, René M.

    2006-01-01

    We have developed the software package Tomato and Potato Assembly Assistance System (TOPAAS), which automates the assembly and scaffolding of contig sequences for low-coverage sequencing projects. The order of contigs predicted by TOPAAS is based on read pair information; alignments between genomic, expressed sequence tags, and bacterial artificial chromosome (BAC) end sequences; and annotated genes. The contig scaffold is used by TOPAAS for automated design of nonredundant sequence gap-flanking PCR primers. We show that TOPAAS builds reliable scaffolds for tomato (Solanum lycopersicum) and potato (Solanum tuberosum) BAC contigs that were assembled from shotgun sequences covering the target at 6- to 8-fold coverage. More than 90% of the gaps are closed by sequence PCR, based on the predicted ordering information. TOPAAS also assists the selection of large genomic insert clones from BAC libraries for walking. For this, tomato BACs are screened by automated BLAST analysis and in parallel, high-density nonselective amplified fragment length polymorphism fingerprinting is used for constructing a high-resolution BAC physical map. BLAST and amplified fragment length polymorphism analysis are then used together to determine the precise overlap. Assembly onto the seed BAC consensus confirms the BACs are properly selected for having an extremely short overlap and largest extending insert. This method will be particularly applicable where related or syntenic genomes are sequenced, as shown here for the Solanaceae, and potentially useful for the monocots Brassicaceae and Leguminosea. PMID:16524981

  5. Industrial stator vane with sequential impingement cooling inserts

    Science.gov (United States)

    Jones, Russell B; Fedock, John A; Goebel, Gloria E; Krueger, Judson J; Rawlings, Christopher K; Memmen, Robert L

    2013-08-06

    A turbine stator vane for an industrial engine, the vane having two impingement cooling inserts that produce a series of impingement cooling from the pressure side to the suction side of the vane walls. Each insert includes a spar with a row of alternating impingement cooling channels and return air channels extending in a radial direction. Impingement cooling plates cover the two sides of the insert and having rows of impingement cooling holes aligned with the impingement cooling channels and return air openings aligned with the return air channel.

  6. Rapid Introgression of the Fusarium Wilt Resistance Gene into an Elite Cabbage Line through the Combined Application of a Microspore Culture, Genome Background Analysis, and Disease Resistance-Specific Marker Assisted Foreground Selection.

    Science.gov (United States)

    Liu, Xing; Han, Fengqing; Kong, Congcong; Fang, Zhiyuan; Yang, Limei; Zhang, Yangyong; Zhuang, Mu; Liu, Yumei; Li, Zhansheng; Lv, Honghao

    2017-01-01

    Cabbage is an economically important vegetable worldwide. Cabbage Fusarium Wilt (CFW) is a destructive disease that results in considerable yield and quality losses in cole crops. The use of CFW-resistant varieties is the most effective strategy to mitigate the effects of CFW. 01-20 is an elite cabbage line with desirable traits and a high combining ability, but it is highly susceptible to CFW. To rapidly transfer a CFW resistance gene into 01-20 plants, we used microspore cultures to develop 230 doubled haploid (DH) lines from a cross between 01-20 (highly susceptible) and 96-100 (highly resistant). One of the generated DH lines (i.e., D134) was highly resistant to CFW and exhibited a phenotypic performance that was similar to that of line 01-20. Therefore, D134 was applied as the resistance donor parent. We generated 24 insertion-deletion markers using whole genome resequencing data for lines 01-20 and 96-100 to analyze the genomic backgrounds of backcross (BC) progenies. Based on the CFW resistance gene FOC1, a simple sequence repeat (SSR) marker (i.e., Frg13) was developed for foreground selections. We screened 240 BC1 individuals and 280 BC2 individuals with these markers and assessed their phenotypic performance. The proportion of recurrent parent genome (PRPG) of the best individuals in BC1 and BC2 were 95.8 and 99.1%. Finally, a best individual designated as YR01-20 was identified from 80 BC2F1 individuals, with homozygous FOC1 allele and genomic background and phenotype almost the same as those of 01-20. Our results may provide a rapid and efficient way of improving elite lines through the combined application of microspore culture, whole-genome background analysis, and disease resistance-specific marker selection. Additionally, the cabbage lines developed in this study represent elite materials useful for the breeding of new CFW-resistant cabbage varieties.

  7. A web-based interactive framework to assist in the prioritization of disease candidate genes in whole-exome sequencing studies.

    Science.gov (United States)

    Alemán, Alejandro; Garcia-Garcia, Francisco; Salavert, Francisco; Medina, Ignacio; Dopazo, Joaquín

    2014-07-01

    Whole-exome sequencing has become a fundamental tool for the discovery of disease-related genes of familial diseases and the identification of somatic driver variants in cancer. However, finding the causal mutation among the enormous background of individual variability in a small number of samples is still a big challenge. Here we describe a web-based tool, BiERapp, which efficiently helps in the identification of causative variants in family and sporadic genetic diseases. The program reads lists of predicted variants (nucleotide substitutions and indels) in affected individuals or tumor samples and controls. In family studies, different modes of inheritance can easily be defined to filter out variants that do not segregate with the disease along the family. Moreover, BiERapp integrates additional information such as allelic frequencies in the general population and the most popular damaging scores to further narrow down the number of putative variants in successive filtering steps. BiERapp provides an interactive and user-friendly interface that implements the filtering strategy used in the context of a large-scale genomic project carried out by the Spanish Network for Research in Rare Diseases (CIBERER) in which more than 800 exomes have been analyzed. BiERapp is freely available at: http://bierapp.babelomics.org/ © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  8. Authentic display of a cholera toxin epitope by chimeric type 1 fimbriae: effects of insert position and host background

    DEFF Research Database (Denmark)

    Stentebjerg-Olesen, B; Pallesen, L; Jensen, LB

    1997-01-01

    The potential of the major structural protein of type 1 fimbriae as a display system for heterologous sequences was tested. As a reporter-epitope, a heterologous sequence mimicking a neutralizing epitope of the cholera toxin B chain was inserted, in one or two copies, into four different positions...... in the fimA gene. This was carried out by introduction of new restriction sites by PCR-mediated site-directed mutagenesis of fimA in positions predicted to correspond to optimally surface-located regions of the subunit protein. Subsequently, the synthetic cholera-toxin-encoding DNA segment was inserted....... Several of the chosen positions seemed amenable even for large foreign inserts; the chimeric proteins were exposed on the bacterial surface and the cholera toxin epitope was authentically displayed, i.e. it was recognized on bacteria by specific antiserum. Display of chimeric fimbriae was tested...

  9. The accuracy and the safety of individualized 3D printing screws insertion templates for cervical screw insertion.

    Science.gov (United States)

    Deng, Ting; Jiang, Minghui; Lei, Qing; Cai, Lihong; Chen, Li

    2016-12-01

    Clinical trial for cervical screw insertion by using individualized 3-dimensional (3D) printing screw insertion templates device. The objective of this study is to evaluate the safety and accuracy of the individualized 3D printing screw insertion template in the cervical spine. Ten patients who underwent posterior cervical fusion surgery with cervical pedicle screws, laminar screws or lateral mass screws between December 2014 and December 2015 were involved in this study. The patients were examined by CT scan before operation. The individualized 3D printing templates were made with photosensitive resin by a 3D printing system to ensure the screw shafts entered the vertebral body without breaking the pedicle or lamina cortex. The templates were sterilized by a plasma sterilizer and used during the operation. The accuracy and the safety of the templates were evaluated by CT scans at the screw insertion levels after operation. The accuracy of this patient-specific template technique was demonstrated. Only one screw axis greatly deviated from the planned track and breached the cortex of the pedicle because the template was split by rough handling and then we inserted the screws under the fluoroscopy. The remaining screws were inserted in the track as preoperative design and the screw axis deviated by less than 2 mm. Vascular or neurologic complications or injuries did not happen. And no infection, broken nails, fracture of bone structure, or screw pullout occurred. This study verified the safety and the accuracy of the individualized 3D printing screw insertion templates in the cervical spine as a kind of intraoperative screw navigation. This individualized 3D printing screw insertion template was user-friendly, moderate cost, and enabled a radiation-free cervical screw insertion.

  10. Evaluation of medication package inserts in Saudi Arabia

    National Research Council Canada - National Science Library

    Al-Aqeel, Sinaa A

    2012-01-01

    The aim of this study was to examine if package inserts (PIs) supplied with prescribed and over-the-counter medications in Saudi Arabia contain information relevant for the safe and appropriate use of these medications...

  11. Inserts and omissions in the Calvinist Catechism printed in 1648

    National Research Council Canada - National Science Library

    Pál, Enikő

    2015-01-01

    .... In this respect, the pursued objective is to set up a typology of inserts and omissions found in the Romanian translation of the catechism printed in 1648, taking into account the main causes which generated...

  12. The use of dimorphic Alu insertions in human DNA fingerprinting

    Energy Technology Data Exchange (ETDEWEB)

    Novick, G.E.; Gonzalez, T.; Garrison, J.; Novick, C.C.; Herrera, R.J. [Florida International Univ., Miami, FL (United States). Dept. of Biological Sciences; Batzer, M.A. [Lawrence Livermore National Lab., CA (United States); Deininger, P.L. [Louisiana State Univ., New Orleans, LA (United States). Medical Center

    1992-12-04

    We have characterized certain Human Specific Alu Insertions as either dimorphic (TPA25, PV92, APO), sightly dimorphic (C2N4 and C4N4) or monomorphic (C3N1, C4N6, C4N2, C4N5, C4N8), based on studies of Caucasian, Asian, American Black and African Black populations. Our approach is based upon: (1) PCR amplification using primers directed to the sequences that flank the site of insertion of the different Alu elements studied; (2) gel electrophoresis and scoring according to the presence or absence of an Alu insertion in one or both homologous chromosomes; (3) allelic frequencies calculated and compared according to Hardy-Weinberg equilibrium. Our DNA fingerprinting procedure using PCR amplification of dimorphic Human Specific Alu insertions, is stable enough to be used not only as a tool for genetic mapping but also to characterize populations, study migrational patterns and track the inheritance of human genetic disorders.

  13. On the Phenomenon of Inserted Thoughts: A Critique of Shaun ...

    African Journals Online (AJOL)

    It is argued here that our sense of agency for thinking requires more than protention, and, ... fully explain the loss of agency for thinking characterizing the experience of thought insertion. ... EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT

  14. Laparoscopic insertion of lumbar peritoneal shunts for idiopathic ...

    African Journals Online (AJOL)

    Background: The treatment of idiopathic intracranial hypertension varies from simple observation to the mechanical diversion of cerebrospinal fluid. Objective: To describe our technique and initial experience with the laparoscopic insertion of lumbarperitoneal shunts. Conclusion: Lumbarperitoneal shunts should be ...

  15. Fireplace insert and its parameters depend on the used glazing

    Science.gov (United States)

    Papučík, Štefan; Čaja, Alexander

    2016-06-01

    The contribution deals with the analysis of the impact of using double glass to change the performance and emission parameters of the fireplace insert. Conventional fireplace inserts are equipped with heat-resistant glass, which is resistant to high temperatures. For this type of inserts are required to be radiant constituent maximized. Prevailing part of heat is into the interior gets just by radiation through the glazed part. The hot water fireplace inserts is the requirement that the radiant constituent to the environment to a minimum. Therefore, instead of a single glass using double glazing which is intended to reduce this part of heat transfer. The temperature in the furnace is increased, and transmitted most of the heat into the water.

  16. Agrobacterium-mediated insertional mutagenesis in the mycorrhizal fungus Laccaria bicolor.

    Science.gov (United States)

    Stephan, B I; Alvarez Crespo, M C; Kemppainen, M J; Pardo, A G

    2017-05-01

    Agrobacterium-mediated gene transfer (AMT) is extensively employed as a tool in fungal functional genomics and accordingly, in previous studies we used AMT on a dikaryotic strain of the ectomycorrhizal basidiomycete Laccaria bicolor. The interest in this fungus derives from its capacity to establish a symbiosis with tree roots, thereby playing a major role in nutrient cycling of forest ecosystems. The ectomycorrhizal symbiosis is a highly complex interaction involving many genes from both partners. To advance in the functional characterization of fungal genes, AMT was used on a monokaryotic L. bicolor. A collection of over 1200 transgenic strains was produced, of which 200 randomly selected strains were analyzed for their genomic T-DNA insertion patterns. By means of insertional mutagenesis, a number of transgenic strains were obtained displaying differential growth features. Moreover, mating with a compatible strain resulted in dikaryons that retained altered phenotypic features of the transgenic monokaryon. The analysis of the T-DNA integration pattern revealed mostly similar results to those reported in earlier studies, confirming the usefulness of AMT on different genetic backgrounds of L. bicolor. Taken together, our studies display the great versatility and potentiality of AMT as a tool for the genetic characterization of L. bicolor.

  17. Shoe inserts and orthotics for sport and physical activities.

    Science.gov (United States)

    Nigg, B M; Nurse, M A; Stefanyshyn, D J

    1999-07-01

    The purposes of this paper were to discuss the perceived benefits of inserts and orthotics for sport activities and to propose a new concept for inserts and orthotics. There is evidence that inserts or orthotics reduce or prevent movement-related injuries. However, there is limited knowledge about the specific functioning an orthotic or insert provides. The same orthotic or insert is often proposed for different problems. Changes in skeletal movement due to inserts or orthotics seem to be small and not systematic. Based on the results of a study using bone pins, one may question the idea that a major function of orthotics or inserts consists in aligning the skeleton. Impact cushioning with shoe inserts or orthotics is typically below 10%. Such small reductions might not be important for injury reduction. It has been suggested that changes in material properties might produce adjustments in the muscular response of the locomotor system. The foot has various sensors to detect input signals with subject specific thresholds. Subjects with similar sensitivity threshold levels seem to respond in their movement pattern in a similar way. Comfort is an important variable. From a biomechanical point of view, comfort may be related to fit, additional stabilizing muscle work, fatigue, and damping of soft tissue vibrations. Based on the presented evidence, the concept of minimizing muscle work is proposed when using orthotics or inserts. A force signal acts as an input variable on the shoe. The shoe sole acts as a first filter, the insert or orthotic as a second filter, the plantar surface of the foot as a third filter for the force input signal. The filtered information is transferred to the central nervous system that provides a subject specific dynamic response. The subject performs the movement for the task at hand. For a given movement task, the skeleton has a preferred path. If an intervention supports/counteracts the preferred movement path, muscle activity can/must be

  18. Production Recesses for Replaceable Cutting Inserts of Milling Tools

    Science.gov (United States)

    Kousal, Lukáš; Sadílek, Marek

    2014-12-01

    This article describes the production of recesses for replaceable cutting inserts of milling tools. The recess manufacture is exemplified on a D20 shanktype milling cutter with three replaceable cutting inserts. A new production technology and its operating cycle are demonstrated. A com-parison of the old and the new technologies shows the percentage saving of change cycles and used tools, including overall evaluation of the tech-nology.

  19. Breakage of an Epidural Catheter Inserted for Labor Analgesia

    OpenAIRE

    Üşar, Pınar; Kar, Aysun Afife; Çıtak, Güven; Maral, Jale; Canlı, Şeyda

    2015-01-01

    The breakage of an epidural catheter, which is usually not noticed, is a rare but important complication encountered while inserting or removing the catheter during epidural blockade. While the epidural catheter was being inserted for labor analgesia, despite no problem being encountered in advancing the catheter, it was drawn back to verify the location; it was observed that 2 cm of the distal end of the catheter was missing. A neurosurgical consultation was requested; it was reported that t...

  20. Metal-Matrix Composite Parts With Metal Inserts

    Science.gov (United States)

    Majkowski, T.; Kashalikar, U.

    1995-01-01

    Developmental fabrication process produces metal-matrix composite (MMC) parts with integral metal inserts. With inserts, MMC parts readily joined to similar parts by use of brazing, welding, or mechanical fasteners. Process conceived to make strong, lightweight components of structures erected in outer space. Also useful on Earth, in such automotive parts as rocker arms, cylinder liners, and pistons. Potential industrial applications include parts subjected to high stresses at high temperatures, as in power-generation, mining, and oil-drilling equipment.

  1. Insertion Loss Analysis of the Acoustic Panels with Composite Construction

    Directory of Open Access Journals (Sweden)

    Vasile Ovidiu

    2013-09-01

    Full Text Available In order to reduce noise pollution, under European legislation in our country need to align, a special attention has the tests carried out on acoustic panels. The most eloquent attempts, defining traffic noise attenuation are tests that can determine the insertion loss of an acoustic screen. In this paper, it briefly shows the method of determining the insertion loss in octave bands and some real results in the case of acoustic panel in a composite construction.

  2. Histological analysis of the tibial anterior cruciate ligament insertion.

    Science.gov (United States)

    Oka, Shinya; Schuhmacher, Peter; Brehmer, Axel; Traut, Ulrike; Kirsch, Joachim; Siebold, Rainer

    2016-03-01

    This study was performed to investigate the morphology of the tibial anterior cruciate ligament (ACL) by histological assessment. The native (undissected) tibial ACL insertion of six fresh-frozen cadaveric knees was cut into four sagittal sections parallel to the long axis of the medial tibial spine. For histological evaluation, the slices were stained with haematoxylin and eosin, Safranin O and Russell-Movat pentachrome. All slices were digitalized and analysed at a magnification of 20×. The anterior tibial ACL insertion was bordered by a bony anterior ridge. The most medial ACL fibres inserted from the medial tibial spine and were adjacent to the articular cartilage of the medial tibial plateau. Parts of the bony insertions of the anterior and posterior horns of the lateral meniscus were in close contact with the lateral part of the tibial ACL insertion. A small fat pad was located just posterior to the functional ACL fibres. The anterior-posterior length of the medial ACL insertion was an average of 10.8 ± 1.1 mm compared with the lateral, which was only 6.2 ± 1.1 mm (p foot-like'. In contrast to previous findings, the functional mid-substance fibres arose from the most posterior part of the 'duck-foot' in a flat and 'c-shaped' way. The most anterior part of the tibial ACL insertion was bordered by a bony anterior ridge and the most medial by the medial tibial spine. No posterolateral fibres nor ACL bundles have been found histologically. This histological investigation may improve our understanding of the tibial ACL insertion and may provide important information for anatomical ACL reconstruction.

  3. Proximal Junctional Kyphosis After Vertical Expandable Prosthetic Titanium Rib Insertion.

    Science.gov (United States)

    Li, Ying; Gold, Meryl; Karlin, Lawrence

    2013-11-01

    Retrospective review of patients who had undergone vertical expandable prosthetic titanium rib (VEPTR) treatment at a single institution. To evaluate whether clinically significant proximal junctional kyphosis (PJK) occurs after VEPTR insertion. PJK is a potential problem after posterior spinal instrumentation and fusion. PJK after VEPTR insertion has not been well-described. A total of 68 patients underwent VEPTR treatment between 1999 and 2009. Diagnosis, age at time of VEPTR insertion, location of VEPTR anchors, preoperative and postoperative scoliosis, T2-T12 kyphosis and PJK, time from VEPTR insertion to development of PJK, revision procedure for significant PJK, change in PJK after the revision procedure, and PJK at final follow-up were recorded. Four patients developed PJK (6%). One patient had congenital scoliosis with rib fusions, 1 had scoliosis associated with a syndrome, and 2 had neuromuscular scoliosis. Mean follow-up was 5.7 years. Average T2-T12 kyphosis and PJK before VEPTR insertion were 77° and 14°, respectively. Mean T2-T12 kyphosis and PJK after VEPTR insertion were 63° and 33°, respectively. Average T2-T12 kyphosis and PJK before the recommended revision procedure for treatment of PJK were 89° and 53°, respectively. All patients developed PJK within the first year after VEPTR insertion. Two patients underwent revision to growing rods. One of these patients had preoperative halo-gravity traction. Mean PJK in these 2 patients improved from 39° to 18° after revision and remained stable at 19° at an average follow-up of 2.9 years. PJK after VEPTR insertion can occur. Patients with preoperative thoracic hyperkyphosis may be at higher risk. PJK can develop within the first year of VEPTR treatment, and can become progressive and severe enough to require complex interventions. In this small case series, patients were revised to growing rods. Copyright © 2013 Scoliosis Research Society. Published by Elsevier Inc. All rights reserved.

  4. Lithium Insertion In Silicon Nanowires: An ab Initio Study

    KAUST Repository

    Zhang, Qianfan

    2010-09-08

    The ultrahigh specific lithium ion storage capacity of Si nanowires (SiNWs) has been demonstrated recently and has opened up exciting opportunities for energy storage. However, a systematic theoretical study on lithium insertion in SiNWs remains a challenge, and as a result, understanding of the fundamental interaction and microscopic dynamics during lithium insertion is still lacking. This paper focuses on the study of single Li atom insertion into SiNWs with different sizes and axis orientations by using full ab initio calculations. We show that the binding energy of interstitial Li increases as the SiNW diameter grows. The binding energies at different insertion sites, which can be classified as surface, intermediate, and core sites, are quite different. We find that surface sites are energetically the most favorable insertion positions and that intermediate sites are the most unfavorable insertion positions. Compared with the other growth directions, the [110] SiNWs with different diameters always present the highest binding energies on various insertion locations, which indicates that [110] SiNWs are more favorable by Li doping. Furthermore, we study Li diffusion inside SiNWs. The results show that the Li surface diffusion has a much higher chance to occur than the surface to core diffusion, which is consistent with the experimental observation that the Li insertion in SiNWs is layer by layer from surface to inner region. After overcoming a large barrier crossing surface-to-intermediate region, the diffusion toward center has a higher possibility to occur than the inverse process. © 2010 American Chemical Society.

  5. Blind bedside insertion of small bowel feeding tubes.

    LENUS (Irish Health Repository)

    Duggan, SN

    2009-12-01

    The use of Naso-Jejunal (NJ) feeding is limited by difficulty in feeding tube placement. Patients have traditionally required transfer to Endoscopy or Radiology for insertion of small bowel feeding tubes, with clear resource implications. We hypothesised that the adoption of a simple bedside procedure would be effective and reduce cost. Clinical nutrition and nurse specialist personnel were trained in the 10\\/10\\/10 method of blind bedside NJ insertion.

  6. Deep electrode insertion and sound coding in cochlear implants.

    Science.gov (United States)

    Hochmair, Ingeborg; Hochmair, Erwin; Nopp, Peter; Waller, Melissa; Jolly, Claude

    2015-04-01

    Present-day cochlear implants demonstrate remarkable speech understanding performance despite the use of non-optimized coding strategies concerning the transmission of tonal information. Most systems rely on place pitch information despite possibly large deviations from correct tonotopic placement of stimulation sites. Low frequency information is limited as well because of the constant pulse rate stimulation generally used and, being even more restrictive, of the limited insertion depth of the electrodes. This results in a compromised perception of music and tonal languages. Newly available flexible long straight electrodes permit deep insertion reaching the apical region with little or no insertion trauma. This article discusses the potential benefits of deep insertion which are obtained using pitch-locked temporal stimulation patterns. Besides the access to low frequency information, further advantages of deeply inserted long electrodes are the possibility to better approximate the correct tonotopic location of contacts, the coverage of a wider range of cochlear locations, and the somewhat reduced channel interaction due to the wider contact separation for a given number of channels. A newly developed set of strategies has been shown to improve speech understanding in noise and to enhance sound quality by providing a more "natural" impression, which especially becomes obvious when listening to music. The benefits of deep insertion should not, however, be compromised by structural damage during insertion. The small cross section and the high flexibility of the new electrodes can help to ensure less traumatic insertions as demonstrated by patients' hearing preservation rate. This article is part of a Special Issue entitled . Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.

  7. Reflections on the Insertion and Fracture Forces of Microneedles.

    Science.gov (United States)

    Ita, Kevin

    2017-01-01

    The use of microneedles for transdermal drug delivery is a feasible alternative to injections and tablets. As different types of microneedles are being developed from a variety of materials, it is important to understand their insertion and fracture forces. In this review, it has been emphasized that for microneedles to be clinically useful, they must penetrate the skin without breaking. It means that the insertion force must be smaller than fracture force. Transdermal experiments involving these forces have been described and theoretical models highlighted. The knowledge of these forces is important for microneedle design and experimental/ clinical use. From an experimental standpoint, different techniques are used to measure insertion and fracture forces. To measure insertion and failure forces, a texture analyzer can be used. In this review, the measurement of insertion and fracture forces has been discussed and their utility in transdermal experiments presented. This review has focused on insertion and failure forces in transdermal drug delivery experiments. Although the question is complex since there is a wide variety of skin models and forces involved, studies carried out in the last few years have thrown more light to aid better understanding of these forces in transdermal drug delivery research. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  8. Minimally invasive technique for insertion of ventriculopleural shunt catheters.

    Science.gov (United States)

    Richardson, Marlin Dustin; Handler, Michael H

    2013-11-01

    Cerebrospinal fluid diversion to the pleural space has employed various methods to insert the distal catheter into the pleural space. The authors report on a minimally invasive method of pleural catheter insertion that they have developed and have used safely in a small series of patients. Pleural shunt catheters were inserted using a split trochar into the pleural space (technique described in further detail in the article). All cases over the previous 10 years in which this technique was employed were reviewed from the existing electronic medical records. Patient age at insertion, sex, reason for hydrocephalus, early and late complications, valve type, and follow-up were recorded. Fourteen shunt procedures performed in 10 patients were identified. Two small pneumothoraces were detected on routine postoperative imaging and required no intervention. There were 3 late mechanical complications, including migration of a catheter out of the pleural space, catheter fracture at the insertion point, and the need for a longer catheter due to the patient's growth. The authors describe a safe, minimally invasive method for insertion of pleural shunt catheters along with a series of patients who have undergone placement of a pleural shunt catheter using this method without complication directly attributable to the use of this technique.

  9. A new specifically designed forceps for chest drain insertion.

    LENUS (Irish Health Repository)

    Andrews, Emmet

    2012-02-03

    Insertion of a chest drain can be associated with serious complications. It is recommended that the drain is inserted with blunt dissection through the chest wall but there is no specific instrument to aid this task. We describe a new reusable forceps that has been designed specifically to facilitate the insertion of chest drains.A feasibility study of its use in patients who required a chest drain as part of elective cardiothoracic operations was undertaken. The primary end-point was successful and accurate placement of the drain. The operators also completed a questionnaire rating defined aspects of the procedure. The new instrument was used to insert the chest drain in 30 patients (19 male, 11 female; median age 61.5 years (range 16-81 years)). The drain was inserted successfully without the trocar in all cases and there were no complications. Use of the instrument rated as significantly easier relative to experience of previous techniques in all specified aspects. The new device can be used to insert intercostal chest drains safely and efficiently without using the trocar or any other instrument.

  10. Sensorless motion planning for medical needle insertion in deformable tissues.

    Science.gov (United States)

    Alterovitz, Ron; Goldberg, Kenneth Y; Pouliot, Jean; Hsu, I-Chow Joe

    2009-03-01

    Minimally invasive medical procedures such as biopsies, anesthesia drug injections, and brachytherapy cancer treatments require inserting a needle to a specific target inside soft tissues. This is difficult because needle insertion displaces and deforms the surrounding soft tissues causing the target to move during the procedure. To facilitate physician training and preoperative planning for these procedures, we develop a needle insertion motion planning system based on an interactive simulation of needle insertion in deformable tissues and numerical optimization to reduce placement error. We describe a 2-D physically based, dynamic simulation of needle insertion that uses a finite-element model of deformable soft tissues and models needle cutting and frictional forces along the needle shaft. The simulation offers guarantees on simulation stability for mesh modifications and achieves interactive, real-time performance on a standard PC. Using texture mapping, the simulation provides visualization comparable to ultrasound images that the physician would see during the procedure. We use the simulation as a component of a sensorless planning algorithm that uses numerical optimization to compute needle insertion offsets that compensate for tissue deformations. We apply the method to radioactive seed implantation during permanent seed prostate brachytherapy to minimize seed placement error.

  11. Templated sequence insertion polymorphisms in the human genome

    Science.gov (United States)

    Onozawa, Masahiro; Aplan, Peter

    2016-11-01

    Templated Sequence Insertion Polymorphism (TSIP) is a recently described form of polymorphism recognized in the human genome, in which a sequence that is templated from a distant genomic region is inserted into the genome, seemingly at random. TSIPs can be grouped into two classes based on nucleotide sequence features at the insertion junctions; Class 1 TSIPs show features of insertions that are mediated via the LINE-1 ORF2 protein, including 1) target-site duplication (TSD), 2) polyadenylation 10-30 nucleotides downstream of a “cryptic” polyadenylation signal, and 3) preference for insertion at a 5’-TTTT/A-3’ sequence. In contrast, class 2 TSIPs show features consistent with repair of a DNA double-strand break via insertion of a DNA “patch” that is derived from a distant genomic region. Survey of a large number of normal human volunteers demonstrates that most individuals have 25-30 TSIPs, and that these TSIPs track with specific geographic regions. Similar to other forms of human polymorphism, we suspect that these TSIPs may be important for the generation of human diversity and genetic diseases.

  12. Insertion of an SVA element, a nonautonomous retrotransposon, in PMS2 intron 7 as a novel cause of Lynch syndrome.

    Science.gov (United States)

    van der Klift, Heleen M; Tops, Carli M; Hes, Frederik J; Devilee, Peter; Wijnen, Juul T

    2012-07-01

    Heterozygous germline mutations in the mismatch repair gene PMS2 predispose carriers for Lynch syndrome, an autosomal dominant predisposition to cancer. Here, we present a LINE-1-mediated retrotranspositional insertion in PMS2 as a novel mutation type for Lynch syndrome. This insertion, detected with Southern blot analysis in the genomic DNA of the patient, is characterized as a 2.2 kb long 5' truncated SVA_F element. The insertion is not detectable by current diagnostic testing limited to MLPA and direct Sanger sequencing on genomic DNA. The molecular nature of this insertion could only be resolved in RNA from cultured lymphocytes in which nonsense-mediated RNA decay was inhibited. Our report illustrates the technical problems encountered in the detection of this mutation type. Especially large heterozygous insertions will remain unnoticed because of preferential amplification of the smaller wild-type allele in genomic DNA, and are probably underreported in the mutation spectra of autosomal dominant disorders. © 2012 Wiley Periodicals, Inc.

  13. 48 CFR 970.5227-5 - Notice and assistance regarding patent and copyright infringement.

    Science.gov (United States)

    2010-10-01

    ... regarding patent and copyright infringement. 970.5227-5 Section 970.5227-5 Federal Acquisition Regulations... assistance regarding patent and copyright infringement. Insert the following clause in solicitations and contracts in accordance with 970.2702-2: Notice and Assistance Regarding Patent and Copyright Infringement...

  14. Transposon based functional characterization of soybean genes

    Science.gov (United States)

    Type II transposable elements that use cut and paste mechanism for jumping from one genomic region to another is ideal in tagging and cloning genes. Precise excision from an insertion site in a mutant gene leads to regaining the wild-type function. Thus, function of a gene can be established based o...

  15. Generation of West Nile virus infectious clones containing amino acid insertions between capsid and capsid anchor.

    Science.gov (United States)

    Vandergaast, Rianna; Hoover, Lisa I; Zheng, Kang; Fredericksen, Brenda L

    2014-04-09

    West Nile virus (WNV) is a positive-sense RNA arbovirus responsible for recent outbreaks of severe neurological disease within the US and Europe. Large-scale analyses of antiviral compounds that inhibit virus replication have been limited due to the lack of an adequate WN reporter virus. Previous attempts to insert a reporter into the 3' untranslated region of WNV generated unstable viruses, suggesting that this region does not accommodate additional nucleotides. Here, we engineered two WNV infectious clones containing insertions at the Capsid (C)/Capsid Anchor (CA) junction of the viral polyprotein. Recombinant viruses containing a TAT(1-67) or Gaussia Luciferase (GLuc) gene at this location were successfully recovered. However, rapid loss of most, if not all, of the reporter sequence occurred for both viruses, indicating that the reporter viruses were not stable. While the GLuc viruses predominantly reverted back to wild-type WNV length, the TAT viruses retained up to 75 additional nucleotides of the reporter sequence. These additional nucleotides were stable over at least five passages and did not significantly alter WNV fitness. Thus, the C/CA junction of WNV can tolerate additional nucleotides, though insertions are subject to certain constraints.

  16. "Retroposon" insertion into the cellular oncogene c-myc in canine transmissible venereal tumor.

    Science.gov (United States)

    Katzir, N; Rechavi, G; Cohen, J B; Unger, T; Simoni, F; Segal, S; Cohen, D; Givol, D

    1985-01-01

    We examined by Southern blotting the state of the cellular oncogene c-myc in the dog transmissible venereal tumor. The tumor DNA contains a 16.8-kilobase pair (kbp) rearranged c-myc fragment in addition to the normal 15-kbp and 7.5-kbp fragments. We compared the structure of the cloned rearranged c-myc (re-myc) with that of a cloned normal c-myc and found that the rearrangement was due to the insertion of a 1.8-kbp DNA upstream to the first exon of c-myc. The inserted DNA is flanked by 10-base-pair direct repeats and contains a dA-rich tail, suggesting its origin from mRNA. Partial sequence of the inserted element showed 62% homology with the primate interdispersed Kpn I repetitive element. These results provide an example for the behavior of repetitive DNA sequences like the Kpn I family, as movable elements that can transpose nearby to oncogenes or other structural genes and perhaps affect their activity. Images PMID:2983328

  17. Cloning of insertion site flanking sequence and construction of transfer DNA insert mutant library in Stylosanthes colletotrichum.

    Science.gov (United States)

    Chen, Helong; Hu, Caiping; Yi, Kexian; Huang, Guixiu; Gao, Jianming; Zhang, Shiqing; Zheng, Jinlong; Liu, Qiaolian; Xi, Jingen

    2014-01-01

    Stylosanthes sp. is the most important forage legume in tropical areas worldwide. Stylosanthes anthracnose, which is mainly caused by Colletotrichum gloeosporioides, is a globally severe disease in stylo production. Little progress has been made in anthracnose molecular pathogenesis research. In this study, Agrobacterium tumefaciens-mediated transformation was used to transform Stylosanthes colletotrichum strain CH008. The major factors of the genetic transformation system of S. colletotrichum were optimized as follows: A. tumefaciens' AGL-1 concentration (OD(600)), 0.8; concentration of Colletotrichum conidium, 1 × 10(6) conidia/mL; acetosyringone concentration, 100 mmol/L; induction time, 6 h; co-culture temperature, 25 °C; and co-culture time, 3 d. Thus, the transformation efficiency was increased to 300-400 transformants per 106 conidia. Based on the optimized system, a mutant library containing 4616 mutants was constructed, from which some mutants were randomly selected for analysis. Results show that the mutants were single copies that could be stably inherited. The growth rate, spore amount, spore germination rate, and appressorium formation rate in some mutants were significantly different from those in the wild-type strain. We then selected the most appropriate method for the preliminary screening and re-screening of each mutant's pathogenic defects. We selected 1230 transformants, and obtained 23 strains with pathogenic defects, namely, 18 strains with reduced pathogenicity and five strains with lost pathogenicity. Thermal asymmetric interlaced PCR was used to identify the transfer DNA (T-DNA) integration site in the mutant that was coded 2430, and a sequence of 476 bp was obtained. The flanking sequence of T-DNA was compared with the Colletotrichum genome by BLAST, and a sequence of 401 bp was found in Contig464 of the Colletotrichum genome. By predicting the function of the flanking sequence, we discovered that T-DNA insertion in the promoter region

  18. Evaluation of matrix-assisted laser desorption ionization-time-of-flight mass spectrometry in comparison to 16S rRNA gene sequencing for species identification of nonfermenting bacteria.

    Science.gov (United States)

    Mellmann, A; Cloud, J; Maier, T; Keckevoet, U; Ramminger, I; Iwen, P; Dunn, J; Hall, G; Wilson, D; Lasala, P; Kostrzewa, M; Harmsen, D

    2008-06-01

    Nonfermenting bacteria are ubiquitous environmental opportunists that cause infections in humans, especially compromised patients. Due to their limited biochemical reactivity and different morphotypes, misidentification by classical phenotypic means occurs frequently. Therefore, we evaluated the use of matrix-assisted laser desorption ionization-time-of-flight mass spectrometry (MALDI-TOF MS) for species identification. By using 248 nonfermenting culture collection strains composed of 37 genera most relevant to human infections, a reference database was established for MALDI-TOF MS-based species identification according to the manufacturer's recommendations for microflex measurement and MALDI BioTyper software (Bruker Daltonik GmbH, Leipzig, Germany), i.e., by using a mass range of 2,000 to 20,000 Da and a new pattern-matching algorithm. To evaluate the database, 80 blind-coded clinical nonfermenting bacterial strains were analyzed. As a reference method for species designation, partial 16S rRNA gene sequencing was applied. By 16S rRNA gene sequencing, 57 of the 80 isolates produced a unique species identification (>or=99% sequence similarity); 11 further isolates gave ambiguous results at this threshold and were rated as identified to the genus level only. Ten isolates were identified to the genus level (>or=97% similarity); and two isolates had similarity values below this threshold, were counted as not identified, and were excluded from further analysis. MALDI-TOF MS identified 67 of the 78 isolates (85.9%) included, in agreement with the results of the reference method; 9 were misidentified and 2 were unidentified. The identities of 10 randomly selected strains were 100% correct when three different mass spectrometers and four different cultivation media were used. Thus, MALDI-TOF MS-based species identification of nonfermenting bacteria provided accurate and reproducible results within 10 min without any substantial costs for consumables.

  19. A Medicago truncatula tobacco retrotransposon insertion mutant collection with defects in nodule development and symbiotic nitrogen fixation.

    Science.gov (United States)

    Pislariu, Catalina I; Murray, Jeremy D; Wen, JiangQi; Cosson, Viviane; Muni, RajaSekhara Reddy Duvvuru; Wang, Mingyi; Benedito, Vagner A; Andriankaja, Andry; Cheng, Xiaofei; Jerez, Ivone Torres; Mondy, Samuel; Zhang, Shulan; Taylor, Mark E; Tadege, Million; Ratet, Pascal; Mysore, Kirankumar S; Chen, Rujin; Udvardi, Michael K

    2012-08-01

    A Tnt1-insertion mutant population of Medicago truncatula ecotype R108 was screened for defects in nodulation and symbiotic nitrogen fixation. Primary screening of 9,300 mutant lines yielded 317 lines with putative defects in nodule development and/or nitrogen fixation. Of these, 230 lines were rescreened, and 156 lines were confirmed with defective symbiotic nitrogen fixation. Mutants were sorted into six distinct phenotypic categories: 72 nonnodulating mutants (Nod-), 51 mutants with totally ineffective nodules (Nod+ Fix-), 17 mutants with partially ineffective nodules (Nod+ Fix+/-), 27 mutants defective in nodule emergence, elongation, and nitrogen fixation (Nod+/- Fix-), one mutant with delayed and reduced nodulation but effective in nitrogen fixation (dNod+/- Fix+), and 11 supernodulating mutants (Nod++Fix+/-). A total of 2,801 flanking sequence tags were generated from the 156 symbiotic mutant lines. Analysis of flanking sequence tags revealed 14 insertion alleles of the following known symbiotic genes: NODULE INCEPTION (NIN), DOESN'T MAKE INFECTIONS3 (DMI3/CCaMK), ERF REQUIRED FOR NODULATION, and SUPERNUMERARY NODULES (SUNN). In parallel, a polymerase chain reaction-based strategy was used to identify Tnt1 insertions in known symbiotic genes, which revealed 25 additional insertion alleles in the following genes: DMI1, DMI2, DMI3, NIN, NODULATION SIGNALING PATHWAY1 (NSP1), NSP2, SUNN, and SICKLE. Thirty-nine Nod- lines were also screened for arbuscular mycorrhizal symbiosis phenotypes, and 30 mutants exhibited defects in arbuscular mycorrhizal symbiosis. Morphological and developmental features of several new symbiotic mutants are reported. The collection of mutants described here is a source of novel alleles of known symbiotic genes and a resource for cloning novel symbiotic genes via Tnt1 tagging.

  20. An intronic LINE-1 insertion in MERTK is strongly associated with retinopathy in Swedish Vallhund dogs.

    Directory of Open Access Journals (Sweden)

    Richard Everson

    Full Text Available The domestic dog segregates a significant number of inherited progressive retinal diseases, several of which mirror human retinal diseases and which are collectively termed progressive retinal atrophy (PRA. In 2014, a novel form of PRA was reported in the Swedish Vallhund breed, and the disease was mapped to canine chromosome 17. The causal mutation was not identified, but expression analyses of the retinas of affected Vallhunds demonstrated a 6-fold increased expression of the MERTK gene compared to unaffected dogs. Using 24 retinopathy cases and 97 controls with no clinical signs of retinopathy, we replicated the chromosome 17 association in Swedish Vallhunds from the UK and aimed to elucidate the causal variant underlying this association using whole genome sequencing (WGS of an affected dog. This revealed a 6-8 kb insertion in intron 1 of MERTK that was not present in WGS of 49 dogs of other breeds. Sequencing and BLASTN analysis of the inserted segment was consistent with the insertion comprising a full-length intact LINE-1 retroelement. Testing of the LINE-1 insertion for association with retinopathy in the UK set of 24 cases and 97 controls revealed a strong statistical association (P-value 6.0 x 10-11 that was subsequently replicated in the original Finnish study set (49 cases and 89 controls (P-value 4.3 x 10-19. In a pooled analysis of both studies (73 cases and 186 controls, the LINE-1 insertion was associated with a ~20-fold increased risk of retinopathy (odds ratio 23.41, 95% confidence intervals 10.99-49.86, P-value 1.3 x 10-27. Our study adds further support for regulatory disruption of MERTK in Swedish Vallhund retinopathy; however, further work is required to establish a functional overexpression model. Future work to characterise the mechanism by which this intronic mutation disrupts gene regulation will further improve the understanding of MERTK biology and its role in retinal function.

  1. CRISPR/Cas9 cleavages in budding yeast reveal templated insertions and strand-specific insertion/deletion profiles.

    Science.gov (United States)

    Lemos, Brenda R; Kaplan, Adam C; Bae, Ji Eun; Ferrazzoli, Alexander E; Kuo, James; Anand, Ranjith P; Waterman, David P; Haber, James E

    2018-02-13

    Harnessing CRISPR-Cas9 technology provides an unprecedented ability to modify genomic loci via DNA double-strand break (DSB) induction and repair. We analyzed nonhomologous end-joining (NHEJ) repair induced by Cas9 in budding yeast and found that the orientation of binding of Cas9 and its guide RNA (gRNA) profoundly influences the pattern of insertion/deletions (indels) at the site of cleavage. A common indel created by Cas9 is a 1-bp (+1) insertion that appears to result from Cas9 creating a 1-nt 5' overhang that is filled in by a DNA polymerase and ligated. The origin of +1 insertions was investigated by using two gRNAs with PAM sequences located on opposite DNA strands but designed to cleave the same sequence. These templated +1 insertions are dependent on the X-family DNA polymerase, Pol4. Deleting Pol4 also eliminated +2 and +3 insertions, which are biased toward homonucleotide insertions. Using inverted PAM sequences, we also found significant differences in overall NHEJ efficiency and repair profiles, suggesting that the binding of the Cas9:gRNA complex influences subsequent NHEJ processing. As with events induced by the site-specific HO endonuclease, CRISPR-Cas9-mediated NHEJ repair depends on the Ku heterodimer and DNA ligase 4. Cas9 events are highly dependent on the Mre11-Rad50-Xrs2 complex, independent of Mre11's nuclease activity. Inspection of the outcomes of a large number of Cas9 cleavage events in mammalian cells reveals a similar templated origin of +1 insertions in human cells, but also a significant frequency of similarly templated +2 insertions.

  2. Methanol Formation via Oxygen Insertion Chemistry in Ices

    Science.gov (United States)

    Bergner, Jennifer B.; Öberg, Karin I.; Rajappan, Mahesh

    2017-08-01

    We present experimental constraints on the insertion of oxygen atoms into methane to form methanol in astrophysical ice analogs. In gas-phase and theoretical studies this process has previously been demonstrated to have a very low or nonexistent energy barrier, but the energetics and mechanisms have not yet been characterized in the solid state. We use a deuterium UV lamp filtered by a sapphire window to selectively dissociate O2 within a mixture of O2:CH4 and observe efficient production of CH3OH via O(1D) insertion. CH3OH growth curves are fit with a kinetic model, and we observe no temperature dependence of the reaction rate constant at temperatures below the oxygen desorption temperature of 25 K. Through an analysis of side products we determine the branching ratio of ice-phase oxygen insertion into CH4: ˜65% of insertions lead to CH3OH, with the remainder leading instead to H2CO formation. There is no evidence for CH3 or OH radical formation, indicating that the fragmentation is not an important channel and that insertions typically lead to increased chemical complexity. CH3OH formation from O2 and CH4 diluted in a CO-dominated ice similarly shows no temperature dependence, consistent with expectations that insertion proceeds with a small or nonexistent barrier. Oxygen insertion chemistry in ices should therefore be efficient under low-temperature ISM-like conditions and could provide an important channel to complex organic molecule formation on grain surfaces in cold interstellar regions such as cloud cores and protoplanetary disk midplanes.

  3. Methanol Formation via Oxygen Insertion Chemistry in Ices

    Energy Technology Data Exchange (ETDEWEB)

    Bergner, Jennifer B. [Harvard University Department of Chemistry and Chemical Biology, 10 Oxford Street, Cambridge, MA 02138 (United States); Öberg, Karin I.; Rajappan, Mahesh [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States)

    2017-08-10

    We present experimental constraints on the insertion of oxygen atoms into methane to form methanol in astrophysical ice analogs. In gas-phase and theoretical studies this process has previously been demonstrated to have a very low or nonexistent energy barrier, but the energetics and mechanisms have not yet been characterized in the solid state. We use a deuterium UV lamp filtered by a sapphire window to selectively dissociate O{sub 2} within a mixture of O{sub 2}:CH{sub 4} and observe efficient production of CH{sub 3}OH via O({sup 1}D) insertion. CH{sub 3}OH growth curves are fit with a kinetic model, and we observe no temperature dependence of the reaction rate constant at temperatures below the oxygen desorption temperature of 25 K. Through an analysis of side products we determine the branching ratio of ice-phase oxygen insertion into CH{sub 4}: ∼65% of insertions lead to CH{sub 3}OH, with the remainder leading instead to H{sub 2}CO formation. There is no evidence for CH{sub 3} or OH radical formation, indicating that the fragmentation is not an important channel and that insertions typically lead to increased chemical complexity. CH{sub 3}OH formation from O{sub 2} and CH{sub 4} diluted in a CO-dominated ice similarly shows no temperature dependence, consistent with expectations that insertion proceeds with a small or nonexistent barrier. Oxygen insertion chemistry in ices should therefore be efficient under low-temperature ISM-like conditions and could provide an important channel to complex organic molecule formation on grain surfaces in cold interstellar regions such as cloud cores and protoplanetary disk midplanes.

  4. Diode-Assisted Buck-Boost Voltage-Source Inverters

    DEFF Research Database (Denmark)

    Gao, Feng; Loh, Poh Chiang; Teodorescu, Remus

    2009-01-01

    This paper proposes a number of diode-assisted buck-boost voltage-source inverters with a unique X-shaped diode-capacitor network inserted between the inverter circuitry and dc source for producing a voltage gain that is comparatively higher than those of other buck-boost conversion techniques......, a number of diode-assisted inverter variants can be designed with each having its own operational principle and voltage gain expression. For controlling them, a generic modulation scheme that can be used for controlling all diode-assisted variants with minimized harmonic distortion and component stress...

  5. An EAV-HP insertion in 5' Flanking region of SLCO1B3 causes blue eggshell in the chicken.

    Directory of Open Access Journals (Sweden)

    Zhepeng Wang

    Full Text Available The genetic determination of eggshell coloration has not been determined in birds. Here we report that the blue eggshell is caused by an EAV-HP insertion that promotes the expression of SLCO1B3 gene in the uterus (shell gland of the oviduct in chicken. In this study, the genetic map location of the blue eggshell gene was refined by linkage analysis in an F(2 chicken population, and four candidate genes within the refined interval were subsequently tested for their expression levels in the shell gland of the uterus from blue-shelled and non-blue-shelled hens. SLCO1B3 gene was found to be the only one expressed in the uterus of blue-shelled hens but not in that of non-blue-shelled hens. Results from a pyrosequencing analysis showed that only the allele of SLCO1B3 from blue-shelled chickens was expressed in the uterus of heterozygous hens (O*LC/O*N. SLCO1B3 gene belongs to the organic anion transporting polypeptide (OATP family; and the OATPs, functioning as membrane transporters, have been reported for the transportation of amphipathic organic compounds, including bile salt in mammals. We subsequently resequenced the whole genomic region of SLCO1B3 and discovered an EAV-HP insertion in the 5' flanking region of SLCO1B3. The EAV-HP insertion was found closely associated with blue eggshell phenotype following complete Mendelian segregation. In situ hybridization also demonstrated that the blue eggshell is associated with ectopic expression of SLCO1B3 in shell glands of uterus. Our finding strongly suggests that the EAV-HP insertion is the causative mutation for the blue eggshell phenotype. The insertion was also found in another Chinese blue-shelled breed and an American blue-shelled breed. In addition, we found that the insertion site in the blue-shelled chickens from Araucana is different from that in Chinese breeds, which implied independent integration events in the blue-shelled chickens from the two continents, providing a parallel evolutionary

  6. Treatment of Sagittal Fracture of the Zygomatic Arch Root Assisted by Surgical Navigation Technology.

    Science.gov (United States)

    Dai, Jin-Hong; Xu, Dong-Dong; Yang, Chang-Yuan; Li, Zu-Bing; Li, Zhi

    2018-01-29

    Sagittal fracture at the temporal root of the zygomatic arch often occurs as a part of zygomaticomaxillary fractures. The authors described the application of computer-assisted navigation in the lag screw insertion for the fixation of sagittal fracture at the temporal root of zygomatic arch. Using the presurgical planning of the computer-assisted navigation system, the trajectory of lag screw insertion was designed, and the insertion depth was calculated. In the presurgical planning, the trajectory of screw insertion was placed with an anterior inclination of 10° to 15° (mean: 12.24°), and the screw insertion depth was 9.0 to 12.0 mm (mean: 10.65 mm). In the operation, the screw insertion in the fixation of the sagittal fracture was performed under the guidance of navigation system according to the presurgical planning. The postoperative CT scan showed exact reduction and fixation of the sagittal fracture in all cases. Computer-assisted navigation is a useful tool for the lag screw insertion in the precise fixation of sagittal fracture at the temporal root of the zygomatic arch in complex zygomaticomaxillary fractures.

  7. A trimeric lipoprotein assists in trimeric autotransporter biogenesis in enterobacteria.

    Science.gov (United States)

    Grin, Iwan; Hartmann, Marcus D; Sauer, Guido; Hernandez Alvarez, Birte; Schütz, Monika; Wagner, Samuel; Madlung, Johannes; Macek, Boris; Felipe-Lopez, Alfonso; Hensel, Michael; Lupas, Andrei; Linke, Dirk

    2014-03-14

    Trimeric autotransporter adhesins (TAAs) are important virulence factors of many Gram-negative bacterial pathogens. TAAs form fibrous, adhesive structures on the bacterial cell surface. Their N-terminal extracellular domains are exported through a C-terminal membrane pore; the insertion of the pore domain into the bacterial outer membrane follows the rules of β-barrel transmembrane protein biogenesis and is dependent on the essential Bam complex. We have recently described the full fiber structure of SadA, a TAA of unknown function in Salmonella and other enterobacteria. In this work, we describe the structure and function of SadB, a small inner membrane lipoprotein. The sadB gene is located in an operon with sadA; orthologous operons are only found in enterobacteria, whereas other TAAs are not typically associated with lipoproteins. Strikingly, SadB is also a trimer, and its co-expression with SadA has a direct influence on SadA structural integrity. This is the first report of a specific export factor of a TAA, suggesting that at least in some cases TAA autotransport is assisted by additional periplasmic proteins.

  8. A Trimeric Lipoprotein Assists in Trimeric Autotransporter Biogenesis in Enterobacteria*

    Science.gov (United States)

    Grin, Iwan; Hartmann, Marcus D.; Sauer, Guido; Hernandez Alvarez, Birte; Schütz, Monika; Wagner, Samuel; Madlung, Johannes; Macek, Boris; Felipe-Lopez, Alfonso; Hensel, Michael; Lupas, Andrei; Linke, Dirk

    2014-01-01

    Trimeric autotransporter adhesins (TAAs) are important virulence factors of many Gram-negative bacterial pathogens. TAAs form fibrous, adhesive structures on the bacterial cell surface. Their N-terminal extracellular domains are exported through a C-terminal membrane pore; the insertion of the pore domain into the bacterial outer membrane follows the rules of β-barrel transmembrane protein biogenesis and is dependent on the essential Bam complex. We have recently described the full fiber structure of SadA, a TAA of unknown function in Salmonella and other enterobacteria. In this work, we describe the structure and function of SadB, a small inner membrane lipoprotein. The sadB gene is located in an operon with sadA; orthologous operons are only found in enterobacteria, whereas other TAAs are not typically associated with lipoproteins. Strikingly, SadB is also a trimer, and its co-expression with SadA has a direct influence on SadA structural integrity. This is the first report of a specific export factor of a TAA, suggesting that at least in some cases TAA autotransport is assisted by additional periplasmic proteins. PMID:24369174

  9. Construction and accuracy assessment of patient-specific biocompatible drill template for cervical anterior transpedicular screw (ATPS insertion: an in vitro study.

    Directory of Open Access Journals (Sweden)

    Maoqing Fu

    Full Text Available BACKGROUND: With the properties of three-column fixation and anterior-approach-only procedure, anterior transpedicular screw (ATPS is ideal for severe multilevel traumatic cervical instabilities. However, the accurate insertion of ATPS remains challenging. Here we constructed a patient-specific biocompatible drill template and evaluated its accuracy in assisting ATPS insertion. METHODS: After ethical approval, 24 formalin-preserved cervical vertebrae (C2-C7 were CT scanned. 3D reconstruction models of cervical vertebra were obtained with 2-mm-diameter virtual pin tracts at the central pedicles. The 3D models were used for rapid prototyping (RP printing. A 2-mm-diameter Kirschner wire was then inserted into the pin tract of the RP model before polymethylmethacrylate was used to construct the patient-specific biocompatible drill template. After removal of the anterior soft tissue, a 2-mm-diameter Kirschner wire was inserted into the cervical pedicle with the assistance of drill template. Cadaveric cervical spines with pin tracts were subsequently scanned using the same CT scanner. A 3D reconstruction was performed of the scanned spines to get 3D models of the vertebrae containing the actual pin tracts. The deviations were calculated between 3D models with virtual and actual pin tracts at the middle point of the cervical pedicle. 3D models of 3.5 mm-diameter screws were used in simulated insertion to grade the screw positions. FINDINGS: The patient-specific biocompatible drill template was constructed to assist ATPS insertion successfully. There were no significant differences between medial/lateral deviations (P = 0.797 or between superior/inferior deviations (P = 0.741. The absolute deviation values were 0.82±0.75 mm and 1.10±0.96 mm in axial and sagittal planes, respectively. In the simulated insertion, the screws in non-critical position were 44/48 (91.7%. CONCLUSIONS: The patient-specific drill template is biocompatible, easy

  10. A novel adaptive needle insertion sequencing for robotic, single needle MR-guided high-dose-rate prostate brachytherapy

    Science.gov (United States)

    Borot de Battisti, M.; de Senneville, B. Denis; Hautvast, G.; Binnekamp, D.; Lagendijk, J. J. W.; Maenhout, M.; Moerland, M. A.

    2017-05-01

    proposed needle insertion sequencing can therefore assist in delivering an optimal dose in HDR prostate brachytherapy.

  11. Immediate post-abortal insertion of intrauterine devices.

    Science.gov (United States)

    Grimes, D; Schulz, K; Stanwood, N

    2000-01-01

    To assess the safety and efficacy of IUD insertion immediately after spontaneous or induced abortion. We used Medline, Popline, and EMBASE computer searches, supplemented by review articles and contacts with investigators. We sought all randomized controlled trials that had at least one treatment arm that involved IUD insertion immediately after an induced abortion or after curettage for spontaneous abortion. We identified 12 trials which described random assignment but excluded three from this review. Two of these revealed unethical research conduct, and one used alternate assignment to treatments. We evaluated the methodological quality of each report and abstracted information onto a data collection form. We focused on gross discontinuation rates (single-decrement life table analysis) for accidental pregnancy, perforation, expulsion, and pelvic inflammatory disease. We entered the data into RevMan 3.1 for analysis of Peto odds ratios. In large multicenter trials, the TCu 220C device proved superior to either the Lippes Loop D or the Copper 7 IUDs for immediate post-abortal insertion. The Peto OR for discontinuation for pregnancy was 0.4 (95% CI 0.2-0.7) compared with the Lippes Loop D and 0.5 (95% CI 0.3-0.8) compared with the Copper 7. Expulsions were also significantly less common with the TCu 220C than with the other two IUDs. In single-center trials, the Nova T IUD had a signicantly higher discontinuation rate for pregnancy than did the Multiload 250 (OR 4.5; 95% CI 1.0-19.8), while the Nova T had a significantly lower discontinuation rate for pregnancy than did the TCu 200 (OR 0.3; 95% CI 0.1-0.9). Only one trial compared immediate vs. delayed insertion. In this trial, the performance of the Copper 7 IUD inserted immediately after abortion was inferior to that after interval insertion (remote from pregnancy), although the differences were not statistically significant. Addition of copper sleeves to a Lippes Loop D improved its performance, but addition of a

  12. The Significance of Placental Cord Insertion Site in Twin Pregnancy.

    Science.gov (United States)

    Kalafat, Erkan; Thilaganathan, Basky; Papageorghiou, Aris; Bhide, Amar; Khalil, Asma

    2017-10-04

    The aim of this study was to investigate the association between abnormal cord insertion and the development of the twin-specific complications, including birthweight discordance, selective fetal growth restriction (sFGR) and twin-to-twin transfusion syndrome (TTTS). A single-center cohort study of twin pregnancies. Abnormal cord insertion was defined as either marginal (cord attachment site less than 2cm to the nearest margin of the placental disc) or velamentous (when the umbilical cord was attached to the membrane before reaching the placental disc with clear evidence of vessels traversing the membranes to connect with the placental disc), as described in placental pathology reports. Major structural or chromosomal abnormalities and monochorionic monoamniotic twins were not included in the study. Information on the pregnancies, ultrasound findings, prenatal investigation and interventions was obtained from the electronic ultrasound database, while data on the placental histopathological findings, pregnancy outcomes, mode of delivery, birthweight, gestational age at delivery, and admission to the neonatal intensive care unit (NICU) were obtained from the maternity records. Categorical variables were compared by the X2 -test or Fisher's exact test, while continuous variables were compared using the t-test, analysis of variance (ANOVA) for multiple comparison and the Kruskal-Wallis test. 497 twin pregnancies, 351 (70.6%) dichorionic and 146 (29.3%) monochorionic, were included in the analysis. The incidence of birthweight discordance of 25% or more was significantly higher in pregnancies with velamentous and marginal cord insertions compared to those with normal cord insertion (24.5%, 15.2% vs 7.5%, Pcord insertions compared to the larger twins (1.8% and 18.5%, respectively Pcord insertions (40.9%) compared to the larger twins (2.3% and 29.5%, respectively Pcord insertion group, only velamentous insertion was significantly associated with the risk of sFGR (OR 9

  13. Focus on peripherally inserted central catheters in critically ill patients.

    Science.gov (United States)

    Cotogni, Paolo; Pittiruti, Mauro

    2014-11-04

    Venous access devices are of pivotal importance for an increasing number of critically ill patients in a variety of disease states and in a variety of clinical settings (emergency, intensive care, surgery) and for different purposes (fluids or drugs infusions, parenteral nutrition, antibiotic therapy, hemodynamic monitoring, procedures of dialysis/apheresis). However, healthcare professionals are commonly worried about the possible consequences that may result using a central venous access device (CVAD) (mainly, bloodstream infections and thrombosis), both peripherally inserted central catheters (PICCs) and centrally inserted central catheters (CICCs). This review aims to discuss indications, insertion techniques, and care of PICCs in critically ill patients. PICCs have many advantages over standard CICCs. First of all, their insertion is easy and safe -due to their placement into peripheral veins of the arm- and the advantage of a central location of catheter tip suitable for all osmolarity and pH solutions. Using the ultrasound-guidance for the PICC insertion, the risk of hemothorax and pneumothorax can be avoided, as well as the possibility of primary malposition is very low. PICC placement is also appropriate to avoid post-procedural hemorrhage in patients with an abnormal coagulative state who need a CVAD. Some limits previously ascribed to PICCs (i.e., low flow rates, difficult central venous pressure monitoring, lack of safety for radio-diagnostic procedures, single-lumen) have delayed their start up in the intensive care units as common practice. Though, the recent development of power-injectable PICCs overcomes these technical limitations and PICCs have started to spread in critical care settings. Two important take-home messages may be drawn from this review. First, the incidence of complications varies depending on venous accesses and healthcare professionals should be aware of the different clinical performance as well as of the different risks

  14. Focus on peripherally inserted central catheters in critically ill patients

    Science.gov (United States)

    Cotogni, Paolo; Pittiruti, Mauro

    2014-01-01

    Venous access devices are of pivotal importance for an increasing number of critically ill patients in a variety of disease states and in a variety of clinical settings (emergency, intensive care, surgery) and for different purposes (fluids or drugs infusions, parenteral nutrition, antibiotic therapy, hemodynamic monitoring, procedures of dialysis/apheresis). However, healthcare professionals are commonly worried about the possible consequences that may result using a central venous access device (CVAD) (mainly, bloodstream infections and thrombosis), both peripherally inserted central catheters (PICCs) and centrally inserted central catheters (CICCs). This review aims to discuss indications, insertion techniques, and care of PICCs in critically ill patients. PICCs have many advantages over standard CICCs. First of all, their insertion is easy and safe -due to their placement into peripheral veins of the arm- and the advantage of a central location of catheter tip suitable for all osmolarity and pH solutions. Using the ultrasound-guidance for the PICC insertion, the risk of hemothorax and pneumothorax can be avoided, as well as the possibility of primary malposition is very low. PICC placement is also appropriate to avoid post-procedural hemorrhage in patients with an abnormal coagulative state who need a CVAD. Some limits previously ascribed to PICCs (i.e., low flow rates, difficult central venous pressure monitoring, lack of safety for radio-diagnostic procedures, single-lumen) have delayed their start up in the intensive care units as common practice. Though, the recent development of power-injectable PICCs overcomes these technical limitations and PICCs have started to spread in critical care settings. Two important take-home messages may be drawn from this review. First, the incidence of complications varies depending on venous accesses and healthcare professionals should be aware of the different clinical performance as well as of the different risks

  15. Informed peg-in-hole insertion using optical sensors

    Science.gov (United States)

    Paulos, Eric; Canny, John F.

    1993-08-01

    Peg-in-hole insertion is not only a longstanding problem in robotics but the most common automated mechanical assembly task. In this paper we present a high precision, self-calibrating peg-in-hole insertion strategy using several very simple, inexpensive, and accurate optical sensors. The self-calibrating feature allows us to achieve successful dead-reckoning insertions with tolerances of 25 microns without any accurate initial position information for the robot, pegs, or holes. The program we implemented works for any cylindrical peg, and the sensing steps do not depend on the peg diameter, which the program does not know. The key to the strategy is the use of a fixed sensor to localize both a mobile sensor and the peg, while the mobile sensor localizes the hole. Our strategy is extremely fast, localizing pegs as they are in route to their insertion location without pausing. The result is that insertion times are dominated by the transport time between pick and place operations.

  16. Staphylococcus aureus infections following knee and hip prosthesis insertion procedures.

    Science.gov (United States)

    Arduino, Jean Marie; Kaye, Keith S; Reed, Shelby D; Peter, Senaka A; Sexton, Daniel J; Chen, Luke F; Hardy, N Chantelle; Tong, Steven Yc; Smugar, Steven S; Fowler, Vance G; Anderson, Deverick J

    2015-01-01

    Staphylococcus aureus is the most common and most important pathogen following knee and hip arthroplasty procedures. Understanding the epidemiology of invasive S. aureus infections is important to quantify this serious complication. This nested retrospective cohort analysis included adult patients who had undergone insertion of knee or hip prostheses with clean or clean-contaminated wound class at 11 hospitals between 2003-2006. Invasive S. aureus infections, non-superficial incisional surgical site infections (SSIs) and blood stream infections (BSIs), were prospectively identified following each procedure. Prevalence rates, per 100 procedures, were estimated. 13,719 prosthetic knee (62%) and hip (38%) insertion procedures were performed. Of 92 invasive S. aureus infections identified, SSIs were more common (80%) than SSI and BSI (10%) or BSI alone (10%). The rate of invasive S. aureus infection/100 procedures was 0.57 [95% CI: 0.43-0.73] for knee insertion and 0.83 [95% CI: 0.61-1.08] for hip insertion. More than half (53%) were methicillin-resistant. Median time-to-onset of infection was 34 and 26 days for knee and hip insertion, respectively. Infection was associated with higher National Healthcare Safety Network risk index (p ≤ 0.0001). Post-operative invasive S. aureus infections were rare, but difficult-to-treat methicillin-resistant infections were relatively common. Optimizing preventative efforts may greatly reduce the healthcare burden associated with S. aureus infections.

  17. Seamless lesion insertion in digital mammography: methodology and reader study

    Science.gov (United States)</